THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 282, NO. 3, pp.
1973–1979, January 19, 2007
Role of RAD51C and XRCC3 in Genetic Recombination
and DNA Repair*
Received for publication, September 25, 2006, and in revised form, October 27, 2006 Published, JBC Papers in Press, November 17, 2006, DOI 10.1074/jbc.M609066200
Yilun Liu1,2, Madalena Tarsounas1,3, Paul O’Regan4, and Stephen C. West 5
From Clare Hall Laboratories, London Research Institute, Cancer Research UK, South Mimms,
Hertfordshire EN6 3LD, United Kingdom
In germ line cells, recombination is required for gene reas-
sortment and proper chromosome segregation at meiosis,
whereas in somatic cells it provides an important mechanism for
the repair of DNA double-strand breaks. Five proteins
(RAD51B, RAD51C, RAD51D, XRCC2, and XRCC3) that share
homology with RAD51 recombinase and are known as the
RAD51 paralogs are important for recombinational repair, as
paralog-defective cell lines exhibit spontaneous chromosomal
aberrations, defective DNA repair, and reduced gene targeting.
The paralogs form two distinct protein complexes, RAD51B-
RAD51C-RAD51D-XRCC2 and RAD51C-XRCC3, but their
precise cellular roles remain unknown. Here, we show that, like
MLH1, RAD51C localized to mouse meiotic chromosomes at
pachytene/diplotene. Using immunoprecipitation and gel filtra-
tion analyses, we found that Holliday junction resolvase activity
associated tightly and co-eluted with the 80-kDa RAD51C-
XRCC3 complex. Taken together, these data indicate that the
RAD51C-XRCC3-associated Holliday junction resolvase com-
plex associates with crossovers and may play an essential role in
the resolution of recombination intermediates prior to chromo-
some segregation.
Genetic recombination is required for the maintenance of
genome stability, proper chromosome segregation, and the
reassortment of genetic traits during meiosis. In humans,
homologous recombination requires a number of proteins,
including RAD51, RAD52, RAD54, replication protein A,
MRE11/RAD50/NBS1, and the RAD51 paralogs (RAD51B,
RAD51C, RAD51D, XRCC2, and XRCC3) (1). The RAD51
recombinase plays a critically important genome caretaker role,
as indicated by the accumulation of chromosome breaks in
chicken DT40 cells carrying a repressible RAD51 transgene (2).
The requirement for other homologous recombination proteins is
less extreme, but cell lines defective in these proteins generally
* This work was supported in part by Cancer Research UK, the European
Union DNA Repair Consortium, and the Breast Cancer Campaign. The costs
of publication of this article were defrayed in part by the payment of page
charges. This article must therefore be hereby marked “advertisement” in
accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
1
Both authors contributed equally to this work.
2
Supported in part by a fellowship from the American Cancer Society. Pres-
ent address: Dept. of Therapeutic Radiology, Yale University School of
Medicine, New Haven, CT 06510.
3
Present address: Dept. of Radiation Oncology and Biology, John Radcliffe
Hospital, University of Oxford, Oxfordshire OX3 9DU, UK.
4 6
Present address: Pfizer, Sandwich, Kent CT13 9NJ, UK.
5
To whom correspondence should be addressed. Tel.: 44-1707-625868; Fax:
44-1707-625811; E-mail: stephen.west@cancer.org.uk.
JANUARY 19, 2007 • VOLUME 282 • NUMBER 3
© 2007 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in the U.S.A.
show a characteristic sensitivity to DNA-damaging agents and
exhibit a spontaneous chromosome instability phenotype.
Two primary RAD51 paralog complexes are thought to exist
in vivo: one contains RAD51B, RAD51C, RAD51D, and XRCC2
(designated the BCDX2 complex), and the other RAD51C and
Downloaded from http://www.jbc.org/ at HIROSHIMA UNIVERSITY on February 7, 2018
XRCC3 (3, 4). In mice, disruption of any of the five RAD51
paralogs leads to embryonic lethality (5–7).6 This indicates that
each of the RAD51 paralogs is essential and non-redundant
during development. However, hamster and human cell lines
that are defective in the RAD51 paralogs have been gener-
ated and shown to exhibit a recombination/repair-defective
phenotype (9 –12).
Following DNA damage, RAD51 forms nuclear foci that are
thought to represent sites where repair reactions take place.
The formation or stability of these RAD51 foci is compromised
in paralog-defective cells (13, 14), leading to the suggestion that
the paralogs are required as mediators for the formation of
active RAD51 filaments (15, 16). In support of this, purified
RAD51B-RAD51C stimulates the activity of substoichiometric
amounts of RAD51 (17), and the overexpression of RAD51 can
partially complement paralog-defective chicken DT40 cells (14).
Recent evidence suggests that some of the paralogs may also act
late in recombination. For example, XRCC3-defective cell lines
exhibit gene conversion lengths in excess of the normal length
(18), and RAD51C-defective cells show an increased frequency of
isochromatid breaks (11). These events may result from defects in
the resolution of recombination intermediates. In Arabidopsis
XRCC3 mutants, meiotic chromosomes pair but then fail to seg-
regate properly at the late stages of meiotic recombination (19).
These defects are not observed in RAD51B or XRCC2 mutants,
which remain fertile (19, 20). Support for a late role for the
RAD51C-XRCC3 complex comes from observations showing
that extracts made from XRCC3- or RAD51C-defective hamster
cells lack normal levels of Holliday junction resolvase activity (21).
These results indicate that the RAD51C-XRCC3 complex may
function in a manner that is distinct from other RAD51 paralogs by
playing a specific role in the resolution of recombination interme-
diates prior to chromosome segregation. Consistent with this
notion, an xrcc3/rad51d double deletion in DT40, involving pro-
teins from both the BCDX2 and RAD51C-XRCC3 complexes,
exhibits a greater DNA repair defect than either of the two single
deletions (22). In the work reported here, we further define the
roles played by the RAD51C-XRCC3 complex.
S. Kuznetsov, M. Pellegrini, K. Shuda, O. Fernandes-Capetillo, Y. Liu, B. K.
Martin, S. Burkett, E. Southon, D. Pati, L. Tessarollo, S. C. West, P. J. Donovan,
A. Nussenzweig, and S. K. Sharan, submitted for publication.
JOURNAL OF BIOLOGICAL CHEMISTRY 1973
RAD51C-XRCC3 in Recombinational Repair
EXPERIMENTAL PROCEDURES
Proteins—RuvA protein (23), RAD51B-RAD51C-RAD51D-
XRCC2 (3), RAD51C-XRCC3 (24), RecQ5␤ (25) and replica-
tion protein A (25) were purified as described previously. The
resolvase-containing fraction SP-15 was purified from HeLa
cells, and the depletion of RAD51C from this fraction was per-
formed as described (21).
Protein Fractionation—Nuclear extracts were prepared from
HeLa cells, and a 25–55% (NH4)2SO4 cut was made as described
(21). The precipitate (⬃3.6 g) was recovered by centrifugation
and stored as two 1.8-g pellets. Each was resuspended in 8 ml of
buffer A (50 mM K2HPO4/KH2PO4 (pH 6.8), 10% glycerol, 1 mM
EDTA, 1 mM dithiothreitol, and 0.01% Nonidet P-40) contain-
ing 250 mM KCl and dialyzed against the same buffer before
loading onto a 320-ml Sephacryl S-300 gel filtration column
(Amersham Biosciences). Proteins were eluted with 320 ml of
buffer A containing 250 mM KCl. Fractions (4 ml) were col-
lected and stored at ⫺80 °C. Molecular mass standards (Bio-
Rad) were analyzed under the same conditions.
RAD51C Affinity Chromatography—Purified His-RAD51C
protein was pre-bound to a nickel-nitrilotriacetic acid column
and incubated overnight at 4 °C with gentle shaking with HeLa
nuclear extract in buffer B (50 mM K2HPO4/KH2PO4 (pH 7.5),
10% glycerol, 300 mM KCl, 2 mM ␤-mercaptoethanol, and 0.01%
Nonidet P-40) containing 5 mM imidazole. The unbound pro-
teins were removed, and the column was washed with the same
buffer. RAD51C and bound proteins were subsequently eluted
using buffer B supplemented with 10, 20, 40, 80, and 500 mM
imidazole.
DNA Substrates—Synthetic Holliday junctions X26 and X0
were made by annealing four oligonucleotides and purified by
gel electrophoresis (26). Both junctions were 5⬘-32P-labeled on
oligonucleotide 1. Control double-stranded DNA (ds26) was
made by annealing 32P-labeled strand 1 of Holliday junction
X26 with its complement.
Resolution and Branch Migration Assays—Resolution assays
were carried out using 32P-labeled synthetic Holliday junction
X0 or X26 in the presence of a 300-fold excess of poly(dI䡠dC)
DNA (21). Branch migration reactions by RecQ5␤ were per-
formed as described using 32P-labeled Holliday junction X26 (25).
Electrophoretic Mobility Shift Assays—HeLa fraction SP-15,
RAD51C-depleted SP-15, or RuvA was incubated on ice for 10
min with 3 fmol of 32P-labeled synthetic Holliday junction X26
in the presence of an unlabeled competitor duplex (150 fmol of
ds26) in binding buffer (50 mM Tris-HCl (pH 8.0), 5 mM EDTA,
1 mM dithiothreitol, 100 mg/ml bovine serum albumin, and 6%
glycerol). Protein-DNA complexes were analyzed on 4% native
polyacrylamide gels containing 0.5⫻ Tris borate/EDTA buffer
at 160 V for 90 min at 4 °C.
In Vitro Transcription/Translation System—Reactions (20
␮l) were carried out using the Promega TNT coupled wheat
germ extraction system at 30 °C for 2 h in the presence of 200 ng
of expression plasmid. The following plasmids had the gene of
interest under the control of the T7 promoter: pET11a-RAD51C,
pET11a-XRCC3, pET11a-RAD51B, pET15b-XRCC2, pET16b-
His-RAD51C, pET16b-His-RAD51C(K131A), and pAM159
(RuvA) (27). In control reactions, we used plasmid pRSFDuet-1
1974 JOURNAL OF BIOLOGICAL CHEMISTRY
(Invitrogen). Resolution assays (10 ␮l) contained aliquots (1 ␮l) of
the transcription/translation mixture. The junction used in the
assay was X0.
Immunoprecipitation—Aliquots (200 ␮l) of gel filtration
fractions 19 –23 were incubated for 10 h at 4 °C with polyclonal
antibody (pAb)7 against either XRCC3 (SWE30) or XRCC2
(SWE35) that had been pre-bound to protein A-Sepharose
beads (15 ␮l; GE Healthcare). The supernatant was removed,
and the beads were washed five times with buffer A containing
1 M KCl. The washed beads were analyzed for activity.
Antibodies—Monoclonal (2H11) and polyclonal (SWE31
and SWE68) antibodies were raised against purified denatured
full-length RAD51C protein (3, 21, 24). pAb SWE72 was made
using a synthetic peptide corresponding to residues 41– 80 of
RAD51C. Monoclonal (10F1) and polyclonal (SWE30) antibod-
ies were raised against purified denatured XRCC3 (24). Mono-
Downloaded from http://www.jbc.org/ at HIROSHIMA UNIVERSITY on February 7, 2018
clonal (7B7) (3) and polyclonal (SWE35) antibodies were raised
against purified denatured XRCC2. Monoclonal (10G11) (28)
and polyclonal (SWE36) antibodies were raised against dena-
tured full-length hamster SCP3 protein. Anti-SCP3 polyclonal
antiserum was raised in guinea pig (29). Monoclonal antibody
(mAb) against human MLH1 was purchased from Pharmingen.
pAbs FBE2 and SWE38 were raised against human RAD51 (30)
and TRF2 (28), respectively.
Immunofluorescence Staining—Spermatocytes from 6 – 8-
week-old wild-type or Mlh1 knock-out (31) mice were surface-
spread and immunostained as described (28). To visualize
MLH1 or RAD51C, the spermatocyte suspension was trans-
ferred to a sterile Petri dish and incubated with E4 cell culture
medium (1 ml) containing 5 ␮M okadaic acid (Sigma) for 2– 4 h
at 37 °C (32). Slides were then washed and further processed for
immunostaining. The okadaic acid treatment accelerates mei-
otic progression and has been used previously to visualize
MLH1 at chiasmata during male meiosis (33). The specificity of
RAD51C staining was confirmed using four different antibod-
ies (mAb 2H11 and pAbs SWE31, SWE68, and SWE72).
Chromatin Immunoprecipitation (ChIP)—ChIP assays were
performed as described (28). Two 50 – 60-day-old male mice
(strain 129OLA) were used for each experiment. The immuno-
precipitated genomic DNA was then PCR-amplified using pairs
of primers (34, 35): the DXYCbl1 XY marker (282 bp) was gen-
erated with CACTATAGTTTTGGCCATAG and GGACGT-
GTATAATCTGGATG; the DXYCbl3 XY marker (194 bp)
with GCCTGAGCAGCATAAAAGAC and TAGGACTAAC-
AAGAGAGGTG; the DXCbl1 X marker (185 bp) with ATCT-
ATCCCTTTTTCTGAGG and CAACATGTTGACAAGTT-
TGG; and the Y4.2M Y marker (208 bp) with AAGAAATAA-
AAGAACCATAG and GCCTTCATGGAATCAGTATT.
RESULTS
Interaction of the Resolvase Complex with Holliday Junctions—
Previously, HeLa nuclear extracts were fractionated through
several columns to enrich Holliday junction resolvase activity
(21). The final fraction, designated SP-15, was found to bind
7
The abbreviations used are: pAb, polyclonal antibody; mAb, monoclonal
antibody; ChIP, chromatin immunoprecipitation; HJ, Holliday junction;
PAR, pseudoautosomal region.
VOLUME 282 • NUMBER 3 • JANUARY 19, 2007
 RAD51C-XRCC3 in Recombinational Repair
We therefore used an alternative
approach to demonstrate junction
binding by RAD51C-XRCC3 by
determining whether the presence
of RAD51C-XRCC3 could affect
the access of other enzymes to the
Holliday junction. We found that
RAD51C-XRCC3 blocked the dis-
sociation of a junction mediated
by the RecQ5␤ DNA helicase (25).
Indeed, RAD51C-XRCC3 was
equally as active as E. coli RuvA
(Fig. 1, C, compare lanes c– e and
i– k; and D). In contrast, the
BCDX2 complex failed to block
RecQ5␤-mediated dissociation of

Downloaded from http://www.jbc.org/ at HIROSHIMA UNIVERSITY on February 7, 2018

the DNA substrate (Fig. 1, C, lanes
f– h; and D). Because a subcomplex
of BCDX2 (RAD51D-XRCC2)
FIGURE 1. Interactions of RAD51C-XRCC3 with Holliday junctions. A, a partially purified fraction from HeLa interacts with BLM (another RecQ
cell extracts (SP-15) and the recombinant RAD51C-XRCC3 complex were analyzed for their ability to bind family protein) and stimulates its
32
P-labeled synthetic Holliday junction X26 or 32P-labeled control duplex in the presence of a 50-fold excess of
unlabeled competitor duplex. Purified E. coli RuvA protein was used as a control. Lanes a and b, 32P-labeled HJ dissociation activity (36), we
duplex DNA; lanes c–l, 32P-labeled Holliday junction. Protein-DNA complexes were analyzed on a 4% native cannot rule out the possibility that
polyacrylamide gel. The HeLa fraction SP-15 was prepared as described under “Experimental Procedures.”
B, DNA binding assays were carried out as described for A using the HeLa fraction SP-15 or SP-15 from which
inhibition of RecQ5␤ by RAD51C-
RAD51C had been immunodepleted (51C-dep SP-15). RuvA was used as a control. Lanes a– e, P-labeled duplex XRCC3 occurs by direct interac-
32

DNA; lanes f– k, 32P-labeled Holliday junction. C, the RAD51C-XRCC3 complex inhibits HJ dissociation by the tion of this paralog pair with
RecQ5␤ DNA helicase. The indicated concentrations of RuvA, RAD51B-RAD51C-RAD51D-XRCC2 complex
(BCDX2), or RAD51C-XRCC3 complex were preincubated with 32P-labeled Holliday junction X26 (1 nM) for 1 min RecQ5␤. However, direct interac-
prior to the addition of the RecQ5␤ protein and replication protein A (20 nM). Reactions were then allowed to tions between RAD51C-XRCC3
proceed for 30 min at 37 °C. DNA products were deproteinized and analyzed by 10% neutral PAGE. D, the and RecQ5␤ have not been
reactions shown in B were quantified. The main products of dissociation were splayed-arm and single-stranded
DNAs and are expressed as a percentage of total DNA. observed,8 leading us to suggest
that the inhibitory effects of
RAD51C-XRCC3 on RecQ5␤-
synthetic Holliday junction DNA to form two distinct protein- mediated junction dissociation are most likely due to the
Holliday junction (HJ) complexes (*1 and *2), even in the pres- junction-binding properties of RAD51C-XRCC3.
ence of a 50-fold molar excess of competitor duplex DNA (Fig. Direct Association of RAD51C and XRCC3 with HJ Resolvase
1A, lanes d– h). Under similar conditions, SP-15 did not bind Activity—The resolvase activity present in HeLa and hamster
duplex DNA substrates (Fig. 1B, lanes c– e). Similar results were cell extracts has also been detected in a variety of calf and rabbit
obtained with the Escherichia coli Holliday junction-binding organ tissues (thymus, testis, and spleen) (37–39). An identical
protein RuvA (Fig. 1, A, lane c; and B, lanes a and f ). The HJ activity is found in plant extracts, such as those obtained from
resolvase activity in SP-15 is known to be RAD51C-dependent wheat germ, giving us a unique opportunity to determine
(21), and consistent with this result, immunodepletion of whether exogenous expression of RAD51C (effectively using an
RAD51C from SP-15 resulted in a loss of Holliday junction- in vitro transcription/translation system) in a wheat germ
binding activity (Fig. 1B, lane k). We therefore concluded that extract stimulates or blocks the endogenous resolvase activity
the DNA-binding component in SP-15 is a RAD51C-contain- present in the extract. We found that expression of human
ing complex. RAD51C efficiently inhibited HJ resolution catalyzed by the
When experiments were carried out with purified recombi- wheat germ HJ resolvase (Fig. 2A, compare lanes b and c). Inhi-
nant RAD51C-XRCC3, we observed complexes similar to those bition was dependent upon a functional RAD51C, as indicated
formed by SP-15 (Fig. 1A, lanes i–l). However, the total amount by the inability of RAD51C(K131A), which carries a single
of protein-DNA complex formed using purified RAD51C- amino acid substitution in the ATP-binding domain (21), to act
XRCC3 was small in comparison with the SP-15 fraction. As as an inhibitor (Fig. 2A, lane i). Expression of other RAD51
observed with SP-15, recombinant RAD51C-XRCC3 bound paralogs, such as RAD51B (Fig. 2A, lane e), XRCC3 (lane d), and
specifically to HJ DNA, and little binding to linear duplex DNA XRCC2 (data not shown), failed to inhibit resolution, even
was observed under the same conditions (Fig. 1A, lane b). The though all proteins were expressed at comparable levels as
small amount of protein-DNA complex formed by the recom- detected by [35S]methionine labeling (lower panels).
binant RAD51C-XRCC3 complex may either be due to the To determine whether inhibition of the wheat germ
instability of the protein-DNA complex under the conditions of resolvase activity was due to the binding of the Holliday junc-
the band shift assays or result from the observed high levels of
insoluble protein in the RAD51C-XRCC3 preparation. 8
P. Janscak, personal communication.

JANUARY 19, 2007 • VOLUME 282 • NUMBER 3 JOURNAL OF BIOLOGICAL CHEMISTRY 1975
RAD51C-XRCC3 in Recombinational Repair
larly, XRCC3 present in the HeLa
extract bound to the RAD51C col-
umn and eluted with resolvase
activity (Fig. 2E, lower panel).
To further analyze the interaction
of the resolution activity with
RAD51C and XRCC3, we fraction-
ated the nuclear extracts made from
HeLa cells by gel filtration after
ammonium sulfate precipitation.
We found that a peak of HJ resolvase
activity eluted with an average molec-
ular mass of ⬃80–90 kDa (Fig. 3A).
The peak of the endogenous RAD51-
C-XRCC3 complex, indicated by the
elution profile of XRCC3 as

Downloaded from http://www.jbc.org/ at HIROSHIMA UNIVERSITY on February 7, 2018

detected by Western blotting, was
coincident with resolvase activity
(Fig. 3A, second panel). RAD51C
was present in these peak fractions
but was also found in fractions con-
taining larger protein complexes;
this is due to the fact that RAD51C
is also a component of the BCDX2
complex, which migrates with a
molecular mass of 160 kDa. The gel
filtration profile of the BCDX2 com-
FIGURE 2. Interaction of HJ resolvase with RAD51C. A and B, RAD51C expression in wheat germ extracts plex was determined by Western
blocks HJ resolution by the wheat resolvase. The indicated human and E. coli proteins were expressed in wheat blotting for XRCC2 (Fig. 3A, fourth
germ transcription/translation extracts, and HJ resolution assays were carried out as described under “Exper-
imental Procedures.” The DNA products were deproteinized and analyzed on 10% neutral polyacrylamide gel panel).
(upper panels). The amounts of the indicated proteins made by the wheat germ extract were monitored by the Immunoprecipitation of XRCC3
addition of [35S]methionine and analyzed by SDS-PAGE (lower panels). C, the schematic diagram indicates the
binding of HJ resolvase activity by RAD51C affinity chromatography. Ni-NTA, nickel-nitrilotriacetic acid; On, from resolvase peak fractions
sample applied to column; FT, flow-through. D, nuclear extracts from HeLa cells were applied to a RAD51C 19 –23, containing protein com-
affinity column. Bound proteins were eluted as described under “Experimental Procedures” and analyzed by plexes with a mass below 100 kDa,
SDS-PAGE, followed by silver staining. E, eluted fractions were analyzed for their ability to promote the reso-
lution of a 32P-labeled Holliday junction (upper panel) and for XRCC3 by Western blotting (lower panel). pulled down the RAD51C-XRCC3
complex together with quantitative
amounts of resolvase activity even
tion by RAD51C, we analyzed the effects of expressing RuvA in in the presence of 1 M KCl (Fig. 3, B and C, lanes d and h). In
the same in vitro transcription/translation system. In contrast contrast, an XRCC2 pulldown from the same fractions failed to
to RAD51C, RuvA expression did not inhibit the wheat germ bring down RAD51C, XRCC3, or the resolvase activity (Fig. 3C,
resolvase (Fig. 2B, lane d). On the basis of Western analysis, we lanes f and i), consistent with previous data indicating that
estimated the amount of RAD51C or RuvA to be no more than XRCC2 is not required for HJ resolution (21). These results
0.5 nM, which is less than the HJ substrate concentration. It is confirm the association between RAD51C-XRCC3-containing
therefore unlikely that human RAD51C inhibits wheat germ complexes and HJ resolvase activity.
resolvase activity by direct junction binding, leading us to sug- The average molecular mass of the resolvase complex
gest that inhibition may be due to the formation of an inactive (80 –90 kDa) containing RAD51C and XRCC3 suggests that the
interspecies complex between human RAD51C and a compo- RAD51C/XRCC3 heterodimer itself is responsible for the
nent of the wheat germ HJ resolvasome. observed resolution activity. However, preparations of recom-
Next, we demonstrated the direct interaction between binant RAD51C-XRCC3 protein, overexpressed and purified
RAD51C and HJ resolvase activity using affinity chromatogra- from insect cells, failed to provide a convincing resolution sig-
phy (Fig. 2C). When nuclear extracts made from HeLa cells nal in our assays. Further studies will therefore be required to
were incubated with a nickel column loaded with recombinant determine whether modification(s) of the RAD51C-XRCC3
His-tagged RAD51C, we found that only a very small propor- complex could result in activation of resolvase activity or to
tion of the applied protein bound to the column, as detected by define the involvement of additional protein factors.
PAGE of the column eluate (Fig. 2D, lane d). However, we Immunofluorescence Detection of RAD51C during Meiosis—
found that all resolvase activity present in the extract bound to Previously, immunofluorescence localization and ChIP tech-
the RAD51C column and subsequently eluted in this fraction, niques were used to show the association of RAD51C with
as detected by HJ cleavage assays (Fig. 2E, upper panel). Simi- chromatin at sites of double-strand breaks (40). However, these

1976 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 282 • NUMBER 3 • JANUARY 19, 2007
 RAD51C-XRCC3 in Recombinational Repair
somal localization of RAD51C and
XRCC3 during meiotic progression
in male mice. The advantage offered
by meiotic recombination is that the
various stages of the recombination
process are carefully timed and
coordinated, so it is relatively easy to
distinguish early from late func-
tions. As controls for early/late
functions, we used RAD51, which
associates with the chromosomes at
the early leptotene/zygotene stages
of prophase I (Fig. 4A), and MLH1,
which serves as a marker for the
later pachytene/diplotene stages of
the process (Fig. 4B). At diplotene,

Downloaded from http://www.jbc.org/ at HIROSHIMA UNIVERSITY on February 7, 2018

the physical connections (chias-
mata) between chromosomes can
be visualized (41), indicating the
formation of crossover products.
FIGURE 3. Direct association of RAD51C and XRCC3 with HJ resolvase activity. A, nuclear extracts from 50
liters of HeLa cells were fractionated by ammonium sulfate precipitation and gel filtration through a Sephacryl
The mismatch repair protein MLH1
S-300 column. Aliquots (1 ␮l) of each fraction were assayed for resolution using 32P-labeled synthetic Holliday is required for normal levels of
junction X0 (first panel). The same fractions were analyzed by 9% SDS-PAGE and immunoblotted using anti- crossover formation (31, 42) and is
XRCC3 mAb 10F1, anti-RAD51C mAb 2H11, and anti-XRCC2 pAb SWE35 (second, third, and fourth panels,
respectively). B, gel filtration fractions containing the peak of the resolvase activity were mixed with protein often used as a marker for recombi-
A-Sepharose beads cross-linked with anti-XRCC3 pAb SWE30. Immunoprecipitated beads were assayed for national interactions that are desig-
their ability to resolve 32P-labeled synthetic Holliday junction X26 (upper panel) and for the presence of XRCC3 nated to become, or have already
using anti-XRCC3 mAb 10F1 (lower panel). C, gel filtration fractions 19 –23 (containing the peak of the resolvase
activity) were mixed with protein A-Sepharose beads cross-linked with either anti-XRCC3 pAb SWE30 or anti- been realized as, crossovers (43). As
XRCC2 pAb SWE35 (left panel). Pre-I, pre-immune serum. Immunoprecipitated (IP) beads were assayed as expected, we observed one or two
described for B and for the presence of RAD51C, XRCC3, and XRCC3 by Western blotting using mAbs against
RAD51C (2H11), XRCC3 (10F1), and XRCC2 (7B7) (right panels). MLH1 foci/chromosome pair at
pachytene/diplotene.
When similar experiments were
carried out for RAD51C, we found a
pattern of staining that was strik-
ingly similar to that of MLH1 (Fig.
4C). At the early stages of meiotic
recombination (leptotene/zygo-
tene), we observed only background
levels of RAD51C, comparable with
those obtained with MLH1. We do
not exclude the possibility that our
inability to visualize RAD51C foci at
this stage could be due to the limita-
tions of immunofluorescence tech-
niques that require the accumula-
tion of significant amounts of
protein or the transient nature of
such complexes. However, at
pachytene, we observed one or two
distinct RAD51C foci associated
with each synapsed bivalent. The
average number of RAD51C foci/
FIGURE 4. Localization of RAD51C during male meiotic prophase I. A, mouse spermatocyte nuclear spreads pachytene nucleus was 29.9 (sample
at successive stages of prophase I were immunostained with anti-RAD51 pAb FBE2 (green) and anti-SCP3 mAb
10G11 (red). B, same as A but stained with anti-MLH1 mAb (green) and anti-SCP3 pAb SWE36 (red). C, same as A size, 10 nuclei; S.D., 2.55). Many of
but stained with anti-RAD51C pAb SWE68 (green) and anti-SCP3 mAb 10G11 (red). these RAD51C foci persisted
through diplotene (average number
techniques were not sensitive enough to determine whether of RAD51C foci/nucleus, 26; sample size, 10 nuclei). Addition-
RAD51C plays an early or late role in subsequent repair reac- ally, a small number of RAD51C foci were observed away from
tions. To overcome this limitation, we analyzed the chromo- the SCP3-delineated axes or were simply in the proximity of

JANUARY 19, 2007 • VOLUME 282 • NUMBER 3 JOURNAL OF BIOLOGICAL CHEMISTRY 1977
RAD51C-XRCC3 in Recombinational Repair
and Y chromosomes and may mark
sites of intersister recombination
events. Although we found it difficult
to visualize autosomal XRCC3 foci in
spermatocyte nuclear spreads, we
observed XRCC3 foci at the XY
PAR. MLH1 also localized to this
region. In spermatocyte spreads
prepared from the Mlh1⫺/⫺ mouse,
we failed to observe RAD51C and
XRCC3 foci at the PAR, supporting
the conclusion that crossover for-
mation and the presence of
RAD51C-XRCC3 foci are interre-
lated events.
In humans, the PAR crossover

Downloaded from http://www.jbc.org/ at HIROSHIMA UNIVERSITY on February 7, 2018

hot spot has been mapped and
shown to have a recombination
FIGURE 5. Association of RAD51C-XRCC3 with the obligate crossover event in the XY PAR determined by frequency ⬃20-fold higher than
immunofluorescence and ChIP analysis. A, sex chromosomes from wild-type (WT) and Mlh1⫺/⫺ mice were the genome average (45). In mice,
stained with anti-RAD51C pAb SWE68 (green) and anti-SCP3 mAb 10G11 (red) (upper panels), with anti-XRCC3
pAb SWE30 (green) (middle panels), and with anti-MLH1 mAb (green) and anti-SCP3 pAb SWE36 (red) (lower the XY hot spot has yet to be fully
panels). Yellow arrows point to the XY PAR. B, shown is a schematic representation of the mouse XY pair. DNA characterized because of the pres-
markers for the PAR (DXYCbl1 and DXYCbl3) and for the X-specific (DXCbl1) and Y-specific (Y4.2M) sequences are ence of variable numbers of
shown. C, RAD51C and XRCC3 localize to PAR as determined using ChIP assays. Two 50 – 60-day-old male mice
(strain 129OLA) were used for each experiment. ChIP assays were carried out on mouse testicular cells using pseudoautosomal repeats in dif-
anti-RAD51C pAbs SWE68 and SWE72 (51C), anti-XRCC3 pAb SWE30 (X3), anti-SCP3 pAb SWE36, and anti-TRF2 ferent mouse strains. However,
pAb SWE38. The immunoprecipitated genomic DNA was then PCR-amplified using pairs of primers as
described under “Experimental Procedures.” In this experiment, anti-SCP3 antibody (the structural component the pseudoautosomal boundary,
of axial elements) was used as a positive control to indiscriminately immunoprecipitate all four markers. The where PAR diverges into X- and
telomeric protein TRF2 served as a negative control. D, the results of the ChIP assays shown in C were quantified Y-specific sequences, has been
and are shown as the average of three independent experiments.
defined using flanking markers
and occurs between DXYCbl1 and
axial elements. Whether these represent active protein com- DXCbl1 (34, 35). Thus, DXYCbl1 and DXYCbl3 serve as
plexes or are artifacts of the spreading technique is unknown. markers for the PAR (Fig. 5B). When ChIP assays were per-
MLH1 disruption results in meiotic arrest with reduced formed on mouse testicular cells, we found that antibodies
crossovers (31), leading us to analyze RAD51C foci in sper- against RAD51C and XRCC3 immunoprecipitated the
matocytes obtained from Mlh1⫺/⫺ mice. We found that DXYCbl1 and DXYCbl3 loci (Fig. 5, C and D). In contrast,
Mlh1⫺/⫺ spermatocytes arrested at zygotene/early pachytene only background amounts of the control X- and Y-specific
and that early pachytene cells from these mice showed fewer regions (DXCbl1 and Y4.2M, respectively) were pulled down.
than five RAD51C foci/nucleus on average (data not shown). These results confirm the immunofluorescence data, show-
These results are consistent with the notion that the RAD51C- ing that RAD51C and XRCC3 associate with the PAR adja-
XRCC3 complex is targeted to crossover sites. However, cent to the pseudoautosomal boundary.
attempts to colocalize RAD51C with MLH1 were unsuccessful,
as those nuclei exhibiting RAD51C foci (⬃7% of total) typically DISCUSSION
did not show MLH1 foci. We suggest that the association of The results presented here show that the RAD51C-XRCC3
RAD51C and MLH1 with synapsed bivalents at the late stages complex associates with HJ resolution activity, a feature not
of recombination is temporal and that the stable chromosomal shared by the other RAD51 paralogs. Although the average
association of one factor may precede the other. When similar molecular mass of the resolvase activity (80 –100 kDa) is close
experiments were carried out using antibodies specific for to the combined masses of RAD51C (42,192 Da) and XRCC3
other paralogs such as RAD51B, XRCC2, and XRCC3, we failed (37,850 Da), efforts to detect resolvase activity from purified
to observe foci on the autosomes at either early or late stages of recombinant RAD51C-XRCC3 have so far proven negative.
meiotic recombination (data not shown). However, it is possible that the RAD51C/XRCC3 heterodimer
RAD51C and XRCC3 Localization at the Pseudoautosomal could be activated for resolution by post-translational modifi-
Region (PAR)—During mammalian spermatogenesis, the X and cation or by interaction with an additional small nuclease sub-
Y chromosomes pair and synapse over a short region of homol- unit. Further experiments are now in progress to determine
ogy known as the XY PAR, where an obligatory crossover event whether RAD51C-XRCC3 constitutes the HJ resolvase and/or
takes place (44). Analysis of wild-type meiotic spreads revealed to identify RAD51C-associated factors.
that RAD51C localized at or close to the XY PAR (62% fre- The biochemical studies are supported by immunofluores-
quency; 100 pachytene nuclei examined) (Fig. 5A). Some cence studies showing that RAD51C associates with paired
RAD51C foci were also observed on the unpaired arms of the X bivalents during the late stages of prophase I at meiosis, when

1978 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 282 • NUMBER 3 • JANUARY 19, 2007

crossover formation and processing occur. Although RAD51C
and XRCC3 were seen only at the late stages of meiotic recom-
bination, an observation that supports the concept that they are
late-acting proteins (18, 19, 21), our data do not rule out the
possibility that these proteins also play an role early in recom-
bination. Indeed, RAD51C and XRCC3 may form foci at the
earlier stages of recombination, but these may be too small or
transient to permit their detection by standard immunofluores-
cence techniques. However, the MLH1-dependent localization
of RAD51C and XRCC3 to the PAR, where an obligate cross-
over event takes place, appears to provide a compelling case for
a defined role late in homologous recombination. Taken
together, the data presented in this study show that the
RAD51C-XRCC3 complex interacts directly with HJ interme-
diates and associates with HJ resolution activity. Although it is
possible that other components of the human HJ resolvase
complex remain to be identified, these observations provide a
step toward understanding how recombination intermediates
are processed in mammalian cells.
Infertility in mice expressing a hypomorphic allele of Rad51c
has been shown to be associated with defects at two stages of
meiotic recombination.6 Spermatocytes undergo developmen-
tal arrest during the early stages of meiotic prophase I, sugges-
tive of a role for RAD51C in the early stages of recombination.
In contrast, oocytes progress normally to metaphase I but dis-
play precocious separation of sister chromatids, aneuploidy,
and broken chromosomes at metaphase II. These defects are
suggestive of a late role for RAD51C in meiotic recombination
and are consistent with observations showing that extracts
from the Rad51c null mouse exhibit reduced HJ resolvase activ-
ity. These observations are in accord with the primary conclu-
sions of this work.
Acknowledgments—We are grateful to Dr. Shyam Sharan (NCI-Fre-
derick) for communication of unpublished data relating the Rad51c
hypomorphic mouse. We thank Pavel Janscak (University of Zurich)
for the gift of RecQ5␤ protein and communication of unpublished
data, Ricardo Benavente (University of Würzburg) for the guinea pig
anti-SCP3 antibody, and Mike Liskay (Oregon Health & Science Uni-
versity) and Alan Clarke (Cardiff University) for the Mlh1 null mice.
REFERENCES
1. West, S. C. (2003) Nat. Rev. Mol. Cell Biol. 4, 435– 445
2. Sonoda, E., Sasaki, M. S., Buerstedde, J.-M., Bezzubova, O., Shinohara, A.,
Ogawa, H., Takata, M., Yamaguchi-Iwai, Y., and Takeda, S. (1998) EMBO
J. 17, 598 – 608
3. Masson, J.-Y., Tarsounas, M. C., Stasiak, A. Z., Stasiak, A., Shah, R., McIl-
wraith, M. J., Benson, F. E., and West, S. C. (2001) Genes Dev. 15,
3296 –3307
4. Liu, N., Schild, D., Thelen, M. P., and Thompson, L. H. (2002) Nucleic
Acids Res. 30, 1009 –1015
5. Shu, Z. G., Smith, S., Wang, L. J., Rice, M. C., and Kmiec, E. B. (1999) Mol.
Cell. Biol. 19, 8686 – 8693
6. Deans, B., Griffin, C. S., Maconochie, M., and Thacker, J. (2000) EMBO J.
19, 6675– 6685
7. Pittman, D. L., and Schimenti, J. C. (2000) Genesis 26, 167–173
8. Deleted in proof
9. Johnson, R. D., Liu, N., and Jasin, M. (1999) Nature 401, 397–399
10. Pierce, A. J., Johnson, R. D., Thompson, L. H., and Jasin, M. (1999) Genes
JANUARY 19, 2007 • VOLUME 282 • NUMBER 3
RAD51C-XRCC3 in Recombinational Repair
Dev. 13, 2633–2638
11. French, C. A., Masson, J.-Y., Griffin, C. S., O’Regan, P., West, S. C., and
Thacker, J. (2002) J. Biol. Chem. 277, 19322–19330
12. Godthelp, B. C., Wiegant, W. W., van Duijn-Goedhart, A., Scharer, O. D.,
van Buul, P. P. W., Kanaar, R., and Zdzienicka, M. Z. (2002) Nucleic Acids
Res. 30, 2172–2182
13. Bishop, D. K., Ear, U., Bhattacharyya, A., Calderone, C., Beckett, M.,
Weichselbaum, R. R., and Shinohara, A. (1998) J. Biol. Chem. 273,
21482–21488
14. Takata, M., Sasaki, M. S., Tachiiri, S., Fukushima, T., Sonoda, E., Schild, D.,
Thompson, L. H., and Takeda, S. (2001) Mol. Cell. Biol. 21, 2858 –2866
15. Gasior, S. L., Olivares, H., Ear, U. S., Hari, D. M., Weichelbaum, R., and
Bishop, D. K. (2001) Proc. Natl. Acad. Sci. U. S. A. 98, 8411– 8418
16. Sung, P., Krejci, L., Van Komen, S., and Sehorn, M. G. (2003) J. Biol. Chem.
278, 42729 – 42732
17. Sigurdsson, S., Van Komen, S., Bussen, W., Schild, D., Albala, J. S., and
Sung, P. (2001) Genes Dev. 15, 3308 –3318
18. Brenneman, M. A., Wagener, B. M., Miller, C. A., Allen, C., and Nickoloff,
J. A. (2002) Mol. Cell 10, 387–395
Downloaded from http://www.jbc.org/ at HIROSHIMA UNIVERSITY on February 7, 2018
19. Bleuyard, J.-Y., Gallego, M. E., Savigny, F., and White, C. I. (2005) Plant J.
41, 533–545
20. Li, W., Yang, X., Lin, Z., Timofejeva, L., Xiao, R., Makaroff, C. A., and Ma,
H. (2005) Plant Physiol. 138, 965–976
21. Liu, Y., Masson, J.-Y., Shah, R., O’Regan, P., and West, S. C. (2004) Science
303, 243–246
22. Yonetani, Y., Hochegger, H., Sonoda, E., Shinya, S., Yoshikawa, H.,
Takeda, S., and Yamazoe, M. (2005) Nucleic Acids Res. 33, 4544 – 4552
23. Eggleston, A. K., Mitchell, A. H., and West, S. C. (1997) Cell 89, 607– 617
24. Masson, J.-Y., Stasiak, A. Z., Stasiak, A., Benson, F. E., and West, S. C.
(2001) Proc. Natl. Acad. Sci. U. S. A. 98, 8440 – 8446
25. Garcia, P. L., Liu, Y., Jiricny, J., West, S. C., and Janscak, P. (2004) EMBO J.
23, 2882–2891
26. Ciccia, A., Constantinou, A., and West, S. C. (2003) J. Biol. Chem. 278,
25172–25178
27. Rafferty, J. B., Ingleston, S. M., Hargreaves, D., Artymiuk, P. J., Sharples,
G. J., Lloyd, R. G., and Rice, D. W. (1998) J. Mol. Biol. 278, 105–116
28. Tarsounas, M., Muñoz, P., Claas, A., Smiraldo, P. G., Pittman, D. L.,
Blasco, M. A., and West, S. C. (2004) Cell 117, 337–347
29. Alsheimer, M., and Benavente, R. (1996) Exp. Cell Res. 228, 181–188
30. Barlow, A. L., Benson, F. E., West, S. C., and Hultén, M. A. (1997) EMBO J.
16, 5207–5215
31. Baker, S. M., Plug, A. W., Prolla, T. A., Bronner, C. E., Harris, A. C., Yao, X.,
Christie, D. M., Monell, C., Arnheim, N., Bradley, A., Ashley, T., and
Liskay, R. M. (1996) Nat. Genet. 13, 336 –342
32. Tarsounas, M., Pearlman, R. E., and Moens, P. B. (1999) J. Cell Sci. 112,
423– 434
33. Marcon, E., and Moens, P. (2003) Genetics 165, 2283–2287
34. Palmer, S., Perry, J., Kipling, D., and Ashworth, A. (1997) Proc. Natl. Acad.
Sci. U. S. A. 94, 12030 –12035
35. Perry, J., Palmer, S., Gabriel, A., and Ashworth, A. (2001) Genome Res. 11,
1826 –1832
36. Braybrooke, J. P., Li, J.-L., Wu, L., Caple, F., Benson, F. E., and Hickson, I. D.
(2003) J. Biol. Chem. 278, 48357– 48366
37. Elborough, K. M., and West, S. C. (1990) EMBO J. 9, 2931–2936
38. Hyde, H., Davies, A. A., Benson, F. E., and West, S. C. (1994) J. Biol. Chem.
269, 5202–5209
39. Constantinou, A., Davies, A. A., and West, S. C. (2001) Cell 104, 259 –268
40. Rodrigue, A., Lafrance, M., Gauthier, M.-C., McDonald, D., Hendzel, M.,
West, S. C., Jasin, M., and Masson, J.-Y. (2006) EMBO J. 25, 222–231
41. Carpenter, A. T. C. (1994) Cell 77, 959 –962
42. Hunter, N., and Borts, R. H. (1997) Genes Dev. 11, 1573–1582
43. Anderson, L. K., Reeves, A., Webb, L. M., and Ashley, T. (1999) Genetics
151, 1569 –1579
44. Burgoyne, P. S. (1982) Hum. Genet. 61, 85–90
45. May, C. A., Shone, A. C., Kalaydjieva, L., Sajantila, A., and Jeffreys, A. J.
(2002) Nat. Genet. 31, 272–275
JOURNAL OF BIOLOGICAL CHEMISTRY 1979
 Role of RAD51C and XRCC3 in Genetic Recombination and DNA Repair
Yilun Liu, Madalena Tarsounas, Paul O'Regan and Stephen C. West
J. Biol. Chem. 2007, 282:1973-1979.
doi: 10.1074/jbc.M609066200 originally published online November 17, 2006

Access the most updated version of this article at doi: 10.1074/jbc.M609066200

Alerts:
• When this article is cited
• When a correction for this article is posted

Downloaded from http://www.jbc.org/ at HIROSHIMA UNIVERSITY on February 7, 2018

Click here to choose from all of JBC's e-mail alerts

This article cites 44 references, 25 of which can be accessed free at

http://www.jbc.org/content/282/3/1973.full.html#ref-list-1