Вы находитесь на странице: 1из 14

Л а б о р а т о р н ы е ж и в о т н ы е  

2018 для научных исследований № 2


https://doi.org/10/29926/2618723X-2018-02-01

Поддержание генетически модифицированных линий мышей:


вклад в развитие биоколлекций в России
Е.С. Петрова1, кандидат технических наук, старший научный сотрудник,
А.В. Громова2, кандидат ветеринарных наук, научный сотрудник,
М.С. Анисименко3, младший научный сотрудник,
Л.А. Рубан1, С.А. Егорова1, зав. виварием НИИФФМ,
И.Ф. Петровская4, директор ООО «ЭМБИ», Т.Г. Амстиславская1, 5, доктор биологических наук,
главный научный сотрудник, зам. директора НИИФФМ по научной работе, Т.В. Липина1, 5,
кандидат биологических наук, зав. лабораторией экспериментальных
моделей патологии когниции и эмоций
1
Федеральное государственное бюджетное научное учреждение «Научно-исследовательский
институт физиологии и фундаментальной медицины», 630117, Россия, г. Новосибирск,
ул. Тимакова, 4, к. 904;
2
Федеральное казенное учреждение здравоохранения «Иркутский научно-исследовательский
противочумный институт Сибири и Дальнего Востока» Роспотребнадзора, 664047, Россия,
г. Иркутск, ул. Трилиссера, 78;
3
Федеральное государственное бюджетное научное учреждение «Научно-исследовательский
институт молекулярной биологии и биофизики», 630117, Россия, г. Новосибирск,
ул. Тимакова, 2/12;
4
Общество с ограниченной ответственностью «Экспериментальные модели для биологических
испытаний» (ООО «ЭМБИ»), 630093, Россия, г. Новосибирск,
проспект Академика Лаврентьева, 10;
5
Новосибирский государственный университет, 630090, Россия, г. Новосибирск, ул. Пирогова,
Е-mail: petrovaes@physiol.ru

Резюме. Потребность в биомедицинских исследованиях на мышах с генетическими наруше-


ниями возрастает постоянно во всем мире. Неотъемлемой частью работы ученых является эф-
фективное сотрудничество между научно-исследовательскими группами как внутри одной стра-
ны, так и на международном уровне. Процесс импорта генетически модифицированных мышей
в Россию сопряжен с выполнением ряда условий, поскольку необходимо оформление таких до-
кументов, как сертификат здоровья, генетический паспорт, интеллектуальные права на переда-
чу той или иной линии мышей, договор о научном сотрудничестве. Рассматривается процедура
доставки генетических линий мышей из центра феногеномики (Toronto Centre for Phenogenomics,
Канада, http://www.phenogenomics.ca/) в виварий НИИФФМ РАН (Россия). На примере питомни-
ка НИИФФМ, содержащего модифицированных мышей линий DISC1-Q31L, DISC1-L100P, PDE4B-
M220T, Clstn2-KO и составляющих уникальную научную установку «Биологическая коллекция –
генетические биомодели нейропсихических заболеваний», описана организация поддержания
племенного ядра биоколлекции, включая регулярную проверку на патогены, возвратное скре-
щивание генетически модифицированных мышей с мышами дикого типа и их генотипирование.
Представленные данные могут быть полезны для продуктивного расширения биоколлекций
в России.
Ключевые слова: генетические линии мышей, биоколлекция, разведение, содержание, генотипи-
рование.

Для цитирования: Петрова Е.С., Громова А.В., Анисименко М.С., Рубан Л.А., Егорова С.А., Пет-
ровская И.Ф., Амстиславская Т.Г., Липина Т.В. Поддержание генетически модифицированных линий

2018 L a b o r a t o r y A n i m a l s f o r S c i e n c e № 2 2
Л а б о р а т о р н ы е ж и в о т н ы е  
2018 для научных исследований № 2
мышей: вклад в развитие биоколлекций в России. Лабораторные животные для научных исследова-
ний. 2018; 2. https://doi.org/10/29926/2618723X-2018-02-01

Maintenance of genetically modified mouse lines: input to the development


of bio-collections in Russia
E. Petrova1, PhD, Senior Researcher, A. Gromova2, Ph.D., Researcher,
M. Anisimenko3, L. Ruban1, S. Egorova1, Head vivarium,
I. Petrovskaya4, Director,
T. Amstislavskaya1,5, Doctor of biological sciences, Senior Researcher, deputy Director,
T. Lipina1,5, PhD., the head laboratory of experimental models of the pathology
of cognition and emotions
1
Federal State Budgetary Scientific Institution, Scientific Research Institute of Physiology and Basic
Medicine, 630117, Russia, Novosibirsk, street Timakova, 4, r. 904;
2
FSHI «Irkutsk Research Antiplague Institute of Siberia and Far East» of Rospotrebnadzor, 664047,
Russia, Irkutsk, street Trilissera, 78;
3
Federal State Budgetary Scientific Institution, Scientific Research Institute of Molecular Biology and
Biophysics, 630117, Russia, Novosibirsk, street Timakova, 2/12;
4
Experimental Models for Bio-assay, Limited Liability Company (EMBI, LLC), 630093, Russia,
Novosibirsk, street Academician Lavrentyev, 10;
5
Novosibirsk State University, 630090, Russia, Novosibirsk, street Pirogova, 1
е-mail: petrovaes@physiol.ru

Summary. There is a need for biomedical research on mice with genetic impairments, which is fast grow-
ing around the world. An essential part of science includes effective cooperation between research groups as
within the same country and at the international level. The process of importing the genetically modified mice
to the Russian Federation involves a number of requirements, as it is necessary to prepare range of documents,
including a health certificate, a genetic passport, intellectual rights to transfer genetic lines, an agreement on
scientific collaboration. This article describes the process of shipment of the genetic lines of mice from the cen-
ter of phenogenomics (Toronto Center for Phenogenomics (http://www.phenogenomics.ca/), Canada) to the
vivarium of the Institute (Russia). The example of unique biocollection of Scientific Research Institute of Physi-
ology and Basic Medicine (Novosibirsk) containing genetic mouse lines: DISC1-Q31L, DISC1-L100P, PDE4B-
M220T, Clstn2-KO, which are the core of the unique scientific installation “Biological collection  – genetic
biomodels of neuropsychiatric diseases”, described how to maintain the breeding colony of the bio-collection,
including regular testing for pathogens, backcrossing of genetically modified mouse lines and their genotyping.
The presented data can be useful for the productive expansion of bio-collections in Russia.
Key words: mouse genetic lines, bio-collections, breeding, maintenance, genotyping

For citation: Petrova E., Gromova A., Anisimenko M., Ruban L., Egorova S., Petrovskaya I., Amstislavskaya T.,
Lipina T. Maintenance of genetically modified mouse lines: input to the development of bio-collections in Russia.
Laboratory Animals for Science. 2018; 2. https://doi.org/10/29926/2618723X-2018-02-01

Введение
В  настоящее время изучение фундаментальных и  прикладных биомедицин-
ских проблем невозможно без проведения исследований на лабораторных жи-
вотных, где особая роль отведена генетически модифицированным организмам.
Благодаря современным молекулярно-клеточным методам появилась возможность
создания генетических линий животных. В результате этого у исследователей те-

2018 L a b o r a t o r y A n i m a l s f o r S c i e n c e № 2 3
Л а б о р а т о р н ы е ж и в о т н ы е  
2018%
для научных исследований № 2
60
50перь есть уникальный
Мнение пациентовинструмент для выяснения роли того или иного гена как
Мнение медсестер
40во временном (возможность изучать эффекты гена при его активации/ингибиро-
57 60
30вании в тот или иной период нейроразвития), так и в пространственном (возмож-
20
ность изучать24 эффекты
33 гена при его активации/ингибировании в  той или иной
10
клеточной популяции) 7измерениях. 3 13 1В настоящий момент мышь является широко
0
используемым
Да Неторганизмом Иногда для
Зависитизучения
от прививки биологии и различных расстройств у че-
ловека по нескольким причинам. Во-первых, оба генома мыши и  человека со-
держат 3,1 биллион пар оснований и ~5% геномов состоят из генов, которые иден-
тичны в среднем на 85% [1]. Во-вторых, организм мыши подходит для проведения
успешных генетических модификаций, в отличие, например, от крыс. Разработка
CRISPR-Cas9 технологии, которая позволяет осуществлять высокоэффективное ре-
дактирование генома, используя сайт-направленные ДНК-эндонуклеазы, значи-
тельно ускорила создание новых генетических линий мышей [2]. Генетические мо-
дели, разработанные на мышах, широко используются в различных областях био-
логии – от нейронауки и этологических исследований до физиологии и онкологии
[3]. Так, в Лаборатории Джексона (The Jackson Laboratory https://www.jax.org/) создано
более 5000 генетически модифицированных линий мышей, из которых 1500 – мо-
дели генетических заболеваний человека [4]. Наконец, содержание и  разведение
мышей сравнительно дешево и достаточно доступно. На рис. 1 представлена дина-
мика количества публикаций за последние 17 лет при запросе в базе PubMed сло-
восочетания «genetically modified mice», отражающая растущий спрос на генетиче-
ские линии мышей. 60
%

50
40
Количество публикаций при запросе

57 60
30
"genetically modified mice"

3500 20
10
3000
0
2500 Да

2000

1500

1000
2000-2005 2006-2011 2011-2017 Год

Рис. 1. Динамика числа публикаций с 2000 по 2017 г. при запросе в базе PubMed словосочетания
«genetically modified mice»

Разнообразие генотипов мышей привело к созданию в 2005 г. Международной


организации Federation of International Mouse Resources  – FIMRe (http://www.fimre.
org), которая объединяет 17 национальных центров генетических ресурсов
Северной Америки, Европы, Азии, Австралии и  координирует их работу [5].
Генетически модифицированные линии мышей доступны из различных между-
народных ресурсов, включая, центр региональных ресурсов мутантных мышей

2018 L a b o r a t o r y A n i m a l s f o r S c i e n c e № 2 4
Л а б о р а т о р н ы е ж и в о т н ы е  
2018 для научных исследований № 2
(IMMRRC, http://www.mmrrc.org), Европейский архив мутантных мышей (EMMA,
http://www.emmanet.org), питомник Taconic Farms (http://www.taconic.com), Японский
биоресурсный центр RIKEN (http://www.brc.riken.jp/rmpd/mouse_phenome_about.html),
Лаборатория Джексон (http://www.jax.org).
В  России не так много питомников, содержащих генетически модифициро-
ванные линии мышей. Например, к  биоресурсным центрам (со статусом SPF;
specific pathogen free  – отсутствие патогенных микроорганизмов) относятся пи-
томник лабораторных животных «Пущино», в котором содержатся 7 генетических
линий; питомник на базе SPF-вивария ИЦиГ СО РАН (Новосибирск) включает кол-
лекцию из 13 генетически модифицированных линий мышей; SPF-виварий ИФАВ
РАН (Черноголовка) – 7 линий мутантных мышей.
Для изучения нейробиологических механизмов ментальных расстройств на
базе НИИ физиологии и фундаментальной медицины (Новосибирск) в 2016 г. была
создана биоресурсная коллекция генетических мышей «Биологическая кол-
лекция – генетические биомодели нейропсихиатрических расстройств» (http://www.
physiol.ru/structure/ckpunu/unu), включающая 4 генетические линии: DISC1-Q31L, моде-
лирующая депрессивно-подобное состояние; DISC1-L100P, соответствующая модели
шизофрении [6]: PDE4B-M220T, проявляющая эндофенотипы посттравматического
стрессового расстройства [7]; Clstn2-KO, моделирующая расстройство аутистиче-
ского спектра с  проявлением гиперактивности [8, 9]. Для поддержания биоре-
сурсной коллекции питомника необходимо выполнять ряд обязательных методи-
ческих процедур, регламентирующих разведение животных, обновление пле-
менных ядер, включая возвратное скрещивание с  диким типом, плановый кон-
троль соответствия генотипа и эндофенотипов каждой генетической линии.
Введение в  мировую практику требований системы GLP (Good Laboratory
Practice) для проведения доклинических испытаний лекарственных веществ
привело к  еще более жестким условиям к  стандартизации содержания жи-
вотных. Стандартность лабораторного животного определяется не только его
генетическим статусом, технологией разведения и  содержания, но и  состоя-
нием его здоровья. По состоянию здоровья лабораторные животные делятся на
следующие категории: конвенциональные – содержащиеся в открытой системе
(1-я  категория); улучшенные конвенциональные  – находящиеся в  барьерной
системе неполного типа. Исходными животными этой категории могут быть
только животные более высокого класса качества (SPF); 2-я  категория качества
животных соответствует таковой, именуемой во многих странах MD (Minimal
Diseases); 3-я и 4-я категории соответствуют категории SPF животных, содержа-
щихся в  строгой барьерной системе; 5-я  категория включает гнотобиоты (без-
микробных) или аксенных животных, содержащихся в  изоляторах.
Стандартность животных определяется мониторингом их статуса на патогены
в  соответствии с  категорией. Контроль состояния животных осуществляется
регулярно с  минимальной частотой для животных 1-й и  2-й категорий  –
1 раз в 6 мес, для 3-й и 4-й категории – 1 раз в 2–3 мес, для 5-й категории – 1 раз
в 6 мес.

2018 L a b o r a t o r y A n i m a l s f o r S c i e n c e № 2 5
Л а б о р а т о р н ы е ж и в о т н ы е  
2018 для научных исследований № 2
Цель настоящей публикации – обсуждение вопросов приобретения мутантных
мышей из международных источников, поддержания чистоты генетической
линии в  локальных питомниках России, а  также предоставления методических
рекомендаций по содержанию и  генотипированию генетически модифициро-
ванных линий мышей на примере биоколлекции на базе НИИФФМ.

Материал и методы
Лабораторные животные. Линия мышей DISC1-Q31L несет точечную мутацию
(замена одного нуклеотида) во 2-м экзоне гена DISC1 (Disrupted-in-Schizophrenia-1),
приводящую к  замене глутамина на лейцин в  положении 31-й аминокислоты
в  DISC1 протеине. Мыши линии DISC1-L100P с  точечной мутацией во 2-м экзоне
гена DISC1, приводящей к  замене лейцина на пролин в  положении 100-й амино-
кислоты в белке DISC1. Линия PDE4B-M220T несет мутацию в 7-м экзоне гена PDE4B
(Phosphodiesterase 4B), приводящая к  замене метионина на треонин в  220-м поло-
жении протеина PDE4B. Линия мышей Clstn2-KO с  нокаутом гена кальсинтенин-2
(calsyntenin-2; Clstn2-KO). Мутантные линии мышей (DISC1-Q31L; DISC1-L100P; PDE4B-
M220T) были созданы при сотрудничестве лаборатории профессора Дж. Родера
с исследователями биоресурсного центра RIKEN [6], а Clstn2-KO линия была полу-
чена при взаимодействии с лабораторией профессора А.-М. Крэга [8].
Импорт генетических линий мышей в Россию. Организацию ввоза генетических
линий мышей из Центра феногеномики (Торонто, Канада; http://www.phenogenomics.
ca/) в  виварий НИИФФМ (http://www.physiol.ru/; Новосибирск, Россия) осуществляло
ООО «ЭМБИ» (https://academpark.com/residents/1648/; http://embiresearch.com). Были подго-
товлены следующие документы:
•  контракт поставки лабораторных мышей между Центром феногеномики
и ООО «ЭМБИ»;
•  счет на оплату контракта;
•  международный ветеринарный сертификат здоровья;
•  генетический паспорт на каждую генетическую линию;
•  разрешение на ввоз от Россельхознадзора через пункты пропуска, располо-
женные на внешней границе Таможенного союза, в которых осуществляется
пограничный государственный ветеринарный контроль.
Общее число ввозимых самцов и  самок четырех генетических линий мышей
составило 45, т.е. более установленного Россельхознадзором (по правилам
Россельхознадзора число животных не должно превышать 50). Доставка генети-
чески модифицированных мышей производилась компанией «Мировой курьер»
(https://www.worldcourier.com/) и  заняла 5 дней, включая отправку из Торонто
(24.06.2014) и получение ООО «ЭМБИ» в Новосибирске (28.06.2014).
Инбредное разведение гомозиготных генетических линий мышей. Разведение ге-
нетических линий осуществляют по принципу тесного инбридинга в 2 этапа: 1-й
этап – работа с племенным ядром и 2-й – ступенчатое расширенное воспроизвод-

2018 L a b o r a t o r y A n i m a l s f o r S c i e n c e № 2 6
Л а б о р а т о р н ы е ж и в о т н ы е  
2018 для научных исследований № 2
ство для использования в  экспериментах (племенное стадо). Племенное ядро
линии представляет собой группу животных, состоящую из размножающихся
пар репродуктивного возраста (родных братьев и  сестер) в  соотношении 1 самец/
1 самка. В пределах племенного стада к 1 самцу подсаживают 2 самки. Обязательна
регистрация инбредного возраста каждого гнезда, которая определяется количе-
ством поколений, обозначается «F» и  номером поколения. Все рожденные от 1-го
поколения (F1) инбредного разведения потомки (помет) считаются 2-м поколением
(F2), при скрещивании которого рождается 3-е поколение (F3) и т.д. Данные генети-
ко-селекционные процедуры являются основополагающими для исключения воз-
можности генетической контаминации (случайных скрещиваний) и потери гомо-
зиготности линий.
Обновление племенных ядер гомозиготных генетических линий мышей. Для под-
держания каждой генетической линии формируют 8–12 родительских гнезд, ко-
торые при выбраковке подвергают обновлению за счет ссаживания особей из
детей (пометов) генетических линий, достигших половозрелого возраста, находя-
щихся в  непосредственно родственных связях. Родительские племенные ядра по
истечении репродуктивного возраста (7–8 мес) подвергаются выбраковке (эвта-
назии с  последующей утилизацией). При падеже/признаках нежизнеспособности
самки или самца в  родительской паре гнезда выбраковывается все гнездо. При
разведении генетических линий мышей биоресурсной коллекции, соблюдая ин-
бридинг, необходимо организовать возвратное скрещивание каждой мутантной/
нокаутной линии с контрольной линией – мыши дикого типа C57Bl/6NCrl для по-
лучения гетерозиготных животных. Затем полученных гетерозиготных самцов
и самок используют для создания гнезд с целью формирования потомства, состоя-
щего из 25% мышей дикого типа, 50% – гетерозигот и 25% – гомозиготных особей
в  одном помете. Полученных животных маркируют (рис. 2) и  генотипируют для
дальнейшего формирования новых гнезд между гомозиготными особями. Данная
процедура осуществляется с регулярностью 1 раз в 1–2 года.

1 2 3 4 5

Рис. 2. Схема маркировки ушей для их дальнейшего генотипирования и экспериментальных


работ. По индивидуальным меткам на левом и правом ухе присваиваются порядковые номера
от 1 до 5 для каждой особи

2018 L a b o r a t o r y A n i m a l s f o r S c i e n c e № 2 7
Л а б о р а т о р н ы е ж и в о т н ы е  
2018 для научных исследований № 2
Определение патогенов. Мониторинг здоровья генетических линий мышей
выполняется в соответствии с рекомендациями FELASA (Федерация европей-
ских научных ассоциаций по лабораторным животным) методом иммунофер-
ментного анализа (ИФА) с  детекцией вирусов специфичными антителами
в  сыворотке или плазме крови и  методом полимеразной цепной реакции
(ПЦР) для определения бактерий и  вирусов в  фекалиях и  мазках из ротовой
полости [10]. Для исследования патогенов у мышей отбирали биологический
материал и  направляли в  лабораторию ООО «Белки-Биотехнологии» (https://
www.bbt-lab.com).
Для определения вирусов методом ИФА необходимо отобрать плазму или
сыворотку крови. Допустимо ее разведение фосфатно-солевым буфером не
более чем в  10 раз. Объем неразведенной сыворотки 1 образца на 1 патоген
должен составлять 5 мкл, т.е. для анализа вирусов, рекомендуемых FELASA,
необходимо не менее 50 мкл сыворотки. Для определения бактерий верхних
дыхательных путей методом ПЦР берется мазок из ротовой полости. Зонд не
должен касаться рабочих поверхностей и рук. Анализ остальных бактерий из
списка FELASA проводится в образцах фекалий животных методом ПЦР. Для
исследования требуется 1 г фекалий от каждого исследуемого животного.
Контроль микробиологического статуса конвенциональных мышей в  ви-
варии НИИФФМ осуществляется следующими методами:
Тест-система. Метод состоит в  исследовании животных высокой катего-
рии качества (SPF) с  известным исходным состоянием после пребывания их
в течение определенного срока (8 нед и более) в колонии конвенционального
разведения.
Выборка животных из популяции колонии. Метод включает общее посмертное,
микробиологическое и  гистологическое обследование. Шансы обнаружить
инфекцию зависят от числа проверенных животных по отношению к общему
числу особей в  колонии (%), а  также от степени распространения инфекции
среди животных. Мыши отбираются из каждой зоны обитания, где мини-
мальная выборка составляет не менее 10 особей, 5 из которых   – в  возрасте
10–12 нед, 5 – старше 6 мес.
Плановая проверка животных на инфекции. Метод позволяет обнаружить па-
тогены или повреждения, угрожающие здоровью колонии и  качеству прово-
димых экспериментов.
Результаты мониторинга здоровья хранятся у руководителя, курирующего
биоресурсную коллекцию генетических линий мышей на бумажном носи-
теле, который должен быть заверен подписью и печатью лаборатории, где вы-
полнялось исследование.

2018 L a b o r a t o r y A n i m a l s f o r S c i e n c e № 2 8
Л а б о р а т о р н ы е ж и в о т н ы е  
2018 для научных исследований № 2
Таблица 1
Химический состав буфера В (при расчете на 500 мл)
5М NaCl 10 мл
1M EDTA 25 мл (растворяется при pH 8,5)
1М Tris-HCl pH 8,0 25 мл

Таблица 2
Химический состав лизирующего буфера (на 1 пробу)
Буфер В 1 мл
SDS 10% 50 мкл
Протеиназа К (10 мг/мл) 12 мкл

Генотипирование. 1. Выделение ДНК солевым методом. Лизирующий буфер го-


товится непосредственно перед выделением ДНК (Табл. 1, 2). Буфер В  хра-
нится при температуре 4°С. Кончик хвоста (около 0,5 см) поместить в  про-
бирку на 1,5 мл. Добавить 1 мл лизирующего буфера. Инкубировать при тем-
пературе 50°С  на шейкере 18–20 ч. Охладить пробирки до 4°С  и  добавить
300 мкл 6М NaCl, перемешивать 10 с  на Vortex. Затем центрифугировать
15 мин при 12  000 g и  4°С. Супернатант слить в  чистую пробирку на 1,5 мл
и центрифугировать 10 мин при 11 000 g и 4°С. Этот раствор можно хранить
при температуре 4°С  (5–7 дней) до получения результатов генотипирования.
Далее отобрать 200 мкл супернатанта в чистую пробирку на 1,5 мл и добавить
400 мкл 96% холодного этанола, охладить до -20°С. Должна наблюдаться бе-
лесая взвесь в верхней части раствора. После этого смесь перемешать до фор-
мирования плотного белого осадка и  центрифугировать 10 мин при 7000 g
и 4°С. Супернатант слить, осадок просушить (около 10 мин), оставив пробирки
вверх дном на салфетке. Затем добавить 1 мл 70% этанола и  центрифугиро-
вать 10 мин при 7000 g и  4°С. Слить супернатант, осадок просушить и  доба-
вить 50–100 мкл бидистиллированной воды. Расчет концентрации ДНК про-
изводили на приборе NanoDrop 2000 (Thermo Scientific, США) при максимуме
поглощения 260 нм. Рабочее разведение раствора ДНК должно быть около
50 нг/мкл. Необходимо обратить внимание на чистоту полученных растворов.
Соотношение 260/230 должно быть >2,2 (230 нм  – максимум поглощения по-
лисахаридов); соотношение 260/280 должно быть >1,8 (280 нм  – максимум
поглощения белков).
2. ПЦР. Праймеры и  зонды. Синтез праймеров и  зондов осуществляла ком-
пания ООО «Лаборатория-Медиген» (Новосибирск). Для разработки ПЦР-
протокола необходимо первоначально провести конструирование пары прай-
меров (затравки для ДНК-полимеразы) (табл. 3). Праймеры подбирали с помощью
программы Primer 3. Полученные параметры проверяли на специфичность, ис-

2018 L a b o r a t o r y A n i m a l s f o r S c i e n c e № 2 9
Л а б о р а т о р н ы е ж и в о т н ы е  
2018 для научных исследований № 2
пользуя биоинформационную базу данных NCBI (National Center for
Biotechnological Information, США) (https://www.ncbi.nlm.nih.gov/tools/primer-blast/).

Таблица 3
Вариантная аминокислота и дизайн праймеров у различных
генетически модифицированных линий мышей
Линия Мутация Норма Прямой праймер Обратный праймер
DISC1- Leucine Glutamine (CAG ACAGTGGGCATGGCTTACC GCCTGGTCTCCGTGTCA
Q31L (CTG - GAC) - GTC)

DISC1- Proline Leucine (GAG CCACTGCCAAGCCTCACT GGCCACAGCAGGGACAA


L100P (GGG -CCC) -CTC)
PDE4B- Threonine Metionine (ATG CCTGTCTGTGTGTTTGTTTCCA GGCACCAGTCTAGTTCCTC
M220T (ACG-TGC) -TAC)

Clstn2-KO 364 п.н. 162 п.н. AAGTTTTGGGCTTGTAGATCCAGCTCTGTC neo-ko-R1(364bp)


AAATTGCATCGCATTGTCTGAGTAGGTGTC
(праймер мутантного типа)
cls2-ko-R2(162bp)
GATGTCTTATTGAGCACCACAGCCTCAAAG
(праймер дикого типа)
Примечание: п.н. – пар нуклеотидов.

Праймер-зонды представляют собой комплиментарные к фрагменту ДНК с то-


чечной мутацией олигонуклеотиды, меченные на 5` конце флюоресцентным кра-
сителем FAM (Fluorescein amidite) для дикого типа, R6G (Rhodamine 6G)  – для му-
тантов, и  гасителем флюоресценции BHQ1 (Black Hole Quencher-1) на 3` конце.
Схематичное изображение флюоресцентного TaqMan зонда представлено на рис. 3.
Для генотипирования мышей линий DISC1-Q31L, DISC1-L100P, PDE4B-M220T ис-
пользовали следующие флюоресцентные зонды (подчеркнуты нуклеотиды, ком-
плементарные соответствующему полиморфизму):

DISC1-Q31L: 5’ – FAM-CAGTAGCCCCTCAGAGG-BHQ1-3’


5’ – R6G-CAGTAGCCCCTCTGAGG-BHQ1-3’
DISC1-L100P: 5’ – FAM-CTCTTGAGAAAAGGCT-BHQ1-3’
5’ – R6G-CTCTTGGGAAAAGGCT-BHQ1-3’
PDE4B-M220T: 5’ – FAM-ATCAGAAACTAGCAATGGAG-BHQ1-3’
5’ – R6G-ATCAGAAACTAGCAACGGAG-BHQ1-3’

Для линии Clstn2-KO зонды не конструировали вследствие возможности гено-


типирования такой мутации менее затратным методом гель-электрофореза.

2018 L a b o r a t o r y A n i m a l s f o r S c i e n c e № 2 10
Л а б о р а т о р н ы е ж и в о т н ы е  
2018 для научных исследований № 2


НО О ОН

CH3
О
О О N
Н3C N
N О N N+
5 3 N CH3 О О+
О N

ОН
Рис. 3. Схематическое изображение флюоресцентного TaqMan зонда. На 5` конце – флюорофор
FAM, на 3` конце – гаситель BHQ1. Жирная полоса обозначает олигонуклеотид

Раствор Master Mix, состоящий из компонентов (BIORON LifeScience, Германия)


для проведения ПЦР аликвотировали по 0,5 мл для хранения при температуре
-20°С  (табл. 4). Смесь PCR mix готовят непосредственно перед выполнением ПЦР
и  не хранят. В  расчете на 1 образец необходимо 23 мкл раствора PCR mix, содер-
жащий Master Mix (5 мкл), 10 мкМ прямой праймер (1 мкл), 10 мкМ обратный
праймер (1 мкл), 10 мкМ зонд для дикого типа (1 мкл), 10 мкМ зонд для мутант-
ного типа (1 мкл) и ddH2O (14 мкл). Для мышей линии Clstn2-KO праймеры в кон-
центрации 10 мкМ добавляют в количестве по 1 мкл, соответственно 15 мкл ddH2O.
На 1 пробу необходимо 2 мкл раствора ДНК с концентрацией около 50 нг/мкл.
Таблица 4
Компоненты для Master Mix (на 300 реакций)
ddH2O 369 мкл
10х PCR buffer 750 мкл
100 mM MgCl2 225 мкл
25 mM dNTPs (A, T, G, C) по 24 мкл
TaqPolymerase (SuperHot Taq) 60 мкл

Параметры для ПЦР. Температурные оптимумы каждой стадии ПЦР для че-
тырех генетических линий мышей представлены в табл. 5. Предварительную де-
натурацию молекулы ДНК проводили при температуре 95°С  в  течение 3 мин,
далее повторяли 35 циклов. Уровень флуоресценции детектировали по окончании
каждого цикла ПЦР.

2018 L a b o r a t o r y A n i m a l s f o r S c i e n c e № 2 11
Л а б о р а т о р н ы е ж и в о т н ы е  
2018 для научных исследований № 2
Таблица 5
Протоколы проведения ПЦР для разных генетически модифицированных линий мышей
Стадии ПЦР DISC1-Q31L DISC1-L100P PDE4B-M220T Clstn2-KO
Предварительная денатурация ДНК 95 °C, 180 с 95 °C, 180 с 95 °C, 180 с 94 °C, 300 с
Денатурация ДНК 95 °C, 10 с 95 °C, 10 с 95 °C, 10 с 94 °C, 30 с
Отжиг праймеров 58 °C, 60 с 50 °C, 60 с 60 °C, 60 с 60 °C, 30 с
Элонгация ДНК 60 °C, 30 с 60 °C, 30 с 60 °C, 30 с 72 °C, 90 с

3. Анализ ПЦР-продуктов. Генотипирование мышей с точечными мутациями


методом ПЦР в реальном времени выполняли на приборе LightCycler 480 (Roche
LifeScience, Германия). Флюоресценцию зондов для дикого типа (FAM) регистри-
ровали при длине волны 465–510 нм, для мутантного типа (R6G) – 533–580 нм
(рис. 4).

Рис. 4. Снимок экрана программы LightCycler 480 Software release после проведения ПЦР в
реальном времени. Вверху слева – расположение проб в планшете, дубли выделены одним цветом;
внизу слева – для каждого образца значения интенсивности флюоресценции по конечной точке
при 456–510 нм и 533–580 нм; сверху справа – динамика флуоресценции смеси при 456–510 нм
(соответствует зонду дикого типа); снизу справа – динамика флюоресценции смеси при
533–580 нм (соответствует зонду мутантного типа). Интенсивность сигнала пропорциональна
количеству специфического ПЦР-продукта. Гомозигота дикого типа (красные линии), гомозигота
мутантного типа (зеленые линии) и 2 гетерозиготы (розовые и голубые линии) вследствие
регистрации сигнала на разной длине волн

2018 L a b o r a t o r y A n i m a l s f o r S c i e n c e № 2 12
Л а б о р а т о р н ы е ж и в о т н ы е  
2018 для научных исследований № 2
При генотипировании мышей линии Clstn2-KO после ПЦР осуществляли
гель-электрофорез продуктов амплификации в камере для горизонтального фо-
реза (Хеликон, Россия) при напряжении 150 В в течение 35 мин. Для электрофо-
реза использовали 2% агарозный гель в 1х ТАЕ буфере. Образцы (5 мкл) смеши-
вали с 1 мкл краски (0,025% раствор бромфенолового синего в 30% растворе гли-
церина) и вносили в агарозный гель. После электрофореза гель инкубировали
в растворе бромистого этидия в течение 10 мин, промывали в воде и анализи-
ровали в  гель-документирующей камере (GelDoc ХR+; BIO-RAD, США) в  ультра-
фиолете. Размер амплифицированного продукта у мышей дикого типа состав-
ляет 162 пары нуклеотидов (п.н.), у  Clstn2-KО мышей  – 364 п.н. В  качестве ли-
нейки молекулярных масс использовали маркер (100 bp DNA Ladder, BIORON
LifeScience, Германия) (рис. 5).

Рис. 5. Электрофореграмма ПЦР-продуктов гетерозиготных (+/-), гомозиготных (-/-) Clstn2-KO


мышей и мышей дикого типа (+/+) при использовании праймеров в области 3-го экзона гена
Clstn2. ПЦР-продукт мышей дикого типа детектируется в виде полосы, соответствующей размеру
в 162 п.н., в то время как ПЦР продукт Clstn2-КО аллелей соответствует 364 п.н.

Результаты и обсуждение
Для поддержания генетически модифицированных линий мышей в  России
важно разработать нормы и  регламент по ввозу, содержанию, разведению, обнов-
лению племенных ядер животных, а также обеспечить доступность процедуры ге-
нотипирования, протокол которого формируется при создании линии и  должен
быть в  открытом доступе. На базе УНУ НИИФФМ, в  которой содержатся мыши
линий DISC1-Q31L, DISC1-L100P, PDE4B-M220T, Clstn2-KO, нами отработан эффек-
тивный, доступный и воспроизводимый протокол генотипирования.

2018 L a b o r a t o r y A n i m a l s f o r S c i e n c e № 2 13
Л а б о р а т о р н ы е ж и в о т н ы е  
2018 для научных исследований № 2
Водный раствор ДНК с чистотой и концентрацией, достаточной для генотипи-
рования, получен методом солевой экстракции нуклеиновых кислот в  присут-
ствии протеиназы К, без применения фенола и  хлороформа. Данный метод дос-
тупный по стоимости, не требует особых условий и  оборудования. После дове-
дения раствора ДНК бидистиллированной водой до концентрации 50 нг/мкл для
линий мышей с точечными мутациями проводили ПЦР в реальном времени. Этот
метод основан на количественной детекции флюоресцентного сигнала, который
увеличивается пропорционально накоплению в реакционной смеси целевого спе-
цифического фрагмента ДНК. Используемые нами зонды TaqMan представляют
собой олигонуклеотиды с флюорофором – молекулой способной к флюоресценции,
на 5` конце и  гасителем  – на 3` (рис. 3). В  ходе ПЦР после гибридизации зонда
с  комплементарной последовательностью, ДНК-полимераза, обладающая 5`-экзо-
нуклеазной активностью, разрушает зонд и приводит к разобщению флюорофора
и  гасителя, а  значит  – к  возрастанию флюоресценции. Такая система позволяет
достоверно регистрировать накопление фрагмента гена строго определенной
последовательности.
Генотипирование мышей линии Clstn2-KO проводили с  использованием гель-
электрофореза. У мышей данной линии нарушена экспрессия гена Clstn2, что ведет
к  отсутствию синаптического белка кальсинтенина-2. В  результате возникают
функциональный дефицит тормозных вставочных ГАМК интернейронов и после-
дующий социальный дефицит, а  также нарушения долговременной пространст-
венной памяти и  гиперактивности [8, 9]. Нокаутировние гена осуществляется за
счет вставки в 3-й экзон гена Clstn2, локализованного на 9-й хромосоме, неомици-
новой кассеты. Амплифицированные фрагменты гена Clstn2 у мышей дикого типа
распределяются в  геле относительно линейки молекулярных масс между 100
и 200 п.н., что соответствует размеру продукта ПЦР в 162 п.н., для мышей линии
Clstn2-KO длина ампликона равна 364 п.н. (рис. 5). У  гетерозиготных животных
присутствуют амплифицированные продукты длиной 162 п.н. и 364 п.н.

Заключение
Ключевая роль лабораторных мышей в  решении задач фундаментальной био-
логии и  смежных наук требует создания новых генетических линий животных
с заданным по запросу исследователя генотипом. Исследователи всего мира имеют
неограниченный доступ к ресурсам многочисленных генетических линий мышей,
однако в России пока не создан специализированный центр с единой коллекцией
таких мышей, который бы объединял как создание новых уникальных линий,
так и  централизованную организацию их импорта в  виварии научно-исследова-
тельских институтов страны. Приобретение генетически модифицированных
мышей из зарубежных питомников с доступом к ~5000 линиям существенно по-
высит эффективность научных исследований в России.
Перспективная задача российского научного сообщества в  области биологии
и медицины – организация и отработка процедуры поддержания биоколлекций,
начиная с импорта генетически модифицированных линий мышей, включая сер-

2018 L a b o r a t o r y A n i m a l s f o r S c i e n c e № 2 14
Л а б о р а т о р н ы е ж и в о т н ы е  
2018 для научных исследований № 2
тификат здоровья, генетический паспорт с  протоколом генотипирования и  соз-
дание условий содержания генетических линий в локальных питомниках России.
Контроль наследования заявленной мутации необходимо проводить путем скри-
нинговой процедуры генотипирования. Для эффективного поддержания чистоты
генетических линий мышей следует учитывать такие критерии методик геноти-
пирования, такие как доступность, надежность, воспроизводимость.

Благодарности
В  данной работе были использованы генетические линии мышей, входящие
в  состав уникальной научной установки (УНУ) «Биологическая коллекция  – гене-
тические биомодели нейропсихических заболеваний» (№493387) НИИФФМ.

Конфликт интересов
Авторы заявляют об отсутствии конфликта интересов.
Conflict of interest
The authors declare no conflict of interest.

Литература
1. Mouse Genome Sequencing Consortium et al. Initial sequencing and comparative analysis of the mouse
genome. Nature. 2002; 420 (6915): 520–62.
2. Burgio G. Redefining mouse transgenesis with CRISPR/Cas9 genome editing technology. Genome Biol.
2018; 19 (1): 27–30.
3. Rosenthal N., Brown S. The mouse ascending: perspectives for human-disease models. Nat. Cell. Biol.
2007; 9 (9): 993–9.
4. Bult C.J., Eppig J.T., Blake J.A. et al. Mouse genome database 2016. Nucleic Acids Res. 2016; 44 (D1):
D840–7.
5. Davisson M. FIMRe: Federation of International Mouse Resources: global networking of resource centers.
Mamm. Genome. 2006; 17 (5): 363–4.
6. Clapcote S.J., Lipina T.V., Millar K.J. et al. Behavioral phenotypes of Disc1 missense mutations in mice.
Neuron. 2007; 54 (3): 387–402.
7. Ryabova O.V., Pavlov K.S., Lipina T.V. The complex approach to study endophenotypes related to
posttraumatic stress disorder in mice with point mutation in the phosphodiesterase 4B gene (PDE4B-M220T).
XII International interdisciplinary congress «Neuroscience for Medicine and Psychology», Sudak, Crimea,
Russia, June 1–1, 2016; 339.
8. Lipina T.V., Prasad T., Yokomaku D. et al. Cognitive deficits in calsyntenin-2-deficient mice associated
with reduced GABAergic transmission. Neuropsychopharmacology. 2016; 41 (3): 802–10.
9. Ranneva S.V., Pavlov K.S., Gromova A.V. et al. Features of emotional and social behavioral phenotypes
of calsyntenin2 knockout mice. Behav. Brain Res. 2017; 332: 343–54.
10. FELASA working group on revision of guidelines for health monitoring of rodents and rabbits et al.
FELASA recommendations for the health monitoring of mouse, rat, hamster, guinea pig and rabbit colonies in
breeding and experimental units. Lab. Anim. 2014; 48 (3): 178–92.

2018 L a b o r a t o r y A n i m a l s f o r S c i e n c e № 2 15