Letters in Applied Microbiology ISSN 0266-8254

ORIGINAL ARTICLE

Evaluation of the PCR method for identification

of Bifidobacterium species
S.Y. Youn1, J.M. Seo1 and G.E. Ji1,2
1 Department of Food and Nutrition, Research Institute of Human Ecology, Seoul National University, Seoul, Korea
2 Research Center, Bifido Inc., Kang-won, Korea

Keywords
Bifidobacterium, enterobacterial repetitive
intergenic consensus, intergenic spacer
region, PCR, ribosomal DNA.
Correspondence
Geun-Eog Ji, Department of Food and
Nutrition, College of Human Ecology, Seoul
National University, San 56-1, Shillim-Dong,
Kwanak-Ku, Seoul 151-742, Korea.
E-mail: geji@snu.ac.kr
2007 ⁄ 0617: received 18 April 2007, revised
3 August 2007 and accepted 8 August 2007
doi:10.1111/j.1472-765X.2007.02263.x
Abstract
Aims: Bifidobacterium species are known for their beneficial effects on health
and their wide use as probiotics. Although various polymerase chain reaction
(PCR) methods for the identification of Bifidobacterium species have been pub-
lished, the reliability of these methods remains open to question.
Methods and Results: In this study, we evaluated 37 previously reported PCR
primer sets designed to amplify 16S rDNA, 23S rDNA, intergenic spacer
regions, or repetitive DNA sequences of various Bifidobacterium species.
Conclusions: Ten of 37 experimental primer sets showed specificity for
B. adolescentis, B. angulatum, B. pseudocatenulatum, B. breve, B. bifidum, B. lon-
gum, B. longum biovar infantis and B. dentium.
Significance and Impact of the Study: The results suggest that published Bifido-
bacterium primer sets should be re-evaluated for both reproducibility and spec-
ificity for the identification of Bifidobacterium species using PCR. Improvement
of existing PCR methods will be needed to facilitate identification of other Bifi-
dobacterium strains, such as B. animalis, B. catenulatum, B. thermophilum and
B. subtile.

consuming, labour-intensive and inaccurate, and showed

Introduction
A variety of Bifidobacterium species reside in the human
gastrointestinal tract. However, various factors such as
antibiotic therapy, stress and an unbalanced diet destroy
the delicate balance among gastrointestinal microflora.
Notably, the number of Bifidobacterium in the intestine
decreases with age (Bezkorovainy 1989; Fuller 1989). As
the value of Bifidobacterium for the improvement of the
gastrointestinal environment is well established, various
kinds of food and pharmaceutical products containing
these bacteria have been developed (Saavedra et al. 1994,
1998; Langhendries et al. 1995). However, despite the
importance of Bifidobacterium for human health, methods
to accurately and rapidly identify these micro-organisms
remain largely insufficient, and thus warrant significant
improvement. Traditionally, Bifidobacterium identification
methods relied on the phenotypic characteristics of
biochemical, microscopic, morphological and selective
culture plating tests. However, those methods were time-
low reproducibility because of the long incubation peri-
ods, lengthy culturing procedures and specific culturing
conditions required (Tannock 1999; Wang et al. 2002;
Cook et al. 2003). More recently, for the efficient identifi-
cation of Bifidobacterium, molecular techniques such as
polymerase chain reaction (PCR), denaturing gradient gel
electrophoresis, temperature gradient gel electrophoresis
and fluorescence in situ hybridization analysis were intro-
duced. Among these techniques, PCR methods have been
used most often. However, the specificity and reproduc-
ibility of these PCR techniques have not been thoroughly
investigated. Several attempts have been made to identify
many strains of Bifidobacterium by PCR amplification of
a region of 16S rDNA (Kaufmann et al. 1997; Matsuki
et al. 1999; Ventura et al. 2001). However, because of the
high similarities of the bifidobacterial 16S rRNA gene
sequences, it is not feasible to develop highly specific pri-
mer and probe sets for the different species based on
these genes. The intergenic spacer of the 16S–23S rRNA

ª 2007 The Authors

Journal compilation ª 2007 The Society for Applied Microbiology, Letters in Applied Microbiology 46 (2008) 7–13 7
Evaluation of Bifidobacterium by PCR S.-Y. Youn et al.

gene may be included for a more detailed analysis of Bifi-
dobacterium species because these sequences are less con-
served than the 16S rRNA gene sequence (Ventura and
Zink 2002; Haarman and Knol 2005).
As for multiplex PCR methods, Masco et al. (2003)
evaluated repetitive DNA element PCR fingerprinting
technique for the identification or typing of Bifidobacteri-
um. Ventura et al. (2003) investigated 26 Bifidobacterium
species and analysed amplicons showing different entero-
bacterial repetitive intergenic consensus (ERIC) patterns
for each Bifidobacterium species. However, it was difficult
to discriminate between closely related species having
similar ERIC-PCR patterns. The aim of this study was to
confirm and evaluate the efficacies of various published
PCR methods for identification of Bifidobacterium using
commercial Taq polymerases and readymade PCR buffers.
USA). All Bifidobacterium strains were incubated at 37C
for 18 h under anaerobic condition. Weissella confusa was
incubated at 30C for 18 h, and Leuconostoc mesenteroides
subsp. mesenteroides and Lactococcus lactis subsp. cremoris
were incubated at 26C for 18 h.
Preparation of template DNA from reference strains
One millilitre of bacterial culture in MRS broth (supple-
mented with 0Æ05% cysteine HCl) was centrifuged for
1 min. The pellet was washed twice with deionized dis-
tilled water to remove PCR inhibitors. Then the pellet
was suspended in 5 ll deionized distilled water and then
transferred to a 1Æ5 ml sterilized microfuge tube, and the
DNA was extracted using a chromosomal DNA extraction
kit (Bioventures, Murfreesboro, TN, USA).

Materials and methods PCR assay

Primer sequences, expected amplicon sizes and DNA tar-
Bacterial strains and growth conditions
get sites for previously published species-specific PCR
Various Bifidobacterium strains and other lactic acid bac- primers are listed in Table 2.
teria used in this study are listed in Table 1. They were PCR mix was composed of 33Æ9 ll deionized distilled
grown in MRS broth (Difco, Detroit, MI, USA), supple- water, 5 ll 10· Unipol buffer (Gene Choice, Maryland,
mented with 0Æ05% cysteine HCl (Sigma, St Louis, MO, USA), 5 ll dNTP mixture (2Æ5 mmol l)1; Takara, Shiga,
Japan), 0Æ3 ll each primer (100 mmol l)1), 0Æ5 U Unipol
(Gene Choice), 1 ll DMSO and 4 ll template DNA. PCR
Table 1 Bifidobacterium spp. and other lactic acid bacteria
amplification was performed with a GENE AMP9700
Species Strain thermocycler (Applied Biosystems, Foster City, CA, USA).
PCR conditions of confirmed species-specific primer sets
Lactobacillus sakei subsp. sakei ATCC 31063
are listed in Table 3. Aliquots of each amplification reac-
L. brevis ATCC 14869T
L. salivarius subsp. salicinius ATCC 11742T
tion (5 ll each) from PCR were separated on 1% agarose
L. acidophilus ATCC 04356T gel at 100 V by electrophoresis and visualized by ethidium
L. casei ATCC 00393T bromide staining for 30 min. Aliquots of each amplifica-
L. rhamnosus GG tion reaction (10 ll each) from ERIC-PCR were separated
Bifidobacterium adolescentis ATCC 15703T on 1Æ2% agarose gel at 100 V by electrophoresis. PCR
B. angulatum ATCC 27535T assays for each species-specific primer set were performed
B. animalis ATCC 25527T
at least three times.
B. bifidum ATCC 15521T
B. breve ATCC 15700T
B. catenulatum ATCC 27539T Results
B. dentium ATCC 27534T
B. longum biovar infantis ATCC 15697T When PCR assays were performed according to conditions
B. longum ATCC 15707T in Table 3, 10 primer sets corresponding to eight
B. pseudocatenulatum ATCC 27919T different species (BiADO-1 ⁄ BiADO-2 for B. adolescentis,
B. subtile ATCC 27537T
IDH63R ⁄ IDHC2F for B. angulatum, Im3r ⁄ G020f for
B. thermophilum ATCC 25525T
Streptococcus thermophilus ATCC 19258T
B. pseudocatenulatum, IDB31F ⁄ IDBC1R for B. breve,
Lactococcus lactis subsp. cremoris ATCC 19257T IDH85R ⁄ IDHC2F for B. bifidum, IDB51F ⁄ IDBC1R and
Leuconostoc mesenteroides subsp. mesenteroides ATCC 27258T BiLON-1 ⁄ BiLON-2 for B. longum, BiINF-1 ⁄ BiINF-2 and
Lactococcus lactis subsp. lactis ATCC 11454 ERIC-1 ⁄ ERIC-2 for B. longum biovar infantis and BiDEN-1 ⁄
Pediococcus acidilactici ATCC 33314 BiDEN-2 for B. dentium) showed amplicons of the
Enterococcus faecium ATCC 27270 expected size (Figs 1 and 2). These 10 species-specific pri-
Weissella confuse ATCC 10881T
mer sets did not react with other Bifidobacterium spp.,
Enterococcus faecalis ATCC 19433T
Lactobacillus spp. or other bacterial genus (data not

ª 2007 The Authors

8 Journal compilation ª 2007 The Society for Applied Microbiology, Letters in Applied Microbiology 46 (2008) 7–13
S.-Y. Youn et al. Evaluation of Bifidobacterium by PCR

Table 2 Sequences of species-specific primers tested

Bifidobacterium Amplicon
species Primer Sequence Target site Location size (bp) Reference

B. bifidum IDH85R AAGACACCCCCGAAAGGCGT 1805–1786 16S-23S rDNA 527 Kwon et al. (2005)
IDHC2F TCAAGGCGGAGTCGCTAGTAA 1279–1299
G003f AAGGGCTCGTAGGCGGC 545–561 16S rDNA 843 Germond et al. (2002)
Im3r CGGGGTGCTGCCCACTTTCATG 1366–1387
IDB21F TGAGGTAACGGCTCACCAAGGCT 239–261 16S rDNA 1018 Kwon et al. (2005)
IDBC1R ATCCGAACTGAGACCGGTT 1256–1238
BiBIF-1 CCACATGATCGCATGTGATTG 184–203 16S rDNA 278 Matsuki et al. (1999)
BiBIF-2 CCGAAGGCTTGCTCCCAAA 478–442
IFTBIF-1 TTGCTTGGTGGTGAGAGTGGC 55–75 16S rDNA 479 Chen et al. unpub. data
IFTBIF-2 TAACCCGCATTTCCCGAG 516–533
B. angulatum IDH63R TGTCCGAAAACACGGACTGCAA 1528–1507 16S–23S rDNA 249 Kwon et al. (2006)
IDHC2F TCAAGGCGGAGTCGCTAGTAA 1279–1299
G009f CGTGTTGCCAGCACATG 1094–1110 16S rDNA 294 Germond et al. (2002)
lm3r CGGGGTGCTGCCCACTTTCATG 1366–1387
BiANG-1 CAGTCCATCGCATGGTGGT 185–203 16S rDNA 275 Matsuki et al. (1999)
BiANG-2 GAAGGCTTGCTCCCCAAC 476–441
IFTANG-1 GCTGGAGCTTGCTCCGGCCG 64–83 16S rDNA 442 Chen et al. unpub. data
IFTANG-2 CGGTCGTCGGCGCCATTA 488–505
B. animalis Ban F2 AACCTGCCCTGTG 128–141 16S rDNA 925 Krizova et al. (2006)
Pbi R1 GCACCACCTGTGAACCG 1053–1037
IFTANI-1 GCGTGCTTAACACATGCAAG 33–52 16S rDNA 550 Chen et al. unpub. data
IFTANI-2 CATCCGCCAAGCAGCGCAGG 563–582
B. longum IDB51F CGGTCGTAGAGATACGGCTT 956–975 16S rDNA 301 Kwon et al. (2005)
IDBC1R ATCCGAACTGAGACCGGTT 1256–1238
BiLON-1 TTCCAGTTGATCGCATGGTC 182–201 16S rDNA 831 Matsuki et al. (1999)
BiLON-2 GGGAAGCCGTATCTCTACGA 1028–1008
G027f GACATGTTCCCGACGGT 967–983 16S rDNA 421 Germond et al. (2002)
lm3r CGGGGTGCTGCCCACTTTCATG 1366–1387
IFTLON-1 GGCGGAGCATGCGGATTAATT 103–123 16S rDNA 224 Chen et al. unpub. data
IFTLON-2 GAGTGCCCTCTGGCGGCCC 308–326
B. breve IDB31F TAGGGAGCAAGGCACTTTGTGT 430–451 16S rDNA 827 Kwon et al. (2005)
IDBC1R ATCCGAACTGAGACCGGTT 1256–1238
FWD GGGAGCAAGGCACTTTGTGT 432–451 16S rDNA 568 Mullie et al. (2003)
REV GAAACCCCATCTCTGGGATC 1000–981
B787f GATGCGACAGTGCGAGC 1229–1245 16S rDNA 159 Germond et al. (2002)
lm3r CGGGGTGCTGCCCACTTTCATG 1366–1387
BiBRE-1 CCGGATGCTCCATCACAC 175–192 16S rDNA 288 Matsuki et al. (1999)
BiBRE-2 ACAAAGTGCCTTGCTCCCT 477–444
IFTBRE-1 CTCCATCACACCGCATGGTG 183–202 16S rDNA 852 Chen et al. unpub. data
IFTBRE-2 GCTGCTAGGGTCTCTACC 991–1008
B. pseudocatenulatum G020f GACAGCCGTAGAGATAT 978–994 16S rDNA 410 Germond et al. (2002)
Im3r CGGGGTGCTGCCCACTTTCATG 1366–1387
B. longum biovar infantis BiINF-1 TTCCAGTTGATCGCATGGTC 182–201 16S rDNA 828 Matsuki et al. (1999)
BiINF-2 GGAAACCCCATCTCTGGGAT 1027–1007
B791f TATCGGGGAGCAAGCGT 427–443 16S rDNA 961 Germond et al. (2002)
Im3r CGGGGTGCTGCCCACTTTCATG 1366–1387
IFTINF-1 GGCGGCGTGCTTAACACATG 27–46 16S rDNA 377 Chen et al. unpub. data
IFTINF-2 GCGGCGCACTCCCTACCTCCGG 385–406
B. dentium BiDEN-1 ATCCCGGGGGTTCGCCT 72–89 16S rDNA 387 Matsuki et al. (1999)
BiDEN-2 GAAGGGCTTGCTCCCGA 473–443
IDH11F ATCCCGGGGGTTCGCCT 36–52 16S rDNA 1221 Kwon et al. (2006)
IDHCBR ATCCGAACTGAGACCGGTT 1256–1238
B790f CATCGCTTAACGGTGGG 585–601 16S rDNA 803 Germond et al. (2002)
Im3r CGGGGTGCTGCCCACTTTCATG 1366–1387

ª 2007 The Authors

Journal compilation ª 2007 The Society for Applied Microbiology, Letters in Applied Microbiology 46 (2008) 7–13 9
Evaluation of Bifidobacterium by PCR S.-Y. Youn et al.

Table 2 (Continued)

Bifidobacterium Amplicon
species Primer Sequence Target site Location size (bp) Reference

B. adolescentis BiADO-1 CTCCAGTTGGATGCATGTC 182–200 16S rDNA 279 Matsuki et al. (1999)
BiADO-2 CGAAGGCTTGCTCCCAGT 474–442
IDH41F GACCATTCCACGGTCTCCGT 784–803 16S rDNA 473 Kwon et al. (2005)
IDHCBR ATCCGAACTGAGACCGGTT 1256–1238
G028f GGGACCATTCCACGGTC 807–823 16S rDNA 581 Germond et al. (2002)
Im3r CGGGGTGCTGCCCACTTTCATG 1366–1387
IDB11F ATCGGCTGGAGCTTGCT 60–76 16S rDNA 1197 Kwon et al. (2005)
IDBC1R ATCCGAACTGAGACCGGTT 1256–1238
B. catenulatum IDH74R CAGGCCCCGAAAAGAACC 1620–1603 16S-23S rDNA 342 Kwon et al. (2005)
IDHC2F TCAAGGCGGAGTCGCTAGTAA 1279–1299
G055f AAGTCGAACGGGATCAG 49–65 16S rDNA 1339 Germond et al. (2002)
Im3r CGGGGTGCTGCCCACTTTCATG 1366–1387
IFTCAT-1 GAAGAACCTTACCTGGGCTT 135–154 16S rDNA 382 Chen et al. unpub. data
IFTCAT-2 CCGCCTCAGCGATCATTAGCGC 495–516
B. thermophilum IFTTH-1 ACGACGGCAGAGATGTCG 982–999 16S rDNA 453 Chen et al. unpub. data
IFTTH-2 TTCGGCCACCGGACT 1420–1434
B. subtile IFTSU-1 CTTAACACATGCAAGTC 38–54 16S rDNA 225 Chen et al. unpub. data
IFTSU-2 CACCCCACTACCGGGTGGTT 243–262
All Bifidobacterium ERIC-1 ATGTAAGCTCCTGGGGATTCAC Rep* Ventura et al. (2003)
ERIC-2 AAGTAAGTGACTGGGGTGAGCG

*Repetitive element sequence.

Table 3 PCR conditions for Bifidobacterium spp.

35 cycles 1 cycle
1 cycle Initial Final
Species Primer heating Denaturation Annealing Extension extension

B. angulatum IDH63R ⁄ IDHC2F 94C 94C 67C 72C 72C

5 min 30 s 40 s 30 s 5 min
B. breve IDB31F ⁄ ICBC1R 94C 94C 64C 72C 72C
B. pseudocatenulatum Im3r ⁄ G020f 5 min 30 s 40 s 30 s 5 min
B. bifidum IDH85R ⁄ IDHC2F 94C 94C 69C 72C 72C
5 min 30 s 40 s 30 s 5 min
B. longum biovar infantis BiINF-1 ⁄ BiINF-2 94C 94C 60C 72C 72C
B. dentium BiDEN-1 ⁄ BiDEN-2 5 min 20 s 20 s 30 s 5 min
B. longum BiLON-1 ⁄ BiLON-2
B. adolescentis BiADO-1 ⁄ BiADO-2
B. longum IDB51F ⁄ IDBC1R 94C 94C 66C 72C 72C
5 min 30 s 40 s 30 s 5 min
B. infantis ERIC-1 ⁄ ERIC-2 95C 95C 51C 65C 65C
7 min 30 s 1 min 8 min 16 min

shown). Within these 10 primer sets, nine sets targeted
16s rDNA, 23S rDNA, or rDNA intergenic spacer region
(ISR) sequences from various Bifidobacterium species and
produced a single amplicon of the expected size (Fig. 1),
whereas B. longum biovar infantis-specific primers targeted
a repetitive DNA sequence and produced amplicons of
eight difference sizes (Fig. 2). Among them, two primer
sets (BiLON-1 ⁄ Bilon-2, IDB51F ⁄ IDBC1R) based on 16S
rDNA sequences showed specificity for B. longum; and
two other primer sets (BiINF-1 ⁄ BiINF-2) based on 16S
rDNA sequences and one (ERIC-1 ⁄ ERIC-2) based on a
repetitive DNA sequence showed specificity for B. longum
biovar infantis.
PCR assays using the other 26 PCR primer sets showed
cross-reactivity to various nontargeted species when the
originally published PCR conditions were used (data not
shown). Additionally, nonspecific PCR products were
produced even when annealing temperatures were gradu-
ally increased to just below the maximum temperature at
which no amplicons were produced.

ª 2007 The Authors

10 Journal compilation ª 2007 The Society for Applied Microbiology, Letters in Applied Microbiology 46 (2008) 7–13
S.-Y. Youn et al. Evaluation of Bifidobacterium by PCR

M 1 M 2 3 4 5 6 7 8 9

1500 1500

1000 1000
500 500

250 250

Figure 1 Agarose gel electrophoresis of PCR products. (a) Lane M, DNA size marker with 1 kb ladder (Promega, Madison, WI, USA); lane 1, PCR
products from Bifidobacterium bifidum (IDH85R ⁄ IDHC2F, 527 bp); Lane 2, B. angulatum (IDH63R ⁄ IDHC2F, 249 bp); lane 3, B. longum (IDB51-
F ⁄ IDBC1R, 301 bp); lane 4, B. breve (IDB31F ⁄ IDBC1R, 827 bp); lane 5, B. pseudocatenulatum (Im3r ⁄ G020f, 410 bp); lane 6, B. longum (BiLON-
1 ⁄ BiLON-2, 831 bp); lane 7, B. adolescentis (BiADO-1 ⁄ BiADO-2, 279 bp); lane 8, B. dentium (BiDEN-1 ⁄ BiDEN-2, 387 bp); lane 9, B. longum biovar
infantis (BiINF-1 ⁄ BiINF-2, 828 bp). (b) Lane M, DNA size markers with 1 kb ladder (Promega); lane 1, ERIC-PCR patterns of Bifidobacterium
longum biovar infantis (ERIC-1 ⁄ ERIC-2, about 3000 bp, 1600 bp, 1000 bp, 800 bp, 600 bp, 400 bp, 350 bp, 200 bp).

M 1 2 3 4 5 6 7 8 9 10 11 12

4000
2000
1500
1000
750
500
250

Figure 2 Agarose gel electrophoresis of PCR products. Lane M, DNA size markers with 1 kb ladder (Promega); lane 1, ERIC-PCR (ERIC-1 ⁄ ERIC-2)
patterns of Bifidobacterium adolescentis; lane 2, B. angulatum; lane 3, B. animalis; lane 4, B. bifidum; lane 5, B. breve; lane 6, B. catenulatum;
lane 7, B. dentium; lane 8, B. pseudocatenulatum; lane 9, B. longum biovar infantis (about 3000 bp, 1600 bp, 1000 bp, 800 bp, 600 bp, 400 bp,
350 bp, 200 bp); lane 10, B. longum; lane 11, B. thermophilum; lane 12, B. subtile.

ERIC-PCR assays for Bifidobacterium species other than
B. longum biovar infantis produced amplicon banding
patterns different from those previously reported (Ven-
tura et al. 2003) (Fig. 2).
Discussion
In this study, we evaluated existing PCR protocols and
PCR primers designed to amplify 16S rDNA, 23S rDNA,
ISR and repetitive DNA sequences of these organisms.
We evaluated 37 primer sets that targeted specific genes
in Bifidobacterium species: six each for B. bifidum and
B. breve; five each for B. adolescentis, B. angulatum and
B. longum; four each for B. catenulatum, B. dentium,
and B. longum biovar infantis; three for B. animalis; and
two for B. pseudocatenulatum, B. thermophilum, and
B. subtile.
The primer set for B. animalis (BanF2 ⁄ PbiR1), whose
sequences were complementary to a partial 16S rRNA
sequence from B. gallicum (Krizova et al. 2006), cross-
reacted with several other Bifidobacterium species. Other
primer sets of B. animalis also elicited cross-reactions.

ª 2007 The Authors

Journal compilation ª 2007 The Society for Applied Microbiology, Letters in Applied Microbiology 46 (2008) 7–13 11
Evaluation of Bifidobacterium by PCR
The 16S rDNA sequence of B. lactis-type strain was clo-
sely related (98Æ6% similarity) to B. animalis-type strain
(Ventura et al. 2001). Hence in this study, we were
unable to find a primer set specific for B. animalis.
The PCR protocol conditions for most of the PCR
primers employed in this study, especially the annealing
temperature, were modified as shown in Table 3. Anneal-
ing temperatures higher than those previously reported
were used to eliminate species cross-reactivity which we
observed when using the original methods (Matsuki et al.
1998, 1999; Germond et al. 2002; Mullie et al. 2003;
Ventura et al. 2003; Wei et al. 2004; Kwon et al. 2005;
Krizova et al. 2006).
The specificity, yield and fidelity of PCR may be influ-
enced by the buffers, the concentrations of dNTPs or prim-
ers, the sources of polymerases, and the other additional
components. Often, the conditions that would permit
maximum yield are not compatible with high fidelity or
specificity, and conditions optimized in regard to fidelity
may adversely affect the efficiency (Cha and Thilly 1993).
By using ERIC-PCR technique, we could demonstrate
species-specificity for only B. longum biovar infantis
among the 12 Bifidobacterium spp. examined. Moreover,
it was difficult to discriminate between different Bifido-
bacterium species, because the reaction produced many
amplicons and the resulting band patterns were common
to more than one Bifidobacterium species. ERIC-PCR
assays using LA Taq polymerase (Takara) and its buffer
system showed less amplicons than that of Unipol (Gene
Choice) (data not shown). In addition, ERIC-PCR assays
using Unipol (Gene Choice) produced amplicon banding
patterns different from the results of Ventura et al.
(2003). Finally, because each Bifidobacterium species dis-
played many amplicons, the use of this technique in mul-
tiplex-PCR is extremely limited.
Despite the claim made in original publications that
the primer sets were species-specific, we found that many
of the primers cross-reacted with more than one Bifido-
bacterium species.
Taken together, our review of the specificity and repro-
ducibility of published PCR conditions for identification
of various Bifidobacterium strains revealed that only 10 of
37 primer sets tested showed the expected specificity. The
remaining primers showed a considerable lack of specific-
ity, even under our modified, more stringent PCR condi-
tions. We suggest, therefore, that further development of
these PCR assays is necessary to optimize their use in
identification of various Bifidobacterium strains.
Acknowledgements
This work was supported by the Korean Ministry of Sci-
ence and Technology (grant no. M1-0302-00-0098).
12 Journal compilation ª 2007 The Society for Applied Microbiology, Letters in Applied Microbiology 46 (2008) 7–13
S.-Y. Youn et al.
References
Bezkorovainy, A. (1989) Ecology of bifidobacteria. In Biochem-
istry and Physiology of Bifidobacteria ed. Bezkorovainy, A.
and Miller-Catchpole, R. pp. 29–72 Florida: CRC Press.
Cha, R.S. and Thilly, W.G. (1993) Specificity, efficiency, and
fidelity of PCR. PCR Methods Appl 3, 18–29.
Cook, V.J., Turenne, C.Y., Wolfe, J., Pauls, R. and Kabani, A.
(2003) Conventional methods versus 16S ribosomal DNA
sequencing for identification of nontuberculous myco-
bacteria: cost analysis. J Clin Microbiol 41, 1010–1015.
Fuller, R. (1989) Probiotics in man and animals. J Appl Bacte-
riol 66, 365–378.
Germond, J.E., Mamin, O. and Mollet, B. (2002) Species spe-
cific identification of nine human Bifidobacterium spp. in
feces. Syst Appl Microbiol 25, 536–543.
Haarman, M. and Knol, J. (2005) Quantitative real-rime PCR
assays to identify and quantify fecal Bifidobacterium species
in infants receiving a prebiotic infant formula. Appl Envi-
ron Microbiol 71, 2318–2324.
Kaufmann, P., Pfefferkorn, A., Teuber, M. and Meile, L.
(1997) Identification and quantification of Bifidobacterium
species isolated from food with genus-specific 16S rRNA-
targeted probes by colony hybridization and PCR. Appl
Environ Microbiol 63, 1268–1273.
Krizova, J., Spanova, A. and Rittich, B. (2006) Evaluation of
amplified ribosomal DNA restriction analysis (ARDRA)
and species-specific PCR for identification of Bifidobacteri-
um species. Syst Appl Microbiol 29, 36–44.
Kwon, H.S., Yang, E.H., Lee, S.H., Yeon, S.W., Kang, B.H. and
Kim, T.Y. (2005) Rapid identification of potentially probi-
otic Bifidobacterium species by multiplex PCR using spe-
cies-specific primers based on the region extending from
16S rRNA through 23S rRNA. FEMS Microbiol Lett 250,
55–62.
Langhendries, J.P., Detry, J., Van Hees, J., Lamboray, J.M.,
Darimont, J., Mozin, M.J., Secretin, M.C. and Senterre, J.
(1995) Effect of a fermented infant formula containing via-
ble bifidobacteria on the fecal flora composition and pH
of healthy full-term infants. J Pediatr Gastroenterol Nutr
21, 177–181.
Masco, L., Huys, G., Gevers, D., Verbrugghen, L. and Swings,
J. (2003) Identification of Bifidobacterium species using
rep-PCR fingerprinting. Syst Appl Microbiol 26, 557–563.
Matsuki, T., Watanabe, K., Tanaka, R. and Oyaizu, H. (1998)
Rapid identification of human intestinal bifidobacteria by
16S rRNA-targeted species- and group-specific primers.
FEMS Microbiol Lett 167, 113–121.
Matsuki, T., Watanabe, K., Tanaka, R., Fukuda, M. and
Oyaizu, H. (1999) Distribution of bifidobacterial species in
human intestinal microflora examined with 16S rRNA-
gene-targeted species-specific primers. Appl Environ Micro-
biol 65, 4506–4512.
Mullie, C., Odou, M.F., Singer, E., Romond, M.D. and Izard,
D. (2003) Multiplex PCR using 16S rRNA gene-targeted
ª 2007 The Authors
S.-Y. Youn et al.
primers for the identification of bifidobacteria from
human origin. FEMS Microbiol Lett 222, 129–136.
Saavedra, J.M., Baumann, N.A. and Oung, I. (1994) Feeding of
Bifidobacterium lactis and Streptococcus thermophilus to
infant in hospital for prevention of diarrhea and shedding
of rotavirus. Lancet 334, 1046–1049.
Saavedra, J.M., Abi-Hanna, A., Moore, N. and Yolken, R.
(1998) Effect of long term consumption of infant formulas
with bifidobacteria and S. thermophilus on stool pattern
and diaper rash in infants. J Pediatr Gastroenterol Nutr 27,
483–486.
Tannock, G.W. (1999) Identification of lactobacilli and bifido-
bacteria. Curr Issues Mol Biol 1, 53–64.
Ventura, M. and Zink, R. (2002) Rapid identification, differen-
tiation, and proposed new taxonomic classification of Bifi-
dobacterium lactis. Appl Environ Microbiol 68, 6429–6434.
Ventura, M., Reniero, R. and Zink, R. (2001) Specific identifi-
cation and targeted characterization of Bifidobacterium lac-
ª 2007 The Authors
Journal compilation ª 2007 The Society for Applied Microbiology, Letters in Applied Microbiology 46 (2008) 7–13
Evaluation of Bifidobacterium by PCR
tis from different environmental isolates by a combined
multiplex-PCR approach. Appl Environ Microbiol 67,
2760–2765.
Ventura, M., Meylan, V. and Zink, R. (2003) Identification
and tracing of Bifidobacterium species by use of enterobac-
terial repetitive intergenic consensus sequences. Appl Envi-
ron Microbiol 69, 4296–4301.
Wang, R.F., Beggs, M.L., Robertson, L.H. and Cerniglia, C.E.
(2002) Design and evaluation of oligonucleotide-micro-
array method for the detection of human intestinal bacte-
ria in fecal samples. FEMS Microbiol Lett 213, 175–182.
Wei, G., Pan, L., Du, H., Chen, J. and Zhao, L. (2004) ERIC-
PCR fingerprinting-based community DNA hybridization
to pinpoint genome-specific fragments as molecular mark-
ers to identify and track populations common to healthy
human guts. J Microbiol Methods 59, 91–108.
13