Biochemical and Biophysical Research Communications 464 (2015) 1157e1162

Contents lists available at ScienceDirect

Biochemical and Biophysical Research Communications

journal homepage: www.elsevier.com/locate/ybbrc

One-day high-fat diet induces inflammation in the nodose ganglion

and hypothalamus of mice
T. M. Zaved Waise a, Koji Toshinai a, b, Farhana Naznin a, Cherl NamKoong a,
Abu Saleh Md Moin a, Hideyuki Sakoda a, Masamitsu Nakazato a, c, *
a
Division of Neurology, Respirology, Endocrinology and Metabolism, Department of Internal Medicine, Faculty of Medicine, University of Miyazaki, 5200
Kihara, Kiyotake, Miyazaki, 889-1692, Japan
b
Department of Sports and Fitness, Faculty of Wellness, Shigakkan University, 55 Nakoyama, Yokone, Obu, 474-8651, Japan
c
AMED-CREST, Japan Agency for Medical Research and Development, 1-7-1 Otemachi, Chiyoda-ku, Tokyo, 100-0004, Japan

a r t i c l e i n f o a b s t r a c t

Article history: A high-fat diet (HFD) induces inflammation in systemic organs including the hypothalamus, resulting in
Received 9 July 2015 obesity and diabetes. The vagus nerve connects the visceral organs and central nervous system, and the
Accepted 20 July 2015 gastric-derived orexigenic peptide ghrelin transmits its starvation signals to the hypothalamus via the
Available online 21 July 2015
vagal afferent nerve. Here we investigated the inflammatory response in vagal afferent neurons and the
hypothalamus in mice following one day of HFD feeding. This treatment increased the number of
Keywords:
macrophages/microglia in the nodose ganglion and hypothalamus. Furthermore, one-day HFD induced
High-fat diet
expression of Toll-like receptor 4 in the goblet cells of the colon and upregulated mRNA expressions of
Inflammation
Ghrelin
the proinflammatory biomarkers Emr1, Iba1, Il6, and Tnfa in the nodose ganglion and hypothalamus. Both
Nodose ganglion subcutaneous administration of ghrelin and celiac vagotomy reduced HFD-induced inflammation in
Vagotomy these tissues. HFD intake triggered inflammatory responses in the gut, nodose ganglion, and subse-
quently in the hypothalamus within 24 h. These findings suggest that the vagal afferent nerve may
transfer gut-derived inflammatory signals to the hypothalamus via the nodose ganglion, and that ghrelin
may protect against HFD-induced inflammation.
© 2015 The Authors. Published by Elsevier Inc. This is an open access article under the CC BY-NC-ND
license (http://creativecommons.org/licenses/by-nc-nd/4.0/).

1. Introduction results in production of a variety of proinflammatory cytokines,

A high-fat diet (HFD) constitutes one of the major risks for
developing obesity, diabetes, atherosclerosis, and other feeding-
related disorders [1,2]. Consumption of a HFD induces inflamma-
tion in the adipose tissue, liver, and skeletal muscle by increasing
endotoxin lipopolysaccharide (LPS) levels in the intestinal lumen,
as well as by enhancing LPS action via Toll-like receptor 4 (TLR4)
[2,3]. This inflammation plays a critical role in the development of
obesity and insulin resistance [4,5]. Obesity-associated inflamma-
tion in the hypothalamus was first reported in 2005 [6], and many
investigators have since replicated this finding [7]. A recent study
demonstrated that inflammation in the hypothalamic arcuate nu-
cleus, a center of feeding regulation, develops 1e3 days after
initiation of HFD feeding [8]. HFD-induced activation of microglia
* Corresponding author. Division of Neurology, Respirology, Endocrinology and
Metabolism, Department of Internal Medicine, Faculty of Medicine, University of
Miyazaki, 5200 Kihara, Kiyotake, Miyazaki, 889-1692, Japan.
E-mail address: nakazato@med.miyazaki-u.ac.jp (M. Nakazato).
thereby provoking inflammatory responses that cause neuronal
death in the arcuate nucleus [8].
The nodose ganglion is a constellation of vagal afferent neurons
that transmit meal-related signals from the gastrointestinal tract to
the nucleus of the tractus solitaries (NTS) in the medulla oblongata
[9]. Vagal afferent neurons synthesize receptors for gastrointestinal
peptides and transport them to the afferent endings in the
gastrointestinal tract. Ghrelin, a 28eamino acid peptide produced
in gastric endocrine cells, stimulates food intake by transmitting
hunger signals to the NTS via the vagal afferent nerve [10,11].
Consumption of a HFD alters the composition of Gram-negative gut
microbiota, which are a major source of LPS production [12]. Vagal
afferent neurons express TLR4, and their axonal terminals inner-
vating the gut are in close proximity to sites of LPS release that
could be exposed to high concentrations of LPS under HFD condi-
tions [13,14]. Ghrelin can suppress LPS-induced release of proin-
flammatory cytokines from macrophages/microglia [15].
In this study, we found that very short-term HFD (one day of
HFD feeding) resulted in inflammation in the colon, nodose

http://dx.doi.org/10.1016/j.bbrc.2015.07.097
0006-291X/© 2015 The Authors. Published by Elsevier Inc. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
1158 T.M.Z. Waise et al. / Biochemical and Biophysical Research Communications 464 (2015) 1157e1162
ganglion, and hypothalamus in mice. HFD-induced inflammatory
responses were abolished by a single peripheral administration of
ghrelin before the initiation of HFD feeding. Celiac vagotomy also
suppressed inflammatory responses in the nodose ganglion and
hypothalamus of HFD-fed mice. Thus, very short-term HFD causes
inflammation in the vagal afferent system, which may transmit
inflammatory signals to the hypothalamus. Ghrelin could exert a
beneficial effect by suppressing HFD-induced inflammatory
processes.
2. Materials and methods
2.1. Animals
Male C57BL/6 J mice (6-week-old; 20e21 g; Charles River Lab-
oratories, Yokohama, Japan) were maintained in individual cages
under controlled temperature (21e23
C) and light (light on:
08:00e20:00) conditions. Mice were maintained on a chow diet
(CD) (12.3% fat, 59.2% carbohydrate, 28.5% protein, 3.4 kcal/g; CLEA
Rodent Diet CE-2, CLEA Japan, Tokyo, Japan) with free access to
food. All animal experiments were approved by the Animal Care
and Use Committee of University of Miyazaki.
2.2. Experimental design
Mice were fed either a CD or HFD (60% fat, 20% carbohydrate,
20% protein, 5.2 kcal/g; no. D12492; Research Diets, New Bruns-
wick, NJ) for a 24-h period from 10:00 to 10:00 on the following
day. They received a subcutaneous administration of saline or
ghrelin (60 nmol/kg body weight (BW), 50 ml saline; Peptide
Institute, Minoh, Japan) just before the start of CD or HFD intake.
2.3. Celiac branch vagotomy
Mice (5-week-old males, n ¼ 8 per group) were anesthetized by
intraperitoneal administration of sodium pentobarbital (Abbot
Laboratories, Chicago, IL). A midline incision was made to provide
wide exposure of the upper abdominal organs. Bilateral celiac
branches of the vagal nerve were split and cut. In the sham oper-
ation, the celiac branches of mice were only exposed and they were
returned to their home cages. Mice were accustomed to experi-
mental conditions by daily handling for 7 days before the experi-
ment. Only mice exhibiting progressive weight gain after surgery
were used in experiments.
2.4. Measurements of blood parameters
Blood was collected by tail-prick 24 h after the start of experi-
ment. Glucose was measured using a glucometer (Terumo, Tokyo,
Japan). Plasma insulin level was determined using a mouse Insulin
EIA Kit (Morinaga Institute of Biological Science, Yokohama, Japan).
Serum triglycerides were determined with a L-Type Triglyceride H
kit (WAKO Pure Chemical Industries, Osaka, Japan), and non-
esterified fatty acids (NEFAs) were measured using an NEFA-SS
‘EIKEN’ kit (EIKEN Chemical, Tokyo, Japan).
2.5. Immunohistochemistry
Mice (n ¼ 6 per group) were anesthetized by intraperitoneal
administration of sodium pentobarbital (5 mg/kg BW) and trans-
cardially perfused with ice-cold phosphate buffer (PB) followed by
4% paraformaldehyde/phosphate buffer saline (PBS) solution.
Nodose ganglion, brain, and distal colon were immersed in 4%
paraformaldehyde/PBS for 24 h at 4
C, and subsequently cry-
oprotected in 0.1 M PB containing 20% sucrose. The nodose
ganglion and distal colon, embedded in Tissue-Tek OCT compound
(Sakura Finetek Japan, Tokyo, Japan), were cut into 8-mm slices
using a cryostat (Leica CM3050S; Leica, Nussloch, Germany) chilled
at 20
C. Hypothalamic sections of 40 mm thickness were prepared
on a freezing microtome (Komatsu Electronics, Kanagawa, Japan).
Sections were blocked in Serum-Free Protein Block (Dako, Carpin-
teria, CA) for 5 min at room temperature, and then incubated
overnight at 4
C with rabbit anti-Iba1 (1:10,000; Wako Pure
Chemicals), rat anti-CD86 (1:100; Abcam, Cambridge, UK), Alexa
Fluor 488econjugated mouse monoclonal anti-NeuN (1:200; Mil-
lipore, Temecula, CA), goat anti-TLR4 (1:100; Santa Cruz Biotech-
nology, Dallas, TX), or rabbit anti-mucin 2 (MUC2) (1:50; Santa Cruz
Biotechnology). Slices were washed with PBS and incubated with
Alexa Fluor 488elabeled anti-rabbit, Alexa Fluor 594elabeled anti-
rat, Alexa Fluor 594elabeled anti-goat, or Alexa Fluor 594elabeled
anti-rabbit (all used at 1:400; Invitrogen, Carlsbad, CA) at room
temperature for 1 h. Nuclei in colon sections were identified by
staining with 40 , 6-diamidino-2-phenylindole (DAPI) (Millipore).
Images were visualized on an OLYMPUS AX-7 fluorescence micro-
scope (Olympus, Tokyo, Japan). Cells immunostained with Iba1 or
CD86 antibody were counted manually with Olympus cellSens
imaging software (Olympus). Quantitative histological analysis of
Iba1, CD86, TLR4, and MUC2 pixel intensities were automatically
performed on three sections from each animal using the cellSens
Dimension imaging software (Olympus). Quantitation was per-
formed in a blinded fashion.
2.6. Real-time polymerase chain reaction (RT-PCR)
Nodose ganglion, hypothalamus, liver, epididymal fat, and
mesenteric fat were removed from anesthetized CD- or HFD-fed
mice. Colons were flushed with PBS/RNAlater (Life Technologies,
Carlsbad, CA), and then the epithelial cells of the luminal side were
scraped off and collected. All samples were placed in a tube con-
taining autoclaved glass beads (425e600 mm) (SigmaeAldrich, St.
Louis, MO), and vortexed for 6 min with TissueLyser (Qiagen). Total
RNA was extracted using the RiboPure kit (Ambion, Austin, TX). RT-
PCR was performed on a LightCycler system (Roche Diagnostics,
Mannheim, Germany) using SYBR Premix Ex Taq (2) (TaKaRa Bio,
Otsu, Japan) and the following primer sets: Iba1, AGCTGCCTGTCT-
TAACCTGCATC and TTCTGGGACCGTTCTCACACTTC; Il6, CCACTTCA-
CAAGTCGGAGGCTTA and CCAGTTTGGTAGCATCCATCATTTC; Tnfa,
TATGGCCCAGACCCTCACA and GGAGTAGACAAGGTACAACCCATC;
Itgam (CD11b), CCACTCATTGTGGGCAGCTC and GGGCAGCTTCATT-
CATCATGTC; Itgax (CD11c), AGGTCTGCTGCTGCTGGCTA and
GGTCCCGTCTGAGACAAACTG; Mpo, CTGCCTCATTGGCACTCAGTTTA
and GGTGATGCCAGTGTTGTCACAG; F4/80: CTCTGTGGTCCCACCTT-
CAT and GATGGCCAAGGATCTGAAAA; Emr1, GAGATTGTGGAAG-
CATCCGAGAC and GACTGTACCCACATGGCTGATGA; Tlr4,
GGAAGTTCACATAGCTGAATGAC and CAAGGCATGTCCA-
GAAATGAGA; Tbp, CATTCTCAAACTCTGACCACTGCAC and CAGC-
CAAGATTCACGGTAGATACAA; and glyceraldehyde phosphate
dehydrogenase (Gapdh), TCAAGAAGGTGGTGAAGCAG and
TGGGAGTTGCTGTTGAAGTC. mRNA levels were normalized against
the level of Gapdh or Tbp in the same sample.
2.7. Statistical analysis
Statistical analyses were performed by one-way ANOVA fol-
lowed by Bonferroni's post-test for multiple comparisons, as
appropriate. When two mean values were compared, analyses were
performed by unpaired t-test. All data are expressed as
means ± SEM. P < 0.05 was considered to be statistically significant.
 T.M.Z. Waise et al. / Biochemical and Biophysical Research Communications 464 (2015) 1157e1162 1159

3. Results
3.1. Characteristics of mice
Table 1 shows characteristics and blood parameters of CD- and
HFD-fed mice. One-day HFD caused significant increases in body
weight, food intake amount, energy intake, epididymal fat weight,
and plasma insulin. All characteristics and parameters of sham
HFD- and vagotomized HFD-fed mice were comparable.
3.2. Iba1-and CD86-positive cells in the nodose ganglion and
hypothalamus, and TLR4 expression in the distal colon
Both the number and size of macrophages stained with Iba1 or
CD86 antibody in the nodose ganglion were significantly greater in
HFD-fed mice than in CD-fed mice (Fig. 1AeH). Approximately 30%
of Iba1þ macrophages in the nodose ganglion of HFD-fed mice
expressed CD86-immunoreactivity (Fig. 1F). In addition, in the
hypothalamus, both the number and size of Iba1þ microglia were
significantly greater in HFD-fed mice than in CD-fed mice, whereas
the number and size of CD86þ microglia were comparable in the
two groups (Fig. 1 IeP). TLR4 and MUC2 expression levels in the
distal colon, as determined by immunohistochemistry, were
significantly higher in HFD-fed mice than in CD-fed mice
(Fig. 1QeR). Approximately 29% of MUC2þ cells in HFD-fed mice
were immunoreactive for TLR4.
3.3. mRNA analysis of inflammatory markers
mRNA levels of Emr1, Iba1, Il6, and Tnfa in both nodose ganglion

Table 1
Characteristics and parameters of CD-fed or HFD-fed mice.

CD HFD Sham HFD Vagotomy HFD

Initial body weight (g) 21.70 ± 0.32 21.88 ± 0.34 21.92 ± 0.17 21.87 ± 0.34
Final body weight (g) 21.92 ± 0.31 23.25 ± 0.30* 22.94 ± 0.17 22.88 ± 0.42
24-h food intake (g) 3.26 ± 0.14 3.83 ± 0.11* 3.91 ± 0.05 3.85 ± 0.06
24-h energy intake (kcal) 11.09 ± 0.48 20.05 ± 0.58* 20.50 ± 0.25 20.20 ± 0.31
Epididymal fat weight (g) 0.30 ± 0.01 0.41 ± 0.01* 0.39 ± 0.01 0.38 ± 0.01
Blood glucose (mmol/l) 10.33 ± 0.53 10.57 ± 0.49 10.11 ± 0.33 10.19 ± 0.25
Plasma insulin (ng/ml) 0.77 ± 0.05 1.76 ± 0.20* 1.84 ± 0.20 1.90 ± 0.15

Data are expressed as means ± SEM (n ¼ 5e18). *P < 0.05 vs CD.

Fig. 1. Histochemical analyses of activated macrophages in nodose ganglion (AeF) and hypothalamus (IeN) of CD- or HFD-fed mice. Quantitation of Iba1þ and CD86þ cells in nodose
ganglion (GeH) and hypothalamus (OeP). Iba1þ (green) cells: A, D, I, and L; CD86þ (red) macrophages/microglia: B, E, J, and M. Arrows in F: co-localization of CD86 with Iba1. (Q)
Immunohistochemistry of TLR4 (red), MUC2 (green) and DAPI (blue) in distal colon of CD- or HFD-fed mice. (R) Relative TLR4 and MUC2 expression levels in the distal colon. Values
are means ± SEM. *P < 0.05 vs CD. Scale bars, 50 mm.
1160 T.M.Z. Waise et al. / Biochemical and Biophysical Research Communications 464 (2015) 1157e1162

and hypothalamus were significantly higher in HFD-fed mice than 4. Discussion

in CD-fed mice (Fig. 2AeB). mRNA levels of Tlr4, Itgax, and Tnfa in
the distal colon (Fig. 2C), Mpo in the liver and epididymal fat Obesity-associated inflammation is characterized by immune
(Fig. 2DeE), and Itgam, Tnfa, and Mpo in the mesenteric fat (Fig. 2F) cell infiltration and high levels of proinflammatory molecules in
were significantly higher in HFD-fed mice than in CD-fed mice. both the periphery and the hypothalamus. The consumption of a
HFD activates microglia and the expression of inflammatory cyto-
kines in the hypothalamus, thereby disrupting the hypothalamic
neuronal routes that maintain energy homeostasis [8,16]. We
3.4. Suppression of inflammatory response by ghrelin
observed that the inflammatory effects of HFD were rapid,
administration or vagotomy
appearing in the nodose ganglion and hypothalamus one day after
exposure to a HFD.
The numbers of macrophages/microglia in both nodose gan-
Macrophages/microglia are classified into classically activated
glion and hypothalamus were significantly higher in HFD-fed mice
macrophages (M1) representing CD86 and alternatively activated
than in CD-fed mice (Fig. 3AeD). Macrophages/microglia of HFD-
macrophages (M2) [17]. In a recent study, we showed that 12-week
fed mice were morphologically rounded and more ramified than
HFD feeding (60% of calories as fat) induced accumulation and
those of CD-fed mice. A single subcutaneous administration of
activation of M1 (Iba1þ/CD86þ) macrophages both in the nodose
ghrelin to HFD-fed mice before the initiation of HFD feeding
ganglion and hypothalamus of mice [18]. In the one-day HFD study
significantly reduced the number of Iba1þ macrophages/microglia
described here we observed elevated recruitment of M1 macro-
in these tissues (Fig. 3AeD). However, ghrelin treatment did not
phages in the nodose ganglion but not in the hypothalamus, sug-
alter TLR4 expression in the goblet cells of HFD-fed mice (data not
gesting that the nodose ganglion receives inflammatory signals
shown). mRNA levels of Iba1, Il6, and Tnfa in both nodose ganglion
before the hypothalamus.
and hypothalamus were significantly higher in HFD-fed mice than
Intestinal mucins are secreted from goblet cells and function
in CD-fed mice (Fig. 3EeF). Ghrelin administration abolished the
against gut inflammation and infection [19]. Administration of LPS
upregulation of these mRNAs in both tissues (Fig. 3E). Ghrelin
to the human goblet cell line HT29-MTX upregulates mucin
administration to CD-fed mice did not affect expression of any
secretion [20]. Increases in goblet cell number and MUC2 produc-
mRNAs tested. Celiac vagotomy significantly reduced upregulation
tion in 12-week HFD-fed mice might interrupt LPS absorption from
of Iba1, Il6, and Tnfa mRNA, as well as the numbers of Iba1þ mac-
the gut lumen to the systemic circulation [21]. In this study,
rophages/microglia in both nodose ganglion and hypothalamus
elevation of TLR4 and MUC2 expression in goblet cells in response
(Fig. 3FeJ).

A B C distal colon
nodose ganglion hypothalamus
400 400 400
*
mRNA (fold chow)
mRNA (fold chow)

mRNA (fold chow)

* * 300
NS
300 * 300 * *
* * NS

200
* 200
* 200 *

100 100 100

0 0 0
Itg 4
am

Itg 4
am
r1
1

r1
1

r1
1

r1
1

/80

/80
Il6

Il6

Il6

Il6

fα

fα
fα

fα

fα

fα

F4 x

F4 x
a

a
Tlr

Tlr
Iba

Iba

Iba

Iba

Tn

Tn
Tn

Tn

Tn

Tn
Em

Em

Em

Em

Itg

Itg

CD HFD CD HFD CD HFD

D E F
liver epididymal fat mesenteric fat
400 400 400

* * *
mRNA (fold chow)

mRNA (fold chow)

mRNA (fold chow)

NS NS
NS
NS
*
300 NS
300 300
NS NS
NS
NS
NS
*
200 200 200

100 100 100

0 0 0
am

o
am

am

o
am

am

o
am

o
/80

/80

/80

/80

/80

/80
fα

fα

fα

fα

fα

fα
F4 x

F4 x

F4 x

F4 x

F4 x

F4 x
o
a

a
Mp

Mp

Mp

Mp

Mp
Mp
Tn

Tn

Tn

Tn

Tn

Tn
Itg

Itg

Itg

Itg

Itg

Itg
Itg

Itg

Itg

Itg

Itg

Itg

CD HFD CD HFD CD HFD

Fig. 2. Effect of one-day HFD feeding on inflammatory gene expression. In the nodose ganglion (A), hypothalamus (B), distal colon (C), liver (D), epididymal fat (E), and mesenteric
fat (F) of CD- or HFD-fed mice. mRNAs are quantitated relative to Gapdh or Tbp mRNA and presented as fold change relative to CD. Values are means ± SEM. *P < 0.05 vs CD. NS, not
significant.
 T.M.Z. Waise et al. / Biochemical and Biophysical Research Communications 464 (2015) 1157e1162 1161

Fig. 3. Effects of ghrelin administration or celiac vagotomy on HFD-induced inflammation. Immunohistochemical detection and quantitation of Iba1 in the nodose ganglion (A, C)
and hypothalamus (B, D) of CD- or HFD-fed mice. (E, F) Relative expression levels of Iba1, Il6, and Tnfa. Immunohistochemical detection and quantitation of Iba1 in the nodose
ganglion (G, I) and hypothalamus (H, J) of sham or vagotomized CD- or HFD-fed mice. Iba1þ cells (red) and nuclei of neurons (green): A, B, G, and H. Values are means ± SEM.
*P < 0.05 vs CD-saline, #P < 0.05 vs HFD-saline, $P < 0.05 vs sham CD, yP < 0.05 vs sham HFD. Scale bars, 50 mm.

to one-day HFD may have served as a protective mechanism in the
colon. In the classical immune response to HFD feeding, neutrophils
infiltrate adipose tissue prior to macrophage infiltration [22]. In this
study, increased mRNA expressions of Itgam, Tnfa, and Mpo in
mesenteric fat indicated neutrophil infiltration and initiation of
acute inflammatory responses. The higher levels of Mpo mRNA
expressions in the liver and epididymal fat may also represent
initiation of acute inflammatory responses.
Ghrelin plays important roles in suppressing inflammation and
regulating immune function [23]. For example, ghrelin binds to a
receptor expressed on activated macrophages and attenuates LPS-
induced expressions of IL-6 and TNF-a [24]. Thaler et al. demon-
strated that the HFD-induced inflammatory response in the rat
hypothalamus exhibits a complex “oneoffeon” pattern, where the
1162 T.M.Z. Waise et al. / Biochemical and Biophysical Research Communications 464 (2015) 1157e1162
initial response declined to baseline after 7 days [8]. Acute in-
flammatory cytokine production is crucial for the initiation of
adaptive immune responses and allows the host to adapt to path-
ological conditions [25]. In this study, we found that ghrelin
administration prior to HFD feeding suppressed macrophages/
microglia infiltration and proinflammatory cytokines production in
the nodose ganglion and hypothalamus. Thus, ghrelin may protect
against HFD-induced inflammation.
Vagal afferents transmit chemical, physiological, and feeding-
related signals from the gut to the NTS [26]. Sub-diaphragmatic
vagotomy attenuated LPS-induced IL-1b mRNA expression in the
mouse hypothalamus [27], suggesting that the vagal afferent nerve
transmits LPS-induced inflammatory signals to the brain. Here, we
showed that celiac vagotomy suppressed one-day HFDeinduced
Iba1þ macrophages/microglia accumulation, as well as production
of the inflammatory cytokines Il6 and TNFa, in both nodose gan-
glion and hypothalamus. Thus, the vagal afferent nerve may
transfer gut-derived inflammatory signals to the hypothalamus via
the nodose ganglion. Our results suggest a novel important role for
the vagal afferent nerve in the progress of HFD-induced obesity,
and raise the possibility that ghrelin may have a therapeutic po-
tential as a means to prevent HFD-induced inflammation.
Conflict of interest
None.
Acknowledgment
This work was supported in part by JSPS KAKENHI (No.
25293216); and CREST, AMED to M.N.
References
[1] A. Chalkiadaki, L. Guarente, High-fat diet triggers inflammation-induced
cleavage of SIRT1 in adipose tissue to promote metabolic dysfunction, Cell
Metab. 16 (2012) 180e188.
[2] P.D. Cani, J. Amar, M.A. Iglesias, M. Poggi, C. Knauf, D. Bastelica, A.M. Neyrinck,

e, B. Cousin, T. Sulpice,
F. Fava, K.M. Tuohy, C. Chabo, A. Waget, E. Delme
res, J.F. Tanti, G.R. Gibson, L. Casteilla, N.M. Delzenne,
B. Chamontin, J. Ferrie
M.C. Alessi, R. Burcelin, Metabolic endotoxemia initiates obesity and insulin
resistance, Diabetes 56 (2007) 1761e1772.
[3] D.M. Tsukumo, M.A. Carvalho-Filho, J.B. Carvalheira, P.O. Prada, S.M. Hirabara,
A.A. Schenka, E.P. Araujo, J. Vassallo, R. Curi, L.A. Velloso, M.J. Saad, Loss-of-
function mutation in toll-like receptor 4 prevents diet-induced obesity and
insulin resistance, Diabetes 56 (2007) 1986e1998.
[4] Y.S. Lee, P. Li, J.Y. Huh, I.J. Hwang, M. Lu, J.I. Kim, M. Ham, S. Talukdar, A. Chen,
W.J. Lu, G.K. Bandyopadhyay, R. Schwendener, J. Olefsky, J.B. Kim, Inflamma-
tion is necessary for long-term but not short-term high-fat dieteinduced in-
sulin resistance, Diabetes 60 (2011) 2474e2483.
[5] S. Schenk, M. Saberi, J.M. Olefsky, Insulin sensitivity: modulation by nutrients
and inflammation, J. Clin. Invest. 118 (2008) 2992e3002.
[6] C.T. De Souza, E.P. Araujo, S. Bordin, R. Ashimine, R.L. Zollner, A.C. Boschero,
M.J. Saad, L.A. Velloso, Consumption of a fat-rich diet activates a proin-
flammatory response and induces insulin resistance in the hypothalamus,
Endocrinology 146 (2005) 4192e4199.
[7] D. Cai, T. Liu, Hypothalamic inflammation: a double-edged sword to
nutritional diseases, Ann. N. Y. Acad. Sci. 1243 (2011) E1eE39.
[8] J.P. Thaler, C.X. Yi, E.A. Schur, S.J. Guyenet, B.H. Hwang, M.O. Dietrich, X. Zhao,
D.A. Sarruf, V. Izgur, K.R. Maravilla, H.T. Nguyen, J.D. Fischer, M.E. Matsen,
B.E. Wisse, G.J. Morton, T.L. Horvath, D.G. Baskin, M.H. Tscho € p, M.W. Schwartz,
Obesity is associated with hypothalamic injury in rodents and humans, J. Clin.
Invest. 122 (2012) 153e162.
[9] S. Kentish, H. Li, L.K. Philp, T.A. O'Donnell, N.J. Isaacs, R.L. Young, G.A. Wittert,
L.A. Blackshaw, A.J. Page, Diet-induced adaptation of vagal afferent function,
J. Physiol. 590 (2012) 209e221.
[10] M. Nakazato, N. Murakami, Y. Date, M. Kojima, H. Matsuo, K. Kangawa,
S. Matsukura, A role for ghrelin in the central regulation of feeding, Nature
409 (2001) 194e198.
[11] Y. Date, N. Murakami, K. Toshinai, S. Matsukura, A. Niijima, H. Matsuo,
K. Kangawa, M. Nakazato, The role of the gastric afferent vagal nerve in
ghrelin-induced feeding and growth hormone secretion in rats, Gastroen-
terology 123 (2002) 1120e1128.
[12] C.B. de La Serre, C.L. Ellis, J. Lee, A.L. Hartman, J.C. Rutledge, H.E. Raybould,
Propensity to high-fat diet-induced obesity in rats is associated with changes
in the gut microbiota and gut inflammation, Am. J. Physiol. Gastrointest. Liver
Physiol. 299 (2010) G440eG448.
[13] T. Hosoi, Y. Okuma, T. Matsuda, Y. Nomura, Novel pathway for LPS-induced
afferent vagus nerve activation: possible role of nodose ganglion, Auton.
Neurosci. 120 (2005) 104e107.
[14] H.E. Raybould, Gut microbiota, epithelial function and derangements in
obesity, J. Physiol. 590 (2012) 441e446.
[15] A. Beynon, M.R. Brown, R. Wright, M. Rees, I.M. Sheldon, J. Davies, Ghrelin
inhibits LPS-induced release of IL-6 from mouse dopaminergic neurones,
J. Neuroinflamm. 10 (2013) 40.
[16] M.B. Lemus, J.A. Bayliss, S.H. Lockie, V.V. Santos, A. Reichenbach, R. Stark,
Z.B. Andrews, A stereological analysis of NPY, POMC, Orexin, GFAP astrocyte,
and Iba1 microglia cell number and volume in diet-induced obese male mice,
Endocrinology 156 (2015) 1701e1713.
[17] K.A. Kigerl, J.C. Gensel, D.P. Ankeny, J.K. Alexander, D.J. Donnelly,
P.G. Popovich, Identification of two distinct macrophage subsets with diver-
gent effects causing either neurotoxicity or regeneration in the injured mouse
spinal cord, J. Neurosci. 29 (2009) 13435e13444.
[18] F. Naznin, K. Toshinai, T.M.Z. Waise, C. NamKoong, A.S. Md Moin, H. Sakoda,
M. Nakazato, Diet-induced obesity causes peripheral and central ghrelin
resistance by promoting inflammation, J. Endocrinol. 226 (2015) 81e92.
[19] G.C. Hansson, Role of mucus layers in gut infection and inflammation, Curr.
Opin. Microbiol. 15 (2012) 57e62.
[20] M.G. Smirnova, L. Guo, J.P. Birchall, J.P. Pearson, LPS up-regulates mucin and
cytokine mRNA expression and stimulates mucin and cytokine secretion in
goblet cells, Cell. Immunol. 221 (2003) 42e49.
[21] B. Benoit, P. Plaisancie
, A. Ge
loe €n, M. Estienne, C. Debard, E. Meugnier,
E. Loizon, P. Daira, J. Bodennec, O. Cousin, H. Vidal, F. Laugerette, M.-
C. Michalski, Pasture v. standard dairy cream in high-fat diet-fed mice:
improved metabolic outcomes and stronger intestinal barrier, Br. J. Nutr. 112
(2014) 520e535.
[22] V. Elgazar-Carmon, A. Rudich, N. Hadad, R. Levy, Neutrophils transiently
infiltrate intra-abdominal fat early in the course of high-fat feeding, J. Lipid
Res. 49 (2008) 1894e1903.
[23] D. Baatar, K. Patel, D.D. Taub, The effects of ghrelin on inflammation and the
immune system, Mol. Cell. Endocrinol. 340 (2011) 44e58.
[24] T. Waseem, M. Duxbury, H. Ito, S.W. Ashley, M.K. Robinson, Exogenous ghrelin
modulates release of pro-inflammatory and anti-inflammatory cytokines in
LPS-stimulated macrophages through distinct signaling pathways, Surgery
143 (2008) 334e342.
[25] R. Medzhitov, Origin and physiological roles of inflammation, Nature 454
(2008) 428e435.
[26] S. Konturek, J. Konturek, T. Pawlik, T. Brzozowski, Brain-gut axis and its role in
the control of food intake, J. Physiol. Pharmacol. 55 (2004) 137e154.
[27] S. Laye, R.M. Bluthe, S. Kent, C. Combe, C. Medina, P. Parnet, K. Kelley,
R. Dantzer, Subdiaphragmatic vagotomy blocks induction of IL-1 beta mRNA
in mice brain in response to peripheral LPS, Am. J. Physiol. 268 (1995)
R1327eR1331.