Вы находитесь на странице: 1из 11

Arthritis & REUMATOLOGÍA Vol. 00, No. 00, Mes 2016,

pp 00-00 DOI 10.1002 / art.39859

VVV dododo 2016,2016,2016, AmericanAmericanAmerican CollegeCollegeCollege ofofof RheumatologyRheumatologyRheumatology

ARTÍCULO ESPECIAL

2016 American College of Rheumatology / Liga Europea

Contra el Reumatismo Criterios de Clasificación para

SjSj primariaprimaria €€ Síndrome de Ogren

Un consenso y metodología basada en datos que incluye tres Internacional

CarolineCarolineCarolineCarolineCaroline H.H.H.H.H. Shiboski,Shiboski,Shiboski,Shiboski,Shiboski, 11111 StephenStephenStephenStephenStephen

Las cohortes de pacientes

C.C.C.C.C. Shiboski,Shiboski,Shiboski,Shiboski,Shiboski, 11111 raphaeraphaeraphaeraphaeraphae

`Le`Le`Le`Le Seror,Seror,Seror,Seror, 2222 LindseyLindseyLindseyLindsey A.A.A.A. Criswell,Criswell,Criswell,Criswell, 1111

MarcMarcMarcMarcMarcMarcMarcMarcMarcMarc Labetoulle,Labetoulle,Labetoulle,Labetoulle,Labetoulle,Labetoulle,Labetoulle,Labetoulle,Labetoulle,Labetoulle, 2222222222 ThomasThomasThomasThomasThomasThomasThomasThomasThomasThomas M.M.M.M.M.M.M.M.M.M. Lietman,Lietman,Lietman,Lietman,Lietman,Lietman,Lietman,Lietman,Lietman,Lietman, 1111111111 AstridAstridAstridAstridAstridAstridAstridAstridAstridAstrid Rasmussen,Rasmussen,Rasmussen,Rasmussen,Rasmussen,Rasmussen,Rasmussen,Rasmussen,Rasmussen,Rasmussen, 3333333333 HalHalHalHalHalHalHalHalHalHal Scofield,Scofield,Scofield,Scofield,Scofield,Scofield,Scofield,Scofield,Scofield,Scofield, 4444444444 ClaudioClaudioClaudioClaudioClaudioClaudioClaudioClaudioClaudioClaudio Vitali,Vitali,Vitali,Vitali,Vitali,Vitali,Vitali,Vitali,Vitali,Vitali, 5555555555

SimonSimonSimonSimonSimon J.J.J.J.J. Bowman,Bowman,Bowman,Bowman,Bowman, 66666 XavierXavierXavierXavierXavier Mariette,Mariette,Mariette,Mariette,Mariette, 22222 yyyyy lalalalala InternacionalInternacionalInternacionalInternacionalInternacional

sjsj €€Criterios de síndrome Grupo de Trabajo de Ogren

Este conjunto de criterios ha sido aprobado por el Colegio Americano de Reumatología (ACR) Consejo de Administración y el Comité Ejecutivo de la Liga Europea Contra el Reumatismo (EULAR). Esto significa que los criterios establecidos ha sido validado cuantitativamente utilizando los datos del paciente, y ha sido validado en base a un conjunto de datos independientes. Se espera que todos los grupos de criterios aprobados por la EULAR ACR / a someterse a cambios intermitentes.

El ACR es una sociedad independiente, profesional, médico y científico que no garantiza, garantiza, ni aprueba ningún producto comercial o servicio.

EsteEste artículoartículo sese publicapublica simultáneamentesimultáneamente enen lala ediciónedición dede eneroenero 20172017 dede AnalesAnales dede las enfermedades reumáticas.

Las cohortes de pacientes que participan en esta investigación fueron financiados

por el NIH (subvenciones del Instituto Nacional de Investigación Dental y Craneofacial [NIDCR],

el Instituto Nacional del Ojo, y la Oficina de Investigación sobre la Salud de la Mujer; contraiga

N01-DE-32636N01-DE-32636 yy elel contratocontrato NIDCRNIDCR HHSN26S201300057CHHSN26S201300057C parapara lala SjSj €€

Colaboraron Internacional de Ogren

rativo cohorte clínica Alianza; y subvenciones AR-053483, AR-050782, DE-

018 209, DE-015223, AI-082714, GM-104938, y 1P50-AR-060 804). El apoyo a la cohorte

Fundación de Investigación Médica de Oklahoma fue proporcionado por la Fundación de

OklahomaOklahoma MedicalMedical Research,Research, lala FundaciónFundación Phileona,Phileona, yy lala SjSj €€

Fundación Síndrome de Ogren. 11 CarolineCaroline H.H. Shiboski,Shiboski, DDS,DDS, MPH,MPH, PhD,PhD, StephenStephen C.C. Shiboski,Shiboski, PhD,PhD, LindseyLindsey CriswellCriswell

A.,A.,A., MD,MD,MD, MPH,MPH,MPH, DSC,DSC,DSC, ThomasThomasThomas M.M.M. Lietman,Lietman,Lietman, MD:MD:MD: UniversidadUniversidadUniversidad dedede California,California,California, SanSanSan Francisco;Francisco;Francisco; 222 raphaeraphaeraphae

`Le Seror, MD, PhD,

Marc Labetoulle, MD, Xavier Mariette, MD, PhD: Universit e ParisSud, AP-HP, H ^

opitaux Universitaires Paris-Sud, INSERM U1184,

París,París,París, Francia;Francia;Francia; 333 AstridAstridAstrid Rasmussen,Rasmussen,Rasmussen, MD,MD,MD, PhD:PhD:PhD: OklahomaOklahomaOklahoma MedicalMedicalMedical ResearchResearchResearch Foundation,Foundation,Foundation, dedede

OklahomaOklahomaOklahoma City;City;City; 444 HalHalHal ScoScoSco campo,campo,campo, MD:MD:MD: OklahomaOklahomaOklahoma MedicalMedicalMedical ResearchResearchResearch Foundation,Foundation,Foundation, UniversidadUniversidadUniversidad dedede

Oklahoma Centro de Ciencias de la Salud, y el Departamento de Asuntos de Veteranos Medical

Center,Center,Center, dedede OklahomaOklahomaOklahoma City;City;City; 555 ClaudioClaudioClaudio Vitali,Vitali,Vitali, MD:MD:MD: IstitutoIstitutoIstituto VillaVillaVilla SanSanSan Giuseppe,Giuseppe,Giuseppe,

1

Como,Como,Como, Italia,Italia,Italia, yyy lalala CasaCasaCasa dididi CuraCuraCura dididi Lecco,Lecco,Lecco, Lecco,Lecco,Lecco, Italia;Italia;Italia; 666 SimonSimonSimon J.J.J. Bowman,Bowman,Bowman, PhD,PhD,PhD, FRCP:FRCP:FRCP:

Hospitales Universitarios Birmingham, NHS Foundation Trust, Birmingham, Reino Unido.

Dres. CH Shiboski y SC Shiboski contribuido igualmente a este trabajo. Dres.

Bowman y Mariette contribuyeron igualmente a este trabajo.

El Dr. CH Shiboski ha recibido honorarios de consultoría del Instituto Pasteur (menos

de $ 10.000). El Dr. SC Shiboski ha recibido regalías de libros de texto de la editorial Springer

(menos de $ 10.000). El Dr. Labetoulle ha recibido honorarios por asesoramiento de Alcon,

Allergan, MSD, Sanofi, Santen, y Thea (menos de $ 10,000 cada uno). El Dr. Scofield ha recibido

honorarios de consultoría de UCB y Eli Lilly (menos de $ 10,000 cada uno). El Dr. Bowman ha

recibido honorarios por asesoramiento de Celgene, Eli Lilly, Glenmark, GlaxoSmithKline,

MedImmune, Novartis, Ono, Pfizer, Roche, Takeda, y UCB (menos de $ 10,000 cada uno).

Correspondencia: Caroline H. Shiboski, DDS, MPH, PhD, Leland A. andGladys K.

Barbero Profesor Distinguido inDentistry, Presidente del Departamento de Ciencias orofaciales,

Box 0422, Sala S612, 513 Parnassus Avenue, Universidad de California, San Francisco, San

Francisco , CA 94143. E-mail: caroline.shiboski@ucsf.edu.

Presentado para su publicación 30 de octubre de, 2015; aceptó en forma revisada 25 de de agosto de 2016.

2

SHIBOSKI ET AL

Objetivo.Objetivo. ParaPara desarrollardesarrollar yy validarvalidar unun sistemasistema internacionalinternacional dedede losloslos criterioscriterioscriterios dedede clasificaciónclasificaciónclasificación dedede SjSjSj primariaprimariaprimaria €€€ ElElEl síndromesíndromesíndrome dedede OgrenOgrenOgren (SS) utilizando guías del Colegio Americano de Reumatología (ACR) y la Liga Europea Contra el Reumatismo (EULAR). Estos criterios fueron desarrollados para su uso en personas con signos y / o síntomas sugestivos de SS.

Métodos.Métodos. AsignamosAsignamos pesospesos dede importanciaimportancia preliminarespreliminares aa unauna listalista de consenso de criterios candidatos artículos, usando análisis de decisión multicriterio. Hemos probado y adaptó el proyecto de criterios resultantes usando datos de cohortes existentes en casos SS primario y controles no-SS, con el estado del caso / no caso derivado de juicio clínico experto. a continuación, se validó el rendimiento de los criterios de clasificación en una cohorte independiente de pacientes.

Resultados.Resultados. LosLos criterioscriterios dede clasificaciónclasificación finalesfinales sese basanbasan enen lala sumasuma ponderada de los 5 elementos: anti-SSA positividad de anticuerpos / Ro y focales sialoadenitissialoadenitissialoadenitissialoadenitissialoadenitis linfocíticalinfocíticalinfocíticalinfocíticalinfocítica conconconconcon unaunaunaunauna puntuaciónpuntuaciónpuntuaciónpuntuaciónpuntuación dedededede enfoqueenfoqueenfoqueenfoqueenfoque ‡‡‡‡‡ 11111 focosfocosfocosfocosfocos ///// 44444 mmmmmmmmmm 2,2,2,2,2, cadacadacadacadacada unounounounouno dedededede puntuaciónpuntuaciónpuntuación 3;3;3; unaunauna puntuaciónpuntuaciónpuntuación anormalanormalanormal tincióntincióntinción ocularocularocular ‡‡‡ 555 (puntuación(puntuación(puntuación ooo camionetacamionetacamioneta dedede BijsterveldBijsterveldBijsterveldBijsterveldBijsterveld ‡‡‡‡‡ 4),4),4),4),4), resultadoresultadoresultadoresultadoresultado dedededede lalalalala pruebapruebapruebapruebaprueba dedededede SchirmerSchirmerSchirmerSchirmerSchirmer dedededede £££££ 55555 mmmmmmmmmm ///// 55555 minutos,minutos,minutos,minutos,minutos, yyyyy unaunaunaunauna tasatasatasatasatasa dedede flujoflujoflujo salivalsalivalsalival nonono estimuladoestimuladoestimulado dedede £££ 0,10,10,1 mlmlml /// minuto,minuto,minuto, cadacadacada unounouno conconcon resultadosresultadosresultados 1.1.1. LosLosLos individuos con signos y / o síntomas sugestivos de SS que tienen una puntuación totaltotaltotal dedede ‡‡‡ 444 paraparapara losloslos elementoselementoselementos anterioresanterioresanteriores cumplencumplencumplen losloslos criterioscriterioscriterios paraparapara elelel SSSSSS primario.primario.primario. La sensibilidad y la especificidad contra el estado del caso / no caso clínico experto derivado en la cohorte de validación final eran altas, es decir, 96% (intervalo de confianza del 95% [IC del 95%] 92-98%) y 95% (IC del 95% 92 -97%), respectivamente.

Conclusión.Conclusión. UsandoUsando lala metodologíametodología consistenteconsistente concon otrosotros criterioscriterios dede clasificación recientes aprobados por EULAR ACR /, hemos desarrollado un único conjunto de criterios de clasificación de consenso basadas en datos para SS primario, que llevan a cabo bien en la validación de los análisis y son muy adecuadas-como criterios para la inscripción en los ensayos clínicos.

sjsj €€síndrome de Ogren (SS) es una enfermedad autoinmune multisistémica caracterizada por hipofunción de salivares y lacrimales glándulas y posibles manifestaciones de múltiples órganos sistémicos. Está gestionado principalmente por reumatólogos, en colaboración con oftalmólogos y especialistas en medicina / patología oral.

Ninguno de los grupos de criterios de clasificación 11 / diagnóstico para SS publicó entre 1965 y 2002 (1-11) había sido aprobado por el Colegio Americano de Reumatología (ACR) o Liga Europea Contra el Reumatismo (EULAR). Durante la última década, los criterios de clasificación más utilizados han sido los criterios American- Grupo de Consenso Europeo (ECGA) (11), que han demostrado ser útiles en la investigación y la práctica clínica. En 2012, los nuevos criterios de clasificación desarrollados utilizando los Institutos NacionalesNacionales dede SaludSalud financiadosfinanciados SjSj €€

de Ogren

Alianza (SECA) registro clínico de Colaboración Internacional se publicaron después de haber sido aprobado provisionalmente por el ACR (12). Estos criterios fueron diseñados para la clasificación de los individuos para la inscripción en los ensayos clínicos, y la población de destino utilizado para su desarrollo y validación consistió en individuos con signos y síntomas sugestivos de SS. Los análisis posteriores para comparar la ACR y criterios ECGA, realizado en una cohorte de pacientes en los Oklahoma Medical Research Foundation (OMRF), reveló un alto nivel de concordancia (13). Aunque ambos grupos de criterios incluyen artículos similares, los criterios ECGA permiten sustituciones de algunos elementos alternativos y el uso de los síntomas de sequedad en los ojos y la boca en la clasificación de los pacientes. Los criterios del ACR provisionales se basan únicamente en las pruebas objetivas,

Mientras que algunos tratamientos pueden mejorar los síntomas y prevenir las complicaciones de la SS, en la actualidad no existe una cura. Sin embargo, el reciente desarrollo de nuevas opciones terapéuticas para el tratamiento de diversas enfermedades autoinmunes es prometedor para los pacientes con SS. criterios de inclusión bien definidos, y los criterios de valoración que permiten la medición de los efectos de los nuevos tratamientos, son necesarios para el desarrollo de nuevas terapias. índices de actividad de la enfermedad para puntos finales SS, es decir, el paciente EULAR SS Reported Índice y el Índice de Actividad de la Enfermedad SS EULAR (ESSDAI), recientemente se han desarrollado y validadovalidado porpor elel SjSj EULAREULAR €€

Grupo de Trabajo de Ogren (14-17). La necesidad de un consenso internacional sobre los criterios de clasificación ha sido recientemente reconocido por la comunidad científica SS (18). Este conjunto de criterios internacionales debe establecerse mediante consideraciones y enfoques publicado por tanto ACR y EULAR, con el fin de ser aprobado por ambas organizaciones (19,20).

En 2012, los investigadores del equipo SECA y la Sj

EULAREULAR €€

Grupo de Trabajo de Ogren formó el Inter-

cionalcional SjSj €€ Criterios de síndrome de Ogren grupo de trabajo. El objetivo era desarrollar criterios de clasificación de SS primario que combinan características de los criterios de la ACR y ECGA, utilizando métodos coherentes con los recomendados por la ACR y EULAR. Se describe en este documento el desarrollo y la validación de los criterios resultantes, que han sido aprobados por el ACR y EULAR. En consonancia con nuestro objetivo de producir criterios para ayudar en el reclutamiento para ensayos clínicos, nos centramos en primaria en lugar de SS secundario. Los pacientes con este último normalmente no serían elegibles para los tratamientos experimentales para la SS.

métodos

VisiónVisión dede conjunto.conjunto. NuestrosNuestros métodosmétodos sese basanbasan enen loslos datosdatos yy elel juiciojuicio clínico experto, y son similares a los utilizados para el desarrollo y la validación de los criterios ACR / EULAR 2010 para

3

3 CLASIFICACIÓN ACR / EULAR para SS PRIMARIA 1000Minds.1000Minds.1000Minds. ‡‡‡ 555 casocasocaso dedede lalala

CLASIFICACIÓN ACR / EULAR para SS PRIMARIA

1000Minds.1000Minds.1000Minds. ‡‡‡ 555 casocasocaso dedede lalala enfermedadenfermedadenfermedad yyy elelel estadoestadoestado dedede no-casono-casono-caso tantotantotanto enenen elelel desarrollodesarrollodesarrollo yyy laslaslas cohortescohortescohortes dedede validaciónvalidaciónvalidación sesese derivanderivanderivan dedede juiciojuiciojuicio clínicoclínicoclínico expertoexpertoexperto basadobasadobasado enenen viñetasviñetasviñetas clínicas.clínicas.clínicas. CRITERIOSCRITERIOSCRITERIOS DEDEDE

FiguraFiguraFigura 1.1.1. DescripciónDescripciónDescripción generalgeneralgeneral dedede lalala metodologíametodologíametodología utilizadautilizadautilizada paraparapara elelel conjuntoconjuntoconjunto definitivodefinitivodefinitivo dedede SjSjSj €€€

El síndrome de Ogren (SS) los criterios de clasificación, basado en los datos y

juicio clínico experto. la generación de posiciones se deriva tanto de los criterios de 2002 del Grupo de América-Europea de Consenso (ECGA) y el Colegio Americano de Reumatología 2012 (ACR). UWSUWSUWSUWSUWSUWSUWS 5555555 velocidadvelocidadvelocidadvelocidadvelocidadvelocidadvelocidad dedededededede flujoflujoflujoflujoflujoflujoflujo dedededededede todatodatodatodatodatodatoda lalalalalalala salivasalivasalivasalivasalivasalivasaliva nonononononono estimulada;estimulada;estimulada;estimulada;estimulada;estimulada;estimulada; VBVBVBVBVBVBVB 5555555 vanvanvanvanvanvanvan Bijsterveld;Bijsterveld;Bijsterveld;Bijsterveld;Bijsterveld;Bijsterveld;Bijsterveld; FSFSFSFSFSFSFS 5555555 centrarsecentrarsecentrarsecentrarsecentrarsecentrarsecentrarse puntuaciónpuntuaciónpuntuaciónpuntuaciónpuntuaciónpuntuaciónpuntuación (calculada(calculada(calculada(calculada(calculada(calculada(calculada aaaaaaa partirpartirpartirpartirpartirpartirpartir dedededededede lalalalalalala biopsiabiopsiabiopsiabiopsiabiopsiabiopsiabiopsia dedededededede lalalalalalala glándulaglándulaglándulaglándulaglándulaglándulaglándula salivalsalivalsalivalsalivalsalivalsalivalsalival labiallabiallabiallabiallabiallabiallabial enenenenenenen presenciapresenciapresenciapresenciapresenciapresenciapresencia dedededededede sialoadenitissialoadenitissialoadenitissialoadenitissialoadenitissialoadenitissialoadenitis linfocíticalinfocíticalinfocíticalinfocíticalinfocíticalinfocíticalinfocítica

focal);focal);focal);focal);focal);focal);focal);focal);focal); OSSOSSOSSOSSOSSOSSOSSOSSOSS 555555555 PuntuaciónPuntuaciónPuntuaciónPuntuaciónPuntuaciónPuntuaciónPuntuaciónPuntuaciónPuntuación dedededededededede tincióntincióntincióntincióntincióntincióntincióntincióntinción ocular;ocular;ocular;ocular;ocular;ocular;ocular;ocular;ocular; RFRFRFRFRFRFRFRFRF 555555555 factorfactorfactorfactorfactorfactorfactorfactorfactor reumatoide;reumatoide;reumatoide;reumatoide;reumatoide;reumatoide;reumatoide;reumatoide;reumatoide; ANAANAANAANAANAANAANAANAANA 555555555 anticuerposanticuerposanticuerposanticuerposanticuerposanticuerposanticuerposanticuerposanticuerpos antinucleares.antinucleares.antinucleares.antinucleares.antinucleares.antinucleares.antinucleares.antinucleares.antinucleares. ********* 555555555 laslaslaslaslaslaslaslaslas reunionesreunionesreunionesreunionesreunionesreunionesreunionesreunionesreuniones deldeldeldeldeldeldeldeldel GrupoGrupoGrupoGrupoGrupoGrupoGrupoGrupoGrupo dedededededededede TrabajoTrabajoTrabajoTrabajoTrabajoTrabajoTrabajoTrabajoTrabajo InternacionalInternacionalInternacionalInternacionalInternacionalInternacionalInternacionalInternacionalInternacional SSSSSSSSSSSSSSSSSS CriteriosCriteriosCriteriosCriteriosCriteriosCriteriosCriteriosCriteriosCriterios aaaaaaaaa cabocabocabocabocabocabocabocabocabo durantedurantedurantedurantedurantedurantedurantedurantedurante elelelelelelelelel 201320132013201320132013201320132013 SimposioSimposioSimposioSimposioSimposioSimposioSimposioSimposioSimposio

InternacionalInternacional sobresobre SjSj €€

SíndromeSíndromeSíndrome (ISSS)(ISSS)(ISSS) enenen Kyoto,Kyoto,Kyoto, JapónJapónJapón yyy lalala ReuniónReuniónReunión AnualAnualAnual 201320132013 deldeldel ACRACRACR enenen SanSanSan Diego,Diego,Diego, California.California.California. ††† 555 LaLaLa encuestaencuestaencuesta dedede múltiplesmúltiplesmúltiples criterioscriterioscriterios dedede análisisanálisisanálisis dedede decisióndecisióndecisión (MCDA)(MCDA)(MCDA) sesese realizórealizórealizó utilizandoutilizandoutilizando elelel softwaresoftwaresoftware

de Ogren

la artritis reumatoide (21,22) y los 2013 criterios ACR / EULAR para la esclerosis sistémica (23,24). El enfoque se describe esquemáticamente en la Figura 1 y se describe a continuación.

1. Hemos generado una lista preliminar de los elementos seleccionados en base a los criterios del ACR y ECGA y guiadas por los análisis de conjuntos de datos existentes (generación artículo). Esta lista se finalizó en 2 reuniones de los criterios internacionales SS del Grupo de Trabajo, que se celebró simultáneamente con el 2013 Simposio Internacional sobre SS y el 2013 Reunión ACRAnnual.

2. Se utilizó el análisis de decisión multicriterio (MCDA) (25) para reducir el número de criterios candidatos artículos, asignar pesos preliminares (reducción del elemento y de asignación de peso), y ayudar a definir un proyecto de criterios establecidos.

3. Hemos comprobado y adaptado el proyecto de criterios utilizando una cohorte de desarrollo con el estado de la enfermedad SS primario, según lo determinado por la evaluación médico-pericial de viñetas clínicas.

4. A continuación, probamos el rendimiento de los criterios de clasificación en una definida

de forma similar, pero por separado, cohorte de validación de los pacientes.

5. También a prueba el rendimiento de los criterios de clasificación en un subconjunto de individuos cuyo caso SS frente el estado del caso no-SS fue difícil determinar (ver abajo).

SjSjSjSj InternacionalInternacionalInternacionalInternacional €€€€ CriteriosCriteriosCriteriosCriterios dededede síndromesíndromesíndromesíndrome dededede OgrenOgrenOgrenOgren grupogrupogrupogrupo dededede trabajo.trabajo.trabajo.trabajo. ElElElEl grupo de trabajo (ver Apéndice A) comprendía 55 por el clínico expertos incluyendo 36 reumatólogos, 10 medicina oral / especialistas patología, y 9 oftalmólogos, así como 2 defensores de los pacientes (de los EE.UU. y Europa). La metodología

equipo estaba formado por un estadístico (SCS) y 2 epidemiólogos (CHS) y RS. Aproximadamente la mitad de los clínicos expertos procedían de Europa (Dinamarca, Francia, Grecia, Italia, Países Bajos, Noruega, España, Suecia y el ReinoUnido), y entre la otra mitad, la mayoría eran de Norte y Sur América (los EE.UU. y Argentina ), con el resto fromJapan.

lala generacióngeneración dede posiciones.posiciones. extensosextensos análisisanálisis estadísticosestadísticos sese llevaronllevaron aa cabo dentro del conjunto de datos SECA, con el aporte del grupo de trabajo para una mejor comprensión de las similitudes y diferencias entre los criterios del ACR ECGA y conjuntos. Al mismo tiempo, los análisis estadísticos que comparan la ACR y los criterios ECGA se realizaron dentro de la cohorte OMRF, y un alto nivel de concordancia fue identificado (91% de concordancia entre los 646 participantes OMRF, incluyendo 244 que se reunió con ambos conjuntos de criterios y 343 que no cumple ninguno ) (13).

Teniendo en cuenta el alto grado de concordancia entre los criterios del ACR y ECGA y el hecho de que los componentes de ambos grupos de criterios se superponen en cierta medida, existe un acuerdo general sobre muchos de los elementos clave para la inclusión. Sin embargo, algunas pruebas se incluyeron en el ECGA pero no en los criterios de la ACR (prueba de Schirmer, saliva total no estimulada [UWS] tasa, sialografía, gammagrafía salivar de flujo), y otros fueron incluidos en el ACR, pero no en los criterios ECGA (anticuerpos antinucleares [ANA] título y el factor reumatoide [RF] de estado). Además, la sequedad ocular se midió usando la puntuación van Bijsterveld (VBS) (26) en los criterios de AECG y la Puntuación Ocular tinción (OSS) (27) en los criterios de la ACR, aunque estas pruebas ambos miden tinción ocular (el primero con verde lisamina

4

SHIBOSKI ET AL

y el segundo con lisamina verde [para conjuntiva] y fluoresceína [para córnea]). Los análisis comparativos realizados tanto en el SECA y las cohortes OMRF, y se presentan al grupo de trabajo, guiado a la generación de una lista final de candidatos artículos. Se acordó que todos los elementos incluidos originalmente en tanto el ECGA y los criterios de la ACR, excepto ANA título y el estado de RF, serían elementos iniciales candidatos. La decisión de excluir a ANA y RF se basó en los análisis que muestran que un número extremadamente pequeño de individuos que cumplían los criterios del ACR fueron negativos para anti-SSA / SSB (anti-Ro / La), pero positivo para ANA (título de $ 1: 320) y RF (13).

reducciónreducción dede puntopunto yy lala asignaciónasignación dede peso.peso. clasificaciónclasificación relativarelativa dede loslos elementoselementos seleccionados reflejan las opiniones del clínico experto se basó en una encuesta basada en la web MCDA administrada usando el software 1000Minds (25,28). Este enfoque, basado en clasificación por pares de alternativas (cada uno definido utilizando criterios seleccionados artículos), ha sido descrito previamente (29). Las ponderaciones de los artículos resultantes se normalizaron como porcentajes y se usan para definir una puntuación de aditivo (véase más adelante) que refleja la probabilidad de asignar el estado del caso de la enfermedad.

DesarrolloDesarrollo yy validaciónvalidación dede pacientespacientes cohortes.cohortes. TresTres cohortescohortes prospectivas de individuos con signos y / o síntomas sugestivos de SS han sido reclutados en los últimos 10 años por equipos de investigadores que ahora son miembros de los criterios internacionales SS del Grupo de Trabajo. Estas cohortes incluyen: 1) la cohorte SECA, que comprende 3.514 pacientes (incluyendo 1.578 personas que cumplen con los criterios de clasificación ACR para el SS primario) reclutados en Argentina, China, Dinamarca, India, Japón, el Reino Unido y los EE.UU. (co-investigadores principales CHS y ALC), 2) la cohorte de Paris-Sud, que consta de 1.011 pacientes (incluyendo 440 personas que cumplen con los criterios ECGA para SS primario) reclutados en París (investigador principal XM), y 3) la cohorte OMRF, que incluye 837 participantes (incluyendo 279 personas que cumplen con los criterios para ECGA SS primario) evaluadosevaluados yaya seasea enen elel SjSj €€

Investigación de Ogren

ClínicaClínica enen OMRFOMRF oo lala SjSj €€

Minnesota (investigador principal K. Sivils, PhD [OMRF]).

Estas cohortes comparten varias características clave que los hacen adecuados para el desarrollo Los criterios de inclusión requerían que los participantes tienen signos y / o síntomas sugestivos de SS, lo que justifica una evaluación completa por un equipo multidisciplinario de médicos de las SS. Además de los datos relacionados con los síntomas, pruebas objetivas con respecto a oral, ocular, y los puntos sistémicos / serológicos finales se habían realizado utilizando procedimientos similares, como se describe a continuación.

Clínica de Ogren en la Universidad de

PruebasPruebas orales.orales. LabialLabial glándulaglándula salivalsalival (LSG)(LSG) lala biopsiabiopsia sese realizórealizó parapara identificar sialoadenitis linfocítica focal y obtener una puntuación de enfoque (30). velocidades de flujo UWS se midieron utilizando métodos estándar (31,32).

pruebaspruebas oculares.oculares. ElEl OSSOSS sese obtuvoobtuvo utilizandoutilizando lisaminalisamina verdeverde yy fluoresceína.fluoresceína. Otros exámenes oculares incluyen pruebas y medición de tiempo de ruptura de la película lagrimal de Schirmer. tinción ocular se evaluó con el VBS en la cohorte de París-Sur, la OSS en la cohorte SECA, y ambos métodos en la cohorte OMRF. Los investigadores de cohortes Paris-Sud también se utiliza fluoresceína y se recogen datos sobre los componentes OSS individuales, por lo que el OSS puede ser calculada posteriormente. Por lo tanto, los datos de las cohortes ParisSud y OMRF podrían ser analizados para establecer un algoritmo de conversión entre ambas puntuaciones de la siguiente manera:

para las puntuaciones más bajas (es decir, las puntuaciones de 1-3), el VBS era igual a la OSS, pero VBS grados de 4, 5, y 6 eran equivalentes a los grados de OSS de 5,

6, y 7, respectivamente. Para la evaluación de las viñetas clínicas, tinción ocular se expresó como la OSS, que van desde 0 a

psps 7.7. UnUn grupogrupo dede 44 oftalmólogosoftalmólogos dede Francia,Francia, loslos EE.UU.EE.UU. yy elel ReinoReino Unido,Unido, incluyendo 3 de los autores, formado un grupo de trabajo especial que interpreta los análisis realizados sobre los datos ParisSud (ML y TML) y en los datos OMRF (AR ). Juntos, derivan el algoritmo de conversión entre el OSS y el VBS descrito anteriormente. Además, desde un VBS de 4 (utilizado previamente en los criterios AECG) era equivalente a un OSS de 5, el grupo acordó para modificar el umbral OSS a 5 en los nuevos criterios establecidos. Este umbral también se ha demostrado, como parte de los análisis posteriores de los datos SICCA, para ser más específicos para propósitos de diagnóstico que la puntuación anterior de 3 (datos no mostrados).

ensayosensayos serológicos.serológicos. LosLos estudiosestudios serológicosserológicos incluyenincluyen pruebaspruebas parapara anti-SSA / SSB (anti-Ro / La), ANA, RF, IgG, y complementos de C3 y C4.

Inhibidores de la proteasa de cohorte se les pide cada uno para proporcionar un conjunto de datos que consistió en una muestra aleatoria de 400 individuos, con igual número de casos SS primario y no casos (usando su propia definición de diagnóstico), y el estado del caso no revelan en el conjunto de datos. Los datos combinados conjuntos así compuesta 1.200 individuos con datos bien caracterizados en las características fenotípicas de SS. viñetas clínicas que describen las características relevantes de cada individuo en forma de texto fueron generadas por ordenador usando un programa escrito en R, versión 3.2 (33). Las viñetas describen cada individuo con respecto a la edad, sexo, síntomas reportados, los signos clínicos, los resultados de pruebas que incluyen ANA título, RF, IgG, C3, C4, anti-SSA / Ro, y anti-SSB / La estado, OSS para cada ojo, resultado de la prueba dede SchirmerSchirmer parapara cadacada ojo,ojo, sisi lala biopsiabiopsia revelóreveló LSGLSG sialoadenitissialoadenitis linfocíticalinfocítica focal,focal, ArtritisArtritis yy ReumatologíaReumatología sitiositio webweb enen http:http: //// onlinelibrary.wiley.com/doi/10.1002/art.39859/abstract). Los síntomas oculares se definieron de acuerdo a la definición AECG, como una respuesta positiva a por lo menos 1 de las siguientes preguntas:

1) ¿Ha tenido diaria, ojos secos, molestos persistentes durante más de 3 meses? 2) ¿Tiene una sensación recurrente de arena o grava en los ojos? 3) ¿Utiliza sustitutos lagrimales más de 3 veces al día? Los síntomas orales se definieron como una respuesta positiva al menos 1 de las siguientes preguntas: 1) ¿Ha tenido la sensación de sequedad en la boca todos los días durante más de 3 meses? 2) ¿Con frecuencia se bebe líquidos para ayudar a tragar alimentos secos?

EvaluaciónEvaluación deldel estadoestado dede SSSS casocaso // control.control. SeSe excluyeronexcluyeron 44 viñetasviñetas seleccionados al azar de la población de estudio para obtener 1.196 viñetas que se distribuyeron aleatoriamente en 26 encuestas, conteniendo cada uno 46 viñetas individuales. Captura de Investigación Electrónica de Datos (redcap) (34) se utiliza para administrar cada encuesta a 2 clínico-expertos, de forma ciega. Veintiséis pares de clínicos expertos participaron en el primer ejercicio de encuesta, y cada par completaron 1 encuesta. Se les instruyó para revisar cada viñeta y se les preguntó si pensaba que el paciente descrito tuvo el SS primario. Las respuestas posibles eran “sí”, “no”, y “no estoy seguro” sí concordantes / no hay respuestas se utilizaron para asignar el estado del caso / no-caso.; concordantes respuestas “No estoy seguro” se interpretaron como viñetas no graduables. Todas las viñetas con respuestas discordantes (sí / no, sí / no está seguro, o no, no / Seguro) se incluyeron en una segunda ronda de encuestas que se enviaron a cada una tercera clínico experto (un total de 9 clínico-expertos contribuyó a la segunda ronda de encuestas). entonces Concordancia se definió como 2 respuestas concordantes de la 3, con una viñeta definido como un caso SS primario si había 2 respuestas “sí” y como un control no-SS si hay

CRITERIOS DE CLASIFICACIÓN ACR / EULAR para SS PRIMARIA

5

Había 2 “no”. Viñetas que recibieron 3 respuestas discordantes (sí / no / no estoy seguro) fueron considerados “casos difíciles de clasificar” y se combinaron en una tercera encuesta enviada a 8 clinicianexperts, todos los cuales eran miembros del comité de dirección. Estos casos difíciles de clasificar se definieron como casos SS si la mayoría de los clínicos expertos ($ 5 de 8) respondió “sí” a una viñeta, y como controles no-SS si themajority respondieron “no”.

La aleatorización de viñetas a través de desarrollo y validación cohortes. Cada uno de los 1.196 viñetas se le asignó un número de identificación único, y las viñetas se dividieron aleatoriamente en dos grupos de 598, con uno a ser utilizado como cohorte de desarrollo y el otro para fines de validación. Clinicianexperts que completaron las encuestas fueron cegados con respecto al origen (el desarrollo o la validación del conjunto) de las viñetas clínicas.

EnsayoEnsayo yy lala adaptaciónadaptación dede loslos criterioscriterios enen proyecto.proyecto. SeSe realizaronrealizaron análisisanálisis exploratorios de la clasificación clínico experto derivados de la encuesta MCDA para caracterizar las distribuciones de los pesos específicos de los artículos. Los resultados se resumen gráficamente y el uso de las estadísticas de resumen. También se realizó el análisis que vinculan elementos de viñeta de la cohorte de desarrollo con los correspondientes

el clínico experto

Salir

clasificaciones,

restringido a las personas con los resultados del caso / no-clínico del caso-experto asignado. clasificadores forestales aleatorios condicionales (35) se utilizaron para obtener el ranking de importancia variable para 1) todos los puntos de viñeta y 2) indicadores

binarios correspondientes a los artículos y utilizados en la encuesta MCDA.

Con base en los resultados de los análisis exploratorios, hemos definido varios criterios de clasificación candidato, centrándose en los elementos seleccionados por el médico-expertos para el estudio de RMDC. Criterios se definieron basándose en las puntuaciones calculadas como sumas ponderadas de indicadores binarios de presencia / ausencia de artículos, con pesos reflejan la importancia relativa. Además de los pesos MCDAderived, hemos utilizado modelos de regresión logística ajustados a la muestra de desarrollo para derivar pesos alternativos de coeficientes-artículo específico. Los valores de corte para la designación caso para los criterios de candidatos se calcularon utilizando características operativas del receptor (ROC) métodos aplicados para el clínico experto- resultados definidos en el conjunto de datos de desarrollo. Para cada elemento candidato, se identificaron 2 valores de corte utilizando un índice Youden generalizada (36). Para el primero valor de corte, sensibilidad y especificidad fueron ponderados como igualmente importante; para el segundo, la especificidad fue ponderada como dos veces tan importante como la sensibilidad.

Llevamos a cabo una reunión final del Grupo de Trabajo Internacional SS Criterios para presentar y discutir la prueba y adaptación de los resultados de un proyecto de criterios. Un informe resumido posteriormente fue enviado a todos los miembros, incluidos aquellos que no pudieron asistir a la reunión. Una encuesta redcap se administró a todo el panel de clínicos expertos, la búsqueda de consenso sobre los criterios de proyecto final antes de la validación.

validaciónvalidación dede criterios.criterios. ValidaciónValidación dede loslos criterioscriterios dede candidatoscandidatos sese basabasa enen ROC análisis utilizando la muestra de validación, restringido a los individuos con el estado del caso clínico-experto asignado / noncase. Se evaluaron por separado rendimiento de la clasificación en el subgrupo de casos difíciles a clasificar. El rendimiento se resumió con sensibilidad estimada y especificidad con el acompañamiento de los intervalos de confianza del 95% (95% IC) y el área bajo la curva (AUC) estadísticas.

resultados

Distribución de las respuestas y las ponderaciones de los artículosartículos enen lala encuestaencuesta MCDA.MCDA. CincuentaCincuenta yy dosdos porpor clínicosclínicos expertosexpertos participaron en la encuesta de RMDC. La Tabla 1 muestra los pesos del artículo para cada una de las 7 artículos (tenga en cuenta que los pesos están normalizados para sumar a 1, produciendo una interpretación proporción). La Figura 2 presenta la distribución de ponderaciones de los artículos a través de expertos. Las curvas de la figura se suavizan las estimaciones de densidad kernel que tienen una interpretación frecuencia relativa similar a la utilizada en los histogramas. Los resultados indican que una biopsia LSG mostrando linfocítica focal sialadenitis con una puntuación foco de $ 1 y anti-SSA / SSB (anti-Ro / La) positividad recibido los pesos promedios más altos, seguido por el OSS, UWS, resultado de la prueba de Schirmer, los síntomas orales, y síntomas oculares, respectivamente. distribuciones de peso para los síntomas oculares / orales, resultado de la prueba de Schirmer / UWS,

la evaluación del estado del caso en las cohortes de desarrollo y validación.validación. LaLa primeraprimera rondaronda dede encuestasencuestas produjoprodujo 819819 concordantesconcordantes yy discordantes 377 respuestas (ver

TablaTabla 1.1. pesospesos estimadosestimados parapara laslas puntuacionespuntuaciones dede criteriocriterio 33 alternativos,alternativos, basadosbasados ​​en​​en loslos datosdatos desarrollodesarrollo viñetaviñeta

ít.

MCDA *

Logístico†

Modificado†

glándula salival labial con linfocítica focal

0.22

3

3

sialadenitissialadenitis puntuaciónpuntuación yy elel focofoco dede $$ 1/41/4 mmmm focosfocos 22 Anti-SSA / SSB (anti-Ro / La) positivo

0.21

3 ‡

3 ‡

OSS $ 5

0.15

1

1

de Schirmer prueba # 5 mm / 5 minutos

0.12

1

1

UWS # 0,1 ml / minuto

0.12

0.5

1

Los síntomas orales

0.09

-

-

Los síntomas oculares

0.09

-

-

Total

1

8.5

9

* Los pesos de múltiples criterios de análisis de decisión (MCDA) se basan en la clasificación por pares de alternativas. † Los pesos de logística

y modificados como resultado de la calificación clínico experto de las viñetas de desarrollo seleccionados al azar de entre el conjunto de datos 3-cohorte. La versión modificada de la puntuación asignada logística pesos igual a la puntuación de tinción ocular (OSS), la prueba de Schirmer

y artículos caudal saliva total no estimulada (UWS). ‡ Basado en anti-SSA / Ro solamente.

SHIBOSKI ET AL

SHIBOSKI ET AL entera. 6 probabilidadprobabilidadprobabilidadprobabilidadprobabilidad deldeldeldeldel

entera. 6

probabilidadprobabilidadprobabilidadprobabilidadprobabilidad deldeldeldeldel núcleo,núcleo,núcleo,núcleo,núcleo, yyyyy lalalalala escalaescalaescalaescalaescala verticalverticalverticalverticalvertical sesesesese puedenpuedenpuedenpuedenpueden interpretarinterpretarinterpretarinterpretarinterpretar dedededede maneramaneramaneramaneramanera similarsimilarsimilarsimilarsimilar aaaaa histogramashistogramashistogramashistogramashistogramas dedededede frecuenciasfrecuenciasfrecuenciasfrecuenciasfrecuencias relativas.relativas.relativas.relativas.relativas. OSSOSSOSSOSSOSS 55555 PuntuaciónPuntuaciónPuntuaciónPuntuaciónPuntuación dedededede tincióntincióntincióntincióntinción ocular;ocular;ocular;ocular;ocular; UWSUWSUWSUWSUWS 55555 tasatasatasatasatasa dedededede flujoflujoflujoflujoflujo dedededede salivasalivasalivasalivasaliva nonononono estimuladaestimuladaestimuladaestimuladaestimulada

FiguraFigura 2.2. LasLas distribucionesdistribuciones dede pesospesos clínico-expertoclínico-experto asignadoasignado porpor 77 artículosartículos incluidosincluidos enen lala encuestaencuesta dede análisisanálisis multicriteriomulticriterio decisióndecisión (MCDA).(MCDA). CurvasCurvas sese suavizansuavizan laslas estimacionesestimaciones dede densidaddensidad dede

SuplementariaSuplementariaSuplementaria FiguraFiguraFigura 2,2,2, enenen lalala ArtritisArtritisArtritis yyy ReumatologíaReumatologíaReumatología sitiositiositio webwebweb enenen http://onlinelibrary.wiley.com/doi/10. 1002 / art.39859 / abstracto). Las respuestas concordantes proporcionan 415 casos SS primario y 377 controles no-SS. Las 377 viñetas con respuestas discordantes fueron incluidas en una segunda ronda de encuestas asignadas a 9 9 clínico-expertos, proporcionando una tercera respuesta a cada viñeta discordante. Esto produjo un adicional de 151 casos SS primario y 125 controles no-SS (con 2 de las 3 respuestas son concordantes). Cuando la conciliación de números de identificación entre las viñetas inicialmente asignados al azar para ser utilizado en cualquiera de cohorte, los primeros 2 rondas de encuestas produjeron 288 casos SS primario y 248 controles no-SS en la cohorte de desarrollo, y 278 casos SS primario y 254 controles no-SS en la cohorte de validación.

Las 72 viñetas en la segunda ronda de la encuesta que recibieron 3 respuestas discordantes fueron incluidos en una tercera ronda de encuestas administradas a los 8 miembros del comité de dirección que también eran clínicos expertos. Estos proporcionan una piscina de 49 casos difficultto clasificar de forma que recibieron una mayoría de respuestas concordantes ($ 5 de 8) después de la tercera ronda de la encuesta: 35 casos SS primario y 14 controles no-SS.

elel desarrollodesarrollo dede criterios.criterios. graduacionesgraduaciones importanciaimportancia variablevariable aleatoriaaleatoria forestales basados ​​en las clasificaciones por clínicos expertos de las viñetas desarrollo de conjuntos de datos se muestran en la Figura 3. Los resultados basados ​​en toda la viñeta

variables, así como los indicadores binarios consistentes con los elementos incluidos en la encuesta de RMDC, se muestran. Graduaciones corresponden bien con los resultados de la encuesta MCDA e indicaron claramente la importancia relativa mayor de medidas objetivas, tales como la puntuación de LSG enfoque y resultados de anticuerpos en las decisiones de clasificación de expertos. Los síntomas orales y oculares no afectan el rendimiento de clasificación, lo que refleja la observación de que 0,94% de los individuos tenían al menos 1 de los síntomas.

Un criterio de puntuación inicial fue desarrollado como una suma ponderada de los 7 elementos de la encuesta MCDA, basado en los pesos medios reportados en la Tabla 1. Se utilizaron modelos de regresión logística para desarrollar una alternativa criterios empíricos para anotar los datos de desarrollo, centrándose en los elementos utilizado en la encuesta MCDA pero incluyendo indicadores de anti-SSA / Ro y anti-SSB / la positividad como variables independientes. Las puntuaciones se calcularon utilizando los pesos basados ​​en coeficientes de regresión reajustarán de un modelo en el que se conservaron los elementos que representan predictores significativos de estado del caso (37). Los síntomas orales y oculares y anti-SSB / La positividad fueron excluidos debido a que no afectó a la actividad de clasificación basado en el ranking de importancia variable aleatoria forestales de las clasificaciones por clínicos expertos de las viñetas de conjuntos de datos de desarrollo (Figura 3B). Además, síntomas orales y / o oculares habían sido parte de los criterios de inclusión para la participación en los 3 grupos de pacientes; por lo tanto, una

CRITERIOS DE CLASIFICACIÓN ACR / EULAR para SS PRIMARIA

7

CRITERIOS DE CLASIFICACIÓN ACR / EULAR para SS PRIMARIA 7 FiguraFigura 3.3. ImportanciaImportancia dede laslas

FiguraFigura 3.3. ImportanciaImportancia dede laslas variablesvariables dede clasificaciónclasificación dede loslos bosquesbosques alal azarazar dede laslas denominacionesdenominaciones casocaso // no-clínicono-clínico deldel casocaso expertoexperto enen viñetasviñetas dede datosdatos dede desarrollo.desarrollo. LosLos análisisanálisis basadosbasados ​​en​​en todastodas laslas variablesvariables dede viñetaviñeta

(((( UN)UN)UN)UN) yyyy sesesese limitalimitalimitalimita aaaa loslosloslos indicadoresindicadoresindicadoresindicadores binariosbinariosbinariosbinarios consistentesconsistentesconsistentesconsistentes conconconcon loslosloslos elementoselementoselementoselementos dededede lalalala encuestaencuestaencuestaencuesta análisisanálisisanálisisanálisis multicriteriomulticriteriomulticriteriomulticriterio (decisión(decisión(decisión(decisión SEGUNDO)SEGUNDO)SEGUNDO)SEGUNDO)

fueronfueronfueronfueronfueronfueronfueronfueronfueron realizados.realizados.realizados.realizados.realizados.realizados.realizados.realizados.realizados. OSSOSSOSSOSSOSSOSSOSSOSSOSS 555555555 PuntuaciónPuntuaciónPuntuaciónPuntuaciónPuntuaciónPuntuaciónPuntuaciónPuntuaciónPuntuación dedededededededede tincióntincióntincióntincióntincióntincióntincióntincióntinción ocular;ocular;ocular;ocular;ocular;ocular;ocular;ocular;ocular; ANAANAANAANAANAANAANAANAANA 555555555 anticuerposanticuerposanticuerposanticuerposanticuerposanticuerposanticuerposanticuerposanticuerpos antinucleares;antinucleares;antinucleares;antinucleares;antinucleares;antinucleares;antinucleares;antinucleares;antinucleares; UWSUWSUWSUWSUWSUWSUWSUWSUWS 555555555 velocidadvelocidadvelocidadvelocidadvelocidadvelocidadvelocidadvelocidadvelocidad dedededededededede flujoflujoflujoflujoflujoflujoflujoflujoflujo dedededededededede todatodatodatodatodatodatodatodatoda lalalalalalalalala salivasalivasalivasalivasalivasalivasalivasalivasaliva nonononononononono estimulada;estimulada;estimulada;estimulada;estimulada;estimulada;estimulada;estimulada;estimulada; RFRFRFRFRFRFRFRFRF 555555555 factorfactorfactorfactorfactorfactorfactorfactorfactor reumatoide.reumatoide.reumatoide.reumatoide.reumatoide.reumatoide.reumatoide.reumatoide.reumatoide.

decisión de grupo se hizo que los síntomas o sospecha de SS orales y / o oculares basado en 1 de los dominios de la ESSDAI serían requisitos preliminares para la aplicación de los nuevos criterios de clasificación SS. La decisión de excluir anti-SSB / La como un producto también se basó en las discusiones de grupo y en un estudio que demuestra que la presencia de anticuerpos anti-SSB / La, sin anti-SSA / Ro

anticuerpos tenían ninguna asociación significativa con las características fenotípicas de la SS, con respecto a los participantes seronegativos (38).

análisis ROC de la puntuación MCDA dio un valor de AUC de 0,96 y 2 puntos de corte alternativos para la clasificación de casos (Tabla 2). análisis ROC de la puntuación logística dio un valor de AUC de 0,98 y 2 puntos de corte alternativos para la clasificación de casos. También se consideró una modificación

TablaTabla 2.2. LosLos valoresvalores dede corte,corte, lala sensibilidad,sensibilidad, lala especificidad,especificidad, lala estadísticaestadística kappa,kappa, loslos valoresvalores dede AUC,AUC, yy elel acuerdoacuerdo concon loslos criterioscriterios dede lala ACRACR yy conjuntosconjuntos ECGAECGA existentes,existentes, parapara

las puntuaciones de criterio 3 candidatos *

criterio candidato

Especificidad

Sensibilidad

De acuerdo con criterios

De acuerdo con criterios dede lala ACRACR (( k)k)

puntuación, corte †

(95% CI)

(95% CI)

k

AUC

ECGAECGA (( k)k)

MCDA ‡

0.96

0.46

83 (78-88)

95 (92-97)

0.79

0.90

0,78

0.58

98 (95-99)

78 (73-83)

0.75

0.70

0.74

Logístico§

0.98

3.5

89 (84-93)

96 (93-98)

0.86

0.91

0.82

4

94 (90-96)

91 (87-94)

0,76

0.70

0.75

Modificado§

0.98

4 89 (85-93)

96 (93-98)

0.86

0.91

0.82

5 98 (95-99)

80 (74-84)

0,76

0.70

0.75

********* AUCAUCAUCAUCAUCAUCAUCAUCAUC 555555555 áreaáreaáreaáreaáreaáreaáreaáreaárea bajobajobajobajobajobajobajobajobajo lalalalalalalalala curva;curva;curva;curva;curva;curva;curva;curva;curva; ECGAECGAECGAECGAECGAECGAECGAECGAECGA 555555555 GrupoGrupoGrupoGrupoGrupoGrupoGrupoGrupoGrupo ConsensoConsensoConsensoConsensoConsensoConsensoConsensoConsensoConsenso dedededededededede EstadosEstadosEstadosEstadosEstadosEstadosEstadosEstadosEstados UnidosUnidosUnidosUnidosUnidosUnidosUnidosUnidosUnidos yyyyyyyyy Europa;Europa;Europa;Europa;Europa;Europa;Europa;Europa;Europa; ACRACRACRACRACRACRACRACRACR 555555555 ColegioColegioColegioColegioColegioColegioColegioColegioColegio AmericanoAmericanoAmericanoAmericanoAmericanoAmericanoAmericanoAmericanoAmericano dedededededededede Reumatología;Reumatología;Reumatología;Reumatología;Reumatología;Reumatología;Reumatología;Reumatología;Reumatología; 95%95%95%95%95%95%95%95%95% CICICICICICICICICI 555555555 intervalointervalointervalointervalointervalointervalointervalointervalointervalo dedededededededede confianza del 95%.

† Score valores mayores que o igual al valor de corte definen un caso. Los puntos de corte fueron elegidos en cada caso al peso sensibilidad y especificidad igualmente (primera fila para cada criterio de puntuación) o de peso especificidad para ser dos veces tan importante como la sensibilidad (segunda fila para cada calificación criterio).

‡ El análisis de decisión multicriterio (MCDA) ponderaciones se basan en la clasificación por pares de alternativas. § La logística y los pesos modificados

como resultado de la calificación por el clínico experto de las viñetas de desarrollo seleccionados al azar entre el conjunto de datos 3-cohorte. La versión

modificada de la puntuación asignada logística pesos igual a la puntuación de tinción ocular, prueba de Schirmer, y artículos de caudal conjunto de saliva

sin estimular.

SHIBOSKI ET AL

TablaTabla 3.3. ColegioColegio AmericanoAmericano dede ReumatologíaReumatología criterioscriterios dede clasificaciónclasificación // LigaLiga EuropeaEuropea ContraContra elel

ReumatismoReumatismo parapara SjSj primariaprimaria €€

drome:drome: LaLa clasificaciónclasificación dede SjSj primariaprimaria €€

syn de Ogren

El síndrome de Ogren se aplica a

cualquier individuo que cumple con los criterios de inclusión, * no tiene ninguna de las condiciones

mencionadas como criterios de exclusión, † y tiene una puntuación de $ 4 cuando se suman los pesos de

los criterios de 5 puntos a continuación.

ít.

Peso / puntuación

La encuesta redcap, la búsqueda de consenso sobre los criterios finales proyectos, dado el 98% de consenso médico experto en el uso de la puntuación logística modificada como base para proyectos de criterios finales, con la condición de caso basado en una puntuación de

psps 4,4, yy elel acuerdoacuerdo parapara seguirseguir adelanteadelante concon lala validaciónvalidación dede estosestos criterios. La definición criterio final se presenta en la Tabla 3.

glándula salival labial con linfocítica focal sialadenitissialadenitissialadenitis puntuaciónpuntuaciónpuntuación yyy elelel focofocofoco dedede $$$ 1/41/41/4 mmmmmm focosfocosfocos 222 ‡‡‡ Anti-SSA / Ro positivo La tinción ocular Puntuación $ 5 (o van Bijsterveld

anotar $ 4) en al menos 1 eye§¶

de Schirmer prueba # 5 mm / 5 minutos en al menos 1 eye§

el flujo de saliva no estimulada toda

tasa # 0.1 ml / minute§ #

3 ValidaciónValidación dede loslos criterioscriterios dede candidatos.candidatos. SeSe hanhan comparadocomparado loslos datosdatos de validación y desarrollo con respecto a las variables clave, incluyendo sus

1 asociaciones con la clasificación de resultado. La concordancia global era bastante alta, lo que indica no hay grandes diferencias aparentes en los 2

1 conjuntosconjuntos dede datosdatos (véase(véase lala TablaTabla suplementariasuplementaria 1,1, enen elel ArtritisArtritis yy ReumatologíaReumatología

1

3

* Estos criterios de inclusión son aplicables a cualquier paciente con al menos 1 síntoma de

ocular o sequedad de boca, que se define como una respuesta positiva al menos 1 de las siguientes preguntas: 1) ¿Ha tenido diaria, persistentes, ojos secos molestos durante más de 3 meses ? 2) ¿Tiene una sensación recurrente de arena o grava en los ojos? 3) ¿Utiliza sustitutos lagrimales más de 3 veces al día? 4) ¿Ha tenido la sensación de sequedad en la boca todos los días durante más de 3 meses? 5) ¿Usted Toma líquidos con frecuencia para ayudar en la deglucióndeglución dede loslos alimentosalimentos secossecos ?,?, oo enen loslos queque hayhay sospechasospecha dede SjSj €€

El síndrome de Ogren (SS) de la europea

cuestionario del Índice de Actividad de la Liga Contra el Reumatismo SS de Enfermedades (al menos 1 dominio con un elemento positivo).

† Los criterios de exclusión incluyen diagnóstico previo de cualquiera de las siguientes condiciones, que excluirían diagnóstico de SS y la participación en los estudios de la SS o ensayos terapéuticos debido a la superposición de las características clínicas o interferencia con las pruebas de criterios: 1) la historia de tratamiento cabeza y la radiación cuello, 2) infección de hepatitis C activa (con confirmación por reacción en cadena de la polimerasa, 3) SIDA, 4) sarcoidosis, 5) amiloidosis, 6) enfermedad de injerto contra huésped, 7) enfermedades relacionadas con el IgG4. ‡ El examen histopatológico debe ser realizada por un patólogo con experiencia en el diagnóstico de sialoadenitis linfocíticas focales y se centran recuento de puntuación, utilizando el protocolo descrito por Daniels et al (30). § Los pacientes que normalmente está tomando medicamentos anticolinérgicos deben ser evaluados para signos objetivos de hipofunción salival y sequedad ocular después de un intervalo suficiente sin estos medicamentos a fin de que estos componentes para ser una medida válida de la sequedad oral y ocular. ¶ Ocular tinción puntaje descrito por Whitcher et al (27); van Bijsterveld puntuación descrito por van Bijsterveld (26).

# todo no estimulada de medición de caudal saliva descrito por Navazesh y Kumar (32). 8

versión de la puntuación de logística que asigna pesos equivalentes a la OSS, resultado de la prueba de Schirmer, y artículos de UWS, reflejando las opiniones clínico experto que UWS deben ser ponderados de manera similar al resultado de la prueba de Schirmer y para mayor coherencia con los resultados de la encuesta MCDA (tabla 1). El análisis ROC produjo resultados similares a la puntuación de logística (AUC 0,98) (Tabla 2).

La Tabla 2 también presenta estadísticas kappa medición acuerdo entre las clasificaciones de resultados a partir de los 3 puntajes de criterio suplentes y clasificaciones con el ECGA existente y criterios de la ACR. Los resultados indican altos niveles de acuerdo, con los valores más fuertes obtuvieron de la logística y modificar las puntuaciones logísticas con un punto de corte seleccionado de peso sensibilidad y especificidad por igual.

sitio web en http://onlinelibrary.wiley.com/doi/10.1002/art. 39859 / abstracto). La validación inicial de los criterios seleccionados se basó en la sensibilidad estimada y especificidad utilizando las respuestas clínico-expertos en el conjunto de datos de validación completo. La sensibilidad fue del 96% (IC 95% 92-98%), y la especificidad del 95% (IC 95% 92-97%). La validación también se realizó en el subconjunto de 49 difíciles de clasificar los casos y no casos, para los que la sensibilidad fue del 83% (IC 95% 66-93%) y la especificidad del 100% (IC 95%

77-100%).

Discusión

Presentamos aquí un sistema internacional de criterios de clasificación de SS primario, desarrollado y validado utilizando métodos aprobados por los comités de ambos ACR y EULAR que supervisan los criterios de clasificación. Estos criterios son aplicables a cualquier paciente con al menos 1 síntoma de sequedad ocular u oral (basado en preguntas AECG) (11) o sospecha de SS debido a las características sistémicas derivadas de la medida ESSDAI (16) con el punto de dominio positiva al menos 1. Los criterios no se aplican a individuos con un diagnóstico previo de una condición (a partir de una lista especificada previamente) que excluiría la participación en SS ensayos terapéuticos primarios debido a la superposición de las características clínicas o interferencia con pruebas de criterio. Los nuevos criterios de clasificación se basan en pruebas objetivas 5 / artículos. Los individuos se clasifican como SS primario si tienen una puntuación total de $ 4, derivada de la suma de los pesos asignados a cada prueba / elemento positivo (con sialoadenitis linfocítica focal con el foco anotar $ 1 y anti-SSA / Ro positividad que tiene los más altos pesos [3 cada uno] y OSS $ 5 [o VBS $ 4], en al menos 1 ojo, de Schirmer resultado de la prueba # 5 mm / 5 minutos en al menos 1 ojo, y la tasa de flujo UWS # 0,1 ml / minuto con un peso de 1 cada uno). Encontramos que los criterios funcionan muy bien cuando validado utilizando viñetas que describen el estado de los pacientes con SS primario definido por la opinión de expertos. Los criterios retenidos alta sensibilidad y especificidad en un subconjunto de 49 viñetas para cuyo caso / no caso distinción era difícil. de Schirmer prueba resultado # 5 mm / 5 minutos en al menos 1 ojo, y la tasa de flujo UWS # 0,1 ml / minuto con un peso de 1 cada uno). Encontramos que los criterios funcionan muy bien cuando validado utilizando viñetas que describen el estado de los pacientes con SS primario definido por la opinión de expertos. Los criterios retenidos alta sensibilidad y especificidad en un subconjunto de 49 viñetas para cuyo caso / no caso distinción era difícil. de Schirmer prueba resultado # 5 mm / 5 minutos en al menos 1 ojo, y la tasa de flujo UWS # 0,1 ml / minuto con un peso de 1 cada uno). Encontramos que los criterios funcionan muy bien cuando validado utilizando viñetas que describen el estado de los pacientes con SS primario definido por la opinión de expertos. Los criterios retenidos alta sensibilidad y especi

CRITERIOS DE CLASIFICACIÓN ACR / EULAR para SS PRIMARIA

9

La forma de los criterios propuestos mejora en los criterios anteriores, en el que se basan en una suma ponderada de los artículos, con pesos derivados de la opinión de expertos consenso y análisis de los datos del paciente. Además, serología positiva para anti-SSB / La falta de Antissa / Ro ya no se considera un elemento criterios. Por ejemplo, en la cohorte de validación, 15 individuos fueron anti-SSB / La positiva en ausencia de anticuerpos anti-SSA / Ro y sialoadenitis linfocítica focal sobre LSG biopsia, y por lo tanto habrían sido clasificadas como no-SS utilizando los nuevos criterios. Sin embargo, 12 de ellos han sido clasificados como SS primario basado tanto en la ECGA y los criterios de la ACR 2012, y esto sería muy probable que haya sido un error de clasificación.

Las mejoras de los 2012 criterios del ACR incluyen la adición de la prueba de Schirmer y el UWS, el uso de un umbral más alto para la OSS ($ 5), y el uso opcional del VBS como una alternativa a la OSS (en los casos en que un oftalmólogo entrenado en la OSS no está disponible). Las modificaciones adicionales incluyen la eliminación de alto título de ANA y FR positivo como artículos. Las mejoras de los criterios AECG 2002 incluyen síntomas orales y oculares que se consideran parte de determinación de elegibilidad (es decir, la elegibilidad de los individuos que deben evaluarse

para SS utilizando los criterios) en lugar de servir como criterios de artículos,

el OSS se incluye como una alternativa a la VBS, y sialografía y la

gammagrafía salivar se han omitido. Además, los nuevos criterios consideran signos sistémicos y biomarcadores de activación de células B (determinado mediante el ESSDAI) en la determinación de elegibilidad inclusión, lo que permitirá el diagnóstico de formas sistémicas y anteriores de la enfermedad cuando sicca características no están ya presentes. En comparación con los criterios ECGA, también se han actualizado las condiciones de exclusión.

enfermedad relacionada con IgG4-ha sido añadido, la infección por hepatitis

C requiere confirmación por reacción en cadena de la polimerasa, y el

linfoma preexistente es permisible, desde el diagnóstico de SS se hace a veces después de una ocurrencia linfoma anterior.

Los puntos fuertes de nuestro enfoque son los siguientes:

1) la asignación de los pesos criterios de posición métodos de consenso para la cuantificación de la opinión de expertos con el análisis estadístico de confirmación de viñetas de pacientes reales clasificados por el clínico expertos combinados; 2) el grupo de trabajo era internacional y representó una gama de especialidades clínicas (65% reumatólogos, 18% medicina oral / especialistas de patología, y un 16% oftalmólogos); y 3) los métodos se han aplicado con éxito en el desarrollo y la validación de los criterios de clasificación ACR / EULAR para la artritis reumatoide (21,22) y la esclerosis sistémica (23,24). Otra ventaja de estos métodos es que son adaptables a futuras modificaciones de los criterios que puedan surgir con la adopción de nuevas

pruebas de diagnóstico, tales como la ecografía parótida, o mejorados ensayos serológicos. Por ejemplo, algunas investigaciones sugieren que puede ser importante para distinguir entre ensayos de anticuerpos monoespecíficos para Ro 60 o Ro 52 (39-42), aunque serán necesarios más estudios de validación antes de que puedan ser utilizados para la clasificación de pacientes. Una limitación común, común a los criterios para muchas enfermedades reumáticas, es el uso de juicio clínico experto en la ausencia de un objetivo “patrón oro” para la definición de la enfermedad, y el efecto asociado de la resultante “circularidad” en el rendimiento medido de criterios conjuntos .

La principal aplicación de los criterios de clasificación es el reclutamiento en los ensayos clínicos y estudios. Aunque nuestro estudio se centró en la clasificación de SS primario, los criterios propuestos pueden ser aplicables a SS asociado con otras enfermedades autoinmunes. Sin embargo, se necesita más investigación para confirmar esto.

El paisaje de la SS ha cambiado en los últimos años, debido tanto a los índices de actividad de la enfermedad recientemente validados y la disponibilidad de nuevos agentes terapéuticos. Usando la metodología consistente con otros criterios de clasificación recientes aprobados por EULAR ACR /, hemos desarrollado un único conjunto de criterios de clasificación de consenso basadas en datos para SS primario, que llevan a cabo bien en la validación y están bien adaptados, como criterios de entrada para ensayos clínicos.

EXPRESIONES DE GRATITUD

Nos gustaría expresar nuestro agradecimiento a Steve Taylor y

KathyKathy HammittHammitt (Sj(Sj €€

Fundación Síndrome de Ogren)

para la celebración de 3 de las reuniones de los criterios internacionales SS Grupo de Trabajo,Trabajo, elel Dr.Dr. P.P. eded EricEric DesmoulinsDesmoulins porpor susu importanteimportante laborlabor enen lala preparaciónpreparación deldel conjunto de datos de cohortes de París-Sur, y Mi Lam por su contribución en la preparación del conjunto de datos SECA. Estamos muy agradecidos a Paul Hansen y Franz Ombler, los desarrolladores y propietarios del software 1000Minds (https: // www.1000minds.com), que nos ha concedido un Premio Académico, proporcionando el acceso y el apoyo técnico para su software. También expresamos nuestro mayor agradecimiento a todos los participantes que se inscribieron en las 3 cohortes de pacientes utilizados para el desarrollo y la validación de los criterios, y para los miembros clinicianexpert del grupo de trabajo internacional para asistir a reuniones, proporcionando información valiosa como parte de estas reuniones, y respondiendo a varias rondas de encuestas, incluyendo clasificación de múltiples viñetas.

CONTRIBUCIONES DE AUTOR

Todos los autores han participado en la redacción del artículo o la revisión crítica de su contenido intelectual importante, y todos los autores aprobó la versión final que se publicarán. El Dr. SC Shiboski tuvo pleno acceso a todos los datos en el estudio y se responsabiliza de la integridad de los datos y la exactitud del análisis de datos.

estudioestudio dede lala concepciónconcepción yy elel diseño.diseño. CHCH Shiboski,Shiboski, SCSC Shiboski,Shiboski, Seror,Seror, Bowman,Bowman, Mariette.Mariette.

AdquisiciónAdquisición dede datos.datos. CHCH Shiboski,Shiboski, SCSC Shiboski,Shiboski, Seror,Seror, Criswell,Criswell, Labetoulle,Labetoulle, Lietman,Lietman, Rasmussen, Scofield, Vitali, Bowman, Mariette.

10

SHIBOSKI ET AL

AnálisisAnálisis ee interpretacióninterpretación dede datos.datos. CHCH Shiboski,Shiboski, SCSC Shiboski,Shiboski, Seror,Seror, Criswell,Criswell, Labetoulle,Labetoulle, Lietman, Rasmussen.

Referencias

1.

Bloch KJ, Buchanan WW, Wohl MJ, Bunim JJ. El síndrome de Sjoegren: un estudio clínico, patológico y serológica de sesenta y dos casos. Medicina (Baltimore) 1965; 44: 187-231.

2.2.

ShearnShearn MA.MA. sjsj €€

El síndrome de Ogren. Philadelphia: WB Saunders;

1971.

3.

Daniels TE, Silverman S Jr, Michalski JP, Greenspan JS, Sylvester RA, Talal N. El

componentecomponente oraloral dede SjSj €€

syn de Ogren

drome. Oral Surg Oral Med Oral Pathol 1975; 39: 875-85.

4.4.

OhfujiOhfuji T.T. SjSj €€

revisión del Comité de Investigación de la Enfermedad de Ogren en

informes de investigación: informe anual del Ministerio de Salud y Bienestar. Tokio:

Ministerio japonés de Salud; 1977.

5.5.

ManthorpeManthorpe R,R, Frost-LarsenFrost-Larsen K,K, IsagerIsager H,H, PrausePrause JU.JU. sjsj €€

de Ogren

Síndrome de Down: una revisión con énfasis en las características inmunológicas. Alergia 1981; 36: 139-53.

6.6.

HommaHomma M,M, TojoTojo T,T, MM Akizuki,Akizuki, YamagataYamagata H.H. CriteriosCriterios parapara SjSj €€ El síndrome de Ogren en Japón. Scand J Rheumatol Suppl 1986; 61: 26-7.

7.

Skopouli FN, Drosos AA, Papaioannou T, Moutsopoulos HM. criterios diagnósticos

preliminarespreliminares parapara SjSj €€

El síndrome de Ogren. Scand J

Rheumatol Suppl 1986; 61: 22-5.

8.8.

FoxFox RI,RI, CACA Robinson,Robinson, CurdCurd JG,JG, KozinKozin M,M, HowellHowell FV.FV. sjsj €€

de Ogren

Síndrome de Down: criterios propuestos para la clasificación. Arthritis Rheum 1986; 29: 577-85.

9.

Vitali C, Bombardieri S, Moutsopoulos HM, Balestrieri G, Bencivelli W, Bernstein RM, et al. CriteriosCriterios preliminarespreliminares parapara lala clasificaciónclasificación dede SjSj €€

El síndrome de Ogren: resultados de un con- prospectivo

la acción concertada con el apoyo de la Comunidad Europea. Arthritis Rheum 1993; 36:

340-7.

10.

Fujibayashi T, Sugai S, Miyasaka N, Hayashi Y, Tsubota K. criterios revisados ​​japonesas

parapara SjSj €€

El síndrome de Ogren (1999): dispo-

capacidad y validez. Mod Rheumatol 2004; 14: 425-34.

11.

Vitali C, Bombardieri S, Jonsson R, Moutsopoulos HM, Alexander EL, Carsons SE, et al.

CriteriosCriterios dede clasificaciónclasificación dede SjSj €€

syn de Ogren

drome: una versión revisada de los criterios europeos propuestos por el Grupo de Consenso Americana-Europea. Ann Rheum Dis 2002; 61: 554-8.

12.

Shiboski SC, Shiboski CH, Criswell LA, Baer AN, Challacombe S,S, LanfranchiLanfranchi H,H, etet al.al. AmericanAmerican CollegeCollege ofof RheumatologyRheumatology criterioscriterios dede clasificaciónclasificación parapara SjSj €€

 

El síndrome de Ogren: una, basada en datos de expertos

 

enfoqueenfoque dede consensoconsenso enen elel SjSj €€

Colaboración Internacional de Ogren

Clínica cohorte Alianza. Res Arthritis Care (Hoboken) 2012; 64: 475-87.

13.

Rasmussen A, JA hielo, Li H, Grundahl K, Kelly JA, Radfar L, et al. Comparación de la American-EuropeanAmerican-European ConsensusConsensus GroupGroup SjSj €€

criterios de clasificación síndrome de Ogren a nuevas propuestas de American College of Rheumatology criterios en una gran cohorte seca, caracterizado cuidadosamente. Ann Rheum Dis 2014; 73: 31-8.

14.

Seror R, Gottenberg JE, Devauchelle-Pensec V, Dubost JJ, le Guern V, Hayem G, et al. Sj LigaLiga EuropeaEuropea ContraContra elel ReumatismoReumatismo €€

Índice de Actividad de la Enfermedad Síndrome de Ogren y Liga Europea Contra el

ReumatismoReumatismo SjSj €€

Índice informados por los pacientes del síndrome de Ogren:

unauna imagenimagen completacompleta dede SjSj primariaprimaria €€ Los pacientes con síndrome de Ogren. Arthri- Res tis Care (Hoboken) 2013; 65: 1358-64.

15.

Seror R, Mariette X, Bowman S, Baron G, Gottenberg JE, Bootsma H, et al. La detección exactaexacta dede cambioscambios enen lala actividadactividad dede lala enfermedadenfermedad enen SjSj primariaprimaria €€

El síndrome de Ogren por la Liga Europea

ContraContra elel ReumatismoReumatismo SjSj €€

Índice de Actividad de la Enfermedad Síndrome de Ogren.

Res Arthritis Care (Hoboken) 2010; 62: 551-8.

16.

Seror R, Ravaud P, Bowman SJ, Baron G, Tzioufas A, Theander

E,E, etet al.al. SjSj EULAREULAR €€

Índice de Actividad de la Enfermedad Síndrome de Ogren:

desarrollodesarrollo dede unun índiceíndice dede actividadactividad dede lala enfermedadenfermedad sistémicasistémica dede consensoconsenso parapara SjSj primariaprimaria €€

El síndrome de Ogren. Ann RheumDis 2010; 69: 1103-9.

17. Seror R, Ravaud P, Mariette X, Bootsma H, Theander E, Hansen

A,A, etet al.al. SjSj EULAREULAR €€

(ESSPRI):(ESSPRI): desarrollodesarrollo dede unun índiceíndice dede pacientepaciente dede consensoconsenso parapara SjSj primariaprimaria €€

Índice informados por los pacientes del síndrome de Ogren

El síndrome de Ogren. Ann RheumDis 2011; 70: 968-72.

18.18. SJSJ Bowman,Bowman, FoxFox RI.RI. CriteriosCriterios dede clasificaciónclasificación dede SjSj €€ Drôme: nada nunca se detiene! Ann Rheum Dis 2014; 73: 1-2.

19. La clasificación y el Subcomité de Respuesta criterios del Colegio Americano de Reumatología Comité de Medidas de calidad. Desarrollo de criterios de clasificación y respuesta para las enfermedades reumáticas. Arthritis Rheum 2006; 55: 348-52.

syn de Ogren

20. Dougados M, L. Criterios de clasificación Gossec para enfermedades reumáticas: ¿Por qué y cómo? Arthritis Rheum 2007; 57: 1112-5.

21. Aletaha D, Neogi T, Silman AJ, Funovits J, Felson DT, BinghamCO III, et al. 2010 reumatoide criterios de clasificación de la artritis: un Colegio Americano de Reumatología iniciativa de colaboración / Liga Europea Contra el Reumatismo. Ann RheumDis 2010; 69: 1580-8.

22. Aletaha D, Neogi T, Silman AJ, Funovits J, Felson DT, Bingham CO III, et al. 2010 reumatoide criterios de clasificación de la artritis: un Colegio Americano de Reumatología iniciativa de colaboración / Liga Europea Contra el Reumatismo. Arthritis Rheum 2010; 62:

2569-81.

23. Van den Hoogen M, D Khanna, Fransen J, Johnson SR, Baron M, Tyndall A, et al. 2013 criterios de clasificación de la esclerosis sistémica: un Colegio Americano de Reumatología iniciativa de colaboración / Liga Europea Contra el Reumatismo. Arthritis Rheum 2013; 65: 2737-47.

24. Van den Hoogen F, Khanna D, Fransen J, Johnson SR, Baron M, Tyndall A, et al. 2013 criterios de clasificación de la esclerosis sistémica: un Colegio Americano de Reumatología iniciativa de colaboración / Liga Europea Contra el Reumatismo. Ann Rheum Dis 2013; 72: 1747-55.

25. Hansen P, Ombler F. Un nuevo método para registrar modelos de valor de múltiples atributos utilizando las clasificaciones por pares de alternativas. J Multi-Crit Decis Anal 2008; 15: 87-107.

26. Van Bijsterveld OP. Las pruebas de diagnóstico en el síndrome de Sicca. Arco Ophthalmol 1969; 82: 10-4.

27. Whitcher JP, Shiboski CH, Shiboski SC, Heidenreich AM, Kitagawa K, Zhang S, et al. Un métodométodo cuantitativocuantitativo simplificadosimplificado parapara lala evaluaciónevaluación dede lala queratoconjuntivitisqueratoconjuntivitis secaseca deldel SjSj €€ Síndrome de Ogren

Registro internacional. Am J Ophthalmol 2010; 149: 405-15.

29. Neogi T, Aletaha D, Silman AJ, Naden RL, Felson DT, Aggarwal R, et al. El Colegio Americano de 2010 Reumatología criterios de clasificación / Liga Europea Contra el

Reumatismo para la artritis reumatoide: la fase 2 informe metodológico. Arthritis Rheum 2010; 62: 2582-91.

30. Daniels TE, Cox D, Shiboski CH, Schiodt M, Wu A, Lanfranchi

H, et al. Las asociaciones entre los diagnósticos histopatológicos de la glándula salival y

característicascaracterísticas fenotípicasfenotípicas dede SjSj €€

1.726 participantes del registro. Arthritis Rheum 2011; 63: 2021-30.

El síndrome de Ogren entre

31. Navazesh M. Los métodos para la recogida de saliva. Ann NY Acad Sci 1993; 694: 72-7.

32. Navazesh M, Kumar SK, Universidad del Sur de California, Escuela de Odontología. La

medición de flujo salival: desafíos y oportunidades. J Am Dent Assoc 2008; 139 Suppl:

35S-40S.

33. Proyecto R. URL: http://www.R-project.org.

34. Harris PA, Taylor R, Thielke R, Payne J, González N, Conde JG. Investigación captura electrónica de datos (redcap): un proceso de flujo de trabajo y la metodología basada en metadatos para proporcionar soporte informático traslacional de investigación. J Biomed Inform 2009; 42: 377-81.

35. Strobl C, Boulesteix AL, Kneib T, T Augustin, Zeileis A. importancia de la variable condicional para los bosques aleatorios. BMC Bioinformatics 2008; 9: 307.

36. Schisterman EF, Perkins NJ, Liu A, Bondell H. Optimal punto de corte y su índice Youden correspondiente para discriminar las personas que utilizan las muestras de sangre combinadas. Epidemiología 2005; 16: 73-81.

37. Sullivan LM, Massaro JM, D'Agostino RB sor Presentación de datos multivariados para uso clínico: las funciones de puntuación de riesgo de Framingham Study. Stat Med 2004; 23:

1631-60.

CRITERIOS DE CLASIFICACIÓN ACR / EULAR para SS PRIMARIA

11

38. Baer AN, McAdams DeMarco M, Shiboski SC, Lam MY, Challacombe S, Daniels TE, et al. El perfil de anticuerpos SSB-positivo / SSA-negativo no está asociado con características fenotípicasfenotípicas claveclave dede SjSj €€

El síndrome de Ogren. Ann RheumDis 2015; 74: 1557-1561.

39. Defendenti C, Atzeni F, Spina MF, Grosso S, Cereda A, Guercilena G, et al. Aspectos clínicos y de laboratorio de autoanticuerpos Ro / SSA52. Autoimmun Rev 2011; 10: 150-4.

40. Dugar M, Cox S, Limaye V, Gordon TP, Roberts-Thomson PJ. Utilidad diagnóstica de anti-Ro52 detección en la autoinmunidad sistémica. Todos los niveles Med J 2010; 86:

79-82.

41. Ghillani P, Andre C, Toly C, Rouquette AM, Bengoufa D, Nicaise P, et al. Significado clínico de la anti-Ro52 (TRIM21) anticuerpos no asociado con anticuerpos anti-SSA 60 kDa:

resultados de un estudio multicéntrico. Autoimmun Rev 2011; 10: 509-13.

42. Un Menéndez, Gómez J, E Escanlar, Caminal Montero-L, Mozo L. Asociaciones clínicas de anti-SSA / Ro60 y anticuerpos anti-Ro52 / TRIM21: utilidad diagnóstica de su detección separada. Autoinmunidad 2013; 46: 32-9.

APÉNDICEAPÉNDICE A:A: LALA SJSJ INTERNACIONALINTERNACIONAL €€

OGREN'S

GRUPO DE TRABAJO DE SÍNDROME CRITERIOS

LosLos miembrosmiembros dede lala SjSj InternacionalInternacional €€

Criterios de síndrome de Ogren

Grupo de Trabajo, además de los autores, fueron los siguientes: Dres. AM Heidenreich, H. Lanfranchi, y C. Vollenweider (Argentina); Dr. M. Schiødt (Dinamarca); Dres. V. Devauchelle, JE Gottenberg,Gottenberg, yy A.A. Saraux,Saraux, yy representanterepresentante deldel pacientepaciente MaggyMaggy PinceminPincemin (Francia);(Francia); Dr.Dr. T.T. DD €€

orner (Alemania); Dr. A. Tzoufias (Grecia); Dres. C. Baldini, S. Bombardieri, y S. De Vita (Italia); Dres. K. Kitagawa, T. Sumida, y

H.

Umehara (Japón); Dres. H. Bootsma, AA Kruize, TR Radstake, y A. Vissink (Países Bajos); El

Dr.

R. Jonsson (Noruega); Dr. M. Ramos-Casals (España); El Dr. E. Theander (Suecia); Dres. S.

Challacombe, B. Fisher, B. Kirkham, G. Larkin, F. Ng, y S. Rauz (Reino Unido); y los Dres. E.

Akpek, J. Atkinson, AN Baer, ​​S. Carsons, N. Carteron, T. Daniels, B. Fox, J. Greenspan, G. Illei,

D. Nelson, A. Parke, S. Pillemer, B. Segal , K. Sivils, EW St.Clair, D. Piedra, F. Vivino, y A. Wu, y

representante de los pacientes Kathy Hammitt (US).