You are on page 1of 13
<a href=See d i scuss i o n s, stats, a n d aut h o r p r o fi les f o r t hi s publ ication at: https://www.researchgate.net/publication/304627517 Utilización de resina Chelex en la extracción de ADN de varios tipos de tejidos de la tortuga marina Caretta caretta, para la... Chapter · January 2008 CITATIONS READS 0 762 5 authors , including: Ruth Marina García García Venezuelan Institute for Scientific Re… 4 PUBLICATIONS 74 CITATIONS SEE PROFILE Lourdes Luz Varela Universidad del Atlantico y Universi… 13 PUBLICATIONS 16 CITATIONS SEE PROFILE Some of the authors of this publication are also working on these related projects: Determinación de mutaciones puntuales en el gen pfdhps de Plasmodium falciparum, asociadas a resistencia a Sulfadoxina en el departamento de Bolívar View project All content following this page was uploaded by Ruth Marina García García on 30 June 2016. The user has requested enhancement of the downloaded file. " id="pdf-obj-0-2" src="pdf-obj-0-2.jpg">

See discussions, stats, and author profiles for this publication at:

Utilización de resina Chelex en la extracción de ADN de varios tipos de tejidos de la tortuga marina Caretta caretta, para la...

Chapter · January 2008

 

CITATIONS

READS

0

762

5

authors, including:

4 PUBLICATIONS 74 CITATIONS SEE PROFILE

<a href=See d i scuss i o n s, stats, a n d aut h o r p r o fi les f o r t hi s publ ication at: https://www.researchgate.net/publication/304627517 Utilización de resina Chelex en la extracción de ADN de varios tipos de tejidos de la tortuga marina Caretta caretta, para la... Chapter · January 2008 CITATIONS READS 0 762 5 authors , including: Ruth Marina García García Venezuelan Institute for Scientific Re… 4 PUBLICATIONS 74 CITATIONS SEE PROFILE Lourdes Luz Varela Universidad del Atlantico y Universi… 13 PUBLICATIONS 16 CITATIONS SEE PROFILE Some of the authors of this publication are also working on these related projects: Determinación de mutaciones puntuales en el gen pfdhps de Plasmodium falciparum, asociadas a resistencia a Sulfadoxina en el departamento de Bolívar View project All content following this page was uploaded by Ruth Marina García García on 30 June 2016. The user has requested enhancement of the downloaded file. " id="pdf-obj-0-69" src="pdf-obj-0-69.jpg">

Universidad del Atlantico y Universi…

13 PUBLICATIONS 16 CITATIONS SEE PROFILE

Some of the authors of this publication are also working on these related projects:

  • Determinación de mutaciones puntuales en el gen pfdhps de Plasmodium falciparum, asociadas a resistencia a Sulfadoxina en el departamento de Bolívar View project

All content following this page was uploaded by Ruth Marina García García on 30 June 2016.

The user has requested enhancement of the downloaded file.

Utilización de resina Chelex

en

la extracción

de

ADN de varios

tipos de

tejidos de

la tortuga

marina

Caretta caretta, para la amplificación

de marcadores moleculares

GARCÍA GARCÍA RUTH, ONOFRI YUNEZ ORIANA LAGARES GUZMÁN ALFREDO, VARELA PRIETO LOURDES* MANJARREZ NELSON**

INTRODUCCIÓN

La variación genética es un componente esencial de la biodiversidad y su es- tudio se reconoce como una parte muy importante para salvaguardar el futuro evolutivo y de programas de conservación de las especies [1]. Por lo tanto, para que estos programas sean efectivos, deben considerar la variación genética de las especies, su distribución y los impactos potenciales de la actividad humana sobre su habitas natural. Aunque la utilización de técnicas de genética molecular es im- portante a la hora de establecer programas de conservación, éstas por si solas no proveen una respuesta final para la conservación de las especies; son una herra- mienta adicional primordial, que pueden ser utilizadas como ayuda al fijar prio- ridades para la conservación, particularmente cuando hay limitada información ecológica [2]. Los análisis genéticos tienen como objetivo determinar la diversi- dad a varios niveles (individual, poblacional o de especie) y pueden ser más efec- tivos cuando se emplean en conjunto con datos ecológicos y demográfico [3]. Un acercamiento combinado es también benéfico porque los métodos tradi- cionales de campo producen poca información respecto a la estructura de la po- blación y el estatus de las especies más crípticas, acuáticas y subterráneas. Los problemas de estas especies serian irreconocibles sin los estudios genéticos, aun - que éstos no proveen información sobre varios aspectos biológicos como la tasa de crecimiento, la dieta, la longevidad y la fecundidad. Por lo tanto, para obtener toda la información necesaria acerca de una población o especie, es importante

* Grupo de Investigación Imunología y Biología Molecular. Universidad del Atlántico.

** Grupo

de

Investigación

SAWAINRU,

lourdesvarela2@yahoo.com

Universidad

de

la

Guajira.

Correo

electrónico:

Facultad de Química y Farmacia

343

EL CARIBE LAS CIENCIAS BÁSICAS E INGENIERÍA

asegurar una combinación de marcadores moleculares junto con datos ecológi- cos, demográficos, reproductivos, de comportamiento y datos clínicos [2, 3, 4]. Las tortugas marinas viven en hábitats oceánicos y costeros difíciles de ob- servar y en varios aspectos su historia natural está tan refractada que no se pue- den hacer aproximaciones científicas. En muchos casos, las rutas migratorias y los comportamientos reproductivos son desconocidos. Esta falta de información científica continúa obstaculizando las metas de manejo de los programas de con- servación para las poblaciones en peligro [5]. Desde la década pasada, las técnicas de genética molecular, han permitido revelar grandes secretos guardados de la naturaleza de estas especies, como lo ha sido descifrar la filopatria de las tortugas, la cual consiste en el retorno de las hembras a su región de origen para reprodu- cirse; lo mismo que la identificación de las relaciones evolutivas entre las distintas especies de tortugas marinas; la comprobación que más de un macho contribuye en la fertilización de una nidada, aspectos que son de gran utilidad a la hora esta- blecer programas de conservación [4]. Igualmente, ha ayudado a resolver proble- mas ecológicos y sistemáticos, como la paternidad, patrones de diversidad, hibridación, variación geografía, especiación y filogenias [5, 7-19]. En la utilización de técnicas de genética molecular son importantes los métodos utilizados para la obtención de buenas muestras de ADN. En la mayoría de los casos se cuenta con cantidades muy pequeñas de tejido biológico, ya que se trata de causar el menor trauma posible a los animales. Por ello, es importante contar con un método adecuado de extracción de ADN, que utilice la menor can- tidad posible de tejido animal, que se adapte a diferentes tipos de tejido y sobre todo que de muestras de ADN de calidad y en suficiente cantidad para ser utiliza- do como plantilla en las amplificaciones. Dentro de los diferentes métodos de ex- tracción de ADN, el método fenol cloroformo ha sido ampliamente utilizado, aunque presenta la desventaja de ser un método que necesita una mayor cantidad de tejido en comparación con el método que utiliza la resina Chelex 100, el cual utiliza una cantidad mínima de tejido biológico. A pesar de las ventajas potenciales que puede brindar la utilización del Che- lex 100 en la extracción de ADN de diferentes muestras de tejido de tortuga des- tinadas para el análisis molecular y la facilidad en su tratamiento, se ha encontrado que para estas especies, este método ha sido poco utilizado. En cam- bio se aplica con éxito en diferentes tipos de tejidos en otras especies [19-24]. El Chelex 100 es una resina intercambiadora de iones que funciona reali- zando una limpieza de los iones metálicos polivalentes, los cuales actúan como catalizadores en la ruptura de ADN a altas temperaturas inhibiendo con esto el proceso de amplificación en la PCR. El chelex funciona removiendo cualquier ca- tión presente en una solución atrayéndolos y pegándolos a la superficie de los

344

Facultad de Química y Farmacia

UTILIZACIÓN DE RESINA CHELEX EN LA EXTRACCIÓN DE AND DE VARIOS TIPOS DE TEJIDOS DE LA TORTUGA MARINA ...

gránulos del chelex. Este enlaza los iones de Mg, los cuales las nucleasas necesitan para digerir el ADN, protegiendo así que el ADN no sea digerido por la contami- nación de las nucleasas en las células [25].

El método de extracción de ADN con fenol-cloroformo es un proceso labo- rioso y complicado. Esta técnica de extracción es larga, costosa y poco practica, especialmente cuando se tiene un gran número de muestras. En el presente estu- dio se realizó una comparación del método de extracción con fenol cloroformo y dos diferentes técnicas basadas en el uso de resina Chelex-100. El método con esta resina es un procedimiento simple, rápido y sobre todo no requiere de múlti- ples pasos. Se analizó la extracción de ADN procedente de varias clases de tejidos como cáscara de huevo, contenido del huevo, tejido de caparazón y cordón umbi- lical, en los cuales se utilizaron los diferentes métodos de extracción como la pre- cipitación con solventes orgánicos y con resina de Chelex-100. Los resultados demuestran que el Chelex es un método eficaz en la extracción de ADN en los diferentes tejidos de la especie. Algunos de los protocolos utilizados a través de la investigación se modificaron hasta obtener óptimos resultados.

MATERIAL Y MÉTODOS

La obtención del ADN nuclear de las tortugas madres adultas se realizó a partir de la cáscara de huevo ya eclosionados o huevos no fertilizados. Las mues- tras de cáscara de huevo se sometieron a tratamiento con EDTA al 0.5 M por una noche a temperatura ambiente, con el fin de remover las endonucleasas que de- gradan el ADN. Posteriormente las muestras fueron maceradas hasta formar un polvo casi homogéneo, para el cual se aplicó la metodología previamente descrita con algunas modificaciones (K. Moore, comunicación personal).

Las muestras de los neonatos se obtuvieron después de la eclosión. Se toma- ron cuidadosamente dos milímetros del caparazón por medio de una biopsia. En esta etapa del desarrollo el caparazón es blando y sana rápidamente, por lo cual no se pone en riesgo la supervivencia de la tortuga; además es más seguro para las crías que tomar muestras de sangre siguiendo la metodología descrita y reco- mendada por K. Moore. A una de las crías recién eclosionadas se le tomó una muestra de saco vitelino, para conocer la viabilidad de este tejido en estudios mo- leculares. Las muestras se guardaron en tubos Eppendorf previamente esteriliza- dos, con alcohol al 95 %. Posteriormente se almacenaron a -20ºC; exceptuando la cáscara de huevo, la cual fue bien lavada y congelada. El corte, procesamiento y extracción del ADN de las muestras se realizó aplicando diferentes metodologías, las cuales se describen a continuación.

Facultad de Química y Farmacia

345

EL CARIBE LAS CIENCIAS BÁSICAS E INGENIERÍA

Método A

Este procedimiento se realizó según la metodología descrita previamente al cual se le realizaron algunas modificaciones. Se cortaron las muestras minuciosa- mente en pequeñas piezas y fueron colocadas en tubos Eppendorf. Seguidamen- te se les agregó 0.6ml de TE 1X, 2µl de Proteinasa K (20mg/ml) y 0.3ml de SDS al 10%. Estas se mezclaron y fueron incubadas por una hora a 37ºC. Seguidamente fueron filtradas y al filtrado se añadió un volumen igual de cloroformo–alcohol isoamílico (24:1). Posteriormente se centrifugaron a 12.000 rpm por 10 minutos, fue tomada la fase liquida y colocada cada una en Eppendorf nuevos, al cual se le añadió nuevamente un volumen igual de cloroformo- alcohol isoamílico y se cen- trifugaron nuevamente. Por ultimo se agregó etanol al 70% y fueron centrifuga- das por 5 minutos. Se descartó el sobrenadante y se dejó evaporar el etanol completamente. El precipitado de ADN se diluyó con TE al 1X.

Método B

Corresponde a la extracción del ADN según el clásico método de precipita- ción con fenol-cloroformo, descrito por Sambrook y Russell 26 . Se colocaron las muestras en un tubo eppendorf y se les agregó 0.6ml de TE 1X, 2µl de Proteinasa K (20mg/ml) y 0.3ml de SDS 10%. Se mezclaron e incubaron por una hora a 37ºC. Inmediatamente fueron filtradas y a este filtrado se le añadió un volumen igual de fenol– cloroformo– alcohol isoamílico (25:24:1). Posteriormente fueron centrifugadas a 12000 rpm por 10 minutos. La fase líquida fue colocada en tubos eppendorf nuevos, al cual se le añadió un volumen igual de cloroformo-alcohol isoamílico y luego fue centrifugada. Por ultimo se agregó etanol al 70% y se cen- trifugaron por 5 minutos. Fue descartado el sobrenadante y el etanol se dejó eva- porar completamente. El precipitado de ADN se diluyó con TE al 1X y fueron guardadas a -20 ºC.

Método C

Este método se aplicó mediante el protocolo de chelex al 5% descrito por Morin y Pearce [27], al cual se le realizaron algunas modificaciones en el transcur- so del estudio para optimizar los resultados. Las muestras guardadas previamen- te en etanol al 70% fueron lavadas con abundante agua destilada para eliminar cualquier remanente del alcohol. Se cor taron muestras de aproximadamente un mm 3 con el objetivo de aumentar la superficie de exposición y se mezclaron con 300 µl de una solución de resina chelex-100 al 5%. La solución se preparó previa- mente disolviendo la resina al 5% en agua esté ril desionizada y en constante

346

Facultad de Química y Farmacia

UTILIZACIÓN DE RESINA CHELEX EN LA EXTRACCIÓN DE AND DE VARIOS TIPOS DE TEJIDOS DE LA TORTUGA MARINA ...

agitación. Cuando la muestra era tejido de caparazón se dejó en incubación con el chelex a temperatura ambiente por dos horas y luego se guardó en el refrigera- dor por una noche. Seguidamente, la mezcla se introdujo en agua a 100 ºC durante 45 minutos. En este paso, cada 15 minutos se le realizó vortex por 10 se- gundos y se centrifuga. Al finalizar los 45 minutos, se realizó un vortex final y se centrifugó por 3 minutos a 13000 rpm. El sobrenadante se pasó a otro tubo listo para la PCR.

Método D

Este método se aplicó mediante el protocolo de chelex al 20% 28 , el cual, igual que el método anterior fue modificado en el transcurso del estudio para mejorar los resultados. Se agregaron 500 µl de chelex 20% y 5 µl de Proteinasa K (20mg/ml) a cada muestra. Se incubó a temperatura ambiente por una noche para romper las membranas de las células y digerir proteínas. Luego se incubó a 55ºC por 2 horas, se realizó vortex y se centrifugó por 5 minutos. El sobrenadante se pasó a otro tubo eppendorf, al cual se le agregó un volumen igual de Chelex al 20% y se dejó hirviendo por ocho minutos más. Se realizó un vortex final seguida- mente se centrifugó por 3 minutos y luego se pasó el sobrenadante a otro tubo, quedando listo para la PCR.

PCR

Para la PCR se utilizaron 10 µl de ADN plantilla, Búfer PCR 10X, 50m.M de MgCl 2 , 10mM de DNTP’s mix, 10 µM de cada primer y Taq polimerasa. Se utilizo el kit de amplificación de Bio-Rad siguiendo las recomendaciones de la casa co- mercial. Se utilizaron tres juegos de primera que amplifican tres microsatélites di- ferentes Cc7 [29].

F: 5’TGCATTGCTTGACCAATTAGTGAG3’, R: 5’ACATGTATAGTTGAGGAG CAAGTG3’; Cc117 [15] F: 5’TCTTTAACGTATCTCCTGTAGCTC3’, R: 5’CAGT AGTGTCAGTTCATTGTTTCA3’, Cc141 [30] F: 5’CAGCAGGCTGTCAGTTCTC CA 3’, R: 5’TAGTACGTCTGGCCTGACTTTC3’.

Los parámetros utilizados en la PCR para la amplificación del microsatélite Cc7 inician con una desnaturalización a 94ºC por 2 minutos, seguida de 30 ciclos que cumplen los pasos de desnaturalización a 94ºC por 30 segundos, hibridación a 58ºC por 30 segundos y extensión a 72ºC por 45 segundos. Terminando con una extensión a 72ºC por 5 minutos [5].

Facultad de Química y Farmacia

347

EL CARIBE LAS CIENCIAS BÁSICAS E INGENIERÍA

Para la amplificación del microsatélite Cc117 se realizó una desnaturaliza- ción inicial por 5 minutos a 95 ºC, seguido de 30 ciclos compuestos por, 45 segun- dos a 95 ºC, 1 minuto a 62 ºC y 45 segundos a 72 ºC. Con una extensión final de 7 minutos a 72 ºC [31].

Para el microsatélite CC141 la desnaturalización inicial fue de 93ºC por tres minutos, seguido de seis ciclos compuestos de 30 segundos a 92 ºC, 55 segundos a 57 ºC y 1 minuto con 25 segundos a 72 ºC. Luego se realizaron 30 ciclos de la si- guiente forma, 30 segundos a 89 ºC y una alineación a 55°C por 55 segundos y 1 minuto a 72 ºC, finalizando con una extensión de 10 minutos a 72 ºC [14].

Electroforesis

Las condiciones utilizadas para los corridos electroforéticos en geles de aga- rosa al 2% fueron: 50 voltios constantes durante 120 minutos. En cada pocillo se sembraron 10 µl de ADN amplificado y 2 µl de búfer de carga 4X. Se utilizó el marcador de peso molecular de 10pb (1µg/ 1µl) de la casa comercial Invitrogen.

RESULTADOS

Estandarización de la extracción de ADN

Las extracciones realizadas con el método B (fenol: cloroformo: alcohol isoamílico) y el método A (cloroformo: alcohol isoamílico) en los tejidos de capa- razón y cáscara de huevo no amplificaron en la PCR, lo cual puede estar indican- do que la cantidad de ADN obtenido en estos dos métodos no fue suficiente, (ver figura 1 pocillos del 2 al 5).

Inicialmente se utilizó una PCR mix ya estandarizada previamente en el la- boratorio la cual era utilizada para ADN extraído de sangre. Al usarlo con el ADN plantilla de las muestras objeto de esta investigación siempre mostraban resulta- dos negativos. Al variar las cantidades de PCR mix y de ADN templado, se obtu- vieron mejores resultados logrando la amplificación. Las muestras de los pocillos 6, 7 y 8 fueron amplificadas con la PCR mix estandarizada para muestras de san- gre dando resultados negativos. En la figura 1 se muestra su reamplificación, la cual fue positiva. Para obviar la reamplificación por los resultados obtenidos se aumentó la concentración de los reactivos en la mix y de ADN templado en la reacción de PCR.

Los métodos utilizados que arrojaron resultados negativos fueron el D (che- lex al 20 %) aplicado al tejido de caparazón (pocillo 9), y el método C (Chelex al

348

Facultad de Química y Farmacia

UTILIZACIÓN DE RESINA CHELEX EN LA EXTRACCIÓN DE AND DE VARIOS TIPOS DE TEJIDOS DE LA TORTUGA MARINA ...

5%) realizado al cordón umbilical (pocillo 13). Sin embargo estas muestras dieron positivo al realizar su reamplificación (pocillo 14 y 15 respectivamente).

Los métodos que dieron resultados positivos a la primera amplificación fue- ron el C realizado en muestras de cáscara entera sin macerar (pocillo 11) y de teji- do caparazón (pocillo 12) y el método D realizado en tejido cáscara sin macerar (pocillo 10) Ver tabla y figura 1.

Estandarización de la PCR

Las muestras que se amplificaron contenían 30 µl los cuales estaban com- puestos por 3.125 µl de 10X PCR Búfer (concentración final CF 0.3125X), 0.94 µl de 50mM de MgCl 2 (CF 0.47mM), 0.625 µl de 10mM de dNTP’s mix (CF 0.0625mM cada dNTP), 1.9 µl de cada primer (CF 0.19µM) y 0.28µl de Taq ADN Polimerasa (1.4 unidades) 11.23 µl de agua miliQ estéril y 10 µl de ADN templado.

DISCUSIÓN

Las extracciones con fenol, cloroformo, alcohol isoamílico y cloroformo al- cohol isoamílico aunque han sido utilizadas con éxito en otros estudios 5 , en el presente los resultados fueron negativos. Una de las razones por las cuales estos protocolos no funcionaron podría ser que para garantizar la extracción se debe tener una muestra de tejido más grande [32]. Esto es una dificultad para el tipo de muestras que se manejan en el presente estudio, ya que para las especies en cuestión las crías miden aproximadamente 6 cm y no se les pueden realizar biop- sias muy grandes debido a que se pone en riesgo su supervivencia. Según K Moo- re, no se deben tomar muestras con un tamaño mayor de 3 mm, esto con el objeto de no causarse lesiones al animal que pueda ponerlo en peligro [5]. Además este método es largo y tedioso especialmente cuando se trabaja con un número gran- de de muestras. También el costo de los reactivos es elevado en comparación con el chelex 100 [32]. Por último, el estado y la pureza de los reactivos deben ser ópti- mos, para asegurar un buen resultado.

Los diferentes protocolos realizados con chelex fueron efectivos. Se hallaron muchos beneficios: aun en pequeñas muestras de tejido el chelex funciona bien corroborando lo encontrado por García González [32] en un estudio hecho en carcinomas de cabeza y cuello. También encontramos que son mucho más fáciles, cortos y requieren pocos reactivos adicionales. Además de ser económicos, tam- bién son menos riesgosos para la salud del investigador. Extracciones que se pen- saba eran negativas por los resultados de la amplificación, se comprobó por

Facultad de Química y Farmacia

349

EL CARIBE LAS CIENCIAS BÁSICAS E INGENIERÍA

medio de su reamplificación que había ADN pero en muy pocas cantidades para ser observado en la electroforesis. Aumentando la cantidad de PCR mix y de ADN templado se solucionó y estandarizó la amplificación de las muestras. Uno de los objetivos de este estudio fue comparar la eficacia de los métodos de extracción de ADN utilizando resina Chelex-100 con el procedimiento clásico de precipitación con solventes orgánicos. La resina Chelex-100 actúa como una resina quelante de iones metálicos polivalentes, iones que actúan como cataliza- dores en la ruptura de ADN a altas temperaturas las cuales pueden inhibir la PCR [33]. Estudios previos muestran que el uso de la resina Chelex sin proteinasa K proporciona una adecuada cantidad de ADN para amplificar [22]. Sin embargo, estos estudios también indican algunos límites considerando el tamaño de los productos que pueden ser amplificados. Se podrían amplificar fragmentos de hasta 650 pb en muestras tratadas sólo con la resina Chelex-100, y fragmentos de hasta 1000 pb en las que se ha utilizado la resina y digestión con proteinasa K. To- dos los fragmentos de ADN que se amplificaron en este trabajo tienen un tamaño máximo de 400 pb, por lo que la aplicación de los métodos basados en la resina Chelex-100 no presenta esta dificultad técnica. Algunos estudios han puesto de manifiesto un descenso en la amplificación de fragmentos mayores de 600 pb cuando se utilizan muestras almacenadas con proteinasa K, quizás debido a una mayor ruptura del ADN [34]. Algunas recomendaciones en el manejo del Chelex son las siguientes: pre- parar la solución de Chelex en el momento de la extracción; para pesar el Chelex y su manipulación debe usarse papel estéril, guantes, tapa boca, gorro, bata y no usar espátula; la extracción debe hacerse frente a un mechero cuando no se tiene una cabina de flujo adecuada, siempre resuspender la solución de chelex cada vez antes de usarse. Al tomar el sobrenadante, tener mucho cuidado para no tomar partículas de Chelex que son inhibidoras de la Taq polimerasa durante la amplifi- cación. A veces la amplificación de las extracciones debe realizarse el mismo día, pero a veces hay que esperar por una noche, debe encontrarse el mejor método para la muestra estudiada. En este estudio se encontró que las muestras amplifi- can mejor cuando la PCR se hace el mismo día de la extracción. Las amplificacio- nes realizadas de extracciones con Chelex pueden llevar hasta la mitad del volumen de PCR mix en ADN templado. Debido al tipo y cantidad de muestra, el ADN extraído puede ser poco. Se recomienda probar con diferentes cantidades de ADN templado en la PCR mix hasta encontrar la adecuada. En esta investiga- ción fueron suficientes 10 µl de ADN templado para un volumen final de PCR mix de 30 µl.

350

Facultad de Química y Farmacia

UTILIZACIÓN DE RESINA CHELEX EN LA EXTRACCIÓN DE AND DE VARIOS TIPOS DE TEJIDOS DE LA TORTUGA MARINA ...

CONCLUSIONES

Se ha comprobado que para la utilización de resina Chelex-100 se precisan menores cantidades de tejido, lo cual generalmente no es posible cuando se pro- cesan las muestras con el método de fenol, cloroformo, alcohol isoamílico. Ade - más, lo dispendioso de este ultimo proceso mencionado y los múltiples pasos hacen que este protocolo no sea adecuado para su aplicación rutinaria y simul- tánea con una cantidad grande de muestras. Atendiendo a los hallazgos obteni- dos hemos encontrado que los diferentes protocolos de chelex 100 son más efec- tivos para estos tipos de muestras.

Para la realización de la determinación de paternidad múltiple en tortugas marinas, son más viables los tejidos de cáscara de huevo, para hallar el genotipo materno, y tejido de caparazón, para el de las crías. No solo por el éxito obtenido en su extracción y amplificación, si no además por la facilidad de toma de mues- tra, viabilidad de encontrar y poco daño producido a la especie.

AGRADECIMIENTOS

Esta investigación se realizó gracias al apoyo financiero de la Universidad del Atlántico, convocatoria: Pensar el Caribe II y al Departamento de Investiga- ción de la Universidad de la Guajira.

BIBLIOGRAFÍA

  • 1. MORITZ, C. 1999. “Conservation units and translocations: Strategies for con- serving evolutionary processes”. Hereditas Vol.130:217-228.

  • 2. FARLEY, S.M. 2004. “Conservation Genetics of the Snapping Turtle (Elseya sp.): An Assessment of Genetic Diversity and Population Structure”. University of Canberra. Thesis.

  • 3. WALLIS, P. 1994. “Population genetics and conservation in New Zealand: A hierarchical synthesis and recommendations for the 1990s”. Journal of the Royal Society of New Zealand Vol. 24(2):143-160.

  • 4. O’ BRIEN, J.S. 1994. “A role for molecular genetics in biological conserva- tion”. The National Academy of Science Vol. 91:5748-5755.

  • 5. MOORE, M.K., BALL, R.M., 2002. “Multiple paternity in loggerhead turtle (Caretta caretta) nest on Melbourne Beach, Florida: a microsatellite analysis”. Molecular Ecology Vol.11 (2): 281-288.

  • 6. FITZSIMMONS, N. N., MORITZ, C., BOWEN B.W. 2000. “Identificación de poblaciones”. Eckert, K. L., Bjorndal, K.A., Abreu-Grobois, F. A. Do- nelly, M., (Editores) 2000 (traducción al español). Técnicas de

Facultad de Química y Farmacia

351

EL CARIBE LAS CIENCIAS BÁSICAS E INGENIERÍA

investigación y manejo para la Conservación de las Tortugas Marinas. Grupo especialista en Tortugas Marinas UICN/CSE. Vol. 4:83-91. 7. GONZÁLEZ, D. 1998. “Marcadores moleculares para los estudios comparati- vos de la variación en ecología y sistemática”. Revista Mexicana de Mico- logía Vol.14:1-21 p.

8. JORDANO, P. 2000. “Utilidad y aplicaciones de técnicas moleculares en ecolo- gía y conservación de especies”. Estación Biológica de Doña Ana, CSIC. Pabellón del Perú. 9. FEDORKA, M.K Y MOUSSEAU, T.A. 2001. “Material and genetic benefits of

female

multiple

mating

and

polyandry”.

Animal

Behaviour

Vol.

64:361–367.

 
  • 10. KNIGHT, M.E., TURNER, G.F., RICO, C., VAN OPPEN, M.J.H., HEWIT, G.M. 1998. “Microsatellite paternity analysis on captive Lakes Malawi cichlids supports reproductive isolation by direct mate choice”. Molecu- lar Ecology Vol.7:1605-1610.

  • 11. CORDERO RIVERA, A Y ANDRÉS, J.A. 2002. “Male coercion and conve- nience polyandry in a calopterygid damselfly”. J Insect Science. Vol. 2:

14.

  • 12. BOWEN, B.W., MEYLAN, A.B., AVISE, J.C. 1988. “An odyssey of the green sea turtle: Ascension Island revisited”. The National Academy of Scien- ces. Vol. 86:573-576.

  • 13. BOWEN, B.W., NELSON, W.S., AVISE, J.C. 1993. “A molecular phylogeny for marine turtles: Trait mapping, rate assessment, and conservation re- levance”. The National Academy of Sciences. Vol. 90:5574-5577.

  • 14. FITZSIMMONS, N.N., LIMPUS, C.J., NORMAN, J.A., GOLDIZEN, A.R., MILLER, J.D., MORITZ, C. 1997. “Philopatry of male marine turtles inferred from mitochondrial DNA markers”. The National Academy of Science Vol. 94:8912–8917.

  • 15. FITZSIMMONS, N.N., MORITZ, C., Moore, S.S. 1995. “Conservation and Dynamics of Microsatellite Loci over 300 Million Years of Marine Turtle Evolution”. Molecular Biology Evolution Vol. 12(3):432-440.

  • 16. BOWEN, B.W., ABREU-GROBOIS, F.A., BALAZS, G.H., KAMEZAKI, N., LIMPUSl, C.J., FERL, R.J. 1995. “Population Biology Trans-Pacific mi- grations of the loggerhead turtle (Caretta caretta) demonstrated with mitochondrial DNA markers”. The National Academy of Sciences. Vol.

92:3731-3734.

  • 17. MONCADA, F., CARRILLO, E., SAENZ, A., NODARSE, G. 1999. “Repro- duction and Nesting of the Hawksbill Turtle, Eretmochelys imbricata, in the Cuban Archipelago”. Chelonian Conservation and Biology Vol.

3(2):257–263.

  • 18. HOEKERT, W.J.E., NEUFÉGLISE, H., SCHOUTEN, A.D., MENKEN, S.B.J. 2000. “Multiple paternity in the olive ridley sea turtle”. NOAA Techni- cal Memorandum NMFS-SEFSC-433:13-14.

352

Facultad de Química y Farmacia

UTILIZACIÓN DE RESINA CHELEX EN LA EXTRACCIÓN DE AND DE VARIOS TIPOS DE TEJIDOS DE LA TORTUGA MARINA ...

  • 19. CALSBEEK, R., SINERVO, B., 2002. “Uncoupling direct and indirect com- ponents of female choice in the wild”. The National Academy of Science Vol. 2; 99(23): 14897–14902.

  • 20. MORTIMER, J.A Y BRODERICK, D. 1999. “Population genetic structure and developmental migrations of sea turtles in the Chagos Archipelago and adjacents regions inferred from mtDNA sequence variation”. Eco- logy of the Chago Archipelago 185-193.

  • 21. BAUMS, I.B., HUGHES, C.R., HELLBERG, M.E. 2005. “Mendelian micro- satellite loci for the Caribbean coral Acropora palmate”. Marine ecology progress series. Vol. 288:115-127.

  • 22. SEPP, R., SZABÓ, I., UDA, H., SAKAMOTO, H. 1994. “Rapid techniques for DNA extraction from routinely processed archival tissue for use in PCR”. Clinical Pathology Vol. 47:318-323.

  • 23. VIGILANT L., 1999. “An evaluation of techniques for the extraction and am- plification of DNA from naturally shed hairs”. Biology Chemistry

Vol.380:1329-1331.

  • 24. ZAMORANO, M.J., RUITER, J., RODERO, A., VEGA-PLA, J.L. 1998. “Análisis genético de marcadores moleculares microsatelitales en dos poblaciones de raza bovina berrenda en negro”. Archivos de Zootecnia Vol. 47: 195-200.

  • 25. BIO-RAD LABORATORIES. 2000. Chelex® 100 Chelex 20 Chelating Ion Resin Instruction Manual. CA 94547.

  • 26. SAMBROOK & RUSELL. 2001. Molecular cloning. Cold spring Harbor Laboratory Pess. Tomo I, II y III.

  • 27. PIERCE, J.M., FIELDS, R.L., SCRIBNER, K.T., 1997. “Nest Materials as a source of genetic data for avian ecological studies”. J. Fields Ornithol Vol. 68(3):471- 481.

  • 28. GOPURENCO, D., 2002. “Genetic structure within the distribution of the Indo- West Pacific mud crab Scylla serrata (Forskal, 1775)”. Australian school of environmental studies, Griffith University.

  • 29. FITZSIMMONS, N.N. 1998. “Single paternity of clutches and sperm storage in the promiscuous green turtle (Chelonia mydas)”. Molecular Ecology Vol. 7:575 – 584.

  • 30. FITZSIMMONS, N.N., MORITZ, C

LIMPUS, C.J., MILLER, J.D.,

, PARMETER, C.J., PRINCE, R. 1996. “Comparative genetics structure of green, loggerhead and flatback population in Australia based on va- riable mtDNA and nDNA regions”, p25-32. In: Bowen B y witzell W. (editores), Proceedings of the International Symposium of Sea Turtle Conservation Genetics. NOAA Technical Memorandum NMFS-SEFSC-396. U.S Department of Commerce.

..

  • 31. LEE, P. L. M., HAYS, G.C., 2004. “Polyandry in marine turtle: Females make the best of a bad job”. The National Academy of Science Vol.101

(17):6530-6535

Facultad de Química y Farmacia

353

EL CARIBE LAS CIENCIAS BÁSICAS E INGENIERÍA

  • 32. GARCIA GONZALEZ L.A., RODRIGO TAPIA, J.P., SANCHES LAZO, P., RAMOS, S., SUAREZ NIETO, C., 2004. “Extracción de ADN con resina Chelex en el análisis De la Amplificación Oncogénica en Carcinoma de Cabeza y Cuello”. Acta otorrinolaringol España Vol. 55: 139 -144.

  • 33. GILL, P., KIMPTON CP, SULLIVAN K. A. 1992. “Rapid polymerase chain reaction method for identifying fixed specimens”. Electrophoresis Vol. 13: 173-5.

  • 34. WRIGHT, D.K., MANOS, M.M., 1990. Simple preparation from paraffin. em- bedded tissues. In: Innis MA, editor. PCR protocols: a guide to methods and applications. San Diego: Academic Press, 153-6.

354

Facultad de Química y Farmacia