Вы находитесь на странице: 1из 24

ARTÍCULO DE INVESTIGACIÓN ORIGINAL

apoptosis inducida por hipoxia de los espermatocitos de ratón está mediada por HIF-1α

aa travéstravés dede unauna víavía deldel receptorreceptor dede muertemuerte yy unauna víavía mitocondrialmitocondrial ††

YinYin juniojunio 11

mitocondrialmitocondrial †† YinYin juniojunio 11 ,,,,,, BingBingBingBingBingBing NiNiNiNiNiNi 1,1,1,1,1,1,

,,,,,, BingBingBingBingBingBing NiNiNiNiNiNi 1,1,1,1,1,1, Wei-gongWei-gongWei-gongWei-gongWei-gongWei-gong LiaoLiaoLiaoLiaoLiaoLiao 111111 *,*,*,*,*,*, Yu-qiYu-qiYu-qiYu-qiYu-qiYu-qi GaoGaoGaoGaoGaoGao 222222 ******

11 DepartamentoDepartamento dede FisiopatologíaFisiopatología yy altaalta altitudaltitud PatologíaPatología // claveclave LaboratorioLaboratorio dede MedicinaMedicina dede lala altaalta altitudaltitud parapara elel MedioMedio AmbienteAmbiente

(Tercera Universidad Médica Militar), Ministerio de Educación de Laboratorio / clave de alta altitud Medicina, Facultad de Medicina

Militar de la alta altitud, Tercera Universidad Médica Militar, Chongqing 400038, República Popular China

22 InstitutoInstituto dede MedicinaMedicina yy dede higienehigiene EquipoEquipo parapara lala regiónregión dede altaalta altitudaltitud // claveclave LaboratorioLaboratorio dede MedicinaMedicina dede lala altaalta altitudaltitud parapara elel

Medio Ambiente (Tercera Universidad Médica Militar), Ministerio de Educación de Laboratorio / clave de alta altitud Medicina,

Facultad de Medicina Militar de la alta altitud, Tercera Universidad Médica Militar, Chongqing 400038 , República Popular china

* los autores correspondientes:

Yuqi Gao,

+86 23 13708319120 Wei-gong Liao

23 13678472601

†† EsteEste artículoartículo haha sidosido aceptadoaceptado parapara susu publicaciónpublicación yy sometidosometido aa revisiónrevisión porpor parespares lleno,lleno, peropero nono haha pasadopasado porpor elel procesoproceso dede

corrección de estilo, composición, paginación y corrección de pruebas, lo que puede dar lugar a diferencias entre esta versión y la

versión del registro. Por favor citar este artículo como doi: [10.1002 / jcp.25974]

Información de apoyo adicional se puede encontrar en la versión en línea de este artículo.

Recibido el 30 de diciembre de de 2016; 24 revisada de abril de 2017. Aceptan las 24 de abril de 2017

Diario de la fisiología celular

Este artículo está protegido por derechos de autor. Todos los derechos reservados

DOI 10.1002 / jcp.25974

Este artículo está protegido por derechos de autor. Todos los derechos reservados

Abstracto

hipoxiahipoxiahipoxia enenen vivovivovivo induceinduceinduce oligozoospermia,oligozoospermia,oligozoospermia, azoospermiaazoospermiaazoospermia yyy lalala degeneracióndegeneracióndegeneración deldeldel epitelioepitelioepitelio germinal,germinal,germinal, peroperopero elelel mecanismomecanismomecanismo molecularmolecularmolecular subyacente de esta inducción no se aclara completamente. El objetivo de este estudio fue investigar el papel de la vía del receptor de muerte y la ruta mitocondrial de la apoptosis inducida por hipoxia de ratón GC-2spd células (GC-2) y la relación entre HIF-1α y la apoptosis de las células GC-2 inducida por la hipoxia. GC-2 células se sometieron a 1% de oxígeno durante 48 h. La apoptosis se detectó por citometría de flujo, tinción TUNEL, LDH, caspasa-3/8/9 en ausencia y presencia de siRNA HIF-1α. Los niveles de proteína de los marcadores relacionados con la apoptosis se determinó por transferencia de western en presencia y ausencia de HIF-1α siRNA. transmembrana cambio potencial mitocondrial fue observada por in situ JC-1 tinción. La viabilidad celular se evaluó tras el tratamiento de inhibidores de la caspasa-8 y la caspasa-9. Los resultados indicaron que la hipoxia en 1% de oxígeno durante 48 h inducidas apoptosis de GC-2 células. Una exposición prolongada de GC-2GC-2GC-2GC-2 célulascélulascélulascélulas aaaa condicionescondicionescondicionescondiciones dededede hipoxiahipoxiahipoxiahipoxia causadacausadacausadacausada regulaciónregulaciónregulaciónregulación porporporpor disminucióndisminucióndisminucióndisminución dededede c-FLIP,c-FLIP,c-FLIP,c-FLIP, DDDD dodododo RRRR 2222

yyy Bcl-2Bcl-2Bcl-2 yyy lalala regulaciónregulaciónregulación positivapositivapositiva dedede DRDRDR 5,5,5, TRAIL,TRAIL,TRAIL, Fas,Fas,Fas, p53p53p53 yyy Bax,Bax,Bax, conconcon unaunauna sobreproducciónsobreproducciónsobreproducción dedede lalala caspasa-3/8/9.caspasa-3/8/9.caspasa-3/8/9. PorPorPor otraotraotra parte,parte,parte, lalala hipoxia en este nivel tuvo un efecto sobre la despolarización mitocondrial. Además, los inhibidores específicos de la caspasa-8/9 parcialmente suprimida GC-2 apoptosis celular inducida por hipoxia, y los efectos anti-apoptóticos de los inhibidores de caspasa fueron aditivos. De nota, desmontables HIF-1α atenuada hipoxia e indujo la apoptosis de GC-2 células. En conclusión, nuestros datos sugieren que la vía del receptor de muerte y vía mitocondrial, lo que probablemente están mediadas por HIF-1α,

contribuyencontribuyen aa lala hipoxiahipoxia inducidainducida porpor GC-2GC-2 apoptosisapoptosis celular.celular. EsteEste artículoartículo estáestá protegidoprotegido porpor derechosderechos dede autor.autor. TodosTodos loslos derechosderechos

reservados

palabraspalabras clave:clave: oligozoospermia;oligozoospermia; azoospermia;azoospermia; víavía deldel receptorreceptor dede muerte;muerte; víavía mitocondrial;mitocondrial; HIF-1α;HIF-1α; hipoxia;hipoxia; apoptosis.

Este artículo está protegido por derechos de autor. Todos los derechos reservados

abreviaturas:abreviaturas: AhR,AhR, receptorreceptor dede arilaril hidrocarburos;hidrocarburos; c-FLIP,c-FLIP, celularcelular dede muertemuerte asociadoasociado aa FasFas dominiodominio similarsimilar aa interleulin-1βinterleulin-1β enzimaenzima dede

conversiónconversiónconversiónconversiónconversiónconversión dededededede proteínaproteínaproteínaproteínaproteínaproteína inhibidora;inhibidora;inhibidora;inhibidora;inhibidora;inhibidora; DRDRDRDRDRDR 5,5,5,5,5,5, ReceptorReceptorReceptorReceptorReceptorReceptor dededededede muertemuertemuertemuertemuertemuerte 5;5;5;5;5;5; rererererere dodododododo RRRRRR 2,2,2,2,2,2,

receptor señuelo 2; DISC, induce a la muerte complejo de señalización; DMOG, Dimethyloxalylglycin; proteína de dominio de

muerte FADD, Fas-asociado; FCM, el método de citometría de flujo; IPAS, PAS Inhibitoria (Per / Arnt / Sim) proteína de dominio;

JC-1, 5,5' , 6,6'-tetracloro-1,1' , 3,3'-tetraethylimidacarbocyanine yoduro; LDH, láctico-deshidrogenasa; MCL-1, de células de la

leucemia mieloide-1; MEFs, fibroblastos de ratón; MMP, potencial de membrana mitocondrial; PHD, prolil hidroxilasas; TRAIL,

necrosis tumoral relacionado con el factor inductor de apoptosis ligando; TUNEL, Terminal desoxinucleotidil transferasa dUTP

mediada por nick fin de etiquetado; VHL, Von Hippel-Lindau supresor de tumor; VSMC, Vascular células de músculo liso; BNIP-3,

Bcl-2 de diecinueve kilodalton proteína de interacción 3

ConflictoConflicto dede interesesintereses divulgación:divulgación: LosLos autoresautores hanhan declaradodeclarado queque nono existeexiste ningúnningún conflictoconflicto dede intereses.intereses.

Este artículo está protegido por derechos de autor. Todos los derechos reservados

Introducción

clara.

A nivel mundial, aproximadamente el 10-15% de las parejas sufren de infertilidad, y la infertilidad masculina contribuye a

La

más de la mitad de estos casos (Inhorn y Patrizio, 2015). La infertilidad masculina puede tener una variedad de causas,

incluyendo azoospermia, oligospermia, astenospermia, orquitis y varicocele (Esteves y Agarwal, 2016; Wu et al, 2016)

genético (Liu et al, 2015; Meng et al, 2015

(Darr et al, 2016;. Reyes et al, 2012)

patogénesis de las enfermedades masculinas enumerados anteriormente generalmente se deriva de dos factores: un factor

)

Y un factor ambiental. Este último incluye el estrés oxidativo y el estrés por calor

Entre los factores ambientales, la bibliografía publicada indica que la hipoxia induce la

infertilidad masculina (Verratti et al., 2008). Sin embargo, el mecanismo subyacente de esto sigue siendo en gran medida poco

Ha sido ampliamente reportado que la hipoxia es una firma de un microambiente tumoral sólido y promueve la proliferación

de células de cáncer humano, incluyendo de mama, cerebro, colorrectal, riñón, vejiga y el cáncer de melanoma (Bostrom et al,

Feng et al, 2015;. Knoll et al, 2016;. Salama et al, 2015). Sin embargo, la

2016;. Caron y Caron, 2015 ; da Motta et al, 2016;

hipoxia como un estrés celular puede inducir la apoptosis de células no cancerosas. Varios estudios recientes demostraron que el

daño celular inducido por la hipoxia está estrechamente relacionado con la apoptosis en los cardiomiocitos, astrocitos, células

endoteliales, células musculares y células pancreáticas (Li et al, 2016;. Ma et al, 2016;

Xu et al, 2016 ). De nota, un estudio indicó,

además, que la hipoxia puede inducir la apoptosis de las células de espermatogénesis en ratones (Reyes et al., 2012). En

consonancia con esta observación, en nuestro estudio anterior, hemos establecido un modelo de la infertilidad masculina mediante

tratamiento con hipoxia hipobárica y encontramos que la hipoxia induce la apoptosis de las células de espermatogénesis,

principalmente los espermatocitos (Liao et al., 2010). Esta evidencia indica que la infertilidad masculina inducida por hipoxia podría

correlacionar principalmente con la apoptosis de los espermatocitos. Sin embargo, los mecanismos subyacentes deben explorarse

más.

Es bien sabido que HIF-1α es un mediador clave de la adaptación celular a la hipoxia. Se identifica como un socio

heterodimérico de AhR, y su expresión puede ser inducida bajo condiciones hipóxicas (McNamee et al., 2016). Bajo un O

reducidareducidareducidareducidareducida 22222 presión,presión,presión,presión,presión, prolil-hidroxilasaprolil-hidroxilasaprolil-hidroxilasaprolil-hidroxilasaprolil-hidroxilasa (PHD)(PHD)(PHD)(PHD)(PHD) existíaexistíaexistíaexistíaexistía comocomocomocomocomo ununununun inhibidorinhibidorinhibidorinhibidorinhibidor dedededede HIF-1αHIF-1αHIF-1αHIF-1αHIF-1α debidodebidodebidodebidodebido aaaaa lalalalala OOOOO inferiorinferiorinferiorinferiorinferior 22222 disponibilidad.disponibilidad.disponibilidad.disponibilidad.disponibilidad. LaLaLaLaLa

inhibición de los resultados PHD tanto en la estabilización y la dimerización de HIF-1α (Favier et al., 2015). Recientemente,

varias líneas de evidencia han indicado que HIF-1α está implicado en la regulación de la apoptosis celular en condiciones de

hipoxia (Janke et al, 2013;. Sendoel et al., 2010) y que la inhibición de HIF-1α protege las células contra el daño apoptosis

Sherman et al, 2016). Por lo tanto, teniendo en cuenta el

durante la isquemia y el tratamiento de hipoxia (Huang et al, 2016;

efecto de la hipoxia sobre la apoptosis spermatocyte y HIF-1α como un mediador clave de la hipoxia que contribuye a la

apoptosis, en este estudio, se investigó si y cómo la hipoxia induce la apoptosis spermatocyte través de la vía HIF-1α en un

pachytene ratón spermatocyte derivados línea celular GC-2.

Este artículo está protegido por derechos de autor. Todos los derechos reservados

Materiales y métodos

Cultivo celular, tratamiento hipoxia y transfección

línea celular derivada de ratón spermatocyte pachytene GC-2 se obtuvieron de Zhong Yuan biológica Ltd (Beijing, China) y se

cultivaroncultivaroncultivaron enenen DMEMDMEMDMEM comocomocomo sesese hahaha descritodescritodescrito previamentepreviamentepreviamente (Kopalli(Kopalli(Kopalli etetet al.,al.,al., 2016).2016).2016). DondeDondeDonde sesese indique,indique,indique, lalala hipoxiahipoxiahipoxia (1%(1%(1% dedede OOO 2)2)2) sesese logrólogrólogró porporpor

unaunaunaunaunaunaunaunaunaunauna mezclamezclamezclamezclamezclamezclamezclamezclamezclamezclamezcla dedededededededededede gasesgasesgasesgasesgasesgasesgasesgasesgasesgasesgases dedededededededededede purezapurezapurezapurezapurezapurezapurezapurezapurezapurezapureza ultraultraultraultraultraultraultraultraultraultraultra altaaltaaltaaltaaltaaltaaltaaltaaltaaltaalta (5%(5%(5%(5%(5%(5%(5%(5%(5%(5%(5% dedededededededededede COCOCOCOCOCOCOCOCOCOCO 2,2,2,2,2,2,2,2,2,2,2, 10%10%10%10%10%10%10%10%10%10%10% HHHHHHHHHHH 22222222222 yyyyyyyyyyy 85%85%85%85%85%85%85%85%85%85%85% NNNNNNNNNNN 2)2)2)2)2)2)2)2)2)2)2) enenenenenenenenenenen ununununununununununun 3737373737373737373737 ooooooooooo CCCCCCCCCCC hipoxiahipoxiahipoxiahipoxiahipoxiahipoxiahipoxiahipoxiahipoxiahipoxiahipoxia estaciónestaciónestaciónestaciónestaciónestaciónestaciónestaciónestaciónestaciónestación dedededededededededede trabajotrabajotrabajotrabajotrabajotrabajotrabajotrabajotrabajotrabajotrabajo (Invivo(Invivo(Invivo(Invivo(Invivo(Invivo(Invivo(Invivo(Invivo(Invivo(Invivo 2,2,2,2,2,2,2,2,2,2,2, Baker,Baker,Baker,Baker,Baker,Baker,Baker,Baker,Baker,Baker,Baker,

Ruskinn, Sanford, ME, EE.UU.). Todas las operaciones experimentales, incluyendo ARN y el aislamiento de proteínas, y TUNEL

/ JC-1 tinción se realizaron en la estación de trabajo hipoxia.

El modelo hipóxico de GC-2 células se estableció de acuerdo con el tratamiento de tiempo diferente y diferente densidad. Para

diferentediferentediferentediferentediferentediferentediferente tiempotiempotiempotiempotiempotiempotiempo dedededededede tratamiento,tratamiento,tratamiento,tratamiento,tratamiento,tratamiento,tratamiento, 5555555 ××××××× 10101010101010 5555555 célulascélulascélulascélulascélulascélulascélulas /////// pocillopocillopocillopocillopocillopocillopocillo sesesesesesese implantaronimplantaronimplantaronimplantaronimplantaronimplantaronimplantaron aaaaaaa laslaslaslaslaslaslas seisseisseisseisseisseisseis platoplatoplatoplatoplatoplatoplato bienbienbienbienbienbienbien (35(35(35(35(35(35(35 mmmmmmmmmmmmmm dedededededede diámetro)diámetro)diámetro)diámetro)diámetro)diámetro)diámetro) enenenenenenen ununununununun 37373737373737 ooooooo C,C,C,C,C,C,C, 21%21%21%21%21%21%21% OOOOOOO 2222222 yyyyyyy

5%5%5% dedede COCOCO 222 incubadora.incubadora.incubadora. LasLasLas célulascélulascélulas sesese lavaronlavaronlavaron unaunauna vezvezvez conconcon soluciónsoluciónsolución salinasalinasalina tampóntampóntampón fosfatofosfatofosfato (PBS)(PBS)(PBS) despuésdespuésdespués dedede 242424 hhh yyy luegoluegoluego sesese cultivaroncultivaroncultivaron

laslaslaslaslas célulascélulascélulascélulascélulas enenenenen ununununun 3737373737 ooooo C,C,C,C,C, 1%1%1%1%1% OOOOO 22222 estaciónestaciónestaciónestaciónestación dedededede trabajotrabajotrabajotrabajotrabajo hipoxiahipoxiahipoxiahipoxiahipoxia durantedurantedurantedurantedurante 4848484848 h,h,h,h,h, 6060606060 hhhhh yyyyy 7272727272 h.h.h.h.h. ParaParaParaParaPara elelelelel tratamientotratamientotratamientotratamientotratamiento dedededede densidaddensidaddensidaddensidaddensidad diferente,diferente,diferente,diferente,diferente,

1,251,251,251,251,251,251,251,251,251,251,251,251,25 ××××××××××××× 10101010101010101010101010 5,5,5,5,5,5,5,5,5,5,5,5,5, 2,52,52,52,52,52,52,52,52,52,52,52,52,5 ××××××××××××× 10101010101010101010101010 5,5,5,5,5,5,5,5,5,5,5,5,5, 5555555555555 ××××××××××××× 10101010101010101010101010 5555555555555 célulascélulascélulascélulascélulascélulascélulascélulascélulascélulascélulascélulascélulas ///////////// pocillopocillopocillopocillopocillopocillopocillopocillopocillopocillopocillopocillopocillo fueronfueronfueronfueronfueronfueronfueronfueronfueronfueronfueronfueronfueron implantadosimplantadosimplantadosimplantadosimplantadosimplantadosimplantadosimplantadosimplantadosimplantadosimplantadosimplantadosimplantados aaaaaaaaaaaaa laslaslaslaslaslaslaslaslaslaslaslaslas seisseisseisseisseisseisseisseisseisseisseisseisseis platoplatoplatoplatoplatoplatoplatoplatoplatoplatoplatoplatoplato bienbienbienbienbienbienbienbienbienbienbienbienbien enenenenenenenenenenenenen ununununununununununununun 37373737373737373737373737 ooooooooooooo C,C,C,C,C,C,C,C,C,C,C,C,C, 21%21%21%21%21%21%21%21%21%21%21%21%21% OOOOOOOOOOOOO 2222222222222 yyyyyyyyyyyyy 5%5%5%5%5%5%5%5%5%5%5%5%5% dedededededededededededede COCOCOCOCOCOCOCOCOCOCOCOCO 2222222222222 incubadora.incubadora.incubadora.incubadora.incubadora.incubadora.incubadora.incubadora.incubadora.incubadora.incubadora.incubadora.incubadora. LasLasLasLasLasLasLasLasLasLasLasLasLas célulascélulascélulascélulascélulascélulascélulascélulascélulascélulascélulascélulascélulas

sesesesese lavaronlavaronlavaronlavaronlavaron unaunaunaunauna vezvezvezvezvez conconconconcon PBSPBSPBSPBSPBS despuésdespuésdespuésdespuésdespués dedededede 2424242424 hhhhh yyyyy despuésdespuésdespuésdespuésdespués sesesesese cultivaroncultivaroncultivaroncultivaroncultivaron enenenenen ununununun 3737373737 ooooo C,C,C,C,C, 1%1%1%1%1% OOOOO 22222 estaciónestaciónestaciónestaciónestación dedededede trabajotrabajotrabajotrabajotrabajo hipoxiahipoxiahipoxiahipoxiahipoxia durantedurantedurantedurantedurante 4848484848 h.h.h.h.h.

las secuencias de ARN de interferencia pequeño para ratón HIF-1α fueron como sigue:

GGGCCAUAUUCAUGUCUAUUUGGGCCAUAUUCAUGUCUAUUUGGGCCAUAUUCAUGUCUAUUUGGGCCAUAUUCAUGUCUAUUU (((( sentido)sentido)sentido)sentido) yyyy AUAGACAUGAAUAUGGCCCUUAUAGACAUGAAUAUGGCCCUUAUAGACAUGAAUAUGGCCCUUAUAGACAUGAAUAUGGCCCUU (((( antisentido).antisentido).antisentido).antisentido). laslaslaslas secuenciassecuenciassecuenciassecuencias dededede ARNARNARNARN dededede interferenciainterferenciainterferenciainterferencia

pequeño para control negativo fueron los siguientes:

UUCUCCGAACGUGUCACGUTTUUCUCCGAACGUGUCACGUTTUUCUCCGAACGUGUCACGUTTUUCUCCGAACGUGUCACGUTT (((( sentido)sentido)sentido)sentido) yyyy ACGUGACACGUUCGGAGAATTACGUGACACGUUCGGAGAATTACGUGACACGUUCGGAGAATTACGUGACACGUUCGGAGAATT (((( antisentido).antisentido).antisentido).antisentido). LaLaLaLa transfeccióntransfeccióntransfeccióntransfección transitoriatransitoriatransitoriatransitoria sesesese realizaronrealizaronrealizaronrealizaron

con Lipofectamine 2000 (Invitrogen, California, EE.UU.). Los experimentos se realizaron de forma rutinaria en los pocillos por

triplicado y se repitieron tres veces.

detección de la apoptosis por citometría de flujo

incidencia de apoptosis se midió con el kit de detección de apoptosis con Anexina V-FITC I (Beyotime, Nanjing, China) según las

instrucciones del fabricante. Brevemente, las células se lavaron dos veces con PBS frío, y luego se resuspendieron en 200? L de

tampóntampóntampón dedede uniónuniónunión aaa unaunauna concentraciónconcentraciónconcentración dedede 111 ××× 101010 666 célulascélulascélulas porporpor ml.ml.ml. 2μl2μl2μl dedede soluciónsoluciónsolución dedede FITCFITCFITC VVV anexinaanexinaanexina yyy 10?10?10? LLL dedede PIPIPI (yoduro(yoduro(yoduro dedede

propidio)propidio)propidio) sesese añadieronañadieronañadieron aaa estasestasestas célulascélulascélulas aaa 373737 ooo CCC durantedurantedurante 303030 min.min.min. LasLasLas célulascélulascélulas sesese analizaronanalizaronanalizaron porporpor citometríacitometríacitometría dedede flujoflujoflujo (FACSCalibur;(FACSCalibur;(FACSCalibur; BDBDBD

Biosciences, San Diego, EE.UU.) dentro de 1 h. Las células apoptóticas se contaron y se representan como un porcentaje del

recuento total de células.

ensayo de TUNEL

ParaParaPara lalala deteccióndeteccióndetección dedede apoptosisapoptosisapoptosis ininin vitro,vitro,vitro, TUNELTUNELTUNEL ensayosensayosensayos sesese realizaronrealizaronrealizaron conconcon elelel kitkitkit TUNELTUNELTUNEL fluorescentefluorescentefluorescente dedede ununun solosolosolo pasopasopaso

(Beyotime). Brevemente, las células estimuladas con o sin hipoxia se permeabilizaron con 0,1% Triton X-100, seguido con

isotiocianatoisotiocianatoisotiocianato dedede fluoresceínafluoresceínafluoresceína (FITC)(FITC)(FITC) marcadomarcadomarcado conconcon lalala tincióntincióntinción dedede TUNELTUNELTUNEL durantedurantedurante 111 hhh aaa 373737 ooo célulascélulascélulas C.C.C. LaLaLa TUNEL-positivosTUNEL-positivosTUNEL-positivos fueronfueronfueron

imágenes bajo

Este artículo está protegido por derechos de autor. Todos los derechos reservados

escaneo láser microscopio confocal (IX81, Olympus, Tokio, Japón) y se cuantifica como el número de manchas

verdes en cada fotografía (× 200); Se contaron 10 fotografías.

la medición de LDH

nivel de LDH en sobrenadantes de cultivo de células se evaluó mediante Kit de detección de LDH (Beyotime) según las instrucciones

deldeldel fabricante.fabricante.fabricante. EnEnEn breve,breve,breve, GC-2GC-2GC-2 célulascélulascélulas fueronfueronfueron sembradassembradassembradas enenen placasplacasplacas dedede cultivocultivocultivo dedede tejidostejidostejidos dedede 969696 pocillospocillospocillos aaa unaunauna densidaddensidaddensidad dedede 222 ××× 101010 444 célulascélulascélulas

porporpor pocillopocillopocillo antesantesantes deldeldel tratamientotratamientotratamiento hipóxico.hipóxico.hipóxico. DespuésDespuésDespués deldeldel tratamiento,tratamiento,tratamiento, laslaslas placasplacasplacas sesese centrifugaroncentrifugaroncentrifugaron aaa 300300300 ××× gramogramogramo durantedurantedurante 555 min;min;min; 606060 lll dedede

sobrenadante libre de células se incubó con solución de sustrato de LDH 30 l durante 30 min, y luego la absorbancia a 490 nm se

registró en un espectrofotómetro de microplacas. La actividad de liberación de LDH fue presentada como el aumento de veces sobre el

grupogrupogrupogrupogrupogrupogrupogrupogrupo control:control:control:control:control:control:control:control:control: [OD[OD[OD[OD[OD[OD[OD[OD[OD muestramuestramuestramuestramuestramuestramuestramuestramuestra - - - - - - - - - ODODODODODODODODOD blanco]/[blanco]/[blanco]/[blanco]/[blanco]/[blanco]/[blanco]/[blanco]/[blanco]/[ sobredosissobredosissobredosissobredosissobredosissobredosissobredosissobredosissobredosis máximamáximamáximamáximamáximamáximamáximamáximamáxima dedededededededede LDHLDHLDHLDHLDHLDHLDHLDHLDH - - - - - - - - - ODODODODODODODODOD blanco].blanco].blanco].blanco].blanco].blanco].blanco].blanco].blanco]. LaLaLaLaLaLaLaLaLa curvacurvacurvacurvacurvacurvacurvacurvacurva estándarestándarestándarestándarestándarestándarestándarestándarestándar dedededededededede LDHLDHLDHLDHLDHLDHLDHLDHLDH sesesesesesesesese representarepresentarepresentarepresentarepresentarepresentarepresentarepresentarepresenta dedededededededede acuerdoacuerdoacuerdoacuerdoacuerdoacuerdoacuerdoacuerdoacuerdo conconconconconconconconcon 000000000 UUUUUUUUU ///////// ml,ml,ml,ml,ml,ml,ml,ml,ml, 6,56,56,56,56,56,56,56,56,5

/ ml, 12,5 U / ml, 25 U / ml, 50 U / ml y 100 U / ml de LDH (Jiancheng, Nanjing, China). Entonces fluido 120? L / pocillo LDH y 60μl /

pocillopocillopocillo dedede deteccióndeteccióndetección dedede LDHLDHLDH sesese mezclaronmezclaronmezclaron enenen 969696 platoplatoplato bien,bien,bien, aaa continuación,continuación,continuación, 969696 platoplatoplato bienbienbien sesese incubóincubóincubó enenen ununun 373737 ooo CCC incubadoraincubadoraincubadora durantedurantedurante 303030

min. Por último, el valor de LDH absoluta se calculó por la curva estándar.

ensayo de viabilidad celular

La proliferación celular se determinó usando el ensayo de sal de tetrazolio WST-8 (Cell Counting Kit-8, Beyotime). Las células se

sembraron en placas de 96 pocillos a una densidad de 2 × 10 4 / así en 0,1 ml de medio de cultivo antes del tratamiento hipóxico. En

sembraron en placas de 96 pocillos a una densidad de 2 × 10 4 / así en 0,1 ml de medio de cultivo antes del tratamiento hipóxico. En

sembraron en placas de 96 pocillos a una densidad de 2 × 10 4 / así en 0,1 ml de medio de cultivo antes del tratamiento hipóxico. En

1h antes del final de los períodos de incubación indicados, 10 l de WST-8 de reactivo se añadieron a las células. Al final de la

incubación, la densidad celular se estimó midiendo la absorbancia del producto de reacción de formazano coloreado a 450 nm

usando un Go microplacas Absorbancia lector Multiskan (Thermo, Massachusetts, EE.UU.). La viabilidad celular se evaluó

mediante la proporción de grupo hipoxia al grupo de normoxia respectivamente.

La caspasa-3, 8, 9 ensayo de actividad

Las células fueron tratadas con la hipoxia con o sin la presencia de HIF-1α, y la actividad de la caspasa-3 / 8/9 en los lisados ​​aclarados

se midieron mediante el uso de la caspasa-3/8/9 Kit de Ensayo de Actividad (Beyotime) de acuerdo con el fabricante de instrucción.

Después de hipoxia, las células se lisaron con tampón de lisis durante 15 min sobre hielo y los lisados ​​celulares se centrifugaron a

16.00016.00016.000 ggg durantedurantedurante 101010 minminmin aaa 444 ooo C.C.C. ActividadActividadActividad dedede lalala caspasa-3/8/9caspasa-3/8/9caspasa-3/8/9 sesese cuantificócuantificócuantificó conconcon ununun MultiskanMultiskanMultiskan GoGoGo microplacasmicroplacasmicroplacas AbsorbanciaAbsorbanciaAbsorbancia ReaderReaderReader

(Thermo) a una absorbancia de 405 nm. Los valores del blanco se restaron y los aumentos de caspasa 3-actividades se expresaron

como aumento en veces y se calculan sobre la base de las actividades medidas a partir de células no tratadas. Cada muestra se midió

por triplicado.

Efectos de los inhibidores de caspasa sobre la viabilidad celular en condiciones de hipoxia

Se trataron GC-2 células como se describió anteriormente. El medio se cambió y las células se pre-incubó con 50 mM

Z-IETD-FMK (un inhibidor de la caspasa-8-específico; BD, New Jersey, EE.UU.),

Este artículo está protegido por derechos de autor. Todos los derechos reservados

or100μM Z-LEHD-FMK (un inhibidor de la caspasa-9 específica, BD) o el tanto por 2 h, respectivamente. Las células fueron estática sin

ningún inhibidor como control negativo; Las células se trataron en condiciones de hipoxia sin inhibidor como control positivo. Luego, las

células se trataron con la hipoxia durante 48 h y se detectó la viabilidad celular como se describió anteriormente.

el aislamiento de ARN y reacción en cadena de polimerasa en tiempo real

El ARN total se extrajo de las células tratadas utilizando 1 ml de reactivo de TRIZOL (Takara Bio, Shiga, Japón). Se sintetizó ADNc a

partir de ARN total de 1? g a través de la transcripción inversa usando un kit de TaKaRa RNA PCR (Takara Bio). Las secuencias para

loslosloslos cebadorescebadorescebadorescebadores sesesese muestranmuestranmuestranmuestran comocomocomocomo siguiente:siguiente:siguiente:siguiente: BNIP-3BNIP-3BNIP-3BNIP-3 (hacia(hacia(hacia(hacia adelante,adelante,adelante,adelante, 5'-5'-5'-5'- GCTCCCAGACACCACAAGAT-GCTCCCAGACACCACAAGAT-GCTCCCAGACACCACAAGAT-GCTCCCAGACACCACAAGAT- 3'3'3'3' yyyy revertir,revertir,revertir,revertir, 5'-5'-5'-5'- TGAGAGTAGCTGTGCGCTTC-TGAGAGTAGCTGTGCGCTTC-TGAGAGTAGCTGTGCGCTTC-TGAGAGTAGCTGTGCGCTTC-

3' ). Cuantitativa en tiempo real PCR se realizó usando 1? G de ADNc y verde SYBR (BioRad, California, EE.UU.) en placas de 96

pocillos en un sistema ciclador térmico rápido LightCycler (investigación MJ, Therma). Los productos de PCR se sometieron a análisis

de la curva de fusión, y los datos se analizaron por el método de cálculo 2-ΔΔCT y estandarizados por β-actina.

Western Blot

Después del tratamiento de hipoxia, la proteína total se extrajo utilizando un kit de Western & IP de lisis celular (Beyotime) que

contiene 1 mM de PMSF. Extractos de células enteras se separaron entonces mediante electroforesis en gel de poliacrilamida con

dodecilsulfato de sodio al 10% y se electrotransfirieron a una membrana de polyvinylidenedifloride (PVDF) (Beyotime). Después del

bloqueo,bloqueo,bloqueo,bloqueo,bloqueo, laslaslaslaslas membranasmembranasmembranasmembranasmembranas sesesesese incubaronincubaronincubaronincubaronincubaron aaaaa 44444 ooooo CCCCC durantedurantedurantedurantedurante lalalalala nochenochenochenochenoche conconconconcon anticuerpoanticuerpoanticuerpoanticuerpoanticuerpo policlonalpoliclonalpoliclonalpoliclonalpoliclonal dedededede conejoconejoconejoconejoconejo contracontracontracontracontra DRDRDRDRDR 55555 ((((( 1:1:1:1:1: 500500500500500 dilución,dilución,dilución,dilución,dilución,

ab8416,ab8416,ab8416, Abcam,Abcam,Abcam, Cambridge,Cambridge,Cambridge, ReinoReinoReino Unido),Unido),Unido), c-FLIPc-FLIPc-FLIP (dilución(dilución(dilución 1:1:1: 1000,1000,1000, ab8421,ab8421,ab8421, Abcam),Abcam),Abcam), TRAILTRAILTRAIL (1:(1:(1: 200200200 dilución,dilución,dilución, ab42121,ab42121,ab42121, Abcam),Abcam),Abcam), DDD dododo RRR

22 (( 1:1: 10001000 dilución,dilución, ab2019,ab2019, Abcam),Abcam), p53p53 (dilución(dilución 1:1: 500,500, sc-6243,sc-6243, SantaSanta Cruz,Cruz, Texas,Texas, EE.UU.),EE.UU.), FasFas (dilución(dilución 1:1: 200,200, sc-1023,sc-1023, SantaSanta

Cruz), Bcl-2 (1: dilución 500, sc-492, Santa Cruz), Bax (dilución 1: 500, sc-6236, Santa Cruz), HIF-1α (dilución 1: 1000, sc-10790,

Santa Cruz), BNIP-3 (1: 1000 dilución, 44060, CST, Boston, Massachusetts, EE.UU.) y β-actina (dilución 1: 1000, sc-8432, Santa

Cruz), a continuación, las membranas se lavaron con TBST y se incubaron con rábano picante anticuerpos secundarios ligados a

peroxidasa (ZDR-5306 , ZDR-5307, Zhong Shan, Pekín, china). Después de ser lavado con TBST, las bandas inmunorreactivas se

visualizaron utilizando NBT / BCIP (Beyotime) como sustrato.

Ensayo de transmembrana potenciales cambios mitocondriales in situ usando el colorante fluorescente JC-1

sonda JC-1 se empleó para medir la despolarización mitocondrial en células GC-2. Después del tratamiento de hipoxia, las células

sesese incubaronincubaronincubaron aaa 373737 ooo CCC durantedurantedurante 202020 minminmin conconcon 555 mgmgmg /// lll JC-1JC-1JC-1 (Beyotime),(Beyotime),(Beyotime), despuésdespuésdespués sesese lavólavólavó dosdosdos vecesvecesveces conconcon PBSPBSPBS yyy sesese colocacolocacoloca enenen mediomediomedio dedede

cultivo 2 ml. Un verde fluorescente (JC-1 como un monómero en los potenciales de membrana bajas) y un fluorescente roja (JC-1

como “J-agregados” A mayores potenciales de membrana) se controló con un microscopio confocal de barrido láser

Este artículo está protegido por derechos de autor. Todos los derechos reservados

(IX81, Olympus). despolarización mitocondrial está indicada por una disminución en la relación de intensidad de fluorescencia roja /

verde.

análisis estadístico

Todos los datos se expresaron como media ± desviación estándar (SD). Los análisis estadísticos se realizaron con el

programa estadístico SPSS 11.5. Significación estadística se evaluó mediante análisis unidireccional de la varianza

(ANOVA), seguido por el menos signi fi diferencia no puede prueba (LSD).

resultados

inducida por tratamiento Hipoxia apoptosis-GC 2 celular

Nosotros establecimos primero la densidad celular óptima para investigar los efectos de la hipoxia en GC-2 apoptosis de las

células por TUNEL y citometría de flujo ensayos. Los resultados mostraron que la morfología de las células de hipoxia-tratada, tal como se

evaluó bajo un microscopio láser de barrido confocal, mostró una disminución gradual relación apoptótica con el aumento de la densidad

dedededededededede célulascélulascélulascélulascélulascélulascélulascélulascélulas enenenenenenenenen cualquieracualquieracualquieracualquieracualquieracualquieracualquieracualquieracualquiera dedededededededede normoxianormoxianormoxianormoxianormoxianormoxianormoxianormoxianormoxia (21%(21%(21%(21%(21%(21%(21%(21%(21% OOOOOOOOO 2)2)2)2)2)2)2)2)2) ooooooooo hipoxiahipoxiahipoxiahipoxiahipoxiahipoxiahipoxiahipoxiahipoxia (1%(1%(1%(1%(1%(1%(1%(1%(1% dedededededededede OOOOOOOOO 2)2)2)2)2)2)2)2)2) condicionescondicionescondicionescondicionescondicionescondicionescondicionescondicionescondiciones despuésdespuésdespuésdespuésdespuésdespuésdespuésdespuésdespués dedededededededede 484848484848484848 hhhhhhhhh dedededededededede cultivocultivocultivocultivocultivocultivocultivocultivocultivo ((((((((( FiguraFiguraFiguraFiguraFiguraFiguraFiguraFiguraFigura S1AS1AS1AS1AS1AS1AS1AS1AS1A yyyyyyyyy S1B),S1B),S1B),S1B),S1B),S1B),S1B),S1B),S1B), reflejandoreflejandoreflejandoreflejandoreflejandoreflejandoreflejandoreflejandoreflejando

los efectos de contacto célula-célula beneficiosos sobre el crecimiento de GC-2 células. El ensayo FCM confirmó adicionalmente esta

observaciónobservaciónobservaciónobservaciónobservaciónobservaciónobservación ((((((( FiguraFiguraFiguraFiguraFiguraFiguraFigura S1CS1CS1CS1CS1CS1CS1C yyyyyyy S1D).S1D).S1D).S1D).S1D).S1D).S1D). PorPorPorPorPorPorPor lololololololo tanto,tanto,tanto,tanto,tanto,tanto,tanto, sesesesesesese determinódeterminódeterminódeterminódeterminódeterminódeterminó ununununununun 5555555 ××××××× 10101010101010 5555555 /////// densidaddensidaddensidaddensidaddensidaddensidaddensidad dedededededede siembrasiembrasiembrasiembrasiembrasiembrasiembra mlmlmlmlmlmlml comocomocomocomocomocomocomo lalalalalalala densidaddensidaddensidaddensidaddensidaddensidaddensidad celularcelularcelularcelularcelularcelularcelular óptimaóptimaóptimaóptimaóptimaóptimaóptima paraparaparaparaparaparapara lalalalalalala

investigación adicional porque había muy pocas células apoptóticas en condiciones de cultivo normoxia A esta densidad celular, formando

unun controlcontrol agudoagudo aa lala queque sese podríapodría compararcomparar lala condicióncondición dede hipoxiahipoxia (( FiguraFigura S1).S1).

A continuación, se determinó el efecto de diferentes tiempos de la hipoxia sobre la apoptosis de las células GC-2 mediante la

mediciónmediciónmedición dedede lalala tasatasatasa dedede apoptosisapoptosisapoptosis aaa laslaslas 242424 h,h,h, 484848 h,h,h, 606060 hhh yyy 727272 hhh despuésdespuésdespués dedede 555 ××× 101010 555 /// lalala siembrasiembrasiembra dedede célulascélulascélulas ml.ml.ml. LosLosLos resultadosresultadosresultados mostraronmostraronmostraron

quequequequeque nonononono hubohubohubohubohubo diferenciasdiferenciasdiferenciasdiferenciasdiferencias enenenenen elelelelel porcentajeporcentajeporcentajeporcentajeporcentaje dedededede célulascélulascélulascélulascélulas apoptóticasapoptóticasapoptóticasapoptóticasapoptóticas entreentreentreentreentre elelelelel 21%21%21%21%21% OOOOO 22222 grupogrupogrupogrupogrupo dedededede tratamientotratamientotratamientotratamientotratamiento yyyyy elelelelel 1%1%1%1%1% OOOOO 22222 grupogrupogrupogrupogrupo dedededede tratamientotratamientotratamientotratamientotratamiento aaaaa

las 24 h. Sin embargo, un aumento gradual de la condensación de la cromatina y fragmentación nuclear se produjo en las células GC-2

despuésdespuésdespués dedede 242424 hhh dedede tratamientotratamientotratamiento (hipoxia(hipoxia(hipoxia FiguraFiguraFigura 1A1A1A yyy 1C),1C),1C), reflejandoreflejandoreflejando losloslos efectosefectosefectos dedede hipoxiahipoxiahipoxia enenen lalala apoptosisapoptosisapoptosis dedede GC-2GC-2GC-2 células.células.células. Además,Además,Además,

más del 25% de las células GC-2 fueron daños apoptóticos y severa de las células GC-2 se observó después de 60 h de tratamiento

hipoxia.hipoxia.hipoxia. LosLosLos resultadosresultadosresultados deldeldel ensayoensayoensayo dedede FCMFCMFCM fueronfueronfueron consistentesconsistentesconsistentes conconcon losloslos resultadosresultadosresultados dedede lalala tincióntincióntinción dedede TUNELTUNELTUNEL ((( FiguraFiguraFigura 1B1B1B yyy 1D).1D).1D). DelDelDel mismomismomismo

modo,modo,modo, enenen comparacióncomparacióncomparación conconcon lalala normoxia,normoxia,normoxia, hipoxiahipoxiahipoxia indujoindujoindujo ununun aumentoaumentoaumento significativosignificativosignificativo enenen elelel nivelnivelnivel dedede proteínaproteínaproteína HIF-1αHIF-1αHIF-1α ((( FiguraFiguraFigura 1E1E1E yyy 1F).1F).1F). FinalmenteFinalmenteFinalmente

sesese optóoptóoptó porporpor utilizarutilizarutilizar 555 ××× 101010 555 /// mlmlml yyy 484848 hhh dedede tratamientotratamientotratamiento hipoxiahipoxiahipoxia comocomocomo elelel modelomodelomodelo dedede apoptosisapoptosisapoptosis dedede laslaslas célulascélulascélulas GC-2GC-2GC-2 porqueporqueporque nonono eraneraneran

moderadamente células apoptóticas en las condiciones de cultivo hipóxicas.

Este artículo está protegido por derechos de autor. Todos los derechos reservados

La hipoxia activa la vía del receptor de muerte en las células de GC-2

Es un hecho documentado que la vía del receptor de muerte se activa en la apoptosis de células germinales, que es inducido por

sustancias tóxicas ambientales (Catlin et al., 2014). También se examinó si el efecto apoptótico de tratamiento hipoxia en GC-2 células

se asoció con la alteración de marcadores de apoptosis relacionada con el receptor de muerte. Los resultados mostraron que la hipoxia

inducidainducidainducidainducidainducidainducidainducida porporporporporporpor ununununununun aumentoaumentoaumentoaumentoaumentoaumentoaumento enenenenenenen losloslosloslosloslos nivelesnivelesnivelesnivelesnivelesnivelesniveles dedededededede DRDRDRDRDRDRDR 5,5,5,5,5,5,5, TRAIL,TRAIL,TRAIL,TRAIL,TRAIL,TRAIL,TRAIL, yyyyyyy Fas,Fas,Fas,Fas,Fas,Fas,Fas, yyyyyyy unaunaunaunaunaunauna disminucióndisminucióndisminucióndisminucióndisminucióndisminucióndisminución enenenenenenen losloslosloslosloslos nivelesnivelesnivelesnivelesnivelesnivelesniveles dedededededede c-FLIPc-FLIPc-FLIPc-FLIPc-FLIPc-FLIPc-FLIP yyyyyyy DDDDDDD dododododododo RRRRRRR 2222222 expresiónexpresiónexpresiónexpresiónexpresiónexpresiónexpresión dedededededede lalalalalalala

proteínaproteínaproteína ((( FigFigFig 2A2A2A yyy 2B),2B),2B), quequeque sesese determinódeterminódeterminó porporpor análisisanálisisanálisis dedede transferenciatransferenciatransferencia Western.Western.Western. Además,Además,Además, enenen comparacióncomparacióncomparación conconcon elelel grupogrupogrupo dedede normoxia,normoxia,normoxia, elelel

grupo hipoxia tenía actividades de la caspasa-8 y LDH que aumentaron significativamente después de 48 h de tratamiento con oxígeno

alalalalal 1%1%1%1%1% ((((( FigFigFigFigFig 2C2C2C2C2C yyyyy 2D).2D).2D).2D).2D). ComoComoComoComoComo sesesesese muestramuestramuestramuestramuestra enenenenen LaLaLaLaLa Fig.Fig.Fig.Fig.Fig. 2E,2E,2E,2E,2E, Z-IETD-FMK,Z-IETD-FMK,Z-IETD-FMK,Z-IETD-FMK,Z-IETD-FMK, ununununun inhibidorinhibidorinhibidorinhibidorinhibidor específicoespecíficoespecíficoespecíficoespecífico dedededede lalalalala caspasa-8,caspasa-8,caspasa-8,caspasa-8,caspasa-8, aumentóaumentóaumentóaumentóaumentó significativamentesignificativamentesignificativamentesignificativamentesignificativamente

la tasa de proliferación celular en células de ratón GC-2 en comparación con las células tratadas con vehículo que fueron expuestos a

las mismas condiciones de hipoxia. Estos datos indicaron que la vía apoptótica DR- se activa durante la apoptosis inducida por hipoxia

en GC-2 células.

La hipoxia activa la vía apoptótica mitocondrial

La vía mitocondrial se activa en la apoptosis de las células germinales que es inducido por sustancias tóxicas ambientales (Guo

et al., 2014). También se determinó el efecto de la hipoxia sobre marcadores apoptóticos relacionados mitocondriales y MMP. Los

resultados del análisis de transferencia Western mostraron que la hipoxia inducida por un aumento en los niveles de proteína de p53 y

BaxBaxBax peroperopero unaunauna disminucióndisminucióndisminución enenen elelel nivelnivelnivel dedede proteínasproteínasproteínas dedede Bcl-2Bcl-2Bcl-2 ((( FigFigFig 3A3A3A yyy 3B).3B).3B). SeSeSe hahaha informadoinformadoinformado dedede quequeque BNIP-3BNIP-3BNIP-3 (Bcl-2(Bcl-2(Bcl-2 dedede diecinuevediecinuevediecinueve

kilodalton proteína de interacción 3, uno de los BH3-sólo los miembros de la familia Bcl-2) inducida por HIF-1α regula positivamente

tanto la apoptosis y mitofagia (Mazure y Pouyssegur,

2010). Por lo tanto, determinamos su proteína y las expresiones de ARNm mediante transferencia Western y ensayos de RT-PCR. Los

resultadosresultadosresultadosresultados mostraronmostraronmostraronmostraron quequequeque elelelel nivelnivelnivelnivel dededede mRNAmRNAmRNAmRNA BNIP-3BNIP-3BNIP-3BNIP-3 (((( LaLaLaLa Fig.Fig.Fig.Fig. 3C)3C)3C)3C) fuefuefuefue activadoactivadoactivadoactivado porporporpor lalalala hipoxia.hipoxia.hipoxia.hipoxia. EnEnEnEn contraste,contraste,contraste,contraste, elelelel nivelnivelnivelnivel dededede proteínaproteínaproteínaproteína BNIP-3BNIP-3BNIP-3BNIP-3 (((( LaLaLaLa

Fig.Fig. 3A)3A) fuefue inhibidainhibida significativamentesignificativamente porpor lala hipoxia.hipoxia. Además,Además, laslas actividadesactividades dede lala caspasa-9caspasa-9 yy lala caspasa-3caspasa-3 aumentaronaumentaron

significativamentesignificativamentesignificativamente enenen célulascélulascélulas GC-2GC-2GC-2 quequeque fueronfueronfueron tratadostratadostratados conconcon hipoxiahipoxiahipoxia ((( Fig.Fig.Fig. 3D).3D).3D). solossolossolos Z-LEHD-FMKZ-LEHD-FMKZ-LEHD-FMK aumentóaumentóaumentó significativamentesignificativamentesignificativamente lalala tasatasatasa dedede

proliferaciónproliferaciónproliferación celularcelularcelular enenen laslaslas célulascélulascélulas GC-2GC-2GC-2 dedede ratónratónratón conconcon respectorespectorespecto aaa laslaslas célulascélulascélulas tratadastratadastratadas conconcon vehículovehículovehículo quequeque fueronfueronfueron expuestosexpuestosexpuestos aaa 1%1%1% OOO 222 concentraciónconcentraciónconcentración

de 48 h. La tasa de proliferación celular se incrementó aún más en las células que se co-incubaron con Z-IETD-FMK y Z-LEHD-FMK

concon elel tratamientotratamiento hipoxiahipoxia (( Fig.Fig. 3E).3E).

El JC-1 (sonda de fluorescencia ensayo de potencial de membrana mitocondrial) agregados se dispersaron a la forma

monoméricamonomérica (fluorescencia(fluorescencia verde)verde) enen laslas célulascélulas queque sese sometieronsometieron aa tratamientotratamiento dede hipoxiahipoxia durantedurante 4848 hh (( FigsFigs 3F,3F, 3G3G yy

3H).3H). LosLos resultadosresultados mostraronmostraron queque elel tratamientotratamiento concon lala hipoxiahipoxia reducereduce lala proporciónproporción dede rojorojo (JC-1(JC-1 agregados)agregados) aa verdeverde (JC-1(JC-1

monómeros), lo que indica que el tratamiento hipoxia causada la disipación del potencial de membrana mitocondrial. Estos

datos indicaron que la hipoxia activa la ruta mitocondrial de la apoptosis en células de ratón GC-2.

Este artículo está protegido por derechos de autor. Todos los derechos reservados

La hipoxia inducida por HIF-1α fue responsable de la DR y mitocondrial mediada por apoptosis de las células GC-2

RecientementeRecientemente sese haha informadoinformado dede queque HIF-1HIF-1 apuntandoapuntando MCL-1MCL-1 (un(un miembromiembro anti-apoptóticosanti-apoptóticos dede lala familiafamilia Bcl-2)Bcl-2) estáestá implicadaimplicada enen

la regulación de la apoptosis de células germinales durante la isquemia testículo (Palladino et al., 2012). A continuación, se evaluó la

posibilidad de que el silenciamiento de HIF-1α podría evitar la apoptosis durante la apoptosis inducida por hipoxia en GC-2 células.

Sin embargo, si HIF-1a podría inducir GC-2 apoptosis de las células a través de la DR y / o vía (s) mitocondrial sigue

siendo poco clara. Para este fin, hemos derribado la expresión endógena de HIF-1α usando siRNA para observar los efectos de

las dos vías de la apoptosis de GC-2 células y determinar sus mecanismos subyacentes. Los resultados mostraron que la

apoptosis de las células GC-2 tratados por silenciamiento de HIF-1α se alivió en condiciones de cultivo hipoxia mediante tinción

conconcon anexinaanexinaanexina V-FITCV-FITCV-FITC yyy PIPIPI ((( FigurasFigurasFiguras 4A4A4A yyy 4B).4B).4B). MientrasMientrasMientras tanto,tanto,tanto, elelel agotamientoagotamientoagotamiento dedede HIF-1αHIF-1αHIF-1α porporpor siRNAsiRNAsiRNA resultóresultóresultó enenen ununun aumentoaumentoaumento evidenteevidenteevidente

enenenenenenen laslaslaslaslaslaslas expresionesexpresionesexpresionesexpresionesexpresionesexpresionesexpresiones dedededededede c-FLIP,c-FLIP,c-FLIP,c-FLIP,c-FLIP,c-FLIP,c-FLIP, DCRDCRDCRDCRDCRDCRDCR 2,2,2,2,2,2,2, Bcl-2Bcl-2Bcl-2Bcl-2Bcl-2Bcl-2Bcl-2 ((((((( LaLaLaLaLaLaLa Fig.Fig.Fig.Fig.Fig.Fig.Fig. 4C)4C)4C)4C)4C)4C)4C) yyyyyyy unaunaunaunaunaunauna reducciónreducciónreducciónreducciónreducciónreducciónreducción significativasignificativasignificativasignificativasignificativasignificativasignificativa enenenenenenen laslaslaslaslaslaslas expresionesexpresionesexpresionesexpresionesexpresionesexpresionesexpresiones dedededededede DRDRDRDRDRDRDR 5,5,5,5,5,5,5, TRAIL,TRAIL,TRAIL,TRAIL,TRAIL,TRAIL,TRAIL, BaxBaxBaxBaxBaxBaxBax yyyyyyy p53p53p53p53p53p53p53

yyy laslaslas actividadesactividadesactividades dedede lalala caspasa-3,caspasa-3,caspasa-3, caspasa-8,caspasa-8,caspasa-8, yyy lalala caspasa-9caspasa-9caspasa-9 ((( Fig.Fig.Fig. 4D),4D),4D), lololo quequeque indicaindicaindica quequeque HIF-1αHIF-1αHIF-1α puedepuedepuede estarestarestar implicadaimplicadaimplicada enenen lalala

regulación de la ruta apoptótica de GC-2 células. En conjunto, estos resultados sugieren que HIF-1α podría ser un regulador

crítico de la apoptosis inducida por hipoxia de las células GC-2 por influir en las vías de la apoptosis extrínsecos e intrínsecos.

Discusión

Un gran altitud, ambiente hipóxico tiene un efecto negativo significativo sobre la función reproductiva de los hombres

migrantes. Un gran número de estudios sobre la alteración de la espermatogénesis siendo causado por la hipoxia se han

reportado (Cikutovic et al, 2009;. Vargas et al., 2011). Además, la apoptosis spermatocyte es el proceso fisiopatológico clave

Reyes et al,

implicada en la alteración de la espermatogénesis inducida por hipoxia in vivo (Liao et al, 2010;

2012). Sin embargo, el mecanismo detrás de la alteración de la espermatogénesis inducida por hipoxia es poco conocido. Los

resultados del presente estudio muestran que la hipoxia induce la apoptosis de las células GC-2 cuando se sembraron dentro del

intervalointervalointervalointervalointervalo desdedesdedesdedesdedesde 1,251,251,251,251,25 hastahastahastahastahasta 55555 ××××× 1010101010 55555 ///// mlmlmlmlml durantedurantedurantedurantedurante 4848484848 h,h,h,h,h, yyyyy aumentóaumentóaumentóaumentóaumentó significativamentesignificativamentesignificativamentesignificativamentesignificativamente lalalalala tasatasatasatasatasa dedededede apoptosisapoptosisapoptosisapoptosisapoptosis dedededede laslaslaslaslas célulascélulascélulascélulascélulas GC-2GC-2GC-2GC-2GC-2 dedededede unaunaunaunauna

manera dependiente del tiempo. Estos resultados sugirieron que la apoptosis inducida por hipoxia de GC-2 células podría dar lugar a

defectos en la espermatogénesis.

El mecanismo subyacente de la apoptosis inducida por hipoxia se ha investigado ampliamente en el carcinoma de células

renales, células de cáncer colorrectal, las células epiteliales del túbulo proximal, macrófagos derivados de monocitos humanos y

células NIH3T3 (Li et al., 2015). Sin embargo, si la apoptosis de GC-2 células es responsable de la alteración de la

espermatogénesis inducida por hipoxia permanece en gran medida desconocido. Se sabe que dos vías caracterizan el proceso de

apoptosis inducida por hipoxia: la vía del receptor extrínseca o la muerte (Pan et al, 2014.) Y la intrínseca

Este artículo está protegido por derechos de autor. Todos los derechos reservados

o vía mitocondrial (Lohberger et al., 2016). La vía extrínseca se produce en respuesta a Fas y TRAIL, ambos de los

cuales contienen el dominio de muerte en su región intracelular para reclutar proteínas apoptóticas aguas abajo (Adams, 2003). Fas / TRAIL interactúa con la caspasa-8 para formar DISC, que activa el iniciador de la caspasa-8 y

se inicia la caspasa-3 más aguas abajo (Ashkenazi, 2002). Se ha informado de que el estrés por calor indujo la

apoptosis de los espermatocitos mediante la activación de la vía del receptor de muerte (Vydra et al., 2006). Del mismo modo, el tratamiento hipoxia activa marcadores relacionados con DR-apoptótica de la vía, tales como DR5, TRAIL, y Fas, y aumentó significativamente la activación de caspasa-8. Además, Z-IETD-FMK invierte parcialmente

viabilidad celular cuando se trató con la hipoxia. La activación de la vía intrínseca se inicia mediante la

perturbación de MMP bajo el control de Bcl-2 (células B proteína proto-oncogén linfocítica-leucemia 2) y la proteína pro-apoptótica Bax. La pérdida de MMP se ha sugerido para provocar la liberación del citocromo C. Autorización de la citocromo C es esencial para la activación de la caspasa-9 (Valero, 2014). Esto resulta en daños internos a las células (Kroemer et al., 2007). tratamiento hipoxia causada regulación positiva de Bax, regulación por disminución de Bcl-2, la despolarización mitocondrial de las células GC-2 y un aumento de la caspasa-3 y caspasa 9-actividades en GC-2 células. Además, Z-LEHD-FMK invierte parcialmente la viabilidad celular y la co-incubación de Z-IETD-FMK y Z-LEHD-FMK invertido totalmente la viabilidad celular.

Se sabe que BNIP3 tiene el potencial de inducir los tres tipos de muerte celular: la necrosis, la apoptosis y mitofagia

).

También se ha demostrado que el aumento de la expresión de la

(Booth et al, 2014; Dhingra et al, 2014; Manu et al, 2017

BNIP-3 proteína inducida mitofagia y la apoptosis en células NRK-52E que fueron expuestos a hipoxia durante 4 h (cámara

hipóxicahipóxicahipóxica bajobajobajo ununun 0%0%0% OOO 222 atmósfera)atmósfera)atmósfera) (Ishihara(Ishihara(Ishihara etetet al.,al.,al., 2013).2013).2013). LaLaLa activaciónactivaciónactivación dedede lalala proteínaproteínaproteína BNIP-3BNIP-3BNIP-3 causócausócausó unaunauna induccióninduccióninducción significativasignificativasignificativa

de mitofagia y la apoptosis en un corazón de rata que se sometió a 30 min de isquemia global, seguido de 15 min de

reperfusión (Hamacher-Brady et al., 2007). Sin embargo, la expresión reducida BNIP-3 induce la supervivencia de los

cánceres de páncreas y colorrectal en condiciones de hipoxia microambiente tumoral (Bacon et al, 2007;. Erkan et al., 2005).

En este estudio, se encontró que la expresión de mRNA de BNIP-3 se upregulated; sin embargo, la expresión de la proteína

de BNIP-3 en GC-2 células fue inhibida por la hipoxia. El mecanismo podría incluir BNIP-3 inestabilidad de la proteína, tales

como ubiquitinación, en células GC-2 en tratamiento hipoxia, pero esto necesita más aclaraciones.

HIF-1 es un heterodímero compuesto de una subunidad α y una subunidad β. Con los niveles normales de oxígeno, HIF-1α es

inestable porque PHDs utilizan oxígeno molecular como un sustrato de hidroxilar restos de prolina de HIF-1α. El HIF-1α hidroxilado

es reconocido por VHL y destinada a la degradación proteosomal (Foxler et al., 2012). HIF-1α juega un papel clave en la aparición de

varicocele y asthenozoospermia mediante la promoción de la angiogénesis (Shiraishi y Naito, 2008) y que influyen en la motilidad

espermática (Salvolini et al., 2014). Sin embargo, HIF-1α protege a las células de Leydig de la apoptosis por la orientación de Mcl-1

(un miembro anti-apoptóticos de la familia Bcl-2) durante

Este artículo está protegido por derechos de autor. Todos los derechos reservados

torsión testicular (Palladino et al., 2012). Se ha informado de que HIF-1α tiene un efecto pro-apoptótico en células PC12 (Huang et al., 2016) y

células A549 (Wang et al., 2008) y un efecto anti-apoptótico sobre el melanoma (Sendoel et al., 2010), condrocitos (Chang et al., 2014) y el

2013;

glioblastoma (Choksi et al., 2011). Hemos encontrado que HIF-1α tiene un efecto pro-apoptótica fundamental en las células GC-2 durante el

tratamiento hipoxia. Estudios previos han indicado que HIF-1α tiene un papel citoprotector mediante la inhibición de la expresión de TNF

(Hindryckx et al., 2010), p53 (Muntane et al., 2013), y Bax (Wang et al., 2013), mientras que la elevación de la expresión de Bcl-2 (Lee et al,

Torii et al, 2011). Hindryckx estudió células epiteliales intestinales y observó la represión de FADD (una molécula adaptadora crítico en

la apoptosis mediada por TNFR-1) y el daño celular durante el tratamiento de DMOG (inhibidores de la hidroxilasa estabilizan factor inducible

por hipoxia-1) (Hindryckx et al., 2010 ). Jordi Muntane observó que la activación de la señalización de HIF-1α y la alteración de las vías

dependientes de p53 en células de cáncer de hígado durante la hipoxia son críticos para la supervivencia de clones de células tumorales

seleccionadas, que puede escapar del ambiente hostil y favorecer un crecimiento sin restricciones (Muntane et al., 2013). Kangkai Wang

observó una reducción en la expresión de Bax en cardiomiocitos que fueron transfectadas con el plásmido HIF-1ɑ (Wang et al., 2013). Torii S.

observó que IPAS (variantes de HIF-3 empalmado Jordi Muntane observó que la activación de la señalización de HIF-1α y la alteración de las

vías dependientes de p53 en células de cáncer de hígado durante la hipoxia son críticos para la supervivencia de clones de células tumorales

seleccionadas, que puede escapar del ambiente hostil y favorecer un crecimiento sin restricciones (Muntane et al., 2013). Kangkai Wang

observó una reducción en la expresión de Bax en cardiomiocitos que fueron transfectadas con el plásmido HIF-1ɑ (Wang et al., 2013). Torii S.

observó que IPAS (variantes de HIF-3 empalmado Jordi Muntane observó que la activación de la señalización de HIF-1α y la alteración de las

vías dependientes de p53 en células de cáncer de hígado durante la hipoxia son críticos para la supervivencia de clones de células tumorales

seleccionadas, que puede escapar del ambiente hostil y favorecer un crecimiento sin restricciones (Muntane et al., 2013). Kangkai Wang

observó una reducción en la expresión de Bax en cardiomiocitos que fueron transfectadas con el plásmido HIF-1ɑ (Wang et al., 2013). Torii S.

observó que IPAS (variantes de HIF-3 empalmado Kangkai Wang observó una reducción en la expresión de Bax en cardiomiocitos que fueron

transfectadas con el plásmido HIF-1ɑ (Wang et al., 2013). Torii S. observó que IPAS (variantes de HIF-3 empalmado Kangkai Wang observó

una reducción en la expresión de Bax en cardiomiocitos que fueron transfectadas con el plásmido HIF-1ɑ (Wang et al., 2013). Torii S. observó

quequeque IPASIPASIPAS (variantes(variantes(variantes dedede HIF-3HIF-3HIF-3 empalmadoempalmadoempalmado α,α,α, ununun inhibidorinhibidorinhibidor negativonegativonegativo dominantedominantedominante dedede HIF-1)HIF-1)HIF-1) unidounidounido aaa losloslos miembrosmiembrosmiembros dedede lalala familiafamiliafamilia Bcl-2Bcl-2Bcl-2

pro-supervivencia a través de su región C-terminal y inhibió la formación del complejo de Bcl-xL / Bax en células PC12 (Torii et al., 2011). Por

otra parte, la represión de las células protegidas de inducción IPAS de apoptosis (Torii et al., 2011). Aquí, hemos demostrado una disminución

significativa en los niveles de HIF-1a en GC de 2 células por tratamiento siRNA HIF-1α, que era incompatible con la regulación al alza de Bcl-2 y

la regulación negativa de p53 y Bax de otros estudios (Lee et al., 2013;. Muntane et al, 2013;. Wang et al, 2013). Nuestros datos muestran que

el efecto pro-apoptóticos de la hipoxia sobre GC-2 células apoptosis fue mediada por HIF-1α desde siRNA HIF-1α revirtió parcialmente su

efecto promotor. Los resultados obtenidos en este estudio apoyan la sugerencia anterior de que HIF-1α podría regular la apoptosis de las células GC-2 a través de p

En conclusión, nuestros resultados revelaron que la hipoxia inducida por la apoptosis de las células GC-2. Esta acción

podríapodríapodría serserser mediadamediadamediada porporpor HIF-1HIF-1HIF-1 α,α,α, seguidoseguidoseguido porporpor lalala activaciónactivaciónactivación dedede losloslos receptoresreceptoresreceptores dedede muertemuertemuerte yyy mitocondrialesmitocondrialesmitocondriales vías,vías,vías, quequeque conduceconduceconduce aaa lalala

regulación positiva DR5, upregulation TRAIL, Fas upregulation, upregulation p53, Bax regulación positiva, regulación a la baja

c-FLIP,c-FLIP,c-FLIP,c-FLIP,c-FLIP, DDDDD dododododo RRRRR 22222 regulaciónregulaciónregulaciónregulaciónregulación aaaaa lalalalala baja,baja,baja,baja,baja, Bcl-2Bcl-2Bcl-2Bcl-2Bcl-2 regulaciónregulaciónregulaciónregulaciónregulación aaaaa lalalalala bajabajabajabajabaja yyyyy unaunaunaunauna elevaciónelevaciónelevaciónelevaciónelevación concomitanteconcomitanteconcomitanteconcomitanteconcomitante dedededede losloslosloslos nivelesnivelesnivelesnivelesniveles dedededede expresiónexpresiónexpresiónexpresiónexpresión dedededede

caspase3, caspasa-8, y la caspasa-9. Por otra parte, la hipoxia suprime la función mitocondrial, que se muestra por los niveles de

expresión disminuidos de MMP y BNIP-3. Estos resultados podrían ser útiles para comprender el mecanismo de la apoptosis

spermatocyte inducida por hipoxia in vivo, lo que contribuye al desarrollo de la alteración de la espermatogénesis.

Este artículo está protegido por derechos de autor. Todos los derechos reservados

Expresiones de gratitud

Este trabajo fue apoyado por el Programa Clave Nacional de Investigación Básica de China (973 Programa, 2012CB518201), los

proyectos clave en el Programa de Pilar Ciencia Militar y Tecnología durante la Decimotercera 5 años Plan de Período

(AWS14C007), y la Fundación Nacional de Ciencias Naturales de China (J1310001).

Este artículo está protegido por derechos de autor. Todos los derechos reservados

referencias

Adams JM. 2003. Las formas de morir: múltiples vías a la apoptosis. Genes & Development

17 (20): 2481-2495.

Ashkenazi A. 2002. Orientación de los receptores de muerte y de señuelo del factor de necrosis tumoral

superfamilia. Naturaleza Reviews Cancer 2 (6): 420-430.

Tocino AL, Fox S, Turley H, Harris AL. 2007. silenciamiento selectivo del factor inducible por hipoxia

1 gen diana BNIP3 por la desacetilación de histonas y la metilación en el cáncer colorrectal. Oncogene 26 (1):

132-141.

Cabina de LA, Tavallai S, Hamed HA, Cruickshanks N, Dent P. 2014. El papel de la señalización celular en

la diafonía entre la autofagia y apoptosis. Señalización Celular 26 (3): 549-555. Bostrom PJ, Thoms J, Sykes J, Ahmed O, Evans A, van Rhijn BW, Mirtti T, Stakhovskyi O, Laato

M, Margel D, Pintilie M, Kuk C, Milosevic M, Zlotta AR, Bristow RG. 2016. La hipoxia marcador de GLUT-1 (transportador de glucosa 1) es un factor pronóstico independiente de supervivencia en cáncer de vejiga pacientes tratados con cistectomía radical. El cáncer de vejiga 2 (1): 101-109.

Caron JM, JM Caron. 2015. metil sulfona Bloqueado múltiple hipoxia y

No inducida por hipoxia Targets metastásicos en células de cáncer de mama y células de melanoma. PLoS ONE 10 (11):

e0141565.

Catlin NR, Huse SM, Boekelheide K. 2014. La apoptosis de células germinales de testículo etapa específica

respuesta a la radiación de baja dosis y la exposición combinada de 2,5-hexanodiona. II: matriz de análisis qRT-PCR revela la dosis alteraciones adaptativas dependientes en la ruta apoptótica. patología Toxicologic 42 (8): 1229-37.

Chang Z, Huo L, Wu Y, Zhang P. 2014. HIF-1 alfa tuvo efectos cruciales en la regulación por disminución de

miR-210 disminución de la viabilidad y la inducción de apoptosis en los condrocitos hipóxicas. TheScientificWorldJournal 2014: 876.363.

Choksi S, Lin Y, Pobezinskaya Y, Chen L, Parque C, Morgan M, Li T, Jitkaew S, Cao X, Kim YS, Kim

SA, Levitt P, Shih G, Birre M, Deng CX, Liu ZG. 2011. Un HIF-1 objetivo, ATIA, protege las células de la apoptosis

mediante la modulación de la tiorredoxina mitocondrial, TRX2. Molecular Cell 42 (5): 597-609.

Cikutovic M, Fuentes N, Bustos-Obregon E. 2009. Efecto de la hipoxia intermitente en el

reproducción de las ratas expuestas a gran altura en el altiplano chileno. La medicina de alta altitud y la biología 10 (4): 357-363.

da Motta LL, Ledaki I, Purshouse K, Haider S, De Bastiani MA, Baban D, Morotti M, Steers G,

Wigfield S, Bridges E, Li JL, Knapp S, Ebner D, Klamt F, Harris AL, McIntyre A. 2016. El inhibidor JQ1 BET afecta selectivamente la respuesta del tumor a la hipoxia y regula a la baja CA9 y la angiogénesis en el cáncer de mama negativo triple. Oncogén. Darr CR, Varner DD, Teague S, Cortopassi GA, Datta S, Meyers SA. 2016. El lactato y piruvato

Son las principales fuentes de energía para semental esperma con dosis efectos sobre la función mitocondrial, la motilidad y ROS producción. Biología de la reproducción. Dhingra R, Margulets V, Chowdhury SR, Thliveris J, Jassal D, Fernyhough P, Dorn GW, segundo,

Kirshenbaum LA. 2014. Bnip3 media la necrosis de miocitos cardiacos inducida por la doxorrubicina

Este artículo está protegido por derechos de autor. Todos los derechos reservados

y la mortalidad a través de cambios en la señalización mitocondrial. Actas de la Academia Nacional de Ciencias de los Estados Unidos de América 111 (51): E5537-5544. Erkan M, Kleeff J, Esposito I, Giese T, Ketterer K, Buchler MW, Giese NA, Friess H. 2005. Pérdida

BNIP3 de expresión es un evento tardío en el cáncer de páncreas que contribuye a la quimio-resistencia y ha empeorado el pronóstico. Oncogene 24 (27): 4.421-4.432. Esteves SC, Agarwal A. 2016. Epílogo a varicocele y la infertilidad masculina: conceptos actuales

y perspectivas futuras. revista asiática de andrología 18 (2): 319-322. Favier FB, Britto FA, Freyssenet DG, Bigard XA, Benoit H. 2015. HIF-1 impulsado por el músculo esquelético

adaptaciones a la hipoxia crónica: ideas molecular en la fisiología del músculo. ciencias de la vida celulares y moleculares: CMLS 72 (24): 4681-4.696.

Feng Y, Zhu M, Dangelmajer S, Lee YM, Wijesekera O, Castellanos CX, Denduluri A, Chaichana

KL, Li Q, Zhang H, Levchenko A, Guerrero-Cazares H, Quinones-Hinojosa A. 2015. células madre hipoxia humana cultivadas derivadas de tejido adiposo mesenquimatosas son no oncogénico y han mejorado la viabilidad, motilidad y tropismo para el cáncer de cerebro. La muerte celular y la enfermedad 6: e1797.

Foxler DE, Puente KS, James V, Webb TM, Mee M, Wong SC, Feng Y, Constantin-Teodosiu D,

Petursdottir TE, Bjornsson J, Ingvarsson S, Ratcliffe PJ, Longmore GD, aguda TV. 2012. proteína El LIMD1 puentea una asociación entre las prolil hidroxilasas y VHL para reprimir la actividad de HIF-1. Nature Cell Biology 14 (2): 201-208.

Guo Y, Wang W, Dong Y, Zhang Z, Zhou Y, Chen G. 2014. El disulfuro de carbono induce testicular rata

lesión a través de vía apoptótica mitocondrial. Chemosphere 108: 367-375. Hamacher-Brady A, Brady NR, Logue SE, Sayen MR, Jinno M, Kirshenbaum LA, RA Gottlieb,

Gustafsson AB. 2007. Respuesta a la lesión por isquemia / reperfusión miocárdica implica Bnip3 y la autofagia. La muerte celular y la diferenciación 14 (1): 146-157. Hindryckx P, De Vos M, Jacques P, Ferdinande L, Peeters H, Olievier K, Bogaert S, Brinkman B,

Vandenabeele P, Elewaut D, Laukens D. 2010. inhibición hidroxilasa abroga TNF-alfa inducida

intestinal

epitelial

dañar

por

inducible por hipoxia

factor-1 de dependiente de la represión de FADD. Journal of Immunology 185 (10): 6306 a 6.316. Huang X, Yang K, Zhang Y, Wang Q, Li Y. 2016. ácido quinolínico induce la apoptosis celular en PC12

células a través de la activación RTP801 HIF-1-dependiente. enfermedad metabólica cerebral 31 (2): 435-444.

Inhorn MC, Patrizio P. 2015. La infertilidad en todo el mundo: nueva forma de pensar sobre el género,

tecnologías de reproducción y movimientos globales en el siglo 21. actualización de la Reproducción Humana 21 (4): 411-426.

Ishihara M, Urushido M, Hamada K, Matsumoto T, Shimamura Y, Ogata K, Inoue K, Taniguchi Y,

Horino T, Fujieda M, Fujimoto S, Terada Y. 2013. sestrina-2 y BNIP3 regulan la autofagia y mitofagia en las células tubulares renales en la lesión renal aguda. American Journal of Physiology Fisiología Renal 305 (4): F495-509.

la inhibición de HIF-1 (FIH-1) modula las interacciones de proteínas de

apoptosis estimulante de unión a proteína p53 2 (ASPP2). Diario de la ciencia de células 126 (Pt

12): 2629-2640.

Janke K, Brockmeier U, Kuhlmann K, Eisenacher M, Nolde J, Meyer HE, Mairbaurl H, Metzen E.

2013. Factor

Knoll G, Bittner S, Kurz M, Jantsch J, Ehrenschwender M. 2016. La hipoxia regula TRAIL

sensibilidad de las células de cáncer colorrectal a través de la autofagia mitocondrial. Oncotarget.

Este artículo está protegido por derechos de autor. Todos los derechos reservados

Kopalli SR, Cha KM, Jeong MS, Lee SH, Sung JH, Seo SK, Kim SK. 2016. pectinasa tratados

Panax ginseng mejora las peróxido de hidrógeno inducida por el estrés oxidativo en las células de esperma GC-2 y modula la

expresión génica testicular en ratas de edad avanzada. Diario de la investigación ginseng 40 (2): 185-195.

Kroemer G, Galluzzi L, Brenner C. 2007. mitocondrial permeabilización de la membrana en la celda

muerte. Physiological Reviews 87 (1): 99-163.

Lee JH, Choi SH, Baek MW, Kim MH, Kim HJ, Kim SH, SJ Oh, Parque HJ, Kim WJ, Jung JY. 2013.

CoCl2 induce la apoptosis a través de la vía mitochondria- y la muerte mediada por el receptor en las células madre embrionarias de ratón. bioquímica molecular y celular 379 (1-2): 133-140.

Li M, Tan J, Miao Y, Lei P, Zhang P. 2015. El doble papel de la autofagia bajo

hipoxia implicación de la interacción entre la autofagia y apoptosis. Apoptosis: una revista internacional sobre la muerte celular programada 20 (6): 769-777.

Li R, Geng HH, Xiao J, Qin XT, Wang F, Xing JH, Xia YF, Mao Y, Liang JW, Ji XP. 2016. miR-7a / b

atenúa la remodelación post-infarto de miocardio y protege H9c2 cardiomyoblast contra la apoptosis inducida por hipoxia que implica Sp1 y PARP-1. Informes científicos 6: 29.082.

Liao W, Cai M, Chen J, Huang J, Liu F, Jiang C, Gao Y. 2010. causas hipoxia hipobárica

efectos deletéreos sobre la espermatogénesis en ratas. Reproducción 139 (6): 1031-1038. Liu K, Zhao R, Shen M, de Ye J,

Li X, Huang Y, Hua L, Wang Z, Li J. 2015. papel de las mutaciones genéticas

en los genes de enzimas relacionados con folato en la infertilidad masculina. Informes científicos 5: 15548. Lohberger B,

Steinecker-Frohnwieser B, Stuendl N, Kaltenegger H, Leithner A, Rinner B. 2016.

El Inhibidor de proteasoma bortezomib afecta a células de condrosarcoma a través de la vía dependiente de mitocondrias de caspasa y Expresión Mejora Receptor de Muerte y autofagia. PLoS ONE 11 (12): e0168193.

Ma YL, Zhang LX, Liu GL, Ventilador Y, Peng Y, Hou WG. 2016. N-myc-Downstream Regulado 2

(Ndrg2) está implicada en la isquemia-hipoxia inducida por astrocitos Apoptosis: una novela de destino para la terapia del

ictus. neurobiología molecular.

Manu KA, Chai TF, Teh JT, Zhu WL, Casey PJ, Wang M. 2017. La inhibición de la isoprenylcysteine

carboxylmethyltransferase induce la detención del ciclo celular y la apoptosis a través de p21 y la inducción BNIP3 p21-regulada en cáncer de páncreas. la terapéutica del cáncer molecular. la muerte celular o supervivencia celular: Mazure NM, Pouyssegur J. 2010. autofagia inducida por hipoxia?

La opinión actual en biología celular 22 (2): 177-180.

McNamee ES, Vohwinkel C, Eltzschig HK. HIF-1 alfa 2016. La hidroxilación independiente

estabilización a través de PKA: Un nuevo paradigma para la señalización de hipoxia. FS11: señalización 9 (430) Science.

Meng X, Yang S, Zhang Y, Wang X, Goodfellow RX, Jia Y, Thiel KW, Reyes HD, Yang B, Leslie KK.

2015. deficiencia genética de MTDH génica en ratones provoca infertilidad masculina a través de deterioro de la gametogénesis y alteraciones en la expresión de los pequeños RNAs no codificantes. El Journal of Biological Chemistry 290 (19): 11853-11864.

Muntane J, De la Rosa AJ, Marin LM, Padillo FJ. 2013. óxido nítrico y muerte celular en el hígado

Células cancerígenas. Mitochondrion 13 (3): 257-262.

Palladino MA, Shah A, Tyson R, Horvath J, Dugan C, Karpodinis M. 2012. célula mieloide

leucemia-1 (Mc1-1) es un gen diana candidato de la hipoxia-inducible factor-1 de (HIF-1) en

Este artículo está protegido por derechos de autor. Todos los derechos reservados

los testículos. biología reproductiva y endocrinología: RB & E 10: 104. Pan WL, Wong JH, Fang EF, Chan YS, Ng TB, Cheung RC. 2014. citotoxicidad preferencial de la

tipo I inactivadora de ribosomas proteína alfa-momorcharin en células de carcinoma nasofaríngeo humanos bajo normoxia e hipoxia. Biochemical Pharmacology 89 (3): 329-339.

Reyes JG, Farías JG, Henríquez-S Olavarrieta, Madrid, E, M Parraga, Zepeda AB, Moreno RD.

2012. El testículo hipóxica: la fisiología y la fisiopatología. Medicina oxidativo y longevidad celular 2012:

929.285.

Salama R, Masson N, Simpson P, Sciesielski LK, Sun M, Tian YM, Ratcliffe PJ, Mole DR. 2015.

Efectos heterogéneas de hipoxia directo vía de activación de cáncer de riñón. PLoS ONE 10 (8): e0134645.

La interleucina-1 beta, la ciclooxigenasa-2, y inducible por hipoxia

Salvolini E, Buldreghini E, Lucarini G, Vignini A, Giulietti A, Lenzi A, Mazzanti L, Di Primio R,

Balercia G. 2014.

factor 1 alfa en astenozoospermia. Histoquímica y biología celular 142 (5): 569-575. Sendoel A, Kohler I, Fellmann C, Lowe SW, Hengartner MO. 2010. HIF-1 antagoniza

apoptosis mediada por p53 a través de un neuronal secretada

465 (7298): 577-583.

tirosinasa. Naturaleza

Sherman MA, Suresh MV, Dolgachev VA, McCandless LK, Xue X, Ziru L, Machado-Aranda D,

Shah YM, Raghavendran K. 2016. Caracterización molecular de células hipóxicas Alveolar epiteliales Después de pulmón Contusion Indica un papel importante para HIF-1 alfa. Anales de la cirugía.

Shiraishi K, Naito K. 2008. La participación de factor de crecimiento endotelial vascular en

espermatogénesis en los testículos con varicocele. Fertility and Sterility 90 (4): 1313-1316. Torii S, Goto Y, Ishizawa T, Hoshi H, Goryo K, Yasumoto K, Fukumura H, Sogawa K. 2011.

actividad pro-apoptótica de inhibidor proteína del dominio PAS (IPAS), un regulador negativo de HIF-1, a través de la unión a favor de la supervivencia proteínas Bcl-2 de la familia. La muerte celular y la diferenciación 18 (11): 1711-1725.

Valero T. 2014. biogénesis mitocondrial: enfoques farmacológicos. Corriente

Pharmaceutical Design 20 (35): 5.507-5.509.

A Vargas, Bustos Obregón-E, R. Hartley 2011. Efectos de la hipoxia en los espermatozoides del epidídimo

parámetros y papel protector del ibuprofeno y la melatonina. La investigación biológica 44 (2): 161-167.

Verratti V, Berardinelli F, Di Giulio C, Bosco G, Cacchio M, Pellicciotta M, Nicolai M, Martinotti

S, Tenaglia R. 2008. La evidencia de que la hipoxia crónica causa un deterioro reversible en la fertilidad masculina. revista asiática de andrología 10 (4): 602-606.

Vydra N, Malusecka E, Jarzab M, Lisowska K, Glowala-Kosinska M, Benedyk K, Widlak P,

Krawczyk Z, Widlak W. 2006. expresión-spermatocyte específica de constitutivamente activa el factor de choque térmico 1 induce la

apoptosis HSP70i resistente en las células germinales masculinas. La muerte celular y la diferenciación 13 (2): 212-222.

Wang K, Lei J, Zou J, Xiao H, Chen A, Liu X, Liu Y, Jiang L, Xiao Z, Xiao X. 2013. Mipu1, una novela

gen diana directa, está implicado en la citoprotección factor inducible por hipoxia 1 mediada. PLoS One 8 (12):

e82827.

Wang L, Liu N, Yao L, Li F, Zhang J, Deng Y, Liu J, Ji S, Yang A, Han H, Zhang Y, Zhang J, Han W,

Liu X. 2008. NDRG2 es un nuevo HIF-1 gen diana necesaria para inducida por hipoxia

Este artículo está protegido por derechos de autor. Todos los derechos reservados

la apoptosis en células A549. fisiología celular y bioquímica: International Journal of experimental de la fisiología celular, bioquímica, farmacología y 21 (1-3): 239-250. Wu H, Sun L, Wen Y, Liu Y, Yu J, Mao M, Wang Y, Tong C, Guo X, Hu Z, Sha J, Liu M, Xia L. 2016.

Los principales defectos spliceosome causan la infertilidad masculina y se asocian con azoospermia no obstructiva en los seres humanos. Actas de la Academia Nacional de Ciencias de los Estados Unidos de América 113 (15): 4134-4139.

Xu M, X Bi, Él X, X Yu, Zhao M, Zang W. 2016. La inhibición de la mitocondria se desarrolló

respuesta de las proteínas por la acetilcolina aliviado hipoxia / reoxigenación apoptosis inducida de las células endoteliales. Ciclo celular 15 (10): 1331-1343.

Zhang Y, Cheng M, Wu L, Zhang G, Wang Z. 2016. Bisfenol A induce spermatocyte

apoptosis en raras minnow gobiocypris rarus. toxicología acuática 179: 18-26.

Este artículo está protegido por derechos de autor. Todos los derechos reservados

Figuras legendarias

Fig. 1 La hipoxia induce la apoptosis celular en células de GC-2 en diferentes momentos.

célulascélulascélulas GC-2GC-2GC-2 sesese sembraronsembraronsembraron aaa 555 xxx 101010 555 /// mlmlml paraparapara 24,24,24, 48,48,48, 60,60,60, yyy 727272 hhh enenen cultivoscultivoscultivos dedede normoxianormoxianormoxia eee hipoxia.hipoxia.hipoxia. (A)(A)(A) LaLaLa tincióntincióntinción TUNELTUNELTUNEL resultadosresultadosresultados dedede GC-2GC-2GC-2

células: núcleos apoptóticos fueron presentados por el ADN condensada o fragmentada que fue brillantemente teñidas con TUNEL. Aumento

original: 200 ×. (B) Los gráficos representativos obtenidos de la citometría de flujo análisis de apoptosis celular después de la doble tinción con

yoduro de anexina V-FITC y yoduro de propidio. (C) La tasa de apoptosis de GC-2 células, que se evaluó por tinción TUNEL bajo un campo

energía de la ampliación. (D) Las incidencias apoptótica de las células GC-2, que se midieron mediante doble tinción con yoduro de anexina

V-FITC y yoduro de propidio. (E) Los ensayos de Western blot representativos de expresión de la proteína HIF-1α en células de ratón GC-2

que fueron sometidos a 1% de oxígeno durante 24 h, 48 h, 60 h y 72 h. (F) El análisis estadístico del ensayo de transferencia de Western se

muestra. El nivel relativo de expresión de HIF-1α se normalizó a la de la β-actina y presentan como la media ± SD. Los datos que se muestran

sonsonsonson dededede trestrestrestres experimentosexperimentosexperimentosexperimentos independientes.independientes.independientes.independientes. **** pppp <<<< 0,050,050,050,05 vsvsvsvs 21%21%21%21% OOOO 2.2.2.2.

Fig. 2 Efectos de la hipoxia en los receptores de muerte marcadores apoptóticos relacionados en células GC-2 de ratón.

(A)(A)(A)(A)(A)(A)(A) LosLosLosLosLosLosLos ensayosensayosensayosensayosensayosensayosensayos dedededededede WesternWesternWesternWesternWesternWesternWestern blotblotblotblotblotblotblot representativosrepresentativosrepresentativosrepresentativosrepresentativosrepresentativosrepresentativos dedededededede DRDRDRDRDRDRDR 5,5,5,5,5,5,5, c-FLIP,c-FLIP,c-FLIP,c-FLIP,c-FLIP,c-FLIP,c-FLIP, DDDDDDD dododododododo RRRRRRR 2,2,2,2,2,2,2, TRAILTRAILTRAILTRAILTRAILTRAILTRAIL yyyyyyy FasFasFasFasFasFasFas enenenenenenen célulascélulascélulascélulascélulascélulascélulas dedededededede ratónratónratónratónratónratónratón GC-2GC-2GC-2GC-2GC-2GC-2GC-2 quequequequequequeque fueronfueronfueronfueronfueronfueronfueron sometidossometidossometidossometidossometidossometidossometidos aaaaaaa unaunaunaunaunaunauna

concentraciónconcentraciónconcentraciónconcentraciónconcentraciónconcentraciónconcentración dedededededede oxígenooxígenooxígenooxígenooxígenooxígenooxígeno alalalalalalal 1%1%1%1%1%1%1% durantedurantedurantedurantedurantedurantedurante 48484848484848 h.h.h.h.h.h.h. (B)(B)(B)(B)(B)(B)(B) ElElElElElElEl panelpanelpanelpanelpanelpanelpanel representarepresentarepresentarepresentarepresentarepresentarepresenta lalalalalalala mediamediamediamediamediamediamedia ±±±±±±± SDSDSDSDSDSDSD dedededededede DRDRDRDRDRDRDR 5,5,5,5,5,5,5, c-FLIP,c-FLIP,c-FLIP,c-FLIP,c-FLIP,c-FLIP,c-FLIP, DDDDDDD dododododododo RRRRRRR 2,2,2,2,2,2,2, TRAILTRAILTRAILTRAILTRAILTRAILTRAIL yyyyyyy FasFasFasFasFasFasFas integradosintegradosintegradosintegradosintegradosintegradosintegrados densidadesdensidadesdensidadesdensidadesdensidadesdensidadesdensidades

ópticas, que se normalizaron a la de la β-actina. Cada punto de datos representa la media ± SD de tres experimentos independientes. * Indica

unaunaunauna diferenciadiferenciadiferenciadiferencia significativasignificativasignificativasignificativa cuandocuandocuandocuando loslosloslos valoresvaloresvaloresvalores sesesese compararoncompararoncompararoncompararon conconconcon lalalala deldeldeldel 21%21%21%21% OOOO 2222 (((( pppp <<<< 0,05).0,05).0,05).0,05). (C)(C)(C)(C) LaLaLaLa actividadactividadactividadactividad dededede LDHLDHLDHLDH enenenen célulascélulascélulascélulas dededede ratónratónratónratón GC-2GC-2GC-2GC-2

que fueron sometidos a 1% de oxígeno durante 48 h. (D) La actividad de la caspasa-8 en células de ratón GC-2 que fueron sometidos a 1%

de oxígeno durante 48 h. (E) La viabilidad celular de las células GC-2 que fueron sometidos a condiciones de oxígeno al 1% durante 48 h con

o sin la presencia de 50? M IETD.

Fig. 3 Efectos de la hipoxia en marcadores de apoptosis relacionado mitocondriales y MOMP en células GC-2 de ratón.

(A) Los ensayos representativos de Western blot para p53, Bcl-2, Bax y BNIP-3 en células de ratón GC-2 que fueron sometidos a 1% de

oxígenooxígeno durantedurante 4848 h.h. (B)(B) ElEl panelpanel representarepresenta lala mediamedia ±± SDSD dede p53,p53, Bcl-2,Bcl-2, BaxBax yy BNIP-3BNIP-3 densidadesdensidades ópticasópticas integradas,integradas, queque sese normalizaronnormalizaron

a la de la β-actina. Cada punto de datos representa la media ± SD de tres experimentos independientes. * Indica una diferencia significativa

cuandocuandocuandocuandocuando losloslosloslos valoresvaloresvaloresvaloresvalores sesesesese compararoncompararoncompararoncompararoncompararon conconconconcon lalalalala deldeldeldeldel 21%21%21%21%21% OOOOO 22222 ((((( ppppp <<<<< 0,05).0,05).0,05).0,05).0,05). (C)(C)(C)(C)(C) LosLosLosLosLos nivelesnivelesnivelesnivelesniveles dedededede expresiónexpresiónexpresiónexpresiónexpresión dedededede ARNmARNmARNmARNmARNm dedededede BNIP-3BNIP-3BNIP-3BNIP-3BNIP-3 enenenenen elelelelel ratónratónratónratónratón célulascélulascélulascélulascélulas GC-2GC-2GC-2GC-2GC-2

que fueron sometidos a 1% de oxígeno durante 48 h fueron examinados por RT-PCR y se presentan como una proporción de valores

normalizadosnormalizadosnormalizadosnormalizados aaaa ß-actinaß-actinaß-actinaß-actina mRNAmRNAmRNAmRNA enenenen cadacadacadacada grupogrupogrupogrupo (n(n(n(n ==== 4).4).4).4). **** PPPP <<<< 0,050,050,050,05 vsvsvsvs 21%21%21%21% OOOO 2.2.2.2.

(D) Las actividades de la caspasa-3 y caspasa-9 en células de ratón GC-2 que fueron sometidos a 1% de oxígeno durante 48 h. (E) La viabilidad

celular de las células GC-2 que fueron sometidos a condiciones de oxígeno 1% durante 48 h en presencia de 100 LEHD M, 50? M IETD, y no

IETD. (F) El gráfico de puntos representativo de la MMP

Este artículo está protegido por derechos de autor. Todos los derechos reservados

cambioscambioscambioscambioscambios porporporporpor citometríacitometríacitometríacitometríacitometría dedededede flujoflujoflujoflujoflujo despuésdespuésdespuésdespuésdespués deldeldeldeldel marcajemarcajemarcajemarcajemarcaje dedededede unaunaunaunauna sondasondasondasondasonda fluorescentefluorescentefluorescentefluorescentefluorescente conconconconcon JC-1.JC-1.JC-1.JC-1.JC-1. FL1-H:FL1-H:FL1-H:FL1-H:FL1-H: Verde;Verde;Verde;Verde;Verde; FL2-H:FL2-H:FL2-H:FL2-H:FL2-H: Rojo.Rojo.Rojo.Rojo.Rojo. ((((( G)G)G)G)G) LasLasLasLasLas fotografíasfotografíasfotografíasfotografíasfotografías

representativas de JC-1 tinción en los diferentes grupos. (F) Los 2 fotografías en cada línea se tomaron bajo el mismo campo y entonces

se combinó juntos. (H) El análisis cuantitativo del cambio en fluorescencia roja mitocondrial para fluorescencia verde entre los grupos. Los

valores de rojo y verde de intensidad de fluorescencia se calcularon mediante ImageJ. Todos los valores se muestran como la media ± SD

dededede 12121212 fotografíasfotografíasfotografíasfotografías independientesindependientesindependientesindependientes quequequeque fueronfueronfueronfueron tomadastomadastomadastomadas enenenen cadacadacadacada grupo.grupo.grupo.grupo. **** PPPP <<<< 0,050,050,050,05 vs.vs.vs.vs. 21%21%21%21% OOOO 2.2.2.2.

Fig.Fig. 44 lala deficienciadeficiencia dede HIF-1αHIF-1α aminoraaminora lala apoptosisapoptosis enen célulascélulas dede ratónratón GC-2GC-2 yy normalizanormaliza loslos nivelesniveles dede expresiónexpresión dede relacionadorelacionado apoptóticaapoptótica marcadoresmarcadores

en GC-2 células. deficientes GC-2 células HIF-1a se sometieron a condiciones de oxígeno al 1% durante 48 h.

(A) Los gráficos representativos de la apoptosis celular, que se obtuvieron mediante citometría de flujo análisis después de la doble tinción con yoduro de

anexina V-FITC y yoduro de propidio. (B) La tasa de apoptosis se analizó por citometría de flujo después de tinción doble con yoduro de anexina V-FITC

y yoduro de propidio. (C) Los marcadores relacionados con la apoptosis se evaluó mediante el ensayo de transferencia de Western. (D) de la caspasa-3,

caspasa-8, y la caspasa-9 se verificaron usando un lector de microplacas.

Leyendas de las figuras complementarias

Supl. Fig. 1. La hipoxia induce la apoptosis celular de GC-2 células durante diferentes densidades de una cultura hipoxia.

célulascélulascélulascélulascélulascélulascélulas GC-2GC-2GC-2GC-2GC-2GC-2GC-2 sesesesesesese sembraronsembraronsembraronsembraronsembraronsembraronsembraron conconconconconconcon 5555555 xxxxxxx 10101010101010 5,5,5,5,5,5,5, 2,52,52,52,52,52,52,5 ××××××× 10101010101010 5,5,5,5,5,5,5, yyyyyyy 1,251,251,251,251,251,251,25 ××××××× 10101010101010 5555555 /////// mlmlmlmlmlmlml durantedurantedurantedurantedurantedurantedurante 48484848484848 hhhhhhh enenenenenenen unaunaunaunaunaunauna culturaculturaculturaculturaculturaculturacultura hipoxia.hipoxia.hipoxia.hipoxia.hipoxia.hipoxia.hipoxia. (A)(A)(A)(A)(A)(A)(A) LaLaLaLaLaLaLa tincióntincióntincióntincióntincióntincióntinción TUNELTUNELTUNELTUNELTUNELTUNELTUNEL dedededededede GC-2GC-2GC-2GC-2GC-2GC-2GC-2 células:células:células:células:células:células:células:

núcleos apoptóticos fueron presentados por el ADN condensada o fragmentada que fue brillantemente teñidas con TUNEL. Aumento original:

200 ×. (B) La tasa de apoptosis de las células GC-2, evaluados mediante tinción TUNEL bajo un campo energía de la ampliación. (C) Los

gráficos representativos de la apoptosis celular, que se obtuvieron mediante citometría de flujo análisis después de la doble tinción con yoduro

de anexina V-FITC y yoduro de propidio. (D) Las incidencias apoptótica de las células GC-2, que se midieron mediante doble tinción con yoduro

de anexina V-FITC y yoduro de propidio.

Este artículo está protegido por derechos de autor. Todos los derechos reservados

Figura 1 Este artículo está protegido por derechos de autor. Todos los derechos reservados

Figura 1

Este artículo está protegido por derechos de autor. Todos los derechos reservados

Figura 2 Este artículo está protegido por derechos de autor. Todos los derechos reservados

Figura 2

Este artículo está protegido por derechos de autor. Todos los derechos reservados

figura 3 Este artículo está protegido por derechos de autor. Todos los derechos reservados

figura 3

Este artículo está protegido por derechos de autor. Todos los derechos reservados

Figura 4 Este artículo está protegido por derechos de autor. Todos los derechos reservados

Figura 4

Este artículo está protegido por derechos de autor. Todos los derechos reservados