Volume 5, Issue 1 (2018) Tropical Plant Research

ISSN (E): 2349 – 1183
ISSN (P): 2349 – 9265

5(1): 01–07, 2018
DOI: 10.22271/tpr.2018.v5.i1.001
Research article
Methylation status of ACCase promoter affects

seed vigor-viability trait in Oryza sativa L.
Subhabrata Ghosh and Swati Sen-Mandi*
Division of Plant Biology, Bose Institute, Kolkata-700009, West Bengal, India
*Corresponding Author: senmandi.swati@gmail.com [Accepted: 17 January 2018]
Abstract: Rice (Oryza sativa L.) varieties exhibiting phenotypic features of high/low seed vigor-
viability were used to explore genetic controls associated with a varietal difference in seed vigor
and viability traits. Since germination rate i.e. vigor is a reflection of the onset of metabolic
activity of a hitherto quiescent embryo and seed viability reflects cell molecular events controlling
macromolecular damage/protection in post-harvest (dry) quiescent embryo, expression of a house-
keeping gene viz. Acetyl CoA Carboxylase (ACCase), that through its dual role controls lipid
biosynthesis for germination and flavonoid biosynthesis for macromolecular protection during
post-harvest aging, was studied. Our data revealed variation in ACCase gene expression among
high and low vigor-viability varieties although Southern blot analysis demonstrated single copy of
this gene in all the varieties regardless of their vigor-viability status. Methylation Sensitive
Restriction Enzyme assay revealed methylation in CpG island of ACCase promoter in the
phenotypically designated low vigor-viability varieties confirming that low seed vigor in rice
varieties is due to low expression of ACCase gene brought about by its promoter methylation.
Since promoter methylation is transferable through breeding lines this study opens up an
opportunity for introgressing high seed vigor-viability trait into otherwise desirable varieties.
Keywords: Oryza sativa - Seed vigor-viability - Acetyl CoA Carboxylase - Gene copy number -
Gene expression - Promoter methylation.
[Cite as: Ghosh S & Sen-Mandi S (2018) Methylation status of ACCase promoter affects seed vigor-viability
trait in Oryza sativa L. Tropical Plant Research 5(1): 1–7]
INTRODUCTION
Seed vigor- seed germination performance of freshly harvested seed (Maguire 1962) and viability- assessed
as seed germination performance of aged seed (Bewley & Black 1994, Sen & Osborne 1977) are important
agronomic traits that exhibit varietal difference (Hodgkin & Hengarty 1978, Julliano et al. 1990). These traits
have been shown to be interrelated through experiments on rice seed under different storage condition have
demonstrated that varieties exhibiting low seed vigor at fresh harvest are poor stores exhibiting low seed
viability/storability status (Chang & Tolentino 1983). From similar seed vigor studies, Milosevic et al. (2010)
have proposed that seed vigor traits could be used as indicators of seed viability. Such empirical studies indicate
a commonality in gene function where seed vigor trait through storage environment related modifications
appears to manifest seed viability trait. Notwithstanding till date, there is not much information on the
genetic/epigenetic control that determines the variation of these traits in the orthodox seed.
Conventionally, genetic studies on seed vigor and viability have mostly focused on identifying and mapping
genes associated with different facets of germination manifested at late seedling stage through identification of
QTLs such as : long root length in rice (Redona & Mackill 1996), heat stress in Brassica oleracea (Bettey &
Finch-Savage 1998), seed tolerance to artificial ageing in Arabidopsis (Benstink et al. 2000), controlled
deterioration test in Arabidopsis (Tesnier et al. 2002), seedling establishment under cold and drought stress in
barley (Chloupek et al. 2003), tolerance to natural ageing (NA) in Arabidopsis (Emile et al. 2004). Such reports
establish a QTL characteristic of late seedling growth without commenting on early embryonic growth that
constitutes sensu stricto germination elaborated by Bettey (2000) and Holdsworth et al. (2008).
www.tropicalplantresearch.com 1
Received: 11 November 2017 Published online: 31 January 2018
https://doi.org/10.22271/tpr.2018.v5.i1.001
Ghosh & Sen-Mandi (2018) 5(1): 01–07
Figure 1. Interrelation between primary and secondary metabolic pathways in field grown plants.
Reports on genomics and proteomics study at sensu stricto germination include studies of Caligaris et al.
(2012) who have identified a gene transcript (At3g08030) a member of the highly conserved family (DUF642)
of cell wall-associated proteins in Arabidopsis that have been proposed as a marker for seed aging that
determines seed viability status. Cademan et al. (2006) have studied cell molecular changes during early and
late germination times of Arabidopsis using microarray for global transcript analysis plant. Weitbrecht et al.
(2011) have demonstrated a massive change in Arabidopsis transcriptome during very early times of seed
imbibitions i.e. when the hitherto quiescent embryo initiates growth-related cell molecular activity representing
sensu stricto germination. Rajjou et al. (2004) have reported a proteomics analysis relating to accelerated
Arabidopsis seed aging. Analyzing gene activity during Arabidopsis seed development Papi et al. (2000) have
identified a seed-specific transcription factor viz. DAG1 in Arabidopsis. Catusse et al. (2004) have reported
proteome and transcriptome profiling also in Arabidopsis for understanding the molecular mechanism
underlying the seed germination and vigor trait. Subtractive cDNA approach has also been undertaken by
Linkies et al. (2010) in Lepidium sativum to understand the seed germination process. While such studies have
provided interesting information on seed vigor - viability (i.e. storability) these have not identified vigor-
viability associated major/candidate gene. Using precisely (metabolomics based) selected high and low vigor
varieties of rice seed Talai & Sen-Mandi (2010) have identified a 900bp DNA Marker associated with high
vigor trait. This has been shown to be useful in germplasm screening for identification of high seed vigor-viable
varieties. The authors have demonstrated a correlation (using NCBI information) of this marker with the house
keeping gene ACCase that affects cellular metabolism through synthesis of lipids, necessary for cell wall
synthesis in germinating embryonic axis and cellular protection in mature (dry) orthodox seed by flavonoids
synthesized during seed maturation on field grown soybean plants (Mazza et al. 2000). Shyam-Choudhury &
Sen-Mandi (2012) have reported higher flavonoid content in mature high vigor seeds of rice. These reports
together with reports of Baudry et al. (2004), working on Arabidopsis, indicate a possibility for ACCase enzyme
as being a common controlling factor for seed vigor and viability traits. Diversion from primary metabolism to
the secondary metabolic pathway (Logemann et al. 2000) through Malonyl CoA via the Phenyl Propanoid
pathway for production of flavonoids occurs under natural UV radiation (Fig. 1). Mazza et al. (2000) have
reported biosynthesis of flavonoids sunscreens in field grown (maturing) soybean crops. Flavonoids thus
synthesized in field grown plants, remaining stored through post-harvest dry storage, confer environmental
protection (Shyam-Choudhury & Sen-Mandi 2012). Being non-enzymatic, flavonoids serve for protection
against spontaneous UV radiation, a major factor causing cell molecular damage and thus loss of vigor viability
Ghosh & Sen-Mandi (2018) 5(1): 01–07
in dehydrated cells (that are incapable of enzymatic repair) of mature seed during storage. Li et al. (1993) have
reported that flavonoid mutants of Arabidopsis are hypersensitive to UV-B radiation. Flavonoids by virtue of
structure-function relationship are capable of serving as antioxidants as well as sun (ultraviolet) screen (Cockell
& Knowland 1999, Kirsch 2001, Amic et al. 2003) in dry stored seeds (Bailly 2004, Christova-Bagdassarian et
al. 2013). It is pertinent to mention here that most of the enzymes in this secondary metabolic pathway are
upregulated by UV (Kliebenstein et al. 2002). Using enzyme kinetics studies Sen-Mandi et al. (2004) have
demonstrated lower affinity of ACCase enzyme (per unit μg protein) towards its substrate in low storable/low
seed vigor-viability varieties than in the high storable/high seed vigor - viability varieties. Such findings suggest
that in varieties with seed exhibiting low ACCase enzyme efficiency would manifest low seed vigor due to a)
low rate of lipid metabolism at sensu stricto germination and b) low seed viability due to low level of flavonoid
biosynthesis during seed maturation thereby failing to equip such low vigor seeds with flavonoids that
(remaining undegraded) protect macromolecular degradation (Stapleton & Walbot 1998) under post-harvest dry
storage under spontaneous UV radiation (Shyam-Choudhury & Sen-Mandi 2012). Depending on the extent of
flavonoid synthesized the variety would remain accordingly protected and thus exhibit appropriate vigor status
in the variety.
This report presents our studies on understanding the cell molecular mechanism relating to differential
ACCase enzyme efficiency in high / low seed vigor-viability genotypes.
Data presented includes studies on contrasting genotypes with respect to seed vigor-viability traits.
1. ACCase gene expression in different genotypes.
2. ACCase gene copy number
3. Exploration of Methylation in the CpG island of the promoter region of ACCase gene in the contrasting
genotypes.
MATERIALS AND METHODS

Plant Materials
Sixteen rice varieties (Oryza sativa L. var indica) viz. IET-13158 (R1), Badshabhog (R2), IET-9978 (R3),
IET10890 (R4), Tulsimanjari (R5), Kataribhog (R6), Pushabasmati-1 (R7), Joya (R8), Patani-23 (R9), Jogen
(R10), Lalat (R11), Pankaj (R12), Basmati Aman (R13), Kalojira(R14), Matla (R15), Mohan (R16) were used in
this study. All freshly harvested seeds were stored at 4°C over CaCl 2 until used. These varieties were used after
assessing their seed vigor-viability status on the basis of: a) rapid seedling growth (studied in standard
germination test) b) ADH time course study on PAGE to determine transition from anaerobic to aerobic
respiration coinciding with transition from sensu stricto germination to visible germination (Talai & Sen-Mandi
2010) c) high level of DNA integrity (assayed on denaturing agarose gel) d) membrane integrity (determined by
extent of lipid peroxidation) (Sen-Mandi & Bhattacharya 2003) e) high levels of non enzymatic anti-oxidant viz.
flavonoids content (Shyam-Choudhury & Sen-Mandi 2012).
Genomic DNA Extraction
Total Genomic DNA was extracted from 3 day old young seedlings using Walbot (1988) method.
Southern blotting
Rice genomic DNA (10 µg) was digested with HindIII and digested DNA was separated by electrophoresis
on a 0.8% agarose gel and then blotted on to a Hybond-N+ nylon membrane filter (Amersham). The filter was
hybridized to 32P-labeled partial ACCase cDNA probe under normal hybridization and washing conditions as
described by Sambrook et al. (1989).
Gene expression study by Quantitative Real Time PCR
a. RNA extraction: Embryos extracted from 72 hrs imbibed seeds were powdered in liquid nitrogen. The total
RNA was extracted using TRIzol reagent. The yield and quality of total RNA were measured by absorbance at
230, 260, and 280 nm (A260/230 and A260/280 ratios) and by running samples on a 1.5% non-denaturing
agarose gel electrophoresis.
b. Conversion of mRNA to cDNA: The mRNA fraction of total RNA population was converted to cDNA using
random hexamer primer and Universal RiboClone cDNA Synthesis System (Promega, USA) following
manufacturer‟s instructions. After conversion cDNA was stored in -20°C.
c. Real Time PCR: In order to investigate the expression pattern of ACCase gene in contrasting varieties of rice
Ghosh & Sen-Mandi (2018) 5(1): 01–07
seed, quantitative RT-PCR was carried out in a 96-well optical plate using a Bio-Rad iQ5 instrument and
universal cycling conditions (3 min at 95°C, 40 cycles of 10 s at 95°C and 30 s at 62°C). A melting curve was
generated at the end of each run to check the specificity of amplification. Primer efficiencies and standard
deviations were calculated based on a standard curve generated. First strand cDNA were used as templates in
RT-PCR reaction with two primers specific (ACCase-F 5‟ACTTCTATTTCCGCGTCACC3‟ and ACCase-R-
5‟TCACCCTCGTCTTCTCACAG3‟) to the coding sequence of ACCase cDNA. The house-keeping gene used
in this reaction was UBQ5 gene which acts as an internal control. Specific primers (UBQ5-F
5‟ATGATAACTCGACGGATCGC 3‟ and UBQ5-R 5‟CTTGGATGTGGTAGCCGTTT 3‟) were designed
according to the conserved regions of plant UBQ5 gene. The Real Time PCR amplification was performed in
triplicate for target and house keeping gene for each sample.
Methylation test
Rice genomic DNA (10 µg) was digested with two Methylation Sensitive Restriction Enzymes viz. NauI and
MbuBI simultaneously. After double digestion PCR analysis was carried out using two primers (MetF- 5‟
AGGAAGGAAGCTGTGTGCTG 3‟ and MetR-5‟ CAGGGAGGAGGAGGAAGAAG 3‟) which have
complementarity to the flanking regions of the restriction sites of the two enzymes said above. The PCR cycle
was run at 94°C for 2 min, 35 cycles of 94°C for 30s, 55°C for 30s, and 72°C for 1 min followed by 72ºC for 10
min. Electrophoresis was carried out in 1.5% agarose gel in TBE buffer along with a 50bp DNA ladder
(Thermo Scientific).
RESULTS AND DISCUSSION

Southern hybridization using rice ACCase gene specific probe have revealed a single band of strong
hybridization signal in each lane (Fig. 2) suggesting that ACCase exits as single copy in the rice genome
irrespective of contrasting vigour - viability status. Data of this experiment demonstrates the presence of a single
copy of ACCase gene in all the studied sixteen rice varieties studied regardless of their seed vigour - viability
status. Being a single copy in both categories (viz. high and low vigour) suggests differential gene expression in
the contrasting genotypes. This is validated by Real Time PCR studies of all the genotypes studied against
ubiquitin-5 gene as the reference gene (Fig. 3). Relative-quantitative Real-Time PCR using gene-specific
primers revealed high (2.5–3 times) ACCase gene expression in high vigour – viability varieties ( i.e. R3, R4,
R6, R7, R9, R12, R15, R16) compared to the low vigour-viability varieties (i.e. R1, R2, R5, R8, R10, R11, R13,
R14) (Fig. 3). Ubiquitin 5 gene was the housekeeping gene used for normalizing gene expression data in this
gene expression study. An interesting correlation with this finding is evident from our earlier report (Sen-Mandi
et al. 2004) that has presented evidence from enzyme kinetics studies demonstrating that ACCase enzyme
exhibits higher substrate affinity (i.e. high enzyme efficiency) in high vigour - viability varieties compared to
low vigour - viability varieties. Low ACCase gene expression would result in low rate of lipid biosynthesis and
thus delayed cell wall formation contributing to slow embryo enlargement and slow rate of embryonic growth at
sensu stricto germinations that is reflected as low seed vigour. High expression of ACCase gene (Fig. 3) would
be responsible for higher flavonoid (non- enzymatic antioxidants) level in high vigour-viability varieties for cell
protection through adverse storage environment (viz. UV) in rice seeds (Shyam-Choudhury & Sen-Mandi 2012).
Figure 2. Southern Blot analysis showing single copy of ACCase gene in all the studied Oryza sativa varieties irrespective
of their vigour-viability status (R1- R16).
Considering the experimental data of figure 2 and figure 3 in perspective, a possible epigenetic mechanism
for controlling vigour-viability status in contrasting genotypes may be envisaged. Our studies on varietal
difference in vigour viability status of rice seeds indicate promoter methylation as the mechanism responsible
for these contrasting traits (Fig. 4). Analyzing the methylation status of the promoter region of ACCase gene
using designed primers, complementary to the flanking region of the recognition sites of the two above said
Ghosh & Sen-Mandi (2018) 5(1): 01–07
Figure 3. Relative ACCase Gene expression study in Oryza sativa varieties showing high ACCase gene expression in high
vigour-viable varieties (R3, R4, R6, R7, R9, R12, R15, R16) and low gene expression in low vigour-viable varieties (R1, R2,
R5, R8, R10, R11, R14, R15).
restriction enzymes (located within the CpG island of the promoter region of ACCase gene), revealed a visible
250 bp band (Fig. 4) in all low vigour - viability varieties (i.e. R1, R2, R5, R8, R10, R11, R13, R14) whereas no
band is present in high vigour - viability varieties (i.e. R3, R4, R6, R7, R9, R12, R15, R16). Presence of a PCR
product in low vigour varieties and its absence (presumably due to lack of methylation at the restriction sites of
the two used restriction enzymes (viz. NaeI and MbuBI) in high vigour varieties establishes the occurrence of
methylation at the promoter region in low vigour varieties. Using specific primer pairs complementary to the
flanking region of the restriction sites of two above said enzymes, located within the CpG island of ACCase
promoter region, a PCR derived DNA band of 250 bp was observed in the low vigour varieties; the band was
absent in the high vigour varieties (Fig. 4). DNA methylation at the CpG island of the promoter region of the
ACCase gene would cause low transcription efficiency and therefore low ACCase enzyme activity - an
epigenetic effect, evident in low vigour varieties. The fact that vigour viability status in different varieties are
found to remain unaltered through generations suggest that such epigenetic effects have been imprinted in the
respective genomes.
Figure 4. ACCase promoter methylation study showing a 250 bp band in low vigour-viable varieties (R1, R2, R5, R8, R10,
R11, R14, R15) whereas complete absence of that band in high vigour-viable varieties (R3, R4, R6, R7, R9, R12, R15, R16).
M- 50bp ladder.
Studies on precisely selected (vide „material‟) rice varieties demonstrated that variation in ACCase gene
expression causes variation in seed vigour-viability trait despite the fact that ACCase gene copy number is
“one” in all the varieties studied. The variation in ACCase gene expression among these varieties has been
Ghosh & Sen-Mandi (2018) 5(1): 01–07
found to be due to differential methylation status at the ACCase promoter region demonstrating that promoter
methylation of ACCase gene (the critical gene regulating both vigour - through lipid biosynthesis as well as
viability - through flavonoid biosynthesis) affects vigour-viability traits in freshly harvested rice seeds.
ACKNOWLEDGEMENTS
Prof. Swati Sen Mandi and Dr. Subhabrata Ghosh are grateful to Indian Council of Medical Research
(ICMR) for receiving Emeritusship and Research Associateship respectively [Grant No: 74/3/2011 –Pers
(EMS)]. The authors wish to acknowledge Prof. Jitendra. P. Khurana, South Campus, University of Delhi for his
advice on technical details on Real Time PCR study.
REFERENCES
Amic D, Davidovic-Amic D, Beslo D & Trinajstic N (2003) Structure-radical Scavenging activity Relationships
of flavonoids. Croatica Chemica Acta 76(1): 55–61.
Bailly C (2004) Active oxygen species and antioxidants in seed biology. Seed Science Research 14: 93–107.
Baudry A, Pourcel L, Debeaujon I, Routaboul JM, Nesi N, Caboche M & Lepinec L (2004) Abstract of 3rd Plant
European Genomics Meeting P-064, 22nd–25th September, Lyon, France.
Benstink L, Alonso-Blanco C, Verugdenhil D, Tesnier K, Groot SPC & Koornnef M (2000) Genetic analysis of
seed-soluble oligosachharides in relation to seed storability of Arabidopsis. Plant Physiology 124: 1595–
1604.
Bettey M & Finch-Savage WE (1998) Stress protein content in mature Brassica seeds and their germination
performance. Seed Science Research 8: 335–347.
Bettey M, Finch-Savage WE, King GJ & Lyan JR (2000) Quantitative genetic analysis of seed vigor and pre
emergence seedling growth traits in Brassica oleracea. New Phylol 148: 277–286.
Bewley JD & Black M (1994) Seeds physiology of development and germination, 2 nd edition. Plenum Press,
New York.
Cademan CSC, Toorop PE, Hilhorst HWM & Finch-Savage WE (2006) Gene expression profiles of
Arabidopsis Cvi seeds during dormancy cycling indicate a common underlying dormancy control
mechanism. The Plant Journal 46: 805–822.
Caligaris LEG, Odette A, Sandra AV & Lopez A (2012) At3g08030 transcript: a molecular marker of seed
ageing. Annals of Botany 110(6): 1253–1260.
Catusse J, Rajjou L, Miche L, Lovigny Y, Robin C, Leydier E, Job C & Job D (2004) Proteome and
Transcriptome profiling to understand Seed germination and identify intrinsic markers determining seed
quality, germination efficiency and early seedling vigor. In: Abstract of 3rd Plant European genomics
meeting P-106, 22nd-25th September, Lyon, France.
Chang TT & Tolentino VT (1983) Seed longevity of three rice cultivars in three packing materials under six
storage conditions. In: Agronomy Abstract, American Society of Agronomy, Madison, pp. 118.
Chloupek O, Hrstkova P & Jurecka D (2003) Tolerance of barley seed germination to cold and drought –stress
expressed as seed vigor. Plant Breeding 122(3): 199–203.
Christova-Bagdassarian VL, Bagdassarian KS & Atanassova KS (2013) Phenolic Compounds and Antioxidant
Capacity in Bulgarian Plans (dry seeds). International Journal of Advanced Research 1(9): 186–197.
Cockell CS & Knowland J (1999) Ultraviolet radiation screening compounds. Biological Reviews 74: 311–345.
Emile JM, Clerk X, Mohammed E, Lithy EL, Elizabeth V, Gerda JR, Hetty BDV, Steven PCG, Dick V &
Marteen K (2004) Analysis of Natural allelic variation of Arabidopsis seed germination and seed longevity
traits hot water using a New Recombinant inbred line populqtion. Plant Physiology 135: 432–443.
Hodgkin T & Hegarty TW (1978) Genetically determined variation in seed germination and field emergence of
Brassica oleracia. Annals of Applied Biology 88: 407–413.
Holdsworth MJ, Finch-Savage WE, Grappin P & Job D (2008) Post-genomics dissection of seed dormancy and
germination. Trends in Plant Science 13(1): 1-7.
Julliano BO, Consuelo M, & Perez TT (1990) Varietal differences in longevity of tropical rough rice stored
under ambient conditions. Seed Science and Technology 18: 45–56.
Kirsch JD (2001) Flavonoids: The good, the bad and the ugly. Free Radical Biology & Medicine 77: 222.
Kliebenstein DJ, Lim JE, Landry LG & Robert L (2002) Arabidopsis UVR8 regulates Ultraviolet-B signal
transduction and tolerance and contains sequence similarity to human Regulator of Chromatin Condensation
Ghosh & Sen-Mandi (2018) 5(1): 01–07
I. Plant Physiology 130(1): 234–243.

Li J, Ou-Lee TM, Raba R, Amundson RG & Last RL (1993) Arabidopsis flavonoid mutants are hypersensitive
to UV-B irradiation. Plant Cell 5: 171–179.
Linkies A, Schuster-Sherpa U, Tintelnot S, Leubner-Metzger G & Muller K (2010) Peroxidases identified in a
subtractive cDNA library approach show tissue-specific transcript abundance and enzyme activity during
seed germination of Lepidium sativum. Journal of Experimental Botany 61(2): 491–502.
Logemann E, Tavernaro A, Schulz W, Somssich IE & Hahlbrock K (2000) UV light selectively induces supply
pathways from primary metabolism and flavonoid secondary product formation in parsley. Proceedings of
National Academy of Sciences 97: 1903–1907.
Maguire JD (1962) Speed of Germination: Aid in Selection and Evaluation for Seedling Emergence and Vigor.
Crop Science 2: 176–177.
Mazza CA, Boccalandro HE, Giordano CV, Battista D, Scopel AL & Ballare CL (2000). Functional
significance and induction by solar radiation of ultraviolet-absorbing sunscreens in field-grown soyabean
crops. Plant Physiology 122: 117–126.
Milosevic M, Vujakovic M & Karagic D (2010) Vigor tests as indicators of seed viability. Genetika 42(1): 103–
118.
Papi M, Sabatini S, Bouchez D, Camilleri C, Costantino P & Vittorioso P (2000) Identification and disruption of
an Arabidopsis zinc finger gene controlling seed germination. Genes & Development 14: 28–33.
Rajjou L, Gallardo K, Debeaujon I, Vandekerckhove J, Job C & Job D (2004) The effect of a-amanitin on the
Arabidopsis seed proteome highlights the distinct roles of stored and neosynthesized mRNAs during
germination. Plant Physiology 134: 1598–1613.
Redona ED & Mckill DJ (1996) Genetic variation for seedling vigor traits in rice. Crop Science 36: 285–290.
Sambrook J, Fritsch EF & Maniatis T (1989) Molecular cloning: a laboratory manual. Cold Spring Harbor
Laboratory Press, New York
Sen S & Osborne DJ (1977) Decline in ribonucleic acid and protein synthesis with loss of viability during early
hours of imbibition of rye (Secale cereale) embryos. Biochemical Journal 166: 33–38.
Sen-Mandi S & Bhattacharya S (2003) Varietal difference in cellular damage associated with ageing in dry
stored seeds. Indian Journal of Plant Physiology (special issue): 210–216.
Sen-Mandi S, Bhattacharya S & Talai S (2004) Functional genomics of rice seed storability: a gene mediated
positive effect of spontaneous UV radiation. In: Abstract of 3rd Plant European genomics meeting P-073,
22nd-25th September, Lyon, France.
Shyam-Choudhury S & Sen-Mandi S (2012) Natural Ultra Violet Radialtion on Field Grown Rice (Oryza sativa
L.) Plants Confer Protection against Oxidative Stress in Seed during Storage under Subtropical Ambience.
Environment and Pollution 1(2): 21–32.
Stapleton A & Walbot V (1994) Flavonoids protects maize DNA from UV damage. Plant Physiology 105: 881–
889.
Talai S & Sen-Mandi S (2010) Seed vigor related DNA marker in rice shows homology with Acetyl CoA
carboxylase gene. Acta Physiologia Plantarum 32: 153–167.
Tesnier K, Strookman-Donkers HM, Van Piljen JG, Van der Geest AHM, Bino RJ & Groot SPC (2002) A
controlled deterioration test of Arabidopsis thaliama reveals genetic variation in seed quality. Seed Science
Technology 30: 149–165.
Walbot V (1988) Preparation of DNA from single rice seedling. Rice Genetics Newsletter 5: 149–157.
Weitbrecht K, Muller K & Leubner-Metzger G (2011) First off the mark: early seed germination. Journal of
Experimental Botany 62(10): 3289–3309.
ISSN (E): 2349 – 1183
ISSN (P): 2349 – 9265
5(1): 08–13, 2018
DOI: 10.22271/tpr.2018.v5.i1.002
Research article
Simple and efficient method for functional RNA extraction from

tropical medicinal plants rich in secondary metabolites
Akshara George
Department of Plant Biotechnology, College of Agriculture, Vellayani,
Thiruvananthapuram-695522, Kerala, India
*Corresponding Author: aksharageorge35@gmail.com [Accepted: 19 January 2018]
Abstract: Isolation of high-quality functional RNA is prerequisite to facilitate any study related to
gene expression and also for downstream applications such as reverse transcription-polymerase
chain reaction (RT-PCR), suppression subtractive hybridization (SSH) library construction,
differential display (DD), real-time PCR and northern hybridization of medicinal plants. Tropical
medicinal plants are rich in polysaccharides, polyphenolics and secondary metabolites that are
reported to interfere with the successful RNA isolation. Conventional approaches for the extraction
of functional RNA are often time-consuming and need expensive reagents. Moreover, these
methods can yield only poor quality and quantity of functional RNA. In our laboratory, we have
aimed at establishing a simple and efficient functional RNA extraction procedure. For this, a
sodium dodecyl sulfate (SDS) based protocol free of guanidine isothiocyanate was adopted. The
total extracted RNA remains in the upper aqueous phase, at acidic conditions leaving DNA and
proteins in the lower organic phase. This principle is used in this protocol and the modifications
made in the SDS- acid phenol RNA extraction protocol were found to be helpful for extracting
RNA from tissues containing large quantities of secondary metabolites. This method can be
completed within 3 hours with purity ranges from 1.8–2.0 as confirmed by A260/280
spectrophotometric readings. The above-described RNA extraction protocol works well with all
the tissues examined so far, where standard RNA isolation methods failed.
Keywords: Functional RNA extraction - Tropical medicinal plants - Polysaccharides -
Polyphenols - Secondary metabolites - RT-PCR.
[Cite as: George A (2018) Simple and efficient method for functional RNA extraction from tropical medicinal
plants rich in secondary metabolites. Tropical Plant Research 5(1): 8–13]
INTRODUCTION
Tropical medicinal plants have been largely exploited for therapeutic purposes by present-day researchers.
Effective conservation and sustainable utilization of plant biodiversity is indispensable for meeting the present
and future requirements of medicinal plants. These medicinal plants are rich sources of alkaloids, polyphenols,
polysaccharides, secondary metabolites, terpenoids and these phyto compounds have dragged the attention of
contemporary researchers. Production of valuable therapeutic compounds from medicinal plants could be made
possible through metabolic engineering and recombinant DNA technology (Titanji et al. 2007). The application
of modern molecular biology techniques may help in better understanding and conservation of medicinal plants.
These tools can unravel the various bioactive compounds with therapeutic significance at the molecular level.
Good quality functional RNA extraction is the most important step in gene expression analysis studies (Ghangal
et al. 2009). However, RNA extraction from tissues having higher polyphenols, polysaccharides and secondary
metabolite contents became a difficult task. The phenolic compounds readily get oxidised to form quinones.
These quinones can bind easily with nucleic acids and act as a barrier for good quality RNA isolation (Wang et
al. 2008).
Several RNA isolation protocols for medicinal plants has been developed or modified and certain
commercial kits were also introduced (John 1992, MacKenzie et al. 1997, Sabir 2012). However, these
protocols were found to be incompatible for RNA isolation from majority of medicinal plant species with higher
George (2018) 5(1): 08–13
polyphenol contents. This is because, the secondary metabolites often co-precipitate with RNA and it affects the
yield and quality of RNA (Ghawana et al. 2011). As RNA molecules are subject to degradation by RNases
enzymes (Gasic et al. 2004, Hou et al. 2011) several RNA isolation protocols need to be tested and modified. In
the present study, three RNA isolation protocols were compared for the production of high-quality RNAs from
twelve medicinal plant species. A sodium dodecyl sulfate (SDS) based protocol free of guanidine isothiocyanate
was modified and presented in this study. Under acidic conditions, total RNA remains in the upper aqueous
phase, leaving DNA and proteins in the lower organic phase. This principle is used in this protocol and the
modifications made in the SDS- acid phenol RNA extraction protocol were found to be helpful for extracting
RNA from tissues containing large quantities of secondary metabolites. Conventional methods like guanidine-
HCl, CTAB and LiCl are incorporated in many studies but they failed to extract high-quality RNA from tissues
with large quantities of polyphenols, secondary metabolites and polysaccharides. Precipitation of RNA using
lithium chloride is not suitable for in vitro translation or reverse transcription based experiments as chloride ions
will inhibit protein synthesis and DNA polymerase. While using TRIZOL reagent for RNA extraction, Bilgin et
al. (2009) had noticed the presence of organic contaminants in the isolated RNA. The objective of this study
was to develop a simple, reliable RNA extraction protocol suitable for a variety of tropical medicinal plants,
which meet the quality parameters for further downstream processes.

Biological materials
A total of twelve medicinal plant leaves were collected from the medicinal plant garden of College of
Agriculture, Vellayani, Thiruvananthapuram. The leaves were snap- frozen in liquid nitrogen and stored at -
80°C until use. This study included fresh leaf tissues of the following tropical medicinal plants Centella asiatica
(Apiaceae), Aerva lanata (Amaranthaceae), Andrographis paniculata (Acanthaceae), Biophytum sensitivum
(Oxalidaceae), Oxalis corniculata (Oxalidaceae), Adhatoda vasica (Acanthaceae), Bacopa monnieri (Bacopa),
Azadirachta indica (Meliaceae), Emilia sonchifolia (Asteraceae), Vitex negundo (Lamiaceae), Piper nigrum
(Piperaceae) and Zingiber officinale (Zingiberaceae).
Reagents and solutions
All the glasswares, laboratory apparatus and distilled water used in RNA extraction must be treated with
0.1% diethyl pyrocarbonate (DEPC) following the standard procedure of Sambrook et al. (1989).
Extraction buffer: 25 mM sodium citrate [pH 7], 25 mM EDTA [pH 8] 40 µl β- mercaptoethanol, 1% SDS and
0.25 g polyvinylpyrolidone (Mr.40,000)
Water-saturated phenol
Isopropanol
70% ethanol
Chloroform: isoamyl alcohol (24:1; v/v)
RNA extraction protocol
100 mg fresh leaf tissues were ground to fine powder using liquid nitrogen with a pre-sterilized DEPC
treated mortar and pestle. 1 ml extraction buffer was added to the samples and ground once more. All the
samples were transferred to 2 mL Eppendrof tubes and 200 µl of 2 M sodium acetate, pH 4.0, 500 µl water-
saturated phenol, 250 µl of chloroform: isoamyl alcohol (24:1) were added to each tube and vortex the samples
thoroughly for 1 min. The samples were kept for incubation on ice for 30 min. After incubation samples were
centrifuged at 10,000 × g for 15 min at 4°C, the supernatant containing upper aqueous phase was collected
carefully into a fresh tube. This upper aqueous phase mostly contains RNA. In to the upper aqueous phase 500
µl water-saturated phenol, 250 µl of chloroform: isoamyl alcohol (24:1) were added and mixed by shaking.
Samples were centrifuged at 10,000 × g for 15 min at 4°C, and the upper aqueous phase was collected carefully
into a fresh tube. In to the upper aqueous layer, 250 µl 3M sodium acetate and 750 µl ice-cold isopropanol were
added and inverted the tubes gently to precipitate RNA. The tubes were kept for 1hour incubation in -20°C. To
pellet the RNA, centrifuged the tubes at 10,000 × g for 15 min at 4°C and discarded the supernatant. 500 µl 70%
ethanol was added to the pellet and centrifuged at 8,000 × g for 5 min at 4°C and this step was repeated twice to
remove the impurities present in the pellet. The pellet was air dried for 10–15 min for removing traces of
ethanol. The RNA pellet was dissolved in 50 µl of DEPC treated RNase free water. The extracted RNA can be
stored at -20°C or 4°C until use.
George (2018) 5(1): 08–13
Quality analysis of RNA

The quality of the isolated RNA was obtained by means of electrophoresis in 1.2% agarose gels, followed by
staining with ethidium bromide (0.1 µg mL-1). The purity of the RNA was estimated by calculating the
absorbance ratio (A260/280) and (A260/230) with a nano drop spectrophotometer (Thermo Scientific NanoDrop™
1000).
cDNA synthesis and real-time RT-PCR
The RNA isolated from leaf samples were subjected to cDNA conversion using Revert Aid FIRST strand
cDNA synthesis kit (Thermo scientific, USA). According to the manufacturer's instructions, 0.5 μg of RNA was
reverse-transcribed to the first-strand cDNA. The reaction conditions comprised of a reverse transcription step at
42°C for 1 hour followed by an extension step at 72°C for five min. Quantitative real-time PCR (qPCR) was
performed with the Eppendroff real plex PCR system (Eppendroff, Hamburg, Germany) in a final volume of 20
μL. The reaction mixture consists of 12.5 μL of 2 x SYBR green master mix (Fermentas, EU), 0.3 μL each of
the forward and reverse primers and 5 μL of reverse-transcribed cDNA (25 ng μL-1). The final volume of the
reaction was adjusted with molecular-grade sterile distilled water. Thermal cycling conditions were designed as
an initial denaturation at 95°C for 30 s, followed by 40 cycles of 95°C for 15 s, 60°C annealing for 1 min and
72°C extension for 15 s and a final extension at 72°C for 8 min. The sequences of forward and reverse primers
for the catalase gene were 5′- CAGACACTCTACGCTCCGTCAT -3′ and 5′-
TTGAAATCATTTTGCTTGGGAAT -3′, respectively. The amplified products were resolved in a 1.2% agarose
gel, and photographs were scanned through a Gel Doc System (Alpha imager, Alpha Innotech).
Comparison of RNA extraction methods
Functional RNA was extracted from the same samples using commercially available kit Ambion Purelink
RNA Mini Kit (Life Technologies, USA) and guanidine - HCl method (Bandyopadhyay et al. 2012). The
efficiency of newly developed RNA extraction protocol was compared with the Ambion Purelink RNA Mini Kit
and guanidine–HCl method in terms of purity and yield.
RESULTS
RNA yield and purity
The yield and purity of the extracted RNA from the twelve different samples were evaluated using a nano
drop spectrophotometer (Thermo Scientific NanoDrop™ 1000) and agarose gel electrophoresis (Fig. 1). RNA
yields up to 2212 ng.µl-1 from 100 mg of sample material, and in all samples, the A260/230 ratio ranged from 2.02
to 2.18, indicating that the RNA was of high purity; free of polyphenol and polysaccharide contamination.
Similarly, the A260/280 ratio ranged from 1.92 to 2.02, which also indicated lack of protein contamination.
Distinct 28S and 18S ribosomal RNA (rRNA) bands without smearing indicated the integrity of isolated RNA
(Fig. 1). This also depicts that the RNA samples were not degraded.
Figure 1. A, Ethidium bromide stained 1.2% agarose gel of total RNA (4 µg) from various plant species extracted with
proposed method. Lane 1: Adhatoda vasica; Lane 2: Aerva lanata; Lane 3: Oscimum sanctum; Lane 4: Biophytum
sensitivum; Lane 5: Zingiber officinale; Lane 6: Oxalis corniculata; Lane 7: Bacopa monnieri; Lane 8: Azadirachta indica;
Lane 9: Emilia sonchifolia; Lane 10: Vitex negundo; Lane 11: Piper nigrum and Lane 12: Centella asiatica; B, Ethidium
bromide stained 1.2% agarose gel of total RNA (4 µg) from various plant species extracted with conventional Guanidine
HCl method.
George (2018) 5(1): 08–13
Quantitative real-time RT-PCR

The catalase gene was amplified from the cDNA samples using real-time RT-PCR (Fig. 2). Electrophoresis
of amplicons indicated that the primer pair used to amplify the catalase gene fragment exhibited high
specificity. The amplification curves demonstrated that these smaller mRNA sequences were largely intact in
the RNA samples and that the catalase gene was present in all tissues in moderate abundance.
Figure 2. cDNA synthesized from the extracted RNA samples using Revert Aid FIRST strand cDNA synthesis kit (Thermo
scientific, USA), Lane M: 1kb plus DNA ladder.
Comparison of RNA extraction methods

Functional RNA from all the leaf samples were obtained by the three protocols tested. Table 1 depicts the
purity and yield variations of the total RNA obtained by each method. RNA purity and yield determined by nano
spectrophotometry measurements showed that RNA produced by the proposed SDS- acid phenol protocol had a
higher purity (A260/280=1.9–2.0). This extraction method facilitated isolation of large quantities of high-quality
RNA from various medicinal plant tissues within in 2–3 hours. Agarose gel electrophoretic analysis showed that
when RNA isolated by the guanidine - HCl method, the two distinct 28S and 18S ribosomal RNA (rRNA) bands
were degraded and not sharp (Fig. 1B). The quantity of RNA extracted using Ambion Purelink RNA Mini Kit,
was comparatively higher. Moreover, the purity of the isolated RNA was also higher.
Table 1. Yield and absorbance ratio of total RNA isolated from leaf tissues of medicinal plant species by three methods
revealed by Nanodrop spectrophotometer: (A) Proposed method; (B) Ambion Purelink RNA Mini kit; (C) Guanidine–HCl
method.
Concentration of RNA (ng.µl-1) A260/230 A260/280
Biological samples
A B C A B C A B C
Adhatoda vasica 1203.24 1011.75 798.84 2.08 2.22 2.46 1.89 1.99 1.78
Aerva lanata 2012.32 1942.22 1106.46 2.02 2.06 2.32 1.92 2.02 2.12
Oscimum sanctum 1998.68 1289.98 998.98 2.09 2.14 2.40 1.96 2.08 2.08
Biophytum sensitivum 2212.38 2289.68 1098.35 2.04 2.08 2.39 1.98 2.06 2.16
Zingiber officinale 1212.38 1243.75 926.98 2.22 2.38 2.56 1.94 2.00 2.06
Oxalis corniculata 1978.25 1918.36 1046.08 2.09 2.18 2.37 1.92 2.06 1.79
Bacopa monnieri 2143.42 1979.54 1008.98 2.07 2.16 2.34 1.97 1.98 2.14
Azadirachta indica 1208.98 956.26 698.43 2.20 2.32 2.49 1.98 1.98 2.18
Emilia sonchifolia 2024.45 1758.46 1065.96 2.05 2.08 2.32 1.94 2.02 2.19
Vitex negundo 1437.43 1038.28 866.98 2.18 2.26 2.44 2.02 2.04 1.68
Piper nigrum 1282.83 1006.98 769.94 2.14 2.24 2.46 1.94 2.06 2.18
Centella asiatica 1884.98 1664.28 922.28 2.03 2.08 2.32 1.98 2.02 2.14
DISCUSSION
The purpose of this study was to develop a simple, reliable and efficient RNA extraction protocol suitable
for samples rich in secondary metabolites. Moreover, the extracted RNA must meet the quality parameters for
downstream processes. The RNA extraction protocol described here is useful for researchers in developing
countries with limited laboratory facilities. This procedure is technically easy for isolating high-quality
functional RNA even without a column purification steps. The modified SDS- acid phenol extraction method is
cost effective and can be completed within 2–3 hours. It can serve as an alternative for expensive kit based RNA
extraction methods. The development of a reliable RNA extraction method could find wide application in
George (2018) 5(1): 08–13
quarantine purposes. Because the only genetic material is moved between countries, this procedure has the
advantage of offering a way to eliminate moving organisms across borders, thus safeguarding quarantine
regulations, while facilitating pathogen characterization and gene expression analysis studies (Mahuku 2004). In
addition, the rapid RNA extraction protocol is beneficial for laboratories that offer RNA analysis services and
have depended on the transfer of frozen or lyophilised samples.
For an efficient RNA extraction procedure, we have to reduce secondary chemical reactions including
oxidation in the initial crude tissue extract, which otherwise could lead to loss of RNA yield. Phenolic
compounds present in the tissue samples readily get oxidised to form quinones (Gehrig et al. 2000, Djami-
Tchatchou & Straker 2011). These quinones can bind easily with nucleic acids and act as a barrier for good
quality RNA isolation. Polyvinylpyrrolidone (PVP) forms a complex with the polyphenols found in the tissue
and helps to get separated from the nucleic acids (Heller & Ernst 2012). The proposed protocol is a guanidinium
salt-free, phenol-based method. It is evident from the researches of Wang et al. (2008), the presence of
guanidinium salt stimulates RNA dissociation from the non-protein complex and that will further results in
inhibition of successful RNA isolation. Phenol act as a strong protein denaturant and RNase inhibitor. SDS and
EDTA used in the extraction buffer are also found to be good RNase inhibitors. Further, pH of the solution was
maintained in the acidic range to allow efficient and preferable partitioning of RNA in the aqueous phase
leaving DNA in the phenolic phase (Chomczynski & Sacchi 2006). For maintaining an acidic pH, instead of
using buffered phenol, water-saturated phenol was used in the separation step (Chomczynski & Sacchi 2006).
Moreover, incorporation of a resuspension step consisting of ice-cold isopropanol and 3 M sodium acetate
resulted in effective precipitation of functional RNA from the contaminating polysaccharides and proteins.
Autoclaved DEPC-treated water provided sufficient aqueous environment for the RNA partitioning into the
aqueous phase.
The yield of RNA depends on the type of tissue and species used for the extraction procedure. The modified
SDS- acid phenol extraction method yielded higher quantities of RNA. The quality of the extracted RNA was
found to be higher with an average A260/280 of 1.98. But in certain cases like Zingiber officinale the absorption
ratio A260/280 of the isolated RNA was found to be lower. However, this RNA preparation was suitable for RT
PCR. Precipitation of RNA using lithium chloride is not suitable for in vitro translation or reverse transcription
based experiments as chloride ions will inhibit protein synthesis and DNA polymerase. The quantity of RNA
extracted using Ambion Purelink RNA Mini Kit, was comparatively higher. But commercial kit based RNA
extraction is not economical for experiments that demand several RNA extractions. The above-described RNA
extraction protocol works well with all the tissues examined so far, where standard RNA isolation methods
failed.
CONCLUSION
The present study aimed to standardize an easy and efficient functional RNA extraction protocol from
various tropical medicinal plant tissues rich in secondary metabolites. The rapid and efficient extraction
procedure together with the use of easily available chemicals makes this method appropriate for routine RNA
isolation which can be used for many downstream molecular works such as Real Time PCR analysis, cDNA
library construction, suppression subtractive hybridization (SSH) library construction, differential display (DD)
and northern hybridization.
ACKNOWLEDGEMENTS
The author is grateful to the Director, ICAR- Central Tuber Crops Research Institute, Sreekariyam,
Thiruvananthapuram for extending the infrastructure facilities and also thankful to Dean, College of Agriculture,
Vellayani, Thiruvananthapuram for the help and support provided throughout the work.
REFERENCES
Bilgin DD, DeLucia EH & Clough SJ (2009) A robust plant RNA isolation method suitable for Affymetrix
GeneChip analysis and quantitative real-time RT-PCR. Nature Protocols 4: 333–340.
Bandyopadhyay T, Bharalee R, Gohain B, Gupta S, Agarwala N, Singh HR, Chakrabarty S, Bhorali P, Kalita
MC & Das S (2012) Isolation of functional RNA from heavily infested, wilted and necrotic leaf tissues of
tea with high polyphenol content. Journal of Agricultural Science and Technology B2: 121–127.
Chomczynski P & Sacchi N (2006) The single-step method of RNA isolation by acid guanidinium thiocyanate
George (2018) 5(1): 08–13
phenol chloroform extraction : twenty-something years on. Nature Protocols 1(2): 581–585.
Djami-Tchatchou AT & Straker CJ 2012) The isolation of high quality RNA from the fruit of avocado (Persea
americana Mill.). South African Journal of Botany 78: 44–46.
Gasic K, Hernandez A & Korban SS (2004) RNA extraction from different apple tissues rich in polyphenols and
polysaccharides for cDNA. Plant Molecular Biology Reporter 22: 437a–437g.
Gehrig HH, Winter K, Cushman J, Borland A & Taybi T (2000) An improved RNA isolation method for
succulent plant species rich in polyphenols and polysaccharides. Plant Molecular Biology Reporter 18(4):
369–376.
Ghangal R, Raghuvanshi S & Chand P (2009) Plant physiology and Biochemistry isolation of good quality
RNA from a medicinal plant seabuckthorn, rich in secondary metabolites. Plant Physiology et Biochemistry
47: 1113–1115.
Ghawana S, Paul A, Kumar H, Kumar A, Singh H, Bhardwaj PK, Rani A, Singh RS, Raizada J, Singh K &
Kumar S (2011) An RNA isolation system for plant tissues rich in secondary metabolites. BMC Research
Notes 4(85): 1–5.
Heller W & Ernst D (2012) A simple and efficient protocol for isolation of functional RNA from plant tissues
rich in secondary metabolites. Plant Molecular Biology Reporter 18: 33–39.
Hou P, Xie Z, Zhang L, Song Z, Mi J, He Y & Li Y (2011) Comparison of three different methods for total
RNA extraction from Fritillaria unibracteata : A rare Chinese medicinal plant 5(13): 2834–2838.
John ME (1992) An efficient method for isolation of RNA and DNA from plants containing
polyphenolics. Nucleic Acids Research 20(9): 2381.
MacKenzie DJ, McLean M A, Mukerji S & Green M (1997) Improved RNA extraction from woody plants for
the detection of viral pathogens by reverse transcription-polymerase chain reaction. Plant Disease 81(2):
222–226.
Mahuku GS (2004) A simple extraction method suitable for PCR- based analysis of plant , fungal , and bacterial
DNA. Plant Molecular Biology Reporter 22: 71–81.
Sabir JSM (2012) Abundant high-quality RNA from medicinal plants for molecular applications. Journal of
Medicinal Plants Research 6(39): 5214–5221.
Sambrook J, Fritsch EF, Maniatis T & Cold Spring Harbor Laboratory (1989) Molecular cloning : a laboratory
manual, 2nd edition. Cold Spring Harbor Laboratory Press, New York.
Titanji VP, Ngwa AA & Ngemenya M (2007) Applications of biotechnology techniques to the study of
medicinal plants. African Journal of Medical Sciences 36: 23–29.
Wang H, Ghosh A, Baigude A,Yang C, Qiu L, Xia X, Zhou H, Rana TM & Xu Z (2008) Therapeutic gene
silencing delivered by a chemically modified small interfering RNA against mutant SOD1 slows
amyotrophic lateral sclerosis progression. The Journal of Biological Chemistry 283(23): 15845–15852.
ISSN (E): 2349 – 1183
ISSN (P): 2349 – 9265
5(1): 14–18, 2018
DOI: 10.22271/tpr.2018.v5.i1.003
Policy article
Revisiting climate change adaptation through proactive policy

designing and institutional mechanism
Ashish K. Chaturvedi*, K. Madhava Chandran and U. Surendran
Water Management (Agriculture) Division, Centre for Water Resources Development and Management,
Kozhikode-673571, Kerala, India
*Corresponding Author: ashispc@gmail.com [Accepted: 27 January 2018]
Abstract: Climate change is a foremost challenge for agricultural productivity. The vulnerability
is predominantly located in tropical regions with marginal farmers of developing countries.
Enhancement of the adaptive capacity to climate change could be possible through revisiting the
policy options with institutional reforms for adapting to the climate risks and sustaining the
resilience in India. Innovative win-win approaches with key policy framework include innovative
institutions, technologies, management systems and necessary financing mechanisms. Areas for
utmost importance comprise agricultural research, irrigation, information technologies, market
support, rural roads and extension services. Support from stakeholders to ensure effective
adaptation/ mitigation strategy implementation and to provide financial support for addressing
climate change issue is very essential. Along with these principles, a strong public-private
partnership with successful institutional mechanisms may lead to the formulation of climate
change adaptation strategies.
Keywords: Climate Change adaptation - Policy - Principles - Institutions.
[Cite as: Chaturvedi AK, Chandran KM & Surendran U (2018) Revisiting climate change adaptation through
proactive policy designing and institutional mechanism. Tropical Plant Research 5(1): 14–18]
INTRODUCTION
Climate change is an unequivocal process, which is evident and has been identified for affecting the
agricultural system in the world (IPCC 2007). Increase in greenhouse gas (GHG) emission using fossil fuel-
based inputs and equipments, deforestation and land conversion are some of the outcomes due to unmanaged
agricultural activities. As a part of these changes, it will result in reduced crop yield, dramatically increased food
insecurity and invalidating traditional agricultural practices. Therefore, proactive redefining of policies for
introducing climate-resilient agricultural practices is essential. The policy interventions require improved
technologies for a “climate-smart agriculture”, which can resist, tolerate and adapt to any changes in climate.
Suitable policies which enforce incorporation of climate-smart technologies in agriculture need to be
constructed especially in developing countries like India. Climate policies play a significant role in adapting
climate resilience in agriculture by shaping the practices which are most suitable in particular location (Nelson
2009, Seo 2010). Clear cut policy and institutional designs are the need of the hour to encourage the innovative
diffusion of these practices and technologies. Proper implementation of these climate-smart agro-technologies
can help farmers to adapt or mitigate the climate change.
Principle oriented institutional mechanisms for climate-smart agriculture in India

Agriculture is the main economic foundation in India as it provides livelihood to around 52% of the
population and contributes about 18% towards GDP of the nation (OECD Economic Survey :India 2017).
Agriculture sector contribution in the economy of the nation is remarkably high than world's average (6.1%).
Being the second largest producer of agriculture produce, India accounts nearly 7.68 percent of total global
agricultural output. However, most of the agricultural inputs in India including fertilizers, electricity, water and
loans are subsidized. Fertilizer (urea) only subsidies amounted to 0.5% of GDP in FY 2014–15, resulting in its
high demand and imbalanced use, polluting soils and water resources. Similarly, subsidy in electricity have led
Chaturvedi et al. (2018) 5(1): 14–18
to uncontrolled exploitation of groundwater, contributing to water stress (OECD Economic Survey: India 2017).
Rapid population growth is a great threat to food security, and to meet the requirements, innovative technologies
coping with climate change are required. To increase agricultural productivity in a socio-environmentally
sustainable manner to strengthen farmers’ resilience to climate change is the key target for climate-smart
agriculture. Policy designing and institutional mechanisms should have innovative practices with better climate
forecasting, risk insurance and proven early warning systems. Transferring existing technologies from the lab to
the land, and developing new technologies such as drought or flood tolerant crops to meet the food demands are
important under the changing climate. Creation of principle oriented climate change policies as well as enabling
policy environment for adaptation are essential.
Climate change may have a profound impact on agriculture by different means, which necessitate
information for better decision making for growers, suppliers and markets. The effectiveness of farmer response
to changing climate is enhanced by the improved human capital of farmers (Schultz 1975). Therefore, rural
schooling, farmer training and communication networks need to be improved for climate change adaptation. The
livelihood of millions of farmers will be influenced directly by climate change, as food prices are likely to
increase. Hence, developmental efforts including attention to warming, precipitation changes, increased climate
variability and market impacts are driven by changes in climate and climate policy require re-examination
(World Bank 2009). Adaptation strategies should be incorporated locally with globally acceptable policies,
which demand improved global connections via international trade and other global linkages (Martin &
Anderson 2010).
Win-win action plan for climate change adaptation

A win-win approach is required for climate change adaptation along with policy interventions and
institutional synergies. A crucial component possesses enhancing knowledge allocation and developing aptitude
by creating and integrating national and regional knowledge networks or platforms for dissemination of climate-
smart agricultural practices and technologies. There are a large number of technologies and practices to scale
and speed of climate change requires considerable investment in filling knowledge gaps in research. It includes
the development of a decision-support system for prioritizing adaptation and mitigation options. Early action for
climate-smart agriculture must involve:
 Scaling up high-quality agricultural management practices and technologies with adequate funding to
enhance the adaptive capacity.
 Strategy and policy expansion with enhanced institutional engagement.
 Demonstration of the economic feasibility of existing good practices, sustaining indigenous traditional
practices in different localities and identifying key areas.
 Testing, monitoring, reporting and verification of methods for better agriculture management under
simulated climate in farmer’s field.
 Piloting and scaling up market-based mechanisms for mitigation
A scheme for revisiting the specific priorities with institutional mechanisms along with policy principles for
climate change adaptation has been outlined in figure 1.
Policy priorities
Expand public agricultural resilience and R&D
Increasing public agricultural R&D investments is essential and important for agricultural productivity under
long-term lowering food prices (World Bank 2009). Resilience in these R&D investments under climate change
should target improvements in agricultural productivity, resistance to more variable growing conditions, water
use efficiency and better agricultural water management. New crop and trait combinations with improved soil
and water management practices will be required to meet demands for global food security. Policymakers need
to formulate policies for incentives and proper funds to improve public agricultural research capacity devoted to
poor regions, especially those facing severe climate change.
Encourage partnership between public and private R&D
Industry and government R&D can play complementary roles. A bridge between emerging public-private
sector R&D in agriculture should be constructed so that dissemination and exchange of adaptation technologies
are more frequent.
Chaturvedi et al. (2018) 5(1): 14–18
Harness agricultural biotechnology and water management

Support for agricultural biotechnology for adaptation in agriculture is emergent, but there remains lacuna
using agricultural biotechnology, and to develop forward-looking regulatory frameworks for climate change
adaptation (Fedoroff et al. 2010). Hence, use of agricultural biotechnology and regulations should be made
flexible. Similarly, irrigation scheduling and crop water requirement for better water management is essential
for sustainability.
Better information and forecasting
Investment in modern information-forecasting devices and techniques should be fostered with rapid pace on
regional as well as global scales so that improved accuracy may be achieved in modeling techniques with long-
term seasonal forecasts.
Support competitive and responsive agricultural markets
Encouragement of input and output agricultural markets with a competence and responsiveness under
climate change should be given priority in making future policies and institutional frameworks. Adequate
communication and transportation infrastructure should be integrated in competitive input and output
agricultural markets to delimit their ability to respond efficiently. Improvements in communications will help in
integration of spatial agricultural markets as a quick policy response (Jensen 2007).
Improved GHG emission measurements
At present, carbon markets refining the GHG markets which stimulate innovation of adaptation technologies
requires a reduction in global GHG emissions. As a policy response, effective measurement of GHG emissions
in agriculture involves institutional innovation, technological hardening and a better understanding of GHG
measurements.
Institutional Frameworks
Institutions for information, dissemination and communication
For assessing the impacts of climate change on agricultural production, institutions play a key role.
Therefore, for the dissemination of information provided by such R & D sectors, separate institutions with
standard regulations should be incorporated in climate resilient agriculture management. These include
institutions engaged in agricultural research, extension, agricultural production and marketing statistics and
provision of climate-related information. Recently, International Institute for Environment and Development
(IIED) has reported some key issues that need to be addressed in designing agricultural research programs that
are responsive to climate change (Anderson et al. 2010). Improving the use of climate science data for
agricultural planning can reduce the uncertainties generated by climate change and improve early warning
systems.
Generate climate field schools
For incorporating climate information within the farm, schools should be opened which will be beneficial for
farmers on-farm decision making and substantial improvement subsequently generating early warning system.
Such efforts were made in countries like Indonesia (FAO 2010).
Institutions to improve co-ordination and collection of socio-economic data
Proper co-ordination between institutions assessing climate change impacts is the need of the present era for
collecting data from diverse regions. Therefore, with standard regulatory mechanisms for coordinating various
institutes to work hand in hand, collection of socioeconomic data along with farmer's perceptions becomes
important for climate change adaptation strategies.
Institutions to support financing and insurance
Climate-smart agriculture needs extended investments at the farm level to enhance the resilience under
varying climate (McCarthy et al. 2011). So, there must be such institutions which could support farmers in
financing and insurance needs. Capturing the synergies between mitigation and food security is a key
opportunity for climate-smart agriculture requiring institutional capacity as well as reduced transaction costs.
Climate forecast and agri-management clinics
At each block and district level, climate forecast management clinics should be established to disseminate
knowledge among big and smallholders. These clinics should have a group of scientists, skilled persons and
Chaturvedi et al. (2018) 5(1): 14–18
self-help groups from diverse fields of agricultural sciences such as agronomy, pathology, soil science, plant
physiology etc. It will also be helpful in explaining basic physiological, agronomical and pathological aspects
through farm demonstrations. It should be used as agri clinics/ agri business and also as KVKs.
Reconstruction of Policy principles/ Institutional mechanism

Essential principles
Promoting Global Improved Sufficient Easy access Improved

economic policy flow of finance to to existing trade
development response information knowledge
poor
through and
with local farmers
sustained systematic
Adaptation
agricultural elasticity
production and
strategies
reduced poverty Steps towards climate resilient agriculture
Desirable Principles Adaptability Marketability Manageability
Acceptable Consumer friendly Proper management

Financial aspects Out put Effective monitoring
mechanism
Win-Win Strategies Institutional frameworks

Expand public agricultural research Institutions for information,
capacity and resilience dissemination and communication
Harness water management Generate climate field schools
Encourage partnership between public Institutions to improve co-ordination

and private R & D and collection of socio-economic
institutional data
Improved information and forecasting
Institutions to support financing and
insurance
Support competitive and responsive
agricultural markets Climate forecast, Agri-management
clinics
Improve GHG emission measurements
Institutions for logical framework
designing
Figure 1. Schematic representation of policy interventions with institutional framework for climate change adaptation.
Institutions for logical framework designing

Climate-resilient agriculture needs a proper management, which is acceptable to farmers through logical
framework designing (NORAD 1999). It requires effective performance management and monitoring of the
ongoing projects towards the achievement of specified objectives. Also, regular reporting of results to decision-
makers will improve the performance index of certain problems.
Chaturvedi et al. (2018) 5(1): 14–18
CONCLUSION
Climate change poses a major challenge for agriculture at the global level. Therefore, revisiting the policy
options with institutional reforms is the need of the hour for adapting the climate risks. Key policy framework
includes innovative institutions, technologies, and management systems, as well as the necessary financing
mechanisms. Areas of utmost importance comprise agricultural research, irrigation, rural roads, information
technologies, market support, and extension services. Cooperation among Governments for effective
implementation of adaptation and mitigation strategies and to explore financial means for addressing climate
change is essential. Apart from these issues, a strong public-private partnership is warranted for generating
climate resilience.
ACKNOWLEDGEMENTS
We are grateful to Executive Director, Centre for Water Resources Development and Management
(CWRDM), Kerala for providing essential support and encouragement for this work. Authors wish to thank the
anonymous reviewers and editor for fine tuning the paper.
REFERENCES
Anderson S, Gundel S, Vanni M (2010) The impacts of climate change on food security in Africa: a synthesis of
policy issues for Europe. IIED, London.
FAO (2010) “Climate Smart” Agriculture: Policies, practices and Financing for Food Security, Adaptation and
Mitigation. Food and Agriculture Organization, Rome.
Fedoroff NV, Battisti DS, Beachy, RN, Cooper PJM, Fischhoff DA, Hodges CN, Knauf VC, Lobell D, Mazur
BJ, Molden D, Reynolds MP, Ronald PC, Rosegrant MW, Sanchez PA, Vonshak A & Zhu JK (2010)
Radically rethinking agriculture for the 21st century. Science 327 (5967): 833–834.
IPCC (2007) Climate Change 2007: Synthesis Report. Contributions of Working Groups I, II, and III to the
Fourth Assessment Report of the Intergovernmental Panel on Climate Change. IPCC, Geneva.
Jensen R (2007) The digital provide: information (technology), market performance, and welfare in the South
Indian fisheries sector. The Quarterly Journal of Economics 122 (3): 879–924.
Martin W, Anderson K (2010) Trade distortions and food price surges. In: Paper for the World Bank-UC
Berkeley conference on agriculture for development—revisited, Berkeley 1: 1–2.
McCarthy L, Lipper L & Branca G (2011) Climate-smart agriculture: smallholder adoption and implications for
climate change adaptation and mitigation. Mitigation of Climate Change in Agriculture Working Paper 3: 1–
37.
Nelson G (2009) Climate Change: Impact on Agriculture and Costs of Adaptation. IFPRI, Washington, DC.
NORAD (1999) The Logical Framework Approach, Handbook for objectives-oriented planning, Fourth edition,
Norwegian Agency for Development Cooperation ISBN 82-7548-160-0.
OECD Economic Surveys: India 2017. Executive summary; OECD Economic Surveys: India, pp. 1–58.
Schultz T (1975) The value of the ability to deal with disequilibria. Journal of Economic Literature 13(3): 827–
846.
Seo S (2010) Is an integrated farm more resilient against climate change? A micro-econometric analysis of
portfolio diversification in African agriculture. Food Policy 35 (1): 32–40.
World Bank (2009) Development and Climate Change. World Bank pp. 12.
ISSN (E): 2349 – 1183
ISSN (P): 2349 – 9265
5(1): 19–26, 2018
DOI: 10.22271/tpr.2018.v5.i1.004
Research article
Comparative epidermal anatomical studies in six taxa of genus

Nephrolepis Swart in Nigeria
A. A. Fajuke, A. M. Makinde, F. A. Oloyede and J. A. Akinloye*
Botany Department, Obafemi Awolowo University, Ile-Ife, Osun State, Nigeria
*Corresponding Author: ajakinloye@gmail.com [Accepted: 28 January 2018]
Abstract: Anatomical studies in six taxa of genus Nephrolepis; N. biserrata, N. cordifolia, N.

exaltata (i) & (ii), N. biserrata var. furcans and N. undulata were carried out with a view to
identify anatomic characters of taxonomic values. Both qualitative and quantitative anatomical
studies were carried out. Quantitative data were subjected to descriptive statistical analysis.
Anatomical characters studied include venation patterns, trichome types, presence and absence of
stomata and values of the stomatal index which are valuable in delimiting the species. The overall
results showed overlaps in the quantitative anatomical attributes of the Nephrolepis taxa studied
suggesting that they belong to the same genus. Qualitative anatomical attributes that separated the
genus into distinct taxa are the presence of simple multicellular glandular trichomes in N. biserrata
and simple multicellular non-glandular trichomes in N. exaltata (i) and N. exalta (ii) while N.
biserrata var. furcans and N. undulata have simple unicellular non-glandular trichomes and
absence of trichome in N. cordifolia. Presence of anisocytic, diacytic or anomocytic stomata were
of diagnostic important in the six taxa.
Keywords: Anatomy - Stomata - Trichomes - Nephrolepis - Taxonomy.
[Cite as: Fajuke AA, Makinde AM, Oloyede FA & Akinloye JA (2018) Comparative epidermal anatomical
studies in six taxa of genus Nephrolepis Swart in Nigeria. Tropical Plant Research 5(1): 19–26]
INTRODUCTION
Nephrolepis Schott is a small genus of ferns that form groups of about 12,000 species in the world, with
many found in the tropics (Carrington 2003). Alston (1959) reported five species of Nephrolepis in both
Northern and Southwestern Nigeria, while Oloyede & Odu (2011) reported six taxa of Nephrolepis in
Southwestern Nigeria. The genus is made up of terrestrial, epiphytic, perennials and sometimes aquatic
(growing in the marshy land). They are flowerless, seedless plants that require water at least during sexual
reproduction (Sporne 1975, Oloyede & Odu 2011). The leaflets are simple, sessile, small in size and possess a
single median vein that fails to reach the apex. These leaves are hairy with serrated margins. The leaves of ferns
are called fronds and consist of two main parts: the stipe which is the stalk that connects the leaf blade to the
rhizome and the leaf blade or lamina that forms the leaf portion which expands outward from the rachis of the
frond.
In ferns, the base of the frond grows faster than the tip which gives the frond a fiddle-head shape (Kenrick &
Crane 1997), this is called acropetal maturation. Leaf base in Nephrolepis could be cordate in N. furcans or
truncate in N. exaltata (i) and (ii). The leaves are spirally arranged and densely cover the branches as a whorled
in Lycopodium species (Bhambie 1965). They differ from the primitive thallophytes by having true leaves called
megaphylls while they also differ from bryophytes by possessing vascular tissues (Carrington 2003).
The taxonomic values of anatomical features have been stressed by several workers including (Metcalfe &
Chalk 1950, 1979, Naik & Nirgude 1981, Palmer & Tucker 1981, Oloyede et al. 2011). Anatomical features
sometimes prove useful in individual identification especially for materials that are not accompanied by flora
parts or fruits and can be used to establish the botanical identity of commercial samples of medicinal plants
(Metcalfe & Chalk 1979). It has a lot of values in forensic Botany. Naik & Nigurde (1981) stressed the value of
anatomical characters and reported that anatomical characters provide additional features which along with other
characters are of great taxonomic values in the classification and identification of plants. Essiet (2004) reported
Received: 17 June 2017 Published online: 31 January 2018
Fajuke et al. (2018) 5(1): 19–26
that anatomical features are widely used in systematic for identification, and placing anomalous groups in
satisfactory position in classification and for indicating patterns of relationship that may have been observed by
superficial convergence in morphological features.
Leaf epidermal features have been employed in taxonomy to separate plant genera and species (Scatena et
al. 2005). The epidermis possesses a number of important diagnostic characters that offer valuable clues for
identification like size, shape and orientation of stomata, guard cells and subsidiary cells, structural peculiarities
of epidermal cells and stomata frequency (Munir et al. 2011). Saheed & Illoh (2010) reported that guard cell
area, stomatal index and frequency, presence or absence of trichomes as well as their length on epidermal
surfaces and wall types are useful in separating the genera Senna and Chamaecrista from their initial genus
Cassia. Oloyede et al. (2011) reported that the abaxial surface of N. biserrata and N. undulata showed that their
epidermal cells were irregular in shape, while the stomata were diacytic, anomocytic and elliptic in shape.
Crystal sand seen was numerous while non-glandular uniserrate multicellular trichome was seen in N. biserrata
but absent in N. undulata. Watson & Dallwitz (1992) described the important anatomical features of the family
Cleomaceae with anomocytic, anisocytic, paracytic, actinocytic or cylocytic stomata found on the both the
abaxial and adaxial surfaces. The presence and types of trichome have long been of considerable importance in
comparative systematic investigations of angiosperm Metclfe & Chalk (1979) and ferns (Oloyede et al. 2011).
Crystals are diagnostic tools in plants for distribution, identification and taxonomy (Illoh & Inyang 1995). In
Nephrolepis biserrata and N. undulata, the common characters like epidermal cell structure, types of stomata,
trichomes, crystals, venation patterns and morphological structures can be used to delimit the two species of the
genus (Oloyede et al. 2011).
From literature, information on anatomical features of Nephrolepis genus in Nigeria is scanty. In this study,
detail anatomical characters of the six taxa of Nephrolepis investigated were examined using Ligth Microscope
with a view to (a) elucidate the similarities and differences that exits among the species and (b) fill the
knowledge gap observed in the taxonomy of the group in Nigeria.

Collections of Accessions
Accessions of the six samples of Nephrolepis studied were collected from various locations in Ile-Ife and
planted at the biological garden of Obafemi Awolowo University, Ile-Ife, Osun State, Nigeria from where macro
morphological data were collected. The collections were identified and authenticated at the IFE Herbarium. N.
exaltata is only species that has two forms of leaf type; unipinnate at young stage [N. exaltata (i)] and bipinnate
at maturity [N. exaltata (ii)] and treated here separately.
Leaf clearing
A sizeable portion of fresh mature leaflets of each taxa was taken from the standard median levels (that is
midway between the apex and the base), washed and decolorized by boiling in 100% ethanol for ten minutes to
remove chlorophyll. The partially decolorized leaflets were washed carefully with 3–5 changes of water to
remove all the traces of alcohol. The leaflets were boiled in sodium hydroxide solution for five minutes. Then
soaked in 5% domestic bleach (JIK) in Petri dish until they become completely decolorized. The leaflets were
washed in five changes of water and then stored in 50% ethanol. The leaflets were stained with Safranin O for 5
minutes and then mounted on a clean slide in 25% glycerol and the edges of the cover slip were sealed with nail
hardener to prevent drying out. Both abaxial and adaxial surfaces of the leaflets were used to study venation
patterns.
Epidermal peel
The cleared leaves were used because the stomata and epidermal anatomy were clearly visible under the
microscope without peeling. Each taxa, 25 stomata were randomly selected in 20 fields from four prepared
slides of the abaxial surface of each taxa. Stomata frequency was determined. The stomata index was estimated
for the leaf surfaces using Cutter (1978) formula i.e. by expressing the number of stomata per unit area as a
percentage of the total number of epidermal cells.
S
Stomata index (I) = X 100
ES
Where, I = Stomata index
S = number of stomata per unit area
Fajuke et al. (2018) 5(1): 19–26
E = number of epidermal cells per unit area.

The guard cell area was calculated by multiplying the length and width of guard cell on the abaxial surface
by Franco (1939) constant.
Guard cell area = (length × width × k) µm2
Where, Franco’s constant (k) = 0.78524
Sectioning
Transverse sections (TS) of the leaf of the six taxa were made at 10 µm thickness using the sledge
microtome (Reichert, Austria). The sections were preserved in 50% ethanol in vials prior to staining.
The sections were stained with Safranin O for five minutes, rinsed in water thrice and counter stained with
Alcian blue for five minutes and rinsed in water thrice. Stained sections were treated in series of grades of
ethanol (50%, 70%, 80%, 90% and 100%) to differentiate the sections. The differentiated sections were
mounted in 25% glycerol on a clean slide, covered with a cover slip and sealed with nail hardener and properly
labeled.
Microscopy
Microscopic observations were done using a light microscope. Tissues, cells and cell inclusions were
identified, described and recorded for taxonomic studies.
Photomicrography
Photomicrographs of the slides were made using Accu- scope trinocular microscope (ACCU-Scope 3001
LED Trinocular microscope with 3.2 MP CMOS digital camera).
Statistical Analysis
The results of the quantitative anatomical data generated were subjected to single Linkage Cluster Analysis
to show if there exists a significant difference in the six taxa studied.
RESULTS AND OBSERVATION

Anatomical Studies
The summary of the quantitative anatomical features of the six taxa of Nephrolepis studied (Table 1) was
used to generate dendrogram and cluster analysis (Fig. 1). The Dendrogram produces two main clusters
comprising Nephrolepis biserrata (Sw.) Schott, and N. exaltata (L.) Schott. while the second cluster is made of
N. cordifolia (L.) C. Presl, N. biserrata ver. furcans hort. ex L.H. Bailey and N. undulata (Afzel. ex Sw.) J. Sm.
The two main clusters had two sub-clusters each. N. biserrata is separated from N. exaltata (i) with unipennate.
N. exaltata (ii) with bipinnate, which are on the same cluster because they are closely related in having curled
and sterile leaflet and some other features e.g. runners. The other sub-cluster gave N. cordifolia and N. furcans
on the same cluster showing the close relationship (leaflet is compound unipinnate), while N. undulata is
separated for being epiphytic.
Artificial taxonomic key to six Nephrolepis taxa generated from the clustered assemblege of Nephrolepis
using anatomical characters
1a Fertile leaflet
2a parallel vein, vein sheath, veinlet ending in sori, trichome glandular ………………………… N. biserrata
2b vein not parallel, vein not sheathed, veinlet ending in hydathode, trichome not glandular
………………………………………………………………………………….……. N. biserrata var. furcans
3a tuber present, mid-rib not thick, trichome present, palisade mesophyll cells cylindrical, root hairs
absent ………………………………………………………………………………………….. N. undulata
3b tuber absent, mid-rib thick, trichome absent, palisade mesophyll cells not cylindrical root hairs present
………………………..………………………………………………………………….…… N. cordifolia
1b Leaflet not fertile
4a reticulate vein, stomata largely anomocytic, uniseriate epidermis, leaflet simple, linear
………………………………………………………………………………………….……..… N. exaltata (i)
4b non-reticulate vein, stomata not anomocytic epidermis not uniseriate, leaflet coiled
……………………………………………………………………………………………...…... N. exaltata (ii)
Fajuke et al. (2018) 5(1): 19–26
This report displays the dendrogram which visually displays a particular cluster configuration of Nephrolepis
biserrata, N. cordifolia N. exaltata (i), N. exaltata (ii), N. biserrata var. furcans and N. undulata. Rows that are
close together i.e. N. cordifolia and N. biserrata var. furcans, N. exaltata (i) and N. exaltata (ii) have small
dissimilarities. Therefore, these taxa are closely related and are very similar. Also, N. undulata is similar to N.
cordifolia and N. biserrata var. furcans. N. undulata, N. cordifolia and N. biserrata var. furcans are different
from N. exaltata (i) and N. exaltata (ii). N. biserrata is very different from other taxa.
Table 1. Summary of the Quantitative Anatomical features of the six Nephrolepis taxa studied.
N. biserrata
N. biserrata N. cordifolia N. exaltata (i) N. exaltata (ii) N. undulata
var. furcans
Characters Abaxial Adaxial Abaxial Adaxial Abaxial adaxial abaxial Adaxial Abaxial adaxial Abaxial adaxial
GCA 10.76 0 8.06 0 2.58 0 2.56 0 10.34 0 10.22 0
GCW 3.05 0 1.15 0 1.64 0 1.52 0 2.59 0 2.52 0
GCL 5.25 0 2.38 0 1.21 0 1.32 0 3.37 0 4.75 0
SFP 8 0 9 0 4 0 4 0 7 0 4 0
STI 13.45 0 18.36 0 29.41 0 29.34 0 8.06 0 13.11 0
LEC 8.96 6.2 2.89 5.8 3.15 4.5 3.12 4.3 8.47 13.84 12.46 13.3
WEC 4.06 3.92 3.15 3.65 3.55 4.08 3.45 4.04 7.24 7.2 5.85 6.68
EPF 37 50 34 46 62 82 66 84 31 48 30 39
NTS 130 142 0 0 66 80 32 12 15 18 3 5
LTF 10 15 0 0 8 8 9 3 10 10 30 30
NVF 48 52 35 28 12 18 14 16 40 42 30 35
LVF 20.5 20.5 10.7 10.7 30.3 30.5 31.2 30.4 19 21 20.3 20.5
TOV 0.05 0.05 0.5 0.5 0.05 0.03 0.04 0.03 0.2 0.3 0.05 0.02
DME 1.5 1.5 1.5 1.5 1.5 0.9 1.5 1.1 1.8 1.6 1.3 1.2
TOR 2.5 2.5 4 4 1 2 1.1 1.1 0.7 0.6 0.4 0.2
Note: GCA- Guard cell area (µm²) ± S.E. N=25; GCW- Guard cell width (µm); GCL- Guard cell length (µm); SFP- stomata frequency
per field; STI- stomata Index %; LEC- length of epidermal cell (µm); WEC- width of epidermal cell (µm); EPF- epidermal cell per field
(µm); NTS- number of trichome per leaflet surface; LTF- length of trichome per field; NVF- number of veins per field; LVF- length of
veins per field; TOV- thickness of veins; DME- distance between leaflets margin; TOR- thickness of costa (mid-rib); and veinlet
endings.
Figure 1. Dendrogram of the six taxa of Nephrolepis studied based on quantitative data from anatomical features. [2-
Nephrolepis biserrata, 3- N. cordifolia, 4- N. exaltata (i), 5- N. exaltata (ii), 6- N. biserrata var. furcans and 7- N. undulata]
Fajuke et al. (2018) 5(1): 19–26
Figure 2. Leaflet anatomical study of Nephrolepis taxa. (AST- anisocytic stomata; EP- epidermal cell; GTR- trichome; ST-
stomata; DIC- dichotomously branched vein; PV- primary vein; MR- mid-rib; VE- vein ending in hydathode/sori; VI-
diacytic stomata; DG- deep groove at the margin; CC- costa cell; all in 400x)
Leaflet anatomical study of Nephrolepis biserrata (Fig. 2A & B)

Abaxial Surface:
The epidermal cell is irregular and undulating. The anticlinal wall is thin and undulating. Stomata are
anisocytic, diacytic and anomocytic. Stomata frequency was 7–9. Long, glandular multicellular trichomes which
are numerous are seen on the abaxial surface.
Adaxial Surface:
Epidermal cells irregular, thin and undulating. No stomata. Long, glandular multicellular trichomes are seen.
Leaflet anatomical study of Nephrolepis cordifolia (Fig. 2C & D)
Abaxial Surface:
The epidermal cell is irregular in shape, thick and undulating. The anticlinal wall is thick and undulating.
Some depressions or grooves at the margin. Stomata are anisocytic. Stomata frequency was 8–10. No trichome.
Few starch grains are present. There is groove at the margin.
Adaxial Surface:
The epidermal cell is thick, irregular in shape and undulating, no stomata and no trichome. Few starch grains
were seen. There is no groove at the margin.
Leaflet anatomical study of Nephrolepis exaltata (i) (Fig. 2E & F)
Abaxial Surface:
The epidermal cell is irregular in shape and anticlinal wall were thin and undulating. Stomata are present and
are diacytic, anisocytic and anomocytic. Stomata frequency was 3–5. Trichome was simple, uniseriate,
multicellular non-glandular and numerous in the lamina. Few starch grains are present. Depression or groove
was seen at the margin.
Adaxial Surface:
Epidermal cells were irregular in shape, thin and undulating. Stomata are absent. Trichome was simple,
uniseriate, multicellular non-glandular and numerous at the lamina. Depression or grooves were seen at the
proximal to the median of the margin.
Fajuke et al. (2018) 5(1): 19–26
Leaflet anatomical study of Nephrolepis exaltata (ii) (Fig. 2G & H)

Abaxial surface:
Epidermal cells were polygonal to irregular in shape. Anticlinal walls were thin and undulating. Anisocytic,
diacytic and anomocytic stomata type were seen. Stomata frequency was 2–4. Non-glandular uniseriate
multicellular trichomes present. Depression or grooves were seen at the margin.
Adaxial surface:
The epidermal cells were polygonal to irregular in shape. Anticlinal walls seen were thin and undulating. No
stomata seen. Non-glandular, uniseriate, multicellular trichomes were seen. Starch grains present and numerous.
Leaflet anatomical study of Nephrolepis biserrata var. furcans (Fig. 2I & J)
Abaxial surface:
Epidermal cells were irregular, thin and undulating. Diacytic and anisocytic stomata were seen while stomata
frequency was 4–9. Few trichomes present. Leaflets form deep depressions or grooves at the tip to form
emarginate apex. Numerous starch grains are present.
Adaxial surface:
Epidermal cell was irregular in shape, thin and undulating. Stomata are absent. No trichome. Depression or
groove at the leaflet surface.
Leaflet anatomical study of Nephrolepis undulata (Fig. 2K & L)
Abaxial surface:
Epidermal cells were irregular in shape, thin and undulating. Anisocytic stomata were seen. Stomata
frequency was 3–5. Few unicellular non-glandular trichomes were seen at the lamina. Few starch grains are
seen.
Adaxial surface:
Epidermal cells are irregular in shape. Anticlinal wall was thin and undulating. Stomata are absent. Few
unicellular non-glandular trichomes were seen.
DISCUSSION
The anatomy of the leaflets of Nephrolepis showed various degrees of differences and similarities that can be
used for taxonomical studies. These anatomical features such as the absence of trichome in N. cordifolia which
can be used to separate this species while the presence of anisocytic stomata shows that they are related and
have a common evolutionary origin are a lot of taxonomic values in the six taxa of Nephrolepis studied in this
work. The result of this study is similar to other workers who reported similar results. They include Carlquist
(1961) who stated that the leaf provides a variety of anatomical features that can be of taxonomic importance.
Illoh (1995) reported on Celosia species that the presence and absence of crystals were used in identification,
Adedeji (2004) on the anatomy of Emilia species reported the shapes of the mid-ribs are relatively the same in
the two species, Ogundipe (2004) on Sapindaceae observed anomocytic stomata in the three species of Blighia
studied and Oloyede et al. (2011) on N. biserrata and N. undulata reported non-glandular uniserrate
multicellular trichome in N. biserrata but was absent in N. undulata In this study, the leaflets of the six taxa
showed remarkable variations on both abaxial and adaxial surfaces. There is variation in the number of veins
and length of veins per field as N. biserrata recorded the highest of 52 veins on the adaxial surface and 48 veins
on the abaxial surface while the lowest of 17 veins on the adaxial and 15 on the abaxial surface in N. exaltata (i)
and (ii) The length of veins per field as in N. exaltata (i) and (ii) having 30.5 and 30.4 µm at the adaxial surface
and 30.3 and 31.2 µm at the abaxial surface respectively as the highest while N. cordifolia recorded the lowest
value of 10.7 µm at both the adaxial and abaxial surfaces respectively. Epidermal cells in this genus are irregular
in shape, with thin undulating anticlinal walls. However anticlinal wall of N. biserrata, N. cordifolia and N.
biserrata var. furcans on both abaxial and adaxial surfaces are thick thus delimiting the taxa. From the study the
length of the epidermal cells of members of this genus shows that N. biserrata var. furcans has the longest 8.74–
18.93 µm long and 6.92–8.94 µm wide on the adaxial surface while the least was observed in N. exaltata (i) &
(ii) as 2.28–5.75 µm long and 2.65–4.12 µm wide. But the abaxial surface of N. biserrata var. furcans as the
highest with 10.92–16.02 µm long and 6.92–7.56 µm wide while N. exaltata (i) had the lowest with 2.75–3.55
µm long and 2.85–4.25 µm wide. Based on the epidermal cell lengths Nephrolepis species can be delimited.
Solerender (1908) and Metcalfe & Chalk (1950) reported that stomata type is of taxonomic value. All the
Fajuke et al. (2018) 5(1): 19–26
six taxa studied are hypostomatic and they are largely anisocytic. In addition, N. biserrata, N. exaltata (i), N.
exaltata (ii) and N. biserrata var. furcans have diacytic as well as anomocytic. The presence of anisocytic
stomata in all the taxa shows that they are related and have a common evolutionary origin and are generic
characters for the genus Nephrolepis.
A marked difference in the stomata frequency was reported in the study. For instance, stomata frequency in
N. cordifolia was 8–10 which is the highest while N. undulata had 3–5 as the least. N. biserrata had 6–8, N.
exaltata (i) & (ii) 2–4, while N. biserrata var. furcans (a variet of biserrata) had 1–3 respectively. These
differences in the stomata frequency could be used as taxonomic value to delimit the taxa (Table 1; Fig. 1).
Stomata indices in the members of this genus are different. For example, stomata index in N. exaltata (i) was
highest with 24.41% while N. biserrata var. furcans had the least with 8.06%. The variation in the stomata
index in this study can be reasonably employed in delimiting the Nephrolepis species. Adedeji & Jewoola
(2008) reported that the stomata index is constant for any given species and the value is more uniform on the
abaxial surface than the adaxial surface except in an isobilateral leaf.
Essiett et al. (2010) reported that stomatal index and the guard cell area provide values that will serve as
parameters for comparison among taxa, which can be useful for identification of the studied taxa. Essiett &
Etukudo (2012) on their study on three species of Acalypha occurring in Nigeria also reported that variation in
stomata index and guard cell areas are useful diagnostic tools. This study reported differences in guard cell areas
as. N. biserrata had the highest guard cell area of 4.70–5.80 µm square long and 2.5–3.6 µm square wide while
N. exaltata (i) had the least with 1.17–1.25 µm square long and 1.52–1.75 µm square wide.
The uses of trichomes in delimiting taxa are reported in literature for example Saheed & Illoh (2010) used
the presence and absence of trichomes to separate the genera Senna and Chamaecrista from their initial genus
Cassia. N. biserrata recorded the highest number of trichome per leaflet surface with 142 on the adaxial and 130
on the abaxial surface followed with N. exaltata (i) having 80 on the adaxial and 66 on the abaxial while N.
biserrata var. furcans has 18 on the adaxial and 15 on the abaxial and N. undulata had the least with 5 on the
adaxial and 3 at the abaxial respectively (Table 1). In addition, N. biserrata have simple multicellular glandular
trichome which is specific to the taxon while N. exaltata (i), N. exaltata (ii) and N. biserrata var. furcans and N.
undulata have simple unicellular non-glandular trichome. N. cordifolia have no trichome. Trichomes of
different types, sizes and numbers are therefore good diagnostic feature for taxonomic studies in this genus
(Table 1).
CONCLUSION
The results from anatomical studies revealed the affinities, similarities and differences among members of
the genus Nephrolepis studied. Anatomically, Nephrolepis taxa studied showed generic features common to all
the selected taxa. In all the six taxa, vein arrangement was dichotomously branched but the veinlet ending can
be grouped into two; the fertile leaflets of N. biserrata, N. cordifolia and N. undulata have their veinlets
terminated with sori while the sterile leaflets of N. exaltata (i), N. exaltata (ii), and N. biserrata var. furcans do
not have sori. Stomata type, stomatal index and stomata area are useful in delimiting the taxa. Anisocytic
stomata are common to all. However, the presence of diacytic in N. biserrata, N. exaltata (i), N. exaltata (ii) and
N. biserrata var. furcans and the presence of anomocytic in N. biserrata, N. exaltata (i) and N. exaltata (ii)
clearly demarcate them from the other taxa. The presence of simple multicellular glandular trichomes in N.
biserrata, simple multicellular non-glandular trichomes in N. exaltata, and simple unicellular non-glandular in
N. biserrata var. furcans and N. undulata is diagnostic while total absence of trichomes in N. cordifolia is taxon
specific and delimits it from the remaining.
ACKNOWLEDGEMENT
Authors are thankful to the Botany Department, Obafemi Awolowo University, Ile-Ife, Osun State, Nigeria
for providing necessary facilities.
REFERENCES
Adedeji O (2004) Leaf epidermal studies of the species of Emilia Cass. (Senecioneae, Asteraceae) in Nigeria.
Botanical Lithuanica 10(2): 121–133.
Adedeji O & Jewoola OA (2008) Importance of leaf epidermal characters in the Asteraceae family. Notulae
Botanicae Horti Agrobotanici Cluj-Napoca 36(2): 7–16.
Fajuke et al. (2018) 5(1): 19–26
Alston AHG (1959) Ferns and ferns-allies of West Tropical Africa, 2nd edition. Crown Agents for Oversea
Governments and Administrations, London, pp. 1–60.
Bhambie S (1965) Studies in Pteridophytes: The Development, Structure and Arrangement of Leaves in some
species of Lycopodium. Proceedings of Indian Academy of Science 58: 153–164.
Carlquist S (1961) Comparative plant Anatomy. Holt, Rinehart and Winston, New York Press.
Carrington CM (2003) Families of vascular plants. Botany 307F. University of Toronto. Available from:
page.tim.dickinso@utorotoc.ca. (accessed 22 March, 2005).
Cutter GC (1978) Plant Anatomy, Part 1, 2nd edition. Edward Publishers Limited, London, pp. 119–126.
Essiett UA & Etukudo IS (2012) Leaf epidermal studies of three species of Acalypha Linn. (Euphorbiaceae).
Advances in Applied Science Research 3(5): 3185–3199.
Essiett UA (2004) Petiole anatomy for systematic purposes in Eremonastax polysperma, Justica insulari and
Asystacia gangetica (Acanthaceae). World Journal of Applied Science and Technology 2(1): 69–75.
Essiett UA, Bala ON & Agbakahi JA (2010) Pharmacognostic studies of the leaves and stems of Dioda
scandens Sw in Nigeria. Archives of Applied Research 2(5) 184–198.
Franco C (1939) Relation between Chromosome Number and the stomata in coffea. Botanical gazette 100: 817–
82.
Illoh HC & Inyang UE (1995) Foliar epidermis and petiole anatomy in some Nigerian Solanium Linn. Species
in the sub-genus Leptostemonum (BITT) DUN. Climpses in Plant Research 12: 73–86.
Illoh HC (1995) Foliar epidermis and petiole anatomy of four species of Celosia L. in Nigeria. Feddes
Repertorium 106(1–2): 15–23.
Kenrick P & Crane PR (1997) The origin and early evolution of plants on land. Nature 389(4): 33–39.
Metcalfe CR & Chalk L (1950) Anatomy of the Dicotyledons, 1st edition. Clarendon Press, Oxford, pp. 222–
234.
Metcalfe CR & Chalk L (1979) Anatomy of the Dicotyledons, 2nd edition. Clarendon Press, Oxford, pp. 1–75.
Munir M, Khan MA, Ahmed A, Beno A, Ahmed K, Tariq S, Tabassur T, Mukhtar M, Ambreen M & Bashir S
(2011) Foliar Anatomy of some Ethnobotanical Important Species of Wild Edible Fruits of North Pakistan.
Journal of Medicinal Plants Research 5(24): 5871–5880.
Naik VN & Nirgude SM (1981) Anatomy in relation to taxonomy of Chlorophytum (Liliaceae). Indian Journal
of Botany 4(2): 48–60.
Ogundipe OT (2004) Foliar micromorphology of the species of Blighia konig (Sapindaceae) in West Africa.
Nigerian Journal of Botany 17: 53–61.
Oloyede FA & Odu EA (2011) Taxonomic Evaluation of Homosporous Leptosporangiate Ferns (Pteridophytes)
in South-Western Nigeria. International Journal of Current Research 2(2): 9–17.
Oloyede FA, Akomolafe FG & Oladipo OT (2011) Comparative Folia Anatomical and Morphological studies of
Nephrolepis biserrata (Swartz) Scott and N. undulata (Swartz). SM. in Nigeria. Journal of Science and
Technology 31(2): 1–10.
Palmer G & Tucker AE (1981) A Scanning Electron Microscope Survey of the Epidermis of East Africa,
Grasses 1. Smithsonian Contribution to Botany, U.S.A., No. 43.
Saheed SA & Illoh HC (2010) Important Morphological Characters in Several Species of Cassiinar
(Leguminosae) in South-Western Nigeria. Notulae Scientia Biologicae 3(2): 47–56.
Scatena VL, Giuletti AM, Borba EL & vanderBerge C (2005) Anatomy of the Bracilian Ericolaceae in
correlation with taxonomy and habitat using multivariate analysis. Plant Systematics and Evolution 253: 1–
22.
Solerender P (1908) Boodle LA & Fitsch FE (Transt) Systematic anatomy of Dicotyledons. Clarendon press,
Oxford.
Sporne KR (1975) The Morphology of Pteridophytes, 4th edition. Hutchinson and Co. Publishers Limited,
London, pp. 1–107.
Watson L & Dallwitz MJ (1992) The Grass Genera. C.A.B. International. Wallingford, Oxford, 1024 p.
ISSN (E): 2349 – 1183
ISSN (P): 2349 – 9265
5(1): 27–28, 2018
DOI: 10.22271/tpr.2018.v5.i1.005
Short communication
A note on the clonal propagation of depleted threatened species

Boswellia serrata Roxb. through branch cuttings
Vivek Vaishnav1* and Ugendra Janghel2
1
Institute of Forest Productivity, Ranchi-835303, Jharkhand, India
2
State Forest Research and Training Institute, Raipur-493111, Chhattisgarh, India
*Corresponding Author: vivekvaishnaw@live.in [Accepted: 27 March 2018]
[Cite as: Vaishnav V & Janghel U (2018) A note on the clonal propagation of depleted threatened species
Boswellia serrata Roxb. through branch cuttings. Tropical Plant Research 5(1): 27–28]
INTRODUCTION
Boswellia serrata Roxb. (Family- Burseraceae) commonly known as salai guggul or Indian olibanum, is an
important deciduous medicinal tree endemic to India (Kapoor 1990, Shah et al. 2008) (Fig. 1). The oleo-gum-
resin obtained by an incision made on the trunk of the tree contains boswellic acid which is effective for the
treatment of an inflammatory disorder such as arthritis and in cardiovascular diseases (Ammon 2006). Apart
from these, due to long wood fiber, the pulpwood was extremely utilized for paper mills like Nepanagar paper
mill of Madhya Pradesh (Khan 1972).
The species is self-incompatible and the self-crossed pollen tubes are inhibited soon after their entry into the
stigma. Cross-pollinated flowers allowed normal pollen germination and pollen tube growth, and resulted in
fruit- and seed-set (Sunnichan et al. 2005). But poor fruit setting (2.6 to 10%) under open pollination,
inadequate production of viable seeds (Joshi 1981) and scanty seed germination (10–20%) restrict the
distribution and therefore limits its natural source (Purohit et al. 1995, Ghorpade et al. 2010). On the other hand,
the tree is harvested to extract the sap and to utilize the pulp in paper industries. Such problematic regeneration
and the destructions have resulted in declining of the natural abundance and the species has been classified
under threatened (Saha et al. 2015). Therefore, development of mass multiplication technique for conservation
and sustainable utilization of this species has become a serious concern. The present experiment was performed
to standardize the propagation technique of the species transferable to nurseries of forest departments.
MATERIAL AND METHODS

The branches and mature fruits were collected from five trees of Boswellia serrata Roxb of compartment
PF318, Kawardha forest division, Chhattisgarh, India (GPS coordinate: N22. 09803 E081.17348) in the month
of April (1st week). From each tree, five cuttings of 25 cm length and different thickness (1–2 cm diameter) were
prepared and after surface sterilization with fungicide (Bavistine) those were treated with Indole-3-Acetic Acid
(IAA) and Indole-3-Butyric Acid (IBA) of 500 ppm, 1000 ppm, 2000 ppm and 4000 ppm concentration
respectively (Fig. 1H). The eight bunches of cuttings were kept overnight treated with growth hormones IAA
and IBA and planted in root trainers filled with the potting mixture soil, vermicompost, and sand (1:1:2). On the
other hand, one huge branch cutting from each tree with 1m of length and 4 cm of basal diameter were also
prepared for planting (Fig. 1B,C). These cuttings were planted within same potting mixture given above,
planting 25cm deep without application of any growth regulator. Five tri-lobbed fruits from each tree were
depulped and kernels were sown in different directions (25 seeds upward and 25 seeds downward) within the
same potting mixture. The planted materials were kept in the shade house and watered daily. The regeneration
and growth data were recorded daily.
RESULT AND DISCUSSION

After 50 days of planting, no growth or differentiation could be observed in 25 cm long sized cuttings. All
seeds germinated but could grow not more than the state of small plantlets. Three out of five 1 m length branch
cuttings of thick diameter survived and first bud was initiated after 12 days of planting. First, leaf differentiation
Received: 08 January 2018 Published online: 31 March 2018
Vaishnav & Janghel (2018) 5(1): 27–28
was observed after 22 days, shoot proliferation was observed after 47 days (Fig. 1D–E). After 65 days of
planting the branch, cuttings were dug out and established rooting was confirmed (Fig. 1F).
The present investigation briefs the importance of larger explants size for rooting in Boswellia serrata Roxb.
The small-sized branch cuttings contain high quantity of gum-resin that might check the rooting even after
treatment of plant growth regulators or by another mean. Khan (1972) endorsed the selection of 100–125 cm
long and 20–25 cm thick branch cuttings for clonal regeneration of Boswellia papyrifera but the same could not
be replicated for Boswellia serrata due to the high content of gum-resin oozes out from the sap.
Figure 1. Boswellia serrata Roxb.: A, A view of a tree trunk; B–C, thick and long branch cuttings; D–E, Shoot proliferation
from large sized cuttings; F, Root proliferation from large size cuttings after 65 days; G, Seeds used for planting; H, 25 cm
long cuttings.
CONCLUSION
Although, success achieved with small number of cuttings, the experiment needs to perform further. The
successful rooting from the large size (thicker >4 cm and long >1 m) branch cuttings can be investigated in an
extended manner.
ACKNOWLEDGEMENT
The fund support from the SFRTI, Chhattisgarh is gratefully acknowledged.
REFERENCES
Ammon HP (2006) Boswellic acid in chronic inflammatory disease. Plantation Medicines 72(12): 1100–1116.
Ghorpade RP, Chopra A & Nikam TD (2010) In vitro zygotic embryo germination and propagation of an
endangered Boswellia serrata Roxb., a source of boswellic acid. Physiology and Molecular Biotechnology of
Plant 16(2): 159–165.
Joshi HB (1981) Troup's Silviculture of Indian trees, Vol. III. The Controller of Publications, New Delhi.
Kapoor LD (1990) CRC Handbook of ayurvedic medicinal plants. CRC Press, Baca Raton, Florida.
Khan MAW (1972) Propagation of Boswellia papyrifera through branch-cuttings. Indian Forester 98(7): 437–440.
Purohit SD, Tak K & Kukad G (1995) In vitro propagation of Boswellia serrata Roxb., Biologia Plantarum
37(3): 35–340.
Saha D, Ved D, Ravikumar K & Haridasan K (2015) Boswellia ovalifoliolata. The IUCN Red List of
Threatened Species 2015: e.T50126567A50131280. Available from: http://dx.doi.org/10.2305/IUCN.UK.
2015- 2.RLTS.T50126567A50131280.en. (accessed: 15 Oct. 2017).
Shah SA, Rathod IS, Suhagia BN, Pandya SS & Parmar VK (2008) A simple high-performance liquid
chromatography for the estimation of boswellic acids from the market formulations containing Boswellia
serrata extract. Journal of Chromatography Science 46(8): 735–738.
Sunnichan VG, Mohan Ram HY & Shivanna KR (2005) Reproductive biology of Boswellia serrata, the source
of salai guggul, an important gum-resin. Botanical Journal of the Linnean Society 147(1): 73–82.
ISSN (E): 2349 – 1183
ISSN (P): 2349 – 9265
5(1): 29–40, 2018
DOI: 10.22271/tpr.2018.v5.i1.006
Research article
Phytosociological studies of the sacred grove of Kanyakumari

district, Tamilnadu, India
S. Sukumaran1*, A. Pepsi1, D. S. SivaPradesh1 and S. Jeeva2
1
Department of Botany and Research centre, Nesamony Memorial Christian College, Marthandam,
Kanyakumari-629165, Tamilnadu, India
2
Department of Botany and Research centre, Scott Christian College, Nagercoil, Kanyakumari-629003,
Tamilnadu, India
*Corresponding Author: sukunmcc@gmail.com [Accepted: 28 March 2018]
Abstract: Sacred groves are forest patches conserved by the local people through religious and
cultural practices. These groves are important reservoirs of biodiversity, preserving indigenous
plant species and serving as asylum of Rare, Endangered and Threatened (RET) species. The
present study was carried out in Muppuram coastal sacred grove of Kanyakumari district to reveal
the plant diversity, structure and regeneration pattern of trees using quadrate method. About 102
plant species were recorded from the total area (0.2 ha) of the grove studied. The vegetation of the
grove clearly indicates tropical dry evergreen forest. Malvaceae was the dominant family. Young
plant species were dominating than older ones (> 160 cm). To avoid the rapid environmental
degradation of the sacred grove, conserving the groves is urgent and it is necessary to conduct
more researches on this grove as well as other groves of the district.
Keywords: Floristic diversity - Regeneration - Conservation - Sacred groves - Traditional.
[Cite as: Sukumaran S, Pepsi A, SivaPradesh DS & Jeeva S (2018) Phytosociological studies of the sacred
grove of Kanyakumari district, Tamilnadu, India. Tropical Plant Research 5(1): 29–40]
INTRODUCTION
The degradation of tropical forests and destruction of habitat due to anthropogenic activities are the major
causes of the decline in global biodiversity (Sukumaran et al. 2008, Rabha 2014). Therefore, in many areas
conservation of biodiversity and maintaining landscape productivity are being taken up on a priority basis, for
the restoration of degraded lands by planting fast-growing indigenous and native plant species (Solbrig 1991).
One of the important challenging tasks before the ecologists is to understand the relationship between
biodiversity and functioning of ecosystems (Younes 1992, Davis & Richardson 1995). The high rate of
extinction of tropical species is aggravated by the clearing of forestland and conversion into agricultural
cropland. Harvesting non-timber forest products, selective extraction of plants and animals, biological invasion
and monocultural practices are serious threat to biodiversity (Myers 1993, Phillips 1995, Phillips 1997,
Sundarapandian & Swamy 1997, Sundarapandian & Swamy 2000, Swamy et al. 2000, Mishra et al. 2004,
Sundarapandian et al. 2005, Mehra et al. 2014, Rastogi et al. 2015, Sarkar & Devi 2017). Reorientation of the
psyche of people towards maintaining biodiversity is of utmost importance (Ramakrishnan et al. 1998).
Despite the vast and varied flora in Southern Western Ghats, information on the biodiversity of the sacred
groves is not explored to a desired level. The past workers such as Raj & Sukumaran (1997), Jeeva et al. (2005a,
b), Jeeva et al. (2006), Prakash et al. (2006) have studied phytodiversity of the region. Nayar (1959),
Sundarapandian & Swamy (1997), Swamy et al. (2000) have paid much attention on forests other than sacred
groves of Kanyakumari district. Due to religious beliefs, patches of vegetation are left untouched known as
sacred groves. The importance and its conservation status have recently gained more importance, hence several
studies have been carried out to evaluate the biodiversity of sacred groves throughout the country (Gadgil &
Vartak 1976, Burman 1992, Rodgers 1994, Balasubramanian & Induchoodan 1996, Tripathi 2001,
Khumbongmayum et al. 2005, Deepa et al. 2017). The plant wealth and conservation potential have
acknowledged sacred groves as ―mini biosphere reserves‖ (Gadgil & Vartak 1975).
Received: 07 December 2017 Published online: 31 March 2018
Sukumaran et al. (2018) 5(1): 29–40
The survey was largely limited to an enumeration of plants and distribution only neglecting quantitative
analysis which is essential for evolving strategies for their conservation. Qualitative studies on plant diversity
and conservation status of some sacred groves of Kanyakumari district were studied by Sukumaran and his co-
workers (Raj & Sukumaran 1997, Sukumaran & Jeeva 2008, Sukumaran et al. 2008). In view of this, the present
study was conducted to investigate the plant diversity, structure and regeneration pattern of trees and highlights
botanical significance, because of the nature of forest communities largely dependent on the ecological
characteristics in sites, species diversity and regeneration status of species.

Study site
Figure 1. Map of the study area.
The present study was conducted in Muppuram sacred grove of Kollencode town panchayat (08°17′51″N
and 77°06′50″ E) of Kanyakumari district, Tamilnadu, India (Fig. 1), which lies close to the boundary of Kerala
towards its west. The soil of this grove is sandy because Arabian Sea is just away from this grove. Climate is
warm and humid. Rainfall varies from 1030 mm to 3100 mm. The grove is governed by Tamilnadu Devasam
board. Tamil and Malayalam are the languages spoken by the people. Christians and Hindus form the sizeable
percentage. Nadar is the major community and other communities are Meenavar, Aasari, Chackarevars, Nair,
Paravas and Kerala Mudalis. The main deity of this grove is Ayappa and other deities worshipped are Nagaraja,
Pillaiyar and Brahma. The mother tree (Sthalavrisha) is Manilkara hexandra. Annual festival is celebrated every
March for 3 days. Devotees used to do milk and fruit abishekam to the deities. Sweet Pongal will be offered to
the deities and then to the devotees. Priest is from Nair community and worship is open to all. A perennial pond
is located in the western part of the grove, which has a separate ecosystem enriched with microalgae, aquatic
plants, fishes, planktons and so on. Apart from the pond there are two wells, one is inside the grove, the water
from this well mostly used for the Poojas and another one is outside where devotees take bath and enter in the
grove. The water present in both wells are believed to cure diseases. Migratory birds from Australia come to this
grove every year for reproduction.
Sukumaran et al. (2018) 5(1): 29–40
Vegetation of the grove

The general floristic composition and physiognomy of vegetation of the Muppuram sacred grove resembles
low level tropical dry evergreen forest. Undisturbed areas of this grove shows luxuriant vegetation comprising
several storeys of trees mixed with shrubs, lianas and herbs. The ground layer is rich in litter and macro fungi
and hence the soil is abundant in humus which favors the growth of seasonal members usually thick populated
species preferring humus and love shade for growth. Aquatic plants and algae grow gregariously on the
perennial pond of the grove. Floristic variations have occurred due to human and animal interferences and also
climatic and edaphic changes. The exact physiological implication behind this high humidity is not
experimentally proved though it may be described to very high transpiration rate of leaves of these floral
elements.
Plant Diversity and Community Attributes
Phytosociological studies were carried out by quadrat sampling method as per Mishra (1968), Kershaw
(1973). Twenty quadrats of 10 m × 10 m were randomly laid for trees (≥ 20 cm gbh). Sixty quadrats of 5 m × 5
m each for shrubs and saplings and 60 quadrats of 1 m × 1 m size for studying herbs and seedlings were laid
within the same 10 m × 10 m quadrats those were laid for the study of trees. Density (trees ha-1) and basal area
values were calculated for each species. Importance value index (IVI) of each species was calculated as per
Phillips (1959). Similarly species richness, dominance and diversity were determined by computing the index
of species richness (Margalef 1958); Shannon diversity index (Shannon & Weiner 1949); Simpson dominance
index (Simpson 1949) and Evenness index (Pielou 1969) were calculated using the formula as given in the
reference cited above.
where, S = Total number of species, N = Total number of individuals and ln = log2.
where, H’ = Shannon–Weiner diversity index, pi = Proportion of IVI of a species i.e. (ni / N).
Sukumaran et al. (2018) 5(1): 29–40
Species Accumulation Curve

Species accumulation curve was plotted against area for both the plots. After randomizing the samples for 50
times using Estimates (Version 6.0b1, 2000), the Chao1 species number generated for the 0.1 ha subplots (10 m
× 10 m) were used to raise the species accumulation curve.
Taxonomic Evaluation
Plants species were collected and identified taxonomically with the help of different floras (Beddome 1868–
1874, Gamble & Fischer 1915–1935) and by using field keys devised by Pascal & Ramesh (1987).
The Herbaria of Botanical Survey of India, Southern Circle, Coimbatore; Kerala Forest Research Institute,
Peechi; Tropical Botanical Garden and Research Institute, Trivandrum, Kerala and the Department of Botany,
Nesamony Memorial Christian College, Marthandam were consulted for correct identification of plant
specimens. The nomenclature of species follows the regional flora. Lists of endangered, rare and endemic plants
found in the sacred groves were prepared with the help of published works of Ahmedullah & Nayar (1986),
Ramesh & Pascal (1991). The voucher specimens were made as per the methods and deposited in the herbarium
of Nesamony Memorial Christian College, Marthandam, Kanyakumari, Tamilnadu, India.

Species composition and their distribution pattern
A total of 102 species were identified in 0.2 ha area of the sacred forest studied. Five species remained
unidentified, included two species of orchids. Phytodiversity of the recently studied sacred groves from various
part of the country shows that a total of 111 species were recorded from four sacred groves of (Ramanujam &
Cyril 2003), 180 species were reported from Sendirakillai sacred grove of Cuddalore district, Tamilnadu
(Gnanasekaran et al. 2012), 94 plant species were recorded from Koraput district, Odisha (Debabrata et al.
2014). A total of 245 flowering plants were recorded from Vallikaattu sacred grove of Kozhikode, Kerala
(Sreeja & Unni 2016), 119 species, representing 8vulnerable, 12 endemic and 3 near threatened species were
reported from Thrissur district, Kerala (Deepa et al. 2016). In the study area, trees were distributed in three
distinct strata, namely canopy (> 15 m height), sub canopy (8–15 m height) and under canopy (< 8 m height).
The canopy layer was composed of Artocarpus heterophyllus, Artocarpus hirsutus, Ficusbenghalensis, Ficus
religiosa and Schleichera oleosa, while Albizia lebbeck, Hydnocarpus wightianus, Litsea glabrata, Mangifera
indica, Strychnos nux-vomica, Swietenia mahagoni and Tamarindus indica constituted subcanopy stratum. Fla-
courtia indica, Drypetes sepiaria, Manilkara hexandra, Magnolia champaca, Morinda coreia,
Tamilnadiauliginosa, Santalum album, Semecarpus travancorica, Syzygium densiflorum and Vitex negundo
formed the under canopy layer. The undercanopy layer composed of rich vegetation due to overhead canopy
layer suppressing the growth of under canopy (Jamir & Pandey 2003). Species richness (number of species per
100 m2 area) clearly indicated that the community was mosaic of high- and low-diversity fragmented forest (Fig.
2). This appears to be the result of combined effect of non-extreme stable environmental conditions and gap
phase dynamics within the forest (Whittaker 1975, Upadhaya et al. 2004).
Figure 2. Spatial distribution of tree species richness in the study area.

Sukumaran et al. (2018) 5(1): 29–40
Table 1. Important value indices (IVI) of plant species recorded in the tropical dry forest fragment of south west coast of
Kanyakumari district.
Botanical names Family IVI
Trees
Adenanthera pavonina L. Leguminosae 12.6
Albizia lebbeck (L.) Benth. Leguminosae 6.77
Anacardium occidentale L. Anacardiaceae 9.1
Annona squamosa L. Annonaceae 2.94
Areca catechu L. Arecaceae 3.48
Artocarpus heterophyllus Lam. Moraceae 8.91
Artocarpus hirsutus Lam. Moraceae 3.89
Buchanania barberi Gamble. Anacardiaceae 2.62
Carica papaya L. Caricaceae 1.75
Cocos nucifera L. Arecaceae 3.89
Drypetes sepiaria (Wight & Arn.) Pax & K. Hoffm. Putranjivaceae 49.5
Ficus benghalensis L. Moraceae 24.58
Ficus religiosa L. Moraceae 7.6
Flacourtia indica (Burm.f.) Merr. Salicaceae 7.63
Gliricidia sepium (Jacq.) Walp. Leguminosae 23.48
Glycosmis pentaphylla (Retz.) DC. Rutaceae 3.41
Hydnocarpus wightianus Blume Achariaceae 3.71
Litsea glabrata Hook.f. Lauraceae 2.31
Magnolia champaca (L.) Baill. ex Pierre Magnoliaceae 3.1
Mangifera indica L. Anacardiaceae 2.73
Manilkara hexandra (Roxb.) Dubard Sapotaceae 25.19
Morinda coreia Buch.-Ham. Rubiaceae 21.28
Phyllanthus emblica L. Phyllanthaceae 1.97
Psidium guajava L. Myrtaceae 1.73
Santalum album L. Santalaceae 6.33
Schleichera oleosa (Lour.) Merr. Sapindaceae 12.04
Semecarpus travancorica Bedd. Anacardiaceae 1.78
Sterculia foetida L. Malvaceae 1.78
Sterculia guttata Roxb. ex G.Don Malvaceae 1.76
Strychnos nux-vomica L. Loganiaceae 3.8
Swietenia mahagoni (L.) Jacq. Meliaceae 2.2
Syzygium densiflorum Wall. ex Wight & Arn. Myrtaceae 1.89
Tamarindus indica L. Leguminosae 12.92
Tamilnadia uliginosa (Retz.) Tirveng. & Sastre Rubiaceae 17.8
Thespesia populnea (L.) Sol. ex Correa Malvaceae 1.78
Vitex negundo L. Lamiaceae 1.76
Shrubs
Barleria prionitis L. Acanthaceae 17.08
Breynia retusa (Dennst.) Alston. Phyllanthaceae 11.18
Bryophyllum pinnatum (Lam.) Oken Crassulaceae 9.4
Calotropis gigantea (L.) Dryand. Apocynaceae 11.5
Carissa spinarum L. Apocynaceae 8.36
Citrus aurantiifolia (Christm.) Swingle Rutaceae 11.62
Ehretia microphylla Lam. Boraginaceae 17
Euphorbia antiquorum L. Euphorbiaceae 10.64
Gardenia resinifera Roth Rubiaceae 16.94
Hibiscus rosa-sinensis L. Malvaceae 17.44
Ixora brachiata Roxb. Rubiaceae 18.3
Lantana camara L. Verbenaceae 25.88
Nerium oleander L. Apocynaceae 7.17
Ochna obtusata DC. Ochnaceae 32.67
Ophiorrhiza mungos L. Rubiaceae 30.67
Opuntia dillenii (Ker Gawl.) Haw. Cactaceae 14.52
Pavetta zeylanica (Hook,f.) Gamble Rubiaceae 24.54
Tabernaemontana alternifolia L. Apocynaceae 15.1
Sukumaran et al. (2018) 5(1): 29–40
Climbers (including Lianas)

Abrus precatorius L. Leguminosae 9.41
Bridelia stipularis (L.) Blume Phyllanthaceae 12.69
Cadaba fruticosa (L.) Druce Capparaceae 1.53
Cansjera rheedii Blanco Opliaceae 4.53
Capparis divaricata Lam.. Capparaceae 4.79
Capparis sepiaria L. Capparaceae 8.36
Capparis zeylanica L. Capparaceae 0.68
Carissa spinarum L. Apocynaceae 1.73
Cayratia japonica (Thunb.) Gagnep. Vitaceae 4.9
Cissampelos pareira L. Menispermaceae 34.84
Cissus vitiginea L. Vitaceae 3.53
Grewia serrulata DC. Malvaceae 7.94
Hugonia serrata Lam. Linaceae 18.38
Jasminum angustifolium (L.) Willd. Oleaceae 11.62
Morinda umbellata L. Rubiaceae 0.84
Pueraria montana var. lobata (Willd.) Sanjappa & Pradeep. Vitaceae 3.79
Pyrenacantha volubilis Hook. Icacinaceae 8.05
Strychnos colubrina Blume. Loganiaceae 26.32
Tetracera akara Merr. Dilleniaceae 11.83
Tetrastigma canarense (Dalziel) Gamble Vitaceae 6.15
Uvaria narum A.DC. Annonaceae 10.57
Ziziphus oenopolia (L.) Mill. Rhamnaceae 7.52
Herbs
Aerva lanata (L.) Juss. Amaranthaceae 1.41
Andrographis paniculata (Burm.f.) Nees Acanthaceae 6.43
Apluda mutica L. Poaceae 11.05
Blepharis maderaspatensis (L.) B.Heyne ex Roth Acanthaceae 9.04
Boerhavia diffusa L. Nyctaginaceae 4.69
Ceropegia spiralis Wight Apocynaceae 2.88
Commelina benghalensis L. Commelinaceae 2.54
Commelina erecta L. Commelinaceae 4.22
Dendrobium macrostachyum Lindl. Orchidaceae 4.22
Eragrostis amabilis (L.) Wight & Arn. Poaceae 15.94
Eragrostis patula (Kunth) Steud. Poaceae 10.46
Gloriosa superba L. Colchicaceae 4.29
Hemidesmus indicus (L.) R.Br. ex Schutt. Apocynaceae 5.49
Justicia japonica Thunb. Acanthaceae 5.02
Justicia tranquebariensis L.f. Acanthaceae 1.41
Knoxia sumatrensis (Retz.) DC. Rubiaceae 1.14
Microstachys chamaelea (L.) Mull.Arg. Euphorbiaceae 4.62
Mimosa pudica L. Leguminosae 2.01
Ocimum tenuiflorum L. Lamiaceae 2.28
Oplismenus compositus (L.) P.Beauv. Poaceae 7.91
Perotis indica (L.) Kuntze Poaceae 23.33
Plumbago zeylanica L. Plumbaginaceae 1.74
Sansevieria roxburghiana Schult. & Schult.f. Asparagaceae 64.61
Sida acuta Burm.f. Malvaceae 1.41
Sida cordifolia L. Malvaceae 0.87
Waltheria indica L. Malvaceae 1
Taxonomically, a total of 102 plant species belonging to 90 genera and 46 families were recorded in the
sacred forest (representative of tropical dry evergreen forest fragment of the southwest coast of Kanyakumari
district) studied (Table 1). Among these, 36 (35.29%) were trees, 18 (17.65%) shrubs, 26 (25.49%) herbs, and
22 were (21.57%) climbers including lianas. In the tropical dry evergreen forest, Malvaceae and Rubiaceae was
the dominant family with 8 species followed by Apocynaceae (7 species), Leguminosae (6 species),
Acanthaceae and Poaceae (5 species each), Anacardiaceae, Capparaceae, Moraceae and Vitaceae (4 species
each) were well represented in the study area. Phyllanthaceae was represented by three species, followed by 8
family of two species each, whereas 28 families were monospecific (Fig. 3).
Sukumaran et al. (2018) 5(1): 29–40
Figure 3. Dominance - distribution pattern of families in the study area.

In the present study, the majority of species (17 spp. 20–40 cm dph; 13 spp. 40–60 cm dph; 15 spp. 60–80cm
dph) were represented by young individuals and species richness decreased with increase in dbh class, except in
the case of mature trees beyond > 180 cm dbh (Fig. 4). In case of distribution pattern, the majority of the species
showed a clumped distribution pattern and only 6–10% of the species were randomly distributed in the forest
(Fig. 5). The clumpy vegetation is due to the canopy gaps forming a major source of disturbance (Armesto et al.
1986).
Figure 4. Distribution of species in different diameter classes in the study area.
Figure 5. Distribution pattern of plant species in the study area.

Sukumaran et al. (2018) 5(1): 29–40
Density and basal cover
Figure 6. Distribution of density in different diameter classes in the study area.

Distribution of density in different girth classes is shown in figure 6. In the sacred forest, 65.24% of the
stem was in the 20–60 cm dbh class and only 2.67 % in 140–160, 1.07 % in 160–180, 2.14% in 180–200 and
3.74% in > 200 cm dbh classes respectively (Fig. 6). The study was more or less similar to the report of
Upadhaya et al. (2004) which showed a maximum density of species in 515 cm dph classes. In Muppuram, 935
individuals of tree species encountered, nearly 50 percent of the species were represented by one or two stems.
Drypetes sepiaria had the maximum number of individuals (135 stems), Manilkara hexandra (95 stems),
Morinda coreia (80 stems), Tamilnadia uliginosa (75 stems), Adenanthera pavonina (50 stems), Tamarindus
indica (40 stems) (Fig. 7). In the study area the density of young trees (20–40 cm dbh) was much greater
compared to the mature trees (> 160 cm dbh). However, despite this, the basal cover of young trees was much
lower than that of mature trees (0.07 versus 31.05 m2.ha-1). A sharp decrease in density with the increase in girth
classes was reported from the sacred groves of Manipur (Khumbongmayum et al. 2005). The reports of
Johnston & Gillman (1995) in Kurupukari sacred grove; Valencia et al. (1994) in Amazonian Ecuador; Jamir
(2000) in subtropical humid forest in Jaintia hills, Meghalaya; Pascal & Pelissier (1996), Parthasarathy &
Karthikeyan (1997) in the sacred groves of Western Ghats also evaluated the same. Drypetes sepiaria was one
of the dominant species in the study area and similar report was given by Sundarapandian & Subbiah (2015) in
tropical dry evergreen forests in Sivagangai district, Tamilnadu.
Figure 7. Species stem relationship in a hectare area of the sacred grove.
Sukumaran et al. (2018) 5(1): 29–40
Shannon-Weiner Diversity Index value was estimated to be 2.92 for trees, 2.72 for shrubs, 2.72 for climbers
and 2.54 for herbs. Simpson’s Dominance Index values for trees, shrubs, climbers and herbs were found to be
0.08, 0.08, 0.09, and 0.13 respectively. The estimated Species Evenness Index value was 0.81 for trees, 0.94 for
shrubs, 0.88 for climbers and 0.78 for herbs. Whitaker Index values for trees, shrubs, climbers and herbs were
calculated to be 6.88, 3.05, 3.41 and 3.93 (Table 2). High diversity and low Simpson’s dominance value is due
to human interferences. Similar statement was given by Parthasarathy et al. (1992), Visalakshi (1995) and
Rampilla (2015) in the sacred groves of southern Western Ghats, tropical evergreen forest and Indrakiladri
sacred grove.
Table 2. Density, basal area, dominance, diversity and evenness indices of plant species in the study area.
Variable Trees Shrubs Climbers Herbs
Density (ha-1) 925 1845 78750 931250
Basal area (m2.ha-1) 132.52 0.34 - -
Shannon’s diversity index 2.92 2.72 2.72 2.54
Pielou’s evenness index 0.81 0.94 0.88 0.78
Simpson’s dominance index 0.08 0.08 0.09 0.13
Whittaker index 6.88 3.05 3.41 3.93
Dominance distribution pattern of Tree species
The dominance distribution yielded log-normal curves showing a high equitability and low dominance in the
Muppuram forest (Fig. 8). The same curve was reported by Mishra et al. (2004) in the sacred grove of
Meghalaya. This is because of the stability of the community. Drypetes sepiaria (IVI = 40.50) and Manilkara
hexandra (IVI = 25.19) was the dominant and co-dominant species respectively, whereas Psidium guajava (IVI
= 1.73) was the least dominant species of the study area.
Figure 8. Dominance - diversity curves of trees in the study area.
CONCLUSION
A discussion on the tropical dry evergreen forest would be complete without assessing their present and
future prospects. The analysis reveals the dominance of belief system over the preservation of grove proper.
Signs of human impacts are unmistakable and vary in extent, viz. conversion into coconut based agroforestry
system, ornate temple construction etc. The introduction of non-grove species, though observed only in two
plots, is ominous at its bound to alter the native species composition. In conclusion, the present study has
documented the prevalence of the sacred forest among the agricultural/urban societies. It further confirms that
these forests have managed to survive up to the modern times but are struggling for survival now. Despite their
alarming conservation status, the biodiversity conserved in them is significantly rich, varied and valuable.
Rappaport (1971) argued that the human societies have employed the concept of sacred to mould human
behavior where the interests of the individual clash with those of forest/grove as a whole. In his opinion, the
Sukumaran et al. (2018) 5(1): 29–40
sacred forest is represented the ecological prudence against the profligacy of individuals. The study reveals that
the very state belief system, which was scrupulously evolved to foster the biodiversity conservation, has
initiated its nemesis too. Unless urgent and stem measures are taken, the time is not far-off that the ―mini
biosphere reserves‖ will turn to the ―relicts of dying wisdom‖.
ACKNOWLEDGEMENT
The authors are thankful to the Head, Department of Botany, Nesamony Memorial Christian College,
Marthandam for providing necessary facilities and encouragement.
REFERENCES
Ahmedullah M & Nayar MP (1986) Endemic plants of the Indian region: Vol. 1. Peninsular India. Botanical
Survey of India, Kolkata, India, pp. 26.
Armesto JJ, Mitchell JD & Villogram C (1986) A comparison of spatial patterns of trees in tropical and
temperate forests. Biotropica 18: 1–11.
Balasubramanian K & Induchoodan NC (1996) Plant diversity in sacred groves of Kerala. Evergreen 36: 3–4.
Beddome RH (1868–1874) Icones Plantarum Indiae Orientalis. Ganz Brothers, Madras. p. 32
Burman RJJ (1992) The institution of sacred grove. Journal of Indian Anthropology and Society 27: 219–238.
Davis G & Richardson D (1995) Mediterranean Type Ecosystems: The function of Biodiversity. Springer,
Berlin, Germany.
Debabrata P, Sekhar BS & Sharat KP (2014) Floral Diversity Conservation through Sacred Groves in Koraput
District, Odisha, India: A Case Study. International Research Journal of Environment Sciences 3(9): 80–86.
Deepa MR, Sheema Dharmapal P & Udayan PS (2016) Floristic diversities and medicinal importance of
selected sacred groves in Thrissur district, Kerala. Tropical Plant Research 3(1): 230–242.
Deepa MR, Udayan PS & Anilkumar KA (2017) Taxonomical and phytosociological studies on Chithalikavu-
A sacred grove, Thrissur district, Kerala. Tropical Plant Research 4(1): 20–30.
Gadgil M & Vartak VD (1975) Sacred Groves of India—A Plea for Continued Conservation. Journal of the
Bombay Natural History Society 72: 313–320.
Gadgil M & Vartak VD (1976) Sacred groves of Western Ghats of India. Economic Botany 30: 152–160.
Gamble JS & Fischer CEC (1915-1935) The Flora of the Presidency of Madras, Part I- II. Adlard and Son Ltd.,
London.
Gnanasekaran G, Nehru P & Narasimhan D (2012) Angiosperms of Sendirakillai sacred grove (SSG),
Cuddalore District, Tamilnadu, India. Check List 8: 113–129.
Jamir SA & Pandey HN (2003) Vascular plant diversity in the sacred groves of Jaintia hills in Northeast India.
Biodiversity and Conservation 12: 1497–1510.
Jamir SA (2000) Studies on plant biodiversity, community structure and population behavior of dominant tree
species of some sacred groves of Jaintia hills, Meghalaya, Ph. D. Thesis. North-Eastern Hill University,
Shillong, India.
Jeeva S, Kiruba S, Mishra BP, Kingston C, Venugopal N & Laloo RC (2005b) Importance of weeds as
traditional medicine in Kanyakumari district, Southern Western Ghats. Journal of Swamy Botanical Club 22:
71–76.
Jeeva S, Kiruba S, Mishra BP, Venugopal N, Das SSM, Sukumaran S, Regini GS, Kingston C, Kavitha A, Raj
ADS & Laloo RC (2006) Weeds of Kanyakumari district and their value in rural life. Indian Journal of
Traditional Knowledge 5: 501–509.
Jeeva S, Kiruba S, Mishra BP, Venugopal N, Kharlukhi L, Regini GS, Das SSM & Laloo RC (2005a) Diversity
of medicinally important plant species under coconut plantation in the coastal region of Cape Comorin.
Flora and Fauna 11: 226–230.
Johnston M & Gillman M (1995) Tree population studies in low-diversity forests, Guyana.I. Floristic
composition and stand structure. Biodiversity and Conservation 4: 339–362.
Kershaw KA (1973) Quantitative and Dynamic Plant Ecology. Edward Arnold, London, 286 p.
Khumbongmayum AD, Khan ML & Tripathi RS (2005) Sacred groves of Manipur, Northeast, India:
biodiversity value, status and strategies for their conservation. Biodiversity and Conservation 14: 1541–
1582.
Margalef R (1958) Information theory in ecology. General Systematics 3: 36–71.
Sukumaran et al. (2018) 5(1): 29–40
Mehra A, Bajpai O & Joshi H (2014) Diversity, utilization and sacred values of Ethno-medicinal plants of
Kumaun Himalaya. Tropical Plant Research 1(3): 80–86.
Mishra BP, Tripathi OP, Tripathi RS & Pandey HN (2004) Effect of anthropogenic disturbance on plant
diversity and community structure of a sacred grove in Meghalaya, north east India. Biodiversity and
Conservation 13: 421–436.
Mishra R (1968) Ecology Work Book. Oxford & IBH Publishing Co., Calcutta, India.
Myers N (1993) Questions of mass extinction. Biodiversity and Conservation 2: 2–17.
Nayar MP (1959) The vegetation of Kanyakumari district. Bulletin of the Botanical Survey of India 1: 122–126.
Parthasarathy N & Karthikeyan R (1997) Plant biodiversity inventory and conservation of two tropical dry
evergreen forests on the Coromandal Coast, South India. Biodiversity and Conservation 6: 1063–1083.
Parthasarathy N, Kinhal V & Kumar PL (1992) Plant species diversity and human impacts in the tropical wet
evergreen forests of Southern Western Ghats. In: Indo-French workshop on Tropical forest ecosystems:
natural functioning and anthropogenic impacts. French institute Pondicherry.
Pascal JP & Pelissier R (1996) Structure and floristic composition of Tropical Evergreen forest in southern
India. Journal of Tropical Ecology 12: 95–218.
Phillips EA (1959) Methods of Vegetation Study. Henry Holt and Co., New York, USA.
Phillips OL (1995) Evaluating turnover in Tropical forests. Science 268: 894–895.
Phillips OL (1997) The changing ecology of tropical forests. Biodiversity and Conservation 6: 291–311.
Pielou EC (1966) The measurement of diversity in different type of biological collections. Journal of
Theoretical Biology 13: 131–144.
Prakash JW, Suman LL, Devi MSV, Premila AB, Anderson NA, Veni P, Essaki G, Amutha M, Rajeev R,
Bensar K, Jeeva S, Williams BC, Regini GS & Das SSM (2006) The medicinal plant diversity of Scott
Christian College (Autonomous) Campus, Nagercoil, South Tamilnadu, India. Journal of Nature
Conservation 18: 81–89.
Rabha D (2014) Species composition and structure of Sal (Shorea robusta Gaertn. f.) forests along distribution
gradients of Western Assam, Northeast India. Tropical Plant Research 1(3): 16–21.
Raj ADS & Sukumaran S (1997) Observations of the sacred groves of south Tamil Nadu. In: Abstracts of
National Symposium on Natural Resources Management Systems. St. Joseph College, Thiruchirapalli,
Tamilnadu.
Ramakrishnan PS, Saxena KG, Rao KS, Maikhuri RK & Das AK (1998) Ethnic and Agricultural Biodiversity in
north-east India. In: Partap T & Sthapit B (eds) Managing Agrobiodiversity in the HKH Region. ICIMOD,
Kathmandu, Nepal.
Ramanujam MP & Cyril KPK (2003) Woody species diversity of four sacred groves in the Pondicherry region
of South India. Biodiversity and Conservation 12: 289–299.
Ramesh BR & Pascal JP (1991) Distribution of endemic arborescent evergreen species in the Western Ghats. In:
The proceedings of the symposium on rare endangered and endemic plants of the Western Ghats. pp. 20–29.
Rampilla V, Khasim S, Mahammad & Kakumanu B (2015) Floristic diversity and Phyto-sociological studies of
Indrakiladri Sacred Grove in Krishna district, Andhra Pradesh, India. Journal of Pharmacy and Biological
Sciences 10: 61–75.
Rappaport A (1971) The sacred in human evolution. Annual Review of Systematics and Ecology 2: 23–44.
Rastogi J, Rawat DS & Chandra S (2015) Diversity of invasive alien species in Pantnagar flora. Tropical Plant
Research 2(3): 282–287.
Rodgers WA (1994) The sacred groves of Meghalaya. Man in India 74: 339–348.
Sarkar M & Devi A (2017) Analysis of medicinal and economic important plant species of Hollongapar Gibbon
wildlife sanctuary, Assam, northeast India. Tropical Plant Research 4(3): 486–495.
Shannon CE & Weiner W (1949) The Mathematical Theory of Communication. University of Illinois Press,
Urbana, Illionis, pp. 1–117.
Simpson EH (1949) Measurement of diversity. Nature 8: 163: 688.
Solbrig OT (1991) From Genes to Ecosystems: A Research Agenda for Biodiversity. IUBS – SCOPE –
UNESCO, Harvard, Cambridge, Massachusetts, 124 p.
Sreeja K & Unni PN (2016) Floristic diversity of Vallikkaattu Kaavu, a sacred grove of Kozhikode, Kerala,
India. Journal of Ecology and Environmental Sciences 8: 175–183.
Sukumaran et al. (2018) 5(1): 29–40
Sukumaran S & Jeeva S (2008) A floristic study on miniature sacred forests at Agastheeshwaram, Southern
Peninsular India. EurAsian Journal of Biosciences 2: 66–72.
Sukumaran S, Jeeva S, Raj ADS & Kannan D (2008) Floristicdiversity, conservation status and Economical
value of miniature sacred groves in Kanyakumari District, Tamilnadu, Southern Peninsular India. Turkish
Journal of Botany 32: 185–199.
Sundarapandian SM & Subbiah S (2015) Diversity and tree population structure of tropical dry evergreen
forests in Sivagangai district of Tamilnadu, India. Tropical Plant Research 2(1): 36–46.
Sundarapandian SM & Swamy PS (1997) Plant biodiversity at low elevation evergreen and moist deciduous
forests at Kodayar (Western Ghats, India). International Journal of Ecology and Environmental Sciences 23:
363–379.
Sundarapandian SM & Swamy PS (2000) Forest ecosystem structure and composition along an altitudinal
gradient in the Western Ghats, South India. Journal of Tropical Forest Science 12: 104–123.
Sundarapandian SM, Chandrasekaran S & Swamy PS (2005) Phenological behaviour of selected tree species in
tropical forests at Kodayar in the Western Ghats, Tamil Nadu, India. Current Science 88: 805–810.
Swamy PS, Sundarapandian SM, Chandrasekar P & Chandrasekaran S (2000) Plant species diversity and tree
population structure of a humid tropical forest in Tamilnadu, India. Biodiversity and Conservation 9: 1643–
1669.
Tripathi RS (2001) Sacred groves: Community biodiversity conservation model in north-east India. In:
Ganeshaiah, KN, UmaShanker R & Bawa KS (eds) Tropical Ecosystems: Structure, Diversity and Human
Welfare (Supplement), Proceedings of the International Conference on Tropical Ecosystems. Ashoka Trust
for Research in Ecology and Environment (ATREE), Bangalore. pp. 104-107.
Upadhaya K, Pandey RN, Law PS & Tripathi RS (2004) Diversity and population characteristics of woody
species in subtropical humid forests exposed to cultural disturbances in Meghalaya, Northeast, India.
Tropical Ecology 45: 475–486.
Valencia R, Balslev H, Paz YG & Mino C (1994). High tree alpha-diversity in Amazonian Ecuador.
Biodiversity and Conservation 3: 21–28.
Visalakshi N (1995) Vegetation analysis of two tropical dry evergreen forests in Southern India. Tropical
Ecology 36: 117–127.
Whittaker RH (1975) Communities and Ecosystems. Macmillan Publishing Company, New York.
Younes T (1992) Ecosystem function of Biodiversity: a progress reports on the IUBS- SCOPE- ENESCO
programme. Bulletin International 21: 6–2.
ISSN (E): 2349 – 1183
ISSN (P): 2349 – 9265
5(1): 41–45, 2018
DOI: 10.22271/tpr.2018.v5.i1.007
Research article
Response of potato plants to foliar application of cement dust

Deepali Tomar, Abrar Ahmad Khan and Gufran Ahmad*
Department of Botany, Aligarh Muslim University, Aligarh-202002, Uttar Pradesh, India
*Corresponding Author: ahmadgufran811@gmail.com [Accepted: 29 March 2018]
Abstract: An experiment was conducted in the net house, Department of Botany, AMU, Aligarh,
India, in 2012 to evaluate the effect of foliar application of cement dust (0.00, 0.25, 0.50, 1.00,
2.00 and 4.00 g.m-2.day-1) on plant growth, yield, biomass, photosynthetic pigments, NPK
concentrations of plants, and protein and carbohydrate contents of Solanum tuberosum. Dusting of
cement dust caused a significant adverse effect on all the above parameters. As the doses were
increased, the values of above parameters were decreased. The epidermal characters of leaves were
also observed. The number and size (length and width) of stomata, and size (length and width) of
the stomatal aperture on both the surfaces of leaves were gradually decreased with the increase in
cement dust levels. While, number and length of trichomes were increased at all the doses of
cement dust.
Keywords: Cement dust - Growth - Potato - Stomata - Trichome - Yield.
[Cite as: Tomar D, Khan AA & Ahmad G (2018) Response of potato plants to foliar application of cement dust.
Tropical Plant Research 5(1): 41–45]
INTRODUCTION
India is a major producer of the cement in the world. Cement dust is a very big problem in India. In 2002,
the total production in the country was 100,000 thousand metric tons out of 1,720,000 thousand metric tons of
the world (Hendrick 2003). Cement dust arises during processing of raw materials, manufacturing, milling,
loading and unloading of cement (Raghav 2006).
The particles going into the atmosphere may remain in the air for varying length of time depending on their
size and weight. Dust particles after moving far away from their source of origin fall and get deposited on the
plants especially on leaf surfaces forming a layer. After settling, particles create problems to crops, this depends
on their setting rate, size, density of particles, turbulence of air and type of particulates as well as the type of
plant species. High particulates emission due to uncontrolled management causes a reduction in quality of
vegetables and fruits growing close to the sources (Raghav & Khan 2002, Raghav 2006). The present study was
a step to observe the effect of cement dust pollution on potato crop.

Cement dust treatments
For the experiment, cement dust was obtained from (pure cement) from Birla Cement Agency, Aligarh. It
was crushed in mortar and pestle and passed through 2 mm sieve and kept for treatment. The five doses of
cement dust (0.25, 0.50, 1.00, 2.00 and 4.00 g.m-2.day-1) were taken.
Plant culture and setting of experiment
Potato (Solanum tuberosum L.) var. Kufri Alankar, collected from Central Potato Reseach Institute, Shimla,
India, was selected for the study. Tuber pieces with eyes (2.5–3.0 cm2) were directly planted (one piece per pot)
in clay pots of 30 cm height (25 cm diameter) containing autoclaved field soil on 10th Nov., 2012. The pieces
were surface sterilized (dipped in 0.01% HgCl2 for 15 min.) before planting. Total 30 pots including control
were prepared for the experiments (6 treatments × 5 replicates). The pots were then arranged on glass house
benches at 27/23°C day and night temperature. Photosynthetic active radiation was PAR>750 μmol.m-2.s-1
between 1100 and 1200 h and humidity in the green house was 67±5%.
Received: 13 December 2017 Published online: 31 March 2018
Tomar et al. (2018) 5(1): 41–45
Foliar application of cement dust

The fine particles of cement dust were dusted by a plastic duster, which delivered the particles uniformly
over the leaf surface. The five different doses of cement dust (0.25, 0.50, 1.00, 2.00 and 4.00 g.m-2.day-1) were
applied on two weeks old plants (four-leaf stage) and continued for 60 days. A plastic hood around the base of
each plant was used to cover the soil to prevent cement dust being deposited on the soil surface. Plants were
always irrigated under these hoods. The experiments were terminated on 30th Jan., 2013, after 90 days from the
date of planting. Plants were uprooted carefully keeping the root system intact and washed thoroughly with a
gentle stream of water to remove the soil particles. Plant growth, yield, photosynthetic pigments, NPK
concentrations of plants, and protein and carbohydrate contents of potato were estimated through standard
methods. Different leaf epidermal characters were also observed. Data were analyzed statistically for
significance.
RESULTS
Plant growth and yield
Data presented in table 1 show that the foliar application of cement dust adversely affected the plant growth,
yield and biomass of Solanum tuberosum. Plant growth in terms of length, fresh weight, dry weight of root and
shoot was reduced gradually and significantly (P<0.05 and P<0.01) in all the doses of cement dust. Yield in
terms of tuber fresh weight and tuber dry weight and plant biomass were also decreased significantly in all the
doses as compared to control.
Photosynthetic pigments and NPK
A gradual and significant (P<0.05 and P<0.01) decrease in photosynthetic pigments has been reported as the
doses were increased in S. tuberosum (Table 2). However, chlchlorophyll b and carotenoids were at par with
control in 0.25 g.m-2.day-1 dose at P<0.01 level. Similarly, NPK concentrations were also significantly reduced
in all the doses except in 0.25 g.m-2.day-1 dose at P<0.01 level as compared to control.
Protein and carbohydrate
Table 3 shows that soluble, insoluble and total protein contents were decreased significantly (P<0.05 and
P<0.01) with the increase in cement dust doses. Similarly, soluble, insoluble and total carbohydrate contents
were also decreased with respect to doses and maximum reduction was occurred in 4.0 g.m-2.day-1 dose.
Epidermal characters
Data given in table 4 show the effect of cement dust as foliar application on stomata and trichomes of leaves
of S. tuberosum. There was a gradual and significant reduction in number of stomata, size of stomata (length and
width) and size of the stomatal aperture (length and width) on both the surfaces in all the doses. However,
number and length of trichomes were gradually increased (P<0.05 and P<0.01) in all the doses, except in 0.25
g.m-2.day-1 dose, where the length of trichomes on upper surface was non-significant at P<0.01 when compared
to control.
DISCUSSION
In foliar application, all the doses of cement dust were found harmful to potato crop in the present study. All
the growth and yield parameters, biomass, photosynthetic pigments, NPK concentrations of plants, and protein
and carbohydrate contents were reduced. Similar responses have also been observed earlier by Darley &
Middleton (1966), when cement dust was applied in concentrations of 0.6 to 3.8 g.m-3 to bean leaves for eight to
ten hours period for two to three days. He found that the average CO 2 exchange was reduced over 30 percent
due to dusting of cement. Prasad & Inamdar (1990) have reported that accumulation of cement kiln dust on plant
surface of Vigna mungo reduced the number and size of flowers, which finally affected the yield to a great
extent in the dusted plants. A reduction in transpiration rate, chlorophyll content and productivity of the wheat
plants due to cement dust pollution was also observed by Singh & Rao (1981). Prasad et al. (1991) observed the
stomatal clogging, reduction in growth, phytomass and net primary production, a decrease in the level of
protein, amino acids, starch, sugars and phenols in Cajanus cajan plants by the application of cement dust. The
number of pods per plant and seeds per pod were reduced in the mustard plant when sprayed with cement dust
(Shukla et al. 1990). In Oryza sativa, number and size of panicles and seed weights were highly reduced (Raza
et al. 1989). Recently, Tomar & Khan (2009) and Tomar et al. (2015). Observed the harmful effect of foliar
application of brick kiln dust and fly ash on potato crops.
Tomar et al. (2018) 5(1): 41–45
Tomar et al. (2018) 5(1): 41–45
The length, size and number of stomata, as well as length and width of aperture of stomata on lower and
upper surfaces, were badly affected due to the foliar application. This might be due to the presence of toxic
compounds in the dust. Effects of cement dust on leaf cuticle and stomatal behaviour have already well worked
out on many crops. The chemicals altered the stomatal structure and ontogeny (Gupta 1992, Tomar & Khan
2009, Tomar et al. 2017). Transpiration rate of cement dusted plants declined at all stages of growth (Raghav
2006, Singh & Rao 1981), possibly due to decreased stomatal and cuticular transpiration of encrusted leaf
surfaces. Interestingly, the trichomes number and size of trichomes were increased. These might be developed in
response to defense with the external factor, which was nothing but the cement dust.
Tomar et al. (2018) 5(1): 41–45
ACKNOWLEDGEMENT
The authors are thankful to the Head, Department of Botany, Aligarh Muslim University, for providing all
the assets required in the experiment.
REFERENCES
Darley EF & Middleton JT (1966) Problems of air pollution in plant pathology. Annual Review of
Phytopathology 4: 103–108.
Gupta M (1992) Effect of growth regulators on foliar stomata of Vicia faba L. Advances in Plant Sciences 5:
483–495.
Hendrick G van Oss (2003) Mineral Commodity Summaries. U.S. Geological Survey, USA, pp. 44–45.
Prasad MSV & Inamdar JA (1990) Effect of cement kiln dust pollution on black gram (Vigna mungo).
Proceedings of the Indian Academy of Sciences (Plant Science Section) 100: 435–443.
Prasad MSV, Subramaniam RB & Inamdar JS (1991) Effect of cement kiln dust on Cajanus cajan (L.) Millsp.
Indian Journal of Environmental Health 33: 11–21.
Raghav D & AA Khan (2002). Impact of industrial particulate pollutants applied to soil on growth and yield of
tomato. Thai Journal of Agricultural Science 35(2): 187–194 .
Raghav D (2006) Studies on the effects of particulate air pollutants application on potato (Solanum tuberosum
L.), Ph. D. Thesis. Aligarh Muslim University, Aligarh, India.
Raza SH, Fatima N & Murthy MSR (1989) Urea and ascorbic acid as ameliorators of cement dust toxicity in
Oryza sativa. Environmental Pollution 62: 213–217.
Shukla J, Pandey V, Singh SN, Yunus M, Singh N & Ahmad KJ (1990) Effect of cement dust on the growth and
yield of Brassica campestris. Environmental Pollution 66: 81–88.
Singh SN & Rao DN (1981) Certain responses of wheat plants to cement dust pollution. Environmental
Pollution 24: 75–81.
Tomar D & Khan AA (2009) Influence of foliar application of brick kiln dust on potato plants. In: International
Conference on Emerging Technologies in Environmental Science and Engineering. Department of Civil
Engineering, A.M.U. Aligarh, India, pp. 1581–1590.
Tomar D, Khan AA & Safiuddin (2017) Impact of foliar application of fly ash on potato crop. Journal of
Functional And Environmental Botany 7(1): 45–49.
ISSN (E): 2349 – 1183
ISSN (P): 2349 – 9265
5(1): 46–52, 2018
DOI: 10.22271/tpr.2018.v5.i1.008
Research article
Socio-economic impacts of charcoal production in

Oke-Ogun area of Oyo State, Nigeria
Olasimbo Olarinde1 and Johnson Adeyinka Olusola2*
1
Federal Ministry of Agriculture and Rural Development, Akure Zonal Office, Akure, Nigeria
2
Department of Forestry and Wood Technology, Federal University of Technology,
Akure, Ondo State, Nigeria
*Corresponding Author: johnsonolusola5@gmail.com [Accepted: 30 March 2018]
Abstract: Many households in developing countries experience low energy consumption and this
make them depend upon wood fuels for their energy. This study examined socio-economic
impacts of charcoal production in Oke-Ogun, Oyo State, Nigeria. Two Local Government Areas
were selected based on the accessibility and the availability of charcoal farmers among ten Local
Government Areas. Results show that 74% of the respondents were male while 26% were female
that are into production of charcoal in the study area. 37.5% of the age range (41–50) of
respondent produces more charcoal than other age range. The respondent did not go beyond
primary school educationally and they are all married. However, respondents with over 11–20
years of experience in the production of charcoal have higher percentage of frequency. Some of
the problem faced by the producers of charcoal in Oke Ogun area are scarcity of trees, wildfire,
government disturbance and transportation. Trees commonly used for production are from
inherited farms and most of the trees used are Butyrosopermum paradoxium, Dialium guineense,
Terminalia glaucencens, Khaya ivorensis. Production is once in a month and later exported.
Energy provision is a basic human need and consumption is closely related to the level of a
country‟s development.
Keywords: Charcoal - Energy consumption - Fuel - Forest disturbance.
[Cite as: Olarinde O & Olusola JA (2018) Socio-economic impacts of charcoal production in Oke-Ogun area of
Oyo State, Nigeria. Tropical Plant Research 5(1): 46–52]
INTRODUCTION
Poverty is one of the greatest moral challenges the whole world is facing in which sixth of the world‟s
population living on less than $1 a day. Development initiatives to combat this have been implemented through
the Millennium Development Goals (MDG) that aim to reduce poverty in half by 2015 (UNDP 2005). Over 90
% of the 1.2 billion living in poverty worldwide rely on forests to some extent for subsistence needs. Whilst
forest resources provide a wide range of benefits to the rural poor, they also contribute significantly to the
economies of developed and developing nations (Sengupta & Maginnis 2005). The extraction of timber for
wood fuels accounts for 61% of total wood removals from forest (FAO 2005). This highlights the importance of
these fuels in the energy mix of many countries. Energy provision is a basic human need and consumption is
closely related to the level of a country‟s development (UN-Energy 2005). In many Sub-Saharan Africa, there is
low energy consumption among household as well as in many other developing countries and this makes them
too heavily dependent upon wood fuels for their energy requirements (Arnold & Persson 2005). The growing
demand for charcoal in these countries has resulted in localized deforestation in vulnerable areas. Household
fuels energy play a major role in domestic cooking, space heating and lighting, but, ESMAP (2003), excludes
fuels for transportation. Many of the different types of households „fuels in use in developing countries come
under the category of “traditional”, which include animal dung and agricultural residues, as well as wood fuel.
Wood fuel, in the view of World Resources (2001), comprises of charcoal, firewood and other wood-derived
fuels; and also constitutes the most important form of non-fossil energy used in households.
Received: 09 January 2018 Published online: 31 March 2018
Olarinde & Olusola (2018) 5(1): 46–52
In Nigeria as a whole, charcoal is not only the major source of household energy for the majority of the rural
and urban dwellers, it is also a significant contributor to national energy balances, an important source of
household incomes, and a potentially renewable energy source capable of powering significant economic
growth while reducing dependency of poor developing countries on costly energy imports (Arnold et al. 2006,
Sepp 2010). Several advantages make charcoal attractive for cooking and heating, especially among the urban
poor. Compared to firewood, charcoal has higher energy content, is less bulky, easier to transport, and more
accessible, and burns more cleanly (with less smoke) (MARGE 2009, Akpalu et al. 2011). The problem of fuel
in Nigeria is gradually becoming unbearable, thus, this gave room for constant deforestation to meet domestic
needs. Most of the household in most of our communities now depend on charcoal because of its refined nature
when compared with firewood. Therefore, as a result, more and more household shifted their demand for this
because kerosene and gas are beyond the reach of household in the study area. There are numerous attempts to
reduce this by promoting more efficient technique of charcoal making, some people have gone as far as to
advocate the active discouragement of charcoal making or even it outright banning (Gerald 1986). Yet in
another area, the effort can be made for expanding charcoal production as a means of utilizing waste wood and
creating an opportunity for local employment and economic development.
Commercial fuelwood extraction such as charcoal production requires a large volume of wood, which in turn
depletes tree stocks causing deforestation. Thus, little is known about the actual extent of deforestation due to
urban charcoal use. Neither are the social and economic patterns, which determine the charcoal exploitation, or
the policy options available to mitigate the problem. This has implications for the country regarding its ability to
design and implement appropriate energy policies that can intervene in the charcoal sectors. Therefore, this
research article focused on charcoal production, its impact on the people living in the Oke-Ogun area of Oyo
State, Nigeria. Also, it also examined some problems associated with the energy sourcing by household
involving in the charcoal production.
METHODOLOGY
Study Area
The study was carried out in Oyo State, and the State is an inland State among the States in Southwestern
Nigeria. It covers a total area of 28,454 km2 and has a population of 5, 591,589 by the 2006 population census
(NPC 2006). Oyo State is bounded in the north by Kwara State, in the East by Osun State, in the south by Ogun
State and in the west partly by Republic of Benin and partly by Ogun State, (Handbook on Agricultural
Activities in Oyo State 2001). The State lies between latitudes 7°3 1 and 9°21 north of the equator and longitudes
2°471 and 4°231 east of the meridian. Due to this location, the State has both wet and dry seasons. The wet
season is the period of rainfall, which is between April and October which is characterized by double maxima
distribution in the Southern part, as a result of the influence of the southwestern monsoon wind on the
atmosphere. The dry season covers between November and March and it is characterized by hot weather. The
weather in Oyo State is dry and it‟s accompanied by dust storms due to the effect of North-East trade winds
between the months of December till early January (Handbook on Agricultural Activities in Oyo State 2001).
Research Method
A structured questionnaire was developed and used to collect information from villagers (those Involved in
the charcoal production in Oke-Ogun area of Oyo State) in other to determine the socioeconomic importance of
charcoal production in the study areas. The questionnaire was used to collect information on the data on socio-
economic characteristics such age of the respondents, marital status of charcoal producers, family size,
education background, production experience and gender of the respondents etc. The questionnaire was pre-
tested before final administration to respondents. Descriptive statistics such as Bar chart, Frequency
Distribution, Tables and Percentages were used for the interpretation of results.

Socio-economic Characteristics of the Respondents
The results of the socioeconomic characteristic of charcoal producers in Oke-Ogun Area were presented in
table 1 below. Some of the characteristics discussed here are gender, marital status, age, educational level,
primary occupation, household size, charcoal production experience. Firstly, there is a distinction between male
and female and the type of work they can do. Males are known for jobs that are energy demanding unlike
females. Therefore, from the result of table 1, it was observed that about 74% of the respondents are male while
less than 30% are female that are involving in the production of charcoal in Oke-Ogun area of Oyo State which
was in line with the report of (Ogara 2011). Also, considering the age range of the people carrying out the
charcoal production, it was discovered that people that are between the age range of 41 to 50 years has the
highest percentage of 37.5 which implies that they are more involved in the production of charcoal than those
that are of other age ranges in Oke-Ogun area of Oyo State and the next set of people are those that are between
the age range of 51 to 60 years which have the record of 23.8% followed by those that are less than 30 years of
age with the percentage of 11.3 and the least age range involved are the people above 60 years of age having a
percentage of 6.9. This is similar to practices in other parts of the world most especially as reported in Asia by
(Bhattarai 1998) that most of the people that involved in charcoal production in Asia are those that are in active
age range of 50–60 years of age.
Table 1. Socio-economic characteristics of the respondents.
Variable Frequency Percentages
Gender
Male 118 74.0
Female 42 26.0
Total 160 100.00
Age
<30 18 11.3
31–40 33 20.6
41–50 60 37.5
51–60 38 23.8
>60 11 6.9
Total 160 100.00
Educational Status
No formal education 24 15.0
Primary education 69 43.0
Secondary 51 32.0
Higher education 16 10.0
Total 160 100.00
Marital Status
Married 133 83.0
Single 11 7.0
Widower 8 5.0
Widow 6 4.0
Divorce 2 1.0
Total 160 100.00
Primary occupation
Farming 119 74.4
Artisans 29 18.1
Unemployed 12 7.5
Total 160 100.00
Household Size
<5 56 35.00
5–10 93 58.13
>10 11 6.88
Total 160 100.00
Experience(years)
<10 25 15.63
11–20 61 38.13
21–30 39 24.4
31–40 19 12
41–50 16 10
Total 160 100. 00
The educational status of the people having the charcoal production was also taken into consideration in this
study, where it was observed that the highest percentage of the people has a primary school education; about
43% of them, followed by those with secondary school education, having a percentage 32% and those that have
no formal education with the percentage of 15 while the least percentage (10%) was found among those that
have higher education. This was similar to the report of (Ogara 2011) who reported that the trade is mostly
involving people with no education, from his report he affirmed that junior class dropouts had the highest
number of frequency in his research. To proceed in this study for more information on the production of
charcoal, the marital status of the people involved was also noted. It was therefore observed that the percentage
of the married people involved is very much higher than the other group of people involving in the production as
it carries about 83.0%, the percentage of another group of people involved are very minimal; the singles
involved are about 7%, the widowers are about 5% while the widows and divorce are about 4% and 1%
respectively. It is therefore expedient to know if these groups of people have another source of income or
primary occupation aside the production of charcoal. It was discovered that about 74.4% of these people are into
farming while about 18.1% are artisans and the least group of people are unemployed which has the percentage
of 7.5%, which was contrary to finding of (Izekor & Amiandamhen 2017) who reported that most of the
respondents in their study area were business men and women representingaround 52.5% while others were
farmers, artisans, students, civil servants and unemployed respectively. The household size of the respondent
was also considered. However, their year of experience in the production of charcoal differs. About 38.13% of
the respondents have been into the production of charcoal for about 11 to 20 years and 24.4% of them have an
experience of about 21 to 30 years. Some of the respondents also, have an experience of fewer than 10 years and
they are about 15.63% while about 12% of them have an experience of 31 to 40 years and those that have the
least experience are about 10% with the experience of 41 to 50 years.
The Challenges Faced During Charcoal Production
This research work also looked into some of the challenges faced with the production of charcoal, and it was
discovered that charcoal producers in the study area faced numerous problems as revealed from the respondents
(Table 2) below. It was showed that about 90% of the respondents said that trees for charcoal production are
getting scarce, unlike two to three decades ago when trees for charcoal production could be gotten a little
distance from their villages, but as at time of this research work, they have to go a very long distance in search
of the available forest where the kind of wood required could be found (Anderson 1996). This, therefore, results
into a change in price in terms of the amount paid by the traders i.e. the farther the distance of production site
from the villages, the higher the transportation cost and the lesser the price that traders would want to pay
(Izekor & Amiandamhen 2017). It was also discovered that wildfire as revealed by the respondents is also
another problem people were faced with the production of charcoal which is negatively affects both the charcoal
producers and nonproducers and even lead to total destruction of the forest where the production is being carried
out. About 70% of the respondents gave this report and that the rate of wildfire in the study area is very
alarming. Government also, was said to be a problem unto them in that the Forestry Department of the State
usually give them problem by stopping them from exploiting the forest and about 74% of the respondent fell
into this category saying, “forest is what God has blessed them with and nobody can dictate to them when and
how to exploit” but it‟s quite unfortunate that they don‟t know the gravity of the problem that the forest
exploitation can pose on human health. However, the respondents also complained of the difficulty they usually
face to get their products transported to where it could be demanded for or purchased and if the products are
sold at the production site, it often times result in little or no gain which makes it difficult for them to go into
production again as reported by about 74% of the respondents.
Table 2. Production and challenges faced by the respondents.
Problems Support (%) Indifference (%)
Scarcity of Tree 90 10
Wildfire 69 31
Government disturbance 74 26
Transportation 80 20
Resources for charcoal production, production process and other important variables
This study reveals that about 60% of the respondents source for the wood they use in producing the charcoal
from an inherited farmland, while 30% of them often purchase wood for the purpose of the production and the
remaining 10% of the respondents combines the two sources for their charcoal production (i.e. the source from
an inherited farmland and as well as purchasing the wood resource) as represented in table 3. But the case was
different from the report of the research conducted by (Izekor & Amiandamhen 2017) and reported that about
51% of the respondents get their supply of fuel wood from fuelwood sellers 15% collects theirs from bushes
around and 25% received theirs from farm lands.
Table 3. Resources for charcoal production, production process and other important variables.
Variable Frequency Percentages
Wood source
Purchased 48 30.0
Inherited 89 56.0
Purchased and inherited 23 14.0
Type of forest
Natural 80.0
Plantation 20.0
Number of laborers
0 48 30.0
1 37 23.0
2 22 14.0
3 20 13.0
4 26 16.0
5 2 1.0
6 5 3.0
Tree species preferred
Butyrosopermum paradoxium (Emi) 50.0
Dialium guineense (Ayin) 20.0
Terminalia glaucencens (Idi) 6.0
Disternonanthus benthamianus (Ayan) 10.0
Khaya ivorensis (Mahogany) 4.0
Azadirachta indica (Dongoyaro) 2.0
Number of days
7–8 37 23
9–15 123 77
Quantity of logs
1–500 3 19.0
501–1000 40 25.0
1001–1500 27 17.0
1501–2000 38 23.0
2001–2500 22 14.0
2501–3000 22 14.0
3001–3500 5 3.0
>3500 3 2.0
Production/Month
Once 118 74.0
Twice 34 21.0
Three times 8 5.0
Buyers preferred
Local traders 53 52.0
Exporters 77 48.0
Consumers - -
Moreover, the source of wood for charcoal production in respect to the type of forest as represented also in
Table 3 is also considered in this research and it was discovered that the majority (80%) of the respondents gets
the wood for charcoal production from the natural forest, while about 20% of the respondents get their wood
from forest reserves. This may be due to the fact that natural habitat environments constitute different species of
the tree species, and this can be a factor whereby they prefer going to the natural environment for collecting the
tree species used for the charcoal production (Izekor & Osayimwen 2010). The labour distribution of the
respondents in the study area was also put into consideration and it was discovered that 30% of the respondent
used family labour in carrying out their charcoal production as they did not rely on hire labourers at all, While
23% of the respondents hire just one labourer who happened to be the saw operator that helped the farmers to
cut the trees to various sizes. Some of the respondents were discovered as represented in table 3 to be using
more than one labourer in their production. About 14%, 13% and 16% of the respondents have additional
labourers of 2, 3, 4 respectively to themselves in the production but very few of the respondents (1%, 3%) use
additional labourers of 5 and 6 respectively.
Tree species are very much important in the production of charcoal as there are specific trees species that are
known to favour charcoal production due to dense and hard charcoal they produce, with higher calorific value
(Izekor & Modugu 2011). These tree species which contain both scientific names and common names are;
Butyrosopermum paradoxium (Emi), Dialium guineense (Ayin), Terminalia glaucencens (Idi), Disternonanthus
benthamianus (Ayan), Azadirachta indica (Dongoyaro) and Khaya grandofoliola or Ivorensis (Mahogany). It
was revealed in table 3 that Butyrosopermum paradoxium accounted for more than 50% proportion of tree
species preferred for charcoal production, Dialium guineense accounted for a proportion of more than 20%
while Disternonanthus benthamianus was revealed to have accounted for 10% of the proportion of tree
preferred for charcoal production. Terminalia glaucencens, Khaya species and Azadirachta indica (Dongoyaro)
accounted for the proportion of 6%, 4% and 2% respectively. It was said that mahogany was very common in
the study area but due to continuous exploitation it is gradually going into extinction. According to the
respondents, presently in the study area, all these trees are not as common as before. However, the method of
charcoal production has a great impact on the output or the yield of the production. The major production
method practice in the study area is traditional methods which is a mound, and are usually rectangular and
circular in shape. Charcoal is produced in mound igniting the kiln and allows carbonization under limited air
supply. It was revealed in table 3 that less than 30% of the respondents accounted for those of which their
carbonization lusted for 7–8 days while more than 70% accounted for those their carbonization lasted for 10–15
days. Carbonization is subject to the level of dryness of the wood and the quantity of wood used for charcoal
production.
CONCLUSION
The study established that charcoal production was profitable in the study area. Though production was
carried out mainly during off seasons, when rainfall was minimal or not available. This period (off season)
income of the farmers is at a low state and in most cases none at all. The farmers now found solace in charcoal
productions, which now stands as another source of revenue for the farmers in the study area. But the extent of
deforestation and ozone layer depletion in the study area is alarming. Massive afforestation should be
encouraged in the study area to lessen the effect of deforestation and fire outbreak caused through this practice
should be managed.
ACKNOWLEDGEMENTS
We wish to appreciate the farmers in the study areas for giving us audience and information‟s on charcoal
production in Oke-Ogun area of Oyo State.
REFERENCES
Akpalu W, Dasmani I & Aglobitse PB (2011) Demand for cooking fuels in a developing country: to what extent
do taste and preferences matter? Energy Policy 39: 6525–6531.
Anderson D (1996) Energy and the Environment: Technical and Economic Possibilities, Finance and
Developments, Appraisal. Available from: http://www.worldbank.org/wbi/sourcebook/sba104.htm.
(accessed: 30 Jul. 2007).
Arnold JEM, Köhlin G & Persson R (2006) Wood fuels, livelihoods, and policy interventions: changing
perspectives. World Development 34(3): 596–611.
Arnold MJE & Person R (2005) Reassessing the fuel wood situation in developing countries. In: Sayer J (ed)
The Earthscan Reader in Forestry and Development. London, Earthscan, pp. 206–214.
Bhattarai TN (1998) Charcoal and its socio-economic importance in Asia. Paper presented at the regional
training at the regional training on Charcoal production, Pontianak, Indonesia, organized by RWEDP, 12 p.
ESMAP (2003) Household fuel use and fuel switching in Guatemala. Joint UNDP/world Bank Energy Sector
Management Assistance Project FAO, Rome No 42, 125 p.
FAO (2005) Global Forest Resources Assessment 2005. FAO Forestry Paper 147: Progress towards sustainable
forest management. Available from: ftp://ftp.fao.org/docrep/fao/008/A0400E/A0400E00.pdf. (accessed: 04
Jan. 2008)
Gerald F (1986) Charcoal Making in Developing Countries Technical Report No 5, Goals, pp 37–41. Available
from: http://esa.un.org/un-energy/pdf/UN-ENRG%20paper.pdf. (accessed: 14 Jul. 2006)

Handbook on Agricultural Activities in Oyo State (2001) A Book Prepared household energy source in Benin
City. African Scientist 2(1): 33–39.
Izekor DN & Amiandamhen SO (2017) Utilization of Fuelwood as Household Energy among Residents of
Benin Metropolis, Edo State, Nigeria. Nigerian Journal of Agriculture, Food and Environment 13(2): 174–
178.
Izekor DN & Modugu WW (2011) Utilization of sawmill wood waste in forest resource conservation. In:
Proceeding of the 34th Annual conference of the Forestry Association of Nigeria held at Oshogbo, Osun
State, Nigeria, pp 418–426.
Izekor DN & Osayimwen FE (2010) Potentials of sawmill wood wastes utilization as household energy source
in Benin City. African Scientist 2(1): 33–39.
MARGE (Marchéage et Gestion de l‟Environnement) (2009) Malawi biomass energy strategy. Consultancy
study for Government of Malawi and European Union Partnership Dialogue Facility. Lilongwe: MARGE.
NPC (2006) National Population Commission, Population Census in By the Department of Planning, Research
and Statistics of the Development, Secretariat, Ibadan, pp. 1–10.
Ogara JI (2011) Preliminary studies on charcoal production and producers‟ knowledge of environmental hazards
in Nasarawa State, Nigeria. Production Agriculture and Technology 7(2): 68–75.
Sengupta S & Maginnis S (2005) Forests and development: Where do we stand? In: Sayer J (ed) The Earthscan
Reader in Forestry and Development. London, Eathscan, pp. 206–214.
Sepp S (2010) Wood energy: renewable, profitable andmodern. Postfach, GTZ, Germany
(DeutscheGesellschaftfürTechnischeZusammenarbeit). Available from: http://www.gtz.de/de/dokumente/
Gtz 2010-en-wood-energy-talking-points.pdf (accessed: 19 Dec. 2011).
UNDP (2005) Basing National Development on the Millennium Development Goals. Available from:
http://www.undp.org.mk/Default.asp? where=focusarea&project=89 (accessed: 18 Apr. 2007).
UN-Energy (2005) The Energy Challenge for Achieving the Millennium Development Goals. Available from:
http://www.undp.org/content/undp/en/home/librarypage/environment-energy/sustainable_energy/the_
energy_challengeforachievingthemillenniumdevelopmentgoals.html (accessed: 18 Apr. 2007).
World Resources (2001) People and Ecosystem: The Fraying Web of Life. WRI, Washington D.C.
ISSN (E): 2349 – 1183
ISSN (P): 2349 – 9265
5(1): 53–60, 2018
DOI: 10.22271/tpr.2018.v5.i1.009
Research article
The Gingers of the north coastal Andhra Pradesh, India

Prameela R.1* and Venkaiah M.2
1
M. R. Degree College, Vizianagaram, Andhra Pradeah-535002, India
2
Department of Botany, Andhra University, Visakhapatnam, Andhra Pradeah-530003, India
*Corresponding Author: prameelachris@yahoo.com [Accepted: 31 March 2018]
Abstract: The north coastal Andhra Pradesh is one of the important agro-climatic zones of Andhra
Pradesh with the high altitude hill zones. Forest range is considered as a basic unit in which
harbours good patches of vegetation. Some important study areas are Chintapally, Narsipatnam,
Anantagiri, Araku, Kurupam, Gummalakshmipuram, Parvathipuram, Salur and Palakonda. As
zingibers are shade loving plants, they mostly grow in damp and humid shady places. Some
species can fully expose to the sun, and grow on high elevation. Very few species cultivated in
plain areas for the commercial and domestic purpose (Ginger, Turmeric and Ornamentals etc.).
North coastal Andhra Pradesh covers the 20 percent of the forest area (6,51,537 ha), with rich
sources of flora and fauna. Zingibers possess great medicinal properties like expectorant, acrid,
aphrodisiac, thermogenic, febrifuge, appetiser, carminative, antihelmintic etc. They are useful in
vitiated conditions of vata, pitta and kapha, respiratory diseases, digestive complaints, and Skin
diseases. Because of the great medicinal properties of zingibers, they are widely used by the
people from all parts of the world, and also pharmacological studies are extensively conducted on
these plants.
Keywords: Ginger - Zingiberaceae - Hill regions - North coastal Andhra Pradesh.
[Cite as: Prameela R & Venkaiah M (2018) The Gingers of the north coastal Andhra Pradesh, India. Tropical
Plant Research 5(1): 53–60]
INTRODUCTION
Family Zingiberaceae having some peculiar and common characters like Rhizomatous perennial rootstock.
Distichous and ligulate leaves. Flowers in racemes, heads or cymes. Flowers zygomorphic, bracteates and
bracteolate. Sepals three, united at the base. Petals three, separate. Fertile stamen one and 1 to 3 petaloids
staminodes formed into a lip. Ovary inferior, tricarpellary, trilocular. Fruit loculisidal capsule (Gamble 1915–
1936). Zingiberaceae is one of the largest, medicinally important families among the monocots (Das et al. 2013,
Kirtikar & Basu 2003). 90 % of the Zingibers are used as herbal medicine in addition to medicine they provide
important natural resources like food, spices, dyes, perfume, essential oils and aesthetics to man (Sirirugsa
1999). Zingiber officinale, for example, has been used for many years as spice and in traditional forms of
medicine to treat a variety of diseases. Throughout the world, Zingiberaceae family contains about 52 genera
with 1587 species (The plant List 2017). The present study was carried out on locally available plants. There are
8 genera and 26 species are studied from this area. Some gingers like Curcuma species, Kaempfera species and
Cheilocostus speciosus are undergone for dormancy for 6 to 7 months during winter and summer season from
December to May. After dormancy period they will germinate in the rainy season. For this reason all the
dormant gingers are blossoms in the rainy season from July to October or November, after flowering they are
undergoing to dormancy.
Present study area, north coastal Andhra Pradesh is one of the important Agro-climatic zones of Andhra
Pradesh with the high altitude hill zones. The region extends an area of 23,48,612 ha. North coastal Andhra
Pradesh comprises the three districts namely Srikakulam, Vizianagaram and Visakhapatnam. In which
Visakhapatnam is the largest district occupying nearly 47% of the area in the region. Some important study
areas are Chintapally, Narsipatnam, Anantagiri, Araku, Kurupam, Gummalakshmipuram, Parvathipuram, Salur
and Palakonda.
Received: 06 September 2017 Published online: 31 March 2018
Prameela & Venkaiah (2018) 5(1): 53–60
This region is divided into coastal land, plains and hilly areas. Major river systems are there like
Vamsadhara, Nagavalli, Janjavathi, Champavathi, Vegavathi, Vattigadda, Gosthani, Sarada, Varaha and
Thandava. In addition to rivers there are number of ponds occurred in this region. Forest range is considered as
basic unit in which harbours good patches of vegetation. According to the forest department the area under
study includes five forest divisions with 21 Forest Ranges covering forest area of 6, 51,537 ha (nearly 20%).
MATERIAL & METHODS

The live plants were collected from the study area that is north coastal Andhra Pradesh situated on the East
Coast known as the Coromandol coast and lies approximately between 17 o 10’ to 19o 10’ N latitudes and 81o 53’
to 84o 50’ E longitudes,and successfully conserved at Botanical garden, Department of Botany, M.R.Degree
college (Formerly M.R.College for women), Vizianagaram. Literature was collected from different sources such
as Ayurvedic classical texts, floras, books, journals and internet databases to make a list of medicinal plants
classified under Zingiberaceae (Rao & Sriramulu 1986, Sharma et al. 1996, Pullaiah 1998, Venkaiah 2004,
SubbaRao & Kumari 2008).

Plant Description
Alpinia calcarata (Haw.) Roscoe, Trans. Linn. Soc. London 8: 347.1807; Gamble vol. 3.1492; Indian
Medicinal Plants vol. 4.2447 1918. (Fig. 1A)
Perennial l rhizomatous herbs, rhizome slightly aromatic, light yellow in colour; leafy stem 0.7–1.2 m high;
leaves linear-lanceolate, acuminate, 30–40 cm long, 3.5–4.0 cm width, margin scaberulous, brown; leaf sheath
7–8 cm long open at one side, ligule 1.0–1.3 cm long, brown; inflorescence terminal, panicle, rhachis pubescent.
Calyx tubular, scaberulous, mouth ciliate, petals linear, white; stamen single, dithecous, staminode or lip
attractive, red and yellow, emarginated; ovary pubescent, inferior, tri-carpellary.
Common name: Snap ginger.
Uses: Indian ginger is useful in arthritis, inflammations, stomatopathy, asthma, bronchitis, hick-up, obesity,
diabetes, dyspepsia and intermittent fevers.
Alpinia galanga (L.) Willd., Sp. Pl. 1: 12.1797; Maha. Fl. 67; Gamble vol. 3.1492.
Perennial herbs, tuberous, slightly aromatic; leaves oblong-lanceolate, acute or acuminate, margins white,
glabrous, upper surface green lower surface pale green, ligule short, rounded, ciliate; flower in open panicle, 10
cm in long, rhachis puberulous; flowers greenish white, lip veined with red, orbicular, spathulate, apex shortly
2-lobed, claw slender with 2 subulate glands at the base, ovary glabrous; capsule orange red.
Common name: Blue ginger or Thai ginger or Chinese ginger.
Uses: Improves appetite, useful in vata, bronchitis and diseases of the heart, head-ache, rheumatic pains, pain in
the chest, burning of the liver, diabetes, diseases of the kidney. It is disinfectant, used to destroy bad smells in
the mouth.
Alpinia malaccensis (Burm.f.) Roscoe, Trans. Linn. Soc. London 8: 345 1807. Gamble vol. 3.1493; MV.205.
Leafy stem up to 3 m high, leaves shortly petiole, petioles, sheathes pubiscent oblong lanceolate, acuminate,
hairy on the midrib beneath; the margins often densely villous; leaves distichous, racemes terminal, up to 0.3 m
long; rachis villous, bracts large, white, petaloid, coreaceous, flowers white with pinkish striations in the centre,
labellum yellow, centre variegated deep-red and yellow, hirsute at base with in with 2 papillose swellings at
base within, stamen 1, pubescent on the inner side of the filament; staminodes 2, ovary hirsute; epigynous
glands 5, free; style long, pubescent, stigma funnel shaped, villous.
Common name: Adavi allamu
Uses: Rhizomes and leaves yield essential oils. Rhizomes employed for treating sores.
Alpinia nutans Roscoe, Exot. Bot. 2: 93.1806; Indian Medicinal Plants vol. 4. 2448. (Fig. 1B)
Perennial rhizomatous shrubs, leafy stem grows upto 1.8 m high, leaves 40–60 cm long, 8.0–15 cm width,
pubescent beneath, inflorescence terminal, panicle, 15–30 cm; rhachis very hairy, lower branches bearing 2–3
crowded flowers, bracteoles broad, navicular; corolla segments oblong, white tipped with pink. Lip broad,
variegated with red and yellow and emarginated.
Common name: Shell flower ginger.
Uses: Improves appetite, useful in kapha and vata, bronchitis, asthma, indigestion and diseases of the heart,
head-ache, rheumatic pains, pain in the chest, burning of the liver, diabetes, diseases of the kidney. It is
disinfectant, used to destroy bad smells in the mouth.
Alpinia purpurata (Vieill.) K.Schum., Pflanzenr. IV, 46: 323.1904; Botanica 84.
Perennial rhizomatous shrubs, leafy stem grows up to 2 m high, leaves 10–15 cm long, 4.0–6.0 cm width,
inflorescence terminal, showy red spikes. Bracts red colour, single flowered, flowers white, new plantlets sprout
among the flower bracts and take root when the dying flower stems fall to the ground under the weight of the
growing plantlets.
Common name: Red ginger.
Uses: It is an ornamental plant grown in the gardens for their beautiful flowers.
Curcuma amada Roxb., Asiat. Res. 11: 341.1810; Gamble vol. 3.1482; Indian Medicinal Plants vol. 4.2422.
Root stock large, sessile tubers thick, cylindric or ellipsoid pale yellow inside, tufted leaves, 0.6–0.9 m high,
leaves with long petiole, lamina oblong lanceolate, acute or acuminate, glabrous, green on both sides, tapering at
both ends, up to 24 cm long, 9.0 cm wide petioles as long; inflorescence arise from the root stock, flowers on
spikes in the centre of the tuft of leaves; peduncle 9.0 cm long or more, flowering bracts 1.5 cm long, greenish
white; bracts of coma longer and narrower, tinged with pink or red; corolla white or pale yellow; lip semi
elliptic, 3-lobed, mid lobe emarginated.
Common name: Mango ginger, Mamidiallamu.
Uses: Rhizome is cooling, appetiser, antipyretic, laxative, all kinds itching and skin diseases, bronchitis, asthma
and hick-up. And also useful in troubles in the mouth and the ear.
Curcuma aromatica Salisb., Parad. Lond. t. 96.1808; Gamble vol. 3.1482; Indian Medicinal Plants vol. 4.2419.
Perennial rhizomatous, palmately branched, sessile annulate biennial tubers, aromatic and yellow inside;
leaves oblong-lanceolate, petioles as long as or longer then the blade. Flowers fragrant, shorter than the bracts,
flowering bracts ovate, recurved, cymbiform, rounded at the tip, tinged with red or pink; calyx irregularly 3-
lobed. Lip yellow, obovate, 3- lobed
Common name: Wild Turmeric, kasturi pasupu.
Uses: Rhizomes used for bruises and sprains.
Curcuma caesia Roxb., Asiat. Res. 11: 334.1810; Indian Medicinal Plants vol. 4.2422.
Leaves broadly lanceolate or oblong, glabrous, with a deep ferruginous purple cloud down the middle which
penetrates to the lower surface, petiole and sheath about as long as the blade; spikes appearing rather before the
leaves. Flowering bracts green with a ferruginous tinge, coma deep bright red, tending to crimson. Flowers pale
yellow, reddish at the outer border.
Common name: Black turmeric, Nallapasupu, or Manupasupu.
Uses: Dried rhizomes and leaves of are used in piles, leprosy asthma, cancer, wounds, impotency,fertility, tooth
ache, vomiting, and allergies.
Curcuma longa L., Sp. Pl. 2.1753; Maha. Fl. 77; Gamble vol. 3.1482. (Fig. 1C)
Large rhizomatous herbs, rhizome ovoid, sessile cylindric, aromatic, bright orange coloured inside; leaves
radical, oblong, caudate acuminate, tapering to the base uo to 25–30 cm long 12 cm wide; flowering spikes
rising in the centre of a previously formed tuft of leaves 10–15 cm long, peduncle clothed in appressed bracts;
flowers in a dense, bracteate, stribiliform spike, terminating in a coma of enlarged sterile bracts, white coloured,
tip tinged with green; fertile bracts forming pouches enclosing single flower, yellow; calyx short, cylindric,
minutely toothed; corolla funnel shaped, lobes 3, ovate, upper one longer and hooded; lateral staminodes
petaloid, connate with the filament, anterior staminode formed into the lip, orbicular, yellow; fertile stamen one,
filament short, anther cells 2, spurred at the base; ovary 3-celled, ovules many, axile placentation, style filiform,
stigma ciliate.
Common name: Turmeric.
Uses: Rhizome is a source of turmeric, used as a condiment and a colouring agent, stimulant, carminative,
stomachic and depurative.
Curcuma pseudomontana J. Graham, Cat. Pl. Bombay 210.1839; Gamble vol. 3.1483; AP. Fl.964. (Fig. 1D)
Root stock small, stem less herbs, up to 40cm high, rhizomes conical, bearing stalked sub globose tubers,
pure white inside, black on drying, leaves oblong-lanceolate, acute or shortly acuminate, entire, acute at base,
glabrous, petioles 6.0–7.0 cm long lamina, 7.0–8.0 cm long, spikes up to 10 × 5 cm, arising from the centre of
atuft of leaves; upper bracts sterile, pink or pinkish white, lowering bracts smaller than the sterile ones, white
with purple tip, saccate, each bearing 2–3 yellow flowers, calyx membranous, cream to white, 3-lobed, corolla
yellow, funnel shaped, lobes 3, subequal; dorsal lobe longer than the other two, stamen 1; filament minute,
connate with 2 yellow, petaloidstaminodes; ovary hirsute; style filiform with 2 nectary glands at base; stigma
small, lobed.
Common name: Hill turmeric, Adavipasupu.
Uses: Rhizome yield a form of arrowroot, it cures jaundice and swellings.
Elettaria cardamomum (L.) Maton, Trans. Linn. Soc. London 10: 254.1811; Gamble vol. 3.1491.
Rootstock, woody, brown, stem 2 m high, clother below with spongy sheaths, leaves linear-lanceolate,
acuminate, tip cuspidate, soft hairy, margins white, hirsute, short petiole, ligule membranous 5 cm long, pinkish
red, 30 cm long, 5 cm width, young plants pinkish red, panicles several up to 0.6 m, erect or prostrate: bracts 6–
7 flowered linear-oblong, obtuse, about 4 cm long, coralla tube white, shortly exserted, lobes 1 cm long, lip
longer, white striped with violet, capsule subtrigonous, about 0.7 cm long.
Common name: Cardamum, Elachi.
Uses: Cardamom is used for digestion problems including heartburn, intestinal spasms, intestinal
gas, constipation, liver and gallbladder complaints, and loss of appetite. It is also used for common
cold, cough, bronchitis, sore mouth and throat, and tendency toward infection. Some people use cardamom as a
stimulant and for urinary problems.In foods, cardamom is used as a spice in many parts of the world.
Globba marantina L., Mant. Pl. 2: 170.1771; Gamble vol. 3.1481. (Fig. 1E)
Herbs, erect, up to 45–85 cm long, drooping; roots fascicled, tuberous, leaves 12 × 4 cm, caudate, pubescent
below; sheaths glabrous, margins ciliate; inflorescence lax flowered spike, flowers orange, calyx funnel shaped,
corolla yellow, filaments long.
Common name: Dancing ladies ginger.
Uses: Bulbils are used as a spice and to stimulate the appetite.
Globba sessiliflora Sims., Bot. Mag. 35: t. 1428.1811; Gamble vol. 3.1480.
Erect herbs, about 40cm high, leaves elliptic, oblong-lanceolate, pubescent below; flowers deep yellow in
spikes; capsules smooth.
Common name: Stalkless swan flower.
Globba orixensis var. pubescens SubbaRao & Kumari, Fl. Visakhapatnam Distr. 2: 259.2008.
Erect herbs up to 70 cm long; leaves few up to 24 cm long, 7cm wide, oblong lanceolate, acuminate or
caudate, entire, cuneate at base, glabrous above, pubescent below; petioles long and puberulous; ligules 0.3 cm
long, membranous ciliate; sheaths 15.5 cm long puberulous, panicles 30 cm long, lax flowered, puberulous,
flowers sessile, bright yellow, staminodes 2 petaloid; lip deeply bifid, deflexed, spotted red, ovary warted,
glandular; stigma clavate, nectary glands linear.
Note: This taxon is nearer to G. orixensis Roxb., but differs from it in having long caudate leaves with pubescent
and glaucous under surface.
Hedychium coronarium J.Koenig, Observ. Bot. 3: 73.1783; Gamble vol. 3.1484; MV. 204; AP. Fl. vol. 3:966;
House plants 49. (Fig. 1F)
Root stock stout horizontal, fleshy, jointed; stem erect, leafy up to 5 ft high, leaves sessile, lanceolate, 25 × 7
cm, acuminate, narrowed at base; flowers, pure white, scented in terminal spikes 10–20 cm long, bracts oblong
subcoriaceous; lip large, 2 fid, white tinged with yellow, ovary 3-celled, ovules many, fruit globose 3-valved
capsule, seeds many, small with a lacerate aril.
Common name: Butterfly ginger, White ginger lily.
Uses: Aerial stem suitable for pulp making. Rhizomes yield a volatile oil, they are used as a febrifuge, tonic,
excitantand antirheumatic. Leaves eaten by cattle.
Hedychium flavescens Carey ex Roscoe, Monandr. Pl. Scitam. t. 50.1824; Gamble vol. 3.1485; AP. Fl. vol. 3:
966.
Root stock stout horizontal, fleshy, jointed; stem erect, leafy up to 5 ft high, leaves sessile, lanceolate, 25 × 7
cm, acuminate, narrowed at base, hirsute on lower surface; flowers in terminal spikes 10–20 cm long, flowers
yellow and aromatic. Bracts broad, tip round, 2 to 3 flowered and green. Calyx tubular, corolla tube curved,
petals 3, linear, lateral staminodes two, lanceolate, lip bilobed, lobes rounded, fertile stamen longer than the lip,
pollen round. Ovary villous, tri-carpellary, tri locular, two ovules in each locule.
Common name: Yellow ginger.
Uses: flowers highly aromatic. Blossoms at evening.
Kaempferia galanga L., Sp. Pl. 3.1753; Gamble vol. 3.1483; Maha. Fl.82. (Fig. 1G)
Small, stem less herbs; root fibers ending in smaller tubers in addition to the large ones leaves 2, spread flat
on the ground; orbicular to rotund ovate; flowers 6–12 between the 2 leaves; bracts lanceolate, flowers fragrant;
calyx short, cylindric, splitting down one side; corolla tube long three, equal; staminodes broad, petaloid, perfect
stamen one, anther two celled, on a wide connective produced above into a petaloid crest, lip broad, white with a
purple or lilac spot on each side of the lip; ovary tri carpellary, tri locular, ovules many, axile placentation, style
long, filiform; stigma turbinate.
Common name: Aromatic ginger, Sand ginger, resurrection lily.
Uses: Rhizomes stimulating, expectorant, carminative, diuretic, given in cough and pectoral affections; also
used to relieve irritation produced by stinging caterpillars. Rhizomes yield a volatile oil.
Kaempferia roscoeana Wall., Bot. Reg. 14: t. 1212.1829; House plants 55. (Fig. 1H)
Stemless with fleshy rhizome, leaves 2, sometimes 1 or 3, blade very broad-ovate, 10 ×13 cm, spreading
horizontally, upper surface beautiful shining bronzy-chocolate taffeta, iridescently veined and zoned pale green
like peacock tail, purplish and shining-grey beneath, flowers lilac with white eye.
Common name: Peacock ginger.
Uses: Ornamental plant, grown in the gardens for their beautiful foliage.
Kaempferia rotunda Linn., Sp. Pl. 3 1753; Gamble vol. 3.1484; Ind. Med. Plants 2428; Use full plants 307.
Rootstock corm, root fibres fleshy; leaves large, erect, oblong; flowering without leaves; flowers arise from
the crowded radical spike, it borne from the underground tuber; spike produces 10 – 12 flowers, only one flower
opening at a time; petals 3, linear, longer than corolla tube, staminodes 2, oblong, acute, 5-6 cm long, as long as
the lip, white; lip lilac, 5-6 cm long and 5-6 cm broad, 2- fid, segments sub orbicular; fertile stamen 2-3 cm
long, deeply 2-fid, lobes lanceolate.
Common name: Bhoomi champa, konda kaluva.
Uses: Corm considered stomachic and used in gastric complaints. Corms used as local application on tumours,
swellings and wounds, they help to remove blood clots and other purulent matter in the body.
Zingiber capitatum Roxb., Asiat. Res. 11: 348.1810; AP. Fl. vol. 3: 967.
Erect herbs up to 2 m long, leaves erect, spreading, up to 55.5 × 2.6 cm, linear-lanceolate, acuminate, entire,
glabrous above, pubescent on the lower surface especially on the midrib, sessile; sheaths up to 40 × 1 cm,
striate, pubescent without; ligule up to 0.3 cm long, pubescent; spikes terminal, dense, up to 18 × 4.1 cm,
oblong-ellipsoid; bracts red, up to 5.3 × 1.8 cm, margins thin, brown; lower bracats ovate, obtuse, pubescent
without; upper ones narrower, acute, pubescent, capsules red, up to 2.2 × 1.0 cm, ovate, striate, pubescent, seeds
up to 0.25 cm long, black, aril white and lacerated.
Common name: Wild ginger.
Zingiber montanum (J.Koenig) Link ex A. Dietr., Sp. Pl. 1: 52.1831; Gamble vol. 3.1489; Indian Medicinal
Plants vol. 4.2439. (Fig. 1I)
Perennial rhizomatous herbs; root fibers ending in smaller tubers in addition to the large ones; rhizome
yellow inside, aromatic, tasting of camphor, leafy stem 3 ft high, leaves subsessile, oblong-lanceolate,
distichous; Inflorescence arise from the rootstock, along with leaves, spikes dence, fusiform or oblong-ellipsoid,
peduncles long, shorter than the leafystem; bracts broadly ovate, bright red or greenish red, single flower,
calyxcylindric, shortly 3- lobed; corolla tubular, lobes lanceolate, the upper concave; perfect stamen single,
filament short, anther dithecous, connective produced into a narrow beak as long as anther cells, there are no
lateral staminodes, anterior staminode formed into the lip, lip broad, orbicular, yellow Spikes possess turmeric
odour, fluid gelatinous;
Common name: Cassumunar ginger, Karallamu or Karupasupu.
Uses: It is a good expectorant, remedy for cough and cold, also used as stimulant and carminative. It possess the
both the ginger and turmeric characters.
Zingiber officinale Roscoe, Trans. Linn. Soc. London 8: 348.1807; Gamble vol. 3.1489; Maha. Fl. 83. (Fig. 1J)
Rhizome stout tuberous with erect leafy stems 0.6–1.2 m high, leaves narrow, distichous, subsessile on the
sheaths, linear-lanceolate, 1–2 cm wide, glabrous, flowers yellowish with a small dark purple or purplish black
lip, in radical spikes 3–7 cm long and 2.5 cm wide on peduncles 15–30 cm long, stamen dark purple, as long as
the lip, rather shorter than the corolla.
Common name: The Ginger.
Uses: Rhizome is highly esteemed as a spice for its characteristic odour and warm pungent taste. Dried ginger is
widely used for flavouring foods. Ginger oil is an essential oil used in perfumery.
Figure 1. Some gingers of north coastal Andhra Pradesh: A, Alpinia calcarata (Haw.) Roscoe; B, Alpinia nutans Roscoe; C,
Curcuma longa L.; D, Curcuma pseudomontana J. Graham; E, Globba marantina L.; F, Hedychium coronarium J.Koenig;
G, Kaempferia galanga L.; H, Kaempferia roscoeana Wall.; I, Zingiber montanum (J.Koenig) Link ex A. Dietr.; J, Zingiber
officinale Roscoe; K, Zingiber roseum (Roxb.) Roscoe; L, Costus pictus D.Don.; M, Cheilocostus speciosus (J.Koenig)
C.D.Specht.
Zingiber roseum (Roxb.) Roscoe, Trans. Linn. Soc. London 8: 348.1807; Gamble vol. 3.1489; AP. Fl. vol. 3:
968. (Fig. 1K)
Erect herbs up to 1.5cm long, leaves distichous 40 × 8 cm long oblong-lanceolate, acuminate, entire
narrowed at base, glabrous above, pubescent below sheaths 28 cm long, striate, pubescent; ligule membranous
1.5 cm long bilobed, sparsely silky; spikes dense, sessile; bracts red, silky pubescent, flowers 6 cm long, calyx
green, tubular, corolla lobes sub equal, pale red, tube white; labellum white recurved, lateral lobes yellow very
short, rounded, stamen bright yellow, arching over the labellum, ovary oblong, villous, style with 2 subulate
glands at base; stigma pubescent, capsule 2.5 cm long 3-angled; pubescent when young, seeds ovoid, arillate,
brown, striate.
Common name: Wild ginger.

Uses: Used for digestion, fevers, rheumatism and to relieve giddiness.
Zingiber wightianum Thwaites, Enum. Pl. Zeyl. 315.1861; Gamble vol. 3.1489; AP. Fl. vol. 3: 968.
Erect herbs 2 m high, leaves 30 × 7 cm, oblong-lanceolate, acuminate, entire,cuneate at base, glabrous
above, pubescent to glabrescent on lower surface, subsessile; spikes arising from rhizomes, peduncles up to 8
cm long, clothed with membranous sheaths; bracts green; bracteoles similar to bracts, calyx green, corolla
yellow, lobes 3 subequal; labellum obovate, emarginated, yellow, spotted and striped purple, anther subsessile,
arching over the labellum; beak 0.8 cm long ovary sub globose; style, bent at apex, with 2 subulate nectary
glands at base; stigma ciliate.
Common name: Mountain ginger
Uses: It has a higher protective effect on liver.
Costaceae was included in the family zingiberaceae in earlier classification because both Costaceae and
zingiberaceae shared the same inflorescence and floral characters. The separation between this two families
were due to the lack of aromatic oils, branched aerial stems, spiromonostichous leaves with a closed sheath and
tubular in Costaceae.
Costus pictus D.Don., Edwards's Bot. Reg. 19: t. 1594 1833. (Fig. 1L)
Herb, an erect plant 1–2 ft high, root stock rhizomatous, stems spirally twisted so that leaves appear spirally
arranged, stem lower half purple red, upper half green; inflorescence cone, bracts compactly arranged, green;
flowers yellow. Plants propagated by rhizomes and stem cuttings.
Common name: Insulin plant.
Uses: This plant is used by diabetic patients.
Cheilocostus speciosus (J.Koenig) C.D.Specht, Taxon 55: 159 2006.
Costus speciosus J.Koening. Gamble vol. 3.1490; Maha. Fl. 70; MV 181; HS 458. (Fig. 1M)
Herb, an erect plant 1–2ft high, root stock rhizomatous, stems spirally twisted so that leaves appear spirally
arranged, stem lower half green, upper half red; in every twist there are 3 leaves appear, leaves oblanceolate 14
cm long, 5cm wide acuminate or cuspidate; cusp 0.4 cm long, white, glabrous above silky pubescent beneath,
leaves shining, flowers white with yellow centre, short lived, in very dense spikes, bracts ovate, bright red, lip
sub orbicular, white with a yellow centre. Plants propagated by rhizomes.
Common name: Spiral ginger.
CONCLUSION
Earlier studies shows that, in the Flora of Andhra Pradesh there are 15 species belongs to 6 genera, in flora
of srikakulam district there are 8 species with 5 genera, in the flora of Vizianagaram district there are 7 species
with 5 genera and in the flora of Visakhapatnam district there are 9 species with 6 genera.
From the present study, twenty six species belongs to 8 genera were studied from the north coastal Andhra
Pradesh region.The eight genera are Alpinia with 5 spp., Curcuma with 5 spp., Elettaria with 1 sp., Globba with
3 spp., Hedychium with 2spp., Kaempferia with 3 spp., Zingiber with 5spp. and Costus with 2 spp. As most of
the gingers are medicinally important, they are utilised by the local people for various diseases. For this purpose
gingers are greatly worked by the pharmacists.
ACKNOWLEDGEMENTS
The authors are very much thankful to students and the local people of this region for their support in
collecting the plants.
REFERENCES
Das S, Mondal P & Zaman MK (2013) Curcuma caesia Roxb. and it’s medicinal uses: a review. International
Journal of Research in Pharmacy and Chemistry 3(2): 370–375.
Gamble JS & Fischer CEC (1915–36) Flora of Presidency of Madras (3 vol.). London (Reprinted in 1957).
Kirtikar KR & Basu BD (2003) Indian medicinal plants-Volume II. International Book Distributors, Dehradun,
India.
Pullaiah T (1998) Flora of Andhra Pradesh (vol. III). Scientific Publishers, Jodhpur. India.
Rao RS & Sriramulu H (1986) Flora of Srikakulam district, Andhra Pradesh, India, (Flora of India series).
Indian Botanical Society, Meerut.

Sharma BD, Karthikeyan S & Singh NP (1996) Flora of Maharashtra state, Monocotyledons, Botanical Survey
of India, Ministry of Environment. Government of India.
Sirirugsa P (1999) Thai Zingiberaceae : Species Diversity And Their Uses. Available from:
http://www.iupac.org/symposia/proceedings/phuket97/sirirugsa.html (accessed: 15 Jul. 2017).
SubbaRao GV & Kumari GR (2008) Flora of Visakhapatnam District, Andhra Pradesh (vol. II). Botanical
Survey of India, Ministry of Environment. Government of India.
The Plant List (2017) Available from: http://www.theplantlist.org (accessed 09 Jun. 2017)
Venkaiah M (2004) Studies on the Vegetation and Flora of Vizianagaram District, Andhra Pradesh. Andhra
University, Visakhapatnam.
ISSN (E): 2349 – 1183
ISSN (P): 2349 – 9265
5(1): 61–76, 2018
DOI: 10.22271/tpr.2018.v5.i1.010
Research article
Structural analysis of Combretum-Terminaliamixed Acacia

vegetation in Ilu Gelan District, West Shewa Zone, Oromia
Region, Central Ethiopia
Zerihun Tadesse1, 2*, Ensermu Kelbessa1 and Tamrat Bekele1
1
Department of Plant Biology and Biodiversity Management, the National Herbarium, Addis Ababa University,
P.O.Box: 3434, Addis Ababa, Ethiopia
2
Wollega University, Faculty of Agriculture, Department of Plant Science, Shambu, Ethiopia
*Corresponding Author: zerihunbio@gmail.com [Accepted: 20 April 2018]
Abstract: Vegetation of two distinct sites known as Dirki and Jato was studied in Ilu Gelan
District, West Shewa Zone of Oromia Region, 195 km west of Addis Ababa, to make a structural
analysis on the component plant species comprising the Vegetation. The systematic sampling
method was used to collect vegetation data from 54 (20 m × 20 m) plots. To collect data for
herbaceous plants, five 1 m × 1 m subplots were laid in each of the main plot, where four were at
the corners and one at the center. Diameter at breast height was measured for woody species taller
than 2 m while height and cover/abundance values were visually estimated. Shannon - Wiener
Diversity Index was used to calculate species diversity, richness and evenness of the plant
communities whereas Soresen’s Similarity ratio was used to measure the similarity between the
Vegetation and four other related vegetation sites studied earlier in different study areas. One
hundred six species were used for the structural analysis of the Vegetation studied. Agglomerative
Cluster Analysis revealed three plant community types from the study area. Total density and basal
area calculated for woody species were 5,145.83 individuals ha-1 and 18.96 m2 ha-1 respectively.
Population structure and regeneration status of selected woody species were assessed and results
revealed that some species had regeneration problems and need management measures.
Keywords: Management measures - Plant community type - Structural analysis.
[Cite as: Tadesse Z, Kelbessa E & Bekele T (2018) Structural analysis of Combretum-Terminalia mixed Acacia
vegetation in Ilu Gelan District, West Shewa Zone, Oromia Region, Central Ethiopia. Tropical Plant Research
5(1): 61–76]
INTRODUCTION
Being in the geographical coordinates of 3o24´ and 14o53´ North and 32o 42´ and 48o 12´ East, and
possessing a variety of topographical land features like mountains, deep gorges, low lands, valleys and flattened
plateaus enabled Ethiopia to be a country of diverse climatic zones. This, in turn, led the country to the
possession enormous biodiversity of flora and fauna in Horn of Africa (NBSAP 2005).
As described in Friis (1992), a wide area of Ethiopia was believed to have been covered by vegetation in the
past. However, according to Moges et al. 2010, as a result of overpopulation that is being followed by the
demand of land for agricultural expansion, the vegetation of Ethiopia shows declining from time to time.
Deforestation, which is the main causative agent for the loss of the greater proportion of the biodiversity of the
county, is still common in remaining areas (Senbeta & Tefera 2001).
Consequences of the destruction are currently being pronounced as cycling rate of drought, increasing
surface area desertification and declining rate of food supply for all living forms in the country (Moges et al.
2010). These problems are more or less induced on the basis of the pressures exerted on the natural vegetation
of the country; and hence need immediate intervention to save further loss of biodiversity in the country.
Therefore, this study was done Combretum-Terminalia mixed with Acacia species vegetation Ilu Gelan District
to analyze the diversity status, structural organization, and pressure intensity on the vegetation as the whole.
Received: 01 October 2017 Published online: 30 April 2018
Tadesse et al. (2018) 5(1): 61–76

Description of the Study Area
The study was conducted in Ilu Gelan District (Fig. 1), which is situated in Oromia Region about 200 km
from Addis Ababa to the west. The central town of the district is known Ijaji is located at the coordinates of 08 o
59´ 51"N and 037o 19´ 49"E with the altitude of 1812 m a.s.l.
Figure 1. Map of Ethiopia showing the Regional States and the study area.
Climate
The climatic data was obtained from NMA (2015) to draw the climadiagram of the study area for 1995–
2014. It indicates that highest and the lowest annual rainfall recorded in Ilu Gelan was in July and February
months, respectively (Fig. 2). Again, the highest temperature was recorded in February while the lowest one was
in November.
Sampling Design
Quadrates of 20 m × 20 m were laid down along a transect line with the altitudinal drop of 25 m in the four
standard geographical directions to collect data for woody plant species at Dirki site. The same procedure was
Tadesse et al. (2018) 5(1): 61–76
applied in the case of Jato site in the north and north-west facing directions of the vegetation. Five other smaller
1 m × 1 m quadrats, one of which was at the center and the rest at the corners were laid in the bigger quadrat to
collect data for herbaceous plants.
Figure 2. Climadiagram showing rainfall distribution and temperature variation from 1995-2014 around Ijaji Town. [Source:
NMA 2015]
Environmental data collection
Records of altitude, geographical coordinates and aspect were taken in each of the bigger quadrat GPS and
Suunnto Compass instruments. The intensity of ecological disturbance was noticed and carefully recorded in the
sample plots. To identify the intensity of disturbances from grazing and anthropogenic influences coding system
was used like : 0=nil; 1= low; 2= moderate; and 3=heavy, following Woldu & Backeus (1991), Tekle et al.
(1997), Hadera (2000), Yeshitela & Bekele (2002) and Kidane et al. (2010).
Vegetation data collection
Vegetation data collection was done for all the plant habit forms (trees, shrubs, lianas, and herbs) obtained
inside the sample quadrats. DBH (Diameter at Breast Height) was measured at height of about 1.30 m above the
ground and recorded for all woody species having DBH ≥ 2 cm and height ≥ 2 m. In addition to this, estimation
of height and cover/abundance values for woody species was made and recorded in the field. If the tree branches
at 1.30 m height or below, the diameter was measured separately for the branches and then averaged.
To assess regeneration status of the vegetation, seedlings and saplings of the woody species encountered in
the sample plots were counted. Young plants of woody species having a height less than 0.5 m were counted as
seedlings while those having height in the range of 0.5 m and 2 m were counted as saplings.
Cover abundance data defined here as the proportion of area in a quadrat covered by every species recorded
and gathered from each quadrat were converted to the 1-9 Braun-Blanquet scale, which was later modified by
Van der Maarel (1979) as follows:
1: Rare, generally one individual;
2: Occasional, with less than 5% cover of the total;
3: Abundant, with less than 5% cover of the total;
4: Very abundant, with less than 5% cover of the total;
5: 5–12% cover of the total area;
Data Analysis
1. Vegetation structure
Density, DBH and height distribution classes of woody species were used to describe the structure of the
Vegetation while IVI was used to describe the ecological importance of some woody species in the study area.
Tadesse et al. (2018) 5(1): 61–76
The density of woody species and basal area of the vegetation were computed on hectare basis. Important
value index (IVI) was computed for all woody species based on relative density (RD), relative dominance (RDo)
and relative frequency (RF) to determine their dominant position. Analysis of population structure for selected
tree species was made on the basis of DBH class distribution to determine their regeneration and recruitment
status. Seedlings (SE) and saplings (SA) of tree species were analyzed with their corresponding mature tree
(MT) species on density basis to determine the status of their regeneration in the vegetation under the study area.
( )
( )
( )
( )
Basal area (BA) will be calculated using DBH as: ⁄

where, π = 3.14; d = DBH (m).
Canonical Correspondence Analysis (CCA) is an important parameter used to analyze the relationship
between environmental variables and vegetation data (Kassa et al. 2016). In this study, CCA was done to
explore the relationship between the environmental variables and vegetation data by fitting the data into
ordination scatter plot using the book in preparation (Woldu 2012).
2. Diversity analysis
Shannon -Wiener Diversity Index was used to analyze the species diversity, species richness and evenness of
the vegetation as:
∑
Where H: Shannon-Wiener Index.
Pi: the proportion of individual tree species.
ln: log basen
The equitability or evenness of the species in each quadrat was computed using the formula:
( ) ∑
Where S: the number of species

Pi: the proportion of individuals of the ith species or the abundance of the ith species expressed as a
proportion of total cover
ln: log base
3. Phytogeographical similarity
Sorenson’s Similarity ratio was used to evaluate the similarity between the three plant community types of
the vegetation in the study area and as well as the similarity between Dirki and Jato Vegetation, and four other
previously studied woodlands on the basis of their species composition.
Where Ss: Sorensen’s similarity coefficient

a: number of species common to both samples /communities/ study areas
b: number of species in sample 1
c: number of species in sample 2
RESULTS
Stem density
Species were classified into five density classes as: A= >100; B= 50.1–100; C= 10.1–50; D= 1.1–10; E= < 1.
The total stem density calculated for individuals of woody species with DBH ≥ 2 cm was 5145.83 ha-1 (Table 1).
Tadesse et al. (2018) 5(1): 61–76
Seventeen species contributed 80.09% of the total density from the density class A where Clausena anisata,
Maytenus arbutifolia, Calpurnia aurea and Premna schimperi constituted 15.99%, 9.59%, 6.96% and 6.93%
respectively. Eighteen species from the density class E constituted only 0.22% of the total density. Brucea
antidysenterica, Buddleja polystachya, Clematis longicauda, Ficus vasta, Phoenix reclinata, Ricinus communis
and Rubus apetalus contributed 0.13% while the rest eleven species of this density class constituted 0.09% of
the total density.
Table 1. Stem density ha-1 distribution of woody plants in different density classes.
Density class Number of species Number of stems Stem density ha-1 % density
A 17 8902 4121.30 80.09
B 5 689 318.98 6.20
C 20 1147 531.02 10.32
D 34 352 162.96 3.17
E 18 25 11.57 0.22
Total 94 11,115 5,145.83 100
DBH distribution
Density distribution of individuals of woody species showed decreasing from lower to higher DBH classes
(Table 2). Most of the species had the highest number of individuals in the lowest DBH class and proceeding
with decreasing degree to the consecutive higher DBH classes. DBH classes: 1= 2.0–4.0 cm, 2= 4.0–6.0 cm, 3=
6.0–10.0 cm, 4= 10.0–20.0 cm, 5= 20.0–30.0 cm, 6= 30.0–40.0 cm, 7= 40.0–50.0 cm, 8= > 50 cm.
Table 2. Density ha-1 distribution of woody individuals in different DBH classes.
DBH Class (cm) Above ground stem Density ha-1 % density ha-1
< 10 10742.00 4973.15 96.64
10.1–20.0 231.00 106.94 2.08
20.1–30.0 69.00 31.94 0.62
30.1–40.0 38.00 17.59 0.34
40.1–50.0 22.00 10.19 0.20
> 50 13.00 6.02 0.12
Total 11,115 5,145.83 100
Height class distribution
Individuals of woody species were classified into six height classes (Table 3) and density ha-1 was calculated
on this basis. Highest density ha-1 (93.19%) was recorded in the lowest height class while in the second height
class, density ha-1 was found to be 5.31%. The calculated densities for the remaining four height classes were
also 0.56%, 0.60%, 0.23% and 0.11% respectively.
Table 3. Density ha-1 of woody individuals in different height classes.
Height class (m) Aboveground stems Density ha-1 % density ha-1
2.0–6.0 10358 4795.37 93.19
6.1–10.0 590 273.15 5.31
10.1–14.0 62 28.70 0.56
14.1–18.0 67 31.02 0.60
18.1–22.0 26 12.04 0.23
>22 12 5.50 0.11
Total 11,115 5,145.83 100
Frequency
Results from the computed frequency values of different species were classified into five frequency classes
as:
A= 1.0–20.0, B= 20.1–40.0, C= 40.1–60.0, D= 60.1–80.0, E= 80.1–100 (Fig. 3).
The result showed that 60.64% of the total woody species were distributed in the lowest frequency class one
whereas, in the next four consecutive frequency classes, 12.77%, 14.89%, 3.19% and 8.51% of the species were
distributed respectively.
The eight most frequent species (Table 4) in the vegetation studied were Premna schimperi (96.30%),
Calpurnia aurea (94.44%), Maytenus arbutifolia (92.59%), Carissa spinarum (87.4%), Grewia ferruginea
(87.04%), Clausena anisata (83.33%), Croton macrostachyus (83.33%) and Searsia natalensis (81.48).
Tadesse et al. (2018) 5(1): 61–76
Figure 3. Frequency distribution for woody species in Dirki and Jato Vegetation.
Table 4. Top 25 most frequent woody species in the study area.
Species % of Frequency
Premnas chimperi Engl. 96.30
Calpurnia aurea (Ait.) Benth. 94.44
Maytenus arbutifolia (A.Rich.) Wilczek 92.59
Carissa spinarum L. 87.04
Grewia ferruginea Hochst. ex A. Rich 87.04
Clausena anisata (Willd). Benth. 83.33
Croton macrostachyus Del. 83.33
Searsia natalensis (Bernh. ex Krauss) F.A Barkley 81.48
Albizia schimperiana Oliv. 75.93
Bersama abyssinica Fresen. 64.81
Searsia pyroides (Burch.) Moffett. 64.81
Acacia abyssinica Hochst. ex Benth 59.26
Maesa lanceolata Forssk. 59.26
Syzygium guineense (Willd.) DC. 59.26
Combretum molle R. Br. ex G.Don 57.41
Rytigynia neglecta (Hiern) Robyns 57.41
Osyris lanceolata Hochst. &Steud 55.56
Vangueria apiculata K. Schum. 51.85
Senna petersiana (Bolle) Lock 50.00
Euclea divinorum Hien 44.44
Phyllanthus ovalifolius Forssk. 44.44
Pterolobium stellatum (Forssk.) Brenan 44.44
Stereospermum kunthianum Cham. 44.44
Flacourtia indica (Burm.f.) Merr 42.59
Olinia rochetiana A.Juss. 42.59
Basal Area
Total basal area of the vegetation was 18.95 m2 ha-1 for woody species >2 cm in DBH and >2 m in height
(Table 5). It was 7.87 m2 ha-1 for individuals 2.0–10.0 cm, 1.67 m2 ha-1 for individuals 10.1–20.0 cm and 9.41
m2 ha-1 for individuals ≥ 20 cm in DBH respectively. Ficus vasta, Acacia abyssinica, Croton macrostachyus,
Syzygium guineense subsp. guineense, Clausena anisata, Cordia africana, Combretum molle, Albizia
schimperiana, Maesa lanceolata and Sapium ellipticum constituted 60.46% of the total basal area.
Table 5. Basal area of woody species within different DBH classes.
DBH (cm) Aboveground stem Basal area ha-1 % Basal area
2.0–10.0 10,742 7.87 41.53
10.1–20.0 231 1.67 8.81
>20 142 9.41 49.66
Total 11,115 18.95 100
Tadesse et al. (2018) 5(1): 61–76
Importance Value Index (IVI)

Data obtained from the analysis of relative density (RD), relative frequency (RF) and relative dominance
(RDo) was used to calculate the importance value index (IVI) of the vegetation (Table 6).Twenty one (22.11%)
woody species having IVI greater than 5 constituted 221.18 (73.73%) from the total 300. Accordingly, the top
15 ecologically most dominant woody species in Dirki and JatoVegetation are Clausena anisata, Maytenus
arbutifolia, Premna schimperi, Acacia abyssinica, Ficus vasta, Calpurnia aurea, Croton macrostachyus,
Syzygium guineense subsp. guineense, Searsia natalensis, Maesa lanceolata, Carissa spinarum, Albizia
schimperiana, Grewia ferruginea, Bersama abyssinica and Combretum molle. These, in turn, constituted 186.71
(62.24%) of the total 300 IVI of the vegetation studied.
Table 6. Relative Density, Relative Frequency, Relative Dominance and IVI of top21woody species in Dirki and Jato
Vegetation.
S/N Species RD RF RDo IVI
1 Clausena anisata (Willd). Benth. 15.99 3.56 4.77 24.32
2 Maytenus arbutifolia (A.Rich.) Wilczek 9.59 3.96 3.11 16.66
3 Premna schimperi Engl. 6.93 4.12 2.81 13.85
4 Acacia abyssinica Hochst. ex Benth 0.98 2.53 10.08 13.59
5 Ficus vasta Forssk. 0.02 0.16 13.07 13.25
6 Calpurnia aurea (Ait.) Benth. 6.96 4.04 2.24 13.24
7 Croton macrostachyus Del. 2.07 3.56 6.55 12.18
8 Syzygium guineense (Willd.) DC. 3.99 2.53 5.43 11.95
9 Searsia natalensis (Bernh. ex Krauss) F.A Barkley 4.78 3.48 3.21 11.48
10 Maesa lanceolata Forssk. 4.79 2.53 3.84 11.16
11 Carissa spinarum L. 4.59 3.72 1.88 10.19
12 Albizia schimperiana Oliv. 2.22 3.25 4.28 9.75
13 Grewia ferruginea Hochst.ex A. Rich. 3.89 3.72 1.81 9.42
14 Bersama abyssinica Fresen. 3.06 2.77 2.02 7.85
15 Combretum molle R. Br. ex G.Don 1.05 2.45 4.32 7.82
16 Searsia pyroides (Burch.) Moffett. 2.10 2.77 1.57 6.44
17 Osyris lanceolata Hochst. & Steud 2.56 2.38 1.39 6.33
18 Olinia rochetiana A.Juss. 2.49 1.82 1.73 6.04
19 Cordia africana Lam. 0.24 0.71 4.49 5.45
20 Rytigynia neglecta (Hiern) Robyns 2.02 2.45 0.62 5.10
21 Millettia ferruginea (Hochst.) Bak. 2.07 1.11 1.92 5.10
Dominance
Because of the relative ecological roles they play in the vegetation area, twentyone tree/and or shrub species
were selected as dominant species in the vegetation (Table 5). Clausena anisata, Maytenus arbutifolia, Premna
schimperi, Acacia abyssinica, Ficus vasta, Calpurnia aurea, Croton macrostachyus, Syzygium guineense subsp.
guineense, Searsia natalensis, Maesa lanceolata, Carissa spinarum, Albizia schimperiana, Grewia ferruginea,
Bersama abyssinica, Combretum molle, Searsia pyroides, Osyris lanceolata, Olinia rochetiana, Cordia
africana, Rytigynia neglecta and Millettia ferruginea were dominant species in the vegetation.
Population structure of selected tree species in the Vegetation
The analysis of selected woody species in the study area resulted in six different patterns of population
structures, and one species was taken to show its corresponding pattern (Fig. 4). The first population pattern was
represented by species distributed only in the DBH class one and totally absent from the other DBH classes (Fig.
4A). Calpurnia aurea was taken as representative species in this pattern. The other species showing this pattern
were Allophylus macrobotrys, Apodytes dimidiata, Bridelia micrantha, Buddleja polystachya, Capparis
tomentosa, Ehretia cymosa, Ekebergia capensis, Dalbergia lacteal, Diospyros abyssinica, Dovyalis abyssinica,
Flacourtia indica, Ficus sycomorus, Ficus thonningii, Maytenus obscura, Pterolobium stellatum, Rothmannia
urcilliformis and Vernonia amygdalina.
The second population pattern was represented by species having the highest density in the first DHH class,
and then decreasing and ending in the DBH class two or three (Fig. 4B). Species showing this pattern were
Clausena anisata, Dodonaea angustifolia, Euclea divinorum, Grewia ferruginea, Maytenus arbutifolia, Maesa
laceolata, Olea europaea subsp. cuspidata, Osyris lanceolata, Searsia natalensis, Searsia pyroides, Sapium
ellipticum, Schrebera alata, Terminalia macroptera, Vangueria apiculata and, Bersama abyssinica (the species
taken as representative to show the pattern).
Tadesse et al. (2018) 5(1): 61–76
Figure 4. Population patterns of Dirki and Jato Vegetation: A, Calpurnia aurea; B, Bersama abyssinica; C, Crotom
macrostachyus; D, Combretum molle; E, Acacia abyssinica; F, Olinia rochetiana. (DBH classes: 1= <10 cm, 2= 10.1–20.0
cm, 3= 20.1–30.0 cm, 4= 30.1–40.0 cm, 5= 40.1–50.0 cm, 6= >50 cm)
The third population pattern represented by Crotom macrostachyus was shown by the species having
relatively the highest density in the DBH class one and decreasing towards the higher DBH classes and then
ending in the DBH class three or four (Fig. 4C). Species showing this pattern were Ficus sur, Millettia
ferruginea and Stereospermum kunthianum.
The fourth population pattern was represented by the species which had the highest density in the DBH class
one and decreasing towards the highest DBH class (Fig. 4D). This population pattern was represented in all the
DBH classes. Species showing this pattern were Combretum molle, Albizia schimperiana and Syzygium
guineense subsp. guineense. Combretum molle was taken to represent the population structure shown by the
species.
The fifth population pattern was shown by the species having the highest density in the DBH class two and
relatively higher density of individuals in the first DBH class, but decreasing towards the higher DBH classes
(Fig. 4E). Acacia abyssinica and Ficus mucuso showed this population pattern. But in the first DBH class,
density was not far apart from the highest density recorded in the DBH class two, whereas it was gradually
decreasing towards the higher classes.
The sixth population pattern represented by Olinia rochetiana was shown by species having relatively the
highest density in the DBH class one and decreasing through interruptions towards the higher DBH classes (Fig.
4F). Species showing this pattern were Carissa spinarum, Celtis africana, Cordia africana, Dombeya torrida,
Ficus vasta, Olinia rochetiana, Podocarpus falcatus, Premna schimperi, Rytigynia neglecta and Senna
petersiana.
Tadesse et al. (2018) 5(1): 61–76
Regeneration Status: Composition and density of seedlings and saplings

Seedlings and saplings of sixty mature tree species were used to describe the regeneration status of the
vegetation. Total density of seedlings, saplings and mature tree species were 4,790.28 ha-1, 4219.91 ha1 and
4685.18 ha-1 respectively (Appendix 1).
Three species groups were obtained from the sixty tree species that were analyzed based on
presence/absence of seedlings and saplings, comparing the total number of the seedlings and saplings together
with the total number of the corresponding mature tree species. Fourteen (23.33%) species categorized under the
first group were not represented by seedlings and saplings. Acacia abyssinica, Apodytes dimidiata, Cordia
africana, Ficus mucuso, Ficus sur, Mimusops kummel, Prunus africana and Rothmannia urcelliformis were
some of the species showed this condition. Twentytwo (36.67%) species categorized under the second group
were represented by less sum total of seedlings and saplings than the mature trees. The species showed this
status were Albizia schimperiana, Allophylus macrobotrys, Bersama abyssinica, Celtis africana, Croton
macrostachyus, Dalbergia lacteal, Ehretia cymosa and Grewia ferruginea. The rest 24 (40%) species put under
the third group were represented by more sum total of seedlings and saplings than the mature trees in the
vegetation. Species like Bridelia micrantha, Calpurnia aurea, Clausena anisata, Combretum paniculatum,
Dodonaea angustifolia, Dombeya torrida, Dovyalis abyssinica, Euclea divinorum and Flacourtia indica were
represented by this behaviour.
Phytogeographical condition of Dirki and Jato Vegetation
The vegetation of Dirki and Jato in Ilu Gelan District has been compared with four other relatively related
woodlands studied at different times. These woodlands are found around Lake Abaya to Chencha highlands
between the altitudinal range of 1177–2718 m a.s.l. (Wana 2002), GamoGofa between the altitudinal range of
600–1900 m a.s.l. (Soromessa et al. 2004), Koga irrigation between the altitudinal range of 1894–2344 m a.s.l.
(Mekonnen 2009) and Gilgel Gibe III between the altitudinal range of 703–828 m a.s.l. (Adugna 2010). The first
two and fourth studies were conducted in southern Ethiopia while the third one was done in the northwest part
of the country. The species richness of these four woodlands was compared with that of Dirki and jato to
determine the phytogeographical impression of the study area (Table 7).
Table 7. Comparison of the vegetation of Dirki and Jato with other woodland vegetations studied in Ethiopia.
Woodlands Reported by a b c Sc
Lake Abaya to Chencha Desalegn Wana (2002) 43 170 132 0.222
GamoGofa Teshome Soromessa et al. (2004) 27 186 189 0.126
Koga irrigation area Amare Mekkonen (2009) 35 178 36 0.246
Gilgel Gibe III area Fisseha Adugna (2010) 20 193 66 0.134
Where, a = Species common to Dirki and Jato Woodlands, and the woodland in comparison.
b = Species unique to the vegetation of Dirki and Jato vegetation.
c = Species found only in the vegetation in comparison with Dirki and Jato vegetation.
Sc = Sorensen’s Similarity Coefficient.
Impacts of environmental variables on vegetation distribution
The relationship between vegetation data and environmental variables, as well as among the environmental
variables themselves (such as altitude, aspect, human impacts and grazing) was calculated through fitting them
onto CCA ordination scatterplots (Fig. 5). The result from the analysis indicates that the ecological disturbances
from anthropogenic and grazing impacts are more deteriorating the Vegetation than the other factors. North-
facing aspect of the vegetation particularly in case of Dirki was less influenced by grazing as compared to the
other aspects. However, since anthropogenic impacts are more or less associated with the whole vegetation, the
variance is not markedly indicated. However, the effects of cutting trees and shrubs, collecting fuelwood and
producing charcoal are well noticed as the main anthropogenic pressures on the vegetation of the study area
(Fig. 5).
DISCUSSION
Density of woody species
Result from the analysis of the vegetation data shows that most proportion of the stem density is contributed
by woody species having stem density in the density class greater than 100 (Density size class: A = >100; B=
50.1–100; C= 10.1–50; D= 1.1–10; E= <1). Only 17 (18.09%) woody species having many aboveground stems
constituted 4121.30 ha-1 (80.09%) of the total density of the Vegetation. The five density wise most dominant
Tadesse et al. (2018) 5(1): 61–76
plant species found in this class are Clausena anisata 822.69 ha-1 (15.99%), Maytenus arbutifolia 493.52 ha-1
(9.59%), Calpurnia aurea 358.33 ha-1 (6.96%), Premna schimperi 356.48 ha-1 (6.93%) and Maesa lanceolata
246.30 ha-1 (4.79%). This result is similar to the finding of the study done by Kebede (2010), as few individuals
cover the most proportion of the density classes of vegetation under secondary regeneration. However, stem
density of 18 woody species with the density class less than one is only 11.57 ha-1 (0.22%). This indicates that
the species are scarcely represented by 1–2 individuals in the vegetation.
Figure 5. Impact of altitude, Aspect and grazing on Dirki and Jato Vegetation.
DBH and height classes
The distribution of density ha-1 of individuals of woody species showed decreasing from lowest DGH class
to the higher DBH classes. More than 96% of the density of the woody species is distributed in the lowest DBH
class < 10 cm which shows that most proportion of the vegetation is represented by shrubs and small trees.
However, as the DBH class increased, density was decreasing, that means, the vegetation has a small number of
big trees in the higher DBH classes as compared to shrubs and small trees concentrated in the lower DBH
classes. This pattern indicates that Dirki and Jato Vegetation have good natural reproduction and recruitment
potential. Similar results were reported by Yeshitela & Bekele (2003), Ayalew et al. (2006), Senbeta (2006) and
Enkossa (2008). Most woody plants that could grow to big trees might have also been cut at early stage. This
indicates that the Vegetation has been under anthropogenic influences.
Like the DBH class distribution, a large proportion of the density ha-1 (93.19%) of the sampled woody plants
is distributed in the lowest height class one. This result is similar to the findings of the study done by Abdena
(2010) and Dibaba et al. (2014). With increasing height classes, density (ha-1) of the woody plants continued
decreasing except the interruptions shown at the 3th and 4th height classes. The interruptions shown in density
distribution at these height classes could be attributed tocut effect that might have exerted on the plants at the
certain development stage. Only a few individual trees (0.11% of the total) were recorded in the highest height
class (> 22 m). This indicates that the vegetation of Dirki and Jato can be categorized under secondary
regeneration, i.e., most primary plants could be cut before growing into big trees. As a result, secondary young
plants can regenerate and replace the primary generation.
Frequency
The result from frequency distribution showed that the highest number (60.64%) of the total species is
distributed in the lowest frequency class A, and few (8.51%) species are distributed in the highest frequency
class E while other species are distributed in between the two marginal frequency classes. Species in the lowest
frequency class were relatively recorded from few sample plots whereas those in the highest frequency class
Tadesse et al. (2018) 5(1): 61–76
were the most frequent ones recorded from several sample plots. Premna schimperi, Calpurnia aurea, Maytenus
arbutifolia, Carissa spinarum, Grewia ferruginea, Clausena anisata, and Croton macrostachyus have shown the
highest values of relative frequency which indicates that these species have relatively good distribution status in
the vegetation. Few woody species having the highest frequency value took the dominant position in the
Vegetation, and this situation is also in line with Kidane et al. (2010).
Figure 6. Effects of human pressures on the vegetation (a-b cutting effect and c-d charcoal production).
Importance Value Index
Data obtained from Relative Frequency, Relative Density and Relative Basal Area to calculate Importance
Value Index (IVI) of woody species. IVI is a useful parameter to make a comparison of the ecological
significance of species (Lamprecht 1989).
The most top ten species having the highest IVI in the Vegetation were Clausena anisat, Matenus
arbutifolia, Premna schimperi, Aacacia abyssinica, Ficus vasta, Calpurnia aurea, Croton macrosthachyus,
Syzygium guineense subsp. Guineense, Searsia natalensis and Maesa lanceolata. Species like and Ficus vasta
are ecologically more important in one community while other species such as Clausena anisata, Calpurnia
aurea and Maytenus arbutifolia are distributed relatively in more than one community and ecologically play
more important roles than the species restricted to one community type.
Analysis of the Importance Value Index (IVI) of the Vegetation indicated that 21 (22.34%) of the total
woody species have IVI greater than 5.00 and constitute 221.18 (73.73%) of the total 300 IVI of the vegetation.
Clausena anisata, Maytenus arbutifolia, Premna schimperi, Acacia abyssinica, Ficus vasta, Calpurnia aurea
and Croton macrostachyus are the species relatively having higher IVI than the rest of the species. The highest
relative density of Clausena anisata and Maytenus arbutifolia attributed to their highest IVI positionwhile the
IVI of Ficus vasta was contributed from the highest value of its basal area.
Tadesse et al. (2018) 5(1): 61–76
Population structures of selected trees and shrubs

Population structures of trees have significant implications for their management, sustainable use and
conservation strategies (Shibru & Balcha 2004, Bajpai et al. 2015). Population pattern is helpful to understand
the population density, regeneration and recruitment status of particular vegetation (Teketay 2005, Alemu
2011). Based on this concept, six population patterns of tree species were observed from the data analyzed.
The first population pattern represented by Calpurnea aurea as shown in (Fig. 4A), indicates that all
individuals of the species were distributed in the DBH class one and totally absent from the higher DBH classes.
This might be attributed to shrubby nature of the species or cutting effects practiced on trees before growing to
big size. Even though this was the case, this population pattern indicates the vegetation has good reproduction
and recruitment capacity (Demise et al. 2013).
The second population pattern represented by Bersama abyssinica (Fig. 4B) was represented by species
having the highest frequencies of individuals in the first DBH class and then ending in the DBH class two. This
pattern is related to the first population structure but shows relatively inverted J-shape which indicates as the
vegetation is in good regeneration and recruitment status (Yineger et al. 2008).
The third population structure was shown in (Fig. 4C) and represented by Croton macrostachyus. In this
pattern, the highest frequencies of individuals of the species were distributed in the DBH class one. Species
represented in the population pattern showed a gradual decrease and become less frequent towards the higher
DBH classes. This pattern indicates also good regeneration status of the Vegetation.
The fourth population pattern was indicated in (Fig. 4D) and represented by Combretum molle. The highest
frequency was relatively distributed in the DBH class one and then shown gradual decline towards the highest
DBH class. This indicates that the Vegetation is in a good regeneration status.
In the fifth population pattern represented by Acacia abyssinica (Fig. 4E), higher frequencies of individuals
of the species were observed in the DBH class two and decreasing towards the higher DBH classes. It indicates
the Vegetation has good regeneration and recruitment capacity of species as relatively few numbers of
individuals are present in the higher DBH classes than in the lower classes (Bekele 1993, Senbeta 2006, Demise
et al. 2013). This structure indicates good regeneration and recruitment status of the woody species represented
by this population pattern.
The sixth population pattern represented by Olinia rochetiana as shown in (Fig. 4F), was represented by
species having the highest frequencies of individuals in the first DBH class and then showed gradual decrease
towards the higher DBH classes. However, representative individual species were not recognized in some DBH
class distributions of this population structure. This might be because of cutting effects exerted on selective
species at certain important development age by the local communities. Even though this is the case, this
population pattern shows a good reproduction and recruitment status of the species (Yineger et al. 2008).
Regeneration status of the woodland vegetation
According to Denu (2006), regeneration status of any vegetation can be explained on the basis of number
and type of seedlings and saplings associated with that vegetation. Comparison of total densities among the
seedlings, saplings and mature plant showed slight variations for selected 60 woody species (Appendix 1). The
total density of seedlings (4790.28 ha-1) exceeded the total density of the saplings (4219.91 ha-1) and the total
density of mature trees and shrubs (4685.18 ha-1) that were included in the analysis. Ratios of seedlings to
saplings = 1.135, seedlings to mature trees and shrubs = 1.022, saplings to mature trees and shrubs = 0.900 also
indicated as less number of saplings were recorded than that of the mature trees and shrubs. Even though the
density of seedlings which is greater than that of the saplings and the mature trees and shrubs indicates as the
vegetation is in a normal regeneration status, the density of saplings has not followed a similar trend. According
to Alemu et al. (2011), this distribution pattern where the density of the mature trees and shrubs exceeded the
total density of the saplings shows that the regeneration status of the studied vegetation is at a low state.
Phytogeographical description of Dirki and Jato Vegetation
The phytogeographical comparison is used to determine the similarity between different vegetation areas in
respect of species composition. Dirki and Jato Vegetation was compared with four other previously studied
vegetation with respect to its species richness (Table 7). The Vegetation shares 24.6% and 22.2% similarity with
Koga woodland and the woodland vegetation extending from Lake Abaya to Chencha highlands, respectively.
The result of the comparison also showed that Dirki and Jato Vegetation shares least similarity (12.6%) with
the woodland vegetation around GamoGofa.
Tadesse et al. (2018) 5(1): 61–76
The woodlands of Lake Abaya to Chencha highlands, GamoGofa and Gilgel Gibe III area are found in the
southern part of Ethiopia, whereas that of Koga irrigation area is found in the northwest. The most similarity
observed between the woodland around Koga and the vegetation of Dirki and Jato could be due to they share
common altitudinal range and found relatively in related ecological climatic zones i.e., northwest of the country.
But, the reason for the less similarity shown between the three woodlands and the vegetation under the study
could be attributed to their geographical differences. This conclusion is in line with the findings given in Kebede
(2010) and Dibaba et al. (2014).
Environmental variables
Variations in environmental gradients such as altitude and aspect can have remarkable effects on the
distribution of plant species in vegetation. In addition to this, grazing and anthropogenic impacts (cutting,
fuelwood collecting, and charcoal producing) can affect the natural distribution patterns of plant species. The
overall assessment made in the vegetation revealed that anthropogenic impacts have been affecting its natural
regeneration. The act of cutting made especially on small to medium sized trees and shrubs and destruction of
the vegetation as a result of the demand for fuelwood and charcoal producing by the local people (Fig. 6),
indicates that the vegetation has been under serious threats. The impacts were almost widely distributed in Dirki
and were not limited to altitude and the sampled plots.
Grazing was another problem identified in the study area where cattle encroached into the vegetation.
Accordingly, the vegetation of Dirki has been more affected particularly from the east, south and west facing
sides as the vegetation is being rapidly changing into grazing land through gradual deforestation. The situation
of Jato is also not far apart from this fact. Because it is found between settlements from the top and bottom, it is
suffering from similar problems too.
The result obtained from the correlation analysis made (CCA) for the vegetation data and environmental
variables shows the plant species were constrained by some environmental factors (altitude, aspect, human
impacts and grazing (Fig. 5). This condition is consistent with the result explained in Kidane et al. (2010).
Accordingly, the vegetation of Dirki and Jato sites has been highly disturbed from grazing at lower altitudinal
ranges than relatively at higher altitudes. However, the effect of aspect might have been overweighed due to the
north-facing part of Dirki has been bordered by a river that protects the vegetation relatively from grazing and
agricultural expansion.
CONCLUSION
Dirki and Jato Vegetation have diverse structural forms which can be explained by density, height, DBH,
frequency, basal area and IVI distributions. Density ha-1 of the woody species used in the analysis was more
concentrated in the lower DBH size class. Species like Clausena anisata, Maytenus arbutifolia and Premna
schimperi attained the highest value of IVI due to their highest relative density even though most of their
individual plants were included in the lower DBH classes. In contrary to this, Acacia abyssinica and Ficus vasta
which have lower relative density could get higher value IVI due to the highest value of their relative dominance
(basal area).
Dependence of the local people for collecting fuelwood, charcoal production, the requirement of different
materials and grazing is highly affecting the diversity and size of the vegetation of Dirki and Jato vegetation
(Fig. 6). Some plant species like Ficus sur, Cordia africana, Apodytes dimidiata, Acacia abyssinica, Ficus
mucuso and few others were not represented by either seedlings or saplings while Albizia schimperiana,
Allophylus macrobotrys, Bersama abyssinica, Celtis africana and few other species were represented by less
number of seedlings and saplings than mature plants. However, species such as Bridelia micrantha, Calpurnia
aurea, Clausena anisata, Myrsine africana, Premna schimperi and others were represented by more numbers of
seedlings and saplings than mature plants and thus they were in a good regeneration status.
ACKNOWLEDGEMENT
The authors express their deepest gratitude to Addis Ababa University in general and the Department of
Plant Biology & Biodiversity Management specifically for facilitating the processes needed for the study; for
facilitating the financial supplements required for the research. They also acknowledge the National Herbarium
of Addis Ababa University as well as Cheliya and Ilu districts of West Shewa Zone for facilitating the necessary
conditions needed to conduct the study.
Tadesse et al. (2018) 5(1): 61–76
REFERENCES
Abdena F (2010) Floristic Composition and Structure of Chato Natural Forest in Horro Guduru Wollega Zone
of Oromia Region, west Ethiopia, Thesis. Addis Ababa University, Addis Ababa, Ethiopia.
Adugna F (2010) Impact Assessment of Dam Construction on Floristic Diversity: A case of Gilgel Gibe III
Hydroelectric Dam, southwestern Ethiopia, Thesis. Addis Ababa University, Addis Ababa, Ethiopia.
Alemu A, Pretzsch J, Mohmoud TE & Adam YO (2011) Population structure, density and natural regeneration
of Boswellia papyrifera (Del.) Hochst in Dry woodlands of Nuba Mountains, South Kordofan State, Sudan.
In: Conference on International Research on Food Security, Natural Resource Management and Rural
Development, University of Bonn, Germany.
Alemu S (2011) Woody Species Composition, Diversity and Structural Analysis of Angada Forest in
MertiWereda, Arsi Zone of Oromia Region, Ethiopia. Thesis, Addis Ababa University, Addis Ababa,
Ethiopia, Thesis. Addis Ababa University, Addis Ababa, Ethiopia.
Ayalew A, Bekele T & Demissew S (2006) The undifferentiated Afromontane Forest of Denkoro in central
highlands of Ethiopia: Floristic and Structural Analysis. SINET: Ethiopian Journal of Science 29: 45–56.
Bajpai O, Kushwaha AK, Srivastava AK, Pandey J & Chaudhary LB (2015) Phytosociological status of a
monotypic genus Indopiptadenia: A Near Threatened Tree from the Terai-Bhabar Region of Central
Himalaya. Research Journal of Forestry 9(2): 35–47.
Bekele T (1993) Vegetation ecology of remnant Afromontane forests on the Central Plateau of Shewa, Ethiopia.
Opulus Press AB, Sweden.
Demise G, Lemenih M & Belliethanthan S (2013) Plant community types, Vegetation Structure and
Regeneration Status of Remnant Afromontane Natural Forest Patch within Debrelibanos Monastery,
Ethiopia. Open Science Repository Natural Resources and Conservation Article ID: e70081972.
Denu D (2006) Floristic Composition and Ecological Study of Bibita Forest (GuraFerda), Southwest Ethiopia,
Thesis. Addis Ababa University, Addis Ababa, Ethiopia.
Dibaba A, Soromessa T, Kelbessa E & Tilahun A (2014) Diversity, Structure and Regeneration Status of the
Woodland and RiverineVegetation of Sire Beggo in Gololcha District, Eastern Ethiopia. Momona Ethiopian
Journal of Science 6(1): 70–96.
Enkossa W (2008) Floristic Analysis of Alata - Bolale Forest In GudayaBilaWereda East Welega Zone, Oromia
Regional State, West Ethiopia, Thesis. Addis Ababa University, Addis Ababa.
Friis I (1992) Forest and Forest Trees of Northeast Tropical Africa: Their natural habitats anddistribution pattern
in Ethiopia, Djibouti and Somalia. Kew Bulletin Additional Series 15: 396.
Hadera G (2000) A study on the ecology and management of the Dessa forest in the northeastern escarpment of
Ethiopia, Thesis. Addis Ababa University, Addis Ababa, Ethiopia.
Kassa Z, Asfaw Z & Demissew S (2016) Plant diversity and community analysis of the vegetation around Tulu
Korma project centre, Ethiopia. Tropical Plant Research 3(2): 292–319.
Kebede B (2010) Floristic Composition and Structural Analysis of Gedo Dry Evergreen Montane Forest, West
Shewa Zone of Oromia National Regional State, Central Ethiopia. Star Journal 3(2): 119–134.
Kidane L, Bekele T & Nemomissa S (2010) Vegetation Composition in Hugumbirda-Gratkhassu National
Forest Priority Area, South Tigray. Momona Ethiopian Journal of Science 2(2): 27–48.
Lamprecht H (1989) Silviculture in the Tropics: Tropical Forest Ecosysytem and their Tree Species possiblties
and methods for their long-term utilization. Deutsche Gesellschaft für Technische Zusammenarbeit,
University of Michigan.
Mekonnen A (2009) Impact of dam construction on plant species Composition and Diversity: the case of Koga
Irrigation Dam, northwestern Ethiopia, Thesis. Addis Ababa University, Addis Ababa, Ethiopia.
Moges Y, Eshetu Z & Nune S (2010) Ethiopian forest resources: Current status and future management options.
In: View of Access to Carbon Finances. Ethiopian Climate Research and Networking, and The United
Nations Development Programme (UNDP), Addis Ababa, Ethiopia.
NBSAP (2005) National Biodiversity Strategy and Action Plan. Addis Ababa, Ethiopia.
NMA (2015) Data of Rainfall and Temperature of twenty years (1995-2014) of Ijaji area. National
Meteorological Agency, Ethiopia.
Senbeta F & Tefera F (2001) Environmental Crises in the Abiyata-Shalla Lakes National Park. In: Imperative
Problems Associated with Forestry in Ethiopia. Paper presented on XIth Annual Conference of Biological
Society of Ethiopia, February 1–2, 2001, Faculty of Science, Addis Ababa University.
Tadesse et al. (2018) 5(1): 61–76
Senbeta F (2006) Biodiversity and Ecology of Afromontane Rainforests with Wild Coffea arabica L. Populations
in Ethiopia. Ecology and Development Series No. 38.Center for Development Research, University of Bonn.
Shibru S & Balcha G (2004) Composition, Structure and regeneration status of woody species in Dindin
Natural Forest, southeast Ethiopia: An implication for conservation. Ethiopian Journal of Science and
Technology 3(1): 15–35.
Soromessa T, Teketay D & Demissew S (2004) Ecological Study of the Vegetation in GamoGofa Zone,
southern Ethiopia. Tropical Ecology 45(2): 209–221.
Teketay D (2005) Seed and Regeneration Ecology in Dry Afromontane Forests of Ethiopia: I. Seed production –
population structures. Tropical Ecology 46(1): 29–44.
Tekle K, Backeus I, Skuglund J & Woldu Z (1997) Vegetation on hill slopes of Wello, Ethiopia: Degradation
and regeneration. Nordic Journal of Botany 17(5): 483–493.
Van der Maarel E (1979) Transformation of cover-abundance values in phytosociology and its effects on
community similarity. Vegetation 39: 97–114.
Wana D (2002) Plant Communities and Diversity Along Altitudinal Gradients from Lake Abaya to
ChenchaHiglands, Thesis. Addis Ababa University, Addis Ababa, Ethiopia.
Woldu Z & Backeus I (1991) The shrub land vegetation in Western Shewa, Ethiopia and its possible recovery.
Journal of Vegetation Science 2: 173–180.
Woldu Z (2012) Comprehensive Analysis of Vegetation and Ecological Data Analysis, Basics, Concepts and
Methods. Press AAU, Addis Ababa.
Yeshitela K & Bekele T (2002) Plant community analysis and ecology of Afromontane transitional rainforest
vegetation of southern Ethiopia. SINET: Ethiopian Journal of Science 25(2): 155–175.
Yineger H, Kelbessa E, Bekele T & Lulekal E (2008) Floristic Composition and Structure of the Dry
Afromontane Forest at Bale Mountains National Park, Ethiopia. Ethiopian Journal of Science 31(2): 103–
120.
Supporting information
Appendix 1: Regeneration status of selected woody species in Dirki and Jato Vegetation.
Tadesse et al. (2018) 5(1): 61–76
Appendix 1: Regeneration status of selected woody species in Dirki and Jato Vegetation.
Species Seedlings Saplings MW TD %TD
Acacia abyssinica Hochst. ex Benth 0 0 50.46 50.47 0.37
Albizia schimperiana Oliv. 38.46 18.98 114.3 171.76 1.25
Allophylus macrobotrys Gilg 3.70 3.70 22.69 30.09 0.22
Apodytes dimidiata E. Mey. ex Am. 0 0 4.63 4.63 0.03
Bersama abyssinica Fresen. 66.20 48.61 157.4 272.22 1.99
Bridelia micrantha (Hochst.) Baill. 2.78 12.04 11.57 26.39 0.19
Calpurnia aurea (Ait.) Benth. 750.93 453.24 358.3 1,562.5 11.41
Celtis africana Buerm.f. 2.31 2.31 20.83 25.46 0.19
Chionanthus mildbraedii (Gilg & Schellenb.) 0 0 6.02 6.02 0.04
Clausena anisata (Willd). Benth. 937.96 690.28 822.7 2,450.9 17.90
Combretum molle R. Br. ex G.Don 19.91 26.85 54.17 100.93 0.74
Combretum paniculatum Vent. 1.39 1.39 5.56 8.3 0.06
Cordia africana L. 0 0 12.5 12.5 0.09
Croton macrostachyus Del. 37.96 59.26 106.5 203.70 1.49
Dalbergia lactea Vatke 7.87 10.19 26.39 44.44 0.32
Diospyros abyssinica (Hiern) F. White 0 0.93 5.09 6.02 0.04
Dodonaea angustifolia L.f. 6.94 6.94 4.63 18.52 0.14
Dombeya torrida (G.F. Gmel.) P. Bamps 100.92 65.28 8.33 174.54 1.27
Dovyalis abyssinica (A. Rich.) Warb. 11.11 13.89 15.74 40.74 0.30
Ehretia cymosa Thonn 0.46 0.93 6.94 8.33 0.06
Ekebergia capensis Sparrm. 0 0 5.09 5.09 0.04
Euclea divinorum Hien 121.76 163.89 76.39 362.04 2.64
Ficus mucuso (Miq.) Miq. 0 0 2.78 2.78 0.02
Ficus sur Forssk. 0 0 5.56 5.56 0.04
Ficus sycomorus L. 0 0 0.46 0.46 0.01
Ficus thonningii Blume 0 0 3.70 3.70 0.03
Ficus vasta Forssk. 0 0 0.93 0.93 0.01
Flacourtia indica (Burm.f.) Merr. 28.24 31.02 23.15 82.41 0.60
Gnidia glauca Steud. ex A. Rich. 17.59 24.07 11.11 52.78 0.39
Grewia ferruginea Hochst.ex A. Rich 106.02 47.69 200 353.70 2.58
Hymenodictyon floribundum (Hochst. & Steud.) Robinson 1.39 1.39 3.24 6.02 0.04
Hypericum quartinianum A. Rich. 6.02 11.11 45.37 62.5 0.46
Maesa lanceolata Forssk. 164.35 110.65 246.3 521.30 3.81
Maytenus arbutifolia (A.Rich.) Wilczek 165.74 106.02 493.5 765.3 5.59
Millettia ferruginea (Hochst.) Bak. 31.02 24.07 106.5 161.57 1.18
Mimusops kummel A. DC. 0 0 0.46 0.46 0.01
Myrsine africana L. 1057.87 950.93 37.96 2046.8 14.94
Nuxia congesta R.Br. ex Fresen. 2.31 2.31 26.85 31.48 0.23
Olea capensis L. subsp. macrocarpa (C.H. Wright) Verdc. 0.46 0.46 1.85 2.78 0.02
Olea europaea L. subsp. cuspidata (Wall.ex G.Don) Cif. 0.93 2.31 4.17 7.41 0.05
Olinia rochetiana A.Juss. 133.79 106.48 128.2 368.52 2.69
Osyris quadripartita Decne. 38.43 68.52 131.9 238.89 1.74
Phyllanthus ovalifolius Forssk. 34.72 69.44 62.5 166.67 1.22
Podocarpus falcatus (Thunb.) R.B. ex. Mirb. 13.43 14.81 6.02 34.26 0.25
Premna schimperi Baker 148.61 299.54 356.5 804.63 5.88
Prunus africana (Hook.f.) Kalkm. 0 0 0.46 0.46 0.01
Psychotria orophila Petit 12.04 13.89 6.02 31.94 0.23
Rhamnus staddo A.Rich. 51.39 39.37 2.78 93.52 0.68
Rhus natalensis Krauss 150 129.63 245.8 525.46 3.84
Rhus vulgaris Meikle 16.20 11.57 107.9 135.65 0.99
Rothmannia urcelliformis (Hiem) Robyns 0 0 1.85 1.85 0.01
Rytigynia neglecta (Hiern) Robyns 176.39 172.22 104.2 452.78 3.31
Sapium ellipticum (Krauss) Pax. 2.31 2.31 6.94 11.57 0.08
Schrebera alata (Hochst.) Welw. 11.11 22.69 38.89 72.68 0.53
Senna petersiana (Bolle) Lock 34.26 68.52 28.24 131.02 0.96
Stereospermum kunthianum Cham. 1.39 2.31 21.76 25.46 0.19
Syzygium guineense (Willd.) DC. 163.43 225 205.1 593.52 4.33
Terminalia macroptera Giull & Perr. 4.63 4.63 27.77 37.04 0.27
Vangueria apiculata K. Schum. 50.46 41.20 75.48 167.13 1.22
Vernonia myriantha Hook.f. 55.09 37.04 16.67 108.80 0.79
Total 4,790.3 4,219.9 4,685 13,695 100
ISSN (E): 2349 – 1183
ISSN (P): 2349 – 9265
5(1): 77–82, 2018
DOI: 10.22271/tpr.2018.v5.i1.011
Research article
Morphological and horticultural diversity of plum varieties

evaluated under Kashmir conditions
Dinesh Kumar1, 2*, K. K. Srivastava2 and S. R. Singh2
1
ICAR-Central Institute of Temperate Horticulture, Srinagar, Jammu and Kashmir, India
2
Division of Crop Production, ICAR-Central Institute for Subtropical Horticulture, Lucknow, India
*Corresponding Author: dkches@rediffmail.com [Accepted: 22 April 2018]
Abstract: This study was carried out to evaluate the morphological and horticultural diversity
among 15 plum varieties grafted on seedling rootstocks at ICAR- Central Institute for Temperate
Horticulture, Srinagar, Jammu and Kashmir during 2013 and 2014. The highest Trunk cross
sectional area (177.37 cm2) was recorded in Santa Rosa and canopy volume (25.42 m3) in Au-
Rosa. The maximum fruit yield (57.91 kg tree-1) was recorded in Meriposa and productivity
efficiency (0.785 kg cm-2) was in Au-cherry. Highest fruit and pulp weight (58.59 g and 56.49 g)
was recorded in Grand Duke and lowest seed weight (0.74 g) in Monarch. The highest length and
width ratio (1.42) was recorded in Grand Duke and lowest (0.94) in Black Amber. The fruit quality
attributes such as TSS (21.10oB) was estimated in Santa Rosa and acidity (0.69%) was in Au-
cherry and Red Beauty cultivars. The varieties Au-Cherry, Meriposa, Tarkol, Beauty and Monark
performed better in respect to yield and Grand Duke, Santa Rosa and Methley were better for fruit
quality of plum under Kashmir conditions.
Keywords: Morphological - Pomological - Diversity - Plum - Varieties.
[Cite as: Kumar D, Srivastava KK & Singh SR (2018) Morphological and horticultural diversity of plum
varieties evaluated under Kashmir conditions. Tropical Plant Research 5(1): 77–82]
INTRODUCTION
Plum (Prunus domestica L.) is one of the important temperate fruit crops of India mainly grown in the state
of Himachal Pradesh, Jammu and Kashmir, Uttarakhand, Punjab and Uttar Pradesh. The total area under plum
cultivation is 22000 ha with annual production of 82000 tonnes and productivity is 3.72 t ha -1 (Anonymous
2015–16). The low productivity because of region specific suitable high-yielding varieties, production and
protection technologies suiting to particular climatic conditions. The plum fruit are commonly used for fresh as
well as for drying purposes. The processed products include candy, frozen fruit, jams, jelly products and tradi-
tional Serbian plum for alcoholic beverages (Milosevic et al. 2010). The ripe fruits are the rich source of
Vitamin A, B (Thiamine), riboflavin and minerals like calcium, phosphorus and iron. The dried plums are
known as prunes and all plum cultivar cannot be used for drying purpose. The prunes have great Ayurvedic
value for medicine. European plum is used both for drying and fresh markets, while Chinese plums are used
mainly for fresh market. In India, different plum varieties are Meriposa, Au-cherry, Tarkol, Beauty, Monarch,
Green Gauge, Methley, Au-Rosa, Frontier, Kanto-05, Santal Rosa, Red Beauty, Grand Duke and President plum
are high yielder and suitable for cultivation in India (Kumar et al. 2016a). Soil macro and micro nutrient play an
important role in productivity and quality of plum (Sidhu & Kaundal 2005, Milosevic et al. 2009). In plum,
some cultivar requires low chill hours are suitable for plain area of Uttar Pradesh and Punjab and others variety
requires high chill hours are suitable for hilly state like Himachal Pradesh, Jammu and Kashmir and
Uttarakhand. In order to improve productivity, an experiment was under taken to evaluate the cultivars for
specific traits under Kashmir conditions.

A field experiment was conducted during the year 2013 and 2014 at the ICAR-Central Institute of
Temperate Horticulture, Srinagar, Jammu and Kashmir. The Research farm is situated at latitude of 34° 05′ N,
Received: 05 January 2018 Published online: 30 April 2018
Kumar et al. (2018) 5(1): 77–82
longitude of 74° 50′ E and altitude of 1640 masl. The soil of experimental field was sandy clay loam having
0.45% organic carbon, 375.14 kg N, 10.45 kg P and 251.24 kg K ha -1. The varieties under evaluation was
Meriposa, Au-cherry, Tarkol, Beauty, Monarch, Green Gauge, Methley, Au-Rosa, Frontier, Kanto-05, Santal
Rosa, Red Beauty, Grand Duke and President plum laid out in Randomised Block Design with three
replication. The trees were trained on modified central leader system and applied uniform standard cultural
practices to all the trees under observations. The plum varieties grafted on seedling root stocks and planted 4m x
4m spacing accommodating 625 plants per ha. The climatic conditions of the site falls under temperate region
having cold conditions and peak during December and January and total average annual precipitation was about
700 mm.
For performance evaluation, individual varieties were marked in the field and observations on growth, yield
and quality were recorded. The trunk cross sectional area was calculated by using formula TCSA=Girth 2/4π
(Westwood & Roberts 1970). Plant height along with canopy spread were measured in east-west and north-
south direction and expressed in meter. Canopy volume was calculated the formula as described by Castle’s
(1983), Canopy volume = 0.5228 × canopy height (m) × canopy diameter (m 2). Canopy volume was recorded
after harvesting the crop every year during the course of study. The fruits were harvested at the time of maturity
of each year (2013 and 2014). Ten ripe fruits from each genotype were randomly selected for recording the
observations on fruit quality traits. The data were collected on fruit length, width (mm), weight (g), pulp weight
(g), stone weight (g), TSS (o Brix), acidity (%) and fruit yield (kg tree-1). The fruit weight was measured by
digital balance of accuracy of 0.001g. The length and diameter of the fruit was measured with digital vernier
calipers. The measurement of fruit length was made on the polar axis, i.e. between the apex and the end of stem.
The maximum width of the fruit, as measured in the direction perpendicular to the polar axis, is defined as the
diameter. After measuring the whole fruit size, the stone was manually separated from the fruits, and traits were
measured. The fruit quality parameters such as Total soluble solids (TSS) was estimated by hand refractometer
(0–32o Brix) after crushing the fruit pulp with a pestle and mortar and then squeezed through muslin cloth for
extraction of juice. The titratable acidity was determined by titrating 2 ml juice against N/10 sodium hydroxide
using phenolphthalein as an indicator and expressed in Percent. The data of each year were analysed statistically
as per the method suggested by Gomez & Gomez (1984) for interpretation of results.
RESULTS
Vegetative growth
Data on trunk cross sectional area (TCSA) and canopy volume as influenced different varieties in plum
(Table 1). Maximum TCSA (165.42 cm2 and 177.31 cm2) were recorded in Santa Rosa variety closely followed
by Frontier (148.68 cm2 and 160.80 cm2) and Methley (124.56 cm2 and 134.47 cm2) respectively, during 2013
and 2014. The variety Santa Rosa was at par with variety Frontier and significantly superior to all other
varieties. The mean maximum TCSA (171.37 cm2) was recorded in Santa Rosa variety followed by Frontier
variety of plum. The canopy volume of the different plum varieties varied from 6.25 to 24.38 m3 and 8.12 to
Table 1. Performance of different plum varieties for Trunk Cross Sectional Area (TCSA) and canopy volume.
TCSA (cm2) Canopy volume(m3)
S.No. Varieties Mean Mean
2013 2014 2013 2014
1 Meriposa 99.87 110.87 105.37 6.25 8.12 7.19
2 Au-cherry 53.45 63.33 58.39 14.99 16.87 15.93
3 Tarkol 87.24 96.52 91.88 10.56 12.63 11.60
4 Beauty 83.56 94.76 89.16 12.22 14.31 13.26
5 Monarch 69.87 78.20 74.04 11.33 13.31 12.32
6 Green Gage 84.63 93.75 89.19 17.16 19.25 18.21
7 Methley 124.56 134.47 129.52 16.89 18.95 17.92
8 Black Amber 74.82 83.63 79.23 9.22 11.25 10.24
9 Au-Rosa 118.28 129.67 123.97 24.38 26.45 25.42
10 Frontier 148.68 160.80 154.74 12.61 14.75 13.68
11 Kanto-05 91.23 102.03 96.63 9.81 11.85 10.83
12 Santa Rosa 165.42 177.31 171.37 20.66 22.67 21.67
13 Red Beauty 66.58 77.39 71.99 6.92 8.98 7.95
14 Grand Duke 89.26 100.59 94.93 13.82 15.75 14.79
15 President Plum 65.89 74.35 70.12 12.02 14.15 13.09
CD at 5% 20.24 21.546 - 7.21 7.27 -
Kumar et al. (2018) 5(1): 77–82
26.45 m3 during 2013 and 2014. Maximum canopy volume (24.38 m3 and 26.45 m3) were recorded in variety
Au-Rosa followed by Santa Rosa (20.66 m3 and 22.67 m3) and Green Gage (17.16 m3 and 19.25 m3),
respectively during 2013 and 2014.
Fruit yield and productivity efficiency
Fruit yield and productivity efficiency as influenced by different varieties in plum (Table 2). Maximum fruit
yield (47.65 kg tree-1) was recorded in the variety Meriposa followed by Beauty (35.83 kg tree-1) and Tarkol
(33.84 kg tree-1), respectively during 2013. Slightly improvement in yield was recorded in Meriposa (43.04%)
followed by Au-cherry (79.68%) and Tarkol (72.90%) during 2014. The mean maximum fruit yield (57.91 kg
tree-1) was recorded in Meriposa followed by Au-cherry (46.68 kg tree-1) and Tarkol (46.18 kg tree-1), varieties
respectively. The productivity efficiency as influenced by different varieties in plum, maximum productivity
efficiency (0.624 kg cm-2 TCSA) followed by Meriposa (0.477 kg cm-2 TCSA) and Monarch (0.462 kg cm-2
TCSA), respectively during 2013. Slightly improvement in productivity efficiency of Au-cherry (51.76%)
followed by Monarch (50.86%) and Meriposa (28.72%), respectively during 2014. The mean maximum
productivity efficiency was recorded in Au-cherry (0.785 kg cm-2 TCSA) followed by Monarch (0.579 kg cm-2
TCSA) and Meriposa (0.543 kg cm-2 TCSA) respectively.
Table 2. Performance of different plum varieties for fruit yield and productivity efficiency.
Fruit yield Productivity efficiency
S.No. Varieties (kg tree-1) Mean (kg cm-2 TCSA) Mean
2013 2014 2013 2014
1. Meriposa 47.65 68.16 57.91 0.477 0.614 0.543
2. Au-cherry 33.38 59.98 46.68 0.624 0.947 0.785
3. Tarkol 33.84 58.51 46.18 0.387 0.606 0.496
4. Beauty 35.83 53.17 44.50 0.428 0.561 0.495
5. Monarch 32.28 54.52 43.40 0.462 0.697 0.579
6. Green Gage 27.23 40.80 34.02 0.322 0.435 0.379
7. Methley 13.22 51.58 32.40 0.106 0.383 0.245
8. Black Amber 9.01 48.38 28.70 0.120 0.578 0.349
9. Au-Rosa 23.19 22.81 23.00 0.196 0.175 0.186
10. Frontier 10.29 34.50 22.40 0.069 0.214 0.142
11. Kanto-05 22.69 19.30 20.99 0.248 0.189 0.219
12. Santa Rosa 24.03 17.55 20.79 0.145 0.099 0.122
13. Red Beauty 10.38 28.07 19.22 0.155 0.362 0.259
14. Grand Duke 22.61 8.55 15.58 0.253 0.085 0.169
15. President Plum 27.03 3.15 15.09 0.410 0.042 0.226
CD at 5% 9.45 11.27 - 0.187 0.225 -
Fruit quality characters
A perusal of data on fruit weight, stone weight and pulp weight as influenced by different varieties in plum
(Table 3). Maximum fruit weight (57.46 g) was recorded in Tarkol variety followed by Meriposa (57.43 g) and
Santa Rosa (55.80 g), respectively during 2013. Whereas, Grand Duke registered highest fruit weight (65.83 g)
followed by Santa Rosa (56.61 g) and President Plum (55.59 g), respectively in 2014. Mean maximum fruit
weight (58.59 g) was recorded in Grand Duke followed by Santa Rosa (56.21 g) and Tarkol (55.08 g),
respectively. Minimum stone weight (0.73 g) was recorded in Black Amber followed by Methley (0.88 g) and
Red Beauty (0.88 g) during 2013. Whereas, Methley registered lowest seed weight (0.60 g) among all the
varieties during 2014. Mean lowest seed weight (0.74 g) was recorded in Methley followed by Black Amber
(0.78 g) and Monarch (0.86 g), respectively. Highest pulp weight (56.17 g) was recorded in Tarkol followed by
Meriposa (55.85 g) and Santa Rosa (54.42 g), respectively during 2013. In 2014, maximum pulp weight (63.26
g) was registered in Grand Duke followed by Santa Rosa (54.77 g) and President plum (52.97 g), respectively.
Mean maximum pulp weight (56.49 g) was recorded in Grand Duke followed by Santa Rosa (54.60 g) and
Tarkol (53.45 g), respectively.
Fruit size as influenced by different varieties in plum (Table 4). Highest fruit length (56.28 mm and 64.04
mm) was recorded in Grand Duke followed by President plum (51.15 mm and 55.63 mm) were recorded in
2013 and 2014. Maximum fruit width (45.99 mm) in Santa Rosa followed by Tarkol (45.56 mm) in 2013
whereas, in 2014 Frontier registered maximum fruit width (46.45 mm) followed by President plum (46.35
mm). The highest length and width ratio (1.39 and 1.44) was recorded in Grand Duke followed by President
Kumar et al. (2018) 5(1): 77–82
plum (1.22 and 1.20) in 2013 and 2014.

Table 3. Performance of different plum varieties for fruit, pulp and stone weight.
Fruit weight (g) Stone weight (g) Pulp weight (g)
S.No. Varieties Mean Mean Mean
2013 2014 2013 2014 2013 2014
1. Meriposa 57.43 50.30 53.87 1.58 1.57 1.58 55.85 48.73 52.29
2. Au-cherry 26.17 27.63 26.90 1.49 1.03 1.26 24.68 26.60 25.64
3. Tarkol 57.46 52.71 55.08 1.29 1.99 1.64 56.17 50.72 53.45
4. Beauty 49.41 46.41 47.91 1.34 0.60 0.97 48.07 45.81 46.94
5. Monarch 28.87 33.80 31.34 0.87 0.84 0.86 28.0 32.96 30.48
6. Green Gage 18.68 19.31 18.99 1.47 1.54 1.51 17.21 17.77 17.49
7. Methley 15.57 24.16 19.86 0.88 0.60 0.74 14.69 23.56 19.13
8. Black Amber 27.72 26.31 27.01 0.73 0.82 0.78 26.99 25.49 26.24
9. Au-Rosa 54.61 44.72 49.66 1.89 2.27 2.08 52.72 42.45 47.58
10. Frontier 48.40 53.90 51.15 1.68 2.42 2.05 46.72 51.48 49.10
11. Kanto-05 42.69 33.60 38.15 1.44 0.75 1.10 41.25 32.85 37.05
12. Santa Rosa 55.80 56.61 56.21 1.38 1.84 1.61 54.42 54.77 54.60
13. Red Beauty 47.37 50.12 48.75 0.88 0.86 0.87 46.49 49.26 47.88
14. Grand Duke 51.36 65.83 58.59 1.64 2.57 2.11 49.72 63.26 56.49
15. President Plum 52.74 65.59 59.16 3.62 2.62 3.12 49.12 62.97 56.05
CD at 5% 16.14 18.27 - 1.02 0.97 - 17.12 19.54 -
Table 4. Performance of different plum varieties for fruit size and L/W ratio.
Fruit size (mm) Fruit size (mm)
Ratio Ratio
S.No. Varieties 2013 2014
(L/W) (L/W)
Length Width Length Width
1. Meriposa 44.01 45.45 0.97 37.28 40.63 0.92
2. Au-cherry 37.15 35.32 1.05 36.97 35.29 1.05
3. Tarkol 42.59 45.56 0.93 44.94 44.01 1.02
4. Beauty 43.76 42.77 1.02 29.87 31.37 0.95
5. Monarch 37.83 36.85 1.03 36.15 32.78 1.10
6. Green Gage 32.06 31.15 1.03 32.18 29.64 1.08
7. Methley 28.96 29.28 0.99 29.56 27.56 1.07
8. Black Amber 34.33 38.75 0.89 35.10 35.23 0.99
9. Au-Rosa 48.04 45.35 1.06 59.10 53.41 1.11
10. Frontier 46.51 44.62 1.04 48.83 46.45 1.05
11. Kanto-05 40.76 40.70 1.00 28.19 27.25 1.03
12. Santa Rosa 43.42 45.99 0.94 48.82 45.85 1.06
13. Red Beauty 36.19 34.86 1.04 46.82 45.11 1.04
14. Grand Duke 56.28 40.38 1.39 64.04 44.53 1.44
15. President Plum 51.15 42.25 1.22 55.63 46.35 1.20
CD at 5% 8.78 6.23 - 8.24 6.41 -
Figure 1. TSS as influenced by different varieties in plum.

Kumar et al. (2018) 5(1): 77–82
The pooled data for two years on fruit quality character as influenced by different varieties in plum (Fig. 1 &
2). Mean maximum Total Soluble Solids content (21.1oB) was recorded in Santa Rosa followed by Methley
(18.47oB) and Frontier (17.28oB), respectively. Fruit acidity varies (0.44 to 0.69 %) in different varieties of
plum. Maximum fruit acidity (0.69%) was recorded in Au-cherry and Red Beauty, whereas, minimum (0.44%)
was recorded in Methley variety of plum.
Figure 2. Fruit acidity as influenced by different varieties in plum.
DISCUSSION
Vegetative growth
In the present investigation results of 15 plum varieties for morphological and pomological diversity
revealed that maximum trunk cross sectional area was recorded in Santa Rosa variety and canopy volume in Au-
Rosa variety might be due to heredity characters of variety performing well under favourable climatic
conditions. This result is in agreement with a previous study by Kumar et al. (2016a) who found lot of variations
in morphological characters in plum varieties grown in Kashmir region. The growth behaviour of plum
depends on varietal characters and environmental conditions of the region (Sosna 2002, Vitanova et al. 2004).
Fruit yield and productivity efficiency
The Au-cherry, Meriposa, Tarkol, Beauty and Monarch varieties of plum performed better in respect to fruit
yield and productivity efficiency due to favourable soil and climatic conditions which increases the uptake of
nutrients from root to aerial part of the plants for better fruit yield and productivity efficiency. These results are
in accordance with the finding of Kumar et al. (2015, 2016a, b) while working on plum and apricot under
Kashmir conditions. The maximum fruit weight in Grand Duke, Santa Rosa and Tarkol might be due to
favourable soil and environmental condition during fruit growth and developmental stages of theses varieties.
Whereas, maximum fruit size was recorded in Grand Duke and President plum might be due to genetical
characters of these varieties and favourable climatic conditions for proper fruit growth. Meland (2005) reported
that fruit size depends on location of fruits on trees in plum.
Fruit quality
The fruit quality characters viz., TSS and acidity, maximum TSS was recorded in Santa Rosa and Methley
might be due to varietal character and environmental conditions favours for improvement in TSS content.
Whereas, higher acidity was recorded in Au-cherry variety might be due to heredity character of the variety and
environmental conditions favours for improvement in acidity content.
CONCLUSION
The present study can be concluded that the varieties Au-cherry, Meriposa, Tarkol, Beauty and Monarch
performed better in respect to fruit yield and productivity efficiency. Whereas, the varieties Grand Duke, Santa
Rosa and Methley were better for Fruit quality traits under Kashmir conditions.
ACKNOWLEDGEMENTS
The authors are grateful to The Director ICAR-CITH, Srinagar, Jammu and Kashmir for providing the
financial and technical assistance for undertaking the experiment.
Kumar et al. (2018) 5(1): 77–82
REFERENCES
Anonymous (2015–16) Area and Production of Horticultural Crops-All India
Castle’s, W (1993) Growth, yield and cold hardness of seven year old ‘Bearss’ lemon on twenty seven root
stocks. Proceeding of Florida State Horticultural Society 9: 23–25.
Gomez KA & Gomez AA (1984) Statistical Procedures for Agricultural Research, 2 nd edition. John Wiley and
Sons Inc., New York.
Kumar D, Lal S & Ahmed N (2015) Morphological and pomological diversity among apricot (Prunus
armeniaca) genotypes grown in India. Indian Journal of Agricultural Sciences 85(10): 1349–1355.
Kumar D, Lal S & Ahmed N (2016a) Genetic diversity among plum genotypes in North west Himalayan region
of India. Indian Journal of Agricultural Sciences 86(5): 666–672.
Kumar D, Singh DB, Srivastava KK, Singh SR & Zargar KA (2016b) Performance of apricot
varieties/genotypes in north western Himalayan region of India. SAARC Journal of Agriculture 14(2): 107–
116.
Meland M (2005) High density planting systems of European plums - the effect of growth and productivity of
three cultivars after nine years. Acta Agriculturae Scandinavica, Section B - Soil and Plant Science 55: 51–
57.
Milosevic T, Glisic I & Milosevic N (2009) Dense planting effect on the productive capacity of some plum
cultivars. Acta Horticulturae 825: 485–490.
Milosevic T, Milosevic N & Mratinic E (2010) Morphogenic variability of some autochthonous plum cultivars
in western Serbia. Brazilian Archives of Biology and Technology 53: 1293–1297.
Sidhu LS & Kaundal GS (2005) Effect of planting density on fruit yield, foliar nutrient content and root
distribution of plum (Prunus salicina Lindl.) cv. Satluj Purple. Acta Horticulturae 696: 299–302.
Sosna I (2002) Growth and cropping of four plum cultivars on different rootstocks in South Western Poland.
Journal of Fruit and Ornamental Plant Research 10: 95–103.
Vitanova I, Dimkova S & Ivanova D (2004) Vegetative and reproductive parameters of introduced plum
cultivars. Journal of Fruit and Ornamental Plant Research 12: 257–262.
Westwood M N & Roberts A N (1970) The relationship between trunk cross sectional area and weight of apple
tree. Journal of American Society for Horticultural Science 95: 28–30.
ISSN (E): 2349 – 1183
ISSN (P): 2349 – 9265
5(1): 83–87, 2018
DOI: 10.22271/tpr.2018.v5.i1.012
Research article
Estimation of the chlorophyll concentration in seven Citrus

species of Kokrajhar district, BTAD, Assam, India
Mohesh Gogoi1* and Miniswrang Basumatary2
1
Department of Botany, Science College, Kokrajhar, BTC, Assam, India
2
Institutional Biotech Hub, Science College, Kokrajhar, BTC, Assam, India
*Corresponding Author: mohesh.gogoi@rediffmail.com [Accepted: 25 April 2018]
Abstract: Green plants synthesize a wide range of primary and secondary metabolites in different
quantity. Chlorophylls belong to the primary metabolites that give the color of the leaves and
fruits, especially in the unripe stage. The spectral properties of chlorophylls are essential in
harvesting light energy and in the transduction of absorbed light energy for photosynthesis. Like
other plants, the variation of leaf colour, as well as photosynthetic activity in Citrus species, is
dependent on chlorophyll concentration. Chlorophyll content determines the photosynthetic
capacity of the plant per unit area of leaf, stress and nutritional deficiencies. The study of
chlorophyll content in seven Citrus species growing in different localities of Kokrajhar district of
Assam has shown some variability among them as an individual character.
Keywords: Citrus leaf - Pigment - Photosynthesis - Metabolite - Productivity.
[Cite as: Gogoi M & Basumatary M (2018) Estimation of the chlorophyll concentration in seven Citrus species
of Kokrajhar district, BTAD, Assam, India. Tropical Plant Research 5(1): 83–87]
INTRODUCTION
Chlorophylls are the most important green pigments in plants for the photosynthetic process (Bhatia &
Parashar 1997). Higher plants contain Chl a, Chl b, accessory pigments and several additional forms of
chlorophyll. The Chl a and Chl b are the best known among five main types of chlorophyll and are most
commonly found in all autotrophic organisms except pigment containing bacteria. Chl a has an empirical
formula of C55H72O5N4Mg and the empirical formula of Chl b is C55H70O6N4Mg. Chl a usually appears blue-
green and Chl b is yellow-green (Devlin & Witham 1997). Both Chl a and Chl b pigments are associated with
light harvesting processes (Ferus & Arkosiova 2001), which are solely responsible for photosynthesis in higher
plants.
Chlorophyll concentration in leaves is an indicator of plant health (Porra 2002). The chlorophyll a:b ratio
also indicates the developmental state of photosynthetic apparatus in plants. It has a determinative role in growth
and development of higher plants. The chlorophyll content also indicates the photosynthetic capacity per unit
area of the leaf (Kozlowski et al. 1991) that determines the rate of photosynthesis in the plant (Dickman &
Kozlowski 1968). Determination of chlorophyll content as an indirect method of estimating the productivity also
provides a good understanding of the photosynthetic regime of plants (Bojovic & Stojanovic 2005).The
chlorophyll content increases with leaf development and then decreases with the senescence phenomenon
(Pereyra et al. 2014). The rate of photosynthesis is also higher in flowering and fruiting branches of sub-tropical
fruit species in comparison to non-fruiting branches (Avery 1977). However, the pigment is a factor that might
also be responsible for the colour variation of leaf in different Citrus species. The present study was undertaken
for estimation of chlorophyll content in the mature leaf of Citrus plant growing in Kokrajhar district, Assam.

Seven Citrus species namely C. limon Burm f, C. medica Linn., C. aurantifolia Swin., C. reticulata Blanco.,
C. nobilis Lour., C. jambhiri Lush., and C. grandis (L.) Osbeck. as reported by Gogoi & Basumatary (2017)
were selected for the present study. The matured leaves were collected from the selected Citrus spp. growing in
different areas of Kokrajhar during the month of December 2017. One gram leaf from each species is measured
Gogoi & Basumatary (2018) 5(1): 83–87
and cut into fine pieces and then grinded with mortar and pestle. Thereafter, 20 ml of 80% acetone and 0.5 g of
(MgCo3) powder was added and further grinded gently following the method of Kamble et al. (2015). The
mixture was then incubated at 4ºC for 3 hours. The mixture was centrifuged at 2500 rpm for 5 min and the
supernatant was transferred to a 100 ml volumetric flask and the volume was made up to 100ml with the
addition of 80% acetone and the solution was used for chlorophyll estimation (Fig. 1). The absorbance of the
Figure 1. Leaves and their chlorophyll extraction in acetone solution: A, Citrus medica; B, Citrus jhambiri; C, Chlorophyll
extract of C. medica & C. jhambiri; D, Citrus nobilis; E, Citrus reticulata; F, Chlorophyll extract of C. nobilis & C.
reticulata; G, Citrus aurantafolia; H, Chlorophyll extract of C. aurantafolia; I, Citrus limon; J, Chlolorophyll extract of C.
limon; K, Citrus grandis; L, Chlorophyll extract of C. grandis.
solutions was measured at 645 nm and 663 nm in LABTRONIC Spectrophotometer LT-39 taking the 80%
acetone solution as blank (Sadasivam & Manickam1996). The reading was taken in a triplicate sample and
average was considered for calculation of chlorophyll content. The chlorophyll a, b and a + b (total chlorophyll)
contents were calculated out by applying the following (Arnon 1949) formulae:-
Where, A = absorbance at specific wavelength

V = final volume of chlorophyll extract in 80% acetone
W = fresh weight of tissue extracted

Table 1. Chlorophyll concentration in seven Citrus spp. found in Kokrajhar district of Assam.
O.D. Readings Chl a Chl b Total Chl
S.No. Name of Species
645 nm 663 nm (mg g-1) (mg g-1) (mg g-1)
1 Citrus limon Burm f. 0.554±0.137 1.277±0.002 1.47 0.61 2.08
2 Citrus medica Linn. 0.404±0.003 0.904±0.002 1.03 0.50 1.53
3 Citrus aurantifolia Swin. 0.231±0.014 0.326±0.032 0.35 0.38 0.73
4 Citrus reticulata Blanco. 0.397±0.001 0.765±0.002 0.87 0.55 1.42
5 Citrus nobilis Lour. 0.354±0.001 0.699±0.002 0.79 0.48 1.27
6 Citrus jhambiri Lush. 0.269±0.004 0.456±0.004 0.51 0.41 0.92
7 Citrus grandis (L.) Osbeck. 0.339±0.010 0.583±0.010 0.65 0.49 1.14
Figure 2. The variation of chlorophyll a and b content among seven Citrus species.
The study has revealed that the Chl a ranges from 0.35 to 1.47 mg g-1 and Chl b ranges from 0.38 to 0.61 mg
g and the total chlorophyll Chl (a+b) ranges from 0.73 to 2.08 mg g-1 in seven Citrus spp. From the result it is
-1
also seen that C. limon Burm f. has the highest concentration of Chl a and Chl b whereas C. aurantifolia
(Christm.) Swin. was found to have least quantity of Chl a and Chl b among the seven species (Table 1 & Fig.
2). Among the seven citrus species the highest total chlorophyll content was found in C. limon (2.08 mg g-1)
followed by C. medica (1.53 mg g-1), C. reticulata (1.42 mg g-1), C. nobilis (1.27 mg g-1), C. grandis (1.14 mg g-
1
), C. jambhiri (0.92 mg g-1) and C. aurantifolia (0.73 mg g-1) respectively (Table 1 & Fig. 3). Similarly, Chl a
was also found to be highest in C. limon (1.47 mg g-1) followed by C. medica (1.03 mg g-1), C. reticulata (0.87
mg g-1), C. nobilis (0.79 mg g-1), C. grandis (0.65 mg g-1), C. jambhiri (0.51 mg g-1) and C. aurantifolia (0.35
mg g-1) respectively. The second highest in quantity of Chl b was found in C. reticulata (0.55 mg g-1) followed
by C. medica (0.50 mg g-1), C. grandis (0.49 mg g-1), C. nobilis (0.48 mg g-1), C. jambhiri (0.41 mg g-1), and C.
aurantifolia (0.38 mg g-1) respectively. The highest variation of chlorophyll a and b were observed in C. limon.
The quantitative variation of chlorophyll content in Citrus spp. may be due to the health condition of the plants,
habitat condition, leaf surface area and nutrients of the soil. Earlier Bojovic & Stojanovic (2005) reported that
chlorophyll and carotenoid content in wheat cultivars depends on the presence of mineral elements in the
substrate and plant physiological and environmental factors. Moreover, the application of plant growth
regulators in higher concentrations has also positive effects on leaf chlorophyll content (Sardoei 2014).
According to Pandey & Sinha (1998) Chl a and Chl b occur together in the higher plants in the ratio of 2:1.
The typical Chl a/b for shade plants is about 1.6–2.2 and daily maximum sunlight exposed plants have the
typical Chl a/b content approximately 2.6–3.4 (Anderson 1986). In Citrus species the Chl a/b was observed in
between 0.73–2.08 which is much lower than Anderson’s view. The reason of dissimilarities of Chl a/b with
other plants may be due to the presence of inactive light harvesting complexes in Citrus resulting effect in
growth and development. Several literature and pieces of evidence suggest that the Chl a:b ratio plays an
important role to higher plants to adapt to new light regions to make optimal use of ambient light intensities and
quantities (Arnon 1949). The ratio of Chl a and b is stable in fully green leaves at nearly 3, but it can vary
depending on the physiological status of the plant (Kouril et al. 1999). An average Chl a:b ratio of 0.81:0.49
was observed in Citrus plants. Bondada & Syvertsen (2003) reported that the nitrogen-deficient leaves of Citrus
reticulata Blanco contain less chlorophyll per unit area, but a greater chlorophyll a:b ratio than N-fertilized
leaves. The Chl a/b in maximum sunlight exposure and shade plants reflect the adaptation of the chloroplast to
prevailing intensity through regulation of the amount of photosystem I (PS I) relative to photosystem II (PS II)
Figure 3. Total chlorophyll content in seven different Citrus species.

and the size and composition of the light harvesting complexes (LHCs) of each photosystem. Moreover, the leaf
colors of a plant can be used to identify stress level due to its adaptation to environmental change (Shibghatallah
2013). Therefore, from the observation it can be said that the C. limon and C. medica were well adapted under
local environmental condition. Kamble et al. (2015) opined that the leaf chlorophyll concentration plays a vital
role in maintenance of photosynthetic mechanism as well as plant metabolism. Apart from these the seasonal
variation and maturity of the leaf also affect the concentration of chlorophyll content in leaf and chlorophyll a:b
ratio remains substantially lower in plants growing in high CO 2 condition (Cave et al. 1981). Nevertheless, in
the present investigation, a variability of chlorophyll content in the Citrus species observed but it has a scope to
consider as tools for identification of Citrus species and varieties. From the (Table 1 & Fig. 2 & 3), an inference
can be made that the Chl a, Chl b and total chlorophyll content in mg/g leaf tissue of different Citrus species are
an individual character of each Citrus species studied. Remarkable variation of green colour of the leaf was
observed as the same is dependent on the variability of chlorophyll content in the species. The alteration of
Chlorophyll content may due to the factors like water, soil, temperature stress etc. which indirectly affect the
leaf area, morphology, thickness and chloroplast distribution.
CONCLUSION
The study provides a reliable data on chlorophyll content of seven citrus species growing in different
localities of Kokrajhar district. The quantitative analysis of photosynthetic pigment showed that the
photosynthetic potential and primary productivity is highest in Citrus limon followed by C. medica among the
seven Citrus spp. Further, the chlorophyll content can be used as indicators of plant health stress and nutritional
deficiencies. Our findings may be helpful in the further studies to monitor the effect of changing micro-climate
on chlorophyll content in citrus plants in terms of temperature, water, carbon dioxide concentration and soil
condition of Kokrajhar district of Assam.
ACKNOWLEDGEMENTS
Financial support from DBT, Govt. of India through the establishment of Institutional Biotech Hub is highly
acknowledged. Authors are also thankful to Principal, Science College, Kokrajhar for his encouragement and
support. Chiranjib Das, Lab Attendant is also acknowledged for his constant help during the lab work.
REFERENCES
Anderson JM (1986) Photoregulation of the composition function and structure of thylakoid membranes. Annual
Review of Plant Physiology 37: 93−136.
Arnon DI (1949) Copper enzymes in isolated chloroplasts phenoloxidase in Beta vulgaris. Plant physiology 24:
1.
Avery DJ (1977) Maximum photosynthetic rate-A case study in Apple. New Phytologist 78: 55−63.
Bhatia KN & Parashar AN (1997) Plant physiology. Trueman Book Company, Jalandhar City, pp. 254−281.
Bojovic B & Stojanovic J (2005) Chlorophyll and carotenoid content in wheat cultivars as a function of mineral
nutrition. Archives of Biological Sciences 57(4): 283−290.
Bondada BR & Syvertsen JP (2003) Leaf chlorophyll, net gas exchange and chloroplast ultrastructure in citrus
leaves of different nitrogen status. Tree Physiology 23: 553–559.
Cave G, Tolley LC & Strain BR (1981) Effect of carbon dioxide enrichment on chlorophyll content, starch
content and starch grain structure in Trifolium subterraneum leaves. Physiologia Plantarum 51(2): 171–174.
Devlin RM & Witham FH (1997) Plant physiology, 4th edition. CBS Publications & Distributions, Delhi, pp.
223−242.
Dickmann DI & Kozlowski TT (1968) Mobilization by Pinus resinosa cones and shoots of C-14 photosynthate
from needles of different ages. American Journal of Botany 55: 900−906.
Ferus P & Arkosiova M (2001) Variability of chlorophyll content under fluctuating environment. Acta
Fytotechnica et Zootechnica Vol. 4. (In: Proceedings of the International Scientific Conference on the
occasion of the 55th Anniversary of the Slovak Agricultural University in Nitra 123).
Gogoi M & Basumatary M (2017) Citrus varieties of Kokrajhar District, BTAD, Assam: Its propagation and
cultivation prospect. Tropical Plant Research 4(1): 7–12.
Kamble PN, Giri SP, Mane RS & Tiwana A (2015) Estimation of Chlorophyll content in young and adult leaves
of some selected plants. Universal journal of environmental research and technology 5(6): 306−310.
Kouril R, Ilik P, Naus J & Schoefs B (1999) On the limits of the applicability of spectrophotometer and
spectrofluorimetric methods for the determination of chlorophyll a/b ratios. Photosynthesis Research 62:
107–116.
Kozlowski TT, Kramer JP & Pallardy GS (1991) The physiological ecology of woody plants. Academic Press,
Inc. San Diego. New York, pp. 37−44.
Pandey SN & Sinha BK (1998) Plant physiology, 3rd edition. Vikas Publishing House Pvt. Ltd., New Delhi, pp.
201−218.
Pereyra MS, Davidenco V, Nunez SB & Argüello JA (2014) Chlorophyll content estimation in oregano leaves
using a portable chlorophyll meter: relationship with mesophyll thickness and leaf age. Rev. Agronomía &
Ambiente 34(1−2): 77−84.
Porra JR (2002) The chequered history of the development and use of simultaneous equations for the accurate
determination of chlorophyll a and b. Photosynthesis research 73: 149−156.
Sadasivam S & Manikam A (1996) Biochemical Methods, 2nd edition. New Age International Pvt. Ltd., New
Delhi.
Sardoei AS, Rahbarian P & Shahdadneghad M (2014) Evaluation chlorophyll contents assessment on three
indoor ornamental plants with plant growth regulators. European Journal of Experimental Biology 4(2):
306−310.
Shibghatallah MAH, Khotimah SN, Suhandono S, Viridi S & Kesuma T (2013) Measuring Leaf Chlorophyll
Concentration from Its Color: A Way in Monitoring Environment Change to Plantations. Available from:
https://arxiv.org/ftp/arxiv/papers/1305/1305.1148.pdf (accessed: 27 Jan. 2018).
ISSN (E): 2349 – 1183
ISSN (P): 2349 – 9265
5(1): 88–95, 2018
DOI: 10.22271/tpr.2018.v5.i1.013
Research article
Chemical constituents and antimycobacterial studies of the leaf

extracts of Pavetta crassipes K. Schum
Nneka N. Ibekwe1,2*, Helena Boshoff3, Joaquin Randle4, Akinbo A. Adesomoju2,
Clifton E. Barry III3 and Joseph I. Okogun1,4,5
1
National Institute for Pharmaceutical Research and Development, Abuja, Nigeria
2
Department of Chemistry, University of Ibadan, Nigeria
3
Tuberculosis Research Section, LCIM, NIAID, NIH, Building 33, 9000 Rockville Pike, Bethesda, MD 20892, USA
4
Acorn NMR Inc, 7670 Las Positas Road, Livermore, CA 94551, USA
5
Emeritus Professor, Department of Chemistry, University of Ibadan, Ibadan, Nigeria
*Corresponding Author: nnekaibekwe@yahoo.com [Accepted: 25 April 2018]
Abstract: Six known compounds; β-sitosterol, ursolic acid, methyl chlorogenate, ethyl
chlorogenate, rutin and mannitol were isolated from the leaf extracts of Pavetta crassipes
(Rubiaceae), a Nigerian medicinal plant used in the indigenous treatment of tuberculosis.
Separation and isolation of the compounds were achieved by chromatographic techniques and the
structures of isolated compounds were established by spectroscopic and chemical methods. The
isolated compounds were screened for antimycobacterial activities against Mycobacterium
tuberculosis H37Rv employing the green fluorescence protein reporter microplate assay and the
broth microdilution method. Ursolic acid, methyl chlorogenate and ethyl chlorogenate were found
moderately active in the broth microdilution assay with MICs of 200, 100 and 50 µg/ml,
respectively while methyl chlorogenate and ethyl chlorogenate were active in the protein reporter
microplate assay with MICs of 200 and 100 µg ml-1, respectively. The presence of
antimycobacterial terpenoids and quinate esters in leaves of Pavetta crassipes provides scientific
evidence for the ethnomedicinal use of the plant as a traditional anti-tuberculosis remedy.
Keywords: Pavetta crassipes - Spectroscopy - Antimycobacterial activity - Broth microdilution
assay - Green fluorescent protein reporter microplate assay.
[Cite as: Ibekwe NN, Boshoff H, Randle J, Adesomoju AA, Barry CE III & Okogun JI (2018) Chemical
constituents and antimycobacterial studies of the leaf extracts of Pavetta crassipes K. Schum. Tropical Plant
Research 5(1): 88–95]
INTRODUCTION
Tuberculosis (TB) remains a major global health concern as it is one of the world’s deadliest diseases.
Approximately one third of the world’s population is infected with TB and according to a 2015 World Health
Organization (WHO) report, an estimated 10.4 million people fell ill from TB and 1.8 million died from the
disease. Africa has the second largest incidence of tuberculosis (26% of global total) with Nigeria as one of the
six countries that accounted for 60% of new cases (WHO 2016). Current anti-tuberculosis therapy is a regimen
of isoniazid, rifampicin and pyrazinamide administered over a period of six months which leads to poor
adherence by patients. Inadequate, incomplete, or improperly supervised treatment regimen, poor prescriptions,
and co-infection with HIV have caused the emergence of resistant strains of Mycobacterium tuberculosis.
Natural products have played and continue to play a significant role in the drug discovery process with
tremendous research all across the continents for novel anti-tuberculosis agents. Some excellent review articles
on natural products have been published on different classes of compounds; exhibiting antimycobacterial
activity (Cantrell et al. 2001, Copp 2003, Okunade et al. 2004, Copp & Pearce 2007).
African traditional medicine is the oldest, and perhaps the most assorted, of all therapeutic systems and the
most common practice across the continent is the use of medicinal plants (Mahomoodally 2013). This practice
Received: 06 December 2017 Published online: 30 April 2018
Ibekwe et al. (2018) 5(1): 88–95
plays an important role in the health care delivery of all African nations and is common especially in the rural
areas due to availability, low cost and sometimes the myth associated with these herbs. The rich biodiversity and
ethnomedicinal history of the Nigerian flora portend great possibilities in research for novel anti-tubercular
compounds. This is however under-explored as only a negligible number of plants used locally in the treatment
of characteristic symptoms of TB have been investigated for their antimycobacterial properties.
The leaves of Pavetta crassipes K. Schum (Rubiaceae) are traditionally used in Northern Nigeria for the
management of respiratory disorders and TB related symptoms, in ethnobotanical practice. A plant widely
distributed in the West African sub-region, P. crassipes is a glabrous shrub to 6 m high, trunk to 30 cm girth, of
the savanna. It has stout squarish branchlets covered with pale corky bark which splits and falls off; leaves often
in threes; flowers greenish-white and fruits black (Burkill 1997). The following pharmacological activities have
been reported on the plant; anti-plasmodial/ malarial activity (Sanon et al. 2003), hypotensive activity (Amos et
al. 2003), inhibitory effects on gastrointestinal and uterine smooth muscles (Amos et al. 1998) and in vitro
antiprotozoal, antimicrobial and antitumor activities (Balde et al. 2010). In our search for novel
antimycobacterial agents from Nigerian medicinal plants, the leaves of P. crassipes were collected from four
different traditional medicine practitioners (TMPs) in Nigeria, as a component of their local herbal recipes for
the treatment of tuberculosis (Ibekwe et al. 2014). The ethnobotanical survey revealed P. crassipes to be an
interesting plant worth further investigations and this was based on the frequency of plant in the collected
recipes from TMPs, potency of the extract based on MIC values, minimal published work on the chemistry of
the plant, and novelty of information on plant’s use as an anti-TB remedy, hence it was prioritized for further
studies. Preliminary studies on the extracts revealed the antimycobacterial potentials of the plant (Ibekwe et al.
2012). There is presently no detailed report on the phytochemistry or antimycobacterial studies of the
metabolites of the plant. We report herein, the isolation, structural elucidation of six compounds from the leaf
extracts of P. crassipes and screening of isolated compounds against M. tuberculosis H37Rv.

General Experimental Procedures
Melting points were determined with a Barnstead Electrothermal 9100 melting point apparatus and are
uncorrected. IR spectra were recorded with a Perkin Elmer Spectrum One FT-IR Spectrophotometer. UV
spectra of isolated compounds were run on a Varian Cary 300 Bio UV-Visible Spectrophotometer. High-
Resolution Mass Spectra (HRMS) were obtained on a q-TOF Waters LCT Premier Mass Spectrometer with
electrospray ionization (ESI) or atmospheric pressure ionization (API) source and in the positive or negative
mode. 1H (400 MHz), 13C NMR (100 MHz) and 2D spectral data were recorded in deuterated CDCl3, DMSO-d6,
D2O or CD3OD, on a Bruker AMX 400. NMR chemical shifts were expressed in parts per million (δ) relative to
tetramethylsilane (TMS) and the coupling constants were given in Hz. Flash column chromatography were
performed on glass columns (4 × 150 cm, 2.7 × 70 cm) using silica gel (230–400 µm mesh, Merck, Germany).
Preparative TLC were carried out with pre-coated glass backed preparative TLC plates- Kieselgel 60 F254 (0.5
mm, 20 × 20 cm; Analtech Inc, USA). Preparative HPLC were performed on a Phenomenex system (Varian Pro
Star Model 218 coupled to a Varian fraction collector model 701) using a reverse phase column 250 × 21.20
mm i.d (5µm, 100A). TLC analyses were carried out using silica 60 F 254 pre-coated glass backed plates (0.25
mm, 20 × 20 cm; Merck, Darmstadt, Germany). Spots were detected on TLC plates under short (λ= 254 nm) and
long (λ= 366 nm) UV light and/or visualized by spraying with vanillin-sulphuric acid, followed by charring at
110oC for 5 minutes. All chemicals were obtained from commercially available sources and reagents prepared
according to standard procedures. The structures of the compounds were confirmed by comparing with
reference data from available literature or comparing with data of commercial authentic samples, or by chemical
modifications of the isolated compounds.
Plant Material
The fresh leaves of Pavetta crassipes K. Schum were collected from Suleja, Niger State, Nigeria in July
2009. The plant was identified at the Herbarium Unit of the Department of Medicinal Plant Research and
Traditional Medicine, National Institute for Pharmaceutical Research and Development, Abuja (NIPRD). A
labeled voucher specimen, NIPRD/H/6241 was deposited in the herbarium of the Institute.
Extraction procedure
The air dried leaves of P. crassipes (1 kg) were finely pulverised and soaked successively with n-hexane,
Ibekwe et al. (2018) 5(1): 88–95
EtOAc and MeOH at 24 h intervals. The hexane, EtOAc and MeOH extracts were evaporated under reduced
pressure at 40oC, to give the crude hexane (green-black syrup, 10.4 g), the EtOAc (green powder, 16.8 g) and
the MeOH extract (dark brownish sticky solid, 131.7 g).
Isolation of components
The hexane extract (5.0 g) was subjected to column chromatography with gradient amounts of ethyl acetate
in hexane. Fractions were examined by TLC and combined to give 8 major fractions, PCH 1–PCH8. Fraction
PCH5 (eluted with 20% EtOAc in hexane), was similarly re-chromatographed to give 5 sub-fractions, PCH5.1–
PCH5.5. Sub-fraction PCH5.4 (eluted with 10–15% EtOAc in hexane) was recrystallized from methanol to yield 1
(22.0 mg). Fraction PCH6, eluted with 30% EtOAc in hexane, was re-chromatographed to obtain 6 sub-
fractions, PCH6.1–PCH6.6. Crystallization of PCH6.5 (eluted with 30–50% EtOAc in hexane) from ethanol,
yielded 2 (34.0 mg).The ethyl acetate extract (9.0 g) was fractionated using column chromatography and eluted
with gradient amounts of ethyl acetate in hexane to obtain 14 major fractions, PCE 1–PCE14. Fractions PCE5 and
PCE6, eluted with 20% and 30% EtOAc in hexane, respectively had similar TLC profiles as fractions PCH 5 and
PCH6 from the hexane extract. These were re-chromatographed under similar conditions to give 1 (15.0 mg) and
2 (102.0 mg). Fraction PCE14, eluted with EtOAc and 10% MeOH in EtOAc, was chromatographed on a prep-
HPLC system. The fractions were eluted with a MeOH-H2O gradient in 0.01% formic acid starting from
MeOH-H2O {5:95} solvent A to MeOH-H2O {95:5} solvent B in 50 minutes with a flow rate of 25 ml min -1.
Fractions with similar retention times were combined. Sub-fractions PCE14.25–PCE14.30 and PCE14.31–PCE14-32
eluted with MeOH-H2O {80:20} and MeOH-H2O {84:16} were pooled. This procedure was repeated to obtain
sufficient amounts of the compounds. Sub-fractions PCE14.(25-30) and PCE14.(31-32) were further purified using prep
TLC developed with CHCl3-MeOH {9:1}. The separated fractions were suspended in methanol for 30 min,
filtered under suction while washing with more methanol. Thereafter, the solvent was evaporated under vacuum,
to yield 3 (8.0 mg) and 4 (18.0 mg). The methanol extract (10.0 g) was fractionated using column
chromatography, with a gradient elution of ethyl acetate in hexane, and methanol in ethyl acetate to obtain
thirteen major fractions, PCM1–PCM13. Compound 5 (56.0 mg) precipitated on standing from fraction PCM10
(eluted with 20% MeOH in EtOAc) as a yellow powder and was further purified by washing with EtOAc.
Fraction PCM10 was further similarly re-chromatographed on a HPLC system to obtain sub-fractions PCM10.25-
PCM10.30, eluted with MeOH-H2O {80:20}. Similar fractions were combined and purification of PCM 10.(25-30)
was carried out using prep-TLC developed with CHCl3-MeOH {9:1} to give compound 3 (12.0 mg). Fraction
PCM11 eluted by 50% MeOH in EtOAc, yielded light brown crystals on standing. Further purification by
recrystallizing from methanol yielded compound 6 as a white solid (68.0 mg).
Physical and Spectral Data of Isolated Compounds
β-sitosterol (1): white crystals, mp 133-135 oC; IR νmax (cm-1): 3356 (O-H), 2959, 2933 (C-H), 1464, 1378,
1214, 1060 (C-O); TOF-ES-MS m/z; 397.4 [M - H2O]+; 1H NMR (400 MHz, CDCl3) δH (ppm): 5.34 (1H, d, H-
6 ), 3.52 (1H, dddd, H-3), 0.82 (3H, d, H-26), 0.80 (3H, d, H-27), 1.00 (3H, s, H-19), 0.91 (3H, d, J = 6 Hz, H-
21), 0.84 (3H, t, J = 8.4 Hz, H-29), 0.67 (3H, s, H-18); 13C NMR (100 MHz, CDCl3) δC (ppm): 140.7 (C-5),
121.7 (C-6) ,72.0 (C-3), 56.7 (C-14), 56.0 (C-17), 50.1 (C-9), 45.9 (C-24), 42.3 (C-13), 40.4 (C-12), 39.8 (C-4),
37.2 (C-1), 36.5 ( C-10), 36.1 (C-20), 33.9 (C-22), 31.9 (C-7), 31.6 (C-8), 29.7 (C-2), 29.1 (C-25), 28.2 (C-16),
26.0 (C-23), 24.3 (C-15), 23.0 (C-28), 21.1 (C-11), 19.8 (C-26), 19.3 (C-27), 19.0 (C-19), 18.7 (C-21), 12.0 ( C-
29), 11.8 (C-18)
Ursolic acid (2): amorphous white solid, mp 284-286 oC; IR νmax(cm-1): 3673 (O-H), 1688 (C=O); TOF-ES-MS
m/z; 457.4 [M + H] +, 439.4 [M - H2O] +; 1H NMR (400 MHz, DMSO-d6) δH (ppm): 11.92 (1H, s, COOH-28),
5.12 (1H, t, H-12), 4.27 (1H, d, OH-3), 2.99 (1H, m, H-3), 2.09 (1H, d, H-18), 1.03 (3H, s, H-27), 0.90 (3H, d,
H-30), 0.89 (3H, s, H-23), 0.86 (3H, s, H-25), 0.81 (3H, d, H-29 ), 0.74 (3H, s, H-26), 0.67 (3H, s, H-24); 13C
NMR (100 MHz, DMSO-d6) δC (ppm): 178.2 (C-28), 138.1 (C-13), 124.5 (C-12), 76.8 (C-3), 54.7 (C-5), 52.3
(C-18), 46.9 (C-9), 46.7 (C-17), 41.6 (C-14), 38.8 (C-8), 38.47 (C-19), 38.40 (C-20), 38.3 (C-4), 38.2 (C-1),
36.5 (C-10), 36.2 (C-22), 32.6 (C-7), 30.1 (C-21), 28.2 (C-23), 27.5 (C-2), 26.9 (C-15), 23.7 (C-16), 23.2 (C-
27), 22.8 (C-11), 21.0 (C-30), 17.9 (C-6), 16.9 (C-26), 16.8 (C-29), 16.0 (C-24), 15.2 (C-25)
Methyl chlorogenate (3): amorphous yellow solid; (MeOH) λ max (nm): 218, 330; TOF-ES-MS, positive ion,
m/z 391.1 [M + Na]+, 369.1 [M + H]+;HRESIMS (positive ion mode) m/z 369.1191[M + H]+ (calculated for
C17H20O9 + H, 369.1185); 1H NMR (400 MHz, CD3OD) δH (ppm): 7.52 (1H, d, J = 15.9 Hz, H-7'), 7.03 (1H, d,
Ibekwe et al. (2018) 5(1): 88–95
J = 2.0 Hz, H-2'), 6.94 (1H, dd, J = 2.0 Hz, 8.1 Hz, H-6'), 6.78 (1H, d, J = 8.1 Hz, H-5'), 6.21 (1H, d, J = 15.9
Hz, H-8'), 5.27 (1H, m, H-3), 4.13 (1H, m, H-5), 3.72 (1H, dd, J = 3.2 Hz, 6.8 Hz, H-4), 3.69 (3H, s, OCH3, H-
8), 1.98-2.22 (4H, m, H-2, 6); 13C NMR (100 MHz, CD3OD) δC (ppm): 175.0 ( C-7), 168.3 (C-9), 149.7 (C-3'),
147.2 (C-7'), 146.9 (C-4'), 127.7 (C-1'), 123.0 (C-6'), 116.5 (C-5'), 115.18 (C-2'), 115.11 (C-7'), 75.9 (C-1), 72.6
(C-4), 72.1 (C-3), 70.4 (C-5), 53.0 (C-1), 38.1 (C-2), 37.8 (C-6)
Ethyl chlorogenate (4): amorphous yellow solid; UV (MeOH) λmax (nm): 218, 330; TOF-ES-MS, positive ion,
m/z 405.1 [M + Na]+, 383.1 [M + H]+; HRESIMS (positive ion mode) m/z 383.1344[M + H]+(calculated for
C18H22O9 + H, 383.1342); 1H NMR (400 MHz, DMSO-d6) δH (ppm): 7.38 (1H, d, J = 15.9 Hz, H-7'), 7.01(1H,
d, J = 2.0 Hz, H-2'), 6.95 (1H, dd, J = 2.0 Hz, 8.1 Hz, H-6'), 6.76 (1H, d, J = 8.1 Hz, H-5'), 6.10 (1H, d, J = 15.9
Hz, H-8'), 5.01 (1H, m, H-3), 4.01 (2H, m, H-8), 3.86 (1H, m, H-5), 3.56 (1H, dd, H-4), 1.91-2.10 (2H, m, H-2),
1.75-2.10 (2H, m, H-6), 1.12 (3H, t, H-9); 13C NMR (100 MHz, CD3OD) δC (ppm): 175.0 (C-7), 168.3 (C-9'),
149.7 (C-3'), 147.2 (C-7'), 146.9 (C-4'), 127.7 (C-1'), 123.0 (C-6'), 116.5 (C-5'), 115.16 (C-2'), 115.11 (C-7'),
75.8 (C-1), 72.7 (C-4), 72.2 (C-3), 70.4 (C-5), 62.5 ( C-8), 38.0 (C-2), 37.8 (C-6), 14.3 (C-9)
Rutin (5): amorphous yellow solid; UV (MeOH) λmax (nm): 257, 358; IR νmax (cm-1): 3337 (O-H), 2943, 2833
(C-H), 1655 (C=O), 1606 (C=C, aromatic), 1448, 1361, 1306, 1202, 1170; TOF-ES-MS, positive ion, m/z 633.1
[M + Na] +, 611.1 [M + H] +, 465.1 [M + H - 146] +, 449 .1 [M + H - 162] +; HRESIMS (positive ion mode) m/z
611.1599 [M + H]+ (calculated for C27H30O16 + H, 611.1611); 1H NMR (400 MHz, CD3OD): δH (ppm): 7.66 (d,
J = 2.0 Hz, H-2'), 7.62 (dd, J = 2.0, 8.0 Hz, H-6'), 6.85 (d, J = 8.0 Hz, H-5'), 6.39 (d, J = 2.0 Hz, H-8), 6.20 (d, J
= 2.0 Hz, H-6); glucosyl protons: 5.11 (1H, d, J = 7.6 Hz, H-1'), 3.80 (1H, dd, H-6a'), 3.44 (1H, t, J = 3.2 Hz, H-
2"), 3.38 (1H, dd, H-6b'); rhamnosyl protons: 4.51 (1H, d, J = 1.6 Hz, H-1"), 1.12 (3H, d, J = 6 Hz, H-6"), other
glycosidic protons; 3.24 - 3.49 (multiplet); 13C NMR (100 MHz, CD3OD) δC (ppm): aglycone: 179.4 (C-4),
166.0 (C-7), 162.9 (C-5), 159.3 (C-2), 158.5 (C-9), 149.8 (C-4'), 145.8 (C-3'), 135.6 (C-3), 123.5 (C-6'), 123.1
(C-1'), 117.6 (C-2'), 116.0 (C-5'), 105.6 (C-10), 99.9 (C-6), 94.8 (C-8), glucose and rhamnose; 104.7 (C-1"),
102.4 (C-1"'), 75.7 (C-2"), 68.5 (C-6"), 17.8 (C-6"'), other glycosidic carbons (69.7, 71.3, 72.1, 72.2, 73.9, 77.2
and 78.1)
Mannitol (6): white solid, mp 154-157 oC; IR νmax (cm-1): 3329 (O-H), 2989 (C-H), 2108, 1637, 1394, 1250,
1066 (C-O); TOF-AP-MS, positive ion, m/z 183.1 [M + 1]+ , 165.1 [M + 1 – H2O]+, 147.1 [165.1 - H2O]+, 129.1
[147.1 - H2O]+, 111.1 [129.1 - H2O]+, HRESIMS (positive ion mode) m/z183.0872 [M + H]+ (calculated for
C6H14O6 + H, 183.0868); 1H NMR (400 MHz, D2O) δH(ppm): 3.75 (2H, dd, J = 2.4, 11.7 Hz, H-1, 6), 3.68 (2H,
d, J = 8.6 Hz, H-3, 4), 3.64 (2H, m, H-2, 5), 3.56 (2H, dd, J = 6, 11.7 Hz, H-1, 6); 13C NMR (100 MHz,
CD3OD) δC (ppm): 70.8 (C-2, 5), 69.2 (C-3, 4) and 63.2 (C-1, 6)
Acid hydrolysis of rutin (5): Compound 5 (10 mg) was dissolved in 1 ml of methanol with concentrated HCl
(0.5 ml) and the solution was kept under reflux for 5 h at 70 oC. After removal of MeOH by rotary evaporation,
the residue was partitioned between n-butanol and H2O. The butanol (lower) layer was removed, dried over
anhydrous Na2CO3 and concentrated under reduced pressure, to afford 3 mg of 5a.
Quercetin (5a): amorphous yellow solid, mp 297-300 oC; UV (MeOH) λmax (nm): 257, 358; TOF-MS-API,
positive ion, m/z 303.1 [M + 1] +; 13C NMR (100 MHz, CD3OD) δC (ppm): 176.5 (C-4), 166.0 (C-7), 161.0 (C-
5), 156.7 (C-9), 148.1 (C-4'), 147.5 (C-2), 145.7 (C-3'), 136.5 (C-3), 123.0 (C-1'), 121.0 (C-6'), 116.5 (C-2'),
116.0 (C-5'), 104.0 (C-10), 99.5 (C-6), 94.5 (C-8)
Antimycobacterial assay
Following the extractions, chromatographic separations and purification of compounds from the leaves of P.
crassipes, compounds were screened against Mycobacterium tuberculosis and bioassays were conducted on
drug sensitive H37Rv ATCC 27294. M. tuberculosis was grown in 7H9-medium (which consisted of
Middlebrook 7H9 broth base supplemented with 0.5 % (w/v) Albumin, 0.2 % (w/v) glucose, 0.2% (v/v)
glycerol, 0.08% (w/v) NaCl and 0.05 % (v/v) Tween 80), to an optical density (OD) 650 nm of 0.2–0.3 after
which cells were diluted 1000-fold in 7H9-medium. The Green Fluorescent Protein Reporter Microplate Assay
(GFPMA; Collins et al. 1998) and a modified Broth Microdilution Method (BMM; Coban et al. 2004) were
employed in the assessment of antimycobacterial activity. Assays of compounds were carried out utilizing a
constitutive Green Fluorescence Protein (GFP) expression vector direct readout of fluorescence (with excitation
at 485 nm and emission at 509 nm) as a measure of bacterial growth. Mycobacterium tuberculosis H37Rv with a
constitutive GFP plasmid was used as a test strain. Compounds were prepared in 100% DMSO at an initial stock
Ibekwe et al. (2018) 5(1): 88–95
concentration of 10 mg mL-1 and serial dilutions of the compounds were prepared in the same solvent and added
to the wells of a black clear-bottom 384-well microtiter plate (in order to minimize background fluorescence) at
2 µL volume compound per well. Forty eight (48) µL of H 37Rv-GFP bacterial suspension was added to the
different concentrations of the compound across the wells resulting in a final volume of 50 µL. Plates were then
incubated at 37oC for 5 days. Mycobacterial growth was determined by measuring GFP fluorescent intensity at
509 nm using a multilabel reader. The increase in fluorescence indicated growth of the GFP-expressing strain
whereas a lack of increase of fluorescence readout or even a decrease in fluorescence relative to the day 0
fluorescence value, indicated growth inhibition. Isoniazid was used as positive control (100% growth) and
DMSO as negative control (0% growth). All the bioassay experiments were done in duplicates and assay results
were reported in the form of MIC values. For the broth microdilution assay, pure compounds for biological
assay were prepared at a concentration of 10 mg ml-1 in 100% DMSO and 40 µl of the stock solution was taken
into 460 µL 7H9-medium. Serial two fold dilutions were made in the broth medium at 50 µL per well in clear
96-well round-bottom microtitre plates after which an equal volume of diluted M. tuberculosis H37Rv was added
at 10,000 cells per well with the final top concentration of DMSO at 2% and incubated at 37°C in a humid
atmosphere for 7–10 days. Growth was visually scored using an enlarging inverted mirror. Isoniazid was used as
positive control. The minimum inhibitory concentration (MIC) was taken as the lowest concentration that
completely inhibited all visible growth.

Repeated column chromatography (silica gel), prep HPLC and prep TLC of the extracts of the leaves of
Pavetta crassipes yielded compounds 1–6 (Fig. 1). The chemical structures of the isolated compounds were
established using spectral data obtained from UV, IR, MS and 1H and 13C NMR spectra in conjunction with 2D
experiments, COSY, HSQC and HMBC. These were compared with published literature and in one of the cases,
with the authentic commercial specimen (Compound 2). Chemical modification and spectral analysis of reaction
product were useful in establishing the structure of Compound 5.
The compounds isolated from the leaves of P. crassipes were identified as ß-sitosterol C29H50O (1) (Lee et
al. 2003), ursolic acid (2) C30H48O3 (Seebacher et al. 2003), methyl chlorogenate C17H20O9 (3) (Lee et al. 2010),
ethyl chlorogenate C18H22O9 (4) (Lee et al. 2010), rutin C27H30O16 (5) (Lallemand & Duteil 1977, Bello et al.
2011) and mannitol C6H12O6 (6) (Hagiwara et al. 2005). Quercetin C15H10O7 (5a), the hydrolyzed product of
rutin, was also identified (Lallemand & Duteil 1977). The structures of the compounds are as shown in figure 1
and the spectroscopic and physical data are presented in the section on Material and Methods.
All compounds were screened for their inhibitory activity on the growth of Mycobacterium tuberculosis
H37Rv, with final concentrations of 200 µg mL-1 (GFPMA) and 400 µg mL-1 (BMM) and the results are
presented in table 1. The GFPMA assay revealed only the quinate esters; ethyl chlorogenate (4) and methyl
chlorogenate (3) with activities against M. tuberculsis H37Rv at 100 and 200 µg ml-1, respectively, while the
BMM assay showed ethyl chlorogenate (4) methyl chlorogenate (3) and ursolic acid (2), with activities with
MIC of 50, 100 and 200 µg/ml, respectively. Interestingly, the bioactive chlorogenate esters are structurally
similar, but for the length of the alkyl substituent, with ethyl chlorogenate being less polar. The differences in
biological activities of the chlorogenate esters may be owed to their differences in polarity as less polar
compounds have been shown to inhibit the growth of M. tuberculosis due to the easier permeability of the cell
wall of the bacterium which is lipophilic in nature (Ducati et al. 2006). The antimycobacterial activities of ethyl
chlorogenate (4) and methyl chlorogenate (3) have not been reported hitherto. Ursolic acid (2) which is a
pentacyclic triterpene, and its analogue, 24-hydoxyursolic acid have previously been reported as
antimycobacterial agents from Valeriana laxiflora (Gu et al. 2004) and Leyssera gnaphaloides (Bamuamba et
al. 2008). Some pentacyclic tritepenes with substituents in C-3 and C-17, such as oleanolic acid, oleanonic acid,
and 3-epioleanolic acid inhibited the growth of M. tuberculosis H37Rv with MIC values of 50, 16, and 16
µg/mL, respectively (Caldwell et al. 2000). It has been reported that the presence of hydroxyl or keto groups in
A or B rings, and a carboxylic group in D/E rings, gave the molecule a moderate antimycobacterial activity
(Wächter et al. 1999, Caldwell et al. 2000). These authors also suggested that the mechanism of action of such
triterpenoids depended on the lipophilicity of the compounds that allowed a rapid penetration across the lipid-
rich mycobacterial cell wall. In their review article, Ducati et al. (2006) also stated that lipophilic molecules
should be able to easily cross the mycobacterium membrane, dissolving in the hydrocarbon interior of the lipid
bilayer, though factors such as low fluidity of the mycolic acid leaflet and the bilayer’s uncommon thickness
Ibekwe et al. (2018) 5(1): 88–95
may result in reduction of this process.

29 30
28 CH3
29 20
23 24
21 25 21
H3C CH3 19
26
22 12 18
18
CH3 20 CH3 22
27 13 17
12
H 11 OH
17 25 26
19 11
13
H 28
CH3 H 16
1 9 14
1 16
9 2
2 14 10 8 O
10 15 15
8 H
H H 5 27
7
7 3 4
HO 3 5 HO 6
4 6
H
1 2 24 23
O OH
OH
6'''
OR H3C 4''' OH
HO C 3'
OH
2' 5'''
4' 3'''
O 8 O 2'''
HO O 5'
7 9 OH
C 2 6'
OH 1'''
HO O
6 O
10 3
5 4 O
O 6''
OH
5''
OH OH O 1''
3 R = CH3 2'' 4''
OH
HO
4 R = CH2CH3 3'' OH
5
OH
OH
OH OH
HO O
HO OH
OH
OH OH
5a OH O 6
Figure 1. Structures of compounds (1–6) from the leaves of Pavetta crassipes.
Table 1 Antimycobacterial activity of compounds against Mycobacterium tuberculosis H37Rv.

GFPMA BMM
Compound
MIC in µg mL-1 MIC in µg mL-1
1 NA* NA
2 NA 200
3 200 100
4 100 50
5 NA NA
5a NA NA
6 NA NA
Note: NA= not active at the concentrations tested. The MIC of isoniazid, the reference compound for the
antimycobacterial assay was 0.2 µM
Comparing the MICs of the two bioassay methods in the antimycobacterial assay, BMM shows more
sensitivity than GFPMA. However, since the intrinsically fluorescent nature of GFP precludes the need for a
substrate, GFPMA offers greater simplicity and also has enhanced biosafety since the microplate need not be
reopened following inoculation (Collins et al. 1998).
Ibekwe et al. (2018) 5(1): 88–95
The phytochemistry of P. crassipes is also important as a chemotaxonomic study, as some of the isolated
compounds may be useful as markers of the Rubiaceae family. Compounds such as triterpene acids, steroids,
chlorogenic acid derivatives and flavonoids have been reported from other species of the Rubiaceae family
(Martins & Nunez 2015).
CONCLUSIONS
This is the first detailed report of the phytochemistry of the leaves of Pavetta crassipes, with rutin as the
only compound previously isolated (Bello et al. 2011). An extensive literature search carried out did not reveal
much information on the phytochemistry of plants in the Pavetta genus. In vitro screening against
Mycobacterium tuberculosis employing the microbroth dilution and the green fluorescent protein microplate
assay techniques showed that the antituberculosis activities of P. crassipes leave were attributed to a ursane type
triterpene acid, ursolic acid and two chlorogenate esters, methyl chlorogenate and ethyl chlorogenate. This is the
first report of the antimycobacterial activities of these compounds from this plant and more interestingly the first
report of chlorogenate esters as antimycobacterial agents. This group of phenolics may represent promising
antimycobacterial agents and should be investigated further as potential leads in the drug discovery of
antituberculosis agents. The antimycobacterial activities of the leaves of P. crassipes are relevant and it would
be interesting to explore the potentials of the bioactive compounds; ursolic acid and the chlorogenate esters as
drug templates by carrying out structural activity relationship (SAR) studies to synthesize new derivatives which
may be highly specific to treat the disease. This study provides, at least in part, some scientific basis and a
biological explanation for the ethnomedicinal use of P. crassipes as a traditional antituberculosis remedy in
Nigeria, through a combination of indigenous knowledge and natural products chemistry.
ACKNOWLEDGEMENTS
N. N. Ibekwe wishes to sincerely thank the Division of Acquired Immunodeficiency Syndrome (DAIDS),
National Institute of Allergy and Infectious Diseases (NIAID), National Institute of Health, Maryland for the
doctoral fellowship. Funding for this program was provided (in part) by the Division of Intramural Research of
the NIAID (project no- A1000693-22), National Institutes of Health (NIH). She also acknowledges Oak Ridge
Associated Universities, Tennessee, for administering the program and the National Institute for Pharmaceutical
Research and Development (NIPRD), Abuja for support. The authors thank Dogonyaro Bege and Matthew
Tsado, for the instrument and information technology support, respectively. They express their gratitude to the
four TMPs who provided the plant for our ethnobotanical study; Isa Mai Maigani and Rabiu Sule from Zaria in
Kaduna state and Azijah Oyhu and Haruna Mary from Jos in Plateau state. They also thank Muazzam Ibrahim
of NIPRD, for his assistance with collection of the plant, and Dr Jemilat Ibrahim, for the botanical identification
of the plant.
REFERENCES
Amos S, Akah PA, Binda L, Enwerem NM, Ogundaini A, Wambebe C, Hussaini IM & Gamaniel KS (2003)
Hypotensive activity of the ethanol extract of Pavetta crassipes leaves. Biological and Pharmaceutical
Bulletin 26: 1674–1680.
Amos S, Okwuasaba FK, Gamaniel K, Akah P & Wambebe C (1998) Inhibitory effects of the aqueous extract
of Pavetta crassipes leaves on gastrointestinal and uterine smooth muscle preparations isolated from rabbits,
guinea pigs and rats. Journal of Ethnopharmacology 61: 209–213.
Balde ES, Megalizzi V, Traore MS, Cos P, Maes L, Decaestecker C, Pieters L & Balde AM (2010) In vitro
antiprotozoal, antimicrobial and antitumor activity of Pavetta crassipes K. Schum leaf extracts. Journal of
Ethnopharmacology 130: 529–535.
Bamuamba K, Gammon DW, Meyers P, Dijoux-Franca MG & Scott G (2008) Anti-mycobacterial activity of
five plant species used as traditional medicines in the Western Cape Province (South Africa). Journal of
Ethnopharmacology 117: 385–390.
Bello IA, Ndukwe GI, Audu OT & Habila JD (2011) A bioactive flavonoid from Pavetta crassipes K. Schum.
Organic and Medicinal Chemistry Letters 1: 14. [doi: 10.1186/2191-2858-1-14]
Burkill HM (1997) The useful plants of West Tropical Africa. Royal Botanic Gardens, Kew, pp. 588.
Caldwell CG, Franzblau SG, Suarez E & Timmermann BN (2000) Oleanane triterpenes from Junellia tridens.
Journal of Natural Products 63: 1611–1614.
Ibekwe et al. (2018) 5(1): 88–95
Cantrell CL, Franzblau SG & Fischer NH (2001) Antimycobacterial plant terpenoids. Planta Medica 67: 685–
694.
Coban AY, Birinci A, Ekinci B & Durupinar B (2004) Drug susceptibility testing of Mycobacterium
tuberculosis by the broth microdilution method with 7H9 broth. Memorias de Instituto Oswaldo Cruz 99:
111–113.
Collins LA, Terreto MN, Franzblau SG (1998) Green fluorescent protein reporter microplate assay for high-
throughput screening of compounds against Mycobacterium tuberculosis. Antimicrobial Agents and
Chemotherapy 42: 344–347.
Copp BR (2003) Antimycobacterial natural products. Natural Product Reports 20: 535–557.
Copp BR, Norrie Pearce A (2007) Natural product growth inhibitors of Mycobacterium tuberculosis. Natural
Product Reports 24: 278–297.
Ducati RG, Ruffino-Netto A, Basso LA & Santos DS (2006) The resumption of consumption - A review on
tuberculosis. Memorias de Instituto Oswaldo Cruz 101: 697–714.
Gu JQ, Wang Y, Franzblau SG, Montenegro G, Yang D & Timmermann BN (2004) Antitubercular constituents
of Valeriana laxiflora. Planta Medica 70: 509–514.
Hagiwara S, Takahashi M, Shen Y, Kaihou S, Tomiyama T, Yazawa M, Tamai Y, Sin Y, Kazusaka A &
Terazawa M (2005) A phytochemical in the edible Tamogi-take mushroom (Pleurotus cornucopiae), D-
Mannitol, inhibits ACE activity and lowers the blood pressure of spontaneously hypertensive rats.
Bioscience Biotechnology and Biochemistry 69: 1603–1605.
Ibekwe NN, Nvau JB, Oladosu PO, Usman AM, Ibrahim K, Boshoff HI, Dowd CS, Orisadipe AT, Aiyelaagbe
O, Adesomoju AA, Barry III CE & Okogun JI (2014) Some Nigerian anti-tuberculosis ethnomedicines: A
preliminary efficacy assessment. Journal of Ethnopharmacology 155: 524–532.
Ibekwe NN, Orishadipe AT, Boshoff H, Adesomoju AA, Okogun JI & Barry CE (2012) In vitro
antimycobacterial studies on the leaf extracts and fractions of Pavetta crassipes K.Schum. African Journal
of Pure and Applied Chemistry 6: 55–58.
Lallemand JY & Duteil M (1977). 13C NMR spectra of quercetin and rutin. Organic Magnetic Resonance 9:
179–180.
Lee EJ, Kim JS, Kim HP, Lee J-H & Kang SS (2010) Phenolic constituents from the flower buds of Lonicera
japonica and their 5-lipoxygenase inhibitory activities. Food Chemistry 120: 134–139.
Lee S, Kim KS, Shim SH, Park YM & Kim B-K (2003) Constituents from the non-polar fraction of Artemisia
apiacea. Archives of Pharmacetical Research 26(11): 902–905.
Mahomoodally MF (2013) Traditional Medicines in Africa: An Appraisal of Ten Potent African Medicinal
Plants. Evidence Based Complimentary and Alternative Medicine 2013: Article ID 617459.
[doi:10.1155/2013/617459]
Martins D & Nunez CV (2015) Secondary metabolites from rubiaceae species. Molecules 20: 13422–13495.
Okunade AL, Elvin-Lewis MP & Lewis WH (2004) Natural antimycobacterial metabolites: current status.
Phytochemistry 65: 1017–1032.
Sanon S, Ollivier E, Azas N, Mahiou V, Gasquet M, Ouattara CT, Nebie I, Traore AS, Esposito F, Balansard
G, Timon-David P & Fumoux F (2003) Ethnobotanical survey and in vitro antiplasmodial activity of plants
used in traditional medicine in Burkina Faso. Journal of Ethnopharmacology 86: 143–147.
Seebacher W, Simic N, Weis R, Saf R & Kunert O (2003) Complete assignments of 1H and 13C NMR
resonances of oleanolic acid, 18α-oleanolic acid, ursolic acid and their 11-oxo derivatives. Magnetic
Resonance Chemistry 41: 636–638.
Wächter GA, Valcic S, Flagg ML, Franzblau SG, Montenegro G, Suarez E & Timmermann BN (1999)
Antitubercular activity of pentacyclic triterpenoids from plants of Argentina and Chile. Phytomedicine 6:
341–345.
WHO (2016) Global tuberculosis report. World Health Organization, Geneva. Available from:
http://apps.who.int/iris/bitstreeam/10665/250441/1/9789241565494-eng.pdf. (accessed: 16 Nov. 2017).
ISSN (E): 2349 – 1183
ISSN (P): 2349 – 9265
5(1): 96–106, 2018
DOI: 10.22271/tpr.2018.v5.i1.014
Research article
Micronutrient status in leaf tissue of mango germplasm

conserved under subtropical environment of
Lucknow, Uttar Pradesh, India
Tarun Adak*, Kailash Kumar, S. K. Shukla, Vinod Kumar Singh and S. Rajan
ICAR-Central Institute for Subtropical Horticulture, Lucknow-226101, Uttar Pradesh, India
*Corresponding Author: tarunadak@gmail.com [Accepted: 26 April 2018]
Abstract: On-farm conservation of elite and indigenous mango germplasm is crucial from the
viewpoint of biodiversity conservation and its utilization for future use. Such conservation
contributes to breeding of new varieties, research on biotic and abiotic stress complexes,
evaluating nutrient dynamics in supporting their livelihood. One hundred thirty eight mango
germplasms conserved in the experimental farm of CISH, Rehmankhera, Lucknow over decades
were used for evaluating micronutrient status. The study revealed the lowest Zn content in Pan &
Aswania (11 mg kg-1) to the highest in Rousa (28 mg kg-1) across these 138 mango germplasms
while the corresponding values of Boron in Langra Digha (6.6 mg kg -1) and Husn-e-ara (44.8 mg
kg-1). It was further inferred that a range of 6 mg kg-1 (Modami Model) to 52 mg kg-1 (Anaiwara)
of Cu was estimated across these germplasms. In case of Mn and Fe micronutrients, wider
variations across these germplasms were recorded. The concentrations of Mn varied between 122
(Mithua Bihar) and 347 (Prabha Shankar) mg kg-1 and Fe being 101(Shohrab Shah) and
461(Bombay Green) mg kg-1. The distribution pattern indicated that highest percentage of B
(52.9%) was recorded in the range of 21–30 mg kg-1, 61.6% of Zn (11–20 mg kg-1), 45.7% of Cu
(16–30 mg kg-1), 68.1% Mn (101–200 mg kg-1) followed by 75.4% Fe (101–200 mg kg-1). Wider
variations in micronutrients contents in some existing commercial mango cultivars were found and
such variations in micronutrient contents indicated the differential response of mango germplasms
under similar soil-climatic conditions for future nutrient management strategy.
Keywords: Biodiversity conservation - Mango germplasms - Micronutrient - Mangifera Indica.
[Cite as: Adak T, Kumar K, Shukla SK, Singh VK & Rajan S (2018) Micronutrient status in leaf tissue of
mango germplasm conserved under subtropical environment of Lucknow, Uttar Pradesh, India. Tropical Plant
Research 5(1): 96–106]
INTRODUCTION
Mango being grown worldwide, endowed with a huge number of diverse germplasms indicates the scope for
its conservation. However, non-availability of some of the elite and ancient germplasms at present may be
because of lack of its scientific conservation and proper management. Maintaining biodiversity of mango
germplasms under different soil and climatic conditions is a challenge under present scenario of climate change,
even within the same agro-climatic conditions. The aberrations in the weather events particularly scanty, uneven
distribution of rainfall and extreme temperature variations make the efficient management of germplasms
difficult. For fruit crops, on-farm conservation is very difficult for want of space and adequate management. As
a result, many of old valuable germplasms virtually vanished from the country and are not at all available in the
present scenario. Conservation of these germplasms would offer scope for better utilization for different
purposes. Farmers are thus encouraged for on-farm conservation of indigenous and rare germplasms of different
fruit crops (Rajan et al. 2016). The in-situ conservation helps in breeding programmes for developing climate
resilient varieties, acts as an excellent source for biotechnological intervention for characterizing number of
unexploited diversity (Singh et al. 2012), farmer friendly varieties resistant to pests and diseases e.g. screening
for mango anthracnose resistance in Australia (Bally et al. 2013), nutrient rich cultivar (Berardini et al. 2005,
Ribeiro et al. 2008) and also limited nutrient requirement for its longer survivability (Bhupal Raj & Prasad Rao
Received: 03 February 2018 Published online: 30 April 2018
Adak et al. (2018) 5(1): 96–106
2006).
Nutrients, particularly micronutrients are required for supporting the metabolism within the tree-ecosystem
and also to support quality fruit production. A number of deficiency symptoms appear in absence of required
amount of micronutrients, restricting its potential use (Shukla et al. 2014). This reduces the longevity of the
germplasms being conserved. In India, under different soil conditions of low, medium and high nutrient contents
of tropical, subtropical, humid ecosystem and across different soil types, the question is whether soil nutrient
status supporting the germplasms being maintained for its potential use. Foliar spray is often recommended to
cater the micronutrient requirement of the germplasms for its survival. However, there is a lack of proper
nutritional trial/management for its optimum use and fruit production purpose, hindering scope for its efficient
utilization for future endeavor.

The study site for this experimentation is concentrated on mango trees available in the Field gene bank of
ICAR-CISH, Lucknow, Uttar Pradesh, India (Fig. 1) wherein mango germplasms are being maintained over 25–
30 years. Leaf samples (35–40) were collected during September–October from 138 mango germplasms after
fruit harvesting. The samples were washed in double distilled water, air dried and processed for digestion in the
laboratory. Samples were digested with di-acid mixture of nitric acid and perchloric acid (9:4 ratios).
Micronutrient contents were estimated by AAS.
Figure 1. Experimental site (CISH, Rehmankhera, Lucknow, Uttar Pradesh, India. [Source: https://www.google.co.in/maps]

The Zinc (Zn) distribution showed wider variations across leaf tissues of 138 mango germplasms. Majority
(61.6%) of the contents fall in the range of 11–20 mg kg-1 while rests (38.4%) are in 21–30 mg kg-1 range (Fig.
2A). The detailed Zn contents in leaf tissues of the said germplasms are tabulated in the table 1. Some of the
existing commercial cultivars had marginally higher Zn content like Lucknow Safeda & Elaichi (22 mg kg -1),
Mohan Bhog (26 mg kg-1) & Begum Pasand (26 mg kg-1) as compared to Langra, Fazri & Baramasi (16 mg kg-
1
), Malda (17 mg kg-1) and Himsagar (19 mg kg-1). In terms of Copper (Cu) concentration, the entire
germplasms may be grouped into 4 categories i.e. ≤15, 16–30, 31–50 and >50 mg kg-1 respectively (Table 2).
Results showed that majority (45.7%) of the germplasms had Cu contents in the range of 16–30 mg kg-1
followed by 28.3% (≤15 mg kg-1), 25.4% (31–50 mg kg-1) and 0.7% (>50 mg kg-1) respectively (Fig. 2B).
Similarly in case of Manganese (Mn) concentration, germplasms had 68.1% in the category of 101–200 ppm
followed by 30.4% (201–300 mg kg-1) and the least (1.4%) for higher concentration of >300 mg kg -1 (Fig. 2C).
Results showed mango cultivars like Chausa, Langra Banarsi, Fazri, Gulab Khas, Safeda Malihabad Dashehari
etc. had Mn contents of 101-200 mg kg-1 whereas Mallika, Baramasi, Langra, Husn-e-ara, Langra Gorakhpur,
Langra Digha and Alphonso Ratnagiri had higher concentration in the range of 201–300 mg kg-1 (Table 3). As
far as Iron (Fe) concentration is concerned, majority (75.4%) of germplasms had recorded the content in the
range between 101–200 mg kg-1 followed by 18.8 % (201–300 mg kg-1) and 5.8% in higher concentration of
Adak et al. (2018) 5(1): 96–106
>300 mg kg-1 (Fig. 2D). Further, it was observed that majority of the commercial cultivars are not deficient in Fe
and had 101–200 mg kg-1, however Bombay green, Baramasi, Dalima had higher contents (Table 4). Since
Boron (B) is an important element for not only improving the quality of the fruit but also essentially required
during flowering, its contents in the existing conserved germplasms had wider range from less than 10 to >30
mg kg-1. The detailed concentrations were tabulated in the table 5. Some of the commercial cultivars like Langra
had a B content of 13.3 mg kg-1, Mallika (17.7 mg kg-1), Langra Banarsi (17.7 mg kg-1), Bombay Green (22.8
mg kg-1), Fazri (26.2 mg kg-1), Elaichi (29.4 mg kg-1), Alphanso Raman (922.5 mg kg-1), Bangalora-2 (26.7 mg
kg-1), Husn-e-ara (44.8 mg kg-1), Lucknow Safeda (27.4 mg kg-1), Chausa (28.3 mg kg-1) and Alphanso
Ratnagiri (32.8 mg kg-1). It was observed that 52.9% germplasms had B concentration in the range of 21–30
ppm, 22.5% (>30 mg kg-1) followed by 21% (11–20 mg kg-1) and the least in 3.6% (up to 10 mg kg-1),
respectively (Fig. 2E).
Figure 2. Distribution of micronutrients: A, Zinc; B, Copper; C, Manganese; D, Iron; E, Boron.

Knowledge of micronutrient contents and its distribution in perennial fruit trees is the key component for
determining the level of management modules required for biodiversity conservation and its maintenance.
Micronutrients particularly zinc and boron play significant role in the quality fruit production system under any
agro-ecosystem (Boaretto et al. 2011, Somasundaram et al. 2011, Kumar et al. 2016a). Micronutrient deficiency
in orchards should be corrected through proper management system to sustain fruit production level.
Germplasms are being maintained worldwide across diverse soil and climatic conditions. Characterizations of
these germplasms in terms of their micronutrient status are essential from the viewpoint of determining the
sustainability in longer term. Micronutrient contents are thus important factor in any biodiversity conservation
programme (Johns 2003, Toledo & Burlingame 2006, Srivastava & Shyam 2006). Enormous problems of Fe in
Mango production system under Israel condition were recorded and resolved by Kadman & Gazit (1984). Under
Brazilian condition, the mineral nutrition in mango orchards was estimated by da Silva et al. (2014). Adak et al.
(2017) advocated growers for optimized micronutrient management in mango for better productivity under Uttar
Pradesh condition. Technological interventions at small and marginal farmer’s field were demonstrated and
Adak et al. (2018) 5(1): 96–106
Table 1. Zinc (Zn) distribution in leaves of mango germplasms.

11–20 ppm 21–30 ppm
Amin Buland Bag (19) Kishan Bhog (19) V.N. Chatterjee (17) Bable Ponesa (19) Alif Laila (21) Shohrab Shah (21)
Asaujia Deoband (18) Mohan Thakur (18) Jafrani Shahabad (14) Beauty Maclino (18) Amin Dofasla (24) Sukul (21)
Chausa (20) Fazri (16) Aswania (11) Modami Model (16) Amin Dhudhia (25) Papla (22)
Gola Bhadaiya (19) Fazri Kalan (14) Bombay Battle (14) Bombay Pedda (17) Amin Brahinpur (22) Kala Pahar (23)
Gulab Jamun (20) Fazri Zafrani (16) Ladario (19) Radling (12) Amin Prince (21) Begum Pasand (26)
Katakee Bahar (20) Malda (17) Pathar (13) Prabha Shankar (15) Amin Khurd (22) Murshidabad (22)
Langra Gorakhpur (18) Mithua Bihar (19) Massarat Shastri (14) Papaya Raja Goh (16) Anopan (24) Kohitoor (21)
Langra (16) Bathui Katikee (17) Mankhurd (12) Baramasi Creeping (23) Kali Pairi (25)
Lat Kampoo (17) Bathui Katikee (20) Papatio (16) Baramasi Aghai Bahar (26) Zamurad (22)
Mallika (18) Baramasi (16) Pan (11) Baramasi Ahra (24) Mohan Bhog (26)
Mithua (17) Mallik (15) Pairi (17) Banzeer (21) Sharda Bhog (25)
Nazuk Badan (19) Bombay (13) Sardar (14) Banzeer Sandila (27) Gulab Khas (26)
Nisar Pasand (15) Bombay Green (18) Bombay (16) Bareilywala (25) Khausal Khas (26)
Nayab (18) Dalima (19) Batle (17) Bhoodia (22) Anda (21)
Pahilwan (16) Chatterjee Khas (12) Rataul (19) Bhadaiya Sukul (21) Alphanso Ratnagiri (23)
Sadaphal (15) Jalsain (18) Gadheymar (17) Bride of Russia (23) Hansraj (24)
Rataul (17) Safeda Mulgoa (20) Fazri (20) Dashehari (26) Hilario (23)
S.B.Chausa (20) Mallviya Bhog (17) Neelam Madrasi (18) Gaurjeet (24) Sakkar Chini (21)
S.B.Rampur (18) MadhoRao Pasand (14) Vellai Colamban (19) Gilas (21) Elaichi (22)
Safeda Mallihabad (17) Mahmooda Bahar (15) Amina (18) Hardil Aziz (25) Alurapali (25)
Serohi (16) Anaiwara (20) Anant Pal (17) Husn-e-ara (22) Nazuk Badan (26)
Shuvedar (19) Soria Malda (13) Amarjio (18) Katakee Farukhabad (21) Rousa (28)
Shurkha Burma (18) Tata Maimidi (17) Kensingto (19) Langra Banarsi (23) Allampur Beneshan (21)
Himsagar (19) Phol Gaal (18) Beneshan (17) Langra Digha (21) Ashadio (21)
Husn-e-ara (20) Darbhanga (18) Banglora-2 (20) Sharbati Bagrain (21) Alphanso Raman (22)
Seipia (19) Bhogal Shah (16) Bappakan (16) Lucknow Safeda (22) Bombay Darsa (24)
Black Andrew (23)
Adak et al. (2018) 5(1): 96–106
Table 2. Copper (Cu) distribution in leaves of mango germplasms.

Up to 15 ppm 16–30 ppm 31–50 ppm > 50 ppm
Alif Laila (12) Amin Buland Bag (19) Bombay Green (23) Bride of Russia (33) Papatio (31) Anaiwara
Amin Dofasla (15) Asaujia Deoband (17) Anda (18) Dashehari (36) Pairi (32) (52)
Amin Dhudhia (14) Baramasi Aghai Bahar (20) Dalima (26) Gola Bhadaiya (37) Sardar (43)
Amin Brahinpur (13) Baramasi Ahra (23) Chatterjee Khas (28) Hardil Aziz (34) Bombay (36)
Amin Prince (13) Banzeer Sandila (22) Jalsain (24) Husn-e-ara (37) Batle (33)
Amin Khurd (10) Bareilywala (19) Mallviya Bhog (30) Katakee Bahar (38) Rataul (46)
Anopan (8) Bhoodia (30) Mahmooda Bahar (29) Katakee Farukhabad (41) Gadheymar (42)
Baramasi Creeping (11) Bhadaiya Sukul (26) Alphanso Ratnagiri (18) Langra Banarsi (36) Hansraj (38)
Banzeer (14) Chausa (28) Bombay Battle (19) Langra Digha (44) Hilario (31)
S.B.Rampur (10) Gaurjeet (17) Ladario (28) Langra Gorakhpur (47)
Sharbati Bagrain (8) Gilas (16) Massarat Shastri (29) Langra (43)
Lucknow Safeda (9) Gulab Jamun (27) Mankhurd (24) Lat Kampoo (39)
Safeda Mallihabad (15) Nisar Pasand (22) Pan (23) Mallika (50)
Serohi (11) Nayab (29) Sakkar Chini (28) Mithua (41)
Shuvedar (12) Pahilwan (24) Fazri (25) Nazuk Badan (38)
Shurkha Burma (11) Sadaphal (20) Elaichi (31) Safeda Mulgoa (33)
Himsagar (14) Rataul (27) Alurapali (27) MadhoRao Pasand (37)
Papla (13) S.B.Chausa (18) Nazuk Badan (21) Soria Malda (41)
Kohitoor (12) Shohrab Shah (16) Rousa (18) Tata Maimidi (38)
Kali Pairi (15) Sukul (26) Vellai Colamban (19) Phol Gaal (43)
Zamurad (9) Husn-e-ara (17) Allampur Beneshan (20) Darbhanga (47)
Mohan Bhog (12) Seipia (22) Alphanso Raman (16) Bhogal Shah (38)
Mohan Thakur (13) Kala Pahar (24) Radling (18) V.N. Chatterjee (44)
Neelam Madrasi (15) Begum Pasand (21) Prabha Shankar (19) Jafrani Shahabad (35)
Amina (14) Murshidabad (16) Aswania (41)
Anant Pal (13) Kishan Bhog (27) Pathar (34)
Ashadio (14) Sharda Bhog (18)
Amarjio (11) Gulab Khas (22)
Kensingto (15) Khausal Khas (16)
Adak et al. (2018) 5(1): 96–106
Beneshan (8) Fazri (21)

Banglora-2 (11) Fazri Kalan (25)
Bappakan (12) Fazri Zafrani (27)
Bable Ponesa (7) Malda (21)
Beauty Maclino (9) Mithua Bihar (18)
Modami Model (6) Bathui (16)
Bombay Darsa (8) Bathui Katikee (19)
Bombay Pedda (10) Baramasi (20)
Black Andrew (7) Mallik (22)
Papaya Raja Goh (14) Bombay (21)
Table 3. Manganese (Mn) distribution in leaves of mango germplasms.

101–200 ppm 201–300 ppm > 300 ppm
Alif Laila (142) Sukul (176) Pan (165) Amin Buland Bag (209) Elaichi (204) Pathar (325)
Amin Dofasla (156) Seipia (179) Pairi (162) Asaujia Deoband (211) Ashadio (231) Prabha Shankar (347)
Amin Dhudhia (154) Papla (154) Sardar (197) Baramasi Creeping (202) Kensingto (234)
Amin Brahinpur (153) Kala Pahar (130) Batle (176) Baramasi Aghai Bahar (236) Alphanso Raman (217)
Amin Prince (186) Begum Pasand (172) Rataul (171) Baramasi Ahra (224) Beneshan (272)
Amin Khurd (189) Kali Pairi (178) Gadheymar (164) Hardil Aziz (206) Banglora-2 (268)
Anopan (162) Kishan Bhog (166) Hansraj (173) Husn-e-ara (218) Bable Ponesa (265)
Banzeer (197) Mohan Bhog (163) Hilario (132) Katakee Bahar (201) Beauty Maclino (288)
Banzeer Sandila (193) Gulab Khas (154) Sakkar Chini (171) Langra Digha (237)
Bareilywala (174) Khausal Khas (169) Fazri (164) Langra Gorakhpur (221)
Bhoodia (153) Mohan Thakur (148) Alurapali (179) Langra (204)
Bhadaiya Sukul (149) Fazri (137) Nazuk Badan (197) Mallika (261)
Bride of Russia (146) Fazri Kalan (128) Rousa (181) Nazuk Badan (237)
Chausa (154) Fazri Zafrani (167) Neelam Madrasi (160) Nisar Pasand (260)
Dashehari (134) Malda (146) Vellai Colamban (136) Nayab (219)
Gaurjeet (145) Mithua Bihar (122) Allampur Beneshan (149) Sadaphal (211)
Gilas (131) Bathui (176) Amina (198) Sharbati Bagrain (214)
Gola Bhadaiya (196) Bathui Katikee (161) Anant Pal (177) Husn-e-ara (208)
Adak et al. (2018) 5(1): 96–106
Gulab Jamun (161) Mallik (196) Amarjio (172) Murshidabad (204)

Katakee Farukhabad (193) Bombay Green (168) Bappakan (150) Kohitoor (233)
Langra Banarsi (158) Dalima (163) Modami Model (177) Zamurad (241)
Lat Kampoo (185) Chatterjee Khas (128) Bombay Darsa (134) Sharda Bhog (248)
Mithua (174) Safeda Mulgoa (160) Bombay Pedda (188) Baramasi (207)
Pahilwan (198) Mallviya Bhog (136) Black Andrew (156) Bombay (214)
Rataul (192) Soria Malda (152) Radling (164) Anda (227)
S.B.Chausa (147) Darbhanga (153) Papaya Raja Goh (180) Jalsain (202)
S.B.Rampur (168) Bhogal Shah (156) MadhoRao Pasand (213)
Lucknow Safeda (163) V.N. Chatterjee (139) Mahmooda Bahar (222)
Safeda Mallihabad (126) Aswania (198) Anaiwara (203)
Serohi (134) Bombay Battle (143) Tata Maimidi (211)
Shuvedar (139) Ladario (200) Phol Gaal (217)
Shohrab Shah (146) Massarat Shastri (196) Jafrani Shahabad (227)
Shurkha Burma (161) Mankhurd (158) Alphanso Ratnagiri (201)
Himsagar (153) Papatio (161) Bombay (204)
Table 4. Iron (Fe) distribution in leaves of mango germplasms.

101–200 ppm 201–300 ppm > 300 ppm
Alif Laila (163) Lat Kampoo (185) Mohan Bhog (163) Papatio (124) Katakee Bahar (206) Bathui Katikee (310)
Amin Dofasla (168) Mallika (199) Sharda Bhog (178) Sardar (163) Langra Banarsi (211) Baramasi (348)
Amin Dhudhia (146) Nazuk Badan (196) Gulab Khas (167) Batle (160) Langra Digha (203) Mallik (450)
Amin Brahinpur (192) Pahilwan (192) Khausal Khas (131) Gadheymar (179) Langra Gorakhpur (251) Bombay Green (461)
Amin Prince (188) Rataul (129) Mohan Thakur (138) Hansraj (165) Langra (216) Dalima (304)
Amin Buland Bag (152) S.B.Chausa (132) Fazri (146) Hilario (139) Mithua (204) Pan (384)
Amin Khurd (148) S.B.Rampur (121) Fazri Kalan (143) Fazri (166) Nisar Pasand (224) Rousa (361)
Anopan (157) Sharbati Bagrain (134) Fazri Zafrani (139) Elaichi (180) Nayab (231) Beneshan (304)
Asaujia Deoband (151) Lucknow Safeda (118) Malda (182) Nazuk Badan (134) Sadaphal (216)
Baramasi Creeping (138) Safeda Mallihabad (102) Mithua Bihar (134) Vellai Colamban (194) Hardil Aziz (201)
Baramasi Aghai Bahar (159) Serohi (122) Chatterjee Khas (161) Allampur Beneshan (143) Bombay (255)
Baramasi Ahra (134) Shuvedar (125) Jalsain (165) Amina (135) Anda (223)
Adak et al. (2018) 5(1): 96–106
Banzeer (150) Shohrab Shah (101) Safeda Mulgoa (158) Anant Pal (122) Mallviya Bhog (247)
Banzeer Sandila (142) Shurkha Burma (127) MadhoRao Pasand (154) Ashadio (114) Tata Maimidi (256)
Bareilywala (147) Himsagar (114) Mahmooda Bahar (148) Amarjio (136) Bathui (201)
Bhoodia (143) Sukul (135) Anaiwara (133) Kensingto (117) Bhogal Shah (251)
Bhadaiya Sukul (152) Husn-e-ara (143) Soria Malda (144) Banglora-2 (172) V.N. Chatterjee (269)
Bride of Russia (168) Seipia (136) Phol Gaal (118) Bappakan (113) Alphanso Ratnagiri (262)
Chausa (164) Papla (127) Darbhanga (127) Bable Ponesa (166) Pairi (241)
Dashehari (167) Kala Pahar (148) Jafrani Shahabad (112) Beauty Maclino (145) Bombay (241)
Gaurjeet (156) Begum Pasand (111) Aswania (138) Modami Model (118) Rataul (247)
Gilas (171) Murshidabad (143) Bombay Battle (116) Bombay Darsa (114) Sakkar Chini (251)
Gola Bhadaiya (166) Kohitoor (156) Ladario (143) Bombay Pedda (116) Alurapali (296)
Gulab Jamun (176) Kali Pairi (174) Pathar (137) Radling (165) Neelam Madrasi (289)
Husn-e-ara (189) Zamurad (159) Massarat Shastri (133) Prabha Shankar (149) Alphanso Raman (233)
Katakee Farukhabad (178) Kishan Bhog (170) Mankhurd (146) Papaya Raja Goh (138) Black Andrew (256)
Table 5. Boron (B) distribution in leaves of mango germplasms.

Up to 10 ppm 11–20 ppm 21–30 ppm > 30 ppm
Langra Digha (6.60) Alif Laila (17.10) Amin Dofasla (26.60) Baramasi (30.80) Gulab Jamun (33.40)
Bappakan (10.80) Amin Khurd (20.70) Amin Dhudhia (21.20) Mallik (27.70) Hardil Aziz (38.60)
Modami Model (12.20) Asaujia Deoband (15.90) Amin Brahinpur (26.30) Bombay (23.20) Husn-e-ara (44.80)
Bombay Pedda (10.60) Baramasi Aghai Bahar (20.80) Amin Prince (26.60) Bombay Green (22.80) S.B.Chausa (38.70)
Black Andrew (12.80) Baramasi Ahra (18.10) Amin Buland Bag (21.30) Anda (27.10) Sharbati Bagrain (33.80)
Bareilywala (16.80) Anopan (27) Dalima (26.80) Zamurad (36.40)
Bhoodia (16.30) Baramasi Creeping (23.60) Jalsain (24.40) Khausal Khas (31.70)
Bhadaiya Sukul (15.70) Banzeer (25.30) Mahmooda Bahar (29.00) Fazri (34.70)
Gilas (20.40) Banzeer Sandila (25.10) Anaiwara (30.30) Fazri Kalan (35.80)
Gola Bhadaiya (17.50) Bride of Russia (27) Soria Malda (27.10) Bathui Katikee (31.80)
Katakee Bahar (12.30) Chausa (28.60) Phol Gaal (23.50) Chatterjee Khas (31.80)
Katakee Farukhabad (15.80) Dashehari (24.30) Darbhanga (28.30) Safeda Mulgoa (33.10)
Langra Banarsi (17.70) Gaurjeet (22.20) V.N. Chatterjee (26.10) Mallviya Bhog (31.60)
Langra Gorakhpur (15.80) Nazuk Badan (23) Jafrani Shahabad (22.40) MadhoRao Pasand (32.20)
Adak et al. (2018) 5(1): 96–106
Langra (13.30) Rataul (26.20) Aswania (30.90) Tata Maimidi (34.60)

Lat Kampoo (14.60) Lucknow Safeda (27.40) Ladario (28.70) Bhogal Shah (32.70)
Mallika (17.70) Safeda Mallihabad (24.80) Mankhurd (22.20) Alphanso Ratnagiri (32.80)
Mithua (16.60) Serohi (26.70) Bombay (30.10) Bombay Battle (31.40)
Nisar Pasand (12.90) Shuvedar (28.30) Rataul (29.60) Pathar (37.80)
Nayab (19.60) Shohrab Shah (24.40) Hansraj (29.30) Massarat Shastri (31.30)
Pahilwan (14.10) Shurkha Burma (25.30) Fazri (26.20) Papatio (33.50)
Sadaphal (20.60) Himsagar (26.00) Elaichi (29.40) Pan (38.00)
S.B.Rampur (15.10) Sukul (26.40) Nazuk Badan (28.20) Pairi (35.70)
Seipia (20.30) Husn-e-ara (23.60) Rousa (25.70) Sardar (37.60)
Murshidabad (19.20) Papla (29.10) Neelam Madrasi (26.60) Batle (33.40)
Mithua Bihar (16.20) Kala Pahar (30.60) Vellai Colamban (30.20) Gadheymar (38.90)
Anant Pal (17.10) Begum Pasand (22.10) Allampur Beneshan (24.90) Hilario (34.40)
Ashadio (19.20) Kohitoor (30.00) Amina (21.50) Sakkar Chini (36.80)
Amarjio (11.70) Kali Pairi (27.50) Alphanso Raman (22.50) Alurapali (32.50)
Kishan Bhog (26.30) Beneshan (25.20) Kensingto (31.20)
Mohan Bhog (30.80) Banglora-2 (26.70) Radling (32.70)
Sharda Bhog (28.50) Bable Ponesa (28.40)
Gulab Khas (29.20) Beauty Maclino (30.30)
Mohan Thakur (26.10) Bombay Darsa (21.10)
Fazri Zafrani (30.20) Prabha Shankar (27.90)
Malda (24.70) Papaya Raja Goh (30.40)
Bathui (27.60)
Adak et al. (2018) 5(1): 96–106
basis for resource utilization based on nutrient contents in soil and leaf tissues along with other technologies
were advocated (Kumar et al. 2016b). The mineral compositions of normal or high density mango plantations
were also equally important in order to have yield sustainability (Adak et al. 2016). Thus, information on
nutrient contents in any biodiversity conservation programme or production system needs special attention for
recording yield variations and orchard sustainability.
CONCLUSION
The present study indicated wide variations across micronutrient contents in 138 conserved mango
germplasms.Some of the commercial cultivars had differential Zn, B, Mn, Cu and Fe contents in its foliar tissues
indicating the basis for wider quality production. Majority of the B contents are recorded in the range of 21 to 30
mg kg-1, Zn for 11–20 mg kg-1, Mn & Fe 101 to 200 mg kg-1 respectively. Maintenance of optimum quantity of
micronutrients are thus required for the good plant health.
ACKNOWLEDGEMENTS
All the authors acknowledged the facility provided by the Director, CISH Lucknow for conducting the field
as well as laboratory experimentation. Financial support provided by the ICAR-networking project on
“Micronutrient management in Horticultural crops for enhancing Yield and quality” is also duly acknowledged.
REFERENCES
Adak T, Kumar K & Singh VK (2017) Micronutrient management for mango and guava orchards: farmers’
perspective. Tropical Plant Research 4(1): 180–182.
Adak T, Singh VK, Kumar K & Singh VK (2016) Soil properties in high density mango orcharding-a basis for
orchard sustainability. GERF Bulletin of Biosciences 7(1): 10–16.
Bally ISE, Akem CN, Dillon NL, Grice C, Lakhesar D & Stockdale K (2013) Screening and breeding for
genetic resistance to anthracnose in mango. In: Acta Horticulturae. International Society for Horticultural
Science (ISHS), Leuven, Belgium, pp. 239–244.
Berardini N, Fezer R, Conrad J, Beifuss U, Carle R & Schieber A (2005) Screening of mango (Mangifera indica
L.) cultivars for their contents of flavonol O-and xanthone C-glycosides, anthocyanins, and pectin. Journal
of agricultural and food chemistry 53(5): 1563–1570.
Bhupal Raj G & Prasad Rao A (2006) Identification of Yield‐Limiting Nutrients in Mango through DRIS
Indices. Communications in Soil Science and Plant Analysis 37: 1761–1774.
Boaretto RM, Quaggio JA, Mattos Jr D, Muraoka T & Boaretto AE (2011) Boron uptake and distribution in
field grown Citrus trees. Journal of Plant Nutrition 34(6): 839–849.
da Silva, João PS, Nascimento WA, Clístenes Silva DJ, Cunha PV, Karina Biondi CM (2014) Changes in soil
fertility and mineral nutrition of mango orchards in São Francisco Valley, Brazil. Agrária - Revista
Brasileira de Ciências Agrárias 9(1): 42–48.
Johns T (2003) Plant Biodiversity and Malnutrition: Simple Solutions to Complex Problems. African Journal of
Food, Agriculture, Nutrition and Development 3(1): 45–52.
Kadman A & Gazit S (1984) The problem of iron deficiency in mango trees and experiments to cure it in Israel.
Journal of Plant Nutrition 7(1–5): 283–290.
Kumar K, Adak T, Shukla SK & Singh VK (2016a) Effect of foliar application of Zn on fruit yield, quality and
Zn content in guava under subtropical Lucknow region. In: 7th Indian Horticulture Congress - 2016. IARI,
New Delhi. pp. 314.
Kumar K, Adak T, Lal B, Shukla PK, Balaji Rajkumar, Chandra S & Singh VK (2016b) Technological
intervention in sustaining mango productivity in a resource poor farmers’ field of Uttar Pradesh. GERF
Bulletin of Biosciences 7(2): 6–11.
Rajan S, Lamers Hugo AH & Lal B (2016) A set of interconnected practices which enhance and conserve
mango diversity in Malihabad, India. In: Sthapit B et al. (eds) Tropical Fruit Tree Diversity: Good Practices
for in Situ and On-Farm Conservation. Routledge, Taylor & Francis Group, New York, pp. 172–183.
Ribeiro SMR, Barbosa LCA, Queiroz JH, Kno¨dler M & Schieber A (2008) Phenolic compounds and
antioxidant capacity of Brazilian mango (Mangifera indica L.) varieties. Food Chemistry 110: 620–626.
Shukla AK, Tiwari PK & Prakash C (2014) Micronutrients Deficiencies vis-à-vis Food and Nutritional Security
of India. Indian Journal of Fertilisers 10 (12): 94–112.
Adak et al. (2018) 5(1): 96–106
Singh NP, Jerath N, Singh G & Gill PPS (2012) Physico-chemical characterization of unexploited mango
diversity in sub-mountane zone of Northern India. Indian Journal of Plant Genetic Resources 25(3): 261–
269.
Somasundaram J, Meena HR, Singh RK, Prasad SN & Parandiyal AK (2011) Diagnosis of Micronutrient
Imbalance in Lime Crop in Semi-arid Region of Rajasthan, India, Communications in Soil Science and Plant
Analysis 42(7): 858–869.
Srivastava AK & S Shyam (2006) Diagnosis of nutrient constraints in citrus orchards of humid tropical India.
Journal of Plant Nutrition 29: 1–16.
Toledo Á & Burlingame B (2006) Biodiversity and nutrition: A common path toward global food security and
sustainable development. Journal of Food Composition and Analysis 19: 477–483.
ISSN (E): 2349 – 1183
ISSN (P): 2349 – 9265
5(1): 107–115, 2018
DOI: 10.22271/tpr.2018.v5.i1.015
Research article
Genetic Diversity and Relationships of Neolamarckia cadamba

(Roxb.) Bosser progenies through cluster analysis
M. Preethi Shree, N. Krishnakumar* and K. T. Parthiban
Forest College and Research Institute, Tamil Nadu Agricultural University, Mettupalayam, Tamil Nadu, India
*Corresponding Author: krishna.forest@gmail.com [Accepted: 26 April 2018]
Abstract: Genetic diversity analysis was conducted for biometric attributes in 20 progenies of
Neolamarckia cadamba. The application of D2 clustering technique in Neolamarckia cadamba
genetic resources resolved the 20 progenies into five clusters. The maximum intra cluster distance
was shown by the cluster II. The maximum inter cluster distance was recorded between cluster III
and V which indicated the presence of wider genetic distance between Neolamarckia cadamba
progenies. Among the growth attributes, volume (36.84 %) contributed maximum towards genetic
divergence followed by bole height, basal diameter, tree height, number of branches in
Neolamarckia cadamba progenies.
Keywords: Genetic diversity - Cluster analysis - Intra cluster distance - Genetic distance.
[Cite as: Preethi Shree M, Krishnakumar N & Parthiban KT (2018) Genetic Diversity and Relationships of
Neolamarckia cadamba (Roxb.) Bosser progenies through cluster analysis. Tropical Plant Research 5(1): 107–
115]
INTRODUCTION
Global demand for wood is increasing at an annual rate of 1.7 percent (Parthiban 2016) At the same time,
planted forest resources are insufficient to meet current demands. The scope for expansion of forested area is
limited (Gregory et al. 2002). This trend creates economic pressure that encourages the commercial exploitation
of natural forests unless supply can be increased through the establishment of high yielding plantations. The
current supply of raw materials for industries like pulpwood, plywood, furniture and matchwood energy in the
state is far behind the demand. Hence, to meet the growing raw material requirement and also to subserve the
1988 National Forest Policy Guidelines of Indian Government and to keep pace with these progressive
developmental changes in the country, the industries must expand sharply its plantation programme. However,
considering the acute shortage of suitable raw material, the industries have to establish a plantation of suitable
species with tree improvement programme to achieve maximum yield within a short rotation period. This
besides, choice of alternative tree species to meet the raw material requirement of industries is the need of the
hour. Neolamarckia cadamba is one such alternative species suitable for pulpwood, plywood, matchwood and
also in pencil industry.
In India both domestic and international market, the timber supply is facing a severe shortage. It is estimated
that the demand for timber is likely to grow from 58 million cubic meters in 2005 to 153 million cubic meters in
2020. The wood supply is increased in past two decades from 29 million cubic meters in 2000 to 60 million
cubic meters in 2020. The shortfall of 93 million cubic meters should be met by import from the international
market. The productivity of timber in India is only 0.7 cu m-1 ha-1 year-1 whereas the world average is 2.1 cu m-1
ha-1 year-1 (Lal 2011). The supply of timber is mainly from forest plantations and wood production is showing a
negative growth rate. In the absence of adequate supply from domestic sources, the nation has to depend heavily
on imports to meet its demand for timber. This will increase the nation’s forest footprint, particularly in South
East Asia. In order to minimize the forest footprint, we need to encourage sustainable consumption of timber by
promoting farm forestry. The demand gap should be bridged by increasing domestic production by introducing
fast growing timber species with a short rotation like Neolamarckia cadamba.
For any tree improvement programme, determination of the species, or geographic source within species,
amount, kind and cause of variation within the species are very important initial steps (Zobel & Talbert 1984).
Preethi Shree et al. (2018) 5(1): 107–115
Abundant variation is available in trees in nature, which the foresters can tap and use it to get the maximum
improvement in a short span of time. Information from field experiments is very valuable because assessed
adaptive genetic variation is still the best input for breeding and conservation activities (Zobel 1971). However,
variation studies using biometric traits in Neolamarckia cadamba is dismally modest and demand intensive
research.
The genetic diversity existing in the population will help to generate a rich base population for initiating
proper selection (Zobel 1981). After clustering, the superior group or individual may directly be utilized for
raising commercial plantation for meet out industrial wood demand. Determination of genetic diversity through
mahalanobis D2 analysis in Neolamarckia cadamba has not been attempted so far and thus underscores
investigation.

The experimental materials for this study consisted of 20 genotypes of Neolamarckia cadamba selected from
various locations of India (Table 1). The progeny evaluation experiments were carried out in the field of Forest
College and Research Institute, Tamil Nadu Agricultural University, Mettupalayam (11 o19′ N, 76o56′ E), 300 m.
a.m.s.l., 800 mm, pH 7.1) during 2012–2013.
Table 1. Location details of Neolamarckia cadamba genetic resources.
Location Genotype State Latitude Longitude Altitude (m)
Tripura FCRIK1 Tripura 23⁰49′ 91⁰17′ 78
Khowai FCRIK2 Tripura 24⁰04′ 91⁰36′ 46
Tripura FCRIK3 Tripura 23⁰55′ 91⁰50′ 89
Mettupalayam FCRIK4 Tamil Nadu 11⁰17′ 76⁰56′ 330
Assam FCRIK5 Assam 26⁰33′ 90⁰26′ 69
Assam FCRIK6 Assam 26⁰33′ 90⁰26′ 69
Coimbatore FCRIK7 Tamil Nadu 11⁰17′ 76⁰56′ 330
Dapoli FCRIK11 Maharashtra 17⁰45′ 73⁰11′ 175
Maharashtra FCRIK12 Maharashtra 21⁰08′ 79⁰05′ 313
Tirupathi FCRIK13 Andhra Pradesh 13⁰37′ 79⁰25′ 155
Andhra Pradesh FCRIK14 Andhra Pradesh 13⁰37′ 79⁰25′ 155
Hyderabad FCRIK15 Andhra Pradesh 17⁰22′ 78⁰29′ 502
Andhra Pradesh FCRIK16 Andhra Pradesh 17⁰22′ 78⁰29′ 502
Karnal FCRIK17 Haryana 29⁰41′ 76⁰59′ 251
Haryana FCRIK18 Haryana 29⁰41′ 76⁰59′ 251
Thrissur FCRIK19 Kerala 10⁰31′ 79⁰13′ 54
Bangalore FCRIK20 Karnataka 12⁰58′ 77⁰35′ 910
Species description
Common name : Kadam
Species : Neolamarckia cadamba (Roxb.) Bosser
Family : Rubiaceae
Botanical features
Neolamarckia cadamba is a large tree with a broad umbrella-shaped crown and straight cylindrical bole. The
tree may reach a height of 45 m with a stem diameter of 100–160 cm and sometimes it has a small buttress up to
2 m high. The bark is grey, smooth and very light in young trees, but rough and longitudinally fissured in old
trees. The branches spread horizontally and drop at the tip. The leaves are glossy green, opposite, simple sessile
to petiolate, ovate to elliptical (15–50 cm long by 8–25 cm wide). In young fertilised trees, the leaves are much
larger, subordinate at the base and acuminate at apex; the stipules are interpetiolar, narrowly triangular and
deciduous. The fruitlets are numerous, somewhat fleshy, with their upper parts containing 4 hollow or solid
structures. The fruit contains approximately 8000 seeds with fleshy yellow-orange infructescence; small and
fleshy capsules closely packed together. The seeds somewhat are trigonal or irregular shaped, not winged
(Martawijaya et al. 1989). It is lightweight hardwood. The heartwood is not clearly different from sapwood. The
heartwood is visually white with a yellow tinge darkening to creamy yellow (Soerianegara & Lemmens 1993).
Determination of genetic diversity

The Biometric data recorded during 32 MAP in Neolamarckia cadamba progeny evaluation trial were used
for diversity analysis (Table 2). The D2 statistics was adopted for the estimation of genetic divergence
(Mahalanobis 1928). Using D2 statistical results, the clustering of progenies was done.
Table 2. Progeny evaluation of (32 MAP) in Neolamarckia cadamba.
Diameter
Name of the Tree Basal Number of Bole Crown
at Breast Volume
progenies height Diameter branches height length
Height
FCRIK1 5.25 29.58 47.72* 24.0 2.25 3.00 0.036
FCRIK2 5.38 26.45 39.12 30.2 2.09 3.29 0.036
FCRIK3 5.71 26.25 47.10* 28.7 2.20 3.51 0.034
FCRIK4 5.40 26.48 40.87 33.5 2.34 3.06 0.029
FCRIK5 5.44 28.53 43.62 33.7 2.28 3.16 0.033
FCRIK6 5.76 26.05 41.92 30.5 2.53 3.24 0.031
FCRIK7 6.69** 32.45* 47.85* 42.5* 2.68* 4.01* 0.059**
FCRIK8 4.84 22.35 35.37 24.2 2.14 2.70 0.021
FCRIK9 5.10 25.55 36.52 26.0 2.28 2.83 0.025
FCRIK10 4.84 23.55 33.85 24.5 2.11 2.73 0.020
FCRIK11 5.31 26.83 37.77 28.7 2.30 3.01 0.030
FCRIK12 5.76 27.33 38.10 32.5 2.29 3.48 0.033
FCRIK13 6.33* 28.00 42.25 31.0 2.21 4.11** 0.035
FCRIK14 5.29 32.40* 42.27 32.2 2.28 3.01 0.045
FCRIK15 5.13 23.10 36.45 30.0 2.18 2.95 0.021
FCRIK16 6.36* 28.90 50.20 40.0* 2.31 4.05* 0.045
FCRIK17 5.55 32.43* 40.45 40.5* 2.65* 2.90 0.048
FCRIK18 5.73 29.85 47.17 39.5 2.21 3.51 0.038
FCRIK19 5.58 28.38 40.62 31.2 2.16 3.41 0.033
FCRIK20 3.89 17.58 27.65 23.5 2.18 1.71 0.013
Mean 5.47 27.10 40.84 31.3 2.28 3.18 0.033
SEd 0.40 2.56 3.13 4.37 0.18 0.39 0.008
CD (p= 0.05) 0.81 5.13 6.28 8.68 0.36 0.77 0.017
CD (p= 0.01) 1.15 6.84 8.36 9.65 0.49 1.03 0.023
D2 statistics
The D2 statistics was carried out using the traits viz., plant height, basal diameter and volume index. The
mean squares and the mean products were estimated between groups and within components by one-way
analysis of variance, covariance and the significance were tested at progeny level. A variance - covariance was
formed from the above and subjected to pivotal condensation to obtain the linear function for the transformation
of character mean values (x) to a set of independent variables (uncorrected mean) value (y).
The difference between any two mean values for each pair of progeny was squared and added to give the D 2
values. For each character Cumulative D2 values in all the possible combination of progeny were estimated.
y1 = x1
y2 = x2 – a2x1
y3 = x3 – a32y2 – a31y1
yp = xp – app-1yp-1 …..ap1y1
Where,
x1 = normalized variables
aij = bij / v (yj) S < -1
v(yj) =  a(ji) bij – bij = ij-1 / atbt
ij = covariance of i and jt = ji
All possible [n (n-1)/2], D2 values were calculated by taking sum of difference between pair of
corresponding ‘y’ values taking two progenies at a time.
Determination of clusters or grouping
The progenies were grouped into different clusters using ‘GENRES’ statistical package on the basis of D 2
values according to Tocher’s method as suggested by Rao (1952).
Tocher’s method
All the [n (n-1) /2] X D2 values were clustered by using Tocher’s method (Rao 1952).
Average intra and inter cluster distances
Intra and inter cluster relationships were studied on the completion of clustering analysis and the relationship
between clusters and their distances were represented. The average intra cluster distances was measured using
the formula
D2 = D12 / n
Where D2 was the sum of distances between all possible combinations of the progeny included in a
cluster whereas the average inter cluster divergences were arrived by taking into consideration of all the
component D2 values possible among the numbers of the two clusters. Then the genetic distance ‘D’ between
the clusters were obtained from the square root of the average D2 values.
RESULT
Genetic divergence
The mean values were transformed into standardized uncorrelated mean values. The D 2 values were
computed for all positive pairs. 20 progenies of Neolamarckia cadamba were placed under five clusters on the
basis of Mahalanobis D2 clustering techniques.
Cluster components
The clustering pattern revealed that the 20 progenies were resolved into five different clusters. The cluster I
constituted 8 progenies viz., FCRIK1, FCRIK2, FCRIK3, FCRIK4, FCRIK5, FCRIK6, FCRIK9 and FCRIK10;
whereas cluster II consisted of 6 progenies FCRIK8, FCRIK11, FCRIK12, FCRIK13, FCRIK14 and FCRIK15;
Cluster III consisted 4 progenies FCRIK7, FCRIK16, FCRIK18 and FCRIK19; Cluster IV consisted 1 progenies
FCRIK 17; Cluster V consisted 1 progeny FCRIK20 (Table 3).
Table 3. Clustering pattern of Neolamarckia cadamba for biometric attributes.
Cluster Number of
Members
No. progenies
I 8 FCRIK1,FCRIK2,FCRIK3,FCRIK4,FCRIK5,FCRIK6,FCRIK9, FCRIK10
FCRIK8, FCRIK11,FCRIK12,FCRIK13,
II 6
FCRIK14,FCRIK15
III 4 FCRIK7,FCRIK16,FCRIK18,FCRIK19,
IV 1 FCRIK17
V 1 FCRIK20
Intra and inter cluster average distance
The average inter and intracluster D2 and D values among the five clusters are presented in table 4. Intra and
inter cluster ranged from 0.00 to 2.69 and 6.40 to 29.79 respectively. Intracluster distance maximum in cluster II
(2.69) with seven accessions and minimum in cluster IV and V (0.00) with one accession respectively. Highest
inter cluster was between cluster III and V (29.795), followed by cluster IV and V (27.528) suggesting that there
is a wide genetic diversity between these groups. The minimum inter cluster distance was between cluster I and
II (7.170).
Table 4. Intra (diagonal) and inter cluster D2 and D (parantheses) values of Neolamarckia cadamba for
biometric attributes.
Cluster 1 2 3 4 5
6.406 7.170 7.839 17.097 19.167
I
(2.531) (2.678) (2.800) (4.135) (4.378)
7.283 7.651 11.914 20.490
II
(2.699) (2.766) (3.452) (4.527)
5.413 15.707 29.795
III
(2.327) (3.963) (5.458)
0.000 27.528
IV
(0.000) (5.247)
0.000
V
(0.000)
Cluster mean performance

The cluster mean for the traits was estimated and furnished in the table 5. Cluster mean expressed significant
variation among clusters for all traits. The members in cluster III showed the highest performance of 5.88 for
tree height followed by cluster II (5.62) while, the minimum was observed for the cluster V (3.88). The
maximum cluster mean of 32.42 was observed for diameter at breast height in cluster III whereas the least
cluster mean for diameter at breast height (17.57) was exhibited by the cluster V. The maximum cluster mean of
46.0 was observed for basal diameter in cluster III whereas the least cluster mean for basal diameter (27.65) was
exhibited by the cluster v. The maximum cluster mean of 42.0 was observed for number of branches in cluster
IV whereas the least cluster mean for number of branches (22.50) was exhibited by the cluster V. The maximum
cluster mean of 2.65 was observed for bole height in cluster IV whereas the least cluster mean for bole height
(2.17) was exhibited by the cluster V. The maximum cluster mean of 3.65 was observed for crown length in
cluster III whereas the least cluster mean for crown length (1.71) was exhibited by the cluster V. In case of
volume, the cluster mean was highest for cluster IV (0.050) and the lowest for cluster V (0.014). In general, the
cluster IV and cluster V had highest and lowest mean values for most of the traits respectively.
Table 5. Cluster mean values for biometric attributes.
Diameter
Cluster/ Tree Basal Number of Clear bole Crown
at breast Volume
Character height diameter branches height height
height
I 5.35 26.55 41.34 30.28 2.25 3.10 .032
II 5.62 27.49 40.01 34.46 2.29 3.32 0.037
III 5.88 32.42 46.00 37.91 2.22 3.65 0.042
IV 5.55 29.04 40.45 42.00 2.65 2.90 0.050
V 3.88 17.57 27.65 22.50 2.17 1.71 0.014
Contribution of characters towards genetic divergence
The number of times each character ranking first was counted and percentage contribution towards
divergence was calculated and presented in table 6. Volume contributed maximum percentage towards
divergence (36.84%) followed by bole height (20.00%). Contribution towards divergence was not recorded by
crown length (0.00%).
Table 6. Percentage contributions of morphometric traits to genetic divergence.
Character No. of first rank % Contribution
Tree height 30 15.78
DBH 8 4.21
Basal diameter 35 18.42
Number of branches 9 4.73
Bole Height 38 20.00
Crown length 0 0.00
Volume 70 36.84
Total 190 100
DISCUSSION AND CONCLUSION

Genetic divergence
Proper genetic resources and sufficient genetic divergence between the population is used in successful tree
improvement programmes. Precise information on the nature and degree of genetic divergence in respect of
important traits is a pre-requisite for undertaking meaningful breeding programme (Chaturvedi & Pandey 2001)
towards the improvement and conservation of a species (Ayad et al. 1995, Gradual et al. 1999). Assessment of
genetic divergence in the populations of a species is of paramount significance in the purposeful breeding
programme. The nature and degree of genetic divergence in the seed sources is useful for classifying them into
groups on the basis of their diversity, particularly when overlapping for one or more characters is frequent, the
genetic divergence analysis also helps in identifying the desirable genotypes for improvement programme,
presuming that genetic diversity would provide greater livelihood of promising genetic rearrangement. In the
current study, genetic diversity existed among the 20 selected progenies of Neolamarckia cadamba had been
assessed through D2 analysis which resolved the 20 progenies in to five clusters.
Cluster composition
Diversity analysis provides in formation on deciding the choice of parents from distantly related cluster to
secure yield improvement in Neolamarckia cadamba. Clustering methods have the goal of separating a pool of
observations in many subgroups to obtain homogeneity within and between the formed subgroups. D 2 statistics
is an important tool in plant breeding for estimating genetic divergence (Aslam et al. 2011). The exploitation of
heterosis and success in getting desirable segregates in a breeding programme, largely depends on the degree of
divergence in a chosen population (Paramathma & Surendran 2000a). Genetic diversity is essential to meet the
diversified goals of tree breeding such as breeding for cultivation, increasing yield, wider adaptation, desirable
quality, pest and disease resistance. The extent of diversity that existed within the selected genotypes has been
estimated using genetic divergence analysis (Mondal 2003).
Application of Mahalanobis statistics and Tocher’s technique allowed grouping of the 20 Neolamarckia
cadamba progenies into five distinct clusters (Fig. 1), indicating adequate genetic variability among the clusters
under study. Among the five clusters, cluster I included a maximum of eight genotypes and cluster II and III
included six and four respectively. The cluster IV and V included only a particularly unique and distinct
genotype. In Pinus wallichiana, 88 plus tree progenies were grouped into 10 distinct clusters on the basis of
Mahalanobis D2 statistic. Maximum number of genotypes (21) was grouped in cluster IV, followed by cluster III
(18) and cluster X (14). Clusters V and VII consisted of 10 genotypes each followed by clusters I and VIII
which included 8 and 4 genotypes, respectively. Cluster III, VI and IX were distinct and unique from others as
each included only one genotype (Aslam et al. 2011). Similarly, 80 batches of teak had been grouped into eight
clusters, of which group A formed the largest cluster containing 46 batches (Bagchi 2000).
Figure 1. Cluster diagram for biometric traits of Neolamarckia cadamba progenies.

In the present investigation, some clusters included genotypes from all the locations, while others included
only a particularly unique and distinct genotype. It could be seen that the genotypes from different locations
grouped together to form a single major cluster as evident in cluster I and therefore the pattern of divergence
was not depended on the geographic locations. These findings were in agreement with the results of Sagwal
(1982), Khosla et al. (1994), Sehgal et al. (1994) in Pinus roxburghii; Arun Prasad et al. (1996) in
Tectona grandis and Aslam et al. (2011) in Pinus wallichiana and suggested that all the genotypes from a given
area may not necessarily form a single cluster. Thus, the pattern of divergence is not dependent on the
geographical nearness of the genotypes and such a pattern could be attributed to differences in the genetic make-
up of the otherwise co-occurring genotypes (Chauhan & Sehgal 2001). The occurrence of genotypes from
geographically different areas in the same cluster, as evidenced in the current study and also reported in Pungam
which indicated that factors other than geographical nearness are also contributing towards genetic divergence
(Kumaran 1991).
Intra and inter cluster average distance

In the present study, the highest intra-cluster distance was observed for the cluster II (7.28) and the minimum
for the cluster III (5.413). Cluster III has the minimum intra-cluster value indicating that genotype within the
cluster was similar, while cluster II showed the maximum intra-cluster D2 value followed by cluster I (6.41)
revealing the existence of diverse genotypes that fell in these clusters. The intra-cluster distance was much lower
than inter-cluster one, suggested heterogeneous and homogenous nature between and within cluster respectively
and also indicated wide genetic diversity among the genotypes of different clusters than those of the same
cluster. The data on inter cluster distances and as per the performance of genotypes were used to select
genetically diverse and silviculturally superior genotypes. The genotypes, exceptionally good with respect to
one or more characters were desirable. A perusal of intra and inter-cluster distances revealed that highest inter-
cluster distance of 29.79 between cluster III and V followed by cluster IV and V (27.52).
If genotypes drawn from such genetically diverse clusters, they could be of particular significance in the
production of high heterotic effect during hybridization (Singh & Singh 1981, Aslam et al. 2011). Such inter and
intra cluster distance among Pinus gerardiana was also reported which support the results of current conclusion
(Kant et al. 2006).
Cluster mean performance
The data revealed considerable differences among the clusters for most of the characters studied. The cluster
III recorded higher tree height, DBH, basal diameter and crown length. In respect of different biometric
parameters considered in the present study, the clusters did vary (Table 5) and such variations in cluster means
have also been reported by Aslam et al (2011) in Pinus wallichiana, Kumaran (1997) in Neem and Bagchi
(2000) in Tectona grandis. Surendran & Chandersekhran (1988) studied the genetic divergence among half-sib
progenies of 35 single tree selections of Eucalyptus tereticornis from different agro-climatic zones of Tamil
Nadu at 24 month growth phase and identified promising clusters for their use in the silvicultural management
of the species. Genetic diversity is the outcome of several factors, including topographical diversification.
Therefore, selection of genotypes of higher productivity should be based on genetic diversity rather than
geographic diversity (Singh 1993).
Contribution of traits towards genetic divergence
In the present investigation, among the growth attributes, volume contributed maximum (36.84%) towards
genetic divergence followed by bole height, basal diameter, tree height, number of branches and DBH.
Paramathma (1992) reported similar results in six Eucalyptus species and twelve interspecific hybrids; Bagchi
(2000) in Tectona grandis; Tikader (2001) in Morus species; Manga & Sen (2000) in Prosopis cineraria; Tewari et
al. (2002) in Dalbergia sissoo; Chauhan & Sehgal (2001) in Pinus roxburghii and Vennila (2009) in Eucalyptus also
reported contribution of volume index along with other morphometric traits towards genetic divergence among the
genotypes tested which might be due to the existence of broader genetic base. Based on the previous work and the
current finding, the contributions of volume index for genetic divergence indicated that this derived factor could be
used as an index for Neolamarckia cadamba tree improvement programme.
The findings of the present study are also in line with the results of Burley & Burrows (1972), who employed
multivariate analysis in Pinus kesiya and suggested that, this techniques mainly used to identify the best progenies
among the different genetic resources through many number of clusters and the selected superior cluster are used to
afforestation and reforestation programmes. Hopefully such knowledge will aid propagators, geneticists, breeder and
tree improvement specialists in enhancing the quality and productivity of the forest ecosystems to meet their market
demand. Notwithstanding the differences, the present study clearly establishes the superiority of cluster III
recommends propagation of material from the trees belonging to this cluster for utilization in immediate plantation
programmes for better productivity of the species.
ACKNOWLODGEMENTS
The authors profusely thank to Forest College and Research Institute, Tamil Nadu Agricultural University,
Mettupalayam for conducting research trials.
REFERENCE
Kant A, Dutt V & Sharma DR (2006) Genetic variability in phenotypic characters of Pinus gerardiana. Indian
Forester 345: 681–690.
Arun Prasad KCA (1996) Variability studies in teak (Tectona grandis Linn. F.), M.Sc. Thesis. Tamil Nadu
Agricultural University, Coimbatore, India.
Aslam MA, Zafar R & Siddiqi TO (2011) Genetic divergence in half-sib progenies of Pinus wallichiana A.B.
Jackson plus trees in the Kashmir Himalaya, India. Tropical Ecology 52(2): 201–208.
Ayad W, Hodgkin G, Jaradat A & Rao UR (1995) Molecular genetic techniques for plant genetic resources.
IPGRI Report, 135 p.
Bagchi SK (2000) Genetic divergence in Tectona grandis. Annual Forester 8(1): 25–37.
Burley J & Burrows PM (1972) Multivariate analysis of variation in needles among provenances of Pinus kesiya
Royle ex Gordon (Syn, P. khasya Royle, and P. insularis Enlicher). Silvae Genetica 21: 69–77.
Chaturvedi OP & Pandey N (2001) Genetic divergence in Bombax ceiba L. germplasms. Silvae Genetica 50:
99–102.
Chauhan SK & Sehgal RN (2001) Genetic diversity among progenies of Himalayan long Pine. Indian Journal
of Forestry 24(1): 65–71.
Gradual L, Kjaer ED, Suangtho P & Kaosaard A (1999) Conservation of genetic resources of Teak (Tectona
grandis) in Thailand. Technical Note No. 52, Danida Forest Seed Centre, Denmark.
Gregory PJ, Ingram JSI, Andersson R, Betts RA, Brovkin V & Chase TN (2002) Environmental consequences
of alternative practices for intensifying crop production. Agricultural Ecosystem Environment 88: 279–290.
Khosla PK (1994) Potential of economic utility of Pines. Proceedings of IUFRO group P.S.01, Manuas, Brazil,
pp. 18–22.
Kumaran K (1991) Genetic analysis of seed and juvenile seedling attributes in Neem (Azadirachta indica A.
Juss) and Pungam [Pongamia pinnata (Linn.) Pierre.], M.Sc. Thesis. Tamil Nadu Agricultural University,
Coimbatore.
Kumaran K (1997) Selection of one - parent families for higher growth, oil and Azadirachtin content in neem
(Azadirachta indica A. Juss.), Ph.D. Thesis. Tamil Nadu Agricultural University, Coimbatore.
Lal P (2011) Clonal Agroforestry Plantations in India. Indian Journal of Ecology 38 (Special Issue): 6–10.
Mahalanobis PC (1928) On the generalized distance in statistics. In: Proceedings, National Institute of Science,
India, pp. 49–55.
Manga VK & Sen DN (2000) Genetic diversity among different genotypes of Prosopis cineraria Druce. Indian
Journal of forestry 23(3): 291–295.
Martawijaya A, Kartasujana I, Mandang YI, Prawira SA & Kadir K (1989) Atlas kayu Indonesia Jilid II. Pusat Penelitian
dan Pengembangan Hasil Hutan, Bogor, Indonesia.
Mondal MAA (2003) Improvement of potato (Solanum tuberosum L.) through hybridization and in vitro culture
technique, Ph.D Thesis. Rajshahi University, Rajshahi, Bangladesh.
Paramathma M (1992) Studies on genetic inheritance and interspecific crosses of Eucalyptus, Ph.D. Thesis.
Tamil Nadu Agricultural University, Coimbatore.
Paramathma M & Surendran C (2000) Exploitation of heterosis for afforestation in Eucalyptus. In: Proceeding of the
International Symposium on Hybrid Breeding and Genetics, 9–14 April, Noose Lake, FRI, Australia.
Parthiban KT (2016) Tree Insurance-An Innovative Intervention in Industrial Agroforestry. Indian Forester
142(5): 1–11.
Rao CR (1952) Advanced statistical methods in biometrical research. John Wiley and Sons, New York. pp.
357–363.
Sagwal SS (1982) Estimation of genetic parameters in needle length of chir pine (Pinus roxburghii Sargent),
Indian Journal of Forestry 5(3): 189–191.
Sehgal RN, Chauhan SK & Dhall SP (1994) Half-sib progeny evaluation in chirpine. Silvae Genet 44(2): 61–62.
Singh NB (1993) Estimation of variance, heritability, genetic gain and correlations among growth characters in
Bambusa pallida. Indian Journal of Forestry 16(1): 33–38.
Singh RB & Singh SV (1981) Phenotypic stability and adaptability of durum and bread wheat for grain yield.
Indian Journal of Genetics 40: 86–92.
Soerianegara I & Lemmens RHMJ (1993) Plant resources of South-east Asia 5 (1): Timber trees: Major commercial
timbers. Pudoc Scientific Publishers, Wageningen, Netherlands.
Surendran C & Chandrasekaran P (1988) Genetic divergence among half sib progenies of Eucalyptus
tereticornis Sm. In: Khosla PK & Seghal RN (eds) Trends in Tree Sciences. ISTS, pp. 218–224.
Tewari SK, Subhanjana AK & Pandey SBS (2002) Genetic Divergence in Shisham (Dalbergia sissoo Roxb).
Indian Journal of forestry 25(1): 21–24.
Tikader A (2001) Genetic Divergence Analysis in Mulberry Germplasm (Morus spp.). Indian Journal of Forestry
24(3): 328–331.
Vennila S (2009) Pulpwood traits, genetic and molecular characterization of Eucalyptus genetic resources, Ph.D
thesis. Tamil Nadu Agricultural University, Coimbatore.
Zobel BJ (1981) Vegetative propagation in forest management operations. In: Proceeding 16th South for Tree
Improvement. Meet, Blacksburg, Virginia, pp. 149–159.
Zobel BJ (1971) The genetic improvement of Southern pines. Scientific American 225: 94–103.
Zobel BJ & Talbert J (1984) Applied Tree Improvement. John Wiley and Co., 503 p.
ISSN (E): 2349 – 1183
ISSN (P): 2349 – 9265
5(1): 116–120, 2018
DOI: 10.22271/tpr.2018.v5.i1.016
Review article
Ethnobotanical profiling of Asparagus aethiopicus L.

Gaddeyya Gandipilli* and Esteru Rani Geddada
Centre of Advanced Study, Department of Botany, Andhra University,
Visakhapatnam-530003, Andhra Pradesh, India
*Corresponding Author: mycology.au@gmail.com [Accepted: 28 April 2018]
Abstract: An ethnobotanical survey was conducted to collect the information and medicinal
properties of Asparagus aethiopicus, a perennial monocot herb of Asparagaceae family. The plants
were collected from the fields of Visakhapatnam District in the Andhra Pradesh state of India. The
live specimens were used for the description of plants and some of the plant material was dried and
stored for long term preservation of the species and for further study. The present study aimed to
describe botanical aspects and medicinal value of the species.
Keywords: Asparagopsis aethiopicus L. - Sprenger asparagus - Asparagaceae - South Africa -
Ayurveda.
[Cite as: Gandipilli G & Geddada ER (2018) Ethnobotanical profiling of Asparagus aethiopicus L. Tropical
Plant Research 5(1): 116–120]
INTRODUCTION
The socio-economic and land use changes are happening very fast during these days and are responsible for
the disappearance of the traditional knowledge about plants and their uses. Documenting and safeguarding
traditional ecological knowledge have become central issues in the planning and management of natural
resources. The relevance of this knowledge as far as increasing the daily living standards of rural populations is
concerned, as well as in taking decisions regarding the sustainable use of plant resources, has frequently been
noted (Benz et al. 2000, Shackleton et al. 2002). Asparagus is a very ancient crop and the ancient Greeks (200
BC) and Romans considered Asparagus as a medicinal plant for relieving toothache (Welbaum 2015). Today
Asparagus has spread around the world and it is an important vegetable in over 60 countries, including many
parts of Europe, Asia, Australia and New Zealand (FAOSTAT 2015). Asparagus aethiopicus L. is a perennial
herb, commonly called as Sprenger's or Asparagus sprengeri, a weed native to South Africa. The species is a
monocot in the family Asparagaceae, subfamily Asparagoideae (Chase et al. 2009). A. aethiopicus was
originally described by Carl Linnaeus in 1767. The attribution "Sprenger's Asparagus" refers to Carl Ludwig
Sprenger, a German Botanist who made it very popular in Europe as an ornamental plant. A. aethiopicus is often
used as an ornamental plant and it is considered as an invasive weed in many locations in South Africa. The
species A. aethiopicus has been confused with A. densiflorus, commonly found in Australia, now regarded as a
separate species.
ETHNOBOTANICAL ASPECTS
The family name Asparagaceae was proposed by Jussieu, soon after the genus Asparagus was named by
Linnaeus (Fellingham & Meyer 1995). Aethiopicus is a Latinised version of Ethiopia, the name often used by
Linnaeus to designate South Africa (Parson & Cuthbertson 2001). The species A. aethiopicus has had many
common names such as Basket asparagus, Bushy asparagus, Ground asparagus, Sprenger asparagus,
Protasparagus, Emerald feather, Fern asparagus, Asparagus fern, Basket asparagus fern, Emerald asparagus fern,
Ground asparagus fern, Ground fern, Regal fern, Sprengeri fern and Sprenger's asparagus fern. The species has
several synonyms such as Asparagopsis aethiopica (L.) Kunth., Asparagus sprengeri Regel., Asparagopsis
lancea (Thunb.) Kunth., Asparagus lanceus Thunb., Asparagus densiflorus (Kunth) Jessop., Asparagus
myriocladus Baker., Protasparagus aethiopicus (L.) Oberm., Protasparagus densiflorus (Kunth) Oberm.
Asparagus aethiopicus has little significance as a noxious weed. It was reported as a weed of coastal sand
Received: 15 December 2017 Published online: 30 April 2018
Gandipilli & Geddada (2018) 5(1): 116–120
dunes, riparian areas, open woodlands, rainforests and forest margins in sub-tropical, warmer temperate and
tropical regions. It prefers sandy soils and usually also some shade, and occasionally found in parks, old gardens
and disturbed sites. The speciesis native to Southeastern coastal regions of South Africa, Eastern Cape and the
Northern Provinces, United States, Hawaii and Florida. This species widely naturalised in the coastal districts of
eastern Australia.The species was native to a small region in southern Africa (i.e. Cape Province of South
Africa) and previously known as A. densiflorus in Australia. A. aethiopicus grown in cooler climates and as
indoor and outdoor as an ornamental garden plant. Two cultivar verities of A. aethiopicus are commonly found,
namely Sprengeri and 'Meyeri'. The 'Sprengeri' (extensively studied by C.L. Sprenger) has a scrambling form
with sparser foliage, while 'Meyeri' has more erect stems to 70 cm (28 in) and denser foliage. The ground
asparagus fern (Asparagus aethiopicus 'Sprengeri') was widely cultivated as a garden plant, particularly in
Eastern Australia. Another cultivar, known as foxtail asparagus fern (Asparagus aethiopicus 'Meyersii'), has also
been widely cultivated in Australia.
Figure 1. Asparagus aethiopicus L. with fern appearance.

Asparagus aethiopicus L. is a well branched perennial herb with tough green aerial stems, sparsely covered
with spines. The leaves of the plant were actually leaf-like cladodes with 1–2 cm long and 0.1–0.2 cm wide, and
arise in groups of four or more from the stem. Flowers small, white or pinkish white in colour and about 0.3–0.5
cm long and arise in clusters on the stem during spring season. Flowers followed the summer by bearing small
round berries 0.5 cm in diameter, which bear a black 3 mm diameter seed. The berries initially green and at
maturity they turn to red colour in the winter. Fruits attract many birds for their food and the seeds are spread by
fruit-eating birds. The root system formed a mat of fibrous roots with bulbous tubers (Fig. 1). A. aethiopicus isa
long-lived (i.e. perennial), low-growing herb with spreading (i.e. erect to sprawling) or arching stems (up to 2 m
long) that arise from a tuberous rootstock (Fig. 2). When growing up over other vegetation it can sometimes also
climb up to 2 m in height. It has tall, woody, vigorous young stems, sometimes they twined. Rhizome-compact,
bearing many long roots with side roots forming ellipsoid tubers (20 mm long), as well as a large network of
white, branched rootlets. Stems- firm, smooth, woody, ribbed when young, pale. Spines- short, 10–20 mm long,
exserted, recurved, hard. Branches- many, close together, fairly equal in length. Cladodes- 4 to 6 in a fascicle,
terete or ridged, 10–40 mm long, 1.0–1.5 mm wide, apiculate, discoid at the base, glaucous green. Racemes-
many, placed all along the branches, from basal side buds, usually exserted, simple or with some short
branchlets. Petals- with the 3 outer perianth segments minutely ciliate, forming a long pericladium, white.
Pedicels- short, subtended by bracts, both persisting after flowers have dropped off. Stamens- anthers orange in
coloured. Ovary- dark, contracted below. The flourish period of the species is between the month of October–
June and the fruiting appeared at all over the year. This species reproduces by seed (Fig. 3) and also vegetatively
Figure 2. Asparagus aethiopicus L.: A, Branch; B, Cladodes; C, Flowering; D, Fruiting; E, Tuber roots.
Figure 3. Asparagus aethiopicus L.: A, Fruits; B, Seeds.

by its creeping underground stems (i.e. rhizomes) and tubers. Its berries are readily eaten by birds and the seed
contained within are thereby spread to new areas. Its seeds and underground tubers are also commonly dispersed
in dumped garden waste. There are several species are similar to A. aethiopicus with certain morphological
characteristics: Ground asparagus fern (Asparagus aethiopicus 'Sprengeri') has some similarities with other
species of asparagus. They are climbing asparagus ferns (Asparagus africanus and Asparagus plumosus), bridal
veil (Asparagus declinatus), bridal creeper (Asparagus asparagoides), garden asparagus (Asparagus officinalis),
sickle thorn (Asparagus falcatus), Ming asparagus fern (Aspargaus retrofractus) and other asparagus ferns
(Asparagus scandens and Asparagus virgatus).
MEDICINAL PROPERTIES
In the developing countries, most of the population depends on the herbal medicines for primary healthcare
needs (De Silva 1997). Asparagus species were used for multipurpose health benefits around the world. Leaves
of asparagus were used to reduce body weight, to increase urination and to treat diabetes in South Africa
(Afolayan & Mbaebie 2010). Recently the investigation on Asparagus species was revealed that the plant might
be useful t to cure severe HIV/AIDS related diseases in Zambia (Kazhila 2016). The root extract is used to treat
diarrhea or dysentery at various parts of Pakistan also reported (Amjad et al. 2017). Out of several species of
'Asparagus' grown in India, Asparagus racemosus, Asparagus gonaclades and Asparagus adsendens are most
commonly used in indigenous medicine. Mostly its tuberous roots are used in Ayurvedic medicines. The
powdered dried root exhibits galactogogic properties; used for the preparation of nutritive tonic used in general
sexual weakness. It is reported to be useful against diarrhea, dysentery and in general debility. Shatavari roots
are used mainly as galactagogue which stimulates the secretion of breast milk. It is applied in improving the lost
body weight and also known as an aphrodisiac. The root is useful in treating the ailments like dysentery,
tuberculosis and diabetes. Commonly, it supports to maintain the health by giving immunity to diseases. It is
considered as very good energy provider to the weak body system (Thakur & Sharma 2015). Extensively the
boiled tuberous roots of asparagus were used to animals and women to increase lactation (Shukla et al. 2010).
IDENTIFICATION KEY (Adopted from Gamble & Fischer 1928).

1. Cladodes flattened, 2–3 mm wide and mostly 15 mm long; berry red …………………....... 1.* A. aethiopicus
1*Cladodes ± terete, 0.5 mm diam; <10 mm long; berry black or orange
2. Final branches and cladodes in 1 plane; flowers and fruit terminal on lateral branchlets; Fruit black
................................................................................................................................. ......................... 2 *A. plumosus
2*Branches and Cladodes not in 1 plane; Flowers and Fruit axillary; fruit orange
3. Cladodes 3–7 at each node ± erect and straight; Stem not pinoe...................... 3* A. virgatus
3*Cladodes 7–12 at each node, spreading and often ± curved, older stems spinose ........................ 4*A. africanus
RED LIST CATEGORY & CRITERIA: LEAST CONCERN

Asparagus aethiopicus L. currently rated as Least Concern of IUCN Red List species due to its large
naturalized range and its status as a noxious weed in many parts of its range. There are no known current threats
to this species in its native range (Monnier & Staden 2013).
DISCUSSION
Asparagus aethiopicus L. was a prostrate perennial monocot commonly grown in the fields and especially
wild localities of the study area. The species was categorized as Least Concern in IUCN Red List due to its large
naturalized range and it was considered as a noxious weed in many parts of the world. The species was entered
into India from Denmark and infested in several areas by seeds. However, the species were identified as
medicinal plant from the ancient period of the world as well as in ancient Indian civilization. The plant has
many medicinal properties and it’sknowledge should be enlightened to identify various drugs from the different
parts of the plant.
ACKNOWLEDGMENTS
The authors were very grateful to local farmers, Agricultural Officers and Taxonomists of Andhra University
for their contribution.
REFERENCES
Afolayan AJ &Mbaebie BO (2010) Ethnobotanical study of medicinal plants used as anti-obesity remedies in
Nkonkobe Municipality of South Africa. Phcog. Net.
Amjad MS, Arshad M, Saboor A, Page S & Chaudhari SK (2017) Ethnobotanical profiling of the medicinal
flora of Kotli, Azad Jammu and Kashmir, Pakistan: Empirical reflections on multinomial logit
specifications. Asian Pacific Journal of Tropical Medicine 10(5): 503–514.
Benz BF, Cevallos J, Santana F, Rosales J & Graff M (2000) Losing Knowledge about plant use in the Sierra de
Manantian Biosphere Reserve, Mexico. Economic Botany 54: 183–191.
Chase MW, Reveal JL & Fay MF (2009) Asubfamilial classification for the expanded asparagalean families
Amaryllidaceae, Asparagaceae and Xanthorrhoeaceae. Botanical Journal of the Linnean Society 161: 132–
136.
De Silva T (1997) Industrial utilization of medicinal plants in developing countries. In: Bodekar G, Bhat, KKS,
Burlay J & Vantomme P (eds) Medicinal plants for forest conservation and healthcare. Nonwood Forest
Products, No 11, FAO, Rome, Italy, pp. 38–48.
FAOSTAT (2015) Statistical Database of the Food and Agriculture Organization of the United Nations. FAO,
Rome.
Fellingham AC & Meyer NL (1995) New combinations and a complete list of Asparagus species in southern
Africa (Asparagaceae). Bothalia 25(2): 205–209.
Gamble JS & Fischer CEC (1928) Flora of the presidency of Madras. (Part VIII- Ulmaceae to Xyridaceae).
Adlard & Son, Ltd, 21 Hart street, W.C. London.
Kazhila CC (2016) Ethnobotanical Study of Plants Used in the Management of HIV/AIDS-Related Diseases in
Livingstone, Southern Province, Zambia. Evidence-Based Complementary and Alternative Medicine.
Hindawi Publishing Corporation.
Monnier RF & von Staden L (2013) Asparagus aethiopicus. The IUCN Red List of Threatened Species 2013,
IUCN.
Parson WT & Cuthbertson EG (2001) Noxious weeds of Australia. CSIRO Publishing, pp. 692.
Shackleton SE, Shackleton CM, Netshiluvhi TR, Geach BS, Balance A & Fairbanks SHK (2002) Use patterns
and value of savanna resources in three rural villages in South Africa. Economic Botany 56: 130–146.
Shukla AN, Srivastava S & Rawat AKS (2010) An ethnobotanical study of medicinal plants of Rewa district,
Madhya Pradesh. Indian Journal of Traditional Knowledge 9(1): 191–202.
Thakur S & Sharma DR (2015) Review on medicinal plant: Asparagus adscendens Roxb. International Journal
of Pharmaceutical Science and Health Care 5(3): 82–97.
Welbaum GE (2015) Vegetable Production and Practices. CABI, pp. 486.

Volume 5, Issue 1 (2018) Tropical Plant Research

Загружено:

Сведения о документе

Авторское право

Доступные форматы

Поделиться этим документом

Поделиться или встроить документ

Параметры публикации

Этот документ был вам полезен?

Это неприемлемый материал?

Авторское право:

Доступные форматы

Volume 5, Issue 1 (2018) Tropical Plant Research

Загружено:

Авторское право:

Доступные форматы

ISSN (E): 2349 – 1183

ISSN (P): 2349 – 9265

Methylation status of ACCase promoter affects

MATERIALS AND METHODS

RESULTS AND DISCUSSION

I. Plant Physiology 130(1): 234–243.

Simple and efficient method for functional RNA extraction from

MATERIALS AND METHODS

Quality analysis of RNA

Quantitative real-time RT-PCR

Comparison of RNA extraction methods

Revisiting climate change adaptation through proactive policy

Principle oriented institutional mechanisms for climate-smart agriculture in India

Win-win action plan for climate change adaptation

Harness agricultural biotechnology and water management

Reconstruction of Policy principles/ Institutional mechanism

Promoting Global Improved Sufficient Easy access Improved

Acceptable Consumer friendly Proper management

Win-Win Strategies Institutional frameworks

Encourage partnership between public Institutions to improve co-ordination

Institutions for logical framework designing

Comparative epidermal anatomical studies in six taxa of genus

Abstract: Anatomical studies in six taxa of genus Nephrolepis; N. biserrata, N. cordifolia, N.

MATERIALS AND METHODS

E = number of epidermal cells per unit area.

RESULTS AND OBSERVATION

Leaflet anatomical study of Nephrolepis biserrata (Fig. 2A & B)

Leaflet anatomical study of Nephrolepis exaltata (ii) (Fig. 2G & H)

A note on the clonal propagation of depleted threatened species

MATERIAL AND METHODS

RESULT AND DISCUSSION

Phytosociological studies of the sacred grove of Kanyakumari

MATERIALS AND METHODS

Figure 1. Map of the study area.

Vegetation of the grove

where, S = Total number of species, N = Total number of individuals and ln = log2.

Species Accumulation Curve

RESULTS AND DISCUSSION

Figure 2. Spatial distribution of tree species richness in the study area.

Climbers (including Lianas)

Figure 3. Dominance - distribution pattern of families in the study area.

Figure 4. Distribution of species in different diameter classes in the study area.

Figure 5. Distribution pattern of plant species in the study area.

Density and basal cover

Figure 6. Distribution of density in different diameter classes in the study area.

Figure 7. Species stem relationship in a hectare area of the sacred grove.

Figure 8. Dominance - diversity curves of trees in the study area.

Response of potato plants to foliar application of cement dust

MATERIALS AND METHODS

Foliar application of cement dust

Socio-economic impacts of charcoal production in

RESULTS AND DISCUSSION

from: http://esa.un.org/un-energy/pdf/UN-ENRG%20paper.pdf. (accessed: 14 Jul. 2006)

The Gingers of the north coastal Andhra Pradesh, India

MATERIAL & METHODS

RESULTS AND DISCUSSION

Common name: Wild ginger.

Indian Botanical Society, Meerut.

Structural analysis of Combretum-Terminaliamixed Acacia

MATERIALS AND METHODS

Basal area (BA) will be calculated using DBH as: ⁄

Where S: the number of species

Where Ss: Sorensen’s similarity coefficient

Importance Value Index (IVI)