Journal of Invertebrate Pathology 132 (2015) 216–227

Contents lists available at ScienceDirect

Journal of Invertebrate Pathology

journal homepage: www.elsevier.com/locate/jip

Unraveling the intraguild competition between Oscheius spp. nematodes

and entomopathogenic nematodes: Implications for their natural
distribution in Swiss agricultural soils
Raquel Campos-Herrera a,⇑, Vladimir Půža b, Geoffrey Jaffuel a, Rubén Blanco-Pérez a,
Rasa Čepulytė-Rakauskienė c, Ted C.J. Turlings a
a
FARCE Laboratory, University of Neuchâtel, Emile-Argand 11, Neuchâtel CH 2000, Switzerland
b
Laboratory of Entomopathogenic Nematodes, Institute of Entomology, Biology Centre, Czech Academy of Sciences, Branišovská 31, 370 05 České Budějovice, Czech Republic
c
Nature Research Centre, Institute of Ecology, Akademijos 2, LT–08412 Vilnius, Lithuania

a r t i c l e i n f o a b s t r a c t

Article history: Entomopathogenic nematodes (EPN) are excellent biological control agents to fight soil-dwelling insect
Received 14 July 2015 pests. In a previous survey of agricultural soils of Switzerland, we found mixtures of free-living nema-
Revised 21 October 2015 todes (FLN) in the genus Oscheius, which appeared to be in intense competition with EPN. As this may
Accepted 26 October 2015
have important implications for the long-term persistence of EPN, we studied this intraguild competition
Available online 27 October 2015
in detail. We hypothesized that (i) Oscheius spp. isolates act as scavengers rather than entomopathogens,
and (ii) cadavers with relatively small numbers of EPN are highly suitable resources for Oscheius spp.
Keywords:
reproduction. To study this, we identified Oscheius spp. isolated from Swiss soils, quantified the outcome
Oscheius
Quantitative real-time PCR
of EPN/Oscheius competition in laboratory experiments, developed species-specific primers and probe for
Intraguild competition quantitative real-time PCR, and evaluated their relative occurrence in the field in the context of the soil
Entomopathogenic nematodes food web. Molecular analysis (ITS/D2D3) identified MG-67/MG-69 as Oscheius onirici and MG-68 as O. tip-
Soil food web ulae (Dolichura-group). Oscheius spp. indeed behaved as scavengers, reproducing in
64% of frozen-killed
cadavers from controlled experiments. Mixed infection in the laboratory by Oscheius spp. with low (3 IJs)
or high (20 IJs) initial EPN numbers revealed simultaneous reproduction in double-exposed cadavers
which resulted in a substantial reduction in the number of EPN progeny from the cadaver. This effect
depended on the number of EPN in the initial inoculum and differed by EPN species; Heterorhabditis megi-
dis was better at overcoming competition. This study reveals Oscheius spp. as facultative kleptoparasites
that compete with EPN for insect cadavers. Using real-time qPCR, we were able to accurately quantify this
strong competition between FLN and EPN in cadavers that were recovered after soil baiting (
86% cadav-
ers with >50% FLN production). The severe competition within the host cadavers and the intense manage-
ment of the soils in annual crops readily explain the low EPN numbers in Swiss field samples. The
developed molecular tools can be used to elucidate the extent to which the competitive interactions
affect EPN populations. This can help to develop strategies to achieve good persistence and natural
EPN recycling, in particular in systems where native EPN levels are low, such as annual crops.
Ó 2015 Elsevier Inc. All rights reserved.

1. Introduction These nematodes occur naturally in soils of all the continents

Entomopathogenic nematodes (EPNs) belonging to the genera
Steinernema and Heterorhabditis have been used to control soil-
dwelling insects in numerous crops around the world for decades
(Georgis et al., 2006; Kaya et al., 2006; Campos-Herrera, 2015).
⇑ Corresponding author at: Fundamental and Applied Research in Chemical
Ecology (FARCE Lab), Institute of Biology, University of Neuchâtel, Emile-Argand 11,
Neuchâtel CH-2000, Switzerland.
E-mail address: raquel.campos@unine.ch (R. Campos-Herrera).
except Antarctica (Griffin et al., 1990; Hominick, 2002; Adams
et al., 2006). At the moment, more than 70 Steinernema and 20
Heterorhabditis species have been described (Stock, 2015), and
the list continues to increase every year. The free-living stage
present in the soil is called the infective juvenile (IJ). It strives to
survive in the soil until it locates and penetrates a host. Once the
IJs are in the hemocoel, the nematodes release the mutualistic
bacterium, which quickly kills the insect in 48–72 h (Boemare,
2002). Inside the cadaver, the nematodes cycle through several
generations until the cadaver is fully exploited as a food resource.

http://dx.doi.org/10.1016/j.jip.2015.10.007
0022-2011/Ó 2015 Elsevier Inc. All rights reserved.
 R. Campos-Herrera et al. / Journal of Invertebrate Pathology 132 (2015) 216–227
This triggers the development of the nematodes into the IJ stage. At
this moment, the new IJs, carrying their associated bacterium, will
leave the cadavers by thousands in search of a new host (Adams
and Nguyen, 2002; Stock, 2015).
During the development and reproduction of EPN-bacteria
inside the cadaver, the bacteria produce the Scavenger Deterrent
Factor (SDF). This is a single compound or mixture of compounds
that remains unknown (Lewis et al., 2006, 2015) but is thought
to protect the cadaver from scavenger activity while the EPN-
bacteria reproduce inside. During the time the EPN species is
cycling through generations within the cadaver, usually 1–3 weeks
(depending on the EPN species, host and environmental condi-
tions), the cadaver is chemically protected against attacks by scav-
engers. Many organisms in the soil system can act as scavengers
such as ants, crickets, cockroaches, springtails, predator insects
and even birds (see review by Lewis et al., 2015). However, the
repellent effects might not extend to all situations and interactions.
Laboratory and field studies have shown free-living bacterivorous
nematodes (FLNs) that act as scavengers to compete with EPN for
their cadavers (Duncan et al., 2003, 2007; Campos-Herrera et al.,
2012). Field evidence supports this notion that FLN and EPN
engage in intraguild competition. For example, an increase in the
number of cadavers producing FLN after augmentation with EPN
was described for certain species (Ishibashi and Kondo, 1986,
1987; Duncan et al., 2003, 2007). Moreover, a substantial reduction
of the total EPN progeny per larvae was described for certain FLN–
EPN combinations (Duncan et al., 2003; Campos-Herrera et al.,
2012). However, there also are reports describing no such signifi-
cant interaction between FLN and EPN (Grewal et al., 1997;
Somaseker et al., 2002; Duncan et al., 2003; Garcia et al., 2011;
Campos-Herrera et al., 2012). The factors that drive these compet-
itive interactions such as species specificity, density and time
dependence, and environmental resource limitation or a combina-
tion of all four is unknown.
Scavenging is a common behavior of many FLN. The use of
cadavers as a food resource can involve necromeny, which is to
latch onto an invertebrate, wait for its death and then, exploit it
as a resource to produce the next generations (Sudhaus and
Schulte, 1989). This step might have been the intermediate
evolutionary stage between parasitism and entomopathogeny, as
proposed recently by Dillman et al. (2012). The critical characteris-
tics of the organism to be considered as a true entomopathogen
were defined by Dillman et al. (2012) as follow: (i) nematodes
use a mutualistic-symbiotic relationship with bacteria, which is
involved in the pathogenesis, (ii) the relationship between the
nematode and the bacteria might be facultative, although it is
maintained over subsequent generations (at least 2–3), (iii) the
death of the insect is fast, in less than 5 days. Under these criteria,
Oscheius chongmingensis and Oscheius carolinensis were recently
reported as true entomopathogens (Zhang et al., 2008; Ye et al.,
2010; Torres-Barragan et al., 2011; Dillman et al., 2012). However,
the status as entomopathogen of the new described species
Oscheius onirici (Torrini et al., 2015) remains to be confirmed under
the criteria established by Dillman et al. (2012). Firstly, it is unclear
if a bacterium or a mixture of bacteria is used by O. onirici to the kill
the insect and if so, it remains unknown if the O. onirici-bacteria
association persists for multiple generations. Lastly, for now, it
appears that the time required to kill the insects tested (Galleria
mellonella and Tenebrio molitor) is longer than the standard 5 days.
The isolate that Torrini et al. (2015) used for the description of
O. onirici was found in a very specific environment, a karstic cave
(Italy) and thus, it is plausible that this particular isolated popula-
tion is in the process of evolving from a necromenic toward a more
entomopathogenic status, but still the specific interaction between
the insect and the nematode is not yet clearly defined and perhaps
fluctuates depending on the environmental conditions. So far, only
217
members of the Insectivora-group in the Oscheius phylogeny (Félix,
2006) have been confirmed as true entomopathogens (Dillman
et al., 2012), and hence, the confirmation of entomopathogen
species within in the Dolichura-group would be a first, expanding
the development of the entomopathogenesis in nature to both
groups in this genus. The characterization of other populations of
the same species from other habitats might help to unravel the
evolutionary scenario that has lead to entomopathogenesis.
The dual behavior as scavenger or entomopathogen that some
nematode species appear to display adds tremendous complexity
to the nematode-insect/cadaver interaction. For example, the
traditional entomopathogenic nematodes from the families
Steinernematidae and Heterorhabditidae can also act as scavengers
(San-Blas and Gowen, 2008; Půža and Mráček, 2010). Similarly,
nematodes in the genus Oscheius can also act as entomopathogen
(Zhang et al., 2008; Ye et al., 2010; Torres-Barragan et al., 2011),
scavenger (Sudhaus, 1993), and possibly kleptoparasite of the
cadaver already occupied by EPNs. Hence, the possible interactions
between these two trophic groups (scavengers and ento-
mopathogens) are much more numerous than previously thought.
As yet, it is unknown whether Oscheius spp. and EPN can co-occur
and exploit the same cadaver. In fact, there is a complete lack of
information on the natural co-occurrence of EPN and Oscheius
spp. If both nematodes behave as entomopathogens it is plausible
that their distribution will not overlap due to niche segregation
that avoids competition for resources. However, if Oscheius can
behave as a facultative scavenger, possibly in a nascent ento-
mopathogenic stage, then co-infection with an EPN and Oscheius
can be expected in nature. Campos-Herrera et al. (2015) reported
that all the cadavers recovered from baited samples of Swiss agri-
cultural soils produced free-living nematodes (FLN), with
80%
containing a mix of EPN with the competing Acrobeloides-group
and/or member of the Oscheius genus. This effect was also main-
tained in the next generation of EPN-infected larvae, but only
Oscheius sp. was present with EPN. This previous study revealed
a strong intraguild competition between EPN and FLN for insect
cadavers, but the extent to which the outcome of the mixed infec-
tion displaced the EPN progeny was unknown (Campos-Herrera
et al., 2015). Advances in the simultaneous molecular identification
and quantification of soil organisms comprising EPN food webs
members facilitate the study of the natural distribution and species
assemblages (Campos-Herrera et al., 2013a,b). By detecting and
quantifying Oscheius spp. in soil-nematode samples, the presence
of EPN spatial patterns along with other nematode competitors
can be determined. Such patterns were previously observed in
citrus orchards (Campos-Herrera et al. 2012, 2013b). The develop-
ment of species-specific primers and probes for real time qPCR
allows for the species specific detection of these EPN competitors
and can be used alongside previous protocols for the estimation
of EPN abundance, nematophagous fungi (NF), other free-living
nematodes (FLNs) competitors, and the detection of the phoreti-
cally associated bacteria in the cuticle of the EPN (Campos-
Herrera et al., 2011a,b, 2012, 2013b, 2015; Pathak et al., 2012).
Because Oscheius spp. were observed co-occurring in the pro-
geny of cadavers recovered from G. mellonella baited soil samples
(Campos-Herrera et al., 2015), we examined the relationship
between EPN and members of Oscheius in an ecological and agro-
nomical context. Our hypotheses were: (i) Swiss Oscheius spp. iso-
lates would act as scavengers rather than entomopathogens, and
(ii) cadavers produced from few EPN or mixed EPN infections will
be highly suitable for Oscheius spp. reproduction thereby displac-
ing EPN progeny, and (iii) natural distribution of Oscheius spp. in
Swiss soils will follow similar spatial/temporal patterns as those
observed for other FLN that are known to compete with EPN for
insect cadavers. To unravel the interaction between Oscheius
and EPN, we defined the following objectives: (1) isolate and
218 R. Campos-Herrera et al. / Journal of Invertebrate Pathology 132 (2015) 216–227
characterize Swiss isolates of Oscheius spp., (2) determine the fate
of Oscheius spp. placed with G. mellonella larvae alone (living or
dead larvae) or in combination with EPN, (3) develop relevant
species-specific primers/probe for quantitative real-time PCR, (4)
estimate the occurrence of Oscheius and EPN in the larvae recov-
ered from baited-soil from two field experiments and (5) evaluate
their natural distribution associated with member of the EPN soil
food web in the same field experiments.
2. Material and methods
2.1. Isolation, molecular identification and phylogenetic analysis based
on ITS and SSU rDNA regions
In April and October 2013, soil samples were recovered in two
30-year old running Swiss field trials to evaluate how tillage might
affect the potential belowground biological control provided by
native EPN (Campos-Herrera et al., 2015). Traditional (insect-
bait) and molecular tools were employed to evaluate the presence
and activity of selected members of the EPN soil food web. EPN
activity was evaluated by baiting 2 subsamples (250 g of each of
the composite soil sample), with 5 G. mellonella larvae (commercial
stock, Au Pêcheur SARL, Neuchâtel, Switzerland), repeating the
baiting twice in total. The observation of the cadavers in individual
White traps (White, 1927) revealed the emergence of mixed popu-
lations of FLN and EPN IJs. Preliminary sequencing protocols of
these mixed infections revealed the presence of two Oscheius
spp., putatively belonging to the Oscheius sp.-2 and O. tipulae
described by Félix et al. (2001) and Félix (2006). Mixed infections
were also observed in progeny recovered after reinfecting accord-
ing to Koch’s postulates (Campos-Herrera et al., 2015). To further
characterize and identify the mixed infections, and to establish cul-
tures, we saved aliquots of the nematode progeny produced by the
original larvae baited in the soil (original DNA, hereafter OG). Like-
wise, we saved material from the nematodes emerging from the
Koch’s postulates (multiplication DNA, hereafter MG) (Campos-
Herrera et al., 2015).
From this material, selected cadavers that produced large num-
bers of free-living nematodes, which possibly exploited insects
killed by EPNs, were isolated for further analysis. Following the
method described by Campos-Herrera et al. (2012), the isolates
MG-67, MG-68 and MG-69 were rinsed in distilled water and run
through a 500 mesh sieve (opening 25 lm). A few nematodes were
then handpicked and transferred to 9 cm diam. Petri dishes con-
taining a thin layer of 1.0% nutrient agar (NA, Fluka Analytical,
Sigma–Aldrich). Nematodes were allowed to develop with their
associated bacterium for 7–10 days. Several rounds of culturing
were performed every 10–15 days without changes in morphology
(Campos-Herrera et al., 2012). In addition to the Swiss isolates, we
maintained the nematodes O. tipulae CEW-1 and Oscheius dolichura
JU72 from the Dolichura-group and Oscheius myriophilus JU1386
from the Insectivora-group (Félix, 2006) from the collection of
Marie-Anne Félix (Department of Biology, Institute de Biology de
l’Ecole Normale Supérieure, ENS, CNRS, France) for molecular and
morphological comparison with our isolates.
The ITS region of the rDNA and the SSU rDNA of each isolate
were sequenced in order to confirm morphological identification
(Vrain et al., 1992; Holterman et al., 2006). Briefly, nematodes were
washed from the media and prepared in aliquots of 300 nematodes
as described (Campos-Herrera et al., 2012). We employed the
QIAamp DNA mini kit (QiagenÒ Ltd, Valencia, CA) for the DNA
extraction from three independent nematode aliquots of each iso-
late, ensuring quality and quantity by using the Nanodrop 1000
system (ND–1000 v3.3.0, Thermo Scientific, Wilmington, DE). PCR
products were generated by using conventional PCR amplification
in a Biometra T1 (Biolabo, France), with concentrations, reaction
protocol, reagents and equipment as described by Campos-
Herrera et al. (2015). All runs contained a negative control by add-
ing mQ water (Milli-Q Water System, Millipore S.A., Molsheim,
France) instead of DNA template. After verification of the PCR-
product size throughout electrophoresis in 2% agarose gel in TBE
(pH 8.0 ± 0.1), individual bands were isolated and purified (QIA-
quick Gel Extraction, QiagenÒ), cloned by using the pGEMÒ-T Easy
Vector System I kit (Promega) and transformed on the JM109 High-
Efficiency Competent Cells (Promega). Plasmids with the corre-
sponding sequence inserted were generated as described by
Campos-Herrera et al. (2015), aligned with the software Geneious
(R.6.1.5., Biomatters, Inc.), compared to reported sequences using
Blast (http://blast.ncbi.nlm.nih.gov) and submitted to Genbank.
For the phylogenetic analysis, an alignment of our isolates
together with sequences of other Oscheius species was produced
for each amplified DNA-region using default ClustalW parameters
in MEGA 6 (Tamura et al., 2013). Alignments were manually in
BioEdit (Hall, 1999). Phylogenetic trees were generated using the
Minimum Evolution method (Rzhetsky and Nei, 1992) in MEGA 6
(Tamura et al., 2013). The Minimum Evolution trees were searched
using the Close-Neighbour-Interchange (CNI) algorithm (Nei and
Kumar, 2000) and Neighbour-joining algorithm (Saitou and Nei,
1987) was used to generate the initial trees. The evolutionary
distances were computed using the P-distance method (Nei and
Kumar, 2000) and were expressed as the number of base differ-
ences per site.
2.2. Laboratory studies on Oscheius spp. biology: pathogenicity,
scavenging behavior and competition for the cadavers with
entomopathogenic nematodes
The isolates MG-67 and MG-68 were selected for biological and
ecological characterization. The two isolates were mass-produced
in NA for 7–10 days (see section 2.1). Several plates were rinsed
in distilled water and passed through a 500 mesh sieve (opening
25 lm) for each of the experiments, producing a suspension of
mainly juvenile nematodes with possibly some adults. Various
experiments evaluated the reproductive ability of the isolates
MG-67 and MG-68, in all cases using 24-well plates (Falcon Multi-
well, 24 well Polystyrene, Corning Incorporated-Life Sciences,
Duham, USA). In all the experiments, each well was filled with
1.0 g of sterile sand (neograd, Migros, Switzerland) and one 24-
well plate per treatment was employed. Nematode suspensions
were applied in adjusted concentrations in a final volume of
200 lL, using the same amount of distilled water for control treat-
ments. Larvae of G. mellonella served as hosts, either alive or freeze-
killed. Experiments were maintained at room temperature
(20–22 °C) in the dark. The experiments using live larvae were
checked daily for one week to recover dead larvae and record time
of death relative to infection point. All cadavers were cleaned with
water before they were individually placed in White traps and
incubated to evaluate nematode emergence. Nematode occurrence
was observed under the microscope every 2–3 days over a period
of 40 days and nematodes were counted for 5 days after the onset
of emergence. From each cadaver, the total number EPN or FLN
progeny was determined.
In the pathogenicity and scavenging behavior experiments, the
treatments (n = 24) were: (i) MG-67, (ii) MG-68 and (iii) control,
with alive or dead larvae as hosts, respectively. Five hundred
nematodes were added in a suspension, equivalent to 250 nema-
todes/cm2 per well (Campos-Herrera and Gutiérrez, 2009). Experi-
ments were performed as described above, with the exception of
the scavenging behavior experiments, in which cadavers were
recovered after 4 days of exposure to simulate the same incubation
time as in the soil-bait (Campos-Herrera et al., 2015). Larval
 R. Campos-Herrera et al. / Journal of Invertebrate Pathology 132 (2015) 216–227
mortality was assessed in the pathogenicity experiments, whereas
nematode reproduction was scored in the scavenging behavior
experiment. Both experiments were repeated at 3 different times
(72 larvae per treatment), with freshly produced nematodes and
hosts.
Based on the previous record of co-occurrence of the EPN spe-
cies and FLN described by Campos-Herrera et al. (2015), the EPN
species Steinernema kraussei (OS population) and Heterorhabditis
megidis (commercial, Andermatt Biocontrol AG) were selected to
evaluate the competition for the cadaver between the FLNs and
EPN. The two EPN species were cultured in G. mellonella larvae
(Woodring and Kaya, 1988), stored at 10 °C and used within
2 weeks of harvest. Two experiments were designed, one with a
low concentration of EPN (3 IJs per well each EPN species, equiva-
lent to 1.5 IJs/cm2) and another with a high concentration (20 IJs
per well each EPN species, equivalent to 10 IJs/cm2). We main-
tained the same concentration for the FLN, 500 nematodes per well
(equivalent to 250 nematodes/cm2), as described above. In each of
these two experiments, we prepared the following treatments
(n = 20): (i) control, (ii) MG-67, (iii) MG-68, (iv) H. megidis (Hm),
(v) S. kraussei (Sk), (vi) Hm and MG-67, (vii) Hm and MG-68, (viii)
Sk and MG-67, (ix) Sk and MG-68, and the EPN mixed infection
treatments: (x) Hm + Sk, (xi) Hm + Sk and MG-67, (xii) Hm + Sk
and MG-68 and (xiii) Hm + Sk and MG-67/MG-68. All the treat-
ments (alone and in combination) were inoculated at the same
time, in all cases before introducing the host. Experiments were
conducted as described above. Larval mortality, number of days
to kill the host, number of days from exposure until nematode
emergence, and number of IJs/FLN progeny were assessed for each
treatment. Both low and high EPN concentration experiments were
repeated at 2 different times (40 larvae per treatment), with
freshly produced nematodes and hosts.
Variables expressed as percentage (larval mortality, nematode
reproduction ability) were arcsine transformed and the quantita-
tive variables (days to kill, days to emerge, number of nematode
as progeny) were log (x + 1) transformed prior to the statistical
analysis by one-way ANOVA (SPSS 21.0, SPSS Statistics, SPSS Inc.,
Chicago, IL, USA). Spearman’s rank correlation coefficient (Spear-
man’s rho) evaluated the relationship between FLN and EPN pro-
duction per larvae in each treatment. All data are presented as
mean ± SEM of untransformed values.
2.3. Validating a system for Oscheius spp. quantification using real
time qPCR: design, optimization and specificity of primers and probe
development
Species–specific primers/probe sets for the three Oscheius spp.
defined by Felix et al. (2001) were designed following methods
described by Campos-Herrera et al. (2011a). Briefly, sequences of
the target nematode species and of closely related species were
retrieved from the NCBI database (http://www.ncbi.nlm.nih.gov/
Genbank/) in addition to the sequences corresponding to the iso-
lates included in this study. For each of the 3 Oscheius species,
we performed multiple alignments of the close related sequences
(Larkin et al., 2007). After selecting the areas of high variability
in the ITS region, the primers and probes were designed using
Primer–Blast (Rozen and Skaletsky, 2000; http://www.ncbi.nlm.nih.
gov/tools/primer-blast/). Species-specific primers and TaqManÒ
probes were synthetized by Eurofins (50 end with the fluorogenic
reporter dye FAM and the 30 end with the quencher BQH-1 for
the probes).
Because live material corresponding to the nematode Oscheius
sp.-3 was not available, we constructed a positive control by syn-
thesizing the whole sequence from GenBank accession number
AJ297890, isolate JU75 (GenScript, USA Inc.), which was trans-
formed as described above, producing plasmids containing the
219
target sequence used for further analysis. For the other two
Oscheius spp., positive controls were prepared by extracting three
independent aliquots of 300 nematodes each (Power SoilR DNA Iso-
lation Kit, MoBio) as described above. Similarly to the standard curve
established for Acrobeloides-group (Campos-Herrera et al., 2012), we
adjusted to 1 ng/lL the DNA extractions of each Oscheius isolate
whereas we employed 0.1 ng/lL for the plasmid DNA. For the stan-
dard curves, serial dilutions were established (1 ng/lL to 0.1 pg/lL
for the genomic DNA and 0.1 ng/lL to 0.01 pg/lL for the plasmid).
For the cross-amplification checks and optimization protocols,
in addition to the six isolates of Oscheius spp. available as living
material and the plasmid corresponding to Oscheius sp.-3, we
employed the DNA corresponding to 17 EPNs species and the
FLN Acrobeloides-group described by Campos-Herrera et al.
(2015) either as 100 IJs or 0.1 ng/lL in the case of plasmid use, if
live material was not available. Conventional PCR reactions were
performed as described by Campos-Herrera et al. (2015), and
optimal temperature matched with later qPCR experiments. Tests
performed in real–time PCR employed 100–well gene discs (Bio-
labo, scientific instruments, Switzerland) reaction plates on the
Corbett Research real-time PCR. SYBR Green I (KAPA SYBR Green
Fast qPCR kit universal master-mix, manufactured by Labgene,
Switzerland) was used to identify possible primer-dimer forma-
tions and check cross-amplifications with the use of just the set
of species-specific primers. For the 3 sets of primers/probe we
optimized reactions by primers concentrations (250 nM, 300 nM,
and 400 nM), probe concentration (100 nM, and 200 nM), and final
volume (15 and 10 lL). Annealing temperature was also adjusted
for the new conditions by checking reaction dynamics at 66, 64,
61, and 59 °C. In each run, 1 lL of sample/control (mQ water) was
employed, with two technical replicates per point. In each check,
all tested FLN and EPN were included using the concentration
described above. The thermal cycling comprised 2 min at 60 °C and
5 min at 95 °C, followed by 36 cycles of 95 °C for 5 s and the adjusted
temperature per organism for 50 s. Standard curve of each
nematode/primer-probe combination described the efficiency and
accuracy of the molecular tools by linear regressions of log (quanti-
ties) and threshold cycle value (Ct) (SPSS 21.0, P 6 0.05).
2.4. Evaluating nematode competition in the field: quantification of the
relative co-occurrence of Oscheius spp. and entomopathogenic
nematodes in insect baits
Aliquots of nematode progeny from the cadavers from original
soil baits (OG samples) and from the Koch’s postulates (MG sam-
ples) described above were extracted using the QIAamp DNA mini
kit. After DNA quality and quantity verification (nanodrop system),
samples were diluted to 0.5–1 ng/lL (Campos-Herrera et al., 2015).
For each of the cadavers producing nematode progeny, real-time
qPCR were run for the 3 Oscheius spp., the Acrobeloides-group and
the six EPN detected in the soil of these field experiments: Stein-
ernema feltiae, Steinernema carpocapsae, Steinernema kraussei–
silvaticum, Steinernema affine, Heterorhabditis bacteriophora and
H. megidis (Campos-Herrera et al., 2015). We combined the data
corresponding to all the larvae from both field experiments to ana-
lyze the nematode progeny emerging from OG and MG larvae. Quan-
tification of the relative emergence was evaluated by using the Ct
value. Because a low Ct value is an indicator of high concentration
and vice versa, to obtain a proxy of relative quantity per nematode
species in each of the cadaver we subtracted the total number of
cycles during the qPCR program (n = 36) to the final Ct value. Then,
we established the frequency of cadaver occurrence with different
degrees of nematode progeny: only EPN (100%), majority EPN (99–
70%), equivalent production (69–30%), displaced by FLN (29–1%),
only FLN production (0%). For each of the categories, we also pro-
vided the general proportional species composition.
220 R. Campos-Herrera et al. / Journal of Invertebrate Pathology 132 (2015) 216–227
2.5. Natural occurrence of Oscheius spp. and their association with
multiple guilds in tillage soils
Soil samples from each of the 30-year old Swiss field experi-
ments were extracted using the sucrose centrifugation method
(Jenkins, 1964) to provide information on the EPN soil food web
assemblages at the two sampling times (see detailed descriptions
of the experiments and methods in Campos-Herrera et al., 2015).
The data corresponding to the EPN, Acrobeloides-group and nema-
tophagous fungi (NF) quantification were analyzed in the context
of the natural occurrence of Oscheius spp. For this purpose, we ana-
lyzed the same DNA samples extracted from the soil samples
described in Campos-Herrera et al. (2015) with the 3 new sets of
primers and probe for Oscheius spp. The quantification of each of
the Oscheius spp. was individually analyzed using a linear model
following step wise procedure and a rank transformation for not
normally distributed data set (package GenABEL, R 3.0.2, CRAN,
2014), as described by Campos-Herrera et al. (2015). The experi-
ment referred to as P20 tested the following factors: (i) tillage (reg-
ular versus light), (ii) culture (monoculture versus crop rotation),
and (iii) sampling season (spring versus autumn). The experiment
referred to as P29 evaluated the treatments: (i) tillage (standard
tillage, 20–25 cm depth: T; light tillage, 12–15 cm: W15; minor
tillage, 5–8 cm: W8; and direct planting: no till, SD), (ii) soil type
(clay: CA; clay loam: CL), and (iii) sampling season (spring versus
autumn). Spearman’s rho correlation coefficient (r) was used to
measure the strength of relationships between selected organisms
in each of the experiments (SPSS 21.0). All data are presented as
mean ± SEM of untransformed values.
3. Results
3.1. Isolation, molecular identification and phylogenetic analysis based
on ITS and SSU rDNA regions
Based on the molecular and morphological data, the isolates
were identified as O. onirici (MG-67 and MG-69) and O. tipulae
(MG-68) (Félix et al., 2001; Félix, 2006; Torrini et al., 2015). The
ITS rDNA sequences of both species were clustered in the Tipu-
lae-subgroup, belonging to Dolichura-group (Fig. 1), demonstrating
100–99% similarity to the reference species in GenBank. A similarly
consistent phylogenetic assemblage was obtained for the SSU
rDNA sequences analysis (Supplementary material 1).
3.2. Laboratory studies on Oscheius spp. biology: pathogenicity,
scavenging behavior and competition for the cadavers with
entomopathogenic nematodes
None of the two Oscheius spp. isolates alone caused mortality to
the G. mellonella larvae in the pathogenicity experiment. However,
both nematodes successfully reproduced in frozen-killed insect
cadavers (P < 0.001), with similar percentage of scavenger activity,
65 ± 4.01% for O. onirici MG-67 and 64 ± 4.03% for O. tipulae MG-68.
In the competition experiments with 3 IJs, only treatments with
addition of EPN caused larval mortality, confirming the previous
results on the pathogenicity experiment. Similar larval mortality
percentage (Supplementary material 2A–C) and the number of
days required to kill the host (Supplementary material 2D–F)
resulted in treatments with few EPNs, independently of the pres-
ence of Oscheius spp. The number of days to complete the life cycle
starting from exposure did not differ between treatments with EPN
and FLN combined and treatments with a single EPN species (Sup-
plementary material 2G–H). It only showed a slight difference
(prolonged killing time) when the two EPN species were combined
simultaneously with Oscheius spp. (P = 0.048, Supplementary
material 2I). Both Oscheius spp. reduced the IJ production
(Fig. 2A–C), with a significant reduction of S. kraussei production
when combined with any of the two Oscheius spp. (P = 0.006,
Fig. 2B), or when S. kraussei was also in combination with H. megi-
dis (P = 0.046, Fig. 2C). The impact of O. onirici on EPN production
was particularly strong (Fig. 2A–C). The strongest impact was on
S. kraussei reproduction, with 50% fewer IJ emerging per larvae.
Interestingly, for the EPN mixed infection (Sk + Hm + Ooni), with
most of the hosts presumably killed by S. kraussei, the number of
IJs was less than 50% than what emerged from cadavers with only
S. kraussei treatments (Fig. 2C). Significant inverse relationships
between the number of EPN IJs and Oscheius spp. were recorded
for the treatments with S. kraussei (Spearman’s rho = 0.579,
P = 0.003) and the EPN mix (Spearman’s rho = 0.578, P = <0.001)
and marginally significant in H. megidis treatments (Spearman’s
rho = 0.246, P = 0.076), supporting the observation of the higher
EPN IJs production, the lower FLN progeny and vice versa.
The results for the experiment with higher EPN numbers were
similar. Percent larval mortality (Supplementary material 3A–C)
and days required to kill the host (Supplementary material 3G–I)
were not significantly affected by the addition of Oscheius spp.
The only exception was the EPN mix treatments, which resulted
in higher mortalities for combinations with Oscheius spp.
(P = 0.008, Supplementary material 3C). Also, the number of days
to emerge ranged from 22 to 27, with no significant differences
among the treatment groups (Supplementary material 3G–I). In
this experiment, the impact of the Oscheius spp. presence on the
total IJs production was minimal (Fig. 2D–F), with only a significant
reduction if mixed EPN were combined with Oscheius spp.
(P = 0.005, Fig. 2F). In proportion, the EPN IJs production over the
total nematode progeny per cadaver significantly decreased when
H. megidis was combined with O. onirici (P = 0.028), and when S.
kraussei or EPN mix were combined with either of the Oscheius
spp. (P < 0.001). When the EPNs were singly inoculated with
Oscheius spp. in a high concentration, the proportion of EPN
progeny increased compared with that in the low concentration
experiment, reaching 91% in H. megidis-O. onirici (Fig. 2D) and val-
ues >43% in S. kraussei. Interestingly, in the EPN-mix treatments,
the proportion of EPN IJs production was significantly lower for
the high EPN concentration experiment (Fig. 2F) compared to the
low EPN experiment (Fig. 2C). The fact that most of the cadavers
producing progeny in the high-EPN treatment were most likely
associated with S. kraussei as main killing-agent might explain
the low numbers. Significant inverse relationships between the
number of EPN IJs production and the Oscheius spp. numbers were
also confirmed in the high EPN numbers application experiments
(H. megidis Spearman’s rho = -0.323, P = 0.001; S. kraussei Spear-
man’s rho = 0.235, P = 0.030; EPN mix Spearman’s rho = 0.467,
P < 0.001).
3.3. Validating a system for Oscheius spp. quantification using real
time qPCR: design, optimization and specificity of primers and probe
development
Three sets of primers and probes (Table 1) were developed for
Oscheius spp. in the Tipulae-subgroup, Dolichura-group (Félix,
2006). By using conventional PCR, primers for Oscheius sp.-3 only
amplified the target DNA, whereas for O. onirici some almost unde-
tectable bands were observed for a few non-target species (Supple-
mentary material 4). Primers designed for O. tipulae amplified also
DNA from Oscheius sp.-3 with the same intensity. When the
primers were tested using SYBR Green fluorescence in qPCR exper-
iments, we found unspecific amplifications for several species at
the late cycles, in most of the cases above cycle 30, suggesting high
resolution of the primers amplification using qPCR or/and possible
minimal unadvertised presence of these nematodes in the cultures.
 R. Campos-Herrera et al. / Journal of Invertebrate Pathology 132 (2015) 216–227 221

Fig. 1. Phylogenetic relationships of the species in the genus ‘‘Oscheius” based on analysis of ITS rDNA regions. Pellioditis mediterranea, P. marina, Heterorhabditis downesi and
H. bacteriophora were used as outgroup taxa. The percentage of replicate trees in which the associated taxa clustered together in the bootstrap test (10,000 replicates) is
shown next to the branches. Branch lengths indicate evolutionary distances and are in the units of the number of base differences per site.

In agreement with the bands observed in conventional PCR, pri-
mers developed for O. tipulae did amplify Ocheius sp.-3 (Supple-
mentary material 4). TaqMan probes significantly improved the
specificity in the qPCR assays. We only detected the target species
(Supplementary material 4), with some exceptions, in which we
observed a late amplification (>33 cycle), and hence, with a low
likelihood of detecting non-target species with this primer/probe
combination, as reported previously for other systems (Campos-
Herrera et al. 2011b, 2015).
3.4. Evaluating nematode competition in the field: quantification of the
relative co-occurrence of Oscheius spp. and EPNs in insect baits
All the cadavers recovered from soil baiting contained FLN or a
mixture of EPN and FLN (Fig. 3). None produced only EPN, and we
only observed one mixed EPN infection in which the majority of
progeny corresponded with EPN in the insects from the soil bait
(OG, Fig. 3A). The EPN H. megidis was encountered in cadavers with
a majority of EPN (99–70% EPN) or when the production of both
nematodes was similar (69–30% EPN), whereas S. kraussei–
silvaticum (molecular analyses cannot establish the difference
between S. kraussei and S. silvaticum, so we refer to both, see
Campos-Herrera et al., 2015) was detected in those mixes in which
FLN were dominant (29–1% EPN). Similarly, Acrobeloides–group
was only encountered when FLN were dominant or evenly dis-
tributed. After Koch’s postulate evaluation, very few cadavers pro-
duced subsequent nematode progeny (MG, Fig. 3B), suggesting
that the high proportion of the FLN in these progenies could have
been the limiting factor, as showed in our controlled laboratory
experiments. Interestingly, Acrobeloides-group was not detected
in any of the MG cadavers (Fig. 3B), whereas both Oscheius spp.
were established in all the cadavers-producing nematodes, except
in one case with just one Oscheius sp. (data not shown). Mixed EPN
infection was only detected in one case in the MG cadavers.
3.5. Natural occurrence of Oscheius spp. and their associations with
multiple guilds in tillage soils
Only O. onirici and O. tipulae were detected in the soil samples
from P20 and P29. In both cases, O. tipulae was more than two
orders of magnitude more numerous than O. onirici. In the experi-
ment P20, Oscheius spp. was not affected by sampling time or til-
lage management (Table 2), but both species were affected by
the type of culture, with higher quantities in the monoculture
(Fig. 4). There was an interactive effect of tillage management
and sampling time for the two Oscheius spp. (Table 2), each show-
ing the same pattern of higher numbers in October in non-till soils,
whereas similar quantities occurred at both sampling times in the
tilled treatment. A similar situation was observed for O. tipulae
and the crop rotation treatment, with higher values in October in
the monoculture and opposite trend in the crop rotation (Table 2).
In the P29 experiment, neither of the two Oscheius spp. were
affected by the soil type (Table 2), whereas numbers of O. tipulae
was slightly higher in October than in April (Fig. 5A and Table 2).
Tillage affected the presence of both Oscheius spp. similarly
(Table 2 and Fig. 5B). None of the interactions were significant
(Table 2).
The occurrence of the Oscheius spp. was not associated with EPN
presence in either of the two field experiments (Table 3), and only
O. tipulae was slightly associated with the NF in P20 (P < 0.1). Both
Oscheius spp. were associated with Acrobeloides-group (P < 0.1–
0.01) and the number of cadavers producing nematode progeny
222 R. Campos-Herrera et al. / Journal of Invertebrate Pathology 132 (2015) 216–227

H. megidis S. kraussei H. megidis+ S. kraussei Oscheius spp.

Experiment with low concentration of entomopathogenic nematodes (3 IJs per well)

A B C
al numberof IJ s/larvae

2,00,000

al numberof IJ s/larvae
2,00,000 2,00,000

Total numberof IJ ss/larvae

1,60,000 1,60,000 1,60,000
a
1,20,000 1,20,000 1,20,000

80,000 80,000
ab ab
a 80,000
b
40,000 40,000
Tota

40,000
,

Tota
b b
0 0 0
Hm Hm + Ooni Hm + Otip Sk Sk + Ooni Sk + Otip Hm + Sk Hm + Sk + Hm + Sk + Hm + Sk +
Color Color Ooni Otip Ooni/Otip
Color
displayed displayed displayed
b cadaver
by d by cadaver d
b cadaver
by

Experiment with high concentration of entomopathogenic nematodes (20 IJs per well)
D E F
Total number of IJs/larvae

Total number of IJs/larvae

Total number of IJs/larvae

2,00,000 2,00,000 2,00,000

1,60,000 1,60,000 1,60,000

1,20,000
,, 1,20,000 1,20,000

80,000 a
80,000 80,000 ab
40,000
b
40,000 40,000 b
0 0 0
Hm Hm + Ooni Hm + Otip Sk Sk + Ooni Sk + Otip Hm + Sk Hm + Sk + Hm + Sk + Hm + Sk +
Ooni Otip Ooni/Otip
Color Color Color
displayed displayed displayed
by cadaver by cadaver by cadaver

Fig. 2. Competition experiments between entomopathogenic nematodes (EPNs) and Oscheius spp. A–C. Addition of 3 infective juvenile (IJs) of either Heterorhabditis megidis
(Hm) or/and Steinernema kraussei (Sk) alone or in combination with Oscheius onirici (Ooni) or/and Oscheius tipulae (Otip). D–F. Addition of 20 infective juvenile (IJs) of either H.
megidis (Hm) or/and S. kraussei (Sk) alone or in combination with O. onirici (Ooni) or/and O. tipulae (Otip). For each treatment we present in pie graphs above each bar the
proportion of EPN and FLN over the total progeny per cadaver. Additionally, the putative identity of each of the cadaver defined by color (red, H. megidis; dark brown, S.
kraussei) is shown in pie graphs below the corresponding treatment in axe ‘‘x”. One-way ANOVA tested differences among treatments of the same EPN species combination
(P < 0.05). Data are average ± SEM. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

Table 1
Specific primers and TaqManÒ probes for detecting three species of Oscheius in the Dolichura-group (Félix et al., 2001; Torrini et al., 2015), with the PCR product size and details for
the qPCR protocols.

Species Primers and probe (50 –30 ) PCR product size (bp) Annealing temperature (°C) Primers/probe concentration (mM)
O. tipulae (Otip) F: ATGGCTGGCTATATGAGCTTTC 177 66 250/100
R: AAGGAAGCAACCGATCAATCC
P: FAM-AGTCCTTTGTGACTAGCGGCT-BHQ-1
O. onirici (Ooni) F: GGCTATGGCAGGGCCTATTT 179 59 400/200
R: CTACACCACAAGGGCAACCA
P: FAM-GCGAGAGCTTAACTGCACTGCCA-BHQ-1
Oscheius sp. 3 (Os_3) F: GACTCGCTGATTGTCG 140 64 250/100
R:CCAGTCACACAGAGGAGACC
P: FAM-CGAAACTGCCTGATGTTTCA-BHQ-1

(P < 0.05) in P20 (Table 3), as was O. tipulae and the cadavers pro- under similar conditions. The new species-specific primers/probe
ducing nematodes in P29 (P < 0.05, Table 3). sets can also be employed with others developed for EPN, FLN in
the Acrobeloides-group, NF and the phoretically associated bacteria
4. Discussion in the genus Paenibacillus to evaluate their contribution to soil
food web assemblage as we seek key drivers of EPN activity and
For the first time the effect of FLN and EPN mixed infection on persistence.
the nematode progeny from a cadaver have been accurately quan- Members of the genus Oscheius are easily isolated from soil
tified, revealing strong intraguild competition for this resource. The samples (Félix et al., 2001). In order of dominance, O. tipulae is
molecular tool-kits developed in this study provide a powerful way the most common species of the Tipulae-subgroup (Félix et al.,
to evaluate the impact of the FLN on EPN fitness in cadavers recov- 2001; Baille et al., 2008), followed by O. onirici (reported as
ered from the field or soil baits. This molecular approach can be Oscheius sp.-2 by Félix et al., 2001) and the less frequent Oscheius
extended to other FLNs also concomitantly detected with EPN sp.-3 (Félix et al., 2001; Félix, 2006). In agreement with these
 R. Campos-Herrera et al. / Journal of Invertebrate Pathology 132 (2015) 216–227 223

O. onirici
.000300
A ***
A

0 g dry soil
14 .000250
meber of OG producing

12
.000200
nematode prrogeny

10

ng DNA/100
.000150
8
6 .000100

4 .000050
Num

2
.000000
0 Monoculture Crop rotation
EPN 100% EPN 99-70% EPN 69-30% EPN 29-1% EPN 0%
FLN 0% FLN 1-29% FLN 30-69% FLN 70-99% FLN 100%

.0250 O. tipulae
B
***

ng DNA/100 g dry soil

.0200
4 B
G producing

.0150
nematode progeny

3
.0100
umeber of MG

2
.0050
1
.0000
Nu

0 Monoculture Crop rotation

EPN 100% EPN 99-70% EPN 69-30% EPN 29-1%
FLN 0% FLN 1-29% FLN 30-69% FLN 70-99%
Fig. 3. Frequency of cadaver producing nematode progeny in the following
categories: only EPN (100%), majority EPN (99–70%), evenly produced (69–30%),
displaced by FLN (29–1%), only FLN production (0%). A. Cadavers from original
Galleria mellonella baited in the soil (OG). B. Cadavers from Koch’s postulates,
multiplication (MG). Above each bar, the average species composition is propor-
tionally dispatched as pie-chart, with species names as follow: Steinernema
kraussei-silvaticum (Sk), Heterorhabditis megidis (Hm), Oscheius tipulae (Otip),
Oscheius onirici (Ooni) and Acrobeloides-group (Acrob).
occurrence records, we only isolated O. tipulae and O. onirici,
whereas Oscheius sp.-3 was not detected yet in any of our Swiss
soils. Our phylogenetic analysis of the ITS and SSU rDNA regions
placed the Swiss isolates together with the corresponding isolates
from each reference species in the Tipulae-subgroup of the Doli-
chura-group (Félix et al., 2001; Félix, 2006; Torrini et al., 2015).
In agreement with our first hypothesis, Swiss isolates of
O. tipulae and O. onirici behaved as scavengers rather than ento-
mopathogens. None of the isolates were able to kill G. mellonella
larvae but could reproduce in frozen-killed Galleria-cadavers. The
fact that nematodes wait for the insect to die and use cadavers
as a resource has been named ‘‘necromeny” (Sudhaus and
Schulte, 1989), and hence, we consider that our isolates of both
species have a scavenger and possibly necromenic relationship
with the insect. In the case of O. tipulae, this scavenger behavior
EPN 0%
FLN 100%
Fig. 4. Natural occurrence of Oscheius spp. in monoculture or crop rotation plots
(field experiment P20). (A) Ocheius onirici. (B) Oscheius tipulae. Analysis performed
by linear mode following step wise procedure (P < 0.001, ⁄⁄⁄). Data are shown as
means ± SEM.
might be the explanation for its sporadic occurrence associated
with cadavers. In fact, the species name makes reference to the
dipteran larvae from the genus Tipula, from which it was originally
isolated, and for which the relationship was described as an exam-
ple of necromeny (Sudhaus, 1993). Contrary to our results, the
Italian isolate of O. onirici, recently discovered in a karstic cave,
was postulated as an entomopathogen after the study of pathogenic-
ity against larvae of G. mellonella and T. molitor, which produced 46%
and 58% larval mortality, respectively, with a lethal time LT50 above
5 days in both cases (Torrini et al., 2015). Considering the main
criteria that Dillman et al. (2012) recently defined to discriminate
between entomopathogenic and other nematode-insect relation-
ships, the time that this Italian O. onirici isolate required to kill
the hosts was above the limit (established as less than 5 days),
but it also remains to be determined if there is a mutualistic-
symbiotic relationship with pathogenic bacteria. According to
Dillman et al. (2012), a true entomopathogen should have bacteria
involved in the pathogenesis, which should be maintained over
subsequent generations, even if this relationship is facultative.
Because necromeny can be considered as to be the evolutionary

Table 2
Statistical analysis of the natural occurrence of the organisms (in 100 g of dry soil) detected by qPCR in the soils from the two field experiments (P20 and P29).

P20 Tillage (T) Crop rotation (CR) Period (P) T ⁄ CR CR ⁄ P T⁄P T ⁄ CR ⁄ P

⁄⁄⁄
O. onirici n.s. 38.6 31 n.s. n.s. 10.9⁄⁄
31 5.2⁄31 n.s.
⁄⁄⁄ ⁄⁄
O. tipulae n.s. 27.5 31 n.s. n.s. 15.531 n.s. n.s.
P29 Tillage (T) Soil type (S) Period (P) T⁄S S⁄P T⁄P T⁄S⁄P
O. onirici 2.9 ⁄52 n.s. n.s. n.s. n.s. n.s. n.s.
O. tipulae 2.9 ⁄52 n.s. 6.2 ⁄52 n.s. n.s. n.s. n.s.

Data are presented as Fdf, and probability levels: ⁄ P < 0.05, ⁄⁄

P < 0.01, ⁄⁄⁄
P < 0.001, n.s., no significant.
224 R. Campos-Herrera et al. / Journal of Invertebrate Pathology 132 (2015) 216–227

.0025 A .0025 B *
*
ng DNA/100 g dry soil
.0020 .0020

ng DNA/100 g dry soil

.0015 .0015

.0010 .0010

.0005 .0005

.0000 .0000
April October T W15 W8 SD

Fig. 5. Natural occurrence of Ocheius tipulae in the field experiment P29. (A) Sampling time. (B) Gradient of tillage in the field experiment: (i) standard tillage 20–25 cm depth
(T), (ii) light tillage 12–15 cm (W15), (iii) minor tillage 5–8 cm (W8), and (iv) direct planting (no till, SD). Analysis performed by linear mode following step wise procedure
(P < 0.05, ⁄). Data are shown as means ± SEM.

Table 3
Spearman’s Rho correlation analysis for two Oscheius spp. detected in the field experiments (P20 and P29).

O. onirici O. tipulae Total EPN Total NF Acrobeloides-group G. mellonella-activity

P20
O. onirici – 0.876⁄⁄⁄ n.s. n.s. 0.661⁄⁄ 0.425⁄
O. tipulae – n.s. 0.387° 0.373° 0.450⁄
P29
O. onirici – 0.286° n.s. n.s. n.s. n.s.
O. tipulae – n.s. n.s. n.s. 0.324⁄

Probability levels: ° P < 0.10, ⁄ P < 0.05, ⁄⁄

P < 0.01, ⁄⁄⁄
P < 0.001, n.s., no significant.

stage preceding parasitism or entomopathogeny (Dillman et al., et al., 2001; Stock et al., 2004), require at least one female and one
2012), it could explain why some members of the Oscheius genus male to complete a life cycle. In the low concentration competition
are considered to be true entomopathogens and the status of experiment (3 IJs/well) the EPN S. kraussei showed a greatly
others is still being discussed. The transition between necromeny decreased ability to reproduce. By increasing its concentration
and entomopathogeny might evolve at different rates for popula- (20 IJs/well) we overcame the FLN competition, which greatly
tions of the same species, so that isolates from distant areas with increased proportion of IJs that were produced.
divergent natural histories could behave as necromenics and In general, our experimental data suggest that the intraguild
others as nascent stages of entomopathogeny. competition EPN-FLN might be species dependent. These observa-
Our study on the competition between two EPN species and the tions are in agreement with the species-specific competition
two Oscheius spp. aimed to explain the intricacies of the intraguild observed for the EPN species S. riobrave, which shows a reduction
interaction revealed in a previous study (Campos-Herrera et al., in IJs production when combined with the FLN Pellioditis sp.
2015). In general, none of the typical variables used in the (Duncan et al., 2003), but no effect when exposed together with
pathogenicity experiments (i.e. larval mortality, time to kill the lar- A. maximum or R. rainai (Campos-Herrera et al., 2012). Our exper-
vae and time to complete the life cycle) resulted in significantly iments differed in some procedures (i.e. host species, concentra-
different when compared EPN-Oscheius treatments with the corre- tion, arenas) with those reported by Duncan et al. (2003) and
sponding EPN-single application treatment. These results are in Campos-Herrera et al. (2012), and therefore comparisons should
agreement with the trends observed in two previous reports be made with caution. Yet, in each case it is evident that different
(Duncan et al., 2003; Campos-Herrera et al., 2012). Host mortality EPN species may have abilities to overcome the competition for the
did not differ from the EPN-single application when Steinernema cadaver with certain FLN.
riobrave, Steinernema diaprepesi or Heterorhabditis indica were com- Because in our preliminary study we observed that some of the
bined with other FLNs, Acrobeloides maximum and Rhabditis rainai cadavers produced a mixed progeny containing two EPN species in
(Campos-Herrera et al., 2012). Similarly, host mortality was not combination with FLN (Campos-Herrera et al., 2015), we also
affected when S. diaprepesi was combined with Pellioditis sp. explored whether this mixed infection could affect the outcome
(Duncan et al., 2003). Only S. riobrave combined with Pellioditis of EPN reproduction. We expected that the FLN would take the
sp. registered an increment of the larval mortality when both were advantage of the addition interspecific competition between two
combined (Duncan et al., 2003). Reduced EPN reproduction was EPN species and it would limit the final IJs production. This
the main trade-off observed for the co-occurrence of both types hypothesis was not confirmed and, similar to single EPN applica-
of nematodes, especially in the case of S. kraussei at low concentra- tion treatments, the larvae were killed and produced new progeny
tion (3 IJs/well). Therefore, in agreement with our second hypoth- in about the same quantity and time than when exposed to only H.
esis, cadavers produced by few EPN favored Oscheius spp. megidis-S. kraussei application or their combination with FLN.
reproduction, but with some exceptions. For example, H. megidis Interestingly, under our experimental conditions, H. megidis was
tended to overcome the competition with the two Oscheius spp., a poor competitor when exposed simultaneously with S. kraussei,
even at just 3 IJs per well. One plausible explanation for the higher recording only even number of cadavers potentially infected by
competitive ability of H. megidis is that heterorhabditids have self- each of the EPN species in the low concentration experiment
fertilized hermaphrodites as adults in the first generation (Adams (3 IJs/well). The bias in the initial identity of the EPN in the cadaver
and Nguyen, 2002; Stock, 2015). On the contrary, all the steinerne- drove the final reproduction, explaining the reduction of the total
matids, with the exception of Steinernema hermaphroditum (Griffin IJs. Alatorre-Rosas and Kaya (1990) also observed interspecific
 R. Campos-Herrera et al. / Journal of Invertebrate Pathology 132 (2015) 216–227
differences in reproduction and establishment when nematodes
were applied simultaneously, with another heterorhabditid nema-
tode, which resulted weaker competitor than Steinernema. In the
Alatorre-Rosas and Kaya (1990) study, co-infection of Heterorhab-
ditis and Steinernema resulted in the death of the host insect but
also of the nematodes. However, Půža and Mráček (2009) showed
that certain steinernematid species can co-infect the same larvae
and produce a mixed progeny, although the ratio of production will
depend on various factors such as the time of arrival at the host,
concentration of both nematodes, etc. In addition to this dual-
infection complexity, EPN can act also as scavengers, being able
to successfully develop in cadavers of various insect species (San
Blas and Gowen, 2008; Půža and Mráček 2010). One question still
to be resolved is whether EPN will compete with the FLN in the
same manner when the available insect is dead before their arrival.
Our hypothesis is that in this cadaver-scenario, EPN might have
lost the advantage of the bacteria to produce certain compounds
to protect the cadaver and hence, the intraguild competition for
the cadaver will be more aggressive. Ongoing experiments are
focused on the role of the bacteria in the interaction of the FLN
and EPN.
Molecular approaches have contributed to our understanding of
FLN biology and ecology, in particular to distinguish cryptic and
closely related species for which morphological characters are, in
most of the cases, insufficient or show overlaps. Approaches such
as those proposed by Félix et al. (2001) provided clean distinctive
identities for closely related Oscheius spp., allowing the quick
screening of numerous isolates using DNA analyses. However,
samples that potentially contain two or more species would bene-
fit from the use of more precise species-specific primers. As the
pioneering work of Jones et al. (2006a) shows, qPCR analyses can
be used to identify several FLN groups and help to study target
FLN in different ecological scenarios (Jones et al., 2006b). Still, this
approach requires a morphological pre-selection of the individuals
and the available molecular tools cannot yet cover all target spe-
cies (Campos-Herrera et al., 2012). Species-specific primers have
also been valuable to study the competition between the two close
related species Caenorhabditis elegans and Caenorhabditis briggsae
(Barriere and Félix, 2005; Félix and Duveau, 2012), or to elucidate
the ecology and evolution of cryptic marine nematode species
(Derycke et al., 2012). In all cases, these experiments were run in
relatively clean systems and were not used for identifying and quan-
tifying target organisms from complex mixtures such as soil. The
first set of primers/probe that allowed these studies were designed
for Acrobeloides-group (Campos-Herrera et al., 2012). It provided a
fast, accurate and reliable system to be linked to other components
of the EPN soil food web, and revealed the spatial association
between these nematodes and EPN. The study presented herein
extends the repertoire of species-specific primers/probe for other
FLN related with EPN, with the first molecular tools that are
species-specific for the Oscheius spp. in the Tipulae-subgroup. In
agreement with known phylogenetic relationships (Félix et al.,
2001; Félix, 2006), cross-amplifications was recorded with conven-
tional PCR when using the primers for O. tipulae and the DNA from
the nematode Oscheius sp.-3. Although these amplifications
increased when using SYBR Green chemistry, the third level of speci-
ficity provided by TaqMan probes mostly resolved these cross-
amplifications. The few late unspecific amplifications (>34 cycle)
that were detected when testing primers/probe for O. tipulae would
require quantities of DNA four orders of magnitude higher than for
the positive control. Therefore, the likelihood of detecting the wrong
species with this primer/probe combination under the conditions
that we used is very low (Campos-Herrera et al. 2011b, 2015). More-
over, by using the strategy described by Campos-Herrera et al.
(2012) we produced reliable and accurate quantification with stan-
dard curves based on the serial dilution of DNA.
225
The molecular method enhanced the resolution in the identifi-
cation and quantification as compared to traditional methods
(Duncan et al., 2003, 2007). Interestingly, all the cadavers from
the original baited-cadavers contained one or more FLN
(Acrobeloides-group, O. tipulae, or/and O. onirici) and also two EPN
species in a few cases. However, in the subsequent multiplication,
only Ocheius spp. persisted in cultures in combination with EPN
species. Campos-Herrera et al. (2012) allowed A. maximum to
establish in the arena with the insect one week prior to EPN inoc-
ulation. It is possible that A. maximum requires a pre-application in
order to successfully compete with EPN for a cadaver, whereas
Oscheius spp. can fight for the resource when it is simultaneously
applied with the EPN. Laboratory experiments using A. maximum
in a similar approach as used in this study are needed to better
understand the nature of the relationship between these two FLN
species and EPN. In all the cadaver progeny, FLN were the majority
of the nematode production, with only one exception for the orig-
inal cadavers. These results demonstrate the strong intraguild
competition between FLN and EPN in the insect baited in the soil,
and they could be used as indirect indicators of the possible natural
dynamics that occur in soils. In fact, very low numbers of EPN were
detected in the corresponding soil samples (Campos-Herrera et al.,
2015), which is in agreement with our experimental results show-
ing that Oscheius spp. was favored when low EPN numbers were
present. Also, in agreement with our hypothesis on the natural dis-
tribution, the natural occurrence of Oscheius spp. in the soil fol-
lowed a trend similar to that observed for Acrobeloides-group, in
particular, in the field experiment P20. More nematodes were
detected in monoculture plots than in those under crop rotation
(field experiment P20, P < 0.001) (Campos-Herrera et al., 2015)
and the presence of the three nematode species was positively cor-
related. Similarly, in the field experiment P29 with different
degrees of tillage in two soil types, more Oscheius spp. nematodes
were detected in the clay soil, but the difference was not signifi-
cant. Tillage also affected O. tipulae distribution, but the pattern
was not clear, as also observed for Acrobeloides-group (Campos-
Herrera et al., 2015). Interestingly, the occurrence of Oscheius
spp. was positively correlated with G. mellonella-mortality, hence,
the cadavers producing nematode progeny in each soil samples.
This positive relationship reinforces the link between Oscheius
spp. and EPN. It is possible that these FLN can use chemical cues
indicative of EPN-infection to locate a new possible EPN-cadaver,
the same way that Acrobeloides-group do (Ali et al., 2013). Studies
on the response to selected chemical cues such as herbivore-
induced plant volatiles used by EPN to oriented toward a new
victim (Rasmann et al., 2005; Ali et al., 2010, 2012) can help to under-
stand the complex belowground dynamics that affect EPN efficacy,
persistence and long-term occurrence under natural conditions.
The impact of the FLN as possible competitors that cause EPN
displacement in the cadaver has to be considered in furthering
the understanding of EPN population dynamics and efficacy. For
example, intraguild competition between FLN and EPN has poten-
tially important implications for conservation biological control
approaches, where biotic and abiotic factors may impact how
native EPN species are distributed in the soil. If these factors are
well understood, soils with naturally low numbers of EPN can pos-
sibly be modified to enhance their activity and presence, but at the
same time consider avoiding simultaneous increase in FLN com-
petitors. It may also facilitate the selection of the right EPN species,
which is critical for augmentation biological control (Duncan et al.
2003, 2007).
This study also suggests that in the past our understanding of
the natural distribution of EPN, as monitored by insect-bait might
have been masked by the presence of FLN in the same way that the
co-infection of two or more EPN species in the same cadaver might
go unnoticed. The combination of using the qPCR tool-kit for the
226 R. Campos-Herrera et al. / Journal of Invertebrate Pathology 132 (2015) 216–227
simultaneous study of EPN, FLN and other members of the EPN soil
food web are now providing new insights into the complex inter-
actions in the soil. Further studies on the impact of this intraguild
competition in natural systems are needed to advance our under-
standing of EPN ecology as well as to identify key players and abi-
otic factors that can be modified for enhanced survival and activity
of the naturally occurring EPN.
Acknowledgments
The authors are grateful for the help provided by Dr. C. Praz and
different members of the FARCE and E-Vol in the molecular biology
laboratory. We also thank the members of the Soil and Vegetation
laboratory for sharing their equipment and installations during the
processing of the samples. We further thank Marie Anne Félix for
kindly sharing her Oscheius isolates and to Monique Rivera for
the revision of the English in the final version. This study was sup-
ported by the NRP68 program ‘‘Sustainable use of soil as a
resource” (Project No. 143065), Swiss National Science Foundation.
G.J. was supported by a PhD assistantship from the University of
Neuchâtel (Switzerland). R.C.R. was awarded with the grant
SF-PD-2012-12-31-0422 from the Research Council of Lithuania.
Appendix A. Supplementary material
Supplementary data associated with this article can be found, in
the online version, at http://dx.doi.org/10.1016/j.jip.2015.10.007.
References
Adams, B.J., Nguyen, K.B., 2002. Taxonomy and systematics. In: Gaugler, R. (Ed.),
Entomopathogenic Nematology. CABI Publishing, Wallinford, UK, pp. 1–33.
Adams, B.J., Fodor, A., Koppenhöfer, H.S., Stackebrandt, E., Stock, S.P., Klein, M.G.,
2006. Biodiversity and systematics of nematode–bacterium entomopathogens.
Biol. Control 38 (565), 4–21.
Alatorre-Rosas, R., Kaya, H.K., 1990. Interspecific competition between
entomopathogenic nematodes in the genera Heterorhabditis and Steinernema
for an insect host in sand. J. Invertebr. Pathol. 55, 179–188.
Ali, J.G., Alborn, H.T., Stelinski, L.L., 2010. Subterranean herbivore-induce volatiles
released by citrus roots attract entomopathogenic nemtaodes. J. Chem. Ecol. 36,
361–368.
Ali, J.G., Alborn, H.T., Campos-Herrera, R., Kaplan, F., Duncan, L.W., Rodriguez-Sanoa,
C., Koppenhöfer, A.M., Stelinski, L.L., 2012. Subterranean, herbivore-induced
plant volatile increases biological control activity of multiple beneficial
nematode species in distinct habitats. PLoS One 7, e38146.
Ali, J.G., Campos-Herrera, R., Alborn, H.T., Duncan, L.W., Stelinski, L.L., 2013. Sending
mixed messages: A trophic cascade produced by a belowground herbivore–
induced cue. J. Chem. Ecol. 39, 1140–1147.
Baille, D., Barrière, A., Félix, M.-A., 2008. Oscheius tipulae, a widespread
hermaphroditic soil nematode, displays a higher genetic diversity and
geographical structure than Caenorhabditis elegans. Mol. Ecol. 17, 1523–1534.
Barrière, A., Félix, M.-A., 2005. High local genetic diversity and low outcrossing rate
in Caenorhabditis elegans natural populations. Curr. Biol. 15, 1176–1184.
Boemare, N., 2002. Biology, taxonomy and systematics of Xenorhabdus and
Phtorhabdus. In: Gaugler, R. (Ed.), Entomopathogenic Nematology. CABI
Publishing, Wallingford, UK, pp. 35–56.
Campos-Herrera, R. (Ed.), 2015. Nematode Pathogenesis of Insects and Other Pests.
Series: Sustainability in Plant and Crop Protection (Ciancio, A., Series Ed.).
Springer International Publishing Switzerland. http://dx.doi.org/10.1007/978-
3-319-18266-7, pp. 530.
Campos-Herrera, R., Gutiérrez, C., 2009. Screening for Spanish isolates of
steinernematid nematodes as biological control agents through laboratory
and greenhouse microcosm study. J. Invertebr. Pathol. 100, 100–105.
Campos-Herrera, R., El-Borai, F.E., Stuart, R.J., Graham, J.H., Duncan, L.W., 2011a.
Entomopathogenic nematodes, phoretic Paenibacillus spp., and the use of real
time quantitative PCR to explore soil food webs in Florida citrus groves. J.
Invertebr. Pathol. 108, 30–39.
Campos-Herrera, R., Johnson, E.G., El-Borai, F.E., Stuart, R.J., Graham, J.H., Duncan, L.
W., 2011b. Long–term stability of entomopathogenic nematode spatial patterns
measured by sentinel insects and real–time PCR assays. Ann. App. Biol. 158, 55–
68.
Campos-Herrera, R., El-Borai, F.E., Duncan, L.W., 2012. Wide interguild relationships
among entomopathogenic and free–living nematodes in soil as measured by
real time qPCR. J. Invertebr. Pathol. 111, 126–135.
Campos-Herrera, R., Ali, J.G., Díaz, B.M., Duncan, L.W., 2013a. Analyzing spatial
patterns linked to the ecology of herbivores and their natural enemies in the
soil. Front. Plant Sci. 4 (378), 1–18.
Campos-Herrera, R., Pathak, E., El-Borai, F.E., Stuart, R.J., Gutiérrez, C., Rodríguez-
Martín, J.A., Graham, J.H., Duncan, L.W., 2013b. Geospatial patterns of soil
properties and the biological control potential of entomopathogenic nematodes
in Florida citrus groves. Soil Biol. Biochem. 66, 163–174.
Campos-Herrera, R., Jaffuel, G., Chiriboga, X., Blanco-Pérez, R., Fesselet, M., Půža, V.,
Mascher, F., Turlings, T.C.J., 2015. Traditional and molecular detection methods
reveal intense interguild competition and other multitrophic interactions
associated with native entomopathogenic nematodes in Swiss tillage soils.
Plant Soil 389, 237–255.
Derycke, S., Sheibani Tezerji, R., Rigaux, A., Moens, T., 2012. Investigating the
ecology and evolution of cryptic marine nematode species through quantitative
real-time PCR of the ribosomal ITS region. Mol. Ecol. Resour. 12, 607–619.
Dillman, A.R., Chaston, J.M., Adams, B.J., Ciche, T.A., Goodrich-Blair, H., Stock, S.P.,
Sternberg, P.W., 2012. An entomopathogenic nematode by any other name.
PLoS Pathogens 8, e1002527.
Duncan, L.W., Dunn, D.C., Bague, G., Nguyen, K., 2003. Competition between
entomopathogenic and free–living bactivorous nematodes in larvae of the
weevil Diaprepes abbreviatus. J. Nematol. 35, 187–193.
Duncan, L.W., Graham, J.H., Zellers, J., Bright, D., Dunn, D.C., El-Borai, F.E.,
Porazinska, D.L., 2007. Food web responses to augmenting the
entomopathogenic nematodes in bare and animal manure–mulched soil. J.
Nematol. 39, 176–189.
Félix, M.-A., 2006. Oscheius tipulae (August 16, 2006), WormBook, Ed. The C. elegans
Research Community, WormBook, http://dx.doi.org/10.1895/wormbook.1.119.
1, <http://www.wormbook.org>.
Félix, M.-A., Vierstraete, A., Vanfleteren, J., 2001. Three biological species closely
related to Rhabditis (Oscheius) pseudodolichura Körner in Osche, 1952. J.
Nematol. 33, 104–109.
Félix, M.-A., Duveau, F., 2012. Population dynamics and habitat sharing of natural
populations of Caenorhabditis elegans and C. briggsae. BMC Biol. 10, 59.
Garcia, J.M., Jenkins, D.A., Chavarria, J.A., Shapiro-Ilan, D., Goenaga, R., 2011.
Interactions of Rhabditis sp. on the virulence of Heterorhabditis and Steinernema
in Puerto Rico. Fl. Entomol. 94, 701–702.
Georgis, R., Koppenhöfer, A.M., Lacey, L.A., Bélair, G., Duncan, L.W., Grewal, P.S.,
Samish, M., Tan, L., Torr, P., van Tol, R.W.H.M., 2006. Successes and failures in
the use of parasitic nematodes for pest control. Biol. Control 38, 103–123.
Grewal, P.S., Martin, W.R., Miller, R.W., Lewis, E.E., 1997. Suppression of plant
parasitic nematode populations in turfgrass by application of
entomopathogenic nematodes. Biocontr. Sci. Technol. 7, 393–399.
Griffin, C.T., O’ Callaghan, K.M., Dix, I., 2001. A self-fertile species of Steinernema
from Indonesia: fighter evidence of convergent evolution amongst
entomopathogenic nematodes? Parasitology 122, 181–186.
Griffin, C.T., Downes, M.J., Block, W., 1990. Tests of Antarctic soils for insect parasitic
nematodes. Antarctic Sci. 2, 221–222.
Hall, T.A., 1999. BioEdit: a user-friendly biological sequence alignment editor and
analysis program for Windows 95/98/NT. Nucl. Acids Symp. Ser. 41, 95–98.
Holterman, M., van der Wurff, A., van den Elsen, S., van Megen, H., Bongers, T.,
Holovachov, O., Bakker, J., Helder, J., 2006. Phylum-wide analysis of SSU rDNA
reveals deep phylogenetic relationships among nematodes and accelerated
evolution toward crown clades. Mol. Biol. Evol. 23, 1792–1800.
Hominick, W.M., 2002. Biogeography. In: Gaugler, R. (Ed.), Entomopathogenic
Nematology. CABI Publishing, Wallingford, UK, pp. 115–143.
Ishibashi, N., Kondo, E., 1986. Steinernema feltiae (DD-136) and S. glaseri: persistence
in soil and bark compost and their influence on native nematodes. J. Nematol.
18, 310–316.
Ishibashi, N., Kondo, E., 1987. Dynamic of entomogenous nematode Steinernema
feltiae applied to soil with and without nematicide treatment. J. Nematol. 19,
404–412.
Jenkins, W.R., 1964. A rapid centrifugal-flotation technique for separating
nematodes from soil. Plant Dis. Rep. 48, 492.
Jones, K.L., Todd, T.C., Herman, M.A., 2006a. Development of taxo-specific markers
for high-throughput screening of microbial-feeding nematodes. Mol. Ecol. Notes
6, 712–714.
Jones, K.L., Todd, T.C., Wall-Beam, J.L., Coolon, J.D., Blair, J.M., Herman, M.A., 2006b.
Molecular approach for assessing responses of microbial-feeding nematodes to
burning and chronic nitrogen enrichment in a native grassland. Mol. Ecol. 15,
2601–2609.
Kaya, H.K., Aguillera, M.M., Alumai, A., Choo, H.Y., de la Torre, M., Fodor, A., Ganguly,
S., Hazir, S., Lakatos, T., Pye, A., Wilson, M., Yamanaka, S., Yang, H., Ehlers, R.-U.,
2006. Status of entomopathogenic nematodes and their symbiotic bacteria from
selected countries or regions of the world. Biol. Control. 38, 134–155.
Larkin, M.A., Blackshields, G., Brown, N.P., Chenna, R., McGettigan, P.A., McWilliam,
H., Valentin, F., Wallace, I.M., Wilm, A., Lopez, R., Thompson, J.D., Gibson, T.J., Higgins,
D.G., 2007. ClustalW2 and ClustalX version 2. Bioinformatics 23, 2947–2948.
Lewis, E.E., Campbell, J., Griffin, C., Kaya, H.K., Peters, A., 2006. Behavioral ecology of
entomopathogenic nematodes. Biol. Control 38, 66–79.
Lewis, E.E., Hazir, S., Hodson, A., Gulcu, B., 2015. Trophic relationships of
entomopathogenic nematodes in agricultural habitats. In: Campos-Herrera, R.
(Ed.), Nematode Pathogenesis of Insects and Other Pests. Series: Sustainability
in Plant and Crop Protection(Ciancio, A., Series Ed.). Springer International
Publishing, Switzerland, pp. 137–161.
Nei, M., Kumar, S., 2000. Molecular Evolution and Phylogenetics. NY, USA, Oxford
University Press, New York.
Pathak, E., El-Borai, F.E., Campos-Herrera, R., Jonhson, E.G., Stuart, R.J., Graham, J.H.,
Duncan, L.W., 2012. Use of real–time PCR to discriminate predatory and
saprophagous behavior by nematophagous fungi. Fungal Biol. 116, 563–573.
 R. Campos-Herrera et al. / Journal of Invertebrate Pathology 132 (2015) 216–227
Půža, V., Mráček, Z., 2009. Mixed infection of Galleria mellonella with two
entomopathogenic nematodes (Nematoda: Rhabditida) species: Steinernema
affine benefits from the presence of Steinernema kraussei. J. Invertebr. Pathol.
102, 40–43.
Půža, V., Mráček, Z., 2010. Does scavenging extend the host range of
entomopathogenic nematodes (Nematoda: Steinernematidae)? J. Invertebr.
Pathol. 104, 1–3.
Rasmann, S., Kollner, T.G., Degenhardt, J., Hiltpold, I., Toepfer, S., Kuhlmann, U.,
Gershenzon, J., Turlings, T.C.J., 2005. Recruitment of entomopathogenic
nematodes by insect–damaged maize roots. Nature 434, 732–737.
Rozen, S., Skaletsky, H.J., 2000. Primer3 on the WWW for general users and for
biologist programmers. In: Krawetz, S., Misener, S. (Eds.), Bioinformatics
Methods and Protocols: Methods in Molecular Biology. Humana Press,
Totowa, NJ, USA, pp. 365–386.
Rzhetsky, A., Nei, M., 1992. A simple method for estimating and testing minimum
evolution trees. Mol. Biol. Evol. 9, 945–967.
Saitou, N., Nei, M., 1987. The neighbor-joining method: A new method for
reconstructing phylogenetic trees. Mol. Biol. Evol. 4, 406–425.
San-Blas, E., Gowen, S.R., 2008. Facultative scavenging as a survival strategy of
entomopathogenic nematodes. Int. J. Parasitol. 38, 85–91.
Somasekhar, N., Grewal, P.S., DeNardo, E.A.B., Stinner, B.R., 2002. Non-target effects
of entomopathogenic nematodes on the soil nematode community. J. Appl. Ecol.
39, 735–744.
Stock, S.P., 2015. Diversity, biology and evolutionary relationships. In: Campos-
Herrera, R. (Ed.), Nematode Pathogenesis of Insects and Other Pests. Series:
Sustainability in Plant and Crop Protection (Ciancio, A. Series Ed.). Springer
International Publishing, Switzerland, pp. 3–27.
Stock, S.P., Griffin, S.P., Chaerani, R.T., 2004. Morphological and molecular characterisation
of Steinernema hermaphroditum n. sp. (Nematoda: Steinernematidae), an
entomopathogenic nematode from Indonesia, and its phylogenetic relationships
with other members of the genus. Nematology 63, 401–412.
View publication stats
227
Sudhaus, W., 1993. Redescription of Rhabditis (Oscheius) tipulae (Nematoda:
Rhabditidae) associated with leatherjackets, larvae of Tipula paludosa
(Diptera: Tipulidae). Nematologica 39, 234–239.
Sudhaus, W., Schulte, F., 1989. Rhabditis (Rhabditis) necromena sp. n. (Nematoda:
Rhabditidae) from South Australian Diplopoda with notes on its siblings R.
myriophil. Nematologica 35, 15–24.
Tamura, K., Stecher, G., Peterson, D., Filipski, A., Kumar, S., 2013. MEGA6: molecular
evolutionary genetics analysis version 6.0. Mol. Biol. Evol. 30, 2725–2729.
Torres-Barragan, A., Suazo, A., Buhler, W.G., Cardoza, Y.J., 2011. Studies on the
entomopathogenicity and bacterial associates of the nematode Oscheius
carolinensis. Biol Contr. 59, 123–129.
Torrini, G., Mazza, G., Carletti, B., Benvenut, C., Roversi, P.F., Fanelli, E., de Luca, F.,
Trocoli, A., Tarasco, E., 2015. Oscheius onirici sp. n. (Nematoda: Rhabditidae): a
new entomopathogenic nematode from an Italian cave. Zootaxa 3937, 533–548.
Vrain, T.C., Wakarchuk, D.A., Levesque, A.C., Hamilton, R.I., 1992. Intraspecific rDNA
restriction fragment length polymorphims in the Xiphinema anericanun group.
Fundam. Appl. Nematol. 15, 563–574.
White, G.F., 1927. A method for obtaining infective nematode larvae from cultures.
Science 66, 302–303.
Woodring, J.L., Kaya, H.K., 1988. Steinernematid and Heterorhabditid nematodes: a
handbook of biology and techniques. Southern Cooperative Series Bulletin 331.
Arkansas Agricultural Experiment Station, Arkansas.
Ye, W.M., Torres-Barragan, A., Cardoza, Y.J., 2010. Oscheius carolinensis n. sp
(Nematoda: Rhabditidae), a potential entomopathogenic nematode from
vermicompost. Nematology 12, 121–135.
Zhang, C., Liu, J., Xu, M., Sun, J., Yang, S., An, X., Gao, G., Lin, M., Lai, R., He, Z., Wu, Y.,
Zhang, K., 2008. Heterorhabditidoides chongmingensis gen. nov., sp. nov.
(Rhabditida: Rhabditidae), a novel member of the entomopathogenic
nematodes. J. Invertebr. Pathol. 98, 153–168.