A Novel Human-Specific Soluble Vascular Endothelial

Growth Factor Receptor 1

Cell Type-Specific Splicing and Implications to Vascular Endothelial
Growth Factor Homeostasis and Preeclampsia
Shay Sela, Ahuva Itin, Shira Natanson-Yaron, Caryn Greenfield, Debra Goldman-Wohl,
Simcha Yagel, Eli Keshet

Abstract—A human-specific splicing variant of vascular endothelial growth factor (VEGF) receptor 1 (Flt1) was discovered,
producing a soluble receptor (designated sFlt1-14) that is qualitatively different from the previously described soluble receptor
(sFlt1) and functioning as a potent VEGF inhibitor. sFlt1-14 is generated in a cell type-specific fashion, primarily in
nonendothelial cells. Notably, in vascular smooth muscle cells, all Flt1 messenger RNA is converted to sFlt1-14, whereas
endothelial cells of the same human vessel express sFlt1. sFlt1-14 expression by vascular smooth muscle cells is dynamically
regulated as evidenced by its upregulation on coculture with endothelial cells or by direct exposure to VEGF. Increased
Downloaded from http://circres.ahajournals.org/ by guest on January 8, 2018

production of soluble VEGF receptors during pregnancy is entirely attributable to induced expression of placental sFlt1-14
starting by the end of the first trimester. Expression is dramatically elevated in the placenta of women with preeclampsia,
specifically induced in abnormal clusters of degenerative syncytiotrophoblasts known as syncytial knots, where it may
undergo further messenger RNA editing. sFlt1-14 is the predominant VEGF-inhibiting protein produced by the preeclamptic
placenta, accumulates in the circulation, and hence is capable of neutralizing VEGF in distant organs affected in preeclampsia.
Together, these findings revealed a new natural VEGF inhibitor that has evolved in humans, possibly to protect nonendothelial
cells from adverse VEGF signaling. Furthermore, the study uncovered the identity of a VEGF-blocking protein implicated in
preeclampsia. (Circ Res. 2008;102:1566-1574.)
Key Words: VEGF 䡲 soluble VEGF receptor 䡲 splicing 䡲 preeclampsia 䡲 vascular smooth muscle cell

V ascular endothelial growth factor (VEGF) is the key factor

promoting vasculogenesis and angiogenesis in the embryo
and the factor orchestrating most, if not all, processes of adult
neovascularization. In addition, VEGF performs nonvascular
developmental functions and plays a number of homeostatic
roles in the adult. The latter includes maintenance of endothelial
fenestrations, a role in vasodilatation, and neurogenic and
neurotrophic activities, among others.1,2 Not surprisingly, there-
fore, VEGF is under a tight spatial and temporal regulation, and
even a moderate deviation from its exquisite dosage control or
perturbation of its precise morphogenetic gradients is detrimen-
tal for proper development and organ homeostasis.3,4
Among the multiple layers of VEGF control, natural VEGF
inhibitors, primarily soluble VEGF receptors, are likely to be
important. Indeed, VEGF receptor-1 (Flt1) messenger RNA
(mRNA) may undergo alternative splicing in a way that the
encoded protein retains the ligand-binding domain but is devoid
of the membrane-spanning and intracellular kinase domains,
hence functioning as a VEGF-trapping soluble receptor. This
secreted protein (designated sFlt1) is a potent inhibitor of both
VEGF-A, VEGF-B, and placental growth factor.2 It is widely
used as a research tool for VEGF inhibition and, more recently,
also harnessed in clinical trials of VEGF blockade. However,
surprisingly little is known concerning natural sFlt1 regulation.
Likewise, the different arenas in which it may act in physiolog-
ical titration of VEGF or in pathological neutralization of VEGF
activity remain to be uncovered. A remarkable recent example
for a physiological role of sFlt1 is the identification of sFlt1 as
the factor responsible for preventing vascular invasion onto the
cornea.5 The best documented case of a pathological role is the
involvement of sFlt1 in preeclampsia (PE).6,7
PE, affecting 5% of pregnant women, is characterized by
severe maternal hypertension, proteinuria, glomerular endo-
theliosis, and neurological symptoms. Although the underly-
ing pathogenic mechanism of PE is largely unknown, sFlt1
was implicated in PE causation because of its abnormally
high levels in the circulation of preeclamptic women.7 Fur-
thermore, a seminal study by Maynard et al6 shows that
systemic sFlt1 causes a PE-like syndrome in rats, presumably
through negating constitutive VEGF function in the kidney.

Original received January 8, 2008; revision received May 7, 2008; accepted May 19, 2008.
From the Department of Molecular Biology (S.S., A.I., E.K.), the Hebrew University-Hadassah Medical School; and Department of Obstetrics and
Gynecology (S.N.-Y., C.G., D.G.-W., S.Y.), Hadassah University Hospital-Mount Scopus, Jerusalem, Israel.
Correspondence to Dr Eli Keshet, Department of Molecular Biology, The Hebrew University-Hadassah Medical School, Jerusalem 91120, Israel.
E-mail keshet@cc.huji.ac.il
© 2008 American Heart Association, Inc.
Circulation Research is available at http://circres.ahajournals.org DOI: 10.1161/CIRCRESAHA.108.171504

1566
 Sela et al A Novel Human-Specific Soluble VEGF-Receptor 1
Initially considered as an endothelial cell (EC)-specific recep-
tor, Flt1 was subsequently detected also in a number of nonen-
dothelial cells, thus extending the spectrum of cells directly
responsive to VEGF. We reason that the splicing ratio of
Flt1/sFlt1 should determine the extent to which a given cell will
transmit or, conversely, resist VEGF signaling. We propose that
dynamic changes in the splicing ratio may serve a regulatory
function, in general, and that predominance of the soluble
receptor might protect nonendothelial cells from adverse effects
of VEGF, in particular. Experiments reported here are compat-
ible with the proposition of a role for sFlt1 in the EC/vascular
smooth muscle cell (VSMC) interface of the mature vessel wall.
A search through human expressed sequence tag databases
indicated that an additional truncated Flt1 RNA transcript may
exist, as indeed verified in a very recent study by Thomas et al8
and also encountered in this study. Here, we show that this
transcript is naturally translated and secreted and functions as a
potent VEGF-blocking soluble receptor. This natural VEGF
Downloaded from http://circres.ahajournals.org/ by guest on January 8, 2018
inhibitor, designated by us as sFlt1-14, evolved during primate
evolution and is the predominant VEGF inhibitor produced by
human nonendothelial cells. Importantly, we show that sFlt1-14
is also the VEGF-neutralizing protein produced by the placenta
of women with PE.
Materials and Methods
cDNA Cloning
Rapid amplification of complementary DNA (cDNA) ends
(RACE) was preformed using a BD Smart RACE cDNA Ampli-
fication Kit (BD Biosciences; catalog no. 634914). For cloning/
sequencing of sFlt1-14 3⬘ untranslated regions (UTRs), RNAs of
PE placentas were reverse-transcribed using a primer complemen-
tary to the beginning of exon 14 of Flt1.
Recombinant sFlt1 and sFlt1-14 Proteins
cDNAs encompassing the entire coding region of both soluble receptor
isoforms were subcloned into Bluescript expression vectors and trans-
fected onto T7 polymerase-expressing Hela cells. Twenty to 24 hours
later, media were collected and the cells were harvested. Secreted and
cell-associated proteins were immunoprecipitated with the FLT11
(Sigma) antibody and analyzed by immunoblotting with the ab9540
antibody (Abcam), both antibodies directed against the extracellular
domain of Flt1.
VEGF Inhibition Assay
Porcine aortic ECs engineered to express high levels of human VEGF-
receptor 2 (VEGF-R2) (a gift from Prof Gera Neufeld, Technion, Haifa,
Israel) were exposed to VEGF preincubated (or not) with sFlt1 or
sFlt1-14 proteins. A reduction in VEGF-R2 phosphorylation was
determined using antibodies detecting phospho-VEGF-R2 (Cell Signal-
ing; catalog no. 2478) and standardized to total VEGF-R2 protein
visualized by immunoblotting with anti–VEGF-R2 antibody (Santa
Cruz Biotechnology; catalog no. SC-504).
RNA and Protein Analyses
For Northern blot analysis, RNAs were hybridized with 32P-labeled
specific cDNA probes prepared with the aid of a Rediprime kit
(Amersham). Probes derived from different regions of Flt1 tran-
scripts were used, as specified in the text and figure legends. For in
situ detection of sFlt1-14 RNA, paraffin-embedded sections of
normal and PE placenta were hybridized with a 35S-labeled riboprobe
composed of exon 15a sequences as previously described.9
For immunoprecipitation/immunoblotting analysis, placentas were
homogenized and immunoprecipitated with 1 of 3 antibodies: CHFK,
CESS, and FLT11 (Sigma; catalog no. V4262) and incubated overnight
1567
with Protein A-coated beads (P3391, Sigma). Precipitates were then
dissolved and proteins separated on 6% acrylamide gel, electrophoreti-
cally transferred to a membrane, and detected with the indicated
antibodies. For analysis of serum proteins, 20 mL of serum from PE
patients was first concentrated through capture on FLT11-coated beads,
and affinity-purified proteins were analyzed by Western blotting as
described above. Placental samples were taken with Institutional Re-
view Board approval. PE samples met the American College of
Obstetricians and Gynecologists criteria for severe PE.
Mass Spectrometry
Protein homogenate of a PE placenta was incubated for 3 hours with a
rabbit preimmune serum (20 ␮L), incubated overnight with Protein A
beads, and precipitated with 3 hours of incubation with 15 ␮L of the
CESS antibody. Precipitated proteins were subsequently separated on a
6% acrylamide gel and visualized by staining with Coomassie blue. The
115- and 130-kDa bands were cut out, digested with trypsin, and
subjected to mass spectrometric analysis by liquid chromatography/
tandem mass spectrometry on DECA/LCQ. Peptides were identified
and analyzed by Pep-Miner and Sequest software against the nr database
of human, mouse, rat bovine, and rabbit.
Enzyme-Linked Immunosorbent Assay (ELISA)
A commercial ELISA kit for the detection of all soluble VEGF
receptor isoforms was used (R&D Systems; DVR 100B).
Cells and Culture
Human primary endothelial and VSMCs were a gift from Dr
Flugelman Moshe (Technion). Primary cell isolation and culture
details were previously described.10
Immunohistochemistry
Paraffin-embedded sections of human corneas were used. Antigen
retrieval was preformed by microwave heating in pH 6 citrate buffer.
The CESS antibody was used at a 1:100 dilution.
Antibodies
Rabbit polyclonal CESS and CHFK antibodies were generated by a
set of 3 injections of the peptides underlined in Figure 1B using the
Sigma-Aldrich protocol. Serum derived after the third injection was
used in this study for the identification of sFlt1-14.
Statistics
Data were analyzed by 1-way analysis of variance, followed by
Tukey post hoc tests.
Results
Identification of a Novel Splice Variant of a
Soluble VEGF Receptor-1 (sFlt1-14)
The majority of mRNA molecules transcribed from VEGF-R1
DNA encodes a transmembrane signaling receptor, but a small
fraction of primary transcripts is usually alternatively spliced,
generating a truncated mRNA devoid of the transmembrane-
and intracellular-encoding domains (Figure 1) and hence capable
of sequestering VEGF and block signaling. In search of circum-
stances in which the soluble receptor (sFlt1) may fulfill a
physiological role of VEGF inhibition, we first searched for
dynamic changes in the Flt1/sFlt1 splicing ratio. To this end,
RNA probes specific for the full receptor or for its soluble
counterpart were used. Unexpectedly, there was marked discrep-
ancy between results obtained using rodent or human materials.
In certain human tissues, sFlt1 could not be detected with a
sFlt1-specific probe (ie, probe detecting unique intron 13 se-
quences; see Figure 1; data not shown but see below). This led
us to examine the possibility that human cells may express a
 1568 Circulation Research June 20, 2008
Downloaded from http://circres.ahajournals.org/ by guest on January 8, 2018

Figure 1. Structure of the novel VEGF-R1 soluble receptor (sFlt1-14). A, Schematic representation of mRNAs encoding the full-size
transmembrane receptor (Flt1), the known soluble receptor (sFlt1), and the new alternatively spliced soluble receptor (sFlt1-14). Transla-
tion start and stop codons are indicated. Boxes mark the 3 different RNA probes used in this work: a probe encompassing exons 1 to
5 detecting all 3 receptor isoforms, a probe derived from intron 13 specific for sFlt1, and an exon 15a– based probe specific for sFlt1-
14. B, The predicted amino acid sequence of sFlt1-14 protein, starting at exon 13 (amino acid 623 in NP_002010). The first row depicts
exon 13 amino acids (shared by all 3 receptors); the second row, exon 14 amino acids (shared by Flt1 and sFlt1-14 but absent in
sFlt1); the third row, exonized amino acids derived from exon 15a (unique to sFlt1-14). Note the unusual polyserine stretch at the car-
boxyl terminus. The underlined amino acids served for developing exon 14- and exon 15a-specific antibodies, designated CHFK and
CESS, respectively.

different form of soluble receptor. 3⬘-RACE methodology was
thus used for cloning truncated Flt1 mRNAs present in human
placental RNA.
These studies culminated in the isolation and characteriza-
tion of a novel human-specific splice variant of VEGF-R1,
designated therein as sFlt1-14 (Figure 1A). A Blat search of
the University of California at Santa Cruz genome browser
indeed revealed 3 expressed sequence tags likely to have been
generated by alternative splicing different from that used to
generate sFlt1. sFlt1-14 sequence data have been submitted to
GenBank under accession no. EU368830. Nucleotide and
amino acid alignment is presented in Figure I of the online
data supplement, available at http://circres.ahajournals.org.
sFlt1-14 uses a previously unknown splice acceptor site
located within intron 14 for generating a mRNA composed of
the 14 N⬘-terminal exons followed by 480 nucleotides of intronic
sequences. The latter are predicted to encode a unique stretch of
28 amino acids (Figure 1B) and a unique 3⬘-UTR, in which a
complete Alu retrotransposon element is embedded (for the
precise localization of the Alu element within the 3⬘-UTR; see
supplemental Figure V). Notably, sFlt1-14 contains unique
coding, as well as noncoding, sequences shared neither by the
full-length receptor nor by the known soluble receptor, sFlt1.
This was used for preparing sFlt1-14 –specific RNA probes
(Figure 1A) and for preparation of sFlt1-14 –specific antibodies
directed against predicted carboxyl-terminal unique epitopes
(Figure 1B). Specificity of these antibodies in distinguishing
sFlt1-14 from sFlt1 is demonstrated in supplemental Figure II.
These antibodies were subsequently used to demonstrate that
sFlt1-14 mRNA is naturally translated into a 733-aa-long soluble
receptor protein (see Figure 6).
sFlt1-14 Is a Natural VEGF Inhibitor
Considering that sFlt1 and sFlt1-14 are qualitatively different
proteins (with sFlt1-14 containing 75 amino acids not present in
sFlt1 and with sFlt1 containing 31 highly conserved amino acids
not present in sFlt1-14), it was essential to demonstrate that
sFlt1-14 functions as a VEGF inhibitor. To this end, we first
expressed a recombinant sFlt1-14 protein in human Hela cells
(and for comparison, also produced sFlt1-expressing Hela cells).
Amounts of the respective protein released to growth medium
were then monitored by ELISA directed against a shared
extracellular epitope. For both proteins, concentrations of 100 to
200 ng/mL were detected in the medium. Media were further
analyzed by immunoprecipitation and Western blotting with 2
different shared (extracellular) antibodies, confirming the mutu-
ally exclusive production of either sFlt1-14 or sFlt1. Two
sFlt1-14 proteins were detected: a cell-associated 115-kDa
isoform and a secreted 130-kDa isoform, likely representing
additional posttranslational modifications. As expected from the
size of the respective coding region, sFlt1-14 proteins were
larger than the corresponding secreted and cellular sFlt1 iso-
forms (Figure 2A). To determine whether sFlt1-14 inhibits
VEGF signaling, increasing amounts were preincubated with a
constant amount of VEGF (20 ng/mL) before adding to the
growth medium of porcine aortic ECs engineered to express
high levels of human VEGF-R2. Levels of VEGF-R2 phosphor-
ylation were then measured as a function of the sFlt1-14/VEGF
ratio. As shown in Figure 2B, sFlt1-14 inhibited VEGF-R2
phosphorylation almost completely already at a 1:1 ratio.
We conclude that sFlt1-14 is a potent inhibitor of VEGF
signaling and that its inhibitory activity is comparable with
that of sFlt1.
 Sela et al A Novel Human-Specific Soluble VEGF-Receptor 1 1569
Downloaded from http://circres.ahajournals.org/ by guest on January 8, 2018

Figure 2. sFlt1-14 is a potent inhibitor of VEGF signaling. A, Recombinant sFlt1 and sFlt1-14 proteins were produced in HeLa cells
transfected with the respective expression vector. Soluble Flt1 receptors found in the cell (c) or released to the medium (m) were
detected by Western blotting using antibody directed against an extracellular epitope (ab9540). Note the presence of a 130-kDa
secreted sFlt1-14 protein and a 115-kDa sFlt1-14 protein in the cellular fraction. B, Porcine aortic ECs engineered to stably express
Flk1 were exposed to 20 ng/mL VEGF, and Flk1 phosphorylation was determined as readout for the extent of VEGF signaling. Inhibi-
tory effect of preincubation of VEGF with the indicated amounts of recombinant sFlt1 or sFlt1-14 was measured, presented as the
pFlk1/Flk1 ratio standardized to the VEGF-induced noninhibited ratio (n⫽4). *P⬍0.005 compared with all other groups. Data are pre-
sented as mean⫾SEM.

sFlt1-14 Is Expressed by Corneal Epithelial Cells
and Is Dynamically Regulated in VSMCs at the
Human Vessel Wall
Although VEGF-R1 is primarily an endothelial-specific recep-
tor, it is also expressed by certain nonendothelial cells like
monocytes and dendritic cells. With our discovery of sFlt1-14,
we wished to identify cell types in which it is expressed. The
avascular cornea is currently the best example for a tissue
protected against VEGF-primed vessel invasion by a soluble
VEGF receptor.5 It was of interest, therefore, to determine
whether sFlt1-14 is produced by human corneal cells. sFlt1-14
mRNA was indeed detected in epithelia isolated from human
cornea by polymerase chain reaction (data not shown), and
immunohistochemical analysis with a sFlt1-14 –specific anti-
body detected sFlt1-14 protein in epithelial cells of human
cornea (Figure 3A). The relative contribution of sFlt1 and
sFlt1-14 for negating VEGF in the cornea remains to be
elucidated.
The blood vessel wall is of particular interest considering that
perturbations of VEGF-mediated vasodilatation are associated
with impairment of blood pressure regulation. We reason,
therefore, that natural VEGF inhibitors like sFlt1 or sFlt1-14
may play a role in maintaining VEGF homeostasis in the mature
vessel wall. To test this proposition, we first separated a freshly
excised human vessel, a saphenous vein, into its endothelial and
VSMC components and examined expression of VEGF-R1 and
its soluble isoforms in primary cultures thereof. Whereas ECs
were found to express sFlt1 but not sFlt1-14, VSMCs from the
same vessel expressed exclusively sFlt1-14 (Figure 3B). Identi-
cal dichotomy in soluble receptor expression was also detected
in primary cultures derived from a human radial artery (data not
shown). These results not only provide a first evidence for
constitutive expression of a natural VEGF inhibitor in VSMCs
but also show that sFlt1-14 is produced in a strictly cell-type
specific manner. Furthermore, in VSMCs, almost all primary
transcripts are converted into sFlt1-14, leaving only a minor
fraction of mRNA from which the full-size receptor can be
translated (Figure 3B). This is in sharp contrast to ECs, in which
sFlt1 is vastly outnumbered by VEGF-R1 mRNA. Obviously,
the ratio of transmembrane/soluble receptor is a critical param-
eter by shifting the balance from ability to transmit VEGF
signals to negating them. Interestingly, dendritic cells also
produce sFlt1-14 and not the previously described sFlt1, and
again, this soluble receptor predominates over the transmem-
brane receptor (Figure 3C).
Next, we examined whether sFlt1-14 is dynamically regulated
in VSMCs under conditions similar to those prevailing in the
vessel wall, namely, proximity to ECs and exposure to EC-
produced VEGF. sFlt1-14 expression was compared in VSMCs,
EC monoculture, and in a VSMC/EC (1:1) coculture. As shown
in Figure 3B, sFlt1-14 was strongly induced in the coculture,
whereas expression of the endothelially produced Flt-1 and sFlt1
remained unchanged (probing in parallel the RNA blot with
isoform-specific riboprobes confirmed the assigned identities
[data not shown]). Addition of VEGF to VSMCs monocultures
also led to upregulated sFlt1-14 expression but not of Flt1 or
sFlt1 expression (Figure 3D and supplemental Figure III). These
results are compatible with a putative, yet unknown, role of
sFlt1-14 taking place in the EC/VSMC interface.
sFlt1-14 Is Upregulated in Syncytial Knots of the
Preeclamptic Placenta
Previous studies highlighted the role of sFlt1 in PE causation,
based on findings that sFlt1 accumulates the circulation of
 1570 Circulation Research June 20, 2008
Downloaded from http://circres.ahajournals.org/ by guest on January 8, 2018

Figure 3. Cell type-specific regulation of alternative splicing generating sFlt1-14. A, Immunohistochemical staining of a human cornea
sections with sFlt1-14 –specific antibody (CESS). Note sFlt1-14 protein in corneal epithelial cells (upper image) (bottom image is immu-
nostaining with a control antibody). B, Primary cultures of ECs and VSMCs were prepared from a surgically removed human saphenous
vein, and a 1:1 coculture was similarly grown. RNA was extracted from the respective cultures and subjected to a Northern blot analy-
sis with a riboprobe detecting exons 1 to 5 sequences. Note exclusive expression of sFlt1-14 in VSMCs and its upregulation on EC
coculturing. The arrowhead marks an unaccounted for band. C, A similar analysis was performed on human dendritic cell (DC) RNA.
Note that contrary to ECs that express sFlt1, dendritic cells express sFlt1-14. D, VEGF (50 ng/mL) was added to cultures of VSMCs
from a human saphenous vein for the indicated times and sFlt1-14 mRNA detected as described above. Note upregulation by VEGF of
constitutively expressed sFlt1-14.

women with PE to substantially higher levels than in normal
pregnancies and on findings that when expressed in rats, a
chimeric protein containing ligand-binding domain of sFlt1
produces the PE-like symptoms of hypertension and protein-
uria.6 Yet, the placental cellular sources of circulating VEGF
receptors and factors responsible for its deregulated expres-
sion in PE are not known. Furthermore, with the discovery of
sFlt1-14, the question arises as to which soluble receptor is
associated with PE. To address these questions, placental RNAs
from different stages of normal pregnancies and from term
placentas of both normal and PE pregnancies were first exam-
ined by Northern blot analysis with shared and specific ribo-
probes. Although expression of total soluble VEGF-R1 increases
progressively, particularly toward the third trimester of preg-
nancy, the relative contribution of the 2 sFlt1 isoforms changed
dramatically, with sFlt1-14 becoming the dominant isoform over
time. Thus, whereas the “classic” sFlt1 accounted for approxi-
mately half of placenta-produced soluble receptors during the
first trimester, a further increase at later times was entirely
attributable to upregulated expression of sFlt1-14 (Figure 4A).
Transition to almost exclusive production of sFlt1-14 took place
by the beginning of the second trimester and was clearly evident
at term (Figure 4A). sFlt1-14 mRNA was also the dominant, if
not the sole, transcript encoding soluble Flt1 in the PE placenta,
reaching steady-state levels exceedingly higher than in the term
normal placenta (Figure 4B). Identity of the respective mRNAs
was secured through probing with a sFlt1-14 –specific riboprobe
(supplemental Figure IV). sFlt1-14 was identified by direct
sequencing of cDNA clones prepared from placenta RNA of 7
of 7 PE patients.
Whereas coding sFlt1-14 sequences were invariably iden-
tical in all cases, extensive RNA editing of the 3⬘-UTR was
encountered (supplemental Figure V).
To identify which cells in the PE placenta produce sFlt1-14,
we carried out in situ hybridization analysis using a sFlt1-14 –
specific riboprobe (Figure 5). The major sites of placental
 Sela et al A Novel Human-Specific Soluble VEGF-Receptor 1 1571

Figure 4. Preferential expression of sFlt1-14 in the maturing normal and PE placenta. A, Left and Middle, Two representative experi-
ments of Northern blot analysis of placental RNAs from the indicated weeks of gestation with the probe detecting shared sequences
of sFlt1-14 and sFlt1. Right, The sFlt1-14/sFlt1 expression ratio calculated on the basis of hybridization intensities. Note dominance of
sFlt1-14 from the second trimester and onward. Cases analyzed were from the following gestational weeks: first trimester: 8, 9, 9, 10,
11 (n⫽5); second trimester: 13, 15, 15 (n⫽3); term placenta: 38, 38, 39, 39, 40 (n⫽5). *P⬍0.02 compared with the first trimester. Data
are presented as mean⫾SEM. B, Northern blot analysis with the shared extracellular part of Flt1 identifies sFlt1-14 as the predominant
receptor isoform in the PE placenta.

sFlt1-14 expression were found to be syncytial knots, ie, clusters lower levels and, importantly, not at all in vascular ECs (Figure
of degenerative syncytiotrophoblasts that are a histological 5, top middle, and at a higher magnification in the image on the
Downloaded from http://circres.ahajournals.org/ by guest on January 8, 2018

hallmark of the PE placenta. Of note, sFlt1-14 is also produced top right), thus identifying syncytial knots as the predominant
by seemingly healthy syncytiotrophoblasts but at significantly site of sFlt1-14 production. It should be pointed out that

Figure 5. Identification of sFlt1-14 –producing cell in the placenta. Top, In situ hybridization with a sFlt1-14-specific riboprobe. Note
that syncytial knots (SK) are the major source of placental sFlt1-14, with a lower expression by apparently healthy syncytiotrophoblasts
(STB) and no sFlt1-14 expression by placental ECs. Hybridization signal is evident as black autoradiographic grains. Bottom, Serial
sections hybridized with either sFlt1-14 –specific probe (left) or a sFlt1-specific probe (right). Note extensive syncytial knots hybridiza-
tion using sFlt1-14 but near background signal with sFlt1. The latter probe gave a clear hybridization signal in syncytiotrophoblasts of
first trimester placenta, indicative of its potency (data not shown).
 1572 Circulation Research June 20, 2008
Figure 6. sFlt1-14 protein produced by the placenta accumu-
lates in the circulation of PE patients. A, Protein extracts from
term human placenta were immunoprecipitated separately with
the 3 indicated antibodies detecting each a different epitope of
sFlt1-14 and immunoblotted with the antibody unique to sFlt1-
14. This procedure identified the 130- and 115-kDa placental
Downloaded from http://circres.ahajournals.org/ by guest on January 8, 2018
proteins as sFlt1-14. B, Serum (20 mL) of a PE patient were
passed through a column of beads coated with anti-Flt1 anti-
bodies (against a shared extracellular epitope), eluted at a low
pH, and immunoblotted with the sFlt1-14-specific CESS anti-
body. For comparison, a CESS immunoprecipitate of the pla-
centa was run in parallel and immunoblotted. Note that the
same 2 protein bands detected in the placenta (and identified
above as sFlt1-14 proteins) are also found in the PE serum.
syncytial knots are often found in aged normal placenta, and we
could indeed detect sFlt1-14 expression in syncytial knots of
normal placenta (data not shown). We conclude that the much
increased abundance of syncytial knot in PE accounts for the
greatly elevated levels of sFlt1-14 produced in the PE placenta.
sFlt1-14 Accumulates in the Circulation of
PE Patients
Findings that the PE placenta expresses primarily sFlt1-14 argue
that this is the major soluble receptor isoform capable of
accumulating in the serum of PE patients. To show that sFlt1-14
protein is produced in the PE placenta and subsequently released
into the circulation of PE patients, the following experiments
were performed. First, term placentas from normal and PE
pregnancies were examined for the relative abundance of soluble
receptors, using immunoprecipitations and immunoblotting with
isoform-specific antibodies. As expected from the mRNA ex-
pression data, sFlt1-14 protein was abundantly produced in term
placenta (Figure 6A). Furthermore, through immunoprecipita-
tion/immunoblotting experiments using different constellations
of common and unique antibodies, we could show the domi-
nance of sFlt1-14 protein over sFlt1 protein in term placenta
(supplemental Figure VI). Of note, this finding is consistent with
our RNA data (Figure 4A) but differs from the findings of
Thomas et al8 who detected comparable levels of sFlt1-14 and
sFlt1 in placenta. Second, proteins from a preeclamptic placenta
were immunoprecipitated with the CESS sFlt1-14 –specific an-
tibody, and the eluted 115-kDa band was unequivocally identi-
fied as sFlt1-14 using mass spectrometry. Of a particular
diagnostic value was a peptide spanning the exon 13/exon 14
junction because it is present in sFlt1-14 but missing in sFlt1 and
because the smaller size of this band rules out that it represents
the full-size Flt1 receptor (supplemental Figure VII). It should be
pointed out that because all peptides identified by mass spec-
trometry are shared by full-size Flt1, it could, in principle,
represent a proteolytic cleavage product of Flt1. This is unlikely,
however, considering that the analyzed protein band was immu-
noprecipitated with the sFlt1-14 –specific antibody CESS (rec-
ognizing an epitope missing in Flt1) and further confirmed to
include the CESS epitope by an analytic CESS immunoblotting
done in parallel before its elution from the gel. Initial analysis of
the 130-kDa band identified this band also as a truncated Flt1
receptor. Third, sera of PE women were analyzed for soluble
Flt1 receptors. ELISA with antibody directed against a shared
extracellular domain confirmed an earlier report of significantly
elevated levels of circulating soluble receptor in PE (800 to 900
pg/mL versus 8000 to 10 000 pg/mL in control and PE third
trimester sera, respectively). To identify the molecular identity
of circulating soluble receptors, PE serum specimens were
passed through FLT11 antibody-coated columns and bound
proteins were subsequently analyzed by western blotting (Figure
6B). Again, sFlt1-14 protein was readily detected in the PE
serum, visualized as 2 bands identical in size to those produced
by the cells transfected with sFlt1-14 expression plasmid and
detected with the sFlt1-14 –specific antibody (Figure 2A). Im-
munoblotting the PE serum with an antibody directed against an
extracellular epitope that recognizes all soluble Flt1 isoforms
failed to present other than the 2 sFlt1-14 bands (supplemental
Figure VIII).
Discussion
The study uncovered a new player in VEGF regulation, namely,
a novel variant of soluble VEGF receptor-1 (designated sFlt1-
14) functioning as a potent VEGF inhibitor. Evolutionarily,
sFlt1-14 represents a relatively recent addition to the multiple
layers of VEGF control, because the unique splicing pattern
generating it, using a previously unrecognized intron 14
splice acceptor site, only takes place in humans and possibly
also in nonhuman primates. Its fixation in the human genome
should have a profound affect on VEGF homeostasis in adult
human organs. This is attributable to the fact that the 3
possible fates of primary VEGF-R1 transcripts, namely,
conversion to mRNAs encoding either the full-size signaling
receptor or 1 of the 2 truncated soluble receptors, are
mutually exclusive. Thus, the highly preferred utilization of
the intron 14 splice acceptor in nonendothelial cells reported
here not only produces a strong VEGF inhibitor but also
comes on the expanse of the possibility to transmit VEGF-
R1–mediated signals altogether. This is in contrast to sFlt1,
whose production in ECs is in most cases accompanied by a
large excess of the transmembrane receptor.
Several additional findings support the notion that sFlt1-14
may protect nonendothelial cells from unwarranted VEGF sig-
naling. In the cornea, a protective role for soluble Flt1 receptor
against VEGF-induced neovascularization has been convinc-
ingly shown,5 and we show here that sFlt1-14 is likely to
participate in this protection. In the context of the blood vessel
wall, several considerations support the notion of sFlt1-14 –
mediated protection. First, there is a clear separation of sFlt1 and
sFlt1-14 expression in ECs and nonendothelial cells, respec-
tively. In the vessel wall, this dichotomy is evidenced by sFlt1
expression in ECs and sFlt1-14 exclusively in neighboring
 Sela et al
VSMCs. Second, sFlt1-14 is dynamically regulated by proxim-
ity to ECs and by VEGF directly, compatible with the notion that
sFlt1-14 may physiologically function in titration of surplus
VEGF. The role(s) of VEGF constitutively produced by the
mature, healthy endothelium is poorly understood. For example,
it is not clear whether perturbing normal function of endotheli-
ally produced VEGF may account for the hypertension devel-
oping in cancer patients treated with anti-VEGF antibodies. We
propose that soluble VEGF-R1 elaborated by VSMCs may keep
in check the levels of VEGF acting in a paracrine fashion (like
preventing VEGF-induced VSMC migration11) while leaving
autocrine VEGF functions12 unaffected. It should be pointed out
that in mice, VSMCs abundantly express sFlt1 rather than
sFlt1-14 (supplemental Figure IX), arguing that a putative
protective role for a VEGF-sequestering soluble receptor in the
vessel wall is not restricted to humans.
The full repertoire of nonendothelial cells expressing sFlt1-14
remains to be elucidated. Of note, sFlt1-14 is also expressed by
Downloaded from http://circres.ahajournals.org/ by guest on January 8, 2018
certain human myeloid cells alongside VEGF-R1. The signifi-
cance of VEGF-R1–mediated VEGF signaling in these cells
and, accordingly, possible modulations by the soluble receptor
also need to be determined. The newly discovered sFlt1-14 is
qualitatively different from sFlt1 by both missing 31 amino acids
and containing exon 14 coded amino acids, as well as 28 unique
amino acids. Although the 31 amino acids missing in sFlt1-14
are evolutionary highly conserved, arguing for their functional
importance, inhibition of VEGF signaling was not compro-
mised. Conversely, it is possible that addition of extra amino
acids (eg, a polyserine stretch) confer unique biological proper-
ties to sFlt1-14. Likewise, the completely different 3⬘-UTR may
strongly impact on a differential sFlt1-14 regulation. The UTR is
known to affect many aspects of mRNA function, including
nuclear export, cytoplasmic localization, and translational effi-
ciency and stability and even to determine tissue-specific func-
tions.13 These parameters may be further modified by posttran-
scriptional RNA editing. Alu insertions, in particular, are known
to provide a favored substrate for RNA editing,14 as also
demonstrated here for the Alu element nested in the 3⬘-UTR of
sFlt1-14. In the case reported here, extensive RNA editing was
accompanied by exceedingly high steady-state levels of sFlt1-14
mRNA in the placenta and was also associated with clinical
manifestations of intrauterine growth restriction. Because we
failed to detect RNA editing in 3 additional PE cases not
complicated by intrauterine growth restriction, it is tempting to
speculate that these phenotypes are causally related, but this
must of course be substantiated by analysis of more cases. The
most significant pathology in which a soluble VEGF-R1 has
been causally implicated is PE. This was based on detecting
abnormally high levels of soluble receptor in circulation of
preeclamptic women and on demonstrating that its systemic
administration in rats produces a PE-like syndrome.6,7 Here, we
provide evidence that the soluble receptor produced by the
placenta, accumulating in the circulation of PE women, and
hence capable of affecting distant organs is primarily sFlt1-14.
The discrepancy with published work is explained by the fact
that, unlike in our study, previous studies have only used probes
and antibodies directed against the extracellular domain of Flt1,
ie, against a sequence or an epitope shared by all mRNA and
proteins encoded by Flt1 gene. The facts that PE is a human-
A Novel Human-Specific Soluble VEGF-Receptor 1 1573
specific disease and that sFlt1-14 is a human-specific protein
raises the speculation that a unique aspect in sFlt1-14 regulation
or a unique, yet unidentified, biological property of this protein
is responsible for disease. Yet, the reason why rodents do not
develop PE could also be attributable to inherent differences in
placentation in rodents and primates. A sFlt1-14 – expressing
mouse (currently under construction) should aid in addressing
this question. Here, we identified syncytial knots as the major
source of local and circulating sFlt1-14. The fact that these
structures increase in number in the normal aging placenta but
are much more abundant in the degenerating PE placenta, a
phenomenon known as the “Tenney–Parker change,”15 may
explain findings that serum levels of soluble receptors (now
identified as mostly sFlt1-14) increase in the second and third
trimesters of normal pregnancies but to dramatically higher
levels in PE pregnancies. These findings place syncytial knot-
ting, a phenomenon common to several placental pathologies, as
central to PE pathogenesis. We note in this regard that hypoxia,
often considered to be an etiological cause of PE, is known to
induce syncytial knotting16 and that syncytial knotting is also
increased in placental malaria,17 known to be associated with
increasing levels of circulating VEGF-R1.18
Finally, we note that our findings provide another example
for a required caution in extrapolating from mouse systems to
human disease, because the latter might also involve human-
specific mRNAs and proteins.
Acknowledgments
We thank Dr Moshe Flugelman, Dr Gera Neufeld, and Genia Maftsir
for providing cells and for helpful discussions.
Sources of Funding
The study was supported by grants from the Israel Science Founda-
tion, Hadassah Women’s Health Fund, and the Hebrew University
Hadassah Dean’s Joint Fund.
Disclosures
None.
References
1. Cao L, Jiao X, Zuzga DS, Liu Y, Fong DM, Young D, During MJ. VEGF
links hippocampal activity with neurogenesis, learning and memory. Nat
Genet. 2004;36:827– 835.
2. Olsson AK, Dimberg A, Kreuger J, Claesson-Welsh L. VEGF receptor
signalling: in control of vascular function. Nat Rev Mol Cell Biol. 2006;7:
359–371.
3. Ferrara N, Carver-Moore K, Chen H, Dowd M, Lu L, O’Shea KS,
Powell-Braxton L, Hillan KJ, Moore MW. Heterozygous embryonic
lethality induced by targeted inactivation of the VEGF gene. Nature.
1996;380:439 – 442.
4. Miquerol L, Langille BL, Nagy A. Embryonic development is disrupted
by modest increases in vascular endothelial growth factor gene
expression. Development. 2000;127:3941–3946.
5. Ambati BK, Nozaki M, Singh N, Takeda A, Jani PD, Suthar T, Albuquerque
RJ, Richter E, Sakurai E, Newcomb MT, Kleinman ME, Caldwell RB, Lin
Q, Ogura Y, Orecchia A, Samuelson DA, Agnew DW, St Leger J, Green
WR, Mahasreshti PJ, Curiel DT, Kwan D, Marsh H, Ikeda S, Leiper LJ,
Collinson JM, Bogdanovich S, Khurana TS, Shibuya M, Baldwin ME,
Ferrara N, Gerber HP, De Falco S, Witta J, Baffi JZ, Raisler BJ, Ambati J.
Corneal avascularity is due to soluble VEGF receptor-1. Nature. 2006;443:
993–997.
6. Maynard SE, Min JY, Merchan J, Lim KH, Li J, Mondal S, Libermann
TA, Morgan JP, Sellke FW, Stillman IE, Epstein FH, Sukhatme VP,
Karumanchi SA. Excess placental soluble fms-like tyrosine kinase 1
 1574 Circulation Research June 20, 2008
(sFlt1) may contribute to endothelial dysfunction, hypertension, and pro-
teinuria in preeclampsia. J Clin Invest. 2003;111:649 – 658.
7. Levine RJ, Maynard SE, Qian C, Lim KH, England LJ, Yu KF,
Schisterman EF, Thadhani R, Sachs BP, Epstein FH, Sibai BM, Sukhatme
VP, Karumanchi SA. Circulating angiogenic factors and the risk of
preeclampsia. N Engl J Med. 2004;350:672– 683.
8. Thomas CP, Andrews JI, Liu KZ. Intronic polyadenylation signal
sequences and alternate splicing generate human soluble Flt1 variants and
regulate the abundance of soluble Flt1 in the placenta. FASEB J. 2007;
21:3885–3895.
9. Motro B, Itin A, Sachs L, Keshet E. Pattern of interleukin 6 gene
expression in vivo suggests a role for this cytokine in angiogenesis. Proc
Natl Acad Sci U S A. 1990;87:3092–3096.
10. Gluzman Z, Koren B, Preis M, Cohen T, Tsaba A, Cosset FL, Shofti R,
Lewis BS, Virmani R, Flugelman MY. Endothelial cells are activated by
angiopoeitin-1 gene transfer and produce coordinated sprouting in vitro and
arteriogenesis in vivo. Biochem Biophys Res Commun. 2007;359:263–268.
11. Wang Z, Castresana MR, Newman WH. Reactive oxygen and NF-kappaB
in VEGF-induced migration of human vascular smooth muscle cells.
Biochem Biophys Res Commun. 2001;285:669 – 674.
Downloaded from http://circres.ahajournals.org/ by guest on January 8, 2018
12. Lee S, Chen TT, Barber CL, Jordan MC, Murdock J, Desai S, Ferrara N,
Nagy A, Roos KP, Iruela-Arispe ML. Autocrine VEGF signaling is
required for vascular homeostasis. Cell. 2007;130:691–703.
13. Hughes TA. Regulation of gene expression by alternative untranslated
regions. Trends Genet. 2006;22:119 –122.
14. Levanon K, Eisenberg E, Rechavi G, Levanon EY. Adenosine-to-inosine
RNA editing in Alu repeats in the human genome. EMBO Rep. 2005;6:
831– 835.
15. Tenney B, Parker F. The placenta in toxemia of pregnancy. Am J Obstet
Gynecol. 1940;39:1000 –1005.
16. Heazell AE, Moll SJ, Jones CJ, Baker PN, Crocker IP. Formation of
syncytial knots is increased by hyperoxia, hypoxia and reactive oxygen
species. Placenta. 2007;28(suppl A):S33–S40.
17. Crocker IP, Tanner OM, Myers JE, Bulmer JN, Walraven G, Baker PN.
Syncytiotrophoblast degradation and the pathophysiology of the malaria-
infected placenta. Placenta. 2004;25:273–282.
18. Muehlenbachs A, Mutabingwa TK, Edmonds S, Fried M, Duffy PE.
Hypertension and maternal-fetal conflict during placental malaria. PLoS
Med. 2006;3:e446.
 A Novel Human-Specific Soluble Vascular Endothelial Growth Factor Receptor 1: Cell
Type-Specific Splicing and Implications to Vascular Endothelial Growth Factor
Homeostasis and Preeclampsia
Downloaded from http://circres.ahajournals.org/ by guest on January 8, 2018

Shay Sela, Ahuva Itin, Shira Natanson-Yaron, Caryn Greenfield, Debra Goldman-Wohl, Simcha
Yagel and Eli Keshet

Circ Res. 2008;102:1566-1574; originally published online May 30, 2008;

doi: 10.1161/CIRCRESAHA.108.171504
Circulation Research is published by the American Heart Association, 7272 Greenville Avenue, Dallas, TX 75231
Copyright © 2008 American Heart Association, Inc. All rights reserved.
Print ISSN: 0009-7330. Online ISSN: 1524-4571

The online version of this article, along with updated information and services, is located on the
World Wide Web at:
http://circres.ahajournals.org/content/102/12/1566

Data Supplement (unedited) at:

http://circres.ahajournals.org/content/suppl/2008/06/23/CIRCRESAHA.108.171504.DC1

Permissions: Requests for permissions to reproduce figures, tables, or portions of articles originally published
in Circulation Research can be obtained via RightsLink, a service of the Copyright Clearance Center, not the
Editorial Office. Once the online version of the published article for which permission is being requested is
located, click Request Permissions in the middle column of the Web page under Services. Further information
about this process is available in the Permissions and Rights Question and Answer document.

Reprints: Information about reprints can be found online at:

http://www.lww.com/reprints

Subscriptions: Information about subscribing to Circulation Research is online at:

http://circres.ahajournals.org//subscriptions/
Online Supplement Sela et al., A Novel Human-Specific Soluble VEGF-Receptor 1…

LEGENDS TO SUPPLEMENTARY FIGURES

Online Figure I: sFlt1-14 coding and 3’ UTR sequences. sFlt1-14 cDNA

containing the full coding region and the 3’-UTR was cloned from human term
placenta. Sequence was deposited at Genbank databases (accession No. EU368830).

Online Figure II: Characterization of CESS & CHFK antibodies. Antibodies

specificity was confirmed by western blotting of recombinant proteins produced by
HeLa cells transfected with either sFlt1- or sFlt1-14 encoding plasmids. Note that,
whereas the common ab9540 antibody recognized both soluble receptors, our CESS
and CHFK antibodies recognized only sFlt1-14.

Online Figure III: sFlt1-14 up regulation in VSMCs in response to VEGF.

VEGF was added to cultures of VSMCs from a human saphenous vein for the
indicated times as described in figure 3D, and sFlt1-14 mRNA detected by real time
PCR using specific primers. Note up regulation by VEGF of constitutively expressed
sFlt1-14. Specific primers were used for Flt1 and sFlt1 as well, but these transcripts
were barely detectable. n=4; *=p<0.05, **=p<0.0001 compared to all other groups;
Data presented as mean ± SEM. PCR primer sequences were the following: sFlt1-14
F- CTCCTGCGAAACCTCAGTG ; sFlt1-14 R- GACGATGGTGACGTTGATGT; sFlt1 F-
GCACGTTTGGATTTGGAGGA; sFlt1 R- GGAAAGGATCATCCCAAGTTGTT; Flt1 F-
TGGACTGACAGCAAACCCAA; Flt1 R- CAGAAACTGGGCCTGCTGAC.

Online Figure IV: Identification of the 3.0 Kb Flt transcript as sFlt1-14 . RNA
blots were analyzed with a probe detecting either exons 1-5 (shared by Flt1, sFlt1 and
sFlt1-14) or exon 15a (unique to sFlt1-14). A. RNA from 9 weeks placenta (same as
in Exp. 1 in figure 4A). B. RNA from two preparations of explanted placental villi of
the 1st trimester. C. RNAs from twin placentas of a PE-complicated pregnancy (one of
the twin embryos also diagnosed as IUGR (same RNAs used in figure 4C).

Online Figure V: sFlt1-14 3' UTR is edited in placenta of a PE patient

complicated by IUGR. A woman with severe PE carried twins with the placenta of
one of them accounting for most of the extremely high levels of circulating soluble
receptor detected in her serum (8200pg/ml). (Left) sFlt1-14 was identified as the
dominant soluble receptor expressed in the placentas of both twins, with the placenta
of the twin also showing Intra-Uterine Growth Retardation (IUGR) expressing
exceedingly high levels of sFlt1-14. (Right) The 3’UTR regions of sFlt1-14 mRNA
from both placentas were cloned and cDNA sequences were determined. Shown is the
3’-UTR sequence (starting at the translation stop codon highlighted in bold) of the
twin with IUGR. The Alu repeat is underlined and the 18 A-to-I transitions resulting
from RNA editing events are marked with the letter "g". No editing events were
detected in the 3’-UTR of the unaffected twin.To what extent, these structural
alterations may affect biological regulation of sFlt1-14 remains to be determined

Online Figure VI: Analysis of soluble Flt1 receptors in term placenta. Placental
extracts from the indicated weeks of gestation were immuno –precipitated with the
FLT11 antibody, and analyzed on western blots first with CESS and sequentially with
ab9540. Note that the 130Kd and 115Kd sFlt1-14 proteins revealed by CESS
(arrowheads) are also the prominent two bands detected by ab9540 which should
Online Supplement Sela et al., A Novel Human-Specific Soluble VEGF-Receptor 1…

detect also sFlt1, thereby indicating that sFlt1-14 is the major soluble receptor
produced by term placenta.

Online Figure VII: sFlt1-14 identification by Mass spectrometry. The 115 Kd

protein band was immuno-precipitated from a preeclamptic placental biopsy with the
CESS antibody and visualized by coomassie blue staining, eluted and analyzed by
mass spectrometry. A part of the amino acids sequence of the membrane spanning
Flt1 is presented for illustration. Highlighted in red are three identified peptides that
map either to the first 13 exons or to the exon13/exon14 junction (Junction indicated
by the green vertical line). The latter rule-out that the protein is sFlt1, while the CESS
immuno-precipitation and size considerations rule-out that it is Flt1, thus identifying
the 115kd protein unequivocally as sFlt1-14.

Online Figure VIII: Analysis of soluble Flt1 receptors in PE serum. The PE

serum analyzed in Figure 6B using the CESS antibody for immuno-blotting was
immuno-blotted here with ab9540 (targeting an extra cellular epitope) and bands were
examined against those immunorecipitated by CESS from a term placenta. Note that
the two bands detected in the PE serum (arrowheads) are similar in size to the two
sFlt1-14 bands shown in Figure 6B. Importantly, no major additional bands were
detected with ab9540, suggesting that sFlt1-14 is a major circulating receptor in PE.

Online Figure IX: sFlt1 expression in mouse Vascular Smooth Muscle Cells
(VSMCs). A section of murine heart immuno-stained with sFlt1 specific antibody.
Note presence of sFlt1 in VSMCs of coronary vessels but not in endothelial cells of
the same vessels.
sFlt1-14 coding sequence : sFlt1-14 3’ UTR :

Online Figure I
 4 4 4
1-1 1 1-1 t1 1-1
lt1 lt lt lt l lt
sF sF s F sF sF sF

130Kd

95Kd

IB: CHFK CESS ab9540

Online Figure II
 140

**

sFlt1-14 (Relative units)

120

100

80

60

40

20 *
0
No 7h 20 h 30 h 45 h
VEGF VEGF VEGF VEGF VEGF

Online Figure III

A. B. C.
5
Probe 1- 15
a
s
Targeting on on
region: Ex Ex Probe Probe
Exons Exon Targeting Exons Exon
Targeting
region: 1-5 15a region: 1-5 15a

al

al
1 2 1 2

R
rm

rm
G

G
28S

No

No
IU

IU
sFlt1-14 Flt1
sFlt1 28S 28S
sFlt1-14 sFlt1-14
18S
sFlt1
18S 18S

Online Figure IV
 CCTCCTGCGAAACCTCAGTGATCACACAGTGGCCATCAGC
IUGR Normal AGTTCCACCACTTTAGACTGTCATGCTAATGGTGTCCCCGA
GCCTCAGATCACTTGGTTTAAAAACAACCACAAAATACAACA
twin twin AGAGCCTGAACTGTATACATCAACGTCACCATCGTCATCGT
CATCATCACCATTGTCATCATCATCATCATCGTCATCATCAT
CATCATCATAGCTATCATCATTATCATCATCATCATCATCAT
CATCATAGCTACCATTTATTGAAAACTATTATGTGTCAACTT
28S CAAAGAACTTATCCTTTAGTTGGAGAGCCAAGACAATCATA
ACAATAACAAATGGCCGGGCgTGGTGGCTCgCGCCTGTAAT
CCCAGCACTTTGGGAGGCCAAGGCgGGTGGATCATTTGAG
sFlt1-14 GTCAGGAGTcCggGACCAGCCTGACCggGATGGTGAAATGC
TGTCTCTATTgAAAATgCAAAATTgGCCgGGCATGGTGGCTC
ATGCCTGTgATGCCgGCTgCTCGGGAGGCTGAGACAGGAG
AgTCACTTGAgCCCgGGAGGCgGAGGTTGCAGGGAGCCGA
18S
GATCGTGTACTGCACTCCAGCCTGGGCAACAAGAGCGAAA
CTCCGTCTCAAAAAACAAATAAATAAATAAATAAATAAACAG
Loading ACAAAATTCACTTTTTATTCTATTAAACTTAACATACATGCTA
control AAAAAAAAAAAA

Online Figure V
 Week Week
39 40

130Kd

95Kd

72Kd
IB:

40
S

S
04
ES

ES

95
95

ab
C

C
ab
IP: FLT11 in all

Online Figure VI
Online Figure VII
 PE placenta
serum

130Kd

95Kd

IP: FLT11 CESS

IB: ab9540

Online Figure VIII

x40 x40

Online Figure IX