One Health
International Journal

Volume 3
Number 1
February 2017

Published quarterly
By
One Health – New Medical Concept Association in Romania
 ONE HEALTH INTERNATIONAL JOURNAL

Honorary Editor-in-chief:
Prof.Emeritus Dr. André-Laurent Parodi
Former President of National Academy of Medicine. France

Editor-in-chief:
Acad. Prof. Emeritus Dr. Nicolae Manolescu
President of the One Health New Medical Concept Association in Romania

Co-Editor-in-chief:
Acad.Prof.Dr. Irinel Popescu
President of the Romanian Academy of Medical Sciencies
Vice-President of the Federation of European Academies of Medicine

General Secretary of editorial board:

Prof. Dr. Sabin Cinca
Institute of Oncology Prof. Dr. Alexandru Trestioreanu, Bucharest, Romania

Redaction secretaries:
Dr. Ana-Maria Coman
Institute of Oncology Prof. Dr. Alexandru Trestioreanu, Bucharest, Romania
Dr. Antonela Buşcă
Institute of Oncology Prof. Dr. Alexandru Trestioreanu, Bucharest, Romania
Dr.Alexandru Supeanu
Phd Student at the Romanian Academy, Bucharest, Romania

Members of the editorial board:

Prof.Dr.Alecsandru I. Baba
University of Agricultural Sciences and Veterinary Medicine, Cluj-Napoca, Romania
Prof.Dr. Emilia Balint
Faculty of Veterinary Medicine, Bucharest, Romania
Prof.Dr.Nastasia Belc
University of Agricultural Sciences and Veterinary Medicine, Bucharest, Romania
Prof.Dr.Emanoil Ceausu
Victor Babeş Hospital, Bucharest, Romania
Dr. Lisa Conti
Co-Founder One Health Initiative, USA
Prof.Dr. Angelo Ferarri
Director of the Reference National Centre of Veterinary and Comparative Oncology, Genoa,
Italy and Director in Zoo-prophylaxis Institute, Torino, Italy
Dr. Cheryl Stroud
Executive Director, One Health Commission, USA
Prof.Dr.Ruxandra Ionescu
Deputy Rector, University of Medicine and Farmacy Carol Davila, Bucharest, Romania
Dr. Laura Kahn
Co-Founder One Health Initiative, USA
Dr. Bruce Kaplan
Co-Founder One Health Initiative, USA
Eng. Virgil Nadolu
Deputy Director, One Health New Medical Concept Association in Romania
Prof.Dr. Giacomo Rossi
Faculty of Veterinary Medicine, Camerino, Italy

                        
 Prof.Dr. Nicolae Suciu
University of Medicine and Farmacy Carol Davila, Bucharest, Romania
Prof.Dr.Dorin Sarafoleanu
University of Medicine and Farmacy Carol Davila, Bucharest, Romania
Prof.Dr. George Stoica
Veterinary Pathobiology, College of Veterinary Medicine and Biomedical Sciences, Texas
A&M University, USA
Dr. Francisc Toba
Deputy Director, One Health – New Medical Concept Association, Romania
Prof.Dr. Juan José Zarate Ramos
Autonomous University of Nuevo León, Mexico

Scientific Secretariat:
Prof.Dr. Vasile Cepoi
State Secretary
Acad.Dr. Mircea Ifrim
General Secretary, Romanian Academy of Medical Sciences, Romania
Prof.Dr. Cornel Cătoi
Rector, University of Agricultural Sciences and Veterinary Medicine, Cluj-Napoca, Romania
Prof.Dr. Leonard Azamfirei
Rector, University of Medicine and Pharmacy, Targu Mures, Romania
Prof.Dr. Cristina Garlea
Research Center for Biodiversity. Bucharest, Romania
Prof.Dr. Cornelia Marin
Spiru Haret University, Bucharest, Romania
Prof.Dr. Sorin Rugină
Rector, Ovidius University, Constanţa, Romania
Prof.Dr. Gabriel Predoi
Dean, Faculty of Veterinary Medicine, Bucharest, Romania
Prof.Dr. Cristinel Sonea
Valahia University, Targoviste, Romania
Bioterra University, Bucharest, Romania
Prof.Dr. Aurelian Bondrea
Rector, Spiru Haret University, Bucharest, Romania
Assist.Prof.Dr. Sorin Cimpoiasu
University of Agricultural Sciences and Veterinary Medicine, Timisoara, Romania
Dr. Ionel Pătraşcu
Immunomedica Spiru Haret, Romania

Copyright © 2017 One Health – New Medical Concept Association – Bucharest, Romania

CurteaVeche Publishing House ISSN 2457 - 8770

ISSN-L 2457 - 8770
Subscription orders:
E-mail:contact@onehealth.ro
POF!IFBMUI!JOUFSOBUJPOBM!KPVSOBM!

Volume 3, number 1, 2017

Dpoufout!

EDITORIAL

1 The contribution of comparative oncology within the

overall One Health Concept
Emilia Balint, Angelo Ferrari, Nicolae Manolescu
SHORT REVIEWS

5 Feline and human immunodeficiency viruses

(FIV and HIV): Comparative options of treatment
Teodora-Diana Supeanu, Alexandru Supeanu, Doina Danes
14 Eco-bio-economy or economy of the future
in One Health context
Viorica Jelev
GENERAL PAPERS

23 Relation between biodiversity – climate –

human welfare in context globalized bioeconomy
Mariana Sandu, Alexandru T. Bogdan, Iudith Ipate,
Leonard George Tobă
30 Osteogenic differentiation of canine
Wharton's Jelly derived mesenchymal stem cells
Ioan Groza, Raul Alexandru Pop, Mihai Cenariu, Simona Ciupe,
Emoke Pall
34 Staphylococcus aureus spa types in strains from patients
with Staphylococcal Food Poisoning,
food chain staff and food, investigated in the 2009-2013
interval at the National Reference Centre for
Staphylococcus, I.Cantacuzino Institute of Research
Irina Codiţă, Ileana-Luminiţa Coldea, Elena-Carmina Drăgulescu,
Brânduşa-Elena Lixandru
40 Antibiosusceptibility spectrum of Listeria monocytogenes
strains isolated from Romanian clinical and food samples
Dana Magdalena Caplan, Marius Eduard Caplan
48 The dual role of reactive oxygen species in experimental
RS-1 hepatocellular carcinoma measured during an anti-
angiogenic treatment
Maria Iuliana Gruia, Antonela Busca, Marieta Panait,
Valentina Negoita, Mirela Dumitru
53 Biological products PC2. Part 1.
Oral and topical treatment of Psoriasis Vulgaris in humans
Lucica Sima , Constantin Chiurciu, Viorica Chirciu,
Ionel Victor Pătraşcu
59 Biological products PC2. Part 2.
Methicillin-resistant Staphylococcus aureus infection
treatment in humans
Constantin Chiurciu, Viorica Chirciu, Violeta Ionescu,
Georgiana Radu, Lucica Sima, Maria Oporanu,
Ionel Victor Pătraşcu
64 Assessment of metallic and mineral elements levels in
canned soft drinks
Gheorghe V. Goran, Emanuela Badea, Liliana Tudoreanu,
Victor Crivineanu
SHORT NOTE

72 A case of human cutaneous anthrax

Sebastian Smadu, Ana-Maria Popescu, Simin Florescu

ix Instructions for authors

One Health International Journal, 3(1),1-4,2017
One Health New Medical Concept Association, Romania

EDITORIAL

The contribution of comparative oncology

within the overall One Health Concept

Emilia Balint1a, Angelo Ferrarib, Nicolae Manolescuc

a) The Faculty of Veterinary Medicine, Bucharest, Romania

b) Zooprophylactic Institute, Torino, Italy
c) Institute of Oncology Prof.dr. Alex.Trestioreanu, Bucharest, Romania

Abstract
The authors intend to shed a crystal clear light on the notion of Comparative Oncology
and, moreover, on its over-integration and contribution pertaining to the new concept of a
new mundane vision of medicine, that has earned the well-deserved generic title: ONE
HEALTH.
As it happens with any scientific novelty, some experts are taken aback, while others take
up the challenge. Therefore, the promoters of this new concept have intended to turn it,
since its very "birth", into a new approach to medicine, that should unite, under the same
umbrella, human medicine and veterinary medicine.
As it happens with any new beginning on the path science, the notion of comparative
oncology was initially understood in veterinary medicine as a comparison of oncological
diseases among animal species.
Comparative oncology is the result of adding up the scientific researches obtained from
human medicine and veterinary medicine which, even if they have been following parallel
roads for many years, in the long run, they have proved their compatibility, thus
demonstrating the necessity of joining them.
Nevertheless, science has not come to a stop, not even for one second, because
researchers still lack a link in explaining the emergence of oncological diseases in areas
not elucidated yet. So new concepts have been brought about, like environmental oncology,
eco-onco-prophyilaxis, eco-onco-therapy which, once resolved, will contribute to
mitigating the oncological diseases in humans and animals.
We acknowledge it as a futuristic idea, worthy of being translated into practice by
"brave" people from very different fields of science, but without which we could not defeat
the whole vegetable and animal oncological diseases in order to preserve our beautiful
planet.

Key words: comparative oncology, One Health, human oncology, veterinary oncology

1
Correspondance author: The Faculty of Veterinary Medicine, Splaiull
Independentei no 105, sector 5, 050097, Bucharest, Romania, e-
mail: emilia_balint@yahoo.com
2 Emilia Balint et al.
The Comparative Oncology is a new science,
drawn from general oncology, addressing
cancerous disease at all levels: air, water, soil,
plants, animals and humans.
Comparative Oncology studies the cancer
phenomenon integrating it in the biouniverse
(living area), in which it appears, develops and
often gets out of control!
This science “is trying” to answer the
question that people keep asking is it about
themselves or about their pets: “who or what is
responsible for this terrible disease, the scourge
of our century that we all we want to defeat?”
It is no easy task incumbent on Comparative
Oncology to carry forth the extent of malign
celular biodiversity in the great majority of
bio-components, and then place them in the
living area, that is the environment.
This is the only way cancer may be correctly
analyzed, thus enabling comparative oncology
to support human oncology, which, in its turn,
relies on veterinary oncology, because MAN
holds a central position in this universe of
knowledge.
Fig.1.shows where Comparative Oncology
stands within the larger framework of General
Oncology, as well as its relationship with the
classical experimental oncology and with the
animal testing in clinical pretrials one, which
will eventually be reflected in Human oncology.
Comparative Oncology has a primordial
role in corroborating all the potentially or
oncologically active events from the whole range
of life on Earth, which, in their turn, trigger
and self-support all the benign or malignant
neoplastic processes at all levels existing in the
"pyramid of life".
Therefore, Comparative Oncology investigates
the etiological and pathogenic components of
the tumor disease at each and every level of
life (from unicellular organisms to humans)
and, by means of comparative onco-epide-
miology, brings closer human oncology to
plant and animal oncology through information
exchange and experimental basis.
Comparative oncology demonstrates the
universality and biomedical identity of neoplastic
disease, regardless of the place held in the
“pyramid of life”.
Comparative oncology offers the possibility
of identifying, quantifying and monitoring the
oncoinducing biotic and abiotic factors
existing at a given time in the area of life (the
environment).
ONE HEALTH INTERNATIONAL JOURNAL, 3(1),2017
Comparative oncology completes the “human
clinical trial” replacing data from classical
experimental oncology with canine clinical
pretrial.
As early as 1934, the great biologist
Academician Radu Codreanu, demonstrated
for the first time in the world the existence of a
form of cancer in ephemeroid insects, acute
myeloid leukemia (AML), in his doctoral
thesis defended at Pasteur Institute in Paris.
That moment of paramount significance was
the starting point for laying the foundations of
comparative oncology both in our country and
abroad (USA, England, Italy) by coalescing
two main oncological domains: human oncology
and animal (veterinary) oncology [1,2,3,4].
The year 1968 marked the debut of this science,
implemented through the perfect collaboration
of two great Romanian researchers, Prof. Dr.
Octav Costăchel at The Oncological Institute
in Bucharest and Dr. Nicolae Manolescu at the
Faculty of Veterinary Medicine.
They were joined in their efforts by the
Oncological School in Cluj, represented by
Prof. Dr. Ion Chiricuţă, the manager, at that time,
of the Oncological Institute in Cluj, and by the
Faculty of Veterinary Medicine in Cluj, through
Prof.Dr. Ion Adameşteanu, together with Prof. Dr.
Constanț a Adameşteanu and Dr. Alecsandru
Ioan Baba, who formed another "elite" team of
researchers in this new medical field.
Comparative Oncology has been operating
for over 45 years and, so far, it has carried out
very important activities and has also set up
national and international structures, as listed
below:
• between 1981 and 2011, over 20 national
and international scientific events (symposia,
conferences, round tables, etc.) were organized;
• numerous national and international
research contracts were carried out, with
remarkable results in professional scientific
research and practice that led to the
development of high-level scientific works;
• in 1999 the bilingual (Romanian-English)
biannual Romanian Journal of Comparative
Oncology was issued, under the auspices of
an international board. Therein, the most
valuable scientific papers are to be found,
representing the results obtained by the
researchers in this field;
• the introduction of Comparative Oncology
discipline in university and post university
education;
 Comparative oncology within the One Health Concept 3

Fig.1. Relationships between comparative oncology and other forms of oncology

• the introduction of Veterinary Oncology
specialization at doctoral level within the
Veterinary Medicine Faculty;
• the setting up of the Romanian Society of
Comparative Oncology in 1991.
We are proud to announce that, as a result
of all these activities and of the numerous
collaborations with prestigious human and
veterinary oncologists from such countries as
Italy, Spain and France, The Mediterranean
Forum of Comparative Oncology has been
recently set up in Genoa, Italy, in 2009, followed
by organizing The National Forum of Comparative
Oncology in Bucharest, Romania, in 2010.
The Comparative Oncology could not have
developed and joined the great international
One Health team without the sustained effort and
support that we have received since 2006 from
Professor Angelo Ferrari, the outstanding pioneer
of the development of modern Italian Compa-
rative Oncology, to whom we pay due homage
and we would like to express our gratitude.
Alongside the great battle waged by both
human and veterinary oncologists, together with
their patients, in diagnosis and therapy specialized
treatment centres, comparative oncology has
opened a “second front” in the living environ-
ment against cancer disease in humans and
animals.
Its purpose is, on the one hand, to reduce
the risk of cancer disease in humans and
animals, and, on the other hand, to act in such
a way as to achieve an “improvement” of life
quality, once the disease installed.
Eco-onco-prophylaxis – as shown by its
name, deals with the prevention of polluting
the environment with onco-inducing factors.
Dog sentinel animal is a concept taken from
American experts, who put this animal on a

ONE HEALTH INTERNATIONAL JOURNAL, 3(1),2017

4 Emilia Balint et al.

high pedestal, because it warns of the potential If we take into account all these desiderata,
existence of onco-inducing factors in a family in a short period of time, we are going to have
environment, therefore, of an active oncological have less cancer patients due to comparative
environment. oncology!
Eco-onco-therapy is a concept that helps The “Oncological cleansing” of our living
us understand that cancerous disease in the space is by no means an easy action, but it is
living environment must be drained before it much easier to prevent than to fight off, when,
reaches the human or the animal. more often than not, it is too late to do it.
The concept of canine clinical pretrial has In each of us there is a will, there is a way
recently appeared, after extensive studies that and there is a responsibility!
have shown that in both humans and canines,
the cancerous disease occurs spontaneously, it REFERENCES
has the same anatomical and pathological
forms and evolves in the same way. 1. Balint E, Manolescu N, Panait M, Mateescu
Taking into account the similarities between C, Predoi G, Fecioru C – Comparative oncology
cancerous disease in humans and canines, the placement in the general oncology sciences
results of the current therapeutical treatment of context, Roum J Comp Oncol, 2011, 21,1389-
human cancer have been verified on dogs suf- 1391;
fering from the same form of onco-pathology. 2. Manolescu N, Balint E, Mateescu C –
The findings evince that results overlap with Comparative oncology in Romania: 1968-
the ones in human therapy, using the same 2010 – 42 years of activity, Roum J Comp
medication (or regimens). Oncol, 2010, 18,1173-1175;
Since the lifespan of the dog, which is 12 3. Manolescu N, Balint E, Mateescu C,
years on average, indicates a ratio dog / man of Dumitrescu I, Busca A, Panait ME, Encut I –
1 year to 6-7 years, it can, therefore, be Researches on comparative oncology, Roum J
inferred that a one year survival of the post Comp Oncol, 2009, 16,1021-1031;
therapy dog means a period of 6-7 year 4. Manolescu N, Miclaus I, Savu C, Pop A,
survival of a human with the same form of Stanculeanu D, Militaru M, Balint E, Zisu D –
cancer. Integrated monitor of the life environment as
Research on experimentally induced cancer related to econcotherapy and ecooncoprophi-
in the laboratory animals may not be trans- laxy of cancer disease in human and animals,
ferred directly to humans due to the dis- Roum J Comp Oncol, 2001, 5,319-325.
advantages posed by the phylogenetic distance
between these species and the fact that animals 0001_170117
submitted to experiments develop a transplantable
cancer, not a spontaneous one; Received 17.01.2017
The therapeutic crosscheckings, with new
Accepted 11.02.2017
dosage forms, carried out in a preclinical phase, if
they are done, on a dog with cancer (appeared
spontaneously) and not on a laboratory animal,
significantly shorten the necessary time for
"marketing" a new anti-neoplastic agent. This
is what we call canine clinical pretrial.
Finally, we deem that the material presented
is a good ambassador meant to demonstrate
the affiliation to comparative oncology both as
an independent element, and a clearly
identifiable component in the great team of
“One Health” new global medical concept.
If Romania has made its contribution to a
small segment of “One Health”, we have to
acknowledge and also be grateful to the USA
(One Health Commission and One Health
Initiative), who initiated and managed to
organize the "One Health" great team. Of
course, Romania belongs to this team, together
with our great partner, Italy.

ONE HEALTH INTERNATIONAL JOURNAL, 3(1),2017

One Helath International Journal, 3(1),5-13,2017
One Health New Medical Concept Association, Romania

SHORT REVIEWS

Feline and human immunodeficiency viruses

(FIV and HIV): Comparative options of treatment

Teodora-Diana Supeanu1a, Alexandru Supeanub, Doina Danesa

a) Faculty of Veterinary Medicine, Department of Infectious Diseases and

Preventive Medicine, Bucharest, Romania
b) Romanian’s Academy Stefan S. Nicolau Institute of Virology,
Bucharest, Romania

Abstract
The Human Immunodeficiency Virus (HIV), the etiological agent for the Acquired
Immune Deficiency Syndrome and the Feline Immunodeficiency Virus (FIV) are both
retroviruses that share a series of resemblances in their viral structure and pathogenic
mechanisms.
The clinical studies conducted by physicians, targeted efficient therapies for the control
and even for the suppression of AIDS, have been using the animal model as a step for the in
vivo research. Although the existence of the monkey’s Simian Immunodeficiency Virus was
already considered, cats and their FIV infections proved to be far more useful for the
antiretroviral medication studies designed for AIDS management.
However, the genetic differences between humans and cats have made it difficult to
implement AIDS medication in the treatment of the Feline Immunodeficiency Virus
infection. Thereby, whereas in human medicine has been using antiretroviral drugs in the
therapy of AIDS/HIV, as well as combinations of 2 or even 3 drugs for the treatment of a
single ill individual, veterinary medicine does not benefit from a high level of knowledge for
FIV, the studies of possible medication for this disease being stuck at the level of
immunomodulators, without having an efficient retroviral medicine implemented in the
current therapeutic protocol for FIV.
The present paper wishes to highlight a comparative study between HIV and FIV on the
efficiency and toxicity of the antiretrovirals and immunomodulators used in the current
practice, knowing that numerous drugs used in the treatment of AIDS are highly inefficient
or even toxic when used in cats infected with FIV.

Key words: HIV, FIV, antivirals, immunodulators

Human Immunodeficiency Virus (HIV) the immune system, which ultimately leads to
infection is characterized by a progressive loss AIDS. HIV pathogenesis is extraordinarily
of CD4+ T- cells and massive dysregulation of complex and begins its course of destruction

1
Correspondance author: Faculty of Veterinary Medicine, Department
of Infectious Diseases and Preventive Medicine, Splaiul Independentei
no 105, Sector 5, 050097, Bucharest, Romania, e-mail:
supeanu.teodora@gmail.com
6 Teodora-Diana Supeanu et al.
during the acute phase of infection, which is
characterized by robust viral replication
concurrent with rapid infection and depletion
of mucosal CD4+ T-cells. During the chronic
phase of infection, CD4+ T- cells are slowly
depleted in lymph nodes, effector tissues and
blood, which persists until the majority of
CD4+ T-cells are depleted and patients develop
opportunistic infections and succumb to AIDS
[1].
The virus is known to have high rates of
mutation over time within the same individual.
Therefore, it was not surprising that drug-
resistant mutants of HIV emerged under the
selective pressure of prolonged chemotherapy
[2].
Highly active antiretroviral therapy has
transformed human immunodeficiency virus
(HIV) infection into a chronic manageable
disease. However, although many regimens
lower plasma viral load to below the limit of
detection in most patients, maintaining a
durable response remains challenging because
of side effects, long-term toxicity, and
complex dosing schedules; all of which can
lead to nonadherence, virologic failure, and
drug resistance [3].
Feline immunodeficiency virus (FIV) is
among the most common infectious agents of
cats. Retroviral tests diagnose only infection
and not clinical disease and cats infected with
FIV can live for many years. Therefore, a
decision regarding treatment or euthanasia
should never be based solely on the presence
of a retrovirus infection. FIV - infected cats
suffer from the same diseases that occur in cats
free of retrovirus infections and, as such, the
clinical signs in an individual cat might not be
related to retrovirus infection at all. FIV-
infected cats need special management and
care. Provided they receive this, they can live
for many years in good health. Most
retrovirus-infected cats are well managed with
symptomatic therapy.
Immunomodulators are commonly used in
retrovirus-infected cats. Results of uncontrolled
studies sometimes suggest dramatic clinical
improvement with these compounds, but these
effects are usually not observed in properly
designed trials, and clear evidence of efficacy
is lacking. Antiviral chemotherapy is only
indicated in exceptional cases of FIV
infection, due to lack of proven efficacy of
many antivirals and also their toxicity [4].
ONE HEALTH INTERNATIONAL JOURNAL, 3(1),2017
Antivirals
Antiretroviral therapeutic agents have been
tested to a limited extent against animal
retroviruses. However, FIV genome
organization, protein chemistry and the
pathogenesis of infection are very similar to
HIV, rendering the FIV-cat model highly
suitable for testing many types of antiviral
compounds and strategies. Furthermore, the
availability of molecular tools, reagents and in
vitro and in vivo test systems is substantial and
increasing, which allows detailed assessment
of immune responses, viral parameters and
adverse effects in this relatively large and
outbred animal model [5].
Table 1 represents a synthesis of the current
antiviral drugs used in the treatment of HIV
and FIV.
Immunomodulators
The basic assumption for immunomodulation
is that the body has the mechanisms to sort its
own problems if we create an environment that
allows a normal, rather than abnormal, response
(the ability to develop an immune response is
essential but some immune responses can be
less appropriate and associated with
detrimental side effects on long term).
An enormous variety of compounds have
been suggested to have immunomodulatory
activity; evidence based support in vivo is
often lacking, either because trials have not
been conducted or the results of trials have not
demonstrated efficacy. The reality is we remain
in the dark ages, the majority of drugs in routine
use being broadly immunosuppressive
(glucocorticoids, ciclosporin, chlorambucil).
These drugs are used in immune-mediated and
inflammatory disease in order to suppress the
immune response (globally) and then
considering that the immunosuppression is
withdrawn the inflammatory stimulus and/or
that the immune system has reset itself and
consequently, an appropriate level of response
or tolerance has re-established.
Clinicians often mention an added benefit
of drugs such as metronidazole, cimetidine,
doxycycline or ursodeoxycholic acid, but they
modulate the immune system, without having
any clear evidence in what way and how
effective that modulation is [11].
Table 2 shows the current immune-
modulators used as therapeutic options for FIV
and HIV.
 FIV and HIV: comparative options of treatment 7

Table 1.
List of antivirals tested for FIV and FIV (adapted after[6])

Controlled
Efficacy Efficacy
Drug Infection
in vitro
Field Study
in vivo
Observations
in vivo
NARTIs (Nucleoside reverse transcriptase inhibitors)
Anti-HIV compound approved
HIV Yes Yes Yes for clinical use in the treatment
of AIDS [7]
Azidothymidine
AZT is the only drug currently
(Zidovudine,
applied to some naturally FIV-
AZT, Retrovir)
FIV Yes Yes Yes infected cats, but is not very
effective and can be associated
with severe adverse effects [6]
Anti-HIV compound approved
HIV Yes Yes Yes for clinical use in thetreatment
Stavudine (d4T)
of AIDS [7]
Possibly effective, but no data
FIV Yes No ND*
in cats [4]
Anti-HIV compound approved
HIV Yes Yes Yes for clinical use in the treatment
Tenofovir
of AIDS [7]
(PMPA)
Possibly effective, but likely
FIV Yes No ND
also relatively toxic [4]
Anti-HIV compound approved
HIV Yes Yes Yes for clinical use in the treatment
Didanosine of AIDS [7]
(ddI) Effective in one experimental
FIV Yes Yes Yes study but neurological side
effects [4]
Anti-HIV compound approved
Zalcitabine HIV Yes Yes Yes for clinical use in the treatment
(ddC) of AIDS [7]
FIV Yes No ND Possibly effective, but toxic [4]
Anti-HIV compound approved
HIV Yes Yes Yes for clinical use in the treatment
Lamivudine
of AIDS [7]
(3TC)
Not very effective, and toxic in
FIV Yes Yes No
high dosages [4]
Anti-HIV compound approved
HIV Yes Yes Yes for clinical use in the treatment
of AIDS [7]
Stampidine Prevented virus replication in
vitro and in vivo, decreased FIV
FIV Yes Yes Yes
load in chronically infected cats,
tolerated [5]
Anti-HIV compound approved
HIV Yes Yes Yes for clinical use in the treatment
of AIDS [7]
Lamivudine Prevented virus replication in
vitro and in vivo, decreased FIV
FIV Yes Yes Yes
load in chronically infected cats,
tolerated [5]

* ND – not determined

ONE HEALTH INTERNATIONAL JOURNAL, 3(1),2017

8 Teodora-Diana Supeanu et al.

Non-NRTIs
Indinavir Anti-HIV compound approved
HIV Yes Yes Yes for clinical use in the treatment
of AIDS [7]
FIV No No No No data available
Possibly effective, but too toxic
HIV Yes Yes No
in vivo [8]
Suramin
Possibly effective, but too toxic
FIV No No ND
[4]
Nucleotide Synthesis Inhibitors
Foscarnet Decreases HIV-1
HIV Yes Yes Yes
Foscarnet Plasma Load [9]
(PFA) Effective in vitro, but too toxic
FIV Yes No ND
[4]
Receptor Homologs/Antagonists
It is a selective inhibitor of
Plerixafor HIV Yes Yes Yes human immunodeficiency virus
(AMD3100, [10]
JM3100) Some effects in study in
FIV Yes Yes Yes
privately owned cats [4]
Protease inhibitors
Antiretroviral drugapproved for
treatment of human immuno-
HIV Yes Yes Yes
deficiency virus(HIV) infection
Atazanavir [5]
Inhibited FIV replication,
FIV Yes Yes Yes reduced neurodegeneration and
in vivo tolerated [5]
Antiretroviral drugapproved for
treatment of human immuno-
HIV Yes Yes Yes
deficiency virus(HIV) infection
Tipranavir [5]
Inhibited FIV replication,
FIV Yes Yes Yes reduced neurodegeneration and
in vivo tolerated [5]
Antiretroviral drugapproved for
treatment of human immuno-
HIV Yes Yes Yes
deficiency virus (HIV) infection
Lopinavir [5]
Inhibited FIV replication,
FIV Yes Yes Yes reduced neurodegeneration and
in vivo tolerated [5]
Integrase inhibitor
Raltegravir Anti-HIV compound approved
HIV Yes Yes Yes for clinical use in the treatment
of AIDS [7]
FIV Yes No ND Possibly effective [4]

ONE HEALTH INTERNATIONAL JOURNAL, 3(1),2017

 FIV and HIV: comparative options of treatment 9

Table 2.
List of antivirals tested for HIV and FIV (adapted after [6])
Controlled
Efficacy Efficacy
Drug Infection
in vitro
Field Study
in vivo
Observations
in vivo
Cytokines & Growth Factors
It is used as a treatment
HIV Yes Yes Yes. strategy for HIV - associated
Filgrastim (G-CSF) neutropenia [10]
Contraindicated (may increase
FIV ND* Yes No
viral replication) [6]
Increasing body weight and
HIV Yes Yes Yes modest improvements in HIV-
IGF-1 specific immune function [10]
Possibly effective in young
FIV ND Yes Yes
cats [6]
Interferons
HIV No No No Only for veterinary use
Feline interferon
omega Some effect (more likely on
FIV Yes Yes Yes
secondary infections) [6]
Treatment of early-stage HIV
infection with IFN-α can result
in a decrease in frequency of
viral isolation. Although its
HIV Yes Yes Yes use may be accompanied by
Human interferon
dose-dependent toxicities,
alpha
IFN-α may have a role in
slowing progression of HIV
disease [12]
Some effect (more likely on
FIV Yes Yes Yes
secondary infections) [4]
IFN & Other Cytokine Inducers
A long-term therapy with pox
inducers in HIV patients
contributes to an improvement
PIND-AVI/PIND- HIV Yes Yes Yes of the immunological state in
ORF part leading to a reduction of
the HIV antigen content in the
blood [13]
FIV ND No ND Likely contraindicated [6]
Poly (I:C) might have most
potential as a topical strategy
that could be applied
immediately within 24 h after
Polyriboinosinic- exposure to curb local spread.
HIV Yes Yes Yes
polyribocytidylic Poly(I:C) triggers unique
acid (poly I:C) innate mechanisms that limit
HIV replication, even after
infection has been initiated
[14]
FIV ND No ND Likely contraindicated [6]

* ND – not determined

ONE HEALTH INTERNATIONAL JOURNAL, 3(1),2017

10 Teodora-Diana Supeanu et al.

It significantly improved
clinical and laboratory
parameters in treated patients,
while no prominent toxic
effects were noted. The mode
of action of acemannan against
HIV infection has been seen as
HIV Yes Yes Yes a combination of destruction
Acemannan of infected or defected cells
due to activation of killer cells,
production of non-infective,
defective HIV virus, enhanced
antibody production and
increased host surveillance for
other antigenic substances [15]
FIV ND No ND Likely contraindicated [6]
Other Drugs with Immunomodulatory Activity
Levamisole is used in treating
HIV Yes Yes Yes
Levamisole of HIV patients [16]
FIV ND No ND Likely ineffective [6]
DEC treatment may have an
important positive impact on
the host’s ability to respond to
the HIV infection in
Diethylcarbamazine HIV Yes Yes Yes
individuals coinfected with
(DEC) filariae and may thereby slow
down the progression of HIV
[17]
FIV ND No ND Likely contraindicated [6]
Milk protein Lf enhances
replication and transmission of
HTLV-I and suppresses
infection with HIV-1, the two
milk-borne pathogens, and
HIV Yes No ND
may have implications for
Lactoferrin
host-pathogen interactions
during transmission via milk
or other biological secretions
[18]
Possibly effective in cats with
FIV ND No ND
stomatitis [6]
Improvement in
immunological parameters,
treatment satisfaction, increase
Nosodes HIV Yes Yes Yes
in weight, relief in symptoms,
and improvement in health
status [1]
FIV ND No ND Likely contraindicated [6]

ONE HEALTH INTERNATIONAL JOURNAL, 3(1),2017

 FIV and HIV: comparative options of treatment
IgY. Recently, the use of Immunoglobulin
Y (IgY) from egg chickens yolks immunized
against certain pathogens has been the focus of
attention in immunotherapy. Immunoglobulin
Y (IgY) represents the major antibody produced
by chickens (Gallus gallus domesticus) [19]
and makes up for about 75% of the total
antibody population [20]. It is continuously
synthesized at a large scale, secreted into the
blood and transferred to the egg yolk, where it
accumulates [19]. Chicken IgY is the functional
equivalent of IgG, the major serum antibody
found in mammals [20], but it shows fundamental
structural differences in comparison to the IgG
molecule. It also differs in proteolysis, tempe-
rature, pressure and freezing stability. The IgY
binds neither to proteins A and G, nor to the
mammalian complement, and does not cross-
react with mammalian immunoglobulins [21].
Chicken eggs present an ideal alternative
antibody source to mammals, as the IgY in the
chickens' blood is transported to the egg where
it accumulates in large quantities (5 to 25mg of
IgY /ml yolk).
In the egg, IgY is stable for months, and
once purified it may be stored for years in the
cold. As the industrial scale automated collection
and separation of eggs is currently carried out,
the large scale production of specific IgY for
immunotherapeutic purposes is feasible. In
contrast to mammalian IgG, IgY antibodies do
not activate mammalian complement, do not
cross-react with Fc receptors, with mammalian
rheumatoid factor, or with human anti-mouse
antibodies, thus eliminating false-positive
results in serological assays. Also, chickens
are able to develop a better response against
mammalian antigens, due to the phylogenetic
distance between mammals and birds [22].
IgY in HIV treatment. Improvements in
quality of life can be elusive for HIV/AIDS
patients. The AIDS Support Organization (TASO)
of Uganda therefore undertook a human study
to verify the usefulness of a food supplement
that could be used to improve quality of people
living with HIV/AIDS where other strategies
are currently unaffordable. The food supplement
was IgY anti-HIV, which was administered on
three groups of human patients during three
months. The investigations included weight,
haemoglobin, total WBC and differential count
and urinalysis. The purpose of the study was to
undertake preliminary assessment on whether
IgY would or would not improve quality of
life for a sick HIV/AIDS population. These
ONE HEALTH INTERNATIONAL JOURNAL, 3(1),2017
11
results suggest that IgY could play an
invaluable role looking a scientifically sound,
non-toxic, easy-to-administer food supplement
that demonstrates an ability to improve quality
of life [23].
IgY in FIV treatment. Preliminary data
showed that administering chicken egg yolk
IgY to FIV infected felines has a positive
impact, is free of adverse reactions and
therefore vouching for initializing a larger
study, comprising immunologic tests questing
for possible more intimate effects of the
aforementioned compound [10]. The WBC
count seem to evolve toward the median
average values, but maybe, the upgrade of the
posology or longer observation period, could
add relevant information. The albumin and the
globulin level as well as their ratio, also seem
to evolve toward the physiological values.
Larger number of subjects, expressing WBC
count and biochemical blood values in the
range of “characteristic to FIV positive cats”
will allow to evaluate of the egg yolk IgY [24].
CONCLUSIONS
The current knowledge of the action
mechanisms of the HIV virus in the body, as
well as the therapeutic options to fight the
virus infection is particularly advanced, a major
contribution to this consisting in the studies on
feline infected patients with a similar retrovirus,
namely the Feline Immunodeficiency Virus.
However, although for the therapy of HIV
infection uses a wide array of antiretrovirals,
in the case of FIV infected cats, the therapeutic
resources are usually limited to symptomatic
treatment and, eventually, non-specific immu-
nomodulators, whose purpose is the improvement
of the clinical signs. Most antiretrovirals,
already used in the management of HIV infection
are, unfortunately, insufficiently effective or
even toxic when used in FIV infected felines,
thus rendering them an avoidable option.
The avian immunoglobulin therapy in
human viral infections is a relatively new concept,
still undergoing studies. This is applicable for
both HIV infections, as well as for FIV
patients. Advanced long-term studies are
necessary, backed-up by complex laboratory
assays, in order to sufficiently determine the
action mechanisms of this immunoglobulin on
the immune system of human or animal patients
infected with an immunosuppressive virus.
12 Teodora-Diana Supeanu et al.
REFERENCES
1. Shah R – Clinical trial for evaluation of
a Human Immunodeficiency Virus nosode in
the treatment for Human Immunodeficiency Virus
– infected individuals, Indian J Res Homeopathy,
2015, 9(1),25-33;
2. Richman DD – Resistance of clinical
isolates of Human Immunodeficiency Virus to
antiretroviral agents, Antimicrob Agents
Chemother, 1993, 37(6),1207-1213;
3. Gallant JE, Staszewski S, Pozniak AL,
DeJesus E, Suleiman JMAH, Miller MD,
Coakley DF, Lu B, Toole JJ, Cheng AK –
Efficacy and safety of Tenofovir DF vs
Stavudine in combination therapy in anti-
retroviral-naive patients, JAMA, 2004,
292(2),191-201;
4. Hartmann K – Efficacy of antiviral
chemotherapy for retrovirus-infected cats –
What does the current literature tell us?, J
Feline Med Surg, 2015, 17,925–939;
5. Mohammadi H, Bienzle D – Pharma-
cological inhibition of Feline Immuno-
deficiency Virus (FIV), Viruses, 2012, 4,708-
724;
6. Hartmann K – Feline Retrovirus
Infection, How I Treat / NAVC Clinician’s
Brief, WSAVA, May 2012,79-84;
7. De Clercq E – Anti-HIV drugs: 25
compounds approved within 25 years after the
discovery of HIV, Int J Antimicrob Agents,
2009, 33,307–320;
8. Mahoney CW, Azzi A, Huang KP –
Effects of Suramin, an anti-human immuno-
deficiency virus reverse transcriptase agent,
on protein kinase C, J Biol Chem, 1990,
265(10),5424-5428;
9. Devianne-Garrigue I, Pellegrin I, Denisi
R, Dupon Mi, Ragnaud J, Barbeau P, Breilh D,
Leng B, Fleury H, Pellegrin J – Foscarnet
decreases HIV-1 plasma load, J Acquir
Immune Defic Syndr Hum Retrovirol, 1998,
18,46-50;
10. Supeanu TD, Supeanu A, Onose G,
Daneş D – Feline Viruses Inducing Immuno-
deficiency (FIV, FeLV) and Human
Immunodeficiency Virus (HIV): Comparative
theoretic substantiation, study initiation and
preliminary results, Proc Rom Acad Series B,
2015, Suppl 1,225-231;
11. Sturgess K – Role of Immunomo-
dulators in Cats and Dogs – Part one, Veterinary
Times, Veterinary Business Development,
2013, pp. 8-10;
ONE HEALTH INTERNATIONAL JOURNAL, 3(1),2017
12. Lane HC, Davey V, Kovacs JA,
Feinberg J, Metcalf JA, Herpin B, Walker R,
Deyton L, Davey JrRT, Falloon J, Polis MA,
Salzman NP, Baseler M, Masur H, Fauci AS –
Interferon-α in patients with asymptomatic
Human Immunodeficiency Virus (HIV)
infection: A randomized, placebo-controlled
trial, Ann Intern Med,1990, 112(11),805-811;
13. Mayr A – Indications for the use as
medicaments of multipotent Parapox immunity
inducers from attenuated, non-immunogenic
Pox viruses or Parapox viruses, United States
Patent, Patent Number: 6,162,600, Date of
Patent: Dec.19,2000;
14. Trapp S, Derby NR, Singer R, Shaw A,
Williams VG, Turville SG, Bess JW Jr, Lifson
JD, Robbiani M – Double-stranded RNA
analog poly(I:C) inhibits Human Immuno-
deficiency Virus amplification in dendritic
cells via type I Interferon-mediated activation of
APOBEC3G, J Virol, 2009, 83(2),884–895;
15. Vlietinck J, De Bruyne T, Apers S,
Pieters LA – Plant-derived leading compounds
for chemotherapy of Human Immunodeficiency
Virus (HIV) infection, Planta Med, 1998,
64,97-109;
16. Mansouri F, Janbakhsh A, Vaziri S,
Sayad B, Afsharian M, Hosseinpor F,
Mahdavian B – Comparative study of
levamisole-selenium supplementation effect on
CD4 increase in HlV / AIDS patients,
Caspian J Intern Med, 2011, 2(2),218-221;
17. Nielsen NO, Simonsen PE, Dalgaard P,
Krarup H, Magnussen P, Magesa S, Friis H –
Effect of Filariasis: diethylcarbamazine on
HIV load, CD4%, and CD4/CD8 ratio in HIV-
infected adult Tanzanians with or without
lymphatic randomized double-blind and
placebo-controlled cross-over trial, Am J Trop
Med Hyg, 2007, 77(3),507–513;
18. Moriuchi M, Moriuchi H – A milk
protein Lactoferrin enhances human T cell
Leukemia Virus Type I and suppresses HIV-1
infection, J Immunol, 2001, 166,4231–4236;
19. Bentes GA, Lanzarini NM, Rodrigues
Pinto Lima L, de Abreu Manso PP, dos Santos
da Silva A, da Silva e Mouta SJ, Rodrigues
Guimarães J, Baroni de Moraes MT, Pelajo-
Machado M, Alves Pinto M – Using immuno-
globulin Y as an alternative antibody for the
detection of hepatitis A virus in frozen liver
sections, Mem Inst Oswaldo Cruz, 2015,
110(4),577-579;
20. Kovacs-Nolan J, Mine Y – Avian egg
antibodies: basic and potential applications,
Avian Poult Biol Rev, 2004, 15(1),25-46;
 FIV and HIV: comparative options of treatment 13

21. Polanowski A, Zabłocka A, Sosnowska

A, Janusz M, Trziszka T – Immunomodulatory
activity accompanying chicken egg Yolk immu-
noglobulin Y, Int J Poult, 2012, 91(12), 3091–
3096;
22. Sudjarwo SA, Indriyani W, Nasronudin,
Sudjarwo GW, Koerniasari – Production and
characterization protein of anti HIV specific
immunoglobulin Y for Immunotherapy, J App
Pharm Sci, 2014, 4(11),30-34;
23. Kizito FB – Improvements in quality of
life for HIV/AIDS patients using hyperimmune
egg – The TASO Study, 3rd International AIDS
Society Conference on HIV Pathogenesis and
Treatment, 2005, Abstract MoPe11.2C43.
http://www.iasociety.org/Abstracts/A2177717.
aspx, accessed December 29,2014;
24. Supeanu TD, Supeanu A, Cobzariu D,
Bărăităreanu S, Daneş D – Preliminary results
of nonspecific Igy therapy in cats with FIV:
dynamics of WBC and serum proteins electro-
phoresis, J Int Sci Publ, 2016, 4,302-318.

0018_170117

Received: 17.01.2017
Accepted: 07.02.2017

ONE HEALTH INTERNATIONAL JOURNAL, 3(1),2017

One Health International Journal, 3(1),14-22,2017
One Health New Medical Concept Association, Romania

Eco-bio-economy or economy of the future

in One Health context

Viorica Jelev1

Faculty of Economic Sciences, Spiru Haret University, Bucharest,

Romania

Abstract
Specialists claim that Eco-Bio-economy or social economy is the economy of future, in
the service of human life by the rational use of environmental resources. The concept brings
together in an integrated manner, according to the researchers, economy, ecology,
biodiversity, biotechnologies and focuses on integrated sustainable development of the
world. The new social economy, together with the corporate social responsibility joins a
new multirole world to a healthy environment by creative and innovative concepts that will
ensure the sustainability of living in a sustainable manner. Doctors have added to this Eco-
Bio-Economy concept a new one called One Health – a new integrated approach for
human, animals and environment health state to that they should emphasize the importance
of human behaviour upon the planet biodiversity. Economists have mostly understood the
importance of alarm signals drawn up by researchers on the destruction of the resources of
the planet and adapted their business sites to the requirements of the green economy. The
educational environment contributes to the trend planetary, with the formation of new
specialists with new knowledge, behaviours and consumers use, forming of new characters,
sensitive to environmental issues. This educational model is also promoted by Spiru Haret
University, by creating the Master degree in environmental protection.

Key words: eco-bio-economy, organic products, education, environmental protection, one health

JEL Classification: A13, I15, I25, M21, O11, Q57, Z32

INTRODUCTION 2. The Eco-Bio-Economy approach represents

1. The article aims to develop the Eco-Bio-
Economy approach by introducing the new
global concept of One Health, which refers to
an integrated approach of animal, human and
environment health, so that to emphasize the
importance of human behaviour responsibility
towards of the planetary biodiversity.
the future economy, an economy in the man’s
service, by the defence of nature, man and
animals, according to the laws of Creation.
3. This article contains three parts: the first
part, explain the concept of Eco-Bio-Economy
and the possible implications on the living
world. The second part shows how it becomes

1
Correspondance author: Faculty of Economic Sciences, Spiru Haret
University, Str. Fabricii no 46G, Sector 6, 030045 Bucharest,
Romania, e-mail: jelevviorica@yahoo.com
 Eco-bio-economy - in One Health context
necessary to develop companies with a strong
involvement in environmental activities and
bio-economy as a results of the need to reduce
the amount of waste from the manufacturing
process, products manufacturing and environ-
mental services supply, in view not to harm
the environment. Further, we show how the
ecological services market development will
create green infrastructure, which in turn, will
form an organic industry with a gradual
transition to a continuously ecological work of
entrepreneurs. The third part of the paper
intends to describe the importance of
education in the process of behaviour changes
within us and around us, paying attention to
nature, in the favour of protecting the
environment, human and animal life. In this
trend, Spiru Haret University, has a strong
contribution, by promoting a new master
program called Environmental Management
and Eco-Bio-Economy in the One Health
context, which will shape future specialists,
economists with deep knowledge in the field
of environmental protection, ethics
environment who will help to solve the
problems of environment pollution, restore
ecosystems damaged by human activities and,
the most important, will become the trainers of
new consciousness about nature and
environment subjected to aggression due to
the modern lifestyle. The earth is a gift from
God to be cherished and cultivated, by a close
link between man and nature, to be bequeathed
to future generations.
4. The present paper is based on the
analysis of a large number of articles and
books from the Romanian and international
specialized literature related to the topic of the
article, with particular emphasis on issues such
as biotechnology, bio-economy, eco-economy,
eco-bio-economy, eco -marketing, agriculture,
environment and ecology, man and biosphere,
sustainable development and diplomacy bio-
economy. The next paragraph is a brief review
of the consulted literature.
LITERATURE REVIEW
There are a large number of scientific papers,
articles, books, treatises, which analyzes direct
or indirect aspects such as the bio-eco-
economy, but also broader issues such as
sustainable development, environmental
protection, relationship between man,
biosphere, environment and the impact of the
limited resources on the economy, that often
was developed ignoring the limited capacity of
ONE HEALTH INTERNATIONAL JOURNAL, 3(1),2017
15
the earth to bear an obvious over-exploitation of
its resources. Eco-bio-economy can provide an
answer and solution to put into practice the
concept of sustainable development,
harmonizing different human activities with the
nature, including those that are closely related
to food security, such as agriculture and agri-
food economy as a whole. The National
Strategy for Sustainable Development (SNDD
2013), establish the main Romania’s sustainable
development priorities aiming the horizon of
2020 – 2030 [1]. In terms of the economy –
environment hierarchy, the top down
relationship is from environment to economy
and not vice-versa [2]. If mankind hitherto
considered that the environment is a
subcomponent of the economy and natural
resources are inexhaustible, in reality, shows
Lester Brown, the economy must be a
subcomponent of the environment, given that
unfortunately, natural resources are not
inexhaustible. We consider that such ideas
must to be in the forefront of global debates
agenda. Jelev I and Brejea R done a careful
analysis of the management systems of
different organizations dealing with
environmental protection and environmental
policies and the importance of promoting of
such approaches and concepts of economies
and activities in harmony with the
environment [3]. In Romania, Bogdan A and
Comsa D have developed the concept of Eco-
Bio-Economy in an original relationship with
the diplomacy [4]. Rabindranath Tagore
wonderfully examines the concept of nature in
the light of European and Oriental philosophies
[5]. James Lovelock takes a new look on life
on Earth, emphasizing the idea that life and the
Earth is a single being [6]. Air, water, oceans,
ensure the existence of life on Earth in a
complex, interrelated and interdependent system,
at the same time very fragile and exposed to
exhaustion, in the context of an chaotic,
unsustainable economic development, based
on the overuse of natural resources. This is
why Eco-Bio-economy is an approach and an
economic concept, that can turn the actual
chaotic development, without concern for the
environment, in a sustainable one, giving a
chance to the future generations.
1. Introduction in Eco-Bio-Economy
Nature and the collective mentality must be
seen like a common, unitary living planet. If
16 Viorica Jelev
we are similar in shape, then we can say that
we are part of the same environment that
includes mountains, seas, forests, birds and
animals, stars and planets. Therefore, nature
should be seen as our relative. All are
composed of the same material and the same
spiritual essence and obey the same pace
planet. We ought to keep the creation that
sustains our lives and abandon irresponsible
overuse of planetary resources.
Having in mind the desire to live in harmony
with our family, Nature, researchers have
developed the concept of Eco-Bio-Economy.
Lester Brown is one of the pioneers of
environmentally sustainable development concept.
He has and developed the concept of Eco-
Economy, or the green economy, which
emphasized the importance of ecology and
environment protection for the sustainable
development of mankind [2]. Specialists stated
that the world economy cannot be developed
without considering the planet's ecological
deficits, when we speak of our present and
future development.
40 years before the American scientist
developed the concept of Eco-Economy there
was the Romanian scientist Nicholas Georgescu -
Roegen, who launched the concept of Bio-
Economy. In this concept he emphasises the
role of man in the anthropogenic ecosystems.
The author shows the excessive consumption
of raw materials is destabilizing planetary
reserves and endanger future generations
(mentioned by Bogdan TA [4]).
The scientist sounded the alarm on the
contradiction between economic growth and
unlimited and excessive row materials
consumption, versus final planetary resources
loss. The proposed solution is the economic
decline in line with the physical law of entropy
and the needs to rebalance economic
development by a comprehensive policy that
respects the principles of biology.
The economic concepts has evolved more
and more, so that in the recent years the
concept of Eco-Bio-Economy has emerged by
joining two visions on Eco-Economy and Eco-
Biology. Bogdan A and Comsa D define in
their book new concepts, like the Eco-Bio
diplomacy [4].
The Eco-Bio-Economy is an economy of
the future, in the service of human life, by the
rational use of environmental resources. It
promotes the sustainable development of mankind
in all its forms, starting with a sensitive
economy to the needs of rational consumption
of planetary resources. This is a multi-
ONE HEALTH INTERNATIONAL JOURNAL, 3(1),2017
disciplinary concept that promotes a smart,
integrated sustainable green nutrition approach.
Thus, we are witnessing today the tendency
for a new planetary consumer behaviour: we
are more careful about what we eat, our food
to be bio, what clothes we wear, the
percentage of natural fibres to dominate
material composition, in which houses we live,
with energy saving bulbs and carefully looking
to unnecessary energy consumption. It is clear
that we become responsible for our resources.
This new concept brings together in an
integrated manner the economy, ecology, and
biodiversity.
It was not too long till the term of Eco-Bio-
Social Economy has appeared, leading directly
to the above mentioned fields, including the
socio-economic side of life, human resources
and communities. Such an approach cannot be
achieved, without a strong political whish.
The new social economy must develop a
new kind of entrepreneurship, the economic actors
to work in every sector of society, changing
attitudes and consumer behaviour and use.
We are talking about the contemporary
biological revolution based on economy and
thus we can even call such a sciences like Bio-
economy. This refers to all economic activities
derived from scientific and research work
focused on biotechnology. In other words, it is
based on the understanding of deep genetic
and molecular processes and their application
in industrial or geographical landscape.
Industries like those of agriculture, chemistry,
energy or health, could benefit from the
applied Eco-Bio-Economy developments.
In the national Eco-Bio-Economy Plans, we
should discuss measures and strategies to
stimulate researches and developments of crop
production, agro-livestock, bio fuels, medical
treatments and to replace the traditional
methods based on large natural resources
consumption.
In agriculture, in the context of the new
economy, we must talk about permaculture, a
system, imitating the nature and based
structurally on ecosystems and on natural
cycles [7]. We speak about an agriculture which
incorporates terraces creation, water gardens,
ponds, aquatic plant growth, livestock, fruit
cultivation, alpine pastures and medicinal plant
cultivation, forest trees and shrubs.
Complementary, eco-tourism is not excluded.
We can also take into account other derivate
concepts like: Eco-Bio-management, a green,
sustainable and innovative management, Eco-
Bio-Business or Eco-Bio-Green-Business in the
 Eco-bio-economy - in One Health context
context of Eco-Bio-Economy, which promotes
a Green, Intelligent, Integrated Agriculture and
Sustainable Development (Smart Integrated
Sustainable Development).
2. Eco-entrepreneurship, a requirement
of the new millennium
Unprecedented scale of the economic
activity of people is one of the main causes of
pollution, threatening the environment and life
in general. Currently, only 2-5% of the raw
materials are transformed into finished products.
The remaining 95-98% are transformed into
waste. In today's society, people are mainly
concerned on the production, and less on the
waste amount diminishing, during this
production [3].
Starting with the need to reduce the amount
of waste from the manufacturing process, it
becomes necessary to develop environmental
services and companies with environmental
concerns, which do not harm the environment.
Eco-entrepreneurship activity is production
and sale of goods, works and provision of services
for preventing damage to the environment and
human health.
First eco-entrepreneurship appeared in Central
and Western Europe, where they formed the
system of organic production principles and
mechanisms, able to address the overall
environmental and economic issues. The
Department for technology, industrialization
and economy in the UN Environmental
Programme (UNEP), has developed the strategy
of organic production in 1989 and also has
adopted the Universal Declaration of Human
Rights and the Environment.
Organic production is widely popularized in
many international forums, such as the
OSPAR Convention (Oslo-Paris) for the
North-East, the North Sea etc.
The strategy of organic production began to
be implemented in countries like Norway, the
Netherlands, Austria, Denmark, France, USA,
Poland and Germany. Later they were joined
by Slovakia, Lithuania, Russia and China.
In Romania it was developed the National
Strategy for Sustainable Development, 2013-
2020-2030 [1]. The document follows the
methodological requirements of the European
Commission and it is a joint project of the
Government of Romania, developed by the
Ministry of Environment and the United Nations
Development Program, through the National
Centre for Sustainable Development.
ONE HEALTH INTERNATIONAL JOURNAL, 3(1),2017
17
The strategy sets goals for transition in a
reasonable and realistic time, to a new European
Union development model, widely shared
globally – that of sustainable development
oriented towards the continuous improvement
of people's lives and their relationships in
harmony with the natural environment.
The Development of the Strategy is the
result of the obligation assumed by Romania
as a member state of the European Union
according to the objectives agreed at the
Community level, especially those included in
the Accession Treaty, the Lisbon Strategy for
Growth and Jobs and the renewed EU
Sustainable Development Strategy 2006 [8].
Having discussed the project at national and
regional level, with the active involvement of
stakeholders and conceptual support of the
Romanian Academy, the Strategy sets out a
vision of Romania's development towards the
next two decades, with the following objectives:
Horizon 2013:
• To incorporate the principles and practices
of sustainable development into all the
programs and policies of Romania;
Horizon 2020:
• Touching current average level of EU
countries on key indicators of sustainable
development;
Horizon 2030:
• Significantly close to the average level of
EU countries (http://www.mmediu.ro/beta/
domenii/dezvoltare-durabila/strategia-
nationala-a-romaniei 2013 -2020-2030/) [1].
In Romania, the ecological activities are big
challenges, and can contribute to the dynamic
growth of the country. More consumers and
users want to buy environmentally friendly goods
and more and more businesses assess the
effectiveness of investments in various
environmental projects.
This activity underpins the modern image of
the entrepreneur involved into social
responsibility activities, which care for the
good of the village where it operates, in the
benefit of the residents.
Considering that the efficiency of capital
investments in services far exceeds the
efficiency of capital investments in the economy
and agriculture in Romania, the development
of ecological services can stimulate the rapid
development of environmental companies.
18 Viorica Jelev

Table 1.
Dynamics of operators and areas, in the organic farming in Romania

Indicator 2010 2011 2012 2013 2014

Number of certified operators in
3155 9703 15544 15194 14470
organic farming
The total area under organic farming
182705.7 229945.67 288260.83 301148.1 289251.79
(ha)
Cereals (ha) 72297.78 79166.95 105148.5 109105.3 102531.47
Dried pulses and protein crops for the
production of grain (including seed and 5560.22 3147.36 2764.04 2397.34 2314.43
mixtures of cereals and pulses) (ha)
Tuberculifere and total root plants (ha) 504.36 1074.981 1124.915 740.75 626.99
Industrial crops (ha) 47815.07 47879.68 44788.73 51770.78 54145.17
Green harvested Plants (ha) 10325.4 4788.49 11082.93 13184.14 13493.53
Other crops on arable land (ha) 579.61 851.44 27.77 263.95 29.87
Vegetables (ha) 734.32 914.08 896.32 1067.67 1928.36
Permanent crops (orchard. vinyards)
3093.04 4166.62 7781.33 9400.31 9438.53
(ha)
Permanent crops (pastures and
31579.11 78197.51 105835.57 103701.5 95684.78
meadows) (ha)
Fallow (ha) 10216.78 9758.554 8810.734 9516.33 9058.66
Collection of spontaneous flora (ha) *
not included into the total area of 77294.35 338051 1082138 944546.2 1787548.25
organic farming
Source: Communications inspection and certification bodies in http://www.madr.ro/agricultura-ecologica/
organisme-de-inspectie-si-certificare.html [9]

Environmental services market development The European Commission, designed to

will create green infrastructures, which in turn,
will forms an organic industry with a gradual
transition to a continuous environmental work
of the entrepreneurs (http://www.madr.ro/
agricultura-ecologica/ dinamica-operators-and-
a-surfaces-in-agriculture-ecologica.html).
Simultaneously with the increasing material
welfare of the population, an increased consumer
demand for healthy food, green houses with
low energy demand, more environmentally
friendly and healthier appliances appear [9].
It can be said that economic agents either in
the private or public environment, are
increasingly more interested in the greening of
production and products, but action is needed
on promoting responsible marketing of these
products and develop a system of training and
environmental education of the population.
support the farmers, has developed a NEW
POLICY OF THE EUROPEAN UNION
ON PROMOTING FOOD PRODUCTS.
This year, the European farmers will be
beneficiaries of 111 mil. EUR programs, in
view to open new markets outside the
European Union and promote consumption of
food outside and within the EU. Actions of
promotion is an essential part of measures
taken by the European Commission in
supporting farmers.
"Enjoy, it's from Europe" is the slogan
which starting with 1 December 2015 will
support the professionals in the sector, to
penetrate international markets and strengthen
their position in these markets, trying at the
same time to increase the European consumer’s
awareness to these efforts.

ONE HEALTH INTERNATIONAL JOURNAL, 3(1),2017

 Eco-bio-economy - in One Health context 19

Table 2.
Prioritizing allocation of budgets for programs co-financed under the annual work program 2016

The amount
Theme
provided (Euro)

Simple programs - Internal market 26 mil.

Theme 1 * - Information and promotion programs aiming to increase the

knowledge and recognition level of the quality systems of the Union. as they 10.050 mil.
were defined in Art. 5 (4) (A). (b) and (c) of Regulation (EU) no. 1144/2014
Theme 2 * - Information and promotion programs aiming to at highlight the
specific characteristics of the Union agricultural methods and of the European 6.700 mil.
agricultural and food products characteristics
Theme 3 - Information and promotion programs on milk / dairy. pork
9 mil.
products or a combination of both
Simple programs - in third countries 68 mil.
Theme 4 * - Information and promotion programs envisaging China. Japan.
11.725 mil.
South Korea and Taiwan separate customs territory
Theme 5 * - Information and promotional programs targeting the US and / or
11.725 mil.
Canada
Theme 6 * - Central America. South America and the Caribbean 7.035 mil.
Theme 7 * - Southeast Asia. namely Brunei. Cambodgia. Indonesia. Laos.
Malaysia. Myanmar. Philippines. Singapore. Thailand. East Timor and 7.035 mil.
Vietnam
Theme 8 * - Africa and Middle East 4.690 mil.
Theme 9 * - Other geographies 4.690 mil.
Theme 10 - Information and promotion programs on milk / dairy. pork
21 mil.
products or a combination of both envisaging any third country
Multinational programs 14 mil.

Simple programs - in case of serious market disturbance 3 mil.

TOTAL 2016 111 mil.

* These programs include milk / dairy products, pork products or a combination of both. However, they may
include milk / dairy products, meat products of pork or a combination of the two, if associated with other
products.
Source: http://www.madr.ro/promovare-produselor-agricole.html [10]

To achieve this objective, the Commission
provides more resources, increase the rate of
co-financing and reduce the approving
bureaucracy for such projects. These measures
are part of an effort of gradual increase of the
EU budget available for promotion, from 61
mil. EUR in 2013 (the year that the new rules
have been proposed) to 200 mil. EUR in 2019
(http: //www.madr.ro/promovare-produselor-
agricole. html) [10].
In Romania, the control and certification of
organic products is currently provided by private
inspection and certification bodies. They are
approved by the Ministry of Agriculture and Rural
Development, based on criteria of independence,
impartiality and competence established in the
Order no. 181/ 2012 for the approval of rules
on the organization of inspection and certification,
approval and certification of inspection bodies
and supervising control bodies.

ONE HEALTH INTERNATIONAL JOURNAL, 3(1),2017

20 Viorica Jelev
Fig.1. National logo ae, specific organic products
Source: http://www.madr.ro/agricultura -
ecologica.html [11]
The national logo ,,ae", for specific organic
products, together with the Community logo,
are used to supplement labelling, and support
the consumers to identify the products
produced in accordance with organic
production methods.
Fig.2 Community logo for organic products
Source: http://www.madr.ro/agricultura-
ecologica.html [12]
3. The role of school today: the
formation of new consumer behaviours and
use patterns, character formation, secured
transfer of experience
Due to the importance given to this topic in
the world, Spiru Haret University has an initiative
to be accredited a Master program intituled
Environmental Management and Eco-Bio-
Economy in One Health context. It will take
place in the Faculty of Economic Sciences and
ONE HEALTH INTERNATIONAL JOURNAL, 3(1),2017
will aim to form economists with a broad
vision on economic development and
sustainable development of the country, taking
into account the implications on environment,
human and animal health.
One of the main porpoise for the
implementation of the new medical global One
Health concept in Romania is to provide the
necessary specialists in this field. The new
specialists can be formed based on a special
Master program containing information in the
fields of eco-bio-economy, environmental health,
human and life in general, particularly by studying
this new concept of One Health. Later on,
specialists will become trainers, trained under
the coordination of the whole relational system
One Health − Eco-Bio-Economy.
With the mission of education and scientific
research, the new Master program proposed for
accreditation, falls in the overall mission of the
Spiru Haret University, Faculty of Economics,
including training of future specialists, conducting
also continuing education programs and research
in economics.
The need to train young graduates in the
field of environmental management and eco-
bio-economy, with reference to health living,
are based on the outputs of the studies
conducted by our group on the evolution of
supply and demand on the labour market in
Romania and the structure of labour demand
work in our country and in Europe.
Some of the potential career paths for future
graduates of the MA program Environmental
Management and Eco-Bio-Health Economics
in One Health context could be the following
(Master MMEOH final report, Faculty of
Economic Sciences, Spiru Haret, 2016) [13]:
• Manager of environmental management
systems.
• Researcher and economist in Environmental
Economics.
• Advisor / expert / inspector / referent /
economist in Environmental Economics.
• Business Information Manager.
• Manager in bio-eco-business.
• Bio-eco-business Specialist in Risk
management.
• Consultant in environmental management.
• Consultant for agricultural business.
• Economical consultant in Agro economy.
• Consultant in ecology and environmental
protection.
• Economic Assistant Researcher in the agro-
food economy.
 Eco-bio-economy - in One Health context
The Master program is designed to be a
specialization for graduates of economic
faculties, geography, environment, human
medicine and veterinary medicine, journalism,
communications and public relations, as well as
of other curricula, who wish to continue their
work in the field, by managing environmental
projects in the departments of management,
marketing, communications and PR from
various concerned structures.
Future specialists, economists with deep
knowledge in the field of environmental
protection, environment ethics, will help solve
the problems of environmental pollution, restore
ecosystems damaged by human activities and
the most important thing is that they will become
the trainers of new consciousness on nature
and the environment, of the creation in general,
subject of aggression, like a consequences of
modern lifestyle, preferences for material
consumption, in opposition with the
fundamental precepts of all world religions (R.
Tagore in 1922) [5]. The earth is a gift from
God to be cherished and cultivated, by a close
link between man and nature, to be bequeathed
to future generations.
CONCLUSIONS
The paper presents the new concepts of
eco-bio-economy and One health, the latter
one representing a new and unified approach
to environmental and health issues in an
integrated concept: humans, animals and the
environment. It stresses the interdependence
between environmental factors and health and
stresses the importance of eco-bio-economy
for the transition to sustainable development in
harmony with the environment and social issues.
Specialists claim that Eco-Bio-Economy is the
economy of the future, in the service of human
life by the rational use of environmental
resources. According to the researchers, the
concept brings together in an integrated manner
economy, ecology, biodiversity, biotechnology
and focuses on the integrated sustainable
development of the world. The new social
economy, along with corporate social
responsibility joins a new multirole world to a
healthy environment by creative and
innovative concepts that will ensure the
sustainability of living in a sustainable
manner. As it was shown before, doctors
added to the concept of Eco-Bio-Economy, a
new one, the One Health newly integrated
approach of the health of humans, animals and
environment, so as to emphasize the importance
ONE HEALTH INTERNATIONAL JOURNAL, 3(1),2017
21
of responsible human behaviour brought on the
Planet biodiversity.
Companies, mostly understood the importance
of alarm pulled by researchers on the
devastation of the planet's resources, and their
business sites were adapted to the requirements
of the new green economy.
The implications of these new approaches,
especially considering the ensemble of all eco-
bio-economy and health in the One Health
concept of are of multiple, assuming deep
conceptual thinking transformations and approach
of human activities, with beneficial effects on
the environment and the health of the planet,
assessing overall biosphere and all living
things, including human rights.
Educational environment should contribute
to the new planetary trend formation of new
consciousness, new consumer behaviours and
utilisation, formation of new characters, sensitive
to environmental an issue that is the support of
the life.
Spiru Haret University brings a substantial
contribution to the training of specialists in
Eco-Bio-Economy by creating a new master
called Environmental Management and Eco-
Bio- Economics in One Health context. The
need to train young graduates in the
environment management and eco-bio-
economy, referring to the health of
biodiversity on the Earth, is the result of many
studies conducted by our team on the
evolution of supply and demand on the labour
market in Romania, as well as the demand
workforce structure in our country and in Europe.
The profound connection between nature,
its protection, religion, human and animal
health, and education, should become a subject
at all educational levels. Only then we become
real lovers and defenders of the environment
and nature, recognizing in it the supreme harmony
that we ennoble life (Tagore 1922) [5].
REFERENCES
1. *** NSDS (2013), National Strategy for
Sustainable Development, in the horizon of the
years 2013-2020-2030 in http://www.mmediu.ro/
beta/domenii/dezvoltare-durabila/strategia-
nationala-a-romaniei-2013-2020-2030/ (in
Romanian);
2. Brown L – Eco-Economy: Creating a
Savings for Our Planet, Technical Publishing,
Bucharest, 2001 (in Romanian);
3. Jelev I, Brejea R – Applied Systems of
Environmental Management, University of
Oradea Publishing, 2006 (in Romanian);
22 Viorica Jelev

4. Bogdan TA, Comsa D – Eco-Bio-

Diplomacy, AOSR Publishing, Bucharest, 2011
(in Romanian);
5. Tagore R – Sadhana – The Path of
Perfection, National Culture, Bucharest, 1922
(in Romanian);
6. Lovelock J – Gaia: A New Look at Life,
Oxford University Press, New York, 1979;
7. Jelev V – Eco-Marketing, Publishing
House of Tomorrow Foundation, Bucharest,
Romania, 2012 (in Romanian);
8. Jelev V – Agricultural Policy and Agro-
Food Economy, University of Oradea Publishing,
2005(a) (in Romanian);
9. Jelev V – Agricultural and Agro-Foods
Economics. Lectures, University of Oradea
Publishing, 2005(b) (in Romanian);
10. *** MARD, Inspection and certification
bodies, 2016(a), http://www.madr.ro/
agricultura-ecologica/organisme-de-inspectie-
si-certificare.html (in Romanian);
11. *** MARD, Promotion of agricultural
products, 2016(b), http://www.madr.ro/
promovare-produselor-agricole.html (in
Romanian);
12. *** MARD, Dynamics of operators and
surfaces in the ecological agriculture, 2016(c),
http://www.madr.ro/agricultura-
ecologica/dinamica-operatorilor-si-a-
suprafetelor-in-agricultura - ecologica.html (in
Romanian);
13. *** Organic agriculture,
http://www.madr. ro/agricultura-ecologica.html
(in Romanian);
14. *** MMEOH, Masters Final Report
MMEOH, Faculty of Economic Sciences,
Spiru Haret University, Bucharest, Romania,
2016 (in Romanian).

0027_170117

Received: 17.01.2017
Accepted: 08.02.2017

ONE HEALTH INTERNATIONAL JOURNAL, 3(1),2017

One Health International Journal, 3(1),23-29,2017
One Health New Medical Concept Association, Romania

GENERAL PAPERS

Relation between biodiversity – climate –

human welfare in context globalized bioeconomy

Mariana Sandu1, Alexandru T. Bogdan, Iudith Ipate,

Leonard George Tobă

Romanian′s Academy Centre of Studies and Research in Agricultural and

Forestry Biodiversity, Bucharest, Romania

Abstract
Continued loss of biodiversity may compromise, on long term, the ability of ecosystems
to adjust the climate, respectively, can accelerate or amplify global warming and lead to
further changes, unforeseen and potentially irreversible in the Earth System.
Based on an extensive documentation, this paper aims to bring attention to the
interdependence between biodiversity, climate and human welfare in globalized context.
Transforming ecosystems and exploitation of natural resources have resulted in
substantial gains for human beeing and economic development. However, the benefits have
not been equitably distributed, and the costs of changes in biodiversity have been either not
recognized or not quantified. This is because ecosystems tend to be evaluated by people
only in terms of direct benefits offered to supply services and cultural (eg food, fiber,
respectively, recreational and aesthetic) which is a component relatively low of
biodiversity. However, providing these services is backed by support services and
regulation (eg primary productivity, respectively, pollination and climate regulation) for
which the value of biodiversity is less visible, but no less important.
Ecosystem degradation, biodiversity loss and consequent changes in ecosystem services
have also led to a decline in human well-being, in some groups, by exacerbating poverty
and increasing social inequalities and regional disparities.
Interdependencies between biodiversity, ecosystems, human livelihoods and climate
system, makes possible to approach the biodiversity loss, ecosystem degradation,
sustainable development, climate change and their impacts, together.

Keywords: biodiversity, ecosystems, climate change, human welfare

Biodiversity or biological diversity concept international instrument for the environment.

was first defined in the UNCED Earth Summit The concept of biodiversity means the variety
1992 in Rio de Janeiro, the context being that of life on earth and involves four levels:
it is necessary the adoption of a new ecosystem diversity, species diversity, genetic

1
Correspondance author: Romanian′s Academy Centre of Studies
and Research in Agricultural and Forestry Biodiversity, Calea 13
Septembrie no 13, Sector 5, 050711, Bucharest, Romania, e-mail:
marianasandu47@gmail.com
24 Mariana Sandu et al.
diversity and ethnocultural diversity. From the
knowledge of biodiversity depends the way
that the mankind will chose for the future
sustainable development, whose essence consist
of proper management of natural resources and
respect the laws of nature.
Population growth, increased consumption,
the phenomenon of urbanization, pollution and
sustained economic development had and
continue to have a strong impact on eco-
systems. Threats such as destruction, degra-
dation, erosion, fragmentation of natural habitats
and the overexploitation of natural resources
are secondary issues arising from increased
population pressure and the requirements of
the population human population.
MATERIALS AND METHODS
This study aims to analyze the relationship
between biodiversity, climate and human
welfare. The scientific approach includes a
series of exploratory research results, which
were aimed at acquiring knowledge and new
concepts specific to the study of phenomena
and processes specific to the studied domain.
In this regard there were consulted numerous
bibliographical sources, communications and
peer reviews with news in this field, treaties
and manuals, which provided valuable
information relating to the subject studied.
RESULTS AND DISCUSSIONS
1. The importance of biodiversity in
ecosystem functioning
There is growing evidence that species
richness is important for maintaining
ecosystem functioning. Whether we consider
the species level or the size of a certain group,
there is consensus that "functional diversity",
ie the type, range and abundance of functional
characteristics in a community, can have
important consequences for ecosystem processes
. Ecosystem services depend fundamentally of
the processes generated by organisms and their
interactions with their environment.
Currently, overexploitation and degradation
habitates caused an erosion of biodiversity in
ecosystems, thus weakening their ability to
provide vital resources and services.
Local extinctions (loss of species in a given
area) and functional extinctions (reduction of a
species so that it no longer plays a significant
role in ecosystem functioning) can have a
dramatic impact on ecosystem services. Loss
of ecosystem functions and also the services
ONE HEALTH INTERNATIONAL JOURNAL, 3(1),2017
derived therefrom, takes place long before the
extinction of a species at world level. Most
often, direct or indirect changes to
biodiversity, pushed beyond a certain limit,
affects the functioning of the local ecosystem
and the loss of ecosystem services may persist
for a long time.
Many changes in ecosystem services are
generated by removal or introduction of
organisms in ecosystems, that disrupts biotic
interactions or processes the ecosystem. As the
network of interactions between species and
network links between ecosystem processes
are complex, the impact on the ecosystem by
removing existing species or the introduction
of new species, it is difficult to predict.
For example, coral reefs and ecosystem
services they provide are directly dependent on
the maintenance of essential interactions
between animals and algae. Coral reefs are
responsible for maintaining a vast repository
of genetic and biological diversity. Ecosystem
services provided by coral reefs are important:
the construction of habitats, nurseries,
reproduction area for fish, the flow of nutrients
and carbon and nitrogen fixation in
environments low in nutritional properties or
environmental buffer for waves and stabilizing
sediments. However, all coral reefs are dependent
by only one key of biotic interaction,
respectively symbiosis with algae. The dramatic
effects of climate change variability on coral
reefs, are translated by disrupting this symbiosis.
There is growing evidence that much of the
natural ecosystems have been degraded to such
an extent that they are approaching on critical
points or thresholds beyond which their ability
to provide relevant services can be reduced
drastically. However, there is considerable
uncertainty about how much different ecosystems
can withstand before overexploitation cause
irreversible damage.
The current rate of species extinction seems
to be 100 to 1,000 times higher than the
average rate of extinction of the emergence of
life on Earth (fig.1).
According to the Red List of the
International Union for Convention of Nature
(IUCN), from the 63,837 fish species, 3,947
are ranked in a critical situation, 5,766
endangered and 10,104 vulnerable, or 19,817
species endangered for extinction. The main
causes are of human nature, especially related
to overfishing, deforestation, pollution and
climate change.
Summit for Sustainable Development − Rio
+ 20, IUCN reiterated that the erosion of
 Relation between biodiversity – climate – human welfare
biodiversity threatens the existence of more
than one billion human beings, knowing that
many animal species are essential for people,
giving them the source of food, for employ-
ment and constituting a genetic reservoir of
needed medications.
To underline the economic importance of
natural capital, the Indian economist Pavan
Sukhdev estimate in a report completed in
2010, that the cost of biodiversity loss globally
are between 1,350 and 3,100 billion per year.
Fig.1. The pace of species extinction (Inter-
national Union for Convention of Nature)
2. The importance of biodiversity for
humanity
The economic value of biodiversity is given
by the direct use of its components,
respectively, of non-renewable natural resources
(fossil fuels, minerals, etc.) and renewable
natural resources (plant and animal species).
Biodiversity contributes directly (through eco-
system services supply, regulation and cultural)
and indirectly (through supporting ecosystem
services) as the material basis for a better life,
to human welfare, food security, health, better
social relationships etc.
Many people have benefited over the last
century from the conversion of natural eco-
systems and exploitation of biodiversity in
ecosytems controlled by humans. At the same
time, however, these losses in biodiversity and
changes in ecosystem services have caused
poverty for some groups.
Substantial benefits have been obtained
from many of the actions that ultimately led to
the homogenization or loss of biodiversity. For
ONE HEALTH INTERNATIONAL JOURNAL, 3(1),2017
25
example, agriculture, forestry and fishing are
three activities that have placed significant
pressures on biodiversity, often beeing the main
pillars of national development strategies, as
provided income that allowed investments in
industrialization and economic growth. The
workforce comprised in agriculture is currently
approximately 22% of the total population and
46% of the total workforce worldwide. In
industrialized countries, the exploitation of
natural resources in rural areas, remains
important for existence.
Worldwide, many species that contribute to
the homogenization of biodiversity, were
introduced on purpose because of the benefits
they provide . In other cases, people have
removed some harmful components of bio-
diversity, such as certain pathogens or pests.
Intensification of agriculture and specialization
of production coupled with the effects of
globalization has led to a substantial reduction
in genetic diversity, through domestication of
plants and animals species. Some of loss of
genetic diversity in crops in farms, were
partially offset by the maintenance of genetic
diversity in seed banks. In addition, extinction
of species and loss of unique populations
(including commercially important species),
which took place in culture systems has
resulted in the loss of unique genetic diversity
contained in those species and populations.
This loss reduces the potential for adaptation
and limited prospects for recovery of species
whose populations are reduced to low levels [1].
3. Climate change
Globally, climate change are the most
serious of environmental, social and economic
challenges. Global warming, respectively, the
increase in average temperature of the atmosphere,
registered in the vicinity of the soil and the
oceans is caused by increasing the concentra-
tion of CO2 in the atmosphere of past centuries.
Currently, the average global temperature is
with 0.85 ºC higher than at the end of the
nineteenth century. An increase of 2 °C
compared to pre-industrial temperatures is
regarded by scientists as the threshold beyond
which there is a much higher risk to witness
the dangerous and potentially catastrophic
climate change globally [2].
Climate change − treated in the United
Nations Framework Convention on Climate
Change 1992 − is attributed directly or indirectly
to human activity that alters the composition
of the global atmosphere. As a result of human
26 Mariana Sandu et al.
activities, high concentrations of greenhouse
gases (GHG) in the atmosphere increases the
Earth's temperature.
Global GHG concentrations, particularly
carbon dioxide (CO2) increased by 70%
compared to 1970. Despite all efforts to reduce
global greenhouse gas emissions, the average
global temperature will continue to increase
thereafter. Increasing global temperature has a
significant impact on physical and biological
systems (water, habitats, health), which are
becoming more fragile.
Many activities of the food system lead to
the production of GHG and other indirect
emissions (aerosols) resulting in an accele-
ration of climate change, exceptions being
some agricultural practices (such as certain
agroforestry systems), which can have a net
carbon sequestration more especially if they
are used to rehabilitate degraded land. Global
GHG emissions vary significantly between the
various activities of the food chain.
In 2008, food systems have contributed
with 19% - 29% of anthropogenic emissions of
greenhouse gases worldwide, releasing the
equivalent of 9800-16900 megatonnes of carbon
dioxide (MtCO2). Agricultural production, inclu-
ding indirect emissions associated with changes
in using the land have contributed 80% - 86%
of total GHG emissions from food systems,
with significant regional variations [3]. Direct
emissions from agricultural production ac-
counted for about 60% of emissions of nitrous
oxide (N2O) and about 50% of the methane
and indirect emissions resulting from defores-
tation, forest degradation and land degradation
represented 12% (with a range of 6%-18%) of
total anthropogenic GHG emissions [4].
In the food pre-production phase, the main
source of GHG emissions is the production of
fertilizers and pesticides for agriculture, largely
due to its energy intensity and emissions of
nitrous oxide (N2O) in the manu-facture of
nitrate fertilizers.
Production of animal feed and aquaculture
directly contributes to GHG emissions due to
inputs of fossil fuels (in cultivation,
transportation and processing of feed), and
indirectly through changing the use of the land
both for grazing and for growing feed. Steinfeld
et al. estimated that more than half of the total
energy consumed in agricultural production is
used in the production of food (about 20% of
the 80 million tons of nitrogen fertilizer
produced annually are used to grow animal
feed which generates GHG emissions
amounting to 41 MtCO2) [5].
ONE HEALTH INTERNATIONAL JOURNAL, 3(1),2017
Within activities of the food system, food
processing include CO2 emissions (from burning
boilers, ovens and cookers), CH4 and N2O
(from wastewater systems). In 2007, GHG
emissions from food processing in China were
48 MtCO2.
Food refrigeration also determines GHG
emissions generated by energy consumption
and direct loss of refrigerants used in
refrigeration systems [6].
GHG emissions from food packaging may
include the manufacture of packaging materials,
packaging process and some of the costs of
refrigeration. Transport has a large direct
contribution to GHG emissions, for example,
in 2002 in the UK GHG emissions were 19
MtCO2, almost all from road transportation
[7]. On the other hand, retail sales of foods
contribute significantly to greenhouse gas
emissions. Tassou et al. it estimated that the
total annual emissions associated to main
outlets of food retailers in the UK, reaching a
value of about 4 MtCO2 [8,9].
Food waste contributes directly to GHG
emissions by CH4 emissions from landfills.
The rates of emissions from landfills differ
considerably depending on the composition of
the waste and related to management practices
(for the UK, GHG emissions from the food
component of landfills is estimated at 2 to 13
MtCO2 per year of which 1 is CH4 [10].
Climate data in the last decades highlights a
progressive warming of the atmosphere and
increased frequency of extreme events (fast
alternations severe heat / severe drought and
rainfall generating rapid winds and floods)
[11].
In the last period of time, globally, there is
an increasing frequency of high-occurrence of
extreme weather phenomena. They cause
major disasters, sometimes resulting in human
casualties and serious damage in important
changes in the environment. Floods cause
impressive material damage, with thousands of
lives lost, while the costs of drought are
similar in magnitude and often lead to heat
waves and devastating fires. During 1992-
2011, more than 530,000 people died as a
direct consequence of the approximately
15,000 extreme weather events that have
caused material losses of over 2.5 trillion
dollars [12].
The most recent report of the UN about the
climate changes and statistics in the field of
evolution of the phenomenon of global
warming argue increasingly more the theories
of specialists on an intensification of extreme
 Relation between biodiversity – climate – human welfare
weather events in the next hundred years, and
the link between the greenhouse effect (caused
excess CO2 from the atmosphere) and extreme
atmospheric phenomena.
4. The connection between biodiversity,
climate and human welfare
In a few hundred years, human activity has
significantly changed the face of the planet,
this period being described as anthropogenic
[13]. The consequences of this period are:
Earth's climate change, species extinction at a
rate much faster than before; degradation or
unsustainable use of many ecosystems that
humans and other species depend for their
survival.
Over the past 50 years, humans have
changed ecosystems more rapidly and
extensively than in any period, comparable in
time, from human history [1]. The implications
of these changes, only now are beginning to be
understood. Anthropogenic climate change
provides an example of the profound effect
that human activities may have on natural
systems and their consequences for human
well-being. Even if emissions of greenhouse
cease immediately, temperatures would still
continue to grow for at least 30 years and the
seas level for another 100 years.
Within ecosystems, biodiversity is important
also for providing ecosystem services, including
climate regulation. Therefore, it can play an
important role in reducing climate change and
its impacts, as well as protecting and improving
the welfare of society. However, efforts to
combat climate change could have the uni-
ntended consequence of biodiversity loss, thus
reducing future options to respond to climate
change.
Because ecosystems determines the bio-
geo-chemical and biophysical processes that
are governing the Earth system, the potential
ecological consequences of biodiversity loss
and climate raises significant scientific interest.
Biodiversity, climate regulation and human
welfare are interlinked and must be essential
for sustainable development.
Interdependencies between biodiversity,
ecosystems, human livelihoods and climate
system makes it possible to address together
biodiversity loss, ecosystem degradation,
sustainable development, climate change and
its impacts (fig.2).
The functions of biodiversity in ecosystems
are complex, therefore the services they
provide are influenced by the nature of the
species present and their functional features.
ONE HEALTH INTERNATIONAL JOURNAL, 3(1),2017
27
Resistant species and a greater genetic
diversity tends to make ecosystems more
resilient to disturbance. This is because the
species are likely to be present with features
that will allow ecosystems to adapt to environ-
mental changes or to provide critical services
(such as water purification). When subjected
to shocks or disturbances ecosystems with low
resistance can reach a point where there is a
sudden change.
Fig.2. Climate change and human well-being
Continued loss of biodiversity may
compromise on long term, the ability of
ecosystems to adjust the climate, respectively,
can accelerate or amplify global warming and
lead to further changes, unforeseen and
potentially irreversible in the Earth System.
Regarding the relationship between bio-
diversity and human welfare, scientific studies
describe four categories of ecosystem services
to society:
support services that underpin all other
ecosystem services such as carbon cycle (eg
primary production, decomposition and soil
formation), water cycle and nutrients (eg
nitrogen and phosphorus);
service for adjustment of mechanisms
that moderate stresses and shocks impact on
ecosystems (eg, climate regulation and
disease);
supply services that determine the
distribution of food, fuel and fiber;
cultural services such as aesthetic and
spiritual values.
The transformation of ecosystems and
natural resources have resulted in substantial
gains for human and economic development.
However, the benefits have not been equitably
distributed, and the costs of changes in bio-
diversity either were not recognized or have
28 Mariana Sandu et al.
not been quantified. This is because eco-
systems tend to be evaluated by people only in
terms of direct benefits offered to supply
services and cultural (eg food, fiber,
respectively, recreational and aesthetic) which
is a relatively reduced component of bio-
diversity. However, providing these services is
backed by support and regulation services (eg
primary productivity, respectively, pollination
and climate regulation) for the value of bio-
diversity is less visible, but no less important [14].
Ecosystem degradation, biodiversity loss and
consequent changes in ecosystem services have
also led to a decline in human well-being, in some
groups, by exacerbating poverty and increasing
social inequalities and regional disparities.
CONCLUSIONS
Maintaining biodiversity is necessary not
only to ensure life in the present but also for
future generations, because it preserves the
ecological balance regionally and globally,
ensure regeneration of biological resources
and maintaining the environmental quality.
Currently, overexploitation and degradation
caused an erosion of biodiversity in
ecosystems, thus weakening their ability to
provide vital resources and services.
There is growing evidence that much of the
natural ecosystems have degraded to the extent
that they are approaching critical points or
thresholds, beyond which their ability to
provide relevant services may be reduced
drastically. However, there is considerable un-
certainty about how much different
ecosystems can withstand before overexploi-
tation cause irreversible damage.
Conservation of biodiversity is, in the
current period, one of the important issues at
international level, but in the last period, the
conservation of biodiversity at ecosystems
level, species, populations and even at the
level of genes, is becoming increasingly acute
due to increased human impact on the biosphere.
Food resources for humanity are mainly
provided by natural ecosystems and
agricultural ecosystems. Keeping productive
capacity of agricultural ecosystems is
conditional on soil quality and the quality and
quantity of water resources, linked as well to
the macroclimate. Climate change impacts due
to human activities (including agriculture and
animal husbandry) generating effects on
agricultural production in terms of quantity
and geographical distribution.
ONE HEALTH INTERNATIONAL JOURNAL, 3(1),2017
Anthropogenic climate change provides an
example of the profound effect that human
activities may have on natural systems and
their consequences for human well-being.
Even if emissions of greenhouse cease
immediately, temperatures would still continue
to grow for at least 30 years and the seas for
another 100 years.
REFERENCES
1. Midgley GF, Thuiller W – Potential
responses of terrestrial biodiversity in Southern
Africa to anthropogenic climate change. Reg
Environ Change, 2011, 11(1), 127-135;
2. Intergovernmental Panel on Climate
Change – Climate Change: Impacts, Adaptation
and Vulnerability, Contribution of Working
Group II to the Fourth Assessment Report of
the Intergovernmental Panel on Climate Change
(Cambridge Univ Press, Cambridge, UK), 2007;
3. Garnett T – Where are the best oppor-
tunities for reducing greenhouse gas emissions
in the food system (including the food chain)?.
Food policy, 2011, 36, S23-S32;
4. Bellarby J, Foereid B, Hastings A,
Smith P. – Cool Farming: Climate Impacts of
Agriculture and Mitigation Potential, Published
by Greenpeace International, Amsterdam, 2008,
pp 13-36;
5. Steinfeld H, Gerber P, Wassenaar T,
Castel V, Rosales M, de Haan C – Livestock‘s
long shadow – Environmental issues and options,
FAO Agriculture Technical paper, Rome, 2006;
6. Ge YT, Tassou SA – Performance
evaluation and optimal design of supermarket
refrigeration systems with supermarket model
Super-Sim.Part II: Model applications, Int J
Refrig, 2011, 34(2),540-549;
7. Vermeulen, Sonja J., Bruce M.
Campbell, and John SI Ingram – Climate
change and food systems. Annu Rev Environ
Resour, 2012, 37,195-222;
8. Tassou SA, Ge Y, Hadawey A,
Marriott D. – Energy consumption and
conservation in food retailing, Appl Therm
Eng, 2011, 31,147–156;
9. Suamir IN, Tassou SA, Marriott D –
Integration of CO2 refrigeration and tri-
generation systems for energy and GHG
emission savings in supermarkets. Int J Refrig,
2012, 35(2), 407-417;
10. Scholes B, Midgley G – Impact of
climate change-driven biodiversity loss on
human livelihoods. Presentation given at the
 Relation between biodiversity – climate – human welfare 29

Royal Society 13 June 2007. http://

www.royalsoc.ac.uk/downloaddoc.asp?id=440 8;
11. Harmeling S, Eckstein D – Global
Climate Risk Index 2013. Publisher:
Germanwatch e.V., 2013, downloaded at:
www.germanwatch. org/en/cri;
12. Crutzen PJ, Stoerm EF – The
Anthropocene, The International Geosphere–
Biosphere Programme (IGBP): A Study of
Global Change of the International Council for
Science (ICSU), 2000;
13. *** MEA (Millennium Ecosystem
Assessment) – Ecosystems and Human Well-
Being: Biodiversity Synthesis. Washington,
DC: World Resources Institute, 2005;
14. Mooney H, Larigauderie A, Cesario M,
Elmquist T, Hoegh-Guldberg O, Lavorel S,
Yahara T – Biodiversity, climate change, and
ecosystem services. Curr Opin Environ
Sustain, 2009, 1(1),46-54.

0011_170117

Received: 17.01.2017
Accepted: 07.02.2017

ONE HEALTH INTERNATIONAL JOURNAL, 3(1),2017

One Health International Journal, 3(1),30-33,2017
One Health New Medical Concept Association, Romania

Osteogenic differentiation of canine

Wharton's Jelly derived mesenchymal stem cells

Ioan Groza1, Raul Alexandru Pop, Mihai Cenariu, Simona Ciupe,

Emoke Pall

University of Agricultural Sciences and Veterinary Medicine,

Cluj-Napoca, Romania

Abstract
Background: Wharton's Jelly derived mesenchymal stem cells (WJ-MSCs) show
mesenchymal cells properties and may represent an attractive source of tissue engineering
in veterinary medicine. WJ-NSCs are primitive stem non-specialized cells with self-renewal
and differentiation capacity. The aim of our study was to evaluate the osteogenic potential
of canine WJ-MSCs.
Methods: mesenchymal stem cells were obtained from canine umbilical cord following
Caesarean section. Flow cytometry analyses confirmed positive expressions of
mesenchymal cell-associated markers, negative expressions of hematopoietic and
endothelial markers. For differentiation the cells were cultured at 2.5 x 104 cells/cm2 in
normal propagation medium until confluence. The propagation medium was replaced with
DMEM-LG supplemented with 10% FBS, 0.1 µM dexamethasone (Sigma-Aldrich), 50 µM
ascorbic acid-2-phophate (Sigma-Aldrich), and 10 mM beta-glycerophosphate (Sigma-
Aldrich), and the cells were cultured for 21 days. Osteogenic differentiation was evaluated
using Alizarin red S staining; the ALP activity was measured using an ALP assay kit.
Results and conclusions: After 21 days large number of mineral nodules was observed.
The level of Alizarin Red S staining was intense compared with control culture, ALP
activity were also significantly higher (p ＜ 0.05). Our data confirmed that the
characterized WJ-MSCS have osteogenic potential and may represent an ideal source for
bone repair procedures.

Key words: canine, stem cells, Wharton's Jelly, differentiation, osteogenic

Wharton's Jelly derived mesenchymal stem
cells (WJ-MSCs) show mesenchymal cells
properties and may represent an attractive
source of tissue engineering in veterinary
medicine [1,2]. WJ-MSCs are primitive stem
non-specialized cells with self-renewal and
differentiation capacity [3], can be harvest
using non-invasive techniques, provides large
number of cells without risk to the donor,
could be expanded, genetically manipulated

1
Correspondance author: University of Agricultural Sciences and
Veterinary Medicine, Calea Mănăştur 3-5, 400372, Cluj-Napoca, Cluj
County, Romania, e-mail: isgroza@yahoo.com
 Osteogenic differentiation of canine Wharton's Jelly
and differentiated in vitro [1,4,5]. WJ-MSCs
are considered with higher proliferation rates
and lower immunogenicity and express both
mesenchymal and embryonic stem cell
markers (OCT4, Nanog and SOX2) [6,7,8,9].
The aim of our study was to evaluate the
osteogenic potential of canine WJ-MSCs.
MATERIALS AND METHODS
Mesenchymal stem cells were obtained
from canine umbilical cord following
Caesarean section. In order to isolate MSCs
the blood vessels were removed from
umbilical cord and the mesenchymal tissue
was minced and incubated with collagenase
solution (2 mg/ml) for 3 hours at 37ºC [9].
Isolated cells after quantification and viability
evaluation were incubated in normal
propagation media DMEM/F12 (Dulbecco's
Modified Eagle's Medium/Nutrient F-12 Ham)
(Sigma-Aldrich, St. Louis, MO, USA)
supplemented with 10% FCS (fetal calf serum)
(EuroClone, MI, Italy), 2 mM glutamine, 1%
Non Essential Amino-Acids (NEAA) (Sigma-
Aldrich, St. Louis, USA). The cultures were
maintained in a humidified atmosphere with
5% CO2 at 37 °C. After 72h the medium was
replaced, the cells were grown until
confluence (70-80%) and then passed (1:2).
After 5 passages the immunophenotypic
analysis were performed using FACS Canto II
and specific antibodies. In order
demonstrate the differentiation capacity of
isolated cells, the cells were incubated at
concentration of 2.5x104 cells/cm2 in normal
propagation medium until confluence. The
propagation medium was replaced with
induction medium DMEM-LG supplemented
with 10% FBS, 0.1µM dexamethasone (Sigma-
Aldrich), 50 µM ascorbic acid-2-phophate
(Sigma-Aldrich), and 10 mM beta-
glycerophosphate (Sigma-Aldrich), and the
cells were cultured for 21 days. Osteogenic
differentiation was evaluated using Alizarin
red S staining; the ALP activity was measured
using an ALP assay kit. Statistical analysis
was performed using GraphPad Prism 6
software (Manual Graph Pad Prism 5.0,
GraphPad Software). A value of p < 0.05 was
considered statistically significant. Data were
reported as the mean ± SD.
31
RESULTS AND CONCLUSIONS
After isolation from the canine umbilical
cord matrix the cells were cultured in normal
propagation medium. Fibroblast-like cells were
characterized after 5 passages using specific cell
markers. Flow cytometry analyses confirmed
positive expressions of mesenchymal cell-
associated markers, negative expressions of
hematopoietic and endothelial markers. The
isolated were positive for CD90, CD44 and
CD105 and negative or low expression for
CD34, CD14 and CD45 (fig1).
%
5
90
44
34
45
14
10
D
D
D
C
C
C
Fig.1. Flow cytometry analysis of P5 canine
WJ-MSCs
to To demonstrate the differentiation capacity,
isolated cells were cultured in osteogenic induction
medium and cells cultured in propagation medium
was used as a control. Cells were maintained
in induction condition for 21 days. Osteogenic
differentiation was confirmed after 21 days by
an increased expression of ALP activity and
presence of the large number of mineral
nodules with calcium depositions (fig.2).
Alkaline phosphatase activities were measured
after cell lysis, using a colorimetric ALP detection
kit. The level of Alizarin Red S staining was
intense compared with control culture, were
also significantly higher (p ＜ 0.05) (fig.3).
Presence of alizarin red stained mineralized
nodules associated with a significant increase
of ALP activity demonstrates that canine WJ-
MSCs have a great potential to differentiate into
osteogenic lineage. However the precise cellular
signaling mechanisms implicated in bone
synthesis is undefined [10].
ONE HEALTH INTERNATIONAL JOURNAL, 3(1),2017
32 Ioan Groza et al.

In conclusion our data confirmed that the

characterized WJ-MSCS have osteogenic
potential and may represent an ideal source for
Absorbance 550nm

bone repair procedures and for allogeneic cell-

based therapies.

REFERENCES

1. Cardoso TC, Ferrari HF, Garcia AF,

Novais JB, Silva-Frade C, Ferrarezi MC,
Andrade AL, Gameiro R – Isolation and
characterization of Wharton’s Jelly-derived

n
L

io
TR

multipotent mesen-chymal stromal cells

ct
C

du
obtained from bovine umbilical cord and
in
c

maintained in a defined serum-free three-

ni
ge

dimensional system, BMC Biotechnol, 2012,

eo

12(1),18-28;
st
O

2. Eder Z, Vieira NM, Bueno DF, Secco M,

Fig.2. ALP level
Fig.3. Level of calcium deposition (Alizarin
red staining)
In recent years, main objective of several
studies was based on the identification of
alternative sources of stem cells for human and
veterinary medicine. MSCs isolated from
umbilical cord matrix umbilical, which is
discarded at birth appeared to satisfy all these
requirements. WJ-MSCs have many advantages,
such as, high population doubling time; easily
expansion due the plastic aderence, plasticity,
anticancer properties, low immunogenicity,
immune-modulatory property [11] can be
transplantated without acute rejection [11,12,
13,14].
Jazedje T, Ambrosio CE, Passos-Bueno MR,
Miglino MA, Zatz M – Mesenchymal stem
cells derived from canine umbilical cord vein
– A novel source for cell therapy studies, Stem
Cells Dev, 2010, 19(3),395-402;
3. Chamberlain G, Fox J, Ashton B,
Middleton J – Concise review: mesenchymal
stem cells: their phenotype, differentiation
capacity, immunological features, and
potential for homing, Stem Cells, 2007,
25(11),2739-2749;
4. De Bruyn C, Najar M, Raicevic G,
Meuleman N, Pieters K, Stamatopoulos B,
Delforge A, Bron D, Lagneaux L – A rapid,
simple and reproducible method for the
isolation of mesenchymal stromal cells from
Wharton´s Jelly without enzymatic treatment,
Stem Cells Dev, 2011, 20(3),547–557;
5. Troyer DL, Weiss ML – Concise review:
Wharton´s Jelly-derived cells are primitive
stromal cell population, Stem Cells, 2008,
26(3),591–599;
6. Fong CY, Chak LL, Biswas A, Tan JH,
Gauthaman K, Chan WK, Bongso A – Human
Wharton's Jelly stem cells have unique
transcriptome profiles compared to human
embryonic stem cells and other mesenchymal
stem cells, Stem Cell Rev, 2011, 7(1),1-16;
7. Fong CY, Subramanian A, Biswas A,
Gauthaman K, Srikanth P, Hande MP, Bongso
A – Derivation efficiency, cell proliferation,
freeze‐thaw survival, stem‐cell properties and
differentiation of human Wharton's jelly stem
cells, Reprod Biomed, 2010, 21(3),391-401;
8. Shivakumar SB, Bharti D, Subbarao RB,
Jang SJ, Park JS, Ullah I, Park JK, Byun JH,
Park BW, Rho GJ – DMSO – and serum – free

ONE HEALTH INTERNATIONAL JOURNAL, 3(1),2017

 Osteogenic differentiation of canine Wharton's Jelly 33

cryopreservation of Wharton's jelly tissue

isolated from human umbilical, Cord J Cell
Biochem, 2016, 117(10),2397–2412;
9. Groza I, Pop RP, Cenariu M, Ciupe S,
Pall E – Canine Wharton's Jelly derived
mesenchymal stem cells isolation, Agriculture
and Agricultural Science Procedia, 2016, 10,
408–411, (presented at 5th International Conference
Agriculture for Life, Life for Agriculture June
9-11, 2016 Bucharest, Romania);
10. Elkhenany H, Amelse L, Caldwell M,
Abdelwahed R, Dhar M – Impact of the source
and serial passaging of goat mesenchymal
stem cells on osteogenic differentiation
potential: implications for bone tissue
engineering, J Anim Sci Biotechnol, 2016,
7,16, doi: 10.1186/s40104-016-0074;
11. Ribeiro J, Pereira T, Amorim I, Caseiro
AR, Lopes MA, Lima J, Gartner A, Santos JD,
Bártolo PJ, Rodrigues JM, Mauricio AC, Luís
AL – Cell therapy with human MSCs isolated
from the umbilical cord Wharton Jelly
associated to a PVA membrane in the
treatment of chronic skin wounds, Int J Med
Sci, 2014, 11(10),979-987;
12. Kim DW, Chung YJ, Kim TG, Kim YL,
Oh IH – Cotransplantation of third-party
mesenchymal stromal cells can alleviate
single-donor predominance and increase
engraftment from double cord transplantation,
Blood, 2004, 103(5),1941-1948;
13. Singh B, Pal L – Sterculia crosslinked
PVA and PVA-poly (AAm) hydrogel wound
dressings for slow drug delivery: mechanical,
mucoadhesive, biocompatible and permeability
properties, J Mech Behav Biomed Mater,
2012, 9,9-21 doi: 10.1016/ nj.jmbbm.
2012.01.021;
14. Tarte K, Gaillard J, Lataillade J-J,
Fouillard L, Becker M, Mossafa H. et al. –
Clinical-grade production of human mesenchymal
stromal cells: occurrence of aneuploidy without
transformation, Blood, 2010, 115,1549-1553.

0013_170117

Received: 17.01.2017
Accepted: 07.02.2017

ONE HEALTH INTERNATIONAL JOURNAL, 3(1),2017

One Health International Journal, 3(1),34-39,2017
One Health New Medical Concept Association, Romania

Staphylococcus aureus spa types in strains from

patients with Staphylococcal Food Poisoning,
food chain staff and food, investigated in the 2009-2013
interval at the National Reference Centre for
Staphylococcus, Cantacuzino Institute of Research

Irina Codiţă1a, Ileana-Luminiţa Coldeaa, Elena-Carmina Drăgulescub,

Brânduşa-Elena Lixandruc

a) Cantacuzino National Institute of Research, Bucharest, Romania

b) Carol Davilla University of Medicine and Pharmacy, Bucharest,
Romania
c) Floreasca Clinical Emergency Hospital, Bucharest, Romania

Abstract
Molecular typing of Staphylococcus aureus strains is useful for tracking their sources
and transmission pathways and for confirming the staphylococcal etiology of the
Staphylococcal Food Poisoning (SFP). Our study aimed at comparing spa types of
Staphylococcus aureus strains isolated from food, from patients and from staff involved in
the food chain, in order to evaluate the implication of food and/or staff as source/
transmission pathway of SFP.
We analyzed at the National Reference Laboratory for Staphylococcus, Cantacuzino
National Institute of Research, 95 strains associated in the 2009-2013 interval with 9
Staphylococcal Food Poisoning (SFP) outbreaks, of which 34 from patients (vomit liquid,
coproculture), 31 from food (dairy products, creams, meet products, vegetables) and 30
from human hosts involved in the food chain (nose, throat or skin); spa typing, based on the
polymorphism of the gene coding for the staphylococcal Protein A, was performed by
analyzing the nucleotides sequence of the spa gene X region, using an ABI 3130 Avant
Genetic Analyzer. The sequence was then edited and analyzed by using the Ridom
StaphType (Ridom GmbH) software.
The 95 S.aureus strains fall in 35 different spa types, of which 2 spa types newly
described (t12656, t12657), registered by Romania in the international data base
(http://spaserver.ridom.de/); the most frequent spa type overall was t053; in the food strains
t053 group was isolated the most frequently (13/31), followed by spa type t458 (4/31); in
the staff strains group, the most frequently detected spa type was t053 (4/30), followed by
t902 (3/30), while in the patients strains group the most frequently detected spa type was
t902 (13/34), followed by t4780 (8/34) and t053 (4/34).

1
Corresponding author: Cantacuzino National Institute of Research,
Splaiul Independentei no 103, 050096, Sector 5, Bucharest,
Romania, e-mail: icodita@cantacuzino.ro

INTERNATIONAL JOURNAL OF ONE HEALTH, 3(1),2017

 Staphylococcus aureus spa types 35

In conclusion, t053 S.aureus strains belonging to the CC5 clonal complex have been
identified in food, in staff involved in the food chain and in patients with SFP, while t902
strains have been found only in staff and patient samples, thus confirming the complex
interplay between the bacteria and enterotoxin coding genes evolving in livestock, food,
food chain staff and patients and supporting the opportunity of integrated surveillance.

Key words: Staphylococcal Food Poisoning, food, spa types

Background when conditions of bacterial multiplication are

Staphylococcal Food Poisoning (SFP) is
caused by staphylococcal enterotoxins (SEs)
produced usually by Staphylococcus aureus (S.
aureus) inside the aliment, before ingestion [1,
2,3,4,5,6].
Staphylococcal strains involved in SFP may
be of human or animal origin.
In humans, S.aureus may cause superficial
skin infections which may spread to adjacent
tissues, into bloodstream and/or via the lymphatic
system, being then able to determine secondary
side infections in any anatomical region, system
or organ.
Food chain staff who are carrying S.aureus
on superficial anatomical sides are most
frequently the source of enterotoxigenic strains.
Carriage may involve normal skin or skin
affected by purulent lesions as furuncles,
abcesses, acnes, infected skin cuts, nose/throat
secretions, conjunctival secretions etc.
S.aureus is able to cause mastitis in cows,
sheep, goats, exsudative epidermal injuries in
pigs, dermal purulent infections in cats and
dogs, staphylococcal infections in birds and
rabbits, septicaemia etc.
Contaminated animal products as milk and
dairy products, meat, eggs etc. are the main
livestock origin sources of SFP. This products
may be involved in SFP in case of lack or
insufficient heat treatment of food or if the
food which was previously treated is coming
accidentally into contact with raw contami-
nated products or human carriers and then kept
unrefrigerated.
Other pathways of food contamination may
be surfaces or equipments used during food
preparation, previously contaminated with S.
aureus coming into contact with food which
are no more submitted to heat treatment.
Food with high protein and carbohydrates
content and/or with complicated preparation
recipes supposing high number of manipula-
tions is most often involved in SFP etiology,
met, especially if food does no more undergo
heat treatment [7].
Cheese and dairy products, salads with
meet, eggs or mayonnaise, fish, potatoes or
pasta, pastry and creams, sandwiches, sausages
etc. are included on the list of food frequently
involved in causing SFP.
Molecular typing of S.aureus strains is
useful for tracking their sources and
transmission pathways and for confirming the
staphylococcal etiology of SFP.
Pulsed Field Gel Electrophoresis (PFGE) of
total DNA, Multi Locus Sequence Typing
(MLST) or Single Locus Sequence Typing
(SLST) targeting the spa gene (spa typing)
have been the most used S.aureus typing
methods [3,8,9,10].
spa-typing is considered to be the most
cost-efficient method which allows informatics
processing of typing results and comparing the
strains with a central data base [10].
In Romania, there are still not sufficient
integrated data allowing the evaluation of the
relationship between livestock and human S.
aureus strains, either in healthcare infections
or in SFP.
Our study aimed at comparing spa types of
Staphylococcus aureus strains isolated from
food, from patients and from staff involved in
the food chain, in order to preliminary evaluate
the implication of food and/or food chain staff
as source and/or transmission pathway of SFP.
MATERIALS AND METHODS
We analyzed at the National Reference
Laboratory for Staphylococcus, Cantacuzino
National Institute of Research, Bucharest,
Romania, 95 strains associated with 9 SFP
outbreaks in the 2009-2013 interval. The SFP
outbreaks evolved in 6 Romanian counties:
Prahova, Maramures, Iassy, Vrancea, Satu-
Mare, Constantza.

ONE HEALTH INTERNATIONAL JOURNAL 3(1),2017

36 Irina Codiţă et al.

Table 1. Distribution of S.aureus strains by sample types

Sample Source Number of strains / %
stool patients 23 (24%)
vomit liquid patients 11 (12%)
Pharyngeal exudate food staff 5 (5%)
nose exudate food staff 24 (25%)
skin food staff 1 (1%)
food food 31 (33%)

Table 2. Sequences of primers used for detecting genes for

staphylococcal enterotoxins by PCR
Amplicon size
Gene Primer Sequences References
(pb)
sea1 GAACCTTCCCATCAAAAACA (Blaiotta, Ercolini et al.
sea 120
sea2 TTGGAAACGGTTAAAACGAA 2004) [11]
seb1 TCGCATCAAACTGACAAACG (Blaiotta, Ercolini et al.
seb 478
seb2 GCAGGTACTCTATAAGTGCC 2004) [11]
sec1 GACATAAAAGCTAGGAATTT (Blaiotta, Ercolini et al.
sec 257
sec2 AAATCGGATTAACATTATCC 2004) [11]
sed1 CTAGTTTGGTAATATCTCCT (Blaiotta, Ercolini et al.
sed 317
sed2 TAATGCTATATCTTATAGGG 2004) [11]
see1 TAGATAAAGTTAAAACAAGC (Blaiotta, Ercolini et al.
see 170
see2 TAACTTACCGTGGACCCTTC 2004) [11]
seg1 CCACCTGTTGAAGGAAGAGG (Xie, He et al. 2011)
seg 432
seg2 TGCAGAACCATCAAACTCGT [12]
seh1 CGAAAGCAGAAGATTTACACG (Blaiotta, Ercolini et al.
seh 495
seh2 GACCTTTACTTATTTCGCTGTC 2004) [11]
sei1 GACAACAAAACTGTCGAAACTG (Blaiotta, Ercolini et al.
sei 630
sei2 CCATATTCTTTGCCTTTACCAG 2004) [11]
ESJ1 CAGCGATAGCAAAAATGAAACA (Blaiotta, Ercolini et al.
sej 426
ESJ2 TCTAGCGGAACAACAGTTCTGA 2004)
sel1 CACCAGAATCACACCGCTTA (Xie, He et al. 2011)
sel 240
sel2 CTGTTTGATGCTTGCCATTG [12]
sem1 CCAATTGAAGACCACCAAAG (Blaiotta, Ercolini et al.
sem 517
sem2 CTTGTCCTGTTCCAGTATCA 2004) [11]
sen1 ATTGTTCTACATAGCTGCAA (Blaiotta, Ercolini et al.
sen 682
sen2 TTGAAAAAACTCTGCTCCCA 2004) [11]
seo1 AGTCAAGTGTAGACCCTATT (Blaiotta, Ercolini et al.
seo 534
seo2 TATGCTCCGAATGAGAATGA 2004) [11]
ser1 TTCAGTAAGTGCTAAACCAGATCC (Xie, He et al. 2011)
ser 367
ser2 CTGTGGAGTGCATTGTAACGCC [12]

Of the analyzed strains, 34 have been isolated
from patients, 31 from food and 30 from human
hosts involved in the food chain (Table 1).
Confirmation of S.aureus strains was
performed by using a PCR for detecting the
nuc gene, coding for staphylococcal thermonu-
clease [13]. Three multiplex PCR and one
simplex PCR have been used to search for
fourteen enterotoxin genes [11,12,14,15,16,17,
18,19,20,21]:
• multiplex PCR for sea, seb, sec, sed ± see
genes – coding for most frequent SEs
involved in SFP;
• multiplex PCR for see, seh, sei genes;
• multiplex PCR for sej, sem, sen genes;
• simplex PCR for seg, sel, seo, ser.

INTERNATIONAL JOURNAL OF ONE HEALTH, 3(1),2017

 Staphylococcus aureus spa types 37

Table 3. Distribution of S.aureus strains associated with SFP outbreaks

by enterotoxin types and samples origin
% S. aureus % S. aureus % S. aureus
% S. aureus
strains / strains/ strains /
Gene strains
food food chain staff patients
n = 95
n = 31 n = 30 n =34
sea 28 48 23 15
seb 10,5 3 3 23,5
sec 6 6 10 3
sed 22 39 17 12
see 0 0 0 0
seg 78 77 70 85
seh 7 0 13 9
sei 74 77 57 85
sej 22 39 17 12
sel 6 6 10 3
sem 74 77 57 85
sen 73 77 57 82
seo 75 77 60 85
ser 23 39 17 15

Fig.1. spa-types identified in S aureus strains associated with SFP outbreaks

ONE HEALTH INTERNATIONAL JOURNAL, 3(1),2017

38 Staphylococcus aureus spa types
Sequences of primers used for detecting
enterotoxin genes are specified in Table 2.
spa typing, based on the polymorphism of
the gene coding for the staphylococcal Protein
A, was performed by analyzing the nucleotide
sequence of the spa gene X region, using an
ABI 3130 Avant Genetic Analyzer. The
sequence was then edited and analyzed by
using the Ridom StaphType (Ridom GmbH,
Wurzburg, Germany) software, v. 2.2.1.
RESULTS AND DISCUSSIONS
Food assortments incriminated in the 9 SFP
outbreaks have been the following:
• Milk and dairy products (29.0%);
• Desserts with creams (45.2%);
• Meat and meat products (16.1%);
• Vegetables (cereals) 9.7%
Analysis of enterotoxin genes profile
obtained by PCR detection of 14 genes coding
for SEs (SEA, SEB, SEC, SED, SEE, SEG,
SEH, SEI, SER) or for enterotoxin-like proteins
(SElJ, SElL, SElM, SElN, SElO) – sea, seb,
sec, sed, see, seg, seh, sei, sej, sel, sem, sen,
seo, ser - revealed that 84 (88.4%) from the 95
S.aureus strains associated with SFP outbreaks
were carrying one or more genes, while 11
strains (11.6%) lacked enterotoxin genes.
Distribution of enterotoxin genes types by
source of the strains is presented in Table 3.
The 84 S.aureus strains producing SEs fall
into 35 different spa types (Fig.1), of which 2
spa types newly described (t12656, t12657),
registered by our reference laboratory in the
international central data base
(http://spaserver.ridom.de/).
The most frequently detected spa type was
t053 (21/95; 22.1%) followed by t902 (18/95;
19%), t4780 (9/95; 9.5%), t127, t458, t891
(4/95; 4.2%), t044, t067, t4321, t12656,
t12657 (2/95; 2.1%) types. The following spa
types have been detected in only one (1.1%) from
the 95 strains each : t005, t024, t059, t091,
t093, t116, t164, t223, t279, t304, t318, t351,
t449, t490, t521, t550, t1484, t1534, t3216,
t3576, t4001, t6346, t9023.
Analysis of spa types by origin of the
strains lead to the following conclusions:
• the most frequent spa type between strains
isolated from food was t053 (13/31)
followed by t458 (4/31);
• the most frequent spa type between strains
isolated from food chain staff was t053
INTERNATIONAL JOURNAL OF ONE HEALTH, 3(1),2017
(4/30), followed by t902 (3/30), t127, t891,
t044, t056 (2/30);
• the most frequent spa type between strains
isolated from SFP pathological samples from
patients was t902 (13/34), followed by t4780
(8/34), t053 (4/34), t127 and t12656 (2/34).
By using the BURP algorithm the entero-
toxigenic S.aureus strains have been classified
in 8 clusters and 3 clonal spa complexes (spa-
CC005, spa-CC053 and spa-CC3216), including
55 S.aureus strains (58%) grouped in 13 spa types:
• spa-CC005 includes spa types t005, t223,
t449, t490, t891, t902, t6346 (27/95; 28.4%);
• spa-CC053 includes spa types t053, t067,
t4321(25/95; 26.3%);
• spa-CC3216 includes spa types t116,
t3216, t4001(3/95; 3.1%).
t053 spa-type has been attributed to human
origin strains, but the real source of strains
contaminating food products is difficult to be
evaluated, as evidence exists on possible
colonization of animals from humans [22].
On the other hand, contamination of food
chain staff from food can not be excluded.
CONCLUSIONS
t053 S.aureus strains belonging to the
CC005 clonal complex have been identified in
food, in staff involved in the food chain and in
patients with SFP, while t902 strains have
been found only in staff and patient samples.
Multiplex PCR and spa typing procedures
optimized in the National Reference Centre for
Staphylococci functioning in Cantacuzino Institute
proved to be useful tools for detecting enterotoxin
genes in S.aureus and for discriminating between
different types of S.aureus for epidemiological
purposes.
Our preliminary findings confirmed the
complex interplay between bacteria and ente-
rotoxin coding genes detected in food, food
chain staff and patients, supporting the
opportunity of complex, integrated surveillance
of livestock, food and food processing
facilities, food chain staff and SFP outbreaks
in humans based on the One Health Concept.
SELECTIVE REFERENCES
1. Balaban N, Rasooly A – Staphylo-
coccal enterotoxins, Int J Food Microbiol,
2000, 61,1-10;
2. Codita I – Staphylococcal enterotoxins,
Bacteriol Virusol Parazitol Epidemiol, 1985,
30(3),233 – 243 (in Romanian);
 Staphylococcus aureus spa types
3. Codita I – Staphylococcal Food Poisonong,
in Infections Transmitted to Humans through
Food and Water (Codita I, Damian M, Negut
M, Eds) Total Publishing, Bucharest, 2013,
pp.1-454 (in Romanian);
4. Coldea IL, Zota L, Dragomirescu CC,
Lixandru BE, Drăgulescu EC, Sorokin M,
Codiţă I – Staphylococcus aureus harbouring egc
cluster coding for non-classical enterotoxins,
involved in a food poisoning outbreak
Romania 2012, Rev Rom Med Lab, 2015,
23(3),285-294;
5. Dinges MM, Orwin PM, Schlievert,
PM – Enterotoxins of Staphylococcus aureus,
Clin Microbiol Rev, 2000, 13,16–34;
6. Le Loir Y, Baron F, Gautier M –
Staphylococcus aureus and food poisoning –
Genet Mol Res, 2003, 2(1),63-76;
7. *** Bad Bug Book – Food Borne
Pathogenic Microorganisms and Natural
Toxins Handbook – Second Ed., 2011 –
http://www.fda.gov/
8. Cotar AI, Zaharia A, Drăgulescu EC,
Pistol A, Popovici F, Codiţă I – The role of
molecular typing methods in the outbreak
investigation of a possible staphylococcal food
poisoning – Rom Biotechnol Lett, 2016,
21(2),11404-11412;
9. Khambaty FM, Bennet RW, Shah DB
– Application of pulse-field gel electrophoresis
to the epidemiological characterization of
Staphylococcus intermedius implicated in a
food-related outbreak, Epidemiol Infect, 1994,
113,75-80;
10. Shopsin B, Gomez M, Montgomery
SO, Smith DH, Waddington M, Dodge DE,
Bost DA, Riechman D, Naidich S, Kreiswirth
BT – Evaluation of Protein A gene polimorphic
region DNA sequencing for typing of Staphy-
lococcus aureus strains, J Clin Microbiol,
1999, 37(11),3556–3563;
11. Blaiotta G, Ercolini D, Pennacchia C,
Fusco V, Casaburi A, Pepe O, Villani F – PCR
detection of staphylococcal enterotoxin genes
in Staphylococcus spp. Strains isolated from
meat and dairy products. Evidence for new
variants of seG and seI in S.aureus AB-8802. J
Appl Microbiol, 2004, 97,719-730;
12. Xie Y, He Y, Gehring A, Hu Y, Li Q,
Tu S-I, Shi X – Genotypes and toxin gene profiles
of Staphylococcus aureus clinical isolates from
China, PLoS One, 2011, 6(12): e28276;
13. Brakstad OG, Aasbakk K, Maeland JA
– Detection of Staphylococcus aureus by poly-
merase chain reaction amplification of the nuc
gene, J Clin Microbiol, 1992, 30(7),1654-1660;
ONE HEALTH INTERNATIONAL JOURNAL, 3(1),2017
39
14. Ercolini D, Blaiotta G, Fusco V,
Coppola S – PCR-based detection of entero-
toxigenic Staphylococcus aureus in the early
stages of raw milk cheese making, J Appl
Microbiol, 2004, 6,1090-1096;
15. Johnson W, Tyler MS, Ewan SD,
Ashton EP, Polland FE, Rozee KR – Detection
of genes for enterotoxins, exofoliative toxins
and toxic shock syndrome toxin 1 in
Staphylococcus aureus by polymerase chain
reaction, J Clin Microbiol, 1991, 29,426–430;
16. McLauchlin J, Narayanan GL, Mithani
V, O’Neill G – The detection of enterotoxins
and toxic shock syndrome toxin genes in
Staphylococcus aureus by polymerase chain
reaction, J Food Prot, 2000, 63, 479–488;
17. Monday SR, Bohach GA – Use of
multiplex PCR to detect classical and newly
described pyrogenic toxin genes in staphylo-
coccal isolates, J Clin Microbiol, 1999,
37,3411–3414;
18. Omoe K, Ishikama M, Shimoda Y, Hu
DL, Ueda S, Shinagawa K – Detection of seg,
seh and sei genes in Staphylococcus aureus
isolates and determination of the enterotoxin
productivities of S.aureus isolates harbouring
seg, seh or sei genes, J Clin Microbiol, 2002,
40,857–862;
19. Rosec JP, Gigaud O – Staphylococcal
enterotoxin genes of classical and new types
detected by PCR in France, Int J Food
Microbiol, 2002, 77,61–70;
20. Slavu CL - Detection of enterotoxin B
in 3 strains of Staphylococcus aureus resistant
to methicillin (S.A.R.M.) of phage group II,
Bacteriol Virusol Parazitol Epidemiol, 2003,
48(4),265-274 (in Romanian);
21. Thomas DY, Jarraud S, Lemercier B,
Cozon G, Echasserieau K, Etienne J, Gougeon
M-L, Lina G, Vandenesch F – Staphylococcal
enterotoxin-like toxins U2 and V, two new
Staphylococcal superantigens arising from
recombination within the enterotoxin gene
cluster, Infect Immun, 2006, 74(8),4724–4734;
22. Drougka E, Foka A, Posantzis D,
Giormezis N, Anastassiou ED, Petinaki E,
Spiliopoulou I – Human Staphylococcus
aureus lineages among Zoological Park
residents in Greece, Open Vet J, 2015, 5(2),
148–53.
0011_170117
Received: 17.01.2017
Accepted: 07.02.2017
International Journal of One Health, 3(1),40-47,2017
One Health New Medical Concept Association, Romania

Antibiosusceptibility spectrum of
Listeria monocytogenes strains isolated from
Romanian clinical and food samples

Dana Magdalena Caplan1a, Marius Eduard Caplanb

a
National Research Institute Cantacuzino, Bucharest, Romania
b
National Company Institute Pasteur Ltd, Bucharest, Romania

Abstract
Listeria monocytogenes has an ubiquitous distribution in nature and could contaminate
food of animal origin, causing severe infections in humans.
The main specie of this genus, Listeria monocytogenes, causes listeriosis, a severe
disease which can lead to septicemia, meningoencephalitis, abortion and stillbirth. The
following individuals are at great risk for listeriosis: immunocompromised and elderly
patients, as well as infants, and pregnant women (and their unborn children).
Till present, little is known about the antibiotic resistance profiles of these strains. The
aim of this study was to determine the antibiotic susceptibility patterns of L.monocytogenes
strains isolated from clinical samples and food-processing samples, by disk diffusion assay
and minimum inhibitory concentration (MIC) of the antibiotics performed using E-test strips.
Clinical samples were collected from 27 patients with septicemia, meningitis/meningo-
encephalitis, abortion cases and newborns, hospitalized during 2010-2015. A number of 19
food samples were collected from meat and dairy products, during 2009-2013.
The investigated strains showed a low degree of diversity. All tested L.monocytogenes
strains from food and clinical isolates revealed the naturally and intrinsically resistant to
cephalosporins and nalidixic acid. From clinical samples, two strains (blood culture and
cerebrospinal fluid) isolated from an immunocompromised patient with meningo-
encephalitis were resistant to penicilins; from food products samples, one strain isolated
from boiled shell snails was resistant to sulphamethoxazole/trimethoprim.
Our results can provide informations regarding antibiosensitivity of Listeria
monocytogenes strains, that can be used in therapy against listeriosis. Ampicillin, or
penicillin plus aminoglycoside remain the treatment of choice for most manifestation of
listeriosis. Sulphamethoxazole/trimethoprim in association with rifampicin may be used as
a second-choice therapy. Most L.monocytogenes strains were susceptible to the antibiotics
commonly used both in veterinary and human listeriosis treatment.
The obtained results indicate the need for further investigation of the antimicrobial resistance
profile of L.monocytogenes strains isolated in our country, in order to provide further knowledge
concerning the efficacy of different antibiotics used in the treatment of the respective infections.
Key words: Listeria monocytogenes, antibiotics, sensibility

1
Correspondance author: National Research Institute Cantacuzino
Splaiul Independentei no. 103, sector 5, 050096 Bucharest, Romania,
e-mail: magdalenacaplan@yahoo.com

ONE HEALTH INERNATIONAL JOURNAL, 3(1), 2017

 Antibiosusceptibility spectrum of Listeria monocytogenes
Among ten currently known Listeria species
– L.monocytogenes, L.ivanovii, L.seeliger,
L.innocua, L.welshimeri, L.gray, L.rocourtiae,
L.marthii, L.fleischmanii and L.weihenste-
phanensis – Listeria monocytogenes is the
main pathogenic species of the respective genus,
found in humans as well as animals. L.mono-
cytogenes is a Gram-positive rod, capable of
growing in conditions of low temperature,
acidic pH, high salt concentration and resistant
in procedures used in food industry against
pathogenic organisms.
Listeria monocytogenes is often implicated in
human listeriosis, a severe disease responsible
of septicaemia, meningitis/meningoencephalitis,
abortion and baby illness at birth. Susceptible
population groups include the elderly peoples,
immune-compromised individuals, pregnant
women and their fetuses or neonates. Consump-
tion of contaminated foods with this micro-
organism is the main cause of human
listeriosis [1].
Antimicrobial drugs are used in the
treatment of listeriosis in humans and animals.
In the present study we investigated the
susceptibility of Listeria monocytogenes strains to
antibiotics used in the treatment of this human
and animal bacterial infection.
For the therapy of listeriosis, it is
recommended as the first choice of antibiotic
treatment the ampicillin or a combination of
ampicillin with an aminoglycoside (i.e. genta-
mycin or streptomycin). In the last years, some
studies have reported L. monocytogenes strains
multiresistant to antimicrobial substances, with
significance for the public health aspect,
requiring a permanent laboratory monitoring
of the antimicrobial susceptibility of Listeria
monocytogenes strains.
MATERIALS AND METHODS
Bacterial strains. A number of 46 L.
monocytogenes strains collected between 2007
and 2013 from more geographic regions of
Romania were studied for their antibio-
susceptibility.
27 (58.69%) L. monocytogenes strains were
isolated from clinical samples i.e. patients with
41
septicaemia, meningitis/meningoencephalitis,
abortion and newborns, hospitalized – in fact
25 patients, considering that from two cases
diagnosed with septicaemia and meningitis,
and respectively, septicaemia and meningo-
encephalitis there were isolated from each of
them two different samples, i.e. blood-culture
and cerebrospinal fluid (CSF) (Table 1).
A number of 19 (41.30%) L.monocytogenes
were food isolates i.e. various meat and dairy
products, including raw minced meat (pork, beef),
pork muscular tissue, beef muscular tissue,
sausages, smocked bacon, poultry roulade,
chicken frankfurters, boiled shell snails and
cheese products (Table 2).
These samples were processed according to
SR EN ISO 11290 Standards part 1 and part 2
[2, 3], and colonies grown on PALCAM agar
were identified as L monocytogenes.
Additionally, L.monocytogenes type 1,
ATCC 19111 was used as reference strain. The
L. monocytogenes isolates were stored at -
70°C in Brain Heart Infusion (BHI) broth
(Oxoid) containing 20% (v/v) glycerol. Before
use, pathogenic strains of L.monocytogenes
were activated in BHI at 37°C for 24 hrs.
Antibiotic susceptibility testing was performed
by disk diffusion method, on Mueller-Hinton
blood agar, using Oxoid disks and L.mono-
cytogenes type 1, ATCC 19111 and Staphylo-
coccus aureus ATCC 29213 as control strains.
Disk diffusion susceptibility tests were performed
according to the procedures recommended by the
Clinical and Laboratory Standards Institute
(CLSI) 2011 [4]. After incubation for 24 hrs at
37°C, the diameter (in mm) of the bacterial
growth inhibition zone around each disk was
measured and interpreted in accordance with the
CLSI guidelines, to classify the antibiotic
susceptibility of each isolate.
The E-test strips (AB bioMérieux) were
used in the purpose to determine the minimal
inhibitory concentration (MIC) of different
antibiotics in case of two clinical strains that
proved to be resistant to penicillins in the disk
diffusion assay. After 24 hours of incubation,
an elliptical zone of inhibition is produced and
the point at which the ellipse meets the strip
gives an indication for the antibiotic MIC level.
ONE HEALTH INERNATIONAL JOURNAL, 3(1), 2017
42 Dana Magdalena Caplan and Marius Eduard Caplan

Table 1
Origin of 27 L.monocytogenes strains isolated from clinical specimens (%)
(The percent value is referring to the total number of 46 L. monocytogenes isolated strains)
No. of Serovar by Multiplex-PCR
Origin of isolates
strains 1/2a, 3a 1/2b, 3b, 7 4b, 4d, 4e 1/2c, 3c 4a/4c not done
CSF* 19 9 8 2
– – –
(41.30) (19.56) (17.39) (4.34)
Blood-culture** 6 4 2
– – – –
(13.04) (8.69) (4.34)
New-born *** 2 1 1
– – – –
(Blood-culture) (4.34) (2.17) (2.17)
Total strains 27 14 8 5
– – –
(58.69) (30.43) (17.39) (10.86)
* One strain (from meningoencephalitis duplicate) penicillins resistant (deceased patient) – case
in >60y age; One strain (from meningitis duplicate) quinolones resistant (deceased patient) – case
in <40y age
** One parturient with abortion in the 31/2 months; One strain (from meningoencephalitis
duplicate) penicillins resistant (deceased patient) – case in >60y age; One strain (from meningitis
duplicate) quinolones resistant (deceased patient) – case in <40y age
*** Deceased neonates

Table 2
Origin of 19 L. monocytogenes strains isolated from animal food products (%)
(The percent value is referring to the total number of 46 L.monocytogenes isolated strains)

Serovar by Multiplex-PCR
No. of
Origin of isolates not
strains 1/2a, 3a 1/2b, 3b, 7 4b, 4d, 4e 1/2c, 3c 4a/4c
done
1 1
pork – – – – –
(2.17) (2.17)
Fresh meat
beef 1 1
– – – – –
(2.17) (2.17)
4 4
Minced pork and beef – – – – –
(8.69) (8.69)
poultry 1
– – – – –
Poultry roulade (2.17)
meat chicken 1 1
– – – – –
frankfurters (2.17) (2.17)
forcemeat 4 1 – – 1 2
balls (8.69) (2.17) (2.17) (4.34) –
Processed fresh 1 – – 1 – –
meat sausages (2.17) – (2.17)
1 1 – – – – –
salami
(2.17) (2.17)
2 2 – – – – –
Smocked bacon
(4.34) (4.34)
1 1 – – – – –
Boiled shell snails
(2.17) (2.17)
1 1 – – – –
sheep cheese
(2.17) – (2.17)
Dairy
Gorgonzola 1 1 – – – –
cheese (2.17) (2.17) -
19 12 3 – – –
Total strains
(41.30) (26.08) (6.52) –

ONE HEALTH INTERNATIONAL JOURNAL, 3(1),2017

 Dana Magdalena Caplan and Marius Eduard Caplan
RESULTS AND DISCUSSIONS
The sensitivity of L.monocytogenes strains
to the tested antibiotics was interpreted in
accordance with the criteria recommended by
Clinical and Laboratory Standard Institute
(CLSI) 2011 [4], as well as recommendations
for veterinary medicine according to the
Comité de l'Antibiogramme de la Société
Française de Microbiologie [5] to Staphylococ-
cus aureus, so that readings can be compared
with other data from the literature [6, 7].
The antibiotics were selected on the criteria
to be used in the frequent treatment of listeriosis,
both for human and animals [8].
The majority of L.monocytogenes isolates
have revealed sensitivity spectrum to penicil-
lins, antibacterial substances in the first-line
treatment of listeriosis. The dates coincide with
those in the literature, where it is mentioned
that both penicillin and ampicillin have revealed
a good activity over the strains of L.monocy-
togenes with a sensitivity of 98.3%, and
respectively 99.4% [9].
With reference aminoglycosides group,
most active antibiotics were: amikacin, genta-
mycin, and neomycin; results similar to data
mentioned in the literature [10, 11].
The data of this study indicated that the
penicillins-gentamycin association proved a
stranger antibacterial activity that penicillin alone
[12]. All strains were sensitive to gentamycin.
As evidenced by the results of this study,
the macrolides may be used as a second line
drug in the treatment of listeriosis [11],
marking a high percentage of sensitivity.
All strains examined showed phenotypes of
natural resistance to all second and the third
generation cephalosporins, and nalidixic acid
(nalidixic acid included in selective media for
isolation of L monocytogenes), as similar data
reported in the literature [8, 9, 13]. The high
level of natural resistance to cephalosporins
may be due to the frequent use of beta-lactams
antibiotics in infections of unknown etiology
[11, 14].
In terms of the spectrum of the quinolones,
some strains showed resistance and respectively
intermediate resistance to ciprofroxacin, the
trend being mentioned in other studies,
especially related to L. monocytogenes serotype
1/2a involved in the food industry chain. It is
mentioned that ciprofloxacin can select co-
resistance for other antimicrobial agents [15].
The antibiotic susceptibility spectrum of the
clinical strains (Table 3) revealed susceptibility
ONE HEALTH INERNATIONAL JOURNAL, 3(1), 2017
43
to aminoglycosides, tetracyclines, erythromycin
(26 from 27 strains), chloramphenicol,
rifampicin and sulfamethoxazole / trimethoprim
(cotrimoxazole).
Literature data indicate a high percentage of
sensitivity, up to 100%, in terms of tetra-
cyclines, chloramphenicol, rifampicin and
macrolides [9, 16, 17].
In two immune-compromised cases with
two samples (blood culture and cerebrospinal
fluid) isolated from each of them, the both
samples of each patient proved the same
antibiotic resistant spectrum (Table 1).
Of the two immune-compromised clinical
cases, in which two samples (blood-culture
and cerebrospinal fluid) were isolated, in one
of them diagnosed both sepsis and meningo-
encephalitis, the both isolated L.monocy-
togenes strains were resistant to penicillins,
both being tested by disk diffusion method and
E-test strips.
A number of nine (19.56%) L.monocytogenes
clinical isolates were intermediary sensitive to
ciprofloxacin, and four (8.69%) were resistant,
from these last four, two being isolated samples
(blood-culture and cerebrospinal fluid) of a
deceased woman with meningitis, and one sample
of a parturient with abortion in the 31/2 months.
All L.monocytogenes food isolates (Table 3)
were susceptible to the first choice of the
antibiotic drugs: penicillin, ampicillin, amoxicillin
+ clavulanic acid, imipenem, amikacin, genta-
mycin, neomycin (16 from 19 strains), tetra-
cycline, erythromycin (18 from 19 strains),
chloramphenicol, rifampicin, sulfamethoxazole /
trimethoprim (18 from 19 strains).
The greatest lot of the tested strains was
susceptible to sulfamethoxazole/trimethoprim,
except one food strain, with resistance to sulfa-
methoxazole component and a low sensitivity
to trimethoprim (fig. 1). In case where it is not
possible to use beta-lactams antibiotics, it is
recommended the second line of treatment
involving the trimethoprim association with a
sulfonamide, such is cotrimoxazol, association
TMP seems to be the active component, its
action being synergistic with that of sulfon-
amide component [11, 18, 19].
In therapeutics, sulfamethoxazole/trimetho-
prim was chosen as an alternative in the treatment
of listeriois, especially for cases of intolerance/
allergy to penicillins, but the emergence of strains
resistant both to trimethoprim and sulfa-metho-
xazole-trimethoprim combination (plasmidial
resistance mediated) implies epizootiological
epidemiological surveillance [20].
ONE HEALTH INERNATIONAL JOURNAL, 3(1), 2017
44 Dana Magdalena Caplan and Marius Eduard Caplan

Table 3
Susceptibility of 27 clinical isolates of L.Monocytogenes to 15 antimicrobial agents

No. of
No. of sensitive No. of resistant
Antibiotic intermediate
strains (%) strains (%)
strains (%)
Penicillin G 10U 25 (54.34) – 2 (4.34)
Ampicillin 10µg 25 (54.34) – 2 (4.34)
Amoxicillin+Clavulanic Ac. 30µg 25 (54.34) – 2 (4.34)
Imipenem 10µg 25 (54.34) – 2 (4.34)
Cefuroxime 30µg – – 27 (58.69)
Amikacin 30µg 27 (58.69) – –
Gentamycin 10µg 27 (58.69) – –
Neomycin 30µg 27 (58.69) – –
Nalidixic Ac. 30µg – – 27 (58.69)
Ciprofloxacin 5µg 14 (30.43) 9 (19.56) 4 (8.69)
Tetracycline 30µg 27 (58.69) - –
Erythromycin 15µg 26 (56.52) 1 (2.17) –
Chloramphenicol 30µg 27 (58.69) – –
Rifampicin 30µg 27 (58.69) – –
Sulfamethoxazole / Trimethoprim
27 (58.69) – –
1.25 / 23.75µg

Table 4
MIC levels to different antibiotics of penicillins resistant strains
Ciprofloxacin

Erythromycin

Vancomycine
Trim. / Sulfa.
Clindamycin

Tetracycline
Gentamycin

Fosfomycin
Ceftriaxone

Rifampicin
Ampicillin

Imipenem
Antibiotic

Penicillin

Oxacilin
MIC

2 4 1 1 0.5 1 0.25 0.25 24 0.5 0.5 1 128 0.5

Interpretation

R R R R S S S S R S S S R I

ONE HEALTH INERNATIONAL JOURNAL, 3(1), 2017

 Antibiosusceptibility spectrum of Listeria monocytogenes 45

Table 5
Susceptibility of 19 food isolates of L.Monocytogenes to 15 antimicrobial agents
No. of
No. of sensitive No. of resistant
intermediate
Antibiotic strains (%) strains (%)
strains (%)
Penicillin G 10U 19 (41.30) – –
Ampicillin 10µg 19 (41.30) – –
Amoxicillin+Clavulanic Ac. 30µg 19 (41.30) – –
Imipenem 10µg 19 (41.30) – –
Cefuroxime 30µg – – 19 (41.30)
Amikacin 30µg 19 (41.30) – –
Gentamycin 10µg 19 (41.30) – –
Neomycin 30µg 16 (34.78) 3 (6.52) –
Nalidixic Ac. 30µg – – 19 (41.30)
Ciprofloxacin 5µg 13 (28.26) 6 (13.04) –
Tetracycline 30µg 19 (41.30) – –
Erythromycin 15µg 18 (39.13) 1 (2.17) –
Chloramphenicol 30µg 19 (41.30) – –
Rifampicin 30µg 19 (41.30) – –
Sulfamethoxazole / Trimethoprim 18 (39.13) – 1 (2.17)
1.25 / 23.75µg

Whereas the criteria recommended by

Clinical and Laboratory Standard Institute [4]
deal with the interpretation of L. mono-
cytogenes susceptibility by MIC only for
penicillin and ampicillin (Table 4), the
readings for other antibiotics were performed
according to the recommendations of the
Comité de l'Antibiogramme de la Société
Française de Microbiologie [5] and E-test
Application Sheet - EAS 021 [21].
L.monocytogenes strains tested using E-test
strips proved to be sensitive to gentamycin,
trimethoprim/ sulfamethoxazole, ciprofloxacin,
erythromycin.
When testing by E-test strip the activity of
ceftriaxone, a cephalosporin of the IIIrd generation,
with resistance spectrum, the breakpoint being
24 µg/ml, it was confirmed the innate resistance Fig.1. Sulfamethoxazole/trimethoprim action
of L.monocytogenes to the antibiotics of this at L.monocytogenes strain:
class. a) trimethoprim component (sensibility) in
Antibiotics that have exhibited a reduced synergism with b) sulfamethoxazole component
activity against the strains of L. monocyto-
(resistant); c) the combination of sulfa-
genes by disk diffusion method, showed an
methoxazole/trimethoprim (sensibility); note
apparent antibacterial activity using E-test
the elongation zone of inhibition to the contact
strips, because the minimal inhibitory concen-
tration (MIC) of an antibiotic reveals more area of trimethoprim and sulfamethoxazole,
undoubtedly the antibiotic’s activity upon demonstrating the synergistic effect of
microorganisms. combination.

ONE HEALTH INTERNATIONAL JOURNAL, 3(1),2017

46 Dana Magdalena Caplan and Marius Eduard Caplan
PCR assay demonstrated that both penicil-
lins resistant samples isolated from the same
patient proved the same profile of the isolated
strains, suggesting the identity of the same
strain (fig.2).
CONCLUSIONS
The standard antibiotic therapy recom-
mended for listeriosis is represented by
penicillin or ampicillin with gentamycin. For
the patients allergic to penicillin, the treatment
may be a combination of vancomycin with an
aminoglycoside, as well as cotrimoxazole with
rifampin.
Generally speaking, the greatest lot of the
tested L.monocytogenes strains isolated from
clinical and food specimens was susceptible to
the antibiotics commonly used in veterinary
and human listeriosis treatment.
All tested L. monocytogenes strains proved
natural resistance phenotypes to the second
and third generation of cephalosporins and
nalidixic acid, as mentioned by literature data;
for this reason, these antibiotics should not be
used in the clinical treatment of listeriosis.
Fig. 2 Rep-PCR assay of the two penicillins
resistant strains
The results of this study may indicate the
potential risk of infection with Listeria
monocytogenes in people consuming animal
food products; these infectious agents may
cause human abortion.
The greatest L. monocytogenes strains were
susceptible to the antibiotics commonly used
in veterinary as well as in human listeriosis
treatment.
Ampicillin, or penicillin associated with
aminoglycoside remain the treatment of choice
for listeriosis infection.
ONE HEALTH INTERNATIONAL JOURNAL, 3(1),2017
REFERENCES
1. Jubb KFV, Kennedy PC, Palmer N –
Diseases of the pregnant uterus, in Pathology
of Domestic Animals (Jubb KFV, Kennedy PC,
Palmer N, Eds), 4th ed., Academic Press, New
York, 1993, pp. 393-406;
2. *** SR EN ISO 11290-1 –
Microbiology of food and animal feeding stuffs
– Horizontal method for the detection and
enumeration of Listeria monocytogenes, 2000,
Part 1: Detection method, pp. 1-25;
3. *** SR EN ISO 11290-2 –
Microbiology of food and animal feeding stuffs
– Horizontal method for the detection and
enumeration of Listeria monocytogenes, 2000
– Part 2: Enumeration method, pp. 1-24;
4. *** Clinical and Laboratory Standards
Institute (CLSI) – Performance Standards for
Antimicrobial Susceptibility Testing; Twenty-
First Informational Supplement, CLSI
document M100-S21, 2011, 31(1)68-76;
5. *** Comité de l’Antibiogramme de la
Société Française de Microbiologie –
Concentrations, diamètres critiques et règles
de lecture interprétative en médecine
vétérinaire pour Staphylococcus spp, 2012, pp.
8-10; Available from: http://www.sfm-
microbiologie.org/;
6. Altuntas EG, Kocan D, Cosansu S,
Ayhan K, Juneja VK, Materon L – Antibiotic
and bacteriocin sensitivity of Listeria
monocytogenes strains isolated from different
foods, Food and Nutrition Sciences, 2012, 3,
363-368;
7. Reis CMF, Barbosa AV, Rusak LA,
Vallim DC, Hofer E – Antimicrobial
susceptibilities of Listeria monocytogenes
human strains isolated from 1970 to 2008 in
Brazil, Rev Soc Bras Med Trop, 2011,
44(2)173-176;
8. Caplan M, Pietzka A, Popescu G, Rafila
A, Ruppitsch W, Stöger A, Borcan AM,
Mateescu AL, Allerberger F, Marutescu L,
Huhulescu S – Characterization of Romanian
Listeria monocytogenes isolates from food and
humans, Roum Biotechnol Lett, 2014,
19(3),9319-9329;
9. Ennaji H, Timinouni M, Ennaji M,
Hassar M, Cohen N – Characterisation and
antibiotic susceptibility of Listeria mono-
cytogenes isolated from poultry and red meat
in Morocco, Infect Drug Resis, 2008, 1(1),45-
50;
10. Wieczorek K, Dmowska K, Osek J –
Characterization and antimicrobial resistance
of Listeria monocytogenes isolated from retail
 Antibiosusceptibility spectrum of Listeria monocytogenes 47

beef meat in Poland, Foodborne Pathogens from: http://www.ilexmedical.com/files/Etest-

and Disease, 2012, 9(8),681-685; ApplicationSheets/fastidiousgrampositivebacilli
11. Yücel N, Çitak S, Önder M – .pdf
Prevalence and antibiotic resistance of
Listeria species in meat products in Ankara,
Turkey, Food Microbiol, 2005, 22,241-245; 0020_170117
12. Conter M, Paludi D, D’Orio V,
Vergara A, Ianieri A – Antimicrobial suscep- Received:17.01.2017
tibility of Listeria monocytogenes isolated Accepted: 07.02.2017
from food and processing environment, Ann
Fac Med Vet di Parma, 2007, 27,157-164;
13. Rahimi E, Momtaz H, Sharifzadeh A,
Behzadnia A, Ashtari MS, Zandi Esfahani S,
Riahi M, Momeni M – Prevalence and
antimicrobial resistance of Listeria species
isolated from traditional dairy products in
Chahar Mahal & Bachtiyari, Iran, Bulgarian J
Vet Med, 2012, 15(2)115-122;
14. Krawczyk-Balska A, Marchiewicz J,
Dudek D, Wasiak K, Samulk A –
Identification of a ferritin-like protein of
Listeria monocytogenes as a mediator of β-
lactam tolerance and innate resistance to
cephalosporins, BMC Microbiol., 2012,
12,278. Available from: http://www.
biomedcentral.com/1471-2180/12/278;
15. Kovacevic J, Sagert J, Wozniak A,
Gilmour MW, Allen KJ – Antimicrobial
resistance and co-selection phenomenon in
Listeria spp. recovered from food and food
production environments, Food Microbiol,
2013, 34(2),319-327;
16. Granier SA, Moubareck C, Colaneri C,
Lemire A, Roussel S, Dao T-T, Courvalin P,
Brisabois A – Antimicrobial resistance of
Listeria monocytogenes isolates from food and
the environment in France over a 10-year
period, Appl Environ Microbiol, 2011, 77(8),
2788-2790;
17. Poroś-Gluchowska J, Markiewicz Z –
Antimicrobial resistance of Listeria mono-
cytogenes, Acta Microbiologica Polonica,
2003, 52(2),113-129;
18. Charpentier E, Courvalin P – Antibiotic
resistance in Listeria spp., Antimicrob Agents
Chemother, 1999, 43(9),2103-2108;
19. Charpentier E, Gerbaud G, Jacquet C,
Rocourt J, Courvalin P – Incidence of
antibiotic resistance in Listeria species, J
Infect Dis, 1995, 172,(1),277-281;
20. Charpentier E, Courvalin P –
Emergence of the Trimethoprim resistance
gene drfD in Listeria monocytogenes BM429,
Antimicrob Agents Chemother, 1997, 41(5),
1134-1136.
21. *** E-test Application Sheet – EAS 021
- Fastidious Gram Positive Bacilli. Available

ONE HEALTH INTERNATIONAL JOURNAL, 3(1),2017

One Health International Journal, 3(1),48-52,2017
One Health New Medical Concept Association, Romania

The dual role of reactive oxygen species in

experimental RS-1 hepatocellular carcinoma
measured during an anti-angiogenic treatment

Maria Iuliana Gruia1, Antonela Busca, Marieta Panait,

Valentina Negoita, Mirela Dumitru

Institute of Oncology Prof.dr. Alex.Trestioreanu, Bucharest, Romania

Abstract
Reactive oxygen species (ROS) have been identified as important signaling molecules in
many cell types including endothelial cells, and have been associated with endothelial cell
proliferation and new vessel formation in response to growth factors including VEGF and
PDGF.
The elucidation of the mechanisms underlying the angiogenesis in cancer cells is
necessary for the development of agents to be used in combination with/instead of standard
chemotherapy. To achieve this goal, it must be taken into consideration also the strong role
played by the redox environment in cancer cells survival, growth, progression, relapse and
drug resistance. Reactive oxygen species, indeed, play both positive and negative roles in
cellular proliferation and survival; this feature has been exploited by different modified
cells to promote the hallmarks of cancer phenotype, either through phosphorylation events
or transcriptional alteration.
In this paper we try to identify reactive oxygen species production in hypoxic conditions
and their role in angiogenesis signaling process. For this purpose we were used hepatoma
cells derived from an experimental tumor, maintained in culture and treated with Avastin,
following in the dynamics of treatment and in successive administrations; the ROS
production in real time were measured by flow cytometry techniques.

Key words: reactive oxygen species (ROS), angiogenesis signaling process, experimental
hepatoma

Tumor growth and metastasis depend on important in the growth and progression of
angiogenesis and lymph angiogenesis solid tumors, the main pro-angiogenic factor,
triggered by chemical signals from tumor cells the vascular endothelial growth factor
in a phase of rapid growth [1]. Angiogenesis is (VEGF), also known as vascular permeability

1
Correspondance author: Institute of Oncology Prof.dr.
Alex.Trestioreanu, Sos. Fundeni no. 252, Sector 2, 022328 Bucharest,
Romania, e-mail: gmariaiuliana@yahoo.com
 Dual role of reactive species
factor, is a potent angiogenic cytokine that
induce mitosis and also regulates the
permeability of endothelial cells [2]. The
soluble isoform of VEGF is induced by
hypoxia. An increase in VEGF expression in
tumor tissue or some blood compartments (i.e.
serum or plasma) has been found in solid and
hematological malignancies of various origins
and is associated with metastasis formation
and poor prognosis [3].
Angiogenesis during development is likely
regulated by a balance between endogenous
pro-angiogenic and anti-angiogenic factors [4].
It is speculated that tumor growth required
disruption of such balance thus, the angiogenic
switch must be turned “on” for cancer
progression [5]. When a subgroup of cells
within the tumor switches to an angiogenic
phenotype by changing the local equilibrium
between positive and negative regulators of
angiogenesis, tumor starts to grow rapidly and
becomes clinically detectable [6]. Reactive
oxygen species (ROS) function as signaling
molecules in many aspects of growth factor-
mediated responses including angiogenesis
[7]. Oxidative stress can activate numerous
intracellular signaling pathways via ROS-
mediated modulation of various enzymes and
critical transcription factors [8]. In one
scenario, transcription factors activated in
response to an increase in ROS or oxidative
damage travel from the cytoplasm to the
nucleus within a cell and bind to promoter
regions of particular genes. As a result, these
stress-activated pathways can have a was quantified in the treated and control cells
significant impact on gene expression, which
will ultimately affect the fate of a cell (e.g.,
apoptosis, proliferation, cytokines production).
The balance between ROS production, cellular
antioxidant defenses, activation of stress-
related signaling pathways, and the production
of various gene products, as well as the effect
of aging on these processes, will determine
whether a cell exposed to an increase in ROS
will be destined for survival or death [9].
The role of ROS in modulating tumor cell
metastasis and angiogenesis has seemed
paradoxical: high ROS levels suppress tumor
angiogenesis and metastasis by destroying
cancer cells, whereas sub-optimal
concentrations assist cancer cells in
metastasizing. Therefore, the elucidation of the
mechanisms underlying the angiogenesis in
cancer cells is necessary for the development
of agents to be used in combination with /
instead of standard chemotherapy [10].
ONE HEALTH INTERNATIONAL JOURNAL, 3(1),2017
49
Avastin (Bevacizumab) is a recombinant,
humanized monoclonal antibody [11] that
binds VEGF with high affinity and has been
approved by the FDA for treatment of certain
late-stage cancers. Several studies have
explored the clinical efficacy of Avastin in
patients however; its therapeutic effects have
not been satisfied.
RS1 hepatoma-alveolar type (hepatocellular
carcinoma) used in our experiments is a
chemical induced tumor obtained by 2-acetyl-
aminofluorene administration in food rats.
Initially obtained and transplanted by serial
grafting, the tumor was a hepato-cholangiomas
carcinoma and these characteristics remain
stable even after several passages.
In this study we try to identify reactive
oxygen species production in hypoxic conditions
and their role in angiogenesis signaling
process. For this purpose we were used
hepatoma cells derived from an experimental
tumor, maintained in culture and treated with
Avastin, but also in vivo following in the
dynamics of treatment and in successive admi-
nistrations; the ROS production in real time
were measured by flow cytometry techniques.
MATERIALS AND METHODS
RS-1 hepatoma cells were treated with
Avastin, in different dose levels (7.5 µg/ml, 100
µg/ml, or 150 µg/ml). Untreated RS-1 cells were
used as control. The intracellular ROS production
using total ROS detection kit (Enzo Life), by
following the manufacturer's instructions. RS-1
treated cells and control cells were harvested at
24, 48, and 72 hours and washed using ROS
buffer supplied with the kit. The control
(untreated) cells were equally divided into three
tubes: one remained with untreated cells and from
the other two were prepared the positive (ROS
inducer) and the negative controls (ROS
inhibitors). The positive, negative, RS-1 treated
and control (untreated) cells were then incubated
with 500 µl ROS detection reagents for 30
minutes at 37°C/5% of CO2 in RPMI-1640/10%
FBS and analyzed on FACSCalibur (Becton
Dickinson, USA) flow cytometer. Were acquired
10,000 events, in coordinates FSC (forward
scatter) versus SSC (side scatter), in a dot-plot
graphic, from which cell debris were ungated.
Finally, the results were obtained by generating a
log FL-1 (X-axis) versus number of cells or
counts (Y-axis) histogram, as percentage values.
50 Maria Iuliana Gruia et al.

RESULTS

There is a direct relationship between the

concentration of the pharmaceutical acting
anti-angiogenic drug and the production of
reactive oxygen species, as can be seen in the
above presented diagram.
We investigated the production of oxidative
stress (%) after 24, 48, and respectively, 72
hours, at different levels of Avastin
concentration (c1 = 7.5 mg/ml, c2 = 100
mg/ml, and c3 = 150 mg/ml).

Fig.1. The production of oxidative stress (%)

in time (hours), at different levels of Avastin
concentration (c1 = 7.5 mg/ml, c2 = 100
mg/ml, and c3=150 mg/ml)

Fig.2. RS-1 hepatoma cells induced with 200
µM pyocyanin and stained with Total ROS
Detection Reagent (red peak); untreated cells –
control (filled colored grey peak).
b
Fig.3. RS-1 hepatoma cells, at 24 (a) and 48
(b) hours after the treatment with Avastin, in
different concentrations (7.5, 100, 150 mg/ml).
RS1 cells treated with different concentrations
of Avastin (7.5 mg/ml, 100 mg/ml, or 150
mg/ml) produce ROS in different levels,
demonstrated by a bright green fluorescence
and registered in FL1 channel appeared
between the negative and positive controls on a
log FL1 (X-axis) versus number of cells (Y-
axis) histogram. In each of figure 3a and 3b are
five peaks corresponding to the histograms: one
grey-negative peak (left), one red-positive peak
(right) and another 3 peaks colored from light
to dark green (intermediates peaks),
corresponding to 7.5, 100 and 150 mg/ml.

ONE HEALTH INTERNATIONAL JOURNAL, 3(1),2017

 Dual role of reactive species
RS-1 hepatoma cells were induced with 200
μM pyocyanin (general ROS inducer) stained
with Total ROS Detection Reagent and analyzed
using flow cytometry. In the histogram (fig.2)
are presented the RS-1 cells with increased
ROS production of induced sample (positive
control) versus untreated cells (negative control).
Cell debris was ungated. The results are presented
as percentages. The percentage of the positive
control (red peak) is 55%.
Fig. 4. RS-1 hepatoma cells, 72 hours after
treatment with Avastin, in different
concentrations (7.5, 100, 150 mg/ml). RS1
cells treated with different concentrations of
Avastin (7.5 mg/ml, 100 mg/ml, or 150
mg/ml) produce ROS in different levels,
demonstrated by a bright green fluorescence
and registered in FL1 channel appeared
between the negative and positive controls on
a log FL1 (X-axis) versus number of cells (Y-
axis) histogram. In figure 4 are five peaks
corresponding to the histograms: one grey-
negative peak (left), one red-positive peak
(right) and another 3 peaks colored from light
to dark green (intermediates peaks),
corresponding to 7.5, 100 and 150 mg/ml.
We observed, at 24 and 48 hours after
administering (fig. 3a, b), regardless of the
concentration, that the treatment with Avastin
does not induced oxidative stress in RS-1 cells.
Contrary, at 72 hours, we observed, an
increased production of oxidative stress,
demonstrated by the three green fluorescence
peaks, appeared between the negative and
ONE HEALTH INTERNATIONAL JOURNAL, 3(1),2017
51
positive controls, on the log FL1 (X-axis)
versus counts (Y-axis) histogram (fig.4). The
treatment with Avastin in concentration of 7.5
mg/ml appears to cause the highest oxidative
stress in RS-1 cells. In the figure 4 this fact is
signaled by a peak which partially overlaps
with the positive control, marking the increasing
in the ROS level. The oxidative stress is in
some measure lower at concentration of 150
mg/ml, and much lower, at 100 mg/ml.
DISCUSSIONS
Reactive oxygen species have been
identified as important signaling molecules in
many cell types including endothelial cells,
and have been associated with endothelial cell
proliferation and new vessel formation in
response to growth factors including VEGF
and PDGF [12]. A major source of vascular
ROS is NADPH oxidases [14]. Oxidative
modification of DNA, proteins, and lipids by
reactive oxygen species (ROS) plays a role in
a wide range of common diseases and
degenerative conditions [15]. ROS can be
generated by both endogenous and exogenous
sources, some of which are known to be
carcinogenic [16]. While ROS have been
shown to be deleterious to cells, they can also
function as signaling molecules to induce
cellular adaptive responses to stress or adverse
microenvironment. In light of a large body of
evidence indicating that ROS are key players
in tumor formation and progression and the
increasing complexity of ROS-related biology,
there is a compelling reason to review and
summarize current data on this field and
disseminate fresh ideas that may evolve to new
research paradigms [17]. When the reactive
oxygen species are in a small concentration
(hypoxic condition that stimulates VEGF
induction) they can initiate the cell phenotype
transformation to an angiogenic form, and
when there is an increase of oxygen reactive
species it is optimal to administer a targeted
anti-angiogenic treatment to induce the
tumoral cells apoptosis.
REFERENCES
1. Plank MF, Sleeman BD – Tumour-
induced angiogenesis: a review, J Theor Biol,
2003, 5(3-4),137-153;
2. Folkman J – Tumor angiogenesis
therapeutic implications, N Engl J Med, 1971,
285(21),1182-1186;
52 Maria Iuliana Gruia et al.

3. Weber GF, Molecular Mechanism of 17. Jordan BF, Sonveaux P – Targeting

Cancer, Springer Netherlands, 2007, pp.369- tumor perfusion and oxygenation to improve
388; the outcome of anticancer therapy, Front
4. Goh PP, Sze DM, Roufogalis BD – Pharmacol, 2012, 3, Article 94 (15 pages).
Molecular and cellular regulators of cancer
angiogenesis, Curr Cancer Drug Targets, 2007,
7(8),743-758;
5. Fidler IJ, Kerbel RS, Ellis LM – Biology 0021_170117
of cancer: angiogenesis, Cancer: principles
and practice of oncology. (DeVita VT, Received 17.01.2017
Hellman S, Rosenberg SA, eds), 6th ed. Accepted 07.02.2017
Lippincott Williams and Wilkins, Philadelphia
(PA), 2001, pp.1137-1148;
6. Folkman J – Anti-angiogenesis: new
concept for therapy of solid tumors, Ann Surg,
1972, 175(3),409-416;
7. Ihle JN – Signal transducers and
activators of transcription, Cell, 1996, 84(3),
331-334;
8. Hanahan D, Folkman J – Patterns and
emerging mechanism of the angiogenic switch
during tumorigenesis, Cell, 1996, 86(3),353-
364;
9. Riley PA – Free radicals in biology:
oxidative stress and the effects of ionizing
radiation, Int J Radiat Biol 1994, 65(1),27-33;
10. Wondrak GT – Redox-directed cancer
therapeutics: molecular mechanisms and
opportunities, Antioxid Redox Signal, 2009,
11(12),3013-3069;
11. Presta LG, Chen H, O’Connor SJ,
Chisholm V, Meng YG, Krummen L, Winkler
M, Ferrara N – Humanization of an anti-
vascular endothelial growth factor monoclonal
antibody for the therapy of solid tumors and
other disorders, Cancer Res, 1997, 57(20),
4593-4599;
12. Ushio-Fukai M, Nakamura Y –
Reactive oxygen species and angiogenesis:
NADPH oxidase as target for cancer therapy,
Cancer Lett, 2008, 266(1),37-52;
13. Aragones J, Fraisl P, Baes M,
Carmeliet P – Oxygen sensors at the crossroad
of metabolism, Cell Metab, 2009, 9(1),11-22;
14. Lassegue B, Griendling KK – NADPH
oxidases: functions and pathologies in the
vasculature, Arterioscler Thromb Vasc Biol,
2010, 30(4),653-661;
15. Goetz ME – Reactive species: a cell
damaging rout assisting to chemical
carcinogens, Cancer Lett, 2008, 266(1),73-83;
16. Engel RH, Evens AM – Oxidative
stress and apoptosis: a new treatment
paradigm in cancer, Front Biosci, 2006,
11,300-312;

ONE HEALTH INTERNATIONAL JOURNAL, 3(1),2017

One Health International Journal, 3(1),53-58,2017
One Health New Medical Concept Association, Romania

Biological products PC2. Part 1.

Oral and topical treatment of Psoriasis Vulgaris
in humans

Lucica Sima 1, Constantin Chiurciu, Viorica Chirciu,

Ionel Victor Pătraşcu

Romvac, Limited Company, Voluntari, Romania

Abstract
Psoriasis is a disease mostly manifesting at skin level that affects an important part of
the human population all over the world. In this study, we have used immunologicaly active
products called Imunoinstant, created by our company, in order to prove their efficiency in
the treatment of this disease. As results show, the simptoms have reduced to zero in most
patients, and the treatment was succesfull, without creating any side effects.

Key words: psoriasis, immunoglobulin, IgY, chicken immunoglobulin, PC2, psoriasis

treatment, skin disease, Imunoinstant

Psoriasis is a common chronic non-
infectious skin disease, with uncertain etiology
and unsuccessful treatment. The negative
impact of this disease on human life can be
huge. Psoriasis affects people of all ages and
countries. Psoriasis prevalence in WHO member
states ranges between 0.09% and 11.43%,
which means that this disease is a major global
concern, with at least 100 million sick people
all around the world [1]. The evolution of
psoriasis symptoms is unpredictable, with a
certain number of external triggers and
significant comorbidities, including arthritis,
cardiovascular diseases, metabolic syndrome,
inflammatory bowel disease and depression.
In 2014, the member states acknowledged
psoriasis as severe non-communicable disease
(NCD) in the world. The World Health
Assembly WHA67.9. underlined that many people
around the world suffer uselessly of psoriasis
due to wrong or delayed diagnosis, inappropriate
treatment and not enough access to caretaking
and, also because of social rejection [1].
In Romania, modern psoriasis treatment is
carried out with biological drugs as per the
recommendations of the National Institute for
Health and Clinical Excellence [1] and British
Association of Dermatologists Biologics
Intervention Register (BADBIR) but also as
per Order no. 1.218 from 16 September 2010,
published in the Official Romanian Gazette,
Part I, no. 723 from 29 October 2010: National
program for treatment of patients with medium
and severe psoriasis vulgaris [2].

1
Corresponding author: Romvac Company, Soseaua de Centura no
7, Ilfov County, Romania, e-mail: simalucica@gmail.com,
54 Lucica Sima et al.

In Romania, the costs of such treatment this immunological message. Lymphocytes T

make the method unapproachable. 1000 activate lymphocytes B to which they transfer
patients with medium or severe psoriasis may the negative image as a negative information
benefit each year from free of charge to lymphocyte T negative and which, at the
biological drugs via CNAS (National Health structuring of IgG antibodies, are a positive
Insurance House). image identical to the information on the IgY-
Recent studies have shown that, due to idiotype administered orally in humans and
unknown reasons, 56% of beneficiaries give prepared on chicken.
up treatment. Therefore only about 550-600
patients are part of this program [3].
Table 1. Differences between PC2 and other
Under these conditions, more than 400.000
biological drugs used for psoriasis treatment in
psoriasis patients are hopeless and treated
humans
inappropriately. Topical treatments with
various solutions, ointments or UV radiations Biological
temporarily reduce the amount of cytokines in Specification PC2
drugs
the skin, which have recurrent inflammatory mono-
effect because these topical products are not 1. Antibodies polyclonal
clonal
specifically effective against macrophages and 2. Origin murine avian
resident lymphocyte T nor on NKF which is
• Chimerical xinab
still effective in the skin.
ROMVAC produces an immunologically • Humanized xumab
active protein complex among which there are • Human umab
immunoglobulins IgY, ovotransferrin (Otf) , 3. Structural relation no yes
lyzosyme (Lys), ovomucin, other bactericide 4. Alergic reaction yes no
proteins and an immunomodulator protein 5. Adverse reactions yes no
complex, transfer molecules and specific 6. HAMA reaction yes no
radicals. All these proteins are found in the 7. Fc reaction yes no
hyperimmune egg I-pc2 [4,5,6,7] and 8. Genetic
personalized I-pc2 [8]. interventions on yes no
From our experience so far, using a product
personalized immunoglobulin or personalized 9. Effect on
immunoglobulin mixture extracted from the I- no yes
lymphocyte T
pc2 egg IMUNOINSTANT may give a chance Oral and
to each and every patient with psoriatic 10. Administration IV
local
wounds infected with antibiotic-sensitive and 11. Immunomo-
–resistant specific pathogenic germs. It is no yes
dulators
known that in most cases of chronic diseases,
12. Anti-inflammatory no yes
the affected tissues have a reduced natural
12. Adsorbed on
resistance and the immunologically modified no yes
mucosa
and deficient cells enable the growth of
microbial flora of various forms and patho- general,
genicity [9]. digestive
14. Effect general
In such cases, the presence of multiple anti- and
pathogenic specific antibodies, modified cutaneous
opportunist flora, cells with abnormal structure 15. Vitamins and
no yes
and antigens reduce the efficacy of antibiotic proteins
treatments (frequent recurrence and acquired 16. Anti-pathogenic
no x20*
resistance). Such data made us consider the antibodies
preparation and use of IgY-polyvalent. 17. Effect on the
no yes
This treatment program involved Jerne’s digestive tube
method (1975) describing the preparation of an 18. Industrial
yes Yes
idiotype Ab1 antibody to be administered per production
os and absorbed in the blood, recognized as 19. Price high reduced
antigen by the naïve lymphocytes T and copy
the antigen information as negative image [10]. Biological drugs are currently and
This information is stored in the own DNA intensively used for psoriasis treatment. All
and a clone is immediately created carrying biological drugs are prepared based on a

ONE HEALTH INTERNATIONAL JOURNAL, 3(1),2017

 PC2 and Psoriasis Vulgaris
murine monoclonal antibody [11,12,13,14,15,
16]. This group contains chimerical (-ximab),
humanized (-xumab), human (-umab) or
protein fusion (-cept) products. These products
contain mammalian proteins (murines) which
are closer to humans due to phylogenetics and
are acknowledged as non self. That is why
various immune reactions occur, among which
idiotype immune reactions that occur in the
organism of the psoriasis patient [17].
These can be simple adverse reactions
specified in the leaflets by the manufacturers,
or complex immune reactions, direct reactions,
ADAs (anti-drug-antibodies), local binary
reactions of resident lymphocyte T or general
idiotype anti-mammalian (murine) protein
immune reactions. IMUNOINSTANT products
and hyperimmune egg PC2 do not trigger such
reactions. This relationship between avian
proteins and human body is explained by the
big phylogenetic difference between human
and chicken [9,18,19].
Table 1 presents the differences between
biological drugs and biological products I-pc2
of Imunoinstant group.
a) The number and immunological structure
of antibodies depend on where these products
are used. Personalized products can also be
prepared using psoriatic wound scrapes which
the personalized antigen is prepared from and
which the chickens the personalized hyper-
immune eggs are used from are immunized with.
b) Due to the big phylogenetic difference
between chickens and mammals, chicken
immunization provides a stronger immune
response. Sometimes, highly preserved proteins
such as hormones prove small phylogenetic
differences. Differences are seen in the amino
acids. Between pig insulin and human insulin
there is a difference of only one amino acid,
and between human insulin and chicken insulin,
differences are of 7 amino acids. Under these
conditions, the chicken will recognize more
loci on the extraneous insulin molecule and
will have more antibodies binding to the
molecule and amplifying the signal in the
immunological tests. If the experimental
model involves another mammalian antibody,
the signal is amplified even more, because
these mammalian antibodies will better bind to
IgY than to rabbit IgG. IgY recognizes more
sites on the mammalian protein which it
recognizes as extraneous and produces a wide
range of antibodies. IgY is likely to produce
antibodies that are hardly or even impossible
to be produced on mammals.
ONE HEALTH INTERNATIONAL JOURNAL, 3(1),2017
55
c) The binding capacity of monoclonal
antibodies can be described as avidity, a
combination between affinity to a single locus
and antibody valence. Valence shows how many
loci the antibodies interact with when binding
to an antigen. IgY can have the same action as
bi or monovalent IgG, depending on antigen
size. This is why the binding capacity of
polyclonal antibodies may be strong or weak.
d) Antibody diversity in mammals is most
often accomplished by rearrangement of various
gene segments to produce the hypervariable
part of antibodies and by somatic mutations as
well. Thus it is possible to be more than one
million specific antibodies.
e) Antibody diversity in chicken is particularly
accomplished by gene conversion and by
flexibility between V-J and by somatic
mutation as in mammals. Unlike mammals,
chickens have a single VH or VL gene, but
besides that they have 25 so-called pseudo-
genes-V (that have lost the common trans-
cription regulation and signal recognition
sequences). Thus, chickens can often produce
antibodies that will recognize more epitopes
than mammalian antibodies [8,17,19,20,22].
Molecular genetic studies have confirmed that
IgY is an ancestral molecule which human IgG
and IgE originate from [22]. The Fc segment
of IgY mediates the major part of biological
effector functions such as complement
fixation, anaphylactic reactions or opso-
nization and the Fab region of IgY contains an
antigen binding site [22]. Human antibodies
are related to avian antibodies. Specialists state
that avian immunoglobulins (avian IgG) are
the ancestors of human IgG, IgM and IgE
[9,20,21].
This paper presents case studies for the
treatment of psoriasis vulgaris using products
I-pc2.
MATERIALS AND METHODS
Psoriasis vulgaris patients come from a group
of 120 cooperating psoriasis patients who have
been clinically healed.
The biological products used are Imunoinstant
[4,5,6,7], and the treatment method is the
previously described one [22].
RESULTS AND DISCUSSIONS
Case study: 1
Patient: 13 years old girl
Diagnostic: generalized psoriasis vulgaris,
for 3 years
56 Lucica Sima et al.
Fig. 1. Case no. 1, before/after treatment,
front
In fig.1, the first photo was taken on
9.06.2016, before the treatment, and the
second one, on 3.08.2016, 43 days after the
treatment started. Just as before, the skin
shows improvement with the disappearance of
inflammatory symptoms (fig.2).
Fig. 2. Case no. 1, before/after treatment,
back
At this very moment (January 2017), the
psoriatic plaques have disappeared completely
and the histological exam shows that the
structure of the skin has recovered. The patient
is following a treatment that focuses on
immunological support.
Case study 2
Patient: 55 years old male
Diagnostic: generalized psoriasis vulgaris,
for 8 years, Staphylococcus aureus-infected
psoriatic plaques.
In fig.3, the first photo was taken in June,
2016, and the second one, 3 months after. The
redness of the skin is gone, along with most of
the scales. January, 2017, psoriatic lesions
disappeared almost completely (99,9% of the skin
ONE HEALTH INTERNATIONAL JOURNAL, 3(1),2017
Fig. 3. Case no. 2, before/after treatment, back
surface is healed) and the histological exam
proves the healthy status of the skin. The
patient is following a treatment that focuses on
immunological support.
Case study 3
Patient: 74 years old female
Diagnostic: generalized psoriasis vulgaris,
for 14 years.
The plaques were Staphylococcus MRSA-
infected. Skin lesions were situated on the
scalp and then spread all over the body, ears,
upper and lower limbs, genitals. The patient
came in for a consult while having suicidal
thoughts. In November 2015. After 8 months
of treatment – histological samplings from the
backside (fig.4).
Results: normal tissue
Fig. 4. Case study 3, before/after treatment,
back.
Case study 4
Patient: 56 years old female
Diagnostic: generalized psoriasis vulgaris,
for 16 years, diagnosed after an immuno-
logical misbalance. No psoriasis history in the
family. The psoriatic wounds appeared on the
lower limbs and then spread on the chest,
abdomen, inguinal area, upper limbs, backside,
scalp and ears. The patient had been under
treatment with cortisone cream for 15 years,
 PC2 and Psoriasis Vulgaris
with no result. After 90 days of treatment, the
psoriatic plaques disappeared, the scales are
reduced, joint lesions are less intense, the
health status improved due to less psoriatic
plaques, the itching and local swelling
subsided. The patient is improved and has
better mobility.
Fig. 5. Case no. 4, before/after treatment, left
arm.
In fig.5, psoriatic wounds on the upper left
limb. Symptoms are rigid joints, hemorrhages,
smarting, pain in the skin and joints. The upper
side of the psoriatic wound shows swollen skin.
After 10-14 days, the psoriatic wound disappeared.
The patient no longer had smarting. The right-
side photo shows the skin during the healing
process and reddish scar from the psoriatic
wound revealing the normal skin.
Fig.6. Case no. 5, before/after treatment,
right hand.
ONE HEALTH INTERNATIONAL JOURNAL, 3(1),2017
57
Case study 5
Patient: 38 years old female
Diagnostic: palmo-plantar psoriasis, Super-
infections with: Bacillus spp, Staphylococcus
epidermidis, Staphylococcus aureus MR.
In fig.6, three months after treatment, the
psoriatic plaques disappeared, joint lesions are
less intense, the health status is improved and
itching and local swelling subsided. The patient
is improved and has better mobility.
CONCLUSIONS − Why are
IMUNOINSTANT products beneficial ?
IgY has more biological effector functions
than monoclonal antibodies (McaB). Mono-
clonal antibodies (McaB) activate the Fc region
which generates the major structural difference
between both types of antibodies. Thus, the
Fc-dependent IgY functions are fundamentally
different from those of mammalian IgG. IgY
does not activate the complement system [23],
IgY does not bind to protein-A and G [8], IgY
is not recognized by mammalian antibodies [23],
by the rheumatoid factor (RF), an auto-
antibody reacting with Fc of IgG or HAMA
(human anti-murine antibodies) and IgY does
not bind to the Fc receptor cell surface [19,21].
These differences of molecular interactions are
highly beneficial for using IgY antibodies.
While genetic modifications were made on
mouse immunoglobulin structure in order to
produce chimerical and humanized biological
drugs, no such interventions have been brought to
the proteins in the hyperimmune egg and
IMUNOINSTANT products (section 8 in table
no. 1). The properties of these products with
direct effect on the human body are the results
of a direct chicken immunization program and
of their specific immune response which is
eventually found in the egg yolk. Imunoinstant
product range also contains whole egg products
and egg white protein products.
Chicken immunoglobulins (IgY) cross the
digestive mucosa either as a whole or as only
Fab fragments maintain their capacity of
specific reaction to the antigens the chickens
have been immunized with. In the organism
they meet lymphocyte T by transfer of
information from the variable V of Fab
fragment. This informa-tion taken from IgY-
specific- idiotype as negative copy is stored in the
own DNA and then cloned. The T cells transfer to
lymphocyte B a copy taken as negative print and
produce human IgG-idiotype which is
immunologically identical to the IgY-specific
idiotype, the source of the initial information.
58 Lucica Sima et al.
Laboratory experiments have been conducted
regarding the IgY-idiotype – IgG-idiotype–
IgG-idiotype reaction on SPF and
Conventional poultry, using CVS strain of
rabies virus antigen as biological marker
(unpublished data, Pătrascu et al.).
REFERENCES
1. *** Global report on psoriasis, WHO
Library Cataloguing-in-Publication Data, 2016;
2. *** Approval of psoriasis treatment with
biologic agents by Romanian National Health
Insurance House Commission, Communication
approving specific treatment in severe chronic
psoriasis, sent on 01.10.2008, (in Romanian)
3. Moraru D, Minca DG, Brinduse LA −
Addressability and adherence to the biological
agents therapy of the patients with moderate
and severe psoriasis, JMB, 2012, 1,62-64 (in
Romanian);
4. Pătraşcu IV, Chiurciu V, Chiurciu C,
Oporanu M, Topilescu G, Mihai I − The
production and application of PC2 ovotrans-
ferrine [OTf-PC2], OSIM Patent no.
A/00008/13.01.2015, see OSIM Official Monitor
7/2015, p.26; Owner: Romvac Company S.A.;
5. Pătraşcu IV, Chiurciu V, Chiurciu C,
Topilescu G − Procedure of production and
application of chicken immunoglobulin [IgY],
OSIM Patent no. A/00156 25.02.2014, see
OSIM Official Monitor 7/2014, p.26; Owner:
Romvac Company S.A.;
6. Pătraşcu IV, Chiurciu V, Chiurciu C,
Oporanu M, Topilescu G − The production
and application of modern ovotransferrin
[OTF-M], OSIM Patent no.A/00653
28.08.2014, see OSIM Official Monitor
2/2015, p 29; Owner: Romvac Company S.A.;
7. Pătraşcu IV, Chiurciu V, Chiurciu C,
Oporanu M, Topilescu G, Mihai I − The
production and application of PC2 hiperimune
egg, OSIM Patent no. A/00810 29.10.2014,
see OSIM Official Monitor 5/2015, p 20;
Owner: Romvac Company S.A.
8. Pătraşcu IV, Chiurciu V, Chiurciu C,
Sima L, Mihai I − The production and use of
personalised hiperimune egg [ovopach] in the
treatment of psoriasis, OSIM Patent no.
A/00735 16.10.2015, see OSIM Official Monitor
3/2016, p 16; Owner: Romvac Company S.A.;
9. Dávalos-Pantoja L, Ortega-Vinuesa JL,
Bastos-González D, Hidalgo-Álvarez R −
Colloidal stability of IgG- and IgY-coated latex
microspheres, Colloids Surf B Biointerfaces,
2001, 20(2),165-175.
10. Jerne NK − The immune system: a web
of v-domains, Harvey Lecture Series, volume
70, Academic Press, Geneva, 1975, pp. 93-110;
ONE HEALTH INTERNATIONAL JOURNAL, 3(1),2017
11. Matucci A, Petroni G, Nencini F, Pratesi S,
Maggi E, Vultaggio A − Anti-drug antibodies and
clinical implications, published on line, 2013
Oct 23, www.clinicaldermatology.eu, 2013,
2(2)77-80;
12. Hsu L, Snodgrass BT, Armstrong AW −
Antidrug antibodies in psoriasis: a systematic
review, Brit J Dematol, 2014, 270(2),261-273;
13. Menon R, David BG − Itolizumab – a
humanized anti-CD6 monoclonal antibody with
a better side effects profile for the treatment of
psoriasis, Clin Cosmet Investig Dermatol 2015,
8,215-222;
14. Sehgal VN, Pandhi D, Khurana A −
Biologics in dermatology: An integrated review,
Indian J Dermatol, 2014, 59(5),424-441;
15. Gniadecki R, Bang B, Bryld LE,
Iversen L, Lasthein S, Skov L − Comparison
of long-term drug survival and safety of
biologic agents in patients with psoriasis
vulgaris, Br J Dermatol, 2015, 172(1),244-252;
16. Jullien D, Prinz JC, Nestle FO −
Immunogenicity of biotherapy used in psoriasis:
the science behind the scenes, J Invest
Dermatol, 2015, 135,31-38;
17. Kofoed K, Skov L, Zachariae C − New
drugs and treatment targets in psoriasis, Acta
Derm Venereol, 2015, 95(2),133-139;
18. *** Chicken Egg Yolk Antibodies,
Production and Application, IgY-Technology
(First laboratory manual on this alternative,
non-invasive method for producing polyclonal
antibodies, Springer Lab Manuals) (Schade R,
Behn I, Erhard M, Hlinak A, Staak C, Eds.),
Springer, 2001;
19. Xu Y, Li X, Jin L, Zhen Y, Lu Y, Li S,
You J, Wang L − Application of chicken egg
yolk immunoglobulins in the control of
terrestrial and aquatic animal diseases: a
review, Biotechnol Adv. 2011, 29(6),860-868;
20. Narat M − Production of antibodies in
chickens, Food Technol Biotechnol, 2003,
41(3),259-267;
21. Leslie GA, Clem LW − Phylogeny of
immunoglobulin structure and function. III.
Immunoglobulins of the chicken, J Exp Med,
1969, 130(6),1337–1352;
22. Warr GW, Magor KE, Higgins DA −
IgY: clues to the origins of modern antibodies,
Immunol Today, 1995, 16(8),392-398;
23. Davidson F, Magor KE, Kaspers B −
Structure and Evolution of Avian Immuglobulins
(chapter 6), in Avian Immunology (Davison F,
Kaspers B, Schat KA, Kaiser P, Eds), Elsevier,
Amsterdam, 2008, pp. 107-127.
0023_170117
Received 17.01.2017
Accepted 14.02.2017
One Health International Journal, 3(1),59-63,2017
One Health New Medical Concept Association, Romania

Biological products PC2. Part 2.

Methicillin-resistant Staphylococcus aureus infection
treatment in humans

Constantin Chiurciu, Viorica Chirciu, Violeta Ionescu,

Georgiana Radu, Lucica Sima1, Maria Oporanu,
Ionel Victor Pătraşcu

Romvac, Limited Company, Voluntari, Romania

Abstract
Immunologically active proteins I-PC2 of Imunoinstant group have been used in the
treatment of Staphylococcus aureus Methicillin-resistant Staphylococcus aureus (MRSA)
nosocomial infections on patients after surgical interventions and on psoriasis patients with
Staphylococcus aureus MSSA- (Methicillin-sensitive Staphylococcus aureus) or MRSA-
infected plaques. Staphylococcus aureus MRSA- and MSSA-infections were successfully
cured with IMUNOINSTANT products used as such, without antibiotics.

Keywords: MRSA, Staphylococcus aureus, PC2, Imunoinstant, infection treatment, IgY,

chicken immunoglobulin

Staphylococcus aureus (S.aureus) is a referred to as MRSA superbug, may start as a

bacterium that can be found on the skin of 25-
30% of population; it is the most frequent
cause of infected plaques. Methicillin-resistant
Staphylococcus aureus (MRSA) is the major
hospital-acquired infection causing, for instance,
infections of surgical prostheses. MRSA is
mainly spread in hospital rooms but also within
a community [1]. Studies conducted at Romvac
regarding skin infections present in psoriatic
plaques showed that 36.6% are Staphylococcus
aureus infections, of which 21.9% are MRSA
[Chiurciu C et al, unpublish data].
MRSA is a form of bacterial infection resistant
against many antibiotics, including methicillin,
amoxicillin, penicillin and oxacillin, making
treatment a challenge. An infection, often
minor skin lesion, a pustule, before becoming
severe, potentially harmful and sometimes
fatal. Each year in the USA there are more
than 90.000 cases of MRSA infection of which
18.500 are associated deaths [2].
Staphylococcus aureus is a human pathogenic
bacterium often found in the nose and on skin.
In the USA, staphylo-cocci infections are one
of the most common causes of skin infections.
33% of population has S.aureus colonies in the
nose without presence of infections and 2% of
population is MRSA-infected [2].
S.aureus can cause skin infections. It can
proliferate on the skin. Theoretically, a single
cell can form a colony of more than one
million cells in 10 hours [2].

1
Corresponding author: Romvac Company, Soseaua de Centura no
7, Ilfov County, Romania, e-mail: simalucica@gmail.com,
60 Constantin Chiurciu et al.
S.aureus may cause skin infections, including:
furuncles, pimples, impetigo, abscesses, infected
plaques. Staphylococcus aureus may enter the
body through skin lesions or during medical
procedures and invade the bloodstream causing
mild to severe life-threatening infection. These
cases may include: septicemia, pneumonia,
osteomielitis, endocarditis, urinary infections
(urinary bladder infection and spread of infection
to the kidneys directly), septic bursitis in the
skin [2].
MRSA can spread from one person to
another (skin to skin contact) and also when
someone is MRSA-infected or colonized with
bacteria.
The skin to skin contact with somebody
MRSA-infected does not always generate the
infection. MRSA bacteria can survive for long
periods of time on surfaces and objects
including door handles, floors, sinks, faucets,
cleaning devices and fabrics [3].
S.aureus MRSA survives on many fabrics.
Samples of fabrics were infected with 10.000
up to 100.000 colony forming units (CFU) of
MRSA and observed daily. Results showed
that S.aureus survived as follows: cotton: 4-21
days, laminate neoprene: 2-14 days, polyester
mix: 1-3 days, polyester: 1-40 days, polypro-
pylene: more than 51 days. Hygiene measures
are highly necessary.
MRSA often cause diseases in people with
compromised immune system who interact or
live in hospitals and other healthcare units.
This is called: healthcare associated with
MRSA treatment, or hospital-acquired MRSA
infections or nosocomial infections.
Many times, MRSA infection occurs as
follows:
• MRSA bacteria can survive long periods of
time on surfaces and objects including door
handles, floors, sinks, faucets, cleaning devices
and fabrics;
• A lesion on the skin and break of the
natural defense barrier such as surgical
wound, burns, catheter wounds, blisters,
allowing bacteria enter the human body;
• Old age, comorbidity or multiple complex
health issues, such as poor immune system
due to immune deficiency or after using
immune-compromising drugs;
• The simple fact that hospitals are visited by
a large number of people creating a proper
environment for bacteria to easily spread
from one another, to patients and healthcare
staff.
ONE HEALTH INTERNATIONAL JOURNAL, 3(1),2017
• Immune-compromised people: hospital
patients, under renal dialysis [hemodialysis],
cancer patients or under treatments affecting
the immune system, drug addicts, people with
surgeries within the last year.
Estimations suggest that 49-65% of S.
aureus infections are associated with patient
treatment and are caused by MRSA.
Romania is on the first place in Europe
regarding MRSA infection [4]. Patients are
intensively treated in hospitals with antibiotics
proven to be inefficient and are eventually
released but uncured. These patients desperately
seek other therapeutic means. Many of them
came to the Research Laboratory of Romvac.
MRSA infection treatment using IPC2 products
Imunoinstant, with immunologically active
proteins (PIA) enabled healing of MRSA
infections in patients considered incurable.
This paper aims to present the possibility to
successfully treat MRSA infections with IAP.
MATERIALS AND METHODS
The patients who came for treatment had
undergone surgeries or had been infected with
MRSA and after additional surgeries, local or
antibiotic treatments, were released uncured.
52 patients of 120 psoriasis patients with S.
aureus of which 18 were MRSA-infected were
treated with PIA I-PC2.
Staphylococcus aureus and MRSA strain
isolation from patients with skin and peritoneal
lesions was done by taking samples from skin,
skin lesions, surgical wounds, peritoneal fluids
from the abdomen by catheters and from the
nose. Isolation and identification of bacteria
was made by rapid agglutination Staphilo
Rapid Test from Sclavo Diagnostics.
Treatment of Staphylococcus aureus MRSA
infections
Biological products PIA I-PC2
The IMUNOINSTANT PIA I-PC2 products
are prepared by a special technique in Romania
[4,5,6,7,8]. These immunologically active proteins
(PIA) contain polyvalent immunoglobulin (IgY)
x16 types of antibodies, apo-ovotransferrin and
holo-ovotransferrin, ovomucin and ovoalbumin,
lysozyme, healing factors, various peptides,
immunomodulators, contact proteins. Bacterial
strains or yeasts for I-PC2 immunogen are
isolated as per international standards but they are
isolated from Romanian patients. The structure of
an immunogen I-PC2 contains: Escerichia coli,
 PC2 and Staphylococcus aureus
Staphylococcus aureus, Fusobacterium nucleatum,
Staphylococcus epidemitis, Enterococcus spp.,
Enterococus faecium, Enterococus fecalis,
Corynebacterium spp. Corynebacterium diphte-
riae, Klebsiella spp, Klebsiella pneumoniae,
Proteus mirabilis, Proteus spp., Candida
glabrata, Candida albicans, Streptococus pneu-
moniae, Salmonella enteritidis, Salmonela
tiphimurium, Acinetobacter Baumani, Clostirium
difficile vegetative form, Clostridium difficile
sporulated form, Clostridium difficile exotoxins A
and B, Pseudomonas aeruginosa, Neiseria
meningitides, Haemophilus inphluenza, Heli-
cobacter pylori. The antigenic composition
depends on the frequency of infections with
antibiotic-resistant germs or upon request.
Biological products PIA I-PC2 appear as
sterile solution, sterile spray, granules, oint-
ments, healing oily liquid, healing granules,
healing tablets with easily absorbed collagen
VII, sterile yolk suspension. Further biological
products are to be prepared.
Personalized biological products PIA I-PC2
When PIA-IPC2 treatment is less efficient,
a personalized PIA I-PC2 is required. The
immunogen is prepared from the pathological
material taken from wounds, psoriatic plaques,
burns etc [7].
Treatment of skin infections is local and
general
Both general and local treatments are
controlled by the immune system and the
principle is active immunity by passive immunity.
The treatment is a direct action of a variable V
from the carrier molecules of variable V holding
the antigenic information of I-PC2 immunogen
transferred to immature lymphocyte T and at
the same time intervenes for lymphocyte B
hyperactivity.
a. Oral general treatment. The sterile
liquid from a sterile glass vial containing PBS
to pH = 7.0 200 mg polyvalent IgY and 10 mg
specific IgY is used. Imunoinstant poly is
orally administered, 6-7ml altogether. Use this
liquid to wash the oral mucosa and teeth, for
throat wash and then swallow it. Repeat until
consuming all 80 ml, within 3 minutes. Do not
eat or drink during night time. While the
patient is sleeping, the immunologically active
proteins I-PC2 with molecular weights
between 1000-200.000 Daltons are absorbed
through the digestive mucosa where they have
local and general effects. After absorption
ONE HEALTH INTERNATIONAL JOURNAL, 3(1),2017
61
through the digestive mucosa, the immuno-
modulators enter the bloodstream. The general
treatment is a part of the oral treatment and
refers to the absorption of IgY, ovotrans-
ferrins, immuno-modulators, peptides in the
blood where they act directly on the immune
system, on the naïve lymphocyte T which
converts to mature lymphocyte T and act on
the hyperactive lymphocyte B.
The recognition of variable V on the IgY-
idiotype and OTf-idiotype specific to immu-
nogen I-PC2, by lymphocyte T and transfer of
information from I-PC2 and storage in the own
DNA becoming mature lymphocyte T is the
first step of immunogenic genetic information.
At the same time, IgY-polyvalent activates
tyrosine hydrolysis to uracil in its own variable
V initiating somatic hyper mutation from the
germinal center of B cells. The somatic hyper
mutation is essential for generating antibodies
with affinity 10 times higher than that of the
antibodies generated by untreated B cells.
The mature lymphocyte T which owns the
genetic information on I-PC2, transfers it to
hyperactive lymphocyte B which will repro-
duce it as human IgG idiotype identical to
IgY-idiotype I-PC2. In the human body orally
treated with PIA I-PC2, the IgG idiotype level
is equal to the level of antibodies obtained
from humans with the competent immune
system, vaccinated with an attenuated live vaccine.
As we can see in this brief presentation, all
immune idiotype mechanisms taking place in
the molecule on the variable V are energetic.
This energetic phenomenon is part of the life
in the molecules and are the expression of a
particularly important biological process in the
life of humans and animals.
Lymphocyte T interacts directly with blood
vessel epithelium, mucosal epithelium and skin.
The mucosal epithelium is a permanent
lymphocyte T informer on the presence of new
antigens to be identified or on which
lymphocyte T is effective.
The general treatment is effective on the
entire organisms directly from the inside to the
outside for the skin and mucosa. It is at the
same time effective on bones, joints soft tissues
that are affected by the disease. This treatment
is also effective in the central nervous system
and induces wellbeing in the patient.
b. Local skin treatment: after mecha-
nical hygiene of the body with dry soap, using
I-PC2 cream, I-PC2 oil or I-spga, IgY-
polyvalent I-PC2, suspension G in dispensing
vials, on the palms and soles. Such treatment is
a long-term one due to the diversity of disease
62 Constantin Chiurciu et al.
symptoms among which there are psoriatic
wounds and plaques. It is recommended for
prevention on the normal skin around wounds.
One should take special care for the skin to be
always hydrates and not dry. One should also
be patient when carrying out the treatment,
depending on the disease evolution. After
removing the dressing, wash the skin with
soap and then generously apply cream all over
the wounds and on the area around. In less
accessible areas you can use IgY-polyvalent
spray. Healing powders are indicated on certain
wounds. After some time, if the cream is
absorbed in the skin, resume treatment.
RESULTS AND DISCUSSIONS
Case study: 1
A 42 years old female admitted with bowel
obstruction, was subjected to bowel resection.
During treatment she became infected inside
the hospital with S.auresus MRSA. 4 days
after release she needed a second surgery to
remove the remaining gauze dressing in her
abdomen. After the second release she was
again admitted to fix the surgery. MRSA
infection persisted, though she had been
receiving antibiotics (Piperacillin/Tazobactam
Kabi 2g/0,25 g, Meronem injectable 500 mg).
The surgical wound failed to close (fig. 1a),
the area was painful and opalescent fluid was
draining. 35 days after the last surgical
intervention the wound closed (fig. 1b) and the
pain subsided.
a B
Fig. 1. Images of case 1.
a − MRSA-infected wound
b − Wound healed after PIA I-PC2 treatment
Case study 2
• 46 years old male.
The patient came for PIA I-PC2 treatment
at the surgeon’s recommendation. He underwent
surgical intervention to fix the multiple-fractured
tibia of the left leg. The bone was reconstituted
using a steel rod. After surgery, 3 days after
release, the patient came back to the hospital
ONE HEALTH INTERNATIONAL JOURNAL, 3(1),2017
with MRSA-infected surgical wound. A
second surgery was conducted and the patient
received antibiotics. 5 days after treatment the
patient came to the Research Laboratory of
Romvac where he was recommended local
treatment with daily washing of the leg
including the surgical wound and spraying
with PIA I-PC2 all over the leg up to the knee.
The oral treatment consisted of sterile liquid
PIA I-PC2 and hyperimmune eggs PIA-I-PC2.
The wound healed within 40 days and the
radiological examination confirmed the ongoing
healing of bone wounds (fig.2).
Fig.2. Evolution of MRSA-infected wound
which was healed within 40 days of PIA I-
PC2 treatment.
Case study 3
51 years old female − came in for a medical
consult, being a particular case. Hoping for a
better way of living and strong-willed, she
asked us to cure her S.aureus MRSA infection
because she needed an emergency surgery and
that was impossible with an MRSA infection.
6 months before, the female patient had
undergone a surgical intervention at a hospital
in Germany to have her left iliac with a benign
tumor. She became infected with S.aureus in
the hospital. The specialists from Germany
designed and performed a plastic hip and the
second surgery would have been the
reconstitution of the plastic hip after removing
the rest of the hip bones.
The patient was treated orally with PIA I-
PC2. Local treatment consisted of soap
washing and then application of sterile liquid
PIA I-PC2 on the wounds and skin. She
decided to introduce 200 mg IgY per 80 ml of
sterile liquid PIA I-PC2 daily through the
surgical drains.
 PC2 and Staphylococcus aureus
She healed within 60 days after treatment
and the samples taken from the skin, surgical
wounds and liquid from the surgical drains
proved MRSA-negative.
The hip replacement surgery was performed
under IMUNOINSTANT treatment. The
surgery was successful and the patient is cured
from S.aureus MRSA.
Treatment of Staphilococus aureus MSSA
and MRSA infected psoriatic plaques
During the psoriasis treatment program,
36.6% from group 1 consisting of 120 patients,
were infected with S.aureus in the psoriatic
plaques. 18 of them were MRSA-infected and
24 samples contained MSSA. All patients
were orally treated with 80ml sterile solution
in PBS with 200 mg IgY and locally with PIA
I-PC2 as sterile solution, cream and ointment.
No patient received antibiotics. All patients were
clinically cured from psoriasis vulgaris. S.aureus
MSSA and MRSA infection disappeared from
the psoriatic plaques within 12-16 days of
treatment.
This paper presented a few cases of patients
with nosocomial infections on surgical
wounds. Patients no longer received antibiotics
during treatment. The same method was
applied to psoriasis patients with MSSA and
MRSA infections. The results showed that
treatment with Imunoinstant immunomodu-
lators and immunologically active proteins can
cure the organism. Immunological support via
IMUNOINSTANT administration is also
likely to be essential. Further studies are
necessary to gain experience and obtain more
scientific information in order to use such
Imunoinstant products for the antibiotic
resistance treatment.
CONCLUSIONS
1. Imunoinstant biological products identified
as immunologically active proteins (PIA) with
I-PC2 specificity inhibit the proliferation of
Staphylococcus aureus MRSA and MSSA in
vivo.
2. Nosocomial Staphylococcus aureus MRSA
infections in patients after surgeries can be
successfully healed.
3. Treatment of Staphylococcus aureus MRSA
and MSSA infections was carried out on
psoriatic plaques without the need of any
antibiotic or other drugs.
ONE HEALTH INTERNATIONAL JOURNAL, 3(1),2017
63
REFERENCES
1. *** Prevalence of antimicrobial
resistance in the WHO European Region.
http://www.euro.who.int/en/home
2. Nichols H − MRSA: Causes, symptoms,
prevention and treatment, MNT, last updated
19 Oct .2015, http://www.medicalnewstoday.com;
3. Neely AN, Maley MP − Survival of
Enterococci and Staphylococci on hospital fabrics
and plastic, J Clin Microbiol, 2000, 38(2),724-
726;
4. Pătraşcu IV, Chiurciu V, Chiurciu C,
Oporanu M, Topilescu G − The production
and application of modern ovotransferrin
[OTF-M], OSIM Patent no.A/00653
28.08.2014, see OSIM Official Monitor
2/2015, p 29; Owner: Romvac Company S.A.;
5. Pătraşcu IV, Chiurciu V, Chiurciu C,
Oporanu M, Topilescu G, Mihai I − The
production and application of PC2 ovotrans-
ferrine [OTf-PC2], OSIM Patent no.
A/00008/13.01.2015, see OSIM Official Monitor
7/2015, p.26; Owner: Romvac Company S.A.;
6. Pătraşcu IV, Chiurciu V, Chiurciu C,
Topilescu G − Procedure of production and
application of chicken immunoglobulin [IgY],
OSIM Patent no. A/00156 25.02.2014, see
OSIM Official Monitor 7/2014, p.26; Owner:
Romvac Company S.A.;
7. Pătraşcu IV, Chiurciu V, Chiurciu C,
Sima L, Mihai I − The production and use of
personalised hiperimune egg [ovopach] in the
treatment of psoriasis, OSIM Patent no.
A/00735 16.10.2015, see OSIM Official Monitor
3/2016, p 16; Owner: Romvac Company S.A.;
8. Pătraşcu IV, Chiurciu V, Chiurciu C,
Oporanu M, Topilescu G, Mihai I − The
production and application of PC2 hiperimune
egg, OSIM Patent no. A/00810 29.10.2014,
see OSIM Official Monitor 5/2015, p 20;
Owner: Romvac Company S.A.
0023_170117
Received 17.01.2017
Accepted 16.02.2017
One Health International Journal, 3(1),64-71,2017
One Health New Medical Concept Association, Romania

Assessment of some mineral levels in canned soft

drinks

Gheorghe V. Goran 1, Emanuela Badea, Liliana Tudoreanu,

Victor Crivineanu

University of Agricultural Sciences and Veterinary Medicine,

Faculty of Veterinary Medicine, Bucharest, Romania

Abstract
A beverage can is a metal container designed to hold a fixed portion of liquid such as
carbonated soft drinks, alcoholic beverages, fruit juices, teas, herbal teas, energy drinks,
etc. Generally, beverage cans are made of aluminum (75% of worldwide production) or tin-
plated steel (25% worldwide production). Production for all beverage cans is
approximately 370 billion cans per year worldwide. Heavy metal and mineral composition
of food are of interest because of their essential or toxic nature. Metallic elements in acid
medium migrate into food or beverages from containers structure in which they are found
as constitutive elements. This study aimed to determine the levels of some heavy metals and
minerals in canned soft drinks commonly consumed in Romania, assessing heavy metals
health risk in consumers. The research was conducted on 21 non-alcoholic canned soft
drinks bought from the local supermarkets, all of them from different producers. Heavy
metal and mineral concentrations were determined using ICP-MS. From the 20 evaluated
elements, Be, B, Mg, Ga, Sr, Ba, Tl and Bi were below the method detection limit, Co, Cu
Li, and Zn were well below the maximum contaminant levels, and over maximum allowed
limits were Cd, Pb and Fe samples in all investigated samples, and Ni in carbonated cola-
type soft drinks samples, making from prolonged use of such products a potential threat to
human health.

Key words: minerals, heavy metals, soft drinks, metallic cans

Heavy metals contamination of the food
chain is mainly due to environmental pollution.
The main elements responsible for heavy metals
pollution were lead, cadmium, and zinc [1].
Cadmium has an important place in environmental
pollution, along with arsenic, lead, mercury
and other elements [2]. Pb and Cd toxicity is
well documented and is recognized as a major
environmental health risk throughout the world
[3]. Cd is a strong inhibitor of the thiol
enzymes, and has carcinogenic action, acting
highly toxic to testicular tissue. Besides out-
standing neurotoxicity, Pb inhibits heme synthesis
causing Saturnian anemia. Pb, as well as other
metallic elements in acid medium, migrates into
food or beverages from containers structure in
which they are found as constitutive elements
[2].

1
Corresponding author: Faculty of Veterinary Medicine, Splaiul
Independentei no 105, Sector 5, 050097 Bucharest, Romania, e-mail:
gheorghegoran@fmvb.ro
 Metallic and nemetallic elements in canned soft drinks
Long-term exposure to Cd lower levels
leads to a buildup in the kidneys and possible
kidney disease, lung damage, and fragile
bones. Pb can affect every organ and system in
the body, and long-term exposure of adults can
result in decreased performance in some tests
that measure functions of the nervous system;
weakness in fingers, wrists, or ankles; small
increases in blood pressure; and anemia [4].
Lifestyle can also impose higher risks of
exposure to heavy metals and health impacts,
after frequent consumption of this kind of
packaged soft drinks.
Demand for metal beverage containers will
post-nominal gains, a recovery from the slight
declines of the 2007-2012 periods, by cans in
the craft beer market, and from continued healthy
expansion of the energy drink market and product
innovations such as vented and shaped cans [5].
Metal determinations can resolve many
issues for all sorts of drinks such as soft drinks
or fruit juice including water [6,7]. The main
questions arisen by consumers are: Have
authentic products been used? Is the product
contaminated? Or how nutritious the product
is? Metals, such as Al, Cd, Pb, Hg, As, have
been for a long time monitored for their
harmful effect on human health [8,9].
In general, beverages packaged in cans
manufacturers’ effort have taken to avoid any
incidents arising from the migration of sub-
stances from the pack into the packaged product.
Technological development in this market has
got to the point that the biggest cans manufac-
turers provide to beverage producers varnishes
for the cans interior protection, customized for
their drinks in order to ensure their exceptional
quality, and consumer awareness in relation
these efforts led to the use of these products
with confidence [5].
But there are countries which are not
members of the international agreements on
the protection of consumers and have not
appropriate legislation in this regard. Companies
from these countries, but also foreign companies
that take advantage of the permissive regime
can ignore the quality requirements, which are
considered standard in developed countries.
Also, they could not respect the international
rules on the composition of alloys and coatings to
protect interior surfaces amid of overall confidence
on the quality of soft drinks packed in cans,
which could be a source of poor quality products
and endanger the health of consumers [10].
Heavy metals have been shown to be
harmful and toxic to humans, and represent a
major concern for public health [3,11,12].
ONE HEALTH INTERNATIONAL JOURNAL, 3(1),2017
65
These metals can cause both acute and chronic
toxicity in children and adults [2,13].
This study main goal was to determine the
levels of some metallic and mineral elements
levels in 4 types of canned soft drinks from
different trademarks sold in Romania as a risk
assessment on consumers.
MATERIALS AND METHODS
Sampling and samples preparation
21 samples represented by several brands and
types of soft drinks (carbonated, teas and energy
drinks), packed in metallic doses were collected
for analysis. Samples of the same type were
collected from different lots.
The 21 samples of non-alcoholic beverages
packed in metallic containers from different
producers (6 carbonated cola-type soft drinks, 6
carbonated orange or lemon soft drinks, 6 energy
carbonated soft drinks, 3 non-carbonated tea or
coffee soft drinks) were bought from the local
supermarkets, numbered, and transported to the
Interdisciplinary Laboratory for the Study and
Modeling of Heavy Metal Accumulation in the
Food Chain – HEVMETFOOD.
In the laboratory, the purchased soft drink
samples were kept in the refrigerator at 4 °C
[14]. Then the samples were initially disag-
gregated and then analyzed to assay the presence
of 20 mineral elements by ICP-MS.
All non-alcoholic beverages were digested
using a microwave oven and the method
descrybed by Barnes & Degrah (1997) using a
Spedwave MWS-2 Berghof microwave oven [15].
Spectrometric analysis
Digested samples were analyzed by a Thermo
XS series 2 ICP-MS spectrometer for the total
minerals and metals concentration. Operating
conditions for Thermo XS series 2 ICP-MS:
Sample uptake 40s, Washout 60s, Runs 3,
Sample uptake: 0.7 l/min, Sampling depth 15mm,
Sampler 1.0mm, Ni, Skimmer 0.4, Ni, Internal
standard 103Rh, Neb. 1.9 bar, Spike recoveries
from 80% to 110%.
All operating conditions were optimized to
yield the highest signal/ background ratio for
9
Be, 115In, 230U, 556Fe, 209Bi, 140Ce, 156 CeO, 75As,
27
Al.
Prior to analysis, each sample was spiked with
the internal standard (Rh). The dilution factor for
each sample is 10.
 66 Gheorghe V. Goran et al.

Table 1.
Total minerals concentrations (µg.L-1) in soft drinks samples
Sample Carbonated Carbonated Carbonated Non-carbonated
cola type orange and lemon energy tea and coffee P value
Mean StDev Mean StDev Mean StDev Mean StDev
Minerals
Al* 54.275a 30.018 32.360 a 8.652 26.135 a 5.227 40.853 a 28.280 0.117
Cd* 44.503 a 2.566 25.573 a 19.168 38.291 a 4.493 33.236 a 14.381 0.078
Co* 1.712 a 0.683 1.240 a 0.129 1.220 a 0.160 1.565 a 0.393 0.152
Cr* 20.180 a 2.700 18.823 a
2.311 17.525 a
0.972 18.527 a 1.387 0.207
Cu* 17.459 a 10.154 11.036 a 5.145 11.610 a 3.222 11.464 a 0.768 0.307
Fe* 324.550 a 109.684 230.766 a 40.243 204.616 a 27.322 315.866 a 129.882 0.054
Li* 1.447 a 0.615 1.427 a 0.413 2.260 a 2.661 1.7126 a 0.542 0.755
Mn* 9.383 a 6.167 7.647 a 3.818 4.678 a 1.710 20.143 b 4.282 0.001
Ni* 20.670 a 5.351 16.676 a
1.641 15.748 a
2.148 18.313 a 1.548 0.089
Pb* 32.103 a 15.899 19.986 a 2.023 19.438 a 2.803 20.563 a 3.761 0.079
Se* 4.383 a 1.390 4.254 a 0.896 3.580 a 0.406 4.007 a 0.703 0.501
Zn* 62.775 a 49.390 29.123 a
5.212 29.660 a
7.245 53.216 a 23.287 0.149
*Levels not connected by the same letter are significantly different. The comparison can be made only
between soft drinks for the concentration of one element and not between different elements concentrations.

All elements were determined against external RESULTS AND DISCUSSIONS

calibration using synthetic standard acid multi-
element standard (MERCK ICP-MS standard of
20 elements). Four standards were prepared by
dilution containing 1 ppb, 10 ppb, 100 ppb and
1000 ppb of the 20 elements. The accuracy of the
calibration was assessed by using reference
materials such as stream sediment CRM (water).
Results calculation
Each sample was analyzed in three repetitions
final value (x) the arithmetic mean of the three
results.
Results are communicated by the formula:
X= x ± s, where:
• x - mean value;
• s - standard deviation;
• X - final result.
Statistical analysis
Statistical analysis was performed using the
JMP5.0 software. One-Way ANOVA was
performed for all samples' mineral concentrations.
For ANOVA generating P ≤ 0.05 means
comparison was carried out by all-pair Tukey
HSD Test.
The presence of heavy metals in water, fruit
juices, beers, and red wines has been investi-
gated in Romania [16,17,18,19].
Also, this kind of research has been
conducted in other countries [3,20,21].
This study is important, given that this is
the first study assessing the mineral composition
of the canned soft drinks in Romania.
From the 20 elements that could be deter-
mined (Al, B, Ba, Be, Bi, Cd, Cr, Co, Cu, Fe,
Ga, Li, Mg, Mn, Ni, Pb, Se, Sr, Tl, and Zn), B,
Ba, Be, Bi, Ga, Mg, Sr, and Tl were below the
analysis method detection limit. Al, Cd, Co,
Cr, Cu Fe, Li, Mn, Ni, Pb, Se, and Zn levels
were over the analysis method detection limit.
The mean mineral contents for soft drinks
samples are presented in Table 1.
If the water is not purified during the
production process of the soft drinks could be
another source of heavy metal contamination,
which is a major public health problem. Thus,
the World Health Organization has set standards
and guidelines on acceptable levels of heavy
metals in water.

ONE HEALTH INTERNATIONAL JOURNAL 3(1), 2017 ONE HEALTH INTERNATIONAL JOURNAL 3(1), 2017
 Gheorghe V. Goran et al. 67

Table 2.
Range of total minerals concentrations (µg.L-1) in soft drinks samples
Sample Carbonated Carbonated Carbonated Non-carbonated
cola type orange and lemon energy tea and coffee
Min. Max. Min. Max. Min. Max. Min. Max.
Minerals
Cr 15.83 22.76 16.51 23.011 16.39 19.051 17.091 19.86
Mn 4.783 21.37 5.667 15.41 3.226 7.456 15.41 23.75
Co 1.224 2.994 1.112 1.461 1.094 1.501 1.111 1.806
Ni 15.95 29.89 14.71 19.39 13.94 19.96 17 20.021
Cu 9.655 37.45 1.811 16.78 9.023 17.83 10.811 12.311
Al 22.71 97.08 20.19 42.12 19.77 35.23 21.82 73.35
Cd 42.18 49.24 4.71 44.92 33.1 44.82 16.71 42.91
Fe 244.2 470.8 195.9 306.7 181.5 249.1 190.7 450
Li 0.93 2.371 0.74 1.791 0.667 7.637 1.086 2.031
Pb 20.56 62.64 17.95 22.32 16.19 22.71 16.32 23.49
Se 3.211 6.717 3.081 5.276 3.032 3.963 3.206 4.523
Zn 28.16 152.3 21.07 35.69 19.79 37.48 27.07 71.73

*MCL for drinking water *MCL for drinking water

Fig.1. Mean Mn concentrations (µg.L-1) in soft Fig. 2. Mean Ni concentrations (µg.L-1) in soft
drinks samples compared to MCL drinks samples compared to MCL

*MCL for drinking water *MCL for drinking water

Fig.3. Mean Cd concentrations (µg.L-1) in soft Fig. 4. Mean Pb concentrations (µg.L-1) in soft
drinks samples compared to MCL drinks samples compared to MCL

ONE HEALTH INTERNATIONAL JOURNAL 3(1), 2017

68 Gheorghe V. Goran et al.
Because the maximum contaminant level
(MCL) (µg.L-1) for heavy metals in soft drinks
have not been settled the determined metals and
minerals total concentrations were compared
to the MCL in drinking water for Al, Cd, Co,
Cr, Cu, Fe, Li, Mn, Ni, Pb, Se, and Zn are 100,
5, 110, 50, 2000, 9, 50, 50, 20, 10, 10, and
3000 µg.L-1, respectively [22].
In this study, the results have indicated that
minerals/heavy metals concentrations depended
on the soft drink type analyzed. One-way ANOVA
test have shown that there were no statistical
differences in minerals concentrations between
the types of soft drinks analyzed (P > 0.05).
Even if some minerals analyzed have recorded
concentrations much below the MCL for drinking
water, but detectable by the analysis method
used, however, they could represent a public
health issue, after long time consumption
because of their cumulative potential.
Compared to the MCL for drinking water,
Co, Cu, Li, and Zn levels were well below these
limits, Al, Cr, Mn, and Se concentrations were
below these levels for all 4 types of samples.
The accumulation of Al in the body can have
harmful effects over time, especially on the
central nervous system [2,23]. Chromium(VI)
is reduced to chromium(III) in the stomach
and gastrointestinal tract, and chromium(VI) in
Group 1 (human carcinogen) and chromium(III)
in Group 3 (not classifiable as to its carcino-
gennicity to humans) [24]. In humans, the
toxic effects of long-term selenium exposure
are manifested mostly in skin, nails, hair, liver,
and changes in peripheral nerves [25].
Even Mn levels registered were below
MCL (fig.1), one-way ANOVA test has shown
that there were significant statistical
differences for its concentrations between
cola-type, orange and lemon and energy soft
drinks compared to tea and coffee soft drinks
(P = 0.001). Manganese determines adverse
neurological effects following extended exposure
to very high levels in drinking-water [26,27].
Ni concentrations registered were high com-
pared to MCL for drinking water, but the mean
Ni levels were over MCL only in carbonated
type cola soft drinks samples (fig.2). Even
WHO guideline value for nickel is 70 µg.L-1,
the European Union standards recommended
limits of 20 µg.L-1. Metallic nickel is possibly
carcinogenic, but allergic contact dermatitis is
the most prevalent effect of nickel in the
general population [28].
In this study, only Cd, Fe, and Pb registered
concentrations over MCL.
ONE HEALTH INTERNATIONAL JOURNAL 3(1), 2017
In the soft drink analyzed samples, the
maximum and minimum mean levels found
were 4.71-49.24 µg.L-1, 181.5-470.8 µg.L-1,
16.19-62.64 µg.L-1 for Cd, Fe, and Pb,
respectively (Table 2).
Cd, Pb, and Fe concentrations determined
in the samples showed no statistical differences
between the types of soft drinks analyzed (P >
0.05). The differences between the mean level
of Cd, Pb, and Fe in the soft drink samples and
the MCL value (5, 10, and 9, µg.L-1, respectively)
are not statistically significant (P < 0.001).
Even there were not significant differences
between Cd concentrations in different soft
drinks analyzed, Cd mean concentrations re-
gistered the highest values in caffeine-containing
soft drinks (44.503 µg.L-1 in cola-type soft
drinks, 38.291 µg.L-1 in energy soft drinks, and
33.236 µg.L-1 in tea and coffee soft drinks
samples, respectively), compared to its mean
levels in orange and lemon soft drinks (25.573
µg.L-1) (fig.3). These Cd concentrations have
been higher compared to those in other studies
[3,20,21]. Cd accumulates primarily in the
kidneys and has a long biological half-life in
humans of 10-35 years.
There is evidence that it is carcinogenic,
and Cd and cadmium compounds have been
classified in Group 2A (probably carcinogenic
to humans). The kidney is the main target
organ for Cd toxicity [29,30].
Pb mean concentrations registered the highest
values in carbonated cola-type soft drinks
(32.103 µg.L-1), and the lowest mean levels in
carbonated energy soft drinks (19.438 µg.L-1),
even in the different soft drinks analyzed there
were not significant differences between Pb
levels (fig.4). Lead chronic poisoning has a
broad spectrum of manifestation, affecting the
entire body, including at low serum levels.
Exposure to lead is associated with a wide
range of effects, including various neuro-
developmental effects, mortality (mainly due
to cardiovascular diseases), impaired renal
function, hypertension, impaired fertility and
adverse pregnancy outcomes [31].
Fe mean levels registered higher values in
carbonated cola type and non-carbonated tea
and coffee soft drinks (324.550 µg.L-1, and
315.866 µg.L-1, respectively), and the lowest
mean levels in carbonated orange and lemon
energy soft drinks (230.766 µg.L-1, and
204.616 µg.L-1, respectively (fig.5).
Some researchers report that individuals with
increased intake than normal of iron have been
predisposed to develop Parkinson's disease [32].
ONE HEALTH INTERNATIONAL JOURNAL 3(1), 2017
 Metallic and nemetallic elements in canned soft drinks
There is usually no noticeable taste at iron
concentrations below 0.3 mg.L-1, although
turbidity and color may develop. No health-
based guideline value is proposed for iron [33].
*MCL for drinking water
Fig.5. Mean Cd concentrations (µg.L-1) in soft
drinks samples compared to MCL
All analyzed minerals in soft drinks samples
registered higher concentrations in carbonated
type cola soft drinks samples compared to the
other kind of analyzed soft drinks, excepting
Mn levels, which were higher in non-carbo-
nated tea and coffee soft drinks samples. These
results could be due to the acidity of these soft
drinks taking into consideration that in cola-
type soft drinks the acidifying agent used is
phosphoric acid and in all the other kind of
soft drinks (orange and lemon, energy or tea
and coffee soft drinks) acidifying agent used is
citric acid, which has a lower acidity than
phosphoric acid. The highest acidity could
determine a higher leach of the metals from
cans into soft drinks, mainly if varnishing
interior of cans for soft drinks was not made
properly or varnishing defects occurred inside
them. So, taking into consideration that
phosphoric acid has a lower pH than citric acid
when at the same concentration [34], thus
would probably be the cause of the higher
levels of minerals in car carbonated type cola
soft drinks samples compared to the other kind
of analyzed soft drinks. Also, the same process
of erosion with minerals solubilization occurs
in teeth exposed to the acidity of carbonated
soft drinks [35,36].
CONCLUSIONS
A high consumption of canned soft drinks
may increase the risk of contamination with
heavy metals like cadmium, lead, iron, and
ONE HEALTH INTERNATIONAL JOURNAL, 3(1),2017
69
nickel, which were present in all types of soft
drinks samples, and their values were above
the MCL for drinking water.
In this research, all detected minerals in
analyzed soft drinks samples, registered higher
concentrations in carbonated type cola soft
drinks samples, excepting Mn levels.
The explanation for the high levels of
contamination with some of the components of
cans may be that the storage and/or marketing
of the final products after they left the factory
have not been done under the manufacturer
recommended conditions.
An excessive and/or long-term consumption
of canned soft drinks that contain heavy metals
above MCL has a dangerous impact on human
health. Soft drinks are widely consumed and
could contribute to a great extent to intake of
heavy metals, thus, as a result, may be a major
concern for public health, and, therefore, the
regulatory authorities are required to monitor
and control the quality of these kinds of
beverages, in order to provide the consumer
safety and minimize the possible risks.
REFERENCES
1. Goran GV − Copper accumulation in
sheep, in Modeling heavy metals transport and
accumulation in plant-animal systems, (Tudoreanu
L, Codreanu MD, Crivineanu V, Goran GV,
Eds), Printech Publ, Bucharest, 2011, pp.153-
169;
2. Goran GV − Heavy metals and metalloids,
in Food Products Innocuity, (Goran GV Ed),
Printech Publ, Bucharest, 2014, pp.177-188 (in
Romanian);
3. Bingöl M, Yentur G, Buket ER, Oktem
AB − Determination of some heavy metal levels
in soft drinks from Turkey using ICP-OES
method, Czech J Food Sci, 2010, 28,213-216;
4. Martin S, Griswold W – Human Health
Effects of Heavy Metals, 2009, CHSR, 15,
http://www.engg.ksu.edu/CHSR/outreach/reso
urces/docs/15HumanHealthEffectsofHeavyMe
tals.pdf;
5. *** US Beverage Containers Market,
2013. https://www.reportbuyer.com/product/
1658927/us-beverage-containers-market.html;
6. Barnes K – Trace metal determination in
fruit, juice and juice products using an axially
viewed plasma, At Spectrosc, 1997, 18(3),84-100;
7. Ashurst PR – Chemistry and Technology
of Soft Drinks and Fruit Juices, Blackwell
Publ, 2005, pp. 113-116;
70 Metallic and nemetallic elements in canned soft drinks
8. Banks WA, Kastin AJ – Aluminum-induced
neurotoxicity: Alterations in membrane function
at the blood-brain barrier, Neurosci Biobehav
Rev, 1989, 13(1),47–53;
9. Anke M, Groppel B, Krause V – The
essentiality of the toxic elements cadmium,
arsenic and nickel, in Proc. 7th Inter Symp. on
Trace Elements in Man and Animals (TEMA
7). (Momcilovic B, Ed). Dubrovnik, IMI,
Zagreb, 1991, pp.11.6-11.8;
10. *** Council of Europe’s policy statements
concerning materials and articles intended to
come into contact with foodstuffs, in
Guidelines on metals and alloys used as food
contact materials, 2002, www.coe.fr/soc-sp;
11. Cabrera C, Lorenzo ML, Lopaz MC –
Lead and cadmium contamination in dairy
product and its repercussion on total dietary
intake, J Agric Food Chem, 1995, 43,1605-
1609;
12. Duffus JH – “Heavy metal” – a
meaningless term? Pure Appl Chem 2002,
74,793-807;
13. Ibrahim D, Froberg B, Wolf A,
Rusyniak DE – Heavy metal poisoning:
clinical presentations and pathophysiology,
Clin Lab Med, 2006, 26,67-97;
14. *** Standard methods for the exami-
nation of water and waste water, American
Public Health Association (APHA) 1998, 20th Ed;
15. Barnes K, Degrah E – Determination of
nutrition labeling education act minerals in
foods by inductively coupled plasma – Optical
emission spectroscopy, At Spectrosc, 1997,
18(2),41-54;
16. Goran GV, Crivineanu V, Tudoreanu L,
Voinea A – Comparative analysis of drinking
water mineral composition, Bulletin UASMV-
CN. 2012a, 69(2),494-496;
17. Goran GV, Crivineanu V, Tudoreanu L,
Iordache R – Mineral composition and metal
contaminants in some beer varieties, Bulletin
UASMV-CN. 2012b, 69(2),497-499;
18. Goran GV, Crivineanu V, Tudoreanu L,
Gheorghe A, Pop L – Nutritional value and
metal contamination of some natural juices,
Bulletin USAMV-CN. 2009, 66(2), 276-281;
19. Tudoreanu L, Goran GV, Crivineanu V,
Nicolae A – Identification of the mineral and
metal contaminants in some varieties of red
wines, Bulletin USAMV-CN. 2012, 69(2),528-
529;
20. Maduabuchı JMU, Nzegwu CN, Adıgba
EO, Aloke RU, Ezomıke CN, Okocha CE, Obı
E, Orısakwe OE – Lead and cadmium
exposures from canned and non-canned beverages
ONE HEALTH INTERNATIONAL JOURNAL, 3(1),2017
in Nigeria: A public health concern, Sci Total
Environ, 2006, 366,621-626;
21. Engwa AG, Ihekwoaba CJ, Ilo US,
Unaegbu M, Ayuk LE, Osuji AG – Determi-
nation of some soft drink constituents and
contamination by some heavy metals in
Nigeria, Toxicol Rep, 2015, 2,384-390;
22. *** Guidelines for Drinking Water
Quality, 4th ed., WHO, Geneva, 2011, pp. 72–
475;
23. *** Aluminium in drinking-water, in
Background document for preparation of
WHO, Guidelines for drinking-water quality,
Geneva, WHO, 2003 (WHO/SDE/WSH/
03.04/53);
24. *** Chromium in drinking-water in
Background document for preparation of
WHO Guidelines for drinking-water quality,
Geneva, WHO, 2003 (WHO/SDE/WSH/
03.04/4);
25. *** Selenium in drinking-water, in
Background document for preparation of
WHO Guidelines for drinking-water quality,
Geneva, WHO, 2003 (WHO/SDE/WSH/
03.04/13);
26. *** Manganese and its compounds.
Geneva, WHO, International Programme on
Chemical Safety, 1999 (Concise International
Chemical Assessment Document 12);
27. *** Manganese in drinking-water in
Background document for preparation of
WHO Guidelines for drinking-water quality,
Geneva, WHO, 2003 (WHO/SDE/WSH/03.
04/104);
28. *** Nickel in drinking-water in Backg-
round document for development of WHO
Guidelines for drinking-water quality, Geneva,
WHO, 2005 (WHO/SDE/WSH/05. 08/55);
29. *** IARC Monograph of the Evaluation
of Carcinogenic Risks to Humans – List of
Clasifications, http://monographs.iarc.fr/ENG/
Classification/ index.php [last update: 22
December 2016];
30. *** Cadmium in drinking-water in
Background document for preparation of
WHO Guidelines for drinking-water quality.
Geneva, WHO, 2003 (WHO/SDE/WSH/
03.04/80);
31. *** Lead in drinking-water in
Background document for preparation of
WHO Guidelines for drinking-water quality,
Geneva, WHO, 2003 (WHO/SDE/WSH/
03.04/9);
32. Logroscino G, Gao X, Chen H, Wing A,
Ascherio A – Dietary iron intake and risk of
Parkinson's disease, Am J Epidemiol, 2008,
168(12),1381-1388;
 Metallic and nemetallic elements in canned soft drinks 71

33. *** Iron in drinking-water in

Background document for preparation of
WHO Guidelines for drinking-water quality,
Geneva, WHO, 2003 (WHO/SDE/WSH/
03.04/8);
34.*** pH of Common Acids and Bases,
http://www.aqion.de/site/191 [last modified:
2016-04-20];
35. Larsen MJ, Nyvad B – Enamel erosion
by some soft drinks and orangejuices relative
to their pH, buffering effect and contents of
calciumphosphate, Carr Res, 1999, 33,81-87;
36. Panich M, Poolthong S – The effect of
casein phosphopeptide-amorphous calcium
phosphate and a cola soft drink on in vitro
enamel hardness, J Am Dental Assoc, 2009,
140(4),455-460.

0029_270117

Received 27.01.2017
Accepted 08.02.2017

ONE HEALTH INTERNATIONAL JOURNAL, 3(1),2017

One Health International Journal, 3(1),72-73,2017
One Health New Medical Concept Association, Romania
A case of human cutaneous anthrax
Simin Florescu1, Sebastian Smadu, Ana-Maria Popescu,
Emanoil Ceausu
Infectious and Tropical Diseases Hospital Dr.Victor Babes, Bucharest,
Romania
Key words: anthrax, zoonosis, cutaneous
Anthrax is zoonotic infection caused by the
gram-positive, rod-shaped bacteria Bacillus
anthracis. First descriptions of anthrax have
been found in historical texts by the writer
Virgil, but its first description was made in
1877 by Robert Koch and was used to
demonstrate his theories, and led to the invention
of the anthrax vaccine in 1887 by Louis Pasteur.
In the modern era, it has been thrown into the
spotlight because of it’s more recent use as an
agent of modern warfare and bioterrorism [1].
The Anthrax bacillus produces spores which
can be naturally found in soil and commonly
affects domestic and wild animals. The spores
thrive in locations free from ultraviolet exposure
and have been known to survive from a few
months to years and decades. The virulence of
anthrax comes from its antiphagocytic capsule
and two exotoxins, but the exact mechanism is
still under debate.
Anthrax is not contagious, and human infection
is associated with expose to infected animals
and contaminated animal products. Animals can
become infected when they breathe in or ingest
spores from contaminated soil, plants, or water.
In areas where domestic animals have had
anthrax in the past, routine vaccination can
prevent outbreaks.
It is important to note that natural incidence
is rare, but it is an occupational hazard among
1
Correspondance author: Infectious and Tropical Diseases Hospital
Dr.Victor Babes, Şos. Mihai Bravu nr. 281, Sector 3, Bucharest,
Romania, e-mail: siminflorescu@yahoo.com
SHORT NOTE
veterinarians and farmers who handle animals
and animal by-products (hair, wool, hide). It is
most common in agricultural regions of
Central and South America, sub-Saharan Africa,
central and southwestern Asia, southern and
eastern Europe, and the Caribbean, and cases
in nonagricultural regions are immediately
isolated due to the concern for bioterrorism.
There are three types of known anthrax:
cutaneous, inhalational and gastrointestinal,
with another special subdivision of injection
anthrax. Cutanous anthrax is the most common
form, appearing in 95% of cases; it is, from a
clinical standpoint, the least serious form with
a positive evolution in most cases. Inhalational
anthrax is very rarely naturally occurring, and
even a sporadic case must raise questions about
its origin; usually fatal, even in cases where
antibiotic therapy and ICU conditions are applied
from the beginning. Gastrointestinal anthrax is
common form in animals, rare in humans, and
may be fatal in some cases if left untreated. A
rare, newer form of anthrax is injection anthrax
in iv drug users; it presents atypically to
cutaneous anthrax, and treatable with antibiotic
therapy but also surgically for particular deep
localized infections.
Clinically, cutaneous anthrax presents with
pruritic papules that enlarge to form a vesicles
and subsequently becomes an ulcer with local
 Simin Florescu et al. 73

edema. The ulcer and surrounding edema evolve Test results, both cultures and PCR came
into a black eschar, and most often the sores back positive for Bacillus Anthraxis.
appear on the face, neck, arms, or hands. Antibiotic treatment was initiated imme-
Inhalation anthrax has a more serious clinical diately, with iv Penicillin 6M UI/day and oral
evolution with fever and chills, myalgia and Ciprofloxacin 500 mg BID for 14 days. The
malaise and subsequent pulmonary affection outcome was favorable, with clinical and
with shortness of breath, cough and important biological positive evolution under treatment.
chest pain, tachypnea and decreased level of
consciousness, meningismus and coma. REFERENCES
Digestive anthrax presents with gastro-intestinal
symptoms like abdominal pain and fever, nausea, 1. Mandell GL, Bennett JE, Dolin R –
vomiting, malaise, anorexia, bloody or watery Mandell, Douglas, and Bennett's Principles
diarrhea [2]. and Practice of Infectious Diseases, 8th Ed.,
The preferred diagnostic procedure for Elsevier, 2015;
cutaneous anthrax is staining of sample with 2. Chiotan M – Infectious Diseases, National
Gram or methylene blue. In patients with a Publ, 2002 (in Romanian);
suggested simptomatology for systemic disse- 3. *** Prevention and treatment of anthrax
mination, blood culture can be used for diagnosis. in adults – Results of Centers for Disease
Enzyme-linked immunosorbent assay (ELISA) Control and Prevention (CDC) Expert Panel
serologic diagnosis is also available for detection Meeting, Emerging Infectious Diseases
of the immunoglobulin G (IgG) response to CME, 2014, 20(2) online report;
the organism [3]. 4. Stevens DL, Bisno AL, Chambers HF,
Immediate initiation of antibiotic therapy is Dellinger EP, Goldstein EJ, Gorbach SL,
important in all cases. The usual proffered Hirschmann JV, Kaplan SL, Montoya JG,
therapy is Penicillin, but many new naturally Wade JC – Practice guidelines for the diagnosis
sourced spores have proven to be resistant, so and management of skin and soft tissue
another course includes oral doxycycline or infections: 2014 update by the Infectious Diseases
any quinolone for 7-14 days. A monoclonal Society of America, Clin Infect Dis, 2014,
antibody (raxibacumab) and human anthrax 59(2),e10-52.
immune globulin have been approved by the
FDA for inhalational anthrax [4].
35 year old patient from Calarasi county, 0012_170117
Romania, without any pathological antecedents,
presents for a consult at Victor Babes Clinical Recived 17.01.2017
Infectious and Tropical Disease Hospital for
Accepted: 12.02.2017
necroting, edematous lesions on his right arm.
He worked with goats and goat byproducts,
and grazed his arms while skinning an animal.
The site of the graze slowly developed a
edematous vesicle with subsequent central
necrosis, and the patient presented to his
general practitioner who prescribed a course of
Amoxicillin. Because the evolution was un-
favorable, the patient presented to the county
hospital from where he was transferred in our
clinic for specialized diagnosis and treatment.
At admission, patient presented with fever
of 38.7 °C, malaise, headache, with 3 lesions
on right forearm with a depressed centre and
black scab, edematous surrounding tissue with
Chaussier crown, and painful axillary lymph-
adenopathy. Blood tests showed leucocytosis
with neutrophilia, normal hemoglobin and
thrombocite number, normal liver and renal
function, and a moderate to low inflammatory
syndrome.

ONE HEALTH INTERNATIONAL JOURNAL 3(1),2017