Mol Biol Rep (2011) 38:2761–2769

DOI 10.1007/s11033-010-0421-7

Transcript profiling of antioxidant genes during biotic and abiotic

stresses in Panax ginseng C. A. Meyer
Gayathri Sathiyaraj • Ok Ran Lee •
Shonana Parvin • Atlanzul Khorolragchaa •

Yu-Jin Kim • Deok Chun Yang

Received: 25 May 2010 / Accepted: 8 November 2010 / Published online: 18 November 2010
Ó Springer Science+Business Media B.V. 2010

Abstract The regulation of reactive oxygen scavengers Keywords Gene expression  Panax ginseng 
against biotic and abiotic conditions were investigated in Antioxidant  Biotic stress  Abiotic stress
the seedling of Panax ginseng C. A. Meyer. From the EST
library we selected the antioxidant marker genes such as
Abbreviations
superoxide dismutase (SOD), catalase (CAT), ascorbate
ROS Reactive oxygen species
peroxidase (APX), glutathione peroxidase (GPX), and
SOD Superoxide dismutase
glutathione synthase (GS). The abiotic chilling, heat,
GPX Glutathione peroxide
osmotic, oxidative, and wounding stresses and biotic
APX Ascorbate peroxide
stresses with fungal pathogens were tested against 3-week-
CAT Catalase
grown seedlings. The expression patterns of the genes were
GS Glutathione synthase
analyzed by means of real-time quantitative RT-PCR. The
qRT–PCR Quantitative real-time polymerase
transcriptome result under abiotic stresses showed differ-
chain reaction
ential expression and elevated up-regulation of PgSOD,
HAT Hours after treatment
PgGPX, PgGS, and PgAPX, thus it may prove the gener-
PCD Programmed cell death
ation of ROS in ginseng. Whereas, in biotic stress the
up-regulation of transcript level merely based on the
incompatible interactions. But PgAPX and PgCAT showed
no significant change or slight down-regulation of tran-
script level during pathogen interaction. Thus it may sug- Introduction
gest that in ginseng, plant-pathogen interaction triggers
defense-related gene transcription via salicylic acid medi- In general, plants produce reactive oxygen species (ROS)
ated signaling mechanism, and also possess crosstalk sig- as a byproduct of various cellular metabolites. ROS are
naling networks between abiotic and biotic stress free radicals that contain one or more unpaired electrons
responses. [1], which react with a large variety of biomolecules such
as nucleic acids, proteins, and lipids [2]. ROS leads to
racemization, deamidation, necrosis and death [3]. In
G. Sathiyaraj  O. R. Lee  S. Parvin  A. Khorolragchaa  plants, ROS are incessantly produced in chloroplast, per-
Y.-J. Kim  D. C. Yang (&) oxisome, and mitochondria [4]. Mostly the biotic and
Korean Ginseng Center for Most Valuable Products and Ginseng
abiotic stress signals also induce the generation of ROS
Genetic Resource Bank, Kyung Hee University,
Suwon 449-701, South Korea both extra- and intracellularly [5], in addition it leads to the
e-mail: deokchunyang@yahoo.co.kr alteration of cellular redox homeostasis, resulting in oxi-
dative stress [6]. The predominant ROS species detected
D. C. Yang
under stress conditions are superoxide (O2-) the first
Department of Oriental Medicinal Material and Processing,
College of Life Science, Kyung Hee University, 1 Seocheon, reduction product of oxygen, hydrogen peroxide (H2O2)-
Kiheung Yongin, Kyunggi 449-701, South Korea not a free radical but participates as oxidant or reductant in

123
2762
many cellular reactions, and hydroxyl radicals (OH)-the
most powerful oxidizing species in biological system.
Consequently, the increased level of ROS leads to the
activation of antioxidant pathway system through signaling
[7]. Thus, the evolution of plant system depends on the
development of efficient ROS-scavenging systems. The
antioxidant enzymes such as, superoxide dismutase (SOD)
presents in mitochondrial intermembrane space, catalyzes
the dismutation of superoxide radical to H2O2 and oxygen.
Furthermore, H2O2 is converted to water and oxygen by
catalase (CAT) or ascorbate peroxide (APX) or glutathione
peroxidase (GPX), which is present in peroxisomes.
Mostly, GPX also have the ability to detoxify peroxides
[8]. Each of these enzymes has physiological function
under non-stressed conditions, but their activity increased
under stressed situations. During biotic and abiotic stresses,
ROS scavenging enzymes are induced to decrease the
concentration of toxic intracellular ROS levels. But the
ROS function may vary in between biotic and abiotic
stresses by the action of hormones, the crosstalk between
different signaling pathways, and the difference in their
location from which ROS produce [9]. These consider-
ations raise the question of how plants can regulate ROS
production and scavenging mechanisms when they are
exposed simultaneously to pathogen attacks and abiotic
stresses. And also, antioxidant enzymes play a major role
in redox balance and their activity is often tested as a
marker of pathophysiological status of a cell [10].
Panax ginseng C. A. Meyer is a slowly growing perennial
herb from the Araliaceae family. It has been traditionally
used as a medicinal plant in Oriental medicine for more than
thousand years in East Asian countries like China, Korea,
and Japan [11]. Ginseng has numerous pharmacological
effects to normalize human metabolic system and also has
activity against headache, fatigue, dizziness, nausea, and
asthma. Mostly ginseng tonic medicine has the property of
revitalizing body and mind [12, 13]. Ginseng grows in the
shade condition giving rise to many environmental abnor-
malities. During long cultivation, plants may attack by many
abiotic and fungal pathogens which cause drastic effects
[14]. Hence this study is designed to check the type of
interaction between plant-abiotic and plant-pathogen stres-
ses through the difference in the generation of ROS by
analyzing modulated antioxidant genes expression. Exten-
sive transcript profiling experiments have established the
regulation of hundreds of genes in response to abiotic stress
which are basically ROS-generating treatments [15]. So,
expression analyses and functional classification of the
ginseng ESTs provided important information about the
different metabolic and regulatory pathways that are possi-
bly associated with cellular adjustment towards stresses. In
addition, we also propose a set of genes which may turn out
to be suitable antioxidant candidates for future genetic
123
Mol Biol Rep (2011) 38:2761–2769
manipulation to improve tolerance in ginseng. In this study,
we compared the expression transcript profiling of antioxi-
dative enzymatic system in ginseng seedlings exposed to
essentially different stresses; wounding, low and high tem-
perature, osmotic (mannitol), oxidative (H2O2), and phyto-
pathogenic fungi. To the best of our knowledge up to now,
this is the first report of a transcriptional analysis of multiple
PgSOD, PgGPX, PgCAT, PgGS, and PgAPX genes in
P. ginseng in response to stresses.
Materials and methods
Plant and fungal materials
The Panax ginseng C. A. Meyer seeds used in this study
were obtained from Korean ginseng resource bank, South
Korea. The 3-week-old ginseng seedlings germinated in
vitro condition on Murashige and Skoog media (Duchefa
biocheme, Netherland) [16] supplemented with gibberellic
acid (30 mg/ml) at 25°C under a 16-h photoperiod were
used for the expression analysis. The fungal strains i.e.,
Rhizoctonia solani (KACC 40101), Fusarium oxysporum
(KACC 40052), Cylindrocarpon destructans (KACC
41077), and Colletotrichum gloeosporoides (KACC 40003)
were obtained from Korean Agricultural Culture Collection
(KACC), South Korea. We selected these strains because
these fungi causes damping-off, rusty rot, fruit, and leaf
blight diseases in ginseng [17].
EST Search
The search of antioxidant ESTs was performed using gin-
seng EST data base [18] and the BLAST program [19] at
the Plant Genome Database server (http://www.plantgdb.
org/PlantGDB-cgi/blast/PlantGDBblast). We used blastn
and tblastx programs with the expectation value (E-value)
lower than 10-4. By searching the ginseng ESTs, we
identified and selected various antioxidant candidate genes
such as SOD, CAT, APX, GPX, and GS (Table 1) based on
their open reading frames encoding the specific protein via
BlastX program (NCBI BlastX program). From the
sequences, the specific gene primers were designed for
each antioxidant genes using Primer 3 program.
Abiotic stresses
For the heat and chilling stress treatment, the plantlets were
exposed to temperatures at 37 and 4°C. For osmotic and
oxidative stresses, mannitol (11%) and H2O2 (10 mM)
were used in the MS media. The plant samples are har-
vested 1, 6, 8, 24, 48, and 72 h time intervals and stored at
-70°C [20]. All treatments were carried out with three
Mol Biol Rep (2011) 38:2761–2769 2763

Table 1 List of antioxidant genes and their specific primers used in this study
No. Genes Ginseng ESTs/ EC no. Primers used (50 -30 )
accession no.

1 Cu–Zn SOD 1 DC03032.F01 1.15.1.1 F: ACCCGGACTTCATGGTTTTC

2 Cu–Zn SOD 2
3 APX
4 GSX 1
5 GSX 2
6 GS
7 CAT
8 Actin
R: CCCTTCCAATGATGGAACCT
DC05contig150 1.15.1.1 F: TCTTGGAGCTGCCTTGGTAA
R: TAGCCAGCGCATCAGAGATT
DC03contig333 1.11.1.11 F: CTGGACCAACAACCCTCTCA
R: CCTCAGCAAATCCCAGTTCA
DC04010_C01 1.11.1.12 F: GTCAAGGATGCTAGAGGGAATG
R: GTCCCTGGCTCCTGTGCT
DC06001-1-H05-044 1.11.1.12 F: GCCAGGATCAAATCCAGAAA
R: AGGTGATGTTGTCGGTGGAT
DC03042A11_085 6.3.2.3 F: CTTCATTTTGTGGGCTGAGTT
R: TCTTCAGTTTGAACCACAAACA
EU327037 1.11.1.6 F: CAAGGATGGGAAAGCACACT
R: TGGTTACATCGAGTGGGTCA
DC03003B12 – F: CGTGATCTTACAGATAGCTTGATGA
R: AGAGAAGCTAAGATTGATCCTCC

replicates on MS media with or without the treatment
solution. The expression pattern of antioxidant genes
against both biotic and abiotic, and exposure to oxidative
stress were investigated by quantitative real-time PCR
(qRT-PCR).
Biotic stresses
The seedlings were treated with 3 mm sized mycelial plug
excised from the actively growing margin of a colony from
PDA (Difco) plates. It suspended in sterile water and
sprayed by following previous method [21]. The infection
was induced evenly on leaves, stems, and buds of the plant.
After the treatment, the plants were covered using poly-
thene bags to attain moisture condition. The untreated
plants were taken as a control. To stimulate wounding,
leaves were mechanically damaged by crushing with a
sterile forceps [22]. Plants were harvested at 6, 24, 48, and
72 h post-infection, frozen in liquid nitrogen, and stored at
-70°C.
RNA isolation and qRT-PCR
10 ng of cDNA in a 10 ll reaction volume using SYBRÒ
Green Sensimix Plus Master Mix (Quantace, Watford,
England) using the primers listed in Table 1. The house-
keeping gene encoding actin protein was used as a control
in the experiment. PCR conditions for each 40 cycles are
95°C for 10 s, 58°C for 10 s, and 72°C 20 s. Melting point
analysis of the qRT-PCR products resulted in a single peak
in all samples, indicating the presence of a single PCR
product. The melting temperature ranged from 78.6 to
80°C, with no clear differences between the treatments.
Fluorescence is detected and measured in the RT-PCR
thermocycler, and its geometric increase of the fluores-
cence corresponding to exponential increase of the product
is used to determine the threshold cycle (Ct) in each
reaction using the formula 2-DDCt. All qRT-PCR reactions
were performed in triplicate.
Results and discussion
Abiotic stress induced the transcripts of antioxidant
genes

RNA was extracted from plants using RNeasy kit (Qiagen,
Valencia, CA, USA) according to the manufacture’s
instruction. The quality and concentration of RNA was
measured using spectrophotometer (GE Nanovalue, USA).
To obtain the first strand of cDNA, 5 lg of total RNA were
reverse transcriptase using Power cDNA kit (invitrogen,
USA) following the instruction given by the manufacture.
qRT-PCR was performed by RT rotary analyzer (Rotor-
Gene 6000, Corbett Life Science, Sydney, Australia) using
Abiotic stress results in the formation of ROS in plants,
which generates a condition called oxidative stress that can
damage cellular components [23]. The abiotic stress
treatment such as osmotic, high temperature, low temper-
ature and oxidative stresses reported to induce ROS pro-
duction as well as antioxidant genes in many plants. In
ginseng we observed transcriptome profiles against various
stresses. Mannitol often used for the external stimulation of
osmotic stress, so we performed this stress treatment with

123
2764 Mol Biol Rep (2011) 38:2761–2769

3-week-old ginseng seedlings grown in vitro condition. in the expression of antioxidant marker genes may prove
The expression profile of antioxidant genes seem to be the generation of free radicals during osmotic imbalance in
regulated differentially. Transcript level of gene expression ginseng.
of PgGPX1 and PgGPX2 increased gradually up to 30- and In prior studies, H2O2 was reported to act as an oxidative
25-fold at 24 h of post treatment and declined at 72 h after stress as well as regulator of various antioxidant genes [26].
treatment compared to the control (Fig. 1a). The strong H2O2 also induces an increase of membrane permeability,
induction of peroxidase activity due to mannitol also chlorophyll damage and lipid peroxidation [27, 28] which
proved in Centaurea ragusina [24]. The PgAPX and in turn increases the antioxidant activity [29]. The gene
PgCAT gene expression increased at 8 h of post treatment expression of antioxidant genes tend to be increased during
and reached maximum at 24 h (37- and 28-fold) respec- the treatment of H2O2. The transcript level of PgGPX1 and
tively. The expression level of PgGS starts at 4 h (3-fold) PgGPX2 was increased maximum at 72 h of post treatment
and reached maximum to 130-fold at 24 h of post treat- (44- and 29-fold). The PgAPX and PgCAT gene also
ment. The PgSOD1 also follows the same pattern (12-fold showed highest up-regulation of transcript level (297- and
at 24 h) but the transcriptome level appears to be less when 38-fold) at 4 h (Fig. 1b) of post treatment when compared
compared to other antioxidant genes within 8 to 48 h. to the control. The PgGS transcript level increased at 24 h
Higher sugar concentration leads to decrease in osmotic with 82-fold than the control, whereas PgSOD at 8 h (47-
potential of the medium [25], thereby generating ROS in fold) of post treatment (Fig. 1b). The expression of all
the plant. Mannitol rapidly induced the accumulation of antioxidant genes seems to have a positive regulation
ROS scavenger’s transcriptome in P. ginseng. The increase against H2O2, because H2O2 itself act as a reactive oxygen

****
a Mannitol (11%) **
c Cold (4 °C) ** **
****
GPX1 GPX1
Relative gene expression

Relative gene expression

100 GPX2 50 GPX2

APX APX **
CAT ** CAT
** * *
GS GS
SOD SOD * *
50 * * *
*
** *
* * *
*
4
15 * * ** *
* * 3 *
*
10 * * **
* *
2 *
** * *
5 1
** * *
0 0
control 1 h 4h 8h 24 h 48 h 72 h control 1 h 4h 8h 24 h 48 h 72 h
Time interval Time interval
100
300 ** ****
b H 2O2 (10 mM) d Heat (37 °C)
250 80
Relative gene expression
Relative gene expression

200
150 60
100 ** ** 40
50 * * * * * **
* * *
20

* *
* *
* 15
* *
10 *
* 10 *
* ** * **
* * * *
* *
5 * * ** * * *
5 ** *
* *
* * *
0 0
control 1 h 4h 8h 24 h 48 h 72 h control 1 h 4h 8h 24 h 48 h 72 h
Time interval Time interval

Fig. 1 Differential expression levels of PgGPXs, PgAPX, PgCAT,
PgGS, and PgSOD in response to mannitol, hydrogen peroxide, cold,
and heat treatments. RNA was isolated from treated-seedlings in the
indicated times, and the expression levels were determined by qRT-
PCR. The Ct value for tested genes were normalized to the Ct value
for b-actin and calculated relative to a calibrator using the formula
2-DDCt. Data represent means ± SD for three independent replicates.
Averages for treated-samples are significantly different compared to
the control at *P \ 0.05 and **P \ 0.01 using Student’s t-test

123
Mol Biol Rep (2011) 38:2761–2769
species. As the PgAPX transcript level increased drastically
with their role in the conversion of H2O2 to water, the
overproduction of APX proved to possess tolerant effect
against oxidative stress in tobacco plant [30].
Exposure of plants to cold stress tends to decrease
membrane fluidity due to fatty acid unsaturation in mem-
brane lipids [31] thus generating ROS. Under chilling
stress (4°C), the PgGPX1 and PgGPX2 showed differential
transcript level (Fig. 1c). PgGPX2 gene increased 4.6-fold
at 24 h after treatment (HAT) whereas, PgGPX1 showed
less expression (1.8-fold) at 8 h of post treatment compared
to the control (Fig. 1c). The PgAPX gene transcript level
accumulated the most at 48 HAT (30.9-fold) and declined
drastically at 72 HAT to the control level (Fig. 1c). The
PgCAT expression level showed maximum accumulation
(7-fold) at 48 HAT (Fig. 1c). The transcript level of PgGS
increased to up to 77-fold at eight HAT when compared to
the control (Fig. 1c). PgSOD1 also showed elevated
expression quite suddenly at 1 h with relative gene
expression of 41-fold and reached maximum at 8 h (82-
fold) and gradually decreased in the expression level up to
5.5-fold at 24 h. Similar expression pattern also proved in
Nicotiana plumbaginifolia [32]. There is escalating evi-
dence that low temperature stress induced the increase of
reactive oxygen which has greater toxicity potentials on
bio-molecules and membranes in plants [33]. The identical
up-regulation of antioxidant genes was also proved in
eggplant [34]. The expression of SOD gene from cassava
and peroxidase gene from sweet potato also showed
increased transcript level against chilling treatment
[35, 36]. Progressive decline in CAT activity that occurred
during chilling has been noticed in many plants [37]. This
cold liability of CAT could be compensated by APX, which
have similar function with CAT. This role for APX at a low
temperature has been reported in many plants [38, 39]. The
highly elevated expression of peroxidase genes were
reported in the suspension culture of sweet potato by cold
[36]. GPX level was also increased in chilled Coffea
Arabica roots [40].
High temperature is one of the major environmental
factors affecting plant growth and productivity [41]. Dur-
ing heat treatment, the gene expression of PgGPX1,
PgGPX2, PgAPX, PgCAT, and PgGS showed elevated
transcript level of 6.3-, 6-, 15-, 92-, and 90-fold at four
HAT, whereas, PgSOD1 transcript level increased at 1 h
with 16-fold compared to the control (Fig. 1d). During heat
stress, the generation of ROS has greater toxicity potentials
on biomolecules and membranes. It has been identified to
be one of the fast kinetic events in plants exposed to
excessive temperature [42]. The increased antioxidant
capacity during heat treatment has been reported in
cucumber seedling [43], and similar kinetic was observed
in ginseng as discussed in this study.
2765
Biotic stress-induced transcript expression
ROS is not only generated by cellular function and abiotic
stresses but also generated during plant-pathogen interac-
tions [44]. Recognition of pathogen induces the defense
mechanism at the site of infection and associated with
hypersensitive reaction like synthesis of hydrolysis
enzymes, phytoalexins [45]. To verify the generation of
ROS during biotic stress, we used ginseng pathogen for
infection and checked the gene transcript patterns. During
the infection of C. destructans, the gene expression of
PgSOD1 and PgSOD2 found to have maximum transcript
level (8.3- and 8.6-fold) at 48 HAT compared to the con-
trol. The PgCAT showed the highest transcript level at 6 h
and decreased gradually to the level of control (Fig. 2a).
The PgAPX showed overall similar level of gene expres-
sion with control. The PgGPX1 and PgGPX2 showed dif-
ferential expression levels; PgGPX1 showed 3-fold
expression at 6 h and gradually declined as the hours
passed, PgGPX2 increased to 3-fold at 24 h of post
infection. PgGS also showed moderate average 6-fold
expression pattern within 6–72 h after treatment (Fig. 2a).
When plants are treated with R. solani, the gene expression
of PgSOD1 and PgSOD2 started at 6 h and increased to
maximum (8- and 8.5-fold) at 72 h. The PgCAT showed
3-fold expression at 6 h (3-fold) and decreased gradually.
PgGPX1 expression increased 2- to 3-fold within 6 h to 72
HAT and PgGPX2 attained 1.5-fold at 24–48 HAT
(Fig. 2b), PgGS showed maximum increase at 24 HAT
(7-fold). The gene expression level of PgAPX did not show
any significant difference compared to the control
(Fig. 2b). During the treatment with C. gloeosporoides, the
transcriptome profile showed elevated expression of
PgSOD which started at 6 h and reached maximum at 24
HAT, then slightly reduced at 72 HAT (Fig. 2c). The mean
expression value of PgCAT and PgAPX was similar to the
control within tested 24–72 h conditions. PgGPXs were
showed moderate expression in all tests, whereas PgGS
showed the highest expression at six HAT and showed
similar increased expressions with PgSODs (Fig. 2c). By
F. oxysporum infection, PgSODs transcript level was
highly induced over the treated times and reached highest
at 48 and 72 HAT (Fig. 2d). PgCAT showed highest
expression at six HAT and declined gradually over the time
goes. However PgAPX did not show any significantly
regulated gene expression pattern. Transcripts of PgGPXs
and PgGS were increased 3-fold at 24 HAT and maintained
till at 72 HAT (Fig. 2d).
Overall transcript level of antioxidant genes rose at six
HAT, increased maximum at 24–48 HAT and declined to 72
HAT during the infection of C. gloeosporoides, C. destruc-
tans, R. solani, and F. oxysporum. This perhaps takes place
during incompatible interactions. Therefore when host
123
2766 Mol Biol Rep (2011) 38:2761–2769

SOD1 SOD2 CAT APX GPX1 GPX2 GS

10
a Cylindrocarpon destructans b Rhizoctonia solani
10
**
9 ** * **
9 *
** *
*
Relative gene expression
8 *

Relative gene expresssion

8 *
7 7 * * *
* *
6 * 6
* * * *
5 * 5
4 4
* *
3 ** ** 3 *
* *
2 * *
2

R
1
1
0
0
control 6h 24 h 48 h 72 h
control 6h 24 h 48 h 72 h
Time intervals Time intervals
c Colletotrichum gloeosporoides 9
d Fusarium oxysporum
yp
12
8
** **
** **

Relative geene expression

10
Relative geene expression

* 7

8 6
*
** 5
6 * ** * *
** * * 4 *
4 3 * * * ** * ** * **
* * 2
2 * *
1
0 0
control 6h 24 h 48 h 72 h control 6h 24 h 48 h 72 h
Time intervals Time intervals

Fig. 2 Effect of biotic stresses on the expression of antioxidant as control. The mRNA transcript level was detected by using qRT-
genes. Actively growing fungi strains were sprayed on the 3-week-old PCR. Data represent means ± SD for three independent replicates.
ginseng plants to induce stress. The infections were terminated as per Averages for treated-samples are significantly different compared to
the time mentioned on the figure. The non-infected plants were used the control at *P \ 0.05 using Student’s t-test

defense responses induced PCD (programmed cell death), ascorbate peroxidase inhibition occurs is by the generation of
very rapid accumulation of H2O2 occurs and, by this means SA free radicals. SA has been shown to inhibit CAT by
pathogen can systemically infect the host plant [46]. The serving as a one-electron donating substrate [49]. In this
expression patterns of PgSOD1, PgGPX were up-regulated process, SA is converted into a free radical, which could then
abundantly by each one of the fungal pathogens, whereas initiate lipid peroxidation. Therefore CAT overproducing
PgCAT and PgAPX gene expression appears to be negatively tobacco plant showed less resistance to pathogen attack [50].
associated with the defense response against fungal infec-
tion. It is possible that this action is strongly correlated with Mechanical wounding induces antioxidant genes
HR (hypersensitive reaction) by facilitating the rapid accu- expression
mulation of redox signals. This also proved in tobacco plant
[47]. Therefore during plant-pathogen interactions, the When plants are exposed to wound stress, generation of
activities and expression of the ROS detoxifiers such as reactive oxygen species (ROS) were reported in many
PgAPX and PgCAT was down-regulated by the signaling of plants [51–53]. Mechanical wounding of plant tissue due to
salicylic acid (SA) and nitrous oxide (NO) [47]. The first physical factors, pest and/or pathogen attack causes rapid
protein shown to reversibly bind SA was a CAT from changes on different gene expressions locally and sys-
tobacco, originally termed SABP (SA-binding protein). temically [54, 55]. The gene expression of PgSOD1
Catalase converts H2O2 to H2O and O2; this activity was increased dramatically and reached highest transcription
proved to be inhibited by SA both in vitro and in vivo [48]. level at 48 h (22-fold) and declined at 72 h of post treat-
Another mechanism through which SA-mediated CAT and ment. The other antioxidant genes, PgGPX1 and PgGPX2

123
Mol Biol Rep (2011) 38:2761–2769 2767

25 24 h (Fig. 3). Wounding showed modest expression of

PgCAT gene at 6 HAT, this may due to the production of
* H2O2 during mechanical wounding in the plants. By
20
wounding, higher amount of H2O2 level increased the SOD
Relative gene exppression

activity and decreased CAT activity in Mesembryanthe-

15 mum crystallinum plant [56]. So it may be one of the
reasons for the decrease of CAT expression in ginseng.

10 *

*
* *
* *
5
** * *
0 stress induction. Diverse expression patterns of antioxidant
control 6h 24 h
Time intervals
Fig. 3 Mechanical wounding induced the expression level of antiox-
idant genes. Three-week-old ginseng seedlings were mechanically
stressed for the times indicated. Relative gene expression was observed
using qRT-PCR. The Ct value for tested genes were normalized to the
Ct value for b-actin and calculated relative to a calibrator using the
formula 2-DDCt. Data represent means ± SD for three independent
replicates. Averages for treated-sample is significantly different
compared to the control at *P \ 0.05 using Student’s t-test
expression starts at (3.5- and 4.11-fold) 6 h, then increased
maximum at (3.8-and 5.4-fold) 24 h. PgAPX, and PgGS,
showed up-regulated gene expression (2.3- and 3.7-fold) at
Conclusion
In conclusion, we showed the changes in antioxidant
* * * expression profiles of various antioxidant genes during
48 h 72 h genes will provide information on the possible functions of
each gene during abiotic and biotic stresses. However, the
transcript level of antioxidant genes showed more elevated
expression during abiotic stress rather than biotic. Because,
biotic and abiotic stresses induce reactive oxygen species
(ROS) through distinct pathways: pathogen infections
activate specific ROS-producing enzymes, which results in
accumulation of cellular or intercellular ROS, such as
superoxide or hydrogen peroxide. Abiotic stresses, on the
other hand, causes elevated ROS production principally
through an impairment of photosynthetic and respiratory
electron transport pathways. Also, these two types of
stresses have diverse effects on the antioxidant system of

Fig. 4 Diagrammatic
representation of predicted
antioxidant defense mechanism
in ginseng during abiotic and
biotic stresses. During abiotic
Chilling Pathogen
stress, the ROS is accumulated, Heat Wounding
hence the antioxidant Mannitol
expression is also increased. H2O2
The SOD will convert
superoxide to H2O2, later it
converted into water by CAT,
APX, and other peroxidases.
But in biotic and wounding, the
expression level of CAT and
APX is rather not changing
drastically. This may be due to
the signaling molecules SA
during biotic and wounding
stresses [47]

superoxide glutathione superoxide glutathione

dismutase peroxidase dismutase peroxidase
2O2 H 2O2 + O 2 GSSG 2O2 H 2O2 + O 2 GSSG

CAT
APX CAT
APX
H 2O H 2O

123
2768
the plant. Especially, the expression patterns of APX and
CAT seems to behave in different ways. During the defense
against plant pathogen, plant produce more ROS thereby,
decreasing the ROS scavenging capacity. The accumulated
ROS activate the PCD, which will limit the spread of
disease from the infection site [23]. In tobacco, the biotic
stress decreased the expression of APX and CAT and
showed increased PCD in cells [30], which resulted in the
incompatible interaction of pathogens to plants [23].
Wounding stress increased the expression of ROS scav-
engers in plants [23] leads to the accumulation of H2O2
which induce PCD, thus it shows similar pattern of anti-
oxidant gene expression with biotic stress (Fig. 3).
The present study clearly shows the up-regulation of all
tested ROS scavengers during abiotic stresses (Fig. 1). In
case of biotic stresses, it also showed similar antioxidant
genes expression patterns where it showed more up-regu-
lated PgSODs, PgGPXs, and PgGS and less-responsive
expression patterns of PgCAT and PgAPX (Fig. 2). Based
on the previous study (for the review, [23]) and current
study, the possible antioxidant system in ginseng is sum-
marized (Fig. 4), although it have to be assured in the
future study. Taken together, we have done the preliminary
work to check the actual mechanism of transcript profile of
antioxidant genes during biotic and abiotic stresses.
Changes in ROS scavenger’s activities during various
abiotic and biotic stresses remain to be studied in future.
Acknowledgments This study was supported by grant from the
KGCMVP for Technology Development Program of Agriculture and
Forestry, Ministry of Food, Agriculture, Forestry and Fisheries,
Republic of Korea.
References
1. Halliwell B, Gutteridge JMC (2006) Free radicals in biology and
medicine, 4th edn. Clarendon Press, Oxford
2. Foote CS, Wexler S (1964) Olefin oxidations with excited singlet
molecular oxygen. J Am Chem Soc 86:3879–3880
3. Girotti AW (2001) Photosensitized oxidation of membrane lipids:
reaction pathways, cytotoxic effects and cryoprotective mecha-
nisms. J Photochem Photobiol 63:103–113
4. Elstner EF (1991) Oxygen radicals—biochemical basis for their
efficacy. Klin Wochenschr 69:949–956
5. Mittler R, Vanderauwera S, Gollery M, Van Breusegem F (2004)
Reactive oxygen gene network of plants. Trends Plant Sci
9:490–498
6. Grene R (2002) Oxidative stress and acclimation mechanisms in
plants. In: Somerville CR, Myerowitz EM (eds) The arabidopsis
book. American Society of Plant Biologists, Rockville, pp 1–19.
Available at http://www.aspb.org/publications/Arabidopsis/
7. Agrawal GK, Rakwal R, Jwa NS, Agrawal VP (2002) Effects of
signaling molecules, protein phosphatase inhibitors and blast
pathogen (Magnaporthe grisea) on the mRNA level of a rice
(Oryza sativa L.) phospholipid hydroperoxide glutathione per-
oxidase (OsPHGPX) gene in seedling leaves. Gene 283:227–236
123
Mol Biol Rep (2011) 38:2761–2769
8. Hernández JA, Jiménez A, Mullineaux P, Sevilla F (2000) Tol-
erance of pea (Pisum sativum L.) to long-term salt stress is
associated with induction of antioxidant defenses. Plant Cell
Environ 23:853–862
9. Pitzschke A, Hirt H (2006) Mitogen-activated protein kinases and
reactive oxygen species signaling in plants. Plant Physiol
141:351–356
10. Alissa EM, Bahijri SM, Lamb DJ, Ferns GA (2004) The effects of
coadministration of dietary copper and zinc supplements on
atherosclerosis, antioxidant enzymes and indices of lipid perox-
idation in the cholesterol-fed rabbit. Int J Exp Pathol 85:265–275
11. Vogler BK, Pittler MH, Ernst E (1999) The efficacy of ginseng. A
systematic review of randomized clinical trials. Eur J Clin
Pharmacol 55:567–575
12. Park JD, Rhee DK, Lee YH (2005) Biological activities and
chemistry of saponins from Panax ginseng C. A. Meyer. Phyto-
chem Rev 4:159–175
13. Choi KT (2008) Botanical characteristics, pharmacological
effects and medicinal components of Korean Panax ginseng C.
A. Meyer. Acta Pharmacol Sin 29:1109–1118
14. Lee SK (2004) Fusarium species associated with ginseng (Panax
ginseng) and their role in the root-rot of ginseng plants. Res Plant
Dis 10:248–259
15. Gadjev I, Vanderauwera S, Gechev TS, Laloi C, Minkov IN,
Shulaev V, Apel K, Inz0 e D, Mittler R, Van Breusegem F (2006)
Transcriptomic footprints disclose specificity of reactive oxygen
species signaling in Arabidopsis. Plant Physiol 141:436–445
16. Murashige T, Skoog F (1962) A revised medium for rapid growth
and bioassays with tobacco tissue. Physiol Plant 15:473–497
17. Kim JH, Kim SG, Kim MS, Jeon YH, Cho DH, Kim YH (2009)
Different structural modifications associated with development of
ginseng root rot caused by Cylindrocarpon destructans. Plant
Pathol J 25:1–5
18. Sathiyamoorthy S, In JG, Gayathri S, Kim YJ, Yang DC (2009)
Generation and gene ontology based analysis of expressed
sequence tags (EST) from a Panax ginseng C. A. Meyer roots.
Mol Biol Rep 46(7):932–939
19. McGinnis S, Madden TL (2004) BLAST: at the core of a pow-
erful and diverse set of sequence analysis tools. Nucleic Acids
Res 32:20–25
20. Parvin S, Pulla RK, Kim YJ, Sathiyaraj G, Jung SK, Khorol-
ragchaa A, In JG, Yang DC (2009) Isolation and characterization
of glycolate oxidase gene from Panax ginseng C. A. Meyer.
J Ginseng Res 33(4):249–255
21. Sathiyaraj G, Srinivasan S, Subramanium S, Kim YJ, Kim YJ,
Kwon SW, Yang DC (2010) Polygalacturonase inhibiting pro-
tein: isolation, developmental regulation and pathogen related
expression in Panax ginseng C.A. Meyer. Mol Biol Rep
37(7):3445–3454
22. Lee JH, Kim YJ, Jeong DY, Sathiyaraj G, Pulla RK, Shim JS, In
JG, Yang DC (2010) Isolation and characterization of a glutamate
decarboxylase (GAD) gene and their differential expression in
response to abiotic stresses from Panax ginseng C. A. Meyer.
Mol Biol Rep 37(7):3455–3463
23. Apel K, Hirt H (2004) Reactive oxygen species: metabolism,
oxidative stress, and signal transduction. Annu Rev Plant Biol
55:373–399
24. Radić S, Radić-Stojković M, Pevalek-Kozlina B (2006) Influence
of NaCl and mannitol on peroxidase activity and lipid peroxi-
dation in Centaurea ragusina L. roots and shoots. J Plant Physiol
163(12):1284–1292
25. Trivedi AH, Dave BJ, Adhvaryu SG (1990) Assesment of
genotoxicity of nicotine employing in vitro mammalian test
systems. Cancer Lett 54:89–94
26. Prasad TK, Anderson MD, Stewart CR (1994) Acclimation,
hydrogen peroxide, and abscisic acid protect mitochondria
Mol Biol Rep (2011) 38:2761–2769
against irreversible chilling injury in maize seedlings. Plant
Physiol 105:619–627
27. Lin JN, Kao CH (1994) Effect of oxidative stress caused by
hydrogen peroxide on senescence of rice. Bot Bull Acad Sin
39:161–165
28. Patra J, Brahma B, Panda A (1998) Comparison of biochemical
responses to oxidative and metal stress in seedlings of barley,
Hordeum vulgare L. Environ Pollut 101:99–105
29. Pastori GM, Trippi VS (1992) Oxidative stress induces high rate
of glutathione reductase synthesis in a drought resistant maize
strain. Plant Cell Physiol 33:957–961
30. Allen RD, Webb RP, Schake SA (1997) Use of transgenic plants
to study antioxidant defenses. Free Radic Biol Med 23:472–479
31. Wang X, Li W, Li M, Welti R (2006) Profiling lipid changes in
plant response to low temperatures. Physiol Plant 126:90–96
32. Tsang EWT, Bowler C, Herouart D, Van Camp W, Villarrod R,
Genetello C, Van Montagu M, Inze D (1991) Differential regu-
lation of superoxide dismutases in plants exposed to environ-
mental stress. Plant Cell 3:783–792
33. Holmberg N, Bülow L (1998) Improving stress tolerance in plants
by gene transfer. Trends Plant Sci 3(2):61–66
34. Zubini P, Bertolini P, Baraldi E (2005) Variation of antioxidant
enzyme gene expression during cold storage of aubergine. Acta
Hort (ISHS) 682:1287–1292
35. Huh GH, Lee SJ, Bae YS, Liu JR, Kwak SS (1997) Molecular
cloning and characterization of cDNAs for anionic and neutral
peroxidases from suspension cultured cells of sweet potato and
their differential expression in response to stress. Mol Gen Genet
255:382–391
36. Kim KY, Huh GH, Lee HS, Kwon SY, Hur Y, Kwak SS (1999)
Molecular characterization of two anionic peroxidase cDNAs
isolated from suspension cultures of sweet potato. Mol Gen Genet
261:941–947
37. Saruyama H, Tanida M (1995) Effect of chilling on activated
oxygen-scavenging enzymes in low temperature-sensitive and -
tolerant cultivars of rice (Oryza sativa L.). Plant Sci 109:105–113
38. Chen G, Asada K (1989) Ascorbate peroxidase in tea leaves:
occurrence of two isozymes and the differences in their enzy-
matic and molecular properties. Plant Cell Physiol 30:987–998
39. Elia MR, Borraccino G, Dipierro S (1992) Soluble ascorbate
peroxidase from potato tubers. Plant Sci 85:17–21
40. Queiroz CGS, Alonso A, Mares-Guia M, Magalhães AC (1998)
Chilling-induced changes in membrane fluidity and antioxidant
enzyme activities in Coffea Arabica L. roots. Biol Plant
41(3):403–413
41. Havaux M (1993) Characterization of thermal damage to the
photosynthetic electron transport system in potato leaves. Plant
Sci 94:19–33
42. Scandalios JG (1993) Oxygen stress and superoxide dismutases.
Plant Physiol 101(1):7–12
2769
43. Kang HM, Saltveit ME (2002) Antioxidant enzymes and DPPH-
radical scavenging activity in chilled and heat-shocked rice
(Oryza sativa L.) seedlings radicles. J Agric Food Chem
50(3):513–518
44. Doke N (1983) Generation of superoxide anion by potato tuber
protoplasts upon the hypersensitive response to hyphal wall
components of Phytophthora infestans and specific inhibition of
the reaction by suppressor of hypersensitivity. Physiol Plant
Pathol 23:359–367
45. Lamb CJ, Lawton MA, Dron M, Dixon RA (1989) Signals and
transduction mechanisms for activation of plant defenses against
microbe attack. Cell 56:215–233
46. Baker MA, Orlandi EW (1995) Active oxygen in plant patho-
genesis. Annu Rev Phytopathol 33:299–321
47. Klessig DF, Durner J, Noad R, Navarre DA, Wendehenne D,
Kumar D, Zhou JM, Shah J, Zhang S, Kachroo P, Trifa Y, Pontier
D (2000) Nitric oxide and salicylic acid signaling in plant
defense. Proc Natl Acad Sci USA 97:8849–8855
48. Chen HS, Klessig DF (1993) Active oxygen species in the
induction of plant systemic acquired resistance by salicylic acid.
Science 262:1883–1886
49. Durner J, Klessig DF (1996) Salicylic acid is a modulator of
tobacco and mammalian catalases. J Biol Chem 271:28492–
28501
50. Polidoros AN, Mylona PV, Scandalios JG (2001) Transgenic
tobacco plants expressing the maize Cat2 gene have altered cat-
alase levels that affect plant-pathogen interactions and resistance
to oxidative stress. Transgenic Res 10(6):555–569
51. Fujita M, Fujita Y, Noutoshi Y, Takahashi F, Narusaka Y,
Yamaguchi-Shinozaki K, Shinozaki K (2006) Crosstalk between
abiotic and biotic stress responses: a current view from the points
of convergence in the stress signaling networks. Curr Opin Plant
Biol 9:436–442
52. Clark SF, Guy PL, Burritt DJ, Jameson PE (2002) Changes in the
activities of antioxidant enzymes in response to virus infection
and hormone treatment. Physiol Plant 114(2):157–164
53. Durner J, Klessig DF (1995) Inhibition of ascorbate peroxidase
by salicylic acid and 2, 6-dichloroisonicotinic acid, two inducers
of plant defense responses. Proc Natl Acad Sci USA 92:11312–
11316
54. Mittler R, Shulaev V, Lam E, Cohen M (1999) Signals control-
ling the expression of cytosolic ascorbate peroxidase during
pathogen-induced programmed cell death in tobacco. Plant Mol
Biol 39:1025–1035
55. Allen RD (1995) Dissection of oxidative stress tolerance using
transgenic plants. Plant Physiol 107:1049
56. Ochsenbein C, Przybyla D, Danon A (2006) The role of EDS1
(enhanced disease susceptibility) during singlet oxygen-mediated
stress responses of Arabidopsis. Plant J 47(3):445
123