Вы находитесь на странице: 1из 3

UNIVERSIDAD DE LAS FUERZAS ARMADAS ESPE

DEPARTAMENTO DE CIENCIAS DE LA VIDA Y AGRICULTURA


INGENIERÍA EN BIOTECNOLOGÍA
BIOLOGÍA MOLECULAR III
Nombre: Poaquiza Paul Fecha: 05/02/2018
NRC: 3734

Sesgos de PCR anidados en la interpretación de la estructura de la comunidad


microbiana en conjuntos de datos de secuencia de genes 16S rRNA

La investigación sobre comunidades microbianas humanas es de gran interés actual en el


ámbito de la salud. Las investigaciones se centran en materiales como heces, torundas
orales y vaginales que tienen poblaciones bacterianas grandes y pocas células humanas.
La PCR anidada es necesaria ya que puede amplificar el ADN objetivo con
concentraciones varias veces inferiores a la PCR estándar. El inconveniente de esta PCR
surge al producirse un sesgo debido a la amplificación cuando se aplican dos reacciones
de PCR sucesivas. El objetivo de este estudio fue evaluar el sesgo de la PCR anidada al
estimar la diversidad y estructura microbiana al compararla con la PCR estándar.
Se utilizaron muestras de 17 hisopos vaginales y 12 fecales, de adultos. El ADN se extrajo
mediante un protocolo ya establecido. Para el diseño de la amplificación, los PCR
tuvieron 40 ciclos. Los PCR anidados tuvieron 10 o 20 ciclos en la primera ronda y 30 o
20 ciclos en la segunda (Nested_10-30/Nested_20-20), utilizando dos pares de primers
(F1: GTGCCAGCMGCCGCGGTAA; R1: TACCTTGTTACGACTT y F2: AATGATAC
GGCGACCACCGAGATCTACACTATGGTAATTGTGTGCCAGCMGCCGCGGTA;
R2: CAAGCAGAAGACGGCATACGAGATXXXXXXXXXXXXAGTCAGTCAGCC
GGACTACHVGGGTWTCTAAT). Los PCR estándar contaron con 10-30 o 20-20 ciclos,
utilizando solo el par de primers F2/R2 (Estándar_10-30/Estándar_20-20). Se adicionó
una PCR Estándar_40. El cocktail de PCR fue de 25 μL, el cual contenía 1 μL de ADN,
0.5 μl de cada primer, 12.5 μl 2x de buffer HF, 0.75 μl de DMSO y agua. El programa de
amplificación fue el siguiente: 98°C por 1 min; 98°C durante 15s, 55°C durante 15s, y
72°C durante 30s; y 72°C durante 1 min. Para ambas PCR, tras la primera ronda, los
productos se limpiaron utilizando ExoSAP-IT.
Posteriormente, se realizó la secuenciación en Illumina MiSeq. Para el análisis de los
datos de la secuencia del gen 16S rRNA se eliminaron lecturas de baja calidad y las
restantes se agruparon como unidades de taxonomía operativa a nivel de especie, al 97%
de identidad, con los programas UCHIME y QIIME 1.8.0. Finalmente, la taxonomía se
asignó utilizando el clasificador RDP 2.2.
Se obtuvo como resultados que, la secuenciación de los genes parciales 16S rRNA fue
exitosa con 16,279 lecturas en 79 de 85 (93%) PCRs en las muestras de hisopo y 12,746
lecturas en 53 de 60 (83%) PCRs en las muestras de heces. Las diferencias por métodos
de PCR no fueron significativas, exceptuando Nested_10-30 y Estándar_10-30, y
Nested_20_20 y Estándar_20_20. Se detectaron conjuntos únicos de OTU solo en las
PCR anidadas o solo en PCR estándar. Las distancias de las muestras del mismo sujeto
agrupado fueron más pequeñas que las distancias entre sujetos.
Se pudo evaluar el efecto de la PCR anidada y otros factores, observando sesgos por PCR
anidada en la estimación de la diversidad y estructura microbiana en las muestras, con
diferencias marcadas entre Nested_20-20 y PCR estándar. Gracias a esto se puede
concluir que, la PCR anidada introducirá sesgos en la interpretación de diversidad y
estructura de una comunidad microbiana con perfiles del gen 16S rRNA producto de
secuenciación. Además, el sesgo fue más significativo para comunidades muy diversas o
un alto número de ciclos en la primera ronda de PCR. Debido a esto es recomendable
utilizar PCR anidado solamente si la PCR estándar no es de buena calidad.

Bibliografía:
Yu G, Fadrosh D, Goedert JJ, Ravel J, Goldstein AM. (2015). Nested PCR Biases in
Interpreting Microbial Community Structure in 16S rRNA Gene Sequence Datasets.
PLOS ONE 10(7): e0132253. doi:10.1371/journal.pone.0132253
PCR múltiplex-Touchdown para detectar simultáneamente Cryptosporidium
parvum, Giardia lamblia y Cyclospora cayetanensis, las causas principales de la
diarrea del viajero

Una de las enfermedades más comunes y de mayor tasa de ataque en un viaje es la diarrea
del viajero (TD). Los patógenos que la causan TD provocan síntomas como heces sueltas
urgentes, dolor abdominal y fiebre. Puede provocarse por bacterias, virus, así como
parásitos protozoarios transmitidos por el agua. Estos últimos han sido causantes de los
brotes endémicos en algunos países, en particular Cryptosporidium parvum, Giardia
lamblia y Cyclospora cayetanensis ya que no pueden ser curados con los tratamientos
antimicrobianos estándar. Por lo que, este estudio tuvo como objetivo desarrollar un
método de PCR multiplex simultáneo para detectar 3 especies de parásitos protozoarios
a base de agua (C. parvum, G. lamblia y C. cayetanensis) causantes de TD.
Para el análisis del ADN se adquirieron ooquistes de C. parvum, quistes de G. lamblia y
ARNr 18S para C. cayetanensis. Se adquirió también muestras de heces fecales. El ADN
se extrajo utilizando un kit de sangre y tejido DNeasy con un proceso repetido de
congelación y descongelación (6 ciclos de 95 ° C durante 1 minuto y nitrógeno líquido
durante 30 segundos). El ADN purificado se eluyó con 20 μl de tampón y se almacenó a
-20ºC. Los cebadores de PCR de diagnóstico se diseñaron para amplificar los segmentos
de genes de la proteína de la pared del ooquiste de Cryptosporidium (COWP), el gen de
la glutamato deshidrogenasa (gdh) para G. lamblia, y el gen del ARN ribosómico 18S
(18S rRNA) para C. cayetanensisfueron.
Para el proceso de PCR se utilizó ADN (1-3 μl), 15 μl de Taq Polimera, y 5 μl de la
mezcla de primers y agua destilada hasta un volumen total de 30 μl. El programa de
amplificación por PCR múltiplex-touchdown consistió en 5 minutos a 95°C para la
desnaturalización previa, 20 ciclos de desnaturalización a 95°C durante 30
segundos, annealing a 65°C (con disminuciones de 0,2°C desde 65°C a 61,2°C en cada
ciclo) durante 40 segundos, y la extensión a 72°C durante 1 minuto. Esto fue seguido por
otros 25 ciclos de desnaturalización a 95°C durante 30 segundos, annealing a 61,2 ° C
durante 40 segundos y extensión a 72 ° C durante 1 minuto. La reacción se terminó con
una extensión final durante 5 minutos a 72 ° C. Los productos de PCR fueron
fotografiados con transiluminación UV después de cargar con agarosa al 2%.
Se obtuvo como resultado que, el tamaño de amplicón para cada parásito fue de 555 pb
(C. parvum), 188 pb (G. lamblia) y 400 pb (C. cayetanensis). Cada amplicón exhibió un
100% de similitud con accesiones a la base de datos de GenBank (AB089292, KJ499992y
AB111183). Al analizar los cebadores en mezcla se observó que no hubo ninguna
reactividad cruzada. Los resultados expuestos dan a conocer que el protocolo de PCR
múltiple a más de no tener reacciones cruzadas fue capaz de proporcionar fragmentos
muy específicos para cada especie, por lo que, en un análisis rápido estas especies podrían
ser caracterizadas y dar a conocer el origen de la TD. Se puede concluir que el protocolo
presentado ha demostrado una elevada la capacidad de diagnóstico simultáneo de
múltiples protozoos en muestras de heces. Sin embargo, hay que tomar en cuenta que este
estudio se limita a tres especies, por lo que es importante realizar más investigaciones
para determinar un tratamiento de ser posible con todos los patógenos causantes de esta
enfermedad.
Bibliografía:
Shin, J.-H., Lee, S.-E., Kim, T. S., Ma, D.-W., Chai, J.-Y., & Shin, E.-H. (2016). Multiplex-
Touchdown PCR to Simultaneously Detect Cryptosporidium parvum, Giardia lamblia, and
Cyclospora cayetanensis, the Major Causes of Traveler’s Diarrhea. The Korean Journal of
Parasitology, 54(5), 631–636. http://doi.org/10.3347/kjp.2016.54.5.631
Retos para diseñar y desarrollar aptámeros de ADN para los objetivos de
proteínas. Optimización de la PCR asimétrica para la generación de una biblioteca
de ADN de una sola hebra
Debido a su alta especificidad, adaptabilidad y facilidad de modificación, los aptámeros
se han utilizado en una amplia gama de aplicaciones, incluida la purificación por afinidad,
el descubrimiento de fármacos, el cribado de alto rendimiento, la administración de
fármacos, los diagnósticos médicos y los biosensores. La obtención de aptámeros se da
por un proceso experimental en el que se usan secuencias aleatorias de ARN o ADN como
punto de partida y las secuencias particulares de ácidos nucleicos con mayor afinidad por
un objetivo son aisladas, este proceso se denomina SELEX (evolución sistemática de
ligandos por enriquecimiento exponencial). Este estudio tiene como objetivo diseñar una
biblioteca de ADN aleatoria para una mayor selección de aptámeros y amplificar la
biblioteca mediante PCR asimétrica, evaluando la influencia de factores como la
temperatura de annealing, el número de ciclos de amplificación y la concentración
de Mg2 +.
Para esto se utilizó un cocktail de PCR que incluye la Taq polimerasa de ADN (5 U/ml),
buffer 10x (KCl 500 mM y Tris-HCl 200 mM, pH 8,4) y MgCl2 (100 mM), una biblioteca
de ADN de cadena sencilla al azar, primers forward y reverse 1 μM en proporción 5:1,
buffer TAE 10x, EDTA 1 mM, y agua purificada, todo a un volumen de 30 μL.
Para la PCR asimétrica se utilizó un molde de ADN al azar de secuencia 5'-
GGTGTTACTCTTCATGTGGATCCG(N30)AGAATTCAGCACCCTAGCCTCGT-3'.
Los primers fueron F: 5'-GGTGTTACTCTTCATGTGGATCCG-3 'y R: 5'-
ACGAGGCTAGGGTGCTGAATTCT-3'. Se usaron 5 ng de ADN al azar como molde
de partida. El programa de termociclador fue: desnaturalización inicial a 95°C durante 3
min, desnaturalización a 95°C durante 30 segundos, annealing del primer a varias
temperaturas por 45s, extensión a 72°C por 30 s y extensión final a 72°C durante 5 min.
Los productos de amplificación se cargaron en gel de agarosa al 3% y se corrió a 70 V
durante 30 minutos a temperatura ambiente, usando una cámara horizontal.
Tras realizar el enriquecimiento y electroforesis se analizó el efecto de la temperatura de
recocido en productos de PCR. Se llevaron a cabo una serie de procesos de amplificación
a diferentes temperaturas de hibridación que varían de 60°C a 70°C en una manera de
PCR de gradiente, siendo la temperatura de annealing óptima 65°C para ambos cebadores.
La concentración de cloruro de magnesio se analizó a diferentes concentraciones: 0,25
mM a 2 mM, siendo 0,5-1,0 mM lo óptimo. Para examinar el efecto de este factor, se
realizaron reacciones de PCR asimétricas en diferentes ciclos de amplificación, de 15 a
45 ciclos por intervalos de 10 ciclos. Después de 25 ciclos de amplificación, se detectaron
productos no específicos en el gel. Gracias a lo descrito se pudo concluir que, la necesidad
de encontrar una metodología óptima para la producción de aptámeros es necesaria pues
éstos han atraído mucha atención debido a su capacidad para unirse a moléculas diana
con alta afinidad y especificidad. SELEX ejecuta el aislamiento de aptámeros con alta
afinidad para un objetivo específico, siendo el paso más importante y crítico en este
proceso de ingeniería la conversión de dsDNA a ssDNA, siempre tomando en cuenta los
factores que afectan el proceso de enriquecimiento. Entre las diversas técnicas
desarrolladas para este proceso, la PCR asimétrica presenta mayor factibilidad económica
y de rendimiento.
Bibliografía:
Tabarzad, M., Kazemi, B., Vahidi, H., Aboofazeli, R., Shahhosseini, S., & Nafissi-Varcheh, N.
(2014). Challenges to Design and Develop of DNA Aptamers for Protein Targets. I.
Optimization of Asymmetric PCR for Generation of a Single Stranded DNA Library. Iranian
Journal of Pharmaceutical Research : IJPR, 13(Suppl), 133–141.