Вы находитесь на странице: 1из 8

Journal of Applied Microbiology 1997, 82, 783–790

DNA probe and PCR-specific reaction for Lactobacillus plantarum

F. Quere 1,2 , A. Deschamps 1 and M. C. Urdaci 1

1 Laboratoire de Microbiologie et Biotechnologie (ISTAB-ENITA), Universite´ Bordeaux I, Talence, and 2 UNICOPA Nutrition Animale, Languidic, France

5872/07/96: received 31 July 1996, revised 30 October 1996 and accepted 1 November 1996

F. QUERE, A. DESCHAMPS AND M. C. URDACI. 1997. A 300 bp DNA fragment of Lactobacillus

plantarum isolated by randomly amplified polymorphic DNA (RAPD) analysis was cloned and sequenced. This fragment was tested using a dot-blot DNA hybridization technique for its ability to identify Lact. plantarum strains. This probe hybridized with all Lact. plantarum strains tested and with some strains of Lact. pentosus, albeit more weakly. Two internal primers of this probe were selected (LbPl1 and LbPl2) and polymerase chain reaction (PCR) was carried out. All Lact. plantarum strains tested amplified a 250 bp fragment contrary to the other LAB species tested. This specific PCR for Lact. plantarum was also performed from colonies grown on MRS medium with similar results. These methods enabled the rapid and specific detection and identification of Lact. plantarum.

INTRODUCTION

Food preserving and flavour development is often carried

by lactic acid bacteria (LAB). The specific environmental

conditions prevailing in a fermenting food promote the

growth of certain species of these bacteria. Lactobacillus plan- tarum is predominantly found (also used as a starter) in fer- mented food and feed products. Lactobacillus plantarum is

implicated in processed food for human consumption

sauerkraut (Pederson 1979), dry fermented sausage (Lu¨ cke 1994), green olive fermentations (Ruiz-Barba et al. 1994) and cheese making (Tzanetakis and Litopoulou-Tzanetakis 1992) as well as in animal nutrition such as crop preservation (Wein- berg et al. 1993; Merry et al. 1995), fish and crab waste

fermentation (Abazinge et al. 1993; Lasse´ n 1994;

Mauguin

like

out

and Novel 1994) and poultry by-product fermentation (Urlings et al. 1993). The fermentation of these food products usually results from growth association and interaction between different

LAB. Identification of these bacteria is essential in both basic

and applied research. However, a clear identification of

ies, particularly within the genus Lactobacillus, may some-

spec-

times be very ambiguous and complicated using phenotypic methods such as sugar fermentation patterns due to an

Correspondence to: Dr M. C. Urdaci, Laboratoire de Microbiologie et Biotechnologie (ISTAB), Universite´ Bordeaux I, avenue des Faculte´ s, 33405

increasing number of LAB species which vary on a small number of these characters. Pot et al. (1994a) and Johansson et al. (1995) have described Lact. plantarum as having a highly variable phenotype. This variability leads to a very difficult discrimination between Lact. plantarum and a closely related species Lact. pentosus (Dellaglio et al. 1973; Abazinge et al.

1993).

Lactobacillus species are identified using a variety of methods other than phenotypic methods. These include phy- sico-chemical methods such as SDS-PAGE protein patterns (Pot et al. 1994b) and Fourier transformed infrared spec- troscopy (Naumann et al. 1991), or genetic methods which include DNA/DNA hybridizations (Johnson et al. 1980; Fujisawa et al. 1992), the analysis of rRNA sequences (Collins et al. 1991) and 16S and 23S rRNA-target oligonucleotide probes (Hertel et al. 1991; Castellanos et al. 1993; Pot et al. 1993; Richter et al. 1995), nucleic acid hybridization by PyrDFE genes (Bringel et al. 1995), ribotyping (Rodtong and Tannock 1993), restriction endonuclease patterns (Stahl et al. 1990; Abazinge et al. 1993; Roussel et al. 1993) and the randomly amplified polymorphic DNA (RAPD) method (Johansson et al. 1995). Nucleic acid DNA probes are known to be useful for the detection and identification of bacteria (Schleifer 1990). Specific oligonucleotidic probes have been described for Lact. plantarum based on 16S or 23S rRNA sequences (Hertel et

Talence, France (e-mail: urdaci@istab.u-bordeaux.fr). al. 1991; Klijn et al. 1991) but they are not discriminative

© 1997 The Society for Applied Bacteriology

784

F. QUERE ET AL.

for Lact. pentosus. In fact, identification at the species level requires the back-up of a large database of rRNA sequences

and, in the case of very closely related species, even

sequence analysis may not be sufficient (Pot et al. 1993). DNA probes have also been described for the Lact. acidophilus group (Pot et al. 1993), Lact. helveticus (Pilloud and Mollet 1990), Lact. curvatus (Petrick et al. 1988; Vogel et al. 1993)

rRNA

and Lact. delbrueckii (Delley et al. 1990) but PCR methods are not usually employed to identify Lactobacillus species

(Nakagawa et al. 1994). This method certainly would be of use

in the food industry to identify rapidly

relevant strains in fermentation processes. This study was undertaken to develop a quick method

the identification of Lact. plantarum and, in particular, to

perfect a probe which could be used in hybridization pro- cedures to specifically identify Lact. plantarum strains and to provide a PCR-specific reaction for quick detection or identification of Lact. plantarum.

and unambiguously

MATERIALS AND METHODS

Bacterial strains and growth conditions

Oligonucleotides and RAPD or PCR-specific reaction

Oligonucleotides were synthesized by Eurogentec (Seraing, Belgium). The OPA3 primer (5?-AGTCAGCCAC-3?) was used in the RAPD reaction. The OPA3-EcoRI primer (5?- CCGAATTCAGTCAGCCAC-3?) was used for re-ampli- fication of the 300 bp RAPD OPA3-DNA fragment for clon- ing. The PCR-specific reaction of Lact. plantarum was performed using the specific primers LbPl1 (5?- AATTGAGGCAGCTGGCCA-3?) and LbPl2 (5?-GAT- TACGGGAGTCCAAGC-3?) primers. The semi-universal primers designated Lb1 (5?-AGAGTTTGATCATGGC

for TCAG-3?) and Lb2 (5?-CGGTATTAGCATCTGT

TTCC-3?) in the present study were designed by Klijn (1993). These primers amplified a variable loop in 16S rRNA sequences of Lactobacillus species and were employed as a positive control of PCR. Twenty-five ml of reaction mixture containing 50 ng of template DNA, 5 pmol l 1 of a 10-mer primer OPA3 (in RAPD reaction), or LbPl1/LbPl2 and Lb1/Lb2 primers (in PCR-specific reaction), 50 mmol l 1 of each dNTP and 0·8

U of Taq DNA polymerase (Appligene) with 2·5 ml of 10

PCR reaction buffer (Appligene) were overlaid with mineral oil. The amplification reaction was performed in a DNA thermal cycler (Own E, Hybaid). The RAPD reaction was adapted from a method described by Meunier and Grimont (1993). Each sample was subjected to a primary denaturation cycle at 95°C for 5 min and at 94°C for 30 s, 36°C for 1 min

The bacterial strains employed in this study are listed in

Table 1. Strains were either derived from culture collections or isolated from a wide variety of products. The Escherichia coli strain used for cloning was DH5a [F supE44thi-1 recA1

gyrA96 relA1 hsdR17 (r

D(lacZYA-argF)U169]. and 72°C for 1 min during 45 cycles. After a denaturation

cycle at 95°C for 5 min, PCR specific amplification with LbPl1/LbPl2 plus Lb1/Lb2 primers was performed with template denaturation at 94°C for 30 s, primer annealing at 54°C for 1 min and primer extension at 72°C for 1 min. In both cases the reactions were terminated at 72°C for 10 min.

Growth of LAB and Sporolactobacillus was performed in MRS broth (Difco) at 37°C under anaerobic conditions. Esch- erichia coli was grown in YT medium (Gibco BRL) at 37°C and Bacillus cereus was grown in PCA medium (Difco) at 30°C under aerobic conditions.

K m K ) endA1 f80dlacZDM15

DNA isolation

Bacterial DNA was extracted according to the method

Luchansky et al. (1991). After centrifugation and two washes

in TE buffer (10 mmol l 1 Tris–HCl, pH 8·0; 1 mmol l 1

EDTA), cells were resuspended in 1 ml of a lysis

Tris, 2 mmol l 1 EDTA) without cooling. A DNA molecular

weight marker (superladder mid-1, Eurogentec) was used

as standard. Gels were stained with ethidium bromide and

at 37°C. The reaction was stopped using 1 ml of

(250 mmol l 1 , pH 8·0) for 5 min. The samples were then treated with 400 ml of 20% (w/v) SDS and 20 ml of a 20 mg ml 1 Proteinase K (Sigma) solution. The mixture was incubated at 65°C until it became clear and less viscous, and then was treated by phenol–chloroform extraction. DNA was precipitated in ethanol and resuspended in 100 ml of TE

buffer 10 ml of RNase (10 mg ml 1 ). the restriction enzyme site EcoRI was synthesized. The iso-

The 300 bp DNA fragment was extracted from the gel by electrolution. An oligonucleotide (EcoRI-OPA3) containing

Gel electrophoresis

of

Gel electrophoresis was carried out by applying 25 ml of sam- ple to submerged horizontal 2% agarose (PCR) or 1·5% (RAPD) slab gel. Gels were run for 30 min at 50 V in TEB

electrophoresis buffer (89 mmol l

1

boric acid, 89 mmol l

1

visualized at 312 nm with a u.v. transilluminator (Fluo-Link, Vilbert Lourmat, Marne-La-Valle´ e, France).

Isolation of the amplified DNA

buffer

(50 mmol l 1 Tris, pH 8·0; 1 mmol l 1 EDTA; 25% sac- charose) containing 40 mg ml 1 of mutanolysine (Sigma) and 20 mg ml 1 of lysozyme (Merck) and incubated for 45 min

EDTA

© 1997 The Society for Applied Bacteriology, Journal of Applied Microbiology 82, 783–790

DNA PROBE AND PCR FOR LACT. PLANTARUM 785

DNA PROBE AND PCR FOR LACT. PLANTARUM 785 Fig. 1 Band patterns obtained after RAPD amplifications

Fig. 1 Band patterns obtained after RAPD amplifications of Lactobacillus strains with the oligonucleotide OPA3. Lanes: 1, DNA molecular weight marker 100 bp; 2–17, Lactobacillus strains listed in Table 1

lated fragment was amplified with the EcoRI-OPA3 primer

to obtain additional DNA for the cloning.

Cloning and sequencing

The amplified DNA fragment was cloned in pCR-Script TM SK( ) cloning vector (Stratagene). The DNA fragment digested by EcoRI was inserted into the EcoRI site of the plasmid. Escherichia coli was transformed by the CaCl method described by Okayama and Berg (1982). Plasmid DNA from E. coli was extracted according to the method of Birnboim and Doly (1979). The sequence was determined by the dideoxy chain termination method (Sanger et al. 1977) using the T7 sequencing kit (Pharmacia, Biotech) and [a 33 P] dCTP (Amersham) according to the manufacturer’s instruc- tions. Sequencing reactions were analysed on 6% poly- acrylamide, 8M urea gels. Research for DNA homologies was performed with the GenBank and EMBL databases. The nucleotide sequence data reported here appear in the GenBank nucleotide sequence databases with the following

2

tested in our laboratory using RAPD on DNA extracts of Lactobacillus species. The band patterns resulting from RAPD on the DNA

accession number: U75315. extracts of Lact. plantarum, Lact. pentosus and other species with OPA3 primer are shown in Fig. 1. All the Lact. plan-

Probe labelling and DNA dot-blot hybridization

A 300 bp DNA probe was labelled with [a 32 P] dATP (Amer-

sham) using random priming (Feinberg and

with a commercially available kit (Appligene). Total DNA (300 ng) was denatured with 0·8 mol l 1 NaOH and 1·5 mol l 1 NaCl and transferred to a nylon membrane (Hybond-N , Amersham) using Hybri-slot TM Mannifold BRL. Membranes were rinsed in 2 SSC, dried and DNA fixed by u.v. irradiation for 4 min at 254 nm. Prehybridization

was performed at 65°C for 1 h in the hybridization

without the DNA probe. Hybridization of the probe was

performed overnight at 65°C in a hybridization

Vogelstein 1984)

tarum strains tested with OPA3 primer exhibited a DNA fragment amplified at about 300 bp. The 300 bp fragment was not apparent in any of the other Lactobacillus species tested. The gel locations of strains tested are listed in Table 1. A dot-blot hybridization method was used to test the speci- ficity of the 300 bp probe for a large number of strains belong- ing to the following genera: Lactobacillus, Carnobacterium, Lactococcus, Enterococcus, Escherichia, Sporolactobacillus and Bacillus. The results of the hybridization of the radiolabelled 300 bp probe with the Lactobacillus and Carnobacterium spec-

ies are shown in Fig. 2. The membrane locations of all the strains tested are listed in Table 1. All Lact. plantarum strains tested showed a high hybridization response to the 300 bp DNA. A weaker response was observed with two of the five Lact. pentosus strains tested. Other Lactobacillus and Car- nobacterium species did not show any hybridization with the probe. No response was observed when 300 bp DNA probe hybridization was carried out with DNA from members of the genera Lactococcus, Enterococcus, Escherichia, Spo- rolactobacillus and Bacillus (data not shown). The amplified 300 bp DNA fragment from Lact. plantarum

DSM 20174 T

solution

solution

containing 5 SSC (1 SSC 0·1 mol l 1 NaCl, 0·015 mol l 1 trisodium citrate, pH 7·0), 5 Denhardt’s solution, 0·5% (w/v) SDS (Sambrook et al. 1989) and

0·2 mg ml 1 denatured salmon sperm DNA.

After incu-

bation, membranes were washed twice at room

temperature

for 10 min with 2 SSC, 0·1% SDS, followed by two washes

at 65°C for 15 min with 1 SSC, 0·1% SDS and one final

wash at 65°C for 15 min in 0·2 SSC, 0·1% SDS. The membranes were air dried for 1 h and exposed to Kodak Min-

was sequenced. The nucleotide sequence of the

RE 100 autoradiography film (Kodak) for up to 6 h. DNA fragment is represented in Fig. 3.

Analysis of the 300 bp DNA fragment revealed no hom- ology to any known sequences contained in standard data-

RESULTS bases. The 300 bp sequence was found to be part of a potential ORF which specifies a protein of at least 50 amino acids (data RAPD analysis and DNA probe not shown). This potential product encoded by the PCR

In a preliminary study, a large number of primers from the OPA, OPM and OPR kit (Operon Technologies Inc.) were

amplified fragment showed no significant similarity to any known proteins in the protein data banks.

© 1997 The Society for Applied Bacteriology, Journal of Applied Microbiology 82, 783–790

786

F. QUERE ET AL.

Table 1 Bacterial strains utilized in this study —––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––

 

PCR

PCR

 

Dot-blot

specific

specific

membrane

RAPD

location

location

Species and source

location

location

(Fig. 4a)

(Fig. 4b)

—––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––

Lactobacillus

plantarum ATCC 8014

2, 7, 51, 52

2

6

1

plantarum DSM 20174 T

41, 50

2

plantarum*

1, 13, 25, 64

3

9

3

plantarum*

59

4

plantarum*

61

5

plantarum*

——

6

7

8

9

10

plantarum F&B 9106

plantarum F&B 8402

plantarum F&B 9532

plantarum F&B 9113

— —

pentosus NCFB 363 T

54

4

2

11

pentosus NCIMB 8531

55

3

12

pentosus

56

13

pentosus

57, 60

14

pentosus

58

15

pentosus

16

pentosus

17

pentosus

18

casei DSM 20011 T

— 8, 40

9

casei rhamnosus DSM 20021 T casei*

3, 9, 35

5

5

27, 53

paracasei paracasei DSM 20008 T

36, 62

paracasei paracasei DSM 20020

30

paracasei paracasei ATCC 25302

33

10

paracasei tolerans DSM 20258 T

18, 37

8

acidophilus ATCC 4356 T

17, 63

11

acidophilus CNRZ 204

23

alimentarius DSM 20249 T

39, 24

12

alimentarius*

31

aviarus spp. aviarus DSM 20655 T

14

aviarus spp. araffinosus DSM 20653 T

15

bifermentans DSM 20003 T

20

brevis DSM 20054 T

11, 47

7

10

brevis*

26, 45

buchneri*

32

13

bulgaricus*

28

14

cellobiosus DSM 20055 T

22

coryneformis spp. coryneformis DSM 20001 T

29

curvatus DSM 20019 T

10

6

11

curvatus* delbrueckii spp. delbrueckii DSM 20074 T farciminis DSM 20184 T fermentum CNRZ 209 fermentum DSM 20052 T halotolerans* helveticus DSM 20075 T leichmanii*

43

34

4, 49

5

6

46

21

38

— — — — ——— — — —

7

4

sake DSM 20017 T

12

8

sake*

42

viridescens*

19

© 1997 The Society for Applied Bacteriology, Journal of Applied Microbiology 82, 783–790

DNA PROBE AND PCR FOR LACT. PLANTARUM 787

Table 1 (continued ) —––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––

 

PCR

PCR

 

Dot-blot

specific

specific

membrane

RAPD

location

location

Species and source

location

location

(Fig. 4a)

(Fig. 4b)

—––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––

Carnobacterium

piscicola DSM 20722

48

16

piscicola DSM 20730 T

65

divergens DSM 20623 T

66

mobile DSM 4848 T

67

Sporolactobacillus laevus IAM 12384 T

68

Lactococcus lactis spp. lactis ATCC 11454 T

16, 44

Pediococcus pentosaceus ATCC 33316 T

70

Bacillus cereus*

69

71

Enterococcus faecalis CIP 76117 T Escherichia coli K 12*

—–––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––– * This laboratory; † University of Seville, Spain; ATCC, American Type Culture Collection; DSM, Deutsche Sammlung von Mikroorganismen; CNRZ, Centre National de Recherches Zootechniques; CIP, Collection Nationale de Cultures de Microorganismes de l’Institut Pasteur, Paris, France; IAM, Institute of Applied Microbiology, University of Tokyo, Japan; F &B, Faculte´ d’'nologie de Bordeaux; NCIMB, National Collection of Industrial and Marine Bacteria, Aberdeen, UK; NCFB, National Collection of Food Bacteria, Reading, UK.

72

Oligonucleotide primer selection and Lact. plantarum PCR-specific determination

A pair of primers were designated from the 300 bp sequence. The forward (LbPl1) and reverse (LbPl2) primers are 253 bp apart. Their exact location within the 300 bp fragment is shown in Fig. 3. The PCR amplification using LbPl1/LbPl2 plus Lb1/Lb2 primers as control generated an approximated 200 bp ampli- fied DNA fragment for all Lactobacillus species tested and a 253 bp amplified DNA band for Lact. plantarum exclusively (Fig. 4). All strains listed in Table 1 were tested for PCR specificity with these primers. The 253 bp fragment was amplified from Lact. plantarum strains and not from the other bacteria listed in Table 1 (data not shown). Identical results were obtained when this specific PCR was performed from colonies grown on MRS medium.

PCR was performed from colonies grown on MRS medium. DISCUSSION In modern taxonomy of bacteria, 16S

DISCUSSION

In modern taxonomy of bacteria, 16S and 23S rRNA sequence analysis is a standard method for the investigation of phylogenetic relationship (Fox et al. 1980) and can also be used to design genus- or species-specific oligonucleotide probes for rapid identification and detection (Kingler and

RAPD. The strain membrane locations are listed in Table 1 Johnson 1988). Furthermore, this approach can be enhanced

the a 32 P-labelled 300 bp fragment generated with OPA3 primer by

Fig. 2 Dot-blot hybridization with different Lactobacillus strains and other genera; 300 ng of purified DNA were applied per spot and processed as described in Materials and Methods. As probe:

© 1997 The Society for Applied Bacteriology, Journal of Applied Microbiology 82, 783–790

788

F. QUERE ET AL.

Fig. 3 Nucleotide sequence of the 300 bp band cloned from the RAPD products of Lactobacillus plantarum (see Fig. 1). The sense and antisense sequences cor- responding to the oligonucleotide

5?-AGTCAGCCACCAACCAGTTATTATTCGAATAAATACTAATTGAGGCAGCTGGCCAATCAT

GAGCTACTACCGTTTGCACAGCTTGTGCTAGTTTGGGATCAACGGCTTGCTTGCTCCTCAAACA OPA3 are in italics. The two CGGTCAGTCGATCATTCACATCAGTCGTGGCCGTTAGCGCGCCATTATAGGCAATCAATCATGG sequences corresponding to the TCGAATTGATTCCTAGTTGTTGCGCAATTCCAAACATCCCTTTAGGCGAACGTGCTGACG specific oligonucleotides LbPl1 CTAACACCATTTGGGCACCCCGGGCCACCGCCGCTTGGACTCCCGTAATCGTGGCTGACT-3? and LbPl2 are underlined

GTGGCTGACT -3 ? and LbPl2 are underlined Fig. 4 (a) PCR-specific reaction with LbPl1/LbPl2 and

Fig. 4 (a) PCR-specific reaction with LbPl1/LbPl2 and Lb1/Lb2 primers. Lanes: 1 and 12, DNA molecular weight marker 100 bp; 2–11, Lactobacillus strains listed in Table 1. A 253 bp fragment amplified with LbPl1/LbPl2 primers was detected in lanes 6 and 9. The 194 bp fragment amplified with Lb1/Lb2 primers was present in every lane. (b) PCR-specific reaction with LbPl1/LbPl2 and Lb1/Lb2 primers. Lanes: PM, DNA molecular weight marker 100 bp; 0, negative control (without DNA); 1–10, Lact. plantarum strains as listed in Table 1; 11–18, Lact. pentosus strains as listed in Table 1. A 253 bp fragment amplified with LbPl1/LbPl2 primers was detected in lanes 1 and 10. The 194 bp fragment amplified with Lb1/Lb2 primers was present in every lane

by the application of the PCR which can be used to amplify rDNA sequences with specific primer sets. Nevertheless, the difference in 16S rRNA sequences between Lact. plantarum and Lact. pentosus was small. Only three nucleotides were different when the 16S rRNA sequences of the two Lacto- bacillus species were compared (data not shown). The 23S rRNA sequences for Lact. plantarum and Lact. pentosus are

not yet available. For closely related species it may be difficult We used random amplification of the DNA (RAPD) to

to generate specific oligonucleotide probes or specific primer

sets based on 16S rRNA. method reported here may be useful for the rapid devel-

develop a specific probe for Lact. plantarum. The RAPD

et al. 1993; Richter et al. 1995) or plasmids (Cocconcelli et al. 1991) are rare. Specific DNA probes for Lact. curvatus, Lact. helveticus and Lact. delbrueckii based on random screening of genomic DNA library and subsequent analysis of clones by dot-blot hybridization are described but the fragments have not been sequenced (Petrick et al. 1988; Delley et al. 1990; Pilloud and Mollet 1990).

DNA probes for lactobacilli other than those based on 16S

opment of specific probes.

or 23S rRNA (Hertel et al. 1991; Castellanos et al. 1993; Pot The 300 bp fragment isolated from Lact. plantarum DSM

© 1997 The Society for Applied Bacteriology, Journal of Applied Microbiology 82, 783–790

DNA PROBE AND PCR FOR LACT. PLANTARUM 789

(1993) Ensiling characteristics of crab waste and wheat straw treated with different additives. Journal of Agricultural and Food Chemistry 41, 657–661. Birnboim, H.C. and Doly, J. (1979) A rapid alkaline extraction

procedure for screening recombinant plasmid DNA. Nucleic Acids Research 7, 1513–1523. the Bringel, F., Curk, M.C. and Hubert, J.C. (1995) Characterization

of Lactobacilli species by nucleic acid hybridizations. Proposition be clearly differentiated from the stronger hybridization for a new species related with L. plantarum: L. paraplantarum.

five Lact. pentosus strains tested. However, these signals could

level with our specific DNA probe (data not shown). Weak hybridization signals were observed with two of

a wide environmental diversity showed a high hybridization

to the Lact. plantarum species isolated in this laboratory from

20174 seemed to be conserved among the other strains of Lact. plantarum species. A large number of strains belonging

obtained with the Lact. plantarum strains. A weak sequence

Book of Abstracts. Lactic Acid Bacteria Conference, Cork, Ireland.

homology located in the 300 bp region may exist between Castellanos, I., Ve´ kris, A. and Deschamps, A. (1993) Elaboration of

Lact. plantarum and Lact. pentosus. This probably reects the close phylogenetic relationship of these two Lactobacillus species. The determination of the 300 bp DNA probe speci- ficity was confirmed by further results obtained with the primer set selected. In fact, a PCR-specific identification of Lact. plantarum is now available. The use of the PCR for bacterial identification and detec-

tion offers a considerable potential as a rapid method and combines speed, specificity, simplicity and sensitivity criteria.

It would be particularly useful when the species are pheno-

typically closely related and hard to distinguish by con- ventional microbiological approaches. DNA probes have been used in combination with PCR to detect specific bacteria.

One of the applications of this technology is the identification

of human pathogens in food (Yamamoto and Harayama 1995).

The probes were able to detect PCR products which

not visible on the agarose gel (i.e. less that 1 ng of DNA)

(Wernars et al. 1991). PCR with Lbp1-Lbp2 primers

followed by specific probe hybridization may offer a very sensitive detection of Lact. plantarum and should be a con-

siderable advantage in analysis of fermented food and silage. Science 209, 457463.

strain-specific probe for probiotic lactobacilli. FEMS Micro- biology Reviews 12, 153. Cocconcelli, P.S., Triban, E., Basso, M. and Bottazzi, V. (1991) Use of DNA probes in the study of silage colonization by Lacto- bacillus and Pediococcus strains. Journal of Applied Bacteriology 71,

296–301.

Collins, M.D., Rodrigues, U., Ash, C., Aguirre, M., Farrow, J.A.E., Martinez-Murcia, A. et al. (1991) Phylogenetic analysis of the genus Lactobacillus and related lactic acid bacteria as determined by reverse transcriptase sequencing of 16S rRNA. FEMS Micro- biology Letters 77, 512. Dellaglio, F., Botazzi, V. and Trovatelli, L.D. (1973) Deoxy- ribonucleic acid homology and base composition in some thermo- philic lactobacilli. Journal of General Microbiology 74, 289–297. Delley, M., Mollet, B. and Hottinger, H. (1990) DNA probe for Lactobacillus delbrueckii. Applied and Environmental Microbiology 56, 1967–1970. Feinberg, A.P. and Vogelstein, B. (1984) A technique for radio- labelling DNA restriction endonuclease fragments to high specific activity. Analytical Biochemistry 132, 6–13. Fox, G.E., Stackebrandt, R.B., Hespell, J., Gibson, J., Maniloff, T.A., Dyer, R.S. et al. (1980) The phylogeny of prokaryotes.

were

or

Direct PCR on colonies selected with a toothpick can be Fujisawa, T., Benno, Y., Yaeshima, T. and Mitsuoka, T. (1992)

advantageous in terms of time and labour costs. Many col- Taxonomic study of the Lactobacillus acidophilus group, with

recognition of Lactobacillus gallinarum sp. nov. and Lactobacillus

of johnsonii sp. nov. and synonymy of Lactobacillus acidophilus group

A3 (Johnson et al. 1980) with the type strain of Lactobacillus amylovorus (Nakamura 1981). International Journal of Systematic

onies could be analysed in a short time and the average

Lact. plantarum in the analysed product could be determined.

A DNA probe may also be used, for instance, to monitor the

specific bacteria in food fermentations and silage processes Bacteriology 32, 487491. by colony hybridization.

In conclusion, a DNA probe and a PCR specific to Lact.

Hertel, C., Ludwig, W., Obst, M., Vogel, R.F., Hammes, W.P. and Schleifer, K.-H. (1991) 23S rRNA-targeted oligonucleotide

plantarum are described here. The use of this PCR, DNA probes for the rapid identification of meat Lactobacilli. Systematic

and Applied Microbiology 14, 173177. Johansson, M.L., Quednau, M., Molin, G. and Ahrne´ , S. (1995)

Randomly amplified polymorphic DNA (RAPD) for rapid typing of Lactobacillus strains. Letters in Applied Microbiology 21, 155–

probe or PCR-DNA probe offers a rapid method for the identification and detection of Lact. plantarum and could be employed in analysis and monitoring of fermented foods and feeds where Lact. plantarum is usually implicated.

159.

Johnson, J.L., Phelps, C.F., Cummins, C.S., London, J. and Gasser, ACKNOWLEDGEMENT F. (1980) Taxonomy of the Lactobacillus acidophilus group. Inter- national Journal of Systematic Bacteriology 30, 53–68.

Kingler, J.D. and Johnson, A.R. (1988) A rapid nucleic acid hybrid- ization assay for Listeria in foods. Food Technology 42, 66–70. Klijn, N., Weerkamp, A.H. and de Vos, W.M. (1991) Identification of mesophilic lactic acid bacteria by using polymerase chain reac- tion-amplified variable regions of 16S rRNA and specific DNA probes. Applied and Environmental Microbiology 57, 3390–3393.

Abazinge, M.D.A., Fontenot, J.P., Allen, V.G. and Flick, G.J.

REFERENCES

Bretagne, France, Project Britta No. 41 56 156.

This work was partly financed by the

Conseil Re´ gional de

© 1997 The Society for Applied Bacteriology, Journal of Applied Microbiology 82, 783–790

790

F. QUERE ET AL.

Lasse´ n, T.M. (1994) Evaluation of conditions for fermentation of

isolated from beer. Book of Abstracts. Lactic Acid Bacteria Con-

fish offal. Agricultural Science in Finland 4, 11–17. ference, Cork, Ireland.

Luchansky, J.B., Tennant, M.C. and Klaenhammer, T.R. (1991) Molecular cloning and DNA polymorphisms in Lactobacillus acidophilus and Lactobacillus gasseri. Journal of Dairy Science 74,

3293–3302.

Lu¨ cke, F.K. (1994) Fermented meat products. Food Research Inter- national 27, 299–307.

Mauguin, S. and Novel, G. (1994) Characterization of lactic

bacteria isolated from seafood. Journal of Applied Bacteriology 76,

acid

616–625.

Merry, R.J., Dhanoa, M.S. and Theodorou, M.K. (1995) Use

freshly cultured lactic acid bacteria as silage inoculants. Grass and Forage Science 50, 112–123. Meunier, J.R. and Grimont, P.A. (1993) Factors affecting repro-

of

ducibility of random amplified

Research Microbiology 144, 373–379.

polymorphic DNA ngerprinting.

Nakagawa, T., Shimada, M., Mukai, H., Asada, K., Kato, I., Fujino, K. and Sato, T. (1994) Detection of alcohol-tolerant Hiochi bac- teria by PCR. Applied and Environmental Microbiology 60, 637–

640.

Naumann, D., Helm, D. and Labischinski, H. (1991) Micro- biological characterization by FT-IR spectroscopy. Nature 351,

81–82.

Okayama, H. and Berg, P. (1982) High efficiency cloning of full-

length cDNA. Molecular and Cellular Biology 2, 161–170.

Pederson, C.S. (1979)

CT: AVI Publishing Co. Petrick, H.A.R., Ambrosio, R.E. and Holzapfel, W.H. (1988) Iso- lation of a DNA probe for Lactobacillus curvatus. Applied and Environmental Microbiology 54, 405–408. Pilloud, N. and Mollet, B. (1990) DNA probes for the detection of Lactobacillus helveticus. Systematic and Applied Microbiology 13,

Microbiology of Food Fermentations . Westport,

Pot, B., Hertel, C., Ludwig, W., Descheemaeker, P., Kersters, K. and Schleifer, K.-H. (1993) Identification and classification of Lactobacillus acidophilus, L. gasseri and L. johnsonii strains by SDS-PAGE and RNA-targeted oligonucleotide probe hybrid-

ization. Journal of General Microbiology 139, 513–517. Pot, B., Ludwig, W., Kersters, K. and Schleifer, K.-H. (1994a)

Pot, B., Vandamme, P. and Kersters, K. (1994b) Analysis of elec- trophoretic whole-organism protein fingerprints. In Chemical Methods in Prokaryotic Systematics ed. Goodfellow, M. and O’Donnell, A.G. pp. 493–521. New York : John Wiley and Sons Ltd. Richter, L., Ehrmann, M., Fanta, D., Bohak, I. and Ludwig, W. (1995) Comparative RNA sequence analysis of lactic acid bacteria

Rodtong, S. and Tannock, G.W. (1993) Differentiation of Lacto- bacillus strains by ribotyping. Applied and Environmental Micro- biology 59, 3480–3484. Roussel, Y., Colmin, C., Simonet, J.M. and Decaris, B. (1993) Strain characterization, genome size and plasmid content in the Lactobacillus acidophilus group. Journal of Applied Bacteriology 74,

549–556.

Ruiz-Barba, J.L., Cathcart, D.P., Warner, P.J. and Jime´ nez-Diaz, R. (1994) Use of Lactobacillus plantarum LPCO10, a bacteriocin producer, as a starter culture in spanish-style green olive fer- mentations. Applied and Environmental Microbiology 60, 2059–

2064.

Sambrook, J., Fritsch, E.F. and Maniatis, T. (1989) Molecular Clon- ing: A Laboratory Manual ed. Ford, N., Nolan, C. and Ferguson, M. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press. Sanger, F., Nicklen, S. and Coulson, A.R. (1977) DNA sequencing with chain terminating inhibitors. Proceedings of the National Academy of Sciences USA 74, 5463–5467. Schleifer, K.-H. (1990) DNA probes in food microbiology. Food Biotechnology 4, 585–589. Stahl, M., Molin, F., Persson, A., Ahrne´ , S. and Stahl, S. (1990) Restriction endonuclease patterns and multivariate analysis as a classification tool for Lactobacillus spp. International Journal of

Systematic Bacteriology 40, 189–193. Tzanetakis, N. and Litopoulou-Tzanetakis, E. (1992) Changes in numbers and kinds of lactic acid bacteria in Feta and Teleme, two greek cheeses from ewes’ milk. Journal of Dairy Science 75,

1389–1393.

Urlings, H.A.P., Bijker, P.G.H. and Van Logtestijn, J.G. (1993) Fermentation of raw poultry by-products for animal nutrition . Journal of Animal Science 71, 24202426. Vogel, R.F., Lohmann, M., Nguyen, M., Weller, A.N. and Hammes, W.P. (1993) Molecular characterization of Lactobacillus curvatus and Lact. sake isolated from sauerkraut and their appli- cation in sausage fermentations. Journal of Applied Bacteriology 74, 295300. Weinberg, Z.G., Ashbell, G., Yaira Hen and Azrieli, A. (1993) The effect of applying lactic acid bacteria at ensiling on the aerobic

Taxonomy of lactic acid bacteria. In Bacteriocins in Lactic Acid stability of silages. Journal of Applied Bacteriology 75, 512–518.

Bacteria ed. De Vuyst, L. and Vandamme, E.J. pp. 1390. Glas-

Wernars, K., Heuvelman, C.J., Chakraborty, T. and Notermans,

gow, UK: Blackie Academic and Professional. S.H.W. (1991) Use of the PCR for the direct detection of Listeria

monocytogenes in soft cheese. Journal of Applied Bacteriology 70,

345–349.

121126.

Yamamoto, S. and Harayama, S. (1995) PCR amplication and direct sequencing of gyrB genes with universal primers and their application to the detection and taxonomic analysis of Pseudo- monas putida strains. Applied and Environmental Microbiology 61,

1104–1109.

© 1997 The Society for Applied Bacteriology, Journal of Applied Microbiology 82, 783–790