Physiological Responses of a Natural Antioxidant

Victor J. Johnson1
Flavonoid Mixture, Silymarin, in BALB/c Mice: Quanren He1
III. Silymarin Inhibits T-Lymphocyte Function at Low Doses but Stimulates Marcin F. Osuchowski1, 2
Inflammatory Processes at High Doses Raghubir P. Sharma2
Original Paper

Abstract
Silymarin is a mixture of bioactive flavonoids isolated from Milk
Thistle (Silybum marianum). Crude extracts from this plant have
been used for centuries as a natural remedy and silymarin is now
effectively used in the treatment of inflammatory liver toxicity
and disease in humans. In vitro studies show that silymarin can
inhibit the production and damage caused by tumor necrosis fac-
tor a (TNFa) and is a potent antioxidant both in vitro and in vivo.
Such findings suggest silymarin may impact the immune system
but little information exists following in vivo exposure. There-
fore, we tested the hypothesis that exposure to silymarin will
modulate the inflammatory immune response. Male BABL/c
mice (6/group) were treated intraperitoneally once daily for five
days with 0, 10, 50 or 250 mg/kg of silymarin. Silymarin exposure
44 did not produce any signs of overt toxicity or any changes in rela-
tive organ weights. Flow cytometric examination of splenic lym-
phocyte populations showed that the absolute number of CD3+
T-lymphocytes was reduced in the 10 and 50 mg/kg groups al-
though significance was evident only in the 10 mg/kg group.
Concomitant decreases in CD4+ and CD8+ T-cell populations
were observed but only the CD4+ population in mice treated
with 10 mg/kg of silymarin was significantly different from con-
trol. Functional examination of secondary lymphoid cells re-
vealed that phytohemagglutinin-induced T-lymphocyte proli-
feration was increased in the lowest dose group only. B-lympho-
cyte blastogenesis induced by lipopolysaccharide was increased
following exposure to 10 and 50 mg/kg of silymarin. Similarly,
expression of TNFa, inducible nitric oxide synthase, IL-1b and
IL-6 mRNA were increased dose-dependently. The expression of
IL-2 and IL-4 were reduced in mice treated with 10 and 50 mg/kg
of silymarin although only the 10 mg/kg group was significantly
different from control. The results indicate that in vivo parenteral
exposure to silymarin results in suppression of T-lymphocyte
function at low doses and stimulation of inflammatory processes
at higher doses. Further studies investigating the effects of sily-
marin on the immune system are warranted.
Key words
Silymarin ´ inflammation ´ natural product ´ T-lymphocyte ´ cyto-
kine ´ Silybum marianum ´ Asteraceae

Introduction
Silymarin is a mixture of bioactive flavonoids isolated from the
seeds and fruits of milk thistle (Silybum marianum). This mixture
has been recognized as a powerful antioxidant displaying hepa-
toprotective [1], chemopreventive [2] and immunomodulatory
[3] properties. Crude extracts from milk thistle have been used
for years in the treatment of human liver toxicity and chronic liv-
er diseases. Pharmacological studies have indicated that even
high doses of silymarin are not overtly toxic to patients receiving
therapy [4]. The biological actions of this mixture have been at-
tributed to several mechanisms including membrane stabiliza-
tion and inhibition of lipid peroxidation [5], elevation of gluta-
thione and superoxide dismutase (SOD) [6] as well as free radical

Affiliation
1
Department of Physiology and Pharmacology, College of Veterinary Medicine,
The University of Georgia, Athens, GA, USA
2
Animal Anatomy, University Warmia and Mazury, Olsztyn, Poland

Correspondence
Dr. Raghubir P. Sharma ´ Department of Physiology and Pharmacology ´ College of Veterinary Medicine ´
The University of Georgia ´ Athens, GA 30602-7389, USA ´ Phone: +1-706-542-2788 ´ Fax: +1-706-542-3015 ´
E-mail: rpsharma@vet.uga.edu

Received May 28, 2002 ´ Accepted July 28, 2002

Bibliography
Planta Med 2003; 69: 44±49 ´  Georg Thieme Verlag Stuttgart ´ New York ´ ISSN 0032-0943
scavenging. The increasing use of silymarin as a natural compo-
nent in nearly 200 natural medications warrants further investi-
gation on the toxicology of this mixture at a subclinical level,
namely the immune system.
Several in vitro studies address the effects of silymarin on com-
ponents of the immune system. Lang et al. [7] demonstrated
that exposure of peripheral blood cells to silymarin resulted in
increased mitogen-induced lymphocyte proliferation but de-
creased antibody-dependent cellular cytotoxicity, natural killer
cell activity and reduced the CD8+ T-cell population. Stimulation
of the basal rate of proliferation was also observed in splenocytes
from silymarin-treated rats [8]. In contrast, Meroni et al. [9]
showed a dose-dependent inhibition of mitogen-induced lym-
phocyte blastogenesis following in vitro exposure to silybin, an
active component of silymarin. In vitro exposure to silymarin
was shown to restore function and maturation of peritoneal
macrophage from patients undergoing continuous ambulatory
peritoneal dialysis [10]. In addition, silibinin is capable of indu-
cing HL-60 cell differentiation into a monocyte lineage [11].
These studies suggest that silymarin may have differential ef-
fects on lymphocytes versus macrophage/monocyte type cells.
Silymarin has also been shown to affect the production and re-
lease of cytokines. Silymarin potently inhibited the expression of
tumor necrosis factor a (TNFa) in mouse skin exposed to tumor
promoters [12]. Silybin displays similar anti-inflammatory actions
resulting in a dose-dependent inhibition of lipopolysaccharide
(LPS)-induced TNFa production in RAW264.7 macrophage cells
[13]. Recent evidence demonstrates that the mechanism of TNFa
inhibition is through decreased activation of nuclear factor kB
(NFkB) in cells exposed to silymarin or its components [3], [14]. It
is likely that the free radical scavenging properties of silymarin are
responsible for the observed inhibition of NFkB.
The vast majority of literature regarding the immune system ef-
fects of silymarin involved pathological or noxious stimuli. There
is a lack of information regarding the immunological effects of
this flavonoid mixture on the normal healthy immune system.
The objective of the present study was to determine the effects
of sub-acute treatment with silymarin on the representation
and function of lymphocytes in the peripheral immune system
of healthy BALB/c mice.
Materials and Methods
Animal care and handling
Inbred male BALB/c mice (Harlan, Indianapolis, IN), 7 ± 8 weeks
of age and an average body weight of 20 g were used. Mice were
randomly assigned to treatment cages (6/cage) and allowed to
acclimate for one week in the University of Georgia Animal Re-
sources facility maintained at 21 8C with a 12-hour light/dark cy-
cle. Rodent chow (Harlan Teklad, Madison, WI) and distilled wa-
ter were supplied ad libitum. Food and water consumption as
well as body weight gain were monitored daily over the treat-
ment period. The care and treatment of the mice were in accord-
ance with the guidelines established by the Public Health Service
Policy on Humane Care and Use of Laboratory Animals and were
approved by the Institutional Animal Care and Use Committee.
Treatment of assay groups
Silymarin was purchased from Sigma-Aldrich Chemical Compa-
ny (St. Louis, MO). This product consists of a mixture of seven
isomers including toxifolin (4 %), silichristin (27.9 %), silidianin
(2.9 %), silybin A (19.3 %), silybin B (31.3 %), isosilybin A (8.2 %)
and isosilybin B (2.3 %) as determined by high-performance li-
quid chromatography with 277 nm detection. Male BALB/c
mice received daily intraperitoneal (i. p.) injections for 5 conse-
cutive days of phosphate buffered saline (PBS, vehicle control)
or 10, 50, 250 mg/kg of silymarin (Sigma, St. Louis, MS) as a sus-
pension in PBS. This route of exposure has been used previously
for the investigation of the hepatoprotective effects of silymar-
in [15] and we recently employed the same protocol to examine
the effects of silymarin on normal liver [16]. One day following
Original Paper
the final injection, mice were euthanized by decapitation, trunk
blood collected and the spleen was aseptically excised and
weighed. Peripheral blood was used for the determination of
erythrocyte and leukocyte populations. Single cell suspensions
were prepared from the spleen as reported previously [17] and
used for phenotypic and functional analysis of lymphocyte po-
pulations.
Mitogen-induced lymphocyte proliferation
The proliferative response of splenic lymphocytes from mice
treated with silymarin in vivo was examined using the lympho-
cyte blastogenesis assay described earlier [17]. Cultures were
stimulated with concanavalin A (ConA; 5 mg/ml), phytohemag-
glutinin (PHA-P; 10 mg/ml) and LPS (50 mg/ml) for 48 hours at
37 8C with 5 % CO2, and subsequently pulsed with [methyl-
3
H]thymidine (25 mCi/ml, 6.7 Ci/mmol, DuPont NEN Products,
Boston, MA) for an additional 18 hours. Proliferative responses
were expressed as net disintegrations per minute (DPM) and
stimulation indices (DPM with mitogen/DPM without mitogen). 45
Flow cytometric phenotyping of splenic lymphocyte
populations
Three-color flow cytometry was used to determine the preval-
ence of specific lymphocyte populations in the spleen as de-
scribed earlier [17]. Labeled cells were fixed in 0.5 % formalin in
PBS and acquired (20 000 events) using an EPICS XL-MCL flow
cytometer (Coulter Cytometry, Hialeah, FL) equipped with a 488
nm argon ion laser and Lysis II acquisition software. Analysis was
performed using WinMDI flow analysis package.
Analysis of mRNA expression
Splenocytes (2.5 ” 106/ml) were stimulated with 10 mg/ml PHA-P
or 1 mg/ml LPS for six hours following which total RNA was ex-
tracted using TRIzol (Invitrogen, Carlsbad, CA) according to
manufacturer's protocol. Reverse-transcriptase polymerase
chain reaction (RT-PCR) was used to analyze the expression of
mRNA for IL-2 and IL-4 in PHA±stimulated cultures and TNFa,
IL-1b, IL-6 and iNOS in LPS-stimulated cultures. The expression
of b-actin (internal control) was examined in both treatments.
The conditions for reverse transcription and PCR steps were per-
formed as previously reported [17] with the exception of primer
sets (see Table 1). Cycle number was optimized to achieve ampli-
fication within the linear range. Amplification products were
electrophoretically separated and documented using a Kodak
DC290 digital camera. The resulting images were digitized and
quantified using UN-SCAN-IT software (Silk Scientific, Inc.,
Johnson VJ et al. Physiological Responses of ¼ Planta Med 2003; 69: 44 ± 49
 Table 1 Primer sets and amplifications conditions*

Cytokine Primer Sequence Annealing Temperature (8C) Cycle Number

IL-2 sense 5¢ CTCGCATCCTGTGTCACATT 3¢ 54 35

antisense 5¢ ATCCTGGGGAGTTTCAGGTT 3¢
IL-4 sense 5¢ TCAACCCCCAGCTAGTTGTC 3¢ 54 35
antisense 5¢ GGAGCTCACTCTCTGTGGTG 3¢
TNFa sense 5¢ CTCTTCAAGGGACAAGGCTG 3¢ 56 31
antisense 5¢ CGGACTCCGCAAAGTCTAAG 3¢
IL-1b sense 5¢ GCAACTGTTCCTGAACTCA 3¢ 55 25
antisense 5¢ CTCGGAGCCTGTAGTGCAG 3¢
IL-6 sense 5¢ TTCCATCCAGTTGCCTTCTT 3¢ 54 33
antisense 5¢ CAGAATTGCCATTGCACAAC 3¢
iNOS sense 5¢ CACCTTGGAGTTCACCCAGT 3¢ 52 32
Original Paper

antisense 5¢ ACCACTCGTACTTGGGATGC 3¢
b-actin sense 5¢ ATGGATGACGATATCGCT 3¢ 56 25
antisense 5¢ ATGAGGTAGTCTGTCAGGT 3¢

* Thermal cycles consisted of denaturation at 94 8C for 15 seconds, annealing (see above) for 15 seconds and extension at 72 8C for 30 seconds followed by a final extension at 72 8C for 2 minutes.

Orem, UT) and the pixel values for each cytokine were normal-
ized to that of b-actin.
Statistical analysis
All statistical analyses were performed using the SAS statistical
software (SAS Institute, Cary, NC). Treatment effects were ana-
lyzed using one way analysis of variance (ANOVA) followed by
Fisher's PLSD. A value of P < 0.05 was considered significant un-
less indicated otherwise.
Results
46
Toxicity
No overt signs of clinical toxicity or behavioral alterations were
observed in mice treated for 5 consecutive days with silymarin.
Treatment with silymarin did result in a significant decrease in
food intake although no affect on body weight gain was evident
among the dose groups (data not shown). Consistent with the
lack of overt toxicity, silymarin treatment did not change relative
organ weights as shown in Table 2. A small, although significant,
increase in erythrocytes was seen in the highest treatment group
(Table 2). Peripheral blood leukocyte counts were not affected by
silymarin treatment.
Lymphocyte populations and functions
Splenic cellularity was not changed by silymarin treatment. Phe-
notypic analysis of lymphocyte populations revealed that sily-
marin caused a decrease in CD3+ T-lymphocytes in the spleen
(Fig. 1a). Interestingly, the decrease was only significant at
10 mg/kg of silymarin. T-lymphocyte populations were the
same as control in the higher dose groups. The CD45+ B-lympho-
cyte population remained unaffected by silymarin treatment
(Fig. 1b). Further separation of the T-lymphocyte pool indicated
that the decrease in the 10 mg/kg group was mainly in the CD4+
T-helper cell population as shown in Fig. 1c. There was a decrease
in the CD8+ T-suppressor/cytotoxic population (Fig. 1d) although
statistical significance was not achieved.
Lymphocyte proliferation also proved to be more sensitive to low
doses of silymarin than to high doses as shown in Table 3. Silymar-
in dose-dependently increased the basal rate of splenocyte proli-
feration although the changes were not significant. PHA-P-induced
T-lymphocyte proliferation was increased by 46 % in mice treated
with 10 mg/kg of silymarin. B-lymphocyte proliferation induced
by LPS was increased by 65 % and 35 % in mice treated with 10 and
50 mg/kg of silymarin, respectively. The proliferative response to
ConA was not changed although the increase in basal proliferation

Table 2 The effects of daily treatment with silymarin for 5 days on relative organ weights and blood cellularity in BALB/c mice

Relative organ weights (g/100 g BW)

Treatment Spleen Thymus Liver Kidney RBCb/mm3 (” 10 ± 6) WBCc/mm3 (” 10 ± 3)
(mg/kg/day)

Control 0.41  0.02a 0.23  0.03 5.62  0.22 1.57  0.04 5.31  0.59 4.54  1.09
10 0.40  0.03 0.26  0.05 5.54  0.11 1.58  0.03 6.55  0.68 5.21  1.50
50 0.38  0.02 0.26  0.04 5.22  0.09 1.58  0.04 5.57  0.45 4.45  0.90
250 0.47  0.03 0.22  0.02 5.24  0.18 1.56  0.02 7.72  0.72* 6.24  0.60

a
Mean  SEM (n = 5 for control; n = 6 for all other groups).
b
Red blood cells.
c
White blood cells (leucocytes).
* Significantly different from control group at P < 0.05 (Fisher's PLSD).

Johnson VJ et al. Physiological Responses of ¼ Planta Med 2003; 69: 44 ± 49

 Fig. 1 Altered splenic lymphocyte phenotype in male
BALB/c mice following short-term treatment with silymarin.
Mice were treated i. p. for 5 days with silymarin following
which flow cytometric analysis of CD3+ T-lymphocyte (a),
CD45+/B220 B-lymphocyte (b), CD4+ T-helper lymphocyte
(c) and CD8+ T-cytotoxic/suppressor lymphocyte (d) popula-
tions was performed. Data expressed as absolute number of
positive cells per spleen. Mean  SEM (n = 6). * indicates
significantly different from control group at P < 0.05.

Original Paper
Table 3 The effects of daily treatment with silymarin for 5 days on basal and mitogen induced lymphocyte blastogenesis in BALB/c mice

Con A PHA-P LPS

Treatment No Mitogen Net DPMb SIc Net DPM SI Net DPM SI
(mg/kg/day) DPMa (” 10 ± 3) (” 10 ± 3) (” 10 ± 3) (” 10 ± 3)

Control 1.6  0.2d 231.7  6.6 144.6  4.6 41.1  8.1 25.7  5.6 42.1  4.2 26.3  3.0
10 2.0  0.2 231.8  4.9 115.7  2.7# 59.9  6.3* 30.0  3.5 69.4  2.7** 34.8  1.5
50 2.0  0.4 235.0  6.2 120.5  3.5# 51.4  8.8 26.4  5.0 56.8  6.1* 29.1  3.4
250 2.8  0.8 222.5  3.8 80.7  1.5# 49.7  7.6 18.0  3.0 35.9  1.0 13.0  0.4# 47
a
DPM = disintegrations/minute.
b
Net DPM = DPM with mitogen - DPM without mitogen.
c
SI = Stimulation Index = DPM with mitogen ˜ DPM without mitogen.
d
Mean  SEM (n = 5)
Significantly different from control; * P < 0.05, ** P < 0.01, #P < 0.001 (Fisher's PLSD).

resulted in a decrease in the ConA induced stimulation index for
proliferation in the silymarin treated animals.
Cytokine gene expression was also sensitive to silymarin treat-
ment. PHA-induced expression of IL-2 and IL-4 was decreased
significantly in the 10 mg/kg group only (Fig. 2). In contrast,
the expression of LPS-induced pro-inflammatory cytokines
was increased by silymarin in a dose-dependent manner as
shown in Fig. 3. TNFa and IL-6 expressions were increased in
mice treated with 50 mg/kg of silymarin and TNFa, IL-6, IL-1b
and iNOS gene expressions were increased in the 250 mg/kg
group.
Discussion
Silymarin at the dose range and treatment duration used in the
present study did not produce any signs of overt clinical toxicity
in male BALB/c mice. Despite the drop in caloric intake, there
were no effects on body weight gain or relative organ weight in
the treated mice. The purpose of this study was to determine the
effects of silymarin on the immune system. Mice treated with a
low dose (10 mg/kg) displayed a decrease in the T-lymphocyte
population in the spleen and decreased functionality of these
cells. In contrast, mice treated with a high dose of silymarin
(250 mg/kg) showed an increased responsiveness to the inflam-
matory agent LPS.
Only low dose treatment with silymarin resulted in a decrease in
the T-lymphocyte population in the spleen, specifically that of
the CD4+ T-helper cell population. Lang et al. [7] showed a de-
creasing effect of this flavonoid on peripheral T-lymphocytes al-
though the target population was CD8+ T-lymphocytes. The CD8+
T-cytotoxic/suppressor population was not significantly de-
creased in this study. Analysis of T-lymphocyte gene expression
also showed suppression at low doses. The effect of silymarin on
IL-2 and IL-4 mRNA expression may be due to a decrease in T-
lymphocytes in the spleen or a decrease in responsiveness to
stimulation as reported by Meroni et al. [9]. Interestingly, sily-
marin treatment elevated the proliferative response of T-lym-

Johnson VJ et al. Physiological Responses of ¼ Planta Med 2003; 69: 44 ± 49


Original Paper
Fig. 2 Decreased PHA-induced expression of T-lymphocyte cytokines
IL-2 and IL-4 in splenocytes from silymarin treated BALB/c mice. Mice
were treated with silymarin i. p. for 5 consecutive days following which
splenocyte cultures were stimulated with PHA (10 mg/ml) and total
RNA was extracted and RT-PCR was used to determine relative changes
in the expression of IL-2 (a) and IL-4 (b). Mean  SEM (n = 6). Signifi-
cantly different from control group at * P < 0.05 and ** P < 0.01.
48
phocytes to PHA-P. This indicates that there may be a compensa-
tory response elicited to correct the silymarin-induced deficit in
T-lymphocyte numbers and/or function.
Johnson VJ et al. Physiological Responses of ¼ Planta Med 2003; 69: 44 ± 49
In contrast to the inhibitory effects of short-term low dose
treatment with silymarin, high doses promoted the inflamma-
tory response in BALB/c mice. Splenocytes from silymarin treat-
ed mice (250 mg/kg group) showed increased expression of
TNFa, IL-1b, IL-6 and iNOS in response to LPS activation. These
results are paradoxical in that they seem to contradict many of
the in vitro studies demonstrating a decrease in NFkB activation
[3], [14] and NFkB-mediated gene expression [12], [13] follow-
ing exposure to silymarin. The duration of treatment may be
responsible for the difference noted above. Silymarin is a pow-
erful antioxidant that in short-term (hours) in vitro experi-
ments will scavenge the reactive oxygen species produced by
inflammatory agents. Treatment with silymarin in vivo has
also been shown to have antioxidant effects mainly in the form
of restoration of cellular thiol status and bolstering of cellular
glutathione pools [18].
Of particular interest to the present research is the effect of si-
lymarin on the expression of superoxide dismutase (SOD). Lang
et al. [19] demonstrated that silymarin markedly induced SOD
expression and activity in lymphocytes and erythrocytes ex-
posed in vitro. SOD is an antioxidant enzyme that catalyzes the
dismutation of superoxide radical to H2O2, a potent activator of
NFkB [20]. Contrary to the antioxidant role of SOD, over-expres-
sion of Cu/Zn-SOD [20] and Mn-SOD [21] resulted in activation
of NFkB and gene expression. It is likely that in the absence of
changes in the H2O2 metabolizing enzymes, over-expression of
SOD leads to excess H2O2 and subsequent NFkB activation. No
evidence exists suggesting that silymarin influences the activ-
ity of catalase or glutathione peroxidase and thus the meta-
bolism of H2O2. Reactive oxygen species including superoxide
and H2O2 are integral to LPS-mediated signal transduction
[22]. It is possible that in our system increased SOD activity in
lymphocytes from silymarin treated mice would result in high-
er generation of H2O2 thus leading to more potent activation of
NFkB. This represents a plausible explanation for the observed
increase in inflammatory gene expression in response to LPS
Fig. 3 Silymarin treatment promotes LPS-induced expres-
sion of inflammatory genes in BABL/c mice. Mice were treat-
ed with silymarin i. p. for 5 consecutive days following which
splenocytes were treated with LPS (1 mg/ml) and total RNA
was extracted and RT-PCR was used to determine relative
changes in the expression of TNFa (a), IL-1b (b), iNOS (c)
and IL-6 (d). Mean  SEM (n = 6). Significantly different
from control group at * P < 0.05, ** P < 0.005 and *** P <
0.001.
stimulation. Further experimentation is needed to confirm this
hypothesis.
The purpose of the present study was to determine the physio-
logical impact of short-term treatment with silymarin on the im-
mune system. The results indicate that silymarin exerts differen-
tial effects depending on the dose administered. We observed an
inhibitory effect on T-lymphocytes at the lowest dose but this ef-
fect disappeared with increased dose. The average daily oral dose
for humans taking silymarin is between 500 and 1000 mg/day
(7 ± 15 mg/kg for 70 kg person). The observed decrease in T-cell
responses in mice exposed to low doses may be beneficial in di-
sease states characterized by T-cell mediated damage as in pri-
mary biliary cirrhosis [23]. At higher doses, our data indicate
that silymarin treatment may increase the ability of the immune
system to fight bacterial infections, thereby adding to the grow-
ing list of therapeutic application for this flavonoid mixture.
Acknowledgements
This study was supported in part by a grant from the National In-
stitutes of Health TW01009.
References
1
Hahn G, Lehmann HD, Kurten M, Uebel H, Vogel G. On the pharmaco-
logy and toxicology of silymarin, and antihepatotoxic active principle
from Silybum marianum. Arzneimittel-Forschung/Drug Research
1968; 18: 698 ± 704
2
Lahiri-Chatterjee M, Katiyar SK, Mohan RR, Agarwal R. A flavonoid an-
tioxidant, silymarin, affords exceptionally high protection against tu-
mor promotion in the SNECAR mouse skin tumorogenisis model. Can-
cer Research 1999; 59: 622 ± 32
3
Manna SK, Mukhopadhyay A, Van NT, Aggarwal BB. Silymarin sup-
presses TNF-induced activation of NK-kB, c-Jun N-terminal kinase,
and apoptosis. The Journal of Immunology 1999; 163: 6800 ± 9
4
Ferenci P, Dragosics B, Dittrich H, Frank H, Benda L, Lochs H, Meryn S,
Base W, Schneider B. Randomized controlled trial of silymarin treat-
ment in patients with cirrhosis of the liver. Journal of Hepatology
1989; 9: 105 ± 13
5
Greimel A, Koch H. Silymarin ± An inhibitor of horseradish peroxidase.
Experimentia 1977; 33: 1417 ± 8
6
Lang I, Deak G, Muzes G, Pronai L, Feher J. Effect of natural bioflavo-
noid antioxidant silymarin on superoxide dismutase (SOD) activity
and expression in vitro. Biotechnology therapeutics 1993; 4: 263 ± 70
7
Lang I, Deak GY, Nekam K, Muzes GY, Gonzalez-Cabello R, Gergely P,
Feher J. Hepatoprotective and immunomodulatory effects of antioxi-
dant therapy. Acta Medica Hungaria 1988; 45: 287 ± 95
8
Agoston M, Cabello RG, Blazovics A, Feher J, Vereckei A. The effect of
amiodarone and/or antioxidant treatment on splenocyte blast trans-
formation. Clinica Chimica Acta 2001; 303: 87 ± 94
9
Meroni PL, Barcellini W, Borghi MO, Vismara A, Ferraro G, Ciani D, Za-
nussi C. Silybin inhibition of human T-lymphocyte activation. Interna-
tional Journal of Tissue Reactions 1988; 10: 177 ± 81
10
Tager M, Dietzmann J, Thiel U, Hinrich Neumann K, Ansorge S. Re-
storation of the cellular thiol status of peritoneal macrophages from
CAPD patients by the flavonoids silibinin and silymarin. Free Radical
Research 2001; 34: 137 ± 51
11
Kang SN, Lee MH, Kim KM, Cho D, Kim TS. Induction of human pro-
myelocytic leukemia HL-60 cell differentiation into monocytes by sili-
binin: involvement of protein kinase C. Biochemical Pharmacology
2001; 61: 1487 ± 95
12
Zi X, Mukhtar H, Agarwal R. Novel cancer chemopreventive effects of a
flavonoid antioxidant silymarin: inhibition of mRNA expression of an
endogenous tumor promoter TNFa. Biochemical and Biophysical Re-
search Communications 1997; 239: 334 ± 9
13
Cho JY, Kim PS, Park J, Yoo ES, Baik KU, Kim Y, Park MH. Inhibition of
tumor necrosis factor-a production in lipopolysaccharide-stimulated
Original Paper
RAW264.7 cells from Amorpha fruticosa. Journal of Ethnopharmacolo-
gy 2000; 70: 127 ± 33
14
Saliou C, Rihn B, Cillard J, Okamoto T, Packer L. Selective inhibition of
NF-kB activation by the flavonoid hepatoprotector silymarin in
HepG2: Evidence for different activating pathways. FEBS Letters
1998; 440: 8 ± 12
15
Letteron P, Labbe G, Degott C, Berson A, Fromenty B, Delaforge M, Lar-
rey D, Pessayre D. Mechanism for the protective effects of silymarin
against carbon tetrachloride-induced lipid peroxidation and hepato-
toxicity in mice. Evidence that silymarin acts both as an inhibitor of
metabolic activation and as a chain-breaking antioxidant. Biochemi-
cal Pharmacology 1990; 39: 2027 ± 34
16
He Q, Osuchowski MF, Johnson VJ, Sharma RP. Physiological responses
of a natural antioxidant flavonoid, silymarin, in BALB/c mice: I. Induc-
tion of transforming growth factor b1 and c-myc in liver with marginal
effects on other genes. Planta Medica2002; 68: 676 ± 9
17
Johnson VJ, Sharma RP. Gender-dependent immunosuppression fol-
lowing subacute exposure to fumonisin B1. International Immuno-
pharmacology 2001; 1: 2023 ± 34
18
Valenzuela A, Aspillaga M, Vial S, Guerra R. Selectivity of silymarin on
the increase of the glutathione content in different tissues of the rat.
Planta Medica 1989; 55: 420 ± 2
19
Lang I, Deak G, Muzes G, Pronai L, Feher J. Effect of the natural biofla-
vonoid antioxidant silymarin on superoxide dismutase (SOD) activity
49
and expression in vitro. Biotechnology Therapeutics 1993; 4: 263 ± 70
20
Schmidt KN, Amstad P, Cerutti P, Baeuerle PA. The roles of hydrogen
peroxide and superoxide as messengers in the activation of transcrip-
tion factor NF-kappa B. Chemistry and Biology 1995; 2: 13 ± 22
21
Li JJ, Oberley LW, Fan M, Colburn NH. Inhibition of AP-1 and NF-kB by
manganese-containing superoxide dismutase in human breast cancer
cells. FASEB Journal 1998; 12: 1713 ± 23
22
Han YJ, Kwon YG, Chung HT, Lee SK, Simmons RL, Billiar TR, Kim YM.
Antioxidant enzymes suppress nitric oxide production through the in-
hibition of NF-kappaB activation: Role of H2O2 and nitric oxide in in-
ducible nitric oxide synthase expression in macrophages. Nitric Oxide
2001; 5: 504 ± 13
23
Kita H, Lian ZX, Van de Water J, He XS, Matsumura S, Kaplan M, Luketic
V, Coppel RL, Ansari AA, Gershwin ME. Identification of HLA-A2-re-
stricted CD8(+) cytotoxic T cell responses in primary biliary cirrhosis:
T cell activation is augmented by immune complexes cross-presented
by dendritic cells. Journal of Experimental Medicine 2002; 195: 113 ±
23
Johnson VJ et al. Physiological Responses of ¼ Planta Med 2003; 69: 44 ± 49