Вы находитесь на странице: 1из 5

“ASIGNACIÓN A CARGO DEL DOCENTE EN LÍNEA”

UNIVERSIDAD ABIERTA Y A DISTANCIA DE MÉXICO

ASIGNATURA

BIOLOGÍA MOLECULAR I

“ASIGNACIÓN A CARGO DEL DOCENTE EN LÍNEA”

ALUMNO

JUAN JESÚS LÓPEZ ROSAS

DOCENTE EN LÍNEA

JUAN ROBERTO ISRAEL BUSTOS GARCÍA

FECHA DE ELABORACIÓN DEL TRABAJO

20 DE MARZO DEL 2018

CARRERA

INGENIERO EN BIOTECNOLOGÍA
1
“ASIGNACIÓN A CARGO DEL DOCENTE EN LÍNEA”

INSTRUCCIONES: Contesta las siguientes preguntas:

1. DESCRIBA LA SÍNTESIS DE UN FRAGMENTO DE OKAZAKI

R= La horquilla de proliferación se simplifica en trayectoria 5’ – 3’. El hilván conductor se


prolifera de manera constante; entretanto que el demorado, se prolifera en fracciones los
cuales son los denominados “Okazaki”.

2. A CONTINUACIÓN, SE PRESENTA UN SEGMENTO DE UNA CADENA SENCILLA


DE DNA, PROPORCIONA LA SECUENCIA DE UNA CADENA CON LA QUE MEDIANTE
LAS REGLAS DE COMPLEMENTARIEDAD PODRÍA FORMAR UNA HÉLICE DOBLE:
5’- ATTCTTATTCGTTGGCACCTTATGGCAGGCTTATTC - 3’

R= TAAGAATAAGCAACCGTGGAATACCGTCCGAATAAG - 5’.

3. ¿QUÉ ES UNA SECUENCIA CONSENSO? Y ¿UNA SECUENCIA CONSERVADA?

R= La secuencia consenso es aquella en la que constituyen los fundamentos más


habituales localizados en las diferentes sucesiones equiparadas; mientras que una
secuencia conservada, es aquella que es la más afín, similar o exacta.

4. ¿CUÁLES SON LAS SEÑALES DE INICIACIÓN Y FINAL DE LA TRADUCCIÓN?

R= Una transcripción presenta tres etapas. En los tratamientos originales de la traducción


procariota pero antes, se da el reconocimiento de la RNA polimerasa con el elemento
“Sigma” y se adhiere a una zona impulsora del DNA en una composición vallada.

A continuación, tenemos las siguientes tres etapas en procariotas:

Iniciación: El complejo acoge una estructura atónita y el inicial nucleótido trifosfato se enfila
con el DNA.

Se constituye el inicial enlace fosfodiéster y se liberaliza el elemento “Sigma”.

Elongación: La simplificación del RNA emergente asciende con el desplazamiento de la


RNA polimerasa a lo amplio del DNA y se torna a constituir el doble propulsor.

Terminación: Se da de dos diferentes formas, ya sea dependiendo o autónomamente del


elemento cambiante p “Rho”. Los terminadores se organizan, por consiguiente, en
autónomos de p y en dependientes de p.

Las etapas de la traducción en eucariotas son iguales que en el lance de los procariotas.

Iniciación: Al igual que sucede con el ADN procariota, en el ADN eucariota acaece de
zonas o sucesiones concretas, los impulsores, que fijan los puntos de comienzo de la
traducción. En el lance de los eucariotas, estos impulsores son más dispares, no obstante
la superior ración incorpora una sucesión, llamada urna TATA, que se encuentra a unos
treinta nucleótidos a posteriori del punto de comienzo. Estos impulsores son identificados
por las ARN - polimerasas a través de un encadenamiento de prótidos llamados elementos
de traducción.

Elongación: La leontina comienza a expandirse gracias a la ARN - polimerasa en


trayectoria 5’ – 3’. Al límite 5’ se le agrega por lo tanto una disposición, llamada capuchón
2

5’, que es un nucleótido de guanina alterado con tres agrupaciones fosfato.


“ASIGNACIÓN A CARGO DEL DOCENTE EN LÍNEA”

Esta disposición preserva este límite de la actuación de nucleasas cuando el ARN escapa
de la médula al citoplasma.

Terminación: El desenlace de la traducción conlleva una finalización denominada como


señal poli – A, seguidamente de la cual un fermento secciona el ARN. La ARN – polimerasa
se segrega de la matriz de ADN y concluye la traducción. Cuando esto sucede, otro
fermento es responsable de agregar al límite 3’ una sucesión de unos doscientos
nucleótidos de adenina que constituyen la llamada cola poli – A.

5. ¿QUÉ AMINOÁCIDOS PUEDEN REEMPLAZAR AL TRIPTÓFANO (UGG) MEDIANTE


LA MUTACIÓN DE UNA SOLA BASE? INDICA TODAS LAS OPCIONES POSIBLES

R= A continuación, tenemos la siguiente tabla sobre codón triptófano “UGG”:

CODÓN TRIPTÓFANO “UGG”

REEMPLAZAMOS: SI MODIFICAMOS LA U: SI MODIFICAMOS LA G: SI MODIFICAMOS LA G:

C. CGG – Arg. UCG – Ser. UGC – Cys.

A. AGG – Arg. UAG – paro. UGA – paro.

G. GGG – Gly.

U. UUG – Leu. UGU – Cys.

6. EXPLICA DE MANERA BREVE ¿CUÁL ES LA DIFERENCIA ENTRE UN


CENTRÓMERO Y UN CINETOCORO?

R= El centrómero es la región de cohesión entre las dos cromáticas y ayuda de amarre a


los capilares del devanero incoloro; entretanto el cinetocoro, es un complejo cambiante del
centrómero que aprensa y contribuye en la conducción de los cromosomas.

7. EN CIERTA VARIEDAD DE MAÍZ. UN GEN AFECTA AL COLOR DEL GRANO Y OTRO


AFECTA LA ALTURA DEL TALLO, LOS FENOTIPOS CORRESPONDIENTES SON LOS
SIGUIENTES:

CC, CC GRANOS PURPURA TT TALLO ALTO

CC GRANOS BLANCOS TT TALLO . . MEDIANO

TT TALLO ENANO

DETERMINE LAS PROPORCIONES DE GENOTIPOS Y FENOTIPOS QUE SE


PRODUCIRÍAN SI SE AUTOFECUNDARA UNA PLANTA HIBRIDA

R= A continuación, tenemos lo siguiente:


3
“ASIGNACIÓN A CARGO DEL DOCENTE EN LÍNEA”

GENOTIPOS: FENOTIPOS:
3/16 C - TT. Purpura, alto.
6/16 C - Tt. Purpura, mediano.
3/16 C - tt. Purpura, enano.
1/16 cc - TT. Blanco, alto.
2/16 cc - Tt. Blanco, mediano.
1/16 cc - tt. Blanco, enano.

8. EN EL SISTEMA DE GRUPOS SANGUÍNEOS ABO, LOS ALELOS A Y B SON


CODOMINANTES Y AMBOS SON DOMINANTES CON RESPECTO AL ALELO O. EN
UNA DISPUTA DE PATERNIDAD, UNA MUJER AFIRMA QUE UNO DE CUATRO
HOMBRES ES EL PADRE DE SU HIJO A. ¿CUÁLES DE LOS SIGUIENTES HOMBRES
PODRÍAN SER EL PADRE EN BASE A LOS DATOS SUMINISTRADOS?

a. Tipo A

b. Tipo B

c. Tipo O

d. Tipo AB

Todas las respuestas son correctas, ya que la criatura era arquetipo “A”, el cual debe haber
aceptado el alelo “A” de su mamá; mientras que el otro alelo de la criatura, será “A” o bien,
“O”. Cualquiera de los cuatro individuos podría acaecer y otorgar uno de estos alelos.

9. ¿CUÁNDO TIENE LUGAR LA REPLICACIÓN CROMOSÓMICA DURANTE EL CICLO


CELULAR?

R= Tiene emplazamiento durante la etapa de simplificación.

10. DESCRIBE DE MANERA BREVE LAS TRES LEYES DE MENDEL

R= A continuación, explicaremos de modo efímero las siguientes tres leyes de Mendel:

Ley de la uniformidad: Es aquella que enuncia los genes dominantes y recesivos, es decir,
involucrados en la inicial concepción; que decreta que, si un dominante se entrelaza con un
recesivo, lo que decreta es que el genotipo y fenotipo será asiduamente el dominante.

Ley de la segregación: Es aquella que incorpora los alelos dominantes y recesivos, no


obstante dialoga sobre la segunda concepción que otorgará genotipos en unos setenta y
cinco por ciento heterocigotos, unos veinticinco por ciento homocigotos, fenotipos en unos
setenta y cinco por ciento idiosincrasia dominante y veinticinco por ciento idiosincrasia
recesivo.

Ley de la herencia independiente de caracteres: Es aquella que esencialmente, nos


platica de los atributos producidos autónomamente por cromosomas y que no se
interceptan entre sí.
4
“ASIGNACIÓN A CARGO DEL DOCENTE EN LÍNEA”

FUENTES CONSULTADAS DE ACUERDO AL FORMATO APA:

De acuerdo a la plataforma. (2018) instrucciones para realizar la asignación a cargo del


docente en línea

https://unadmexico.blackboard.com/webapps/blackboard/execute/announcement?method
=search&context=mybb&course_id=_46863_1&viewChoice=3

De acuerdo a la plataforma. (2018) unidad 1. Replicación y genes

https://unadmexico.blackboard.com/bbcswebdav/institution/DCSBA/Bloque%201/BT/05/B
BM1/U1/Unidad1.Replicacionygenes_131216.pdf

De acuerdo a la plataforma. (2018) unidad 2. Síntesis de proteínas

https://unadmexico.blackboard.com/bbcswebdav/institution/DCSBA/Bloque%201/BT/05/B
BM1/U2/Unidad2.Sintesisdeproteinas_131216.pdf

De acuerdo a la plataforma. (2018) unidad 3. Variabilidad genética

https://unadmexico.blackboard.com/bbcswebdav/institution/DCSBA/Bloque%201/BT/05/B
BM1/U3/Unidad3.Variabilidadgenetica_131216.pdf

De acuerdo a Virgili Rafael y Taboada José. (2018) genoma humano nuevos avances en
investigación, diagnóstico y tratamiento

http://www.publicacions.ub.es/refs/indices/06554.pdf

De acuerdo a López Belén y María Fernández. (2016) biología

https://books.google.com.mx/books?id=-
oUcDAAAQBAJ&printsec=frontcover&redir_esc=y#v=onepage&q&f=false

De acuerdo a Jiménez Luis y Merchant. (2015) biología celular y molecular

https://oncouasd.files.wordpress.com/2015/06/biologia-celular-y-molecular.pdf

De acuerdo a Villacampa Baladrón. (2002) manual de supervivencia para la preparación


del examen MIR

https://books.google.com.mx/books?id=RYXOb9_CgX0C&printsec=frontcover&redir_esc=
y#v=onepage&q&f=false
5