Вы находитесь на странице: 1из 25

ACCIÓNACCIÓNACCIÓNACCIÓN DEDEDEDE TUTELA/DerechoTUTELA/DerechoTUTELA/DerechoTUTELA/Derecho aaaa lalalala salud/salud/salud/salud/ ElElElEl tratamientotratamientotratamientotratamiento integralintegralintegralintegral lolololo ordenaordenaordenaordena elelelel juezjuezjuezjuez conformeconformeconformeconforme aaaa lolololo prescritoprescritoprescritoprescrito porporporpor elelelel médicmédicmédicmédicoooo tratante.tratante.tratante.tratante.

“Frente a la condena en abstracto que presuntamente vulnera el derecho de defensa de la demandada, considera la Sala que debe recordársele al impugnante, que quien decide el tratamiento pertinente para el agenciado, como el bien lo afirma, es el profesional de la medicina, su médico tratante y no el Juez Constitucional, es decir, que el Juez de tutela le corresponde el estudio de los derechos fundamentales de la parte accionante y decidir si los hechos implican una vulneración a los mismos, no a limitar dicho tratamiento y faltar a la integralidad que se ha sostenido en la doctrina constitucional. Lo anterior implica, que la condena en abstracto como el impugnante la denomina, obedece a que al no conocerse cuál es el tratamiento médico que llegare a requerir el señor JEJEN EUSCATEGUI, y teniendo en cuenta que se limita el campo de acción del juez constitucional simplemente a lo obrante en el expediente, en pro de la salvaguarda del derecho a la salud y a la vida, debe aplicarse un tratamiento integral impidiendo que más adelante se pudiera negar cualquier tipo de servicio o tratamiento ordenado por el galeno tratante. Así las cosas, frente a dicho argumento, no puede pretender el señor Director de CAPRECOM Seccional Cauca, limitar las órdenes de los jueces de la República con función constitucional, pues el juez de tutela puede, con argumentos jurídicos, fallar ultra y extra petita, toda vez que como en el presente caso, teniendo en cuenta la edad y condición médica del actor, se encuentra que no puede someterse en un futuro al actor a trámites innecesarios que conlleven una resulta fatal”.

ACCIÓNACCIÓNACCIÓNACCIÓN DEDEDEDE TUTELA/TUTELA/TUTELA/TUTELA/ DerechoDerechoDerechoDerecho aaaa lalalala Salud/SufragSalud/SufragaciónSalud/SufragSalud/Sufragaciónaciónación dededede loslosloslos gastosgastosgastosgastos dededede transportetransportetransportetransporte deldeldeldel pacientepacientepacientepaciente aaaa otraotraotraotra ciudad.ciudad.ciudad.ciudad.

“Para que no quede duda alguna, retomando las consideraciones anteriormente traídas a colación en este fallo, en sentencia T-1158 de 2001 la H. Corte Constitucional sostuvo que el postulado de accesibilidad al servicio supone la remoción de todos los obstáculos formales y materiales que limiten el goce de éste. En tal sentido, la estructura sobre la cual descansa el Sistema de Seguridad Social en Salud, compuesta, de acuerdo a la Ley 100 de 1993, por un conjunto de normas, instituciones y

Expediente

2011 00257 01

Actor

JOSÉ ELÍ JEJEN EUSCATEGUI

Demandada

SECRETARÍA DEPARTAMENTAL DE SALUD DEL CAUCA Y CAPRECOM

Acción

TUTELA – SEGUNDA INSTANCIA

Apelación

SENTENCIA DE 9 DE JUNIO DE 2.011

Procedencia:

JUZGADO QUINTO ADMINISTRATIVO DEL CIRCUITO DE POPAYÁN

procedimientos, debe asegurar que la efectiva prestación del servicio no sea entorpecida por la existencia de barreras que promuevan factores de discriminación que alejen a determinados sectores de la población de la posibilidad de disfrutar de este servicio. Es así como encontramos que el hecho de no contar con la capacidad económica suficiente para acarrear con los gastos de transporte y así recibir la atención requerida, se constituye en un claro obstáculo a la prestación integral del servicio, pues de una u otra manera se le impide acceder al tratamiento médico indispensable para su óptima evolución, convirtiéndose en una clara violación al derecho a la salud, a toda luz evidente basándonos en el

desarrollo Jurisprudencial que ha tenido este contenido. (…) En relación con la falta de capacidad económica de la agenciada, la jurisprudencia constitucional ha señalado una presunción en el caso de las personas que pertenecen al régimen subsidiado y que han sido clasificados por la encuesta SISBEN, por lo que, en estos eventos, las condiciones descritas permiten presumir que ni el señor JOSÉ ELÍ JEJEN EUSCATEGUI, ni muchos menos su esposa en calidad de agente oficioso, cuentan con los recursos suficientes para sufragar por ellas mismas los costos de transporte que implican el traslado a la ciudad de Cali para que la Agenciada reciba la atención de rehabilitación anteriormente descrita”.

la atención de rehabilitación anteriormente descrita”. REPUBLICAREPUBLICAREPUBLICAREPUBLICA DEDEDEDE

REPUBLICAREPUBLICAREPUBLICAREPUBLICA DEDEDEDE COLOMBIACOLOMBIACOLOMBIACOLOMBIA RAMARAMARAMARAMA JUDICIALJUDICIALJUDICIALJUDICIAL DELDELDELDEL PODERPODERPODERPODER PÚBLICOPÚBLICOPÚBLICOPÚBLICO TRIBUNALTRIBUNALTRIBUNALTRIBUNAL CONTENCIOSOCONTENCIOSOCONTENCIOSOCONTENCIOSO ADMINISTRATIVOADMINISTRATIVOADMINISTRATIVOADMINISTRATIVO DELDELDELDEL CAUCACAUCACAUCACAUCA

Popayán,Popayán,Popayán,Popayán, quincequincequincequince ((1((115155)5))) dededede juliojuliojuliojulio dededede dosdosdosdos milmilmilmil onceonceonceonce (2.01(2.011(2.01(2.0111)1)))

MagistradoMagistradoMagistradoMagistrado Ponente:Ponente:Ponente:Ponente: MOISÉSMOISÉSMOISÉSMOISÉS RODRÍGUEZRODRÍGUEZRODRÍGUEZRODRÍGUEZ PÉREZPÉREZPÉREZPÉREZ

ExpedienteExpedienteExpedienteExpediente

2012011201201111

00200257002002575757

00100111

ActorActorActorActor

JOSÉJOSÉJOSÉJOSÉ ELÍELÍELÍELÍ JEJENJEJENJEJENJEJEN EUSCATEGUIEUSCATEGUIEUSCATEGUIEUSCATEGUI

DemandadaDemandadaDemandadaDemandada SECRETARÍASECRETARÍASECRETARÍASECRETARÍA DEPARTAMENTALDEPARTAMENTALDEPARTAMENTALDEPARTAMENTAL DEDEDEDE SALUDSALUDSALUDSALUD DELDELDELDEL CAUCACAUCACAUCACAUCA YYYY

CAPRCAPRECOMCAPRCAPRECOMECOMECOM

2

Expediente

2011 00257 01

Actor

JOSÉ ELÍ JEJEN EUSCATEGUI

Demandada

SECRETARÍA DEPARTAMENTAL DE SALUD DEL CAUCA Y CAPRECOM

Acción

TUTELA – SEGUNDA INSTANCIA

Apelación

SENTENCIA DE 9 DE JUNIO DE 2.011

Procedencia:

JUZGADO QUINTO ADMINISTRATIVO DEL CIRCUITO DE POPAYÁN

AcciónAcciónAcciónAcción

TUTELATUTELATUTELATUTELA –––– SEGUNDASEGUNDASEGUNDASEGUNDA INSTANCIAINSTANCIAINSTANCIAINSTANCIA

SENTENCIASENTENCIASENTENCIASENTENCIA No.No.No.No.

I.I.I.I. OBJETOOBJETOOBJETOOBJETO AAAA DECIDIRDECIDIRDECIDIRDECIDIR

Decide la Sala la impugnación formulada por el Director de CAPRECOM

contra la sentencia de 9 de junio de 2.011, proferida por el Juzgado Quinto

Administrativo del Circuito de Popayán, en la que se tutelaron los derechos

a la salud, a la vida, a la seguridad social, a la dignidad humana, a la

especial protección de los derechos de los adultos mayores,

presuntamente vulnerados al actor, al omitir la prestación de los servicios

ordenados por los médicos especialistas tratantes y someterlo a trámites

administrativos dilatorios que pueden afectar aún más su estado de salud.

Así mismo, negó las pretensiones de suministrar servicios de transporte en

ambulancia a la ciudad de Cali, u otra, pero aseguró que la Entidad deberá

asumir los costos de transporte y alojamiento del paciente y un

acompañante.

III.III.I.I. ACCIONANTEACCIONANTEACCIONANTEACCIONANTE

La presente Acción fue instaurada la señora JOSÉ ELÍ EUSCATEGUI

identificado con C.C. 10.519.470 de Popayán – Cauca.

IIIIIIIIIII.I ACCIACCIONADOACCIACCIONADOONADOONADO

La Acción está dirigida en contra de la SECRETARÍA DEPARTAMENTAL DE

SALUD DEL CAUCA Y CAPRECOM EPS.

IIV.IIV.V.V. ANTECEDENTESANTECEDENTESANTECEDENTESANTECEDENTES

44.44

1

1.1.1.

LaLaLaLa demandademandademandademanda

La señora FLOR DE MARÍA PIAMBA actuando como Agente oficiosa de JOSÉ

ELÍ JEJEN EUSCATEGUI, interpuso acción de tutela en contra de CAPRECOM

3

Expediente

2011 00257 01

Actor

JOSÉ ELÍ JEJEN EUSCATEGUI

Demandada

SECRETARÍA DEPARTAMENTAL DE SALUD DEL CAUCA Y CAPRECOM

Acción

TUTELA – SEGUNDA INSTANCIA

Apelación

SENTENCIA DE 9 DE JUNIO DE 2.011

Procedencia:

JUZGADO QUINTO ADMINISTRATIVO DEL CIRCUITO DE POPAYÁN

Y LA SECRETARÍA DEPARTAMENTAL DE SALUD DEL CAUCA, por la presunta

vulneración del derecho fundamental a la salud en conexidad con la vida.

2.22.2

44.44

LosLosLosLos hechoshechoshechoshechos

Como hechos que sustentan las pretensiones, la agente oficiosa narró los

siguientes:

Manifestó su esposo JOSE ELI JEJEN EUSCATEGUI, es una persona de la

tercera edad, cuenta con 63 años de edad y se encuentra afiliado a la E.P.S.

CAPRECOM, No. 19001002104.

Sostuvo que desde hace aproximadamente cuatro años, su esposo ha sido

diagnosticado con “ENFERMEDAD PULMONAR OBSTRUCTIVA CRÓNICA, NO

ESPECIFICADAD”. El 26 de marzo del presente año se hizo necesario

ingresarlo a cuidados intensivos por orden de los médicos del Hospital

Susana López de Valencia, y le dieron salida el 27 de abril de 2.011.

Afirmó que en la orden de salida se ordenó esquema con inhaloterapia y

rehabilitación pulmonar, igual se ordena procedimiento de “ESPIROMETRIA

PRE Y BRONCODILATADORES, LA CUAL SE DEBE REALIZAR AL MES DE EGRESADO DE LA UNIDAD DE CUIDADOS INTENSIVOS E IGUAL SE ORDENAN 24 SESIONES DE terapia respiratoria, tres sesiones semanales.”

Adujo que inició los trámites para que se ordenaran las terapias y en

CAPRECOM le dieron la orden para dirigirse a la Secretaría Departamental

de Salud del Cauca, quienes posteriormente los enviaron a la Clínica Valle

de Lili en la ciudad de Cali.

Finalmente arguyó: “Nosotros somos personas de la tercera edad no somos pensionado no tenemos recursos económicos con que sufragar los gastos de transporte a la ciudad de Cali, esto lo comunique verbalmente a CAPRECOM y a la Secretaria de Salud del Cauca, pero ellos me informaron que aquí no había contrato con ninguna entidad para estas terapias y que necesariamente tenemos que ir a Cali. Si estas terapias no se realizan mi esposo empieza a respirar con dificultad al punto de ponerse cianótico”.

V.V.V.V. LOLOLOLO QUEQUEQUEQUE SESESESE PIDE.PIDE.PIDE.PIDE.

4

Expediente

2011 00257 01

Actor

JOSÉ ELÍ JEJEN EUSCATEGUI

Demandada

SECRETARÍA DEPARTAMENTAL DE SALUD DEL CAUCA Y CAPRECOM

Acción

TUTELA – SEGUNDA INSTANCIA

Apelación

SENTENCIA DE 9 DE JUNIO DE 2.011

Procedencia:

JUZGADO QUINTO ADMINISTRATIVO DEL CIRCUITO DE POPAYÁN

Mediante escrito recibido el 25 de mayo de 2.011 1 , FLOR DE MARÍA

PIAMBA, actuando como Agente Oficioso del señor JOSE ELI JEJEN

EUSCATEGUI, manifestó lo siguiente:

“En consecuencia, solicito se ordene a CAPRECOM Y SECRETARIA DE SALUD DEL CAUCA, se preste el servicio de ambulancia para poder llevar a mi esposo a la Ciudad de Cali, si esto no sucede no tenemos los medios económicos para llevarlo y su vida estaría en riesgo inminente.”.

VIVI.VIVI LALALALA CONTESTACIONCONTESTACIONCONTESTACIONCONTESTACION DEDEDEDE LALALALA DEMANDADEMANDADEMANDADEMANDA

66.166.1.1

1

PorPorPorPor parteparteparteparte dededede lalalala SecretaríaSecretaríaSecretaríaSecretaría DepartamentalDepartamentalDepartamentalDepartamental dededede SaludSaludSaludSalud ddddelelelel CaucaCauca.CaucaCauca 2222

La Secretaría Departamental de Salud del Cauca, por medio de profesional

especializada con funciones jurídicas de apoyo a dicha Secretaría, se refirió

a la demanda en los siguientes términos:

Argumentó que resulta una obligación para las Entidades Administradoras

del Régimen Contributivo y Subsidiado garantizar a los usuarios la

prestación de los servicios de salud que se encuentren o no incluidos en el

POS, pues la finalidad de ese procedimiento es lograr la universalidad,

solidaridad y eficiencia en el Sistema de Seguridad Social en Salud.

Aseguró que la atención requerida por el agenciado, señor JOSE ELI JEJEN

es competencia de CAPRECOM EPS-RS, con la posibilidad de realizar

recobro a la SDSC, de acuerdo a las tarifas establecidas y reconocidas por

esa Entidad.

Afirmó que conforme a los preceptos normativos y jurisprudenciales, a

CAPRECOM EPS-RS le corresponde la atención integral del señor JOSE ELI

JEJEN respecto de la patología que padece denominada ENFERMEDAD

PULMONAR OBSTRUCTIVA CRÓNICA y con la posibilidad de realizar

recobros de acuerdo a las sentencias C-319 de 9 de abril de 2.008, C-463

1 Folio 17

2 Folios 30 a 34

5

Expediente

2011 00257 01

Actor

JOSÉ ELÍ JEJEN EUSCATEGUI

Demandada

SECRETARÍA DEPARTAMENTAL DE SALUD DEL CAUCA Y CAPRECOM

Acción

TUTELA – SEGUNDA INSTANCIA

Apelación

SENTENCIA DE 9 DE JUNIO DE 2.011

Procedencia:

JUZGADO QUINTO ADMINISTRATIVO DEL CIRCUITO DE POPAYÁN

de 14 de mayo de 2.008 y T- 760 de 31 de julio de 2.008 de la Honorable Corte Constitucional.

Sostuvo que la Secretaría Departamental de Salud del Cauca, no puede garantizar la atención integral en salud del actor, por ser una Entidad oficial que sólo administra recursos del Sistema General de Participaciones para la Población pobre y vulnerable no cubierta con subsidios a la demanda son los llamados participantes vinculados, que no tienen ninguna seguridad social, según lo ordena la Ley 715 de 2.001 en su artículo 49.

Finalmente manifestó que dicha Entidad no ha vulnerado derechos fundamentales del agenciado y en consecuencia solicitó que se le desvinculara de la presente acción constitucional.

VII.VII.VII.VII. PRUEBASPRUEBASPRUEBASPRUEBAS DELDELDELDEL EXPEDIENTE.EXPEDIENTE.EXPEDIENTE.EXPEDIENTE.

Aportó como pruebas las siguientes:

Copia simple de apartes de Historia Clínica y Órdenes Médicas del señor JEJEN EUSCATEGUI. 3

Copia simple de la cédula de ciudadanía del actor. 4

Copia simple del Carné de afiliación a CAPRECOM EPS-RS del señor JEJEN EUSCATEGUI. 5

Respuesta a oficio No. J5A-S-1209/11, suscrito por el Dr. WILLIAM MARTINEZ GUZMÁN- Internista Neumólogo de la Fundación Valle del Lili, donde expone la situación del señor JEJEN EUSCATEGUI. 6

VIVIIIVIVIIIII.II ELELELEL FALLOFALLOFALLOFALLO DEDEDEDE PRIMERAPRIMERAPRIMERAPRIMERA INSTANCIAINSTANCIAINSTANCIAINSTANCIA

El Juzgado Quinto Administrativo del Circuito de Popayán, mediante sentencia de 9 de junio de 2.011, dispuso tutelar los derechos a la salud, a la vida, a la seguridad social, a la dignidad humana, a la especial protección de los derechos de los adultos mayores, presuntamente

3 Folios 4 a 9 y 12 a 15

4 Folio 10

5 Folio 11

6 Folio 25 a 26 y 38

6

Expediente

2011 00257 01

Actor

JOSÉ ELÍ JEJEN EUSCATEGUI

Demandada

SECRETARÍA DEPARTAMENTAL DE SALUD DEL CAUCA Y CAPRECOM

Acción

TUTELA – SEGUNDA INSTANCIA

Apelación

SENTENCIA DE 9 DE JUNIO DE 2.011

Procedencia:

JUZGADO QUINTO ADMINISTRATIVO DEL CIRCUITO DE POPAYÁN

vulnerados al actor, al omitir la prestación de los servicios ordenados por los médicos especialistas tratantes y someterlo a trámites administrativos dilatorios que pueden afectar aún más su estado de salud. Así mismo, negó las pretensiones de suministrar servicios de transporte en ambulancia a la ciudad de Cali, pero aseguró que la Entidad deberá asumir los costos de transporte y alojamiento del paciente y un acompañante.

En síntesis, la Juez A quo encontró que la negativa inicial de la Caja Nacional al no autorizar los procedimiento ordenados por el médico tratante y la consecuente remisión a la Secretaría Departamental de Salud del Cauca para que autorizara los servicios, a sabiendas de la cobertura POSS que tienen, así como el no brindar todo el tratamiento integral que requiere, por tratarse de un adulto mayor y por su padecimiento, que lo ubica en estado de debilidad manifiesta, vulnera de manera flagrante sus derechos fundamentales, en cuanto a pesar de la regulación y jurisprudencia existente, la Entidad pretende desconocerlas y dilatar en el tiempo el oportuno tratamiento, porque si bien el Departamento expidió las órdenes de apoyo requeridas, sostuvo, que no ha podido el actor hacerlas efectivas, porque fue remitido a la ciudad de Cali donde no puede desplazarse por sus propios medios al no tener recursos económicos.

Respecto del traslado en ambulancia, sostuvo que como el Médico Internista Neumólogo WILLIAM MATINEZ GUZMÁN de la Fundación Valle del Lili de Cali, manifestó expresamente que en la condición actual del paciente no es necesario su traslado en vehículo especial tipo ambulancia para la realización de terapias y exámenes ordenados, por lo que la Juez A quo no accedió a dicha pretensión.

No obstante lo anterior, arguyó que como la Entidad afirma no tener contrato en esta ciudad para la prestación del servicio y por tanto debe el paciente acudir a la Fundación Valle del Lili en Cali, y, la parte actora manifiesta no contar con recursos para solventar los gastos de desplazamiento, deberá la CAJA DE PREVISIÓN SOCIAL DE COMUNICACIONES CAPRECOM EPS, en caso de no brindar la atención en esta ciudad, asumir y sufragar los costos de transporte y manutención (alojamiento y alimentación), del usuario y un acompañante.

7

Expediente

2011 00257 01

Actor

JOSÉ ELÍ JEJEN EUSCATEGUI

Demandada

SECRETARÍA DEPARTAMENTAL DE SALUD DEL CAUCA Y CAPRECOM

Acción

TUTELA – SEGUNDA INSTANCIA

Apelación

SENTENCIA DE 9 DE JUNIO DE 2.011

Procedencia:

JUZGADO QUINTO ADMINISTRATIVO DEL CIRCUITO DE POPAYÁN

IXIX.IXIX FUNDAMENTOSFUNDAMENTOSFUNDAMENTOSFUNDAMENTOS DEDEDEDE LALALALA IMPUGNACIÓNIMPUGNACIÓNIMPUGNACIÓNIMPUGNACIÓN 7777

Mediante escrito radicado el 14 de junio de 2.011, el Director Territorial de CAPRECOM Cauca, impugnó la sentencia de 9 de junio de 2.011 proferida por el Juzgado Quinto Administrativo del Circuito de Popayán, en síntesis en los siguientes términos:

La Entidad accionada presente su inconformidad con la decisión adoptada, por cuanto ordena un tratamiento integral a futuro, frente al cual hay total incertidumbre, pues es evidente que frente a la condena abstracta como la decidida por el Despacho, no hay argumentos que se puedan exponer por parte de la Entidad, lo cual afirmó, vulnera de manera evidente el derecho de defensa que le asiste a dicha Entidad.

Sostuvo que es incierto el tratamiento que deba adelantar la paciente en lo sucesivo, por lo cual no puede asumir obligaciones que desconoce, con una orden judicial como la proferida por el Despacho.

Solicitó que se tenga en cuenta que la familia de la accionante tiene una obligación legal de ayudarla, y el Juez de tutela debe limitar su ejercicio a la protección de los derechos supuestamente vulnerados, no a intervenir en el ámbito médico, pues solamente el médico puede determinar la necesidad de pago de transporte de ella y su acompañante.

Por lo anterior, afirmó que dicha Entidad como prestadora de servicios en salud en el régimen subsidiado estima que no hay lugar a ordenar transporte y estadía pues no se dan las circunstancias para tal orden se expida, y mucho menos a que sea obligada a contratar estos servicios. En consecuencia de lo anteriormente expuesto, solicitó revocar el fallo y conceder el recurso impetrado.

X.X.X.X. RECUENTORECUENTORECUENTORECUENTO PROCESALPROCESALPROCESALPROCESAL DEDEDEDE SEGUNDASEGUNDASEGUNDASEGUNDA INSTANCIA.INSTANCIA.INSTANCIA.INSTANCIA.

Mediante Auto de 20 de junio de 2.011 se resolvió admitir la impugnación contra el fallo proferido el 9 de junio de 2.011 por el Juzgado Quinto Administrativo de Popayán. 8

7 Folios 63 a 67

8

Expediente

2011 00257 01

Actor

JOSÉ ELÍ JEJEN EUSCATEGUI

Demandada

SECRETARÍA DEPARTAMENTAL DE SALUD DEL CAUCA Y CAPRECOM

Acción

TUTELA – SEGUNDA INSTANCIA

Apelación

SENTENCIA DE 9 DE JUNIO DE 2.011

Procedencia:

JUZGADO QUINTO ADMINISTRATIVO DEL CIRCUITO DE POPAYÁN

A dicho Auto se le dio cabal cumplimiento. 9

XXIXXII.I CONSIDERACIONESCONSIDERACIONESCONSIDERACIONESCONSIDERACIONES DELDELDELDEL TRIBUNALTRIBUNALTRIBUNALTRIBUNAL

1111111.11.1.1 1

LaLaLaLa competenciacompetenciacompetenciacompetencia

El Tribunal es competente para conocer de la presente acción de tutela

según lo establecido por el Decreto Ley 2591 de 1991 en su artículo 32,

en SEGUNDASEGUNDASEGUNDASEGUNDA INSTANCIA.INSTANCIA.INSTANCIA.INSTANCIA.

1111111.1 2.2.2.

2

ProceProcedenciaProceProcedenciadenciadencia dededede lalalala acciónacciónacciónacción dededede tutelatutelatutelatutela

De conformidad con el artículo 86 de la Carta, la acción de tutela es un

derecho público subjetivo del que goza toda persona para obtener del

Estado, a través de la Rama Judicial, la protección inmediata de sus

derechos constitucionales fundamentales, cuando resulten vulnerados o

amenazados por la acción o la omisión de cualquier autoridad pública o

incluso de los particulares, en ciertos casos.

Sin embargo, no debe perderse de vista que esta acción es de carácter

residual y subsidiario, es decir, que sólo procede en aquellos eventos en

los que no exista un instrumento constitucional o legal diferente que le

permita al actor solicitar, ante los jueces ordinarios, la protección de sus

derechos, salvo que se pretenda evitar un perjuicio irremediable, el cual

debe aparecer acreditado en el proceso.

1111.1111 3.3.3.

3

LosLosLosLos problemasproblemasproblemasproblemas jurídicosjurídicosjurídicosjurídicos

Considera el Tribunal que en el presente caso se debe establecer si:

¿Se encuentra ajustada a derecho la orden el cubrimiento de los gastos de transporte y alojamiento para el paciente y un

8 Folio 75

9 Folios 76

9

Expediente

2011 00257 01

Actor

JOSÉ ELÍ JEJEN EUSCATEGUI

Demandada

SECRETARÍA DEPARTAMENTAL DE SALUD DEL CAUCA Y CAPRECOM

Acción

TUTELA – SEGUNDA INSTANCIA

Apelación

SENTENCIA DE 9 DE JUNIO DE 2.011

Procedencia:

JUZGADO QUINTO ADMINISTRATIVO DEL CIRCUITO DE POPAYÁN

acompañante cuando requiera atención fuera de la ciudad de Residencia?

¿El hecho de no sufragar los gastos de transporte del paciente y un acompañante para la realización de las terapias en otra ciudad, implica una vulneración de los derechos de la agenciada?

¿Le asiste razón al Director Seccional de CAPRECOM EPS-S, que afirmó que no había lugar a ordenarse transporte y estadía pues no se dan las circunstancias para tal orden se expida, y mucho menos a que sea obligada a contratar estos servicios?

Para desatar la controversia planteada es del caso referirse a: (i) la

protección del derecho a la salud; (ii) la procedencia de la acción de tutela

para ordenar que los gastos de traslado sean costeados por las E.P.S; (iii)

el precedente constitucional sobre el cubrimiento de los gastos de traslado

de pacientes y sus acompañantes, por parte de las E. P. S.

1111.1111 4.44.4

mediantemediantemediantemediante lalalala acciónacciónacciónacción dededede tutelatutelatutelatutela

ElElElEl derechoderechoderechoderecho aaaa lalalala saludsaludsaludsalud comocomocomocomo derechoderechoderechoderecho fundamentalfundamentalfundamentalfundamental yyyy susususu protecciónprotecciónprotecciónprotección

El derecho a la salud se encuentra consagrado en el artículo 49 del Texto

Superior, correspondiente al capítulo 2 del título II de la Constitución,

referente a “LOS DERECHOS SOCIALES, ECONÓMICOS Y CULTURALES”. Allí,

el constituyente estableció que la atención en salud no sólo es un derecho

constitucional, sino también un servicio público a cargo del Estado, por lo

que éste se encuentra comprometido en el deber de asegurar su efectiva

prestación en términos de promoción, protección y recuperación,

conforme lo ordenan los principios superiores de universalidad, eficiencia

y solidaridad.

Con fundamento en lo anterior y atendiendo al carácter prestacional que lo

reviste, en una primera etapa, la jurisprudencia reiterada de la Corte

Constitucional señalaba que el derecho a la salud no tenía prima facie el

carácter de derecho fundamental susceptible de ser protegido a través de

la acción de tutela, salvo en aquellos eventos en que éste se encontrara en

10

Expediente

2011 00257 01

Actor

JOSÉ ELÍ JEJEN EUSCATEGUI

Demandada

SECRETARÍA DEPARTAMENTAL DE SALUD DEL CAUCA Y CAPRECOM

Acción

TUTELA – SEGUNDA INSTANCIA

Apelación

SENTENCIA DE 9 DE JUNIO DE 2.011

Procedencia:

JUZGADO QUINTO ADMINISTRATIVO DEL CIRCUITO DE POPAYÁN

relación de conexidad con otro u otros derechos que sí ostentaran esa naturaleza jurídica, tales como la vida o la integridad personal. 10

No obstante, la jurisprudencia constitucional avanzó en el desarrollo y entendimiento del derecho a la salud, para sostener de manera categórica que la acción de tutela es procedente para ampararlo de forma directa, sin atender al concepto de conexidad con un derecho fundamental. Así, la Sala Novena de Revisión de la H. Corte Constitucional, en Sentencia T- 525 de 12 de julio de 2007, con ponencia de la Dra. Clara Inés Vargas Hernández, señaló:

“El Derecho a la salud como derecho fundamental y su protección por vía de tutela.

Inicialmente la jurisprudencia de la Corte Constitucional se caracterizó por diferenciar los derechos susceptibles de protección mediante la acción de tutela y los derechos de contenido meramente prestacional, los cuales para ser amparados por vía de tutela, debían exponer conexidad con los derechos inicialmente nombrados, es decir, los de primer orden.

En reciente jurisprudencia, mediante ponencia del Magistrado Humberto Sierra Porto, la sentencia T-016 de 2007, esta Corporación señaló el carácter fundamental de todos los derechos sin distinguir si se trata de derechos políticos, civiles, sociales, económicos o culturales, así como que dicha fundamentalidad tampoco debe derivar de la manera como estos derechos se hagan efectivos en la práctica. En este sentido se señaló:

“De acuerdo con la línea de pensamiento expuesta y que acoge la Sala en la presente sentencia, la fundamentalidad de los derechos no depende –ni puede depender- de la manera como estos derechos se hacen efectivos en la práctica. Los derechos todos son fundamentales pues se conectan de manera directa con los valores que las y los Constituyentes quisieron elevar democráticamente a la categoría de bienes especialmente protegidos por la Constitución. Estos valores consignados en normas jurídicas con efectos vinculantes marcan las fronteras materiales más allá de las cuales no puede ir la acción estatal sin incurrir en una actuación arbitraria (obligaciones estatales de orden negativo o de abstención). Significan de modo simultáneo, admitir que en el Estado social y democrático de derecho no todas las personas gozan de las mismas oportunidades ni disponen de los medios –económicos y educativos- indispensables que les permitan elegir con libertad aquello que tienen razones para valorar. De ahí el matiz activo

10 Sentencias T-1036 de 2000, T-175 de 2002 y T-1213 de 2004, entre otras.

11

Expediente

2011 00257 01

Actor

JOSÉ ELÍ JEJEN EUSCATEGUI

Demandada

SECRETARÍA DEPARTAMENTAL DE SALUD DEL CAUCA Y CAPRECOM

Acción

TUTELA – SEGUNDA INSTANCIA

Apelación

SENTENCIA DE 9 DE JUNIO DE 2.011

Procedencia:

JUZGADO QUINTO ADMINISTRATIVO DEL CIRCUITO DE POPAYÁN

del papel del Estado en la consecución de un mayor grado de libertad, en especial, a favor de aquella personas ubicadas en situación de desventaja social, económica y educativa. Por ello, también la necesidad de compensar los profundos desequilibrios en relación con las condiciones de partida mediante una acción estatal eficaz (obligaciones estatales de carácter positivo o de acción).

En este sentido, señaló la sentencia en comento, que la fundamentalidad de los derechos cuyo contenido es marcadamente prestacional, caso del derecho a la salud, conlleva que ante la renuencia de las instancias políticas y administrativas competentes en implementar medidas orientadas a realizar estos derechos en la práctica, los jueces puedan hacer efectivo su ejercicio por vía de tutela cuando se encuentren amenazados o vulnerados.

De igual manera y para enfatizar aun más, en la protección constitucional del derecho a la salud, la sentencia T-200 de 2007 menciona la gran dimensión para el amparo de tal bien jurídico, al respecto se mencionó:

“…En abundante jurisprudencia esta Corporación ha señalado que la protección ofrecida por el texto constitucional a la salud, como bien jurídico que goza de especial protección, tal como lo enseña el tramado de disposiciones que componen el articulado superior y el bloque de constitucionalidad, se da en dos sentidos: (i) en primer lugar, de acuerdo al artículo 49 de la Constitución, la salud es un servicio público cuya organización, dirección y reglamentación corresponde al Estado. La prestación de este servicio debe ser realizado bajo el impostergable compromiso de satisfacer los principios de universalidad, solidaridad y eficiencia que, según dispone el artículo 49 superior, orientan dicho servicio. En el mismo sentido, como fue precisado por esta Sala de revisión en sentencia T-016 de 2007, el diseño de las políticas encaminadas a la efectiva prestación del servicio público de salud debe estar, en todo caso, fielmente orientado a la consecución de los altos fines a los cuales se compromete el Estado, según lo establece el artículo 2° del texto constitucional.

(ii) La segunda dimensión en la cual es protegido este bien jurídico es su estructuración como derecho. Sobre el particular, la jurisprudencia de esta Corporación ha señalado que el derecho a la salud no es de aquellos cuya protección puede ser solicitada prima facie por vía de tutela. No obstante, en una decantada línea que ha hecho carrera en los pronunciamientos de la Corte Constitucional, se ha considerado que una vez se ha superado la indeterminación de su contenido –que es el obstáculo principal a su estructuración como derecho fundamental- por medio de la regulación ofrecida por el Congreso de la República y por las autoridades que participan en el Sistema de Seguridad Social; las prestaciones a las cuales

12

Expediente

2011 00257 01

Actor

JOSÉ ELÍ JEJEN EUSCATEGUI

Demandada

SECRETARÍA DEPARTAMENTAL DE SALUD DEL CAUCA Y CAPRECOM

Acción

TUTELA – SEGUNDA INSTANCIA

Apelación

SENTENCIA DE 9 DE JUNIO DE 2.011

Procedencia:

JUZGADO QUINTO ADMINISTRATIVO DEL CIRCUITO DE POPAYÁN

se encuentran obligadas las instituciones del Sistema adquieren el carácter de derechos subjetivos…”

Estamos entonces ante una línea jurisprudencial, que después de concienzudos estudios ha logrado establecer que el derecho a la salud se considera fundamental, ya que el mismo integra el conjunto necesario para poder llevar y disfrutar plenamente de una vida íntegra y armónica.”

En criterio del Tribunal, las anteriores consideraciones tienen plena

consonancia con el contenido esencial del derecho a la salud, inherente a

todo ser humano y por tanto objeto de protección directa por vía de tutela,

al margen de su eventual relación de conexidad con otro derecho

fundamental.

1111111.1 5.5.5.

5

ProcedenciaProcedenciaProcedenciaProcedencia dededede lalalala acciónacciónacciónacción dededede tutelatutelatutelatutela paraparaparapara ordenarordenarordenarordenar quequequeque loslosloslos gastosgastosgastosgastos dededede

trasladotrasladotrasladotraslado seanseanseansean costeadoscosteadoscosteadoscosteados porporporpor laslaslaslas EPS.EPS.EPS.EPS. ReiteraciónReiteraciónReiteraciónReiteración dededede jurisprudenciajurisprudenciajurisprudenciajurisprudencia

El artículo 86 de la Carta Magna establece como un requisito de

procedibilidad de la acción de tutela la omisión o actuación de cualquier

autoridad pública o de particulares, en determinados casos, que conculque

o amenace derechos fundamentales. En este sentido, el inciso primero del

mencionado artículo consagra que: “Toda persona tendrá acción de tutela para reclamar ante los jueces, en todo momento y lugar, mediante un procedimiento preferente y sumario (…), la protección inmediata de sus derechos constitucionales fundamentales cuando quiera que éstos resulten vulnerados o amenazados por la acción o la omisión de cualquier autoridad pública (…)”,

Y el inciso quinto establece la procedencia contra particulares en los

siguientes términos:

“(…) encargados de la prestación de un servicio público o cuya conducta afecte grave y directamente el interés colectivo, respecto de quienes el solicitante se halle en estado de subordinación o indefensión.”

A partir del mencionado requisito de procedibilidad, la Corte

Constitucional, en casos como el que se estudia, ha indicado como

necesario que se haya requerido a las EPS con el fin de obtener el

cubrimiento de los costos del traslado de pacientes y acompañantes. Así,

en sentencia T- 900 de 2002 se indicó:

13

Expediente

2011 00257 01

Actor

JOSÉ ELÍ JEJEN EUSCATEGUI

Demandada

SECRETARÍA DEPARTAMENTAL DE SALUD DEL CAUCA Y CAPRECOM

Acción

TUTELA – SEGUNDA INSTANCIA

Apelación

SENTENCIA DE 9 DE JUNIO DE 2.011

Procedencia:

JUZGADO QUINTO ADMINISTRATIVO DEL CIRCUITO DE POPAYÁN

“Resulta a todas luces inadecuada esta práctica (partir del supuesto de la negativa de la demandada de cubrir los costos del traslado) porque, sin desconocer el inmenso estado de angustia que lleva consigo la presencia de una enfermedad en algún miembro de la familia, la solución no está en acudir directamente al juez de tutela con base en una posible negativa en la prestación del servicio, sin detenerse a considerar que, en la generalidad de los casos, la vulneración que podrá examinar el juez únicamente podrá partir de la base de que en realidad existe la negativa o la omisión de la entidad prestadora del servicio de salud, en suministrar lo pretendido por el paciente, pues, si no existe la negativa o la omisión de la prestación del servicio de salud, difícilmente puede darse la violación de algún derecho fundamental.”

“4.3 Por ello, no obstante que en casos como los que se estudian, se está ante la premura en la protección de derechos fundamentales, como la vida o la integridad física, el hecho de que no se haya requerido previamente a la entidad prestadora de salud, salvo casos verdaderamente excepcionales, impide que la acción de tutela proceda, puesto que ella está consagrada para “la protección inmediata de sus derechos constitucionales fundamentales, cuando quiera que éstos resulten vulnerados o amenazados por la acción o la omisión de cualquier autoridad pública.” (Art. 86 de la Carta)(…)”.

En concordancia con el planteamiento anterior, se concluye, que el texto Constitucional se erige como un requisito para la procedencia de la Acción de Tutela. Es del caso valorar lo que dice la H. Corte Constitucional en la cita anteriormente expuesta, pues es necesario para la procedencia en el caso particular de esta Acción, el hecho de que la solicitud haya sido presentada ante la entidad y que esta a su vez emita la negativa a la misma.

Contrario a ello, el simple hecho de presentar la Acción de Tutela, sin haber recibido la negativa de la entidad, hace del papel del Juez de Tutela, una actuación ante una realidad presunta, que no le permite valorar en últimas si existe o no una verdadera o palpable violación de los derechos fundamentales.

1111111.1 6.66.6

PrecedentePrecedentePrecedentePrecedente constitucionalconstitucionalconstitucionalconstitucional sobresobresobresobre elelelel cubrimientocubrimientocubrimientocubrimiento dededede loslosllosos gastosgastosgastosgastos ddddeeee

trasladotrasladotrasladotraslado dededede pacientespacientespacientespacientes yyyy sussussussus acompañantesacompañantesacompañantesacompañantes porporporpor laslaslaslas E.E.E.E. P.P.P.P. S.S.S.S.

El análisis de las obligaciones que en esta materia puedan recaer, eventualmente, en cabeza de las E. P. S. exige tener en cuenta la exigencia de accesibilidad al servicio de salud como una faceta que garantiza la vigencia del mencionado derecho fundamental.

14

Expediente

2011 00257 01

Actor

JOSÉ ELÍ JEJEN EUSCATEGUI

Demandada

SECRETARÍA DEPARTAMENTAL DE SALUD DEL CAUCA Y CAPRECOM

Acción

TUTELA – SEGUNDA INSTANCIA

Apelación

SENTENCIA DE 9 DE JUNIO DE 2.011

Procedencia:

JUZGADO QUINTO ADMINISTRATIVO DEL CIRCUITO DE POPAYÁN

Al respecto, en sentencia T-1158 de 2001 la H. Corte Constitucional sostuvo que el postulado de accesibilidad al servicio supone la remoción de todos los obstáculos formales y materiales que limiten el goce de éste. En tal sentido, la estructura sobre la cual descansa el Sistema de Seguridad Social en Salud, compuesta, de acuerdo a la Ley 100 de 1993, por un conjunto de normas, instituciones y procedimientos, debe asegurar que la efectiva prestación del servicio no sea entorpecida por la existencia de barreras que promuevan factores de discriminación que alejen a determinados sectores de la población de la posibilidad de disfrutar de este servicio.

De tal manera, el diseño de las políticas de acceso al Sistema de Seguridad Social en Salud debe estar edificado sobre las exigencias que supone la plena satisfacción del derecho a la igualdad, lo cual, en últimas, conduce a la realización del principio de universalidad, postulado que, según lo dispone el artículo 48 superior, debe inspirar el sistema de seguridad social.

En abundante jurisprudencia, el Alto Tribunal Constitucional se ha ocupado de establecer si dentro del campo de prestaciones a las cuales se encuentran obligadas las E. P. S. se inscribe la obligación de ofrecer el servicio de transporte a los usuarios del Sistema. En tal sentido, de manera unánime, ha señalado que corresponde al paciente o a su núcleo asumir dicha carga patrimonial, lo cual coincide con el principio de solidaridad consagrado en el artículo 48 como uno de los postulados rectores de la seguridad social.

Esta consideración es desarrollada por la Resolución número 5261 de 1994, en la que se anota que en aquellos eventos en los cuales el

municipio en donde reside el paciente, no cuente con el servicio de salud

que requiere, “

podrá ser remitido al municipio más cercano que cuente

con él. Los gastos de desplazamiento generados en las remisiones serán de responsabilidad del paciente, salvo en los casos de urgencia debidamente certificada o en los pacientes internados que requieran atención complementaria. Se exceptúan de esta norma las zonas donde se

paga una U.P.C. diferencial mayor, en donde todos los gastos de transporte estarán a cargo de la E.P.S.

15

Expediente

2011 00257 01

Actor

JOSÉ ELÍ JEJEN EUSCATEGUI

Demandada

SECRETARÍA DEPARTAMENTAL DE SALUD DEL CAUCA Y CAPRECOM

Acción

TUTELA – SEGUNDA INSTANCIA

Apelación

SENTENCIA DE 9 DE JUNIO DE 2.011

Procedencia:

JUZGADO QUINTO ADMINISTRATIVO DEL CIRCUITO DE POPAYÁN

No obstante, en ocasiones la dimensión de los gastos de traslado llega a desbordar la capacidad económica del paciente y de su familia, en cuyo caso se advierte la existencia de una barrera formal al acceso del servicio de salud que debe ser eliminada, según lo ordena el criterio de accesibilidad, pues en estos casos el disfrute material del derecho a la salud del individuo resulta entorpecido por un elemento -capacidad económica- que en ningún caso puede restringir su plena satisfacción.

En estos eventos la aplicación del deber de solidaridad que pesa sobre el núcleo familiar del usuario resulta inconducente, dado que, si bien es legítimo acudir a él, como primera medida, para que brinde la asistencia económica requerida, en el caso concreto el gasto que implica excede su capacidad económica, por lo que si el acceso del paciente se hace depender de él en forma exclusiva, se presentaría un insalvable obstáculo al disfrute del derecho a la salud. En tal sentido, como lo ha afirmado la Corte Constitucional, en estos eventos las Empresas Promotoras de Salud deben sufragar dicho costo, lo cual supone la máxima realización del principio de eficiencia consagrado en el artículo 49 superior, dado que, en este supuesto, la oferta de las prestaciones médico asistenciales que está realizando la entidad es acompañada de los medios más expeditos para acercarla a los sectores de la población más vulnerables.

Al respecto, en sentencia T-975 de 2006, se señaló que:

“la accesibilidad y el acceso efectivo al servicio público de salud comprende un todo inescindible, [lo cual supone la procedencia de] la protección constitucional del derecho en aquellos casos en los cuales se acredite la imposibilidad objetiva del suministro de los medios suficientes y adecuados para hacer uso de la atención asistencial. De allí que sea un despropósito manifestar que el Estado tiene la obligación de prestar el servicio público de salud, bien directamente o a través de particulares vigilados por éste, pero que dicha obligación no comprende el deber de otorgar a los titulares de los derechos fundamentales relacionados con esta prestación, los medios que requieren para acceder a la misma.”

1111111.1 7.77.7

pacientepacientepacientepaciente yyyy susususu acompañanteacompañanteacompañanteacompañante

RequiRequisitosRequiRequisitossitossitos paraparaparapara lalalala procedenciaprocedenciaprocedenciaprocedencia deldeldeldel cubrimientocubrimientocubrimientocubrimiento dededede traslatraslatraslatrasladodododo deldeldeldel

16

Expediente

2011 00257 01

Actor

JOSÉ ELÍ JEJEN EUSCATEGUI

Demandada

SECRETARÍA DEPARTAMENTAL DE SALUD DEL CAUCA Y CAPRECOM

Acción

TUTELA – SEGUNDA INSTANCIA

Apelación

SENTENCIA DE 9 DE JUNIO DE 2.011

Procedencia:

JUZGADO QUINTO ADMINISTRATIVO DEL CIRCUITO DE POPAYÁN

Como se dijo, la jurisprudencia constitucional ha establecido que la conducencia de este servicio adicional se encuentra condicionada a la satisfacción de ciertos requisitos que tienen como objetivo asegurar que el esfuerzo prestacional realizado procure el acceso a las personas que, de manera efectiva, requieren la asistencia de estas entidades, pues de otra forma su aplicación irrestricta conduciría a una desconcentrada inversión de los recursos que, en últimas, perjudicaría a los sectores de la población que reclaman atención prevalente.

Así, los supuestos que permiten colegir el deber de suministrar el traslado de pacientes en los casos no establecidos en la legislación fueron resumidos por la sentencia T-201 de 2007 de la siguiente manera:

“(i) el procedimiento o tratamiento debe ser imprescindible para asegurar el derecho a la salud y la integridad de la persona. Al respecto se debe observar que la salud no se limita a la conservación del conjunto determinado de condiciones biológicas de las que depende, en estricto sentido, la visa humana, sino que este concepto, a la luz de lo dispuesto en los artículos 1° y 11 del Texto Constitucional, extiende sus márgenes hasta comprender los elementos requeridos por el ser humano para disfrutar de una vida digna 11 (ii) el paciente o sus familiares carecen de recursos económicos para sufragar los gastos de desplazamiento 12 y (iii) la imposibilidad de acceder al tratamiento por no llevarse a cabo el traslado genera riesgo para la vida, la integridad física o la salud del paciente, la cual incluye su fase de recuperación 13 .”

Por su parte, en la Sentencia T-786 de 2006, en relación con el servicio de transporte del paciente y sus acompañantes la Corte señaló:

“EnEnEnEn consecuencia,consecuencia,consecuencia,consecuencia, elelelel cubrimientocubrimientocubrimientocubrimiento dededede loslosloslos gastosgastosgastosgastos dededede trtrtrtransporteansporteansporteansporte paraparaparapara quequequeque unununun usuariousuariousuariousuario puedapuedapuedapueda accederaccederaccederacceder alalalal servicioservicioservicioservicio dededede saludsaludsaludsalud estáestáestáestá sujetosujetosujetosujeto aaaa lalalala capacidadcapacidadcapacidadcapacidad económicaeconómicaeconómicaeconómica deldeldeldel pacientepacientepacientepaciente yyyy aaaa sussussussus capacidadescapacidadescapacidadescapacidades físicasfísicasfísicasfísicas yyyy mentales,mentales,mentales,mentales, puespuespuespues enenenen casoscasoscasoscasos enenenen loslosloslos quequequeque sesesese encuentrenencuentrenencuentrenencuentren involucradosinvolucradosinvolucradosinvolucrados menores,menores,menores,menores, discapacitadosdiscapacitadosdiscapacitadosdiscapacitados yyyy personaspersonaspersonaspersonas dededede lalalala terceraterceraterceratercera edad,edad,edad,edad, sesesese hacehacehacehace evidenteevidenteevidenteevidente que,que,que,que, ademásademásademásademás dededede lalalala necesidadnecesidadnecesidadnecesidad deldeldeldel cubrimientocubrimientocubrimientocubrimiento deldeldeldel gastogastogastogasto dededede trasladotrasladotrasladotraslado aaaa ooootratratratra ciudadciudadciudadciudad paraparaparapara sísísísí

11 Sentencia T-364 de 2005. M.P. Clara Inés Vargas Hernández.

12 Sentencias T-786 de 2006, T-861 de 2005, T-408 de 2005, T-197 de 203, T-467 de 2002, T-900 de 2002, T-1079 de 2001, T-057 de 2009, T-067 de 2009.

13 Cfr. T-786 de 2006, T-861 de 2005, T-408 de 2005, T-197 de 2003, T-900 de 2002

17

Expediente

2011 00257 01

Actor

JOSÉ ELÍ JEJEN EUSCATEGUI

Demandada

SECRETARÍA DEPARTAMENTAL DE SALUD DEL CAUCA Y CAPRECOM

Acción

TUTELA – SEGUNDA INSTANCIA

Apelación

SENTENCIA DE 9 DE JUNIO DE 2.011

Procedencia:

JUZGADO QUINTO ADMINISTRATIVO DEL CIRCUITO DE POPAYÁN

mismos,mismos,mismos,mismos,

desplazamiedesplazamientodesplazamiedesplazamientontonto dededede unununun acompañante,acompañante,acompañante,acompañante, porporporpor parteparteparteparte dededede lalalala E.P.SE.P.SEE.P.S.P.S

eseseses

indispensableindispensableindispensableindispensable

elelelel

cubrimientocubrimientocubrimientocubrimiento

dededede

loslosloslos

gastgastgastgastosososos

dededede

(Se destaca).

“Es entonces evidente que la obligación de las Entidades Prestadoras del Servicio de Salud supera los límites de la pura y elemental atención médica de los usuarios y, en consecuencia, implica el análisis y la valoración integral de cada caso, atendiendo a la realidad física, social y económica del paciente, entre otros elementos, que permita identificar las necesidades y las garantías en salud que se le deben prestar (…)”.

En este contexto, cuando deban decidirse sobre solicitudes de traslado de

acompañantes, no solamente deben ser acreditados los requisitos de

transporte de usuarios, arriba señalados sino también debe observarse

que se trate de personas con discapacidad 14 , ancianos 15 o menores de

edad que no pueden valerse por sí mismos 16 .

1111.1111 8.88.8

ElElElEl casocasocasocaso concretoconcretoconcretoconcreto

En el presente caso, la Acción de Tutela es presentada por la señora FLOR

DE MARÍA PIAMBA actuando en calidad de Agente Oficiosa del señor JOSÉ

ELÍ JEJEN EUSCATEGUI, de 63 años de edad. Lo primero a tratar entonces,

frente al caso concreto, es el tema de la agencia oficiosa.

dispone que, “Toda persona

tendrá acción de tutela para reclamar ante los jueces, en todo momento y lugar, mediante un procedimiento preferente y sumario, por sí misma o por quien actúe a su nombre, la protección inmediata de sus derechos constitucionales fundamentales, cuando quiera que éstos resulten vulnerados o amenazados por la acción u omisión de cualquier autoridad pública”.

El artículo 86 de la Constitución Política

14 En sentencia T-099 de 2006, la Corte ordenó a la EPS sufragar el traslado del usuario Gustavo

señaló: “por causa de la

esquizofrenia que padece y su dependencia a medicamentos que debe tomar diariamente para el mantenimiento de su estabilidad mental, es una persona que requiere atención permanente para garantizar su integridad física y el ejercicio adecuado de sus labores cotidianas, por lo que autorizará también el cubrimiento del traslado de un acompañante”.

Adolfo

Sierra

y

de

un

acompañante.

En

sus

consideraciones

15 Véase. Sentencia T- 003 de 2006

16 Véanse, Sentencias T-364 de 2005, T-408 de 2005.

18

Expediente

2011 00257 01

Actor

JOSÉ ELÍ JEJEN EUSCATEGUI

Demandada

SECRETARÍA DEPARTAMENTAL DE SALUD DEL CAUCA Y CAPRECOM

Acción

TUTELA – SEGUNDA INSTANCIA

Apelación

SENTENCIA DE 9 DE JUNIO DE 2.011

Procedencia:

JUZGADO QUINTO ADMINISTRATIVO DEL CIRCUITO DE POPAYÁN

Por su parte, el artículo 10 del Decreto 2591 de 1991, establece que la acción de tutela puede ser ejercida por cualquier persona que considere violados o amenazados sus derechos fundamentales, pudiendo actuar directamente o a través de su representante.

Agrega la citada disposición que, “También se pueden agenciar derechos ajenos cuando el titular de los mismos no esté en condiciones de promover su propia defensa. Cuando tal circunstancia ocurra, deberá manifestarse en la solicitud.”

Sobre el particular, ha reiterado la Corte Constitucional que, la figura de la agencia oficiosa tiene lugar cuando de manera expresa sea invocada su utilización por el actor o que claramente se desprenda de los hechos relatados y cuando de forma efectiva se acredite la imposibilidad de manera directa y personal de acudir en busca de la protección de los derechos fundamentales.

Sin entrar en mayores consideraciones, la agencia oficiosa se encuentra plenamente establecida, en razón de que la señora FLOR DE MARÍA PIAMBA, manifiesta actuar en representación de su esposo JOSÉ ELÍ JEJEN EUSCATEGUI y está acreditado que se trata de una persona con

incapacidad referida a una “enfermedad pulmonar obstructiva crónica no

especificada”, patología que la imposibilita para ejercer directamente la acción de amparo constitucional.

Tal como se estableció en el acápite de antecedentes de la presente providencia, la agente oficiosa solicitó que se ordene a las demandadas, que se prestara el servicio de ambulancia para poder llevar a su esposo a la Ciudad de Cali teniendo en cuenta que no tienen los medios económicos para llevarlo.

La Juez A quo en la sentencia objeto de la presente impugnación, además de tutelar los derechos a la salud, a la vida, a la seguridad social, a la dignidad humana, a la especial protección de los derechos de los adultos mayores, negó las pretensiones de suministrar servicios de transporte en ambulancia a la ciudad de Cali, pero aseguró que la Entidad deberá asumir los costos de transporte y alojamiento del paciente y un acompañante.

19

Expediente

2011 00257 01

Actor

JOSÉ ELÍ JEJEN EUSCATEGUI

Demandada

SECRETARÍA DEPARTAMENTAL DE SALUD DEL CAUCA Y CAPRECOM

Acción

TUTELA – SEGUNDA INSTANCIA

Apelación

SENTENCIA DE 9 DE JUNIO DE 2.011

Procedencia:

JUZGADO QUINTO ADMINISTRATIVO DEL CIRCUITO DE POPAYÁN

En los argumentos de la impugnación, La Entidad accionada presentó su inconformidad con la decisión adoptada, por cuanto ordena un tratamiento integral, condena abstracta que implica que la demandada no tenga argumentos que se puedan exponer, lo cual afirmó, vulnera de manera evidente el derecho de defensa que le asiste a dicha Entidad.

Solicitó que se tenga en cuenta que la familia de la accionante tiene una obligación legal de ayudarla, y el Juez de tutela debe limitar su ejercicio a

la protección de los derechos supuestamente vulnerados, no a intervenir

en el ámbito médico, pues solamente el médico puede determinar la necesidad de pago de transporte de ella y su acompañante.

Frente a la condena en abstracto que presuntamente vulnera el derecho de defensa de la demandada, considera la Sala que debe recordársele al impugnante, que quien decide el tratamiento pertinente para el agenciado, como el bien lo afirma, es el profesional de la medicina, su médico tratante y no el Juez Constitucional, es decir, que el Juez de tutela le corresponde el estudio de los derechos fundamentales de la parte accionante y decidir si los hechos implican una vulneración a los mismos, no a limitar dicho tratamiento y faltar a la integralidad que se ha sostenido en la doctrina constitucional.

Lo anterior implica, que la condena en abstracto como el impugnante la denomina, obedece a que al no conocerse cuál es el tratamiento médico que llegare a requerir el señor JEJEN EUSCATEGUI, y teniendo en cuenta que se limita el campo de acción del juez constitucional simplemente a lo

obrante en el expediente, en pro de la salvaguarda del derecho a la salud y

a la vida, debe aplicarse un tratamiento integral impidiendo que más adelante se pudiera negar cualquier tipo de servicio o tratamiento ordenado por el galeno tratante.

Así las cosas, frente a dicho argumento, no puede pretender el señor Director de CAPRECOM Seccional Cauca, limitar las órdenes de los jueces de la República con función constitucional, pues el juez de tutela puede,

con argumentos jurídicos, fallar ultra y extra petita, toda vez que como en

el presente caso, teniendo en cuenta la edad y condición médica del actor,

se encuentra que no puede someterse en un futuro al actor a trámites innecesarios que conlleven una resulta fatal.

20

Expediente

2011 00257 01

Actor

JOSÉ ELÍ JEJEN EUSCATEGUI

Demandada

SECRETARÍA DEPARTAMENTAL DE SALUD DEL CAUCA Y CAPRECOM

Acción

TUTELA – SEGUNDA INSTANCIA

Apelación

SENTENCIA DE 9 DE JUNIO DE 2.011

Procedencia:

JUZGADO QUINTO ADMINISTRATIVO DEL CIRCUITO DE POPAYÁN

Por lo anterior, esta Corporación encuentra ajustados a derecho los argumentos del Juzgado Quinto Administrativo del Circuito de Popayán y le asiste razón a su decisión.

Para que no quede duda alguna, retomando las consideraciones anteriormente traídas a colación en este fallo, en sentencia T-1158 de 2001 la H. Corte Constitucional sostuvo que el postulado de accesibilidad al servicio supone la remoción de todos los obstáculos formales y materiales que limiten el goce de éste. En tal sentido, la estructura sobre la cual descansa el Sistema de Seguridad Social en Salud, compuesta, de acuerdo a la Ley 100 de 1993, por un conjunto de normas, instituciones y procedimientos, debe asegurar que la efectiva prestación del servicio no sea entorpecida por la existencia de barreras que promuevan factores de discriminación que alejen a determinados sectores de la población de la posibilidad de disfrutar de este servicio. Es así como encontramos que el hecho de no contar con la capacidad económica suficiente para acarrear con los gastos de transporte y así recibir la atención requerida, se constituye en un claro obstáculo a la prestación integral del servicio, pues de una u otra manera se le impide acceder al tratamiento médico indispensable para su óptima evolución, convirtiéndose en una clara violación al derecho a la salud, a toda luz evidente basándonos en el desarrollo Jurisprudencial que ha tenido este contenido.

El tema de los gastos de transporte, entonces, exige la verificación del cumplimiento de las reglas de procedibilidad de la acción de tutela para estos casos. Así las cosas y teniendo en cuenta los criterios que la H. Corte Constitucional ha señalado en reiteradas oportunidades, para inaplicar por vía de acción de tutela las exclusiones consagradas en la normatividad vigente, este Tribunal concluye que en el presente caso se reúnen los criterios estrictamente referidos para el agenciado JOSÉ ELÍ JEJEN EUSCATEGUI, como se pasa a establecer.

En relación con la falta de capacidad económica de la agenciada, la jurisprudencia constitucional ha señalado una presunción en el caso de las personas que pertenecen al régimen subsidiado y que han sido clasificados por la encuesta SISBEN, por lo que, en estos eventos, las condiciones descritas permiten presumir que ni el señor JOSÉ ELÍ JEJEN

21

Expediente

2011 00257 01

Actor

JOSÉ ELÍ JEJEN EUSCATEGUI

Demandada

SECRETARÍA DEPARTAMENTAL DE SALUD DEL CAUCA Y CAPRECOM

Acción

TUTELA – SEGUNDA INSTANCIA

Apelación

SENTENCIA DE 9 DE JUNIO DE 2.011

Procedencia:

JUZGADO QUINTO ADMINISTRATIVO DEL CIRCUITO DE POPAYÁN

EUSCATEGUI, ni muchos menos su esposa en calidad de agente oficioso, cuentan con los recursos suficientes para sufragar por ellas mismas los costos de transporte que implican el traslado a la ciudad de Cali para que la Agenciada reciba la atención de rehabilitación anteriormente descrita.

Partiendo del anterior planteamiento, encontramos que el agenciad JOSÉ ELÍ JEJEN EUSCATEGUI, cumple con el requisito específicamente planteado por la H. Corte Constitucional de falta de capacidad económica por ser de Nivel I del POS-S y que rompe a su vez con el principio de solidaridad establecido en la Ley 100 de 1993, y que implicaría que la familia de la paciente solventara los gastos adicionales, en este caso los solicitados por la Agente oficiosa. Tanto él como su familia, no cuentan con los recursos suficientes para trasladar al Agenciad, a la ciudad de Cali para que reciba su tratamiento de rehabilitación pulmonar.

No obstante ello, si bien es cierto que la orden está dirigida para que CAPRECOM EPS-S, corra con los gastos de traslado a la ciudad de Cali, la misma no se realizó de manera exclusiva para el agenciado, pues además de él, se requiere, en palabras del Agente oficioso, que se sufraguen los gastos de un acompañante.

Así pues, es evidente que se cumple el requisito de falta de capacidad económica en la agenciada y con las exigencias planteadas por la H. Corte Constitucional en jurisprudencia reiterada y expuestos anteriormente en esta providencia, respecto a la obligación que surge para el acompañante de la paciente. Al respecto, en la Sentencia T-786 de 2006, en relación con el servicio de transporte del paciente y sus acompañantes la Corte señaló:

“En consecuencia, el cubrimiento de los gastos de transporte para que un usuario pueda acceder al servicio de salud está sujeto a la capacidad económica del paciente yyyy aaaa sussussussus capacidadescapacidadescapacidadescapacidades físicasfísicasfísicasfísicas yyyy mentales,mentales,mentales,mentales, puespuespuespues enenenen casoscasoscasoscasos enenenen loslosloslos quequequeque sesesese encuentrenencuentrenencuentrenencuentren involucradosinvolucradosinvolucradosinvolucrados menoresmenoresmenoresmenores,,,, discapacitadosdiscapacitadosdiscapacitadosdiscapacitados yyyy personaspersonaspersonaspersonas dededede lalalala terceterceratercetercerarara edad,edad,edad,edad, sesesese hacehacehacehace evidenteevidenteevidenteevidente que,que,que,que, ademásademásademásademás dededede lalalala necesidadnecesidadnecesidadnecesidad deldeldeldel cubrimientocubrimientocubrimientocubrimiento deldeldeldel gastogastogastogasto dededede trasladotrasladotrasladotraslado aaaa ooootratratratra ciudadciudadciudadciudad paraparaparapara sísísísí

mismos,mismos,mismos,mismos,

desplazamientodesplazamientodesplazamientodesplazamiento dededede unununun acompañante,acompañante,acompañante,acompañante, porporporpor parteparteparteparte dededede lalalala EEEE.P.S.P.S.P.S.P.S (Se destaca).

eseseses

indispensableindispensableindispensableindispensable

elelelel

cubrimientocubrimientocubrimientocubrimiento

dededede

loslosloslos

gastgastgastgastosososos

dededede

22

Expediente

2011 00257 01

Actor

JOSÉ ELÍ JEJEN EUSCATEGUI

Demandada

SECRETARÍA DEPARTAMENTAL DE SALUD DEL CAUCA Y CAPRECOM

Acción

TUTELA – SEGUNDA INSTANCIA

Apelación

SENTENCIA DE 9 DE JUNIO DE 2.011

Procedencia:

JUZGADO QUINTO ADMINISTRATIVO DEL CIRCUITO DE POPAYÁN

Después de hacer un análisis del expediente, a folio 20 se encuentra oficio suscrito señor WILLIAM MARTÍNEZ GUZMÁN- Internista Neumólogo de la Fundación Valle del Lili médico tratante del actor, de la cual se desprende:

“a. ElElElEl señorseñorseñorseñor JOSEJOSEJOSEJOSE ELIELIELIELI JEJENJEJENJEJENJEJEN EUSCATEGUIEUSCATEGUIEUSCATEGUIEUSCATEGUI presentapresentapresentapresenta unaunaunauna ENFERMEDADENFERMEDADENFENFERMEDADERMEDAD PULMONARPULMONARPULMONARPULMONAR OBSTRUCTIVAOBSTRUCTIVAOBSTRUCTIVAOBSTRUCTIVA CRÓNICA,CRÓNICA,CRÓNICA,CRÓNICA, condicióncondicióncondicióncondición actualmenteactualmenteactualmenteactualmente exacerbadaexacerbadaexacerbadaexacerbada paraparaparapara lalalala quequequeque sesesese ordenaordenaordenaordena manejomanejomanejomanejo médico,médico,médico,médico, dentrodentrodentrodentro dededede lalalala ccccualualualual sesesese consideraconsideraconsideraconsidera necesarionecesarionecesarionecesario elelelel suministrosuministrosuministrosuministro dededede oxígenooxígenooxígenooxígeno durantedurantedurantedurante mínimomínimomínimomínimo 11118888 horashorashorashoras diarias.diarias.diarias.diarias. DeDeDeDe igualigualigualigual maneramaneramaneramanera eseseses necesarianecesarianecesarianecesaria lalalala realizaciórealizaciónrealizaciórealizaciónnn dededede unununun programaprogramaprogprogramarama dededede rehabilitaciónrehabilitaciónrehabilitaciónrehabilitación pulmonarpulmonarpulmonarpulmonar elelelel cualcualcualcual debedebedebedebe garantizargarantizargarantizargarantizar trestrestrestres sesionessesionessesionessesiones semasemasemasemanalesnalesnalesnales porporporpor ochoochoochoocho semanassemanassemanassemanas paraparaparapara quequequeque elelelel tratamientotratamientotratamientotratamiento surtasurtasurtasurta elelelel efectoefectoefectoefecto desdesdesdeseado.eado.eado.eado. (Se(Se(Se(Se destaca)destaca)destaca)destaca)

b. El traslado del paciente debe garantizar el aporte de oxígeno suplementario, para lo cual se requeriría de una bala de oxígeno de transporte que permita cubrir las distancias entre su lugar de residencia y el sitio donde se realicen sus terapias. Cumpliendo con los recambios semanales requeridos de acuerdo con su uso. Si las terapias son autorizadas en nuestra institución, esto sería por lo menos tres recambios semanales

(…)”

Por lo anterior, la Sala considera que se encuentra probado, que debido a su delicado estado de salud, el Agenciado necesita de un acompañante para sus terapias, es decir que, que el señor JOSÉ ELÍ JEJEN EUSCATEGUI, se encuentra disminuido en sus capacidades, motivo que justifica y configura como indispensable el coste de los gastos de transporte para su acompañante.

Frente al fallo de primera instancia, el Tribunal considera, que la A quo se pronunció de manera adecuada y ajustada a derecho, teniendo en cuenta que la orden de solventar gastos de transporte, sustentada en la integralidad de la atención en salud, si bien no se manifestó con el escrito de la acción, era necesario tutelar el derecho a la salud en el entendido de que se debe propender por una atención integral sin ningún tipo de obstáculo para el paciente, lo cual implica su garantía en sus diferentes facetas como lo es en una faceta preventiva, dirigida a evitar que se produzca la enfermedad; una faceta reparadora que tiene efectos curativos y una faceta mitigadora orientada a mitigar los efectos negativos de la

23

Expediente

2011 00257 01

Actor

JOSÉ ELÍ JEJEN EUSCATEGUI

Demandada

SECRETARÍA DEPARTAMENTAL DE SALUD DEL CAUCA Y CAPRECOM

Acción

TUTELA – SEGUNDA INSTANCIA

Apelación

SENTENCIA DE 9 DE JUNIO DE 2.011

Procedencia:

JUZGADO QUINTO ADMINISTRATIVO DEL CIRCUITO DE POPAYÁN

enfermedad. Todo lo anterior con el fin de solventar el obstáculo, que en el caso en concreto se manifiesta en la falta de recursos para dirigirse a la ciudad de Cali y recibir el tratamiento necesario para llevar a plenitud el derecho fundamental a la salud del Agenciado.

Es necesario recordar, que en la sentencia de 9 de junio de 2.011, la Juez A quo manifestó que lo referido al transporte, aplica en el evento de no poder brindársele el tratamiento médico en esta ciudad, caso en cual, deberá la Entidad accionada suministrarle lo requerido para el traslado a otra ciudad en las condiciones señaladas por el médico tratante, es decir, que dicha orden aplica en los tratamientos que se deban que prestar en una ciudad diferente a Popayán.

10.910.9.10.910.9 ConclusiónConclusiónConclusiónConclusión

En este orden de ideas, las respuestas a los problemas jurídicos anteriormente planteados son las siguientes:

La respuesta al primer problema jurídico planteado es positiva de acuerdo a los motivos anteriormente expuestos.

La respuesta al segundo problema jurídico, teniendo en cuenta los aspectos puntuales del presente caso es positiva, por lo que CAPRECOM EPS-S debe estar presta a garantizar de manera integral el derecho fundamental a la salud del agenciado, así como cualquier otro componente que los médicos tratantes le ordenen en su oportunidad.

Finalmente, de cara al tercer problema jurídico planteado, se tiene que la respuesta es negativa, por lo que el fallo impugnado será confirmado en su integridad en los términos expuestos en acápite anterior.

XIXI.XIXI DECISIÓNDECISIÓNDECISIÓNDECISIÓN

Por lo expuesto, el TRIBUNALTRIBUNALTRIBUNALTRIBUNAL CONTENCIOSOCONTENCIOSOCONTENCIOSOCONTENCIOSO ADMINISTRATIVOADMINISTRATIVOADMINISTRAADMINISTRATIVOTIVO DELDELDELDEL CAUCACAUCA,CAUCACAUCA administrando justicia en nombre de la República de Colombia y por autoridad de la Ley.

24

Expediente

2011 00257 01

Actor

JOSÉ ELÍ JEJEN EUSCATEGUI

Demandada

SECRETARÍA DEPARTAMENTAL DE SALUD DEL CAUCA Y CAPRECOM

Acción

TUTELA – SEGUNDA INSTANCIA

Apelación

SENTENCIA DE 9 DE JUNIO DE 2.011

Procedencia:

JUZGADO QUINTO ADMINISTRATIVO DEL CIRCUITO DE POPAYÁN

RESUELVERESUELVERESUELVERESUELVE

PRIMERO:PRIMERO:PRIMERO:PRIMERO: CONFÍRMASECONFÍRMASECONFÍRMASECONFÍRMASE la sentencia de 9 de junio de 2.011 proferida por el Juzgado Quinto Administrativo del Circuito de Popayán.

SEGUNDO:SEGUNDO:SEGUNDO:SEGUNDO: CÓPIESECÓPIESECÓPIESECÓPIESE YYYY NOTIFÍQUESENOTIFÍQUESENOTIFÍQUESENOTIFÍQUESE por telegrama, personalmente o por cualquier medio efectivo a los interesados en los términos del Art. 30 del Decreto 2591 de 1991.

TERCERO:TERCERO:TERCERO:TERCERO: ENVÍESEENVÍESEENVÍESEENVÍESE el expediente a la H. Corte Constitucional para su eventual revisión, dentro de los diez (10) días siguientes a la ejecutoria de esta providencia.

CÓPIESE,CÓPIESE,CÓPIESE,CÓPIESE, NOTIFÍQUESENOTIFÍQUESENOTIFÍQUESENOTIFÍQUESE YYYY CÚMPLASECÚMPLASE.CÚMPLASECÚMPLASE

Se hace constar que el proyecto de esta providencia fue considerado y aprobado por el Tribunal en sesión de la fecha, según consta en Acta No.

LosLosLosLos Magistrados,Magistrados,Magistrados,Magistrados,

MOISÉSMOISÉSMOISÉSMOISÉS RODRÍGUEZRODRÍGUEZRODRÍGUEZRODRÍGUEZ PÉREZPÉREZPÉREZPÉREZ

CARMENCARMENCARMENCARMEN AMPAROAMPAROAMPAROAMPARO PONCEPONCEPONCEPONCE DELGADODELGADODELGADODELGADO

25

HILDAHILDAHILDAHILDA CALVACHECALVACHECALVACHECALVACHE ROJASROJASROJASROJAS