Вы находитесь на странице: 1из 1152

Tradução:

Carlos Henrique de Araújo Cosendey


Paulo Henrique Machado

PARA TODOS OS ESTUDANTES DE ANESTESIOLOGIA

M294 Manual de anestesiologia clínica [recurso eletrônico] / Paul G.


Barash ... [et al.] ; revisão técnica : Luciana Cadore Stefani,
Patrícia Wajnberg Gamermann. – 7. ed. – Porto Alegre :
Artmed, 2014.

Editado também como livro impresso em 2014.


ISBN 978-85-8271-106-4

1. Anestesiologia - Manual. I. Barash, Paul G.

CDU 612.887(035)

Catalogação na publicação: Poliana Sanchez de Araujo – CRB 10/2094

Barash_Iniciais_7ed_eletronica.indd ii 06/09/14 22:37


Paul G. Barash, MD Robert K. Stoelting, MD M. Christine Stock, MD
Bruce F. Cullen, MD Michael K. Cahalan, MD Rafael Ortega, MD

Revisão técnica desta edição:


Luciana P. Cadore Stefani
Médica anestesiologista.
Professora adjunta do Departamento de Cirurgia da
Universidade Federal do Rio Grande do Sul (UFRGS).
Responsável pelo Centro de Ensino e Treinamento em Anestesiologia do Serviço de
Anestesiologia e Medicina Perioperatória do Hospital de Clínicas de Porto Alegre.
Doutora pelo Programa de Pós-Graduação em Medicina: Ciências Médicas da UFRGS.
Patricia Wajnberg Gamermann
Médica anestesiologista.
Chefe da Unidade de Residência Médica e Pesquisa do Serviço de Anestesiologia e
Medicina Perioperatória do Hospital de Clínicas de Porto Alegre.
Título Superior em Anestesiologia.

Versão impressa
desta obra: 2015

2015

Barash_Iniciais_7ed_eletronica.indd iii 06/09/14 22:37


Obra originalmente publicada sob o título Handbook of clinical anesthesia, 7th Edition
ISBN 9781451176155
Copyright © 2013 Lippincott Williams & Wilkins, a Wolters Kluwer business.
Lippincott Williams & Wilkins/Wolters Kluwer Health did not participate in the translation
of this title.
Published by arrangement with Lippincott Williams & Wilkins/Wolters Kluwer Health Inc. USA.

Gerente editorial: Letícia Bispo de Lima

Colaboraram nesta edição:


Preparação de originais e leitura final: Heloísa Stefan
Capa: Paola Manica
Editoração: Techbooks

NOTA
A medicina é uma ciência em constante evolução. À medida que novas pesquisas e a pró-
pria experiência clínica ampliam o nosso conhecimento, são necessárias modificações na
terapêutica, em que também se insere o uso de medicamentos. Os autores desta obra consul-
taram as fontes consideradas confiáveis, num esforço para oferecer informações completas
e, geralmente, de acordo com os padrões aceitos à época da publicação. Entretanto, tendo
em vista a possibilidade de falha humana ou de alterações nas ciências médicas, os leitores
devem confirmar essas informações com outras fontes. Por exemplo, e em particular, os lei-
tores são aconselhados a conferir a bula completa de qualquer medicamento que pretendam
administrar, para se certificar de que a informação contida neste livro está correta e de que
não houve alteração na dose recomendada nem nas precauções e contraindicações para o seu
uso. Essa recomendação é particularmente importante em relação a medicamentos introdu-
zidos recentemente no mercado farmacêutico ou raramente utilizados.

Reservados todos os direitos de publicação, em língua portuguesa, à


ARTMED EDITORA LTDA., uma empresa do GRUPO A EDUCAÇÃO S.A.
Av. Jerônimo de Ornelas, 670 – Santana
90040-340 – Porto Alegre – RS
Fone: (51) 3027-7000 Fax: (51) 3027-7070

É proibida a duplicação ou reprodução deste volume, no todo ou em parte, sob quaisquer formas
ou por quaisquer meios (eletrônico, mecânico, gravação, fotocópia, distribuição na Web e outros),
sem permissão expressa da Editora.

Unidade São Paulo


Av. Embaixador Macedo Soares, 10.735 – Pavilhão 5 – Cond. Espace Center
Vila Anastácio – 05095-035 – São Paulo – SP
Fone: (11) 3665-1100 Fax: (11) 3667-1333

SAC 0800 703-3444 – www.grupoa.com.br

IMPRESSO NO BRASIL
PRINTED IN BRAZIL

Barash_Iniciais.indd iv 22/08/14 17:40


ORGANIZADORES

Paul G. Barash, md Michael K. Cahalan, md


Professor Professor and Chair
Department of Anesthesiology Department of Anesthesiology
School of Medicine School of Medicine
Yale University School of Medicine The University of Utah
Attending Anesthesiologist Salt Lake City, Utah
Yale-New Haven Hospital
New Haven, Connecticut M. Christine Stock, md
Professor and Chair
Bruce F. Cullen, md Department of Anesthesiology
Emeritus Professor Feinberg School of Medicine
Department of Anesthesiology Northwestern University
School of Medicine Chicago, Illinois
University of Washington
Seattle, Washington Rafael Ortega, md
Professor
Robert K. Stoelting, md Department of Anesthesiology
Emeritus Professor and Past Chair School of Medicine
Department of Anesthesia Boston University
School of Medicine Boston, Massachussetts
Indiana University
Indianapolis, Indiana

Barash_Iniciais.indd v 22/08/14 17:40


Esta página foi deixada em branco intencionalmente.

Barash_Iniciais.indd vi 22/08/14 17:40


COAUTORES

Agradecemos os esforços de todos os coautores da 7ª edição do livro que deu


origem a este Manual, o Clinical anesthesia, também 7ª edição.

Aaron Sandler, MD, PhD Douglas R. Bacon, MD, MA


Aarti Sharma, MD Edmond Cohen, MD
Adam D. Lichtman, MD Erik Olofsen, MSc
Adam K. Jacob, MD Ferne R. Braveman, MD
Albert C. Perrino, Jr., MD François Donati, MD, PhD, FRCPC
Albert Dahan, MD Frank J. Overdyk, MSEE, MD
Alex S. Evers, MD G. Alec Rooke, MD, PhD
Amalia Cochran, MD Gerard Manecke, MD
Ana Fernandez-Bustamante, MD, Gina C. Badescu, MD
PhD Girish P. Joshi, MBBS, MD, FFARCSI
Andrew F. Stasic, MD Glenn Ramsey, MD
Andrew J. Pittaway, FRCA Harriet W. Hopf, MD
Andrew Shaw, MB, FRCA, FCCM Harry A. Seifert, MD, MSCE
Anthony Cunningham, MD Honorio T. Benzon, MD
Armagan Dagal, MD, FRCA Hugh M. Smith, MD
Arthur M. Lam, MD, FRCPC J. Lance Lichtor, MD
Asokumar Buvanendran, MD J. Sean Funston, MD
Ban C.H. Tsui, MSc, MD, FRCP(C) J. Steven Hata, MD, FCCP, MSc
Barbara M. Scavone, MD James B. Eisenkraft, MD
Ben Julian Palanca, MD, PhD Jan Ehrenwerth, MD
Benjamin Sherman, MD Jay S. Grider, DO, PhD
Brenda Bucklin, MD Jeana E. Havidich, MD
Bruce D. Spiess, MD, FAHA Jeffrey J. Schwartz, MD
C. Michael Crowder, MD, PhD Jerrold H. Levy, MD, FAHA, FCCM
C. Richard Chapman, PhD Jerrold Lerman, MD, FRCPC,
Catherine Kuhn, MD FANZCA
Charles D. Nargozian, MD John H. Eichhorn, MD
Charles W. Otto, MD, FCCM John P. Kampine, MD, PhD
Christer H. Svensén, MD, PhD, Jonathan D. Katz, MD
DEAA, MSc Joseph P. Mathew, MD
Christopher M. Bernards, MD* Karen B. Domino, MD, MPH
Christopher W. Connor, MD, PhD Karen J. Souter, MB, BS, MSc, FRCA
Dalia Banks, MD, FASE Karen L. Posner, PhD
David A. Lubarsky, MD, MBA Kathryn E. Glas, MD, MBA
David F. Stowe, MD, PhD Kathryn E. McGoldrick, MD
Dhanesh K. Gupta, MD Katie Schenning, MD, MPH
Donald S. Prough, MD Kevin Friede, BA
Kevin J. Gingrich, MD
Kevin T. Riutort, MD, MS
* Falecido. Larry Lindenbaum, MD

Barash_Iniciais.indd vii 22/08/14 17:40


viii Coautores

Laurence M. Hausman, MD Richard W. Rosenquist, MD


Lee A. Fleisher, MD Robert S. Holzman, MD
Levon M. Capan, MD Robert W. Hurley, MD, PhD
Loreta Grecu, MD Saint Adeogba, MD
Louanne M. Carabini, MD Sandra L. Kopp, MD
Lucy S. Hostetter, MD Sanford M. Miller, MD
Lynne R. Ferrari, MD Santhanam Suresh, MD
Marcelle E. Blessing, MD Scott M. Fishman, MD
Marie Csete, MD, PhD Shamsuddin Akhtar, MD
Marieke Niesters, MD Simon C. Hillier, MB, ChB
Mark Stafford-Smith, MD, CM, Spencer S. Liu, MD
FRCPC Stanley H. Rosenbaum, MA, MD
Matthew R. Eng, MD Stephen F. Dierdorf, MD
Matthew R. Hallman, MD Stephen J. Thomas, MD
Meg A. Rosenblatt, MD Stephen M. Macres, PharmD, MD
Merriam Treggiari, MD Steven C. Hall, MD
Michael A. Fowler, MD, MBA Steven Deem, MD
Michael B. Dorrough, MD Steven I. Gayer, MD, MBA
Michael J. Murray, MD, PhD, FCCM, Steven M. Neustein, MD
FCCP Tara M. Hata, MD
Michael L. Ault, MD, FCCP, FCCM Terese T. Horlocker, MD
Michael P. Hutchens, MD, MA Terry Smith, PhD
Michael S. Mazurek, MD Thomas J. Ebert, MD, PhD
Michelle Y. Braunfeld, MD Thomas K. Henthorn, MD
Mihai V. Podgoreanu, MD Timothy E. Miller, MBChB, FRCA
Nathan Leon Pace, MD, MStat Timothy R. Deer, MD
Nikolaos J. Skubas, MD, FASE Todd J. Smaka, MD
Paul C. Tamul, DO Tong J. Gan, MD
Paul S. Pagel, MD, PhD Wanda M. Popescu, MD
Peter G. Moore, MD, PhD Wariya Sukhupragarn, MD
Randal O. Dull, MD, PhD William H. Rosenblatt, MD
Randolph H. Steadman, MD Yi Lin, MD, PhD

Barash_Iniciais.indd viii 22/08/14 17:40


PREFÁCIO

Bem-vindo à 7ª edição do Manual de anestesiologia clínica, elaborado para pre-


encher todos os requisitos para que os provedores de assistência médica possam
ter as informações essenciais contidas no livro maior, mas em um formato de
bolso. Este Manual continua desempenhando um papel importante, mesmo
com o advento dos computadores pessoais, smart phones e tablets.
Dr. Robert Stoelting foi o grande mentor do Manual desde o início em
1991 até esta edição, sua última participação. Cada um dos demais organizado-
res agradece ao Dr. Stoelting seus esforços e o tempo que dedicou ao projeto e,
ainda mais importante, por ter sido um importante modelo de conduta.
Esta edição do Manual contém um novo capítulo sobre procedimentos
laparoscópicos e em cirurgia robótica. Além disso, os apêndices sobre eletro-
cardiografia e marca-passos/desfibriladores implantáveis foram aprimorados
graficamente, para facilitar o entendimento desses temas tão importantes. Além
disso, em torno de 20% dos capítulos foram escritos por novos coautores do
livro maior.
Assim, queremos agradecer aos coautores opriginais do Clinical anesthe-
sia, pois, embora este Manual tenha sido elaborado por novos convidados, os
capítulos foram desenvolvidos a partir do conhecimento específico desses pro-
fissionais, sendo reorganizados e reescritos para se adequar ao texto da presente
obra. Queremos agradecer também aos assistentes administrativos Gail Norup,
Ruby Wilson, Deanna Walker e Mary Wynn. Expressamos nossos agradecimen-
tos, ainda, aos editores da Lippincott Williams & Wilkins-Wolters Kluwer, Brian
Brown e Lisa McAllister, pelo comprometimento com a excelência. Para fina-
lizar, expressamos nossa gratidão a Nicole Dernoski, editora sênior na LWW;
Chris Miller, gerente de produção na Aptara; Lisa Lawrence, gerente de marke-
ting na LWW, cujo gerenciamento diário deste projeto resultou em uma publica-
ção que excedeu nossas expectativas.

Os organizadores

Barash_Iniciais.indd ix 22/08/14 17:40


Esta página foi deixada em branco intencionalmente.

Barash_Iniciais.indd x 22/08/14 17:40


SUMÁRIO

SEÇÃO I INTRODUÇÃO À ANESTESIOLOGIA


1 História da Anestesia 1
2 Particularidades da Especialidade 7
3 Saúde Ocupacional 15
4 Risco Anestésico, Melhorias na Qualidade e na
Responsabilidade 29

SEÇÃO II FUNDAMENTOS CIENTÍFICOS


DA ANESTESIA
5 Mecanismos da Anestesia e da Consciência 39
6 Base Genômica da Medicina Perioperatória 50
7 Princípios Básicos da Farmacologia Clínica 65
8 Segurança Elétrica e Contra Incêndios 80
9 Delineamento Experimental e Estatística 94

SEÇÃO III ANATOMIA E FISIOLOGIA


10 Anatomia e Fisiologia do Coração 99
11 Função Respiratória e Anestesia 112
12 A Resposta Alérgica 129
13 Inflamação, Cicatrização das Feridas e Infecção 139
14 Fisiologia dos Líquidos, dos Eletrólitos e do Equilíbrio
Acidobásico 154
15 Sistema Nervoso Autônomo: Fisiologia e Farmacologia 179
16 Hemostasia e Medicina Transfusional 204

Barash_Iniciais.indd xi 22/08/14 17:40


xii Sumário

SEÇÃO IV FÁRMACOS ANESTÉSICOS, ADJUVANTES


E INTERAÇÕES MEDICAMENTOSAS
17 Anestésicos Inalatórios 227
18 Anestésicos Intravenosos 252
19 Opioides 271
20 Agentes Bloqueadores Neuromusculares 290
21 Anestésicos Locais 310

SEÇÃO V AVALIAÇÃO E PREPARO PRÉ-ANESTÉSICO


22 Avaliação e Preparo Pré-Anestésico 325
23 Doenças Raras e Coexistentes 347
24 Estação de Trabalho e Sistemas de Administração de
Anestésicos Inalatórios 370

SEÇÃO VI MANEJO ANESTÉSICO


25 Monitorização 387
26 Ecocardiografia 405
27 Manejo das Vias Aéreas 417
28 Posicionamento dos Pacientes e Lesões Associadas 434
29 Cuidados Monitorados de Anestesia 441
30 Anestesia Ambulatorial 456
31 Anestesia em Clínicas 469
32 Anestesia Fora de Centros Cirúrgicos 482
33 Anestesia em Pacientes Idosos 496
34 Anestesia Peridural e Anestesia Raquidiana 508

Barash_Iniciais.indd xii 22/08/14 17:40


Sumário xiii

SEÇÃO VII ANESTESIA PARA SUBESPECIALIDADES


CIRÚRGICAS
35 Bloqueios de Nervos Periféricos 535
36 Anestesia em Neurocirurgia 553
37 Anestesia em Cirurgia Torácica 580
38 Anestesia em Cirurgia Cardíaca 597
39 Anestesia em Cirurgia Vascular 621
40 Anestesia Obstétrica 637
41 Anestesia Neonatal 658
42 Anestesia Pediátrica 674
43 Anestesia para Procedimentos Laparoscópicos
e em Cirurgia Robótica 696
44 Anestesia e Obesidade 711
45 Fígado: Cirurgia e Anestesia 730
46 Função Endócrina 749
47 Anestesia em Cirurgia Otorrinolaringológica 770
48 Anestesia em Cirurgia Oftalmológica 780
49 Sistema Renal e Anestesia em Cirurgia Urológica 792
50 Anestesia em Cirurgia Ortopédica 823
51 Anestesia para Transplantes 842
52 Traumatismos e Queimaduras 858
53 Atendimento Emergencial em Calamidades Públicas
por Desastres Naturais e Acidentes Químicos, Biológicos,
Radiológicos, Nucleares e Explosivos de Longo Alcance 890

Barash_Iniciais.indd xiii 22/08/14 17:40


xiv Sumário

SEÇÃO VIII CUIDADOS PERIOPERATÓRIOS E


SERVIÇOS DE CONSULTORIA
54 Recuperação Pós-Anestésica 903
55 Medicina Intensiva 918
56 Tratamento da Dor Aguda 942
57 Tratamento da Dor Crônica 964
58 Reanimação Cardiopulmonar 982

APÊNDICES
A Fórmulas 1005
B Atlas Eletrocardiográfico 1009
C Protocolos para Marca-Passos e Desfibriladores Cardíacos
Implantáveis 1041
D Protocolos de Ressuscitação da American Heart Association
(AHA) 1057
E Normas, Orientações e Parâmetros Práticos da American
Society of Anesthesiologists 1078
F Algoritmos de Abordagem da Via Aérea e da Via
Aérea Difícil 1095
G Protocolo de Atendimento à Hipertermia Maligna 1097
H Medicamentos Fitoterápicos 1100

Índice 1109

Barash_Iniciais.indd xiv 22/08/14 17:40


SEÇÃO
Introdução à
I Anestesiologia

CAPÍTULO

1
História da Anestesia
Embora a maior parte das civilizações humanas tenha desenvolvido algum mé-
todo para diminuir o desconforto dos pacientes, a anestesia, em seu significado
moderno atual, é uma descoberta comparativamente recente, cujas origens ras-
treáveis remontam a 160 anos. (O epitáfio de um monumento em homenagem
a William T. G. Morton, um dos fundadores da anestesia, diz o seguinte: “Antes
dele, em todos os tempos, a Cirurgia era uma Agonia.”) (Jacob AK, Kopp SL,
Bacon DR, Smith HM. The history of anesthesia. Em: Barash PG, Cullen BF,
Stoelting RK, Cahalan MK, Ortega R, Stock MC, Eds. Clinical Anesthesia. Phila-
delphia: Lippincott Williams & Wilkins; 2013: 1-27.)

I. ANESTESIA ANTES DO ÉTER. De maneira geral, além das limitações


do conhecimento técnico, as atitudes culturais em relação à dor são citadas
como as razões que, durante séculos, levaram os humanos a suportar cirur-
gias sem qualquer anestesia.
A. Os Primeiros Analgésicos e Soporíferos (Tab. 1.1)
B. Quase uma Descoberta: Clarke, Long e Wells
1. Em janeiro de 1842, em Rochester, NY, William E. Clarke, então
um estudante de medicina, talvez tenha sido o primeiro médico a
aplicar anestesia com éter em um caso de extração dentária.
2. Em 30 de março de 1842, na cidade de Jefferson, GA, Crawford
Williamson Long administrou éter na anestesia cirúrgica aplica-
da em James M. Venable para remoção de um tumor no pesco-
ço. Long relatou o sucesso da aplicação do anestésico somente em
1849, ocasião em que a anestesia com éter já era de conhecimento
geral.
3. Horace Wells observou os “efeitos analgésicos” do óxido nitroso
quando participou de um seminário apresentado pelo “cientista”
itinerante Gardner Quincy Colton. Algumas semanas mais tarde,
em janeiro de 1845, Wells tentou realizar uma demonstração pú-
blica na Harvard Medical School, em Boston, porém a experiência
foi considerada um fracasso.
C. Demonstração Pública de Anestesia com Éter. William Thomas
Green Morton foi responsável pela primeira demonstração pública
bem-sucedida de analgesia com éter. Essa demonstração, que aconte-

Barash_I.indd 1 22/08/14 17:39


2 Barash, Cullen, Stoelting, Cahalan, Stock, Ortega

TABELA 1.1 Os primeiros analgésicos e soporíferos


Mandrágora (esponja soporífera)
Álcool
Éter dietílico (conhecido no século XVI e, possivelmente, desde o século VIII)
Óxido nitroso (preparado por Joseph Priestly em 1773)

ceu no Bullfinch Amphitheater do Massachusetts General Hospital,


em 16 de outubro de 1846, tornou-se inesquecível pela declaração do
cirurgião à sua audiência, no final do procedimento: “Senhores, isto não
é charlatanice”.
D. Clorofórmio e Obstetrícia
1. James Young Simpson, obstetra bem-sucedido de Edimburgo, Es-
cócia, foi um dos pioneiros no uso do éter para aliviar a dor em
obstetrícia. A insatisfação com o uso do éter foi um grande incen-
tivo para a utilização de clorofórmio.
2. A aprovação da rainha Vitória à anestesia obstétrica resultou na
aceitação do uso da anestesia nos trabalhos de parto.
3. John Snow interessou-se pela prática anestésica imediatamente
após a divulgação das notícias da anestesia com éter na Inglaterra
em dezembro de 1846. Snow desenvolveu uma máscara que se as-
semelhava às máscaras faciais modernas e, além disso, introduziu
um inalador de clorofórmio.

II. PRINCÍPIOS ANESTÉSICOS, EQUIPAMENTOS E NORMAS


A. Controle das Vias Aéreas
1. O controle definitivo das vias aéreas, habilidade considerada im-
prescindível pelos anestesiologistas, foi desenvolvido somente
depois que muitos episódios dolorosos e apneicos incentivaram o
desenvolvimento de técnicas mais seguras de tratamento.
2. Joseph Clover, um cidadão inglês, foi o primeiro indivíduo a reco-
mendar a prática de tracionar a mandíbula para evitar obstrução
das vias aéreas pela língua.
B. Intubação Traqueal
1. O desenvolvimento de técnicas e instrumentos para intubação está
entre os avanços mais importantes registrados na história da anes-
tesiologia.
2. Joseph O’Dwyer, um cirurgião norte-americano, desenhou vários
tubos laríngeos metálicos, que eram inseridos às cegas, entre as
cordas vocais de crianças com crises diftéricas.
3. Em 1895, em Berlim, Alfred Kirstein projetou o primeiro laringos-
cópio com visão direta.

Barash_I.indd 2 22/08/14 17:39


Manual de Anestesiologia Clínica 3

4. Antes da introdução dos relaxantes musculares na década de 1940,


a intubação traqueal era um grande desafio. Entretanto, esse de-
safio tornou-se muito mais fácil com o advento de laringoscópios
com lâminas especificamente desenhadas para aumentar a visuali-

Introdução à Anestesiologia
zação das cordas vocais.
5. Em 1926, Arthur Guedel iniciou uma série de experimentos que
resultaram na introdução do tubo com balonete.
6. Em 1953, os tubos de lúmen único foram complementados por tu-
bos endotraqueais de duplo lúmen.
C. Dispositivos Avançados para as Vias Aéreas. Os laringoscópios con-
vencionais são comprovadamente inadequados para pacientes com vias
aéreas difíceis. O Dr. A. I. J. “Archie” Brain identificou, pela primeira
vez, em 1981, o princípio da máscara laríngea.
D. Primeiros Sistemas de Aplicação de Anestesia. John Snow criou
inaladores de éter, e Joseph Clover foi o primeiro indivíduo a admi-
nistrar clorofórmio, em concentrações conhecidas, através da “bolsa
de Clover”. O desenvolvimento de um aparelho capaz de administrar
quantidades calibradas de gás e de anestésicos voláteis (incluindo ab-
sorção de dióxido de carbono, vaporizadores e ventiladores) foi extre-
mamente importante para aumentar a segurança dos pacientes.
E. Dois cirurgiões norte-americanos, George W. Crile e Harvey Cushing,
defendiam a monitorização da pressão arterial sistêmica durante a
anestesia. Em 1902, Cushing utilizou o manguito de Riva Rocci para
medições da pressão arterial que foram registradas em um relatório de
anestesia.
1. O uso difundido de técnicas como eletrocardiografia, oximetria de
pulso, gasometria, capnografia e monitorização do bloqueio neu-
romuscular reduziu o nível de morbidade e mortalidade e revolu-
cionou a prática da anestesia.
2. A monitorização contínua dos movimentos respiratórios e a visua-
lização em forma de onda da concentração de dióxido de carbono
expirada (absorção infravermelha) confirmam a intubação endo-
traqueal (excluem a hipótese de intubação esofágica acidental).
F. Normas de Segurança. A introdução das características de segurança
foi coordenada pelo American National Standards Institute Committee
Z79, com patrocínio da American Society of Anesthesiologists, durante
o período de 1956 a 1983. Desde 1983, representantes da indústria, do
governo e dos profissionais da área de assistência médica têm partici-
pado de reuniões conhecidas como Comitê Z79 da American Society
for Testing and Materials. Essa organização delibera normas que se
transformam em normas nacionais para a segurança dos equipamentos
de anestesia.

Barash_I.indd 3 22/08/14 17:39


4 Barash, Cullen, Stoelting, Cahalan, Stock, Ortega

III. HISTÓRIA DOS AGENTES ANESTÉSICOS E ADJUVANTES


A. Anestésicos Inalatórios. Os hidrocarbonetos fluorados revoluciona-
ram a anestesia inalatória (halotano em 1956, metoxiflurano em 1960,
enflurano e isoflurano na década de 1970, desflurano em 1992 e sevo-
flurano em 1994).
B. Anestésicos Intravenosos. O tiopental foi aplicado pela primeira vez
em um paciente em março de 1934, na Universidade de Wisconsin, se-
guido por cetamina (1960), etomidato e, mais recentemente, propofol.
C. Anestésicos Locais. O uso de aminoésteres (procaína em 1905, tetraca-
ína) era muito comum em infiltrações locais e em anestesias raquidia-
nas, apesar de sua baixa potência e da grande probabilidade de causar
reações alérgicas. A lidocaína, um anestésico local aminoamida, foi de-
senvolvida em 1944 e conquistou popularidade imediata por causa da
sua potência, do seu rápido início de ação, da sua baixa incidência de
reações alérgicas e da sua boa eficácia para todos os tipos de bloqueio
anestésico regional. Desde a introdução da lidocaína, todos os anestési-
cos locais desenvolvidos e comercializados (mepivacaína, bupivacaína,
ropivacaína, levobupivacaína) pertencem à classe aminoamida.
D. Os opioides são usados rotineiramente no tratamento da dor durante o
período perioperatório e em uma grande variedade de situações de dor
aguda e crônica. Em 1939, foi desenvolvida a meperidina, o primeiro
opioide sintético. O fentanil foi desenvolvido em 1960, e, a seguir, sur-
giram o sufentanil, o alfentanil e o remifentanil. O cetorolaco, fármaco
anti-inflamatório não esteroide (AINE) aprovado para uso em 1990, foi
o primeiro AINE indicado para tratamento de dor pós-operatória.
E. Os relaxantes musculares passaram a fazer parte da prática anestésica
quase um século depois do desenvolvimento dos anestésicos inalató-
rios. O curare, primeiro agente de bloqueio neuromuscular conheci-
do, foi usado originalmente pelos povos nativos da América do Sul em
caçadas e guerras tribais. A aplicação clínica do curare ocorreu após a
introdução da intubação traqueal e do controle da ventilação pulmo-
nar. Em 23 de janeiro de 1942, Griffith e seu residente, Enid Johnson,
utilizaram curare e anestesiaram e intubaram a traqueia de um jovem,
logo no início de uma apendicectomia. O relaxamento abdominal foi
satisfatório, e a cirurgia prosseguiu sem incidentes. O relato de Griffith
e Johnson sobre o uso bem-sucedido de curare em uma série de 25 pa-
cientes iniciou uma revolução na prática anestésica. Em 1949, a succi-
nilcolina foi preparada por Daniel Bovet, ganhador do prêmio Nobel, e
foi usada amplamente em nível internacional, antes de os historiadores
terem observado que esse fármaco havia sido sintetizado e testado no
início do século XX. O reconhecimento de que o atracúrio e o cisa-
tracúrio sofrem degradação espontânea pela eliminação de Hoffmann
definiu o papel desses relaxantes musculares em pacientes portadores
de insuficiência renal e hepática.

Barash_I.indd 4 22/08/14 17:39


Manual de Anestesiologia Clínica 5

F. Antieméticos. A evolução na eficácia dos tratamentos de pacientes


com náuseas e vômitos no pós-operatório (NVPO) é recente e ganhou
força com os incentivos para limitar as despesas hospitalares e melho-
rar a satisfação dos pacientes. Os efeitos antieméticos dos corticoste-

Introdução à Anestesiologia
roides foram reconhecidos pela primeira vez por oncologistas que tra-
tavam pacientes com edema intracraniano provocado por tumores. O
reconhecimento do papel da via serotoninérgica (5-HT3) no manejo de
NVPO resultou em uma incomparável classe de fármacos (incluindo o
ondansetron em 1991) dirigida a esse problema específico.

IV. SUBESPECIALIDADES ANESTÉSICAS


A. Anestesia Regional. A expressão “anestesia raquidiana” foi criada em
1885 por um neurologista, Leonard Corning, embora, na realidade,
seja mais provável que ele tenha aplicado uma injeção peridural. Em
1944, Edward Tuohy, da Clínica Mayo, introduziu o uso da agulha de
Tuohy para facilitar a aplicação de técnicas espinais contínuas. Em
1949, Martinez Curbelo, de Havana, Cuba, usou a agulha de Tuohy e
um cateter ureteral para aplicar o primeiro anestésico peridural con-
tínuo. As várias contribuições de John J. Bonica para a anestesiologia
durante os períodos de serviço militar, civil e acadêmico na Univer-
sidade de Washington incluíram o desenvolvimento de uma clínica
multidisciplinar para tratamento da dor e na publicação do texto The
Management of Pain.
B. Anestesia Cardiovascular. Muitas pessoas acreditam que o sucesso da
ligação feita por Robert Gross no ducto arterial patente de uma garota
de 7 anos de idade, em 1938, tenha sido o marco inicial da cirurgia car-
díaca moderna. A primeira utilização bem-sucedida em humanos do
aparelho de circulação extracorpórea de Gibbon, em maio de 1953, foi
um avanço extraordinário no tratamento cirúrgico de patologias cardía-
cas complexas. Em 1967, J. Earl Waynards publicou um dos primeiros
artigos sobre o manejo anestésico de pacientes submetidos ao tratamen-
to cirúrgico da doença arterial coronariana. A ventilação mecânica pós-
-operatória e as unidades cirúrgicas de tratamento intensivo surgiram
no final da década de 1960. Posteriormente, a ecocardiografia transeso-
fágica ajudou a definir a subespecialidade de anestesia cardíaca.
C. Neuroanestesia. Embora a introdução de agentes como tiopental,
curare e halotano tenha produzido avanços na anestesiologia em geral,
o desenvolvimento de métodos para medir a atividade elétrica cere-
bral, o fluxo sanguíneo cerebral e a taxa metabólica colocou a prática
da neuroanestesia em um patamar científico.
D. Anestesia Obstétrica. As atitudes sociais em relação à dor associada
ao parto começaram a mudar a partir da década de 1860, e as mulheres
passaram a exigir a anestesia. O sistema de Virginia Apgar para avalia-
ção de recém-nascidos, desenvolvido em 1953, demonstrou que havia

Barash_I.indd 5 22/08/14 17:39


6 Barash, Cullen, Stoelting, Cahalan, Stock, Ortega

uma diferença nos neonatos de mães que haviam sido anestesiadas. Na


última década, as mortes relacionadas à anestesia durante cesarianas
sob anestesia geral tornaram-se mais prováveis do que as mortes rela-
cionadas à anestesia neuroaxial, fato que transformou a anestesia regio-
nal no método de escolha. Com a disponibilidade de opções seguras
e eficazes para o alívio da dor durante o trabalho de parto e o parto
propriamente dito, o foco atual é melhorar a qualidade da experiência
do nascimento para pais expectantes.

V. PROFISSIONALISMO E PRÁTICA ANESTÉSICA


A. Anestesiologia Organizada. A Long Island Society of Anesthetists,
primeira organização médica norte-americana de anestesiologia, foi
fundada por nove médicos em 6 de outubro de 1905. Os membros
tinham obrigações anuais de U$ 1,00. Uma das figuras mais notáveis
na luta para profissionalizar a anestesiologia foi Francis Hoffer McMe-
chan, que se tornou editor da primeira revista especializada em anes-
tesia, Current Researches in Anesthesia and Analgesia, precursora da
Anesthesia and Analgesia, revista mais antiga da especialidade. Ralph
Waters e John Lundy, entre outros, participaram no processo evolutivo
da organização da especialidade.
B. Anestesiologia Acadêmica. Em 1927, Erwin Schmidt, professor de
cirurgia na Faculdade de Medicina de Wisconsin, incentivou Dean
Charles Bardeen a recrutar Dr. Ralph Waters para a primeira posição
acadêmica norte-americana em anestesiologia.
C. Constituindo uma Sociedade. Em 1936, a New York Society of
Anesthetists alterou a denominação social para American Society of
Regional Anesthesia. Em 1938, a American Board of Anesthesiology,
em combinação com a American Society of Regional Anesthesia, foi
organizada como uma diretoria subordinada à American Board of
Surgery, tornando-se uma entidade independente a partir de 1940. Em
1945, Ralph Waters foi eleito o primeiro presidente da nova entidade,
que passou a se chamar American Society of Anesthesiologists.

Barash_I.indd 6 22/08/14 17:39


CAPÍTULO

2
Particularidades da Especialidade
Nos EUA, a prática médica, incluindo a infraestrutura e os detalhes funcionais,
encontra-se em fase de mudanças e de evolução rápida (Eichhorn JH, Grider JS.
Scope of practice. Em: Barash PG, Cullen BF, Stoelting RK, Cahalan MK, Ortega
R, Stock MC, Eds. Clinical Anesthesia. Philadelphia, Lippincott Williams & Wi-
lkins; 2013: 28-60). Tradicionalmente, os anestesiologistas pouco se envolviam
na administração de vários componentes de sua área de atuação além de sua
prática médica diária.

I. COMPONENTES ADMINISTRATIVOS DA PRÁTICA DA


ANESTESIOLOGIA
A. Recursos Operacionais e Informações
1. A American Society of Anesthesiologists (ASA) fornece a seus
membros um material extenso sobre a prática da especialidade
(www.asahq.org) (Tab. 2.1).
2. Esses documentos são atualizados regularmente pela ASA por
meio de seus comitês e da House of Delegates.
3. O site da Anesthesia Patient Safety Foundation (www.apsf.org) é bas-
tante útil no que diz respeito à promoção de práticas clínicas seguras.
B. Processo de Credenciamento e Privilégios Clínicos
1. O sistema de credenciamento de profissionais da área da saúde e
a concessão de privilégios clínicos são motivados pela premissa de
que educação adequada, treinamento e experiência, aliados à au-
sência de um número excessivo de resultados adversos, aumentam
a probabilidade de que o atendimento feito por um profissional
credenciado seja de alta qualidade.
2. A ASA distribui formulários para credenciamento de anestesiolo-
gistas.
3. Um tema importante na concessão de privilégios clínicos, particu-
larmente em especialidades baseadas em procedimentos como a
anestesiologia, é conceder privilégios “gerais” (i.e., direito de fazer
tudo o que estiver tradicionalmente associado à especialidade).
C. Manutenção de Certificação em Anestesiologia
1. A partir de 1o de janeiro de 2000, a certificação inicial concedida
pela American Board of Anesthesiology passou a ter um “prazo
limitado”, com validade de 10 anos. A Maintenance of Certifica-
tion in Anesthesiology (MOCA) é o processo formal para novas
certificações por um período adicional e, a seguir, por intervalos
subsequentes de 10 anos.
2. O programa MOCA, em vigor desde 2000, subdivide-se em quatro
componentes ou módulos que incluem sustentação profissional,
aprendizado permanente e autoavaliação, exames cognitivos, ava-
liação e aprimoramento da experiência prática.

Barash_I.indd 7 22/08/14 17:39


8 Barash, Cullen, Stoelting, Cahalan, Stock, Ortega

TABELA 2.1 Materiais sobre a prática da anestesia fornecidos pela


American Society of Anesthesiologists
Organização do Departamento de Anestesia
Orientações para Delineamento de Privilégios Clínicos em Anestesiologia
Orientações para Programas de Educação Complementar
Orientações para Prática Ética da Anestesiologia
Orientações Éticas para Cuidados Anestésicos de Pacientes com Ordens de Não
Ressuscitação ou Outras Diretrizes que Limitam o Tratamento
Orientações para Atendimento de Pacientes em Anestesiologia
Orientações para Qualificação Técnica e Testemunho de Peritos
Orientações para Delegação de Funções Técnicas Anestésicas para Pessoas Fora da
Área Médica
A Equipe de Cuidados Anestésicos
Declaração de Conflito de Interesses
Declaração de Credenciamento Econômico
Declaração do Direito de Praticar de um Membro
Declaração Sobre Rotinas de Exames Laboratoriais e de Diagnósticos Pré-Operatórios

D. Participação e Relacionamentos de Equipes Profissionais


1. As atividades das equipes médicas são cada vez mais importantes
para obtenção favorável de um status de acreditação hospitalar.
2. Os anestesiologistas devem participar ativamente nas atividades
administrativas (Tab. 2.2).
E. Definição das Normas Assistenciais e Compreensão do Padrão de
Atendimento
1. A anestesiologia norte-americana é uma das líderes na definição
de normas para o exercício da profissão com a finalidade de ma-
ximizar a qualidade dos serviços e de auxiliar o anestesiologista
a tomar decisões difíceis, como aspectos relacionados ao risco-
-benefício e ao custo-benefício de práticas específicas (Tab. 2.3).
2. O padrão de atendimento é definido por condutas e habilidades
esperadas de um profissional prudente para com todos os seus pa-
cientes.
a. A impossibilidade de atingir o padrão de atendimento é consi-
derada imperícia médica.
b. Tradicionalmente, os tribunais baseiam-se em pareceres de es-
pecialistas médicos para caracterizar o padrão de atendimento
e verificar se as normas pertinentes foram aplicadas em cada
caso.
3. Assumindo a Liderança. Os anestesiologistas participam ativa-
mente na publicação das normas de atendimento (Tab. 2.3).

Barash_I.indd 8 22/08/14 17:39


Manual de Anestesiologia Clínica 9

TABELA 2.2 Exemplos da participação de anestesiologistas em


atividades administrativas
Credenciamento

Introdução à Anestesiologia
Auditorias
Comitês transfusionais
Administração dos centros cirúrgicos
Direção médica de unidades cirúrgicas ambulatoriais
Direção médica de unidades de recuperação pós-anestésica
Direção médica de unidades de tratamento intensivo
Direção médica de clínicas e serviços de tratamento da dor

TABELA 2.3 Materais fornecidos pela American Society of


Anesthesiologists para definição dos padrões
assistenciais
Padrões (Exigências Mínimas para Práticas Anestésicas)
Padrões Básicos de Atendimento Pré-Anestésico
Padrões de Monitorização Anestésica Básica
Padrões de Atendimento Pós-Anestésico

Diretrizes (Recomendações para Tratamento de Pacientes)


Diretrizes para Instalações Cirúrgicas Ambulatoriais
Diretrizes para Cuidados Críticos em Anestesiologia
Diretrizes para Anestesia fora do Centro Cirúrgico
Diretrizes para Anestesia Regional em Obstetrícia

Orientações Práticas
Orientações Práticas para Tratamento de Dor Aguda em Centros Perioperatórios
Orientações Práticas para Manejo de Vias Aéreas Difíceis
Orientações Práticas para Cateterização da Artéria Pulmonar

Parâmetros Práticos
Tratamento da Dor
Ecocardiografia Transesofágica
Sedação Feita por Não Anestesiologistas
Jejum Pré-Operatório
Prevenção de Neuropatias Periféricas
Fast-Track em Pacientes Submetidos a Cirurgia de Revascularização do Miocárdio

4. Orientações Práticas. Alguns elementos das orientações práticas


são os mesmos das normas da prática assistencial, embora seu foco
principal seja orientar o julgamento, principalmente por meio de
algoritmos.
a. As orientações práticas são veículos potenciais que ajudam a eli-
minar procedimentos desnecessários e a reduzir custos.

Barash_I.indd 9 22/08/14 17:39


10 Barash, Cullen, Stoelting, Cahalan, Stock, Ortega

b. As orientações não definem o padrão de atendimento, embora o


cumprimento rigoroso dos princípios estabelecidos coloque os
anestesiologistas em uma posição razoavelmente defensável.
5. Normas de Acreditação Hospitalar. Basicamente, as normas da
acreditação hospitalar focam o credenciamento e a concessão de
privilégios, a verificação de uniformidade na qualidade dos servi-
ços de assistência anestésica, a reciclagem constante dos profissio-
nais e a documentação das avaliações pré e pós-operatórias.
6. Implicações das Auditorias. Funcionam como sistema regulató-
rio cujos objetivos incluem itens relacionados a admissão hospita-
lar, utilização e qualidade assistencial.
F. Política e Procedimento
1. Um dos aspectos organizacionais mais importantes de um departa-
mento de anestesiologia é o manual de políticas e procedimentos.
2. Este manual inclui protocolos específicos para áreas mencionadas
nas normas da acreditação hospitalar, incluindo avaliação pré-
-anestésica, segurança do paciente durante a anestesia, registro de
todos os eventos pertinentes durante a anestesia e alta do paciente
na unidade de recuperação pós-anestésica (URPA).
3. Os protocolos para relatar eventos adversos são extremamente
importantes (Anesthesia Patient Safety Foundation Newsletter,
2006:21:11, www.apsf.org).
G. Reuniões e Discussão de Casos
1. As reuniões de departamento devem ser programadas de forma
regular.
2. A acreditação hospitalar exige a realização de reuniões mensais
para discutir e documentar a administração de riscos e as ativida-
des relacionadas à melhoria da qualidade.
H. Equipe Assistencial. A manutenção de uma equipe assistencial em to-
dos os serviços de anestesia é extremamente importante.
I. Equipamentos de Anestesia
Defeitos nos equipamentos raramente provocam eventos adversos
graves em comparação às falhas humanas. A Anesthesia Patient Sa-
fety Foundation recomenda o desenvolvimento de processos que
permitam verificar o nível de treinamento dos anestesistas para o
uso de novas tecnologias introduzidas nos centros cirúrgicos.
1. Serviços. Os serviços de manutenção de equipamentos são forne-
cidos por representantes dos fabricantes ou pela equipe de manu-
tenção da própria entidade.
2. A substituição de aparelhos de anestesia obsoletos (normalmente
estima-se a vida útil em 10 anos) e o monitoramento dos equipa-
mentos em uso são componentes importantes dos programas de
modificação do risco.

Barash_I.indd 10 22/08/14 17:39


Manual de Anestesiologia Clínica 11

J. Seguro contra Imperícia Médica


1. O termo ocorrência significa que o médico terá cobertura se a
apólice de seguro estiver em vigor no momento em que ocorrer
algum incidente que possa culminar em ação judicial.

Introdução à Anestesiologia
2. As queixas apresentadas têm cobertura de seguro somente se a
ação judicial for interposta dentro do prazo de validade da apólice
(é necessário fazer “cobertura adicional” quando não houver reno-
vação anual da apólice de seguro).
3. Uma abordagem nova no seguro e na gestão de riscos médicos é
informar imediatamente as vítimas ou sobreviventes. Essa aborda-
gem transforma a tradicional cultura de culpa com punição para
uma cultura de reparos e indenizações.
K. Resposta a Eventos Adversos
1. Apesar da redução na incidência de catástrofes anestésicas, mes-
mo com a melhor prática, existe a probabilidade estatística de que
o anestesista seja envolvido em acidentes anestésicos pelo menos
uma vez durante o exercício da profissão.
2. O movimento que defende a apresentação imediata dos fatos e de
pedidos de desculpas reflete a mudança da “cultura da culpa”, com
aplicação de penalidades, para a cultura de reparos e indenizações.
Por mais louvável que seja a política de apresentação imediata dos
fatos e de desculpas, é imprescindível que, antes de aplicar essa
política, os anestesistas consultem todas as entidades envolvidas,
incluindo a companhia seguradora, o grupo clínico e a adminis-
tração do hospital.

II. FUNDAMENTOS PRÁTICOS


A. O “mercado de trabalho” para os anestesistas é influenciado por fa-
tores como número de residentes em fase de treinamento, má distri-
buição geográfica desses profissionais e forças de mercado. Tais fatores
são refletidos pelas organizações de prestação de serviços de assistência
médica e pelo impacto real e potencial sobre o número de procedimen-
tos cirúrgicos.
B. As possibilidades de atuação incluem vida acadêmica, prática privada,
vínculo empregatício a hospitais e em consultórios médicos.
C. O faturamento e a cobrança devem basear-se em cálculos feitos de
acordo com as unidades e o tempo; ou um único honorário predeter-
minado, independentemente do tempo; ou o somatório dos honorários
de todos os médicos envolvidos no procedimento cirúrgico.
1. Todas as instituições mantêm tabelas de programas específicos
para assegurar a codificação correta dos serviços prestados.
2. A cobrança de honorários para procedimentos específicos torna-se
irrelevante em sistemas de pagamentos prospectivos per capita nos
casos em que o número de pacientes for excessivamente elevado
(quantidade fixa mensal por membro associado).

Barash_I.indd 11 22/08/14 17:39


12 Barash, Cullen, Stoelting, Cahalan, Stock, Ortega

3. O governo federal americano criou uma nova legislação que per-


mite a cada estado a “opção de não cumprir” a obrigatoriedade de
supervisão de enfermeiros anestesiologistas por um médico, de
acordo com as normas de cobrança de honorários da Medicare*.
D. Considerações Antitrustes
1. A legislação preocupa-se apenas com a preservação da concorrência
em mercados bem definidos e com os direitos dos consumidores.
2. O mercado não pode ser ameaçado caso um médico seja excluído
da equipe médica de um hospital.
E. Os contratos de prestação de serviços devem ter uma cláusula estipu-
lando que os anestesistas sejam parte integrante do grupo signatário do
contrato.
1. Em determinadas situações, alguns membros do grupo podem ser
excluídos da equipe médica sem abertura de processos administra-
tivos normais.
2. Credenciamento econômico (que não tem o apoio da ASA) é de-
finido como uso de critérios econômicos para definir a remune-
ração, independentemente da qualidade do atendimento ou da
competência profissional.
F. Subsídios Hospitalares. A realidade econômica moderna exige que
as equipes reconheçam que, eventualmente, depois do pagamento das
despesas gerais, a receita obtida com o atendimento de pacientes não
gera remuneração suficiente para atrair e manter o número de mem-
bros e a qualidade das equipes médicas.
1. Nessas circunstâncias, é necessário negociar com o hospital a con-
cessão de subsídios financeiros diretos para aumentar a remunera-
ção dos anestesistas em níveis compatíveis com o mercado.
2. O escritório da ASA em Washington, DC, mantém uma equipe de
consultores para dar suporte aos anestesiologistas e aos grupos que
trabalham com subsídios hospitalares.

III. NOVAS FORMAS DE CONTRATAÇÃO DE SERVIÇOS DE


ANESTESIA
A. Mesmo com a queda relativa na influência dos planos de saúde, ainda
existe um processo iterativo que exerce algum impacto sobre a prática
da anestesia.
B. Pagamentos Fixos. Nessa modalidade de contrato, cada grupo de pro-
vedores de uma organização de prestação de assistência médica recebe
um valor fixo mensal por membro e compromete-se, exceto em cir-
cunstâncias atípicas (“trabalho excessivo”), a fornecer serviços médicos
de qualidade.

* N. de R. T. Medicare é o nome do principal sistema de seguros de saúde gerido pelo governo


dos EUA, destinado às pessoas maiores de 65 anos ou que possuam algum tipo de deficiência ou
doença renal avançada.

Barash_I.indd 12 22/08/14 17:39


Manual de Anestesiologia Clínica 13

C. Mudança de Paradigma. Atualmente, existe uma tendência de contra-


tar organizações privadas e vincular os pagamentos de serviços profis-
sionais aos honorários estabelecidos pela Medicare para códigos CPT-4
específicos.

Introdução à Anestesiologia
D. Pagamento com base no desempenho é um conceito novo defendido
pelas companhias de seguro e pelo Center for Medicaid and Medicare
Services para diminuir os custos de assistência médica, reduzindo o
número de complicações nos atendimentos prestados.
1. As Organizações de Assistência Médica foram criadas pelo Pa-
tient Protection and Affordable Care Act que se transformou em lei
em 2010. A ASA está pleiteando a criação de um modelo de aten-
dimento “domiciliar” para assegurar, nesses dispositivos legais, a
importância dos cuidados pré-operatórios de pacientes cirúrgicos.
2. Peculiaridades Administrativas. As complexidades da prática
médica moderna criaram empresas de consultoria que oferecem
serviços especializados aos grupos de anestesistas.

IV. HIPAA
A. A implementação da norma de privacidade do Health Insurance Porta-
bility and Accountability Act (HIPAA) criou mudanças importantes na
forma de administrar os registros médicos e as informações fornecidas
pelos pacientes. De acordo com o HIPAA, o nome dos pacientes não
deve ser utilizado nas “salas de operação” se houver alguma possibili-
dade de que possam ser vistos por pessoas que não estejam diretamente
envolvidas nos respectivos casos.
B. Registros Médicos Eletrônicos (RME). Os hospitais têm enfrentado al-
guns problemas com a implantação de RMEs básicos (p. ex., custo, ausên-
cia de software adequado), sendo que a implementação de sistemas de ge-
renciamento eletrônico da documentação anestésica é ainda mais difícil.

V. EXPANSÃO DA MEDICINA PERIOPERATÓRIA, CUIDADOS


HOSPITALARES E MEDICINA HIPERBÁRICA
A. As clínicas de avaliação pré-anestésica administradas e formadas por
anestesiologistas substituem a prática histórica de encaminhar os pa-
cientes para consultorias ou para atendimento por clínico geral para
fins de “avaliação pré-operatória”.
B. Os anestesiologistas podem tornar-se coordenadores de cuidados pós-
-operatórios, especialmente no campo de tratamento da dor aguda e
crônica.

VI. ADMINISTRAÇÃO DOS CENTROS CIRÚRGICOS


A. A ênfase atual sobre o gerenciamento de custos e eficiência exige a pre-
sença de anestesistas que tenham condições de administrar problemas
práticos nos centros cirúrgicos (p. ex., o momento exato de iniciar o
primeiro caso da manhã).

Barash_I.indd 13 22/08/14 17:39


14 Barash, Cullen, Stoelting, Cahalan, Stock, Ortega

1. Anestesistas com visão geral do sistema são mais qualificados para


exercer liderança nos centros cirúrgicos.
2. Um aspecto importante na organização dos centros cirúrgicos é a
gestão de materiais.
B. Programação da Agenda Cirúrgica
1. A participação de anestesiologistas na programação da agenda cirúr-
gica é muito importante, porque o número desses profissionais depen-
de da carga diária de casos, incluindo áreas fora do centro cirúrgico.
2. A maior parte dos centros cirúrgicos utiliza programação em bloco
(tempo predeterminado garantido da sala de operação, com tempo
de corte previamente combinado), programação aberta (primeiro a
chegar, primeiro a ser atendido) ou uma combinação de ambas as
modalidades.
3. A informatização provavelmente trará benefícios para todos os
centros cirúrgicos.
C. Clínicas de Avaliação Pré-Operatória. De maneira geral, o uso de
clínicas de avaliação anestésica pré-operatória aumenta a eficiência
administrativa dos centros cirúrgicos, além de evitar cancelamentos e
postergações não programadas.
D. Assuntos Relacionados aos Anestesiologistas. Tendo em vista o dé-
ficit atual e futuro de anestesiologistas no mercado, os problemas rela-
cionados à administração ainda irão dominar o ambiente dos centros
cirúrgicos durante muito tempo.
E. Assuntos Relacionados a Custos e Qualidade
1. A assistência médica é responsável por cerca de 14% do produto
interno bruto dos EUA, sendo que a anestesia (direta ou indireta-
mente) representa 3 a 5% dos custos totais dos serviços de atendi-
mento médico.
2. As despesas com fármacos anestésicos representam uma pequena
porção dos custos perioperatórios totais, embora o grande número
de doses administradas contribua substancialmente para o custo
total agregado das instituições hospitalares.
a. Nos EUA, a redução do fluxo de ar fresco de 5 para 2 L/min,
quando possível, representa uma economia de cerca de US$ 100
milhões por ano.
b. O uso de técnicas e de fármacos de custo mais elevado pode
reduzir os custos indiretos (p. ex., o propofol em infusão contí-
nua tem custo mais elevado, porém pode diminuir o tempo da
URPA e reduzir a incidência de náusea e vômito).
c. Em procedimentos cirúrgicos prolongados, os fármacos mais
recentes e mais caros oferecem benefícios limitados em relação
às alternativas mais tradicionais e de custo menor.
d. Estima-se que os 10 fármacos de custo mais elevado represen-
tam mais de 80% dos custos com fármacos anestésicos em algu-
mas instituições.

Barash_I.indd 14 22/08/14 17:39


CAPÍTULO

3
Saúde Ocupacional
Nos EUA, o setor de assistência médica tem o privilégio dúbio de ser um dos
locais de trabalho de mais alta periculosidade (é superado apenas pelo setor in-
dustrial no número de doenças e lesões ocupacionais) (Katz JD, Holzman RS.
Occupational health. Em: Barash PG, Cullen BF, Stoelting RK, Cahalan MK,
Ortega R, Stock MC, Eds. Clinical Anesthesia. Philadelphia: Lippincott Williams
& Wilkins; 2013: 61-89).

I. RISCOS FÍSICOS
A. Gases Anestésicos
1. As preocupações com os possíveis efeitos tóxicos da exposição
ocupacional a anestésicos inalatórios remontam à época de sua
introdução na prática clínica.
2. Os vários estudos que realizaram testes à procura de aberrações
cromossômicas, trocas de cromátides-irmãs ou alterações em lin-
fócitos periféricos não encontraram evidências de danos celulares
em médicos que haviam sido expostos aos níveis de gases anestési-
cos normalmente encontrados em centros cirúrgicos com ventila-
ção adequada.
3. A exposição ao óxido nitroso é uma situação especial, levando-se
em consideração que esse gás oxida, de forma irreversível, o átomo
de cobalto da vitamina B12 para um estado inativo. Essa oxidação
inibe a metionina sintetase e impede a conversão do metiltetra-
-hidrofolato em tetra-hidrofolato, imprescindível para a síntese de
DNA, para a formação de bainhas mielínicas e para a substituição
de metila nos neurotransmissores. Em concentrações clínicas ade-
quadas de óxido nitroso, essa inibição pode resultar em anemia e
polineuropatia. Da mesma forma como ocorre com os anestésicos
à base de hidrocarbonetos halogenados, esses efeitos do óxido ni-
troso não foram demonstrados em centros cirúrgicos devidamente
higienizados, com remoção eficaz dos resíduos gasosos.
B. Desfechos Reprodutivos
1. Estudos realizados com pessoas que trabalham em ambientes com
adequado sistema antipoluição revelaram que não há uma eleva-
ção no risco de abortos espontâneos.
2. Provavelmente outras condições associadas ao ambiente de traba-
lho (p. ex., estresse, infecções, longas horas de trabalho, trabalho
em regime de turnos e exposição à radiação), além da exposição a
resíduos de gases anestésicos, possam ser responsáveis por muitos
dos desfechos reprodutivos adversos relatados entre alguns profis-
sionais da saúde.

Barash_I.indd 15 22/08/14 17:39


16 Barash, Cullen, Stoelting, Cahalan, Stock, Ortega

3. As evidências sugerem que há um discreto aumento no risco relati-


vo de aborto espontâneo e anormalidades congênitas nos filhos de
profissionais da saúde do sexo feminino que trabalham em centros
cirúrgicos. A aplicação adequada de sistemas antipoluição mini-
miza a incidência desses riscos.
C. Câncer. Não foi encontrada nenhuma diferença entre anestesiologistas
e um grupo de internistas no que diz respeito ao risco global de morta-
lidade causada por câncer.
D. Efeitos Comportamentais
1. Uma das principais razões identificadas pelo National Institute of
Occupational Safety and Health (NIOSH) para limitar a exposição
ocupacional aos resíduos de gases anestésicos é evitar “quedas no
desempenho profissional, no nível de conhecimentos, na capaci-
dade audiovisual e nas habilidades técnicas”.
2. Muitas das alterações psicomotoras e cognitivas mensuráveis (le-
targia e fadiga) provocadas por exposições breves têm curta dura-
ção e desaparecem em 5 minutos após o término da exposição.
E. Níveis de Resíduos de Gases Anestésicos
1. O uso de sistemas antipoluição e a eficiência nas trocas de ar per-
mitem reduzir de forma significativa os níveis de resíduos de gases
anestésicos nos centros cirúrgicos.
2. Fatores como ventilação, trocas adequadas de gases e interrupção
no uso de gases anestésicos antes da saída da sala cirúrgica garan-
tem a manutenção de níveis mínimos de gases anestésicos nas uni-
dades de recuperação pós-anestésica (URPAs).
F. Recomendações do National Institute of Occupational Safety and
Health e da Occupational Safety and Health Administration
1. Em 1977, o NIOSH publicou um documento contendo os limites
recomendados de exposição (LREs) a resíduos de gases anestésicos
a duas partes por milhão (ppm) (teto de 1 hora) para agentes anes-
tésicos halogenados usados isoladamente ou 0,5 ppm para agentes
halogenados e 25 ppm de óxido nitroso quando esses fármacos fo-
rem usados em combinação (média ponderada do tempo durante
o período de administração do anestésico).
2. O NIOSH ainda não desenvolveu LREs para os agentes utilizados
com mais frequência na prática atual (isoflurano, sevoflurano e
desflurano). Esses agentes voláteis têm potência química específica
e produtos metabólicos significativamente diferentes dos anestési-
cos mais antigos. Entretanto, a maioria dos estados norte-america-
nos criou regulamentos que exigem a monitorização dos gases nos
ambientes cirúrgicos e obrigam a manutenção de níveis que não
excedam os valores arbitrários máximos.

Barash_I.indd 16 22/08/14 17:39


Manual de Anestesiologia Clínica 17

3. Por uma questão de prudência, as medidas aplicáveis aos ambien-


tes cirúrgicos devem prever a manutenção dos resíduos anestésicos
nos níveis mais baixos possíveis. Para assegurar a redução na expo-
sição ocupacional, as instituições devem contemplar procedimen-

Introdução à Anestesiologia
tos que permitam monitorar a detecção de vazamentos nos equi-
pamentos e evitar contaminações causadas por falhas nas técnicas
de anestesia (p. ex., ajuste inadequado da máscara, vazamentos ao
redor dos balonetes de tubos endotraqueais e de máscara laríngea
e funcionamento inadequado do sistema antipoluição; Tab. 3.1).
a. Se houve vazamento de gases anestésicos, a dispersão e a remo-
ção dos poluentes dependem da adequada ventilação do am-
biente, ou seja, pelo menos 15 a 21 trocas de ar por hora.
b. A concentração anestésica ambiental pode ser reduzida aos ní-
veis mínimos com uso de equipamentos antipoluição, técnicas
anestésicas adequadas e sistemas eficientes de ventilação nos
centros cirúrgicos.
G. Produtos Químicos
1. As complicações cardiovasculares causadas por metilmetacrilato
em pacientes cirúrgicos incluem hipotensão, bradicardia e parada
cardíaca.

TABELA 3.1 Fontes de contaminação nos centros cirúrgicos


Técnicas Anestésicas
Não interrupção do fluxo de gases ao final da anestesia
Ligar o fluxo de gases antes de adaptar a máscara ao paciente
Máscaras com ajuste inadequado (especialmente na indução anestésica)
Lavagem do circuito
Enchimento dos vaporizadores anestésicos
Tubos traqueais sem balonete ou com vazamento (tubos pediátricos)
Máscaras laríngeas com ajuste inadequado
Analisadores de amostras de dióxido de carbono tipo side stream e analisadores de
gases anestésicos

Sistema de Administração de Anestesia e Sistema Antipoluição


Sistema semifechado
Funcionamento inadequado do sistema antipoluição
Vazamentos (conectores ou mangueiras de alta pressão, instalação do tanque de óxido
nitroso, canisters absorvedores de CO2 e circuitos de baixa pressão)

Outras Fontes
Unidades de criocirurgia
Circulação extracorpórea

Barash_I.indd 17 22/08/14 17:39


18 Barash, Cullen, Stoelting, Cahalan, Stock, Ortega

2. Os riscos conhecidos da exposição constante ao metilmetacrilato


se caracterizam por irritação e queimação na pele, reações alérgi-
cas e asma, irritação nos olhos com possível ulceração na córnea,
cefaleia e sinais neurológicos.
3. A Occupational Safety and Health Administration (OSHA) reco-
menda o uso de dispositivos antipoluentes para manter uma expo-
sição média ponderada de 8 horas a 100 ppm de metilmetacrilato.
H. As reações alérgicas aos agentes anestésicos voláteis e a alguns rela-
xantes musculares foram associadas à dermatite de contato, hepatite
e anafilaxia em anestesiologistas (aparentemente não causam hepatite
induzida por anestésicos).
1. O látex das luvas tornou-se uma fonte comum de reações alérgicas
entre os profissionais que trabalham nos centros cirúrgicos. Em
muitos casos, os profissionais da saúde alérgicos ao látex experi-
mentam as primeiras reações adversas enquanto são pacientes
cirúrgicos. A prevalência de sensibilidade ao látex entre os aneste-
siologistas é de cerca de 12%.
2. O teor de proteínas é responsável pela maioria das reações alér-
gicas generalizadas às luvas cirúrgicas que contêm látex. Essas
reações são exacerbadas pela presença do pó que intensifica o po-
tencial de aerossolização e disseminação das partículas de látex no
sistema respiratório das pessoas e nas superfícies ambientais du-
rante a colocação e remoção das luvas (Tab. 3.2).
I. Radiação
1. Os profissionais da anestesiologia estão em risco de exposição tan-
to às fontes diretas (feixes primários de raios X e vazamentos de
outros locais com aparelhos de raios X) quanto indiretas (radiação
espalhada a partir de superfícies refletidas) de radiação ionizante.
2. Os efeitos da radiação que resultam em lesões no DNA podem
provocar câncer. Não existe nenhum limiar conhecido abaixo do
qual o risco de desenvolvimento de câncer desapareça completa-
mente e, além disso, pode ocorrer um longo período de latência
antes da apresentação clínica de neoplasias.
3. Estudos recentes, realizados após o aumento no uso de radiação
ionizante nos centros cirúrgicos, nos laboratórios de hemodinâ-
mica e em outras áreas de radiologia intervencionista, revelaram
uma tendência preocupante de aumento da exposição entre os
profissionais da anestesiologia (embora em níveis bem abaixo dos
limites estabelecidos pela OSHA [5 Rems]).
4. Uma segunda forma de radiação com potencial de risco para a saú-
de se origina da exposição crônica a campos eletromagnéticos de
baixa frequência como aqueles emitidos por equipamentos de ge-
ração de imagens por ressonância magnética (RM). (Até que sejam
definidos os limites de segurança para esse tipo de exposição, os
anestesiologistas devem manter a exposição nos níveis mais baixos
possíveis.)

Barash_I.indd 18 22/08/14 17:39


Manual de Anestesiologia Clínica 19

TABELA 3.2 Tipos de reação ao látex


Reação Sinais/Sintomas Causa Tratamento

Introdução à Anestesiologia
Dermatite de contato Descamação, secura Irritação direta Identificar a reação,
irritativa ou rachadura na da pele por evitar irritantes,
pele luvas, pó ou possível uso de
sabonetes revestimento
nas luvas, uso
de produtos
alternativos
Tipo IV: Coceira, formação Aditivos Identificar o aditivo
hipersensibilidade de bolhas, químicos químico, possível
tardia formação de utilizados nos uso de produtos
crostas (retardo processos de alternativos sem
de 6 a 72 horas) fabricação aditivos químicos,
possível uso
de luvas com
revestimento
Tipo I: Proteínas Identificar a reação,
hipersensibilidade encontradas evitar produtos
imediata no látex contendo látex,
uso de luvas sem
látex ou sem pó de
talco e com baixo
teor de proteínas
Urticária localizada Coceira e outras Anti-histamínicos,
provocada por erupções esteroides tópicos
contato cutâneas na área ou sistêmicos
de contato com o
látex (imediato)
Reação generalizada Coriza, olhos Protocolo de reação
inchados, anafilática
erupções
cutâneas
ou urticária
generalizada,
broncospasmo,
anafilaxia

Reproduzida da American Society of Anesthesiologists Task Force on Latex Sensitivity


of the Committee on Occupational Health of Operating Room Personnel: Natural Latex
Allergy: Considerations for Anesthesiologists. Disponível em http://ecommerce.asahq.org/
publicationsAndServices/latexallergy.pdf. Acessado em 30 de outubro de 2012.

Barash_I.indd 19 22/08/14 17:39


20 Barash, Cullen, Stoelting, Cahalan, Stock, Ortega

J. Poluição Sonora
1. De acordo com determinação da OSHA, o nível máximo de expo-
sição sonora é de 90 dB durante 8 horas (ventiladores, equipamen-
tos de sucção, música e conversa entre pessoas produzem ruídos
ambientais que variam de 75 a 90 dB).
2. A exposição a ruídos excessivos diminui a eficiência mental, a me-
mória de curto prazo, a capacidade para executar tarefas multi-
funcionais e tarefas psicomotoras complexas. Níveis excessivos de
ruído interferem também na capacidade de ouvir alarmes (salas de
RM, música).

II. ERGONOMIA E FATOR HUMANO


A. Análise de fatores humanos (ergonomia) é o estudo da interação en-
tre homens e máquinas e o impacto do desenho dos equipamentos
sobre sua utilização. O tipo de trabalho executado por anestesiologis-
tas compartilha muitas das características encontradas em atividades
industriais de alto risco (aeronáutica, energia nuclear e exploração de
petróleo), incluindo a complexidade das tarefas, margens estreitas de
erro e vulnerabilidade a falhas humanas.
1. Existem inúmeras dificuldades nos locais de trabalho dos aneste-
siologistas relacionadas a fatores humanos (p. ex., com frequência,
os equipamentos são malprojetados ou estão em uma posição ina-
dequada; quase sempre a localização dos monitores de anestesia
faz com que a atenção dos anestesiologistas se desvie do paciente e
do campo cirúrgico).
2. A capacidade para executar tarefas complexas de monitoramento
(como permanecer alerta e responder a incidentes críticos) fica
vulnerável a momentos de distração resultantes do projeto ou lo-
calização inadequados dos equipamentos.
3. Mesmo os sistemas de alarme desenvolvidos com a finalidade es-
pecífica de intensificar a vigilância apresentam desvantagens sig-
nificativas (p. ex., os alarmes não são específicos e podem criar
frustração e confusão, são suscetíveis à ação de vários tipos de ar-
tefato e a falso-positivos que resultam na “ineficiência do alarme”,
desviando a atenção do observador de informações mais impor-
tantes do ponto de vista clínico).
a. É muito comum os profissionais ignorarem ou desativarem
alarmes que desviam a atenção.
b. Atualmente, há uma tendência emergente na tecnologia dos
sistemas de alarme que se caracteriza pelo desenvolvimento de
“alarmes baseados no conhecimento” que conseguem integrar
informações de mais de um monitor e apresentar uma lista de
possibilidades diagnósticas e terapêuticas.
4. A ocorrência de várias catástrofes aéreas ilustra o potencial para
desastres de sistemas inadequados de comunicação. Nos centros
cirúrgicos, há uma grande possibilidade de falhas de comunicação

Barash_I.indd 20 22/08/14 17:39


Manual de Anestesiologia Clínica 21

e acidentes, onde, em comparação com a estrutura da tripulação


das companhias aéreas, não existe uma organização hierárquica
bem definida que se sobreponha a áreas de especialidades e res-
ponsabilidades. A comunicação inadequada pode gerar conflitos e

Introdução à Anestesiologia
comprometer a segurança dos pacientes e, além disso, foi conside-
rada a causa principal de muitos eventos-sentinela relacionados à
anestesia.

III. HORAS DE TRABALHO, PLANTÕES NOTURNOS E FADIGA


A. O padrão circadiano de vigília e sono é um elemento fundamental para
a fisiologia saudável dos seres humanos. Indivíduos com privação de
sono (apneia obstrutiva do sono e agendas de trabalho desordenadas)
também pensam e se movimentam mais lentamente e são mais suscetí-
veis a cometer erros.
B. De maneira geral, as pessoas com privação do sono apresentam queda
no desempenho e correm mais risco de cometer erros. As alterações
resultantes da privação do sono se assemelham às da intoxicação por
álcool. Vários relatos identificaram a privação do sono como fator cau-
sativo de erros que ocorrem no setor da assistência médica.
C. Inúmeras consequências da privação do sono têm potencial para cau-
sar impactos adversos na execução de atividades assistenciais seguras,
incluindo alterações cognitivas, na memória de curto prazo e no pro-
cesso de tomadas de decisões clínicas; tempo de reação prolongado; e
redução na atenção, na vigilância e no desempenho.
D. Há uma disparidade aparente entre os relatos de alterações no desem-
penho associadas à fadiga e a impossibilidade de vincular com precisão
essas alterações a erros médicos ou a desfechos adversos.
E. Em 2000, o Accreditation Council for Graduate Medical Education
(ACGME) elaborou o primeiro conjunto de normas para limitar o nú-
mero de horas para residentes (revisadas pelo ACGME em 2011). Tais
normas reconhecem que essas restrições nos períodos de trabalho se
aplicam somente aos trainees, sendo que permanece inalterada a regu-
lamentação das horas de trabalho na prática médica. Horas adicionais
de trabalho e privação do sono são elementos onipresentes na vida de
muitos anestesiologistas.

IV. RISCOS DE INFECÇÃO


A. Os profissionais da anestesia correm o risco de contrair infecções dos
pacientes e de outros colegas de trabalho.
B. Normas da OSHA, Precauções Gerais e Precauções para Isolamento
1. As características principais das precauções universais foram resu-
midas em “Precauções Gerais” que se aplicam a todos os pacientes.
2. As precauções gerais incluem aplicação adequada e lavagem das
mãos, uso de equipamentos de proteção individual (EPIs), higiene
respiratória e etiqueta da tosse.

Barash_I.indd 21 22/08/14 17:39


22 Barash, Cullen, Stoelting, Cahalan, Stock, Ortega

a. As luvas são os únicos itens necessários em muitos procedimen-


tos que exigem contato com as membranas mucosas ou com
fluidos orais (p. ex., intubações endotraqueais de rotina e inser-
ção de cateteres intravenosos periféricos).
b. O uso de proteção individual complementar (avental, máscara
e proteção facial) é imprescindível durante intubações endotra-
queais nos casos em que o paciente tiver hematêmese ou duran-
te broncoscopias ou aspiração endotraqueal.
3. Os funcionários de assistência médica das instituições de saúde
devem solicitar aos funcionários recém-admitidos o histórico de
doenças contagiosas e providenciar o teste de imunização e o teste
cutâneo anual de derivados de proteína purificada (PPD [purified
protein derivative]). Além disso, as pessoas que trabalham com
serviços de assistência médica devem seguir protocolos para lidar
com colegas expostos a doenças contagiosas e colegas que tenham
contato com sangue percutâneo ou membranas mucosas de pa-
cientes infectados pelo HIV ou pelo vírus da hepatite B ou C.
C. Os vírus respiratórios são responsáveis por metade ou mais de todas
as enfermidades agudas e costumam ser transmitidos por pequenas
partículas de aerossol produzidas pela tosse, por espirros e pelo ato de
falar (gripe e sarampo) ou gotas maiores produzidas pela tosse ou por
espirros que podem contaminar as mãos ou superfícies inanimadas.
1. Os profissionais da anestesia que atendem rotineiramente pacien-
tes nos grupos de alto risco de influenza devem ser imunizados
todos os anos (abril ou maio).
2. O vírus sincicial respiratório humano (VSRH) é a causa mais co-
mum de bronquite grave e doenças no trato respiratório inferior
em lactentes e crianças mais jovens no mundo todo.
a. O VSRH pode também ser uma causa significativa de enfermi-
dades em pacientes idosos saudáveis e indivíduos portadores de
doença cardíaca ou pulmonar crônica.
b. A lavagem cuidadosa das mãos e a adoção de precauções gerais
reduzem as infecções por VSRH nos profissionais que traba-
lham em hospitais.
3. A síndrome do desconforto respiratório agudo (SDRA) costuma
se apresentar com febre acima de 38,0°C seguida de cefaleia, dores
generalizadas e tosse. A ocorrência de pneumonia grave pode levar
à síndrome do desconforto respiratório agudo e à morte.
D. Vírus de DNA
1. O vírus herpes simples (HSV-1, HSV-2; Herpesvirus hominis)
produz uma grande variedade de infecções envolvendo as super-
fícies mucocutâneas, o sistema nervoso central e, às vezes, órgãos
viscerais (cegueira corneana).
a. A exposição ao HSV nas superfícies mucosas ou em abrasões
cutâneas por atrito facilita a penetração do vírus e o início da
replicação viral.

Barash_I.indd 22 22/08/14 17:39


Manual de Anestesiologia Clínica 23

b. Em geral, embora não sejam clinicamente aparentes, as infec-


ções primárias causadas pelo HSV tipo 1 podem envolver lesões
orais graves, febre e adenopatia.
2. O vírus varicela-zóster (VVZ) é o agente causador de varicela (ca-

Introdução à Anestesiologia
tapora) e herpes-zóster (cobreiro).
a. A maioria dos adultos norte-americanos possui anticorpos que
protegem contra o VVZ.
b. Os profissionais com titulação negativa não podem cuidar de
pacientes com infecções por VVZ ativo e devem ser imunizados
com duas doses de vacina contra varicela.
c. Os profissionais suscetíveis com exposição significativa a pa-
cientes com infecções por VVZ são potencialmente contagiosos
entre 10 e 21 dias após a exposição e não devem entrar em con-
tato com nenhum paciente durante esse período. Eles devem ser
vacinados dentro de 3 a 5 dias após a exposição tendo em vista
a possibilidade de ocorrerem alterações no nível de gravidade e
no tempo de duração da doença.
E. Hepatites Virais
1. As formas mais comuns de hepatites virais são do tipo A (hepatite
infecciosa), do tipo B (VHB, hepatite sérica) e do tipo C (VHC e
hepatites que não pertencem aos tipos A e B), que é responsável
pela maioria dos casos de hepatite transmitidos por via parente-
ral nos EUA. Todos os tipos de hepatites virais causam quadros
semelhantes do ponto de vista clínico (infecções que variam de as-
sintomáticas a fulminantes e fatais; doenças hepáticas variando de
subclínicas a crônicas persistentes que podem evoluir para cirrose
e carcinoma hepatocelular). Os maiores riscos de transmissão ocu-
pacional para os profissionais da anestesiologia estão associados ao
VHB e VHC.
2. O vírus da hepatite tipo A é a causa de aproximadamente 20 a
40% das hepatites virais em adultos nos EUA (em geral uma
doença autolimitada, sendo que não há portadores crônicos).
a. A disseminação ocorre predominantemente pelas vias fecal e
oral, pelo contato entre pessoas ou pela ingestão de alimentos
ou de água contaminada.
b. A imunoglobulina protege contra a hepatite tipo A por meio da
transferência passiva de anticorpos, sendo que também é utili-
zada na profilaxia pós-exposição.
3. O vírus da hepatite tipo B é um risco ocupacional significativo
para anestesistas não imunizados e outros profissionais da área
médica que permanecem em contato frequente com sangue e pro-
dutos derivados do sangue.
a. Nos EUA, a incidência de hepatite tipo B aguda caiu quase 80%,
sendo que tal queda é atribuída a programas eficientes de vaci-
nação e à observância de precauções universais na utilização de
agulhas.

Barash_I.indd 23 22/08/14 17:39


24 Barash, Cullen, Stoelting, Cahalan, Stock, Ortega

b. As infecções agudas pelo VHB podem ser assintomáticas e em


geral desaparecem sem causar danos hepáticos significativos
(menos de 1% dos pacientes com infecção aguda evolui para
hepatite fulminante).
c. Cerca de 10% dos indivíduos tornam-se portadores crônicos do
VHB (evidência sorológica por mais de seis meses). A infecção
da metade dos portadores crônicos desaparece dentro de dois
anos sem comprometimento hepático significativo. A hepatite
crônica ativa, que pode evoluir para cirrose e está associada à
formação de carcinomas hepatocelulares, costuma acometer in-
divíduos com infecção viral crônica por mais de dois anos.
d. Os profissionais da anestesiologia correm risco de contrair in-
fecção ocupacional pelo VHB como resultado do contato aci-
dental percutâneo ou com membranas mucosas com sangue ou
líquidos corporais de pacientes infectados.
e. A vacina contra hepatite B é a estratégia principal para evitar a
transmissão do VHB para os profissionais da anestesiologia.
4. O vírus da hepatite tipo C é responsável pela maioria dos casos
de transmissão parenteral de hepatites que não pertencem ao tipo
A nem ao tipo B, além de ser a causa principal de doença hepá-
tica crônica nos EUA. Embora o anticorpo do VHC (anti-VHC)
seja encontrado na maioria dos pacientes com hepatite tipo C, sua
presença não se correlaciona com a resolução de casos de infecção
aguda ou com a progressão da hepatite, nem confere imunidade
contra infecção pelo VHC.
a. Entre os indivíduos que desenvolvem hepatite crônica, 20% po-
dem desenvolver cirrose dentro de 20 a 30 anos, sendo que, nos
casos de cirrose, 1 a 2% das pessoas podem apresentar diagnós-
tico de carcinoma hepatocelular.
b. O maior risco de transmissão do VHC ocupacional está associa-
do à exposição ao sangue de fontes positivas desse vírus.
c. Não existe nenhum tipo de vacina ou profilaxia pós-exposição
eficaz para evitar infecções pelo VHC, e o uso de imunoglobulina
não é mais recomendado após exposições confirmadas. A pre-
venção da exposição ainda é a principal estratégia para proteger
os profissionais da saúde contra infecções causadas pelo VHC.
F. Retrovírus Humanos Patogênicos (vírus linfotrópicos de células T
humanas [HTLV-1, HTLV-2]) e Vírus da Imunodeficiência Humana
(HIV-1, HIV-2)
1. A infecção por HIV/Aids é uma pandemia global (33,3 milhões
de pessoas infectadas em todo o mundo; 1,1 milhão nos EUA, dos
quais 21% não sabem que têm a infecção).
2. A infecção pelo HIV inicia-se como uma síndrome que se asseme-
lha à mononucleose com linfadenopatia e erupção cutânea. Den-
tro de algumas semanas, é possível detectar anticorpos por meio

Barash_I.indd 24 22/08/14 17:39


Manual de Anestesiologia Clínica 25

de um ensaio imunoenzimático ou um teste rápido para detecção


de anticorpos anti-HIV, embora seja necessário confirmar o re-
sultado positivo usando técnicas como o Western blot ou o ensaio
imunofluorescente. Após um período de tempo variável de infec-

Introdução à Anestesiologia
ção assintomática pelo HIV, ocorre um aumento no título viral e
uma alteração na imunidade do hospedeiro, causando infecções e
doenças malignas oportunistas típicas da Aids.
3. Atualmente, nos EUA o risco de infecção pelo HIV por transfusão
de sangue é de cerca de 1 por 1,5 milhão de unidades.
4. Risco de Infecção Ocupacional pelo HIV. O risco de transmissão
do HIV é de 0,3% após punção cutânea com agulhas ou objetos
pontiagudos contaminados e de 0,09% após exposição a membra-
nas mucosas, caso a pessoa lesionada ou exposta não seja tratada
dentro de 24 horas com medicamentos antirretrovirais.
a. Com frequência, os profissionais da anestesiologia são expostos
a sangue e líquidos corporais durante procedimentos invasivos
como inserção de cateteres vasculares, punções arteriais e intu-
bações endotraqueais.
b. Embora muitas exposições sejam mucocutâneas e possam ser
evitadas com uso de luvas e aventais de proteção, essas barrei-
ras não evitam exposições percutâneas, como as lesões causadas
pela picada de agulhas, que representam um risco muito maior
para a transmissão de patógenos.
c. O risco de transmissão do HIV de profissionais da saúde para
pacientes é extremamente baixo.
5. Tratamento Pós-Exposição e Terapia Antirretroviral Profilá-
tica. Com base na natureza da lesão, o profissional exposto e a
fonte individual devem fazer o teste para evidências sorológicas
de infecção por HIV, VHB e VHC. Se a fonte for HIV-positiva, o
profissional deve se submeter a novo teste para verificar a presença
de anticorpos anti-HIV dentro de 6 e 12 semanas e 6 meses após a
exposição, embora a expectativa é de que a maioria das pessoas in-
fectadas faça soroconversão dentro das primeiras 6 a 12 semanas.
a. Os médicos devem considerar o potencial para exposições
ocupacionais como situações de urgência, para assegurar o
tratamento pós-exposição em tempo hábil e a possível admi-
nistração de profilaxia antirretroviral após a exposição (PEP
[postexposure antiretoviral prophylaxis]).
b. Para os casos em que a decisão for a PEP, as orientações do US
Public Health Service recomendam a combinação de dois ini-
bidores da transcriptase reversa análogos dos nucleosídeos por
quatro semanas para exposições menos graves ou uma combi-
nação de dois inibidores da transcriptase reversa análogos dos
nucleosídeos mais um terceiro fármaco durante quatro semanas
para exposições mais graves.

Barash_I.indd 25 22/08/14 17:39


26 Barash, Cullen, Stoelting, Cahalan, Stock, Ortega

c. Para consultas sobre o tratamento de exposições ocupacionais


ao HIV e de outros patógenos sanguíneos, o médico responsável
pelo paciente exposto pode entrar em contato com a National
Clinicians’ Post-Exposure Prophylaxis Hotline (PEPline).
G. Doenças Causadas por Príons
1. Os príons (de proteína 1 infecção) são compostos de proteínas
com configuração anormal sem ácido nucleico. Os príons são res-
ponsáveis por encefalopatias espongiformes transmissíveis (ence-
falopatia espongiforme bovina ou “doença da vaca louca” no gado
bovino e doença de Creutzfeldt-Jakob em humanos). Todas são
fatais e não têm tratamento.
2. A partir do momento em que penetram em organismos saudáveis,
os príons criam um modelo para guiar a má configuração de uma
proteína normal para o interior de uma forma priônica extrema-
mente estável (a descontaminação priônica efetiva torna-se difícil
porque se baseia na hidrólise proteica ou na redução/destruição de
estruturas proteicas terciárias).
H. A forma mais comum de transmissão de tuberculose (TB) de uma pes-
soa com TB pulmonar infecciosa para outras é por meio do núcleo de
gotículas de aerossol através da tosse, de espirros ou da fala (a maioria
dos pacientes infectados é portadora de doença pulmonar cavitária). A
prevenção efetiva da disseminação entre profissionais da saúde exige
a identificação rápida dos pacientes infectados e o início imediato do
isolamento das infecções transmissíveis pelo ar.
1. A cirurgia eletiva deve ser adiada até que os pacientes infectados
tenham recebido tratamento quimioterápico durante um período
de tempo adequado. Se a cirurgia for inevitável, é necessário utili-
zar filtros bacterianos (filtros de alta eficiência para partículas do
ar) no circuito de respiração de anestésicos para pacientes tubercu-
losos. Os quartos para recuperação dos pacientes devem atender a
todos os requisitos de precauções relacionados à circulação do ar.
2. A política de saúde aplicável aos profissionais que trabalham em
hospitais deve contemplar avaliações periódicas para tuberculose.
I. Vírus em Nuvens de Fumaça. Recomenda-se o uso de sistemas a vá-
cuo ou de EPIs sempre que profissionais da saúde estiverem nas pro-
ximidades de fumaça cirúrgica. Os profissionais de centros cirúrgicos
que estiverem próximos de equipamentos de vaporização a laser devem
usar luvas, óculos de proteção e máscaras com filtros eficientes.

V. CONSIDERAÇÕES EMOCIONAIS
A. Ocorre estresse (ocupacional) quando as exigências impostas pelo tra-
balho excedem as capacidades e os recursos de um profissional, poden-
do resultar em prejuízos à saúde mental e física, acidentes industriais e
lesões. As enfermidades mais comuns relacionadas ao estresse incluem
transtornos do humor e do sono, problemas no relacionamento fami-

Barash_I.indd 26 22/08/14 17:39


Manual de Anestesiologia Clínica 27

liar e social e vários tipos de doenças gastrintestinais, musculoesquelé-


ticas e cardiovasculares.
1. A anestesiologia é uma profissão extremamente estressante. A roti-
na do meio cirúrgico é composta por condições de estresse crônico

Introdução à Anestesiologia
de baixa intensidade que, com frequência, é interrompido por epi-
sódios agudos de estresse extremo.
2. Os estressores específicos relatados por anestesiologistas incluem
a imprevisibilidade do trabalho, a necessidade de vigilância cons-
tante durante longos períodos de tempo, a pressão relacionada à
produção, o medo de ações litigiosas, a dificuldade nas relações
interpessoais e incertezas econômicas.
B. Burnout é uma síndrome clínica que se caracteriza por cansaço físico e
emocional, alteração no julgamento, cinismo, complexo de culpa, sen-
sação de inutilidade e um sentimento de despersonalização no relacio-
namento com colegas de trabalho ou pacientes.
1. O burnout afeta principalmente médicos e enfermeiros cujas fun-
ções exigem interação intensa com indivíduos que têm grandes
necessidades físicas e emocionais.
2. As causas mais citadas de burnout entre profissionais da saúde são
aumento nas exigências de produtividade, excesso de burocracia
e regulamentações, longas horas de trabalho, falta de controle, di-
minuição no ganho, expansão rápida dos conhecimentos médicos
básicos e dificuldade para conciliar a vida pessoal com a vida pro-
fissional.
C. Uso, Abuso e Dependência de Substâncias
1. Estima-se que 20 milhões de norte-americanos abusem de subs-
tâncias e 5 milhões sejam dependentes (continuam a usar a subs-
tância apesar de tentativas malsucedidas de controlar o uso, a
necessidade de quantidades maiores da substância, sintomas de
abstinência e a necessidade de passar cada vez mais tempo à pro-
cura da substância).
2. Em torno de 10 a 12% dos médicos desenvolvem algum tipo trans-
torno relacionado ao abuso de substâncias durante suas carreiras.
(Os médicos tendem a usar substâncias diferentes daquelas usadas
pela população em geral e são menos propensos a abusar do taba-
co ou de drogas ilícitas, preferindo se automedicar com fármacos
controlados como os opioides e o propofol.)
3. Estudos recentes relatam que há uma alta prevalência no abuso de
substâncias entre residentes e anestesistas. (O abuso de substâncias
é considerado o principal risco ocupacional da anestesiologia.)
4. Os anestesiologistas se destacam entre os médicos porque pres-
crevem com frequência, assim como administram pessoalmente,
esses fármacos psicoativos com grande potencial de dependência.
Por outro lado, os médicos da maioria das outras especialidades
prescrevem fármacos que são administrados por outras pessoas.

Barash_I.indd 27 22/08/14 17:39


28 Barash, Cullen, Stoelting, Cahalan, Stock, Ortega

5. A taxa de recidiva na população em geral se aproxima de 60% para


pacientes que receberam tratamento contra a dependência. Os
médicos são altamente motivados e, em geral, o prognóstico para
recuperação desses profissionais excede o da população em geral.
D. Mortalidade entre Anestesiologistas. Os inúmeros relatos sobre a lon-
gevidade média dos anestesiologistas são conflitantes. Os relatos mais
recentes não conseguiram identificar um aumento no risco de câncer
entre esses profissionais, mas descobriram que houve aumento no nú-
mero de mortes e suicídios relacionados ao uso de fármacos.
E. Suicídio
1. Vários relatos selecionaram os anestesiologistas como particular-
mente vulneráveis, embora tal conclusão tenha sido questionada.
2. O estresse resultante de ações judiciais por imperícia talvez tenha
uma associação causal direta com os suicídios.
3. O abuso de substâncias entre os profissionais da anestesiologia é
outro contribuinte potencial para a elevação na taxa de suicídios.
O abuso de drogas está entre as principais causas de morte, sendo
o método mais frequente de suicídio entre os anestesiologistas.

Barash_I.indd 28 22/08/14 17:39


CAPÍTULO

4
Risco Anestésico, Melhorias na
Qualidade e na Responsabilidade
Na anestesiologia, assim como em outras áreas de atividade, nem sempre tudo
acontece de acordo com o que foi planejado, existindo a possibilidade de ocor-
rerem resultados indesejáveis, seja qual for a qualidade dos serviços de atendi-
mento médico. Por isso, é importante implantar programas de gerenciamento
de risco anestésico, em conjunto com programas de melhoria de qualidade,
para minimizar os riscos de eventos adversos e, ao mesmo tempo, maximizar a
qualidade do atendimento aos pacientes (Posner KL, Adeogba S, Domino KB.
Anesthetic risk, quality improvement, and liability. Em: Barash PG, Cullen BF,
Stoelting RK, Cahalan MK, Ortega R, Stock MC, Eds. Clinical Anesthesia. Phila-
delphia: Lippincott Williams & Wilkins; 2013: 90-104.)

I. RISCO ANESTÉSICO
A. Mortalidade e Morbidade Relacionadas à Anestesia. É extremamente
difícil quantificar as estimativas de morbidade e de mortalidade rela-
cionadas à anestesia devido às diferentes metodologias empregadas nos
estudos, assim como à variabilidade nas definições de complicação, no
período de duração dos acompanhamentos e na avaliação da contribui-
ção dos cuidados anestésicos na obtenção de resultados (Tab. 4.1). O
consenso é que a segurança da anestesia melhorou nos últimos 50 anos.
Entretanto, várias complicações são associadas à anestesia e são motivo
de atenção especial (Tab. 4.2 e Fig. 4.1).

II. GERENCIAMENTO DE RISCO


A. Introdução Conceitual. Os programas de gerenciamento de risco e
de melhoria da qualidade operam simultaneamente para minimizar a
chance de erros e, ao mesmo tempo, maximizar a qualidade do atendi-
mento médico aos pacientes. Os departamentos de melhoria na qua-
lidade (às vezes chamada de segurança do paciente) são responsáveis
pela disponibilização de recursos que permitam garantir um atendi-
mento médico seguro, com foco no paciente, no momento certo, efi-
ciente e justo.
B. Gerenciamento de Risco. Os aspectos do gerenciamento de risco mais
relevantes à assistência prestada pelos anestesiologistas incluem preven-
ção de danos aos pacientes, adesão às normas de atendimento, docu-
mentação e relacionamento com os pacientes.
1. Os principais fatores na prevenção de danos aos pacientes são vigi-
lância, conhecimentos atualizados e monitorização adequada.

Barash_I.indd 29 22/08/14 17:39


30 Barash, Cullen, Stoelting, Cahalan, Stock, Ortega

TABELA 4.1 Estimativa de óbitos relacionados à anestesia


Óbito Relacionado à
Período País Métodos e Fontes de Dados Anestesia
1989-1999 EUA Paradas cardíacas ocorridas dentro 0,55/10.000 anestesias
de 24 h após cirurgias (72.959
anestesias) realizadas em um
hospital-escola

1992-1994 EUA Hospital-escola suburbano (37.924 0,79/10.000 anestesias


anestesias e 115 óbitos)

1995-1997 EUA Hospital-escola urbano (146.548 0,75/10.000 anestesias


anestesias e 232 óbitos)

1995-1997 Holanda Óbitos que ocorreram dentro 1,4/10.000 anestesias


de 24 h ou pacientes que
permaneceram em coma
24 h após a cirurgia (869.483
anestesias e 811 óbitos)

1990-1995 Austrália Óbitos que ocorreram após 48 h ou 1/40.000 anestesias


Ocidental óbitos nos quais a anestesia foi
considerada um fator causador

1994-1996 Austrália Óbitos relatados ao comitê 0,16/10.000 anestesias


(8.500.000 anestesias)

1992-2002 Japão Óbitos causados por eventos 0,1/10.000 anestesias


com risco de vida em centros
cirúrgicos (3.855.384 anestesias)
de hospitais-escola

1994-1998 Japão Questionários para hospitais-escola 0,21/10.000 anestesias


(2.363.038 anestesias)

1989-1995 França Pacientes ASA 1-4 que receberam 0,6/10.000 anestesias


anestesia (101.769 anestesias e
24 paradas cardíacas dentro de
24 h após a anestesia)

1994-1997 EUA Pacientes pediátricos de 63 0,36/10.000 anestesias


hospitais (1.089.200 anestesias)

1999-2005 EUA Óbitos relacionados a anestesia, 8,2/1 milhão de altas


dados de atestados de óbito cirúrgicas em
hospitais
2003-2005 Austrália Óbitos relatados aos comitês de 0,19/10.000 óbitos
mortalidade relacionados à
anestesia

ASA 5 American Society of Anesthesiologists.

2. O uso perioperatório de checklists de segurança cirúrgica reduziu o


número de complicações cirúrgicas e mortalidade (Tab. 4.3).

Barash_I.indd 30 22/08/14 17:39


Manual de Anestesiologia Clínica 31

TABELA 4.2 Complicações relacionadas à anestesia


Complicações neurológicas pós-operatórias
Lesão no nervo ulnar

Introdução à Anestesiologia
Neuropatia periférica após cirurgia na posição de litotomia com anestesia neuroaxial
Consciência durante anestesia geral (ocorrência estimada em 1 a 2 a cada 1.000 pacientes)
Lesões nos olhos e perda visual
Abrasão na córnea
Neuropatia óptica isquêmica
Oclusão da artéria central da retina
Lesões dentárias (3,6/10.000 para anestesia geral com intubação traqueal)

C. O consentimento informado referente à anestesia deve ser documen-


tado juntamente com uma observação no prontuário informando que
foram discutidos os riscos da anestesia e todas as alternativas. A exposi-
ção clara dos fatos melhora as relações entre médico e paciente, facilita
o entendimento dos procedimentos e diminui potencialmente o risco
de processos relacionados a imperícia.

Outros (21%) Morte (29%)

Queimaduras
(4%)
Lesões
nos olhos
(4%)

Sofrimento
emocional
(6%)
Lesões nas
vias aéreas Lesões
(6%) nervosas
Danos cerebrais
permanentes (9%) (21%)

FIGURA 4.1 Lesões mais comuns que resultaram em ações judiciais contra imperícia
anestésica no período de 2000 a 2009 (American Society of Anesthesiologists Closed
Claims Project). A categoria “Outros” inclui aspiração (4%), pneumotórax (3%), in-
farto do miocárdio (3%), lesões em recém-nascidos (2%), cefaleia (2%) e consciência
ou lembranças durante anestesia geral (2%). Lesões nos dentes e dentaduras foram
excluídas.

Barash_I.indd 31 22/08/14 17:39


32 Barash, Cullen, Stoelting, Cahalan, Stock, Ortega

TABELA 4.3 Elementos do checklist de cirurgia segura da


Organização Mundial de Saúde
Antes da Indução
Confirmar a identidade do paciente, o local, o procedimento e o consentimento.
Marcar o local.
Verificar o equipamento de anestesia e os fármacos.
Verificar se o oxímetro de pulso está funcionando.
O paciente tem:
Alergia conhecida?
Risco de via aérea difícil ou aspiração?

Antes da Incisão
Fazer a apresentação dos membros da equipe dizendo o nome e a função.
Confirmar a identidade do paciente, o procedimento e o local da incisão.
Administrar antibióticos dentro de 60 min.
Eventos críticos previstos:
Etapas críticas ou que não fazem parte da rotina do procedimento.
Duração prevista da cirurgia.
Previsão de perda de sangue.
Preocupações com a anestesia.
Confirmação da esterilidade.
Preocupações e assuntos relacionados ao equipamento.
Necessidade de exames transoperatórios

Antes de o Paciente Sair do Centro Cirúrgico


Confirmar o procedimento.
Realizar a contagem completa dos instrumentos, compressas e agulhas.
Colocar etiquetas nas amostras.
Verificar se há algum problema no equipamento.
Quais são as principais preocupações com a recuperação?

D. Documentação da Anestesia. O registro da anestesia deve ser preciso,


completo e o mais inteligível possível. O uso de registros automatizados
é muito útil na defesa de casos de imperícia médica.
E. O Que Fazer após a Ocorrência de Eventos Adversos
1. Se houver algum incidente crítico durante uma anestesia, é extre-
mamente importante descrever o evento no prontuário do pacien-
te, os fármacos que foram usados, a sequência temporal e o nome
das pessoas que estavam presentes.
2. Nos casos de complicações anestésicas, o anestesiologista deve ser
honesto com o paciente e com a família sobre a causa. Deve fazer-
-se um pedido formal de desculpas se o resultado imprevisto tiver
sido causado por um erro médico ou por uma falha do sistema.
Alguns estados americanos possuem leis que obrigam a divulga-
ção de eventos adversos graves (em ações judiciais por imperícia

Barash_I.indd 32 22/08/14 17:39


Manual de Anestesiologia Clínica 33

médica, as discussões sobre divulgação podem ser proibidas como


evidências).
3. Sempre que uma complicação anestésica tornar-se aparente após
uma cirurgia, é importante procurar alguma orientação, notificar

Introdução à Anestesiologia
o departamento de risco ou o grupo institucional de gerencia-
mento de risco. A companhia de seguros deve ser notificada se a
complicação exigir hospitalização prolongada ou resultar em lesão
permanente.
F. Circunstâncias Especiais: “Paciente Não Reanimável” e a Religião
Testemunhas de Jeová. Os pacientes possuem direitos bem definidos
e, entre eles, o direito de recusar tratamentos específicos.
1. Paciente Não Reanimável (PNR). No momento da apresentação
para anestesia, é extremamente importante discutir esse assunto
com pacientes com status PNR, ou com as pessoas responsáveis, a
fim de esclarecer as intenções do indivíduo a ser anestesiado. Em
muitos hospitais, a política institucional é suspender a prescrição
para não ressuscitar durante o período perioperatório levando-se
em consideração que é possível identificar claramente a causa de
parada cardíaca e tratar o paciente durante a cirurgia.
2. Testemunhas de Jeová. Os pacientes podem recusar a adminis-
tração de sangue ou de produtos derivados do sangue com base na
crença de que a vida depois da morte pode ser negada àqueles que
receberem sangue de outras pessoas.
3. Como regra, os médicos não são obrigados a tratar todos os pa-
cientes que procuram tratamento em situações eletivas.
a. Os cuidados médicos na emergência impõem grandes restri-
ções uma vez que o médico envolvido está limitado pela falta de
oportunidade de oferecer um atendimento continuado.
b. As exceções aos direitos dos pacientes incluem parturientes e
adultos que sejam os únicos suportes de crianças menores de
idade. Nessas situações, pode ser necessário procurar uma au-
torização judicial para prosseguir com terapias médicas recusa-
das, como, por exemplo, transfusão de sangue.
G. O National Practitioner Data Bank exige a notificação dos seguintes
eventos: (1) pagamentos realizados em casos de imperícia médica; (2)
ações relacionadas a licenças interpostas por conselhos de medicina;
(3) ações relacionadas a licenças interpostas pelos estados; e (4) ações
ou achados negativos por auditorias ou por entidades privadas de acre-
ditação.

III. MELHORIA DA QUALIDADE E SEGURANÇA DOS PACIENTES EM


ANESTESIA. O consenso é que o foco na qualidade melhora a segurança
e a satisfação dos pacientes sob os cuidados da anestesia. Deve-se dar ênfa-
se especial à segurança dos pacientes e à prevenção de danos causados por
cuidados médicos. De maneira geral, os programas de melhoria da qua-

Barash_I.indd 33 22/08/14 17:39


34 Barash, Cullen, Stoelting, Cahalan, Stock, Ortega

lidade são orientados por exigências da Joint Commission International


(JCI), que é o órgão responsável pela acreditação de hospitais e de serviços
de assistência médica.
A. Estrutura, Processo e Resultado: Os Pilares da Qualidade
1. Embora seja difícil definir qualidade da assistência médica, o consen-
so é que ela se constitui de três componentes: estrutura (instalação
onde os serviços são executados), processo do atendimento médico
(avaliação pré-anestésica além de cuidados contínuos perioperató-
rios) e resultado. Os programas de melhoria da qualidade concen-
tram-se na mensuração e no aprimoramento desses componentes.
2. Os erros nos processos são o foco principal da melhoria contínua
da qualidade (MCQ). Esses erros são controláveis e solucioná-
veis, ao contrário dos erros aleatórios, que são difíceis de evitar.
Os programas de MCQ consideram que os eventos adversos são
formas de identificar oportunidades de melhorias na estrutura e
no processo dos serviços de assistência médica. As auditorias são
extremamente importantes para esse processo.
B. Dificuldade na Mensuração de Desfechos em Anestesia
1. Em geral, a melhoria na qualidade do atendimento médico é men-
surada por reduções na taxa de eventos adversos.
2. Os eventos adversos são raros na anestesia, o que dificulta a mensu-
ração do nível de melhorias. Para complementar a mensuração de
resultados, os programas de MCQ na anestesiologia devem concen-
trar-se em incidentes críticos (eventos que causam ou têm potencial
para causar lesões em pacientes se não forem notificados ou corrigi-
dos em tempo hábil [p. ex., desconexão de um ventilador]), eventos
sentinelas e falhas humanas (inevitáveis, porém com grande poten-
cial de prevenção, por meio de sistemas de proteção adequados).
C. Exigências da Joint Commission International para Melhoria da
Qualidade
1. Os cuidados anestésicos são uma função importante do atendi-
mento aos pacientes identificada pela JCI. É imprescindível que
as políticas e os procedimentos para administração de anestesia
sejam consistentes em todos os locais dentro dos hospitais.
2. A JCI adotou metas para a segurança dos pacientes aplicáveis a
organizações acreditadas, cuja atualização é feita anualmente
(Tab. 4.4).
3. As inspeções da JCI para fins de acreditação não são anunciadas e
envolvem a presença de um inspetor cuja função é observar o aten-
dimento aos pacientes e confirmar a implementação rotineira de
barreiras de segurança na prática assistencial (p. ex., administração
de antibióticos no tempo certo e etiquetagem adequada de todas as
seringas nas fichas de anestesia).
4. A JCI exige que todas as causas de eventos sentinelas (i.e., ocorrên-
cias inesperadas envolvendo morte ou lesão física ou psicológica
grave) sejam analisadas com o máximo rigor possível.

Barash_I.indd 34 22/08/14 17:39


Manual de Anestesiologia Clínica 35

TABELA 4.4 Metas de segurança do paciente estabelecidas pela Joint


Commission International para hospitais acreditados*
1. Identificar os pacientes corretamente.

Introdução à Anestesiologia
2. Melhorar a comunicação efetiva.
3. Melhorar a segurança de medicamentos de alta vigilância.
4. Assegurar cirurgias com paciente correto, procedimento correto e local de
intervenção correto.
5. Reduzir o risco de infecções associadas aos cuidados de saúde.
6. Reduzir o risco de lesões decorrentes de quedas dos pacientes.

*N. de R.T. As metas internacionais de segurança são estabelecidas pela Joint Commission
International, cujo representante exclusivo no Brasil é o Consórcio Brasileiro de Acreditação (CBA). 

D. Pagamento por Desempenho


1. Sob o ponto de vista conceitual, a meta é criar incentivos financeiros
para a implementação de práticas seguras por meio da mensuração
do desempenho e do cumprimento das metas de desempenho pre-
viamente estabelecidas (p. ex., pagamento com base na qualidade do
serviço em vez do simples pagamento pela prestação do serviço).
2. Os grandes motivadores de pagamentos por desempenho são o
Leapfrog Group, o Institute for Healthcare Improvement, os Centers
for Medicare and Medicaid Services e o National Quality Forum.
3. Os benchmarkings como indicadores de mensurações e de melho-
rias incluem a “lista de eventos sentinelas” (p. ex., cirurgia no pa-
ciente ou no local errados, retenção involuntária de corpos estra-
nhos, morte de pacientes provocada por erro de medicação, morte
perioperatória de pacientes ASA 1).
4. O Anesthesia Quality Institute (AQI) foi contratado pela ASA em
2009 para assessorar seus membros na manutenção das certifica-
ções, no atendimento às novas normas e na coleta de informações
sobre estudo de casos. O AQI está desenvolvendo o National Anes-
thesia Clinical Outcomes Registry, que poderá tornar-se um recur-
so importante de benchmarking para os anestesiologistas.

IV. RESPONSABILIDADE PROFISSIONAL


A. Sistema de Agravo
1. Agravo pode ser definido como um delito civil. A negligência é
um tipo de agravo. Imperícia refere-se a qualquer tipo de má con-
duta profissional, embora, em geral, sob o ponto de vista jurídico,
esse termo seja usado para definir negligência profissional.
2. Para vencer uma ação judicial de imperícia, o paciente (autor da
ação) deve comprovar quatro elementos de negligência (Tab. 4.5).
B. Obrigações. Sempre que existir uma relação entre médico e paciente,
o anestesiologista deve estabelecer compromisso com o paciente. Ba-
sicamente, já existe um compromisso predefinido quando o paciente

Barash_I.indd 35 22/08/14 17:39


36 Barash, Cullen, Stoelting, Cahalan, Stock, Ortega

TABELA 4.5 Elementos necessários para comprovação de imperícia


Obrigações (estabelecidas durante a visita ao paciente antes da cirurgia).
Não cumprimento das obrigações (em geral é determinado por testemunhas
especializadas no assunto).
Causalidade (o juiz e o júri determinam se o não cumprimento dessas obrigações foi a
causa imediata da lesão).
Danos (o não cumprimento do padrão de tratamento foi a causa do dano).

é visitado antes da cirurgia, e, nesse momento, o anestesiologista con-


corda em realizar a anestesia. Considerando que é impossível delinear
normas específicas para todos os aspectos da prática médica e para
todas as eventualidades, os tribunais criaram o conceito de razoável
e prudente. Uma obrigação de caráter geral é a obtenção de consenti-
mento informado que inclua riscos comuns e, nos casos de anestesia
regional, riscos raros com consequências graves, incluindo convulsão,
parada cardíaca, neuropatia permanente e paralisia.
C. Não Cumprimento das Obrigações. Nas ações judiciais de imperícia
médica, as testemunhas especializadas no assunto devem revisar os
prontuários médicos e determinar se o anestesiologista agiu de manei-
ra razoável naquela situação específica e cumpriu suas obrigações em
relação ao paciente.
D. Causalidade. Embora, normalmente, o ônus da prova da causalidade
recaia sobre o paciente (autor da ação), em circunstâncias especiais
pode ser transferido para o médico (réu), com base na doutrina res ipsa
loquitur (“os fatos falam por si mesmos”) (Tab. 4.6).
E. Nas ações judiciais de imperícia médica, os danos caracterizam-se
como danos gerais (dor e sofrimento como resultado direto da lesão),
danos especiais (despesas médicas, perda de renda) e danos punitivos
(raramente aplicados em ações judiciais por imperícia). O júri é res-
ponsável pelo cálculo do valor dos danos expresso em moeda corrente.
F. Padrão de Atendimento
1. Considerando que, em geral, a imperícia médica envolve assun-
tos além da compreensão de juízes e jurados leigos, os tribunais
determinam o padrão de atendimento em cada caso com base

TABELA 4.6 Elementos necessários para comprovar a condição res


ipsa loquitur
Em geral, a lesão não ocorre na ausência de negligência.
A lesão foi causada por algo sob controle exclusivo do anestesiologista.
A lesão não pode ser atribuída a qualquer contribuição do paciente.
A evidência para explicação dos eventos é mais acessível ao anestesiologista do que ao
paciente.

Barash_I.indd 36 22/08/14 17:39


Manual de Anestesiologia Clínica 37

no testemunho de peritos. Os peritos diferem das testemunhas


factuais, principalmente porque são obrigados a dar pareceres
técnicos. O juiz do tribunal de primeira instância tem poder dis-
cricionário para determinar se a testemunha pode qualificar-se

Introdução à Anestesiologia
ou não como perito.
2. Os peritos têm a tendência de vincular lesões graves a cuidados
inadequados (tendência de associar maus resultados a atendimen-
tos precários).
3. A diferença essencial entre normas e orientações é que as orienta-
ções são diretrizes que deveriam ser seguidas, e as normas devem
ser rigorosamente seguidas. A ASA publica normas e orientações
para uma grande variedade de atividades relacionadas à anestesio-
logia.
G. Causas de Ações Judiciais Relacionadas à Anestesiologia
1. Os resultados adversos que terminam em ações judiciais por impe-
rícia são muito poucos. Estima-se que menos de 1 em 25 lesões em
pacientes resulte em litígio por imperícia médica.
2. As causas principais de lesões que resultam na interposição de
ações judiciais contra anestesiologistas são morte, complicações
neurológicas (lesão na medula espinal, lesão em nervos periféri-
cos) e danos cerebrais (Closed Claims Project) (ver Fig. 4.1). Na
maioria das vezes, as causas de morte e de danos cerebrais refletem
problemas no manejo das vias aéreas.
a. As complicações neurológicas, em especial no nervo ulnar, cos-
tumam ocorrer a despeito de posicionamentos aparentemente
adequados.
b. O tratamento de dor crônica (em especial intervenções cervicais
e lesões na medula espinal) é uma fonte cada vez maior de quei-
xas de imperícia médica contra os anestesiologistas.
3. Se os resultados de um procedimento forem desfavoráveis, os
anestesiologistas são os alvos mais prováveis de ações judiciais,
porque, em geral, o relacionamento entre médico e paciente é in-
completo (p. ex., raramente o paciente escolhe o anestesiologista, a
visita pré-operatória é muito rápida, e um anestesiologista diferen-
te pode realizar anestesia).
H. O Que Fazer no Caso de uma Ação Judicial (Tab. 4.7)

TABELA 4.7 Etapas a serem seguidas quando um médico for citado


em uma ação judicial
Não discutir o caso com outras pessoas.
Nunca alterar nenhum registro.
Juntar todos os registros relevantes.
Fazer anotações relacionadas à sua recordação dos eventos.
Trabalhar junto com o advogado.

Barash_I.indd 37 22/08/14 17:39


Esta página foi deixada em branco intencionalmente.

Barash_I.indd 38 22/08/14 17:39


SEÇÃO
Fundamentos Científicos
II da Anestesia

CAPÍTULO

5
Mecanismos da Anestesia e da
Consciência
A introdução da anestesia geral na prática clínica há mais de 150 anos é uma
das maiores inovações da medicina. Ela facilitou o desenvolvimento da cirur-
gia moderna e da especialidade anestesiologia (Crowder CM, Palanca BJ, Evers
AS. Mechanisms of anesthesia and consciousness. Em: Barash PG, Cullen
BF, Stoelting RK, Cahalan MK, Ortega R, Stock MC, Eds. Clinical Anesthesia.
Philadelphia: Lippincott Williams & Wilkins; 2013: 105-129). Apesar da impor-
tância da anestesia geral e de mais de cem anos de pesquisa ativa, os mecanismos
moleculares responsáveis pela ação anestésica ainda são um dos mistérios da
ciência (Tab. 5.1).

I. O QUE É ANESTESIA? Uma descrição prática da anestesia é o conjunto


de alterações no comportamento ou na percepção (os elementos do es-
tado anestésico incluem inconsciência, amnésia, analgesia, imobilidade e
atenuação da resposta autonômica aos estímulos nóxicos). Seja qual for
a definição utilizada de anestesia, as alterações rápidas e reversíveis indu-
zidas por fármacos no comportamento ou na percepção são elementos
essenciais à anestesia. Consequentemente, só é possível definir e medir a
anestesia em organismos intactos.
A. Acredita-se, há muito tempo, que a anestesia seja um estado factível a
partir do momento em que um determinado agente anestésico atin-
ge um nível específico de concentração no sítio efetor localizado no
cérebro, e que, se houver tolerância ao anestésico, torna-se necessário
aumentar a concentração para manter um nível de anestesia constante
durante administrações prolongadas.
B. A descoberta recente de que são necessárias concentrações cerebrais
mais elevadas de anestésico para a indução do que para a manutenção
do estado anestésico (a emergência ocorre em concentrações significati-
vamente mais baixas do que na indução) contradiz tais suposições. Esse
fenômeno é conhecido por inércia neutra e sugere que os mecanismos
de indução e de emergência anestésica possivelmente sejam diferentes.

Barash_II.indd 39 22/08/14 11:50


40 Barash, Cullen, Stoelting, Cahalan, Stock, Ortega

TABELA 5.1 Por que é tão difícil esclarecer os mecanismos da


anestesia?
Dificuldade de associar os efeitos anestésicos observados in vitro a animais intactos.
Não existem relações aparentes entre estrutura e atividade.
Uma ampla variedade de compostos sem nenhuma relação estrutural (de esteroides até
xenônio) é capaz de produzir anestesia.
Vários mecanismos moleculares podem produzir anestesia.
Os anestésicos agem em concentrações extremamente elevadas (em comparação com
fármacos, hormônios e neurotransmissores que se ligam a receptores específicos).
Na hipótese de agirem em receptores, a ligação dos anestésicos possui baixa afinidade e
curta duração (a observação e a caracterização são muito difíceis).

II. COMO MEDIR O ESTADO ANESTÉSICO? Medir quantitativamente a


potência de um anestésico é fundamental para o estudo de suas ações. Con-
centração alveolar mínima (CAM) é definida como a pressão alveolar parcial
de um gás na qual 50% dos humanos não reagem a uma incisão cirúrgica.
A. O uso da CAM para medir a potência anestésica tem a vantagem de
ser uma medida facilmente reproduzível e extremamente constante em
uma ampla variedade de espécies. Além disso, o uso da concentração
do gás expirado gera o índice de concentração “livre” do fármaco ne-
cessária para produzir anestesia, levando-se em conta que a concentra-
ção do gás expirado permanece em equilíbrio com a concentração livre
no plasma.
B. O conceito de CAM tem várias limitações importantes, principalmente
quando se tenta estabelecer uma relação entre valores da CAM e a po-
tência anestésica observada in vitro (Tab. 5.2).
C. Monitores que medem a profundidade anestésica foram introduzidos
na prática clínica.
1. O monitor mais popular faz a conversão de formas de ondas ele-
troencefalográficas em um único valor que se correlaciona com a
profundidade anestésica de alguns anestésicos gerais.
2. Até o momento, ainda não foi comprovado que esses monitores
sejam mais eficazes para impedir a consciência durante a anestesia
do que a simples manutenção de níveis adequados de concentra-
ções de gases expirados.

III. QUAL É A NATUREZA QUÍMICA DOS SÍTIOS ANESTÉSICOS?


A. Regra de Meyer-Overton (Fig. 5.1)
1. Considerando que uma ampla variedade de compostos sem ne-
nhuma relação estrutural segue a regra de Meyer-Overton, o racio-
cínio lógico sugere que, provavelmente, a ação de todos os anesté-
sicos ocorra no mesmo sítio molecular (fato conhecido por teoria
unitária da anestesia).

Barash_II.indd 40 22/08/14 11:50


Manual de Anestesiologia Clínica 41

TABELA 5.2 Conceito de limitações das concentrações alveolares


mínimas (CAM)
O resultado final das determinações das CAMs é quântico (o paciente é anestesiado ou
não).
Dificuldade para comparar as mensurações da CAM com as curvas de concentração e
de reação obtidas in vitro.
As CAMs representam a reação média de toda uma população de pacientes, e não a
reação de um único paciente.
As mensurações da CAM podem ser aplicadas diretamente apenas em gases anestésicos.
Equivalentes da CAM para os anestésicos parenterais (barbitúricos, neuroesteroides e
propofol) são concentrações plasmáticas livres do fármaco necessárias para impedir
movimentos em resposta a estímulos prejudiciais em 50% dos pacientes.
Há uma grande dependência da CAM em relação ao resultado anestésico final
(comando verbal vs. estímulo prejudicial).

Fundamentos Científicos da Anestesia


2. Presume-se que a natureza do sítio anestésico alvo seja hidrofóbi-
ca, considerando que há uma forte correlação entre a solubilidade
em solventes específicos e a potência anestésica.
3. O coeficiente de partição octanol/água é o que melhor se correla-
ciona com a potência anestésica, sugerindo a possibilidade de que
o sítio de aplicação do anestésico seja anfipático, isto é, tem carac-
terística polar e monopolar.
B. Exceções à Regra de Meyer-Overton
1. Existem compostos que possuem estrutura semelhante à de anes-
tésicos halogenados, barbitúricos e neuroesteroides, mas agem
como convulsivantes e não como anestésicos.
2. Em várias séries homólogas de anestésicos, a potência aumenta de
acordo com o aumento no comprimento da cadeia, até atingir um
comprimento crítico. Além desse nível crítico, os compostos não
conseguem produzir anestesia, mesmo nas concentrações mais
elevadas (efeito de teto).
3. A observação de que os enantiômeros (compostos de imagens es-
peculares) de anestésicos possuem potências distintas como anes-
tésicos é um desvio da regra de Meyer-Overton.
4. Ao definir o(s) alvo(s) anestésico(s) das moléculas de um anes-
tésico, deve-se levar em consideração a regra de Meyer-Overton,
assim como as exceções bem definidas a essa regra.
5. Em algumas ocasiões, sugeriu-se que o mecanismo molecular
correto da anestesia deve também ser responsável pela inversão
pressórica (fenômeno por meio do qual a concentração de um de-
terminado anestésico necessária para produzir anestesia aumenta
significativamente se o fármaco for administrado em animais em
condições hiperbáricas). Entretanto, as evidências indicam que a

Barash_II.indd 41 22/08/14 11:50


42 Barash, Cullen, Stoelting, Cahalan, Stock, Ortega

H2
100

Tetrafluoreto de carbono

CAM (atmosferas)
10
Hexafluoreto de enxofre

Óxido nitroso
Xenônio
1

Ciclopropano
0,1
Fluorexano
Éter
Enflurano

Halotano 0,01
Clorofórmio

Metoxiflurano

0,001

Coeficiente de partição óleo gás (37%) Tiometoxiflurano


0,01 0,1 1 10 100 1.000

FIGURA 5.1 Regra de Meyer-Overton. Há uma relação linear (em uma escala loga-
rítmica) entre o coeficiente de partição óleo/gás e a potência dos anestésicos (con-
centração alveolar mínima [CAM]) de inúmeros gases. A correlação entre solubilidade
lipídica e CAM se estende em uma diferença de 70.000 vezes na potência anestésica.

pressão inverte a anestesia pela produção de excitação, anulando


a depressão anestésica sob o ponto de vista fisiológico, em vez de
agir como um antagonista anestésico no sítio efetor.
C. Alvos Lipídicos versus Alvos Proteicos. Os anestésicos interagem com
vários alvos moleculares para produzir efeitos na função dos canais iô-
nicos e de outras proteínas.
D. Teorias Lipídicas da Anestesia. A teoria lipídica da anestesia postula
que os anestésicos dissolvem-se na camada dupla dos lipídeos de mem-
branas biológicas e produzem anestesia no momento em que atingem
concentrações críticas. Mesmo assim, nenhuma teoria lipídica conse-
gue explicar de forma plausível toda a farmacologia dos anestésicos,
sendo que grande parte dos investigadores não considera os lipídeos
como alvo mais provável dos anestésicos gerais.

Barash_II.indd 42 22/08/14 11:50


Manual de Anestesiologia Clínica 43

E. Teorias Proteicas da Anestesia. A regra de Meyer-Overton pode tam-


bém ser explicada pela interação de anestésicos com sítios hidrofóbicos
nas proteínas.
1. As interações diretas das moléculas anestésicas com as proteínas
satisfazem não apenas a regra de Meyer-Overton, mas explicam
também de uma forma mais simples os compostos que se desviam
dessa regra.
2. Os sítios de ligações proteicas para os anestésicos também expli-
cam os efeitos convulsivantes de alguns alcanos poli-halogenados.

IV. COMO OS ANESTÉSICOS INTERFEREM NA FUNÇÃO ELETROFI-


SIOLÓGICA DO SISTEMA NERVOSO? O neurônio é a unidade fun-
cional do sistema nervoso central (SNC). Em última análise, os anesté-
sicos gerais interrompem a função dos neurônios que fazem a mediação
do comportamento, da consciência e da memória. Os anestésicos podem
executar essa tarefa alterando a taxa intrínseca de disparo de neurônios
individuais (excitabilidade neuronal) ou alterando a comunicação entre
neurônios (transmissão sináptica).

Fundamentos Científicos da Anestesia


A. Excitabilidade Neuronal. Os anestésicos podem hiperpolarizar (criar
um potencial de membrana em repouso mais negativo) os neurônios
motores espinais e os neurônios corticais, sendo essa capacidade de hi-
perpolarização correlacionada com a potência anestésica. Embora os
dados atuais ainda concordem com a visão prevalente de que a exci-
tabilidade neuronal é apenas discretamente afetada pelos anestésicos
gerais, esse pequeno efeito pode, mesmo assim, contribuir de forma
significativa para a ação clínica dos anestésicos voláteis.
B. Transmissão Sináptica. A transmissão sináptica é considerada o sítio
subcelular mais provável da ação dos anestésicos gerais. A neurotrans-
missão através de sinapses tanto excitatórias (nem todas as sinapses ex-
citatórias são igualmente sensíveis aos anestésicos) quanto inibitórias é
bastante alterada pelos anestésicos gerais.
1. Efeitos Pré-Sinápticos. A liberação do neurotransmissor de sinap-
ses glutamatérgicas é inibida por concentrações clínicas de anesté-
sicos voláteis.
2. Efeitos Pós-Sinápticos. Os anestésicos alteram a resposta pós-
-sináptica aos neurotransmissores liberados em uma grande varie-
dade de sinapses.

V. AÇÕES ANESTÉSICAS SOBRE OS CANAIS IÔNICOS. Os canais iôni-


cos provavelmente estejam entre os alvos da ação anestésica.
A. Efeitos Anestésicos sobre Canais Iônicos Voltagem-Dependentes.
Uma grande variedade de canais iônicos tem capacidade de captar alte-
rações no potencial de membrana e de apresentar respostas abrindo ou
fechando os poros.
1. A função dos canais de cálcio voltagem-dependentes é acoplar a
atividade elétrica a funções celulares específicas (resposta ao po-

Barash_II.indd 43 22/08/14 11:50


44 Barash, Cullen, Stoelting, Cahalan, Stock, Ortega

tencial de ação ao abrir). A abertura permite a entrada de cálcio na


célula e ativa a secreção dependente de cálcio dos neurotransmis-
sores na fenda sináptica.
2. Os canais de potássio são os canais iônicos mais diversificados e
incluem os canais voltagem-dependentes (canais de fundo ou de
vazamento) que se abrem em uma ampla gama de voltagens.
B. Efeitos Anestésicos sobre Canais Controlados por Ligantes. As ações
dos canais iônicos controlados por ligantes medeiam a neurotransmis-
são excitatória e inibitória rápida. A liberação sináptica de glutamato
ou de ácido gama-aminobutírico (GABA) se difunde ao longo da fenda
sináptica ligando-se aos canais proteicos que se abrem em consequên-
cia da liberação pelo neurotransmissor. Os canais iônicos controlados
por ligantes produzem um alvo lógico para a ação anestésica porque
os efeitos seletivos sobre esses canais inibem a transmissão sináptica
excitatória rápida ou facilitam a transmissão sináptica inibitória rápida.
1. Os canais iônicos ativados por glutamato incluem receptores do
AMPA (ácido alfa-amino-3-hidróxi-5-metil-4-isoxazole propiô-
nico), receptores de cainato e receptores do N-metil-d-aspartato
(NMDA).
a. Os receptores de AMPA e cainato são canais catiônicos mono-
valentes relativamente seletivos envolvidos na transmissão si-
náptica excitatória rápida.
b. Além de serem condutores de Na1 e K1, os canais de NMDA
conduzem também Ca11 e estão envolvidos na modulação a
longo prazo de respostas sinápticas (potencialização de longo
prazo). Aparentemente, as correntes ativadas pelo NMDA tam-
bém são sensíveis a um subgrupo de anestésicos.
c. A cetamina é um inibidor potente e seletivo de correntes ativa-
das pelo receptor NMDA. A cetamina inibe as correntes geradas
de forma estereosseletiva, ligando-se ao sítio de fenciclidina que
se localiza na proteína do receptor NMDA.
d. Os receptores NMDA podem também ser um alvo importante
para o óxido nitroso e o xenônio.
2. Canais Iônicos Ativados pelo GABA. O GABA é o neurotrans-
missor inibitório mais importante no SNC dos mamíferos.
a. Os canais iônicos ativados pelo GABA (receptores GABAA) me-
deiam respostas pós-sinápticas, permitindo, de forma seletiva, a
penetração de íons cloreto com a consequente hiperpolarização
dos neurônios. Os receptores GABAA são proteínas de multissu-
bunidades consistindo em várias combinações de subunidades
a, b, d e «, sendo que cada uma dessas subunidades possui vá-
rios subtipos.
b. A função dos receptores GABAA é modulada por uma ampla
variedade de agentes farmacológicos, como convulsivantes, an-
ticonvulsivantes, sedativos, ansiolíticos e anestésicos.

Barash_II.indd 44 22/08/14 11:50


Manual de Anestesiologia Clínica 45

c. Barbitúricos, anestésicos esteroides, benzodiazepínicos, propo-


fol, etomidato e os anestésicos voláteis modulam a função dos
receptores GABAA (potencialização, controle direto e inibição).
d. Apesar da semelhança dos efeitos de vários anestésicos sobre a
função do receptor GABAA, diferentes anestésicos agem sobre
subtipos distintos desses receptores (a sensibilidade aos ben-
zodiazepínicos exige a presença do subtipo da subunidade g2;
a sensibilidade ao etomidato exige a presença do subtipo da
subunidade b2 ou b3).
3. Outros Canais Iônicos Ativados por Ligantes. Os receptores
controlados por ligantes com estrutura química semelhante à do
receptor GABAA, incluindo os receptores da acetilcolina nicotínica
(tipos muscular e neuronal), receptores da glicina e receptores do
5-HT3, são modulados por anestésicos gerais.
a. A glicina é um importante neurotransmissor inibitório, sobre-
tudo na medula espinal e no tronco encefálico (os anestésicos
voláteis potencializam as correntes ativadas pela glicina). O re-

Fundamentos Científicos da Anestesia


ceptor da glicina é um dos membros da superfamília do canal
ativado por ligantes que, a exemplo do receptor GABAA, é um
canal iônico seletivo para o cloreto.
b. Os receptores do 5-HT3 também pertencem à superfamília
geneticamente relacionada dos canais de receptores contro-
lados por ligantes (os anestésicos voláteis potencializam as
correntes ativadas pela 5-hidroxitriptamina). Os receptores
do 5-HT3 desempenham papel importante no estado anesté-
sico produzido por anestésicos voláteis, embora possam con-
tribuir com alguns efeitos anestésicos colaterais indesejáveis
como náusea e vômito.

VI. COMO OS EFEITOS MOLECULARES DOS ANESTÉSICOS SÃO


VINCULADOS À ANESTESIA?
A. Abordagens Farmacológicas. Um dos paradigmas experimentais uti-
lizado com frequência para estudar os mecanismos anestésicos é admi-
nistrar um fármaco que exerça uma ação específica sobre um suposto
alvo anestésico (um agonista ou antagonista de receptores; um ativador
ou antagonista de um canal iônico) e, a seguir, verificar se esse fármaco
aumentou ou diminuiu a sensibilidade do animal a um determinado
anestésico. O desenvolvimento de antagonistas específicos para agentes
anestésicos poderia criar uma ferramenta importante para vincular os
efeitos anestésicos à anestesia no nível molecular em organismos intac-
tos e poderia também ser extremamente útil do ponto de vista clínico.
B. Abordagens Genéticas. Uma das abordagens alternativas para estudar
a relação entre os efeitos anestésicos observados in vitro e na anestesia
geral em animais é como este fato poderia afetar a sensibilidade à anes-
tesia geral.

Barash_II.indd 45 22/08/14 11:50


46 Barash, Cullen, Stoelting, Cahalan, Stock, Ortega

1. Ultimamente, o foco das atenções tem se voltado para um novo


possível canal catiônico, NCA-1/NCA-2, que controla a sensibili-
dade ao halotano na Caenorhabditis elegans e na Drosophila, co-
nhecida como mosca-das-frutas.
2. Nos mamíferos, o camundongo é o modelo de organismo genético
mais poderoso e foi utilizado para desenvolver técnicas que modi-
ficam qualquer gene de interesse. O receptor GABAA foi estudado
de forma extensiva por meio de técnicas genéticas em camundon-
gos.

VII. EM QUE PARTE DO SISTEMA NERVOSO CENTRAL OCORRE A


AÇÃO DOS ANESTÉSICOS?
A. Imobilidade. As evidências indicam que a medula espinal é o principal
sítio de ação dos anestésicos para inibir os movimentos em resposta a
um estímulo nóxico. Este é o desfecho final utilizado na maior parte
das mensurações da potência anestésica. Os valores da CAM para os
anestésicos voláteis não chegam a ser afetados em ratos por descerebra-
ção ou por transecção cervical da medula espinal.
B. Controle Autonômico. A anestesia exerce efeitos profundos sobre os
mecanismos homeostáticos por meio de efeitos nos centros autonômi-
cos do tronco encefálico. As alterações cardiovasculares também são
parcialmente mediadas nos centros autonômicos. Os anestésicos tam-
bém interferem com a termorregulação hipotalâmica.
C. Amnésia. Embora os mecanismos neurobiológicos subjacentes ao apren-
dizado, à consolidação da memória e à capacidade de armazenamento da
memória ainda permaneçam obscuros, o hipocampo e as amígdalas são
alvos anestésicos plausíveis para suprimir a formação de memória.
D. Inconsciência. Do ponto de vista operacional, consciência é um estado
complexo que pode ser dividido em dois componentes (excitação e de-
pressão) e bloqueado individualmente por anestésicos.
E. Sistema de Ativação Reticular e Centros Excitatórios. O sistema de
ativação reticular (RAS, reticular activating system) é um grupo difuso
de neurônios do tronco encefálico que fazem a mediação da excitação. A
estimulação elétrica do RAS induz a excitação em animais anestesiados.
1. Várias linhas de evidências sugerem que a inibição anestésica do
núcleo tuberomamilar (NTM) do hipotálamo dorsal altera a exci-
tação (Fig. 5.2).
2. Aparentemente, a área perifornical do hipotálamo lateral é crítica
na emergência, e não na indução de inconsciência por anestésicos.
Essa área é a única fonte de orexina, neurotransmissor que estabi-
liza a flutuação do sono.
3. A função exata dos centros excitatórios dopaminérgicos e noradre-
nérgicos na inconsciência induzida por anestésicos ainda perma-
nece obscura.

Barash_II.indd 46 22/08/14 11:50


Manual de Anestesiologia Clínica 47

Córtex cerebral

His Ach

DA Tálamo NBM Nor


His

Ox
NTM
Ox His

GABA
PF VLPO
Ox GABA

Nor

Fundamentos Científicos da Anestesia


Ox
VTA LC

FIGURA 5.2 Diagrama do circuito de excitação subcortical envolvido na inconsci-


ência induzida por anestésicos. O núcleo tuberomamilar (NTM) e o núcleo pré-óptico
ventrolateral (VLPO, ventrolateral preoptic) formam um interruptor sono/vigília biestá-
vel. A liberação de orexina (Ox) a partir da área perifornical (PF) estabiliza o interruptor
de sono VLPO-NTM e desempenha um papel relevante na modulação das saídas de
várias áreas. Ach 5 acetilcolina; DA 5 dopamina; GABA 5 ácido gama-aminobutíri-
co; His 5 histamina; LC 5 locus coeruleus; NBM 5 núcleo basal de Meynert; nor 5
norepinefrina; VTA 5 área tegmental ventral.

F. Tálamo. O tálamo é um alvo provável da ablação anestésica da cons-


ciência, embora seus mecanismos exatos sejam desconhecidos.
G. Córtex Cerebral. O córtex cerebral é o sítio principal de integração,
armazenamento e recuperação de informações para a geração da cons-
ciência do ambiente externo.
1. A interrupção das conexões de feedback pelos anestésicos pode
contribuir para alterações na consciência, atenuando a integração
de informações distribuídas entre as regiões corticais.
2. Os efeitos dos anestésicos sobre a atividade cortical basal e sobre
os potenciais de ação provavelmente contribuam para a perda da
consciência limitando a diversidade de informações que podem
ser representadas e a integração das informações neurais.
3. Os anestésicos alteram a topologia de conexões frontais, parietais
e temporais facilitando a atenção e processos cognitivos superiores
com base nos padrões de atividades correlatas.

Barash_II.indd 47 22/08/14 11:50


48 Barash, Cullen, Stoelting, Cahalan, Stock, Ortega

4. Os anestésicos enfraquecem a atividade cortical oscilatória sincro-


nizada de alta frequência que, normalmente, é importante para a
integração de informações ao longo das áreas corticais.

VIII. CONCLUSÕES (Fig. 5.3)


A. Está suficientemente claro que todas as ações anestésicas não podem se
localizar em relação a um sítio específico no SNC (evidências conside-
ráveis permitem concluir que componentes distintos do estado anesté-
sico são mediados por ações em sítios anatômicos bem diferentes).

Movimento da
consciência

Neuro-
Excitabilidade transmissão
neuronal excitatória

Receptores Canais Canais de Receptores


GABAA de sódio potássio NMDA
de fundo

Etomidato,
Anestésicos Óxido nitroso,
propofol, Cetamina
voláteis xenônio
barbitúricos

FIGURA 5.3 Modelo com vários sítios de ação dos anestésicos. Os anestésicos estão
agrupados de acordo com a semelhança do mecanismo. As setas indicam ativação ou
potencialização, e os Ts indicam inibição ou antagonismo. Os efeitos neurofisiológicos
dos anestésicos gerais estão agrupados na excitabilidade neuronal (a probabilidade de
um disparo neuronal e da propagação potencial de ação axonal) e na neurotransmissão
excitatória (atividade sináptica em sinapses excitatórias como a glutamatérgica). Nesse
contexto, a excitabilidade neuronal é a soma de fatores intrínsecos e extrínsecos (ini-
bição gabaérgica). GABA 5 ácido gama-aminobutírico; NMDA 5 N-metil-D-aspartato.

Barash_II.indd 48 22/08/14 11:50


Manual de Anestesiologia Clínica 49

B. As ações dos anestésicos não podem ser localizadas em um único pro-


cesso fisiológico.
1. No nível molecular, os anestésicos voláteis apresentam alguma se-
letividade, mas, mesmo assim, afetam a função de vários canais
iônicos e de proteínas sinápticas.
2. Anestésicos intravenosos, etomidato, propofol e barbitúricos são
mais específicos quando o receptor GABAA for o alvo principal.
C. Os dados genéticos demonstram claramente que a teoria unitária da
anestesiologia não é correta.
D. Não existe um mecanismo único que seja responsável pelos efeitos de
todos os anestésicos gerais, nem um único mecanismo que seja respon-
sável por todos os efeitos de um único anestésico, pelo menos nos casos
que foram observados.
E. Embora o conjunto exato das interações moleculares responsáveis pela
produção de anestesia ainda não tenha sido completamente esclareci-
do, os anestésicos não agem por meio de efeitos seletivos sobre alvos
moleculares específicos.

Fundamentos Científicos da Anestesia

Barash_II.indd 49 22/08/14 11:50


CAPÍTULO

6
Base Genômica da Medicina
Perioperatória
A diversidade biológica humana envolve variabilidade interindividual na morfo-
logia, no comportamento, na fisiologia, no desenvolvimento, na suscetibilidade
a doenças e na resposta a estímulos estressantes e a terapias farmacológicas (fe-
nótipos) (Friede K, Mathew JP, Podgoreanu MV. Genomic basis of perioperative
medicine. Em: Barash PG, Cullen BF, Stoelting RK, Cahalan MK, Ortega R, Stock
MC, Eds. Clinical Anesthesia. Philadelphia: Lippincott Williams & Wilkins; 2013:
130-155). A variação fenotípica é determinada, pelo menos em parte, por dife-
renças na constituição genética específica (genótipo) de um indivíduo.

I. PRINCÍPIO CIENTÍFICO BÁSICO DA MEDICINA GENÔMICA. A


medicina genômica propõe a utilização de informações genômicas para
auxiliar a tomada de decisões médicas e individualizar os cuidados de saú-
de. Melhorias impressionantes nas tecnologias de sequenciamento e redu-
ções de custo são os estímulos para buscar a criação de pesquisas médicas
personalizadas.
A. Muitas doenças comuns como aterosclerose, doença arterial coronaria-
na, hipertensão, diabetes, câncer e asma, assim como muitas respostas
individuais a lesões, fármacos e terapias não farmacológicas, em geral
são complexas e costumam envolver interações de inúmeras variações
genéticas nas vias moleculares e bioquímicas.
B. O período perioperatório representa um exemplo único e extremo da
interação entre gene e ambiente.
1. A marca registrada da fisiologia perioperatória é a variabilidade
impressionante nas respostas dos pacientes a alterações induzidas
por eventos que ocorrem durante o período operatório.
2. Isso se traduz em variabilidade interindividual relevante nos even-
tos adversos perioperatórios imediatos (p. ex., mortalidade, inci-
dência ou gravidade da disfunção de algum órgão), bem como nos
desfechos a longo prazo (Tab. 6.1).
3. A variação genética é parcialmente responsável pela variabilidade
observada nos resultados.
C. Com evidências cada vez maiores sugerindo que a variação genética
pode modular, de forma significativa, o risco de eventos periopera-
tórios adversos, o campo emergente da genômica perioperatória tem
como objetivo a aplicação de abordagens genômicas funcionais com a
finalidade de descobrir mecanismos biológicos subjacentes.
1. Essas abordagens explicam por que pacientes semelhantes apre-
sentam resultados tão dramaticamente diferentes depois de uma
cirurgia. Esses resultados são determinados por uma combinação
exclusiva de insultos ambientais e de fenótipos pós-operatórios

Barash_II.indd 50 22/08/14 11:50


Manual de Anestesiologia Clínica 51

TABELA 6.1 Categorias de fenótipos perioperatórios


Desfechos Perioperatórios Imediatos
Mortalidade hospitalar
Infarto do miocárdio perioperatório
Síndrome do baixo débito cardíaco perioperatório
Síndrome vasoplégica perioperatória
Arritmias perioperatórias (fibrilação atrial, prolongamento do intervalo QTc)
Sangramento pós-operatório
Trombose venosa perioperatória
Acidente vascular encefálico pós-operatório agudo
Delirium pós-operatório
Lesão renal aguda perioperatória
Lesão pulmonar aguda perioperatória (ventilação mecânica pós-operatória prolongada)
Disfunção/rejeição aguda de aloenxerto
Sepse pós-operatória
Síndrome da disfunção de múltiplos órgãos
Náusea e vômito no pós-operatório

Fundamentos Científicos da Anestesia


Dor pós-operatória aguda
Variabilidade na resposta a anestésicos, analgésicos e outros fármacos perioperatórios
Fenótipos intermediários (níveis plasmáticos de biomarcadores)

Desfechos Pós-Operatórios a Longo Prazo


Sobrevida sem eventos ou com eventos cardíacos adversos graves
Progressão de doença em enxertos venosos
Disfunção ou rejeição crônica de aloenxerto
Disfunção cognitiva pós-operatória
Depressão pós-operatória
Transição de dor aguda para dor crônica
Progressão de câncer
Qualidade de vida

que caracterizam populações de pacientes cirúrgicos e de pacientes


portadores de doenças críticas.
2. Para integrar essa nova geração de resultados genéticos na prática
clínica, os médicos do perioperatório precisam entender os pa-
drões de variação do genoma humano, os métodos de investigação
genética com base na população e os princípios analíticos da ex-
pressão genética e proteica.

II. VISÃO GERAL DA VARIAÇÃO GENÉTICA HUMANA


A. Embora a sequência do DNA humano seja 99,9% idêntica entre os in-
divíduos, qualquer variação pode afetar substancialmente a suscetibili-
dade de uma pessoa a doenças.
B. Variantes genéticas raras (mutações) são responsáveis por mais de 1.500
distúrbios monogênicos (p. ex., cardiomiopatia hipertrófica, síndrome

Barash_II.indd 51 22/08/14 11:50


52 Barash, Cullen, Stoelting, Cahalan, Stock, Ortega

do QT longo, anemia falciforme, fibrose cística, hipercolesterolemia fa-


miliar).
C. Grande parte da diversidade genética na população é atribuível a varia-
ções mais generalizadas na sequência do DNA (polimorfismos), em geral
substituições simples na base dos nucleotídeos (polimorfismos de nucleotí-
deo único [SNP, de single nucleotide polymorphisms]) (Fig. 6.1).
1. Estima-se que existam cerca de 15 milhões de SNPs no genoma
humano, aproximadamente uma vez a cada 300 pares de base, lo-
calizados em genes e ao redor das regiões do genoma.
2. Os polimorfismos podem alterar diretamente a sequência de ami-
noácidos e, portanto, alteram potencialmente a função proteica ou
as sequências de DNA que modulam a expressão proteica.
3. Os grupos de SNPs próximos em um cromossomo são herdados
em blocos e denominam-se haplótipos.
D. O ano de 2007 foi marcado pela conscientização de que o DNA difere
de pessoa para pessoa muito mais do que se suspeitava antes.

III. ABORDAGENS METODOLÓGICAS PARA O ESTUDO GENÉTICO


DE DOENÇAS COMPLEXAS COMUNS
A. A maior parte das pesquisas sobre distúrbios complexos atualmente em
curso tem como foco principal a identificação de polimorfismos gené-
ticos que intensificam a suscetibilidade em determinadas condições (p.
ex., varreduras de genes candidatos e de genomas usados para identifi-
car polimorfismos que afetam as doenças comuns).
B. A análise de ligação é utilizada para identificar a localização cromossô-
mica de variantes genéticas relacionadas a uma determinada doença por
meio do estudo da distribuição dos alelos de doença em indivíduos afe-
tados em toda a árvore genealógica. A natureza complexa da maior parte
das doenças (em especial nos casos de eventos adversos perioperatórios)
impede o estudo de linhagens familiares estendidas às multigerações.
C. Os estudos de associação genética avaliam a frequência de polimor-
fismos genéticos específicos em amostras de populações de indivíduos
portadores de doenças não relacionadas e controles não afetados com
características comparáveis. O fato de tais estudos não exigirem obten-
ção de amostras com base familiar é a vantagem principal dessa abor-
dagem em relação à análise de ligação.
1. O conjunto de evidências provenientes de estudos sobre a asso-
ciação de genes candidatos também sugere a vinculação de genó-
tipos específicos a uma grande variedade de desfechos adversos
perioperatórios em órgãos específicos (p. ex., infarto do miocárdio
[IM], disfunção neurocognitiva, comprometimento renal, reeste-
nose de enxertos venosos, trombose pós-operatória, reatividade
vascular, sepse grave, rejeição de transplante e morte).
2. A replicação de achados em populações diferentes ou fenótipos re-
lacionados ainda é o método mais confiável para validar relações
autênticas entre polimorfismos genéticos e doenças.

Barash_II.indd 52 22/08/14 11:50


Manual de Anestesiologia Clínica 53

Par de
cromossomos
A A
T T
Alelo A T Lócus C Alelo a
G X G
A A
A A
CGTATCGAAC
A. Polimorfismo de nucleotídeo único
CGTCTCGAAC

CGTACACACACACATCGA (CA)5
B. Microssatélite
CGTACACACACACACACATCGA (CA)7

Fundamentos Científicos da Anestesia


CGTACTCAATGATCGA
C. Inserção ou deleção
CGTATCGA

A B C D A B C C C C D D. CNV
Referência CNV multialélico (C) 4
FIGURA 6.1 Categorias de polimorfismos genéticos. A. Os polimorfismos de nucleo-
tídeo único (SNPs) podem ser silenciosos ou resultam em consequências funcionais
que variam desde alterações na sequência de aminoácidos até o encerramento pre-
maturo da síntese proteica. B. Repetição do polimorfismo microssatélite com número
variável de dinucleotídeos (CA)n. C. Polimorfismo de inserção-deleção. O lócus é a
localização de um gene ou marcador genético no genoma. Os alelos são formas alter-
nativas de um gene ou de um marcador genético. Genótipo são os alelos observados
para um indivíduo em um determinado lócus genético. Heterozigoto significa que dois
alelos diferentes estão presentes em um lócus. Homozigoto significa que dois alelos
idênticos estão presentes em um lócus. D. Variação do número de cópias (CNV).

3. O ano de 2007 foi o grande marco da publicação de replicações


adequadas e bem-sucedidas de estudos amplos de associação de
genomas que identificaram contribuintes genéticos importantes
para o risco de doenças poligênicas comuns (p. ex., doença ar-
terial coronariana, IM, diabetes tipos I e II, fibrilação atrial, obe-
sidade, asma, cânceres comuns, artrite reumatoide e doença de
Crohn).
4. Variantes no gene CDKN2A/B, ou próximo dele (inibidores 2 A/B
de cinases dependentes da ciclina), aumentam os riscos de inci-

Barash_II.indd 53 22/08/14 11:50


54 Barash, Cullen, Stoelting, Cahalan, Stock, Ortega

dência de diabetes tipo II e IM, que explicam o mecanismo de liga-


ção entre os dois distúrbios.

IV. PERFIS DAS EXPRESSÕES GENÉTICAS E PROTEICAS EM LARGA


ESCALA: MARCADORES GENÔMICOS VERSUS DINÂMICOS DOS
DESFECHOS PERIOPERATÓRIOS
A. As abordagens genômicas baseiam-se no conceito de transcrição do
RNA mensageiro (mRNA) de uma replicação do DNA e, a seguir, na
tradução do RNA em proteína (Fig. 6.2).
B. A transcrição é uma etapa reguladora importante que pode, no final,
sinalizar muitas outras cascatas de eventos.
1. Embora o genoma humano contenha apenas cerca de 25.000 ge-
nes, a variabilidade funcional no nível proteico é muito mais diver-
sa, como resultado de modificações pós-transcricionais, traducio-
nais e pós-traducionais extensas.
2. Acredita-se que existam cerca de 200.000 proteínas distintas nos
seres humanos, que, por sua vez, são modificadas, pós-traducio-
nalmente, por fosforilação, glicosilação, oxidação e por estruturas
de dissulfeto.
C. Evidências cada vez mais numerosas sugerem que a variabilidade nos
níveis da expressão genética constitui a base de doenças complexas e,
além disso, é determinada por polimorfismos reguladores do DNA que
afetam a eficiência da transcrição, da junção e da tradução, de uma for-
ma estímulo e tecido-específica.

DNA
Transcrição Regulação
transcricional
RNA
Processamento Regulação Junção alternativa
do RNA pós-transcricional Edição
mRNA Poliadenilação alternativa
AAAAA
Tradução Regulação da tradução
e da degradação
Proteína
Glicosilação
Modificações pós-traducionais
Fosforilação
Proteólise
Hidroxilação
Compartimentalização
Clivagem proteolítica, etc.
EFEITOS BIOLÓGICOS
FIGURA 6.2 Dogma central da biologia molecular. A expressão proteica envolve
dois processos principais: a síntese do RNA (transcrição) e a síntese proteica (tradu-
ção), com várias etapas reguladoras intermediárias.

Barash_II.indd 54 22/08/14 11:50


Manual de Anestesiologia Clínica 55

1. As principais categorias funcionais de genes identificados como


potencialmente envolvidos em vias cardioprotetoras incluem um
hospedeiro de fatores de transcrição, proteínas e genes antioxi-
dantes.
2. Aparentemente, programas genéticos diferentes são ativados por
meio de precondicionamento isquêmico versus anestésico, resul-
tando em dois fenótipos cardioprotetores distintos.
D. O transcriptoma (coleção completa de elementos transcritos do geno-
ma) não é totalmente representativo do proteoma (complemento com-
pleto de proteínas codificadas pelo genoma), porque muitos transcritos
não são marcados para tradução, como foi evidenciado recentemente
pelo conceito de silenciamento genético pela interferência do RNA.
1. Portanto, junções alternativas, uma ampla variedade de modifi-
cações pós-traducionais e interações entre proteínas responsáveis
pela função biológica não deveriam ser detectadas pelo perfil da
expressão genética.
2. Isso resultou no surgimento da proteômica, um campo novo que

Fundamentos Científicos da Anestesia


estuda a sequência, modificação e função de muitas proteínas dos
sistemas biológicos em um determinado momento. Em vez de
concentrar-se no DNA “estático”, os estudos de proteômica anali-
sam os produtos proteicos dinâmicos com o objetivo de identificar
proteínas que sofrem alterações em abundância, modificação ou
localização em resposta ao estado de uma doença, trauma, estresse
ou intervenção terapêutica.
3. A proteômica apresenta uma visão mais global e integrada da bio-
logia, complementando outras abordagens genômicas funcionais.

V. GENÔMICA E PERFIL DO RISCO PERIOPERATÓRIO


A. Anualmente, nos EUA, mais de 40 milhões de pacientes se submetem a
algum tipo de cirurgia, a um custo anual total de US$ 450 bilhões. A cada
ano, cerca de 1 milhão de pacientes apresentam complicações médicas
pós-cirúrgicas, resultando em um custo anual total de US$ 25 bilhões.
1. As complicações perioperatórias são significativas e têm custo
muito elevado, com grande variedade de relatos e, em geral, são
detectadas e identificadas de forma imprecisa. Há uma necessi-
dade premente de bases de dados de resultados perioperatórios
abrangentes e precisos.
2. O perfil dos riscos pré-cirúrgicos é inconsistente e deve receber
atenção especial, principalmente nos casos de cirurgias não cardía-
cas, cirurgias não vasculares e de pacientes mais velhos.
3. Há um reconhecimento cada mais vez maior de que a morbidade
perioperatória é resultado direto do estresse ambiental causado
por cirurgias realizadas em quadros de suscetibilidades, determi-
nados pelas características clínicas e genéticas dos indivíduos, o
que pode ocorrer também em pacientes saudáveis.

Barash_II.indd 55 22/08/14 11:50


56 Barash, Cullen, Stoelting, Cahalan, Stock, Ortega

4. A compreensão do papel da variação alotípica em vias pró-infla-


matórias e pró-trombóticas, principais mecanismos fisiopatoló-
gicos responsáveis pelas complicações perioperatórias, pode con-
tribuir para o desenvolvimento de terapias com alvos específicos,
limitando, consequentemente, a incidência de eventos adversos
em pacientes de alto risco.
B. Biomarcadores Preditivos de Eventos Cardíacos Perioperatórios
Adversos. Existe um consenso em torno do fato de que pacientes por-
tadores de doença cardiovascular subjacente estão em risco de eventos
cardíacos adversos depois de cirurgias. Entretanto, a identificação de
pacientes com risco mais elevado de IM perioperatório ainda é extre-
mamente difícil, a despeito de uma forte contribuição genética para o
risco de eventos cardiovasculares adversos.
1. Biomarcadores Inflamatórios e Eventos Cardíacos Periopera-
tórios Adversos. Foram identificados polimorfismos genéticos
inflamatórios que são preditores independentes de IM pós-opera-
tório depois de cirurgia cardíaca com circulação extracorpórea.
a. A proteína C-reativa (PCR) é o protótipo de marcador inflama-
tório de fase aguda e uma forte preditora de risco cardiovascular.
b. Níveis pré-operatórios elevados de PCR (. 3 mg/L) foram as-
sociados a um aumento na morbidade e na mortalidade após
cirurgia de revascularização do miocárdio (CRM).
c. Os níveis plasmáticos elevados de PCR na linha de base e a ele-
vação na fase aguda nos níveis plasmáticos pós-operatórios de
PCR são determinados por meios genéticos.
2. Biomarcadores Trombóticos e Eventos Cardíacos Periopera-
tórios Adversos. Além da ativação inflamatória, a resposta dos
hospedeiros a cirurgias se caracteriza também por elevação na
concentração de fibrinogênio, aderência plaquetária e produção
do inibidor do ativador de plasminogênio tipo 1.
a. Os eventos trombóticos perioperatórios (p. ex., trombose em
enxerto coronariano, IM, acidente vascular encefálico – AVE
– e embolia pulmonar), após cirurgia cardíaca, representam o
extremo em uma transição gradual de disfunção da coagulação,
com a coagulopatia no outro extremo do espectro.
b. As evidências sugerem que a variabilidade genética modula a
ativação de cada uma dessas vias mecânicas, refletindo uma he-
reditariedade significativa do estado pró-trombótico.
3. Peptídeos Natriuréticos e Eventos Cardíacos Perioperatórios
Adversos. O peptídeo natriurético tipo B (PNB) em circulação
(produzido principalmente no miocárdio ventricular) é um bio-
marcador importante de desfechos cardiovasculares perioperató-
rios adversos em muitas circunstâncias.

Barash_II.indd 56 22/08/14 11:50


Manual de Anestesiologia Clínica 57

4. Variação Genética na Reatividade Vascular e em Eventos Car-


díacos Perioperatórios
a. As respostas ao estresse perioperatório também se caracterizam
pela ativação do sistema nervoso simpático, que desempenha
algum tipo de papel na fisiopatologia do IM pós-operatório.
b. Pacientes portadores de doença arterial coronariana e com
polimorfismos genéticos específicos do receptor adrenérgico
podem ser particularmente suscetíveis à toxicidade por cateco-
laminas e a complicações cardíacas.
5. Fibrilação Atrial Perioperatória. Novos episódios de fibrilação atrial
(FA) perioperatória ainda são complicações comuns de procedimen-
tos cardíacos e torácicos não cardíacos (incidência de 27 a 40%) e
estão associados à morbidade aumentada, a internações hospitalares
mais prolongadas, a uma incidência maior de novas hospitalizações,
aumento nos custos de atendimento médico e redução na sobrevida.
a. Formas hereditárias de FA ocorrem na população ambulatorial
não cirúrgica.

Fundamentos Científicos da Anestesia


b. O papel inflamatório da FA perioperatória é sugerido por níveis
basais de PCR em pacientes do sexo masculino e leucocitose
pós-operatória exagerada, sendo que ambas as condições são
preditoras de FA perioperatória. A administração de anti-infla-
matórios não esteroides tem efeito protetor.
6. Rejeição de Aloenxerto Cardíaco. A identificação de biomarcadores
proteicos e de biomarcadores genéticos de sangue para monitorar,
diagnosticar e prever, de forma não invasiva, rejeições de aloenxerto
cardíaco perioperatório é uma área em amplo desenvolvimento.
7. Biomarcadores Preditivos para Sobrevida Pós-Operatória.
Evidências crescentes sugerem que o polimorfismo do gene ACE
pode influenciar a incidência de complicações após cirurgias de
revascularização coronariana (CABG, de coronary artery bypass
graft), sendo que os portadores do alelo D apresentam taxas mais
elevadas de mortalidade e de reestenose depois desse tipo de ci-
rurgia, em comparação com portadores do alelo I.
C. Biomarcadores Preditivos de Desfechos Neurológicos Perioperató-
rios Adversos
1. Apesar dos avanços nas técnicas cirúrgicas e anestésicas, a morbida-
de neurológica ainda é significativa e sua gravidade varia de coma e
AVE (incidência de 1 a 3%) a deficiências cognitivas mais sutis (in-
cidência # 69%), causando impacto substancial no risco de morte
perioperatória, na qualidade de vida e na utilização de recursos.
2. Acredita-se que a fisiopatologia de lesões neurológicas periope-
ratórias envolva interações complexas entre vias primárias asso-
ciadas à aterosclerose e trombose e vias de respostas secundárias
como inflamação, reatividade vascular e lesões celulares diretas.

Barash_II.indd 57 22/08/14 11:50


58 Barash, Cullen, Stoelting, Cahalan, Stock, Ortega

a. Existem relatos de muitas variantes genéticas funcionais em


cada uma das vias mecânicas envolvidas na modulação da
magnitude e nas respostas a lesões neurológicas, que podem
ter implicações nos desfechos neurocognitivos perioperatórios
crônicos e agudos. Vias específicas estão associadas ao desen-
volvimento de complicações pós-operatórias, como a disfunção
cognitiva pós-operatória.
b. Há uma relação significativa entre o genótipo da apolipopro-
teína E e eventos neurológicos adversos em pacientes que se
submetem a cirurgia cardíaca. A incidência de delirium pós-
-operatório após cirurgias cardíacas importantes em idosos e
em pacientes portadores de doenças críticas aumenta nos por-
tadores desse genótipo.
c. A ativação plaquetária é importante na fisiopatologia de se-
quelas neurológicas adversas. As implicações na medicina pe-
rioperatória incluem identificação de populações de risco que
possam se beneficiar não apenas de melhorias no consenti-
mento informado, na estratificação e na alocação de recursos,
mas também de estratégias anti-inflamatórias direcionadas.
D. Biomarcadores Preditivos de Lesão Renal Aguda Perioperatória
1. A insuficiência renal aguda é uma complicação comum importan-
te das cirurgias cardíacas. Cerca de 8 a 15% dos pacientes desen-
volvem lesão renal moderada (aumento no pico do nível de creati-
nina . 1,0 mg/dL), e até 5% desenvolvem insuficiência renal que
exige diálise. A insuficiência renal aguda está associada, de forma
independente, a taxas de mortalidade hospitalar superiores a 60%
em pacientes que necessitam de diálise.
2. Alguns estudos demonstraram que a herança de polimorfismos
genéticos está associada a lesões renais agudas após cirurgia para
revascularização do miocárdio.
E. Variantes Genéticas e Risco de Ventilação Mecânica Pós-Opera-
tória Prolongada. Variantes genéticas na via da renina-angiotensina
e genes das citocinas pró-inflamatórias possivelmente estejam asso-
ciados a complicações respiratórias após circulação extracorpórea.

VI. GENÔMICA E ANESTESIA


A farmacogenômica descreve como variações hereditárias atuam na
variabilidade interindividual na ação de fármacos (farmacocinética ou
farmacodinâmica) (Fig. 6.3). Variabilidade farmacocinética refere-se a
variações na absorção, na distribuição, no metabolismo e na excreção de
um fármaco, regulando sua eficácia e toxicidade (incluem enzimas de me-
tabolização de fármacos como os membros do citocromo P450 ou da su-
perfamília CYP). Variabilidade farmacodinâmica refere-se aos efeitos de
vários fármacos independentemente da liberação de fármacos equivalentes
no sítio molecular da ação (receptores).

Barash_II.indd 58 22/08/14 11:50


Manual de Anestesiologia Clínica 59

A. Variabilidade
farmacocinética

Absorção do fármaco Distribuição do fármaco Metabolismo do fármaco


(variantes do transporte Excreção do fármaco
(ligação de proteínas (variantes da enzima de
de fármacos) (renal/hepática)
plasmáticas) metabolização)

B. Variabilidade
farmacodinâmica

Variabilidade do alvo do
Interações Sinalização Efeitos indiretos sobre
fármaco (variantes
alvo-fármaco pós-receptor a resposta ao fármaco
do receptor)

FIGURA 6.3 Os determinantes farmacogenômicos da resposta individual aos fárma-


cos operam por meio de mecanismos farmacocinéticos (A) e farmacodinâmicos (B).

A. Deficiência de Pseudocolinesterase. Indivíduos com formas atípicas

Fundamentos Científicos da Anestesia


de pseudocolinesterase, resultando em taxas acentuadamente redu-
zidas no metabolismo dos fármacos, correm risco de bloqueio neu-
romuscular excessivo e de apneia prolongada. Mais de 20 variantes
foram identificadas no gene da butirilcolinesterase. Portanto, atual-
mente, os testes farmacogenéticos não são recomendados na popu-
lação em geral, a não ser como explicação para incidência de eventos
adversos.
B. Genética da Hipertermia Maligna
1. A hipertermia maligna (HM) é uma doença genética autossômica
dominante rara do metabolismo do cálcio dos músculos esqueléti-
cos deflagrada pela administração de fármacos anestésicos voláteis
ou de succinilcolina em indivíduos suscetíveis.
2. Inicialmente, a suscetibilidade à HM foi vinculada ao lócus do
gene do receptor de rianodina (RYRI) no cromossomo 19q, porém
está se tornando cada vez mais aparente que a suscetibilidade à
HM resulta de uma interação complexa entre vários genes e fatores
ambientais (p. ex., toxinas ambientais).
3. Por causa do determinismo poligênico e da penetração variável,
atualmente não se recomenda fazer testes diretos de DNA na po-
pulação em geral para verificação de suscetibilidade à HM. Já os
testes em indivíduos de famílias afetadas têm o potencial de redu-
zir substancialmente a mortalidade e a morbidade.
C. Variabilidade Genética e Resposta aos Agentes Anestésicos
1. A potência anestésica, definida pela concentração alveolar míni-
ma (CAM) de um anestésico inalatório que elimina movimentos
voluntários em resposta a estímulos nóxicos, varia entre os indiví-
duos com um coeficiente de variação de cerca de 10% (razão entre
o desvio-padrão e a média).

Barash_II.indd 59 22/08/14 11:50


60 Barash, Cullen, Stoelting, Cahalan, Stock, Ortega

2. As evidências de uma base genética para necessidades maiores de


anestésicos são sugeridas pela observação de que a demanda de
desflurano é crescente em pacientes com cabelos ruivos em relação
aos pacientes com cabelos pretos.
D. Variabilidade Genética e Resposta a Dor
1. Da mesma forma como foi observado na variabilidade da potên-
cia anestésica, a resposta a estímulos dolorosos e às manipulações
analgésicas varia entre indivíduos.
2. Evidências crescentes sugerem que o comportamento da dor em
resposta a estímulos nóxicos e sua modulação pelo sistema nervo-
so central, em resposta à administração de fármacos ou a estresses
ambientais, bem como o desenvolvimento de condições dolorosas
persistentes por meio da amplificação da dor, são fortemente in-
fluenciados por fatores genéticos.
E. Variabilidade Genética em Resposta a Outros Fármacos Periopera-
tórios
1. Uma ampla variedade de fármacos utilizados no período periope-
ratório apresenta variabilidade farmacocinética ou farmacodinâ-
mica significativa, sujeita a modulações genéticas (Tab. 6.2).
2. Em geral, as categorias mais citadas envolvidas em reações ad-
versas incluem fármacos cardiovasculares, antibióticos, psiquiá-
tricos e analgésicos, sendo que cada categoria possui uma base
genética conhecida para risco aumentado de reações adversas.
3. A variação genética nos alvos (receptores) pode exercer efeitos
profundos na eficácia dos fármacos.
a. Os transportadores dos alelos de suscetibilidade não possuem
nenhum prolongamento manifesto do intervalo QT ou históri-
co de morte súbita até a sobreposição da administração de fár-
macos que prolongam o QT.
b. A predisposição para o prolongamento do intervalo QT (con-
siderado fator de risco de arritmias ventriculares com risco de
vida) foi responsável pela retirada de mais fármacos do mercado
que qualquer outra categoria de evento adverso.
F. A farmacogenômica está se sobressaindo como componente modi-
ficador adicional da anestesia juntamente com idade, sexo, comorbi-
dades e uso de fármacos. Existem testes específicos e orientações de
tratamento que permitem aos médicos alterar, de forma adequada, a
utilização dos fármacos (p. ex., ajuste de doses ou alteração do fárma-
co) para alguns compostos e que provavelmente serão expandidos para
todos os componentes terapêuticos relevantes, junto com a identifica-
ção de novos alvos terapêuticos.

Barash_II.indd 60 22/08/14 11:50


Manual de Anestesiologia Clínica 61

TABELA 6.2 Exemplos de polimorfismos genéticos envolvidos em


respostas variáveis aos fármacos usados no período
perioperatório
Classe Nome do Gene (Símbolo
Farmacológica do Gene) Efeito do Polimorfismo
Variabilidade Farmacocinética
Betabloqueadores Citocromo P450 2D6 Efeito intensificado do fármaco
(CYP2D6)
Codeína, (CYP2D6) Efeito diminuído do fármaco
dextrometorfano
Bloqueadores do Citocromo P450 3A4 Incerto
canal de cálcio (CYP3A4)
Alfentanil CYP3A4 Efeito intensificado do fármaco
Bloqueadores do Citocromo P450 2C9 Resposta pressórica aumentada
receptor tipo 1 da (CYP2C9)
angiotensina II

Fundamentos Científicos da Anestesia


Varfarina CYP2C9 Efeito anticoagulante
intensificado, risco de
sangramento
Fenitoína CYP2C9 Efeito intensificado do fármaco
Inibidores da ECA Enzima conversora da Resposta pressórica
angiotensina I (ECA)
Procainamida N-acetiltransferase 2 Efeito intensificado do fármaco
(NAT2)
Succinilcolina Butirilcolinesterase Efeito intensificado do fármaco
(BCHE)
Digoxina P-glicoproteína (ABCB1, Biodisponibilidade aumentada
MDR1)
Variabilidade Farmacodinâmica
Betabloqueadores Receptores adrenérgicos b1 Resposta à pressão arterial
e b2 (ADRB1, ADRB2) e à frequência cardíaca,
sensibilidade das vias aéreas
aos agonistas b2
Fármacos que Canais iônicos de sódio Síndrome do QT longo, risco de
prolongam o QT e de potássio (SCN5A, torsade de pointes
(antiarrítmicos, KCNH2, KCNE2,
cisaprida, KCNQ1)
eritromicina)
Aspirina, inibidores Subunidade da Variabilidade nos efeitos
da glicoproteína glicoproteína IIIa da antiplaquetários
IIb/IIIa glicoproteína plaquetária
IIb/IIIa (ITGB3)
Fenilefrina Síntese do óxido nítrico Resposta pressórica
endotelial (NOS3)

Barash_II.indd 61 22/08/14 11:50


62 Barash, Cullen, Stoelting, Cahalan, Stock, Ortega

VII. GENÔMICA E CUIDADOS CRÍTICOS


A. Variabilidade Genética e Resposta a Lesões
1. Lesões sistêmicas (incluindo trauma e estresse cirúrgico), choque
e infecção desencadeiam respostas fisiológicas como febre, taqui-
cardia, taquipneia e leucocitose que, coletivamente, definem a sín-
drome da resposta inflamatória sistêmica.
2. Os novos paradigmas médicos de tratamentos críticos indicam
que os desfechos de doenças críticas são determinados pela intera-
ção entre a lesão e os processos de reparo deflagrados pela agressão
inicial.
a. Desfechos negativos são os resultados combinados de lesões te-
ciduais diretas, dos efeitos colaterais dos processos de reparo e
os mecanismos secundários de lesões que produzem resultados
subótimos.
b. Esse conceito forma a base do novo sistema de estágios PIRO
(predisposição, infecção ou insulto, resposta e disfunção orgâ-
nica) em doenças críticas.
c. Os fatores genômicos desempenham algum papel ao longo des-
se continuum entre variantes de genes inflamatórios e modula-
dores da interação patógeno-hospedeiro à genômica microbia-
na e a ensaios de detecção rápida que identificam patógenos e
biomarcadores, diferenciando infecção de inflamação nas men-
surações dinâmicas de respostas celulares a insulto, apoptose,
hipoxia citopática e estresse celular.
3. A grande variabilidade interindividual na magnitude das respostas
a lesões, incluindo a ativação de cascatas inflamatórias e coagula-
tórias, apoptose e fibrose, sugere o envolvimento de fatores genéti-
cos reguladores.
B. Genômica Funcional das Lesões
1. Em nível celular, os estímulos lesivos desencadeiam respostas ao
estresse adaptativo determinadas por alterações quantitativas e
qualitativas nas cascatas de vias biológicas que interagem de for-
mas complexas e, às vezes, redundantes. Como resultado, inúme-
ros ensaios clínicos que tentaram bloquear mediadores inflamató-
rios simples não obtiveram bons resultados.
2. As lesões em órgãos podem ser definidas por padrões de alterações
genéticas e de sínteses proteicas.

VIII. DIRETRIZES FUTURAS


A. Abordagem Biológica Sistêmica da Medicina Perioperatória. A bio-
logia dos sistemas é uma estrutura conceitual que permite aos cientistas

Barash_II.indd 62 22/08/14 11:50


Manual de Anestesiologia Clínica 63

fazer tentativas para correlacionar quantidades maciças de dados apa-


rentemente não relacionados em uma explicação unificada.
B. Alvos Terapêuticos: Os “5Ps” da Medicina Perioperatória e Geren-
ciamento da Dor
1. As abordagens genômicas e proteômicas estão se transformando
rapidamente em plataformas para todos os aspectos da descoberta
e do desenvolvimento de fármacos, desde a identificação e valida-
ção do alvo até a individualização da terapia farmacológica.
2. O genoma humano contém cerca de 25.000 genes que codificam
em torno de 200.000 proteínas, que representam alvos potenciais
dos fármacos.
C. Considerações Éticas
1. Embora um dos objetivos principais do Projeto Genoma Humano
seja aprimorar as terapias por meio de previsões com base no ge-
noma, o surgimento da genômica pessoal abre uma caixa de Pan-
dora de temas éticos, incluindo privacidade e risco de discrimi-
nação contra indivíduos geneticamente predispostos a distúrbios

Fundamentos Científicos da Anestesia


médicos.
2. Outra preocupação ética é a extrapolação de testes genéticos entre
diferentes grupos étnicos, em especial na previsão de respostas ad-
versas aos fármacos.
a. Grande parte dos polimorfismos associados à variabilidade das
respostas aos fármacos mostra diferenças significativas na fre-
quência de alelos entre populações e grupos étnicos.
b. Os padrões de desequilíbrio de ligações são acentuadamente di-
ferentes entre os grupos étnicos, o que pode resultar em achados
espúrios, em vez de variantes causais.
3. Considerando que o objetivo da medicina personalizada é a previ-
são de risco e o tratamento de doenças com base no perfil genético
dos indivíduos, alguns especialistas entendem que a consideração
biológica de raça se tornará obsoleta.

IX. CONCLUSÕES
A. O Projeto Genoma Humano revolucionou todos os aspectos da me-
dicina, permitindo avaliar o impacto da variabilidade genética na ta-
xonomia, na caracterização e no resultado das doenças e as respostas
individuais a vários fármacos e lesões.
B. Sob o ponto de vista mecanicista, as informações compiladas por meio
de abordagens genômicas já estão desvendando questões antigas que
envolvam a ação dos anestésicos gerais e as respostas adversas aos fár-
macos utilizados durante as cirurgias.

Barash_II.indd 63 22/08/14 11:50


64 Barash, Cullen, Stoelting, Cahalan, Stock, Ortega

C. Atualmente, com a utilização de tecnologias moleculares de alta pro-


dutividade, perfis genéticos de enzimas metabolizadoras de fármacos,
proteínas transportadoras e receptores permitirão personalizar a esco-
lha de fármacos e regimes de dosagem específicos para o perfil farma-
cogênico de cada paciente. Nesse ponto, os médicos do perioperatório
terão à disposição informações muito mais consistentes para usar na
elaboração de um plano anestésico individualizado, mais adequado e
seguro.

Barash_II.indd 64 22/08/14 11:50


CAPÍTULO

7
Princípios Básicos da
Farmacologia Clínica
O objetivo principal da administração de fármacos anestésicos é estabelecer e
manter, de forma rápida, os efeitos terapêuticos e minimizar a incidência de
efeitos colaterais indesejáveis (Gupta DK, Henthorn TK. Basic principles of
clinical pharmacology. Em: Barash PG, Cullen BF, Stoelting RK, Cahalan MK,
Ortega R, Stock MC, Eds. Clinical Anesthesia. Philadelphia: Lippincott Williams
& Wilkins; 2013: 156-188).

I. PRINCÍPIOS FARMACOCINÉTICOS: ABSORÇÃO DE FÁRMACOS E


VIAS DE ADMINISTRAÇÃO
A. Transporte de Fármacos Através de Membranas. Mesmo o fármaco
mais simples administrado diretamente na corrente sanguínea, para
exercer sua ação, deve atravessar pelo menos uma membrana celular
até o seu sítio de ação.
1. Considerando que as membranas biológicas são compostas de uma
bicamada lipídica com uma extremidade hidrofílica e outra hidro-
fóbica, apenas fármacos lipofílicos pequenos difundem-se passiva-
mente através da membrana até seu gradiente de concentração.
2. Para que os fármacos solúveis em água possam difundir-se passi-
vamente através da membrana até seu gradiente de concentração,
são necessárias proteínas transmembrânicas que formam um canal
hidrofílico.
B. A administração intravenosa (IV) resulta em rápido aumento na con-
centração dos fármacos. Embora isso possa agilizar o início do efeito,
para os fármacos com índice terapêutico baixo (proporção entre a dose
IV que produz efeitos tóxicos e a dose IV que produz efeitos terapêuticos
em 50% da população), o rápido aumento da concentração plasmática
pode resultar, potencialmente, em efeitos adversos imediatos e graves.
1. Biodisponibilidade é a quantidade relativa da dose de um fár-
maco que atinge a circulação sistêmica sem nenhuma alteração,
bem como a taxa em que ocorre esse processo. Na maior parte dos
fármacos administrados por via IV, a biodisponibilidade absoluta
é próxima da unidade, e a taxa é quase instantânea.
2. Se a distribuição no endotélio alveolar for extensa, como ocorre
com a absorção pulmonar do fentanil, o endotélio pulmonar lenti-
fica a taxa na qual os fármacos administrados por via IV atingem
a circulação sistêmica. Além disso, o endotélio pulmonar contém
enzimas que metabolizam os fármacos administrados por via IV
(propofol) (metabolismo de primeira passagem), além de reduzir
sua biodisponibilidade absoluta.

Barash_II.indd 65 22/08/14 11:50


66 Barash, Cullen, Stoelting, Cahalan, Stock, Ortega

C. A administração oral não é usada com muita frequência na prática


anestésica devido à sua limitada e variável biodisponibilidade.
1. Devido ao extenso metabolismo de primeira passagem, a dose oral
da maioria dos fármacos deve ser significativamente maior para
possibilitar a geração de concentrações plasmáticas terapêuticas.
2. Fármacos altamente lipofílicos que mantêm tempo elevado de
contato com a mucosa nasal ou oral (sublingual) são absorvidos
sem necessidade de atravessar o trato gastrintestinal (GI). A ad-
ministração sublingual de fármacos apresenta a vantagem adicio-
nal sobre a absorção GI considerando que o fármaco absorvido
penetra diretamente na circulação venosa, evitando, portanto, a
passagem pela mucosa intestinal metabolicamente ativa e o meta-
bolismo hepático de primeira passagem.
D. Administração Transcutânea. Poucos fármacos lipofílicos (p. ex., es-
copolamina, nitroglicerina, fentanil) foram fabricados em formulações
suficientes para permitir a penetração em peles intactas.
E. Administração Intramuscular e Subcutânea. A absorção dos fár-
macos dos depósitos que se localizam nos tecidos subcutâneos ou nos
tecidos musculares depende diretamente da formulação e do fluxo san-
guíneo.
F. Injeção Intratecal, Peridural e Perineural. A principal desvantagem
dessas três técnicas é a habilidade relativa exigida pela aplicação de
anestésicos regionais em comparação com a administração oral, IV e
inalatória de fármacos.
G. Administração Inalatória. A grande área superficial dos alvéolos
pulmonares disponíveis para realização de trocas com grandes fluxos
volumétricos de sangue dos vasos capilares do pulmão torna a admi-
nistração inalatória um método extremamente atrativo (se aproxima
da administração IV) para a aplicação de fármacos.

II. DISTRIBUIÇÃO DOS FÁRMACOS A distribuição relativa do débito


cardíaco entre os sistemas vasculares determina a velocidade de exposição
de cada órgão aos fármacos. Os principais componentes circulatórios com
alta perfusão (cérebro, pulmões, coração e rins) recebem uma distribuição
relativa mais alta do débito cardíaco e, portanto, são os primeiros órgãos
que atingem o equilíbrio com as concentrações plasmáticas dos fármacos.
A transferência dos fármacos para tecidos musculares de volume interme-
diário menos perfundidos pode levar algumas horas para atingir o equilí-
brio, ao passo que a transferência para grandes volumes celulares de tecido
adiposo pouco perfundido pode levar vários dias.
A. Redistribuição
1. Assim que a concentração do fármaco nos tecidos cerebrais tornar-
-se mais alta que a concentração plasmática, ocorre uma inversão
no gradiente de concentração, de forma que os fármacos lipofílicos

Barash_II.indd 66 22/08/14 11:50


Manual de Anestesiologia Clínica 67

difundem-se rapidamente de volta para o sangue, sendo redistri-


buídos para os outros tecidos que ainda os estiverem recebendo.
2. Embora doses simples moderadas de fármacos altamente lipofíli-
cos tenham tempo de ação muito curto no sistema nervoso central
(SNC), por causa da redistribuição a partir desse sistema para o
sangue e outros tecidos menos perfundidos, injeções repetidas de
um fármaco possibilitam o estabelecimento rápido de concentra-
ções significativas nos tecidos periféricos.

III. ELIMINAÇÃO DOS FÁRMACOS. Eliminação é o termo farmacociné-


tico que descreve todos os processos que removem os fármacos do orga-
nismo. Embora fígado e rins sejam considerados os órgãos principais desse
processo de eliminação, o metabolismo dos fármacos pode ocorrer em
outros locais que contenham enzimas metabolizantes (p. ex., vasculatura
pulmonar e eritrócitos), sendo que os fármacos podem ser eliminados por
outros órgãos (p. ex., os pulmões) sem nenhuma alteração.
A. Eliminação de fármacos corresponde ao volume teórico de sangue do

Fundamentos Científicos da Anestesia


qual um fármaco é removido, de forma completa e irreversível, em uma
unidade de tempo.
B. Reações de Biotransformação. A maior parte dos fármacos elimina-
da do corpo sem nenhuma alteração é de origem hidrofílica e, como
consequência, é eliminada com facilidade pela urina ou pelas fezes. Os
fármacos que não forem suficientemente hidrofílicos para serem eli-
minados sem alteração são transformados em compostos hidrofílicos
excretáveis (reações enzimáticas).
1. As reações da fase I hidrolisam, oxidam ou reduzem o composto
mais simples.
a. As enzimas do citrocromo P450 (CYPs) formam uma super-
família de enzimas constitutivas e induzíveis que catalisam
a maior parte das biotransformações da fase I. A CYP3A4 é a
enzima mais simples responsável por 40 a 45% de todo o meta-
bolismo de fármacos mediados por CYPs.
b. As CYPs são incorporadas, em concentrações elevadas, no retí-
culo endoplasmático liso dos hepatócitos e nas membranas dos
enterócitos intestinais superiores (Tab. 7.1).
2. As reações da fase II são conhecidas como conjugação ou reações
sintéticas. As enzimas que catalisam as reações da fase II são in-
duzíveis, da mesma forma como ocorre no sistema do citocromo
P450.
3. Variações Genéticas no Metabolismo dos Fármacos. O metabo-
lismo dos fármacos varia substancialmente entre os indivíduos em
razão da variabilidade dos genes que controlam as diversas enzi-
mas responsáveis pela biotransformação.

Barash_II.indd 67 22/08/14 11:50


68

Barash_II.indd 68
TABELA 7.1 Substratos de isoenzimas CYP vistos em anestesiologia
CYP3A4 CYP2D6 CYP2B6 CYP2C9 CYP2C19
Acetaminofeno Captopril Metadona Diclofenaco Diazepam
Alfentanil Codeína Propofol Ibuprofeno Omeprazol
Alprazolam Hidrocodona Indometacina Propranolol
Bupivacaína Metoprolol Varfarina
Cisaprida Ondansetron
Codeína Oxicodona
Diazepam Propranolol
Digitoxina Timolol
Diltiazem
Estatinas
Fentanil
Lidocaína
Metadona
Midazolam
Nicardipina
Barash, Cullen, Stoelting, Cahalan, Stock, Ortega

Nifedipina
Omeprazol
Ropivacaína
Sufentanil
Varfarina
Verapamil

22/08/14 11:50
Manual de Anestesiologia Clínica 69

TABELA 7.2 Fármacos com excreção renal significativa utilizados


na anestesiologia
Aminoglicosídeos Pancurônio
Atenolol Penicilinas
Cefalosporinas Piridostigmina
Digoxina Procainamida
Edrofônio Quinolonas
Nadolol Rocurônio
Neostigmina Sugamadex

4. Variações Cronológicas no Metabolismo dos Fármacos. A ca-


pacidade e a atividade das enzimas CYP aumentam de níveis sub-
normais no período fetal e neonatal e atingem níveis normais por
volta de 1 ano de idade. Os neonatos têm capacidade limitada para
realizar reações de conjugação da fase II; porém, após a normali-

Fundamentos Científicos da Anestesia


zação dessa fase no ano inicial de vida, os avanços na idade não
afetam a capacidade de executar as reações da fase II.
C. Eliminação Renal de Fármacos. O papel principal dos rins na elimi-
nação de fármacos é excretar, pela urina, fármacos hidrofílicos inalte-
rados e metabólitos de origem hepática provenientes das reações das
fases I e II de fármacos lipofílicos. Em pacientes com insuficiência renal
aguda ou crônica, incluindo idade, estados de baixo débito cardíaco e
síndrome hepatorrenal, a dosagem dos fármacos deve ser alterada para
evitar acúmulo de seus componentes e de metabólitos potencialmente
tóxicos (Tab. 7.2).
D. Eliminação Hepática de Fármacos. A eliminação hepática depende
da capacidade intrínseca de metabolização do fígado e da quantidade
disponível de fármaco para disseminação dentro do órgão (fluxo san-
guíneo hepático) (Tab. 7.3).

IV. MODELOS FARMACOCINÉTICOS. A concentração no sítio tecidual ou


nos sítios de ação é a determinante fundamental dos efeitos farmacológicos
de um fármaco.
A. Modelos Fisiológicos versus Modelos Compartimentais
1. O despertar após uma dose única de tiopental é basicamente re-
sultado da redistribuição do fármaco do cérebro para os músculos,
com pouca contribuição da distribuição para tecidos menos per-
fundidos ou do metabolismo desse fármaco. Esse conceito funda-
mental de redistribuição aplica-se a todos os fármacos lipofílicos.
2. As concentrações farmacológicas no sangue são usadas para defi-
nir a relação entre dose e tempo necessário para provocar altera-
ções na concentração do fármaco.

Barash_II.indd 69 22/08/14 11:50


70 Barash, Cullen, Stoelting, Cahalan, Stock, Ortega

TABELA 7.3 Classificação dos fármacos utilizados em


anestesiologia de acordo com as taxas de
extração hepática
Baixa Intermediária Alta
Diazepam Alfentanil Alprenolol
Fenitoína Midazolam Bupivacaína
Lorazepam Vecurônio Cetamina
Metadona Diltiazem
Rocurônio Fentanil
Teofilina Lidocaína
Tiopental Meperidina
Metoprolol
Morfina
Naloxona
Nifedipina
Propofol
Propranolol
Sufentanil

B. Conceitos Farmacocinéticos
1. Constante de Velocidade e Meia-Vida. A disposição da maior
parte dos fármacos segue a cinética de primeira ordem. Proces-
sos de cinética de primeira ordem são aqueles em que uma fração
constante de um fármaco é removida durante um período finito de
tempo, seja qual for a quantidade ou a concentração do fármaco.
Em vez de usar constantes de velocidade, a velocidade dos pro-
cessos farmacocinéticos costuma ser descrita por meias-vidas, que
é o tempo necessário para que a concentração plasmática reduza
em 50%. Depois de cinco meias-vidas, o processo está quase 97%
completo (Tab. 7.4). Por questões práticas, isso corresponde essen-
cialmente a 100%, de forma que uma quantidade desprezível do
fármaco ainda permanece no organismo do indivíduo.
2. O volume de distribuição quantifica a extensão da distribuição de
um fármaco (capacidade tecidual total versus capacidade do san-
gue para aquele fármaco). Se a distribuição for extensa, a concen-
tração será mais baixa em relação à quantidade do fármaco, o que
se equipara a um maior volume de distribuição. Volume aparente
é um índice numérico da extensão da distribuição de um fárma-
co que não tem nenhuma relação com o volume real de qualquer
tecido ou de grupos de tecidos. Em geral, os fármacos lipofílicos
apresentam maior volume de distribuição que os hidrofílicos.
3. Meia-vida de eliminação é o tempo durante o qual a quantidade
de fármaco existente no corpo diminui em cerca de 50%. Embora a
eliminação de um fármaco inicie-se no momento da liberação para

Barash_II.indd 70 22/08/14 11:50


Manual de Anestesiologia Clínica 71

TABELA 7.4 Meias-vidas e percentual de remoção de fármacos


Percentual de Remoção Percentual do Fármaco
Número de Meias-Vidas do Fármaco que Permanece no Corpo
0 100 0
1 50 50
2 25 75
3 12,5 87,5
4 6,25 93,75
5 3,125 96,875

os órgãos eliminadores, o término rápido do efeito de um bólus de


fármaco IV é atribuível à redistribuição dele, do cérebro para o san-
gue, e subsequentemente para outros tecidos (músculos). Portanto,
o efeito da maioria dos anestésicos desaparece antes que a meia-
-vida de eliminação tenha sido completada. Como consequência, a

Fundamentos Científicos da Anestesia


meia-vida de eliminação tem pouca utilidade na prática anestésica.
C. Efeito de Doenças Hepáticas ou Renais sobre os Parâmetros Farma-
cocinéticos. A multiplicidade de alterações fisiopatológicas em pacien-
tes com doença hepática ou renal dificulta a previsão do comporta-
mento farmacocinético dos fármacos utilizados.
1. Quando a eliminação hepática de um fármaco for reduzida, a do-
sagem repetida em bólus ou infusões contínuas, como os benzo-
diazepínicos, os opioides e os barbitúricos, pode resultar no acú-
mulo excessivo e em efeitos farmacológicos prolongados.
2. Levando-se em consideração que, em grande parte, a recuperação
de pequenas doses de tiopental ou fentanil resulta da redistribui-
ção, a redução do clearance de eliminação afeta minimamente o
término de ação desses fármacos.

V. MODELOS COMPARTIMENTAIS EM FARMACOCINÉTICA


A. Modelo de Um Compartimento. Embora seja uma simplificação ex-
cessiva para a maioria dos fármacos, o modelo de um compartimento
ilustra as relações básicas entre eliminação, volume de distribuição e
meia-vida de eliminação (Fig. 7.1).
B. Modelo de Dois Compartimentos. Há duas fases discretas no declí-
nio da concentração plasmática (Fig. 7.2). A aplicação desse compor-
tamento bifásico parte do princípio de que o corpo é formado por dois
compartimentos, um compartimento central que inclui o plasma e um
compartimento periférico.
C. Modelo de Três Compartimentos. Após a injeção IV de alguns fárma-
cos, a fase de distribuição inicial é rápida e seguida por uma segunda
fase de distribuição mais lenta, antes de a fase de eliminação tornar-se
evidente.

Barash_II.indd 71 22/08/14 11:50


72 Barash, Cullen, Stoelting, Cahalan, Stock, Ortega

10 10

Concentração logarítmica
8
Concentração

6
1
4

0,1
0 100 200 300
Tempo (min)
FIGURA 7.1 Concentração plasmática versus perfil de tempo plotado na escala li-
near (linha em vermelho, eixo do y à esquerda) e na logarítmica (linha em azul, eixo
do y à direita) de um fármaco hipotético mostrando a farmacocinética de primeira
ordem com um compartimento.

D. De maneira geral, opta-se pelo uso do modelo com menor número de


compartimentos que retrate com maior acurácia os dados de fármacos
individuais.

VI. PRINCÍPIOS FARMACODINÂMICOS. Os estudos farmacodinâmicos


concentram-se na análise quantitativa da relação entre a concentração de
um fármaco no sangue e os efeitos resultantes nos processos fisiológicos.

VII. INTERAÇÕES ENTRE FÁRMACO E RECEPTOR. A maior parte dos


fármacos produz efeitos fisiológicos por meio da ligação a um receptor es-
pecífico que provoca alterações na função celular. A maioria dos recepto-
res farmacológicos é constituída de proteínas transmembrânicas, embora
alguns se localizem no citoplasma ou no núcleo das células.
A. Dessensibilização e Downregulation de Receptores. Os receptores
são componentes celulares dinâmicos que se adaptam ao ambiente. A
exposição prolongada de um receptor a seu agonista produz dessensi-
bilização; doses subsequentes do agonista produzem efeitos máximos
mais baixos.
B. Agonistas, Agonistas Parciais e Antagonistas. Fármacos que se li-
gam a receptores e produzem um efeito são chamados agonistas. Ago-
nistas parciais são fármacos que não são capazes de produzir efeito

Barash_II.indd 72 22/08/14 11:50


Manual de Anestesiologia Clínica 73

A B
A

Cp(t) 5 Ae2at 1 Be2bt


Concentração

B
Fase de eliminação
inclinação 5 b

Fase de distribuição
inclinação 5 a

Tempo após a injeção IV

Fundamentos Científicos da Anestesia


FIGURA 7.2 Concentração plasmática logarítmica versus perfil de tempo para um
fármaco hipotético mostrando a farmacocinética de primeira ordem com dois com-
partimentos. Observe que a fase de distribuição tem uma inclinação significativa-
mente maior que a fase de eliminação, indicando que o processo de distribuição não
é mais rápido que o de eliminação do organismo, porém é responsável pela maior
parte do declínio da concentração plasmática, vários minutos após a administração
do fármaco.

máximo, mesmo em concentrações muito elevadas. Compostos que


se ligam a receptores sem produzir nenhuma alteração na função ce-
lular são conhecidos por antagonistas. Os antagonistas competitivos
ligam-se de forma reversível aos receptores, sendo que o efeito de
bloqueio pode ser superado por altas concentrações de um agonista
(competição). Os antagonistas não competitivos ligam-se irreversivel-
mente aos receptores.
C. As relações entre dose e resposta determinam a relação entre doses
crescentes de um fármaco e as respectivas alterações nos efeitos farma-
cológicos (Fig. 7.3).
D. Relações entre Concentração e Resposta (Fig. 7.4). A magnitude do
efeito farmacológico é uma função da quantidade de fármaco existen-
te no sítio efetor, de forma que qualquer aumento na dose aumenta o
efeito máximo. O início de ação de doses maiores é mais rápido porque
atingem-se concentrações farmacologicamente ativas mais precoce-
mente no sítio efetor. Aumentando-se a dose, aumenta também a du-
ração da ação porque as concentrações eficazes sob o ponto de vista
farmacológico são mantidas por períodos mais longos.

Barash_II.indd 73 22/08/14 11:50


74 Percentagem de resposta máxima Barash, Cullen, Stoelting, Cahalan, Stock, Ortega

100 100

80 80

60 60

40 40

20 20

0 0
Escala linear Escala logarítmica
Dose
FIGURA 7.3 Curva esquemática do efeito de um fármaco plotado contra a dose.
No painel à esquerda, os dados da resposta são plotados contra os dados da dose em
uma escala linear. No painel à direita, os mesmos dados da resposta são plotados con-
tra os dados da dose em uma escala logarítmica, produzindo uma curva sigmoide de
dose-resposta que apresenta característica linear entre 20 e 80% do efeito máximo.

VIII. INTERAÇÕES ENTRE FÁRMACOS. Dez ou mais medicamentos


(pré-medicação, antibióticos perioperatórios, agentes IV, anestésicos
inalatórios, opioides, relaxantes musculares, fármacos antagonistas e
analgésicos pós-operatórios) podem ser administrados em uma aneste-
sia de rotina.
A. As interações farmacológicas (físico-químicas) in vitro podem al-
terar significativamente a biodisponibilidade de um fármaco e gerar
subprodutos indesejáveis.
1. Um dos exemplos típicos de interação farmacológica que altera a
biodisponibilidade de um fármaco é a formação de sais insolúveis

1,0 C
Cp e efeito

A B
Efeito
Cp
0
Tempo
FIGURA 7.4 Alterações na concentração plasmática de um fármaco e efeito farma-
cológico durante e após uma infusão IV. Cp 5 concentração plasmática.

Barash_II.indd 74 22/08/14 11:50


Manual de Anestesiologia Clínica 75

que precipitam quando se misturam fármacos ácidos (tiopental)


com fármacos básicos (opioides e relaxantes musculares).
2. As preparações comerciais de anestésicos locais que contenham
epinefrina têm pH mais baixo que as soluções anestésicas locais
normais nas quais se adiciona epinefrina um pouco antes da admi-
nistração, tendo em vista o nível elevado de acidez dos estabiliza-
dores antioxidantes utilizados nessas preparações (aparentemente
a eficácia do anestésico local é menor por causa do aumento na
concentração do anestésico local ionizado permeável existente em
ambientes ácidos).
3. Em condições corretas, os anestésicos voláteis halogenados pode-
rão sofrer alguma degradação provocada pela base forte (hidróxi-
do de sódio ou de potássio) contida no absorvedor de dióxido de
carbono (formação do composto A).
a. Embora os efeitos do composto A na função renal humana não
sejam preocupantes sob o ponto de vista clínico, a base forte de
alguns absorventes de dióxido de carbono também pode degra-

Fundamentos Científicos da Anestesia


dar os anestésicos voláteis halogenados contendo difluorometil
(desflurano e isoflurano) em monóxido de carbono.
b. Essas preocupações com a segurança dos pacientes culminaram
no desenvolvimento e no aumento no uso de Amsorb, um ab-
sorvente de dióxido de carbono que contém lama de hidróxido
de cálcio em vez de hidróxido de sódio ou de potássio e, conse-
quentemente, a formação do composto A ou de monóxido de
carbono é mínima ou nula.
B. As interações farmacológicas (físico-químicas) in vivo foram estuda-
das com o objetivo de desenvolver duas novas abordagens para antago-
nizar os agentes bloqueadores neuromusculares.
1. O sugamadex liga-se irreversivelmente ao rocurônio no plasma e
age como um quelante que reduz rapidamente a concentração plas-
mática livre e promove a redistribuição deste fármaco da junção
neuromuscular (espaço extracelular) até o espaço intravascular.
2. Uma abordagem alternativa para o antagonismo ao bloqueio
neuromuscular é designar uma molécula que possa ser desativa-
da através de vias não biológicas (as moléculas são desativadas
rapidamente pela formação não enzimática de adutos de cisteína
quando se combinarem com cisteína plasmática).
C. Interações Farmacocinéticas. Um fármaco pode alterar a absorção,
distribuição e eliminação de outros fármacos.
1. Interações Farmacocinéticas: Absorção
a. Fármacos como a ranitidina, que altera o pH gástrico, e a me-
toclopramida, que estimula o esvaziamento gástrico, alteram a
absorção do trato GI.
b. Os vasoconstritores, que diminuem o fluxo sanguíneo local e
reduzem a absorção sistêmica dos fármacos, podem ser benéfi-

Barash_II.indd 75 22/08/14 11:50


76 Barash, Cullen, Stoelting, Cahalan, Stock, Ortega

cos nas situações em que forem adicionados a soluções de anes-


tésicos locais.
2. Interações Farmacocinéticas: Distribuição
a. Alterações no débito cardíaco induzidas por fármacos e a dis-
tribuição do débito cardíaco para os tecidos podem modificar
o clearance de distribuição de outros fármacos (os agentes va-
soativos alteram a distribuição tecidual por meio de alterações
no fluxo sanguíneo regional, mesmo que o débito cardíaco total
permaneça inalterado).
b. A importância clínica da ligação proteica em relação aos agen-
tes anestésicos se baseia em vários conceitos errôneos aplicá-
veis à distribuição de fármacos. Em primeiro lugar, o número
de receptores desocupados é muito superior ao número de
moléculas de anestésicos administradas (é extremamente di-
fícil visualizar um cenário em que ocorram deslocamentos
significativos). A base teórica que sustenta a relevância da li-
gação proteica em fármacos altamente lipofílicos ignora o fato
de que esse grupo farmacológico apresenta um fluxo limitado
de eliminação e de distribuição tecidual. (Não há exemplos na
literatura indicando que as interações farmacológicas produ-
zam alterações clinicamente relevantes na ligação proteica de
opioides e de agentes hipnóticos.)
3. Interações Farmacocinéticas: Metabolismo (Tab. 7.5)
a. A fenitoína reduz o tempo de duração dos bloqueadores neu-
romusculares não despolarizantes por meio da indução de
CYP3A4 e, como consequência, intensifica a depuração plas-
mática do fármaco.
b. Na presença de inibição da isoenzima CYP (inibidores da pro-
tease), torna-se mais difícil ajustar a dose do fármaco sem atin-
gir concentrações supraterapêuticas e, possivelmente, tóxicas
(opioides, varfarina e gliburida).
c. A titulação de pró-fármacos para adequar os efeitos clínicos
pode ser muito difícil porque dependem da atividade da isoen-
zima CYP para se converterem em formas ativas (pró-fármacos
opioides como codeína, oxicodona, hidrocodona e tramadol de-
pendem da enzima CYP2D6 para se converterem em opioides
biologicamente ativos).
d. Pacientes que tomam inibidores seletivos da recaptação da
serotonina que, por sua vez, inibem também a atividade de
CYP2D6, a qual possui um caráter altamente polimórfico,
podem não receber analgesia adequada com a administração
desses opioides (outros opioides possivelmente tenham menos
variabilidade nas respostas às dosagens e, portanto, talvez sejam
uma escolha melhor que esses pró-fármacos).

Barash_II.indd 76 22/08/14 11:50


Manual de Anestesiologia Clínica 77

TABELA 7.5 Indutores e inibidores do metabolismo de fármacos


hepáticos
Indutores Inibidores
Carbamazepina Antibióticos macrolídeos (claritromicina e eritromicina)
Erva-de-são-joão Antifúngicos azólicos (cetoconazol e itraconazol)
Etanol Cimetidina
Fenitoína Dissulfiram
Fenobarbital Inibidores da protease (ritonavir, indinavir e saquinavir)
Glicocorticoides Inibidores seletivos da recaptação da serotonina
(fluoxetina e sertralina), CYP3A4 e CYP2D6
Rifampicina Quinidina
Tamoxifeno Suco de toranja

D. As interações farmacodinâmicas se enquadram em duas grandes clas-

Fundamentos Científicos da Anestesia


sificações.
1. Fármacos que interagem, direta ou indiretamente, nos mesmos re-
ceptores.
a. Os antagonistas de opioides deslocam diretamente os opioides
dos seus receptores.
b. Os inibidores da colinesterase antagonizam indiretamente
os efeitos dos bloqueadores neuromusculares, aumentando a
quantidade de acetilcolina que desloca os fármacos bloqueado-
res dos receptores nicotínicos.
2. As interações ocorrem também nos casos em que dois fármacos
afetam um sistema fisiológico em sítios distintos.
a. A depressão ventilatória mediada por receptores mu opioides
pode ser antagonizada seletivamente por ampaquinas que po-
tencializam a excitação glutamatérgica mediada pelo receptor
do ácido alfa amino-3-hidroxi-5-metil-4 isoxazole propiônico
(AMPA), sem neutralizar a analgesia induzida por opioides.
b. A interação farmacodinâmica entre dois fármacos pode ser ca-
racterizada pela utilização de modelos de superfície de resposta.
3. Síndrome Serotoninérgica
a. O uso mais comum de medicações que modulam o sistema se-
rotoninérgico aumentou a incidência da síndrome da serotoni-
na potencialmente fatal (toxicidade da síndrome).
b. Concentrações elevadas de serotonina no SNC produzem alte-
rações no estado mental (confusão, hiperatividade e problemas
de memória), espasmos musculares, sudorese, calafrios e febre.
c. Classicamente, níveis excessivos de serotonina no SNC foram
associados à inibição da monoaminoxidase, enzima responsável
pela decomposição da serotonina no cérebro.

Barash_II.indd 77 22/08/14 11:50


78 Barash, Cullen, Stoelting, Cahalan, Stock, Ortega

d. A interação da meperidina com inibidores da monoaminoxida-


se é a interação farmacológica mais clássica associada à síndro-
me serotoninérgica.
e. Deve-se suspeitar de síndrome serotoninérgica quando pacientes
usuários de fármacos serotoninérgicos receberem azul de metile-
no ou opioides derivados de fenilpiperidina.

IX. APLICAÇÕES CLÍNICAS DA FARMACOCINÉTICA E DA FARMACO-


DINÂMICA NA ADMINISTRAÇÃO DE ANESTÉSICOS INTRAVENO-
SOS. As simulações por computador são importantes para interpretar e
planejar regimes de administração precisa de fármacos.
A. Concentração do Estado de Equilíbrio. A concentração de um fárma-
co versus o perfil de elevação até o estado de equilíbrio corresponde à
imagem de seu perfil de eliminação.
B. Esquemas de Infusão. Com base no modelo farmacocinético de um
compartimento, é possível manter concentrações plasmáticas estáveis
em estado de equilíbrio (Cpss) administrando-se uma infusão a uma
taxa proporcional à eliminação do fármaco do organismo.
C. Cálculo de Isoconcentrações. Para fazer simulações adequadas, deve-
-se utilizar um software que calcule as taxas de infusão necessárias para
manter as concentrações plasmáticas de um fármaco com base na far-
macocinética multicompartimental.
D. Meia-Vida Contexto-Dependente. Durante uma infusão, o fármaco é
absorvido por tecidos periféricos inertes. Depois do término da infu-
são, a recuperação ocorre quando a concentração no sítio efetor reduzir
a ponto de não produzir efeitos farmacológicos.
E. Infusões Alvo-Controladas. Para acessar a concentração plasmática
desejada de um fármaco, basta conectar um computador com o mode-
lo farmacocinético adequado a uma bomba de infusão. Em questão de
segundos, o computador calcula a infusão que permite atingir a con-
centração determinada.
F. Tempo para Alcançar a Concentração Máxima no Sítio Efetor. A
partir da construção de um modelo que considera a concentração
plasmática de um fármaco versus os dados relacionados ao tempo (far-
macocinética) e os efeitos medidos do fármaco (farmacodinâmica), é
possível estimar a constante da taxa de transferência entre o plasma e o
sítio efetor.
G. Volume de Distribuição no Pico do Efeito. É possível calcular a dose
de um bólus que permita atingir a concentração estimada em relação
ao TMAX sem ultrapassar os limites no sítio efetor.
H. A cinética de distribuição inicial (front-end kinetics) refere-se à mistu-
ra intravascular, à absorção pulmonar e aos eventos recirculatórios que
ocorrem nos primeiros minutos durante e após a administração de um
fármaco. Tais eventos cinéticos e a concentração do fármaco versus o
perfil de tempo resultante são importantes porque o efeito máximo dos
fármacos de ação rápida ocorre durante essa janela temporal.

Barash_II.indd 78 22/08/14 11:50


Manual de Anestesiologia Clínica 79

I. Infusões em Alça Fechada. A mensuração contínua do efeito de um


fármaco possibilita sua titulação automática por meio de feedback. Es-
ses sistemas têm sido utilizados, de forma experimental, para controlar
a pressão arterial, a liberação de oxigênio, a glicemia, o bloqueio mus-
cular e a profundidade da anestesia.
1. Os sistemas em alça fechada para controle da anestesia são os mais
difíceis de desenhar e de implementar porque a definição de anes-
tesia ainda permanece imprecisa, assim como a monitorização ro-
busta da profundidade anestésica.
2. Levando-se em consideração que a modificação no estado de
consciência acompanha a anestesia, os parâmetros eletroencefalo-
gráficos (EEGs) processados que se correlacionarem com o nível
de consciência, como o índice bispectral, a entropia eletroencefa-
lográfica e os potenciais evocados auditivos, possibilitam fazer o
controle em alça fechada da anestesia.
J. Modelos de Resposta Superficial às Interações entre Fármacos.
Durante a cirurgia, a anestesia deve garantir amnésia, imobilidade e

Fundamentos Científicos da Anestesia


controle da resposta simpática ao trauma. Em geral, a administração
conjunta de um opioide e um hipnótico (sinergística para a maioria dos
efeitos farmacológicos) limita a ocorrência de efeitos adversos.

Barash_II.indd 79 22/08/14 11:50


CAPÍTULO

8
Segurança Elétrica e Contra Incêndios
A miríade de dispositivos elétricos que existe nos centros cirúrgicos modernos
melhora, substancialmente, a assistência médica e a segurança, mas, ao mesmo
tempo, aumenta a exposição dos pacientes e dos profissionais de saúde a vários
tipos de risco (Ehrenwerth J, Seifert HA. Electrical and fire safety. Em: Barash
PG, Cullen BF, Stoelting RK, Cahalan MK, Ortega R, Stock MC, Eds. Clinical
Anesthesia. Philadelphia: Lippincott Williams & Wilkins; 2013: 189-218).

I. PRINCÍPIOS DE ELETRICIDADE. Um dos princípios básicos da eletri-


cidade é conhecido por lei de Ohm, representado pela equação E 5 I 3 R
(força eletromotiva expressa em volts 5 corrente expressa em ampères ve-
zes a resistência expressa em ohms). A lei de Ohm é o fundamento básico
da equação fisiológica na qual a pressão arterial é igual ao débito cardíaco
vezes a resistência vascular sistêmica (PA 5 DC 3 RVS). A potência elétri-
ca é medida em watts (tensão 3 amperagem). A quantidade de execução
de trabalho elétrico (watt-segundo ou joule) é uma designação comum da
energia elétrica despendida (a energia produzida por um desfibrilador é
medida em joules).
A. Corrente Contínua e Corrente Alternada. O fluxo de elétrons (cor-
rente) através de um condutor caracteriza-se como corrente contínua
(o fluxo de elétrons é sempre na mesma direção) ou corrente alternada
(o fluxo de elétrons inverte a direção em intervalos regulares).
B. Impedância é a soma de forças que se opõem ao movimento de elé-
trons em um circuito de corrente alternada.
C. Capacitância é a capacidade de um capacitor (dois condutores parale-
los, separados por um isolamento) de armazenar energia elétrica.
1. Em um circuito de corrente contínua, as placas carregadas do ca-
pacitor (bateria) não resultam em fluxo de corrente a menos que
a resistência seja conectada entre as duas placas e o capacitor seja
descarregado.
2. Capacitância por dispersão é aquela que não se destina ao siste-
ma, ou seja, é incidental na fabricação dos equipamentos (todos
os equipamentos que operam com corrente alternada produzem
capacitância por dispersão, mesmo quando estiverem desligados).

II. RISCO DE CHOQUE ELÉTRICO


A. Corrente Contínua e Corrente Alternada
1. Qualquer indivíduo pode levar um choque elétrico sempre que
entrar em contato com uma fonte externa de eletricidade (a in-
tensidade do choque da corrente contínua deve ser cerca de três
vezes maior que a da corrente alternada para provocar fibrilação
ventricular [FV]).

Barash_II.indd 80 22/08/14 11:50


Manual de Anestesiologia Clínica 81

Caixa
Tomada energizada A
elétrica

Plugue Curto-circuito

Neutro Energizado

Caixa de
fusíveis B
Terra

FIGURA 8.1 Quando uma peça danificada de um equipamento sem dispositivo de


aterramento for ligada em uma tomada também sem aterramento, a carcaça do ins-

Fundamentos Científicos da Anestesia


trumento torna-se energizada (“aquecida”). Se um indivíduo tocar na carcaça (A),
levará um choque (a linha tracejada mostra o caminho da corrente elétrica), porque
está de pé tocando no piso (B), completando o circuito.

2. O curto-circuito ocorre com impedância zero a um alto fluxo de


corrente.
B. Fontes de Choques Elétricos
1. Acidentes ou choques elétricos ocorrem nas situações em que uma
pessoa torna-se parte ou completa um circuito elétrico (Fig. 8.1).
2. Os danos provenientes de uma corrente elétrica são causados pelo
rompimento da função elétrica normal das células (contratura dos
músculos esqueléticos, FV) ou pela dissipação de energia elétrica
(queimaduras).
3. A gravidade de um choque elétrico é determinada pela quantidade
de corrente e pela duração do fluxo da corrente.
a. O macrochoque descreve grandes quantidades de fluxo de cor-
rente que podem causar danos ou morte.
b. O microchoque descreve pequenas quantidades de fluxo de
corrente e aplica-se apenas a pacientes eletricamente suscetíveis
(aqueles com um eletroduto externo em contato com o coração,
como, por exemplo, um fio de marca-passo ou um cateter de
pressão venosa central [PVC] com solução salina), nos quais
mesmo quantidades mínimas de corrente (1 mA é o limite per-
ceptível) podem causar FV.
4. Correntes de frequência muito alta não excitam tecidos contráteis
e não provocam arritmias cardíacas.
C. Aterramento. O conhecimento completo do conceito de aterramento é
extremamente importante para entender plenamente os riscos de cho-

Barash_II.indd 81 22/08/14 11:50


82 Barash, Cullen, Stoelting, Cahalan, Stock, Ortega

ques elétricos e sua prevenção. Na terminologia elétrica, o aterramento


é aplicado na energia elétrica e em equipamentos.

III. ENERGIA ELÉTRICA COM ATERRAMENTO


A. Em geral, os utilitários elétricos fornecem energia para residências com
aterramento (por convenção, o potencial de aterramento é zero).
B. O choque elétrico é um perigo inerente aos sistemas de fornecimento de
energia elétrica com aterramento. Um indivíduo de pé em contato com
o solo ou em contato com um objeto relacionado ao aterramento preci-
sa apenas de um ponto de contato adicional para completar o circuito.
C. Os sistemas modernos de cabeamento incluíram um terceiro cabo (um
caminho de baixa resistência através do qual a corrente pode fluir para
o aterramento) para diminuir a gravidade de potenciais choques elétri-
cos (Fig. 8.2).

IV. ENERGIA ELÉTRICA SEM ATERRAMENTO


A. Os vários dispositivos eletrônicos, junto a cabos elétricos e poças de
soluções salinas no piso, tendem a transformar os centros cirúrgicos
em ambientes altamente perigosos, sob o ponto de vista elétrico, para
os pacientes e para os profissionais de saúde.
B. O suprimento de energia elétrica da maioria dos centros cirúrgicos não
possui aterramento (i.e., a corrente permanece isolada do aterramento)
como alternativa para reduzir o risco de choques elétricos.

Caixa
energizada A
Tomada
elétrica
Plugue de três pinos

Fluxo de
corrente
Curto-circuito
Neutro Energizado
Aterramento Fluxo de
corrente
Caixa de
fusíveis Terra B

FIGURA 8.2 Quando uma peça danificada de um equipamento com dispositivo de


aterramento for ligada em uma tomada também com proteção de aterramento, a
corrente elétrica (linha tracejada) fluirá, preferencialmente, no sentido descendente,
para o cabo de baixa resistência do aterramento. Se um indivíduo tocar no equipa-
mento (A) e permanecer de pé em contato com o solo (B), mesmo assim completará
o circuito. Entretanto, apenas uma pequena parte da corrente fluirá através dele.

Barash_II.indd 82 22/08/14 11:50


Manual de Anestesiologia Clínica 83

Primário Secundário
Transformador Tomada
de isolamento elétrica
Energizado Linha 1
Caixa
120 Volts
Companhia de 120 Volts 120 Volts
de força fusíveis
e luz Neutro Linha 2

Aterramento
Sem conexão
direta com o
Terra aterramento

FIGURA 8.3 Nas salas cirúrgicas, o transformador de isolamento converte a energia


elétrica aterrada do lado primário em um sistema de energia sem aterramento no lado
secundário do transformador. Não há conexão direta entre o lado secundário e o ater-
ramento. Entretanto, o cabo de aterramento do equipamento ainda está presente.

Fundamentos Científicos da Anestesia


C. O suprimento de energia elétrica sem aterramento dos centros cirúrgi-
cos exige o uso de um transformador de isolamento (Fig. 8.3).
1. Os sistemas de suprimento de energia elétrica com isolamento for-
necem proteção contra macrochoques (Fig. 8.4).
2. A conexão de peças defeituosas em sistemas isolados de suprimen-
to de energia elétrica não apresenta risco de choque.

V. MONITOR DE ISOLAMENTO DE LINHA


A. O monitor de isolamento de linha é um dispositivo que monitora conti-
nuamente a integridade dos sistemas elétricos isolados (i.e., mede a im-
pedância do aterramento em cada lado de um sistema elétrico isolado).

Primário Secundário
Transformador
Energizado de isolamento Linha 1
A
Caixa

Companhia de
oh

de força fusíveis
á fl

e luz Neutro Linha 2


uxo
de

Aterramento
cor
ren
te

Terra B

FIGURA 8.4 Ilustração das características de segurança de um sistema elétrico iso-


lado. Se um indivíduo entrar em contato com um dos lados de um sistema elétrico
isolado (A) e permanecer de pé em contato com o solo (B), não levará nenhum cho-
que. Nessa situação, o indivíduo não está em contato com dois pontos do circuito e,
portanto, não o está completando.

Barash_II.indd 83 22/08/14 11:50


84 Barash, Cullen, Stoelting, Cahalan, Stock, Ortega

B. A conexão da peça defeituosa de um equipamento em um sistema elé-


trico isolado certamente irá alterá-lo para um sistema aterrado conven-
cional, e a peça com defeito continuará funcionando normalmente.
1. A medição do monitor de isolamento de linha indica a quantidade
de vazamento existente no sistema, como resultado da ligação de
qualquer dispositivo no sistema elétrico isolado.
2. Os alarmes visuais e sonoros são disparados sempre que o isola-
mento do aterramento for degradado além do limite predetermi-
nado (Fig. 8.5).
C. Se o alarme do monitor de isolamento de linha for disparado, o primei-
ro passo é verificar se de fato ocorreu alguma falha.
1. Se a leitura do medidor ficar entre 2 e 5 mA, significa que, pro-
vavelmente, há muitos equipamentos elétricos ligados no circuito.
Todos os dispositivos operados com corrente alternada têm algu-
ma capacitância e vazamento de corrente associado.
2. Se a leitura do medidor estiver acima de 5 mA, significa que, pro-
vavelmente, na sala cirúrgica, a peça de algum equipamento está
com defeito. Para identificar o equipamento, é necessário desco-
nectar todas as peças até que o alarme seja desligado.
3. Caso não seja essencial, a peça com falha deve ser retirada da sala
cirúrgica e encaminhada para reparos. Se for uma peça de um
equipamento vital para segurança, ela ainda pode ser usada, po-

Caixa
de
fusíveis
Primário Secundário
Transformador Tomada LIM
de isolamento elétrica
Energizado Linha 1
Caixa
Companhia de Plugue de
de força fusíveis três pinos
e luz Neutro Linha 2

Aterramento
Monitor de Curto-circuito
isolamento
de linha
Terra Alarme

FIGURA 8.5 Sempre que a peça defeituosa de um equipamento é conectada em


um sistema elétrico isolado, há uma redução na impedância da linha 1 ou da linha 2
em relação ao aterramento. Essa falha pode ser detectada pelo monitor de isolamen-
to de linha, que dispara um alarme. A peça do equipamento que está com problema
não apresenta nenhum risco de choque, mas converte o sistema elétrico isolado em
um sistema elétrico aterrado.

Barash_II.indd 84 22/08/14 11:50


Manual de Anestesiologia Clínica 85

rém nenhuma outra peça elétrica poderá ser conectada durante


o tempo remanescente do caso ou até que a peça defeituosa seja
removida.
4. O monitor de isolamento de linha não possui características de
proteção contra microchoques.

VI. INTERRUPTOR DE CIRCUITOS DE FALHAS DE ATERRAMENTO


A. O interruptor de circuitos com falhas de aterramento (disjuntor) é
usado para evitar que os indivíduos recebam choque elétrico em sis-
temas elétricos aterrados. Esse interruptor faz o monitoramento dos
dois lados do circuito e verifica a equalização do fluxo de corrente, e,
se for detectada alguma diferença, o suprimento de energia elétrica é
interrompido imediatamente.
B. A desvantagem de usar os disjuntores de circuitos com falhas de ater-
ramento em centros cirúrgicos é que ele corta o suprimento de energia
elétrica sem avisar. Nessa hipótese, não é possível usar peças com defei-
to, o que seria um grande problema para o suporte à vida.

Fundamentos Científicos da Anestesia


VII. ISOLAMENTO DUPLO. O isolamento duplo aplica-se a equipamentos
com plugues de dois pinos (bombas de infusão), sendo que, nos centros ci-
rúrgicos, sua utilização é permitida apenas em sistemas elétricos isolados.

VIII. MICROCHOQUE
A. Em pacientes eletricamente suscetíveis (com conexão externa direta no
coração como cateter venoso central ou marca-passo transvenoso), as
correntes abaixo do limite da percepção humana (1 mA) podem pro-
duzir FV.
B. A capacitância de dispersão que faz parte de qualquer instrumento
elétrico acionado por corrente alternada pode resultar em quantidades
significativas de acúmulo de carga nos instrumentos.
1. Ao tocar ao mesmo tempo um instrumento e um paciente com
suscetibilidade elétrica, qualquer indivíduo tem o potencial de
provocar, inconscientemente, uma descarga que pode causar FV.
2. Os equipamentos com aterramento intacto fornecem caminhos de
baixa resistência que permitem o vazamento de corrente e são as
principais fontes de proteção contra microchoques em pacientes
com suscetibilidade elétrica.
3. O anestesiologista nunca deve tocar simultaneamente um disposi-
tivo elétrico e um cateter venoso central ou marca-passo transve-
noso. É importante usar luvas de borracha.
4. Os monitores modernos foram projetados para isolar todas as co-
nexões diretas dos pacientes em relação à fonte de alimentação de
energia elétrica. Para tanto, coloca-se uma alta impedância entre o
paciente e o dispositivo (isso limita a menos de 0,01 mA a quanti-
dade de vazamento interno através da conexão do paciente).

Barash_II.indd 85 22/08/14 11:50


86 Barash, Cullen, Stoelting, Cahalan, Stock, Ortega

C. O objetivo da segurança elétrica é dificultar a passagem de corrente elé-


trica através das pessoas. Na medida do possível, tanto pacientes como
anestesiologistas devem ser isolados de qualquer tipo de aterramento.
1. O transformador de isolamento é utilizado para converter energia
com aterramento em energia sem aterramento. Se a peça defeituosa
de algum equipamento for conectada a uma das tomadas do cir-
cuito isolado, o monitor de isolamento de linha avisa sempre que
houver perda de isolamento elétrico em relação ao aterramento.
2. Todos os equipamentos que forem conectados a um sistema elé-
trico isolado possuem um dispositivo de aterramento cuja fina-
lidade é fornecer caminhos alternativos de baixa resistência que
permitem que correntes potencialmente perigosas (macrochoque)
fluam à terra. Além disso, os fios aterrados eliminam vazamentos
de corrente e protegem pacientes eletricamente suscetíveis contra
microchoques.
3. Os serviços de manutenção, assistência técnica e inspeção devem
ser executados regularmente em todos os equipamentos elétricos
para assegurar sua conformidade com os padrões de segurança
elétrica preestabelecidos. É importante manter um registro dos
serviços de manutenção de rotina.
4. Os cabos elétricos devem ser aéreos e localizar-se em áreas de pou-
co tráfego de pessoas, tendo em vista que estão sujeitos a esmaga-
mento se permanecerem sobre os pisos.
5. As extensões para vários conectores não devem permanecer sobre
os pisos considerando o risco de entrarem em contato com solu-
ções eletrolíticas.

IX. ELETROCIRURGIA
A. O eletrocautério (UEC, unidade elétrico-cirúrgica), inventado pelo
professor William T. Bovie, opera por meio da geração de correntes de
alta frequência (faixa de radiofrequência). A geração de calor ocorre
quando a corrente passa através de uma resistência. Ao concentrar a
energia na ponta do cautério (lápis de Bovie), o cirurgião pode fazer
incisões ou coagulações.
1. As correntes de alta frequência caracterizam-se por uma baixa pe-
netração tecidual e por não excitarem células contráteis (o contato
direto com o coração não provoca FV).
2. A energia elétrica de alta frequência gerada pelo eletrocautério in-
terfere nos sinais dos monitores fisiológicos.
B. O eletrocautério somente poderá ser operado com segurança se a ener-
gia for conduzida de forma adequada do eletrocautério para o paciente
e de volta para o eletrocautério através de um eletrodo dispersivo com
grande área superficial (em geral, conhecido erroneamente como “pla-
ca de aterramento”) (Fig. 8.6).

Barash_II.indd 86 22/08/14 11:50


Manual de Anestesiologia Clínica 87

Corrente de alta Eletrodo ativo


densidade

Eletro-
cautério

Eletrodo de
retorno
Corrente de
baixa densidade Placa de retorno
FIGURA 8.6 Aplicação correta da placa de retorno de um eletrocautério. A densi-
dade da corrente da placa de retorno é baixa, sem nenhum perigo para o paciente.

Fundamentos Científicos da Anestesia


1. Como a área da placa de retorno é muito grande, a densidade da
corrente é baixa, não havendo, portanto, possibilidade de ocorrer
aquecimento prejudicial ou destruição tecidual.
2. Se a placa de retorno for aplicada de forma incorreta no paciente,
ou se o cabo de conexão da placa de retorno ao eletrocautério es-
tiver danificado, a corrente elétrica de alta frequência irá procurar
um caminho de retorno alternativo (fios eletroencefalográficos,
cabos de monitores de temperatura), resultando, possivelmente,
em queimaduras sérias no paciente neste lado do retorno, pois as
correntes de alta densidade são fontes geradoras de calor (Fig. 8.7).
3. Na maior parte dos eletrocautérios modernos, o suprimento de
energia elétrica é isolado do aterramento para proteger os pacien-
tes contra queimaduras mediante a eliminação dos caminhos de
retorno alternativos. Os eletrocautérios isolados não protegem os
pacientes contra queimaduras se o contato entre o eletrodo de re-
torno e o paciente não for adequado.
4. O fator mais importante na prevenção de queimaduras provocadas
por eletrocautérios é a aplicação correta da placa de retorno (Tab. 8.1).
5. A necessidade de ajustes acima do normal indica que é necessário
inspecionar a placa de retorno e o cabo.
C. Nos eletrocautérios bipolares, a corrente passa apenas entre as duas lâ-
minas de um par de fórceps.
1. Como os eletrodos ativos e de retorno são as duas lâminas do fór-
ceps, é necessário colocar outro eletrodo dispersivo no paciente.
2. Os eletrocautérios bipolares geram menos energia que os unipola-
res e são utilizados, principalmente, em cirurgias oftalmológicas e
neurológicas.

Barash_II.indd 87 22/08/14 11:50


88 Barash, Cullen, Stoelting, Cahalan, Stock, Ortega

Corrente de Eletrodo ativo


alta densidade

Eletro-
cautério

Eletrodo de
Mau contato retorno
Corrente de
alta densidade Placa de retorno

FIGURA 8.7 Aplicação incorreta da placa de retorno de um eletrocautério. O mau


contato com a placa de retorno resulta na geração de corrente de alta densidade
(calor) e na ocorrência de possíveis queimaduras no paciente.

D. O uso de eletrocautérios unipolares (também na eletroconvulsoterapia)


pode provocar interferência elétrica que, por sua vez, pode ser interpre-
tada como taquiarritmia ventricular pelos desfibriladores cardioverso-
res automáticos implantáveis, resultando na liberação de choque para
desfibrilação para o paciente.
E. Em ambientes enriquecidos com oxigênio, a fagulha do eletrocautério
pode transformar-se em fonte de ignição de materiais combustíveis (p.
ex., plásticos como máscaras faciais anestésicas e tubos traqueais) e
provocar incêndios e lesões associadas em pacientes e nos profissionais
de atendimento dos centros cirúrgicos.
1. O risco de incêndios cirúrgicos deve ser considerado sempre que
um eletrocautério for utilizado nas proximidades de ambientes en-
riquecidos com oxigênio.
2. Lençóis esterilizados em forma de tenda permitem a dispersão do
oxigênio acumulado e sua diluição no ar ambiente ou a utiliza-
ção de sistemas respiratórios circulares, com vazamento mínimo

TABELA 8.1 Aplicação correta da placa de retorno dispersível das


unidades eletrocirúrgicas
Usar quantidades adequadas de gel eletrolítico.
Verificar se a placa de retorno está intacta.
Depois que a placa for utilizada, é importante verificar se o gel eletrolítico não está seco.
A placa deve ser colocada em um local o mais próximo possível do sítio da operação.
Se o paciente usa marca-passo cardíaco artificial, a placa deve ser colocada abaixo do
tórax.

Barash_II.indd 88 22/08/14 11:50


Manual de Anestesiologia Clínica 89

de gases ao redor da máscara anestésica. Além disso, diminuem o


risco de ignição por fagulhas geradas por eletrocautérios.
F. Não é necessário instalar pisos condutivos em áreas de aplicação de
anestesia que não utilizam anestésicos inflamáveis.

X. RISCOS AMBIENTAIS
A. Os riscos potenciais nos centros cirúrgicos incluem choque elétrico em
pacientes e nos profissionais e presença de cabos e fios de equipamen-
tos elétricos e de dispositivos de monitorização (instalações montadas
no teto).
B. Os dispositivos de monitorização modernos incluem entradas isoladas
para aplicação nos pacientes. Essas entradas fazem parte da fonte de
alimentação de força.
C. Todas as unidades de prestação de serviços de assistência médica de-
vem ter uma fonte de fornecimento de energia emergencial (geradores
elétricos, fontes de iluminação operadas com bateria, incluindo larin-
goscópios).

Fundamentos Científicos da Anestesia


XI. INTERFERÊNCIA ELETROMAGNÉTICA
A. Os dispositivos de comunicação sem fio (telefones celulares, telefones sem
fio, radiotransmissores) emitem interferência eletromagnética (IEM).
B. Existe uma grande preocupação em torno da possível IEM em marca-
-passos implantados ou em vários tipos de dispositivos de monitoriza-
ção em áreas de cuidados críticos.
1. Os telefones celulares devem ser mantidos a uma distância de pelo
menos 15 cm de um marca-passo.
2. Aparentemente, os telefones celulares não interferem em desfibri-
ladores cardioversores automáticos implantáveis.

XII. CONSTRUÇÃO DE CENTROS CIRÚRGICOS NOVOS


A. As normas da National Fire Protection Association (NFPA) aplicáveis às
instalações de prestação de serviços médicos não exigem mais a instalação
de sistemas elétricos isolados ou de monitores de isolamento de linhas em
áreas destinadas somente ao uso de anestésicos não inflamáveis.
B. A decisão de instalar sistemas elétricos isolados é determinada pelas
condições de umidade dos centros cirúrgicos (presença de sangue, de
fluidos e de soluções salinas). Se houver algum indício de umidade, é
importante verificar a real necessidade de instalação de um sistema de
interrupção do suprimento de energia.
1. Quando a interrupção no suprimento de energia for aceitável, a
melhor forma de proteção alternativa é a utilização de interrupto-
res de circuitos de falhas de aterramento.
2. Quando a interrupção no suprimento de energia não for aceitável,
a melhor opção é instalar um sistema elétrico isolado e um moni-
tor de isolamento de linha.

Barash_II.indd 89 22/08/14 11:50


90 Barash, Cullen, Stoelting, Cahalan, Stock, Ortega

C. O código da NPFA-99 se aplica a centros cirúrgicos remodelados ou com


“estado definido como locais para execução de procedimentos úmidos
que deverão ser protegidos com sistemas isolados de suprimento de ener-
gia elétrica ou com interruptores de circuitos de falhas de aterramento”.

XIII. SEGURANÇA CONTRA INCÊNDIO


A. Atualmente, o risco de incêndios em centros cirúrgicos é tão grande
quanto há cem anos, quando os pacientes eram anestesiados com agen-
tes anestésicos inflamáveis (Tab. 8.2). Entretanto, ao contrário das si-
tuações que predominavam na era dos anestésicos inflamáveis, nos dias
atuais, aparentemente, há uma falta de consciência sobre o potencial de
incêndios em salas cirúrgicas (Tab. 8.3).
1. O início de um incêndio está associado a três componentes (calor
ou fonte de ignição, combustível e oxidante) (Fig. 8.8).
2. O fogo é causado pela combinação rápida da reação química de
um combustível com um oxidante liberando energia sob a forma
de calor e luz.
3. Para prevenir incêndios, é necessário impedir a ocorrência simul-
tânea dos três elementos da tríade.
B. Os perigos principais dos incêndios são queimaduras em pacientes e
nos profissionais que trabalham em centros cirúrgicos e liberação de
compostos tóxicos (p. ex., monóxido de carbono, amônia, cloreto de
hidrogênio e cianeto) resultante da queima de materiais plásticos.

TABELA 8.2 Tríade de incêndios: elementos necessários para iniciar


um incêndio
Calor (Fonte de Ignição)
Unidade elétrica cirúrgica
Lasers
Ferramentas elétricas
Cabos elétricos de fibra óptica

Combustíveis
Agentes de preparação (álcool)
Lençóis esterilizados de papel
Cabelos
Gases alimentares
Unguentos
Equipamentos para anestesia (p. ex., mangueiras de circuitos respiratórios, máscaras,
tubos endotraqueais, máscaras laríngeas, anestésicos voláteis, absorvedores de
dióxido de carbono)

Oxidantes
Ar
Oxigênio
Óxido nitroso

Barash_II.indd 90 22/08/14 11:50


Manual de Anestesiologia Clínica 91

TABELA 8.3 Recomendações para prevenção e controle de


incêndios em centros cirúrgicos
Preparação
Verificar se existe alguma situação de risco elevado (uso de fontes de ignição em
ambientes enriquecidos com oxidante).
A equipe deve determinar como fazer a prevenção e o controle de incêndios.
Cada pessoa deve ter uma tarefa específica (p. ex., remoção de tubos endotraqueais,
desconexão de circuitos).
Divulgar o protocolo de controle de incêndios.
Assegurar a disponibilidade de equipamentos de combate a incêndios.

Prevenção
O anestesiologista deve colaborar com a equipe durante todo o procedimento para
minimizar a presença de ambientes enriquecidos com agentes oxidantes nas
proximidades de fontes de ignição.
Os lençóis esterilizados devem ser configurados de forma adequada para evitar
acúmulo de agentes oxidantes.
As preparações inflamáveis para aplicação na pele devem secar completamente antes da

Fundamentos Científicos da Anestesia


colocação de lençóis esterilizados.
Gaze e esponjas que estiverem nas proximidades de alguma fonte de ignição devem ser
umedecidas.
O cirurgião deve ser notificado se o agente oxidante e a fonte de ignição estiverem
muito próximos.
Manter as concentrações de oxigênio nos níveis clínicos o mais baixo possível (o ideal é
manter o nível abaixo de 30%).
Evitar o uso de óxido nitroso.
Dar tempo suficiente para a dissipação do agente oxidante.

Controle
Procurar sinais de alerta de início de incêndio (p. ex., estalidos, lampejos e fumaça).
Interromper o procedimento; cada membro da equipe deve executar imediatamente a
respectiva tarefa.

Fogo nas Vias Aéreas


Remover o tubo endotraqueal simultaneamente com a interrupção no fornecimento de
gás ou desligar o circuito.
Despejar solução salina na via aérea.
Remover os materiais que estiverem queimando.
Ventilar a máscara, avaliar a lesão, considerar a hipótese de usar broncoscopia e intubar
novamente a traqueia do paciente.

Fogo no Paciente
Desligar o suprimento de gases.
Remover o lençol esterilizado e os materiais que estiverem queimando.
Extinguir as chamas com água, solução salina ou extintor.
Avaliar o estado do paciente, elaborar um plano de cuidados e avaliar a inalação de
fumaça.
(continua)

Barash_II.indd 91 22/08/14 11:50


92 Barash, Cullen, Stoelting, Cahalan, Stock, Ortega

TABELA 8.3 Recomendações para prevenção e controle de


incêndios em centros cirúrgicos (continuação)
Falha na Extinção do Fogo
Usar extintor com dióxido de carbono.
Acionar o alarme de incêndio.
Considerar a evacuação da sala de operação (fechar a porta e não abrir novamente).
Desligar o suprimento de gases do centro cirúrgico.

Gestão de Risco
Preservar o local.
Notificar o gerente de risco do hospital.
Seguir as exigências normativas locais em relação à apresentação de relatórios.
Tratar o incêndio como um evento adverso.
Conduzir treinamentos de combate a incêndio.
Adaptada da American Society of Anesthesiologists: Practice advisory for the prevention and
management of operating room fires: a report by the American Society of Anesthesiologists Task
Force on Operating Room Fires. Anesthesiology 2008; 108:786-801.

FONTE DE IGNIÇÃO
Cirurgiões

OXIDANTE COMBUSTÍVEL
Aplicadores de anestesia Enfermeiros

FIGURA 8.8 Os triângulos ilustram os três componentes necessários para a ocor-


rência de incêndios.

Barash_II.indd 92 22/08/14 11:50


Manual de Anestesiologia Clínica 93

1. Os tubos endotraqueais resistentes aos raios laser agem como um


tipo de tocha flamejante e podem provocar lesões graves na tra-
queia e nos pulmões.
2. O vazamento de gases ao redor de tubos endotraqueais sem ba-
lonete, na presença de eletrocautério, pode provocar a ignição de
tubos inflamáveis. Para minimizar os riscos, deve-se manter a con-
centração do oxigênio inspirado no nível mais baixo possível.
3. Em pacientes com doenças críticas que exigem altas concentrações
de oxigênio durante traqueostomias cirúrgicas, o mais prudente é
não utilizar eletrocautérios.
4. A difusão de óxido nitroso no abdome pode criar risco de incên-
dio durante cirurgias laparoscópicas; o dióxido de carbono não
suporta combustão.
C. A probabilidade de ocorrer combustão em pacientes é mais comum
durante cirurgias na cabeça e no pescoço, ou nas proximidades desses
locais, durante um procedimento com sedação e uso de oxigênio suple-
mentar (máscara facial ou cânula nasal).

Fundamentos Científicos da Anestesia


1. O oxigênio deve ser tratado e administrado como fármaco para
otimizar os benefícios (p. ex., deve ser titulado no nível desejado).
2. Usar lençóis esterilizados sob a forma de tenda e lençóis aderentes
é uma forma de vedar o sítio operatório contra o fluxo de oxigênio
para diminuir o risco de incêndio.
3. Grandes quantidades de soluções preparadas podem produzir va-
pores alcoólicos inflamáveis.
D. Absorvedores de dióxido de carbono dessecados podem provocar rea-
ções exotérmicas na presença de anestésicos voláteis (em especial o se-
voflurano) (a combustão pode envolver o circuito respiratório).
E. Em caso de incêndio, o primeiro passo é interromper a tríade incendi-
ária removendo um dos componentes. A melhor alternativa é remover
o agente oxidante (ver Tab. 8.3).
1. De maneira geral, a desconexão de um tubo endotraqueal do cir-
cuito do anestésico resulta na extinção do fogo (não é recomendá-
vel remover tubos endotraqueais que estiverem queimando, consi-
derando que os danos para o paciente podem ser maiores).
2. Por questão de segurança, recomenda-se retirar o tubo endotra-
queal após a extinção do fogo e inspecionar a via aérea do paciente
por broncoscopia e fazer nova intubação.
3. Se o fogo se disseminar pelo paciente, jogar uma bacia de solução
salina é uma intervenção rápida e eficaz.
a. Os lençóis esterilizados de papel são impermeáveis à água. Por-
tanto, a alternativa de jogar água ou solução salina nesse tipo de
lençol provavelmente não terá nenhuma eficácia.
b. Após a remoção de lençóis esterilizados em chamas, o fogo
pode ser extinto com um extintor de incêndio.
F. As soluções preparadas com álcool devem secar totalmente antes do
início de uma cirurgia.

Barash_II.indd 93 22/08/14 11:50


CAPÍTULO

9
Delineamento Experimental e
Estatística
Os profissionais de medicina devem ser capazes de ler a linguagem científica para
poderem avaliar e interpretar, de forma independente, a literatura e a ênfase cada
vez maior nos métodos estatísticos (Pace NL. Experimental design and statistics.
Em: Barash PG, Cullen BF, Stoelting RK, Cahalan MK, Ortega R, Stock MC, Eds.
Clinical Anesthesia.Philadelphia: Lippincott Williams & Wilkins; 2013: 219-236).

I. DELINEAMENTO DOS ESTUDOS DE PESQUISA. Embora despertem


interesse e desejo pela realização de experiências, os relatos de casos não for-
necem evidências suficientes para produzir avanços na medicina científica.
A. Amostragem
1. Amostragem é um subconjunto de uma população-alvo cuja fi-
nalidade é permitir ao pesquisador generalizar os resultados de pe-
quenas amostras para toda a população. Os elementos do delinea-
mento experimental evitam e minimizam a possibilidade de vieses.
2. As expectativas em torno de amostras representativas de uma
determinada população poderiam materializar-se se cada indiví-
duo dessa amostra tivesse a mesma chance de participar de um
experimento (amostragem aleatória). Entretanto, a maior parte
dos estudos sobre anestesia clínica limita-se ao uso de pacientes
disponíveis (amostragem de conveniência).
B. Os grupos-controle podem ser grupos cruzados ou grupos-controle
paralelo versus grupos-controle histórico (os estudos que usam esse úl-
timo tipo de controle são mais frequentes para demonstrar o benefício
de uma nova terapia).
C. A randomização é muito útil para evitar vieses ao colocar pacientes
em grupos de estudo específicos. Em geral, a randomização é feita por
meio de números aleatórios gerados por computador.
D. Cegar significa mascarar uma visão, tanto do paciente como do pesquisa-
dor, em relação ao grupo experimental para o qual o paciente foi alocado.
1. Em estudos simples cegos, o paciente desconhece o tratamento que
lhe será administrado (as expectativas do paciente em relação ao
tratamento poderiam influenciar os resultados).
2. Em estudos duplo-cegos, o paciente e a pessoa responsável pela co-
leta de dados desconhecem o grupo de tratamento. Essa é a melhor
maneira de testar novas terapias.
E. Tipos de Delineamento de Pesquisa
1. Os estudos longitudinais avaliam alterações ao longo do tempo
utilizando objetos de pesquisa selecionados prospectivamente
(coorte) ou retrospectivamente (caso-controle). Os estudos re-
trospectivos são as principais ferramentas da epidemiologia.

Barash_II.indd 94 22/08/14 11:50


Manual de Anestesiologia Clínica 95

2. Os estudos transversais avaliam alterações em determinado pon-


to do tempo.

II. DADOS E ESTATÍSTICA DESCRITIVA


A. Estatística é o método para trabalhar com conjuntos de números (X e Y)
e determinar se os valores são diferentes. Os métodos estatísticos são im-
portantes porque há fontes de variação em qualquer conjunto de dados,
incluindo variações biológicas aleatórias e medições de erros. Esses erros
dificultam a prevenção de vieses e a realização de cálculos precisos.
B. Estrutura de Dados. A atribuição adequada de uma variável ao tipo
correto de dado é essencial para escolher a técnica estatística correta
(Tab. 9.1).
C. A função da estatística descritiva é descrever a amostra de números
obtidos e caracterizar a população de onde a amostra foi coletada. Os
dois resumos estatísticos usados com mais frequência são localização
central e margem ou variabilidade (Tab. 9.2).

Fundamentos Científicos da Anestesia


III. HIPÓTESES E PARÂMETROS
A. Formulação de Hipóteses
1. Os pesquisadores iniciam o trabalho com alguma percepção intui-
tiva do fenômeno a ser estudado (hipótese biológica).
2. A hipótese biológica se transforma em uma hipótese estatística du-
rante o planejamento da pesquisa.

TABELA 9.1 Tipos de dados


Tipos de Dados Definição Exemplos
Intervalo
Discreto Assumem valores dentro de um Paridade
conjunto com os números Número de dentes
especificados
Contínuo Assumem valores em um intervalo Pressão arterial
contínuo de números Temperatura
Categóricos
Dicotômicos Dados binários Mortalidade
Sexo
Nominais Dados qualitativos que não podem Cor dos olhos
ser ordenados ou classificados Categoria do fármaco
Ordinais Dados ordenados, classificados ou Classificação do estado
medidos sem intervalo de escala físico de acordo com
constante a ASA
Escala analógico-visual
da dor
ASA 5 American Society of Anesthesiologists.

Barash_II.indd 95 22/08/14 11:50


96 Barash, Cullen, Stoelting, Cahalan, Stock, Ortega

TABELA 9.2 Estatística descritiva


Localização Central para Variáveis de Intervalo
Média aritmética (média dos números de um grupo de dados)
Mediana (número médio ou número que divide as amostras em duas partes iguais; não
é afetada por números muito altos ou muito baixos)
Moda (número de uma amostra que aparece com mais frequência)

Margem ou Variabilidade
Desvio-padrão (DP; aproxima a margem dos dados de uma amostra; 1 DP engloba
cerca de 68% da amostra e dos membros de uma população, e 3 DPs englobam 99%)

Intervalos de Confiança
Erro-padrão da média (aproxima a precisão com a qual o centro da população é
conhecido)

B. Lógica da Prova
1. Se for suficientemente improvável que os valores de uma amostra
tenham ocorrido por acaso (alfa [p] , 0,05), a hipótese nula (que
parte da premissa de que não há nenhuma diferença) deve ser re-
jeitada.
2. Considerando que a estatística trata de probabilidades em vez de
certezas, há chance de erros em decisões tomadas com base na hi-
pótese nula.
a. O erro tipo I (alfa) é a rejeição errônea de uma hipótese nula
(falso-positiva). Quanto menor for o alfa selecionado, menor é
o risco de um erro tipo I.
b. O erro tipo II (beta) é a falha em rejeitar uma hipótese nula
(falso-negativa). A variabilidade na população aumenta a chance
de um erro tipo II. O aumento no número de pacientes (que é
muito importante no delineamento de pesquisas de ensaios clí-
nicos controlados), o aumento no valor alfa e grandes diferenças
entre duas condições aumentam as chances de erro tipo II.
C. Estatística Indutiva (Inferência Estatística). Os testes de hipóteses ou
os testes de significância são os focos principais da estatística indutiva
(Tab. 9.3).

IV. APLICAÇÕES ESTATÍSTICAS


A. Dados em Intervalos. As estatísticas paramétricas são a escolha mais
comum para a análise de dados em intervalos. O objetivo dessa análise
é testar a hipótese de diferenças entre as médias de uma população.
B. Intervalos de Confiança. Os intervalos de confiança descrevem a pro-
babilidade de o parâmetro de uma população ser estimado por meio de
uma ferramenta estatística como a média.

Barash_II.indd 96 22/08/14 11:50


Manual de Anestesiologia Clínica 97

TABELA 9.3 Informações necessárias para aceitar ou rejeitar a


hipótese nula
Verificar se os dados experimentais estão em conformidade com as premissas do teste
estatístico pretendido.
Escolher um nível de significância (alfa).
Realizar o teste estatístico.
Determinar o(s) grau(s) de liberdade.
Encontrar o valor crítico para o alfa escolhido e o(s) grau(s) de liberdade da
distribuição teórica apropriada.
Se o teste estatístico exceder o valor crítico, a hipótese nula deve ser rejeitada.
Se o teste estatístico não exceder o valor crítico, a hipótese nula não deve ser rejeitada.

C. Teste t. O teste t de Student é utilizado para comparar os valores das


médias de duas populações. O teste t pareado é usado quando cada
indivíduo atua como seu próprio controle (a variabilidade diminui e

Fundamentos Científicos da Anestesia


o poder estatístico aumenta antes e depois de medições no mesmo pa-
ciente). O teste t não pareado é usado quando as medições são feitas
em dois grupos de indivíduos.
D. Análise de Variância
1. A análise de variância (ANOVA) é a abordagem mais versátil para
manusear comparações entre médias de mais de dois grupos.
2. No caso da estatística paramétrica (testes t e ANOVA), parte-se da
premissa de que as populações seguem uma distribuição normal.
E. Os testes não paramétricos são usados sempre que existir alguma
preocupação com o fato de as populações não seguirem uma distribui-
ção normal.
F. Revisões Sistemáticas e Metanálises. Para responder às perguntas ex-
perimentais, os dados são obtidos pela compilação de estudos contro-
lados (em geral randomizados) relatados pela literatura médica.
1. A American Society of Anesthesiologists desenvolveu um processo
para criação de parâmetros práticos que incluem uma forma va-
riante de revisões sistemáticas.
G. Interpretação dos Resultados
1. Os estudos científicos não terminam com os testes estatísticos (a
significância estatística nem sempre se equipara à relevância bioló-
gica).
2. Mesmo diferenças pequenas e sem importância sob o ponto de
vista clínico entre grupos podem ser detectadas se o tamanho da
amostra for suficientemente grande. Se o tamanho da amostra for
pequeno, há uma chance muito maior de confundir variáveis que
poderiam explicar qualquer diferença.

Barash_II.indd 97 22/08/14 11:50


98 Barash, Cullen, Stoelting, Cahalan, Stock, Ortega

TABELA 9.4 Força das evidências (ordem crescente) em relação à


eficácia
Relato de caso
Estudo retrospectivo
Estudo prospectivo com controles históricos
Ensaio clínico randomizado e controlado
Série de ensaios clínicos randomizados e controlados

3. Se os grupos experimentais de um estudo com delineamento ade-


quado receberem três ou mais doses de um fármaco, a expectativa
do leitor seria observar um aumento ou uma redução uniforme na
relação dose-resposta.
4. Na comparação entre duas terapias, a superioridade de uma em
relação à outra depende do delineamento do estudo (Tab. 9.4).

V. CONCLUSÕES
A. Recursos Estatísticos. O acompanhamento do crescimento exponen-
cial das informações médicas desde a Segunda Guerra Mundial resul-
tou na criação de um grande acervo de conhecimentos bioestatísticos
(livros, revistas e internet).
B. Estatística e Anestesia. O entendimento da pesquisa clínica impede
que novos tratamentos sejam incorporados quando baseados em estu-
dos com delineamento frágil.

Barash_II.indd 98 22/08/14 11:50


SEÇÃO

III Anatomia e Fisiologia

CAPÍTULO

10
Anatomia e Fisiologia do Coração
O coração é uma bomba muscular fásica eletricamente autossustentável que tra-
balha em velocidade variável e provê sua própria irrigação sanguínea (Pagel PS,
Kampine JP, Stowe DF. Cardiac anatomy and physiology. Em: Barash PG, Cullen
BF, Stoelting RK, Cahalan MK, Ortega R, Stock MC, Eds. Clinical Anesthesia.
Philadelphia: Lippincott Williams & Wilkins; 2013: 237-262). Os dois pares de
átrios e ventrículos do coração são câmaras elásticas dispostas de forma a su-
prir quantidades iguais de sangue às circulações pulmonar e sistêmica. A função
contrátil dos átrios e dos ventrículos e sua capacidade de encher adequadamente
sem pressão excessiva determinam o desempenho cardíaco global. Assim, anor-
malidades da função sistólica ou diastólica podem causar insuficiência cardíaca.
Os conhecimentos abrangentes de anatomia e fisiologia do coração são cruciais
à prática da anestesia moderna.

I. ANATOMIA MACROSCÓPICA
A. Arquitetura
1. Uma estrutura cartilaginosa flexível forma o esqueleto cardíaco e
é composta pelos ânulos das valvas cardíacas, raízes da aorta e da
artéria pulmonar (AP), corpo fibroso central e trígonos fibrosos
direito e esquerdo. Essa estrutura básica cartilaginosa fornece su-
porte às valvas e mantém a integridade estrutural do coração em
condições de pressão interna estabelecidas.
2. As fibras musculares subendocárdicas e subepicárdicas do ven-
trículo esquerdo (VE) estão orientadas nos planos perpendicular,
oblíquo e helicoidal (“forma de oito”), que permitem um movi-
mento de “torção” e, assim, aumentam a força sistólica dessa câ-
mara cardíaca. A perda dessa ação helicoidal-rotacional contribui
para a redução da fração de ejeção (FE) durante a progressão da
insuficiência cardíaca congestiva (ICC).
3. Anatomicamente, o ventrículo direito (VD) em forma de crescente
está situado à frente e à direita do VE. Essa câmara cardíaca bom-
beia sangue venoso desoxigenado para o sistema relativamente
complacente de baixa pressão das APs.
B. Estrutura Valvar
1. Dois pares de valvas transparentes e avasculares ao exame macros-
cópico garantem o fluxo unidirecional do sangue no coração.

Barash_III.indd 99 22/08/14 11:56


100 Barash, Cullen, Stoelting, Cahalan, Stock, Ortega

2. As valvas pulmonar e aórtica separam o VD e o VE da AP e da


aorta, respectivamente. Essas valvas abrem e fecham e operam pas-
sivamente com as alterações de pressão resultantes da contração e
do relaxamento do VD e do VE.
3. Os seios de Valsalva são segmentos dilatados da raiz aórtica pro-
ximal que estão localizados pouco acima de cada cúspide da valva
aórtica.
4. A valva mitral localizada entre o átrio esquerdo (AE) e o VE abre
em resposta ao gradiente de pressão positivo entre essas duas câ-
maras cardíacas. O fechamento das cúspides ocorre quando o flu-
xo sanguíneo retrógrado avança na direção da valva no início da
sístole.
a. A cordoalha tendínea funciona como “cabos de estabilização”
para evitar prolapso e inversão das cúspides durante a contração
do VE.
b. O aparelho da valva mitral é fundamental à função global do VE
(assegura que o fluxo sanguíneo proveniente do AE ao VE seja
unidirecional).
c. A isquemia ou o infarto de um músculo papilar pode causar
disfunção do aparelho mitral e geralmente se acompanha de re-
gurgitação mitral aguda.
5. A valva tricúspide é formada de três cúspides (anterior, posterior e
septal) e assegura o fluxo unidirecional do sangue do átrio direito
(AD) para o VD. Ao contrário da valva mitral, a valva tricúspide
não tem um anel colagenoso, mas se origina do sulco atrioventri-
cular (AV) (que também contém a artéria coronária direita, a qual
deve ser cuidadosamente evitada durante uma cirurgia da valva
tricúspide) que separa o AD do VD.
C. Irrigação Coronariana
1. A irrigação sanguínea do VE é suprida pelas artérias coronária
descendente anterior esquerda (DAE), artéria coronária circunfle-
xa esquerda (ACCE) e artéria coronária direita (ACD) (Fig. 10.1).
2. A maior parte do fluxo sanguíneo que irriga o miocárdio do VE
circula durante a diástole, porque a pressão arterial aórtica é maior
que a pressão ventricular esquerda. Uma estenose crítica ou obs-
trução aguda de uma dessas três artérias pode causar isquemia ou
infarto do miocárdio acompanhado de disfunção contrátil regio-
nal com base na distribuição conhecida de cada artéria coronária
responsável pela irrigação sanguínea do coração (Tab. 10.1).
3. A “dominância” da circulação coronariana é determinada pela ar-
téria coronária principal que irriga a artéria coronária descendente
posterior (ACDP). A circulação “dominante direita” ocorre quan-
do a ACD fornece sangue para a ACDP e é detectada em cerca de
80% dos indivíduos. A circulação “dominante esquerda”, na qual a
ACDP é irrigada pela ACCE, é observada nos casos restantes (20%
dos indivíduos).

Barash_III.indd 100 22/08/14 11:56


Manual de Anestesiologia Clínica 101

Artéria coronária
esquerda

Ramo circunflexo
da artéria
coronária
esquerda
Artéria
coronária
direita Veia cardíaca
magna

Ramo
descendente
Veias anterior da
cardíacas artéria coronária
anteriores esquerda

Ramo direito da
artéria pulmonar

Veia cardíaca Veia cava


magna inferior

Seio coronariano

Ramo Artéria coronária


circunflexo direita
da artéria
coronária
esquerda
Ramo
descendente
Veia posterior da artéria
Anatomia e Fisiologia

cardíaca parva coronária direita

FIGURA 10.1 A visão anterior do coração (esquerda) demonstra as artérias coroná-


ria direita e descendente anterior esquerda. A visão posterior (direita) permite obser-
var as artérias coronárias circunflexa esquerda e descendente posterior. As veias car-
díacas anteriores originadas do ventrículo direito e do seio coronariano, que drenam
predominantemente o ventrículo esquerdo, esvaziam no átrio direito.

4. A perfusão sanguínea do AD, do AE e do VD ocorre durante a


sístole e a diástole, porque a pressão arterial aórtica sempre é maior

Barash_III.indd 101 22/08/14 11:56


102 Barash, Cullen, Stoelting, Cahalan, Stock, Ortega

TABELA 10.1 Áreas em risco de isquemia miocárdica com base na


distribuição das artérias coronárias
Artéria Coronária Descendente Anterior Esquerda
Parede anterior medial do ventrículo esquerdo
Dois terços anteriores do septo interventricular
Ápice do ventrículo esquerdo
Parede anterior do ventrículo direito

Artéria Coronária Circunflexa Esquerda


Segmentos anterior e posterior da parede lateral do ventrículo esquerdo
Átrio esquerdo
Nodo sinoatrial (45% dos pacientes)

Artéria Coronária Direita


Segmentos mediais da parede posterior e terço posterior do septo interventricular
Nodo sinoatrial (55% dos pacientes)
Ventrículo direito
Nodo atrioventricular (menos comum que a artéria coronária circunflexa esquerda)

que a pressão dentro dessas câmaras cardíacas (Fig. 10.2).


5. O grau de desenvolvimento de circulação colateral coronariana
pode determinar se a isquemia ou o infarto do miocárdio é prová-
vel nos pacientes com doença arterial coronariana.
6. As veias coronarianas convergem e terminam no seio coronariano,
que drena na região posterior do AD acima da valva tricúspide
(representando cerca de 85% do fluxo sanguíneo coronariano total
do VE). O fluxo sanguíneo restante drena diretamente nas câma-
ras atriais e ventriculares por meio das veias thebesianas. As veias
do VD drenam para as veias cardíacas anteriores que, por sua vez,
drenam separadamente para o AD.
D. Condução dos Estímulos
1. A forma como o coração é ativado eletricamente é fundamental
ao seu desempenho mecânico. O marca-passo cardíaco primário
é o nodo sinoatrial, mas os declínios da frequência de ativação e
os atrasos (ou bloqueios) da condução normal podem resultar no
aparecimento de marca-passos secundários.
2. Os átrios estão isolados eletricamente dos ventrículos pelo es-
queleto cartilaginoso do coração. Por essa razão, a despolarização
atrial é dirigida unicamente pelo VD e VE por meio do nodo AV.
Como a condução pelo nodo AV é relativamente lenta em com-
paração com as vias proximais e distais a ele, tal estrutura é res-
ponsável pelo padrão de contrações sequenciais dos átrios e dos
ventrículos.

Barash_III.indd 102 22/08/14 11:56


Manual de Anestesiologia Clínica 103

120
Pressão aórtica
(mm Hg)

100

80
Fluxo sanguíneo coronariano fásico (mL/min)

100

80

60 Artéria
coronária
40 esquerda
20

15

10
Artéria
5 coronária
direita
0

0,2 0,4 0,6 0,8 1


Tempo (s)
FIGURA 10.2 Ilustração esquemática do fluxo sanguíneo das artérias coronárias es-
querda e direita durante as duas fases do ciclo cardíaco. Observe que a maior parte
do fluxo coronariano esquerdo ocorre durante a sístole, enquanto o fluxo coronariano
direito (e o fluxo do seio coronariano) ocorre predominantemente no final da sístole
e no início da diástole.
Anatomia e Fisiologia

3. As vias acessórias que não passam pelo nodo AV e estabelecem


um padrão de condução anormal entre os átrios e os ventrículos
podem causar taquiarritmias supraventriculares.

II. FISIOLOGIA CORONARIANA


A. Irrigação Sanguínea Coronariana
1. A irrigação sanguínea do VE depende diretamente da diferença de
pressão diastólica final entre a aorta e o VE (pressão de perfusão

Barash_III.indd 103 22/08/14 11:56


104 Barash, Cullen, Stoelting, Cahalan, Stock, Ortega

coronariana) e está relacionada inversamente com a resistência ao


fluxo vascular, que varia com a quarta potência do raio do vaso (lei
de Poiseuille).
2. Nos adultos, o fluxo sanguíneo coronariano em repouso é de cerca
de 250 mL/minuto (1 mL/min/g) ou 5% do débito cardíaco total.
3. O miocárdio subendocárdico do VE está exposto a uma pressão
mais alta que a camada subepicárdica durante a sístole (a pressão
intraventricular sistólica pode ser maior que a pressão sistólica de
pico do VE). Em razão dessas diferenças de pressão dos tecidos, a
camada subendocárdica é mais suscetível à isquemia quando há
estenoses das artérias coronárias, hipertrofia por sobrecarga de
pressão, ou taquicardia extrema.
4. Normalmente, o coração extrai cerca de 75 a 80% do teor de O2
do sangue arterial, ou seja, de longe a taxa de extração mais alta
dentre todos os órgãos do corpo.
5. O consumo de oxigênio do miocárdio é um dos determinantes
principais do fluxo sanguíneo coronariano.

III. ANATOMIA E FUNÇÃO DOS MIÓCITOS CARDÍACOS


A. Ultraestrutura
1. O coração contrai e relaxa cerca de 3 bilhões de vezes durante um
período de vida mediano, tomando como base a frequência de 70
batimentos por minuto e a expectativa de vida de 75 anos.
2. O sarcolema é a membrana externa da célula muscular do cora-
ção (contém canais iônicos e receptores), e invaginações profun-
das dessa membrana (túbulos transversais ou “T”) penetram na
estrutura interna do miócito, assegurando a transmissão rápida e
homogênea dos impulsos despolarizantes que iniciam a contração
e sua distribuição simultânea por toda a célula.
B. Aparelho Contrátil
1. Miosina, actina, tropomiosina e complexo troponínico de três pro-
teínas são os seis componentes principais do aparelho contrátil.
2. Estudos demonstraram que a velocidade máxima de encurtamento
do sarcômero depende da atividade dessa miosina-ATPase ativada
pela actina.
C. Interação entre Cálcio e Miofilamento. A ligação do Ca21 à troponina
C desencadeia uma série de alterações de conformação do complexo de
troponina-tropomiosina que resultam na exposição do sítio de ligação
da miosina existente na molécula de actina.
D. Interação entre Miosina e Actina. A ligação de alta afinidade do tri-
fosfato de adenosina com o domínio catalítico da miosina desencadeia
uma série de reações químicas e alterações mecânicas que resultam na
contração do sarcômero.

Barash_III.indd 104 22/08/14 11:56


Manual de Anestesiologia Clínica 105

IV. O CICLO CARDÍACO (Fig. 10.3)


A. O complexo QRS do eletrocardiograma indica que houve despolariza-
ção do VD e do VE. Esse fenômeno elétrico inicia a contração (sístole)
e está associado aos aumentos rápidos de pressão nessas duas câmaras
cardíacas. Quando as pressões do VD e do VE são maiores que as pres-
sões do AD e do AE, as valvas tricúspide e mitral fecham e, desse modo,
resultam na primeira bulha cardíaca (B1).
B. A taxa máxima de elevação da pressão do VE (1dP/dt) – um índice de
contratilidade miocárdica bastante utilizado – também ocorre durante
a contração isovolumétrica dessa câmara cardíaca.
C. As pressões da aorta e da AP excedem brevemente as pressões do VE
e do VD à medida que essa fase de ejeção mais lenta chega ao fim, e
as valvas aórtica e pulmonar fecham em resposta às inversões desses
gradientes de pressão.
1. O fechamento das valvas aórtica e pulmonar é responsável pela se-
gunda bulha cardíaca (B2); tal evento indica o final da sístole.
2. Normalmente, a B2 é desdobrada porque a valva aórtica fecha um
pouco antes da valva pulmonar.
3. A valva mitral abre quando a pressão do AE é maior que a pressão
do VE, e o gradiente de pressão entre essas câmaras cardíacas em-
purra o sangue armazenado no AE para dentro do VE.
D. Idade e doença cardíaca (isquemia miocárdica, hipertrofia por sobre-
carga de pressão) frequentemente retardam o tempo de relaxamento do
VE, reduzindo o enchimento inicial do VE por diminuição do gradien-
te de pressão entre o AE e o VE.
E. A sístole atrial é responsável por 15 a 25% do volume ejetado (Ve) final,
mas sua importância é acentuada quando há retardo do relaxamento
ventricular esquerdo ou redução da complacência do VE. Assim, é co-
mum que os pacientes com essas anormalidades desenvolvam instabi-
lidade cardiovascular ou ICC quando a contração do AE não está ade-
quadamente sincronizada (bloqueio da condução AV) ou não ocorre
(fibrilação atrial).
F. Três deflexões principais são observadas no traçado de pressão do AE
durante o ritmo sinusal.
1. A onda P de despolarização atrial é seguida da contração do AE,
Anatomia e Fisiologia

que produz a onda “a” da sístole atrial. O aumento da pré-carga ou


da contratilidade do AE acentua a magnitude da onda “a”.
2. A onda “v” resulta do enchimento do AE durante a sístole do VE
e do início do relaxamento, à medida que o sangue venoso re-
tornado das veias pulmonares entra no AE. Regurgitação mitral
ou reduções da complacência do AE aumentam a magnitude da
onda “v”.

Barash_III.indd 105 22/08/14 11:56


106 Barash, Cullen, Stoelting, Cahalan, Stock, Ortega

Tempo (s)
0 0,2 0,4 0,6 0,8
120

100
Aorta
Pressão (mm Hg)

80

60 Ventrículo

40

20
Átrio
0
Sístole Diástole

120
Volume (mL)

80

40

1a 2a 3a 4a
Bulhas cardíacas

R R

T P
P

ECG
Q S Q

PCI PRI
FIGURA 10.3 Eventos mecânicos e elétricos do ciclo cardíaco, demonstrando tam-
bém a curva de volume ventricular esquerdo (VE) e as bulhas cardíacas. Observe os
períodos de contração isovolumétrica (PCI) e de relaxamento isovolumétrico (PRI) du-
rante os quais não há alteração do volume do VE porque as valvas aórtica e mitral
estão fechadas. O volume do VE diminui à medida que ele ejeta seu conteúdo dentro
da aorta. Durante o primeiro terço da ejeção sistólica (período de ejeção rápida), a
curva de esvaziamento é aguda. ECG 5 eletrocardiograma.

Barash_III.indd 106 22/08/14 11:56


Manual de Anestesiologia Clínica 107

V. DIAGRAMA DE PRESSÃO-VOLUME (Fig. 10.4)


A. As variações contínuas de pressão e volume do VE podem ser ilus-
tradas graficamente em forma comparativa para obter um diagrama
tempo-dependente que é útil à análise das funções sistólica e diastólica
dessa câmara cardíaca.
B. O volume diastólico final (VDF) e o volume sistólico final (VSF) nor-
mais são de cerca de 120 e 40 mL, respectivamente. Desse modo, o vo-
lume ejetado (Ve) 5 (VDF – VSF), ou 80 mL, enquanto a fração de
ejeção (FE) é (Ve/VDF), ou 67% nos corações normais.
C. A ICC resultante da disfunção sistólica ou diastólica do VE pode ser
representada claramente por meio da análise do diagrama de P-V.

VI. FATORES QUE DETERMINAM A FUNÇÃO SISTÓLICA


A. A função de bombeamento do VE (e das outras câmaras cardíacas) é
determinada por sua capacidade de acomodar e ejetar sangue.
B. O débito cardíaco e a FE são mais utilizados para quantificar a fun-
ção sistólica do VE. O volume de sangue contido dentro do VE antes
do início da contração, a resistência arterial ao esvaziamento que o VE
precisa superar e as propriedades contráteis do próprio VE determi-
nam o volume ejetado a cada ciclo cardíaco (Fig. 10.5).
C. Frequência Cardíaca
1. O estado contrátil do músculo cardíaco isolado está relacionado
diretamente com sua frequência de estimulação (conhecida como
efeito Bowditch, “escadaria” ou “treppe” [“escada”, em alemão] ou
relação “força-frequência”).
2. Taquiarritmias ou estimulação rápida de um marca-passo podem
causar hipotensão profunda ou colapso hemodinâmico. O efeito
Bowditch é especialmente importante para aumentar a contrati-
lidade e manter a pressão arterial adequada quando há tampona-
mento pericárdico ou pericardite constritiva, porque essas doenças
caracterizam-se por limitação grave do enchimento do VE.
D. Pré-Carga
1. O VDF é mais utilizado para definir a pré-carga do VE porque
esse volume de sangue está relacionado diretamente com o estresse
diastólico final das paredes do VE.
Anatomia e Fisiologia

2. Na maioria dos casos, o VDF do VE é estimado pela ecocardiogra-


fia transesofágica bidimensional.
E. Pós-Carga é a carga adicional à qual o músculo cardíaco fica exposto
depois de começar a contração.
1. A estimativa clínica da pós-carga do VE mais usada é a resistência
vascular sistêmica calculada pela fórmula ([PAM – PAD]80)/DC.
2. O VE insuficiente é especialmente sensível aos aumentos da pós-
-carga, e a redução da pós-carga do VE é crucial ao tratamento
clínico da ICC.

Barash_III.indd 107 22/08/14 11:56


108 Barash, Cullen, Stoelting, Cahalan, Stock, Ortega

150
RPVSF

C
100 B
Pressão do VE (mm Hg)

TS
50

PE RPVDF

D
A

40 80 120

Volume do VE (mL)

FIGURA 10.4 Diagrama de pressão-volume do ventrículo esquerdo (VE) em esta-


do de equilíbrio. O ciclo cardíaco avança em direção anti-horária tempo-dependente
(setas). Os pontos A, B, C e D correspondem ao final da diástole do VE (fechamento
da valva mitral), à abertura da valva aórtica, ao final da sístole do VE (fechamento da
valva aórtica) e à abertura da valva mitral, respectivamente. Os segmentos AB, BC, CD
e DA representam a contração isovolumétrica, a ejeção, o relaxamento isovolumétrico
e o enchimento, respectivamente. O VE é obrigado a operar dentro dos limites das
relações de pressão-volume sistólico final e diastólico final (RPVSF e RPVDF, respecti-
vamente). A área delimitada pelo diagrama de pressão-volume do VE corresponde
ao trabalho sistólico (TS) realizado durante o ciclo cardíaco. A área à esquerda do
diagrama de pressão-volume do VE entre a RPVSF e a RPVDF é a energia potencial
(EP) restante no sistema.

Barash_III.indd 108 22/08/14 11:56


Manual de Anestesiologia Clínica 109

Função diastólica Função sistólica


Fluxo sanguíneo da VP
Função do AE Pré-carga
Mecânica
Valva mitral Pós-carga arterial
Relaxamento do AE Contratilidade
Complacência do VE

Fração de ejeção
Volume ejetado Débito
1 cardíaco
Frequência cardíaca

FIGURA 10.5 Principais fatores que determinam as funções diastólica (à esquerda)


e sistólica (à direita) do ventrículo esquerdo (VE). Observe que o fluxo sanguíneo da
veia pulmonar (VP), a função do átrio esquerdo (AE), a integridade da valva mitral, o
relaxamento do AE e a complacência do VE combinam-se e determinam a pré-carga
ventricular esquerda.

F. Contratilidade miocárdica (também conhecida como estado inotró-


pico) é a força específica que o músculo cardíaco consegue produzir
durante a contração em condições controladas de pressão e frequência
de estimulação.
1. A FE (razão entre volume ejetado e VDF) é o parâmetro clínico
de contratilidade VE mais utilizado. A ecocardiografia é realizada
mais comumente para calcular a FE.
2. A FE pode ser maior que o normal nos casos de regurgitação mitral
grave, porque uma percentagem grande do fluxo sanguíneo origi-
nado do VE é desviada para o AE de baixa pressão durante a sístole.

VII. FATORES QUE DETERMINAM A FUNÇÃO DIASTÓLICA


A. Cada câmara cardíaca precisa encher adequadamente com pressões
normais para facilitar o funcionamento ideal durante a contração sub-
sequente (Tab. 10.2).
Anatomia e Fisiologia

B. A resposta do VE às alterações das condições de enchimento (inclusive


as que são observadas no centro cirúrgico) é determinada basicamente
pela função diastólica do VE.
1. Alguns anestésicos voláteis e intravenosos comumente utilizados
afetam o relaxamento e o enchimento do VE dos corações normais
e insuficientes.
2. A determinação pré-operatória da existência, da causa e da gra-
vidade da disfunção diastólica do VE é importante no cuidado de
pacientes submetidos a uma cirurgia na qual são esperadas gran-
des variações do volume intravascular (Tab. 10.3).

Barash_III.indd 109 22/08/14 11:56


110 Barash, Cullen, Stoelting, Cahalan, Stock, Ortega

TABELA 10.2 Determinantes da disfunção diastólica do ventrículo


esquerdo
Frequência e ritmo cardíacos
Função sistólica do ventrículo esquerdo
Espessura das paredes
Geometria da câmara
Duração, grau e extensão de relaxamento dos miócitos
Magnitude da sucção diastólica
Gradiente de pressão entre o átrio e o ventrículo esquerdos
Estrutura e função da valva mitral
Fluxo sanguíneo da veia pulmonar
Condições de carga e função do ventrículo direito
Fluxo sanguíneo coronariano
Compressão por massas mediastínicas

C. Monitoração Invasiva do Relaxamento Ventricular Esquerdo


1. A impossibilidade de dissociação adequada das ligações cruzadas
entre actina e miosina ou a remoção do Ca21 intracelular pode
contribuir para os atrasos do relaxamento normal do VE.
2. A ICC é frequentemente desencadeada pelo início súbito de fibri-
lação atrial nos pacientes com doenças cardíacas caracterizadas
pelo retardo do relaxamento do VE (hipertrofia por sobrecarga de
pressão, miocardiopatia obstrutiva hipertrófica).
3. A isquemia miocárdica causada pela obstrução aguda de uma ar-
téria coronária importante também é uma causa frequente de re-
tardo do relaxamento do VE e pode acompanhar-se de reduções
da complacência ventricular esquerda, que limitam ainda mais o
enchimento dessa câmara cardíaca.
4. A avaliação quantitativa do relaxamento do VE é realizada mais
comumente por determinações do declínio da pressão do VE du-
rante o relaxamento isovolumétrico.

TABELA 10.3 Causas comuns de disfunção diastólica do ventrículo


esquerdo
Idade maior que 60 anos
Isquemia miocárdica aguda
“Atordoamento” do miocárdio (stunning)
Remodelação ventricular após infarto
Hipertrofia por sobrecarga de pressão (estenose aórtica, hipertensão sistêmica)
Sobrecarga de volume (regurgitação aórtica ou mitral)
Miocardiopatia (obstrutiva hipertrófica, dilatada, restritiva)
Doenças pericárdicas (tamponamento, pericardite constritiva)

Barash_III.indd 110 22/08/14 11:56


Manual de Anestesiologia Clínica 111

D. Monitoração Invasiva do Enchimento e da Complacência do Ventrí-


culo Esquerdo
1. Os índices de enchimento do VE podem ser calculados por méto-
dos de mensuração invasivos ou não invasivos (ecocardiografia,
angiografia radionuclídica, ressonância magnética dinâmica).
2. O traçado dV/dt assemelha-se ao sinal de velocidade do fluxo san-
guíneo transmitral adquirido durante o enchimento do VE por
meio da ecocardiografia com Doppler. Estudos demonstraram que
o desenvolvimento de ICC causa alterações da morfologia do tra-
çado dV/dt.
E. Monitoração Não Invasiva da Função Diastólica
1. O intervalo entre o fechamento da valva aórtica e a abertura da
valva mitral define o tempo (ou período) de relaxamento isovolu-
métrico, que em geral é utilizado como indicador não invasivo do
relaxamento do VE.
2. A avaliação não invasiva da função diastólica do VE baseia-se na
determinação da velocidade do fluxo sanguíneo transmitral por
ecocardiografia com Doppler.
3. Sintomas clínicos, tolerância aos esforços, classe funcional da New
York Heart Association e mortalidade estão diretamente relaciona-
dos com a gravidade relativa da disfunção diastólica do VE.

Anatomia e Fisiologia

Barash_III.indd 111 22/08/14 11:56


CAPÍTULO

11
Função Respiratória e Anestesia
Os anestesiologistas interferem diretamente na função respiratória e, por essa
razão, é importante que tenham conhecimentos detalhados sobre fisiologia pul-
monar de forma a garantir a segurança da anestesia (Tamul PC, Ault ML. Res-
piratory function in anesthesia. Em: Barash PG, Cullen BF, Stoelting RK, Caha-
lan MK, Ortega R, Stock MC, Eds. Clinical Anesthesia. Philadelphia: Lippincott
Williams & Wilkins; 2013: 263-286).

I. ANATOMIA FUNCIONAL DOS PULMÕES


A. Músculos da Respiração
1. Os músculos da respiração são resistentes, porém afetados nega-
tivamente por desnutrição, doença pulmonar obstrutiva crônica
(DPOC) e aumento da resistência das vias aéreas.
2. O principal músculo respiratório é o diafragma, com contribui-
ções menores dos músculos intercostais. Os músculos da parede
abdominal são importantes durante os esforços expulsivos (p. ex.,
durante a tosse).
B. Estruturas Pulmonares
1. As pleuras visceral e parietal estão em contato constante, forman-
do o espaço intrapleural virtual no qual a pressão diminui quando
o diafragma desce e o gradil costal expande.
2. O parênquima pulmonar é subdividido em três categorias de vias
aéreas com base na anatomia pulmonar funcional (Tab. 11.1).
a. As vias aéreas calibrosas (diâmetros iguais ou maiores que
2 mm) são responsáveis por 90% da resistência total das vias
aéreas.
b. O número de alvéolos aumenta progressivamente com a idade,
começando com cerca de 24 milhões ao nascer e alcançando a
contagem final do adulto de 300 milhões em torno dos 8 a 9
anos de idade. A superfície estimada disponível para a troca de
gases é de 70 m2.
c. A traqueia do adulto mede 10 a 12 cm de comprimento e seu
diâmetro interno é de cerca de 20 mm. A cartilagem cricóidea
corresponde ao nível do sexto corpo vertebral cervical. As duas
extremidades da traqueia estão ligadas a estruturas móveis e,
nos adultos, a carina pode movimentar-se em média por 3,8 cm
com a flexão e a extensão do pescoço (isso é importante nos pa-
cientes intubados). Nas crianças, a mobilidade do tubo traqueal
é ainda mais importante, porque deslocamentos de apenas 1 cm
podem mover o tubo para fora da traqueia ou abaixo da carina.

Barash_III.indd 112 22/08/14 11:56


Manual de Anestesiologia Clínica 113

TABELA 11.1 Divisões funcionais das vias aéreas


Tipo Função Estrutura
Condutivas Transferência da maior parte do Traqueia até os bronquíolos
volume de gases terminais
Transicionais Transferência da maior parte do Bronquíolos respiratórios
volume de gases Ductos alveolares
Troca gasosa limitada
Respiratórias Troca gasosa Alvéolos
Sacos alveolares

d. Nos adultos, o brônquio principal direito deixa a traqueia a um


ângulo aproximado de 25 graus com relação ao eixo vertical da
traqueia; o ângulo do brônquio principal esquerdo é de cerca de
45 graus. Por essa razão, a intubação endobrônquica acidental
ou as aspirações são mais prováveis no lado direito. Nas crianças
com menos de três anos de idade, os ângulos formados pelos
brônquios principais direito e esquerdo são praticamente iguais.
e. O brônquio principal direito estende-se por cerca de 2,5 cm an-
tes de formar sua primeira ramificação; o brônquio principal
esquerdo estende-se por cerca de 4,5 cm. Em 2 a 3% dos adultos,
o brônquio lobar superior direito abre-se na traqueia acima da
carina, um fato importante que deve ser levado em considera-
ção durante a colocação de um tubo de duplo lúmen.
3. Vias Aéreas e Membrana Alveolocapilar
a. A membrana alveolocapilar é importante para o transporte dos
gases alveolares (O2, CO2) e o metabolismo das substâncias que
circulam no sangue.
b. As células alveolares tipo I fornecem superfície ampla de troca
gasosa, e essas células podem ser lesadas (síndrome da angústia
respiratória aguda).
c. As células alveolares tipo III são macrófagos, que conferem
proteção contra infecções e participam da reação inflamatória
Anatomia e Fisiologia

pulmonar.
4. Sistemas Vasculares Pulmonares
a. Dois sistemas circulatórios principais fornecem sangue aos pul-
mões: as redes vasculares pulmonar (que possibilita a troca de
gases e atende às necessidades metabólicas do parênquima al-
veolar) e brônquica (que fornece O2 às vias aéreas condutivas e
aos vasos pulmonares).
b. As conexões anatômicas entre as circulações venosas brôn-
quica e pulmonar constituem um shunt absoluto, pelo qual
transitam cerca de 2% do débito cardíaco (“shunt fisiológico
ou normal”).

Barash_III.indd 113 22/08/14 11:56


114 Barash, Cullen, Stoelting, Cahalan, Stock, Ortega

II. MECÂNICA PULMONAR. Os movimentos dos pulmões são inteira-


mente passivos e respondem às forças externas aos pulmões. Durante a
respiração espontânea, as forças externas são produzidas pelos músculos
ventilatórios.
A. Trabalho Elástico
1. A tendência natural dos pulmões é de entrar em colapso (re-
tração elástica), de forma que a expiração normal em repouso é
passiva.
2. A tensão superficial na interface entre ar e líquido é responsável
por manter os alvéolos abertos. Durante a inspiração, a tensão
superficial aumenta, assegurando que os gases tendam a fluir dos
alvéolos maiores para os menores, impedindo assim o colapso.
3. A pressão esofágica é um reflexo da pressão intrapleural e permi-
te estimar o trabalho respiratório do paciente (trabalho elástico e
trabalho resistivo para superar a resistência ao fluxo dos gases nas
vias aéreas).
4. Os pacientes com complacência pulmonar reduzida em geral res-
piram com volumes correntes menores a uma frequência mais alta.
Os pacientes com doenças que aumentam a complacência pulmo-
nar (retenção de ar causada por asma ou DPOC) precisam usar os
músculos ventilatórios para exalar ativamente.
B. Resistência ao Fluxo de Gases. Dentro do trato respiratório, os fluxos
de ar são laminar e turbulento.
1. O fluxo laminar não é audível, sendo influenciado apenas pela
viscosidade. O gás hélio tem baixa densidade, mas sua viscosidade
fica próxima da do ar.
2. O fluxo turbulento é audível e quase sempre ocorre quando a re-
sistência alta ao fluxo de gases nas vias aéreas causa problemas (o
gás hélio facilita o fluxo).
C. Aumento da Resistência das Vias Aéreas
1. A resposta normal ao aumento da resistência à inspiração é a acen-
tuação do esforço dos músculos inspiratórios.
2. A resposta normal ao aumento da resistência à expiração é a uti-
lização dos músculos acessórios para forçar a saída dos gases dos
pulmões. Os pacientes que utilizam cronicamente os músculos
acessórios para exalar o ar estão sujeitos à fadiga dos músculos
ventilatórios quando se deparam com um aumento agudo do tra-
balho ventilatório, mais comumente quando desenvolvem pneu-
monia ou insuficiência cardíaca.
3. O aumento da PaCO2 quando a resistência das vias aéreas está
aumentada pode indicar que os mecanismos compensatórios do
paciente estão praticamente exauridos.

Barash_III.indd 114 22/08/14 11:56


Manual de Anestesiologia Clínica 115

TABELA 11.2 Alterações fisiológicas da função respiratória


associadas ao envelhecimento
Dilatação dos alvéolos
Ampliação dos espaços aéreos
Redução da superfície de troca
Perda dos tecidos de sustentação
Redução da retração elástica dos pulmões
Aumento da capacidade residual funcional
Redução da complacência torácica (aumento do esforço para respirar)
Redução da força dos músculos respiratórios (nutrição, índice cardíaco)
Redução das taxas de fluxo expiratório
Atenuação da resposta respiratória à hipoxemia e à hipercapnia (evidenciada nos casos
de insuficiência cardíaca, obstrução das vias aéreas, pneumonia)

D. Alterações Fisiológicas da Função Respiratória Associadas ao Enve-


lhecimento (Tab. 11.2). Apesar dessas alterações, o sistema respiratório
consegue manter a troca gasosa adequada em repouso e durante os es-
forços ao longo de toda a vida, com reduções apenas modestas da PaO2
e nenhuma variação da PaCO2.

III. CONTROLE DA VENTILAÇÃO. Os mecanismos que controlam a venti-


lação são complexos e dependem da integração de vários componentes do
sistema nervoso central e periférico (Fig. 11.1).
A. Terminologia. Os termos respiração (ato de inspirar e expirar), ven-
tilação (movimento dos gases para dentro e para fora dos pulmões) e
respiração celular (ocorre quando a energia é liberada por moléculas
orgânicas) são utilizados como sinônimos. A respiração requer utili-
zação de energia para sustentar o trabalho muscular. Quando ocorre
espontaneamente, a ventilação requer energia para manter o trabalho
muscular e, por essa razão, é o mesmo que respiração.
B. Desenvolvimento do Padrão Ventilatório (Tab. 11.3)
1. O bulbo contém os centros de controle ventilatório mais básicos
do cérebro.
Anatomia e Fisiologia

2. Os centros da ponte processam informações originadas do bulbo.


3. O sistema ativador reticular do mesencéfalo aumenta a frequência
e a amplitude da ventilação.
4. O córtex cerebral pode afetar o padrão respiratório.
C. Controle Reflexo da Ventilação
1. Os reflexos que afetam diretamente o padrão ventilatório (degluti-
ção, tosse e vômito) em geral têm como finalidade evitar a obstru-
ção das vias aéreas.

Barash_III.indd 115 22/08/14 11:56


116 Barash, Cullen, Stoelting, Cahalan, Stock, Ortega

Centros superiores
do SNC

Centro
pneumotáxico

Ponte

Centro apnêustico

Tronco
encefálico
Quimiorreceptores centrais
Centro inspiratório
pH, pCo2
Bulbo

Quimiorreceptores periféricos
Centro expiratório
pO2 (pH, pCo2)

Neurônios motores
Medula espinal Músculos da respiração
respiratórios

Nervo vago

Receptores de
estiramento pulmonar
de Hering-Breuer

FIGURA 11.1 Diagrama ilustrando os centros respiratórios do sistema nervoso cen-


tral (SNC), os circuitos de feedback neural, os estímulos sensoriais neuro-humorais
primários e os estímulos de ativação mecânica.

TABELA 11.3 Definições dos termos respiratórios


Termo Definição
Eupneia Movimentos inspiratórios e expiratórios contínuos
e sem interrupções
Apneia Cessação do esforço ventilatório ao final da
expiração passiva
Apneuse Cessação do esforço ventilatório ao final da
inspiração
Respiração apnêustica Apneuse com espasmos expiratórios periódicos
Respiração de Biot Arquejos respiratórios intercalados por períodos
em apneia (respiração agônica)

Barash_III.indd 116 22/08/14 11:56


Manual de Anestesiologia Clínica 117

2. O reflexo de Hering-Breuer (apneia durante a distensão pulmonar


persistente) está presente de forma atenuada nos humanos.
D. Controle Químico da Ventilação
1. Os quimiorreceptores periféricos são os corpos carotídeos (os
efeitos ventilatórios caracterizam-se por aumentos da frequência
respiratória e do volume corrente) e os corpos aórticos (os efeitos
circulatórios evidenciam-se por bradicardia e hipertensão).
a. Os corpos carotídeos e aórticos são estimulados pela redução da
PaO2 (, 60 mm Hg), mas não pela saturação da hemoglobina
nem pela concentração arterial de O2 (anemia) ou pela PaCO2.
b. Os pacientes que dependem do drive ventilatório hipóxico têm
níveis de PaO2 em torno de 60 mm Hg.
c. Os anestésicos inalatórios potentes deprimem as respostas ven-
tilatórias à hipoxia porque deprimem a reação dos corpos caro-
tídeos à hipoxemia.
2. Quimiorreceptores Centrais
a. Cerca de 80% da resposta ventilatória ao CO2 inalado originam-
-se dos centros bulbares centrais.
b. As áreas quimiossensíveis dos centros ventilatórios bulbares são
extremamente sensíveis à concentração de íons hidrogênio do
líquido extracelular. (O CO2 define indiretamente essa concen-
tração porque reage com a água para formar ácido carbônico.)
c. A PaCO2 alta é um estímulo mais potente (aumenta a frequên-
cia respiratória e o volume corrente dentro de 60 a 120 s) para
a ventilação que a acidose metabólica. (O CO2 pode atravessar
facilmente a barreira hematencefálica, ao contrário dos íons hi-
drogênio.)
d. A normalização do pH do líquido cefalorraquidiano (transporte
ativo de íons bicarbonato) com o tempo resulta no declínio da
ventilação, apesar dos aumentos persistentes da PaCO2. A se-
quência inversa ocorre quando a subida rápida a uma altitude
elevada estimula inicialmente a ventilação, resultando na redu-
ção abrupta da PaCO2.
E. Suspensão da Respiração
1. Quando adultos despertos e pré-oxigenados com pulmões nor-
Anatomia e Fisiologia

mais prendem a respiração sem hiperventilação prévia, a taxa de


elevação da PaCO2 é de 7 mm Hg nos primeiros 10 segundos, 2
mm Hg nos próximos 10 segundos e 6 mm Hg a partir daí.
2. Nos pacientes anestesiados em apneia, a taxa de aumento da
PaCO2 é de 12 mm Hg durante o primeiro minuto e de 3,5 mm
Hg a cada minuto subsequente. Isso reflete a redução da taxa me-
tabólica e a produção de CO2 pelos indivíduos anestesiados, em
contraste com os indivíduos acordados.

Barash_III.indd 117 22/08/14 11:56


118 Barash, Cullen, Stoelting, Cahalan, Stock, Ortega

3. A hiperventilação raramente é seguida de um período de apneia


nos seres humanos acordados, apesar da PaCO2 reduzida. Por
outro lado, mesmo um período de hiperventilação leve durante a
anestesia geral causa apneia.
F. Aspectos Quantitativos do Controle Químico da Respiração (Fig.
11.2)
1. A curva de resposta ao CO2 é praticamente linear com níveis de
PaCO2 entre 20 e 80 mm Hg (. 100 mm Hg; o CO2 atua como
depressor respiratório).
2. A inclinação da curva de resposta ao CO2 é considerada represen-
tativa da sensibilidade ao CO2 (normalmente, 0,5 a 0,7 L/min/mm
Hg CO2).
3. O limiar apneico ocorre com uma PaCO2 de cerca de 32 mm Hg.
4. Várias condições desviam a posição ou alteram a inclinação da
curva de resposta ao CO2 (Tab. 11.4).

60 A B

50
V E (L/min)

40

30
·

20

10

0 10 20 30 40 50 60 70 80
PaCO2 (mm Hg)

FIGURA 11.2 Curvas de resposta ventilatória ao CO2. A curva A é produzida por


.
variações da ventilação-minuto (VE) e por determinações das alterações da PaCO2. A
curva B é a curva clássica de resposta ventilatória ao CO2, que é produzida por varia-
.
ções da PaCO2 e por determinações da VE resultante. A inclinação da curva define a
sensibilidade aos efeitos estimulantes ventilatórios do CO2. Os anestésicos voláteis e
os opioides desviam a curva para a direita e, por fim, reduzem sua inclinação (linhas
verde, vermelha e marrom).

Barash_III.indd 118 22/08/14 11:56


Manual de Anestesiologia Clínica 119

TABELA 11.4 Condições clínicas associadas às alterações da


resposta ventilatória ao dióxido de carbono
Desvio à Esquerda ou Inclinação Aumentada
Hiperventilação (aumento da ventilação-minuto acarretando redução da PaCO2 e
alcalose respiratória)
Hipoxemia arterial
Acidose metabólica
Causas centrais (fármacos [salicilatos], hipertensão intracraniana, cirrose, ansiedade)

Desvio à Direita ou Inclinação Reduzida


Sono fisiológico (a PaCO2 aumenta em até 10 mm Hg)
Alcalose metabólica
Desenervação dos quimiorreceptores periféricos
Opioides (reduzem a frequência respiratória e aumentam o volume corrente)
Anestésicos voláteis

IV. TRANSPORTE DE OXIGÊNIO E DIÓXIDO DE CARBONO


A. O movimento dos gases através da membrana alveolocapilar depende
da integridade dos sistemas cardíaco e pulmonar.
B. Fluxo Predominante dos Gases (Convecção)
1. A maior parte da resistência das vias aéreas ocorre nas vias aéreas
mais calibrosas (. 2 mm de diâmetro), onde as moléculas dos ga-
ses são transportadas mais rapidamente.
2. Durante a respiração normal e tranquila, o fluxo dos gases den-
tro das vias aéreas de convecção é praticamente laminar e, desse
modo, a resistência ao fluxo é menor.
C. Difusão dos Gases
1. São raros os distúrbios da difusão que causam hipoxemia arte-
rial. A razão mais comum de uma redução detectável da capa-
cidade de difusão é a desproporção entre ventilação e perfusão,
que funcionalmente acarreta redução da superfície disponível à
difusão.
2. A hipercapnia nunca é causada por distúrbios da difusão (o CO2 é
Anatomia e Fisiologia

20 vezes mais difusível que o O2).


D. Distribuição da Ventilação e da Perfusão
1. A eficiência com que a troca de O2 por CO2 é efetuada na mem-
brana alveolocapilar depende da correspondência entre perfusão
capilar e ventilação alveolar.
2. A distribuição do fluxo sanguíneo dentro dos pulmões depen-
de basicamente da gravidade, ou seja, depende da relação entre
pressão arterial pulmonar, pressão alveolar e pressão venosa pul-
monar (Fig. 11.3).

Barash_III.indd 119 22/08/14 11:56


120 Barash, Cullen, Stoelting, Cahalan, Stock, Ortega

Zona 1
1. Colapso PA Ppa Ppv
Ppa 5 PA
Alveolar Zona 2
Arterial Venoso Ppa PA Ppv
PA
Ppa Ppas

2. Cascata Distância
Ppv 5 PA

Zona 3
3. Distensão Ppa Ppv PA

FIGURA 11.3 Distribuição do fluxo sanguíneo no pulmão isolado. PA 5 pressão al-


veolar; Ppa 5 pressão arterial pulmonar; Ppv 5 pressão venosa pulmonar.

3. A distribuição da ventilação é dirigida preferencialmente para as


áreas mais pendentes do pulmão.
4. A proporção ideal entre ventilação e perfusão (V/Q 5 1) parece
ocorrer aproximadamente no nível da primeira costela. Acima
desse nível, a ventilação é ligeiramente maior que a perfusão; abai-
xo desse nível, a razão torna-se , 1 (Fig. 11.4).
a. A vasoconstrição pulmonar hipóxica reduz o fluxo sanguíneo
aos alvéolos não ventilados (hipóxicos) na tentativa de manter
uma razão V/Q proporcional.
b. Enquanto os aumentos da ventilação do espaço morto afetam
principalmente a eliminação de CO2 e têm pouco efeito na oxi-
genação arterial, o shunt fisiológico afeta essencialmente a oxi-
genação arterial com pouco efeito na eliminação de CO2.
E. Espaço Morto Fisiológico
1. O espaço morto anatômico (2 mL/kg) representa a maior parte
da ventilação do espaço morto e é atribuível à ventilação das es-
truturas que não participam da oxigenação (oronasofaringe até os
bronquíolos respiratórios e terminais). As condições clínicas que
modificam o espaço morto anatômico são intubação traqueal, tra-
queostomia e distâncias longas dos tubos ventilatórios entre o tubo
traqueal e a peça Y do respirador.
2. O espaço morto alveolar é atribuído à ventilação dos alvéolos
quando há pouca ou nenhuma perfusão.
3. Os aumentos do espaço morto fisiológico são causados mais
comumente por ampliações do espaço morto alveolar (redução
do débito cardíaco que pode ocorrer quando há diminuição do
retorno venoso após início de ventilação pulmonar com pressão
positiva, com a embolia pulmonar e com a DPOC). A redução do

Barash_III.indd 120 22/08/14 11:56


Manual de Anestesiologia Clínica 121

Unidade de Unidade Unidade de


shunt absoluto normal espaço morto absoluto

Efeito do
Efeito do shunt espaço morto

Valv Valv Valv


· 0 · >1 ·
Q cap Q cap Q cap

Resposta
Resposta
vaso-hipóxica bronquiolar-constritiva
pulmonar Unidade pulmonar
“silenciosa”

Valv
· Indefinida
Q cap
FIGURA 11.4 Continuum das relações entre ventilação e perfusão. A troca gasosa
tem eficiência máxima nas unidades pulmonares normais e eficiência apenas parcial
nas unidades do shunt fisiológico e do espaço morto. A troca gasosa não ocorre em
absoluto nas unidades “silenciosas”, nas unidades com shunt absoluto e nas unida-
des do espaço morto.

fluxo sanguíneo pulmonar associada à embolia pulmonar é causa-


Anatomia e Fisiologia

da mais comumente por broncoconstrição reflexa, em comparação


com a obstrução mecânica da circulação pulmonar.
4. Avaliação do Espaço Morto Fisiológico. A comparação da ven-
tilação por minuto e da PaCO2 permite uma avaliação qualitativa
grosseira da ventilação do espaço morto fisiológico. A diferença
entre o CO2 corrente final (PETCO2) e a PaCO2 é atribuível à venti-
lação do espaço morto.
F. Shunt Fisiológico. Shunt fisiológico é a parte do débito cardíaco que
retorna ao coração esquerdo sem ser exposta aos alvéolos ventilados.
(O shunt absoluto e a oxigenação não podem ser aumentados com a
administração de O2 suplementar.)

Barash_III.indd 121 22/08/14 11:56


122 Barash, Cullen, Stoelting, Cahalan, Stock, Ortega

1. O shunt anatômico origina-se do retorno venoso das veias pleu-


rais, bronquiolares e thebesianas (2 a 5% do débito cardíaco).
2. Os shunts anatômicos de amplitude mais acentuada geralmente
estão associados às cardiopatias congênitas.
3. O efeito de shunt (mistura venosa) ocorre nas áreas em que a
ventilação alveolar é deficiente em comparação com a perfusão. A
oxigenação melhora com a administração de O2 suplementar. En-
tre as doenças que tendem a produzir mistura venosa estão edema
pulmonar leve, atelectasia pós-operatória e DPOC.
G. Avaliação da Oxigenação Arterial e do Shunt Fisiológico. A avaliação
mais simples da oxigenação é a comparação qualitativa da concentra-
ção de O2 inspirado pelo paciente e a PaO2 resultante (a mistura venosa
amplifica o efeito de um shunt pequeno).
H. O cálculo do shunt fisiológico inclui a contribuição do sangue venoso
misto, que pode estar extremamente insaturado nos pacientes em esta-
do crítico, em consequência do débito cardíaco reduzido, da anemia,
da hipoxemia arterial e dos aumentos das demandas metabólicas de O2.
Esse cálculo é a melhor estimativa da eficiência com que os pulmões
podem oxigenar o sangue arterial.

V. PROVAS DE FUNÇÃO PULMONAR (Tab. 11.5 e Fig. 11.5)


A. Volumes e Capacidades Pulmonares (Fig. 11.6)
B. Curvas de Fluxo-Volume. As técnicas de imagem (ressonância
magnética) fornecem informações mais úteis e precisas na investiga-
ção diagnóstica das obstruções das vias aéreas superiores e extrato-
rácicas e substituíram a utilização das curvas de fluxo-volume.
C. Capacidade de Difusão do Monóxido de Carbono
1. Enquanto a baixa concentração de hemoglobina reduz a capaci-
dade de difusão do monóxido de carbono (DLCO), o aumento da
PACO2 eleva a DLCO.
2. A DLCO é reduzida pela fibrose alveolar associada aos efeitos tóxi-
cos do O2 e pelo edema pulmonar.
D. Avaliação Pulmonar Pré-Operatória (Tab. 11.6)
1. As determinações específicas da função pulmonar não preveem
complicações pós-operatórias.
2. História de tabagismo (. 40 maços-ano), DPOC, asma, tosse e
intolerância aos esforços (menos de um lance de escadas) são mais
sugestivas de complicações pós-operatórias.
3. Os dados da função pulmonar basal são reservados para os pa-
cientes com função pulmonar pré-operatória gravemente compro-
metida (indivíduos com tetraplegia ou miastenia), de forma que
a avaliação do “desmame” da ventilação mecânica ou a extubação
traqueal possa ser orientada pelos valores pré-operatórios.

Barash_III.indd 122 22/08/14 11:56


Manual de Anestesiologia Clínica 123

TABELA 11.5 Provas de função pulmonar com doenças pulmonares


obstrutivas e restritivas
Determinação Doença Restritiva Doença Obstrutiva
CVF Reduzida Normal ou ligeiramente reduzida
VEF1 Reduzido Normal ou ligeiramente reduzido
VEF1/CVF Normal Reduzida
FEF25%-75% Normal Reduzido
CRF Reduzida Normal ou ligeiramente aumentada
CPT Reduzida Normal ou ligeiramente aumentada
CVF 5 capacidade vital forçada; VEF1 5 volume expiratório forçado em 1 segundo; FEF25%-75% 5
fluxo expiratório forçado entre 25% e 75% do volume expiratório total; CRF 5 capacidade residual
funcional; CPT 5 capacidade pulmonar total.

4. A gasometria arterial não está indicada, a menos que a história


do paciente indique hipoxemia ou retenção de CO2 (para iden-
tificar doença reversível ou definir a gravidade em condições
basais).

3 75% da CVF
Volume expirado (L)

2 FEF25%–75% 5 1,45 L/s

1 25% da CVF
Anatomia e Fisiologia

0
0 1 2 3 4
Tempo (s)
FIGURA 11.5 Este espirograma ilustra um paciente com capacidade vital forçada
(CVF) de 4 L no qual estão assinalados os pontos representativos das frações de 25%
e 75% da CVF. A inclinação da linha que interliga os pontos é o fluxo expiratório
forçado (FEF25%-75%).

Barash_III.indd 123 22/08/14 11:56


124 Barash, Cullen, Stoelting, Cahalan, Stock, Ortega

CPT CI CV VRI

VC

CRF VRE

VR VR

FIGURA 11.6 Volumes e capacidades pulmonares. A barra mais escura representa


os quatro volumes pulmonares básicos, que se somam e resultam na capacidade pul-
monar total (CPT). CI 5 capacidade inspiratória; CRF 5 capacidade residual funcional;
CV 5 capacidade vital; VC 5 volume corrente; VR 5 volume residual; VRE 5 volume
de reserva expiratória; VRI 5 volume de reserva inspiratória.

5. As determinações da PaO2 e da PaCO2 basais são importantes


quando se espera que um paciente com DPOC grave necessitará
de ventilação artificial no período pós-operatório (Tab. 11.7).

VI. ANESTESIA E DOENÇA PULMONAR OBSTRUTIVA


A. Os pacientes com doença pulmonar obstrutiva grave têm riscos mais
altos de complicações intraoperatórias (broncoconstrição durante a la-
ringoscopia e a intubação traqueal) e pós-operatórias.
1. Os pacientes portadores de asma e DPOC podem ser beneficiados
com o tratamento broncodilatador pré-operatório.
2. A ventilação controlada dos pulmões a , 10 respirações por minu-
to deve evitar hipercapnia, reduzir a desproporção V/Q e permitir
tempo para a expiração.
3. O volume corrente e as taxas de fluxo inspiratório são ajustados
para manter a pressão de pico nas vias aéreas abaixo de 40 cm H2O.
B. A extubação traqueal logo que seja possível após o final da cirurgia é
desejável com o objetivo de reduzir o risco de infecção iatrogênica.

Barash_III.indd 124 22/08/14 11:56


Manual de Anestesiologia Clínica 125

TABELA 11.6 Avaliação pulmonar pré-operatória


Detectar Antecipadamente Disfunção Pulmonar em Condições e Pacientes
Específicos
Doença pulmonar crônica
História de tabagismo
Tosse ou sibilância persistente
Obesidade mórbida
Necessidade de anestesia unilateral ou ressecção pulmonar
Doença neuromuscular

A História Clínica Determina a Necessidade de Realizar Testes da Função


Respiratória (tolerância aos esforços)
Radiografias de tórax
Gasometria arterial
Espirometria de triagem (identificar os pacientes que podem ser beneficiados pelo
tratamento pré-operatório; obter dados basais antes da ressecção pulmonar)

VII. ANESTESIA E DOENÇA PULMONAR RESTRITIVA


A. Esses pacientes em geral respiram rápida e superficialmente porque
mais pressão é necessária para expandir pulmões rígidos.
B. A pressão expiratória final positiva aumenta a capacidade residual fun-
cional e reverte a hipoxemia arterial.
1. Pressões de pico altas nas vias aéreas podem ser necessárias para
expandir os pulmões enrijecidos, mas os volumes correntes grandes
devem ser evitados porque podem causar barotrauma e volutrauma.

TABELA 11.7 Valores respiratórios para orientar o “desmame” do


respirador artificial ou a extubação traqueal
Parâmetro Valores Normais (Adulto de 70 kg)
Pressão de O2 alveolar 110 mm Hg (FIO2 de 0,21)
Anatomia e Fisiologia

Gradiente de O2 alveoloarterial , 10 mm Hg (FIO2)


Razão de O2 arterioalveolar . 0,75
Concentração de O2 arterial 20 mL/100 mL de sangue
Concentração de O2 venoso misto 15 mL/100 mL de sangue
Concentração de O2 arteriovenoso 4 a 6 mL/100 mL de sangue
Shunt intrapulmonar , 5%
Espaço morto fisiológico 0,33
Consumo de O2 250 mL/min
Transporte de O2 1.000 mL/min
Quociente respiratório 0,8

Barash_III.indd 125 22/08/14 11:56


126 Barash, Cullen, Stoelting, Cahalan, Stock, Ortega

2. A hipoxemia arterial pode desenvolver-se rapidamente (p. ex., du-


rante a apneia para intubação traqueal ou o transporte do centro
cirúrgico), refletindo as reservas exíguas de O2 nos pulmões em
consequência da capacidade residual funcional reduzida.
3. A anestesia geral reduz ainda mais a capacidade residual funcio-
nal, e essa redução persiste no período pós-operatório (tal altera-
ção pode ser superada com pressão positiva nas vias aéreas).
C. O aspecto mais importante do cuidado respiratório pós-operatório é
conseguir que o paciente saia do leito, de preferência que ande.

VIII. EFEITOS DO TABAGISMO NA FUNÇÃO PULMONAR (Tab. 11.8)


A. A cessação do tabagismo 12 a 24 horas antes é suficiente para reduzir os
níveis de carboxiemoglobina até níveis praticamente normais, mas não
afeta de maneira previsível a incidência de complicações pulmonares
pós-operatórias.
1. A normalização da função mucociliar requer duas a três semanas
de abstinência do tabagismo e, durante esse período, o volume de
escarro aumenta.
2. Os fumantes que reduzem o consumo de cigarros, mas não pa-
ram de fumar (alteram o método de inalação da fumaça), con-
tinuam a receber a mesma quantidade de nicotina, e não é pro-
vável que as complicações pulmonares pós-operatórias sejam
alteradas.
B. Os pacientes que fumam devem ser instruídos a parar de fumar dois
meses antes de cirurgias eletivas de forma a maximizar o efeito da abs-
tinência do fumo, ou no mínimo quatro semanas antes para obter al-
gum benefício advindo da melhora da função mucociliar.
C. O tabagismo é um dos principais fatores de risco associados a morbida-
de pós-operatória (pneumonia).

IX. FUNÇÃO PULMONAR PÓS-OPERATÓRIA


A. Função Pulmonar Pós-Operatória
1. As alterações da função respiratória que ocorrem após procedi-
mentos cirúrgicos são predominantemente restritivas (evidencia-
das por redução da capacidade residual funcional).
2. Isoladamente, o local da incisão cirúrgica é o determinante mais
importante da restrição pulmonar e das complicações respiratórias
pós-operatórias (Tab. 11.9).
B. Complicações Pulmonares Pós-Operatórias
1. Atelectasia e pneumonia, evidenciadas por alterações da cor e da
quantidade de escarro, temperatura oral acima de 38ºC e infiltra-
dos recentes evidenciados nas radiografias do tórax, são as duas
complicações pós-operatórias mais comuns.

Barash_III.indd 126 22/08/14 11:56


Manual de Anestesiologia Clínica 127

TABELA 11.8 Efeitos do tabagismo


Redução da motilidade ciliar
Aumento da produção de escarro
Aumento da reatividade das vias aéreas
Desenvolvimento de doença pulmonar obstrutiva
Desproporção entre ventilação e perfusão (mistura venosa e hipoxemia arterial)
Retenção de ar
Aumento da ventilação-minuto
Deformidade do tórax em barril
Redução da complacência pulmonar (o paciente precisa expirar vigorosamente para
evitar retenção de ar)
Aumento da concentração de carboxiemoglobina (normal , 1%; pode variar de 8 a
10% entre os fumantes)

2. O risco de complicações pulmonares pós-operatórias pode ser


reduzido com a erradicação rigorosa das infecções pulmonares
ativas e o uso de broncodilatadores em doses terapêuticas quando
a hiper-reatividade das vias aéreas está associada ao aumento da
resistência ao fluxo de ar.
3. As medidas para reduzir o risco de complicações pós-operatórias
são realizar exercícios de expansão pulmonar, escolher um método
analgésico eficaz e parar de fumar.
a. Incentivar a movimentação (caminhada) é tão eficaz quanto a
espirometria de esforço.
b. Após esternotomia mediana, a capacidade residual funcional
não volta ao normal senão algumas semanas depois, indepen-
dentemente do tratamento pulmonar pós-operatório.
c. O aspecto mais importante do cuidado pulmonar pós-opera-
tório é conseguir que o paciente saia do leito, de preferência
que ande.

TABELA 11.9 Relações entre local da cirurgia e reduções


Anatomia e Fisiologia

pós-operatórias da capacidade residual funcional


Redução da Capacidade Residual
Local da Cirurgia Funcional (%)
Cirurgia convencional do abdome superior 40 a 50*
Cirurgia do abdome inferior e do tórax 30
Cirurgia intracraniana 15 a 20
Cirurgia vascular periférica 15 a 20
*Com a utilização de técnicas analgésicas pós-operatórias convencionais.

Barash_III.indd 127 22/08/14 11:56


128 Barash, Cullen, Stoelting, Cahalan, Stock, Ortega

d. A analgesia pós-operatória influencia o risco de complicações


pulmonares pós-operatórias (a analgesia peridural, especial-
mente para cirurgias abdominais e torácicas, reduz o risco).

Barash_III.indd 128 22/08/14 11:56


CAPÍTULO

12
A Resposta Alérgica
As reações alérgicas que ocorrem durante a anestesia representam uma causa
importante de complicações perioperatórias (Levy JH. The allergic response.
Em: Barash PG, Cullen BF, Stoelting RK, Cahalan MK, Ortega R, Stock MC,
Eds. Clinical Anesthesia. Philadelphia: Lippincott Williams & Wilkins; 2013:
287-303). Os anestesiologistas tratam rotineiramente de pacientes no período
perioperatório, durante o qual ocorre exposição a inúmeras substâncias (fárma-
cos, incluindo anestésicos, antibióticos, bloqueadores neuromusculares, prota-
mina e hemocomponentes) e antígenos ambientais (látex).

I. PRINCÍPIOS BÁSICOS DE IMUNOLOGIA. Os sistemas de defesa do


organismo podem ser divididos em componentes celulares (linfócitos T) e
humorais (anticorpos, complemento e citocinas).
A. Antígenos são moléculas capazes de estimular uma reação imune (pro-
dução de anticorpos ou ativação dos linfócitos) (Tab. 12.1).
B. Linfócitos Derivados do Timo (Células T) e Linfócitos Derivados da
Bursa (Células B)
1. Os linfócitos derivados do timo (células T) têm receptores que
são ativados pela ligação com antígenos e, em seguida, secretam
mediadores que regulam a resposta imune (p. ex., a síndrome da
imunodeficiência adquirida é causada pela infecção dos linfócitos
T auxiliares por um retrovírus conhecido como vírus da imunode-
ficiência humana).
2. Os linfócitos derivados da bursa (células B) diferenciam-se em
plasmócitos que sintetizam anticorpos.
C. Anticorpos são proteínas específicas (imunoglobulinas) que conse-
guem reconhecer e ligar-se a um antígeno específico (ver Tab. 12.1).
Os anticorpos funcionam como moléculas receptoras específicas para
células e proteínas imunes.
D. Células Efetoras e Proteínas das Células Imunes (Tab. 12.2)
1. Monócitos, neutrófilos (leucócitos polimorfonucleares) e eosinófi-
los são células efetoras que migram para as áreas de inflamação em
resposta aos fatores quimiotáxicos.
2. Opsonização é a deposição de anticorpos ou fragmentos do com-
plemento nas superfícies das células estranhas, a qual facilita o
processo de eliminação pelas células efetoras.
E. Proteínas
1. Citocinas e Interleucinas
a. Citocinas (interleucina-1, fator de necrose tumoral) são ati-
vadores das células inflamatórias que são sintetizados pelos
macrófagos para atuar como segundos-mensageiros que ativam

Barash_III.indd 129 22/08/14 11:56


130 Barash, Cullen, Stoelting, Cahalan, Stock, Ortega

TABELA 12.1 Características biológicas das imunoglobulinas


IgG IgM IgA IgE IgD
Peso molecular 160.000 900.000 170.000 188.000 184.000
Concentração 6 a 14 0,5 a 1,5 1a3 , 0,5 3 103 , 0,1
sérica (mg/dL)
Ativação do Todas, exceto 1 – – –
complemento IgG4
Transferência 1 – – – –
placentária
Meia-vida sérica 23 5 6 1a5 2a8
(dias)
Ligação às Mastócitos, Linfócitos Mastócitos, Neutrófilos,
células neutrófilos, basófilos, linfócitos
linfócitos, linfócitos
células mo-
nonucleares,
plaquetas

as células endoteliais e os leucócitos (produzem uma reação in-


flamatória) (Tab. 12.3).
b. Os linfócitos T produzem interleucinas.
2. Complemento
a. A resposta humoral primária ao antígeno e ao anticorpo ligado
é a ativação do sistema complemento (cerca de 20 proteínas di-
ferentes que são ativadas pelas interações entre o antígeno e o
anticorpo, pela plasmina e pelas endotoxinas).
b. Um conjunto de inibidores regula o sistema complemento (p.
ex., o edema angioneurótico, que pode ser desencadeado por
um procedimento cirúrgico e evidencia-se por obstrução da
laringe, é causado pela deficiência de um inibidor de C1 do sis-
tema complemento).

TABELA 12.2 Células que participam da resposta imune


Macrófagos (fagocitam antígenos)
Leucócitos polimorfonucleares (neutrófilos; primeiras células a aparecer em uma
reação inflamatória aguda)
Eosinófilos (função desconhecida)
Basófilos (granulócitos do sangue; as superfícies das células contêm receptores de IgE)
Mastócitos (localizados nos espaços perivasculares da pele, dos pulmões e dos
intestinos; as superfícies das células contêm receptores de IgE)

Barash_III.indd 130 22/08/14 11:56


Manual de Anestesiologia Clínica 131

TABELA 12.3 Sinais e sintomas causados pela liberação de citocinas


Febre
Hipotensão
Depressão miocárdica
Catabolismo

F. Efeitos da Anestesia na Função Imune. A anestesia e intervenções ci-


rúrgicas deprimem a reatividade das células B e T, bem como os meca-
nismos de resistência inespecífica do organismo, inclusive a fagocitose.
Ainda não está claro qual é o significado (se existe algum) dessas altera-
ções. (É provável que tenham pouca importância, em comparação com
os aspectos hormonais da reação ao estresse.)

II. REAÇÕES DE HIPERSENSIBILIDADE (ALERGIA) (Tab. 12.4 e Fig. 12.1)


A. Reações Alérgicas Intraoperatórias
1. Mais de 90% das reações alérgicas provocadas por fármacos admi-
nistrados por via intravenosa ocorrem nos primeiros três minutos
após a infusão. (Algumas estimativas sugeriram que ocorram rea-
ções alérgicas uma vez a cada 5.000 a 25.000 anestésicos adminis-
trados.)
2. A única manifestação de uma reação alérgica intraoperatória pode
ser hipotensão refratária (Tab. 12.5 e Fig. 12.2).

III. REAÇÕES ANAFILÁTICAS


A. Fisiopatologia das Reações Mediadas por IgE. A ligação de um antí-
geno aos anticorpos da classe IgE, que indica exposição pregressa a esse
antígeno, desencadeia a anafilaxia. O antígeno liga-se e interliga-se a
dois anticorpos imunoespecíficos localizados nas superfícies dos mas-
tócitos e dos basófilos, resultando na liberação de histamina e outras
substâncias químicas.
B. Mediadores Químicos da Anafilaxia (Tab. 12.6)
C. Diagnóstico da Anafilaxia (ver Tab. 12.5)
Anatomia e Fisiologia

1. As manifestações clínicas e a evolução da anafilaxia variam signi-


ficativamente entre os diversos indivíduos. (O espectro varia de
uma reação com pouco significado clínico até a morte.)
2. O enigma da anafilaxia consiste na imprevisibilidade de sua ocor-
rência, na gravidade do episódio e na inexistência de história pre-
gressa de reação alérgica no paciente.
D. Liberação de Histamina Não Mediada por Mecanismos Imunes
1. Muitas moléculas diferentes administradas no período periopera-
tório liberam histamina por mecanismos não imunes dependentes
da dose (Tab. 12.7).

Barash_III.indd 131 22/08/14 11:56


132 Barash, Cullen, Stoelting, Cahalan, Stock, Ortega

TABELA 12.4 Classificação da hipersensibilidade


Reação do Tipo I: reação de hipersensibilidade do tipo imediato (anafilaxia) com
liberação de mediadores químicos (ver Tab. 12.6) pelos mastócitos e basófilos em
resposta à ligação dos anticorpos da classe IgE às superfícies dessas células.
Reação do Tipo II: mediada por anticorpos da classe IgG ou IgM dirigidos contra
antígenos localizados nas superfícies das células estranhas (p. ex., reações de
incompatibilidade ABO).
Reação do Tipo III: complexos antígeno-anticorpo formam complexos insolúveis que
se depositam na microcirculação (p. ex., pós-infecção estreptocócica).
Reação do Tipo IV: reação de hipersensibilidade tardia mediada pela imunidade
celular (p. ex., rejeição de tecidos, reação à tuberculina).

2. A liberação não imune de histamina difere da liberação mediada


por antígenos porque a histamina parece ser o único mediador li-
berado.
3. Quando são administrados nas doses recomendadas clinicamente,
os miorrelaxantes aminoesteroides (p. ex., rocurônio) produzem
efeitos mínimos na liberação de histamina.
4. O pré-tratamento com anti-histamínicos não inibe a liberação de
histamina, mas em vez disso compete com este mediador em seus
receptores e atenua os efeitos fisiológicos resultantes.
E. Plano de Tratamento. O plano de tratamento é o mesmo indicado para
reações anafiláticas potencialmente fatais e reações anafilactoides. To-
dos os pacientes que tiveram reações alérgicas potencialmente fatais

Mastócito
Liberação
de aminas
vasoativas

Receptor Fc

IgE

Antígeno

FIGURA 12.1 As reações de hipersensibilidade imediata (tipo I, ou anafilaxia) envol-


vem anticorpos da classe das imunoglobulinas E (IgE), que se ligam aos mastócitos ou
aos basófilos por seus receptores Fc. Quando encontra antígenos imunoespecíficos,
a IgE forma ligações cruzadas e induz a desgranulação, a ativação intracelular e a
liberação de mediadores químicos.

Barash_III.indd 132 22/08/14 11:56


Manual de Anestesiologia Clínica 133

TABELA 12.5 Diagnóstico da anafilaxia durante anestesias regional


e geral
Sistema Sintomas Sinais
Respiratório Dispneia Tosse
Sibilos
Espirros
Edema de laringe
Redução da complacência
pulmonar
Edema pulmonar fulminante
Insuficiência respiratória aguda
Cardiovascular Tontura Desorientação
Mal-estar Sudorese
Desconforto retroesternal Hipotensão
Taquicardia
Arritmias cardíacas
Redução da resistência
sistêmica
Hipertensão pulmonar
Parada cardíaca
Cutâneo Prurido Urticária
Ardência Ruborização
Formigamento Edema periorbitário
Edema perioral

Broncospasmo

Mastócito

IV
IM

Vasodilatação
Anatomia e Fisiologia

Antígeno Histamina
Leucotrienos e aumento da
Prostaglandinas permeabilidade capilar
Cininas
A B LEC-A C Urticária

FIGURA 12.2 Durante uma reação alérgica do tipo I, o antígeno entra em um pa-
ciente por meio da anestesia induzida por via parenteral (intravenosa [IV] ou intra-
muscular [IM]) (A). O antígeno interliga dois anticorpos da classe IgE na superfície dos
mastócitos ou dos basófilos e provoca a liberação dos seus grânulos (desgranulação)
(B). Os mediadores químicos liberados causam os sinais e sintomas clínicos típicos de
uma reação alérgica (C). LEC 5 líquido extracelular.

Barash_III.indd 133 22/08/14 11:56


134 Barash, Cullen, Stoelting, Cahalan, Stock, Ortega

TABELA 12.6 Mediadores químicos da anafilaxia


Histamina
Mediadores peptídicos
Fator quimiotáxico para eosinófilos
Fator quimiotáxico para neutrófilos
Metabólitos do ácido araquidônico (leucotrienos e prostaglandinas são sintetizados
após a ativação dos mastócitos a partir do metabolismo do ácido araquidônico dos
fosfolipídeos das membranas celulares)
Cininas
Fator de ativação das plaquetas
Triptase

devem ser hospitalizados para monitoração por 24 horas, porque as ma-


nifestações clínicas podem recidivar, mesmo após tratamento eficaz.
F. Tratamento Inicial (Tab. 12.8)
1. A epinefrina é o fármaco preferido para a reanimação dos pacien-
tes com reações alérgicas. (Os efeitos alfa-adrenérgicos revertem a
hipotensão, e a estimulação beta-adrenérgica causa broncodilata-
ção e inibe a liberação continuada de mediadores químicos.)
2. A gasometria arterial deve ser monitorada durante a fase de reani-
mação.
3. Até 40% do volume de líquidos intravasculares podem ser transfe-
ridos para o espaço intersticial durante uma reação alérgica.
G. Tratamento Secundário (ver Tab. 12.8)
1. Broncodilatadores. Os fármacos beta-adrenérgicos inalatórios,
inclusive albuterol e terbutalina em preparações inalatórias, estão
indicados quando o broncospasmo é uma manifestação clínica im-
portante. A inalação de ipratrópio pode ser especialmente útil ao
tratamento do broncospasmo.
2. Avaliação das Vias Aéreas. Quando há qualquer indício de edema
das vias aéreas superiores (p. ex., edema facial, inexistência de saída

TABELA 12.7 Fármacos que podem estimular a liberação não


imunológica de histamina
Antibióticos (vancomicina)
Compostos básicos (protamina)
Agentes hiperosmóticos
Miorrelaxantes
Opioides (morfina, meperidina, codeína)
Tiobarbitúricos

Barash_III.indd 134 22/08/14 11:56


Manual de Anestesiologia Clínica 135

TABELA 12.8 Tratamento da anafilaxia durante a anestesia geral


Tratamento Inicial
Interromper a administração do antígeno.
Manter as vias aéreas superiores e administrar oxigênio a 100%.
Interromper a administração de todos os anestésicos.
Iniciar expansão do volume intravascular (2 a 4 L de solução cristaloide ou coloide se
houver hipotensão).
Administrar epinefrina (5 a 10 mg IV se houver hipotensão e titular a dose conforme a
necessidade; 0,1 a 1,0 mg IV se houver colapso cardiovascular).

Tratamento Secundário
Anti-histamínicos (0,5 a 1,0 mg/kg de difenidramina IV)
Infusões de catecolaminas (doses iniciais: epinefrina, 4 a 8 mg/min; norepinefrina, 4 a
8 mg/min; isoproterenol, 0,5 a 1,0 mg/min em infusão contínua e com doses tituladas
com base nos efeitos obtidos)
Albuterol (4 a 8 puffs por inalador dosimetrado)
Corticoides (cortisol, 250 a 1.000 mg; metilprednisolona, 1 a 2 g, principalmente
quando há suspeita de ativação do complemento)
Bicarbonato
Avaliação das vias aéreas antes da extubação
Hipotensão refratária (vasopressina para tratar choque refratário por vasodilatação,
dose de 0,01 U/min)
IV 5 intravenosa.

de ar quando o balonete do tubo traqueal é esvaziado), a laringos-


copia direta deve ser realizada antes de retirar o tubo da traqueia.
3. Hipotensão Refratária. A vasopressina pode atenuar a vasodila-
tação refratária patológica. A monitoração (inclusive ecocardio-
gráfica) deve ser considerada para os pacientes com hipotensão
refratária, de forma a avaliar mais claramente a função cardíaca ou
a hipovolemia.

IV. TRATAMENTO PERIOPERATÓRIO DO PACIENTE ALÉRGICO. As


reações alérgicas aos fármacos representam 6 a 10% dos efeitos farmacoló-
Anatomia e Fisiologia

gicos adversos. Algumas estimativas sugerem que 5% dos adultos america-


nos tenham alergias a um ou mais fármacos.
A. Mecanismos Imunológicos da Alergia aos Fármacos
1. Existem relatos de que a maioria dos fármacos administrados aos
pacientes pelos anestesiologistas causa reações alérgicas (Tab. 12.9).
2. Os relaxantes musculares estão entre os fármacos que mais comu-
mente provocam reações alérgicas intraoperatórias. (A hipersensi-
bilidade cruzada ocorre entre succinilcolina e miorrelaxantes não
despolarizantes.)

Barash_III.indd 135 22/08/14 11:56


136 Barash, Cullen, Stoelting, Cahalan, Stock, Ortega

3. O colapso cardiovascular intraoperatório inexplicável tem sido


atribuído à anafilaxia desencadeada pelo látex (borracha natu-
ral). Os pacientes com espinha bífida têm incidência mais alta de
alergia ao látex. Os sinais e sintomas causados pela alergia ao látex
podem não ocorrer até que tenham decorrido vários minutos da
exposição e, por essa razão, podem ser atribuídos erroneamente a
outras causas.
4. As reações alérgicas potencialmente fatais são mais prováveis nos
pacientes com história de alergia, atopia ou asma. Como a incidência
de reações alérgicas é muito baixa, mesmo esse tipo de história não
requer avaliação mais detalhada ou pré-tratamento farmacológico.
B. Avaliação dos Pacientes com Reações Alérgicas. A identificação do
fármaco responsável por uma suposta reação alérgica depende de evi-
dências circunstanciais indicando a sequência temporal após sua admi-
nistração.
1. A exposição direta do paciente a uma dose de teste do fármaco
supostamente causador da alergia é potencialmente perigosa e não
recomendada.
2. Uma pequena dose-teste do fármaco administrado durante a anes-
tesia reflete mais precisamente uma dose-teste farmacológica, di-
ferentemente das doses imunogênicas.
3. A detecção de anticorpos específicos para o fármaco em geral é
aceita como evidência de que o paciente possa estar em risco de
anafilaxia se esse fármaco for administrado.

TABELA 12.9 Fármacos implicados nas reações alérgicas durante a


anestesia
Anestésicos
Fármacos para indução (etomidato, propofol)
Anestésicos locais (ésteres do ácido para-aminobenzoico)
Relaxantes musculares
Opioides (morfina, meperidina, fentanil)

Outros Fármacos
Antibióticos (cefalosporinas, penicilina, vancomicina)
Hemocomponentes (sangue total, concentrado de hemácias, plaquetas, plasma fresco
congelado, fibrinogênio, gamaglobulina)
Aprotinina
Metilmetacrilato
Protamina
Contrastes radiográficos
Látex (borracha natural)
Aditivos/conservantes contidos em fármacos
Material de enxertos vasculares
Coloides expansores de volume (dextranas, albumina, hidroxietilamido)

Barash_III.indd 136 22/08/14 11:56


Manual de Anestesiologia Clínica 137

C. Testes para Alergia


1. Após uma reação alérgica, é importante identificar o alérgeno de-
sencadeante de forma a evitar a administração subsequente. (Em
geral, os pacientes receberam simultaneamente vários fármacos
diferentes, com ou sem conservantes.)
2. Existem testes in vitro para investigar alergias aos anestésicos (Tab.
12.10).
D. Fármacos Implicados nas Reações Alérgicas. Qualquer substância
antigênica que o paciente tenha recebido por injeção, infusão ou expo-
sição ambiental pode causar reação alérgica.
1. Antibióticos. A maioria dos pacientes cirúrgicos recebe um anti-
biótico profilático, inclusive cefalosporina ou vancomicina.
2. Reações anafiláticas a cefalosporinas e vancomicina (um fármaco
potente como estímulo para liberação de histamina) são raras.
3. A maioria dos pacientes com história de alergia à penicilina tolera
as cefalosporinas.
E. Alergia ao Látex. Os profissionais de saúde e as crianças com espinha
bífida e malformações urogenitais estão mais sujeitos a ter alergia ao lá-
tex. Os pacientes alérgicos a bananas, abacates e kiwis também podem
ter reações cruzadas ao látex. É uma tarefa difícil criar um ambiente
livre de látex para pacientes sensibilizados. (Esses pacientes devem usar
um bracelete de alerta médico.)
F. Anestésicos Locais
1. Os testes cutâneos aos anestésicos locais são considerados um
estímulo direto (os anestésicos são injetados em condições con-
troladas). Esses testes determinam se um indivíduo pode receber
sem riscos derivados de amidas (lidocaína) e também podem ser
usados para decidir se um paciente é sensível aos ésteres do ácido
para-aminobenzoico (procaína, tetracaína).
2. Outros ingredientes das preparações de anestésicos locais foram
implicados como desencadeantes (conservantes, contaminantes de
látex nos frascos de injeção).

TABELA 12.10 Testes para alergia aos fármacos


Anatomia e Fisiologia

Liberação de histamina dos leucócitos (incubar os leucócitos do paciente com o


fármaco em questão e medir a liberação de histamina como marcador de ativação dos
basófilos)
Teste radioalergoabsorvente (RAST; antígenos disponíveis comercialmente [poucos
anestésicos estão disponíveis] são incubados com o plasma do paciente para detectar
anticorpos IgE específicos)
Ensaio imunoabsorvente ligado a enzima (ELISA; detecta anticorpos antígeno-
específicos; semelhante ao RAST)
Testes intradérmicos (a liberação de histamina pelos mastócitos causa vasodilatação
[rubor] e edema localizado)

Barash_III.indd 137 22/08/14 11:56


138 Barash, Cullen, Stoelting, Cahalan, Stock, Ortega

3. Os resultados positivos dos testes cutâneos com anestésicos locais


não são comuns, e tais testes têm valor preditivo positivo excelente.
G. Os bloqueadores neuromusculares têm composições moleculares que
os tornam alérgenos em potencial.
1. Os testes cutâneos são realizados comumente para confirmar que
os bloqueadores neuromusculares foram as causas de reações alér-
gicas. Existe a possibilidade de ocorrer sensibilidade cruzada entre
os relaxantes musculares, tendo em vista a semelhança entre seus
sítios ativos (molécula de amônio quaternário).
2. Um relaxante muscular alternativo não pode ser escolhido sem al-
gum tipo de teste imunológico.

V. RESUMO. Durante o período perioperatório, podem ocorrer diversas


reações alérgicas potencialmente fatais e imprevisíveis a qualquer fármaco.
Grau elevado de suspeita, detecção imediata e tratamentos apropriados e
rigorosos podem ajudar a evitar consequências desastrosas.

Barash_III.indd 138 22/08/14 11:56


CAPÍTULO

13
Inflamação, Cicatrização das
Feridas e Infecção
Apesar dos avanços significativos no manejo dos pacientes cirúrgicos (técnica
asséptica, antibióticos profiláticos) e dos progressos das abordagens cirúrgicas
(cirurgia laparoscópica), as infecções das feridas cirúrgicas e a deiscência de
anastomoses ainda são complicações pós-operatórias comuns (Hopf HW, Cha-
pman CR, Cochran A, Dorrough MB, Dull RO. Inflammation, wound healing
and infection. Em: Barash PG, Cullen BF, Stoelting RK, Cahalan MK, Ortega
R, Stock MC, Eds. Clinical Anesthesia. Philadelphia: Lippincott Williams & Wi-
lkins; 2013: 304-326). Além da técnica asséptica e dos antibióticos profiláticos, a
manutenção da perfusão e da oxigenação tecidual é fundamental.

I. CONTROLE DE INFECÇÃO
A. Higiene das Mãos (Tab. 13.1 e Fig. 13.1)
1. Talvez o componente mais crucial da prevenção de infecções seja a
higiene frequente e eficaz das mãos. (Em 1847, Ignaz Semmelweis
instituiu a prática de lavar as mãos entre os exames dos pacientes.)
2. Apesar do conhecimento teórico atual sobre a fisiopatologia da
infecção, a higiene das mãos ainda é um componente inexplicavel-
mente negligenciado do controle de infecção.
3. Mesmo as atividades ditas “limpas”, como aferir o pulso do pa-
ciente ou aplicar monitores, podem resultar na contaminação das
mãos.
4. Existem alguns produtos disponíveis para a higiene das mãos. O
composto ideal destrói um espectro amplo de micróbios, tem ati-
vidade antibacteriana persistente por no mínimo 6 horas após a
aplicação, é simples de usar e causa poucos efeitos colaterais.
a. Em geral, sabão comum (sem antisséptico) e água são as medi-
das menos eficazes para reduzir a contaminação das mãos. En-
tretanto, sabão e água são os mais eficazes para remover esporos
(Clostridium difficile ou Bacillus anthracis).
b. Os antissépticos que contêm etanol entre 60 e 95% em solução
aquosa são germicidas e eficazes contra bactérias gram-positi-
vas e gram-negativas e vírus lipofílicos (herpes simples, vírus da
imunodeficiência humana, influenza, vírus sincicial respirató-
rio, vacínia e vírus das hepatites B e C).
c. A clorexidina é uma bisbiguanida catiônica com atividade ger-
micida contra bactérias gram-positivas e vírus lipofílicos. A
clorexidina persiste por tempo significativo na pele, sendo re-
conhecidamente o agente tópico preferido para preparação da
pele antes da colocação de cateter venoso central. A clorexidina

Barash_III.indd 139 22/08/14 11:56


140 Barash, Cullen, Stoelting, Cahalan, Stock, Ortega

TABELA 13.1 Técnica de higiene das mãos


Descontaminação das mãos por fricção com álcool gel:
Aplicar o volume recomendado do produto na palma de uma das mãos. Esfregar as
mãos uma na outra, cobrindo todas as superfícies das mãos e dos dedos, até que
estejam secos.

Quando lavar as mãos com água e sabão:


Molhar primeiramente as mãos com água.
Aplicar nas mãos o produto na quantidade recomendada pelo fabricante.
Esfregar vigorosamente as mãos uma na outra por no mínimo 15 segundos, cobrindo
todas as superfícies das mãos e dos dedos.
Enxaguar as mãos com água e secar cuidadosamente com uma toalha descartável.
Utilizar a toalha para fechar a torneira.
Evitar o uso de água quente, porque a exposição repetida pode aumentar o risco de
dermatite.

As preparações de sabão comum sem atividade antimicrobiana podem ser em


líquido, barra ou pó.
Quando for usado sabão em barra, devem ser utilizadas saboneteiras que facilitem a
drenagem e barras pequenas.

pode causar lesão grave da córnea após contato direto com os


olhos, ototoxicidade após contato direto com a orelha média ou
interna, e neurotoxicidade após contato direto com o cérebro ou
as meninges.
d. O iodo e os iodóforos (iodo com um carreador de polímero) são
bactericidas contra bactérias gram-positivas, gram-negativas
e algumas bactérias formadoras de esporos. As alergias a essa
classe de agente tópico são comuns.
e. A contaminação bacteriana da área de trabalho do anestesista
(válvula limitadora de pressão, fluxômetros) pode causar con-
taminação cruzada de partes estéreis como as dânulas (evitável
em grande parte pelo aumento da frequência com que se realiza
a higiene das mãos).
f. O uso de luvas não reduz a necessidade de higienizar as mãos. A
higiene das mãos deve ser realizada antes de se colocar as luvas
e logo depois de retirá-las. O uso de luvas duplas foi recomenda-
do por alguns autores.
5. O uso de anéis não aumenta as contagens bacterianas globais isola-
das das mãos dos profissionais de saúde. Por essa razão, ainda não
está claro se a transmissão de infecções poderia ser reduzida com a
proibição de que os profissionais de saúde usem anéis.
B. Antissepsia
1. As máscaras têm sido recomendadas há muito tempo para evitar
infecção do campo cirúrgico; contudo, dados sugerem que o uso

Barash_III.indd 140 22/08/14 11:56


Manual de Anestesiologia Clínica 141

Seus 5 momentos para


HIGIENE DAS MÃOS
ANTES DE
REALIZAR UM
PROCEDIMENTO
ASSÉPTICO

ANTES DE APÓS
ENTRAR EM CONTATO COM
CONTATO COM O PACIENTE
O PACIENTE

QUANDO HÁ RISCO
DE EXPOSIÇÃO AOS
LÍQUIDOS CORPORAIS

APÓS
CONTATO COM O
AMBIENTE NO QUAL
O PACIENTE ESTÁ

ANTES DE ENTRAR QUANDO? Lave suas mãos antes de tocar no paciente quando se aproximar dele.
EM CONTATO COM
POR QUÊ? Para proteger o paciente contra germes perigosos transportados em suas mãos.
O PACIENTE

ANTES DE REALIZAR QUANDO? Lave suas mãos imediatamente antes de realizar qualquer procedimento asséptico.
UM PROCEDIMENTO POR QUÊ? Para proteger o paciente contra germes perigosos, inclusive os do seu próprio
ASSÉPTICO corpo, de forma a impedir que entrem no corpo dele.

QUANDO? Lave suas mãos imediatamente quando há risco de exposição aos líquidos
QUANDO HÁ RISCO DE
corporais (e depois de retirar as luvas).
EXPOSIÇÃO AOS
POR QUÊ? Para proteger a si próprio e o ambiente de cuidado da saúde contra germes
LÍQUIDOS CORPORAIS perigosos do paciente.
QUANDO? Lave suas mãos depois de tocar no paciente e no ambiente no qual ele
está, depois de sair.
APÓS CONTATO COM
O PACIENTE POR QUÊ? Para proteger a si próprio e o ambiente de cuidado da saúde contra germes
perigosos do paciente.
QUANDO? Lave suas mãos depois de tocar em qualquer objeto ou móvel no ambiente no
APÓS CONTATO COM qual o paciente está, depois de sair.
O AMBIENTE NO QUAL
POR QUÊ? Para proteger a si próprio e o ambiente de cuidado da saúde contra germes
O PACIENTE ESTÁ perigosos do paciente.
Anatomia e Fisiologia

FIGURA 13.1 Ilustração esquemática dos “5 momentos” para higiene das mãos, de
acordo com a Organização Mundial de Saúde.

de uma touca de cabeça seja útil para evitar infecção do campo


cirúrgico, mas não o uso de máscara.
2. As máscaras têm como propósito proteger o profissional de saú-
de, sobretudo quando são combinadas com proteção ocular e, por
essa razão, certamente devem ser utilizadas durante a intubação

Barash_III.indd 141 22/08/14 11:56


142 Barash, Cullen, Stoelting, Cahalan, Stock, Ortega

traqueal e outras ocasiões em que se necessita de proteção contra


exposição aos líquidos corporais.
3. A maioria das infecções cirúrgicas pós-operatórias é causada pela
flora endógena do paciente; os contaminantes ambientais e transpor-
tados pelo ar também podem ter um papel etiológico importante.
4. Uma consideração essencial, embora frequentemente negligencia-
da, é o papel que os padrões de tráfego no centro cirúrgico podem
desempenhar na exposição dos pacientes aos microrganismos
veiculados pelo ar. As práticas recomendadas hoje em dia são que
os padrões de tráfego devam limitar o acesso de pessoas ao cen-
tro cirúrgico em uso e que, durante o procedimento realizado no
centro cirúrgico, deve estar presente o menor número possível de
profissionais.
5. O uso de avental, luvas, técnica asséptica e campo estéril amplo deve
ser rotineiro durante a colocação de cateteres venosos centrais.
6. A formação de abscesso peridural é extremamente rara, mas pode
ser uma complicação catastrófica da anestesia neuroaxial e da co-
locação de cateteres peridurais. A consideração mais importante é
evitar contaminação da agulha e do cateter.
a. Higiene das mãos, preparação da pele, utilização de campo esté-
ril e manutenção da assepsia são medidas importantes.
b. Entretanto, é improvável que o uso de avental e máscara reduza
o risco de infecção.
c. O uso de cateteres peridurais provavelmente deve ser evitado
nos pacientes com bacteriemia suspeita ou comprovada, ou sua
colocação deve ser postergada até que tenham sido administra-
dos antibióticos apropriados.
C. Profilaxia Antibiótica (Tabs. 13.2 e 13.3)
1. A profilaxia antibiótica é uma prática padronizada antes de proce-
dimentos cirúrgicos em que o risco de infecção é mais que mínimo.
2. As recomendações publicadas em 2004 pelo National Surgical In-
fection Prevention Project enfatizam a ocasião da administração e
a escolha dos fármacos apropriados.
a. O fármaco escolhido para profilaxia antibiótica deve cobrir o
espectro de bactérias mais provavelmente encontrado no campo
cirúrgico.
b. O antibiótico mais utilizado em profilaxia cirúrgica é cefazolina,
uma cefalosporina de primeira geração, porque os patógenos
potenciais da grande maioria dos procedimentos cirúrgicos são
cocos gram-positivos da pele.
3. O momento exato de administração do antibiótico depende da
farmacologia e da meia-vida do fármaco. Em condições ideais, a
administração do antibiótico profilático deve ocorrer dentro de
30 minutos a uma hora antes da incisão. Em geral, considera-se
aceitável quando a infusão é iniciada antes da incisão. Quando se

Barash_III.indd 142 22/08/14 11:56


TABELA 13.2 Antibióticos recomendados antes de procedimentos comuns

Barash_III.indd 143
Antibiótico Alternativo (quando o
Procedimento Antibiótico Principal principal está contraindicado)
Procedimentos ortopédicos em geral Cefazolina Clindamicina
Artroplastias
Cirurgias da coluna vertebral
Cirurgia cardiotorácica
Neurocirurgia
Cirurgia vascular
Transplante de rim
Cirurgia plástica
Cirurgia cardiotorácica Cefazolina Cefuroxima
ou
Clindamicina
Cirurgia colorretal Cefoxitina Ciprofloxacino e metronidazol
Cirurgia ginecológica Cefazolina Clindamicina e gentamicina
Histerectomia abdominal ou
1
Ciprofloxacino e metronidazol
Cirurgia gástrica e biliar convencional – risco baixo Cefazolina Clindamicina
Cirurgia gástrica e biliar convencional – risco alto Cefoxitina Clindamicina e gentamicina
Colocação de stent biliar ou outro corpo estranho ou
Clindamicina e ciprofloxacino
Manual de Anestesiologia Clínica

Cirurgia de cabeça e pescoço – risco baixo Cefazolina Clindamicina e gentamicina


(Continua)
143

Anatomia e Fisiologia

22/08/14 11:56
144

Barash_III.indd 144
TABELA 13.2 Antibióticos recomendados antes de procedimentos comuns (Continuação)
Antibiótico Alternativo (quando o
Procedimento Antibiótico Principal principal está contraindicado)
Cirurgia de cabeça e pescoço – risco alto Clindamicina Clindamicina e gentamicina
Envolvimento da cavidade oral ou
Ertapenem
Cirurgia geniturinária – risco baixo Cefazolina Clindamicina
Cirurgia geniturinária – risco alto Ciprofloxacino
LEC com urina não estéril
Colocação de implante ou outro corpo estranho
Procedimentos eletivos de risco baixo sem implantes Cefazolina ou Clindamicina ou
• Colecistectomia laparoscópica Nenhum antibiótico Nenhum antibiótico
Barash, Cullen, Stoelting, Cahalan, Stock, Ortega

• Biópsia de mama
• Reparo de hérnia inguinal
• Cirurgia anorretal
• LEC com urina estéril
• Tireoidectomia

22/08/14 11:56
Quando antibióticos em doses terapêuticas já foram administrados no Manter os antibióticos iniciados

Barash_III.indd 145
SE (apendicite, colecistite aguda) no SE. Recalcular a dose
utilizando as diretrizes para
ajuste intraoperatório da dose do
antibiótico usado.
1. Note que o ciprofloxacino é infundido em uma hora. Em condições ideais, a infusão deve estar concluída antes da incisão.
NOTA:
• Sempre confirme com os cirurgiões na hora da saída ou antes.
• O cirurgião pode querer postergar a administração dos antibióticos até coletar amostras para cultura.
• Os antibióticos podem não estar indicados (risco baixo, procedimentos eletivos como colecistectomia laparoscópica ou biópsia de mama quando não serão colocados
implantes).
• Assegure-se de registrar no prontuário a razão pela qual os antibióticos não foram administrados.
• Em condições ideais, a infusão do antibiótico deve estar concluída antes da incisão, mas as diretrizes do CMS consideram adequada a possibilidade de iniciar a infusão antes da
incisão. Quando é possível, com fármacos que requerem infusão lenta (mais de 30 min), a infusão deve ser iniciada antes da cirurgia.
• Quando se usa torniquete, a dose precisa ser concluída no mínimo cinco minutos antes que o torniquete seja insuflado.
• Doses intraoperatórias adicionais devem ser administradas quando há sangramento significativo (cerca de metade a um volume de sangue). Use a segunda dose recomendada
para essa finalidade.
• Quando os antibióticos são administrados em doses terapêuticas para tratar uma infecção presumida ou confirmada (p. ex., apendicite aguda), os antibióticos profiláticos não
são necessários. Cada caso deve ser avaliado individualmente: Quando o antibiótico foi administrado? Qual antibiótico foi usado? Em alguns casos, a cobertura antibiótica para a
flora cutânea pode ser adequada antes da incisão da pele, mas em geral a manutenção dos antibióticos usados terapeuticamente é suficiente.
LEC 5 litotripsia extracorpórea; SE 5 setor de emergência.
Manual de Anestesiologia Clínica
145

Anatomia e Fisiologia

22/08/14 11:56
TABELA 13.3 Fármacos e doses disponíveis rotineiramente para profilaxia antibiótica (os fármacos devem ser
146
administrados no centro cirúrgico por um anestesiologista)

Barash_III.indd 146
Intervalo se
Dose Inicial Dose Inicial Dose Repetida Creatinina Sérica
Fármaco (, 80 kg) ($ 80 kg) Tempo (Intervalo) .3
Cefazolina 1g 2g 0 a 60 min antes da incisão 1 g (4 h) 12 h
Cefoxitina 2g 2g 0 a 60 min antes da incisão 1 g a cada 3 h 12 h
Cefuroxima 1,5 g 1,5 g 0 a 60 min antes da incisão 1,5 g a cada 4 h Não repetir a dose
Não repetir a dose se
creatinina . 3
Clindamicina 600 mg 900 mg Infundir em 10 a 15 min 600 mg a cada 6 h 12 h
Gentamicina 1,5 mg/kg 1,5 mg/kg Infundir em 10 a 15 min 1 mg/kg a cada 6 h 12 h
Metronidazol 500 mg 500 mg Infundir em 30 min 500 mg a cada 6 h 12 h
Aztreonam 2g 2g Infundir em 30 min 1 g a cada 4 h 12 h
Ertapenem 1g 1g Infundir em 30 min A cada 24 h A cada 24 h
Repetir a dose dos antibióticos administrados terapeuticamente antes da cirurgia
Piperacilina-tazobactam 3,375 g 3,375 g Infundir em 30 min Repetir a dose antes 12 h
Barash, Cullen, Stoelting, Cahalan, Stock, Ortega

da incisão se a
dose mais recente
foi mais de 2 h
antes da incisão;
em seguida,
repetir a dose a
cada 4 h

22/08/14 11:56
Manual de Anestesiologia Clínica 147

utiliza torniquete, a infusão deve estar concluída antes da insufla-


ção do dispositivo.
a. A administração dos antibióticos não é complicada quando o
fármaco pode ser administrado em dose única (cefalosporinas)
ou em infusão de alguns minutos (clindamicina) e, desse modo,
alcança níveis teciduais dentro de alguns minutos.
b. Com os fármacos que precisam ser infundidos em uma hora
(p. ex., vancomicina*), a coordenação da administração é mais
complicada.
c. Dependendo de suas meias-vidas, os antibióticos devem ser repe-
tidos durante cirurgias longas ou com grandes perdas sanguíneas.
(A cefazolina normalmente é administrada a cada 8 h, mas a dose
deve ser repetida a cada 4 h durante o procedimento cirúrgico.)
d. Os antibióticos profiláticos devem ser interrompidos 24 horas
depois da cirurgia, porque o prolongamento do tempo de ad-
ministração dos antibióticos profiláticos não reduz o risco de
infecção, mas aumenta as chances de ocorrerem efeitos adversos
associados ao antibiótico.
4. O Staphylococcus aureus resistente à meticilina (SARM) é um
patógeno cada vez mais comum. A higiene das mãos é uma das
medidas mais eficazes para evitar o desenvolvimento do SARM
porque, quando utilizadas de maneira adequada, as preparações
de álcool em gel conseguem matar mais de 99,9% de todos os pató-
genos transitórios (inclusive SARM). Aparentemente, não há razão
para utilizar antibióticos eficazes contra SARM como profilaxia na
maioria das condições clínicas.
5. Os anestesiologistas devem trabalhar em conjunto com os cirur-
giões para seguir as diretrizes determinadas pela comissão de con-
trole de infecção hospitalar, de forma a tomarem a iniciativa de
administrar antibióticos profiláticos.

II. MECANISMOS DE REPARO DAS FERIDAS (Tab. 13.4)


A. Resposta Inicial à Lesão
1. Tradicionalmente, a cicatrização de feridas costuma ser descrita em
quatro fases diferentes: hemostasia, inflamação, proliferação e re-
Anatomia e Fisiologia

modelação. Cada fase é constituída de interações complexas entre as


células do organismo, contaminantes, citocinas e outros mediadores
químicos que, quando funcionam adequadamente, resultam na re-
paração da lesão. Esses processos são muito semelhantes entre as di-

* A vancomicina está indicada para pacientes transferidos de um serviço de enfermagem especial-


izada (SEE), prisão ou instituição de longa permanência para cirurgia cardíaca; veja protocolo. A
vancomicina está indicada para pacientes transferidos de um SEE, prisão ou instituição de longa
permanência, ou que foram hospitalizados nos últimos seis meses para artroplastia; veja protocolo
(http://intranet.uuhsc.utah.edu/orders/categories/Orthopaedics/Pre-Op%20Orders%20For%20
Total%20Joint%20Service.pdf).

Barash_III.indd 147 22/08/14 11:56


148 Barash, Cullen, Stoelting, Cahalan, Stock, Ortega

TABELA 13.4 Fatores que podem dificultar a cicatrização de feridas


Fornecimento de Oxigênio às Feridas (aspecto mais importante)
Fatores Sistêmicos
Comorbidades médicas
Nutrição
Ativação do sistema nervoso simpático
Idade

Fatores Ambientais Locais


Contagem bacteriana
Gravidade da inflamação
Teor de umidade
Pressão de oxigênio
Perfusão vascular

ferentes espécies, indicando a importância fundamental da resposta


inflamatória que dirige o processo de reparação tecidual e celular.
2. Nas feridas, a irrigação sanguínea local diminui simultaneamente
ao aumento das demandas metabólicas (os tecidos da ferida tor-
nam-se hipóxicos e acidóticos). A hipoxia atua como estímulo à
reparação, mas também resulta em cicatrização inadequada e au-
mento da suscetibilidade às infecções.
B. Resistência à Infecção
1. Após violação da barreira cutânea normal, a cicatrização eficaz da
ferida depende da capacidade de eliminar corpos estranhos e re-
sistir à infecção. Os neutrófilos conferem imunidade inespecífica e
evitam infecção. Quando não há infecção, os neutrófilos desapare-
cem cerca de 48 horas depois da intervenção cirúrgica.
2. A resistência à infecção está profundamente reduzida quando há
hipoxia, e a cicatrização da ferida torna-se mais eficiente à medida
que a PO2 aumenta, mesmo a níveis muito altos (500 a 1.000 mm
Hg, como ocorre com a oxigenação hiperbárica).
C. Proliferação. A fase proliferativa (granulação e reepitelialização) nor-
malmente começa cerca de quatro dias após a lesão e coincide com a
regressão da fase inflamatória.
D. A neovascularização das feridas é atribuída à angiogênese (prolifera-
ção dos vasos sanguíneos por ramificação a partir dos vasos existentes)
e vasculogênese.
E. Deposição de Colágeno e Matriz Extracelular. Vasos sanguíneos
novos proliferam na matriz que é produzida pelos fibroblastos. A re-
sistência da ferida resulta da deposição de colágeno e é extremamente
sensível à hipoxia local.
F. A reepitelialização caracteriza-se pela replicação e pela migração das
células epiteliais através das bordas da pele em resposta aos fatores de

Barash_III.indd 148 22/08/14 11:56


Manual de Anestesiologia Clínica 149

crescimento. Alguns estudos recomendaram a aplicação tópica de oxi-


gênio por um método que não resseque as células epiteliais, como for-
ma de acelerar a taxa de reepitelialização.
G. Maturação e Remodelação
1. A última fase da reparação da ferida é a maturação, que consiste na
remodelação contínua dos tecidos de granulação e no aumento da
resistência elástica da ferida.
2. A contração é inibida pela administração de doses altas de corti-
coides (mesmo os corticoides administrados vários dias após a le-
são produzem tal efeito). Nas feridas com contração anormal, esse
efeito pode ser favorável.
3. Algumas feridas formam tecido cicatricial excessivo. A cicatriz
hipertrófica (mais comum após queimaduras) e os queloides são
formas comuns de tecido cicatricial anormal causado pelas respos-
tas alteradas à cicatrização. Os queloides provavelmente têm pre-
disposição genética.

III. PERFUSÃO E OXIGENAÇÃO DA FERIDA


A. As complicações das feridas são falha de cicatrização, infecção e retra-
ção fibrótica ou contratura excessiva.
B. Todos os procedimentos cirúrgicos causam algum grau de contamina-
ção, que precisa ser controlada pelas defesas locais do organismo. As
primeiras horas após a contaminação representam um período decisi-
vo, durante o qual as defesas locais ineficazes podem permitir o desen-
volvimento de infecções.
1. Normalmente, as feridas dos membros e do tronco cicatrizam mais
lentamente que as localizadas na face. A diferença principal entre
essas feridas é o grau de perfusão tecidual e, como consequência, a
pressão de oxigênio nos tecidos da ferida.
2. Os tecidos isquêmicos ou hipóxicos são altamente suscetíveis à in-
fecção e não cicatrizam de forma adequada, ou nem mesmo cica-
trizam. Um nível alto de PO2 é necessário para forçar o oxigênio a
entrar nos tecidos danificados em processo de cicatrização, princi-
palmente nos tecidos subcutâneos, fáscias, tendões e ossos (tecidos
mais sujeitos à cicatrização inadequada).
Anatomia e Fisiologia

a. Nos pacientes cirúrgicos, a taxa de infecção das feridas é inver-


samente proporcional, e a deposição de colágeno é diretamente
proporcional à pressão de oxigênio nos tecidos subcutâneos da
ferida após a cirurgia.
b. Pressões altas de oxigênio (. 100 mm Hg) podem ser alcança-
das nas feridas, mas apenas quando a perfusão é rápida e a PO2
arterial é alta. A capacidade de transportar oxigênio (concentra-
ção de hemoglobina) não é particularmente importante para a
cicatrização das feridas, contanto que a perfusão esteja normal.
c. A vasoconstrição periférica resultante da ativação simpática
central do tônus vascular subcutâneo provavelmente é o obstá-

Barash_III.indd 149 22/08/14 11:56


150 Barash, Cullen, Stoelting, Cahalan, Stock, Ortega

TABELA 13.5 Causas de vasoconstrição periférica mediada por


ativação simpática
Hipotermia (anestésicos, exposição ao frio, redistribuição do calor corporal do centro
para a periferia)
Dor
Medo
Déficit de volume sanguíneo
Fármacos
Nicotina
Antagonistas beta-adrenérgicos
Alfa1-agonistas

culo mais comum e clinicamente mais importante a determinar


a oxigenação da ferida (Tab. 13.5).
d. A prevenção ou a correção da hipotermia e dos déficits de vo-
lume sanguíneo reduz as infecções das feridas e aumenta a de-
posição de colágeno dos pacientes submetidos a procedimentos
cirúrgicos abdominais de grande porte.
e. O aquecimento local ou sistêmico (aquecedor de ar forçado)
pré-operatório reduz o índice de infecções das feridas.
3. A incidência de infecção do campo cirúrgico pode ser reduzida
quando as concentrações de oxigênio inspirado são . 50%. Os
níveis altos de oxigênio inspirado parecem ser uma intervenção
de baixo risco para reforçar as defesas do hospedeiro e reduzir a
incidência de infecção do campo cirúrgico.
4. A distribuição dos antibióticos aos tecidos também depende da
perfusão.

IV. ESTABILIZAÇÃO DO PACIENTE


A. Preparação Pré-Operatória (Tab. 13.6)
B. Cuidados Intraoperatórios (Tab. 13.7)
1. Uma técnica cirúrgica cuidadosa é fundamental à cicatrização
normal das feridas.
2. O manuseio delicado dos tecidos, a hemostasia rigorosa e a expe-
riência do cirurgião resultam em feridas mais saudáveis.
3. A prevenção da hipotermia (causada por anestésicos, vasoconstri-
ção, centros cirúrgicos gelados) por aquecimento de ar forçado (ou
tecnologia equivalente) e a manutenção da temperatura do centro
cirúrgico em um nível alto são medidas recomendáveis.
C. Reposição de Volume
1. O estresse cirúrgico aumenta as necessidades de líquidos intrave-
nosos.
2. As principais complicações associadas à hipervolemia são edema
pulmonar, insuficiência cardíaca congestiva, edema intestinal com

Barash_III.indd 150 22/08/14 11:56


Manual de Anestesiologia Clínica 151

TABELA 13.6 Checklist pré-operatório


Avaliar e melhorar a função cardiopulmonar (tratar hipotensão).
Reverter a vasoconstrição (volume sanguíneo, dor, ansiedade).
Avaliar a nutrição recente e adotar medidas corretivas necessárias.
Tratar infecção existente (limpar e tratar as infecções cutâneas).
Manter a glicose sanguínea entre 100 e 200 mg/dL.

íleo persistente e, possivelmente, aumento da incidência de arrit-


mias cardíacas.
3. Além da instabilidade hemodinâmica, as principais complicações
da hipovolemia são redução da oxigenação do sítio cirúrgico (que
predispõe à infecção), diminuição da formação de colágeno, cica-
trização anormal das feridas e aumento da incidência de deiscên-
cia de anastomoses.
4. A ecocardiografia transesofágica intraoperatória foi recomendada
como método mais útil para monitorar as condições de volume
intraoperatório, em comparação com o Swan-Ganz.
5. As recomendações atuais incluem repor perdas líquidas com base
nas diretrizes padronizadas pelo tipo de operação, reposição do
sangue perdido e reposição de outras perdas contínuas de líquidos
(Tab. 13.8).
D. Cuidados Pós-Operatórios (Tab. 13.9)
1. As feridas são mais vulneráveis nas primeiras horas após a cirur-
gia. Embora os antibióticos percam sua eficácia depois das primei-
ras horas, a imunidade natural da ferida (dependente do nível de
oxigenação) é mais persistente.
2. Mesmo um período breve de vasoconstrição nas primeiras horas
após a operação é suficiente para reduzir o fornecimento de oxi-

TABELA 13.7 Cuidados intraoperatórios


Administrar antibióticos profiláticos apropriados no início de qualquer procedimento
Anatomia e Fisiologia

no qual as infecções sejam altamente prováveis ou tenham consequências


potencialmente desastrosas. Os níveis do antibiótico devem ser mantidos durante
cirurgias longas.
Manter os pacientes aquecidos.
Adotar técnica operatória cuidadosa com uso mínimo de suturas e cautério.
Manter as feridas úmidas.
Fazer irrigação com antibióticos nos casos contaminados.
Aumentar a PaO2.
Realizar fechamento tardio das feridas altamente contaminadas.
Utilizar suturas (e fitas cutâneas) apropriadas.
Aplicar curativos adequados.

Barash_III.indd 151 22/08/14 11:56


152 Barash, Cullen, Stoelting, Cahalan, Stock, Ortega

TABELA 13.8 Recomendações padronizadas para reposição de


volume dos pacientes cirúrgicos
Necessidade de líquidos 5 Déficit 1 Manutenção (volume basal mais reposição) 1 Perda
sanguínea (e outras perdas imperceptíveis de líquidos) estimada
Déficit 5 Manutenção (1,5 mL/kg) 3 Horas em NPO
Realizar ajustes se houver febre, drenagem nasogástrica volumosa, preparação intestinal.
Repor o sangramento estimado a 3:1 com cristaloide e 1:1 com coloide.

Necessidades de Manutenção para Diferentes Procedimentos Cirúrgicos


Traumatismo cirúrgico superficial (cirurgia dos membros): 1 a 2 mL/kg/h
Traumatismo cirúrgico mínimo (cirurgia de cabeça e pescoço, hérnia, joelho):
3 a 4 mL/kg/h
Traumatismo cirúrgico moderado (cirurgia de grande porte sem exposição do
conteúdo abdominal): 5 a 6 mL/kg/h
Traumatismo cirúrgico grave (cirurgia de grande porte com exposição do conteúdo
abdominal): 8 a 10 mL/kg/h
NPO 5 nada por via oral.

gênio e aumentar o risco de infecção. A prevenção e a correção da


vasoconstrição nas primeiras 24 a 48 horas após o procedimento
cirúrgico trazem efeitos benéficos significativos.
3. A recomendação atual é manter a glicose sanguínea próximo do
normal (100 a 200 mg/dL).
4. A perfusão local não é assegurada até que os pacientes tenham vo-
lume sanguíneo normal, estejam aquecidos, sem dor e sem neces-
sidade de fármacos vasoconstritores.

TABELA 13.9 Cuidados pós-operatórios


Manter o paciente aquecido.
Fornecer analgesia para manter o paciente confortável.
O relato do paciente e a capacidade de mover-se livremente são os melhores sinais de
alívio adequado da dor.
Usar apenas uma dose pós-operatória de antibiótico, a menos que haja infecção ou que
persista a contaminação.
Acompanhar atentamente perdas para o terceiro espaço (a febre aumenta as perdas de
líquido).
Monitorizar e otimizar a perfusão.
Evitar diurese até que haja alívio da dor e que o paciente esteja aquecido.
Avaliar perdas (incluindo perdas térmicas) se a ferida estiver aberta.
Avaliar a necessidade de nutrição parenteral ou enteral.
Manter sob controle hipertensão e hiperglicemia.

Barash_III.indd 152 22/08/14 11:56


Manual de Anestesiologia Clínica 153

a. O aquecimento deve ser mantido até que os pacientes estejam


totalmente acordados e ativos e possam manter seu próprio
equilíbrio térmico.
b. Débito urinário baixo pode indicar perfusão renal reduzida,
mas níveis normais ou até aumentados de volume urinário têm
pouca relação com a PO2 da ferida ou dos tecidos.
c. O exame físico (retorno capilar, turgor ocular, pele seca e aque-
cida) do paciente é o melhor parâmetro para detectar hipovole-
mia e vasoconstrição.
d. Os fármacos vasoconstritores (nicotina, betabloqueadores) de-
vem ser evitados.
e. A manutenção da PO2 tecidual requer atenção à função pulmo-
nar após a cirurgia. A administração de oxigênio suplementar
por máscara facial ou cânula nasal parece aumentar a segurança
dos pacientes tratados com opioides sistêmicos. O controle da
dor também parece ser importante, porque afeta favoravelmen-
te a função pulmonar e o tônus vascular.

V. RESUMO. Durante o procedimento cirúrgico, o uso de um antibiótico


apropriado, a prevenção da vasoconstrição por reposição adequada de vo-
lume, aquecimento e a manutenção da PaO2 alta (300 a 500 mm Hg) são
fundamentais. No período pós-operatório, objetiva-se evitar a vasoconstri-
ção por alívio da dor, aquecimento e administração de volume adequado
na unidade de recuperação pós-anestésica.

Anatomia e Fisiologia

Barash_III.indd 153 22/08/14 11:56


CAPÍTULO

14
Fisiologia dos Líquidos, dos Eletrólitos
e do Equilíbrio Acidobásico
Como consequência das doenças coexistentes e das intervenções terapêuticas, os
pacientes cirúrgicos podem desenvolver distúrbios potencialmente deletérios do
equilíbrio acidobásico, dos volumes intra e extravascular e dos eletrólitos séricos
(Prough DS, Funston JS, Svensen CH, Wolf SW. Fluids, electrolytes and acid-base
physiology. Em: Barash PG, Cullen BF, Stoelting RK, Cahalan MK, Ortega R,
Stock MC, Eds. Clinical Anesthesia. Philadelphia: Lippincott Williams & Wilkins;
2013: 327-361). O controle rigoroso do equilíbrio acidobásico, dos líquidos e dos
eletrólitos pode reduzir a morbidade e a mortalidade perioperatórias.

I. INTERPRETAÇÃO E TRATAMENTO DOS DISTÚRBIOS


ACIDOBÁSICOS
A correção dos distúrbios acidobásicos requer conhecimentos sobre os
quatro distúrbios acidobásicos simples (alcalose metabólica, acidose meta-
bólica, alcalose respiratória e acidose respiratória), bem como das combi-
nações de desequilíbrios mais complexos.
A. Revisão do Equilíbrio Acidobásico. Por convenção, o equilíbrio aci-
dobásico é descrito utilizando a equação de Henderson-Hasselbalch
(Fig. 14.1). Como a concentração de bicarbonato é regulada basica-
mente pelos rins e o nível de CO2 é controlado pelos pulmões, a in-
terpretação do equilíbrio acidobásico tem enfatizado a consideração
dos distúrbios com base nas anormalidades metabólicas (basicamente,
aumentos ou reduções do bicarbonato) e respiratórias (sobretudo au-
mentos ou reduções da PaCO2).
1. O logaritmo negativo da concentração de íons hidrogênio é descri-
to como pH. O pH de 7,4 corresponde a uma concentração de íons
hidrogênio de 40 nmol/L.
2. Entre o pH de 7,2 e 7,5, a curva de concentração de íons hidrogênio
é relativamente linear e, para cada alteração de 0,01 unidade do pH
a partir de 7,4, pode-se estimar que a concentração de íons hidro-
gênio aumenta (pH , 7,4) ou diminua (pH . 7,4) em 1 nmol/L.
B. Alcalose metabólica (pH . 7,45 e bicarbonato . 27 mEq/L) é o dis-
túrbio acidobásico mais comum nos pacientes em estado crítico (Tabs.
14.1 e 14.2).
1. A alcalose metabólica causa vários efeitos fisiológicos (Tab. 14.3).
2. A detecção da hiperbicarbonatemia justifica a realização de ga-
sometria arterial (GA) e deve alertar o anestesiologista para a
possibilidade de que o paciente tenha hipovolemia ou hipopo-
tassemia.
3. Tratamento da alcalose metabólica (Tab. 14.4)

Barash_III.indd 154 22/08/14 11:56


Manual de Anestesiologia Clínica 155

pH 5 6,1 1 log [HCO3]/0,03 3 PaCO2


FIGURA 14.1 Equação de Henderson-Hasselbalch.

C. Acidose Metabólica (pH , 7,35 e bicarbonato , 21 mEq/L)


1. Existem dois tipos de acidose metabólica, dependendo do anion
gap calculado estar normal ou aumentado (Tab. 14.5). Em geral,
o cátion medido comumente (sódio) é maior que a concentração
de ânions (cloro, bicarbonato) em 9 a 13 mEq/L.
2. A acidose metabólica causa vários efeitos fisiológicos (Tab. 14.6).
3. As implicações anestésicas da acidose metabólica são proporcio-
nais à gravidade do processo subjacente (Tab. 14.7).
4. O tratamento da acidose metabólica consiste em reverter o proces-
so fisiopatológico primário (hipoperfusão, hipoxemia arterial) e,
quando o pH está profundamente reduzido, administrar bicarbo-
nato de sódio (Tab. 14.8). A opinião corrente é que o bicarbonato
de sódio raramente deva ser usado para tratar acidemia induzida
pela acidose metabólica, pois ele não melhora a resposta cardio-
vascular às catecolaminas e diminui o cálcio ionizado plasmático.

TABELA 14.1 Mecanismos da alcalose metabólica


Mecanismo Exemplos
Perda de Ácidos do Espaço Extracelular
Perda de secreções gástricas (HCl) Vômitos
Perda de ácidos na urina; Hiperaldosteronismo primário com diurético
aumento da secreção de
sódio distal na presença de
hiperaldosteronismo
Desvios de ácidos para dentro das Deficiência de potássio
células
Anatomia e Fisiologia

Perda de ácidos nas fezes Diarreia congênita com perda de cloreto


Excesso de Bicarbonato
Absoluto
Suplemento oral ou parenteral de Síndrome leite-álcali
bicarbonato
Conversão metabólica dos sais de Infusão de lactato, acetato ou citrato
ácidos orgânicos em bicarbonato
Relativo
Estados pós-hipercapnia Correção da hipercapnia crônica (com suporte
por ventilação mecânica)

Barash_III.indd 155 22/08/14 11:56


156 Barash, Cullen, Stoelting, Cahalan, Stock, Ortega

TABELA 14.2 Fatores que mantêm a alcalose metabólica


Fator Mecanismo Proposto
Redução da TFG Aumenta a fração de bicarbonato reabsorvido
e impede que as concentrações plasmáticas
altas de bicarbonato superem a TFG.
Depleção de volume Estimula a reabsorção do bicarbonato nos
túbulos proximais.
Hipopotassemia Reduz a TFG e aumenta a reabsorção de
bicarbonato nos túbulos proximais.
Estimula a secreção (baixa) sódio-
independente e potássio-dependente nos
túbulos coletores corticais.
Hipocloremia* Aumenta a renina.
Reduz a eliminação de cloreto nos túbulos
distais.
Refluxo passivo de bicarbonato Produz um gradiente de concentração
favorável à transferência passiva do
bicarbonato da luz dos túbulos proximais
para o sangue.
Aldosterona Aumenta a secreção de prótons sódio-
dependentes nos túbulos coletores
corticais e a secreção de prótons sódio-
independentes nos túbulos coletores
corticais e nos túbulos coletores medulares.
*Em modelos animais.
TFG 5 taxa de filtração glomerular.

TABELA 14.3 Efeitos fisiológicos da alcalose metabólica


Hipopotassemia (potencializa os efeitos da digoxina; provoca arritmias cardíacas
ventriculares)
Redução da concentração sérica de cálcio ionizado
Hipoventilação compensatória (pode ser exagerada nos pacientes com DPOC, ou nos
que são tratados com opioides. A hipoventilação compensatória raramente eleva a
PaCO2 acima de 55 mm Hg)
Hipoxemia arterial (reflete o efeito da hipoventilação compensatória)
Aumento do tônus dos brônquios (pode contribuir para atelectasia)
Desvio da curva de dissociação da oxiemoglobina à esquerda (menos oxigênio
disponível aos tecidos)
Redução do débito cardíaco
Depressão cardiovascular e arritmias cardíacas (resultam da alcalose respiratória
iatrogênica acidental em resposta à alcalose metabólica preexistente durante o
procedimento anestésico)
DPOC 5 doença pulmonar obstrutiva crônica.

Barash_III.indd 156 22/08/14 11:56


Manual de Anestesiologia Clínica 157

TABELA 14.4 Tratamento da alcalose metabólica


Tratamento Etiológico
Expandir o volume de líquidos intravasculares (reposição de líquidos intraoperatórios
com soro fisiológico; a solução de Ringer-lactato fornece mais substratos para a
produção de bicarbonato).
Administrar potássio.
Evitar hiperventilação iatrogênica.

Tratamento Não Etiológico


Administrar acetazolamida (causa eliminação de bicarbonato pelos rins).
Administrar hidrogênio (cloreto de amônio, cloridrato de arginina, ácido clorídrico
[deve ser injetado em uma veia central]).

TABELA 14.5 Diagnóstico diferencial da acidose metabólica


Anion Gap Normal
Acidose tubular renal
Diarreia
Administração de inibidores da anidrase carbônica
Insuficiência renal aguda
Administração de solução salina

Anion Gap Aumentado (. 13 mEq/L)


Uremia
Cetoacidose
Acidose láctica
Toxinas (metanol, etilenoglicol, salicilatos)
Anatomia e Fisiologia

TABELA 14.6 Efeitos fisiológicos da acidose metabólica


Redução da contratilidade miocárdica
Aumento da resistência vascular pulmonar
Redução da resistência vascular sistêmica
Depressão da resposta do sistema cardiovascular às catecolaminas endógenas e
exógenas
Hiperventilação compensatória

Barash_III.indd 157 22/08/14 11:56


158 Barash, Cullen, Stoelting, Cahalan, Stock, Ortega

TABELA 14.7 Implicações anestésicas da acidose metabólica


Monitorar a gasometria e o pH arteriais.
Atentar à possibilidade de respostas hipotensoras exageradas aos fármacos e à
ventilação com pressão positiva (reflete hipovolemia).
Considerar monitoração por um cateter intra-arterial e um cateter de artéria pulmonar.
Manter o nível preexistente de hiperventilação compensatória.

D. A alcalose respiratória (pH . 7,45 e PaCO2 , 35 mm Hg) é resultante


do aumento da ventilação-minuto acima da necessária para excretar o
CO2 produzido pelo metabolismo.
1. O desenvolvimento de alcalose respiratória espontânea em um
paciente que antes apresentava normocapnia deve ser investigado
imediatamente (Tab. 14.9).
2. A alcalose respiratória causa vários efeitos fisiológicos (Tab.
14.10).
3. O tratamento da alcalose respiratória propriamente dita em geral
não é necessário. As medidas mais importantes são detectar e tra-
tar a causa básica (p. ex., hipoxemia arterial, acidose láctica induzi-
da por hipoperfusão).
4. A detecção da hiperventilação crônica no período pré-operatório
exige a manutenção de uma PaCO2 semelhante durante o procedi-
mento cirúrgico.
E. A acidose respiratória (pH de 7,35 e PaCO2 . 45 mm Hg) ocorre por-
que a ventilação-minuto diminui e/ou a produção metabólica de CO2
aumenta.
1. A acidose respiratória pode ser aguda (não há retenção de bicar-
bonato pelos rins) ou crônica (a retenção de bicarbonato pelos rins
aumenta o pH a níveis praticamente normais).
2. A acidose respiratória ocorre porque há redução da ventilação-
-minuto ou aumento da produção de CO2 (Tab. 14.11).
3. Os pacientes com hipercapnia crônica causada por doenças pul-
monares intrínsecas requerem avaliação pré-operatória cuidado-
sa (determinações da GA e do pH arterial), cuidados anestésicos

TABELA 14.8 Cálculo da dose de bicarbonato de sódio


Peso (kg) 3 0,3 3 (24 mEq/L
[bicarbonato real])
Bicarbonato de sódio (mEq/L) 5
2

Barash_III.indd 158 22/08/14 11:56


Manual de Anestesiologia Clínica 159

TABELA 14.9 Causas de alcalose respiratória


Síndrome de hiperventilação (diagnóstico de exclusão; encontrada mais comumente no
setor de emergência)
Hiperventilação iatrogênica
Dor
Ansiedade
Hipoxemia arterial
Doença do sistema nervoso central
Sepse sistêmica

(monitoração invasiva da pressão arterial e determinações fre-


quentes da GA) e cuidados pós-operatórios (controle da dor, em
geral com opioides neuroaxiais, e suporte ventilatório).
a. A administração de opioides e sedativos, mesmo em doses bai-
xas, pode causar depressão respiratória.
b. Durante o procedimento cirúrgico, um paciente com hiper-
capnia crônica deve ser ventilado para manter o pH normal.
(A elevação súbita da ventilação alveolar pode causar alcale-
mia profunda, porque a excreção renal de bicarbonato está
reduzida.)
4. O tratamento da acidose respiratória aguda consiste em reverter o
fator desencadeante (opioides, relaxantes musculares) e, quando
necessário, manter ventilação artificial. A acidose respiratória crô-
nica raramente precisa ser tratada com ventilação artificial, mas
sim com medidas para melhorar a função pulmonar de forma a
permitir a eliminação adequada de CO2.
F. Nos pacientes que necessitam de ventilação artificial porque estão em
insuficiência respiratória, a ventilação protetora pulmonar pode causar
hipercapnia que, por sua vez, pode ser tratada com alcalinização.
Anatomia e Fisiologia

TABELA 14.10 Efeitos fisiológicos da alcalose respiratória


Hipopotassemia (potencializa os efeitos tóxicos da digoxina)
Hipocalcemia
Arritmias cardíacas
Broncoconstrição
Hipotensão
Redução do fluxo sanguíneo cerebral (retorna ao normal em 8 a 24 h, correspondendo
à normalização do pH do líquido cefalorraquidiano)

Barash_III.indd 159 22/08/14 11:56


160 Barash, Cullen, Stoelting, Cahalan, Stock, Ortega

TABELA 14.11 Causas de acidose respiratória


Ventilação Alveolar Reduzida
Depressão do sistema nervoso central (opioides, anestésicos gerais)
Fraqueza da musculatura esquelética periférica (bloqueadores neuromusculares,
miastenia grave)
Doença pulmonar obstrutiva crônica
Insuficiência respiratória aguda

Produção de Dióxido de Carbono Aumentada


Estados hipermetabólicos
Sepse
Febre
Politraumatismo
Hipertermia maligna
Hiperalimentação

II. ABORDAGEM PRÁTICA À INTERPRETAÇÃO DOS DISTÚRBIOS


ACIDOBÁSICOS. A interpretação rápida do estado acidobásico de um
paciente consiste em integrar os dados fornecidos pela GA, pH e dosa-
gens dos eletrólitos com base na história clínica. Depois da obtenção des-
ses dados, a abordagem progressiva facilita a interpretação (Tab. 14.12).
A. Em geral, o pH indica o distúrbio primário (acidose ou alcalose).
B. Quando a PaCO2 e o pH oscilam reciprocamente, mas a magnitude
das alterações do pH e do bicarbonato não é compatível com um dis-
túrbio respiratório agudo simples, deve-se considerar um problema
respiratório ou metabólico crônico (mais de 24 h). (O pH alcança
níveis praticamente normais à medida que o organismo compensa o
distúrbio.)
C. Quando um distúrbio respiratório agudo ou crônico não poderia ter
causado as alterações da GA, então o paciente deve ter um distúrbio
metabólico.
D. A compensação em resposta aos distúrbios metabólicos é imediata por
meio de alterações da PaCO2, mas a compensação renal dos distúrbios
respiratórios é mais lenta.
E. A impossibilidade de considerar a existência ou a inexistência de anion
gap aumentado resulta no diagnóstico errôneo e na postergação do tra-
tamento apropriado. A avaliação adequada do anion gap depende da
correção da hipoalbuminemia.

III. FISIOLOGIA DO VOLUME DE LÍQUIDOS


A. Compartimentos de Líquidos Corporais. A reposição acurada dos
déficits de líquidos requer conhecimentos sobre os espaços de distri-

Barash_III.indd 160 22/08/14 11:56


Manual de Anestesiologia Clínica 161

TABELA 14.12 Abordagem sequencial à interpretação do equilíbrio


acidobásico
Quando o pH está em uma faixa potencialmente fatal, há necessidade de intervenção
imediata?
O pH reflete acidose ou alcalose primária?
A gasometria arterial e as determinações do pH poderiam indicar uma alteração aguda
da PaCO2?
Quando não há evidência de alteração aguda da PaCO2, existe evidência de um
distúrbio respiratório crônico ou de um distúrbio metabólico agudo?
O organismo lançou mão de alterações compensatórias apropriadas?
O anion gap está aumentado?
Os dados clínicos são compatíveis com o estado acidobásico?

buição da água, do sódio e do coloide. A água corporal total representa


cerca de 60% do peso total do corpo (42 L em um adulto de 70 kg). A
água corporal total consiste em líquido intracelular (LIC; 28 L) e líqui-
do extracelular (LEC; 14 L). O volume plasmático é de cerca de 3 L, e o
volume de hemácias é de cerca de 2 L. Enquanto o sódio está presente
principalmente no LEC (140 mEq/L), o potássio predomina no LIC
(150 mEq/L). A albumina é o componente ativo oncoticamente mais
importante do LEC (4 g/dL).
B. Distribuição dos Líquidos Infundidos. Por convenção, a previsão
clínica de expansão do volume plasmático após a infusão de líqui-
dos parte do pressuposto de que os espaços dos líquidos corporais
sejam estáticos. Entretanto, o líquido infundido simplesmente não
se equilibra por todo o volume de distribuição suposto, mas é acres-
centado a um sistema rigorosamente regulado que procura manter
os volumes intravascular, intersticial e intracelular. Modelos cinéti-
cos de infusão de líquidos intravenosos (IV) permitem que seja vista
com mais acurácia a evolução temporal das alterações de volume
produzidas pelas infusões de soluções com composições diferentes.
C. A regulação do volume de LEC é influenciada pela aldosterona (au-
menta a reabsorção de sódio), pelo hormônio antidiurético (aumenta
Anatomia e Fisiologia

a reabsorção de água) e pelo peptídeo natriurético atrial (aumenta as


excreções de sódio e água).

IV. TRATAMENTO DE REPOSIÇÃO DE LÍQUIDOS


A. Necessidades de Manutenção de Água, Sódio e Potássio. Os adultos
saudáveis necessitam de água suficiente para compensar as perdas gas-
trintestinais (100 a 200 mL/dia), as perdas imperceptíveis (500 a 1.000
mL/dia, que representam as perdas pelas vias aéreas e pela pele) e as
perdas urinárias (1.000 mL/dia).

Barash_III.indd 161 22/08/14 11:56


162 Barash, Cullen, Stoelting, Cahalan, Stock, Ortega

1. As necessidades de manutenção de água em geral são calculadas


com base no peso corporal. Para um adulto de 70 kg, as necessida-
des diárias de manutenção de água oscilam na faixa de 2.500 mL
(Tab. 14.13).
2. A conservação de sódio pelos rins é altamente eficiente, de forma
que a necessidade diária média de manutenção para um adulto é
de cerca de 75 mEq.
3. A necessidade diária média de manutenção de potássio é de cerca
de 40 mEq. A diurese fisiológica acarreta perda obrigatória de no
mínimo 10 mEq de potássio para cada 1.000 mL de urina.
4. Os eletrólitos como cloreto, cálcio e magnésio não precisam ser
repostos a curto prazo, embora devam ser supridos durante a ma-
nutenção crônica com líquidos IV.
B. Glicose. O acréscimo de glicose às soluções de manutenção do equilí-
brio de líquidos está indicado apenas para pacientes considerados sus-
cetíveis a desenvolver hipoglicemia (lactentes, pacientes em tratamento
com insulina). Nos demais casos, a resposta hiperglicêmica normal ao
estresse cirúrgico é suficiente para evitar hipoglicemia.
1. A hiperglicemia iatrogênica pode reduzir a eficácia da reposição
de líquidos porque induz diurese osmótica.
2. Nos pacientes em estado crítico, algumas evidências sugerem que
o controle rigoroso da glicose plasmática (80 a 110 mg/dL) esteja
associado a desfechos mais favoráveis, mas outros indícios suge-
rem o contrário.
C. Necessidades de Líquidos em Cirurgia
1. Composição de Água e Eletrólitos dos Líquidos Perdidos. Os
pacientes cirúrgicos necessitam repor o volume plasmático e o
LEC em consequência de hemorragias e manipulação dos tecidos
(perda para o terceiro espaço). A solução de Ringer-lactato costu-
ma ser escolhida para repor as perdas para o terceiro espaço, bem
como perdas de secreções gastrintestinais.
2. Influência das Taxas de Infusão de Líquidos Perioperatórios
nos Desfechos Clínicos. Convencionalmente, a reposição de lí-
quidos intraoperatórios incluía a administração de líquidos que
supostamente tinham acumulado no espaço extravascular dos
tecidos manipulados cirurgicamente. Até pouco tempo, a prática

TABELA 14.13 Necessidades de manutenção de água


Peso (kg) mL/kg/h mL/kg/dia
1 a 10 4 100
11 a 20 2 50
. 20 1 20

Barash_III.indd 162 22/08/14 11:56


Manual de Anestesiologia Clínica 163

clínica perioperatória incluía, além dos líquidos de manutenção


e da perda de sangue, 4 a 6 mL/kg/hora para procedimentos que
acarretavam traumatismo mínimo dos tecidos, 6 a 8 mL/kg/hora
para os que causavam traumatismo moderado e 8 a 12 mL/kg/hora
para os procedimentos que acarretavam traumatismo extremo.
Contudo, a administração de líquidos perioperatórios pode estar
relacionada com morbidade leve a grave.
a. A restrição de líquidos não parece ser tão bem tolerada quanto
a administração liberal de líquidos aos pacientes submetidos a
procedimentos cirúrgicos de pequeno porte (p. ex., artroplastia
do joelho).
b. Nos pacientes submetidos a cirurgias abdominais de grande
porte, a administração restritiva de líquidos está associada a
efeitos positivos e negativos.
c. Os pacientes em estado crítico com lesão pulmonar aguda po-
dem melhorar com a reposição conservadora de líquidos, sem
aumento da incidência de insuficiência renal.

V. COLOIDES, CRISTALOIDES E SOLUÇÕES HIPERTÔNICAS


A. Fisiologia e Farmacologia. Os líquidos administrados por via IV va-
riam quanto à pressão oncótica, à osmolaridade e à tonicidade. Quando
a membrana capilar está preservada, os líquidos que contêm coloides
(p. ex., albumina ou amido hidroxietílico) expandem preferencialmen-
te o volume plasmático, em vez do volume de LIC.
B. Implicações Clínicas das Escolhas entre os Líquidos Alternativos.
Apesar das vantagens e desvantagens relativas, não há evidências a fa-
vor da superioridade das soluções contendo cristaloides ou coloides no
sentido de influenciar a mortalidade (Tab. 14.14). Nenhuma evidência
indica que uma solução coloide seja mais eficaz ou segura que qualquer
outra.
C. Implicações das Infusões de Cristaloides e Coloides na Pressão In-
tracraniana. Apesar da impressão clínica, o risco de hipertensão intra-
craniana não parece ser dependente da escolha de uma solução conten-
do cristaloide ou coloide.
D. Implicações Clínicas da Administração de Soluções Hipertônicas.
Anatomia e Fisiologia

Os líquidos hipertônicos e hiperoncóticos parecem mais provavelmen-


te ser efetivos no tratamento dos pacientes hipovolêmicos que têm
complacência intracraniana reduzida.

VI. VOLUME DE LÍQUIDOS: AVALIAÇÃO E MONITORAÇÃO


A. Avaliação Clínica Convencional. A avaliação clínica pré-operatória
do volume sanguíneo e do volume de LEC começa com a detecção das
condições que provavelmente acarretam déficits (Tab. 14.15).

Barash_III.indd 163 22/08/14 11:56


164 Barash, Cullen, Stoelting, Cahalan, Stock, Ortega

TABELA 14.14 Vantagens e desvantagens potenciais dos líquidos


intravenosos cristaloides versus coloides
Vantagens Desvantagens
Coloides Menor volume infundido Custo mais elevado
Aumento persistente do volume Coagulopatia (dextrana .
plasmático amido hidroxietílico)
Mais edema periférico Redução da taxa de
Menos edema cerebral filtração glomerular
Diurese osmótica
(dextrana de baixo peso
molecular)
Cristaloides Custo mais baixo Melhora hemodinâmica
Fluxo urinário maior transitória
Reposição do líquido intersticial Edema periférico
(diluição das proteínas)
Edema pulmonar
(diluição das proteínas
mais elevação da
pressão de oclusão da
artéria pulmonar)

1. Os sinais físicos de hipovolemia são inespecíficos e pouco sensí-


veis (Tab. 14.16). Um valor normal de pressão arterial pode re-
presentar hipotensão relativa em um paciente idoso ou hiperten-
so crônico. Por outro lado, pode haver hipovolemia significativa
apesar da pressão arterial e da frequência cardíaca aparentemente
normais.
a. Os pacientes idosos podem ter hipotensão ortostática, apesar do
volume sanguíneo normal.
b. Os indivíduos jovens e saudáveis podem tolerar sangramentos
agudos equivalentes a 20% do seu volume sanguíneo ao mesmo
tempo em que apresentam apenas taquicardia postural e hipo-
tensão postural variável.
c. As alterações ortostáticas da pressão venosa central, combina-
das com a avaliação da resposta à infusão de líquidos, podem
ser um teste útil quanto à adequação do volume sanguíneo.
2. Os resultados dos exames laboratoriais podem sugerir hipovole-
mia ou déficit de volume de LEC (Tab. 14.17).
a. O hematócrito não é um indicador confiável do volume sanguí-
neo, porque é afetado pelo intervalo decorrido desde o início da

Barash_III.indd 164 22/08/14 11:56


Manual de Anestesiologia Clínica 165

TABELA 14.15 Condições associadas aos déficits de volume


sanguíneo e de líquido extracelular
Traumatismo
Pancreatite
Queimaduras
Obstrução intestinal
Sepse
Hipertensão sistêmica crônica
Uso crônico de diuréticos
Perdas gastrintestinais prolongadas

hemorragia e pelo volume de líquido (exceto sangue) reposto. O


hematócrito praticamente não se altera quando há hemorragia
aguda; mais tarde, há hemodiluição à medida que são adminis-
trados líquidos ou ocorrem transferências de líquidos do espaço
intersticial para o espaço intravascular. Se o volume de líquidos
intravasculares é reposto, a determinação do hematócrito reflete
com mais exatidão a massa eritrocitária e pode ser usada para
orientar a transfusão.
b. Os níveis sanguíneos de ureia e creatinina podem aumentar
quando a hipovolemia é suficientemente prolongada. (Esses
dois parâmetros também podem ser afetados por outras con-
dições não relacionadas com o volume sanguíneo.) Embora a
hipovolemia não cause alcalose metabólica, a depleção de vo-
lume do LEC é um estímulo potente para a persistência desse
distúrbio acidobásico.
B. Avaliação Clínica Intraoperatória. A estimativa visual – com base nas
compressas e nos campos cirúrgicos – é o método mais simples para
quantificar a perda sanguínea intraoperatória.
1. A adequação da reposição intraoperatória do volume sanguíneo
não pode ser assegurada por nenhum método isoladamente (Tab.
14.18).
Anatomia e Fisiologia

TABELA 14.16 Sinais e sintomas de hipovolemia


Oligúria (excluir insuficiência renal ou reação endócrina induzida pelo estresse)
Hipotensão na posição supina (indica déficit de volume . 30%)
Hipotensão postural (aumento da frequência cardíaca [. 20 bpm] e redução da pressão
arterial sistólica [. 20 mm Hg] quando o paciente fica de pé)

Barash_III.indd 165 22/08/14 11:56


166 Barash, Cullen, Stoelting, Cahalan, Stock, Ortega

TABELA 14.17 Evidências laboratoriais de hipovolemia


Hemoconcentração (o hematócrito não é um indicador confiável do volume
sanguíneo)
Azotemia (pode ser afetada por outras condições não relacionadas com o volume
sanguíneo)
Concentração baixa de sódio sérico (, 20 mEq para cada 1.000 mL de urina)
Alcalose metabólica
Acidose metabólica (indica hipoperfusão dos órgãos)

2. A preservação da pressão arterial e um nível de pressão venosa


central entre 6 e 12 mm Hg durante o uso de um anestésico volátil
sugerem volume sanguíneo adequado.
a. Durante a hipovolemia profunda, a determinação indireta da
pressão arterial pode subestimar significativamente a pressão
arterial real, enfatizando o valor potencial das determinações
diretas da pressão sanguínea em determinados casos.
b. Outra vantagem da monitoração direta da pressão arterial pode
ser a detecção de variações da pressão arterial sistólica elevada,
que acompanham a ventilação com pressão positiva dos pacien-
tes com hipovolemia. Embora a variação da pressão de pulso
possa ser mais fidedigna que a pressão venosa central como
forma de prever o aumento do débito cardíaco em resposta à
reposição de líquidos, esse parâmetro não é conclusivo em cerca
de 25% dos casos.
3. Em geral, o débito urinário diminui repentinamente (, 0,5 mL/
kg/h) quando há hipovolemia moderada a grave.
C. Fornecimento de Oxigênio como Objetivo do Tratamento. Ne-
nhum monitor utilizado durante os procedimentos cirúrgicos é
suficientemente sensível ou específico para detectar hipoperfusão
em todos os pacientes. Nos pacientes cirúrgicos de alto risco, o for-
necimento de oxigênio (DO2) igual ou maior que 600 mL/m2/min
(equivalente a um débito cardíaco de 3 L/m2/min) e concentração

TABELA 14.18 Indicadores clínicos da adequação da reposição


intraoperatória do volume sanguíneo
Frequência cardíaca (a taquicardia é um indicador inespecífico e pouco sensível)
Pressão arterial
Pressão venosa central
Débito urinário
Oxigenação arterial e pH

Barash_III.indd 166 22/08/14 11:56


Manual de Anestesiologia Clínica 167

de hemoglobina equivalente a 14 g/dL) pode assegurar um desfecho


mais favorável.

VII. ELETRÓLITOS
A. Funções Fisiológicas dos Eletrólitos (Tab. 14.19)
B. Sódio. Os distúrbios da concentração de sódio (hiponatremia e hiper-
natremia) em geral resultam do déficit ou excesso de água. A regulação
da quantidade e da concentração de eletrólitos é conseguida principal-
mente pelos sistemas renal e endócrino.
1. Hiponatremia (, 130 mEq/L) é o distúrbio eletrolítico mais co-
mum dos pacientes hospitalizados (pós-operatório, doença intra-
craniana aguda) e, em geral, é causada por excesso de água corpo-
ral total.
a. Os sinais e sintomas da hiponatremia dependem da taxa com
que a concentração plasmática de sódio diminui e da profundi-
dade de tal redução (Tab. 14.20).
b. A síndrome cerebral com depleção salina parece ser mediada
pelo peptídeo natriurético cerebral; a secreção de hormônio an-
tidiurético é apropriada.
c. Muitos pacientes desenvolvem hiponatremia em consequência
da síndrome de secreção inadequada de hormônio antidiurético
(SSIADH). O elemento fundamental do tratamento dessa sín-
drome é restringir a ingestão de água livre e eliminar as causas
desencadeantes (Tab. 14.21).
d. A correção excessivamente rápida da hiponatremia pode causar
desidratação cerebral aguda. (A síndrome de desmielinização
osmótica é mais provável quando a hiponatremia persiste por
mais de 48 h.)
e. Para os pacientes que precisam de tratamento farmacológico
prolongado para hiponatremia, os antagonistas do receptor de
vasopressina podem ser úteis.
2. A hipernatremia (. 150 mEq/L) costuma ser resultante da redu-
ção da água corporal total.
a. Os sinais e sintomas de hipernatremia refletem mais provavel-
mente o efeito da desidratação dos neurônios e a ocorrência de
Anatomia e Fisiologia

hipoperfusão causada pela hipovolemia (Tab. 14.22). Quando a


hipernatremia começa de forma repentina, a desidratação cere-
bral súbita pode distender e romper vasos cerebrais, resultando
em hematoma subdural, hemorragia subaracnóidea e trombose
venosa.
b. Os pacientes em pós-operatório de procedimentos neurocirúr-
gicos para tratar distúrbios hipofisários estão especialmente su-
jeitos a desenvolver diabetes insípido transitório ou persistente,
que cursa com hipernatremia.

Barash_III.indd 167 22/08/14 11:56


168 Barash, Cullen, Stoelting, Cahalan, Stock, Ortega

TABELA 14.19 Funções fisiológicas dos eletrólitos


Eletrólito Funções Fisiológicas
Sódio Osmolaridade
Volume de líquido extracelular
Potencial de ação
Potássio Potencial transmembrana
Potencial de ação
Cálcio Excitação-contração
Neurotransmissão
Função enzimática
Atividade do marca-passo cardíaco
Potencial de ação cardíaco
Estrutura óssea
Fósforo Reservas de energia (trifosfato de
adenosina)
Componente dos segundos-mensageiros
(monofosfato de adenosina cíclico)
Componente das membranas celulares
(fosfolipídeos)
Magnésio Cofator enzimático (bomba de sódio-
potássio)
Controle da transferência de potássio para
dentro das células
Excitabilidade das membranas
Estrutura óssea

TABELA 14.20 Sinais e sintomas de hiponatremia


Neurológicos
Alterações da consciência (sedação a coma)
Convulsões
Edema cerebral

Gastrintestinais
Perda de apetite
Náusea e vômitos

Musculares
Cãibras
Fraqueza

Barash_III.indd 168 22/08/14 11:56


Manual de Anestesiologia Clínica 169

TABELA 14.21 Causas desencadeantes da secreção inadequada de


hormônio antidiurético
Hipovolemia
Doença pulmonar
Lesão do sistema nervoso central
Disfunção endócrina
Fármacos que mimetizam a ação do hormônio antidiurético

c. O tratamento da hipernatremia é determinado pela avaliação


clínica do volume de LEC (Tab. 14.23).
C. Potássio
1. A hipopotassemia (, 3,0 mEq/L) pode ser causada pela redistri-
buição aguda do potássio do compartimento extracelular para o
LIC (a concentração corporal total de potássio permanece normal)
ou pela deficiência crônica de potássio no corpo. Quando há perda
crônica de potássio, a razão entre as concentrações intracelular e
extracelular de potássio permanece relativamente constante, mas
a redistribuição rápida do potássio altera de forma significativa a
diferença de potencial em repouso nos dois lados das membranas
celulares.
a. A concentração plasmática de potássio não reflete claramente
o nível total de potássio do corpo, e a hipopotassemia pode
ocorrer com níveis corporais totais de potássio altos, normais
ou reduzidos. A concentração plasmática de potássio (98%
do potássio estão dentro das células) não se correlaciona di-

TABELA 14.22 Sinais e sintomas de hipernatremia


Neurológicos
Sede
Fraqueza
Hiper-reflexia
Anatomia e Fisiologia

Convulsões
Hemorragia intracraniana

Cardiovasculares
Hipovolemia

Renais
Poliúria ou oligúria
Insuficiência renal

Barash_III.indd 169 22/08/14 11:56


170 Barash, Cullen, Stoelting, Cahalan, Stock, Ortega

TABELA 14.23 Tratamento da hipernatremia


Déficit de Sódio (Hipovolemia)
Corrigir a hipovolemia (com soro fisiológico)
Corrigir a hipernatremia (com líquidos hipotônicos)

Excesso de Sódio (Hipervolemia)


Aumentar a excreção de sódio (diuréticos de alça, diálise)
Repor o déficit de água (com líquidos hipotônicos)

Sódio Corporal Total Normal (Euvolemia)


Repor o déficit de água (com líquidos hipotônicos)
Controlar o diabetes insípido (desmopressina, vasopressina, clorpropamida)
Controlar o diabetes insípido nefrogênico (limitar a ingestão de sódio e água, diuréticos
tiazídicos)

retamente com as reservas totais de potássio do organismo.


O potássio corporal total fica em torno de 50 a 55 mEq/kg.
Como orientação geral, a redução crônica do potássio sérico
de 1 mEq/L corresponde a um déficit corporal total de cerca de
200 a 300 mEq.
b. Os sinais e sintomas de hipopotassemia refletem os efeitos difu-
sos do potássio nas membranas celulares e nos tecidos excitáveis
(Tab. 14.24).
c. Os distúrbios do ritmo cardíaco estão entre as complicações
mais perigosas da hipopotassemia. Embora não exista um
limiar claramente definido para o nível de hipopotassemia
abaixo do qual a segurança da anestesia fica comprometida, as
concentrações séricas de potássio menores que 3,5 mEq/L po-
dem estar associadas à incidência crescente de arritmias perio-
peratórias (fibrilação ou flutter atrial nos pacientes de cirurgia
cardíaca).
d. A deficiência de potássio pode acarretar dificuldade de concen-
trar a urina e causar poliúria.
e. A hipopotassemia causa fraqueza dos músculos esqueléticos e,
quando é grave, pode até provocar paralisia.
f. O tratamento da hipopotassemia consiste em repor potássio,
corrigir a alcalose e interromper a administração dos fár-
macos desencadeantes (diuréticos, aminoglicosídeos) (Tab.
14.25). A hipopotassemia secundária apenas à redistribuição
aguda nem sempre precisa ser tratada. A administração oral
de cloreto de potássio (a deficiência de cloreto pode limitar a
capacidade renal de conservar potássio) é preferível à infusão
IV quando as reservas totais de potássio estão reduzidas. A

Barash_III.indd 170 22/08/14 11:56


Manual de Anestesiologia Clínica 171

TABELA 14.24 Sinais e sintomas de hipopotassemia


Cardiovasculares
Arritmias cardíacas (contrações ventriculares prematuras)
Alterações do ECG (complexo QRS alargado, depressão do segmento S-T, bloqueio
cardíaco AV de primeiro grau)
Potencialização dos efeitos tóxicos dos digitálicos
Hipotensão postural

Neuromusculares
Fraqueza dos músculos esqueléticos (hipoventilação)
Hiporreflexia
Confusão mental

Renais
Poliúria
Déficit de concentração

Metabólicos
Intolerância à glicose
Potencialização dos efeitos da hipercalcemia e da hipomagnesemia
AV 5 atrioventricular; ECG 5 eletrocardiograma.

reposição intravenosa de potássio a uma taxa . 20 mEq/hora


deve ser monitorada continuamente por eletrocardiografia
(ECG).
2. A hiperpotassemia (. 5 mEq/L) é causada mais comumente
por insuficiência renal ou fármacos que limitam a excreção de
potássio (anti-inflamatórios não esteroides, inibidores da enzima
conversora de angiotensina, ciclosporina, diuréticos que conser-
vam potássio). As manifestações mais letais da hiperpotassemia
afetam o sistema de condução cardíaca (Fig. 14.2). Em geral, o

TABELA 14.25 Tratamento da hipopotassemia


Anatomia e Fisiologia

Corrigir os Fatores Desencadeantes (alcalose, hipomagnesemia, fármacos)


1
Hipopotassemia Leve (K . 2 mEq/L)
Infundir cloreto de potássio a uma taxa # 10 mEq/h por via IV
1
Hipopotassemia Grave (K # 2 mEq/L, alterações do ECG, fraqueza acentuada dos
músculos esqueléticos)
Infundir cloreto de potássio por via IV a uma taxa # 40 mEq/h
Monitorar continuamente o ECG
ECG 5 eletrocardiograma; IV 5 intravenosa.

Barash_III.indd 171 22/08/14 11:56


172 Barash, Cullen, Stoelting, Cahalan, Stock, Ortega

Anormalidades
Potássio sérico Aspecto típico do ECG
potenciais do ECG

Ondas T apiculadas
Aumento leve
Segmento PR prolongado
(5,5 a 6,5 mEq/L)

Desaparecimento da onda P
Complexo QRS prolongado
Aumento moderado Elevação do segmento S-T
(6,5 a 8,0 mEq/L) Batimentos ectópicos e
ritmos de escape

Alargamento progressivo
do complexo QRS
Onda sinusal
Aumento grave (> 8 mEq/L) Fibrilação ventricular
Assistolia
Desvios do eixo cardíaco
Bloqueios de ramo
Bloqueios fasciculares

FIGURA 14.2 Alterações no eletrocardiograma (ECG) que podem ocorrer com os


aumentos progressivos das concentrações séricas de potássio.

ECG não é um método sensível e específico para detectar hiper-


potassemia.
a. Os sinais e sintomas de hiperpotassemia referem-se basicamen-
te aos sistemas nervoso e cardiovascular (Tab. 14.26).
b. O tratamento da hiperpotassemia tem como objetivos corrigir a
causa, reverter a hiperexcitabilidade das membranas e remover
potássio do corpo (Fig. 14.3 e Tab. 14.27).

TABELA 14.26 Sinais e sintomas de hiperpotassemia


Cardiovasculares
Arritmias cardíacas (bloqueio cardíaco)
Alterações no ECG (alargamento do complexo QRS, ondas T altas e apiculadas,
assistolia atrial, prolongamento do intervalo P-R)

Neuromusculares
Fraqueza dos músculos esqueléticos
Parestesias
Confusão mental
ECG 5 eletrocardiograma.

Barash_III.indd 172 22/08/14 11:56


Manual de Anestesiologia Clínica 173

TABELA 14.27 Tratamento da hiperpotassemia grave*


Reverter os Efeitos nas Membranas
Cálcio (cloreto de cálcio a 10% em infusão IV durante 10 min)

Transferir Potássio para Dentro das Células


Glicose (SG10 e insulina regular (5 a 10 U de insulina regular para cada 25 a 50 g de
glicose)
Bicarbonato de sódio (50 a 100 mEq em 5 a 10 min)
Beta2-agonistas

Remover Potássio do Corpo


Diuréticos (proximais ou de alça)
Resinas permutadoras de potássio
Hemodiálise (remove 25 a 50 mEq/h)
* . 7 mEq/L, alterações do ECG.
ECG 5 eletrocardiograma; IV 5 intravenosa; SG10 5 soro glicosado a 10%.

D. Cálcio
1. A hipocalcemia (cálcio ionizado , 4,0 mg/dL) ocorre em conse-
quência da deficiência de hormônio paratireóideo (lesão ou res-
secção cirúrgica das glândulas paratireoides, queimaduras, sepse),
ou da quelação ou precipitação do cálcio (hiperfosfatemia, a partir
da destruição celular secundária à quimioterapia).
a. As marcas características da hipocalcemia são acentuação
da irritabilidade das membranas neuronais e tetania (Tab.
14.28).
b. A redução da concentração de cálcio sérico total ocorre em cer-
ca de 80% dos pacientes em estado crítico e no pós-operatório,
mas poucos têm hipocalcemia com déficit de cálcio ionizado
(politraumatismo, após circulação extracorpórea, transfusão
maciça [citrato]).
c. Tratamento da hipocalcemia (Tab. 14.29).
2. A hipercalcemia (cálcio ionizado . 5,2 mg/dL) ocorre quando o
cálcio entra no LCE mais rapidamente que os rins conseguem ex-
Anatomia e Fisiologia

cretar. Clinicamente, a hipercalcemia resulta mais comumente da


reabsorção óssea maior que a formação óssea, em geral secundária
a uma doença neoplásica maligna, ao hiperparatireoidismo ou à
imobilidade.
a. Os sinais e sintomas estão descritos na Tab. 14.30.
b. O tratamento da hipercalcemia do período perioperatório in-
clui infusão de soro fisiológico e administração de furosemida
para aumentar a excreção de cálcio (o débito urinário deve ser
mantido entre 200 e 300 mL/h).

Barash_III.indd 173 22/08/14 11:56


174 Barash, Cullen, Stoelting, Cahalan, Stock, Ortega

O paciente tem hiperpotassemia potencialmente fatal?


Alterações do ECG?
Risco alto (insuficiência renal, tratamento por diálise, fármacos Não
desencadeantes)
Potássio sérico . 6,5 mEq/L

Sim

1º passo: estabilizar o miocárdio

Cloreto de cálcio IV ou gluconato


Considerar a repetição da dose se as
de cálcio IV, 10 mL (1 ampola)
alterações do ECG persistirem
de solução a 10%

2º passo: transferir potássio para


K dentro das células
LIC

LEC
Insulina regular IV (10 a 20 U)
Glicose IV (25 a 50 g)
Repetir a dosagem da glicose a cada 20 min

Salbutamol por nebulização (10 a 20 mg) ou


Salbutamol por IDM (0,18 mg)

K 3º passo: aumentar a eliminação de potássio

Volume de líquidos Resina permutadora


Reduzido
do paciente com laxante

Tentar repor volume com NaCl a


Normal ou aumentado
0,9%, se houver indicação clínica

O paciente está em anúria?

Sim Não Hemodiálise

Tentar diurético de alça,


inclusive furosemida Nenhuma resposta
(80 a 240 mg)

FIGURA 14.3 Tratamento da hiperpotassemia. ECG 5 eletrocardiograma; IDM 5


inalador dosimetrado; IV 5 intravenosa; LEC 5 líquido extracelular; LIC 5 líquido
intracelular.

Barash_III.indd 174 22/08/14 11:56


Manual de Anestesiologia Clínica 175

TABELA 14.28 Sinais e sintomas de hipocalcemia


Cardiovasculares
Arritmias cardíacas
Alterações do ECG (prolongamento do intervalo Q-T, inversão da onda T)
Hipotensão
Insuficiência cardíaca congestiva

Neuromusculares
Espasmo dos músculos esqueléticos
Tetania
Fraqueza dos músculos esqueléticos
Convulsões

Pulmonares
Laringospasmo
Broncospasmo
Hipoventilação

Psiquiátricos
Ansiedade
Demência
Depressão
ECG 5 eletrocardiograma.

E. O magnésio está localizado principalmente no meio intracelular e é


necessário às reações enzimáticas.
1. A hipomagnesemia (, 1,8 mg/dL) é comum nos pacientes em
estado crítico, quase certamente como consequência da aspiração
nasogástrica e da incapacidade de conservar magnésio nos túbulos
renais. A hipomagnesemia pode agravar os efeitos tóxicos da digo-
xina e a insuficiência cardíaca congestiva.
a. Os sinais e sintomas estão descritos na Tab. 14.31.
b. Tratamento da Hipomagnesemia (Tab. 14.32). Durante a repo-
sição de magnésio, os reflexos patelares devem ser monitorados
Anatomia e Fisiologia

TABELA 14.29 Tratamento da hipocalcemia


Administrar cálcio.
Administrar 10 mL de gluconato de cálcio a 10% por via IV em 10 min e, em seguida,
infusão contínua de 500 a 1.000 mg de cálcio a cada 6 h.
Administrar vitamina D.
Monitorar o ECG.
ECG 5 eletrocardiograma; IV 5 intravenosa.

Barash_III.indd 175 22/08/14 11:56


176 Barash, Cullen, Stoelting, Cahalan, Stock, Ortega

TABELA 14.30 Sinais e sintomas de hipercalcemia


Cardiovasculares
Hipertensão
Bloqueio cardíaco
Sensibilidade exagerada aos digitálicos

Neuromusculares
Fraqueza dos músculos esqueléticos
Hiporreflexia
Sedação ou coma

Renais
Nefrolitíase
Poliúria (déficit de concentração nos túbulos renais)
Azotemia

Gastrintestinais
Doença ulcerosa péptica
Pancreatite
Anorexia

TABELA 14.31 Sinais e sintomas de hipomagnesemia


Cardiovasculares
Vasospasmo coronariano
Arritmias cardíacas (principalmente após infarto do miocárdio ou bypass
cardiopulmonar)
Fibrilação ventricular refratária ao tratamento
Insuficiência cardíaca congestiva

Neuromusculares
Irritabilidade neuronal (tetania)
Fraqueza dos músculos esqueléticos
Sedação
Convulsões

Diversos
Disfagia
Anorexia
Náusea
Hipopotassemia (perda de potássio induzida pelo magnésio)
Hipocalcemia (supressão da secreção de hormônio paratireóideo induzida pelo
magnésio)

Barash_III.indd 176 22/08/14 11:56


Manual de Anestesiologia Clínica 177

TABELA 14.32 Tratamento da hipomagnesemia


Administrar magnésio.*
Administrar magnésio IV, 8 a 16 mEq em 1 h e, em seguida, 2 a 4 mEq/h.
Administrar magnésio IM, 10 mEq a cada 4 a 6 h.
*1 g de MgSO4 5 8 mEq; 1 g de MgCl2 5 10 mEq.
IM 5 intramuscular; IV 5 intravenosa.

TABELA 14.33 Sinais e sintomas de hipermagnesemia


Concentração Plasmática de Magnésio (mg/dL)
Faixa de referência 1,8 a 2,5
Faixa terapêutica (pré-eclâmpsia) 5a8
Hipotensão 3a5
Hiporreflexia dos tendões profundos 5
Sonolência 7 a 12
Arreflexia dos tendões profundos 7 a 12
Hipoventilação . 12
Bloqueio cardíaco . 12
Parada cardíaca . 12

com mais frequência, e a infusão deve ser suspensa quando es-


ses reflexos estão suprimidos. Durante a infusão IV de magné-
sio, é importante monitorar continuamente o ECG para detec-
tar efeitos tóxicos cardíacos.
2. A hipermagnesemia (. 2,5 mg/dL) costuma ser iatrogênica (p.
ex., tratamento da hipertensão induzida pela gravidez ou do traba-
lho de parto prematuro).
a. Os sinais e sintomas estão descritos na Tab. 14.33.
b. A hipermagnesemia antagoniza a liberação e o efeito da acetil-
colina na junção neuromuscular e isso se evidencia por poten-
Anatomia e Fisiologia

cialização dos efeitos dos relaxantes musculares não despolari-


zantes.
c. Os efeitos tóxicos neuromusculares e cardíacos produzidos
pela hipermagnesemia podem ser imediatamente antagoni-
zados pela infusão IV de 5 a 10 mEq de cálcio, embora o efei-
to terapêutico seja transitório. A excreção urinária de magné-
sio pode ser aumentada pela expansão do volume de LEC e

Barash_III.indd 177 22/08/14 11:56


178 Barash, Cullen, Stoelting, Cahalan, Stock, Ortega

pela indução de diurese com uma combinação de furosemida


e soro fisiológico. Em situações de emergência e em pacientes
com insuficiência renal, o magnésio pode ser removido por
diálise.

Barash_III.indd 178 22/08/14 11:56


CAPÍTULO

15
Sistema Nervoso Autônomo:
Fisiologia e Farmacologia
Anestesiologia é a prática médica aplicada ao sistema nervoso autônomo
(SNA) (Grecu L. Autonomic nervous system: physiology and pharmacology.
Em: Barash PG, Cullen BF, Stoelting RK, Cahalan MK, Ortega R, Stock MC,
Eds. Clinical Anesthesia. Philadelphia: Lippincott Williams & Wilkins; 2013:
362-407). Os dados registrados no prontuário de anestesia em geral refletem
a função e a homeostasia do SNA. Os fármacos usados durante a anestesia, as-
sim como os estímulos dolorosos e as doenças, frequentemente causam efeitos
colaterais referidos ao SNA.

I. ANATOMIA FUNCIONAL. O SNA é dividido em sistema nervoso sim-


pático (SNS; sistema adrenérgico) e sistema nervoso parassimpático (SNP;
sistema colinérgico) (Fig. 15.1). O SNS e o SNP produzem efeitos comple-
mentares na atividade dos diversos sistemas do corpo (Tab. 15.1).
A. Organização do Sistema Nervoso Autônomo Central. O local prin-
cipal no qual ocorre a integração do SNA (controle da pressão arterial,
regulação da temperatura, respostas ao estresse) é o hipotálamo. Os
centros vitais ao controle hemodinâmico e ventilatório estão localiza-
dos no bulbo e na ponte. A hiper-reflexia do SNA é um exemplo de
mediação da medula espinal nos reflexos do SNA, sem integração da
função com os centros inibitórios superiores.
B. Organização do Sistema Nervoso Autônomo Periférico (Fig. 15.2)
1. O corpo celular do neurônio pré-ganglionar origina-se do sistema
nervoso central (SNC) e forma sinapses com um gânglio autonô-
mico. A medula suprarrenal é uma exceção. As fibras pré-ganglio-
nares são mielinizadas (condução rápida).
2. Os neurônios pós-ganglionares originam-se dos gânglios autonô-
micos e são distribuídos aos órgãos efetores. As fibras pós-ganglio-
nares não são mielinizadas (condução lenta).
a. Os 22 pares de gânglios do SNS (paravertebrais) estão localiza-
dos mais perto da medula espinal que o órgão inervado.
b. Os gânglios do SNP estão localizados no próprio órgão inerva-
do ou em suas proximidades.
3. Enquanto a ativação do SNS desencadeia uma reação fisiológica
global (reflexo em massa), a ativação do SNP causa reações mais
demarcadas. Por exemplo, a estimulação vagal pode causar bradi-
cardia, sem qualquer efeito na motilidade intestinal.
C. Inervação Autonômica
1. Coração. As inervações simpática (SNS) e parassimpática (SNP)
do coração por meio do gânglio estrelado afetam a frequência car-

Barash_III.indd 179 22/08/14 11:56


180 Barash, Cullen, Stoelting, Cahalan, Stock, Ortega

Olho Fibras pré-ganglionares


Fibras pós-ganglionares
Gânglio
Glândula lacrimal ciliar
III
Gânglio
esfenopalatino
VII
Glândula parótida XI
Gânglio ótico
Glândulas Gânglio cervical superior
X
submandibulares
Gânglio C1–C8 Gânglio cervical médio
e sublinguais
esfenopalatino
Gânglio estrelado (cervical inferior)
Brônquios, T1
2 Para vísceras torácicas, coração
pulmões e
3 Suprarrenais
esôfago Gânglio
4 Nervo
Estômago Coração 5 celíaco Rins
e baço esplâncnico
6 maior
T1–T12
Intestinos e parte 7 Gânglio
proximal do colo 8 mesentérico
9 superior
10 Nervo
Fígado 11 esplâncnico Pâncreas e
Pâncreas e menor Para os segmentos superiores
12
suprarrenais L1 intestinos do trato GI
2
3 Gânglio mesentérico
L1–L5
Rins 4 inferior ou pélvico
Gânglio pélvico 5
Colo descendente, S1–S5
reto e órgãos Para segmentos distais
geniturinários do intestino e órgãos
Plexo pélvico Co1–Co2 geniturinários

Distribuição dos nervos parassimpáticos Distribuição dos nervos simpáticos


(sistema craniossacral) (sistema toracolombar)

FIGURA 15.1 Ilustração esquemática da distribuição dos componentes craniossacral


(parassimpático) e toracolombar (simpático) do sistema nervoso autônomo. As fibras
pré-ganglionares parassimpáticas dirigem-se diretamente ao órgão que é inervado
(e causam efeitos discretos e limitados). A ativação das fibras simpáticas causa uma
reação fisiológica mais difusa. GI 5 gastrintestinal.

díaca (cronotropismo), a força das contrações (inotropismo) e o


fluxo sanguíneo coronariano.
a. As fibras vagais cardíacas do SNP são distribuídas principal-
mente aos nodos sinoatrial (SA) e atrioventricular (AV), de
forma que o efeito principal da estimulação vagal do coração
é cronotrópico. A estimulação vagal intensa pode suprimir os
disparos do nodo SA e bloquear a condução dos impulsos aos
ventrículos.
b. O SNS tem a mesma distribuição supraventricular que o SNP,
porém a distribuição é mais ampla para os ventrículos. O tônus
normal do SNS mantém a contratilidade cerca de 20% acima da
que ocorreria se não houvesse estimulação simpática.

Barash_III.indd 180 22/08/14 11:56


Manual de Anestesiologia Clínica 181

TABELA 15.1 Equilíbrio homeostático entre os componentes do


sistema nervoso autônomo
Sistema Nervoso Sistema Nervoso
Simpático Parassimpático
Coração
Nodo sinoatrial Taquicardia Bradicardia
Nodo atrioventricular Facilitação da condução Redução da condução
Sistema de His-Purkinje Aumento da automaticidade Efeito mínimo
Aumento da velocidade de
condução
Miocárdio Aumento da contratilidade Redução mínima da
Aumento da velocidade de contratilidade
condução
Aumento da automaticidade
Vasos coronarianos Constrição (a1)
Dilatação (b1)
Vasos Sanguíneos
Pele e mucosas Constrição Dilatação
Músculo esquelético Constrição (a1) . dilatação Dilatação
(b)
Pulmões Constrição Dilatação
Músculo Liso dos Relaxamento Contração
Brônquios
Trato Gastrintestinal
Vesícula biliar Relaxamento Contração
Motilidade e secreções Redução Aumento
intestinais
Bexiga
Detrusor Relaxamento Contração
Trígono Contração Relaxamento
Glândulas (nasais, Vasoconstrição e redução Aumento das secreções
lacrimais, salivares e das secreções
Anatomia e Fisiologia

pancreáticas)
Glândulas sudoríparas Sudorese (colinérgica) Nenhum efeito
Glândulas apócrinas Secreções espessas e Nenhum efeito
odoríferas
Olhos
Pupila Midríase Miose
Corpo ciliar Relaxamento para visão à Contração para visão
distância de perto

Barash_III.indd 181 22/08/14 11:56


182 Barash, Cullen, Stoelting, Cahalan, Stock, Ortega

Central Periférico
Gânglios do
Simpático
tronco Gânglios colaterais
(sistema toracolombar)
simpático
Coração
Pré-ganglionares Pós-ganglionares Pulmões
NE
Músculo liso
Ach (nicotínico) Glândulas salivares

Pré-ganglionar Pós-ganglionar
ACh Glândulas sudoríparas
Ach (nicotínico)

Pré-ganglionar Pós-ganglionar
NE Vísceras
Ach (nicotínico) Medula suprarrenal

Pré-ganglionar NE
ACh
EPI

Parassimpático
(sacral) Vísceras
(pós-ganglionar)

Pré-ganglionar
ACh ACh
Pré-ganglionar
Pós-ganglionar Muscarínico

FIGURA 15.2 Ilustração esquemática do sistema nervoso autônomo eferente. Ach


5 acetilcolina; EPI 5 epinefrina; NE 5 norepinefrina.

2. Circulação Periférica. O SNS é o regulador mais importante da


circulação periférica. O tônus basal do SNA mantém o diâmetro
arteriolar em torno de 50% do máximo e, desse modo, assegura a
possibilidade de acentuar a vasoconstrição ou a vasodilatação. Por-
que funciona como um reservatório para cerca de 80% do volume
sanguíneo, alterações diminutas da capacitância venosa produzida
pela venoconstrição mediada pelo SNS causam alterações profun-
das do retorno venoso.

II. TRANSMISSÃO NO SISTEMA NERVOSO AUTÔNOMO


A. A transmissão dos impulsos através das áreas juncionais dos nervos
(fendas sinápticas) do SNA periférico ocorre pela liberação de media-
dores químicos (neurotransmissores). Esses neurotransmissores inte-
ragem com um receptor no órgão-alvo e desencadeiam uma resposta
biológica.
B. Neurotransmissão do Sistema Nervoso Parassimpático
1. Acetilcolina (ACh) é o neurotransmissor das terminações dos
nervos pré-ganglionares do SNS e do SNP e das terminações dos
nervos pós-ganglionares do SNP.

Barash_III.indd 182 22/08/14 11:56


Manual de Anestesiologia Clínica 183

2. A capacidade de um receptor modular a função de um órgão efetor


depende da recuperação rápida do seu estado basal após a esti-
mulação. A remoção da ACh ocorre por hidrólise rápida pela ace-
tilcolinesterase (colinesterase verdadeira). A pseudocolinesterase
(colinesterase plasmática) não é fisiologicamente significativa para
a interrupção da ação (hidrólise) da ACh.
C. Neurotransmissão do Sistema Nervoso Simpático
1. Norepinefrina é o neurotransmissor das terminações dos nervos
pós-ganglionares do SNS (exceto nas glândulas sudoríparas, onde
a ACh é o neurotransmissor).
a. O trifosfato de adenosina (ATP) é liberado com a norepinefrina
e, desse modo, funciona como coneurotransmissor.
b. A epinefrina é o principal hormônio liberado pelas células cro-
mafínicas (que funcionam como neurônios pós-ganglionares
do SNS) na circulação, de forma a atuar como um hormônio
neurotransmissor.
2. Catecolaminas: Os Primeiros-Mensageiros
a. As catecolaminas endógenas são dopamina (neurotransmissor
do SNC), norepinefrina e epinefrina. Catecolamina (inclusive as
catecolaminas sintéticas) é qualquer composto com um núcleo
catecol (anel de benzeno com dois grupos hidroxílicos adjacen-
tes) e uma cadeia lateral contendo amina (Fig. 15.3).
b. Os efeitos das catecolaminas endógenas ou sintéticas nos re-
ceptores adrenérgicos podem ser indiretos (pouca atividade in-
trínseca, mas estimulam a liberação de outro neurotransmissor
armazenado) e diretos.
3. A inativação das catecolaminas ocorre por sua receptação para
dentro das terminações pré-sinápticas por captação, difusão e me-
tabolismo extraneuronais.

III. RECEPTORES. Os receptores parecem ser macromoléculas proteicas das


membranas celulares que, quando são ativadas por um agonista (ACh ou
norepinefrina), desencadeiam uma resposta da célula efetora. Antagonista
é uma substância que se liga ao receptor (impede o acesso de um agonista),
mas não desencadeia uma resposta da célula efetora.
Anatomia e Fisiologia

A. Os receptores colinérgicos são subdivididos em muscarínicos (termi-


nações dos nervos pós-ganglionares) e nicotínicos (gânglios autonômi-
cos, junção neuromuscular). A ACh é o neurotransmissor dos recepto-
res colinérgicos. Atropina é um antagonista específico dos receptores
muscarínicos.
B. Os receptores adrenérgicos são subdivididos em a, b e dopaminérgi-
cos, com subtipos em cada categoria (Tab. 15.2).
1. Receptores a-Adrenérgicos do Sistema Cardiovascular
a. Artérias coronárias. Os receptores a2 pós-sinápticos predo-
minam nos vasos de condutância epicárdicos calibrosos. Esses

Barash_III.indd 183 22/08/14 11:56


184 Barash, Cullen, Stoelting, Cahalan, Stock, Ortega

C CH NH2 Fenilalanina

H COOH
COOH

CH2 CH NH2 Tirosina


Tirosina-
HO
-hidroxilase
COOH

Inibição por feedback


HO CH2 CH NH2 Dopa
Dopa-
HO -descarboxilase

HO CH2 CH2 NH2 Dopamina


Dopamina-
HO
-b-hidroxilase
OH

HO CH CH2 NH2 Norepinefrina


Feniletanolamina-
HO N-metiltransferase
OH

HO CH CH2 NH Epinefrina

HO CH3

FIGURA 15.3 Síntese das catecolaminas.

vasos são responsáveis por cerca de 5% da resistência arterial


coronariana total, e isso explica porque a fenilefrina tem pouco
efeito na resistência ao fluxo sanguíneo das artérias coronárias.
Os receptores a2 pós-sinápticos predominam nos vasos de resis-
tência das artérias coronárias pequenas. A densidade de recep-
tores a2 das artérias coronárias aumenta em resposta à isquemia
miocárdica.
b. Vasos Periféricos. Os receptores vasculares a2 pré-sinápticos
causam vasodilatação, enquanto os receptores vasculares a1 e a2
pós-sinápticos causam vasoconstrição. Os receptores vasculares
a2 pós-sinápticos predominam no lado venoso da circulação. As

Barash_III.indd 184 22/08/14 11:56


Barash_III.indd 185
TABELA 15.2 Receptores adrenérgicos e ordem de potência dos agonistas e dos antagonistas
Receptor Potência Agonistas Antagonistas Localização Ação
a1 1111 Norepinefrina Fenoxibenzamina* Músculo liso (vascular, íris, radial, Contração
111 Epinefrina Fentolamina* pilomotor, uterino, trígono, Vasoconstrição
11 Dopamina Alcaloides do esporão esfíncteres do trato GI e da bexiga)
1 Isoproterenol de centeio* Cérebro Neurotransmissão
Prazosina Músculo liso (GI) Relaxamento
Tolazolina* Coração Glicogenólise
Labetalol*
a2 1111 Clonidina Ioimbina Terminações dos nervos adrenérgicos Inibição da liberação de
111 Norepinefrina Piperoxan norepinefrina
11 Epinefrina Fentolamina* Pré-sináptica (SNC) Agregação
11 Norepinefrina Fenoxibenzamina* Plaquetas Liberação de grânulos
1 Fenilefrina Tolazolina* Tecido adiposo Inibição da lipólise
Labetalol* Pâncreas endócrino Inibição da secreção de
Rim insulina
Cérebro Inibição da secreção de renina
Neurotransmissão
(continua)
Manual de Anestesiologia Clínica
185

Anatomia e Fisiologia

22/08/14 11:56
TABELA 15.2 Receptores adrenérgicos e ordem de potência dos agonistas e dos antagonistas (Continuação)
186
Receptor Potência Agonistas Antagonistas Localização Ação

Barash_III.indd 186
b1 1111 Isoproterenol* Acebutolol Coração Aumento da frequência
111 Epinefrina Practolol cardíaca
Aumento da contratilidade
Aumento da velocidade de
condução
11 Norepinefrina Propranolol* Vasodilatação coronariana
1 Dopamina Alprenolol* Tecido adiposo Lipólise
Metoprolol
Esmolol
b2 1111 Isoproterenol Propranolol* Fígado Glicogenólise
111 Epinefrina Butoxamina Gliconeogênese
1 Norepinefrina Alprenolol Músculo esquelético Glicogenólise
Dopamina Esmolol Musculatura lisa Liberação de lactato
Nadolol Relaxamento
Timolol
Labetalol
Barash, Cullen, Stoelting, Cahalan, Stock, Ortega

Dopamina1 1111 Fenoldopam Haloperidol Musculatura lisa vascular Vasodilatação


11 Dopamina Droperidol Renal
1 Epinefrina Fenotiazinas Mesentérica
Metoclopramida
Dopamina2 11 Dopamina Domperidona Terminações dos nervos adrenérgicos Inibição da liberação de
1 Bromocriptina pré-sinápticos norepinefrina
*Não seletivos.
GI 5 gastrintestinal; SNC 5 sistema nervoso central.

22/08/14 11:56
Manual de Anestesiologia Clínica 187

ações atribuídas aos receptores a2 pós-sinápticos incluem vaso-


constrição arterial e venosa, agregação plaquetária, inibição da
secreção de insulina, inibição da motilidade intestinal e inibição
da secreção de hormônio antidiurético.
2. Receptores a do Sistema Renal. Os receptores a1 predominam
nos vasos sanguíneos renais (a vasoconstrição modula o fluxo san-
guíneo renal), enquanto os receptores a2 predominam nos túbulos
renais, especialmente nas alças de Henle (que estimulam a excre-
ção de sódio e água).
3. Receptores b do Sistema Cardiovascular
a. Miocárdio. Os receptores b1 pós-sinápticos e os receptores b2
pré-sinápticos provavelmente desempenham funções seme-
lhantes na regulação da frequência cardíaca e da contratilidade
miocárdica. Os níveis altos de catecolaminas circulantes asso-
ciados à insuficiência cardíaca congestiva causam hiporregula-
ção dos receptores b1, com preservação relativa dos receptores
b2 e a1. (Na insuficiência cardíaca, os receptores b2 e a1 desem-
penham um papel preponderante na resposta inotrópica às ca-
tecolaminas.)
b. Vasos Periféricos. Os receptores b vasculares pós-sinápticos
são predominantemente do subtipo b2.
4. Receptores b do Sistema Renal. Os receptores b1 são mais proe-
minentes que os receptores b2 nos rins, e sua ativação provoca se-
creção de renina.
C. Densidade e Sensibilidade dos Receptores Adrenérgicos
1. Os receptores são regulados dinamicamente por várias condições
(concentrações locais de catecolaminas, fármacos e fatores genéti-
cos), resultando em respostas alteradas às catecolaminas e estimu-
lação do SNA.
2. A alteração do número (ou densidade) de receptores é descrita
pelos termos hiper-regulação ou hiporregulação. O tratamento
prolongado com clonidina ou propranolol causa hiper-regulação
e síndrome de abstinência se o uso do fármaco for interrompido
repentinamente.
Anatomia e Fisiologia

IV. REFLEXOS E INTERAÇÕES DO SISTEMA NERVOSO AUTÔNOMO.


O SNA foi comparado a um circuito de computador (sensor, via aferente,
integração no SNC, via eferente).
A. Os barorreceptores localizados no seio carotídeo e na crossa aórti-
ca reagem às alterações de estiramento causadas pelas oscilações da
pressão arterial (Fig. 15.4). Os anestésicos voláteis interferem com a
função dos barorreceptores; por essa razão, as reduções da pressão ar-
terial induzida pelos anestésicos podem não desencadear alterações da
frequência cardíaca. A complacência dos receptores de estiramento e
sua sensibilidade podem ser alteradas pela aterosclerose do seio caro-

Barash_III.indd 187 22/08/14 11:56


188 Barash, Cullen, Stoelting, Cahalan, Stock, Ortega

Pressão arterial

200
(mm Hg)

0
10 segundos

A Início Fim
Frequência cardíaca

100
(bpm)

B Início Fim
FIGURA 15.4 Respostas da pressão arterial e da frequência cardíaca à manobra de
Valsalva (A, normal; B, anormal em um paciente com tetraplegia cervical).

tídeo. (Vasculopatia carotídea pode ser uma causa de hipertensão, em


vez de uma consequência.)
B. Os barorreceptores venosos localizados no átrio direito e nas veias
calibrosas aumentam a frequência cardíaca quando o átrio direito é
dilatado pela pressão elevada de enchimento (reflexo de Bainbridge).
A redução da frequência cardíaca durante a anestesia raquidiana pode
refletir a ativação dos barorreceptores venosos em consequência da di-
minuição do retorno venoso.

V. FARMACOLOGIA CLÍNICA APLICADA AO SISTEMA NERVOSO


AUTÔNOMO. Os fármacos que alteram a atividade do SNA podem ser
classificados com base em seu local de ação, mecanismo de ação ou doen-
ças (anti-hipertensivos) nas quais são utilizados.
A. Fármacos Colinérgicos. Os agonistas muscarínicos atuam nos locais
do corpo onde o neurotransmissor é a ACh.
1. Colinomiméticos Indiretos. Os anticolinesterásicos (neostigmi-
na, piridostigmina, edrofônio) inibem a atividade da acetilcoli-
nesterase, que normalmente decompõe a ACh por hidrólise. Em
consequência dessa inibição, a ACh acumula-se nos receptores
muscarínicos e nicotínicos. A administração simultânea de um

Barash_III.indd 188 22/08/14 11:56


Manual de Anestesiologia Clínica 189

fármaco anticolinérgico protege os pacientes dos efeitos mus-


carínicos indesejáveis (bradicardia, salivação, broncospasmo,
hipermotilidade intestinal), sem suprimir os efeitos nicotínicos
da ACh (reversão dos efeitos dos relaxantes musculares não des-
polarizantes).
B. Fármacos Colinérgicos. O termo antagonista muscarínico refere-se a
uma ação farmacológica específica, para a qual costuma se usar a descri-
ção anticolinérgica (qualquer fármaco que interfira com a ação da ACh
como neurotransmissor). Os fármacos anticolinérgicos (atropina, esco-
polamina, glicopirrolato) interferem com as ações muscarínicas da ACh
por inibição competitiva dos nervos pós-ganglionares colinérgicos.
1. Existem variações marcantes de sensibilidade aos fármacos antico-
linérgicos nos diferentes sítios receptores muscarínicos.
2. A síndrome anticolinérgica central caracteriza-se por sinais e
sintomas que variam de sedação a delirium, provavelmente secun-
dários à inibição dos receptores muscarínicos do SNC pelos fár-
macos anticolinérgicos (essa síndrome não é provável com o glico-
pirrolato, que não consegue atravessar a barreira hematencefálica).
O tratamento consiste em administrar fisostigmina, porque sua
estrutura de amina terciária permite que ela atravesse rapidamente
a barreira hematencefálica; os outros fármacos anticolinesterásicos
são compostos de amônio quaternário, que não têm a lipossolubi-
lidade necessária para conseguir acesso imediato ao SNC.
C. Fármacos Simpaticomiméticos. As catecolaminas e os fármacos
simpaticomiméticos são a principal classe farmacológica usada que
dá suporte cardiovascular nos estados de hipotensão (Tab. 15.3). O
anestesiologista deve estar familiarizado com alguns fármacos para
tratar a maioria das condições clínicas (Tab. 15.4). A síndrome de
baixo débito ocorre quando um indivíduo apresenta anormalidades
do coração, do volume sanguíneo ou da distribuição do fluxo sanguí-
neo. Se a síndrome de baixo débito persistir por mais de uma hora, ela
em geral se deve a todas essas três anormalidades.
1. Choque séptico é a anormalidade distributiva mais comum, e a
reposição de volume é uma intervenção inicial importante. O tra-
tamento do choque cardiogênico requer várias intervenções no
Anatomia e Fisiologia

sistema nervoso autônomo.


2. Efeitos Adversos. Na maioria dos casos, os efeitos colaterais dos
agonistas a refletem hiperatividade dos receptores a e b.
D. Agonistas Adrenérgicos
1. A fenilefrina é considerada um agonista a puro que produz mais
venoconstrição que constrição arterial. Por isso, o retorno venoso
e a pressão arterial aumentam (o débito cardíaco pode não au-
mentar em razão da bradicardia induzida por esse fármaco).
a. A fenilefrina é preferida nos centros cirúrgicos para aumentar
a pressão arterial durante a circulação extracorpórea, para pa-

Barash_III.indd 189 22/08/14 11:56


190

Barash_III.indd 190
TABELA 15.3 Doses e principais locais de ação dos agonistas adrenérgicos
Fármaco Bólus (IV) Infusão Contínua a1 a2 b1 b2 Dopamina1 Dopamina2
Fenilefrina 50 a 100 mg 0,15 mg/kg/min (10 mg em 11111 ? 1/- 0 0
250 mL, 40 mg/mL)
Norepinefrina 0,1 mg/kg/min (4 mL em 11111 11111 111 0 0
250 mL, 16 mg/mL)
Epinefrina 2 a 8 mg* 0,015 mg/kg/min (1 mL em 11111 111 11111 11 0

0,3 a 0,5 mg 250 mL, 4 mg/mL)
Efedrina 5 a 10 mg 11 ? 111 11 0
Dopamina 2 a 10 mg/kg/min (200 mg 1a ? 1111 11 111 ?
em 250 mL, 800 mg/mL) 1111
Dobutamina 2 a 30 mg/kg/min (250 mg 0a1 ? 1111 11 0
em 250 mL, 1.000 mg/mL)
Isoproterenol 4 mg 0,015 mg/kg/min (0,15 mg/ 0 0 11111 11111 0
kg/min até obter o efeito
Barash, Cullen, Stoelting, Cahalan, Stock, Ortega

desejado no bloqueio
cardíaco de terceiro grau)
1 mg em 250 mL, 4 mg/mL
*Dose para tratar hipertensão.

Dose para tratar parada cardíaca.
IV 5 intravenosa.

22/08/14 11:56
Barash_III.indd 191
TABELA 15.4 Efeitos hemodinâmicos dos agonistas adrenérgicos
Fármaco Frequência Cardíaca Débito Cardíaco Resistência Vascular Sistêmica Retorno Venoso Fluxo Sanguíneo Renal
Fenilefrina Redução Redução Aumento Aumento Redução
Norepinefrina Redução Redução Aumento Aumento Redução
Epinefrina Aumento Aumento Aumento Aumento Redução
Efedrina Aumento Aumento Aumento Aumento Imprevisível
Dopamina Nenhuma alteração Aumento Redução ou nenhuma alteração Aumento Aumento
Dobutamina Aumento Aumento Redução ou nenhuma alteração Imprevisível Aumento ou nenhuma alteração
Isoproterenol Aumento Aumento Redução Redução Aumento ou nenhuma alteração
Manual de Anestesiologia Clínica
191

Anatomia e Fisiologia

22/08/14 11:56
192 Barash, Cullen, Stoelting, Cahalan, Stock, Ortega

cientes com estenose aórtica crítica ou tetralogia de Fallot e para


mulheres hipotensas durante o parto cesáreo.
b. A fenilefrina torna-se cada vez mais o vasopressor preferido na
prática obstétrica. (A efedrina atravessa a barreira placentária
mais facilmente e pode agravar o pH e o excesso de bases do
feto.)
c. A fenilefrina é administrada em dose única (50 a 100 mg por
via intravenosa [IV]) para reverter reduções da pressão arte-
rial induzidas pelos anestésicos e hipotensão durante a cir-
culação extracorpórea e, em infusão contínua, para manter
a pressão de perfusão durante cirurgias neurovasculares e
vasculares periféricas. Nessas situações, a administração deve
ser realizada com cuidado, porque pode provocar isquemia
miocárdica nos pacientes suscetíveis.
2. Norepinefrina e metoxamina produzem efeitos hemodinâmicos
dose-dependentes semelhantes, que se caracterizam por efeitos a e
b mais acentuados.
a. A vasoconstrição aumenta a pressão arterial sistêmica, mas
também reduz o fluxo sanguíneo aos tecidos (principalmente
o fluxo sanguíneo renal) e aumenta a demanda de oxigênio do
miocárdio.
b. A infusão contínua de norepinefrina (que deve ser administrada
por um cateter venoso central) para manter a pressão arterial
sistólica acima de 90 mm Hg requer monitoração invasiva e
atenção à reposição de líquidos.
c. Em condições clínicas caracterizadas por pressão de perfusão
baixa e fluxo aumentado (vasodilatação) e má distribuição do
sangue, a norepinefrina aumenta os fluxos sanguíneos renal e
esplâncnico por elevação da pressão de perfusão, contanto que
o paciente tenha recebido reposição de volume adequada.
3. Epinefrina. Enquanto os efeitos a da epinefrina predominam nas
circulações renal e cutânea e reduzem o fluxo sanguíneo, os efeitos
b aumentam o fluxo sanguíneo dos músculos esqueléticos.
a. As arritmias cardíacas são consequências perigosas do excesso
de estimulação b. (As crianças toleram doses subcutâneas maio-
res que os adultos.)
b. A epinefrina é usada para tratar asma (0,3 a 0,5 mg por via sub-
cutânea) e parada cardíaca ou reações alérgicas potencialmente
fatais (0,3 a 0,5 mg por via IV), produzir hemostasia (1.200.000
ou 5 mg/mL injetados por via subcutânea ou submucosa), pro-
longar a anestesia regional (0,2 mg acrescentado às soluções de
anestésicos locais para bloqueio raquidiano, ou na concentra-
ção de 1:200.000 para produzir bloqueio peridural), ou para
reduzir o sangramento no campo cirúrgico em artroscopia com
infusões de grande volume de soluções contendo epinefrina
(1:200.000).

Barash_III.indd 192 22/08/14 11:56


Manual de Anestesiologia Clínica 193

c. A administração intramuscular da epinefrina é o método prefe-


rido para tratar anafilaxia e crupe moderado a grave.
4. A efedrina produz efeitos cardiovasculares semelhantes aos da epi-
nefrina; porém, sua potência é muito menor, embora a duração da
sua ação seja cerca de 10 vezes maior que a deste último fármaco.
A venoconstrição é mais acentuada que a vasoconstrição arterial;
por essa razão, o retorno venoso e o débito cardíaco aumentam. O
efeito b aumenta a frequência cardíaca e também favorece o débito
cardíaco. Os efeitos a e b da efedrina causam aumentos modestos
e previsíveis da pressão arterial.
a. Taquicardia e arritmias cardíacas podem ocorrer, porém são
menos prováveis do que após a administração de epinefrina.
b. A efedrina é o vasopressor mais utilizado (dose de 5 a 10 mg por
via IV) para tratar reduções da pressão arterial induzidas pela
anestesia (principalmente bloqueios regionais).
c. Hoje em dia, a efedrina é a segunda opção de tratamento para
hipotensão em obstetrícia, porque ela atravessa a placenta e re-
duz o pH fetal.
5. Isoproterenol é um agonista b inespecífico que não produz efeitos
a agonistas. Enquanto o débito cardíaco aumenta em consequên-
cia da aceleração da frequência cardíaca e do aumento da contra-
tilidade miocárdica, as reduções da resistência vascular sistêmica
contribuem para a diminuição da pós-carga.
a. Pacientes suscetíveis podem desenvolver isquemia miocárdica
(as demandas de oxigênio do miocárdio aumentam em con-
sequência da taquicardia e do aumento da contratilidade mio-
cárdica, além de haver redução do fornecimento de oxigênio
às coronárias porque a pressão arterial diastólica diminui). Os
aumentos do débito cardíaco podem ser desviados para tecidos
não vitais, inclusive músculos esqueléticos.
b. O isoproterenol é administrado mais comumente em infusão IV
contínua para tratar insuficiência cardíaca congestiva associada
à bradicardia, asma ou hipertensão pulmonar. Essa catecolami-
na atua como marca-passo cardíaco farmacológico quando há
bloqueio cardíaco completo.
Anatomia e Fisiologia

6. Dobutamina é uma catecolamina sintética derivada do isoprote-


renol que atua diretamente nos receptores b1 e não provoca libera-
ção de norepinefrina ou estimulação dos receptores de dopamina.
Os efeitos agonistas a1 fracos da dobutamina podem ser revelados
pelo betabloqueio. A dobutamina produz efeito inotrópico posi-
tivo com efeitos mínimos na frequência cardíaca e na resistência
vascular sistêmica (uma vantagem comparada ao isoproterenol).
a. A dobutamina pode causar aumentos da automaticidade do
nodo SA e da condução dos impulsos cardíacos pelo nodo AV
e pelos ventrículos, enfatizando a necessidade de cautela ao
administrar esse fármaco aos pacientes com fibrilação atrial

Barash_III.indd 193 22/08/14 11:56


194 Barash, Cullen, Stoelting, Cahalan, Stock, Ortega

ou outras taquiarritmias. A dobutamina pode aumentar mais


a frequência cardíaca que a epinefrina para um determinado
aumento do débito cardíaco.
b. Na maioria dos casos, a dobutamina é administrada (2 a 30 mg/
kg/min por via IV) por seus efeitos inotrópicos nos pacientes
com contratilidade miocárdica reduzida (p. ex., após circulação
extracorpórea).
c. Em doses mais baixas, a redução da resistência vascular sistêmi-
ca sem aumento significativo do cronotropismo faz da dobuta-
mina o fármaco preferido como suporte inotrópico para choque
séptico dos pacientes com disfunção miocárdica.
7. A dopamina tem ação agonista nos receptores dopaminérgicos
(0,5 a 2,0 mg/kg/min por via IV), nos receptores b (2 a 10 mg/
kg/min por via IV) e nos receptores a (. 10 mg/kg/min por via
IV). Taxas de infusão maiores que 10 mg/kg/minuto por via IV
podem causar vasoconstrição suficiente para anular os efeitos fa-
voráveis da dopamina nos receptores dopaminérgicos (aumento
do fluxo sanguíneo renal) e nos receptores b (aumento do débito
cardíaco). O conceito de “dose renal” de dopamina (0,5 a 2,0 mg/
kg/min por via IV) é considerado obsoleto. Apesar da aparente
dependência de dose-resposta à dopamina, estudos demonstra-
ram amplas variações individuais dos efeitos desse fármaco.
a. Taquicardia e arritmias cardíacas ocorrem raramente. O extra-
vasamento da dopamina pode causar gangrena. A pressão da
artéria pulmonar pode aumentar, impedindo o uso desse fárma-
co nos pacientes com insuficiência cardíaca direita. A secreção
de insulina é inibida, e isso explica a ocorrência frequente de
hiperglicemia durante a infusão de dopamina.
b. A dopamina é administrada mais comumente em infusão intra-
venosa contínua (2 a 10 mg/kg/min) por seus efeitos inotrópicos
e diuréticos nos pacientes com contratilidade miocárdica depri-
mida (p. ex., após circulação extracorpórea).
8. Na maioria dos casos, o tratamento combinado consiste em do-
pamina e dobutamina na tentativa de acentuar o efeito inotrópico
positivo com menos vasoconstrição.
E. Fenoldopam é um agonista seletivo dos receptores de dopamina1 sem
qualquer atividade a e b quando comparado com a dopamina.
F. Clonidina é um agonista a2 parcial de ação central seletiva. Esse fár-
maco é usado como anti-hipertensivo por sua capacidade de reduzir a
ativação simpática central.
1. Sedação, bradicardia e ressecamento da boca são efeitos sim-
paticolíticos comuns. A interrupção súbita do uso de clonidina
(p. ex., antes de um procedimento cirúrgico) pode causar hiper-
tensão de rebote, sobretudo quando a dose diária é maior que

Barash_III.indd 194 22/08/14 11:56


Manual de Anestesiologia Clínica 195

1,2 mg. Essa reação hipertensiva pode ser confundida com uma


resposta à superficialização da anestesia, mas em geral demora
cerca de 18 horas para começar. A administração transdérmica
de clonidina é uma alternativa à via oral. A hipertensão poten-
cialmente fatal após a interrupção do tratamento com clonidina
pode ser controlada com nitroprussiato.
2. Além do seu efeito anti-hipertensivo, a clonidina administrada
no período pré-operatório (5 mg/kg por via oral) atenua as rea-
ções reflexas do SNS, inclusive as que estão associadas à larin-
goscopia direta ou à estimulação cirúrgica, reduzindo expressi-
vamente ($ 40%) as doses necessárias de anestésicos voláteis ou
opioides. Quando é injetada no espaço subaracnóideo ou peridu-
ral, a clonidina causa analgesia possivelmente acompanhada de
sedação e bradicardia, mas sem depressão da ventilação.
G. Dexmedetomidina é um agonista a2 mais seletivo que a clonidina. A
capacidade de interação estereosseletiva com receptores, resultando na
redução das doses necessárias dos anestésicos, é uma evidência de que
exista um “receptor anestésico”.
1. Esse fármaco produz sedação excelente (sem depressão da venti-
lação, embora possa ocorrer obstrução das vias aéreas superiores),
tem ação analgésica, reduz a pressão arterial e a frequência car-
díaca (melhora a estabilidade hemodinâmica) e reduz acentuada-
mente os níveis das catecolaminas plasmáticas.
2. A dexmedetomidina é uma alternativa viável para as outras opções
utilizadas durante craniotomia com pacientes despertos, em razão
de seus efeitos respiratórios mínimos e da inexistência de interfe-
rência com a monitoração eletroneurofisiológica.
3. A infusão de 1 mg/kg (dose de impregnação) é administrada em 10
minutos sob monitorização.

VI. FÁRMACOS SIMPATICOMIMÉTICOS NÃO ADRENÉRGICOS


A. A vasopressina e seu congênere desmopressina são preparações exóge-
nas do hormônio antidiurético endógeno.
1. As indicações clínicas da vasopressina incluem o tratamento do
diabetes insípido e o tratamento coadjuvante dos sangramentos
Anatomia e Fisiologia

gastrintestinais (GI) e de varizes esofágicas.


2. Indicações clínicas recentes da vasopressina incluem o suporte
de pacientes em choque séptico e parada cardíaca (40 UI em 40
mL por via IV) secundária à fibrilação ventricular ou à taquicar-
dia ventricular sem pulso. As diretrizes do Suporte Avançado de
Vida Cardiovascular (ACLS, ou Advanced Cardiac Life Support)
recomendam vasopressina em substituição à primeira ou à segun-
da dose de epinefrina durante o tratamento da parada cardíaca
sem pulso.

Barash_III.indd 195 22/08/14 11:56


196 Barash, Cullen, Stoelting, Cahalan, Stock, Ortega

B. Adenosina é um subproduto endógeno do ATP e produz efeitos cro-


notrópicos negativos no nodo SA e também efeitos dromotrópicos ne-
gativos no nodo AV quando administrada por infusão IV. A indicação
clínica principal da adenosina é suprimir taquicardia supraventricular
paroxística (6 mg por via IV [100 a 150 mg/kg por via IV para pacientes
pediátricos]).
C. Os inibidores da fosfodiesterase não atuam por estimulação dos re-
ceptores a ou b. Esses fármacos combinam inotropismo positivo com
atividade vasodilatadora por inibição seletiva da fosfodiesterase.
1. Milrinona é um inibidor da fosfodiesterase mais potente que
não causa alterações plaquetárias e pode ser útil no tratamen-
to intravenoso de curta duração para insuficiência cardíaca
congestiva.
D. Glicosídeos Digitálicos. A digoxina é administrada principalmente
para tratar insuficiência cardíaca congestiva e controlar taquiarrit-
mias supraventriculares (p. ex., fibrilação atrial). O efeito terapêutico
começa dentro de 10 minutos (0,25 a 1,0 mg por via IV para adul-
tos). Os sinais de intoxicação digitálica (arritmias cardíacas, distúr-
bios GI) devem ser investigados durante a avaliação pré-operatória
dos pacientes. A toxicidade digitálica é acentuada por hipopotassemia
ou infusão de cálcio. A hiperventilação pulmonar iatrogênica com
hipopotassemia deve ser evitada durante a anestesia. A maioria dos
especialistas recomenda a manutenção do tratamento digitálico no
período perioperatório, em particular quando o digitálico é usado
para controlar a frequência cardíaca. A administração pré-operatória
profilática das preparações digitálicas é controversa, mas pode ter
utilidade especial nos pacientes idosos submetidos a procedimentos
cirúrgicos torácicos.

VII. FÁRMACOS SIMPATICOLÍTICOS


A. Os antagonistas a causam hipotensão ortostática, taquicardia e miose.
1. A fentolamina é um antagonista competitivo não seletivo dos
receptores a1 e a2 usada em certas situações para o adequado
controle da pressão arterial (doses de 2 a 5 mg por via IV). A
taquicardia é atribuída à liberação pré-sináptica persistente de
norepinefrina em razão do bloqueio dos receptores a2.
2. A prazosina é um antagonista a1 pós-sináptico seletivo que não
interfere com o mecanismo de feedback negativo da liberação de
norepinefrina, que é mediado pela atividade a2 pré-sináptica. Esse
fármaco é útil para a preparação pré-operatória dos pacientes com
feocromocitoma.

Barash_III.indd 196 22/08/14 11:56


Manual de Anestesiologia Clínica 197

B. Os antagonistas b (betabloqueadores) variam quanto às suas proprie-


dades farmacocinéticas e farmacodinâmicas (Tab. 15.5).
1. Os betabloqueadores constituem uma classe farmacológica impor-
tante que é indicada para tratar doença arterial coronariana, hiper-
tensão, insuficiência cardíaca e taquiarritmias. Eles têm sua indica-
ção principal no tratamento dos pacientes que tiveram infarto do
miocárdio (IM). Os betabloqueadores reduzem a mortalidade dos
pacientes com insuficiência cardíaca causada por disfunção sistó-
lica ventricular esquerda. Além disso, reduzem a incidência de IM
perioperatório e podem ser úteis no perioperatório de pacientes de
alto risco submetidos a procedimentos cirúrgicos vasculares ou a
outras intervenções cirúrgicas de alto risco.
2. O estudo POISE concluiu que o betabloqueio perioperatório redu-
ziu o risco de eventos cardíacos, mas aumentou os riscos de mor-
talidade por todas as causas e de acidentes vasculares encefálicos
(AVEs) significativos.
3. O betabloqueio seletivo (cardiosseletivo) oferece mais segurança
ao tratamento dos pacientes com doença pulmonar obstrutiva,
diabetes melito e doença vascular periférica, porque os efeitos
agonistas b2 (broncodilatação, vasodilatação) provavelmente são
mantidos. O significado clínico da atividade de estabilização das
membranas (um efeito anestésico local nas células miocárdicas
em doses altas) e da atividade simpaticomimética intrínseca (ati-
vidade beta-agonista parcial em doses baixas) não foi confirma-
do. Em razão de sua seletividade, os betabloqueadores podem ser
usados no tratamento da insuficiência cardíaca congestiva.
4. O propranolol é um antagonista b não seletivo que pode ser
administrado em doses IV intermitentes de 0,1 a 0,5 mg (dose
máxima de cerca de 2 mg) para reduzir a frequência cardíaca
durante a anestesia. Os efeitos inotrópicos ou cronotrópicos ne-
gativos adicionais são prováveis quando se administram anesté-
sicos inalatórios ou injetáveis, mas não causam problema clínico
significativo.
5. O timolol é administrado como preparação tópica para tratar glau-
coma. A absorção sistêmica pode ser suficiente para causar bradi-
Anatomia e Fisiologia

cardia e hipotensão, que são resistentes à inibição com atropina.


6. Antagonistas Mistos
a. O labetalol produz efeitos b-antagonistas não seletivos e a1
seletivos. Quando é administrado em dose única (0,05 a 0,15
mg/kg por via IV em 2 min), esse fármaco ajuda a controlar a
hipertensão e a taquicardia em resposta à estimulação dolorosa

Barash_III.indd 197 22/08/14 11:56


198

Barash_III.indd 198
TABELA 15.5 Farmacocinética dos b-antagonistas
Atividade de Atividade
Seletividade b1 Estabilização das Simpaticomimética Meia-Vida de
Fármaco Relativa Membranas Intrínseca Eliminação (h) Lipossolubilidade Via de Eliminação
Propranolol 0 1 0 3a4 111 Hepática
Metoprolol 11 0 0 3a4 1 Hepática
Atenolol 11 0 0 6a9 0 Renal
Esmolol 11 0 0 0,16 ? Esterase plasmática
Timolol 0 0 0 4a5 1 Hepática, renal
Barash, Cullen, Stoelting, Cahalan, Stock, Ortega

22/08/14 11:56
Manual de Anestesiologia Clínica 199

durante a anestesia geral. Embora a magnitude desses efeitos


seja menor que os efeitos dos antagonistas b, pode ocorrer piora
da insuficiência cardíaca congestiva ou broncospasmo após a
administração do labetalol.

VIII. BLOQUEADORES DO CANAL DE CÁLCIO. Esses fármacos interagem


com as membranas celulares de forma a interferir com o transporte de cál-
cio para dentro das células por meio de canais iônicos específicos (conhe-
cidos como canais lentos, porque sua transição entre os estados de repou-
so, ativação e inativação é mais lenta, quando comparada com os canais de
sódio rápidos). Os bloqueadores do canal de cálcio constituem um grupo
heterogêneo de fármacos com estruturas diversas e propriedades eletrofi-
siológicas e farmacológicas diferentes. Esses fármacos são muito úteis ao
tratamento das taquiarritmias supraventriculares e do vasospasmo arterial
coronariano (Tab. 15.6).
A. O verapamil é o fármaco preferido para suprimir arritmias supraven-
triculares e também é útil para reduzir a frequência cardíaca dos pa-
cientes com fibrilação e flutter atriais. O intervalo P-R do eletrocardio-
grama aumenta com uma relação dose-dependente e também ocorre
retardo da condução dos impulsos cardíacos pelo nodo AV.
1. É importante ter cuidado ao tratar pacientes com síndrome de
Wolff-Parkinson-White, porque o verapamil pode aumentar a ve-
locidade de condução pela via acessória.
2. Ao contrário dos antagonistas b, o verapamil não aumenta a
resistência das vias aéreas dos pacientes com doença pulmonar
obstrutiva.
B. A nifedipina é mais eficaz que a nitroglicerina no tratamento da angi-
na causada por vasospasmo das artérias coronárias.
1. A vasodilatação causa taquicardia compensatória, e o débito car-
díaco pode aumentar em resposta à redução da pós-carga.
2. A administração de nifedipina é útil durante a anestesia quando há
evidência de isquemia miocárdica associada à hipertensão.
C. O diltiazem é um vasodilatador coronariano eficaz, mas sua ação va-
sodilatadora periférica é insatisfatória; esse fármaco pode causar bradi-
cardia.
Anatomia e Fisiologia

D. A nicardipina causa vasodilatação das arteríolas coronarianas sem al-


terar a atividade do nodo sinusal ou a condução dos estímulos cardía-
cos pelo nodo AV.
E. A nimodipina é um fármaco altamente lipofílico que provoca vasodi-
latação relativamente seletiva das artérias cerebrais, e é usada para re-
duzir as sequelas neurológicas causadas pelo vasospasmo cerebral após
hemorragia subaracnóidea.
F. Felodipino e Clevidipino
1. O felodipino é um fármaco para uso diário que pode ser adminis-
trado para controlar a pressão arterial.

Barash_III.indd 199 22/08/14 11:56


200 Barash, Cullen, Stoelting, Cahalan, Stock, Ortega

TABELA 15.6 Efeitos comparativos dos bloqueadores do canal de


cálcio
Verapamil Nifedipina Diltiazem
Dose
IV (mg/kg) 75 a 150 5 a 15 75 a 150
Oral (mg a cada 8 h) 80 a 160 10 a 20 60 a 90
Efeito inotrópico negativo 1 0 0/1
Efeito cronotrópico negativo 1 0 0/1
Efeito dromotrópico negativo 1111 0 111
Vasodilatação coronariana 11 1111 111
Vasodilatação sistêmica 11 1111 11
Broncodilatação 0/1 0/1
Meia-vida de eliminação (h) 2a7 4a5 4
Via de eliminação Renal Renal Hepática
IV 5 intravenosa.

2. O clevidipino é um bloqueador do canal de cálcio com ação ul-


tracurta (hidrólise éster) após o uso IV e é empregado para tratar
hipertensão moderada a grave (como alternativa à nitroglicerina,
ao nitroprussiato e a nicardipina).
G. Bloqueadores do Canal de Cálcio e Anestesia. Os fármacos desse gru-
po podem causar efeitos depressores miocárdicos aditivos aos anestési-
cos voláteis, que também podem interferir com o transporte do cálcio
para dentro das células. Os opioides não parecem alterar a resposta aos
bloqueadores do canal de cálcio. Aparentemente, os bloqueadores do
canal de cálcio acentuam os efeitos dos relaxantes musculares despola-
rizantes e não despolarizantes, algo semelhante ao que ocorre com os
antibióticos do grupo das “micinas”.

IX. INIBIDORES DA ENZIMA CONVERSORA DE ANGIOTENSINA


A. Os inibidores da enzima conversora de angiotensina (captopril, enala-
pril, lisinopril) impedem a conversão da angiotensina I em angiotensi-
na II. Esses fármacos são eficazes para tratar insuficiência cardíaca con-
gestiva e hipertensão idiopática, bem como hipertensão renovascular e
maligna.
B. Os efeitos colaterais são leves, e o principal efeito cardiovascular adver-
so é a redução da resistência vascular sistêmica.

Barash_III.indd 200 22/08/14 11:56


Manual de Anestesiologia Clínica 201

X. VASODILATADORES. Os vasodilatadores reduzem a pressão arterial


por efeito dose-dependente na musculatura lisa dos vasos sanguíneos que
não dependem dos receptores a ou b (Tab. 15.7). Esses fármacos podem
provocar aumentos da frequência cardíaca mediados pelos barorrecepto-
res. A combinação de um b-antagonista pode ser necessária para controlar
essa taquicardia reflexa (manter a frequência cardíaca abaixo de 100 bati-
mentos/min).
A. A hidralazina (5 a 10 mg por via IV a cada 10 a 20 min) ajuda a contro-
lar a hipertensão perioperatória.
B. O nitroprussiato é administrado por infusão IV contínua (0,25 a 0,5
mg/kg/min) por uma bomba de infusão e com monitoração ininter-
rupta da pressão arterial. A dose é aumentada lentamente até contro-
lar a hipertensão ou causar hipotensão reversível. Em casos raros, são
necessários mais de 3 a 5 mg/kg/minuto de nitroprussiato para tratar
hipertensão em pacientes anestesiados. As reações hipertensivas agu-
das podem ser tratadas com doses IV intermitentes de 50 a 100 mg.
1. O efeito hipotensor do nitroprussiato depende do relaxamento
direto da musculatura lisa das artérias e das veias, com reduções
resultantes da pré-carga e da pós-carga. Os efeitos hipotensores
desse fármaco são potencializados pelos anestésicos voláteis e por
hemorragia.
2. O íon ferroso do nitroprussiato reage com os grupos sulfidrila das
hemácias e libera cianeto, que é reduzido a tiocianato no fígado.
Doses altas de nitroprussiato (. 10 mg/kg/min por via IV) podem
causar intoxicação por cianeto. Não há evidência de que doenças
renais ou hepáticas aumentem as chances de ocorrer intoxicação
por cianeto.
a. Taquifilaxia, aumento da pressão venosa de oxigênio e acido-
se metabólica são sinais de intoxicação por cianeto (o cianeto
liga-se a citocromo-oxidase e causa hipoxia celular) e indicam a
necessidade de interromper imediatamente a infusão de nitro-
prussiato.
b. O tratamento da intoxicação por cianeto consiste em adminis-
trar tiossulfato de sódio (150 mg/kg por via IV em 50 mL de
água) durante 15 minutos para acelerar a conversão do cianeto
Anatomia e Fisiologia

em tiocianato.
C. A nitroglicerina é administrada por infusão IV contínua (0,25 a 3,0
mg/kg/min) para tratar isquemia miocárdica. Esse fármaco atua predo-
minantemente nas vênulas, aumentando a capacitância venosa e redu-
zindo o retorno venoso.
1. O controle da hipertensão com nitroglicerina é menos eficiente
que com nitroprussiato, enfatizando o efeito mínimo deste primei-
ro fármaco na musculatura lisa das artérias.

Barash_III.indd 201 22/08/14 11:56


202

Barash_III.indd 202
TABELA 15.7 Doses e locais de ação dos vasodilatadores
Fármaco Bólus (Adulto, IV) Infusão Contínua (Adulto, IV) Local de Ação Início (min) Duração
Hidralazina 5 a 10 mg Arterial 15 a 20 4a6h
Nitroprussiato 50 a 100 mg 0,25 a 0,5 mg/kg/min (50 mg em 250 mL, 200 mg/mL) Arterial, venoso 1a2 2 a 5 min
Nitroglicerina 0,25 a 3 mg/kg/min (50 mg em 250 mL, 200 mg/mL) Venoso, arterial 2a5 3 a 5 min
Barash, Cullen, Stoelting, Cahalan, Stock, Ortega

22/08/14 11:56
Manual de Anestesiologia Clínica 203

2. Ao contrário do nitroprussiato, a nitroglicerina não acarreta risco


de intoxicação por cianeto. Por essa razão, a nitroglicerina pode
ser preferível ao nitroprussiato para controlar hipertensão associa-
da à gestação.
D. A nesiritida é uma preparação recombinante do peptídeo natriurético
humano tipo B que produz efeitos hemodinâmicos favoráveis por va-
sodilatação arterial e venosa, inclusive vasodilatação das artérias coro-
nárias.

Anatomia e Fisiologia

Barash_III.indd 203 22/08/14 11:56


CAPÍTULO

16
Hemostasia e Medicina Transfusional
O tratamento perioperatório com hemocomponentes representa no mínimo
23% de todas as transfusões de produtos sanguíneos (Carabini LM, Ramsey G.
Hemostasis and transfusion medicine. Em: Barash PG, Cullen BF, Stoelting RK,
Cahalan MK, Ortega R, Stock MC, Eds. Clinical Anesthesia. Philadelphia: Lip-
pincott Williams & Wilkins; 2013: 408-444). De forma a prestar melhores cuida-
dos aos seus pacientes, é fundamental que os anestesiologistas compreendam os
efeitos terapêuticos benéficos, os efeitos adversos comuns e raros e os detalhes
terapêuticos específicos sobre preparação e técnica de administração de cada
hemocomponente.

I. HEMOSTASIA E COAGULAÇÃO
A. Hemostasia Primária. O equilíbrio delicado entre anticoagulação e
coagulação é mantido por um sistema complexo de proteínas e células
(plaquetas) sanguíneas contrabalançadas. Alguns distúrbios congênitos
e adquiridos podem desviar esse sistema de modo a favorecer hemor-
ragia ou trombose. Alguns exames podem ser usados para avaliar o
sistema e, em seguida, adotar medidas terapêuticas para corrigir esses
distúrbios.
1. As plaquetas aderem aos locais em que houve lesão do endotélio;
são ativadas a recrutar mais plaquetas e amplificar a resposta des-
sas células; e, em seguida, formam ligações cruzadas com a fibrina
(produto final da cascata de fatores plasmáticos da coagulação)
para produzir um tampão plaquetário (Fig. 16.1).
2. A fim de manter o equilíbrio hemostático, as plaquetas estão natu-
ralmente inibidas em seu ambiente endotelial.
B. Hemostasia Secundária. Os fatores da coagulação do plasma são ati-
vados nos locais em que ocorre lesão do endotélio e formam complexos
enzimáticos que ativam a trombina.
1. A via extrínseca começa quando a lesão do endotélio expõe o fator
tecidual das membranas das células subjacentes, ou seja, um pro-
cesso extrínseco à circulação (Fig. 16.2A-E).
2. A via intrínseca depende da trombina, que desempenha várias
funções primordiais (Fig. 16.2F-J).
a. Os fatores da coagulação são produzidos principalmente no
fígado, com exceção do fator VIII, que também é liberado pe-
las células endoteliais e não se altera na doença hepática.
b. As meias-vidas plasmáticas da maioria dos fatores da coagula-
ção giram em torno de 1,5 a 3 dias, mas as meias-vidas do fator
VII (6 h) e dos cofatores V e VIII (8 a 12 h) são muito mais
breves.
3. Inibição dos Fatores da Coagulação (Fig. 16.3)

Barash_III.indd 204 22/08/14 11:56


B. Ativação
TxAZ
Trombina
ADP Serotonina
Agonistas: Epinefrina
Vasopressina

Barash_III.indd 205
Outros
GPCRs: TP PAR-1 PAR-4 P2Y1 P2Y12
GPCRs COX-1

PLA2 AA TxAZ

G
PK ADP
Serotonina
Grânulos densos Ca21
P
cGM A Ca21
PK
Fatores da coagulação
Grânulos a
IP3 Outras proteínas
D. Inibição P PLC
M
NO cA Alteração do formato da plaqueta
AC
DAG
Outros efeitos da ativação:
IP
I Z/ Selectina-P de superfície
PG E
PD Ligando CD40: superfície e liberação
P
AM Liberação de micropartículas
c PKC

En
Ativação dos leucócitos

do

Ib/IX Ia/IIa, GP VI

lio
Integrinas:
vWF Colágeno
Fibrina Ligações cruzadas
Cisalhamento intenso Cisalhamento leve Ativação vWF entre plaquetas
da IIb/IIIa
Endotélio lesado
A. Aderência C. Estabilização

FIGURA 16.1 Visão geral dos mecanismos que resultam na adesão, ativação, estabilização e inibição fisiológica das plaquetas. AA 5 ácido araqui-
Manual de Anestesiologia Clínica

dônico; ADP 5 difosfato de adenosina; AMPc 5 monofosfato de adenosina cíclico; COX 5 cicloxigenase; DAG 5 diacilglicerol; GP 5 glicoproteína;
GPCR 5 receptor acoplado à proteína G; IP3 5 trifosfato de inositol; NO 5 óxido nítrico; PAR 5 receptor ativado por proteinase; PDE 5 fosfodieste-
rase; PGI2 5 prostaciclina I2; PKC 5 proteinocinase C; PKG 5 proteinocinase G; PLA 5 fosfolipase A; PLC 5 fosfolipase C; TP 5 terutrobano; TXA 5
205

tromboxano; vWF 5 fator de von Willebrand.

Anatomia e Fisiologia

22/08/14 11:56
206 Barash, Cullen, Stoelting, Cahalan, Stock, Ortega

Fibrina Fibrina Fibrinogênio


estável XIIIa
IIa
K
TF A
XIII II
Complexo
protrombinase
Xa–Va J
TF B

Complexo Xa X
VII VIIa tenase
IXa–VIIIa I
TF–VIIa C

IX IXa
X Xa IX IXa
IXa H
XI XIa
TFPI–Xa
TF–VIIa
TF–VIIa
D
Xa IIa
TFPI
vWF-–VIII VIIIa G
Complexo Plaqueta
protrombinase E IIa
TF–VIIa (V)
Xa–Va IIa
vWF
V Va F
II IIa IIa
(trombina)
(Ativação)

FIGURA 16.2 Resumo da hemostasia secundária e das vias intrínseca, extrínseca e


comum da coagulação. TF 5 fator tecidual; TFPI 5 inibidor da via do fator tecidual;
vWF 5 fator de von Willebrand.

II. FIBRINÓLISE
A. Os trombos de fibrina precisam ser decompostos depois de finalizar
seu trabalho, e a fibrinólise também é um processo balanceado com-
plexo com inibidores e ativadores. No final, o plasminogênio é ativado
em plasmina, que decompõe os polímeros de fibrina (Fig. 16.4).
B. Inibição da Fibrinólise (ver Fig. 16.4)

III. AVALIAÇÃO LABORATORIAL DA HEMOSTASIA. O primeiro com-


ponente investigativo da triagem para distúrbios da hemostasia sempre
deve ser a história médica do paciente (Tab. 16.1).

IV. AVALIAÇÃO LABORATORIAL DA HEMOSTASIA PRIMÁRIA


A. A contagem automatizada normal de plaquetas dos adultos varia en-
tre 150.000 e 400.000/mL. O esfregaço de sangue periférico deve ser
examinado quando as contagens ou as dimensões das plaquetas são

Barash_III.indd 206 22/08/14 11:56


Manual de Anestesiologia Clínica 207

XII XIIa
TF
XI XIa
VIIa VII
IX IXa
TF–VIIa 1
IXa–VIIIa TFPI
X
X Xa–Va (Proteína S)
5
Antitrombina aPC Proteína C
II IIa
2

I Ia TM–IIa
4
ADPase eNO PgI2 tPA
Heparano TM
Glicocálix 3 (Células endoteliais)
FIGURA 16.3 Ilustração da regulação antitrombótica da hemostasia. aPC 5 pro-
teína C ativada; eNO 5 óxido nítrico expirado; PGI2 5 prostaciclina; TF 5 fator teci-
dual; TFPI 5 inibidor da via do fator tecidual; TM 5 trombomodulina; t-PA 5 ativador
do plasminogênio tecidual; vWF 5 fator de von Willebrand.

FXIII

Trombina

FXIIIa

Fibrinogênio Fibrina Fibrina


estável
TAFI
Anatomia e Fisiologia

Plasminogênio Plasmina

PAI-1
FDPs
tPA

(Células endoteliais)
FIGURA 16.4 Mecanismos e regulação da fibrinólise. FDP 5 produto de decompo-
sição da fibrina; PAI-1 5 inibidor do ativador de plasminogênio tipo 1; TAFI 5 inibidor
da fibrinólise ativável por trombina; t-PA 5 ativador do plasminogênio tecidual.

Barash_III.indd 207 22/08/14 11:56


208 Barash, Cullen, Stoelting, Cahalan, Stock, Ortega

TABELA 16.1 História clínica como exame de triagem para


distúrbios da hemostasia
Tipo de Distúrbio Hemorrágico
Sangramento da pele ou da mucosa (disfunção plaquetária)
Hemartroses ou sangramento em tecidos moles (deficiências de fator)
Tromboses

História de Alterações da Hemostasia (procedimentos cirúrgicos ou dentários,


menstruação)
Distúrbios congênitos

Fármacos (rever antes de solicitar exames laboratoriais)


Anticoagulantes
Antiplaquetários (fármacos vendidos sem prescrição)

anormais no exame automatizado. A agregação plaquetária é o teste da


função plaquetária global mais detalhado.
B. Doença de von Willebrand (DvW) é uma deficiência de fator que acar-
reta manifestações clínicas de disfunção plaquetária em razão da fun-
ção fundamental do fator de von Willebrand (vWF) na ligação cruzada
das plaquetas ativadas para formar o tampão plaquetário. Os exames
iniciais para DvW incluem nível de antígeno do vWF, grau de atividade
do vWF e nível de atividade do fator VIII para comparação com o vWF.

V. AVALIAÇÃO LABORATORIAL DA HEMOSTASIA SECUNDÁRIA E


DA COAGULAÇÃO
A. Uma visão geral da atividade dos fatores da coagulação plasmática
pode ser obtida com o tempo de protrombina (TP) para a via intrínseca
(tecidual) e o tempo de tromboplastina parcial ativada (TTPa) para a via
extrínseca, mas esses dois exames são concluídos pela via comum (ver
Fig. 16.1).
1. As faixas normais representativas oscilam em torno de 12 a 15 se-
gundos para o TP e 25 a 35 segundos para o TTPa, mas as faixas de
referência são definidas por cada laboratório, que utiliza seus pró-
prios equipamentos, reagentes e espécimes normais. Esses exames
são realizados rotineiramente a 37ºC, mas a hipotermia de um pa-
ciente dificulta as reações enzimáticas para formação do trombo.
2. A maioria dos ensaios avalia a conversão funcional do fibrinogênio
em fibrina, embora o nível de fibrinogênio também possa ser de-
terminado com finalidade comparativa de forma a investigar dis-
túrbios do fibrinogênio. Os níveis normais de fibrinogênio variam
de 150 a 400 mg/dL.

Barash_III.indd 208 22/08/14 11:56


Manual de Anestesiologia Clínica 209

B. Exames Combinados. Para investigar níveis inesperadamente altos de


TP ou TTPa, os exames devem ser repetidos depois de misturar o plas-
ma do paciente com volumes iguais de plasma normal.
1. Quando há deficiências graves de fatores da coagulação, o TP e
o TTPa mostram correção expressiva no sentido dos valores nor-
mais após um teste combinado.
2. Quando o plasma do paciente contém um inibidor ou um anticoa-
gulante, o plasma normal também é afetado e o TP ou o TTPa não
é corrigido.
C. Os níveis de atividade de cada fator da coagulação são determinados
pelo grau de correção que o plasma do paciente alcança quando é mis-
turado com plasma com deficiência de um fator específico.
D. Inibidores da coagulação são substâncias (em geral, anticorpos) que
bloqueiam um ou mais fatores da coagulação.
E. Coagulação intravascular disseminada (CID) é um distúrbio da coagu-
lação iniciado por ativação sistêmica patológica da via intrínseca.
F. Outros exames realizados comumente durante procedimentos cirúr-
gicos com amostras de sangue total são tempo de coagulação ativada
(TCA), tempo de coagulação de ecarina (TCE) e coagulação viscoelásti-
ca do sangue total com tromboelastograma.
1. O TCA é um teste realizado à beira do leito para avaliar a via in-
trínseca da coagulação e sobretudo para monitorar a anticoagula-
ção com heparina e sua reversão com protamina durante circula-
ção extracorpórea ou procedimento cirúrgico vascular.
2. A coagulação do sangue total e a fibrinólise podem ser avaliadas
pelo teste viscoelástico em tromboelastograma.

VI. DIAGNÓSTICO DOS DISTÚRBIOS TROMBOEMBÓLICOS


O risco de trombose venosa profunda (TVP) aumenta quando há fatores
intercorrentes como inatividade física ou imobilização, câncer, anticoncep-
cionais orais, tratamento de reposição com estrogênio e gravidez.
A. Fatores de Risco Congênitos para Trombose
1. Os distúrbios congênitos são classificados basicamente como de-
ficiências das vias antitrombóticas ou estados de hipercoagulabili-
dade.
Anatomia e Fisiologia

2. Vários fatores congênitos afetam o complexo da proteinase C e


sua função. A proteína C propriamente dita está funcionalmente
deficiente em 0,5% da população, com padrão hereditário autossô-
mico dominante. Isso resulta na hiperatividade do fator VIII e do
cofator V em seus respectivos complexos de tenase e protrombina-
se da via intrínseca.
B. Fatores de Risco Adquiridos para Trombose (Tab. 16.2)

Barash_III.indd 209 22/08/14 11:56


210 Barash, Cullen, Stoelting, Cahalan, Stock, Ortega

TABELA 16.2 Fatores de risco adquiridos para trombose


Anticorpos antifosfolipídicos
Anticorpos anticoagulantes lúpicos
• TTPa prolongado (nem todos os pacientes têm prolongamento deste teste)
• Tempo de veneno de Russel diluído
Hiper-homocisteinemia
TTPa 5 tempo de tromboplastina parcial ativada.

VII. MONITORAÇÃO DA ANTICOAGULAÇÃO TERAPÊUTICA. A maio-


ria dos tratamentos anticoagulantes requer exames contínuos ou seletivos
para avaliar seu efeito terapêutico. A monitoração apropriada assegura que
os níveis desses fármacos sejam mantidos nas faixas terapêuticas; se isso
não ocorrer, os pacientes estão sujeitos a tromboembolismo e complica-
ções hemorrágicas.
A. Anticoagulação com Varfarina. O tratamento com varfarina deve ser
monitorado pelo TP e seu análogo INR (razão normalizada internacio-
nal, ou international normalized ratio, em inglês) para essa finalidade,
de forma a evitar coagulação insuficiente ou excessiva.
1. As técnicas e os reagentes do TP podem diferir amplamente entre
os diversos laboratórios, produzindo resultados variáveis de TP
para o mesmo grau de deficiência do fator.
2. O INR é um valor normalizado cuja finalidade é comparar os re-
sultados entre os diversos laboratórios.
B. Testes para Anticoagulação com Heparina. O TTPa é usado para ava-
liar a anticoagulação com heparina. Cada laboratório determina sua
própria faixa terapêutica almejada para a anticoagulação com heparina
(em geral, na faixa de 1,5 a 2,5 vezes acima da média normal).
1. As heparinas de baixo peso molecular (HBPMs) e seu análogo
pentassacarídico sintético (fondaparinux) não afetam o ensaio de
TTPa e, em geral, não é preciso realizar estudos da coagulação.
2. A heparina e, em menor grau, as HBPMs podem estimular a pro-
dução de anticorpos contra o complexo do fator 4 plaquetário liga-
do à heparina. Por sua vez, esses anticorpos podem causar trombo-
citopenia induzida pela heparina (TIH) ou ativação das plaquetas
com trombose subsequente.
C. Os anticoagulantes mais novos (alternativas à heparina para pacien-
tes com TIH ou em tratamento com varfarina) são anticoagulantes
diretos (rivaroxabana, apixabana) cujas ações não são mediadas pela
antitrombina. Eles prolongam o TP e o TTPa, mas a monitoração des-
ses exames não é recomendada e o INR não deve ser usado.
D. Os inibidores diretos da trombina (IDTs) prolongam o TP e o TTPa e
interferem com os ensaios de fibrinogênio baseados em coágulo.

Barash_III.indd 210 22/08/14 11:56


Manual de Anestesiologia Clínica 211

VIII. PRODUÇÃO DE HEMOCOMPONENTES


A. Coleta de Sangue (Tab. 16.3). A produção de hemocomponentes é ri-
gorosamente controlada por regulamentos e requisitos de acreditação
de forma a assegurar os interesses do doador, a segurança do receptor e
a eficácia terapêutica. Os doadores de sangue são cuidadosamente tria-
dos e testados, e os hemocomponentes são produzidos em laboratórios
e outros serviços especializados.
B. Processamento e Armazenamento dos Hemocomponentes
1. A leucorredução separa os leucócitos das hemácias e das plaquetas e
reduz o risco de aloimunização aos antígenos leucocitários, reações
transfusionais não hemolíticas febris e transmissão do citomegalo-
vírus (CMV) aos pacientes que necessitam dessas precauções.
2. A lavagem dos componentes celulares com soro fisiológico é rea-
lizada sobretudo para remover plasma antes de transfundir nos
pacientes que tiveram reações transfusionais alérgicas, inclusive
portadores de deficiência de imunoglobulina A.
3. A irradiação dos componentes celulares é realizada para evitar
doença enxerto-versus-hospedeiro (DEVH) após transfusão de
hemocomponentes de doadores parentes consanguíneos e para
pacientes profundamente imunossuprimidos (portadores de leu-
cemia ou linfoma, receptores de transplantes de células-tronco
hematopoiéticas, ou pacientes com imunodeficiências celulares
congênitas) em risco de desenvolver essa complicação.

TABELA 16.3 Hemocomponentes


Hemocomponente Volume Médio Condições de Armazenamento
Concentrado de hemácias 300 mL 1 a 6ºC por 21 a 35 dias, ou 42
dias com solução aditiva
Hemácias congeladas 300 mL , 265ºC por 10 anos
Plaquetas derivadas do 50 mL por bolsa; dose 20 a 24ºC por 5 dias
Anatomia e Fisiologia

sangue total habitual: 4 a 6 bolsas


Plaquetas separadas por 300 mL 20 a 24ºC por 5 dias
aférese
Plasma fresco congelado 250 mL , 218ºC por 1 ano, ou
, 265ºC por 7 anos
Plasma fresco congelado 250 mL , 218ºC por 1 ano
dentro de 24 h
Crioprecipitado 15 mL por bolsa; dose , 218ºC por 1 ano
habitual: 4 a 6 bolsas

Barash_III.indd 211 22/08/14 11:56


212 Barash, Cullen, Stoelting, Cahalan, Stock, Ortega

4. As plaquetas são armazenadas sob temperatura ambiente para pre-


servar sua função coagulante, mas isso aumenta o risco de prolife-
ração bacteriana nas unidades contaminadas, em comparação com
outros hemocomponentes.
5. As soluções de preservação de hemácias usam CDPA (citrato como
anticoagulante, fosfato como tampão, adenina e 1 a 2 g de dextrose
para manter os níveis do trifosfato de adenosina e a integridade da
membrana das hemácias).
C. Hemoderivados (ou derivados do plasma, como albumina, imunoglo-
bulinas, fatores da coagulação) são proteínas processadas e retiradas do
plasma para infusão terapêutica.
1. A albumina é produzida em grandes quantidades para fornecer
suporte ao volume intravascular e é pasteurizada a 60ºC para asse-
gurar sua esterilidade.
2. As imunoglobulinas (Igs) são administradas como suporte imune
ou imunomodulação para suprimir a produção de anticorpos na-
turais.

IX. HEMOCOMPONENTES E LIMITES TRANSFUSIONAIS


A. Testes de Compatibilidade
1. A testagem rotineira de compatibilidade de hemácias inclui classi-
ficação ABO e fator RhD, triagem de anticorpos IgG contra outros
antígenos eritrocitários (exceto ABO) e prova-cruzada.
2. As hemácias devem ser ABO-compatíveis para evitar hemólise in-
travascular, e os pacientes RhD-negativos devem receber hemácias
D-negativas para evitar aloimunização anti-D.
3. Os anticorpos anti-Rh, Kell, Kidd, Duffy e alguns outros não per-
tencentes ao sistema ABO podem hemolisar as hemácias trans-
fundidas; 1% de todos os pacientes e 5 a 20% dos pacientes que
recebem transfusões maciças desenvolvem esses anticorpos.
B. Hemácias
1. De acordo com as Diretrizes Práticas para Tratamento com Hemo-
componentes da American Society for Anesthesiologists, “a trans-
fusão de hemácias raramente está indicada quando a concentração
de hemoglobina é maior que 10 g/dL e quase sempre recomendada
quando menor que 6 g/dL”.
2. No passado, os pacientes com doença cardiovascular e anemia
eram considerados em risco significativo de isquemia tecidual
e, por essa razão, acreditava-se que fossem beneficiados por me-
tas de hemoglobina mais altas durante o período perioperatório.
Revisões realizadas recentemente contradisseram essas hipóteses
quando documentaram a segurança de hematócrito , 24% duran-
te cirurgias cardíacas com circulação extracorpórea.

Barash_III.indd 212 22/08/14 11:56


Manual de Anestesiologia Clínica 213

3. Os pacientes com doença vascular encefálica ou doença neurológica


aguda (p. ex., acidente vascular encefálico [AVE] isquêmico, hemor-
ragia subaracnóidea e traumatismo cranioencefálico) têm riscos sig-
nificativos de desenvolver complicações secundárias à hipoxia teci-
dual. (Existem evidências de que os níveis de hemoglobina , 9 g/
dL sejam fatores preditivos independentes de desfecho desfavorável,
sobretudo nos pacientes com lesão vascular encefálica.)

X. COMPENSAÇÃO FISIOLÓGICA DA ANEMIA (Tab. 16.4)


A. A justificativa clínica da transfusão de hemácias supõe que o aumento
da hemoglobina melhora a capacidade de transportar oxigênio e, desse
modo, evita hipoxia tecidual. Contudo, como o organismo tem capaci-
dade de compensar anemia, não está claro se a elevação da hemoglo-
bina de um paciente anêmico estável realmente melhora a oxigenação
dos tecidos.
1. Os mecanismos compensatórios da anemia são (i) aumento do
débito cardíaco; (ii) alteração do fluxo sanguíneo da microcircula-
ção; e (iii) aumento da taxa de extração de oxigênio da hemoglobi-
na nos tecidos.
2. Essas alterações fisiológicas, junto com o impacto deletério do
armazenamento das hemácias, limitam a eficácia terapêutica das
transfusões (ver Tab. 16.4).

TABELA 16.4 Equações para avaliar a oxigenação tecidual


Parâmetro Unidade Equação
Fornecimento de mL de O2/min DO2 5 DC (L/min) 3 CaO2 (mL/dL)
oxigênio (DO2)
Conteúdo arterial de mL de O2/dL CaO2 5 1,36 3 Hb (g/dL) 3 SaO2 (%)
oxigênio (CaO2) 1 [PaO2 3 0,003]
Conteúdo venoso de CvO2 5 1,36 3 Hb (g/dL) 3 SVO2 (%)
oxigênio (CvO2) 1 [PVO2 3 0,003]
4
Fluxo sanguíneo, débito L/min Fluxo 5 pr DP/8hL
Anatomia e Fisiologia

cardíaco (DC)
Consumo de oxigênio mL de O2/min VO2 5 DC (L/min) 3 [CaO2 2 CvO2]
(VO2)
Taxa de extração de Percentagem O2EF 5 [CaO2 2 CvO2]/CaO2 3 100%,
oxigênio (O2EF) Ou 5 VO2/DO2 3 100%
DP 5 variação de pressão; h 5 viscosidade; Hb 5 hemoglobina; L 5 comprimento do vaso;
PaO2 5 pressão parcial de oxigênio do sangue arterial; PvO2 5 pressão parcial de oxigênio do sangue
venoso; r 5 raio.

Barash_III.indd 213 22/08/14 11:56


214 Barash, Cullen, Stoelting, Cahalan, Stock, Ortega

TABELA 16.5 Indicadores clínicos de hipoxia tecidual


Sinais Vitais Instáveis
Taquicardia
Hipotensão
Taquipneia ou dispneia

Indicadores Laboratoriais de Monitorização Invasiva


Saturação de O2 venoso misto (SVmO2) , 50%
Saturação de O2 venoso central (SVcO2) , 60%
Taxa de extração de O2 (O2ER) . 50%
Acidose láctica (acidemia metabólica com lactato . 2 mmol/L)

Sinais de Disfunção de Órgãos-Alvo


Alterações do eletrocardiograma (alterações de ST, arritmias de início recente) ou
indícios ecocardiográficos de isquemia miocárdica
Indícios eletroencefalográficos de hipoperfusão cerebral
Oligúria de início recente (, 0,5 mL/kg/h por mais de 6 h)

B. Ainda existem controvérsias quanto à transfusão de hemácias, em vista


da ausência de evidências a favor de um limiar transfusional aplicável a
todos os casos.
1. Apesar da literatura abundante documentando os efeitos deletérios
potenciais, as transfusões ainda são fundamentais ao tratamento
das anemias agudas e crônicas (Tab. 16.5).
2. Nos pacientes estáveis sem sangramento em atividade, a hemo-
globina deve aumentar 1 g/dL e o hematócrito cerca de 3% após
transfusão de cada unidade de concentrado de hemácias.
3. No caso de perda sanguínea descompensada, os níveis de hemo-
globina podem estar normais ou artificialmente altos. Nesses ca-
sos, o médico deve estimar a perda sanguínea com base no quadro
hemodinâmico do cliente e na avaliação do campo operatório para
orientar o tratamento transfusional.

XI. PLAQUETAS. Diversas recomendações orientam o tratamento transfu-


sional dos pacientes com trombocitopenia e distúrbios plaquetários here-
ditários ou adquiridos (Tab. 16.6).
A. Como preparação para procedimentos cirúrgicos oftalmológicos ou do
sistema nervoso central, a contagem de plaquetas deve ser elevada a
. 100.000/mL.
B. A transfusão de plaquetas não deve ser determinada pelas contagens
plaquetárias apenas, mas também pela suspeita clínica de disfunção
plaquetária, que pode ser hereditária ou adquirida (Tab. 16.7).

Barash_III.indd 214 22/08/14 11:56


Manual de Anestesiologia Clínica 215

TABELA 16.6 Indicações para transfusão de plaquetas


Pacientes estáveis sem evidência de sangramento ou coagulopatia , 10.000/mL
Profilaxia antes de procedimentos invasivos como punção lombar, , 50.000/mL
anestesia neuroaxial, cateterização venosa central, endoscopia com
biópsia, biópsia hepática ou cirurgias de grande porte
Pacientes estáveis com indícios clínicos de sangramento ou , 50.000/mL
coagulopatia
Pacientes com CID e sinais de sangramento em atividade , 50.000/mL
Pacientes submetidos a transfusões maciças , 75.000/mL
Pacientes submetidos a intervenções cirúrgicas em locais críticos, , 100.000/mL
como olho ou SNC
Sangramento microvascular atribuído à disfunção plaquetária, A critério do
inclusive por uremia, doença hepática ou pós-circulação médico
extracorpórea
CID 5 coagulação intravascular disseminada; SNC 5 sistema nervoso central.

XII. PLASMA FRESCO CONGELADO (PFC) é um hemocomponente que


contém todos os fatores necessários à hemostasia (indicado para tratar
coagulopatias secundárias às deficiências hereditárias ou adquiridas de
fatores da coagulação). As reações adversas, os benefícios profiláticos li-
mitados e a frequência alta de utilização inadequada fazem do PFC o mais
arriscado hemocomponente a ser transfundido (Tab. 16.8).

TABELA 16.7 Causas de disfunção plaquetária adquirida


Uremia
Doença hepática
Paraproteinemia (mieloma múltiplo, macroglobulinemia de Waldenström, gamopatia
monoclonal, ou hipergamaglobulinemia policlonal)
Doença mieloproliferativa
Anatomia e Fisiologia

Síndrome mielodisplásica
Coagulopatia intravascular disseminada
Circulação extracorpórea (diálise, plasmaférese)
Fármacos (aspirina, AINEs, tienopiridinas, antagonistas da GP IIb/IIIa, antibióticos
betalactâmicos, antidepressivos, fenotiazinas)
Fitoterápicos (óleo de peixe, óleo de linhaça, extrato de sementes de gengibre, Ginkgo
biloba, alho, açafrão-da-índia)
AINEs 5 anti-inflamatórios não esteroides; GP 5 glicoproteína.

Barash_III.indd 215 22/08/14 11:56


216 Barash, Cullen, Stoelting, Cahalan, Stock, Ortega

TABELA 16.8 Indicações do uso de plasma fresco congelado


Correção das deficiências hereditárias de fatores da coagulação quando não há um
concentrado do fator específico (p. ex., fator V) e quando o TP ou o TTPa é . 1,5
vezes o controle médio.
Correção das deficiências adquiridas de vários fatores com evidência clínica de
sangramento, ou em antecipação a um procedimento cirúrgico de grande porte ou
um procedimento invasivo quando o TP ou o TTPa é . 1,5 vezes o controle.
• Disfunção hepática com sinais clínicos de sangramento.
• CID com sinais clínicos de sangramento.
• Sangramento microvascular associado às transfusões maciças e perda sanguínea
estimada em mais de 1 volemia (quando o TP e o TTPa estão acima de 1,5 vezes o
controle ou não podem ser determinados).
• Reversão dos efeitos dos antagonistas da vitamina K (varfarina).*
• Resistência à heparina, secundária à deficiência de antitrombina quando não se
dispõe de concentrado de AT.
Tratamento das microangiopatias trombóticas (PTT, síndrome HELLP ou SHU).
Tratamento do angioedema hereditário quando não se dispõe de inibidor de esterase
de C1.
*Os concentrados de complexo protrombínico (II, VII, IX e X) são mais eficazes que PFC.
AT 5 antitrombina; CID 5 coagulação intravascular disseminada; HELLP 5 anemia hemolítica,
enzimas hepáticas elevadas e contagem baixa de plaquetas; PFC 5 plasma fresco congelado; PTT
5 púrpura trombocitopênica trombótica; SHU 5 síndrome hemolítico-urêmica; TP 5 tempo de
protrombina; TTPa 5 tempo de tromboplastina parcial ativada.

XIII. CRIOPRECIPITADO. Esse hemocomponente é produzido pelo descon-


gelamento controlado do plasma congelado, de forma a permitir a preci-
pitação das moléculas grandes. Em seguida, o material é centrifugado e o
produto final contém fibrinogênio, fibronectina, vWF, fator VIII e fator
XIII (1 unidade de plasma geralmente produz 10 a 20 mL de crioprecipita-
do) (Tab. 16.9).

XIV. RISCOS DA ADMINISTRAÇÃO DE HEMOCOMPONENTES. Agora


que a triagem dos doadores e a testagem dos hemocomponentes reduzi-
ram drasticamente a transmissão das infecções virais, os riscos não virais
da transfusão começaram a ser enfatizados porque são tão preocupantes
quanto e estão associados a morbidade e mortalidade significativas.
A. Testagem para Riscos Infecciosos dos Hemocomponentes. Desde
a introdução dos testes de ácido nucleico para as principais infecções
virais transmissíveis por transfusão (vírus da hepatite C em 2000; HIV
em 2003; vírus da hepatite B em 2006), o risco de infecção transmi-
tida por transfusões de hemocomponentes diminuiu expressivamente
(Tab. 16.10).
1. Vírus da Imunodeficiência Humana (HIV). O risco residual de
transmissão do HIV diminuiu a menos de 1 por 1,8 milhões de
transfusões de hemocomponentes.

Barash_III.indd 216 22/08/14 11:56


Manual de Anestesiologia Clínica 217

TABELA 16.9 Indicações de uso do crioprecipitado


Sangramento microvascular com hipofibrinogenemia
• CID com fibrinogênio , 80 a 100 mg/dL
• Hemorragia ou transfusão maciça com fibrinogênio , 100 a 150 mg/dL
Profilaxia para pacientes com hemofilia A e DvW (quando não se dispõe de
concentrados do fator específico ou estes são ineficazes porque o paciente tem
inibidores)
Profilaxia para pacientes com disfibrinogenemia congênita
CID 5 coagulação intravascular disseminada; DvW 5 doença de von Willebrand.

2. O vírus da hepatite C (VHC) é mais raro que os outros tipos de


hepatite infecciosa e tem uma fase aguda relativamente benigna,
mas progride ao estado de portador crônico em até 85% das infec-
ções e está associado a riscos significativos de insuficiência hepáti-
ca fulminante, cirrose, carcinoma hepatocelular e morte.
3. O vírus da hepatite B (prevalência baixa nos EUA, em comparação
com Oriente Médio, África e Ásia) é assintomático na maioria dos
casos e raras vezes evolui para insuficiência hepática fulminante.
4. Vírus Linfotrópico de Células T Humanas (HTLV) Tipos 1 e 2
a. O HTLV-1 causa leucemia e linfoma de células T ou, em uma
percentagem pequena dos pacientes infectados, mielopatia as-
sociada ao HTLV.
b. O HTLV-2 não causa problemas significativos para os pacientes
imunocompetentes, ou mesmo para os indivíduos coinfectados
pelo HIV.
5. Citomegalovirose (CMV) é a doença mais comumente transmiti-
da por transfusões, com incidência estimada em 1 a 3%.
a. Nos receptores imunocompetentes, a infecção em geral é assin-
tomática ou leve e autolimitada.
b. Nos pacientes imunossuprimidos, principalmente recém-nasci-
dos, pacientes infectados pelo HIV e receptores de transplante,
Anatomia e Fisiologia

essa doença pode causar falência de múltiplos órgãos, inclusive


fígado, pulmões, rins, sistema hematológico, trato gastrintesti-
nal e sistema nervoso central.
6. A contaminação bacteriana é o risco principal das transfusões
(duas a três vezes maior que o risco de adquirir doenças virais
transmitidas por transfusão).
B. Riscos Não infecciosos da Administração de Hemocomponentes
Em vista do uso expressivo de métodos mais sensíveis de triagem e
controle dos riscos infecciosos das transfusões de hemocomponentes,
as complicações não infecciosas tornaram-se uma causa significativa
de morbidade e mortalidade associadas às transfusões (Tab. 16.11).

Barash_III.indd 217 22/08/14 11:56


218 Barash, Cullen, Stoelting, Cahalan, Stock, Ortega

TABELA 16.10 Riscos residuais de transmissão de infecções por


transfusão
Período de Janela e
Infecção Risco Residual Comentários
Infecções Virais
Vírus da imunodeficiência 1/1.860.800 Janela de 9,1 dias
humana (HIV)
Hepatite C (VHC) 1/1.657.700 Janela de 7,4 dias
Hepatite B (VHB) 1/366.500 Janela de 38 dias
Vírus linfotrópico de células 1/3.394.000 Janela de 51 dias
T humanas (HTLV)
Vírus do oeste do Nilo Raro 11 casos relatados
(VON) entre 2003 e 2010
Citomegalovírus (CMV) – 1 a 3%
pool de doadores 0,023%
• Produtos leucorreduzidos
Infecções Emergentes Raras Incidência muito baixa
para ser estimada
Doença de Chagas e malária A triagem dos
doadores limita o
risco nos EUA
Doença de Creutzfeldt- Período de incubação
Jakob (vírus da DCJ) de alguns anos
Vírus da dengue e espécies Epidemias transitórias
Babesia aumentam os riscos
Parvovírus (vírus B19) Pode causar
anemia aplásica
nos pacientes
imunossuprimidos
Contaminação Bacteriana 1/3.000
(todos os tipos)
Concentrado de hemácias 1/35.000 Risco menor que os
concentrados de
plaquetas
Concentrado de plaquetas 1/15.000 A aférese reduz o risco

XV. TÉCNICAS DE CONSERVAÇÃO DO SANGUE (Tab. 16.12)

XVI. DISTÚRBIOS DA HEMOSTASIA: DIAGNÓSTICO E TRATAMENTO.


Os distúrbios da hemostasia podem ser classificados basicamente entre
os que causam propensão à hemorragia e os que facilitam a trombose
anormal. Esses distúrbios também são subdivididos entre os que afetam

Barash_III.indd 218 22/08/14 11:56


Manual de Anestesiologia Clínica 219

a hemostasia primária; a formação inicial do tampão plaquetário; ou a


hemostasia secundária, inclusive o sistema da coagulação e a formação
de ligações cruzadas entre as moléculas de fibrina. Por fim, os distúrbios
hemostáticos podem ser causados por doenças genéticas hereditárias ou
deficiências adquiridas (Tab. 16.13).
A. Distúrbios da Hemostasia Primária (Tab. 16.14)
B. Distúrbios da Hemostasia Secundária (Tab. 16.15)
C. Distúrbios Adquiridos da Hemostasia (Tab. 16.16)

XVII. ANTICOAGULAÇÃO E TRATAMENTO FARMACOLÓGICO


A. Esquemas de Anticoagulação e Implicações Pertinentes à Anestesia
1. O tratamento antiplaquetário está indicado para pacientes em
risco de acidente vascular encefálico (AVE), infarto do miocárdio
(IM) ou outras complicações da trombose vascular.
2. Inibidores da Cicloxigenase (COX) (aspirina, anti-inflamatórios
não esteroides)
a. Existem dois tipos de enzima cicloxigenase (COX) cuja distri-
buição é variável entre os diversos componentes do corpo. A
COX-1 desempenha um papel fundamental na manutenção da
integridade do revestimento gástrico, no fluxo sanguíneo renal
e na iniciação da síntese do tromboxano A2, que é uma molécu-
la importante para a agregação plaquetária.
b. A inibição da COX-1 coloca o paciente em risco de sangramen-
to e complicações gastrintestinais e renais. A COX-2 é responsá-
vel basicamente por sintetizar mediadores prostaglandínicos da
dor e da inflamação.
c. As recomendações atuais da American Heart Administration
referentes ao uso terapêutico dos inibidores de COX-2 (p. ex.,
celecoxibe) nos pacientes com doença cardiovascular enfatizam
o uso da menor dose eficaz e, simultaneamente, um inibidor da
bomba de prótons e aspirina em doses baixas.
3. Os inibidores de fosfodiesterase são usados principalmente na
profilaxia de AVE porque aumentam a síntese do monofosfato de
adenosina cíclico, que é um inibidor ativo da agregação plaquetária.
4. Os antagonistas do receptor de monofosfato de adenosina
Anatomia e Fisiologia

P2Y12 (clopidogrel, prasugrel, ticlopidina) impedem a expressão


da glicoproteína (GP) IIa/IIIb na superfície das plaquetas ativadas
e, desse modo, inibem a adesão e a agregação plaquetárias.
a. Esses fármacos são usados por pacientes com doença arterial
coronariana para evitar IM ou trombose dos stents e pacientes
com doença vascular arterial cerebral ou periférica para evitar
tromboembolismo.
b. O clopidogrel é o fármaco mais comumente prescrito dessa
classe e atua como antagonista irreversível não competitivo. O
clopidogrel é um pró-fármaco que precisa ser oxidado em seu

Barash_III.indd 219 22/08/14 11:56


220 Barash, Cullen, Stoelting, Cahalan, Stock, Ortega

TABELA 16.11 Reações transfusionais não infecciosas


Reação Adversa Incidência Comentários
Reações Mediadas Imunologicamente
Reação transfusional não hemolítica febril 0,03 a 2%
Reações alérgicas leves (urticária, 1 a 3%
ruborização)
Reações anafiláticas ou anafilactoides
• Concentrado de hemácias 0,5/100.000 A deficiência de IgA aumenta
o risco; a lavagem do
hemocomponente pode
evitar esse tipo de reação.
• Plasma fresco congelado e plaquetas 2 a 3/100.000 Mais prevalente com os
produtos que contêm plasma.
Reação transfusional hemolítica aguda 1/80.000
(RTHA)
Reação transfusional hemolítica tardia 1/1.500 Associada aos aloanticorpos
(RTHT) contra antígenos
eritrocitários secundários,
Kidd ou Rh.
Um terço tem reação clínica.
Imunomodulação relacionada com 100%
transfusão (IMRT)
Aloimunização 2% Para todos os pacientes, o risco
aumenta com o número de
unidades transfundidas.
Lesão pulmonar aguda relacionada com a 1/1.300 a Varia com o hemocomponente
transfusão (LPART, ou TRALI em inglês) 5.000 e a população de pacientes.
Doença enxerto-versus-hospedeiro 1/5.000 Relacionada com a
(DEVH) associada à transfusão (AT) imunossupressão; risco
reduzido após irradiação do
hemocomponente.
Púrpura pós-transfusional (PPT) Rara Atribuída ao anticorpo contra
antígeno-1a da plaqueta
humana.
Reações Relacionadas com Comorbidades do Paciente ou com a Prática Transfusional
Sobrecarga cardiovascular associada à 1 a 8% Incidência mais alta nos
transfusão (SCVAT) pacientes em estado crítico.
Distúrbios metabólicos:
• Hiperpotassemia
• Efeitos tóxicos do citrato
• Sobrecarga de ferro
• Hipotermia
Infusão de microagregados
*As frequências estão referidas em percentagens quando são . 0,1% e, nos demais casos, em forma de razão.
IgA 5 imunoglobulina A.

Barash_III.indd 220 22/08/14 11:56


Manual de Anestesiologia Clínica 221

TABELA 16.12 Técnicas de conservação perioperatória dos


hemocomponentes
Técnica Comentários
Doação autóloga pré-operatória (DAP) O volume total de transfusão necessária
é maior; os níveis de hemoglobina pré-
operatória são mais baixos.
Hemodiluição normovolêmica aguda Pouca evidência de efeito benéfico;
(HNA) contém fatores da coagulação e
plaquetas.
Recuperação de sangue intraoperatória Relação custo-benefício favorável, risco
(RSIO) baixo e eficácia extrema.
Recuperação de sangue pós-operatória Eficácia comprovada em cirurgia
(RSPO) ortopédica.
Fármacos:
• Estimulantes da eritropoiese Eritropoietina, vitamina B12, folato
• Agentes pró-hemostáticos Vitamina K, DDAVP, antifibrinolíticos,
• Substitutos do sangue FVIIar
Soluções carreadoras de oxigênio à base
de hemoglobina
DDAVP 5 1-damino-8-D-arginina vasopressina; FVIIar 5 fator VII ativado recombinante.

TABELA 16.13 Classificação da doença de von Willebrand


hereditária
Tipo Fisiopatologia Comentários
Tipo 1 Deficiência quantitativa Forma mais leve e mais
parcial de vWF comum; responde à
DDAVP
Tipo 2A Disfunção da adesão Pode melhorar com
plaquetária DDAVP
Tipo 2M Disfunção da adesão Pode melhorar com
plaquetária DDAVP
Anatomia e Fisiologia

Tipo 2B Aumento da afinidade de Trombocitopenia com


ligação das plaquetas DDAVP
Tipo 2N Redução da afinidade de Confundido comumente
ligação do FVIII com hemofilia A
Tipo 3 Deficiência quantitativa Forma mais rara e mais
grave de vWF grave; em geral requer
concentrados de fatores
DDAVP 5 1-damino-8-D-arginina vasopressina; FVIII 5 fator VIII; vWF 5 fator de von Willebrand.

Barash_III.indd 221 22/08/14 11:56


222 Barash, Cullen, Stoelting, Cahalan, Stock, Ortega

TABELA 16.14 Algoritmo de graduação para diagnosticar


coagulação intravascular disseminada
Exame Diagnóstico Escore
Contagem de plaquetas . 100.000/mm3 5 0
3
, 100.000/mm 5 1
3
, 50.000/mm 5 2
Tempo de protrombina , 3 segundos 5 0
. 3 segundos mas , 6 segundos 5 1
. 6 segundos 5 2
Produtos de decomposição da fibrina Nenhum aumento 5 0
Aumento moderado 5 2
Aumento acentuado 5 3
Nível de fibrinogênio . 1 g/L 5 0
, 1 g/L 5 1
Cálculo do escore
• Se $ 5 Compatível com CID estabelecida
• Se , 5 CID estabelecida improvável; repetir os
exames em 1 a 2 dias
CID 5 coagulação intravascular disseminada.
Algoritmo desenvolvido pela International Society of Thrombosis and Hemostasis.

metabólito ativo. Um polimorfismo genético resulta na inca-


pacidade de metabolizar esse fármaco, tornando-o ineficaz e
colocando os pacientes em risco de morbidade e mortalidade
cardiovasculares.
5. Os bloqueadores do receptor de GP IIb/IIIa (abciximabe, tirofi-
bano, eptifibatida) inibem a ligação cruzada do fibrinogênio, que
é a última etapa da via hemostática comum necessária à agregação
das plaquetas.
a. Esses fármacos são administrados apenas por via intravenosa,
sendo usados principalmente para tratar síndrome coronariana
aguda.

TABELA 16.15 Distúrbios da hemostasia secundária


Hemofilias
• Hemofilia A (responsável por 85% dos casos; causada por deficiências do fator VIII)
• Hemofilia B
• Hemofilia adquirida
Hipercoagulabilidade hereditária (risco elevado de TEV)
Deficiências de proteínas C e S (risco elevado de TEV)
TEV 5 tromboembolismo venoso.

Barash_III.indd 222 22/08/14 11:56


Manual de Anestesiologia Clínica 223

TABELA 16.16 Distúrbios adquiridos da hemostasia


Deficiência de vitamina K (TP e TTPa prolongados)
Doença hepática
Coagulação intravascular disseminada
Ativação sistêmica da coagulação, resultando em um desequilíbrio da hemostasia
Sempre estão associados a alguma comorbidade (infecção, inflamação, câncer)
A trombose difusa pode causar falência de múltiplos órgãos ou coagulopatia de
consumo e sangramento
O tratamento do distúrbio subjacente é a principal medida terapêutica somada à
administração de plasma fresco congelado
TP 5 tempo de protrombina; TTPa 5 tempo de tromboplastina parcial ativada.

b. Os efeitos deles podem ser monitorados pelos tempos de coagu-


lação ativada e são reversíveis quando eliminados do corpo.
c. Todos esses fármacos causam trombocitopenia, mas o efeito é
mais acentuado com o abciximabe, cuja incidência é de cerca
de 2,5% em comparação com 0,5% dos outros antagonistas do
receptor de GP IIb/IIIa.
6. A varfarina é um anticoagulante oral usado como primeira opção
para tratar distúrbios de hipercoagulabilidade e tromboembolis-
mo venoso (TEV) e como profilaxia para pacientes com fibrilação
atrial ou valvas cardíacas mecânicas.
a. O tratamento com varfarina é monitorado pelo INR (em geral,
os alvos terapêuticos ficam na faixa entre 2 e 3).
b. Nas situações de emergência, a reversão dos efeitos da varfarina
nos pacientes com sangramentos significativos ou que precisam
ser submetidos a uma intervenção cirúrgica imediata pode ser
conseguida com uma dose de 25 a 50 mg/kg dos concentrados
de complexo protrombínico de quatro fatores, que contém os
fatores ativos II, VII, IX e X.
B. Anticoagulantes Orais Novos
1. A dabigatrana (um inibidor direto da trombina) e os inibidores do
Anatomia e Fisiologia

fator Xa (rivaroxibana e apixabana) já passaram pelas experiências


da fase III e agora estão em fase de aprovação pelo FDA (Food
and Drug Administration) americano como profilaxia de AVE e
anticoagulação terapêutica de pacientes com história de TEV.
2. A monitoração da coagulação não é necessária (a variabilidade
entre os pacientes é pequena e ocorrem poucas interações com fár-
macos ou dieta) (Tab. 16.17).
3. Quando é necessário um efeito antagônico urgente, é razoável ten-
tar reverter o efeito deste fármaco com concentrados de complexo
protrombínico (CCPs), que contêm os fatores II, VII, IX e X e, por-
tanto, anulam os efeitos antagônicos.

Barash_III.indd 223 22/08/14 11:56


224 Barash, Cullen, Stoelting, Cahalan, Stock, Ortega

a. O uso desses fármacos deve ser interrompido 24 horas antes de


cirurgias de pequeno porte ou procedimentos diagnósticos e 48
horas antes de cirurgias de grande porte ou procedimentos que
envolvam os olhos, a coluna vertebral ou o cérebro.
b. As meias-vidas desses fármacos são de cerca de 12 horas; por
essa razão, supondo-se que as funções hepática e renal estejam
normais, mais de quatro meias-vidas asseguram a eliminação de
quase 100% do fármaco.
C. O tratamento com heparina é um dos esquemas anticoagulantes mais
antigos e mais usados. (O uso profilático da heparina para evitar TEV
diminuiu, mas esse fármaco ainda é empregado para anticoagulação
de emergência em síndrome coronariana aguda, embolia pulmonar e
durante circulação extracorpórea ou cirurgia vascular.)
1. Os efeitos clínicos do tratamento com heparina são monitorados
pelo TTPa ou pelo TCA.
2. Os pacientes podem desenvolver resistência à heparina não fra-
cionada quando têm insuficiência hereditária de antitrombina III
(ATIII) ou uma deficiência adquirida após tratamento prolonga-
do com esse fármaco. A ATIII é reposta com transfusões de PFC.
3. A principal complicação do uso da heparina é a trombocitopenia
induzida por heparina (TIH).
D. A heparina de baixo peso molecular (HBPM, como enoxaparina, dal-
teparina e nevirapina) é uma preparação fracionada de heparina que
atua por mecanismo semelhante, mas tem ação inibitória mais especí-
fica do fator Xa.
1. O uso de HBPM é preferido à heparina não fracionada como pro-
filaxia e tratamento da TVP, porque não é necessário realizar mo-
nitoração laboratorial e sua meia-vida mais longa permite a aplica-
ção de uma ou duas doses diárias.

TABELA 16.17 Anticoagulantes orais


Varfarina Dabigatrana Apixabana Rivaroxabana
Alvo Vitamina K Trombina Fator Xa Fator Xa
Pico de ação (h) 72 a 96 1a2 3 2,5 a 4
Meia-vida (h) 40 9 a 13 8 a 15 7 a 11
Dose (mg) 2 a 10 150 5 20
Frequência Diária ou a cada Uma ou duas Duas vezes Diária
dois dias vezes por dia ao dia
Metabolismo Nenhum Excreção renal Hepático Hepático
Interações CYP2C9 Poucas CYP3A4 CYP3A4
farmacológicas

Barash_III.indd 224 22/08/14 11:56


Manual de Anestesiologia Clínica 225

2. O tratamento pode ser monitorado pelas dosagens dos níveis do


fator Xa, mas isso é necessário apenas nos pacientes obesos e nos
portadores de insuficiência renal, que prolonga a eliminação.
3. A reversão do efeito anticoagulante com protamina é imprevisível
e não tende a evitar por completo as tendências hemorrágicas.
E. Antagonistas Indiretos do Fator Xa
1. O fondaparinux é um antagonista altamente específico do fator Xa
livre, que também atua por ligação à ATIII. Como ocorre com as
HBPMs, o fondaparinux é preferido como profilaxia e tratamen-
to da TVP porque tem meia-vida longa (é necessário administrar
apenas uma dose diária) e absorção altamente previsível, que evita
a necessidade de monitorar a coagulação.
2. Quando há sangramento ou é necessário realizar procedimentos
de emergência, não existe antídoto.
3. A incidência de TIH é relativamente baixa com essa classe farma-
cológica.
F. A trombocitopenia induzida pela heparina (TIH) é um distúrbio clí-
nico que ocorre após tratamento prolongado com esse fármaco.
1. Essa complicação ocorre em 1 a 5% dos pacientes tratados com
heparina e está associada à morbidade causada pelas complicações
tromboembólicas.
2. Existem dois tipos. A TIH1 evidencia-se por trombocitopenia leve,
é benigna e não envolve imunocomplexos. A TIH2 é uma reação
imune e acarreta risco expressivo de hipercoagulabilidade.
G. Os IDTs parenterais inibem diretamente a trombina em seus estados
livre e ligado à fibrina. Nenhum desses fármacos é imunogênico e, por
essa razão, não há risco de causar TIH.

XVIII. CONCENTRADOS DE COMPLEXO PROTROMBÍNICO


Os concentrados de complexo protrombínico (CCPs) são administrados
principalmente para reverter os efeitos dos antagonistas da vitamina K
e tratar sangramentos graves associados a procedimentos cirúrgicos de
grande porte, traumatismo ou insuficiência hepática.
A. Os CCPs são as preparações preferidas para reverter os efeitos dos an-
ticoagulantes orais em situações de emergência, quando não se dispõe
Anatomia e Fisiologia

de fator VIIa e PFC, que são as opções iniciais preferíveis.


B. A possibilidade de que os CCPs causem uma “explosão” significativa de
trombina coloca os pacientes em risco de complicações trombóticas.

XIX. DESMOPRESSINA. Desmopressina é um análogo sintético do hormô-


nio antidiurético endógeno que foi introduzido originalmente para tratar
pacientes com diabetes insípido; mais tarde, também ficou demonstrado
que esse fármaco melhora a hemostasia e a função plaquetária (uma das
opções preferidas para tratar sangramentos leves dos pacientes com DvW
e hemofilia leve).

Barash_III.indd 225 22/08/14 11:56


226 Barash, Cullen, Stoelting, Cahalan, Stock, Ortega

XX. TRATAMENTO ANTIFIBRINOLÍTICO


A. Os fármacos antifibrinolíticos têm sido usados para evitar e tratar per-
das sanguíneas intraoperatórias.
B. Existem dois tipos: análogos da lisina como o ácido épsilon-aminoca-
proico (EACA) e o ácido tranexâmico (ATX); e um inibidor de serino-
protease conhecido como aprotinina.
1. A aprotinina reduz o sangramento perioperatório e a necessidade
de transfusões e reoperações.
2. Também existem evidências abundantes demonstrando que esse
fármaco não está associado à insuficiência renal e à mortalidade.

Barash_III.indd 226 22/08/14 11:56


SEÇÃO Fármacos Anestésicos,

IV Adjuvantes e Interações
Medicamentosas
CAPÍTULO

17
Anestésicos Inalatórios
A popularidade dos anestésicos inalatórios para produzir anestesia geral se ba-
seia na facilidade de administração (por meio de inalação) e na capacidade para
monitorar os efeitos (sinais clínicos e concentrações expiradas) (Fig. 17.1) (Ebert
TJ, Linderman L. Inhaled anesthetics. Em: Barash PG, Cullen BF, Stoelting RK,
Cahalan MK, Ortega R, Stock MC, Eds. Clinical Anesthesia. Philadelphia: Li-
ppincott Williams & Wilkins; 2013: 445-477). Os anestésicos inalatórios mais
potentes usados nos procedimentos cirúrgicos em adultos são o sevoflurano,
o desflurano e o isoflurano (Fig. 17.1). O sevoflurano é o anestésico inalatório
mais usado em pacientes pediátricos.

I. PRINCÍPIOS FARMACOCINÉTICOS
A. Classicamente, a farmacologia dos medicamentos divide-se em far-
macodinâmica (aquilo que o organismo faz sobre o fármaco) e farma-
cocinética (aquilo que o fármaco faz ao organismo). A farmacocinética
dos medicamentos possui quatro fases: absorção (captação), distribui-
ção, metabolismo e excreção (eliminação).
B. Características Exclusivas dos Anestésicos Inalatórios
1. Velocidade, Estado Gasoso e Via de Administração. Os anestési-
cos inalatórios estão entre os medicamentos de ação mais rápida, e,
ao administrar um anestésico geral, essa velocidade cria uma mar-
gem de segurança e melhora a eficiência.
2. Sob o ponto de vista técnico, o óxido nitroso e o xenônio são os
únicos gases autênticos; os outros anestésicos inalatórios são vapo-
res de líquidos voláteis (a título de simplificação, todos são conhe-
cidos como gases).
3. Uma das vantagens exclusivas dos gases anestésicos é a possibilida-
de de serem liberados na corrente sanguínea através dos pulmões
dos pacientes.
C. Características Físicas dos Anestésicos Inalatórios (Tabs. 17.1 e 17.2)
1. O objetivo da administração de anestésicos inalatórios é produ-
zir estado anestésico por meio de uma concentração específica
(pressão parcial) no sistema nervoso central (SNC). Para tanto,

Barash_IV.indd 227 22/08/14 13:08


228 Barash, Cullen, Stoelting, Cahalan, Stock, Ortega

F Br

N N O F C C H

F Cl
Óxido nitroso Halotano

F F F F H F

H C C O C H F C C O C H

Cl F F F Cl F
Enflurano Isoflurano

F C F F

H C O C H F H F

F C F H F C C O C H

F F F F
Sevoflurano Desflurano
FIGURA 17.1 Estrutura química dos anestésicos inalatórios. O halotano (não está
mais disponível comercialmente) é um alcano, ao passo que todos os outros anestési-
cos voláteis são derivativos. O isoflurano, o enflurano e o desflurano são derivados do
éter metiletílico, e o sevoflurano é um éter metilisopropílico. O isoflurano e o enflura-
no são isômeros, e o desflurano difere do isoflurano na substituição de um átomo de
flúor por um átomo de cloro.

é necessário determinar a pressão pulmonar parcial desejada que


entre em equilíbrio com o cérebro e a medula espinal.
2. No estado de equilíbrio, a pressão parcial do SNC é igual à
pressão parcial do sangue, que, por sua vez, é igual à pressão par-
cial alveolar.
D. Mistura de Gases. Em qualquer mistura de gases em recipientes fe-
chados, cada gás exerce uma pressão proporcional à massa fracionada
(pressão parcial).
E. Gases em Soluções
1. A concentração de qualquer gás em uma mistura de gases em so-
lução depende (i) da pressão parcial do gás na fase em equilíbrio
com a solução e (ii) da solubilidade dentro da solução.

Barash_IV.indd 228 22/08/14 13:08


Barash_IV.indd 229
TABELA 17.1 Propriedades físico-químicas dos anestésicos voláteis
Propriedade Sevoflurano Desflurano Isoflurano Enflurano Óxido Nitroso
Ponto de ebulição (°C) 59 24 49 57 288
Pressão de vapor a 20°C (mm Hg) 157 669 238 172 38.770
Peso molecular (g) 200 168 184 184 44
Coeficiente de partição óleo:gás 47 19 91 97 1,4
Coeficiente de partição sangue:gás 0,65 0,42 1,46 1,9 0,46
Solubilidade cérebro:sangue 1,7 1,3 1,6 1,4 1,1
Solubilidade gordura:sangue 47,5 27,2 44,9 36 2,3
Solubilidade músculo:sangue 3,1 2,0 2,9 1,7 1,2
CAM em oxigênio, 30 a 60 anos a 37°C, PB760 (%) 1,8 6,6 1,17 1,63 104
CAM em óxido nitroso a 60 a 70% 0,66 2,38 0,56 0,57
CAM, . 65 anos (%) 1,45 5,17 1,0 1,55
Conservante Não Não Não Não Não
Estável em absorvedores úmidos do dióxido de Não Sim Sim Sim Sim
carbono
Inflamabilidade (%) (em 70% de óxido nitroso e 10 17 7 5,8
30% de oxigênio)
Metabolismo (%) 2a5 0,02 0,2 2,4
Manual de Anestesiologia Clínica

CAM 5 concentração alveolar mínima.


229

Fármacos Anestésicos...

22/08/14 13:08
230 Barash, Cullen, Stoelting, Cahalan, Stock, Ortega

TABELA 17.2 Grupos teciduais e farmacocinética


Perfusão
Grupo Massa Corporal (%) Débito Cardíaco (%) (mL/min/100 g)
Rico em vasos 10 75 75
Muscular 50 19 3
Adiposo 20 6 3

2. A concentração de um anestésico no tecido-alvo depende da


pressão parcial no ponto de equilíbrio e da solubilidade tecidual.
3. A monitoração da concentração alveolar fornece um índice da con-
centração no sítio efetor, que é o cérebro, levando-se em considera-
ção que os anestésicos inalatórios são gases e que as pressões par-
ciais permanecem em equilíbrio em todo o sistema.
F. Transferência Anestésica: da Máquina para o Sistema Nervoso Cen-
tral (Tab. 17.3)
G. Absorção e Distribuição
1. FA/FI. Uma forma simples de avaliar a absorção anestésica é acom-
panhar a razão da concentração alveolar (FA) até a concentração
inspirada dos anestésicos (FI) ao longo do tempo (FA/FI) (Fig. 17.2).
2. Distribuição (Absorção Tecidual). Os fatores que aumentam ou
diminuem a taxa de aumento da razão FA/FI determinam a veloci-
dade de indução anestésica (ver Fig. 17.2 e Tab. 17.3).
3. O metabolismo desempenha papel secundário na indução, mas
pode ter algum significado na determinação da taxa de recuperação.
H. Over Pressure e Efeito da Concentração
1. A over pressure (administração de FI mais elevada que a FA efetiva-
mente desejada para o paciente) é análoga ao bólus intravenoso e,
como consequência, agiliza a indução à anestesia.
2. Efeito da concentração (quanto maior a FI de um anestésico ina-
latório, mais rápida a taxa de aumento da razão FA/FI) é o método
utilizado para agilizar a indução à anestesia (Fig. 17.3).
I. Efeito do Segundo Gás
1. Um caso especial do efeito da concentração é a administração si-
multânea de dois gases (óxido nitroso e um anestésico volátil po-
tente) em que a captação de altas concentrações de N2O aumenta
(concentra) a FA do anestésico volátil.
J. Efeitos da Ventilação
1. Os anestésicos inalatórios com baixa solubilidade no sangue apre-
sentam taxa elevada de aumento na razão FA/FI, na indução da
anestesia, e consequentemente há pouco espaço para melhorar
essa taxa, aumentando ou diminuindo a ventilação (ver Fig. 17.3).

Barash_IV.indd 230 22/08/14 13:08


Manual de Anestesiologia Clínica 231

TABELA 17.3 Fatores que aumentam ou diminuem a taxa de


aumento da concentração alveolar dos anestésicos
(FA)/concentração inspirada dos anestésicos (FI)

Fármacos Anestésicos...
Aumento Redução
Baixa solubilidade no Alta solubilidade no Quanto mais baixa a
sangue sangue solubilidade sangue:gás,
mais rápido é o
aumento na razão FA/FI.
Débito cardíaco baixo Dé