Вы находитесь на странице: 1из 3

1 catcctgacc ctcaagtacc ccatcgaaca cggcattgtc accaactggg acgacatgga

61 gaagatctgg caccacacct tctacaacga gctgcgcgtg gcccccgagg agcacccggt

121 gctgctcacc gaggccccct tgaaccccaa ggccaaccgt gagaagatga ctcagatcat

181 gttcgagacc ttcaacaccc cagccatgta cgtggccatc caggccgtgc tgtctctgta

241 cgcttctggc cgcaccactg gtattgtcat ggactctggg gacggggtca cccacactgt

301 gcccatctac gaggggtacg ccctgcccca cgccatcctg cgtctggacc tggctggccg

361 ggacctgacg gactacctca tgaagatcct cacggagcgc ggctacagtt tcaccaccac

421 cgccgagcgg gaaattgtgc gtgacatcaa ggagaagctg tgctacgtgg ccctggattt

481 tgagcaggag atggccacgg ccgcgtcctc gtcctccctg gagaagagct acgagctgcc

541 cgacgggcag gtgatcacca tcggcaacga gcggttccgc tgccccgagg cgctcttcca

601 gccttccttc ctgggtatgg agtcctgtgg catccacgag accaccttca actccatcat

661 gaagtgtgac gttgacatcc ggaaggacct ctacgctaac acggtgctgt ctggcgggac

721 caccatgtac cccggcatcg ccgacaggat gcagaaggag atcacagctc tggcgcccag

781 cacgatgaag atcaagatca tcgctccccc tgagcgcaag tactccgtgt ggatcggggg

841 ctccatcctg gcgtcgct

Forward primer : 5’-gcccatctacgaggggta-3’ = 18

gc = 11

ta= 7

3’-atggggagcatctacccg-5’= diner 4

Nb: berpasangan jika dibalik

1-3 yang berpasangan terjadinya hair pin rendah jika diatas 5 terjadi hair pin akan

semakin banyak

Hair-pin terjadi jika jarak nya jauh

Bagaimana modifikasi gen?

Jika di cloning harus dimasukan ke plasmid

Gen ditambahi clong site : Spe 1 5’-ACTAGT-3’


Ditambahi spe 1

5’-gcccatctacgaggggta-3’

Forward star codon ditambahi spe 1

Langsung dikopi sekuen asli dan di tambahi sebelum stard codon

5’-ACTAGTgcccatctacgaggggta-3’

actagtgcccatctacgaggggta Forward : langsung dikopi dan ditambah


cloning site

Reverse : dirubah dulu dan dikopi ditambah


spe 1 E CO R1 cloning site

actagtgcccatctacgaggggta

SPE 1g PROMOTOR (GFR)*ECO R1

Membuat reverse primer:

Cloning- site SPE 1 DAN NOT 1 5’-ACTAGT-3’= spe 1

Forward primer : Spe 1 –b-actin

Reverse primer : b- actin-GFP-NOT 1

5’-gcccatctacgaggggta-3’

3’-cgggtagatgctccccat-5’ anti sense

5’-tacccctcgtagatgggc-3’

Reverse primer :b –actin-GFP-NOT 1

GFP diletakan sesudah stard codon agar bisa terekspresi

NOT 1

5’-GCGGCCGCtacGFPGFPGFPccctcgtagatgggc-3’

Pemotongan sebelum stop codon dan ketentuan panjang 18-22

basa nitrogenn

5’-GCGGCCGCtacGFPGFPGFPcc-3’