Available online at www.sciencedirect.

com

Journal of Virological Methods 148 (2008) 81–88

A multiplex real-time RT-PCR for detection and identification of

influenza virus types A and B and subtypes H5 and N1
Chunli Wu a , Xiaowen Cheng b , Jianfan He b , Xing Lv b , Jingwen Wang a ,
Riqiang Deng a , Qingxing Long a , Xunzhang Wang a,∗
a State Key Laboratory of Biocontrol, Sun Yat-sen University, Guangzhou 510275, China
b Centers for Disease Control and Prevention, Shenzhen 518020, China

Received 23 May 2007; received in revised form 22 October 2007; accepted 26 October 2007
Available online 19 December 2007

Abstract
A multiplex real-time RT-PCR method for the simultaneous detection of influenza virus types A and B and identification of subtypes H5 and
N1 in a single tube is described. The method was developed with four sets of primers and probes which were specific to influenza virus (sub)types
A, B, H5, and N1, and evaluated by using a total of 40 influenza virus reference strains, including 17 avian influenza A (12 H5N1, 1 H1N1, 1
H3N2, 1 H4N6, 1 H7N3, and 1 H9N2), 18 human influenza A (11 H3N2, 6 H1N1 and 1 H5N1) and 5 influenza B viruses. The method exhibited
a high specificity and sensitivity of approximately 101 –102 copies/␮l for each (sub)type and a high reproducibility with intra- and inter-assay CV
from 0.13 to 4.24%. In an analysis of 189 clinical samples from patients during the year 2004 and 2005, the method identified 81 positive samples
(42.9%) and identified simultaneously 14 type B samples and 11 subtype N1 samples, in comparison only 46 positive samples (24.3%) identified
by the conventional culturing method. The method would be a useful molecular diagnostic tool for large-scale screening of clinical samples for
influenza virus.
© 2007 Elsevier B.V. All rights reserved.

Keywords: Influenza virus; Real-time RT-PCR; H5; N1; Subtypes identification

1. Introduction
Influenza is an important public health problem. A pan-
demic may happen when the virus incorporates a novel HA
gene and includes the ability to spread efficiently among humans
in a population which lacks immunity to the virus. During the
20th century, this occurred three times. The most devastating
influenza pandemic, which occurred in 1918–1919 and known
as the “Spanish flu”, killed up to 100 million people world-
wide. Millions of people also died during the 1957 and 1968
pandemics (Luk et al., 2001; Oxford, 2000; Scholtissek et al.,
1978).
Since the report of outbreaks of highly pathogenic H5N1
in poultry farms and wet markets in Hong Kong, the number
of outbreaks of the highly pathogenic avian influenza (HPAI)
increased during the last decade. HPAI outbreaks occurred in
∗ Corresponding author. Tel.: +86 20 84113964; fax: +86 20 84113964.
E-mail address: wxz@mail.sysu.edu.cn (X. Wang).
poultry in over 30 countries and areas from SE Asia, the Mid-
dle East, Europe, and Africa. This expansion led directly to a
marked increase in human cases and increased the pandemic
threat (Centre for Health Protection, 2007; WHO, 2006b). From
2003 to February 2007, at least 270 cases of human infections
with H5N1 in 10 countries were confirmed by the World Health
Organization, 164 of infected individuals died of severe pneumo-
nia complicated by acute respiratory distress syndrome (WHO,
2007).
Influenza virus is an enveloped single-stranded RNA virus
belonging to the family Orthomyxoviridae. Based on antigenic
differences in the NP and M proteins, influenza virus was clas-
sified into A, B, and C types. All influenza pandemics have been
caused by types A and B virus.
Influenza virus type A is divided further into subtypes based
on the antigenic relationships in the surface glycoproteins,
haemagglutinin (HA), and neuraminidase (NA). Currently, 16
HA subtypes (H1–H16) and 9 NA subtypes (N1–N9) have been
recognized (Fouchier et al., 2005). Types B and C virus are not
divided into subtypes.

0166-0934/$ – see front matter © 2007 Elsevier B.V. All rights reserved.
doi:10.1016/j.jviromet.2007.10.023
82 C. Wu et al. / Journal of Virological Methods 148 (2008) 81–88
From 2003, only influenza type B virus and two subtypes
H1N1 and H3N2 of type A virus were circulating extensively
in humans (Rota et al., 1990; Xu et al., 2004). However,
since 1994 a few subtypes, H5N1, H7N3, H7N7, H9N2, and
H10N7 of avian influenza virus have crossed the species bar-
rier and infected humans (Stephenson et al., 2004; Yu et al.,
2006). Recently, seven members of a single extended family in
Indonesia were confirmed with the H5N1 avian influenza virus
infection, which was suspected to be due to human-to-human
transmission (WHO, 2006a). Therefore, it is important to iden-
tify these HPAI subtypes rapidly in different types of respiratory
clinical samples.
Although virus isolation by cell culture and embryonated
eggs culture is still the standard for influenza virus detection,
many novel diagnostic techniques have been developed in the
past few years to obtain more sensitive and rapid diagnostic
results. These include immunofluorescence, enzyme immunoas-
say, one-step RT-PCR, real-time RT-PCR, real-time NASBA,
and RT-LAMP (Doller et al., 1992; Ellis et al., 1997; Masaki et
al., 2006; Sunchai et al., 2006; van Aarle et al., 2006; van Elden
et al., 2001; Ziegler et al., 1995).
In this study, a multiplex real-time RT-PCR system was
developed for detection of influenza types A and B virus and
simultaneous identification of H5 and N1 subtypes in a single
tube. The genetic diagnostic system was carried out with four
pairs of primers and various labeled TaqMan probes correspond-
ing to the specific genes of influenza (sub)types A, B, H5, and
N1.
2. Materials and methods
2.1. Virus strains and clinical specimens
Human influenza A and B virus reference strains used in this
study were isolated from clinical specimens received from fac-
tory, school, hospital, and medical centers during the outbreaks
in Shen Zhen from 1994 to 2006. Avian influenza virus reference
strains were obtained from the Key Laboratory of Poultry Feed-
ing & Diseases Control, Ministry of Agriculture, Guangzhou,
China. Reference strains of parainfluenza virus 1 and 3, res-
piratory syncytial virus A (RSV), rhinovirus 1E-6, adenovirus,
coxsackievirus A, herpes simplex virus 1 were provided by Cen-
ter for Health Protecion, Department of Health, Hong Kong,
China. 189 throat swabs from patients with respiratory disease
symptoms were provided by the Center for Disease Control
and Prevention of WuHan, ShaoGuan, and FoShan, Ministry
of Public Health, China.
2.2. Virus isolation and RNA extraction
All virus isolates were cultured in MDCK cells or grown and
passaged in specific pathogen-free (SPF) 9–11-day-old embry-
onated chicken eggs as described previously (Schweiger et al.,
2000; Wang, 1999).
RNA extraction was carried out with the High Pure Viral
RNA Kit (Roche Diagnostics GmbH, Mannheim, Germany)
according to the manufacturer’s protocol.
2.3. Primer and probe design
The nucleotide sequences of the matrix (M), haemagglu-
tinin (HA), and neuraminidase (NA) genes of influenza virus
were obtained from GenBank database. Multiple sequences
were aligned using the CLUSTAL W software program (Ver-
sion 1.83; EBI, Cambridge, http://www.ebi.ac.uk/clustalw). The
M gene, conserved for influenza A, was selected for detec-
tion of type A influenza virus. The M gene-specific primer
and probe set was designed based on sequences compari-
son among different subtypes of over 50 strains of influenza
A virus from human and avian sources. The N1 primer and
probe set was selected based on the conserved regions of over
85 influenza A virus sequences, including subtypes 22H1N1,
H5N1, H6N1, H7N1 and so on. The H5 primer and probe
set was designed based on the alignment of over 110 sub-
types H5 sequences of representative viruses from Asia, Africa
and Europe. The B primer and probe set was modified from
those described previously (van Elden et al., 2001). All the
primer and probe sets were designed and analyzed by using soft-
ware Primer 3 (Whitehead Institute for Biomedical Research,
MD, http://fokker.wi.mit.edu/primer3/) and Primer Premier
(Version5.0; PREMIER Biosoft International, CA). Selected
primer and probe sequences were compared with sequences
submitted to the GenBank nucleotide database using a stan-
dard nucleotide–nucleotide comparison tool BLASTN (Version
2.2.1; NCBI, MD, http://www.ncbi.nlm.nih.gov/). The primers
and probes used in this study are listed in Table 1. The probes
were labeled with BHQ1-3 at the 3 end and four different flu-
orescent reporter dyes (FAM, HEX, ROX, and CY5) at the 5
end, so that the four different genes of influenza virus could
been detected simultaneously in a single tube according to the
different emission wavelengths of FAM, HEX, ROX, and CY5.
2.4. One-step multiplex real-time RT-PCR
The one-step multiplex real-time RT-PCR was carried out
using the real time one-step RNA PCR kit (TaKaRa Biotechnol-
ogy Co., Dalian, China) in a 25 ␮l reaction mixture containing
2.5 ␮l of 10× reaction buffer, 5 mM MgCl2 , 1 mM each dNTPs,
20 units of RNase inhibitor, 12.5 units of M-MLV RTase (RNase
H free), 2.5 units of TaKaRa Ex Taq HS, additional 4 ␮l RNA
sample, and four sets of primers and probes. Each primer was
used at a final concentration of 0.5 ␮M and the probes for A,
B, H5, N1 were used at final concentrations of 0.15, 0.4, 0.4,
and 0.8 ␮M, respectively. The multiplex real-time reaction was
conducted on the Mx4000 multiplex quantitative PCR system
(Stratagene Co., La Jolla, CA). The fluorescence RT-PCR pro-
gram consisted of 30 min at 42 ◦ C for reverse transcription, 2 min
at 95 ◦ C for activation of Taq enzyme, followed by 40 cycles for
amplification with 95 ◦ C for 5 s and 60 ◦ C for 1 min. The mul-
tiple fluorescence signals of FAM, HEX, ROX, and CY5 were
acquired at the end of each annealing step. For each dye, the
analysis of fluorescence data was conducted using the Mx4000
software (Version 4.2; Stratagene Co., La Jolla, CA). The thresh-
old fluorescence level, used to derive Ct values, was determined
automatically by the Mx4000 software.
 C. Wu et al. / Journal of Virological Methods 148 (2008) 81–88 83

Table 1
Primers and Taqman probes for use in influenza virus multiplex RT-PCR assay
Type or subtype Target gene Primer and probe Sequence (5 –3 ) Locationa Strand

A M AF2 AGGTCGAAACGTAYGTTCTCTCTAT 17–41 Sense

AR3 GGTCTTGTCTTTAGCCAYTCCAT 149–127 Antisense
A-probe FAM-TCAGGCCCCCTCAAAGCCGA-BHQ1 49–68 Sense
H5 HA H5-F1 GGTAACGGTTGTTTCGARTTCTATCA 1435–1460 Sense
H5-R2 ATAGACCAGCYACCATGATTGCCA 1654–1631 Antisense
H5-probe ROX-CCGCAGTATTCAGAAGAAGCAA-BHQ2 1513–1534 Sense
N1 NA N1-F2 TGGACYAGTGGGAGCAGCAT 1330–1349 Sense
N1-R3 TGTCAATGGTRAA YGGCAACTC 1426–1405 Antisense
N1-probe HEX-TGGTCTTGGCCAGACGGTGC-BHQ1 1383–1403 Sense
B HA B1 AAATACGGTGGATTAAATAAAAGCAA 970–995 Sense
B2 CCAGCAATAGCTCCGAAGAAA 1139–1119 Antisense
B-probe CY5-CACCCATATTGGGCAATTTCCTATGGC-BHQ3 1024–1050 Sense
a
Primer and probe positions for type A influenza virus corresponding to the M gene of A/Hong Kong/1/68 (H3N2, GenBank accession no. AF348188), for
subtype H5 corresponding to HA gene of A/chicken/Fujian/12239/2005 (H5N1, GenBank accession no. DQ992830), for subtype N1 corresponding to NA gene of
A/Wuhan/371/95 (H1N1, GenBank accession no. AJ518097), for type B corresponding to those described previously (van Elden et al., 2001).

2.5. Specificity of the multiplex amplification
Specificity determination of the multiplex real-time RT-
PCR was performed using the reference strains of human
influenza A and B virus and avian influenza virus. The iso-
lates of human and avian influenza A virus including subtypes
H1N1, H3N2, H5N1, H4N6, H7N3, and H9N2 were iden-
tified previously by haemagglutination-inhibition (HI) and
neuraminidase-inhibition (NI) tests (Wang, 1999), respectively.
Some other respiratory viruses were used as negative controls,
including parainfluenza virus 1 and 3, RSV, rhinovirus 1E-6,
adenovirus, coxsackievirus A, herpes simplex virus 1.
2.6. Sensitivity and reproducibility of the multiplex
amplification
The specific target gene segments of (sub)types A,
B, H5 and N1 were amplified from influenza virus
strains A/Shenzhen/1/2000(H3N2), B/Shenzhen/451/2004,
A/Guangdong/2/2006(H5N1), and A/Shenzhen/42/2005
(H1N1), respectively. The amplified products were then cloned
into the pGEM-T Easy vector (Promega, Madison, WI) as
per the manufacturer’s directions and sequenced to verify its
accuracy. After linearization by SalI (TaKaRa Biotechnology
Co., Dalian, China), the four plasmids were gel purified
and used as templates with a RiboMax T7 Express In Vitro
Transcription System (Promega, Madison, WI) following the
manufacturer’s recommendations. The concentration of the
transcribed RNAs was determined by measuring absorbance at
260 nm with BioPhotometer (Eppendorf, Hamburg, Germany),
and 10-fold serial dilutions of RNAs, ranging from 107 to 100 ,
were then prepared.
To detect the sensitivity and reproducibility of the assay, six
independent experiments were undertaken in six replicates of
each run for all serial dilution tests. The mean CT, standard devi-
ation (S.D.) and coefficient of variation (CV) were calculated to
measure the inter- and intra-reproducibility of the assay.
To evaluate the influence of compounds in the sam-
ples on the multiplex amplification system, three reference
strains of influenza virus, including A/Shenzhen/1/2000(H3N2),
A/Guangdong/2/2006(H5N1) (cultured in MDCK cells) and
A/Shenzhen/149/2006(H1N1) (grown in SPF embryonated
eggs), were used in the detection. The viral RNAs were extracted
from the virus isolates, and 10-fold serial dilutions of viral
RNAs, ranging from 100 to 10−5 , were then prepared.
2.7. Performance of the multiplex amplification on titrated
viruses in different matrixes
The virus titer was determined by the method of 50% tis-
sue culture infective doses (TCID50 ). The titrated viruses were
spiked in three different transport media for clinical specimens,
including MEM cell culture medium, Hanks balanced salt solu-
tion and physiological saline solution (0.85%). All the transport
media were supplemented with penicillin and streptomycin at
a concentration of 200 units/ml and 200 ␮g/ml, respectively.
MEM cell culture medium and Hanks balanced salt solution
were supplemented with bovine serum albumin (BSA) to a con-
centration of 0.5%. The viral RNAs were extracted from the
viruses in different media simultaneously, and the multiplex
amplifications were carried out under the same conditions. Three
independent experiments were carried out in three replicates of
each run for each virus.
3. Results
3.1. One-step multiplex real-time RT-PCR detection
Four sets of primers and probes specific to influenza virus
(sub)types A, B, H5 and N1 (Table 1) were used in the multiplex
real-time RT-PCR detection system. All the primers and probes
were designed to work under the same PCR conditions in the
multiplex format.
The results showed that a single fluorescent signal of FAM or
CY5 could be detected by the multiplex amplification system for
influenza A virus H3N2 or influenza B virus, a dual fluorescent
signal of FAM and HEX for influenza A virus H1N1, and a
triple fluorescent signal of FAM, ROX, and HEX for human
84 C. Wu et al. / Journal of Virological Methods 148 (2008) 81–88
Fig. 1. Amplification plots of influenza virus detection by multiplex real-time
RT-PCR. Mixture of influenza A virus (H5N1) and influenza B virus yielded
quadruple fluorescent signals.
avian influenza A virus subtype H5N1. When RNA mixtures of
influenza A virus H5N1 and influenza B virus were added to the
multiplex amplification system, all of the four fluorescent signals
of FAM, HEX, ROX, and CY5 were detected (Fig. 1). The results
showed that four target genes specific for A, B, H5, and N1
were amplified successfully without spurious amplification and
significant cross-talk of the four fluorescent reporter dyes.
3.2. Specificity and sensitivity of the protocol
To validate the specificity of the protocol, human influenza
virus B, human H1N1, H3N2, and H5N1 virus of ShenZhen from
1994 to 2006, and some avian influenza virus subtypes H1N1,
H3N2, H4N6, H5N1, H7N3, and H9N2 were subjected to the
multiplex assay (Table 2). The influenza viruses were isolated
from human, swine, and various avian species. In the evaluation
assays, with the four sets of primers and probes, target genes of
different subtype viruses were identified precisely. The subtypes
H5 and N1 viruses were distinguished successfully from the
samples that were influenza A virus positive. In contrast, no
positive fluorescent signal was observed in the assays of the
other respiratory viruses, including parainfluenza virus 1 and
3, RSV A, rhinovirus 1E-6, adenovirus, coxsackievirus A, and
herpes simplex virus 1. The results indicate that the multiplex
amplification system was a precise and reliable diagnostic tool
for influenza virus.
Table 2
Evaluation result of multiplex real-time RT-PCR showing successful amplification of specific target genes of influenza virus reference strains
Influenza virus strains Subtypes
B/Shenzhen/116/2006 / +
A/Shenzhen/24/2006 H3N2
A/Shenzhen/17/2006 H1N1
A/Guangdong/2/2006 H5N1
A/chicken/Guangzhou/13/2004 H9N2
A/duck/Guangzhou/A7/2004 H7N3
A/duck/Guangzhou/19/2004 H4N6
Fig. 2. Sensitivity of the protocol for type A was evaluated by testing serial
10-fold of transcribed RNAs ranging from 107 to 100 copies/␮l. No positive
fluorescent signal was detected at 100 dilutions. The limit of the detection was
as low as 88.3, 62.7, 557 and 95.9 copies/␮l, corresponding to A, B, H5 and N1
transcribed RNAs, respectively.
The concentration of the transcribed RNAs of A, B, H5
and N1 was 11.2, 9.2, 9.7 and 10.2 ␮g/␮l, corresponding
to 8.8 × 1013 , 6.3 × 1013 , 5.6 × 1013 and 9.6 × 1013 copies/␮l,
respectively. The sensitivity for each type or subtype in the mul-
tiplex system was evaluated by testing serial 10-fold dilutions of
transcribed RNAs ranging from 107 to 100 copies/␮l. No posi-
tive fluorescent signal was detected at 100 dilutions. While, for
H5 there was no positive fluorescent signal at 101 dilutions. The
positive signals as low as 88.3, 62.7, 557 and 95.9 copies/␮l, cor-
responding to A, B, H5 and N1 transcribed RNAs, respectively,
could be detected (Fig. 2).
3.3. Efficiency of gene amplification and reproducibility
For different subtypes of influenza A virus, different tar-
get genes could be amplified using this protocol. To compare
the amplification efficiencies among genes of different subtype
virus, standard curves for different genes were generated by
plotting their cycle threshold numbers (CT) versus their dilution
factors. High correlation values (R2 > 0.99) between CT values
and dilution factors were obtained by the multiplex amplification
assay. Using the slope from the linear equation, the amplification
efficiencies based on in vitro transcribed RNAs of monoplex,
duplex and triplex format were estimated to be 102.1 ± 0.6,
Amplification of specific target gene
Type B Type A Subtype H5 Subtype N1
− − −
− + − −
− + − +
− + + +
− + − −
− + − −
− + − −
 C. Wu et al. / Journal of Virological Methods 148 (2008) 81–88 85

95.8 ± 1.8, and 105.7 ± 1.3% for M genes of type A, and for NA

Inter-CV (%)
genes of N1 subtype duplex and triplex format were 90.5 ± 1.7
and 103.4 ± 1.3%. The result indicated that using all the four sets

2.58
2.19
2.07
1.61
4.24
3.67
2.08
of primers and probes in the multiplex amplification system did
not lead to significant cross-interference. However, the amplifi-

Intra-CV (%)
cation efficiencies based on the viral RNAs of H3N2, H1N1
and H5N1 were estimated to be 72.8 ± 1.2, 76.0 ± 1.6, and
70.6 ± 1.3% for M genes of type A; 82.3 ± 1.7 and 72.3 ± 1.6%

0.57
0.31
1.60
0.99
1.29
1.48
0.76
for NA genes of N1 subtype; 72.5 ± 1.2% for HA gene of H5
subtype. The result suggested that decrease of amplification effi-

Mean CT
ciencies might be caused by the compounds in the samples that

13.21
16.05
18.85
22.27
25.10
28.97
33.63
could be co-extracted with viral RNAs.

N1
The coefficient of variation (CV) of the mean CT values were
obtained for each run ranging from 107 to 101 copies/␮l of the

Inter-CV (%)
standard RNA from six independent experiments. As the results
shown in Table 3, the multiplex assays for each target RNA were

0.91
1.18
0.94
2.89
2.04
3.04
NA
extremely reproducible. Intra-assay CV of A, B, H5 and N1 were
0.7–1.5, 0.1–2.6, 0.5–1.7, 0.3–1.6%, and the inter-assay CV was

Intra-CV (%)
1.0–1.7, 1.4–3.4, 0.9–3.0, 1.6–4.2%, respectively.

3.4. Performances of the multiplex amplification on titrated

0.46
0.48
0.67
0.90
0.56
1.67
NA
viruses in different matrixes

Mean CT
Four types of titrated viruses, including H3N2, H1N1, H5N1

16.15
19.41
22.49
25.94
28.76
32.52
and B, were spiked in MEM cell culture medium, Hanks

NA
H5
balanced salt solution and physiological saline solution, respec-
tively. All the target genes of different (sub)type viruses were

Inter-CV (%)
amplified. The mean CT values of amplification for each virus
in different transport media were obtained from three indepen-

2.51
2.24
1.91
1.36
2.21
2.21
3.38
dent experiments. As the results shown in Table 4, the mean
CT values of all the target genes of viruses in physiological
saline were lower than that of viruses in the other two media.
Intra-CV (%)

Furthermore, the difference of CT values between them was

significant (P < 0.03). However, although the mean CT values
0.13
0.58
0.54
0.27
0.45
0.75
2.59
of most target genes of viruses in Hanks balanced salt solution
were also lower than that of the viruses in MEM cell culture
Mean CT

medium, there was no significant difference (P > 0.05) between

them. The results indicated that there were slightly differences
12.18
15.38
18.48
21.96
25.14
28.20
32.67

of the amplification performances on the viruses in different

B
Intra- and inter-assay reproducibility of the multiplex amplification

media.
Inter-CV (%)

3.5. Comparison between multiplex real-time RT-PCR and

conventional culturing method for assessing clinical
1.48
1.60
1.26
1.41
1.02
1.09
1.73

samples
Intra-CV (%)

Multiplex PCR and viral culture were carried out on each

of 189 clinical samples (throat swabs) from city of Wuhan,
0.65
0.45
0.76
0.90
0.48
0.78
1.48

Shaoguan, and Foshan. All the clinical samples were collected

from patients with respiratory disease symptoms during the
influenza seasons between 2004 and 2005. RNA was extracted
Mean CT

from each sample and multiplex real-time RT-PCR assay was

14.68
17.77
20.92
24.03
28.41
31.67
34.95

conducted as described previously. The amplification products

A

of PCR-positive samples were analyzed subsequently by agarose

Copy number

gel (2%) electrophoresis to check for their size and confirm

the results. At the same time, isolation of influenza virus from
Table 3

throat swabs samples was carried out by cell culture and shell
107
106
105
104
103
102
101

viral culture. HA and NA subtypes of culturing-positive samples

86 C. Wu et al. / Journal of Virological Methods 148 (2008) 81–88

Table 5

19.67 (0.22)
Comparison of the diagnostic efficiency between multiplex real-time RT-PCR
and conventional culturing method in assessing 189 clinical samples

–
–

–
Type or subtype No. of positive samples No. of positive samples

B
by multiplex RT-PCR by conventional culturing

20.25 (0.27)
A (subtype N1) 67 (11) 35 (5)
B 14 11

H5
Total (%) 81 (42.9) 46 (24.3)

–
–

–
20.75 (0.17)
19.44 (0.30) were identified by the method of HI and NI tests as described
Physiological saline

N1

– previously.
As shown in Table 5, 81 of the 189 samples (42.9%) were
19.48 (0.12)
20.29 (0.10)
19.45 (0.14)

identified as types A and B influenza virus by the multiplex RT-

PCR assays and agarose gel electrophoresis analysis, including
–
A

11 subtype N1 samples. While only 46 samples (24.3%) were

confirmed positive by conventional culturing and the HI and
19.91 (0.12)

NI tests, with 5 samples of subtype N1. The positive samples

identified by the multiplex RT-PCR included all the positive
–
–
–

samples by conventional culturing. No subtype H5 was detected

B

by the two ways. The result indicated that the multiplex real-
20.59 (0.24)

time RT-PCR was more sensitive than the conventional culture

method.
H5

–
–

–
Hanks balanced salt solution

21.03 (0.17)
19.86 (0.26)

4. Discussion

The multiplex real-time RT-PCR assay is a more efficient

N1

and sensitive method comparing to (multiplex) RT-PCR (Xie et

19.57 (0.15)

19.88 (0.21)
20.47 (0.12)

al., 2006) in which the post-PCR analysis is time-consuming

and it is difficult to avoid contamination by amplicon carry-
over despite the use of UNG treatment (Schweiger et al., 1997).
–
A

Contamination by amplicon carryover is almost avoided com-

20.04 (0.15)

pletely by using real-time RT-PCR. The sensitivity of the assay

reached approximately 101 –102 copies/␮l, which was similar
Performances of the multiplex amplification on titrated viruses in different matrixes

to the detection limit reported by other researchers (Spackman

–

–
–
B

et al., 2003; Sunchai et al., 2006). Multiplex real-time RT-

PCR assay permitted the detection of mixed virus infections
20.56 (0.13)

that could be missed by virus isolation or single real-time

reaction (Erdman et al., 2003). In comparison to traditional
H5

–
–
Virus type TCID50 (×103 ) Mean CT of amplification (S.D.)

methods, multiplex real-time RT-PCR could increase the effi-

ciency significantly and save money when large number of
19.90 (0.16)
21.15 (0.14)
MEM cell culture medium

clinical samples were processed during the season of influenza

pandemics.
N1

In addition to some factors that could affect the sensitiv-

ity of the real-time RT-PCR assay, such as RNA extraction
19.75 (0.20)

19.86 (0.16)
20.52 (0.11)

procedure, efficiency of Taq polymerase, and different fluores-

cent reporter dyes, two other factors could cause decrease in
sensitivity to the multiplex reactions. One was primer–dimer
A

and primer/probe–dimer formation that inhibited the subsequent

PCR reaction. The other was the efficiency of reverse transcrip-
tion that could be affected by competition between amplicons
of different sizes, though smaller products would minimize the
6.32
1.00
3.56
2.00

effects (Spackman et al., 2003). In this multiplex amplification

system, the detection limit of H5 was a little higher than that
Table 4

H3N2
H1N1
H5N1

of A, B and N1, which was probable because of a little bigger

amplicons of H5 than others.
B
 C. Wu et al. / Journal of Virological Methods 148 (2008) 81–88
The PCR efficiencies calculated by using the slopes of
the linear equations reflected the performance of multiplex
amplification. In this study, the results of amplification effi-
ciencies based on in vitro transcribed RNAs indicated that
monoplex, duplex and triplex formats of the target genes did
not affect the relative efficiency of amplification. The four sets
of primers and probes used in the multiplex amplification sys-
tem seemed not to interfere with each other. However, the
amplification efficiencies based on the viral RNAs decreased
significantly. It was probable that the compounds in the sam-
ples that could have been co-extracted with viral RNAs, such
as cellular nucleic acids, proteins, salts and other cellular impu-
rities, had inhibitor effects on the PCR amplifications. For the
two types of virus isolates used in the detection, the interference
of virus isolates cultured in MDCK cells seemed a little more
serious than that of virus isolates grown in SPF embryonated
eggs.
To evaluate the performance of the assay on clinical speci-
mens in different matrixes, the titrated viruses were spiked in
three different transport media to imitate the real clinical con-
ditions. The multiplex assays for each virus provided a very
stable and reproducible performance of detection, although there
was a little difference of the amplification results using differ-
ent matrixes. The difference among them was probably due to
the different efficiencies of viral RNA extraction in the three
different matrixes.
There were marked differences in nucleotide sequence
between human and avian influenza virus. Thus, in order to
increase the specificity of the assay for both human and avian
influenza virus, large number of sequences of human and avian
influenza virus from distinct regions were selected and degen-
erated bases were used in the primer and probe designing. The
primers and probes used in this study were designed to target
specifically (sub)types A, B, H5, and N1 influenza virus. Results
of the evaluation assay showed that 23 reference strains of human
influenza virus and 17 reference strains of avian influenza virus
were detected successfully by this method, including a strain of
H5N1 virus isolated from an infected male in ShenZhen, June
2006.
This protocol is also useful for detecting the usual seasonal
influenza types in addition to laboratory screening for the H5N1
viruses. Normally, for example in 2003, only influenza type B
virus and two subtypes H1N1 and H3N2 of type A virus were
circulating extensively in humans. Therefore, in most cases, for
influenza A virus-positive and H5 negative samples, the result of
N1 would be helpful to differentiate between H3N2 and H1N1.
However, this protocol could not differentiate subtypes of avian
influenza H7/H9 virus positive samples. Fortunately only a few
people were confirmed with H7/H9 avian influenza virus infec-
tion in regular seasons (Stephenson et al., 2004; Yu et al., 2006).
In conclusion, the one-step multiplex real-time RT-PCR pro-
tocol offers a rapid, specific, sensitive and reproducible method
for the detection of types A and B influenza virus and simulta-
neous identification of H5 and N1 subtypes. The method would
be a useful molecular diagnostic tool for large-scale screening
of clinical samples, especially at the time of influenza virus
outbreaks.
87
Acknowledgments
We thank Dr. Ming Liao, Department of Zoology, South
China Agriculture University; Dr. Wilina Lim and Peter Cheng,
Center for Health Protection of Hong Kong; the staff of the
CDC of WuHan, ShaoGuan and FoShan, for providing the
tested specimens.
References
Centre for Health Protection, 2007. Global Statistics of Avian Influenza.,
http://www.info.gov.hk/info/flu/eng/global.htm.
Doller, G., Schuy, W., Tjhen, K.Y., Stekeler, B., Gerth, H.J., 1992. Direct
detection of influenza virus antigen in nasopharyngeal specimens by direct
enzyme immunoassay in comparison with quantitating virus shedding. J.
Clin. Microbiol. 30, 866–869.
Ellis, J.S., Fleming, D.M., Zambon, M.C., 1997. Multiplex reverse transcription-
PCR for surveillance of influenza A and B viruses in England and Wales in
1995 and 1996. J. Clin. Microbiol. 35, 2076–2082.
Erdman, D.D., Weinberg, G.A., Edwards, K.M., Walker, F.J., Anderson,
B.C., Winter, J., Gonzalez, M., Anderson, L.J., 2003. GeneScan reverse
transcription-PCR assay for detection of six common respiratory viruses in
young children hospitalized with acute respiratory illness. J. Clin. Microbiol.
41, 4298–4303.
Fouchier, R.A., Munster, V., Wallensten, A., Bestebroer, T.M., Herfst, S., Smith,
D., Rimmelzwaan, G.F., Olsen, B., Osterhaus, A.D., 2005. Characterization
of a novel influenza A virus hemagglutinin subtype (H16) obtained from
black-headed gulls. J. Virol. 79, 2814–2822.
Luk, J., Gross, P., Thompson, W.W., 2001. Observations on mortality during the
1918 influenza pandemic. Clin. Infect. Dis. 33, 1375–1378.
Masaki, I., Ninomiya, A., Minekawa, H., Notomi, T., Ishizaki, T., Tashiro, M.,
Odagiri, T., 2006. Development of H5-RT-LAMP (loop-mediated isother-
mal amplification) system for rapid diagnosis of H5 avian influenza virus
infection. Vaccine 24, 6679–6682.
Oxford, J.S., 2000. Influenza A pandemic of the 20th century with special ref-
erence to 1918: virology, pathology and epidemiology. Rev. Med. Virol. 10,
119–133.
Rota, P., Wallis, T.R., Harmon, M.W., Rota, J.S., Kendal, A.P., Nerome, K.,
1990. Cocirculation of two distinct evolutionary lineages of influenza type
B virus since 1983. Virology 175, 59–68.
Scholtissek, C., Rohde, W., Hoyningen, V.V., Rott, R., 1978. On the origin of
the human influenza virus subtypes H2N2 and H3N2. Virology 87, 13–20.
Schweiger, B., Paul, G., Zeichhardt, H., Kucherer, C., 1997. A multicentre qual-
ity assessment study to monitor the performance of HIV-1 PCR. J. Virol.
Methods 67, 45–55.
Schweiger, B., Zadow, I., Heckler, R., Timm, H., Pauli, G., 2000. Application
of a fluorogenic PCR assay for typing and subtyping of influenza viruses in
respiratory samples. J. Clin. Microbiol. 38, 1552–1558.
Spackman, E., Senne, D.A., Bulaga, L.L., Trock, S., Suarez, D.L., 2003.
Development of multiplex real-time RT-PCR as a diagnostic tool for avian
influenza. Avian Dis. 47, 1087–1090.
Stephenson, I., Nicholson, K.G., Wood, J.M., Zambon, M.C., Katz, J.M., 2004.
Confronting the avian influenza threat: vaccine development for a potential
pandemic. Lancet 4, 499–509.
Sunchai, P., Salin, C., Arunee, C., Sudarat, D., Chantanee, B., Alongkorn, A.,
Apiradee, T., Yong, P., 2006. Single step multiplex real-time RT-PCR for
H5N1 influenza A virus detection. J. Virol. Methods 131, 143–147.
van Aarle, R., BrengeI-Pesce, K., Lefeuvre, A., Touchard, M., Jacobs, E., van
de Wiel, R., 2006. Real-time NASBA assay for the detection of influenza A
and B. J. Clin. Virol. 36, 46–47.
van Elden, L., Nijhuis, M., Schipper, P., Schuurman, R., Van Loon, A.M.,
2001. Simultaneous detection of influenza viruses A and B using real-time
quantitative PCR. J. Clin. Microbiol. 39, 196–200.
Wang, Z., 1999. Influenza virus microneutralization assay. In: Guo, Y.J., Daniel,
L., Nancy, J.C., Kuniaki, N. (Eds.), Laboratory Diagnosis of Influenza. Sino-
Danish Postgraduate Training Center, Beijing, pp. 58–60.
88 C. Wu et al. / Journal of Virological Methods 148 (2008) 81–88
World Health Organization (WHO), 2006a. Avian Influenza—Situation in
Indonesia., http://www.who.int/csr/don/archive/country/idn/en/.
World Health Organization (WHO), 2006b. H5N1 Avian Influenza: Timeline.,
http://www.who.int/csr/disease/avian influenza/country/en.
World Health Organization (WHO), 2007. Cumulative Number of Con-
firmed Human Cases of Avian Influenza A (H5N1)., http://www.who.
int/csr/disease/avian influenza/country/en.
Xie, Z.X., Pang, Y.S., Liu, J.B., Deng, X.W., Tang, X.F., Sun, J.H., Mazhar,
I.K., 2006. A multiplex RT-PCR for detection of type A influenza virus and
differentiation of avian H5, H7, and H9 hemagglutinin subtypes. Mol. Cell.
Probes 20, 245–249.
Xu, X.Y., Stephen, E.L., Michael, W.S., Catherine, B.S., Henrietta, E.H.,
Bruce, A.M., Kanta, S., Nancy, J.C., Alexander, K., 2004. Reassortment
and evolution of current human influenza A and B viruses. Virus Res. 103,
55–60.
Yu, H.J., Shu, Y.L., Hu, S.X., Zhang, H., Gao, Z.C., Chen, H., Dong, J., Xu, C.,
Zhang, Y., Xiang, N., Wang, M., Guo, Y., Cox, N., Lim, W., Li, D., Wang,
Y., Yang, W., 2006. The first confirmed human case of avian influenza A
(H5N1) in mainland China. Lancet 367, 84.
Ziegler, T., Hall, H., Sanchez-Fauquier, A., Gamble, W.C., Cox, N.J., 1995. Type
and subtype specific detection of influenza viruses in clinical specimens by
rapid culture assay. J. Clin. Microbiol. 33, 318–321.