UC Davis iGEM Project Design Notebook

Cenozoic: iGEM at UC Davis, 2018 Project Design Notebook 1
Project Design Notebook

Cenozoic: 2018 iGEM at
University of California, Davis
http://2018.igem.org/Team:UC_Davis

This notebook contains our thought and research as well as work space, as we designed our
project. Within, we grapple with aspects of human practices, molecular biology,
environmental toxicology, and the logistics of planning our experiments.
Team Cenozoic

Contents

1. On perspectives in synthetic biology Daniel 4.20.18
2. On biosensors Daniel 4.23.18
3. On safety, security, and chimeras Daniel 4.24.18
4. On Superfund sites Daniel 4.25.18
5. On haloalkanes, environmental toxicology, and bioremediation Daniel 4.26.18
6. On a home for synthetic biology Daniel 4.27.18
7. On requirements for a host strain Daniel 4.30.18
8. Excerpts from Opentrons application Team, Mentors 5.1.18
9. Overview of project as currently envisioned Daniel 5.4.18
10. EPA emails Daniel, Jacob, Achala 5.14.18
11. Project overview in more detail Daniel 5.15.18
12. Findings from team meeting Team 5.29.18
13. Notes for the Klamath trip Team 5.29.18
14. A complete cyclic narrative: learnings from Klamath Team 6.25.18
15. Overview of project as currently envisioned Team 6.26.18
16. Cenozoic: the age of mammals Team 6.27.18
17. Safety Sheet Team 6.28.18
18. Experimental Design Team 6.29.18
19. Notes from work day: Target Genes Team 7.2.18
20. Notes from work day Team 7.3.18
21. Notes from work day Team 7.5.18
22. Protocol Rough Draft Team 7.9.18
23. Protocol Development Team 7.10.18
24. DNA Design Team 7.11.18
25. How to get a FASTA from UCSC genome browser Team 7.17.18
26. PrimerMaking and Stuff! Jacob 7.17.18
27. Work Space for Project Development Team July
28. Media Formulation Team July
29. More Work Space Team August
30. Chemicals of Concern Team August
31. Work Space Team August
32. Cloning Progress Daniel September
33. Design Content for Wiki Daniel September
34. Interlab Study Content for Wiki Daniel September


1. On perspectives in synthetic biology (Daniel 4.20.18)

iGEM human practices usually are concerned with a few broad categories, and groups usually
consider multiple, but rarely all, categories: economics and entrepreneurship, clinical
applications, politics and public policy, the environment, resource allocation and resource
security, ethics and philosophy, safety and security (safety refers to preventing harm which may
arise by accident, while security refers to preventing harm which may arise by intention).

This project is a bit unusual, compared to the majority of iGEM projects in a few regards, most
obviously because it is in the “fundamental advances” track, making it a bit closer to a “science
project” than an “engineering project”; of course in this case, we’re doing “science for the sake
of engineering,” that is, we still have a purpose based in the principles of engineering (find a
need, try to make something to fill that need). So this project is unusual in that the “product”
isn’t really a physical device, but rather we are producing a body of knowledge. But knowledge
can have a very large impact on society (e.g. Copernicus and the heliocentric theory, or Darwin
and “descent with modification”), so we still need to really think about what types of knowledge
we are searching for, what we might find, and if there might be “unintended consequences.”

There has been a historical problem of perspective in biotechnology because it is a specialized
field requiring specialized education, and because laypeople encounter living things every day,
there is a “differential” so to speak, or perhaps “diffraction” is the better word, with two parties
both very much invested in the topic at hand, but two mutually unrecognizable views. At the core
of this is a difference in the way biotechnologists and laypeople view living systems. In the
book, “ Synthetic Biology; the technoscience and its societal implications ,” edited by Markus
Schmidt, Alexander Kelle, Agomoni GanguliMitra, and Huib de Vriend, the biotechnologists’
view is summarized as the following:

“. . .The core of the Loebian standpoint was the belief that biology could be formulated, not as a
natural science, but as an engineering science. More broadly, it means that nature was fading
away. As biologists’ power over organisms increased, their experience with them as ‘natural’
objects declined. And as the extent of possible manipulation and construction expanded, the
original organization and normal processes of organisms no longer seemed scientifically
privileged; nature was merely one state among an indefinite number of possibilities, and a state
that could be scientifically boring. (Pauly 1987)”

An analogy which I favor, regarding the two views, what might be called the “synthetic view”
and the “naturalism view,” is to consider the game of Monopoly. The naturalism view would say
that the game consists of a certain set of players, with a certain set of pieces at certain locations
on the board at a certain time. The synthetic view would say that the game consists of the rules
by which the game is played that players may come and go, and that pieces may be exchanged
and they may change in location over time. To explain the analogy a bit further, there is nothing
particularly privileged about our current place on the board with the current players and pieces,
when compared to other points in time.

According to the synthetic view, while there may be plenty of pragmatic and aesthetic reasons to
be attached to, and defend, nature, there is nothing about it which would make it immoral to alter
the present state, a priori , because there is not really such a thing as “the present state” nature is
constantly in flux, species evolving and going extinct, environmental conditions changing, DNA
being mutated, recombining, moving around between cells, and natural selection sorting out the
useful and useless mutations.

My personal take on the synthetic view may in part be elucidated by my study of astrobiology.
Astrobiologists have to face the tricky question of defining what is life and what is nonlife. This
is hard. Consider a virus most of us would agree that it is “biotic” or belonging in some sense
to the set of things which arise from living things and are made of the same sort of stuff and
reproduce similarly to how all other living things reproduce. But a virus doesn’t do all of the
things included in the definition of life commonly taught in introductory college biology
courses it doesn’t metabolize and can’t reproduce itself outside of a host cell. Consider a
second case, of fire. Fire, like viruses, hits most of the criterion of living things, but unlike
viruses, almost all of us would agree that it is “abiotic” it isn’t made of the same sort of stuff as
living things, it doesn’t use information, it can’t change over time in any substantive way except
for growing larger or smaller and hotter or cooler.

One of the currently popular definitions of life in astrobiology, and one favored by NASA, is that
“life is any chemical system capable of Darwinian evolution.” Personally, I like this definition
because of how elegantly simple it is. There are factions of astrobiologists and xenobiologists
who would criticise the explicit limitation of life as a quality of only chemical systems they
would argue that this is nothing more than a failure of imagination, and that there exist a great
many other possible systems capable of Darwinian evolution apart from chemical, and
especially, the watersolventcarbonbasedredoxchemistry terran biology we are familiar with.

This amended definition, that “life is any system capable of darwinian evolution,” could be
applied with a bit of imagination to certain computer programs1, and with a bit more imagination,
this definition of life could include solar systems or galaxies or the universe itself.

But to return to the original intent, the synthetic view, that life is something constantly in
movement, is rather different from the naturalism view, that life is something standing still and
perfectly balanced. I think our sense of time is in part responsible for this we (lay people) don’t
see life changing on the scale of 80 years, not in any sort of meaningful way. Because the
frequency of beneficial mutations (those which help living things adapt to the current
environment) is so low, when we do encounter mutations and other changes in living systems,
they are something threatening *the way things are* in an unambiguously negative sense. A
plurality, or perhaps majority, of us, will encounter, or have already encountered, cancer, either
personally, or in a close relation or friend. So this has the effect of reinforcing the belief that the
only changes possible from *the way things are* are dangerous, a threat to a natural order
perfectly balanced, and to be avoided at all costs.

I want to make a small note here we are operating at a very different time scale, compared to
the time scale of living systems (biospheres, ecosystems, species, genes, etc), and this can give a
false impression of the true *way things are*. Consider a film of a man stacking rocks, and a
point in which the stack of rocks is knocked unbalanced, and falls. (if you have trouble in the
abstract, consider this film specifically ). If you slow down the film enough, it appears that the
rocks are perfectly balanced, even if they are in fact in the process of falling. If you slow down
your perspective enough, and go frame by frame, almost no movement is perceptible. I think this
is a good analogy for our perception of the living world (biospheres, ecosystems, species, genes,
etc) day by day, it appears perfectly balanced, but if you step back, you’ll see that it is always
in motion.

2. On Biosensors (Daniel 4.23.18)

1
this idea of digital life is in the academic literature called “artificial life” not to be confused
with “synthetic biology” which is primarily about fooling around with terranbiochemistry, or
“xenobiology” which is probably the hardest to define to a first approximation, xenobiology is
the search of *really far out stuff* alternatives to terranbiochemistry, “shadow biospheres,”
and similar topics. Astrobiology is relatively simple looking for life on planets besides earth.
“Synthetic Astrobiology,” a hybrid field, is about using terranbiochemistry to make living things
tough enough to live on places besides earth. David Toomey’s book, “Weird Life: the search for
life that is very, very different from our own” has a good treatment of these strange subfields of
biology.
One thing which we need to do is make the connection between studying the synthetic biology of
gene regulation in mammalian (CHO) cells and bioremediation. This connection needs to be
made explicitly for the reason of securing funding from a source affiliated with the cause of
bioremediation. Okay, how do we do that?

To start with, we can discuss sensors. Biological sensors are analogous to any other sort of
sensor, in that there is a certain signal to noise ratio. If a sensor has a false positive once in a
million, and a false negative once in a million, and it is sensing things in the per hundredth
concentration, that is a fairly small amount of noise, relative to the signal. But if the outcome of
the sensor is important, say in defense systems or aerospace, that level of noise may be
inacceptable. That is one reason why radiation hardened electronics are used in sensitive
applications, as radiation can “flip a bit” in the working memory and yield a false result (or
worse, alter a value in the program or operating system, similar to biological cancer). But this
means that a sensor with a false positive once in a million, and a false negative once in a million,
when you are sensing events in the per billionths concentration or lower, it has a signal to noise
level which is ridiculous, and is incapable of generating any meaningful data.

To have any practical value, a biosensor needs to meet a few criterion; it needs to be able to do a
job which ordinary chemical or electrical sensors cannot do, or it needs to do it better. Most
molecules can probably be detected without much difficulty, just using chemistry test reactions,
NMR, IR, mass spec.; it only makes sense to use biology where chemistry runs short, or where a
complex chemical problem can be substituted by a simple biology problem . To first
approximations, this means mostly the identification of large chiral biomolecules (polypeptides,
etc) using other large chiral biomolecules.

Other things to consider where can you run this test? In the field? In a medical clinic? In an
ordinary lab? In a biosafety cabinet? In a BSL3 lab? How expensive is it per test? Biology is all
about self replicating parts if you can get a test that is self replicating, theoretically, the cost per
test approaches zero, thanks to exponential growth. But that isn’t what we see in biotechnology
the cost does not approach zero; it doesn’t make it all the way down to free. Reagents and
feedstocks are not free, since we don’t use primary producers in the majority of biotechnology
(one notable exception is the use of transgenic algae and cyanobacteria to produce biofuels or
other products), and contamination, fixed operating costs, and perdose profit margins help keep
this from approaching zero. Another thing to consider is the number of times which the product
is to be used. A single productuse genetic operation, like gene therapy, will necessarily always
be more expensive than a genetic operation which yields many thousands or millions of
productuses, such as development of a strain of GM corn. An additional concern regarding
mammalian hosts for biosensors is their relative expense and fragility, compared to E. coli and
yeast.

One area in which I see significant potential is not in *extracellular biosensors* but *intracellular
biosensors* instead of sensing conditions external to a cell, sense conditions internal to a cell
which arise due to conditions external to the cell. This would allow for greater understanding of
the effect of environmental conditions including toxins on biochemical pathways. This really
only has a use as a scientific tool for research, but could be useful in characterizing drug
metabolism and other activities of biomedical relevance. To be useful, such a system would need
a very low noise to signal ratio, and would be dynamic enough to be applied to many different
biochemical pathways and stimuli. A difficulty of this is that the sensor apparatus may impose a
significant metabolic burden on the cell, thus changing its behavior compared to wild type cells.

3. On safety, security, and chimeras (Daniel 4.24.18)

Safety and security, when working with CHO cells, are not very major concerns. CHO cells are
nonpathogenic, and unlikely to survive outside of carefully controlled laboratory settings.
Ordinarily, hamster cells only live inside of hamsters, a feature of evolutionary biology which
makes it unlikely for free living hamster cells to overrun the natural environment and
outcompete indigenous species. There is a possibility that CHO cells might attract pathogens
which may go on to infect other mammals (such as humans), and reasonable safety measures
need to be taken to prevent any accidental contamination (proper PPE, sterilize and properly
wash labware, only work within a controlled lab environment, work inside a biosafety cabinet).
Proper care should be taken when handling samples, recombinant DNA, and sensitive reagents,
guidelines for which are provided by the university’s environmental health and safety department
2
.

Biosecurity is not a major topic of concern for a project researching gene regulation and creation
of genetic circuits in engineered mammalian hosts. The potential for misuse by bad actors in this
space is relatively small. However, as this project represents an attempt to lower the barriers to
entry in biotechnology, by making it easier to consistently and predictably express (trans)genes
in mammalian hosts, it is part of a larger trend which does have biosecurity risks. If, by result of
this project, it becomes easier for individuals, including bad agents, to engineer mammalian
cells, it is a real risk that this may be used for deleterious ends, and this potential downside must
be weighed when determining when following a course of research would be responsible or
irresponsible.

Another aspect to consider is that with the shift in focus of synthetic biology from bacteria, algae
and unicellular yeasts, to mammals, we are decreasing the phylogenetic distance from Homo
2
UC Davis Biological Safety Guidelines available here .
sapiens . Mammals also have more rights in our culture, compared to plants, invertebrates, and
microbes. Many countries in the western world have animal abuse laws protecting mammals
from cruel and unusual treatment. Animal testing is regulated by the government3; one such set
of requirements include the following:

“Each animal protocol must include:
—A justification for using animals, the number of animals to be used, and the species
chosen
—The procedures or drugs to be used to eliminate or minimize pain and discomfort
—A description of the methods and sources used to search for alternative to painful
procedures
—A description of the search used to ensure that the experiment does not unnecessarily
duplicate previous research”

In western culture, rights are usually assigned to things with brains; a collection of cells in a petri
dish is presumed to be incapable of suffering, so our use of CHO cells is not held to the same
standards as use of whole hamsters.
In addition, many attach a special value to human cells and human DNA, with much public
outcry regarding the creation of humananimal chimeras4. A major bioethical concern when
contemplating humananimal chimeras is the problem of assigning moral worth to these
chimeras. One definition of moral worth is the following:
“ Moral worth can be defined as a particular way in which an action or an agent are valuable, or
deserve credit (or deserve discredit). A central thought about moral worth is that it involves the
agent's motives for acting: intuitively, an action is morally worthy when and to the extent that it
is performed for the right moral reasons. ”5
An indepth treatment of the morality of humananimal chimeras is available in the Stanford
Encyclopedia of Philosophy, from which the following is excerpted:
3
https://www.ncbi.nlm.nih.gov/books/NBK24650/
4
http://www.bbc.com/earth/story/20170104thebirthofthehumananimalchimeras
5
https://philpapers.org/browse/moralworth
“ A chimera is an individual composed of cells with different embryonic origins. The successful
isolation of five human embryonic stem cell (hESC) lines in 1998 increased scientists' ability to
create human/nonhuman chimeras and prompted extensive bioethics discussion, resulting in
what has been dubbed “the other stem cell debate” (Shreeve 2005). The debate about chimeras
has focused on five main arguments. The Unnaturalness Argument explores the ethics of
violating natural species boundaries. The Moral Confusion Argument alleges that the existence
of entities that cannot be definitively classified as either human or nonhuman will cause moral
confusion that will undermine valuable social and cultural practices. The
BorderlinePersonhood Argument focuses on great apes and concludes that their
borderlinepersonhood confers a high enough degree of moral status to make most, if not all,
chimeric research on them impermissible. The Human Dignity Argument claims that it is an
affront to human dignity to give an individual “trapped” in the body of a nonhuman animal the
capacities associated with human dignity. Finally, the Moral Status Framework maintains that
research in which a nonhuman animal's moral status is enhanced to that of a normal adult
human is impermissible unless reasonable assurances are in place that its new moral status will
be respected, which is unlikely given the motivations for chimeric research and the oversight
likely to be provided. These arguments provide different rationales for evaluating chimeric
research and consequently differ in their implications both for the range of chimeric research
that is unethical as well as the way chimeric research should be addressed in public policy. ”6
4. On Superfund sites (Daniel 4.25.18)
From the EPA website, here is an overview of Superfund sites:
“Thousands of contaminated sites exist nationally due to hazardous waste being dumped, left out
in the open, or otherwise improperly managed. These sites include manufacturing facilities,
processing plants, landfills and mining sites.
In the late 1970s, toxic waste dumps such as Love Canal and Valley of the Drums received
national attention when the public learned about the risks to human health and the environment
posed by contaminated sites.
In response, Congress established the Comprehensive Environmental Response, Compensation
and Liability Act (CERCLA) in 1980.
CERCLA is informally called Superfund. It allows EPA to clean up contaminated sites. It also
forces the parties responsible for the contamination to either perform cleanups or reimburse the
government for EPAled cleanup work.
6
https://plato.stanford.edu/entries/chimeras/
When there is no viable responsible party, Superfund gives EPA the funds and authority to clean
up contaminated sites.
Superfund’s goals are to:
● Protect human health and the environment by cleaning up polluted sites;
● Make responsible parties pay for cleanup work;
● Involve communities in the Superfund process; and
● Return Superfund sites to productive use.”7
According to the EPA, the most common pollutants at Superfund sites are lead, asbestos, dioxin
(a potent family of carcinogens related to haloalkanes), and radiation8. We *probably* can’t get
permission to work with radioactivity9.
According to the Davis Wiki, there are three Superfund sites in Davis: a transmitter base
associated with McClellan Air Force Base, Frontier Fertilizer site, and Pilau Drum site10.
7
https://www.epa.gov/superfund/whatsuperfund
8
https://www.epa.gov/superfund/contaminantssuperfundsites
9
Which is a shame because it means we don’t get to read rad articles like “Bioremediation of Radioactive
Waste”
10
https://localwiki.org/davis/EPA_Superfund_Sites

Links aggregated by Dr. F:
https://cumulis.epa.gov/supercpad/cursites/csitinfo.cfm?id=0904786
https://cumulis.epa.gov/supercpad/SiteProfiles/index.cfm?fuseaction=second.Cleanup&id=09015
54#bkground

The Frontier Fertilizer Superfund site is the most notable of these three. It is in east Davis, near
the Target. The Davis Wiki has this to say about it:
“Located on 2nd Street (aka County Road 32a) between Cantrill Drive and Mace, it is a large
fencedoff area which is designated by a extremely faded sign that warns trespassers of danger
and to keep out. A public health assessment was last filed in 1995 for this site. ( EPA Database ).
The EPA website contains a narrative describing this site and possibly other information. In a
general way, the site has both soil and groundwater contamination due to the production of
fertilizers for agriculture. The fence is to keep people away from the surface soil contamination,
and there is a groundwater treatment system that is trying to clean up the groundwater. As no
one is currently being poisoned from the site, the EPA is not heavily invested in doing treatment
any faster (they have other places to spend resources where people are getting sick, or at least
the potential is much higher).”

Detailed information on the Frontier Fertilizer site is available here .

“The chemicals of concern (COCs) identified in the 1999 Risk Assessment at the Site are the
pesticides 1,2dibromoethane (EDB), 1,2dibromo3chloropropane (DBCP),
1,2dichloropropane (DCP), and 1,2,3trichloropropane (TCP), which were used as soil
fumigants. Carbon tetrachloride (CCl4) also was used as a grain fumigant, and the source
appears to be separate from the pesticides.”

Chemicals of Concern at the Davis Frontier Fertilizer Superfund Site

Name Formula Concerns More Data
1,2dibromoethane (EDB) BrCH 2 CH 2 Br Acute toxicity, suspected reproductive WolframAlpha

toxin, suspected carcinogen, groundwater Wikipedia
contaminant Toxicity
1,2dibromo3chloropropane C 3 H 5 Br 2 Cl Acute toxicity, carcinogen, “PAN Bad WolframAlpha

(DBCP) Actor”, reproductive toxin, groundwater Wikipedia
contaminant, endocrine disruptor Toxicity
1,2dichloropropane (DCP) CH 3 CHClCH 2 Cl carcinogen, toxic, classified as “IDLH” WolframAlpha

(Immediately Dangerous to Life or Wikipedia
Health)
1,2,3trichloropropane (TCP) CH 2 ClCHClCH 2 Cl Irritant, carcinogen WolframAlpha

Wikipedia
Carbon tetrachloride CCl 4 Toxic, ozone depleting, greenhouse gas, WolframAlpha

suspected carcinogen Wikipedia

Contact info for Davis Frontier Fertilizer Superfund Site

Community Involvement Jackie Lane lane.jackie@epa.gov (415)9723236
Coordinator
Remedial Project Manager Bianca Handley handley.bianca@epa.gov (415)9723023
DTSC11 project manager Juan Peng Juan.Peng@dtsc.ca.gov (916)2553802
Community Advisory Pam Nieberg pnieberg@dcn.org (530)7566856

Oversight Group President

Based off the Davis Frontier Fertilizer Superfund Site, it looks like there is a lot of work which
could be done with the haloalkane family of environmental toxins. This family includes
herbicides and pesticides like DDT.

5. On haloalkanes, environmental toxicology, and bioremediation (Daniel 4.26.18)

Haloalkanes are commonly used in the chemical, agricultural, and pharmaceutical industries, and
have significant environmental impacts and risks to human health. The Montreal Protocol on
Substances that Deplete the Ozone Layer (1987)12 is a global agreement created with the purpose
of phasing out and ending use of ozone depleting chemicals such as chlorofluorocarbons (CFCs).
The Montreal Protocol is widely regarded as successful, and was the first treaty to be ratified by
every country in the world. Some haloalkanes are naturally occuring, and are mainly produced
by bacteria, algae, and fungi. There exists a family of bacterial enzymes known as
dehalogenases, which remove halogens from organic molecules13.

The family of enzymes, haloalkane dehalogenase, have been suggested as a possible tool in
bioremediation of haloalkanes in the environment. The following is taken from Wikipedia:

11
DTSC is a state agency http://www.dtsc.ca.gov/
12
https://www.state.gov/e/oes/eqt/chemicalpollution/83007.htm
13
Wikipedia Dehalogenase
“A number of halogenated compounds are environmentally toxic industrial byproducts, and it
has been suggested that haloalkane dehalogenases may be useful catalysts for their
biodegradation, with potential applications in bioremediation.”14

The following selection considering bioremediation through genetic engineering is also taken
from Wikipedia:

“There are concerns surrounding release and containment of genetically modified organisms
into the environment due to the potential of horizontal gene transfer. Genetically modified
organisms are classified and controlled under the Toxic Substances Control Act of 1976 under
United States Environmental Protection Agency. Measures have been created to address these
concerns. Organisms can be modified such that they can only survive and grow under specific
sets of environmental conditions. Outside of environmental conditions they were designed for,
they lose their biodegradation ability or undergo self destruction. To survive, a signal (the
pollutant) is required. In the absence of the signal, a suicide gene is expressed which will lead to
cell apoptosis. In addition, the tracking of modified organisms can be made easier with the
insertion of bioluminescence genes for visual identification.”15

If this were a standard iGEM project, I would say that this suggests an obvious path forward;
build a genetic circuit into E. coli that senses haloalkanes, and another which synthesizes a
dehalogenase enzyme. More work could be done to see if the dehalogenase can be secreted and
if there are any special conditions that the enzyme needs to work properly. Additionally, it needs
to be shown that the end products are safe (to humans and environment), and that standard steps
are taken to control the engineered bacterium (ie nutrient dependency, genetic kill switches, self
destruct genetic circuits etc). In fact, this is such an obvious iGEM project that before even
checking, I was fairly certain it had been done, and would have been surprised to learn
otherwise. A four second search later, and my intuition was confirmed a similar project was
done by a team in China in 2017, and there are parts in the registry for dehalogenase enzymes16.

But even if nobody had thought of doing an iGEM project in this space before, this is not a
standard iGEM project, and it would be a terrible idea to try and substitute CHO cells for E. coli
with disregard to the actual characteristics of the hosts.

6. On a home for synthetic biology (Daniel 4.27.18)

14
Wikipedia Haloalkane Dehalogenase
15
Wikipedia Bioremediation
16
http://2017.igem.org/Team:UESTCChina/part
What work needs to be done, in order to produce a new viable host strain for use in synthetic
biology? There seem to be two approaches to this question, based off two different views of the
future of synthetic biology two different answers to the question, “where will heavily
genetically engineered organisms live?” One answer is “in labs and other carefully controlled
environments,” while the other answer is “everywhere.” This question of the appropriate home
for engineered life is a complicated, messy one, which will not be resolved today, and probably
won’t be for many decades to come.

The problem, in some sense, can be traced all the way back to 1818 in Mary Shelley’s
“ Frankenstein ,” unlike the caricature which popular culture has delivered to us, the monster is
intelligent and rather charismatic. Throughout the course of a few months, the monster reads
Plutarch’s “ Lives, ” Goethe’s “ The Sorrows of Young Werther ,” and Milton’s “ Paradise Lost ,”
making him substantially better read than most modern undergraduates. The main conflict of the
story arises, not through the inherent monstrousness of the monster, as in later film adaptations,
but because Dr. Frankenstein has not prepared a home for the monster, and abandons him,
leaving the monster to face an intolerant world. It is in the face of the cruelty shown to the
monster that his essentially good nature (analogous to Rousseau’s Noble Savage ), is corrupted.

Comparisons between biotechnology and Frankenstein are often made by those who have not
read Frankenstein17, and are operating off an image of Bela Lugosi lurching about in a graveyard.
That said, there is a good analogy to be made between Shelley’s Dr. Frankenstein and modern
synthetic biologists: we need to prepare a place for our creatures.

By keeping synthetic biology in the lab, it can be closely monitored and kept under control, but
the downside is that the potential benefits are severely limited; whole exciting and useful fields
of science and engineering are left unexplored augmented bioremediation, reintroduction of
deextinct species, ecosystem engineering, radical advances in agriculture, mosquito extinction,
geoengineering, creation of a “biological information cloud,” and other fun ideas. Of course,
given the reaction against humble Bt corn, it seems unrealistic to imagine the public and
policymakers allowing us to engineer high altitude bacteria with the purpose of reversing climate
change by increasing the albedo of the earth.

The idea of *synthetic biology everywhere,* similar to the idea of ubiquitous computing18,
proposes a radically new *way things are*. Perhaps one day we will wear clothing which is
made out of living colonies of engineered lichen. Perhaps one day we will use the DNA of
atmospheric bacteria to backup our photos and documents in a sort of massively parallel
17
In contrast to many kneejerk diatribes against “frankenfoods” this article is quite thoughtful.
18
Wikipedia Ubiquitous Computing
sneakernet with a capacity of a thousand yottabytes19. Perhaps one day we will make Michael
Creighton’s dreams true if not with dinosaurs, at least woolly mammoths20. Perhaps one day
cosmetic gene therapy will be offered like plastic surgery is today. But that day is not today. The
science isn’t ready, the public isn’t ready, and the policymakers aren’t ready.

An alternative to the “keep it in a lab” versus “set it free” paradigm is “send it to Mars.” By
keeping synthetic biology in labs and other controlled settings on Earth, some excitement is
sacrificed for responsibility here at home, but the rest of the solar system can be used as a
playground for some of the more outlandish synthetic biology projects21. Current best estimates
for the first man on Mars are circa 2024203022, giving synthetic astrobiology only a few years
left as a theoretical field, before it becomes an experimental field23. There is clearly a great deal
of work to be done before the science can produce a Mars viable cell, but it promises to be
another “Mount Everest” of biology, much like the Human Genome Project or the Woolly
Mammoth Deextinction Project.

Returning now once more to the question “Where will our new host strain live?” It seems
reasonable to say, for the time being, that it will live in the lab and other carefully controlled
environments. With the habitat thus determined, we can return to the larger question, “What
work needs to be done, in order to produce a new viable host strain for use in synthetic biology?”

7. On requirements for a host strain (Daniel 4.30.17)

Now that it seems clear our host strain will be living in a lab or similar carefully controlled
environment, what do we require it to be able to do?

Requirements for a Host Strain

1. Easily grown in a lab
19
Current estimates for the total amount of data produced and stored by humanity put it at roughly 3000
zettabytes. You can store roughly one zettabyte per gram of DNA; the DNA in a human adult encodes
about 150 zettabytes; https://twistbioscience.com/company/blog/twistbiosiencednastoragefountain
20
If you are unfamiliar with the mammoth project, I recommend this article . I also highly recommend Beth
Shapiro’s book, “ How to Clone a Mammoth ”
21
For an enjoyable, “hard science fiction,” look at what that might be like, I recommend Kim Stanley
Robinson’s “Red Mars/Green Mars/Blue Mars” trilogy. KSR gave a talk to the UC Davis Synthetic Biology
Club in 2017 on the relationship between science and science fiction.
22
http://www.spacex.com/mars , https://www.nasa.gov/content/journeytomarsoverview
23
Some good work in the field of Synthetic Astrobiology was done by Dr. John Cumbers, formerly of
NASA, who, incidentally, also gave a talk to the UC Davis Synthetic Biology Club in 2017.
a. Requires only standard, inexpensive feedstocks24
b. Fast doubling time
2. Nonhazardous to people and the environment
a. Nonpathogenic
b. Unlikely to become an invasive species if introduced to the local environment
c. Unlikely to undergo horizontal gene transfer with other organisms in the local
environment
d. Can be rendered nonviable outside of the lab (e.g. nutrient dependency, genetic
kill switches, sterility)
3. Easily genetically modified
a. An effective means exists to insert DNA to the cell (e.g. heat shock
transformation, viral vectors, electroporation, agrobacterium)
b. An effective means exists to stabilize the DNA in the cell (e.g. chromosome
integration, persistent plasmid)
c. Mutants can be effectively screened and selected
4. Transgene expression can be controlled
a. Complex genetic circuits can be built that work reliably
b. Expression levels of various genes can be controlled independently
c. Products can be effectively isolated from culture

E. coli CHO
Easily grown in a lab Commonly used for microbiology, Commonly used in pharmaceutical

synthetic biology, biotechnology, biotechnology; a major problem is
genetics research; very well studied contamination
model organism
Requires only standard, agar, tryptone, NaCl, yeast extract, specialized media available25 (approx.

inexpensive feedstocks sometimes common antibiotics $100+ per liter)
Doubling time 1520 minutes 20 hours
Nonhazardous to people E. coli is a naturally occuring bacteria CHO cells are derived from the ovaries

and the environment found in the human gut; some strains are of chinese hamsters; they are unlikely to
beneficial to the microbiome, while survive outside of laboratory conditions
24
The gold star of this would be to use a primary producer like photosynthetic cyanobacteria or algae,
requiring only water, air, light, and small amounts of nitrogen and phosphorus. Paper giving overview of
work in synbio with cyanobacteria

25
Available from Thermo Fisher here
others cause serious illness.
Nonpathogenic Some strains of E. coli are pathogenic, CHO cells are not pathogenic of their

but the most commonly used strains, like own accord, but they may attract other
DH5α, are nonpathogenic. pathogens, for which reason they are
used inside of biosafety cabinets.
Unlikely to become an E. coli are already commonly found in Unlikely to survive outside of laboratory

invasive species if the environment. conditions.
introduced to the local
environment
Unlikely to undergo Because of the above, this is a real Unlikely to survive outside of laboratory

horizontal gene transfer concern. E. coli is known to share genes conditions, and horizontal gene transfer
with other organisms in mainly through viral mediated is presumed to be slower between
mechanisms (transduction); this is a mammals (hamsterhuman for example)
the local environment
concern when labgrown strains of E. than bacteriabacteria gene transfer. Not
coli are given antibiotic resistance, a major concern.
because this can lead to the microbiome
of lab workers gaining antibiotic
resistance and spreading the resistance
genes26
Can be rendered Commonly used techniques are nutrient Unlikely to survive outside of laboratory

nonviable outside of the dependency, but a variety of different conditions.
lab methods have been developed, including
“suicide genes”
Easily genetically Heat shock transformation with plasmids
modified and competent E. coli is regularly done
by high schoolers and undergraduates.
An effective means exists Common methods are heat shock
to insert DNA to the cell transformation, electroporation
An effective means exists Typically, plasmids are used with Probably use CRISPR to try and do

to stabilize the DNA in the antibiotic resistance coexpressed with some chromosome integration?
cell the (trans)gene of interest, and cells are
grown in presence of antibiotic, thus they
retain the plasmid for many generations
Mutants can be effectively Screening usually uses antibiotic
screened and selected resistance (see above) and fluorescence
26
Paper discussing how the human microbiome can shuttle around antibiotic resistance genes
genes like RFP and GFP coexpressed
with the gene of interest.
Transgene expression
can be controlled
Complex genetic circuits A large amount of work has been done
can be built that work by research labs and iGEM teams
reliably developing complex sensors and other
genetic circuits in E. coli
Expression levels of
various genes can be
controlled independently
Products can be Cells are commonly lysed and protein
effectively isolated from products extracted from solution. Also,
culture proteins can be secreted extracellularly27

8. Excerpts from Opentrons application (whole team, mentors 5.1.18)

First draft

How does your team plan to use good measurement practices to validate your
parts/methods and illustrate their efficacy?

Because of the foundational nature of the project, replicability is a key aspect of it. To be able to
accurately characterize how novel elements may affect gene expression, we need to test in
parallel many identical samples, with as little external deviation between them as possible. By
using an OT2 robot, we can automate many laborintensive fluid handling tasks, and develop
good opensource measurement protocols to be shared with the larger scientific community.
Because our project is centered around the development of complex genetic circuits in
mammalian cells, we need to be able to accurately determine the sources of variation in gene
expression, and by minimizing extrinsic variability, we can better evaluate the variability
intrinsic to the genetic environment.
27
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5299778/

Using the OT2 robot, what reproducible methods could you develop and contribute to the
open source library of Opentrons protocols available to the whole scientific community?

If we receive an OT2 robot, we plan on improving existing basic protocols such as PCR and
SLIC to fit the specific requirements of CHO cell lines. In addition to improving basic protocols,
it is very important to us to develop robust protocols for the measurement of gene expression in
the presence of novel genetic elements and environmental toxicology. We intend on making all
of our protocols opensource and clearly documented, for the benefit of the wider scientific
community.

Describe your team's iGEM project in 400 words or less.
(Bonus points for great descriptions and/or creative depictions of what you plan to do
using the power of synthetic biology.)

We want to change the way synthetic biology is done why only use the most simple forms of
life, when there is such potential in complex eukaryotic hosts? Mammalian host cell synthetic
biology is years behind work in bacterial systems, and we want to change that.

We are studying the synthetic biology of mammalian host cells, and plan to develop and
characterize novel genetic elements to enable predictable and controllable gene expression for
use in complex genetic circuits. By using mammalian cells, we can develop more sophisticated
genetic circuits and pathways utilizing differential spatiotemporal gene expression. Although
CHO cells have long been used for pharmaceutical production, there are large gaps in the
fundamental knowledge necessary for creating sophisticated genetic circuits.

Our overarching goal is to analogously translate functional parts originally used in bacterial
systems for use in mammalian systems, and to cooperate with other teams around to globe to
make not just a series of incremental improvements, but a whole revolution of higherorganism
synthetic biology replicating and expanding upon several years’ focus on bacterial systems.

Our immediate goal is the development of an intracellular genetic sensor to study the effect of
environmental toxins on metabolism in mammalian cells. By developing a robust genetic
reporter system that can be applied to a variety of stimuli and metabolic pathways of interest,
researchers will be able to assess with precision and ease the effect of toxins on cellular
physiology, allowing more accurate assessment and understanding of hazards to human and
environmental health.

Please provide a link to your team page, a video, or any additional resources you have to
help us understand why your team's project is awesome, and why you should receive an
OT2!

In addition to our awesome project, awarding us an Opentrons OT2 would provide Opentrons
and the OT2 access to our entire university community. Our team this summer is working in the
UC Davis TEAM Molecular Prototyping and BioInnovation Lab. This space provides the
facilities and mentorship to any undergraduate, graduate, staff or faculty who is interested in
pursuing a biological/molecular themed project. If we win one of the OT2 robots, we plan on
housing and maintaining the unit in this space. In the past academic calendar, the space has seen
use from over 250 undergraduates, spanning over 50 majors, across STEM and nonSTEM
disciplines. The space, with its existing traditional molecular lab equipment, has catalyzed
development of 17 new handson courses (with topics as diverse as the iGEM competition itself),
three startup companies, and multiple industry partnerships. We believe placing the OT2 in the
space would continue to enable diverse and exciting opportunities for our student and research
community and also increase accessibility of this awesome “Open”tron to a large number of
budding and established scientists.

https://team.ucdavis.edu/infosheet/

Second Draft

Please describe your experience with lab automation:
We have advisors who are experienced with automated fluid handling tools.
If awarded the instrument, we would place the OT2 in the UC Davis TEAM Molecular
Prototyping and BioInnovation Lab (MPBIL). The unique biomaker space is managed by our
mentor and will be our summer home. MPBIL could also provide support for longterm
maintenance and training on the instrument and open the platform for students in Sr. Design,
clubs and courses to innovate new applications well beyond the time it will be used for iGEM.
In the past academic calendar year, for instance, MPBIL has served over 250 undergraduates,
spanning over 50 majors, across STEM and nonSTEM disciplines. The space, with its
existing traditional molecular lab equipment, has in the last 4 years catalyzed the development
of 17 new handson courses, hosted iGEM teams, led to three student startup companies, and
multiple industry partnerships. We believe placing the OT2 in the space would continue to
enable diverse and exciting opportunities for our student and research community and also
increase the visibility of this awesome “Open”tron to a large number of budding and
established scientists. Finally, MPBIL is managed as a part of the aforementioned TEAM
prototyping space and would therefore be in an environment where students and researchers
are working on both the wet side of biological engineering but also designing new hardware.
Will your team have access to lab automation during the iGEM 2018 competition?
No
Does your team plan to create any opensource hardware modules or software
integrations on the OT2 robot if you receive one?
Yes
Please BRIEFLY describe the opensource hardware and/or software your team plans to
create:
We are very interested in trying existing software protocols for cell seeding and media
exchange and expanding these for different eukaryotic cell culture conditions. We also
potentially have interest in developing a gentle oscillating platform that can be used for
positioning a multiwell culture plate plate at angles during pipetting and for gentle mixing of
a reagent post pipetting. Our team has access to the Biomedical Engineering TEAM
electromechanical prototyping laboratory < team.ucdavis.edu > and its support staff for the
design and fabrication of physical prototypes. We expect to contribute to any protocols we
develop to the Opentron protocols library.
How does your team plan to use good measurement practices to validate your
parts/methods and illustrate their efficacy?
Our project is focused on the development and characterization of new gene regulatory
elements and libraries thereof for mammalian cell engineering. The foundational nature of our
project requires us to pay particular attention to measurement and standardization. Accurately
characterizing how our genetic elements may affect gene expression in different contexts
requires that we test numerous samples in parallel conditions, while simultaneously
minimizing experimental noise that can be introduced by sample handling. By using an OT2
robot, we can automate and standardize many of laborintensive fluid handling tasks, and
develop good opensource measurement protocols to be shared with the larger scientific
community. By minimizing experimental variability we also hope accurately characterize
between extrinsic and intrinsic factors influencing expect variation in gene expression.

Moreover, we expect that using a robot to facilitate the full partscharacterization workflow
will enable us to describe a standard and reproducible protocol for part characterization that
includes concrete descriptions of factors outlined by NIST required for good measurement
practices. These include: measures of reproducibility, standard units, instrument calibrations,
instrument tolerances, and assay sensitivity. In this respect, our team is also interested in
examining the effects of context on measurement. Context, as described by the Joint Initiative
for Metrology in Biology’s Minimum Information Standard for Engineered Organism
Experiments < jimb.stanford.edu/mieo > can include variables like cell type, media
components, and container geometry. Should we receive an OT2 robot, we would be
interested in conducting experiments that compare manual versus automated characterization
of the same parts.

Using the OT2 robot, what reproducible methods could you develop and contribute to
the open source library of Opentrons protocols available to the whole scientific
community?
We are interested in developing robust protocols for the measurement of gene regulatory
element activity in mammalian cells. We would like to work on standardizing cell culturing
and expansion, including cell seeding and media exchange steps. While some early protocols
already exist for these steps, we expect to expand upon these and refine them in the specific
context of our project. Due to our funding source, we are also specifically interested in using
what we learn from part characterization experiments to develop protocols for the
development of assays for the study of environmental toxicology particularly toxins of
relevance to the Superfund program. Finally, our team is interested in improving or refining
existing protocols highly parallel to DNA amplification and assembly that might help enable
students and student groups at UC Davis and beyond create more sophisticated genetic
devices in an affordable and reliable manner.

Describe your team's iGEM project in 400 words or less. BE CREATIVE!
We hope to set some of the technical groundwork that will help to bring forth a second
generation of biomanufacturing and numerous novel applications that can result from making
the engineering mammalian and complex eukaryotic cells easier and more reliable. Recent
technology developments like CRISPR, the continuing decreasing cost of DNA synthesis, and
increasingly sophisticated CAD tools biological design are starting to put the complex
engineering of mammalian and other complex eukaryotic cells within the technical grasp of
the scientific “masses” including undergraduate students like us.

While increasingly democratized technologies for cellular engineering make it easier for more
people to access this field, the practical ability to construct complex genetic devices in
mammalian cells lags behind what is possible in bacterial systems. Fortunately, we can learn
from the work of the last two decades in synthetic biology to guide the rapid development of
key tools for the genetic engineering of these more complex systems.

One of the critical lessons learned from the development of synthetic biology in bacterial
systems is that libraries of wellcharacterized genetic control elements can be extraordinarily
powerful in spurring the development of new projects and ideas. A second lesson learned in
this respect is that rigorous characterization of part function in different contexts can be
critical to determining function and that some strategies can be employed to minimize
contextdependent variation of part function.

Our project aims to build on these lessons by developing sets of genetic control elements that
can function in complex eukaryotes (specifically mammalian systems) and to build standard
and reproducible ways of characterizing part function in ways that are consistent with good
measurement practice. We plan to test what we learn about part characterization by
developing an simple intracellular genetic sensor to study the effect of environmental
Superfund toxins on the physiology in mammalian cells. If successful this application could
allowing for the development of new tools to assess and understand the potential hazards to
human and environmental health associated with exposure to environmental toxins.

Please provide a link to your team page, a video, or any additional resources you have to
help us understand why your team's project is awesome, and why you should receive an
OT2! (Optional)
team.ucdavis.edu

Response from Opentrons (5.15.18)

Hi team,

Thank you so much for your application to Opentrons' 2018 Team Challenge. We thought long
and hard about the applications we received and, while we wish we could have given everyone a
robot, we had to make some tough choices. Your team was not chosen for this year's challenge,
but your application was brilliant and we wish you the best in your project!!

We'd still absolutely love to have you as part of our community and would like to extend an offer
for $2000 off an OT2 for the duration of the 2018 competition season. We want to make sure
that as many teams as possible can access our technology, and we hope it helps to foster
collaboration and reproducibility within and between teams. For more information on this special
offer, please email us we'd love to bring you on board as quickly as possible and work with you
to help your project run!

With best wishes from all of us,

The Opentrons Team

9. Overview of project as currently envisioned (Daniel 5.4.18)

1. Develop background knowledge
a. Prior work done in CHO cell synthetic biology
b. Basic protocols for handling CHO cells
c. Prior work done in predicting effect on gene regulation of genetic control
elements
d. Methods of characterizing genetic control elements
e. Contextaware characterization and principles of good measurement

2. Characterize genetic control elements
a. Select a library of genetic control elements
b. Rigorously characterize the effect of each control element on gene expression in a
variety of specific contexts
c. Analyze results to look for patterns that can allow for predictive characterization
of novel elements. Possible computational aspect. (? may be beyond scope of
project). Need to do some more reading in this.
d. Test predictive characterization hypotheses (? may be beyond scope of project)

3. Proof of concept intracellular sensor
a. Research superfund sites and environmental toxicology. How in vitro models are
used to study environmental toxicology. Regulations, guidelines, EPA testing and
context.
b. Design and build a simple genetic circuit to signal effect of environmental toxin
on expression of gene of interest / status of biochemical pathway
c. Assess the functionality of the intracellular sensor
d. Introduce idea of EPA testing of environmental toxins, then describe need of
wellcharacterized regulatory elements for testing systems
e. See if what we’re doing could be applicable across multiple cell lines

10. EPA emails (Daniel, Jacob 5.14.18)

title name email phone Email sent Reply
received
Community Jackie Lane 5.14.18

Involvement
Coordinator
Remedial Project Bianca 5.14.18 5.14.18

Manager Handley
DTSC project Juan Peng 5.14.18 5.14.18

manager
Community Pam 5.14.18

Advisory Nieberg
Oversight Group
President

Subject: Davis, CA Superfund Site

Dear ________,

I am part of a team of undergraduate researchers at UC Davis interested in superfund sites. We
are working on a project in the area of environmental toxicology, bioremediation, and the effect
of pollutants on the genetic health of animals. This is part of an international universitylevel
science competition ( igem.org ).

We are very interested in learning more about superfund sites in the Davis area, specifically the
impact on local communities and what current measures are being taken to maintain these
hazardous sites.

If it would be possible to meet and discuss these topics, and potentially visit a superfund site in
the Davis/Sacramento area, it would be greatly appreciated.

Thank you for your time.
Sincerely,

Daniel Graves
iGEM at UC Davis

Hello Mr. Graves,

Looks like a very interesting topic and competition!
We have two superfund sites that I can think of in Davis, Frontier Fertilizer and LEHR , and we
also have sites in Sacramento, and the Bay Area.

As far as your project, you mentioned you are interested in the current measures being taken to
maintain the site; are you specifically looking at maintenance of superfund sites or are you
looking more at remediation?

I am the project manager for Frontier Fertilizer, which has had groundwater extraction and
treatment system for over 20 years now. This treatment system has been transferred to the state,
specifically the department of toxic substances control (DTSC), for operation and maintenance
until we meet our remedial action objectives in the groundwater. I’m sure the both the state
project manager and I would be very glad to help you in whatever way we can, but you should
review the website28 to make sure our site is relevant to your project focus. If not, I’m happy to
help you get in touch with some other EPA remedial project managers to find a site more related
to your interests.

Sincerely,

Bianca Handley
28
https://cumulis.epa.gov/supercpad/cursites/csitinfo.cfm?id=0901554
U.S. Environmental Protection Agency
Superfund Division

Hi Daniel,

Glad to hear from young researchers interested in Superfund sites. I assume you already knew
my site Frontier Fertilizer Superfund Site located in Davis. It is a pesticidescontaminated site.
Like many other pesticides site in the central valley, bioremediation is often not the selected
remedy because it is not always suitable for the site settings and the contaminants. Selected
remedy for Frontier Fertilizer includes In Situ Thermal Treatment29 (for soil in source area) and
Groundwater Pump and Treat. Environmental toxicologists are involved during all phases of a
Superfund site cleanup, to provide professional inputs on human health and ecological risk
assessments.

If you want to know more about my site and the work we do, I would be happy to meet and
discuss with you and your fellow team members. I can also refer you to toxicologists in DTSC’s
Human and Ecological Risk Office if you want to know more about the environmental
toxicologyside of our work.

Thank you,

Juan

Juan Peng, Ph.D., P.E.
Project Manager
National Priorities List Unit, Cleanup Program
Department of Toxic Substances Control

Dear Bianca Handley,

Thank you for getting back to us. As of now, the team is interested in gaining insight into the
science and infrastructure of the site to help guide us in shaping our project.

29
https://www.epa.gov/sites/production/files/201504/documents/istt_cs_epa542r04010.pdf
Our team is looking to focus on the remediation aspect of Superfund sites. We are specifically
interested in finding out the methods of sampling and monitoring toxic substances and further
details on what is being done to clean up the site.

We would greatly appreciate the opportunity to come visit the site and talk to employees
regarding our project and our projects contributions to remediation efforts. Please let us know if
this can be arranged.

Thank you for your time, we look forward to hearing from you.

Sincerely,

Daniel
iGEM at UC Davis

Dear Juan Peng,

Thank you for getting back to us. The team is looking to gain insight into the science and the
infrastructure of Superfund sites to help guide us in shaping our project.

Our team would be interested in visiting the site and learning more about the work done at the
location. We would also greatly appreciate if you could connect us to toxicologists in DTSC’s
Human and Ecological Risk Office. The added input of specialists would be very valuable for
our project.

Please let us know how to proceed. Thank you for your time, we look forward to hearing from
you.

Sincerely,

Daniel
iGEM at UC Davis

Hi Daniel,

I am referring you to Dr. Claudio Sorrentino, a Supervisor in DTSC’s Human and Ecological
Risk Office (HERO), for toxicology questions. He or his staff will be able to assist you.

Superfund sites are usually the most contaminated sites in the nation, therefore, public access to
these sites is usually restricted for health and safety concerns. However, we do have sites where
the public was offered site tour by the agencies. If you can provide me with a total number of
team members that may be interested in visiting the site, and the level of health and safety
trainings the team has taken, it will help us evaluate your site visit request.

I also encourage you to check on the public profile of Frontier Fertilizer on DTSC’s EnviroStor
database: https://www.envirostor.dtsc.ca.gov/public/profile_report.asp?global_id=57070001 . The
2006 Record of Decision document will give you a good idea of site contamination, sitespecific
human health and ecological risks, and how certain remediation technologies were selected to
clean up the site:
( https://www.envirostor.dtsc.ca.gov/public/deliverable_documents/6720273673/Frontier_Record
%20of%20Decision_092006_ROD.pdf .

Best,

Juan

Juan Peng, Ph.D., P.E.
Hazardous Substances Engineer
National Priorities List Unit, Cleanup Program
Department of Toxic Substances Control

Daniel,
You may also want to look in your own “backyard” (a.k.a. UCD campus): there is another
superfund site near the Raptor Center at Putah Creek
https://www.envirostor.dtsc.ca.gov/public/profile_report.asp?global_id=48990004

Claudio

11. Project overview in more detail (Daniel 5.15.18)

1. Develop background knowledge

a. Prior work done in CHO cell synthetic biology
i. What methods are used to introduce transgenic DNA?
ii. How can we stabilize DNA in the cells?
1. Plasmids?
2. Chromosomal insertions?
a. Possibly use CRISPR
b. We would need to be aware of exactly where in the
chromosome/genome the insertion is, and be consistent
i. May need to sequence or do some other test to
confirm the location of the insertion
iii. How do CHO cells handle complex genetic circuits?
1. Do they behave very differently when under additional metabolic
stress compared to wild type?
a. Are there well defined parameters or amounts of stress
which a cell can tolerate associated with expression of
transgenic proteins, correlated with different physiological
behaviors (e.g. growth rate, morphology, etc)?
i. If not, is this something we can develop?
iv. What types of applications have been attempted in the past?
1. What problems did people encounter when trying that?
2. What are the most reasonable things to do with mammalian cells?
a. Make medicine (antibodies, protein replacement therapy,
etc) for other mammals
b. Research models
i. For use in Environmental toxicology
ii. For use in drug metabolism studies in pharma
iii. As models in basic biology research

b. Basic protocols for handling CHO cells
i. How to keep them alive?
1. What specific media and environmental conditions must be met?
2. How long do cultures live for?
3. How do we store them?
a. What temperature, special solution requirements, for how
long can we keep them?
ii. How can we get peak protein synthesis / gene expression
1. “midlog growth”
iii. What specific strains of CHO cells are there, and what are they good for?
1. How much genetic diversity between strains is there?
2. How much genetic diversity within strains is there?
iv. What safety measures do we need to take when handling CHO cells or
other mammalian cell lines?
1. How do we safely dispose of them?
a. autoclave? Or is there a special way to dispose of
mammalian cells?

c. Prior work done in predicting effect on gene regulation of genetic control
elements
i. Are there computational models in the literature / online?
1. How advanced are they? E.g. simple algebra and calculus, or
complex machine learning algorithms?
2. How good are they?
a. Not very good
ii. What methods did they use?
1. Are their methods robust?

d. Methods of characterizing genetic control elements
i. Well defined, consistent procedures and environmental conditions

e. Contextaware characterization and principles of good measurement

2. Characterize genetic control elements

a. Select a library of genetic control elements
i. What types of control elements?
ii. How many elements should we test?
iii. Are we considering naturally occurring elements or de novo mutants we
produce? (or both)

b. Rigorously characterize the effect of each control element on gene expression in a
variety of specific contexts
i. How many different contexts should we test each control element in?
ii. What should be the range of variation?
1. What is the range of variation within each context? (e.g. in the
range of 29.5º C to 30.5º C)
2. What is the range of variation between each context? (e.g. test
points in the interval from 20º C to 40º C, or from 0º C to 100º C)
iii. How many trials do we need for each context for our findings to be
statistically significant?

c. Analyze results to look for patterns that can allow for predictive characterization
of novel elements.
i. Possible computational aspect.
ii. This may be beyond scope of project and the skill set of the team

d. Test predictive characterization hypotheses
i. See above. May be beyond scope of project

3. Proof of concept intracellular sensor

a. Research superfund sites and environmental toxicology.
i. How in vitro models are used to study environmental toxicology.
ii. Regulations, guidelines, EPA testing
iii. Effect of superfund sites on local communities
1. In Davis
a. Frontier Fertilizer site
2. In Klamath
a. visit the Yurok Tribe
b. Regional contamination due to unregulated marijuana
grows
c. Tentative date of “field trip,” June 1820

b. Design and build a simple genetic circuit to signal effect of environmental toxin
on expression of gene of interest / status of biochemical pathway

c. Assess the functionality of the intracellular sensor
i. Handle toxic chemicals with care so that our lab doesn’t “become a
superfund site as well”

d. Introduce idea of EPA testing of environmental toxins, and describe need of
wellcharacterized regulatory elements for testing systems as the “client need” or
motivation for the engineering project

e. See if what we’re doing could be applicable across multiple cell lines if we have
time
i. Test in other mammalian systems
ii. Test in more exotic eukaryotic systems
1. Plants
a. Likely to have very different genetic control elements
compared to a mammal
2. Reptiles, fish, amphibians, etc

4. Administrative tasks

a. Fundraising
i. Talk to College of Engineering, Bio Sci, etc
ii. Talk to biotech companies
iii. CrowdfundingExperiment ?

b. Presentation of findings
i. Wiki
ii. Poster
iii. Oral presentations

c. Gold Medal Requirements

d. Travel

12. Findings from team meeting (Team 5.29.18)

iGEM Standard Part Assembly
http://parts.igem.org/Help:Standards/Assembly/RFC10


^ an important resource for working with CHO cells and biosecurity always be thinking about
dual use situations ^

Trichloropropane findings:

http://aem.asm.org/content/68/7/3582.full

“ Biodegradation of 1,2,3Trichloropropane through Directed Evolution and Heterologous
Expression of a Haloalkane Dehalogenase Gene ”

“Using a combined strategy of random mutagenesis of haloalkane dehalogenase and genetic
engineering of a chloropropanolutilizing bacterium, we constructed an organism that is capable
of growth on 1,2,3trichloropropane (TCP). This highly toxic and recalcitrant compound is a
waste product generated from the manufacture of the industrial chemical epichlorohydrin. …
these results demonstrated that directed evolution of a key catabolic enzyme and its subsequent
recruitment by a suitable host organism can be used for the construction of bacteria for the
degradation of a toxic and environmentally recalcitrant chemical.”

Email Draft:
Dear Mr. Peng,

Thank you for connecting us with Dr. Sorrentino, we appreciate your help. There are a total of 5
team members and potentially two team advisors. Everyone on the team has certified laboratory
safety training from the University of California, Davis. We are trained to work with chemicals
and mammalian cell lines. Please let us know if a site visit can be arranged.

Respectfully,

13. Notes for the Klamath trip (Team 5.29.18)

Hi iGEM,

1. Is there a list of all email addresses for iGEM? If so, can someone please send.

2. I talked to Justin last night iGEM came up. There is a potential opportunity to take a field
trip to Klamath to visit the Yurok Tribe and hear directly from the Tribal members about
regional contamination due to unregulated marijuana grows. This is, BTW, what the Superfund
grant is focused on.

The dates are June 1820 and Justin is offering to try getting you the opportunity to go if you
like. This might be a terrific opportunity to learn more about some of the problems that would be
motivating your work and the realworld impact it might lead to AND be a very powerful
addition to your human practices component of your project.

Can you guys talk about if anyone in the group would be interested in going and let me know
very soon. Apparently, the Tribe wants to know who is coming on their land and be able to plan
ahead no last second dropins.

Marc

Excerpts from the Yurok Tribe website:

“ The mission of the Yurok Tribe is to exercise the aboriginal and sovereign rights of the Yurok
People to continue forever our Tribal traditions of selfgovernance, cultural and spiritual
preservation, stewardship of Yurok lands, waters and other natural endowments, balanced social
and economic development, peace and reciprocity, and respect for the dignity and individual
rights of all persons living within the jurisdiction of the Yurok Tribe, while honoring our Creator,
our ancestors and our descendants.

Our world began long before nonIndian exploration and settlement occurred in our area.

At one time our people lived in over fifty villages throughout our ancestral territory. The
laws, health and spirituality of our people were untouched by nonIndians .

Culturally, our people are known as great fishermen, eelers, basket weavers, canoe makers,
storytellers, singers, dancers, healers and strong medicine people. Before we were given the
name "Yurok" we referred to ourselves and others in our area using our Indian language. When
we refer to ourselves we say Oohl, meaning Indian people. When we reference people from
down river on the Klamath we call them Pueliklo' (Down River Indian), those on the upper
Klamath and Trinity are Peycheeklo' (Up River Indian) and on the coast Ner'erner' (Coast
Indian). The KlamathTrinity River is the lifeline of our people because the majority of the food
supply, like neypuy (salmon), Kaaka (sturgeon) and kworror (candlefish) are offered to us
from these rivers. Also, important to our people are the foods which are offered from the ocean
and inland areas such as peeee (mussels), cheygel' (seaweed), woomehl (acorns), puuek (deer),
meyweehl (elk), leychehl (berries), and weyyokseep (teas). These foods are essential to
our people's health, wellness and religious ceremonies. Our way was never to over harvest
and to always ensure sustainability of our food supply for future generations .

Our traditional family homes and sweathouses are made from fallen keehl (redwood trees) which
are then cut into redwood boards. Before contact, it was common for every village to have
several family homes and sweathouses. Today, only a small number of villages with traditional
family homes and sweathouses remain intact. Our traditional stories teach us that the
redwood trees are sacred living beings . Although, we use them in our homes and canoes, we
also respect redwood trees because they stand as guardians over our sacred places. The yoch
(canoe) makers are recognized for their intuitive craftsmanship. The primary function of the
canoes is to get people up and down the river and for ocean travel. The canoe is also very
important to the White Deerskin Dance, a ceremony recently rejuvenated. The canoes are used to
transport dancers and ceremonial people. The traditional money used by Yurok people is
terkterm (dentalia shell), which is a shell harvested from the ocean. The dentalia used on
necklaces are most often used in traditional ceremonies, such as the u pyuewes (White Deerskin
Dance), wooneekweleygoo (Jump Dance) and meylee (Brush Dance). It was standard years
ago, to use dentalia to settle debts, pay dowry, and purchase large or small items needed by
individuals or families. Tattoos on men's arms measured the length of the dentalia.”

http://www.yuroktribe.org/departments/ytep/
http://www.yuroktribe.org/
https://yurok.tribal.codes/YTC/21.15

Article I. General Provisions

21.15.010 Title.

The ordinance codified in this chapter shall be referred to as the “Yurok Tribe Genetically
Engineered Organisms Ordinance” or “Yurok GEO Ordinance.” [Ord. 46 § 8001, adopted,
12/10/2015.]

21.15.020 Findings.

The Yurok Tribal Council finds that:

(a) The Creator set forth the laws by which the Yurok people are instructed to interact and care
for our natural world, including the plants and animals we use for our foods and medicines;

(b) Resisting and undoing the many negative impacts of invasion and colonization for the Yurok
people means restoring what was taken from us in the process. These include our lands, waters,
traditional learning and teaching systems, seeds, food and medicinal plants and animals, salmon,
sacred places, and the health and wellbeing of our families and villages;

(c) These sacred elements and our relationship with Mother Earth are of absolute necessity for
restoring the practice of our food sovereignty and for our spiritual, cultural, physical, social and
environmental health, identity, and survival;

(d) The Yurok people, as World Renewal People, have managed and relied upon the abundance
of Klamath River Wild Salmon since time immemorial and have and continue to be known as
“Salmon People” of the northwest coast;30
30
https://www.scientificamerican.com/article/firstgeneticallyengineeredsalmonsoldincanada/
(e) The Yurok Tribe adopted a Constitution in order to:
(1) Preserve forever the survival of our Tribe and protect it from forces which may threaten its
existence;
(2) Uphold and protect our Tribal sovereignty which has existed from time immemorial and
which remains undiminished;
(3) Provide for the health, education, economy, and social wellbeing of our members and future
members; and
(4) Restore, enhance, and manage the Tribal fishery, Tribal water rights, Tribal forests, and all
other natural resources;
(f) The Tribe has a vital cultural, legal, subsistence, and economic interest in the viability of and
survival of Klamath River Wild Salmon and all other lifegiving food and water resources in
their traditional forms, natural diversity, and original integrity;
(g) Protecting our traditional seeds, plants, salmon, and other lifegiving foods and methods
from the many current threats such as climate change, mining and extractive industries, genetic
engineering, chemical pesticides, and other toxic contaminants is essential for our survival, and
is at the core of our sacred responsibilities as Yurok people;
(h) It is the inherent sovereign right of the Yurok people to grow plants from natural traditional
seeds and to sustainably harvest plants, salmon and other fish, animals, and other lifegiving
foods and medicines, in order to sustain our families and communities as we have successfully
done since time immemorial; and
(i) The threat to the Yurok Tribal Territory of contamination of our traditional seeds, plants,
animals, and fish from genetically engineered organisms is not yet severe. However, given the
rapid federal governmental approval and pending approval of a wide variety of genetically
engineered seeds, animals, and fish (including GMO salmon), the Tribe enacts the ordinance
codified in this chapter primarily as a preventative measure against future harm. [Ord. 46 § 8003,
adopted, 12/10/2015.]

21.15.030 Purpose.
The purpose of this chapter is to:
(a) Maintain and protect food sovereignty and Tribal control, free from outside corporate
interests and unnecessary and overreaching preemption by any outside governments, of the
agriculture, environment, Tribal health, welfare, and economy as they pertain to genetic
contamination from genetically engineered organisms;
(b) Prohibit any person, corporation, or entity from propagating, raising, growing, spawning,
incubating, or releasing genetically engineered organisms within the territory of the Tribe;
(c) Educate and protect the Yurok community as to the health and environmental hazards of
genetically engineered foods, and to work towards labeling and/or phasing out the sale and
provision of such foods on Tribal lands;
(d) Declare the Yurok Tribal Territory to be a zone kept free from genetically engineered or
modified seeds, plants, fish, and animals. This will preserve a healthy and safe place for our
traditional seeds, plants, animals, and fish, as well as for our children and future generations to
thrive within the boundaries of our territory in health, strength, and harmony; and
(e) Enable the Tribe to enforce the genetically engineered organism prohibitions and recover the
costs of such enforcement. [Ord. 46 § 8004, adopted, 12/10/2015.]

21.15.040 Scope.
This chapter shall apply to all persons and entities throughout and within the Yurok Reservation
and territory over which it has jurisdiction, including over all lands, waters, riverbeds, submerged
lands, properties, air space, minerals, fish, forests, wildlife, and other resources, and any interest
therein now or in the future. This chapter shall also apply to any offreservation conduct that
causes material onreservation genetic trespass or contamination by genetically engineered
organisms. [Ord. 46 § 8005, adopted, 12/10/2015.]
21.15.050 Definitions.
“DNA” means “deoxyribonucleic acid,” which is the genetic material that is present in every cell
of an organism and is the “blueprint” for the organism’s development.
“Genetic contamination” means the dispersal or spread of altered genetic information from
genetically engineered organisms into the genomes of organisms in which such genes are not
present in nature, such as by crosspollination.
“Genetically engineered,” “genetically modified” or “transgenic” means modification of living
plants, animals, and other organisms by genetic engineering. Examples of genetic engineering
and modification include, but are not limited to: altering or amending DNA using recombinant
DNA technology such as gene deletion, gene doubling, introducing a foreign gene, or changing
the position of genes, and includes cell fusion (including protoplast fusion), microencapsulation,
macroencapsulation, gene splicing, or hybridization techniques that overcome natural
physiological, reproductive, or recombination barriers, where the donor cells/protoplasts do not
fall within the same taxonomic species and in a way that does not occur by natural multiplication
or natural recombination.
“Genetically modified organism” or “GMO” means any living organism that possesses a novel
combination of genetic material produced through the use of modern biotechnology genetic
engineering techniques, separate from naturally occurring processes. For purposes of this
chapter, genetically engineered or modified organisms do not include organisms created by
traditional selective breeding, burning practices, fermenting, conjugation, normal in vitro
fertilization or hybridization, or microorganisms created by moving genes or gene segments
between unrelated bacteria .
“In vitro nucleic acid techniques” include but are not limited to recombinant DNA or RNA
techniques that use vector systems and techniques involving the direct introduction into the
organisms of hereditary materials prepared outside the organism such as microinjection,
macroinjection, chemoporation, electroporation, microencapsulation and liposome fusion, and
any other technology or technique that results in an organism that contains genes from more than
one species, or genes that are not naturally occurring.
“Natural seeds” or “natural organisms” means seeds or organisms that do not possesses a novel
combination of genetic material obtained through the use of modern biotechnology and have not
been genetically modified or engineered. Natural seeds or organisms include those seeds or
organisms created by selective breeding or hybridization methods.
“Organism” means any living thing. [Ord. 46 § 8010, adopted, 12/10/2015.]
Article II. Prohibited Activities

21.15.060 : Prohibited activities.
It shall be unlawful for any person, corporation or other entity to:

(a) Propagate, cultivate, raise, grow, spawn, incubate, or release genetically engineered or
genetically modified organisms within the territory and jurisdiction of the Tribe, or to knowingly
or negligently allow such activities to occur within such territory and jurisdiction, except as
provided in YTC 21.15.070 .

(b) Intentionally or negligently cause or allow any genetically engineered or genetically
modified organisms or materials from within or outside the jurisdiction of the Tribe to
substantially enter, drift, or be dispersed into and within the territory and jurisdiction of the
Tribe, in such a way as to risk genetic contamination of natural organisms within the jurisdiction
of the Tribe. The Tribe may enforce such violations to the extent possible pursuant to applicable
laws. [Ord. 46 § 8101, adopted, 12/10/2015.]

21.15.070 Exceptions to prohibited activities.

(a) State or federally licensed medical research institutions, medical laboratories, or medical
manufacturing facilities engaged in licensed medical production, or medical research involving
genetically engineered or genetically modified organisms are exempt from this chapter;
provided, that prior written permission is obtained from the Tribe and that such activities are
conducted under secure, enclosed, indoor laboratory conditions with the utmost precautions to
prevent release to the outside environment any part of the genetically engineered organisms,
especially but not limited to pollen.

(b) Educational or scientific institutes working with genetically engineered organisms are
exempt from this chapter; provided, that prior written permission is obtained from the Tribe and
that such activities are conducted under secure, enclosed, indoor laboratory conditions with the
utmost precautions to prevent release to the outside environment,any part of the genetically
engineered organisms, especially but not limited to pollen.

(c) Any institution listed in subsection (a) or (b) of this section that intentionally or negligently
allows release of any part of the genetically engineered or genetically modified organisms into
the outside environment is in violation of this chapter and subject to enforcement as set forth
herein. [Ord. 46 § 8102, adopted, 12/10/2015.]
Article III. Implementation and Enforcement

21.15.080 Enforcement entities.
The Tribal Council hereby designates the Yurok Tribe Environmental Program (“YTEP”),
working with the Yurok Department of Public Safety (“YDPS”) and the Office of Tribal
Attorney (“OTA”), to administer and enforce the provisions of this chapter. [Ord. 46 § 8201,
adopted, 12/10/2015.]

21.15.090 Powers and authorities of enforcement entities.
(a) YTEP may impose fines for noncompliance in increasing amounts for repeated violations, as
follows:
(1) First Offense. The Code Enforcement Officer may, in its sole discretion, impose a fine up to
$500.00.
(2) Second Offense. The Code Enforcement Officer may, in its sole discretion, impose a fine up
to $1,000.00.
(3) Third Offense. The Code Enforcement Officer may, in its sole discretion, impose a fine up to
$3,000.00.
(4) The above schedule may be adjusted depending on the scope of the violation and resulting
damage, the violator’s willfulness or recklessness, and other exacerbating (or mitigating)
circumstances.
(b) Claims of violations may also be investigated by YDPS in collaboration with Tribal
Fisheries, cultural officers, and environmental officers.
(c) YTEP or YDPS may issue citations to any person or entity believed to have committed a
violation of this chapter. The citation will explain in plain terms what conduct has violated the
code, and shall include the following information:
(1) The specific conduct that violated this chapter, referring to the specific relevant section(s) in
this chapter;
(2) The date(s) the conduct occurred or was discovered;
(3) What steps must be taken by the violator to address the violation;
(4) The date by which the violator must come into compliance with this chapter, including the
development of a transition/phaseout plan with YTEP to avoid the imposition of further
penalties and fines;
(5) The penalties that may be imposed if the offender continues to violate this chapter, including
the filing of a civil action;
(6) The contact information for YTEP, and whether a meeting needs to be scheduled to discuss,
in more detail, the reasons the conduct violated this chapter and how to avoid violating this
chapter again;
(7) That the offender may appeal, in writing, YTEP’s finding that a violation occurred, and the
date by which this appeal must be received by the Tribal Court. [Ord. 46 § 8202, adopted,
12/10/2015.]

21.15.100 Initial notification.
(a) Upon enactment, YTEP shall make reasonable efforts to provide initial notification of this
chapter to farming, forestry, and fishery operations within the territory and jurisdiction of the
Tribe.
(b) YTEP shall make reasonable efforts to notify farming, forestry, and fishing operations of
technical assistance and resources that may be available to assist with the transition from
genetically engineered organisms to natural organisms.
(c) Actions required of YTEP in this section are intended to assist farming, forestry, and fishing
operations with compliance and assistance. Failure to receive notification does not waive or
otherwise affect requirements for compliance with the provisions of this chapter. [Ord. 46 §
8203, adopted, 12/10/2015.]

21.15.110 Required disclosures.
Every person, corporation, or entity cultivating, raising, growing, spawning, incubating, or
releasing genetically engineered or genetically modified organisms must disclose to YTEP,
within 30 days of enactment of the ordinance codified in this chapter, the location and
description of existing or planned genetically engineered organisms involved, in order to develop
a transition plan, approved by YTEP, to phase out such organisms. [Ord. 46 § 8204, adopted,
12/10/2015.]

21.15.120 Transition plan.
Persons, corporations, or entities cultivating, raising, growing, spawning, incubating, or releasing
genetically engineered or genetically modified organisms within the Tribe’s territory and
jurisdiction shall have up to 12 months from the date of enactment to implement a transition plan
as set forth in YTC 21.15.110 to phase out planting, cultivating and harvesting of genetically
engineered or genetically modified organisms. [Ord. 46 § 8205, adopted, 12/10/2015.]
Article IV. Process and Remedies

21.15.130 Notification.
YTEP shall notify any person, corporation, or entity that may be in violation of this chapter that
any organisms in violation of this chapter are subject to confiscation and destruction. [Ord. 46 §
8301, adopted, 12/10/2015.]

21.15.140 Response.
(a) Any person, corporation or entity that receives notification shall have 15 days to respond to
such notification with evidence that such organisms are not in violation of this chapter. Time for
response may be shortened upon a showing of current, ongoing, and/or imminent harm or risk of
genetic contamination.
(b) If the notified party does not provide such evidence or if there is probable cause to believe
genetically engineered organisms are present, YTEP may take necessary actions required by law
(such as obtaining a search warrant) to obtain access to the property and obtain material samples,
in accordance with due process. [Ord. 46 § 8302, adopted, 12/10/2015.]

21.15.150 Determination.
Upon receipt of any evidence under YTC 21.15.140 , YTEP shall consider such evidence and any
other evidence that is presented or which is relevant to a determination of such violation. YTEP
shall act in good faith to make such determination as soon as possible, and before any genetic
contamination may occur. If genetic contamination has already occurred or cannot be prevented
before the determination is completed, YTEP shall make efforts to abate and prevent further
contamination. [Ord. 46 § 8303, adopted, 12/10/2015.]

21.15.160 Enforcement and sanctions.
(a) YTEP shall work with OTA to develop appropriate enforcement forms and methods.
(b) In addition to any remedies and penalties provided that may be available by law, the
following sanctions may be imposed:
(1) Any organisms that are the subject of violation of this chapter may be confiscated,
quarantined, and destroyed before any genetic contamination may occur. If genetic
contamination has already occurred, the contaminated organisms may be confiscated,
quarantined, and destroyed in accordance with due process.
(2) Testing, administrative, and abatement costs associated with the confiscation and destruction
of organisms may be imposed on responsible parties (namely the person(s), corporation(s), or
other entities responsible for the violation). If contamination has already occurred, costs for
remediation of contamination may be imposed on responsible parties.
(3) In imposing administrative and abatement costs and other fees, fines, and accrued interest on
the responsible parties, YTEP shall take into account the amount of actual and reasonably
foreseeable damage and the degree of willfulness, reckless disregard, or negligence of the
person, corporation, or entity involved. Fines shall be payable to the enforcing department.
(4) The Tribe or any individual within the Tribe’s jurisdiction shall have standing to assert any
rights secured by this chapter (for violations occurring within the Tribe’s territory) that have been
violated or are threatened with violation, and may seek injunctive and/or compensatory relief
from the Tribal Court. While an individual may recover actual damages, any assessed fines are
payable to the enforcing agency. [Ord. 46 § 8304, adopted, 12/10/2015.]

21.15.170 Seizure and forfeiture.
Equipment used to violate this chapter, along with any illegal substances in plain view, is subject
to seizure and forfeiture. [Ord. 46 § 8305, adopted, 12/10/2015.]
Article V. Chemical Pesticide and GEO Education Committee

21.15.180 Education Committee established.
A Chemical Pesticide and GEO Education Committee is hereby established, with representatives
from, but not limited to: YTEP, TDPS, Tribal Court, OTA, Tribal Fisheries, and cultural
programs. This Education Committee shall meet regularly and make recommendations to the
Tribal Council regarding:
(a) Educating the Yurok Tribal community about the harmful effects of chemical pesticides;
(b) Tribal policies and legislation to regulate and reduce chemical pesticides use on the
Reservation;
(c) Educating the Yurok Tribal community about the harmful environmental and health effects
of genetically engineered organisms; and
(d) The viability of labeling and/or restricting the sale, promotion, or provision of genetically
engineered food products within the Yurok Tribal Territory (in consultation with the Yurok
Economic Development Corporation). [Ord. 46 § 8401, adopted, 12/10/2015.]

21.15.190 GEO guidelines.
In the event the Chemical Pesticide and GEO Education Committee proposes recommendations
and guidelines regarding the safety of chemical pesticides and/or genetically engineered food
products sold or distributed on the Yurok Reservation that the Tribe subsequently adopts by
regular Council action, the Tribal resolution adopting such guidelines shall be attached to the
ordinance codified in this chapter and a cause of action in Tribal Court or any court of competent
jurisdiction shall be created to thereafter regulate or prohibit such sale or distribution of products
the Tribe deems unsafe for human consumption pursuant to those adopted guidelines. [Ord. 46 §
8402, adopted, 12/10/2015.]

Article VI. Tribal Court Review and Enforcement

21.15.200 Tribal Court enforcement.
Any person who violates this chapter may be subject to prosecution before the Yurok Tribal
Court and subject to civil damages, fines, penalties (including interest), and/or injunctive actions.
[Ord. 46 § 8501, adopted, 12/10/2015.]

http://www.latimes.com/local/california/lamesalmondemiseyuroksuicides20170519htmlsto
ry.html

https://www.mnn.com/family/protectionsafety/stories/whatismicrocystin

https://greendiamond.com/

14. A complete cyclic narrative: learnings from Klamath (Team 6.25.18 )

(notes from first work day of the summer)

Motivation draft:

After visiting the Yurok Tribe, it became clear that to have a real positive impact regarding their
problems with pollution and health, it would be necessary to draw a clear narrative between
sources of pollution, a specific toxin in the environment, a high quality field test, a causal effect
on human health, and a specific policy change.

Polluters –> Environment (Field Test) –> Human Disease –> Policy Change –| Polluters

For best outcomes, every link in this chain needs to be well documented and backed by
substantial evidence/data. It needs to be clear which organizations are responsible for introducing
which toxins into the environment, that they are present in meaningful concentrations in the
environment, that these toxins have a known causal effect on human disease, and what set of
policy changes can help improve public health.

This model suggests an obvious guiding narrative to a project, with a very strong human
practices component involving “cultural competencies” working with, and respecting the views
and opinions of an indigenous people, and designing policy change to improve public health.

Furthermore, this project has a clear, concrete “deliverable”– to close the cycle it is necessary to
have an effective field test to gather reliable data about the presence of a specific toxin in the
environment. The first step to do is learn about existing field tests, including “ELISA”31
immunoassay tests. We plan on researching ELISA tests on the internet and visiting a lab at UC
Davis which specializes in immunoassays to learn about the advantages and disadvantages of
31
https://www.healthline.com/health/elisa
these tests. It is our intention to use synthetic biology to create a better test than those currently
available for a specific Chemical of Concern (COC) in the Klamath River/Yurok Tribal Lands.

To do this, we are using a “multidimensional model of betterness,” which is to say that there are
unique advantages and disadvantages of every test. “Better” can mean different things in
different contexts: cheaper, easier to use, safer, easier to produce at scale, more accurate, faster,
provide more detailed data (e.g. quantitative versus qualitative), provide many more data points,
etc. In this context, it is clear that there are many opportunities to develop a “better” test than
those currently available with respect to different dimensions of “betterness.”

A triple venn diagram:
1. CHO cells and mammalian synthetic biology
2. Superfund
3. Honest best attempt to help yurok

The project we designed in May is in the intersection of CHO and Superfund

The project we designed today is in the intersection of Superfund and an honest best attempt to
help the Yurok

Is there anywhere in the middle of all three?

https://openi.nlm.nih.gov/detailedresult.php?img=PMC1175961_gb2005661122&req=4

http://biodynamics.ucsd.edu/
Jeff Hasty at UC San Diego

Michaelis Menten Kinetics for use in modeling
https://en.wikipedia.org/wiki/Michaelis%E2%80%93Menten_kinetics

Email draft:
> Andrew has Suzanne’s contact info. Also check spelling of her name

Hello Suzanne,

This is Jacob from the UC Davis iGEM team. We all wanted to thank you again for hosting us
during the Klamath site visit. Our team is looking to gain more insight into the tribe’s stance on
genetically engineered organisms. A potential path for our project would involve developing a
sensor that utilizes genetically engineered enzymes in order to make a better field test for toxins
and chemicals of concern in the environment.

We would like to know the tribe’s stance on the use of such a device. In the final sensor, there
would be no living cells capable of replicating, and the engineered proteins would not be
exposed directly to the environment, but be entirely contained within the device. After exposure
to high temperatures (approximately 100120º C), the enzymes would be completely deactivated,
and could be disposed of in standard research lab waste.

We look forward to receiving any feedback to ensure the tribe’s values are reflected in our
project.

Jacob Lang
iGEM at UC Davis

15. Overview of project as currently envisioned (Team 6.26.18 )

(notes from second work day)

An idealized finding from our project would be in the form:

“We have evidence to support the finding that (COC) is correlated with the expression of
(reporter genes) coupled with promoters associated with physiological stress (e.g. oxidative) in
mammalian cells.”

^This needs a bit more work ^

“Promoters coupled to a reporter gene can serve as an indicator of physiological stress in
mammalian cells, upon exposure to a chemical of concern.”

Strengths:

This sentence doesn’t overpromise anything. For example, it doesn’t say that these COCs
definitively cause disease in mammals.

Critiques and extensions:

At what concentration of chemical do you get this effect?
What is the specific context in which these measurements were taken?
What is the current consensus on toxic/harmful levels of these chemicals (and does our data
conflict with it)?
Are the conditions which the cultured cells were exposed to representative of conditions which
are found in living systems (how does the bioavailability factor into this?)
What difference is there when the culture is exposed to multiple toxins at once?

Motivation:

After visiting the Yurok Tribe, it became clear that to have a real positive impact regarding their
problems with pollution and health, it would be necessary to draw a clear narrative between
sources of pollution, measurements of a specific toxin in the environment using a high quality
field test, demonstration of an effect on human health at these concentrations, and a specific
policy change.

Polluters –> Environment (Field Test) –> Human Disease –> Policy Change –| Polluters

For best outcomes, every link in this chain needs to be well documented and backed by
substantial evidence/data. It needs to be clear which organizations are responsible for introducing
which toxins into the environment, that they are present in meaningful concentrations in the
environment, that these toxins have a known causal effect on human disease, and what set of
policy changes can help improve public health.

This model suggests an obvious guiding narrative to a project, with a very strong human
practices component involving “cultural competencies” working with, and respecting the views
and opinions of an indigenous people, and designing policy change to improve public health.

After initially focusing on the possibility of developing a new field test to help detect COCs in
the environment, upon further research, it was determined that the current state of the art field
tests, ELISA immunoassays, are of high quality and effectiveness. In light of this finding, we
determined that our efforts were best spent studying the effect of COCs, including chemicals
which have not been previously studied in detail, on the physiological health of mammalian
cells.

A limitation of our research is that we will not be able to show a definitive causal link between
COCs and human disease, but it is our intention to find links between COCs and physiological
stress in mammalian systems, with the hope that our findings may motivate and inform further
studies to find out if there is a causal link between these COCs and human disease.

A possible extension of our research would be to determine the effect of multiple COCs on the
physiological health of mammalian cells. This would be of value in assessing and creating sane
standards for pollution, as organisms in the natural environment are exposed to a variety of
COCs at once, which may not have been previously screened in conjunction with each other. A
possible finding from this might be that COC “A,” at a concentration below what is currently
considered to be harmful, in the presence of COC “B,” also at a concentration below what is
currently considered to be harmful, interact together to trigger a response associated with stress
in mammalian cells.

Next steps of work:

Assemble a list of chemicals of concern in Klamath River/Yurok Tribal Lands

Find out at what concentrations these COCs are found in the environment, what concentrations
are currently deemed harmful and nonharmful. (can talk to ELISA Lab at UCD)

Do a literature review to find data on the bioavailability of these COCs & ask other teams that
have already done work on this project.

Assemble a list of mammalian promoters associated with genes and genetic pathways associated
with physiological stress
https://www.nature.com/articles/nbt.2689 “Engineering dynamic pathway regulation
using stressresponse promoters”

Select a reporter gene (check best practices from mammalian cell biotechnology and
pharmaceutical research)
Tentatively, GFP or similar fluorescence protein

Determine how to insert DNA constructs to mammalian (CHO) cells
Transient plasmid
Viral vector
Chromosomal insertion using CRISPR

Determine/design/characterize the genomic context of our construct (e.g. transcription factors,
location on chromosome if using chromosomal integration)

Create narrative explaining the advantages of using synthetic biology in this specific experiment

“In 2008, the California State Water Resource Control Board noted that conditions on the
Klamath River indicate an ongoing “decline in the river’s water quality and ability to support
healthy fisheries.” The Board also acknowledges that the river has seen noteworthy increases in
toxic bluegreen algae and a general decline in fish populations. Toxic water quality in the
Klamath River is a direct result of both upper basin agricultural development (the draining of
wetlands and intense chemical use), and the presence of PacifiCorp's dams, creating warm,
stagnant pools for algae to develop.
[...]
Microcystin toxins , released by toxic algae, pose significant health risks. Microcystin toxins are
known to cause harmful results ranging from skin rashes and fevers to livestock poisoning and
liver toxicity. Sampling of microcystin toxins in several locations in the Iron Gate and Copco
reservoirs of the KHP since 2004 have revealed hazardous levels of toxic algae above the World
Health Organization recommendation. During JulySeptember of 2005, samples exceeded World
Health Organization levels by 10100 times. Later sampling in July and August of 2006 revealed
that one site exceeded the World Health Organization moderateriskexposure standard by 3,900
times.”32

“Based on our extensive data mining efforts on historical contaminant distribution and effects in
the basin, we found clear evidence that past organochlorine pesticide use was a major source of
avian impacts in the basin, and likely influenced other taxonomic groups as well. The
moratorium on organochlorine pesticide use has resulted in a sharp decrease in exposure, greatly
reducing the likelihood that these compounds still pose a major threat. However, some
compounds have highly recalcitrant degradation products that also are toxic, and may continue to
pose a threat to fauna in the region. Specifically, there is some limited evidence that DDE (a
degradation product of DDT) may still occur in the Upper Basin at 6 concentrations that can
elicit deleterious effects on avian reproduction. However, limited data over the past 20 years
make this difficult to confirm.”33

The website is now up online: http://2018.igem.org/Team:UC_Davis

32
http://www.oregonwild.org/waters/klamath/theklamathriver/klamathriverwaterquality
33

https://www.fws.gov/arcata/fisheries/reports/technical/EaglesSmith%20and%20Johnson%202012_Klama
th%20contaminants_Final_052312.pdf
16. Cenozoic: the age of mammals (Team 6.27.18)

(notes from third work day)

The team name. Cenozoic. We wanted something that had a good sound, that would represent
our team and what was special about our project. After some thought, we decided that the
distinguishing characteristic of our project was that we were working with mammalian cells,
which has been uncommon in iGEM in past years, and poses new opportunities and challenges.
The Cenozoic era is also known as ‘The Age of Mammals,’ in which mammals diversified to fill
a world suddenly lacking dinosaurs. It is our hope that our work will help accelerate the use of
mammalian and other higher eukaryotic strains as hosts in synthetic biology, by helping to lay
some of the groundwork and foundational knowledge in this area. The word Cenozoic is derived
from the greek words for ‘new’ and ‘life,’ which seems to fit very well into the purpose of iGEM
and synthetic biology as a field to use life to create new and wonderful types of tools and
knowledge for the benefit of mankind.

Bios for the wiki
Example from a previous year here

Daniel Graves

Hi, I am a third year Genetics and Genomics B.Sc. student. I plan on pursuing a PhD in Synthetic
Biology after I graduate from UC Davis. Outside of the lab, my interests include writing novels
and running marathons. I also enjoy memes.

Jolee NieberdingSwanberg
Hello, my name is Jolee NieberdingSwanberg. I am a sophomore in the College of Letters and
Sciences at UC Davis. I am intrigued by stem cells, the microbiome, and bacterial cellulose. If
I'm not in lab, I’m running halfmarathons, reading, or eating Thai food.

Ares Torres
Hi, my name is Ares Torres and I am a third year Bio Systems Engineer B.S. student. I plan on
pursuing a career in biotechnology. I am particularly interested in biofuels and composting. I
enjoy gardening, badly playing the guitar, and watching anime.

Jacob Lang

Hello, my name is Jacob Lang and I am a third year Biochemistry and Molecular Biology B. Sc.
student. Once I graduate, I hope to start a biotech company.. Outside of school and science, I like
to do boxing and playing Fortnite.

Achala Rao

Hi! My name is Achala Rao and I am a fourth year Biological systems Engineering major. I aim
to pursue a career in pharmaceutical engineering after graduating from UC Davis. In my free
time, I enjoy painting, reading and watching Netflix.

Advisors:

Dr. Marc Facciotti
■ Ph.D. in Biophysics
■ Department: Biomedical Engineering and UC Davis Genome Center
■ Facciotti Lab Website

Andrew Yao
■ B.S. in Biomedical Engineering
■ M.S. in Biochemistry, Molecular, Cellular, Developmental Biology
■ Department: Biomedical Engineering
■ TEAM/Molecular Prototyping Lab Manager

Link to Go Fund Me:

https://www.gofundme.com/mammaliancellbiosensorfortoxins?teamInvite=fomVCOnRmjX1
4xGmvAHXUdOuzd6oHElGg4R7bL7tExvG6TMjQEWrinBZKXNagnyN

Graphic:

High school student activity for Thursday June 27th

1. Who we are (the iGEM team) and what we are doing
2. Discuss entrepreneurship in biotechnology
a. Recent advances and trends (CRISPR, decreasing cost of sequencing and
synthesis) moving towards lower barriers to entry
b. Exciting new companies we interact with
i. Ravata
ii. MiraculeX
iii. Bolt Threads (Micah, a former student lab manager is now working for
them)
3. Safety briefing (Marc will give this)
4. Bacterial Transformation
a. Explain the underlying scientific theory
b. Explain the protocol (demonstrate use of micropipettes, sterile technique, plating
cultures on agar)
c. Perform the experiment, culture overnight

Cenozoic: iGEM at UC Davis 2018 Bacterial Transformation Lab

In today’s lab we want to:

Demonstrate basic principles of biotechnology by transforming DNA into E. coli cells to change
their phenotype

Tools and disposables Equipment Reagents
1 1000 µL Pipet Centrifuge Competent DH5a cells

1 100 µL or 200 µL Water bath set LB media
Pipet to 42ºC 2 LB + amp/carb plates
1 10 µL Pipet Bunsen burner transforming DNA (plasmid)
1 box of 1000 µL Tips (?)
1 box of 200 µL Tips Cell spreader
1 box of 10 µL Tips
2 14 mL Falcon tube
Bucket of ice

SAFETY and TRASH MANAGEMENT

Materials: Disposable pipet tips; 14 mL conical Falcon tubes; tubes containing transforming
DNA; competent cells; LB media; LB+carb plates

Equipment: Pipettes; centrifuge; ice + ice bucket; water bath

Required PPE: Lab coat, gloves and eye glasses while the wetlab work is happening. Wash
your hands with soap and water before leaving the lab.

Trash and disposal:
All tubes, pipet tips and other disposable lab supplies should be disposed of in the pipet tip
collection containers on the bench top.
Dispose of your used gloves in the bench top tip collection bin or lab’s biotechnology collections
bin.

Hazards: (1) Ensure that all tubes are fully closed before mixing; (2) Ensure that centrifuges
are balanced

Protocol

1. Label and place your two falcon tubes on ice. ☐
2. Ask an iGEM team member for your competent cells. Transfer the tube to an ice bath.
Store the cells on ice for 10 minutes. ☐
3. Gently transfer 50 µL of competent cells to the BOTTOM of each of your falcon tubes.
Store the cells on ice. ☐ (probably want to spin the tubes first, before pipetting out the
cells)
4. Moving your pipette tip in a GENTLE circular motion, gently add 2.5 µL of
transforming DNA directly to the suspended cells in the bottom of your tube. (The
volume of your transforming DNA should not exceed 5% of the volume of competent
cells) Store the tubes on ice for 15 minutes . ☐ (spin the DNA first before you pipet it
out. it is probably in a solution with a buffer)
1. Transfer the tubes to a rack placed in a preheated 42°C water bath. Store the tubes in the
rack for exactly 45 seconds . Do not shake the tubes. ☐
2. Rapidly transfer the tubes back on ice. Allow the cells to cool for 12 minutes. ☐
3. Add 800 µl of LB medium to each tube (at the bunsen burner station). Transfer the tubes
to a shaking incubator set at 37°C . Incubate the cultures for 45 minutes to allow the
bacteria to recover and to express the antibiotic resistance marker encoded by the
plasmid. ☐ (what is the purpose of the bunsen burner?)
4. Transfer 200 µl of transformed competent cells onto agar LB + carb plates. ☐
5. Invert the plates and incubate them at 37°C . Transformed colonies should appear in
1216 hours . ☐ (you can confirm visually that transformation occurred)
————————
Simplified diagram of transformation protocol (some steps are left out)

Action items

Interlab study (June 29)
Safety forms to send in (June 29)
Gold medal requirements
High school outreach activity (Thursday 11 AM 1 PM)
Website
Go Fund Me
Experiment Design
Fill out Bios for the wiki

17. Safety Sheet (Team 6.28.18)

iGEM Safety Form (6.28.18)

1. Please upload a photo or two of your lab to the iGEM 2018 server (include your team name in
the file name), preferably showing the relevant safety features and paste the link here:

http://2018.igem.org/wiki/images/d/d2/TUC_Davisbleep.jpg

http://2018.igem.org/wiki/images/c/cd/TUC_Davisblec.jpg

http://2018.igem.org/wiki/images/8/86/TUC_DavisIMG_6204.jpg

2. Describe the goal of your project: what is your engineered organism supposed to do? Please
include specific technical details and names of important parts.

Our project this year is to find evidence that certain pesticides/herbicides/algae toxins
cause physiological stress using stress pathways in mammalian cells. We will use promoters
from mammalian cells which are active in physiological stress pathways, coupled to a
reporter gene (GFP), and measure the activity of the gene in presence of environmental
toxins.

3. iGEM has developed a Risk Assessment Tool to help you identify possible risks to you, your
colleagues, communities, or the environment. We encourage you to use this tool before filling in
this part of the form. What are you using / planning to use? Some organisms and parts present
risks beyond what is ordinary for lab work in synthetic biology. As your project progresses, you
should consider the risks presented by each organism and part you plan to use.

Which whole organisms, including viruses, are you planning to use or using in your project?
Please provide as much detail as possible (such as strain information). If you are not using an
organism, please note this.

We will be using the DH5a strain of E. coli..

4. What risks could these organisms pose to you or your colleagues, or to your community or the
environment if they escape the lab?
If you are not using an organism, please note this.

Since the strain of E. coli is nonpathogenic, there is little to no danger posed to colleagues,
the community, or environment if they were to escape the lab.

5. What is your chassis organism?
For the purposes of iGEM, a chassis is the organism in which you are putting your parts, or
which you are modifying in your project. Many teams will use a common lab organism as a
chassis. Some teams may use a more exotic organism. Some project may not involve a chassis.
Escherichia coli (give names of all strains you are using): DH5a

Others : Chinese Hamster Ovarian Cells (Cricetulus griseus)

Comments : We also hope to test other cell lines but we have not yet determined which of the
other mammalian cell lines will work best for our purpose.

6. What risks could your chassis pose to you or your colleagues, or to your community or the
environment if they escape the lab?
If not using a chassis organism, please note this.

The threats posed by the CHO cells would be minimal. Mammalian cells are optimized to
live inside of mammals, and are not likely to survive in the natural environment or infect
other mammals. We will also be using E. coli in our experiments to replicate DNA. We are
only going to be using nonpathogenic strains of E. coli.

What parts are you making or planning to make?
This part of the of the form is for you to tell us about the parts you are planning to make or have
developed during your project. It summarises information that might already have been
submitted through Checkin forms . If you submitted a CheckIn form for an organism or part,
you should still include it in this section. You may omit nonproteincoding parts (except if they
are known virulence or antimicrobial factors – you should undertake a literature search to
determine if they are), and you may omit parts that were already in the Registry if you are using
them without significant modifications. For more information on virulence factors see the Safety
Policy page and the White List . If there are major changes to your project after June 29, please
contact the Safety and Security Committee by emailing safety AT igem DOT org.

7. As part of your project, are you are planning to make / have made new parts or substantively
changed existing parts in the Registry.

Yes (All relevant new or revised parts should be described on a spreadsheet)

8. Part information is submitted in a spreadsheet.

Please visit this page to download a blank copy of the spreadsheet for this question. (If you need
a CSV version instead of XLSX, visit this page.)
Instructions for parts spreadsheet: Remember to change the filename of your spreadsheet! Put
your team's name in place of "TeamName".
A. Species name (including strain): For an organism, give the scientific name of the species.
Include a strain name or number (such as "K12" for E. coli K12) if there is one. For a part, give
the name and strain of the organism that the part originally came from.
B. Risk Group: Give the Risk Group of the organism in column A. You may use a categorization
according to your home country, according to the USA, or according to the WHO. If the
organism falls into an 'inbetween' or special category such as 2+ or 2Agricultural, explain this
category in the Notes column. If you cannot find any Risk Group categorization for this
organism, write "N/A" and explain in the Notes column. (Multicellular organisms generally do
not have a Risk Group.)
C. Risk Group Source: Cite the source from which you obtained the Risk Group information. See
Risk Group Guide for recommended sources. If you got the information from the Canadian
PSDS, from the NIH Guidelines, or from the DSMZ catalogue, you may simply write "PSDS",
"NIH", or "DSMZ". Otherwise, please give a web link or a full citation for your source.
D. Disease risk to humans: Does this organism cause any disease in humans? If yes, what disease
does it cause?
E. Disease or other risks to the environment: Does the organism cause plant or animal diseases or
would in any other way pose a risk to the environment if accidentally released?
F. Part number/name:For a part: If it has a Registry part number (like BBa_XXXXX), write that
number. If it has no Registry part number, give a short name for the part. (For example: "Actin",
"Alcohol Dehydrogenase".) For a whole organism, leave this column blank.
G. Natural function of part: For a part: Briefly describe what the part does in its parent
organism. (If it is an enzyme, what reaction does it catalyze? If it is a receptor, what molecules
does it bind to? Etc.) For a whole organism, leave this column blank.
H.How did you acquire it: Describe how you acquired the organism/part. If you have not
acquired it yet, describe how you plan to acquire it. (For example: did you receive the part DNA
from another lab? Did you order the part DNA from a synthesis company? Did you use PCR to
isolate the part from genomic DNA of its parent organism? Did you order the cell line from a
company?)
I. How will you use it: Describe how you are using the organism/part in the lab. (For
example: "This organism is our chassis." "This part senses when the cells are exposed to
glucose." "This organism is the source for a part that we are isolating by PCR." "This part
produces the toxin which our biosensor is designed to detect.")
J. Notes: Use this column to give any additional information that is necessary.
Upload Spreadsheet Please do not change the "Destination Filename"!
[File:TTeamNameSafety2018_Spreadsheet.xls] You may upload multiple versions of your
spreadsheet, using the same Destination Filename. The wiki software will keep track of different
versions, and list them in chronological order.

In spreadsheet

9. What experiments will you do with your organisms and parts?
Please explain briefly. We are particularly keen to understand the boundaries or scope of your
project. You should include the names of species / cell lines / strains. You should include
experiments involving parts taken from other organisms, even if they are being synthesized
rather than isolated from nature – you need not include any parts already in the registry.

We will make a sensor for physiological stress in mammals by coupling a mammalian
promoter associated with stress pathways to a reporter gene (GFP) and cloning this genetic
construct into CHO cells (Cricetulus griseus).

10. What risks could arise from these experiments?
For example, could they produce aerosols making it more likely that you could inhale
something? Or are you using needles and could accidentally stick yourself? Could you produce
something that is not inactivated using standard lab protocols? If you are not conducting any
experiments, please note this.

We will be working in a biological safety cabinet when handling CHO cells, however if we
are exposed to CHO cells which have been subject to contamination, there is a possibility of
exposure to pathogens.

11. Imagine that your project was fully developed into a real product that real people could use.
How would people use it?
Check all appropriate boxes and expand in the comments section. (Note: iGEM teams should not
release modified organisms into the natural environment but you could imagine such a release if
your project was fully developed.)

Our project is foundational / we do not have a specific realworld application in mind
(Examples: library of standardized promoters, system for communication between cells)
Only in the lab (Examples: reporter strain for measuring the strength of promoters)

Our project would only be used in the lab to determine the effects of environmental toxins
on the physiological health of mammalian cells

12. What safety, security or ethical risks would be involved with such a use?
● It is possible that software projects could also pose relevant risks.

This use involves minimal risks to safety, security, or ethics.

13. How will experts overseeing your project help to manage any of the risks you identified in
this form?

Andrew Yao, the lab manager, is responsible for overseeing that the safety protocols are
met. As a professional lab manager and advisor for previous iGEM teams, our lab manager
has the necessary expertise and knowledge to assist us with our project.

14. What rules or guidance cover your work which could help to manage any of the risks you
identified in the last section?
For example: In your country / region, what are the laws and regulations that govern biosafety or
biosecurity in research laboratories? Please give a link to these regulations, or briefly describe
them if you cannot give a link. What are the guidelines for laboratory biosafety and biosecurity?
Please give a link to these guidelines, or briefly describe them if you cannot give a link.

https://www.dir.ca.gov/title8/sb7g16a107.html

https://safetyservices.ucdavis.edu/article/biologicaluseauthorizationbua

15. Have your team members received any safety training?
For the purposes of iGEM, biosafety and biosecurity training covers the procedures and practices
used to manage risks from accidents or deliberate misuse of your projects to your team,
colleagues, communities and the environment. All team members are expected to be aware of
these risks and to work to manage them.

Yes, we have already received safety training.
Yes, we have already received security training.

16. Please select the topics that you learned about (or will learn about) in your safety training.

Lab access and rules (including appropriate clothing, eating and drinking, etc.)
Responsible individuals (such as lab or departmental specialist or institutional biosafety
officer)
Differences between biosafety levels
Biosafety equipment (such as biosafety cabinets)
Good microbial technique (such as lab practices)
Disinfection and sterilization
Emergency procedures
Transport rules
Physical biosecurity
Personnel biosecurity
Dualuse and experiments of concern
Data biosecurity
Chemicals, fire and electrical safety

17. Which work areas do you use / are you using to handle biological materials?
Please check all the containment provisions you are using. If you are using more than one space
please check all that apply and note this in the other work area box.

Open bench
Biosafety cabinet (please note there are important differences between biosafety cabinets
and laminar flow hoods / clean benches. iGEM encourages the use of biosafety cabinets but
discourages the use of laminar flow hoods or clean benches)

Other work area. Please describe:
Genome Biomedical Sciences Facility may use other general lab, dry ice stored here

18. What is the biosafety Level of your lab?

Level 1 (low risk)

19. How will the rules, training, containment and other procedures and practices help to manage
any of the risks you identified in the last section?
Please give details of any steps you have taken to manage any risks identified. This might
include things you deliberately didn't do. For example, if you are not conducting any
experiments, especially on grounds of safety, security or as a responsible scientist / engineer,
please note this. Examples might include, making sure you only use nonpathogenic strains of an
organism, deciding that animal use experiments are not yet warranted, or avoiding plant infection
experiments because the affected plant is found in your country.

Please also consider waste treatment – how will you know that any waste produced in your
project will be successfully activated?

We are making sure to use only nonpathogenic E. coli strains, and all work with CHO cells
will be done in a biological safety cabinet. Biological waste including cells will be
autoclaved and disposed of using standard biological research waste streams at our
university.

20. Are you planning / have released any organism or product derived from your project?
For the purposes of iGEM, release includes putting any engineered organism or product from one
into the environment, yourselves or volunteers (including by eating or drinking), or into a device
that will be placed in the environment.
No
Yes
STOP: Release is not allowed in iGEM. For more information see the policy page . Please contact
the Safety and Security Committee by emailing safety AT igem DOT org

21. Are you planning to make / or have made a gene drives?
For the purposes of iGEM, a gene drive includes Cas9 (and other endonucleases, such as dCas9
and Cpf1) integrated into the genome (including through the use of gRNA) of a sexually
reproducing eukaryotic organisms (including organisms that reproduce both sexually and
asexually, such as yeast) and/or the use of a drive to impact the progeny.

No
Yes

STOP: Gene Drives are not allowed in iGEM projects without a special exception from the
Safety and Security Committee. For more information see the policy page and the White List .
Please contact the Safety and Security Committee by emailing safety AT igem DOT org

22. Are you planning / have used resistance factors (or associated sequences) for critically or
highly clinically important antimicrobials, as listed by the World Health Organization?
For the current list of these antimicrobials see the table on p10 of this report . You need NOT
include any resistance factors included in iGEM’s distribution kit.

No
Yes

STOP: Before you acquire or use resistance factors and associated sequences for critically or
highly clinically important antimicrobials, you must submit a CheckIn form . CheckIns allow
the iGEM Safety and Security Committee to help you ensure that you will work safely with these
riskier organisms/parts. The Safety and Security Committee will base its review on the
information you provide – please provide as much information as possible and use references as
appropriate.

23. Are you planning to use, or using any animals (including insects and invertebrates) not on the
Whitelist?

No
Yes

STOP: Before you acquire or use any animal NOT on the Whitelist , you must submit a
CheckIn form . CheckIns allow the iGEM Safety and Security Committee to help you ensure
that you will work safely and responsible with these organisms. The Safety and Security
Committee will base its review on the information you provide – please provide as much
information as possible and use references as appropriate.

24. Are you planning to use / have used any vertebrates (e.g. rats, mice, guinea pigs, hamsters) or
higher order invertebrates (e.g. cuttlefish, octopus, squid, lobster)?

No
Yes

STOP: Before you acquire or use any vertebrate you must submit an Animal Use form . The use
of animals is not allowed in iGEM projects without a special exception from the Safety and
Security Committee. For more information see the policy page and the White List . Please contact
the Safety and Security Committee by emailing safety AT igem DOT org

25. Are you planning to use, or using any parts not on the Whitelist?

No
Yes

STOP: Before you acquire or use any part that is NOT on the Whitelist, you must submit a
CheckIn form . CheckIns allow the iGEM Safety and Security Committee to help you ensure
that you will work safely with these riskier parts. The Safety and Security Committee will base
its review on the information you provide – please provide as much information as possible and
use references as appropriate.

26. Are you planning to use, or using any parts or organisms obtained from outside the lab or
regular suppliers?

No
Yes

STOP: Before you acquire or use any organism/part that has come from outside the lab or regular
suppliers, you must submit a CheckIn form . CheckIns allow the iGEM Safety and Security
Committee to help you ensure that you will work safely with these riskier organisms/parts. The
Safety and Security Committee will base its review on the information you provide – please
provide as much information as possible and use references as appropriate.

27. What else can you tell us about any risks associated with your project, how you are managing
them, or your compliance with iGEM’s safety and security rules and policies?
This can include any improvements you would like to see to our safety and security efforts, or
anything that has not been sufficiently clear, or where additional guidance would be useful, or
where you see important uncertainties.

We are dedicated to following the safety and security rules of our university and the iGEM
competition, as well as applicable state and national standards. Our efforts include
designing an experiment which minimizes risk and exposure to hazardous substances and
cells, working in an appropriate setting, and being properly trained by safety officers at
our university.

The information above will save automatically. Please fill as much information as possible by
June 29, 2018


18. Experiment Design (Team 6.29.18)

Info on Assays:
Comparison of different reporter assays;
https://www.thescientist.com/technologyprofile/choosingthebestreporterassay54442

The link above made it seem like a luciferase assay might be a really good option. It can be
sensitive to less than 10 20 mol of luciferase and it’s not posttranslational modified, so luciferase
activity is closely coupled to protein synthesis. However, after talking to Marc about it, he
believed that we should just start with GFP because it’s much easier to use than the luciferase
assay.

A fairly comprehensive review of GFP Reporter Assays: Includes protocols for Direct Colony
Examination, Fluorescence Microscopy, Fluorometry, and Flow Cytometry
http://www.springerprotocols.com/Full/doi/10.1385/1592594093:297?encCode=REZJOjc5Mj
ozLTkwNC05NTI5NS0x&tokenString=EJJDXmLMVn+e5FrtbwG2HA==

StressRelated Pathways (Oxidative, Heat Shock, etc.)

https://www.nature.com/articles/nbt.2689 “Engineering dynamic pathway regulation
using stressresponse promoters
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3155297/ “Cellular stress response
pathways and ageing: intricate molecular relationships”
https://www.ncbi.nlm.nih.gov/pubmed/15163548 Calabrese EJ (2004) Hormesis: from
marginalization to mainstream: a case for hormesis as the default doseresponse model in
risk assessment. Toxicol Appl Pharmacol 197: 125–136
https://www.hindawi.com/journals/ijcb/2010/214074/ “Cellular Stress Responses: Cell
Survival and Cell Death”
https://www.ncbi.nlm.nih.gov/pubmed/28182330/ “Heatshock protein 27 (HSP27,
HSPB1) is synthetic lethal to cells with oncogenic activation of MET, EGFR and BRAF.”
https://www.uniprot.org/uniprot/?query=heat+shock+protein+%22beta+1%22+chinese+h
amster&sort=score POSSIBLE HSP 27 gene
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4336284/ “Activity of Heat Shock
Genes’ Promoters in Thermally Contrasting Animal Species”
https://www.ncbi.nlm.nih.gov/gene/3315 “HSPB1 heat shock protein family B (small)
member 1 [ Homo sapiens (human) ]”


Chemicals of Concern in the Klamath River Basin:

Chemical class Chemicals of concern
Herbicides Triazines (atrazine, simazine and others),
thiocarbamates (molinate, thiobencarb),
paraquat, bentazon, bromacil, ureas
(monuron, diuron, linuron)
Insecticides Acephate, carbaryl, fipronil, pyrethroids
(esfenvalerate, permethrin, fenpropathrin,
cypermethrin, deltamethrin),
Pesticides organochlorine pesticides, warfarin
Personal care products and pharmaceuticals Triclosan, triclocarban, warfarin
Flame retardants Polybrominated diphenyl ether47,
tetrabromobisphenol A
Industrial chemicals Naphthalene, nitrophenols,
2,3,7,8tetrachlorodibenzodioxin
Biomarkers of exposure Triazine metabolites (OHtriazine,
NDealkylated, triazine mercapturates),
triclosan glucuronides, phenyl and thiophenyl
glucuronide, Naphthol, Pyrethroids
(3phenoxybenzoic acid, fenvaleric acid,
permethric acid), Fipronil metabolites.
Naturally occuring toxins Microcystin toxins

A cursory search shows that most of these are readily available from standard reagent suppliers,
as shown below:

Selected chemicals of concern Supplier
Triclosan Sigma Aldrich
Naphthalene Sigma Aldrich
Microcystin Sigma Aldrich
Warfarin Sigma Aldrich

More information on organochlorine pesticides :
“The two main groups of organochlorine insecticides are the DDTtype compounds and the
chlorinated alicyclics. Their mechanism of action differs slightly.
● The DDT like compounds work on the peripheral nervous system. At the axon's
sodium channel, they prevent gate closure after activation and membrane
depolarization. Sodium ions leak through the nerve membrane and create a
destabilizing negative "afterpotential" with hyperexcitability of the nerve. This
leakage causes repeated discharges in the neuron either spontaneously or after a
single stimulus.
● Chlorinated cyclodienes include aldrin, dieldrin, endrin, heptachlor, chlordane and
endosulfan. A 2 to 8hour exposure leads to depressed central nervous system (CNS)
activity, followed by hyperexcitability, tremors, and then seizures. The mechanism of
action is the insecticide binding at the GABA A site in the gammaAminobutyric acid
(GABA) chloride ionophore complex, which inhibits chloride flow into the nerve.
● Other examples include dicofol, mirex, kepone, and pentachlorophenol. These can be
either hydrophilic or hydrophobic, depending on their molecular structure.”34

Hormesis
“ Hormesis is a term used by toxicologists to refer to a biphasic dose response to an
environmental agent characterized by a low dose stimulation or beneficial effect and a high dose
inhibitory or toxic effect. In the fields of biology and medicine hormesis is defined as an adaptive
response of cells and organisms to a moderate (usually intermittent) stress. Examples include
ischemic preconditioning, exercise, dietary energy restriction and exposures to low doses of
certain phytochemicals. Recent findings have elucidated the cellular signaling pathways and
molecular mechanisms that mediate hormetic responses which typically involve enzymes such as
kinases and deacetylases, and transcription factors such as Nrf2 and NFκB. As a result, cells
increase their production of cytoprotective and restorative proteins including growth factors,
phase 2 and antioxidant enzymes, and protein chaperones. A better understanding of hormesis
mechanisms at the cellular and molecular levels is leading to and to novel approaches for the
prevention and treatment of many different diseases.”35

Heat shock proteins
“Heat shock proteins (HSP) are a family of proteins that are produced by cells in response to
exposure to stressful conditions. They were first described in relation to heat shock, but are now
known to also be expressed during other stresses including exposure to cold, UV light, and
during wound healing or tissue remodeling. Many members of this group perform chaperone
function by stabilizing new proteins to ensure correct folding or by helping to refold proteins that
were damaged by the cell stress. This increase in expression is transcriptionally regulated. The
dramatic upregulation of the heat shock proteins is a key part of the heat shock response and is
induced primarily by heat shock factor (HSF). HSPs are found in virtually all living organisms,
from bacteria to humans.”36

The promoter regions of HSP 27 and 70 are the most applicable
34
https://en.wikipedia.org/wiki/Organochloride
35
36
https://en.wikipedia.org/wiki/Heat_shock_protein

“Production of high levels of heat shock proteins can also be triggered by exposure to different
kinds of environmental stress conditions, such as infection, inflammation, exercise, exposure of
the cell to toxins (ethanol, arsenic, trace metals, and ultraviolet light, among many others),
starvation, hypoxia (oxygen deprivation), nitrogen deficiency (in plants), or water deprivation.
As a consequence, the heat shock proteins are also referred to as stress proteins and their
upregulation is sometimes described more generally as part of the stress response.”37

“Living cells are continually challenged by conditions which cause acute and chronic stress. To
adapt to environmental changes and survive different types of injuries, eukaryotic cells have
evolved networks of different responses which detect and control diverse forms of stress. One of
these responses, known as the heat shock response, has attracted a great deal of attention as a
universal fundamental mechanism necessary for cell survival under a variety of unfavorable
conditions. In mammalian cells, the induction of the heat shock response requires the activation
and translocation to the nucleus of one or more heat shock transcription factors which control the
expression of a specific set of genes encoding cytoprotective heat shock proteins. The discovery
that the heat shock response is turned on under several pathological conditions and contributes to
establish a cytoprotective state in a variety of human diseases, including ischemia, inflammation,
and infection, has opened new perspectives in medicine and pharmacology, as molecules
activating this defense mechanism appear as possible candidates for novel cytoprotective drugs.
This article focuses on the regulation and function of the heat shock response in mammalian cells
and discusses the molecular mechanisms involved in its activation by stress and bioactive
cyclopentenone prostanoids, as well as its interaction with nuclear factor κB, a stressregulated
transcription factor with a pivotal role in inflammation and immunity.”38

Note: we can also test our stress sensor against heat, cold, hypoxia, starvation, water deprivation.
(We aren’t allowed to use radiation).

“HSPB1 heat shock protein family B (small) member 1 [ Homo sapiens (human) ]”
https://www.ncbi.nlm.nih.gov/gene/3315

Genetic element Purchase link
37
https://en.wikipedia.org/wiki/Heat_shock_protein

38
https://www.sciencedirect.com/science/article/pii/S0006295299002993?via%3Dihub
pDRIVE bearing mouse HSP70 promoter https://www.invivogen.com/pdrivehsp70
Lucia (we can just synthesize the promoter using
IDT and put it into a plasmid or use CRISPR
with it)

Past iGEM projects which have worked with mammalian cells (23):

CHO cells
http://2017.igem.org/Team:TECHNIONISRAEL/cell_lines

http://2017.igem.org/Team:NEUChina
http://2016.igem.org/Team:SYSUCHINA
http://2017.igem.org/Team:CPU_CHINA
http://2013.igem.org/Team:HZAUChina
http://2013.igem.org/Team:Hong_Kong_HKUST

http://2012.igem.org/Team:Warsaw
http://2010.igem.org/Team:Warsaw

http://2010.igem.org/Team:MIT

http://2010.igem.org/Team:Purdue
http://2009.igem.org/Team:Purdue

http://2013.igem.org/Team:Freiburg
http://2013.igem.org/Team:GeorgiaTech
http://2013.igem.org/Team:UCLA
http://2011.igem.org/Team:McGill
http://2011.igem.org/Team:Penn
http://2011.igem.org/Team:DTUDenmark2
http://2012.igem.org/Team:EPFLausanne
http://2012.igem.org/Team:NRPUEANorwich
http://2012.igem.org/Team:Slovenia
http://2009.igem.org/Team:Heidelberg
http://2016.igem.org/Team:Duesseldorf

19. Notes from work day (Team 7.2.18)
Target genes
Promoter mouse sequence
Mouse HSPB1 CCCTGAGACGGTCATTG
CCATTAATAGAGACCTG
AAGCACCGCCTGCTAAA
AATACCCG39
Heat Shock Protein 7040 Not found
HSP90AA141 Implicated in cancer gctgggcgggcccgcctctatataagg

ccggcgcagggggcggcgcgccAG
TTGCTTCAG42
HSP90AB143 Implicated in cancer. Might ccgggctgtgcttcgccttatatagggcg

be constitutively expressed. gtcgggggcgttcgggagctCTCTT
GAGTCA44
HSP90AA245 Not found
HSP90B1 cccgcccgcaagcagtggggtgaaaa
gcggcccgacctgcgcgcggcttAG
TGGGCGGAC46
GADD45α Implicated in cancer; [slightly uncertain]

Genotoxic stress
GGCTGAGGGCTAGCCCC
ATATCTCCGGAATCGGG
CCCTTTGTCCTCCAGTG
GC47
39
See data from BLAST in following pages of notebook
40
https://en.wikipedia.org/wiki/Hsp70
41
https://en.wikipedia.org/wiki/Heat_shock_protein_90kDa_alpha_(cytosolic),_member_A1
42
https://epd.vitalit.ch/cgibin/get_doc?db=mmEpdNew&format=genome&entry=Hsp90aa1_1
43
https://en.wikipedia.org/wiki/HSP90AB1
44
https://epd.vitalit.ch/cgibin/get_doc?db=mmEpdNew&format=genome&entry=Hsp90ab1_1
45
https://en.wikipedia.org/wiki/HSP90AA2
46
https://epd.vitalit.ch/cgibin/get_doc?db=mmEpdNew&format=genome&entry=Hsp90b1_1
47
Used BLAST of homo sapiens promoter from EPD
https://epd.vitalit.ch/cgibin/get_doc?db=hgEpdNew&format=genome&entry=GADD45A_1 to find Mus
musculus promoter. Not 100% confident with this sequence because the GADD gene is located 157 bp
on the 5’ side of the promoter
HMOX1 Oxidative stress accacgtgacccgcgtacttaaagggct

ggcgcgggcagctgctcgctcACG
GTCTCCAG48
CYP1A1 Metabolic stress
CDKN1A

Additional links found:
https://www.sciencedirect.com/science/article/pii/0955067495800638

HSP 27 promoter sequence in drosophila (581 bp)
https://www.ncbi.nlm.nih.gov/nuccore/8117

HSP 27 gene sequence: mouse
http://www.informatics.jax.org/sequence/OTTMUSG00000024281

Example of mouse model being used in human toxicology studies:
http://www.clinexprheumatol.org/article.asp?a=4843

HMOX1 gene sequence: mouse
https://www.uniprot.org/uniprot/P14901
http://cancerres.aacrjournals.org/content/canres/51/3/974.full.pdf

GADD45α gene sequence: mouse

CYP1A1 gene sequence: mouse
48
https://epd.vitalit.ch/cgibin/get_doc?db=mmEpdNew&format=genome&entry=Hmox1_1

“Most of the heat shock genes analysed have HSEs within 30 bp of their TATA box (Pelham,
1985). The Drosophila hsp27 gene is an exception, in that no good homology to the HSE
sequence lies within the first 270 bp of 5'flanking sequence (Ingolia and Craig, 1981; Southgate
et al., 1983). Moreover, unlike the Drosophila hsp70 gene, it is not heat inducible when
transfected into mammalian cells (Pelham and Lewis, 1983; Ayme et al., 1985). The experiments
reported here were designed to locate regulatory elements in the hsp27 promoter and to
determine why they do not allow expression in mammalian cells.”

Induction of Chinese Hamster HSP27 Gene Expression in Mouse Cells Confers Resistance to
Heat Shock
http://www.jbc.org/content/268/5/3420.full.pdf
They used Metallothionein promoter, which is from a pathway sensitive to heavy metal
toxicity and oxidative stress49

iGEM Requirements
Interlab Study Requirement Details
http://2017.igem.org/Competition/InterLab_Study/Plate_Read er

Letters to Senator and environmental Toxicologists

Sent to Dobbs, Harris, Feinstein, McGuire...

Subject: iGEM at UC Davis wants to take on policy change via aiding indigenous peoples and
Superfund sites

Hello Senator _______,
My name is Jolee Nieberding Swanberg, I am a rising sophomore on the iGEM (an inter
49
https://en.wikipedia.org/wiki/Metallothionein
national synthetic biology competition) team at University of California, Davis. Our research this
year is focused on using stress pathways in mammalian cells as a biosensor to detect
physiological stress. We hope our research will result in evidence that can aid indigenous peoples
in their fight to change current environmental toxicology regulations as they are not sufficient in
protecting the peoples' health nor keeping the environment in its original state. We would
appreciate your help in pointing us in the right direction so we can help implement the necessary
policy changes.

Thank you for your time,

Sent to Wood, Dension, Shibamoto

Subject: iGEM

Hello Dr. ______,
My name is Jolee NieberdingSwanberg, I am a rising sophomore on the iGEM (an inter
national synthetic biology competition) team at University of California, Davis. Our research this
year is focused on using stress pathways in mammalian cells as a biosensor to detect
physiological stress from environmental toxins. We hope our research will result in evidence that
can aid indigenous peoples in their fight to change current environmental toxicology regulations
as they are not sufficient in protecting the peoples' health nor keeping the environment in its
original state. We would really appreciate the input of a toxicologist and noticed you have
experience with ________________________. If you are interested and available please let us
know, we would love to meet with you.

Thank you for your time,


Use the Eukaryotic Promoter Database50

50
https://epd.vitalit.ch/index.php
We wanted HSP27 promoter from mouse.
We had access to the sequence for drosophila and homo sapiens. So we took the homo sapiens
sequence (ccctcaaacgggtcattgccattaatagagacctcaaacaccgcctgctAAAAATACCCG51) and used
BLAST to find a homologous sequence in Mus musculus. We found a promoter candidate
( CCCTGAGACGGTCATTGCCATTAATAGAGACCTGAAGCACCGCCTGCTAAAAATAC
CCG) with a feature 98 bp at 3' side: heat shock protein beta152 . This sequence has a similarity
of 55/60 nucleotides with the homo sapiens promoter.
51

https://epd.vitalit.ch/cgibin/query_result.pl?out_format=NICE&from=499&to=100&Entry_0=HS_HSPB1_
1
52

https://www.ncbi.nlm.nih.gov/nucleotide/NC_000071.6?report=gbwithparts&from=135888059&to=135889
430&RID=KR93JH6J014

Notes about p21 gene: “Recent work exploring p21 activation in response to DNA
damage at a singlecell level have demonstrated that pulsatile p53 activity leads to
subsequent pulses of p21, and that the strength of p21 activation is cell cycle phase
dependent.[28] Moreover, studies of p21levels in populations of cycling cells, not
exposed to DNA damaging agents, have shown that DNA damage occurring in mother
cell Sphase can induce p21 accumulation over both mother G2 and daughter G1 phases
which subsequently induces cell cycle arrest;[29] this responsible for the bifurcation in
CDK2 activity observed in Spencer et al..[15]”

● Review of small heat shock proteins:
The human small HSP family contains ten members and one related protein
(HSP16.2/HSPB11). Some are ubiquitously expressed while others are only expressed in
specific tissues.

HSPs, their names, and their locations

Protein Alternati Human Molecular Tissue Diseases
name a ve name gene ID mass (kD) distributio
n
HSPB1 HSP27 3315 22,3 Ubiquitous Neuropathy, Cancer,

Ischemia/reperfusion
HSPB2 MKBP 3316 20,2 Heart and Myopathy, Ischemia/reperfusion

muscle
HSPB3 HSPL27 8988 17,0 Heart and

muscle
HSPB4 CRYAA 1409 19,9 Eye lens Cataract
HSPB5 CRYAB 1410 20,2 Ubiquitous Neuropathy, Myopathy,

Ischemia/reperfusion, Cancer,
Cataract
HSPB6 HSP20 126393 17,1 Ubiquitous Neuropathy, Ischemia/reperfusion

HSPB7 cvHSP 27129 18,6 Heart and

muscle
HSPB8 Hll and 26353 21,6 Ubiquitous Neuropathy, Cancer, Ischemia

HSP22
HSPB9 CT51 94086 17,5 Testis Cancer
HSPB1 ODF1 4956 28,4 Testis

0
HSPB1 HSP16.2 51668 16,3 Placenta Cancer

1
a
Table based on Kampinga et al. (2009) and Van de Schootbrugge and Boelens (2010) .

“Results the hsp27 promoter requires extensive 5 'flanking sequences for full activity ”
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC1166991/pdf/emboj001700237.pdf
This paper discusses upstream regulatory elements which increase activity of the HSP27 gene
It says that HSP27 is not heat inducible in mammalian cells

● Paper recommended by Marc: https://www.ncbi.nlm.nih.gov/pubmed/21885784
○ “Multiinput RNAibased logic circuit for identification of specific cancer cells”

https://currentprotocols.onlinelibrary.wiley.com/doi/full/10.1002/0471142735.ima01ts58

42ºC for heat shock

“ Heat shock treatments (42°C) for subsequent analysis were conducted by shifting cells from
28°C to prewarmed flasks at 42°C for various time lengths as indicated in the figure legends.”53

https://www.degruyter.com/view/j/bchm.2008.389.issue10/bc.2008.150/bc.2008.150.xml
53

http://genesdev.cshlp.org/content/13/6/633.long
https://en.wikipedia.org/wiki/FourU_thermometer
https://en.wikipedia.org/wiki/Repression_of_heat_shock_gene_expression_(ROSE)_element

MEETING WITH DR. DAN TANCREDI
Do you have information regarding bioavailability of these chemicals?

What do you do in the project? (what is your role in the context of this project?)
Statistician. Clinical research, testing wellformulated
Design sampling plans, help clinical studies in collecting data and carrying out statistical
analysis
Has team
What data do you have? What does it mean?

What can you share with us?

Who is in charge of the ELISA labs? (Jim Trimmer)

Our project would likely best fit in conjunction with the (Thomas Young?) lab. Do they
have


“In multicellular organisms, smHSPs are among the most highly induced heat shock proteins
under stress conditions, and some smHSPs may also be subject to developmentally regulated
expression in the absence of stress, as first noted in Drosophila studies ( 8 ). Studies on the
protective effect of mammalian hsp27 revealed that cells overexpressing this protein were mainly
resistant to the heatinduced disruptions seen in the microfilament lattice ( 910 ), and it was
suggested that actin might be a major target of the protective effect of hsp27 ( 10 ). Subsequent
work suggested that this protective effect was dependent on the ability of hsp27 to be
phosphorylated in vivo ( 11 ). Recently, hsp27 was found to interfere with apoptosis induced by
tumor necrosis factor α, probably by decreasing the level of reactive oxygen species and
increasing the level of glutathione ( 12 ). This protective function was found to be dependent on
the formation of large hsp27 aggregates, and in contrast to the earlier work, mutants of hsp27 in
which key phosphorylation sites were eliminated also formed large aggregates and conferred
protection against tumor necrosis factor α ( 13 ). The ability to form large aggregates is a property
of most smHSPs, however, and is not necessarily dependent upon phosphorylation, since some
members of this family are not phosphorylated ( 14 ).54”

Cellular Models for In Vitro Toxicity Testing :
https://link.springer.com/chapter/10.1007/9783642804120_21

Chapter 3 Models and Methods for In Vitro Toxicity:
https://www.sciencedirect.com/science/article/pii/B9780128046678000031
“These in vitro model systems used in toxicity testing have diverse advantages together with the
decrease in the number of animals, the reduced price of animal maintenance, as well as small
amount of chemicals needed for testing, shortening of the time needed, and increase in
throughput for evaluating large number of chemical compounds and their metabolism. One of the
current major benefits of in vitro test system is their value for screening of chemicals, drugs,
toxicants, pesticides, etc.”

HSP 70 is stress inducible
https://www.uniprot.org/uniprot/A1E2B8

Regulation of the mouse αBcrystallin and MKBP/HspB2 promoter activities by shared and gene
specific intergenic elements: the importance of context dependency
http://www.ijdb.ehu.es/web/descarga/paper/072302ss

P21:

Immortal mouse liver cells
https://www.sciencedirect.com/science/article/pii/B978012811410000009X?via%3Dihub
https://www.atcc.org/Products/All/CRL2254.aspx#generalinformation

Metallothionein
HSP 70
HSP90AB1(might be constitutive)
P21
54
http://www.jbc.org/content/275/13/9510.full

https://www.hindawi.com/journals/ijcb/2010/717520/ Mentions HSP 25 as the rat analogue of HSP 27

GADD 45a:

More GADDs http://clincancerres.aacrjournals.org/content/14/10/2978 Novel Glioblastoma
Markers with Diagnostic and Prognostic Value Identified through Transcriptome Analysis

Promoter interest mouse sequence
HSPB1 Chaperone functionality CCCTGAGACGGTCATTG

CCATTAATAGAGACCTG
AAGCACCGCCTGCTAAA
AATACCCG55
HSP 7056 Not found
HSP90AA157 Implicated in cancer gctgggcgggcccgcctctatataagg

ccggcgcagggggcggcgcgccAG
TTGCTTCAG58
HSP90AB159 Implicated in cancer. Might ccgggctgtgcttcgccttatatagggcg

be constitutively expressed. gtcgggggcgttcgggagctCTCTT
GAGTCA60
HSP90AA261 Not found
HSP90B1 cccgcccgcaagcagtggggtgaaaa
gcggcccgacctgcgcgcggcttAG
TGGGCGGAC62
GADD45α Implicated in cancer; ttggctgagggctagccccatatctccg

Genotoxic stress gaatcgggccctttgtcctccAGTGG
CCCCGA
Sensitive to 2,4D
55
See data from BLAST in notebook
56
https://en.wikipedia.org/wiki/Hsp70
57
58
59
60
61
62
HMOX1 Oxidative stress accacgtgacccgcgtacttaaagggct

ggcgcgggcagctgctcgctcACG
GTCTCCAG63
CYP1A1 Metabolic stress caacagacacagagtcctataaaggtg

gtggtgccttcaccctaaccctGAAG
GTGGTAG64
CDKN1A Activates and responds to p53 gggcggggcctgggccgacgctataa

ggaggcagctcgacgccaactgcAG
CAGCCGAGA65
Metallothionein 166 Sensitive to heavy metals and cggactcgtccaacgactataaagagg

possibly oxidative stress, gcaggctgtcctctaagcgtcaCCAC
might be involved in GACTTCA67
regulation of p53
Metallothionein 2 cgacccaatactctccgctataaaggtc
gcgctccgcgtgcttctctccATCAC
GCTCCT68

“The mouse metallothioneinI gene is transcriptionally regulated by cadmium following
transfection into human or mouse cells.” 69
Metallothionein binds to heavy metals like zinc, copper, selenium, cadmium, arsenic, mercury,
silver
HSP90AA2 not found in EPD

Heavy Metal Stats:

63
64
https://epd.vitalit.ch/cgibin/get_doc?db=mmEpdNew&format=genome&entry=Cyp1a1_1
65
https://epd.vitalit.ch/cgibin/get_doc?db=mmEpdNew&format=genome&entry=Cdkn1a_1
66
https://en.wikipedia.org/wiki/Metallothionein ,

67
https://epd.vitalit.ch/cgibin/get_doc?db=mmEpdNew&format=genome&entry=Mt1_1
68
69
https://www.ncbi.nlm.nih.gov/pubmed/6955027

Link to paper:
http://pages.uoregon.edu/norgaard/pdf/TraceMetalAnalysisTraditionalFoodsNorgaardetal2
013.pdf

All toxins ever in the Klamath river:
https://www.fws.gov/arcata/fisheries/reports/technical/EaglesSmith%20and%20Johnson%2020
12_Klamath%20contaminants_Final_052312.pdf

Gene expression units explained: RPM, RPKM, FPKM and TPM
https://www.biostars.org/p/273537/

EPA guidelines:
Health Effects Test Guidelines OPPTS 870.5300 In Vitro Mammalian Cell Gene Mutation Test
https://www.epa.gov/testguidelinespesticidesandtoxicsubstances/series870healtheffectste
stguidelines

https://ehjournal.biomedcentral.com/track/pdf/10.1186/s1294001500561

With all the animal and cell based models, there are questions about the translatability of animal
cell models to human health.

Looking at cell based assays for toxicology

Disadvantages of using cell line: don’t have same physiology as an in vivo system
Try to remedy/lessen the effects of these differences
How can we use synbio to
Model: we can make the rationale that we’re exploring non human cell lines for the sake
of iGEM

22. Protocol Rough Draft (Team 7.9.18)

GOOD PAPER with METAlLOTHIONEIN

Paper with GADD153, procedure is a good reference

Ultra super important paper for gadd153 promoter sequence *enhance image*

Promoter that they used:

pRP.ExBiMTIIahPSAeGFP

EXISTING EXAMPLES OF “STRESS” REPORTS IN MAMMALIAN SYSTEMS


Price for HMOX1 with GFP reporter:
https://www.abmgood.com/HMOX13'UTRGFPReporters.html
https://www.biorxiv.org/content/biorxiv/early/2017/01/05/098467.full.pdf
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5746521/pdf/TJP596105.pdf

Green Fluorescent ProteinBased Biosensor To Detect and Quantify Stress Responses Induced
by DNADegrading Colicins

Development of a Green Fluorescent Protein Microplate Assay for the Screening of
Chemopreventive Agents
https://www.sciencedirect.com/science/article/pii/S0003269700948759

Development of a fluorescent reporter system for monitoring ER stress in Chinese hamster ovary
cells
http://journals.plos.org/plosone/article?id=10.1371/journal.pone.0183694

The genomic sequence of the Chinese hamster ovary (CHO)K1 cell line
https://www.nature.com/articles/nbt.1932

Screening for estrogen and androgen receptor activities in 200 pesticides by in vitro reporter
gene assays using Chinese hamster ovary cells.

MTIIa promoter eGFP
https://www.frontiersin.org/articles/10.3389/fmicb.2016.01280/full
Link to supplementary sheet with complete nucleotide sequence

Protocol Rough Draft

1: Design plasmid
Include origin of replication, selection gene for E coli, selection gene for mammalian host
GFP reporter gene with standardized RBS and the promoter of interest (POI)

2: Put plasmid together
we would likely be ordering separate genes that would need to be put together

3: Clone plasmid in E. coli
4: Get plasmid out using miniprep
5: Get plasmid into mammalian cells (transfection)
Pick a way to do transfection
Xtreme gene is about $22070
Lipofectamine is commonly used and Marc has some on hand (we think)
Measure cell transfection proportion

6: Culture transfected mammalian cells
7: Measure baseline expression of GFP (if any)
8: Expose transfected mammalian cells to chemicals of concern (COC)
measure cell viability after exposure
(one method is to use “alamarBlue reagent” from thermo scientific)
Get a response curve by testing several concentrations of COC
Make sure that response curve includes concentrations currently found in Klamath River

If data is available, compare fluorescence measurements to measurements of actual original
protein expression

● Tiers of Promoters and Chemicals of Concern

Promoters Tentative Chemicals of Concern Cell Lines
Tier 1 Metallothionein 271, CDKN1A72, CYP1A173, CuSO477, methyl bromide, metam CHOK1 , AML12

HMOX174, GADD45α75, HSP90B176, ATF4 sodium , 2,4D , warfarin , Hydrogen
70
https://www.sigmaaldrich.com/catalog/product/ROCHE/XTGHPRO?lang=en&region=US
71
cgacccaatactctccgctataaaggtcgcgctccgcgtgcttctctccATCACGCTCCT
72
gggcggggcctgggccgacgctataaggaggcagctcgacgccaactgcAGCAGCCGAGA
73
caacagacacagagtcctataaaggtggtggtgccttcaccctaaccctGAAGGTGGTAG
74
accacgtgacccgcgtacttaaagggctggcgcgggcagctgctcgctcACGGTCTCCAG
75
ttggctgagggctagccccatatctccggaatcgggccctttgtcctccAGTGGCCCCGA
76
cccgcccgcaagcagtggggtgaaaagcggcccgacctgcgcgcggcttAGTGGGCGGAC
77
Copper is known to be present in high concentrations in Klamath, and CuSO4 induces metallothionein.
Relatively cheap and ubiquitous
Peroxide
Tier 2 HSP90AB178, HSP90AA279, Metallothionein 180 Glyphosate, tunicamycin, HeLa, Hek, etc

, HSP90AA181, HSP 7082, HSPB183 thapsigargin

Probably too dangerous to use: chloropicrin
Very expensive: tunicamycin, thapsigargin

More chemicals we can look at:
Chemical class Chemicals of concern
Herbicides Triazines (atrazine, simazine and others),
thiocarbamates (molinate, thiobencarb),
paraquat, bentazon, bromacil, ureas
(monuron, diuron, linuron)
Insecticides Acephate, carbaryl, fipronil, pyrethroids
(esfenvalerate, permethrin, fenpropathrin,
cypermethrin, deltamethrin),
Pesticides organochlorine pesticides, warfarin
Personal care products and pharmaceuticals Triclosan, triclocarban, warfarin
Flame retardants Polybrominated diphenyl ether47,
tetrabromobisphenol A
Industrial chemicals Naphthalene, nitrophenols,
2,3,7,8tetrachlorodibenzodioxin
Biomarkers of exposure Triazine metabolites (OHtriazine,
NDealkylated, triazine mercapturates),
triclosan glucuronides, phenyl and thiophenyl
glucuronide, Naphthol, Pyrethroids
(3phenoxybenzoic acid, fenvaleric acid,
permethric acid), Fipronil metabolites.
78
ccgggctgtgcttcgccttatatagggcggtcgggggcgttcgggagctCTCTTGAGTCA
79
Not found yet
80
cggactcgtccaacgactataaagagggcaggctgtcctctaagcgtcaCCACGACTTCA
81
gctgggcgggcccgcctctatataaggccggcgcagggggcggcgcgccAGTTGCTTCAG
82
Not found yet
CCCTGAGACGGTCATTGCCATTAATAGAGACCTGAAGCACCGCCTGCTAAAAATAC
83
CCG
Naturally occuring toxins Microcystin toxins

Note: we can also test for stress due to osmolarity, temperature, nutrient withdrawal, hypoxia

Note: for publication, we will need a positive and negative control

http://www.krisweb.com/biblio/gen_usfws_kierassoc_1991_lrp.pdf

Meeting with Dan 07.09.18

Dynamic measurements
Details of cloning.
ASK ANDREW about the plasmid he wanted vs. the one found available on addgene
Liquid nitrogen and buy media
Gibson or restriction enzymes or SOEing other ways to cut and paste

23. Protocol Development (Team 7.10.18)

Protocol

1: Design plasmid
Include origin of replication, selection gene for E coli (AMP resistance), selection gene
for mammalian host (EGFP)
GFP reporter gene with standardized RBS and the promoter of interest (POI)

2: Put plasmid together
we would likely be ordering separate genes that would need to be put together

Plasmid https://www.addgene.org/13031/

3: Clone plasmid in E. coli

Clone Plasmid in E. coli subprotocol
Bacterial Heat Shock Transformation
Tools and disposables Equipment Reagents
1 1000 µL Pipet Centrifuge Competent DH5a cells

1 100 µL or 200 µL Water bath set LB media
Pipet to 42ºC 2 LB + amp/carb plates
1 10 µL Pipet Bunsen burner transforming DNA (plasmid)
1 box of 1000 µL Tips (?)
1 box of 200 µL Tips Cell spreader
1 box of 10 µL Tips
2 14 mL Falcon tube
Bucket of ice

Protocol

1. Label and place your two falcon tubes on ice. ☐
2. Obtain competent cells. Transfer the tube to an ice bath. Store the cells on ice for 10
minutes. ☐
3. Gently transfer 50 µL of competent cells to the BOTTOM of each of your falcon tubes.
Store the cells on ice. ☐ (probably want to spin the tubes first, before pipetting out the
cells)
4. Moving your pipette tip in a GENTLE circular motion, gently add 2.5 µL of
transforming DNA directly to the suspended cells in the bottom of your tube. (The
volume of your transforming DNA should not exceed 5% of the volume of competent
cells) Store the tubes on ice for 15 minutes . ☐ (spin the DNA first before you pipet it
out. it is probably in a solution with a buffer)
1. Transfer the tubes to a rack placed in a preheated 42°C water bath. Store the tubes in the
rack for exactly 45 seconds . Do not shake the tubes. ☐
2. Rapidly transfer the tubes back on ice. Allow the cells to cool for 12 minutes. ☐
3. Add 800 µl of LB medium to each tube (at the bunsen burner station). Transfer the tubes
to a shaking incubator set at 37°C . Incubate the cultures for 45 minutes to allow the
bacteria to recover and to express the antibiotic resistance marker encoded by the
plasmid. ☐ (what is the purpose of the bunsen burner?)
4. Transfer 200 µl of transformed competent cells onto agar LB + carb plates. ☐
5. Invert the plates and incubate them at 37°C . Transformed colonies should appear in
1216 hours . ☐ (you can confirm visually that transformation occurred)

4: Get plasmid out using midiprep
Specific instructions are provided by the manufacturer

5: Get plasmid into mammalian cells (transfection)
Pick a way to do transfection
Xtreme gene is about $22084
Lipofectamine is commonly used and Marc has some on hand (we think)
Measure cell transfection proportion

6: Culture transfected mammalian cells
ATCC Guideline For Animal Cell Lines
UC Davis Guidelines
Cryopreservation of Mammalian Cells

7: Measure baseline expression of GFP (if any)
8: Expose transfected mammalian cells to chemicals of concern (COC)
measure cell viability after exposure
(one method is to use “alamarBlue reagent” from thermo scientific)
Get a response curve by testing several concentrations of COC
We will use lab grade chemicals, and if time and resources permit, then will test
environmental samples
Make sure that response curve includes concentrations currently found in Klamath
River
Measure response in real time

9: If data is available, compare fluorescence measurements to measurements of actual
original protein expression

Basic Techniques for Mammalian Cell UNIT 1.1 Tissue Culture
https://bme.ucdavis.edu/georgelab/files/2017/07/BasicTechniqueforTissueCulture.pdf

Purchase link for CHOK1

Information gathered about CHOK1 cells
84
https://www.sigmaaldrich.com/catalog/product/ROCHE/XTGHPRO?lang=en&region=US
The cells require proline in the medium for growth.
The base medium for this cell line is ATCCformulated F12K Medium, Catalog No. 302004.
To make the complete growth medium, add the following components to the base medium: fetal
bovine serum to a final concentration of 10%

Freeze medium: Complete growth medium 95%; DMSO, 5%
Storage temperature: liquid nitrogen vapor phase

FOR ORDERING STUFF:

First try vmcs2.ucdavis.edu

Other paper: The SOS chromotest: a review.

24. DNA design (Team 7.11.18)

Plasmids
Name Elements Purchase link or link to sequence

Promoters

Name Function and notes Sequence (mus
musculus)
HSPB1 “Small heat shock protein which functions as a molecular chaperone probably CCCTGAGAC

(Tier 2) maintaining denatured proteins in a foldingcompetent state. Plays a role in GGTCATTGC
stress resistance and actin organization (PubMed: 17661394 ). Through its CATTAATAG
molecular chaperone activity may regulate numerous biological processes
AGACCTGAA
including the phosphorylation and the axonal transport of neurofilament
proteins (By similarity).”85 GCACCGCCT
85
GCTAAAAAT
ACCCG86
HSPA1A “This intronless gene encodes a 70kDa heat shock protein which is a member cggggccggtgaa

of the heat shock protein 70 family. In conjunction with other heat shock gactccttaaaggc
proteins, this protein stabilizes existing proteins against aggregation and gcagggcggcgag
mediates the folding of newly translated proteins in the cytosol and in caggtcaccAGA
organelles. It is also involved in the ubiquitinproteasome pathway through CGCTGACA88
interaction with the AUrich element RNAbinding protein 1. The gene is
located in the major histocompatibility complex class III region, in a cluster
with two closely related genes which encode similar proteins.”87
HSP90AA189 Implicated in cancer, “ Hsp90 (90 kDa heat shock protein) is a molecular gctgggcgggccc

(Tier 2) chaperone that aids protein folding and quality control for a large number of gcctctatataaggc
'client' proteins. Hsp90 operates as dimer and has intrinsic ATPase activity. The cggcgcagggggc
Hsp90 dimer acts in concert with other chaperones (e.g. Hsp70)”90 ggcgcgccAGT
TGCTTCAG91
HSP90AB192 Implicated in cancer. Might be constitutively expressed. ccgggctgtgcttcg

(Tier 2) “This gene encodes a member of the heat shock protein 90 family; these ccttatatagggcgg
proteins are involved in signal transduction, protein folding and degradation tcgggggcgttcgg
and morphological evolution. This gene encodes the constitutive form of the gagctCTCTTG
cytosolic 90 kDa heatshock protein and is thought to play a role in gastric AGTCA94
apoptosis and inflammation. Alternative splicing results in multiple transcript
variants. Pseudogenes have been identified on multiple chromosomes.”93
HSP90AA295 “ HSP90 proteins are highly conserved molecular chaperones that have key Not found

(Tier 2) roles in signal transduction, protein folding, protein degradation, and
morphologic evolution. HSP90 proteins normally associate with other
cochaperones and play important roles in folding newly synthesized proteins
or stabilizing and refolding denatured proteins after stress. HSP90AA2 is a
cytosolic HSP90 protein. Other HSP90 proteins are found in endoplasmic
reticulum (HSP90B1; MIM 191175) and mitochondria (TRAP1; MIM 606219)
86
Determined using data from a homologous sequence in homo sapiens and compared using BLAST to
mus musculus genome (data in notebook)
87
https://www.genecards.org/cgibin/carddisp.pl?gene=HSPA1A
88
https://epd.vitalit.ch/cgibin/get_doc?db=mmEpdNew&format=genome&entry=Hspa1a_1
89
90
https://www.genecards.org/cgibin/carddisp.pl?gene=HSP90AA1
91
92
93
https://www.genecards.org/cgibin/carddisp.pl?gene=HSP90AB1
94
95
(Chen et al., 2005 [PubMed 16269234]). See HSP90AA1 (MIM 140571) for
further information on HSP90 proteins.”96
HSP90B1 “This gene encodes a member of a family of adenosine cccgcccgcaagc

(Tier 1) triphosphate(ATP)metabolizing molecular chaperones with roles in stabilizing agtggggtgaaaag
and folding other proteins. The encoded protein is localized to melanosomes cggcccgacctgcg
and the endoplasmic reticulum. Expression of this protein is associated with a cgcggcttAGTG
variety of pathogenic states, including tumor formation . There is a microRNA GGCGGAC98
gene located within the 5' exon of this gene. There are pseudogenes for this
gene on chromosomes 1 and 15.”97
GADD45α Implicated in cancer; Genotoxic stress, Sensitive to 2,4D ttggctgagggcta

(Tier 1) “ This gene is a member of a group of genes whose transcript levels are gccccatatctccgg
increased following stressful growth arrest conditions and treatment with aatcgggccctttgt
DNAdamaging agents. The protein encoded by this gene responds to cctccAGTGGC
environmental stresses by mediating activation of the p38/JNK pathway via CCCGA
MTK1/MEKK4 kinase. The DNA damageinduced transcription of this gene is
mediated by both p53dependent and independent mechanisms . Alternatively
spliced transcript variants encoding distinct isoforms have been found for this
gene.”99
HMOX1 Oxidative stress accacgtgacccgc

(Tier 1) “Heme oxygenase, an essential enzyme in heme catabolism, cleaves heme to gtacttaaagggctg
form biliverdin, which is subsequently converted to bilirubin by biliverdin gcgcgggcagctg
reductase, and carbon monoxide, a putative neurotransmitter. Heme oxygenase ctcgctcACGGT
activity is induced by its substrate heme and by various nonheme substances. CTCCAG101
Heme oxygenase occurs as 2 isozymes, an inducible heme oxygenase1 and a
constitutive heme oxygenase2 . HMOX1 and HMOX2 belong to the heme
oxygenase family.”100
CYP1A1 Metabolic stress, associated with cancer caacagacacaga

(Tier 1) “ This gene, CYP1A1, encodes a member of the cytochrome P450 superfamily gtcctataaaggtgg
of enzymes. The cytochrome P450 proteins are monooxygenases which tggtgccttcaccct
catalyze many reactions involved in drug metabolism and synthesis of aaccctGAAGG
cholesterol, steroids and other lipids. This protein localizes to the endoplasmic TGGTAG103
reticulum and its expression is induced by some polycyclic aromatic
hydrocarbons (PAHs) , some of which are found in cigarette smoke. The
enzyme's endogenous substrate is unknown; however, it is able to metabolize
some PAHs to carcinogenic intermediates. The gene has been associated with
96
https://www.genecards.org/cgibin/carddisp.pl?gene=HSP90AA2P
97
https://www.genecards.org/cgibin/carddisp.pl?gene=HSP90B1
98
99
https://www.genecards.org/cgibin/carddisp.pl?gene=GADD45A
100
https://www.genecards.org/cgibin/carddisp.pl?gene=HMOX1&keywords=HMOX1
101
lung cancer risk. A related family member, CYP1A2, is located approximately
25 kb away from CYP1A1 on chromosome 15. Alternative splicing results in
multiple transcript variants encoding distinct isoforms.”102
CDKN1A Activates and responds to p53 gggcggggcctgg

(Tier 1) “ This gene encodes a potent cyclindependent kinase inhibitor. The encoded gccgacgctataag
protein binds to and inhibits the activity of cyclincyclindependent kinase 2 or gaggcagctcgac
cyclindependent kinase 4 complexes, and thus functions as a regulator of cell gccaactgcAGC
cycle progression at G1. The expression of this gene is tightly controlled by the AGCCGAGA
105
tumor suppressor protein p53, through which this protein mediates the
p53dependent cell cycle G1 phase arrest in response to a variety of stress
stimuli. This protein can interact with proliferating cell nuclear antigen, a DNA
polymerase accessory factor, and plays a regulatory role in S phase DNA
replication and DNA damage repair. This protein was reported to be
specifically cleaved by CASP3like caspases, which thus leads to a dramatic
activation of cyclindependent kinase 2, and may be instrumental in the
execution of apoptosis following caspase activation. Mice that lack this gene
have the ability to regenerate damaged or missing tissue. Multiple alternatively
spliced variants have been found for this gene. ”104
Metallothionein 1 Sensitive to heavy metals and possibly oxidative stress, might be involved in cggactcgtccaac

106
regulation of p53 gactataaagaggg
(Tier 2) “ This gene is a member of the metallothionein family of genes. Proteins caggctgtcctctaa
encoded by this gene family are low in molecular weight, are cysteinerich, gcgtcaCCACG
lack aromatic residues, and bind divalent heavy metal ions. The conserved ACTTCA108
cysteine residues coordinate metal ions using mercaptide linkages. These
proteins act as antioxidants, protect against hydroxyl free radicals, are
important in homeostatic control of metal in the cell, and play a role in
detoxification of heavy metals. Disruption of two metallothionein genes in
mouse resulted in defects in protection against heavy metals, oxidative stress,
immune reactions, carcinogens, and displayed obesity. […] Metallothioneins
have a high content of cysteine residues that bind various heavy metals; these
proteins are transcriptionally regulated by both heavy metals and
glucocorticoids .”107
Metallothionein 2 “This gene is a member of the metallothionein family of genes. Proteins cgacccaatactctc

(Tier 1) encoded by this gene family are low in molecular weight, are cysteinerich, cgctataaaggtcg
lack aromatic residues, and bind divalent heavy metal ions, altering the cgctccgcgtgcttc
103
https://epd.vitalit.ch/cgibin/get_doc?db=mmEpdNew&format=genome&entry=Cyp1a1_1
102
https://www.genecards.org/cgibin/carddisp.pl?gene=CYP1A1&keywords=CYP1A1
104
https://www.genecards.org/cgibin/carddisp.pl?gene=CDKN1A&keywords=CDKN1A
105
https://epd.vitalit.ch/cgibin/get_doc?db=mmEpdNew&format=genome&entry=Cdkn1a_1
106
https://en.wikipedia.org/wiki/Metallothionein ,
107
https://www.genecards.org/cgibin/carddisp.pl?gene=MT1A&keywords=MT1
108
intracellular concentration of heavy metals in the cell. These proteins act as tctccATCACG
antioxidants, protect against hydroxyl free radicals, are important in CTCCT110
homeostatic control of metal in the cell, and play a role in detoxification of
heavy metals. The encoded protein interacts with the protein encoded by the
homeobox containing 1 gene in some cell types, controlling intracellular zinc
levels, affecting apoptotic and autophagy pathways. Some polymorphisms in
this gene are associated with an increased risk of cancer. [...] Metallothioneins
have a high content of cysteine residues that bind various heavy metals; these
proteins are transcriptionally regulated by both heavy metals and
glucocorticoids .”109
ATF 4 “This gene encodes a transcription factor that was originally identified as a gcgtccctggccga

(Tier 1) widely expressed mammalian DNA binding protein that could bind a ggctataaagggcg
taxresponsive enhancer element in the LTR of HTLV1. The encoded protein ggtttagggcgtgc
was also isolated and characterized as the cAMPresponse element binding cgccgccATTT
protein 2 (CREB2). The protein encoded by this gene belongs to a family of CTGCTTG112
DNAbinding proteins that includes the AP1 family of transcription factors,
cAMPresponse element binding proteins (CREBs) and CREBlike proteins.
These transcription factors share a leucine zipper region that is involved in
proteinprotein interactions, located Cterminal to a stretch of basic amino
acids that functions as a DNA binding domain. Two alternative transcripts
encoding the same protein have been described. Two pseudogenes are located
on the X chromosome at q28 in a region containing a large inverted
duplication.111”

Taking fluorescence measurements:

Quantitation of Green Fluorescent Protein in Microplates using the FL600
https://www.biotek.com/resources/docs/FL600_Quantitation_of_Grn_Fluorescent_Protei
ns_in_Microplates.pdf
Doesn’t give a very good protocol, but tells of some of the advantages of a
GFPbased reporter assay as well as things to consider when measuring
fluorescence

Still not a comprehensive protocol, but people added more comments of things to consider
https://www.researchgate.net/post/Good_platereader_protocol_for_GFP_measurements_
in_S_cerevisiae
109
https://www.genecards.org/cgibin/carddisp.pl?gene=MT2A&keywords=MT2
110
111
https://www.genecards.org/cgibin/carddisp.pl?gene=ATF4
112
https://epd.vitalit.ch/cgibin/get_doc?db=mmEpdNew&format=genome&entry=Atf4_1

Previous (2013) iGEM team wrote out a basic protocol for measuring inducible promoter activity
http://2013.igem.org/wiki/images/6/6a/Promoter_Assay_Protocol.pdf

Example fluorescence measurement protocol: from Highspecificity and highsensitivity
genotoxicity assessment in a human cell line: Validation of the GreenScreen HC GADD45aGFP
genotoxicity assay


2.2. Microplate preparation
Assays were carried out in 96well, black, clearbottomed microplates (Matrix ScreenMates,
catalogue no. 4929; Matrix Technologies, Hudson, NH). The assays were performed using an
8channel pipette (Matrix Technologies, Hudson, NH) with a protocol designed to test up to four
compounds per plate. Setup takes 20 min per plate. It is reasonable to test up to 50 compounds
per day using this manual protocol, although in principle considerably higher numbers could be
tested using a multiprobe robot. The following standard protocol was followed. A 20mM stock
of the test chemical was prepared in 2% (v/v) aqueous dimethyl sulfoxide (DMSO) and used to
make two identical dilution series across the microplate and a ‘control’ (see below). To achieve
this, 150 μL of the test chemical solution were put into two microplate wells. Each sample was
serially diluted by transferring 75 μL into 75 μL of 2% DMSO, mixing and then taking 75 μL out
and into the next well. This produced nine serial dilutions of 75 μL each. Controls were added as
follows: (i) test compound alone, to provide information on compound absorbance/fluorescence;
(ii) lymphoblastoid cultures diluted with 2% DMSO alone (final concentration, 1% DMSO), to
give a measure of maximum proliferative potential; (iii) methyl methanesulphonate (MMS) as a
genotoxicity and cytotoxicity control: ‘high’ = 50 μg/mL (w/v); ‘low’ = 10 μg/mL (w/v); (iv)
assay medium (Gentronix Ltd., Manchester, UK) diluted in 2% DMSO (final concentration, 1%
DMSO), to confirm sterility/lack of contamination, and to provide information on medium
absorbance/fluorescence for correction calculations. Exponential phase cultures of GenMT01
and GenMC01 were washed in phosphatebuffered saline (PBS; GIBCO, Corp., Carlsbad, CA,
USA) and concentrated to 2 × 106 cells/mL in assay medium supplemented with 20% HIDHS.
An aliquot of 75 μL of the cell suspension was added to each well of the diluted chemical (final
cell concentration of 1 × 106 cells/mL in assay medium with 1% DMSO v/v): GenMT01 to one
series and GenMC01 to the second series of each compound, and to appropriate standards and
controls. After the plates were filled, they were sealed using either a gaspermeable membrane
(BreathEasy; Diversifed Biotech, USA) or a plastic lid and then incubated, without shaking, for
48 h at 37 °C, 5% CO2, and 95% humidity. A different protocol was used for the initial
experiments on reporter development, as well as the assessment of a promutagenic compound
that requires incubation with S9 to become DNAreactive. In the modified assay, cell and
chemical concentrations were the same as those used in the 96well microplates above, but
scaledup to facilitate handling. Cultures (1 mL) of 1 × 106 cell/mL GenMC01 and GenMT01
cells in RPMI1640 medium (supplemented with 10% (v/v) HIDHS and 10 mM sodium
pyruvate) were grown and exposed to chemicals (with or without 10% S9 mix, final
concentration of 1% S9) in 24well plastic plates. After 24 h incubation at 37 °C, 5% CO2, and
95% humidity, cells were pipetted into 1.5mL microfuge tubes, harvested by centrifugation,
washed in PBS, and resuspended in 300 μL PBS. Samples of 150 μL were transferred to wells
of a 96well plate for data collection (see below).

……..

2.4. Data collection and handling
Following 24 h incubation, GFPreporter fluorescence and cellculture absorbance data were
collected from the microplates. Two different microplate readers that combine fluorescence and
absorbance functionality were used, and comparable data were obtained. These were: a Tecan
Ultra384 (Tecan UK Ltd., Theale, UK), excitation 485 nm, emission 535 nm with an additional
dichroic mirror (reflectance 320 ± 500 nm, transmission 520 ± 800 nm); a Wallac 1420 Victor2
(Perkin Elmer Life Sciences, Wellesley, MA), excitation 485 nm, emission 535 nm. Absorbance
was measured through a 620nm filter in the Tecan instrument and through a 600nm filter in the
Wallac. After data collection at 24 h plates were resealed and incubated for a further 24 h, after
which time GFP reporter fluorescence and cellculture absorbance data were collected again. The
data from the 24 and 48h incubation were transferred into a Microsoft Excel spreadsheet and
converted to graphical format (see typical data in Fig. 2). Data processing requires only simple
mathematical manipulations. Absorbance data were used to give an indication of the reduction in
proliferative potential or relative suspension growth, and these data were normalized to the
untreated control (=100% growth). Fluorescence data were divided by absorbance data to give
‘brightness units’, the measure of the average GFP induction per cell. These data were
normalized to the untreated control (=1). In order to correct for induced cellular autofluorescence
and intrinsic compound fluorescence, the brightness values for the GenMC01 cell line were
subtracted from those of GenMT01 cells. This makes visual assessment of the data more
reliable. All data were checked with and without this correction, and the decision (see below) on
whether or not a compound was classified as being genotoxic was not affected.

2.5. Decision thresholds
It is useful to have clear definitions of positive and negative results from routine assays and such
definitions have been derived, taking into account the maximum background noise in the system
and data from chemicals where there is a clear consensus on genotoxicity and mechanism of
action. Naturally, it is also possible for users to inspect the numerical and graphical data. Marks
and/or damage to microplate bases, bubbles in individual wells and user errors can all introduce
spikes in microplate data and these are recognized simply by inspection of the graphical data.
However, visual inspection can also help in decision making. For example an upward trend in
genotoxicity data that does not cross the threshold might still distinguish two related compounds
and allow a decision on selection or followup testing. The decision thresholds used in data
analysis for this paper were set as follows. Two thresholds were set from the absorbance data.
The first is the threshold at which there is a statistically significant reduction in the proliferative
potential or relative suspension growth (RSG). This threshold is not used in data handling but is
provided to give an indication to the user that the compound is causing some growth inhibition.
It is set at 80% of the maximum extent of cell proliferation on each microplate (i.e. the cell
density reached by the untreated control cells). This is greater than three times the standard
deviation of the background brightness. Mortality is not measured in this assay: 80% RSG does
not mean 20% of the cells are dead. In Table 1 ‘+’ is recorded if one compound dilution produces
a final cell density below the 80% threshold after 48 h, and ‘−’ is recorded when no compound
dilutions produce a final cell density lower than the 80% threshold. The lowest effective
concentration (LEC) for growth inhibition is the lowest test compound concentration that
produces a final cell density below the 80% threshold.

The second threshold is set at 30% RSG. This is a rejection threshold for genotoxicity data and
reflects two properties of the system. Firstly, this threshold recognizes the limits imposed by
instrumentation: at cell densities lower than 30% RSG, interference in the optical measurements
becomes significant due to variation in the background reflectance and absorbance of the
microplate. Secondly, this level of growth means that the cell culture has been unable to
complete even one doubling and as such is a toxicity threshold (the normal cell doubling time of
the reporter and control cell lines is 20–24 h). A breakdown in cell integrity can lead to
nonspecific DNA damage, although if a cell is dead or dying this is clearly of little genetic
consequence: apoptosis in mammalian cells is itself a deliberate manifestation of this. All the
positive genotoxicity results presented in this paper are from test compound concentrations at
which RSG was in an acceptable range (>30%). The genotoxic threshold reflects a statistically
significant increase in brightness compared with the untreated control. It is set at 1.5 (i.e. a 50%
increase) and this is greater than three times the standard deviation of the background brightness.
A positive genotoxicity result (+) is concluded if one compound dilution produces a relative GFP
induction greater than the 1.5 threshold. A negative genotoxicity result (−) is concluded where no
compound dilution produce a relative GFP induction greater than the 1.5 threshold. If both
clearly positive and negative results were observed for either relative suspension growth or
genotoxicity the chemical was marked as ±. If a clear increasing trend in GFP induction was
observed that did not exceed the 1.5fold relative GFP induction threshold the chemical was
concluded to be equivocal (E) for genotoxicity. If a positive (+) genotoxicity result was observed
after 24 and/or 48 h the compound was concluded positive for genotoxicity. The LEC for a
positive genotoxicity result is the lowest test compound concentration that produces a relative
GFP induction greater than the 1.5 threshold.

2.6. Cell proliferation and genotoxicity reporter controls
The genotoxicity and cytotoxicity controls indicate that the cell lines are behaving normally to
toxic and genotoxic stress. The ‘high’ MMS standard should reduce the final cell density to
below the 80% RSG threshold after 48 h of incubation and should be a lower value than the
‘low’ standard. If it is not, a warning can be generated automatically by the dataprocessing
spreadsheet indicating that the system is not detecting a dosedependent effect on proliferation.
The ‘high’ MMS standard must produce a relative fluorescence induction ratio greater than 2 and
be a greater value than the ‘low’ MMS standard, indicating a dosedependent effect on the
reporter. A warning can be generated automatically. The growth inhibition and genotoxicity
controls are in place for qualitative reasons to demonstrate that the assay is responding in a
dosedependent manner. The exact figures for relative total growth and fluorescence induction of
the controls are not used in any calculations of toxicity/genotoxicity of the particular compounds
being analysed. Controls are included on each microplate tested.

2.7. Test compound controls
The compound absorbance control allows a warning to be generated if a test compound is
significantly absorbing (for example, if compound precipitates from solution). If the ratio of the
absorbance of the compound control well to a well filled with diluent/medium alone is >2, there
is a risk of interference with the interpretation. The compound fluorescence control allows a
warning to be generated when a compound is highly autofluorescent. If the ratio of the
fluorescence of the compound control well to a diluent/medium filled well is >5, there is a risk of
interference with the interpretation. In these cases, fluorescence polarization can be used to
distinguish GFP from other sources of fluorescence [41], [42]. The Tecan and Wallac instruments
can have this facility. Occasionally, compounds induce cellular autofluorescence although they
are not fluorescent themselves. This is apparent from a dosedependent increase in brightness in
the control cell line (GenMC01) in the absence of fluorescence from the chemicalonly control.
The routine subtraction of GenMC01 from GenMT01 data eliminates this interference.

2.8. Comparisons
Published results from other genotoxicity tests and cancer studies have been tabulated. The tests
include the bacterial reverse mutation assay (the Ames test), the mouse lymphoma assay (MLA),
in vitro and in vivo cytogenetics (chromosome aberration assays; CA), the in vivo rodent
micronucleus test (MNT) and the rodent carcinogenicity bioassay. The data have been collected
both from the peerreviewed literature and from freely available internet resources. These include
CCRIS (Chemical Carcinogenesis Research Information System, http://toxnet.nlm.nih.gov), NTP
(National Toxicology Program Reports, http://ntpserver.niehs.nih.gov), IARC (International
Agency for Research on Cancer, http://www.iarc.fr), NIOSH (National Institute for Occupational
Safety and Health, http://www.cdc.gov/niosh/homepage.html) and the USEPA (US
Environmental Protection Agency, http://www.epa.gov/iris/search.htm). Chromosome aberration
test results were largely drawn from Ishidate et al. [43].

Meeting with Environmental Toxicologist: Dr. Denison
Congratulate on retirement
His research : Molecular toxicology; biochemical and molecular mechanisms of action of
halogenated aromatic hydrocarbons and related chemicals; mechanisms of induction of
drug metabolizing enzymes; structure and function of receptors for hormones and
xenobiotics; gene expression; bioassay systems for detection of environmental
contaminants.

Agenda :
Introductions
Describe our project
Ask him for an overview of his work

Questions to ask:
What work have you done with Heat Shock Proteins (we saw you wrote a paper
involving HSP90), or stress pathways in general?

Have you used GFP or other reporters? Any comments for things to consider?

Heat shock proteins are general, can be used to test for no results ( same for
metallothionein)
Can we leap from cell to human health?
biscuits/ oreos have a lot of estrogenic compounds, but doesn’t show up in animal
studies (metabolized too fast)
Connection to human health is difficult
Multiplex systems?
Tox21
Toxcast
CYP promoter needs 1000bp to get first dioxin response
Compare to existing data that shows a correlation to adverse effects of the toxins.
Isolate big class of compounds
Bioassays screen for a wider spectrum of compounds ( can find things that instrumental
analysis cant find)
Nrf2 protein that regulates the expression of antioxidant proteins
https://www.epa.gov/chemicalresearch/toxicityforecastertoxcasttmdata

AOP’s : Adverse Outcome Pathways
Our project would fit into the early mechanism of an AOP
Dilution vs concentration curve: bioanalytical equivalence
Mammalian cells are better because stuff gets in easier : no cell walls

https://www.ncbi.nlm.nih.gov/pubmed/15649641 “Cellbased highthroughput bioassays to
assess induction and inhibition of CYP1A enzymes.”

“Abstract
CYP1A is a subfamily of cytochrome P450 enzymes involved in the metabolism of numerous
therapeutic drugs and in the bioactivation of procarcinogens to mutagens. Because of their
diverse metabolic capacities, differences in expression of CYP1A enzymes may profoundly
influence drugdrug interactions and drug or carcinogen activation and detoxification. Here, we
demonstrate that cellbased bioassays are capable of identifying xenobiotics that either alter aryl
hydrocarbon receptor (AhR)mediated CYP1A levels or produce inhibition of enzyme activity.
To assess induction, a stable cell line harboring a luciferase reporter driven by multiple dioxin
response elements (DREs) was developed. Using this cell line, AhR agonists and antagonists
were identified among drugs, dietary agents, and environmental compounds. Of the chemicals
examined, the therapeutic agent omeprazole induced reporter gene activity 12.5+/0.41 fold
above control, whereas the phytochemical, chrysin and environmental pollutant, benzanthracene
enhanced luciferase activity 3.3+/0.03 and 28.7+/1.7 fold above control, respectively. Several
natural products, polychlorinated biphenyls (PCBs) and polycyclic aromatic hydrocarbons
(PAHs) prevented TCDDmediated increases in luciferase expression. For example, the botanical
kava inhibited TCDDmediated induction by 88%. Northern blot analyses of CYP1A1 in HepG2
cells treated with similar agents validated results generated in the stable cell line. The stable cells
were further used to identify inhibitors of CYP1Amediated metabolism. Resveratrol and
furafylline exhibited dosedependent decreases in CYP1A1 and CYP1A2 enzyme activities with
IC50 values of 1.89 and 0.79 microM, respectively. In summary, chemicals that possess the
ability to alter CYP1A expression or inhibit CYP1A enzyme activities can be rapidly identified
with the cellbased bioassays described here.”
“2.1. Preparation of a construct containing the dioxin response element (DRE)
The core sequence of AhR binding motif, DRE, (5′T/GNGCGTGAA/CG/CAA3)′ identified in
the regulatory region of many TCDDinducible genes including CYP1A2, CYP1B1,
UDPglucuronosyltransferase 1A1 and glutathione Stransferase Ya C( Lusska et al., 1993 ,
Whitlock, 1999 , Yueh et al., 2003 ) was utilized to construct an oligonucleotide. A pair of
complimentary oligonucleotides, containing three copies of the DRE in tandem with the
restriction enzymes KpnI and XhoI as linkers, were constructed that had the following sequence:
5′(TTG CGT GCG A) (TT GCG TGC GA) (T TGC GTG CGA)3′, 5′TCG A(TC GCA CGC
AA)(T CGC ACG CAA)(TCG CAC GCA A)GT AC3′. The synthesized oligonucleotides were
phosphorylated, annealed, and ligated into analogous sites of a modified luciferase vector that
contained an antibiotic selection cassette and the SV40 viral promoter. That the luciferase
construct contained three copies of the DRE, was verified by sequence analysis.”

Consider the fact that commercial grade vs. lab grade chemicals have different effects

2,4D effects on cells, organs, and organisms:
The adverse outcome pathway as integrating framework for systematic …


Andrew thought of a “nifty” way to make multiple repeats

Very good paper
Expression System Based on an MTIIa Promoter to Produce hPSA in Mammalian Cell Cultures

YES SELECTION MARKER

Paper relating CYP2C9 to Warfarin (AOP):
https://jamanetwork.com/journals/jama/fullarticle/194791

More papers daniel found

https://en.wikipedia.org/wiki/Heat_shock_factor
https://en.wikipedia.org/wiki/Internal_ribosome_entry_site

Human metallothionein gene IIA promoter region with binding domains
Obtained from “Expression System Based on an MTIIa Promoter to Produce hPSA in
Mammalian Cell Cultures”

1 acacggcgga ggcgcacggc gtgggcaccc agcacccggt acactgtgtc ctcccgctgc
61 acccagcccc ttcagcgcga ggcgtccccg aggcgcaagt gggccgcctt cagggaactg
121 accgcccgcg gcccgtgtgc agagccgggt gcgcccggcc cagtgcgcgc ggccgggtgt
181 ttcgcttgga gccgcaagtg acttctagcg cggggcgtgt gcagggacgg ccggggcggg
241 gcttttgcac tcgtcccggc tctttctagc tataaacact gcttgccgcg ctgcactcca
301 ccacgcctcc tccaagtccc agcgaacccg cgtgcaacct gtcccgactc tagccgcctc
361 ttcagctcgc catgatc

This is the extended MT2 promoter (371 bp). A paper we read used a shortened form (60bp):

“The reduced (371 to 60 bp) MTIIa promoter region (X00504.1) was inserted before the target
gene. The pRP.ExBi backbone allowed the insertion of the promoter sequence of the gene of
interest and a reporter gene. The MTIIa promoter (60 bp) has multiple copies of cisregulatory
elements and is involved in the MRE for MTF1 binding (Jervis and Kilburn, 1996).”

https://www.uniprot.org/uniprot/P02798 >NG_055242.1 Homo sapiens CYP1A1 5' regulatory
region (LOC110467515) on chromosome 15113

HMOX1
https://www.ncbi.nlm.nih.gov/nuccore/S58267
https://ac.elscdn.com/S0021915004000176/1s2.0S0021915004000176main.pdf?_tid=e0ccdd
404c30415295c6d64462088f27&acdnat=1531420724_f633f4a2df9c7e752ae6bbde27b2e5da
https://www.sciencedirect.com/science/article/pii/S0891584904005477#sec1

//114

Transcriptional Regulation of Heme Oxygenase1 Gene Expression by MAP Kinases of the JNK
and p38 Pathways in Primary Cultures of Rat Hepatocytes
(http://www.jbc.org/content/278/20/17927.full.pdf)

FGF

https://www.ncbi.nlm.nih.gov/nuccore/NC_000019.10?report=fasta&from=48755127&to=4875
8666
NCBI Reference Sequence: NC_000019.10
113
https://www.ncbi.nlm.nih.gov/gene/1543 and https://www.ncbi.nlm.nih.gov/gene/110467515 and
https://www.ncbi.nlm.nih.gov/nuccore/NG_055242.1 and http://www.jbc.org/content/279/23/23969.full.pdf
114
https://www.ncbi.nlm.nih.gov/nuccore/S58267.1?report=genbank&to=1440
LOC109279247 FGF21/FUT1 promoter region [ Homo sapiens (human) ]
https://www.ncbi.nlm.nih.gov/gene/109279247

Michael Denison https://scholar.google.com/citations?user=w3gP0yYAAAAJ&hl=en&oi=ao

“DNA Sequence Determinants for Binding of Transformed Ah Receptor to a DioxinResponsive
Enhancer” https://pubs.acs.org/doi/pdf/10.1021/bi00136a019

How the reduced (59 bp) promoter for MT2 was found:
Compare the full plasmid used (containing the shortened promoter) to the full promoter (371 bp)
using BLAST


MT2 promoter

MT2 promoter 59 bp reduced promoter

CGTCCCGGCTCTTTCTAGCTATAAACACTGCTTGCCGCGCTGCACTCCACCACGCCTC
C

MT2 promoter 371 bp promoter

ACACGGCGGAGGCGCACGGCGTGGGCACCCAGCACCCGGTACACTGTGTCCTCCCG
CTGCACCCAGCCCC
TTCAGCGCGAGGCGTCCCCGAGGCGCAAGTGGGCCGCCTTCAGGGAACTGACCGCC
CGCGGCCCGTGTGC
AGAGCCGGGTGCGCCCGGCCCAGTGCGCGCGGCCGGGTGTTTCGCTTGGAGCCGCA
AGTGACTTCTAGCG
CGGGGCGTGTGCAGGGACGGCCGGGGCGGGGCTTTTGCACTCGTCCCGGCTCTTTCT
AGCTATAAACACT
GCTTGCCGCGCTGCACTCCACCACGCCTCCTCCAAGTCCCAGCGAACCCGCGTGCAA
CCTGTCCCGACTCTAGCCGCCTCTTCAGCTCGCCATGATC>

NG_055242.1 Homo sapiens CYP1A1 5' regulatory region (LOC110467515) on chromosome 15


CYP1A1 Mouse Ortholog: LOC110467519 Cyp1a1 5' regulatory region [ Mus musculus (house
mouse) ]
>NG_055251.1:1011802 Mus musculus Cyp1a1 5' regulatory region (LOC110467519) on
chromosome 9115 https://www.ncbi.nlm.nih.gov/gene/110467519

This is a very good paper
https://onlinelibrary.wiley.com/doi/epdf/10.1002/humu.9503
They linked the promoter from HSPB1 to luciferase, and were able to induce transcription

“Sequence Analysis of the HSPB1 Gene
The proximal promoter (684/1, relative to ATG), the three exons and the two introns of HSPB1
were PCRamplified with overlapping primer sets. Primer oligonucleotides were designed based
on the HSPB1 sequence (GenBank accession number NT_007933.14) and are available upon
request.”

Here is the NCBI sequence of the actual gene
https://www.ncbi.nlm.nih.gov/nuccore/NM_001540.4?&feature=CDS

FGF21:
https://www.sciencedirect.com/science/article/pii/S0006291X13014976#s0080
https://www.tandfonline.com/doi/full/10.1080/09168451.2015.1135045#
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4090247/?report=reader
https://www.sciencedirect.com/science/article/pii/S030090841200435X?via%3Dihub#appsec1
115
Functional analysis of the dioxin response elements (DREs) of the murine CYP1A1 gene promoter:
beyond the core DRE sequence.

Table S1. Sequences of the primers used in RTqPCR.

Gene Species Refseq Forward Reverse
36B4 Human NM_0010 tcatcaacgggtacaaacga gccttgaccttttcagcaag

02
FGF21 Human NM_0191 actccagtcctctcctgcaa agtggagcgatccatacagg

13
DDIT3 Human NM_0040 AGCCAAAATCAGAGCTG CAGTGTCCCGAAGGAG

83 GAA AAAG
GRP78 Human NM_0053 GGCTGGAAAGCCACCAA TTGGGGGAGGGCCTGCA

47 GATGCT CTT
ERDJ4 Human NM_0123 TCTACCTGCCCTTGGGCT ACACTCTGCAACGCAAG

28 CACT TCACA
36B4 Mouse NM_0074 CCAGCGAGGCCACACTG ACACTGGCCACGTTGCG

75 CTG GAC
Fgf21 Mouse NM_0200 GTAGGCGCAGCACACCG GACGCAGGGGCAGGCC

13 CA ATG
Ddit3 Mouse NM_0078 AAGATGAGCGGGTGGCA TGCCATGACTGCACGTG

37 GCG GACC
Erdj4 Mouse NM_0137 GTGGAGAAGCTGCGTCG TGAGGCAGACTTTGGCA

60 GGG CACCT
36B4 Rat NM_0224 cctcaccgagattagggaca atcgctcaggatttcaatgg

02
Fgf21 Rat NM_1307 AGGACGGAACAGTGGTG GCAGGCCATGGGCCTCA

52 GGCA GAC
Ddit3 Rat NM_0241 ACCTGAGGAGAGAGAA ACCTCTGCTGGCCCTGG

34 ACCGGTCC CTC
Grp78 Rat NM_0130 CCGTCCCGTGGCATCAA GGGCACCACAGTGTTCC

83 CCC TCGG
Erdj4 Rat NM_0126 TTGCCCCTCCCTCCCCCA GCCCGAGTTACAGGGAC

99 AC CATAGGC
Gadd3 Rat NM_1335 AAGCCAGCACCACCTTG TGCCTGGGCAATGCGTC

4 46 GGC GAG
Xbp1 a Rat NM_0010 ACGCTTGGGGATGAATG GGGTCCAACTTGTCCAG

04210 CCCTG AATGCCC
Xbp1 b Rat NM_0010 GGCCCAGTTGTCACCTC CAGCTTGGCTGATGAGG

04210 CCC TCCCC

a Used for agarose gel analysis of Xbp1 mRNA splicing.
b Used for RTqPCR analysis of Xbp1 mRNA expression.

To do list:
1. Interlab study
2. Design promoters with restriction sites, order DNA
3. Order cell lines and media and other things on shopping list

“Activation of the gadd153 Promoter by Genotoxic Agents: A Rapid and Specific Response to
DNA Damage” http://cancerres.aacrjournals.org/content/52/1/5

Daniel’s GADD143 promoter
I have doubts about the quality of this though we previously found that UCSC’s genome
browser is about 20 bp off from the coordinates that NCBI provides

Addgene https://www.addgene.org/36035/
A Paper
https://www.semanticscholar.org/paper/Activationofthegadd153promoterbygenotoxicaL%
C3%BCthyHolbrook/be40ac38e6d2e53b5cb072fa96ccd092fe559cf8
Genbank location of the gene https://www.ncbi.nlm.nih.gov/gene/1649
NC_000012.12 (57516588..57520517, complement) on chromosome 12
http://genome.ucsc.edu/cgibin/das/hg38/dna?segment=chr12:57515939,57516724

25. How to get FASTA from UCSC genome browser ( Team 7.17.18)
How to get a FASTA from coordinates on a genome on UCSC Genome Browser
brought to you by Daniel and Jacob
1. go to UCSC genome browser, Table Browser
https://genome.ucsc.edu/cgibin/hgTables
2. pick your species
example: mouse build 10 “mm10”
3. pick group as “all tracks”
4. set “Track” to NCBI refseq
5. click “add custom tracks”
6. type something like this in the box
example: "chr8 94178851 94179157"
7. then click “submit”
8. on the next screen hit “go”
9. then on new screen, go to top “view” select “DNA”
10. then select “get DNA”
11. it will give you a FASTA
">mm10_dna range=chr8:9417885194179157 5'pad=0 3'pad=0 strand=+ repeatMasking=none
TGGTCGCTGCTCAGGAACTCCAGGAAAGGAGAAGCTGAGGTTACCACGCT
GCGAATGGGTTTACGGAGATAGCTGGCTTTCCGGGGTGAGTTCTCGTAAA
CTCCAGAGCAGCGATAGGCCGTAATATCGGGGAAAGCACTATAGGGACAT
GATGTTCCACACGTCACATGGGTCGTCCTATCCGAGCCAGTCGTGCCAAA
GGGGCGGTCCCGCTGTGCACACTGGCGCTCCAGGGAGCTCTGCACTCCGC
CCGAAAAGTGCGCTCGGCTCTGCCAAGGACGCGGGGCGCGTGACTATGCG
TGGGCTG”
There is often an offset, so always double check with BLAST
( https://blast.ncbi.nlm.nih.gov/Blast.cgi ). Note also that the offset is likely not consistent
between genomes.
26. PrimerMaking and Stuff!! (Jacob)
Rationale for plasmid https://www.addgene.org/13031/
https://blog.addgene.org/plasmids101mammalianvectors
http://journals.plos.org/plospathogens/article/file?type=supplementary&id=info:doi/10.1371/jour
nal.ppat.1002029.s004

Jolee checked for restriction sites within our chosen promoters. She found that none of them
contained the sites: Acc651 , Kpn1, and Not1 .
WE will be using BglII and MfeI for our upstream site, and NotI for the
downstream site.
HOW TO MAKE PRIMERS:
(for restriction digest)
1. Look at plasmid, and find the restriction sites.
a. This example protocol is using the plasmid “pcDNA3EGFP”
https://www.addgene.org/13031/
b. In our case, we want to clone in the site upstream of the EGFP gene. We would
also like to remove the CMV Enhancer and the CMV promoter, so our upstream
cutting site should be upstream of the CMV enhancer and promoter, while our
downstream site should be downstream of the CMV enhancer and promoter.
2. Decide what restriction sites you want to use.
a. It’s very important to check your promoter sequences for internal restriction sites.
If we were to use an enzyme that cuts the promoter, it would become useless.
b. The way we checked our promoters for internal restriction sites was by putting
each sequence into ApE, clicking on the “Enzyme Selection Dialog”(found right
below the “help” button), and seeing what restriction sites are listed. If there is a
“(0)” next to a restriction site’s name, then there are no sites within the promoter.
If there is a “(1)”, there’s one site, etc..
3. Once you obtain two sites that are not found in your promoter, find the sequence of the
restriction sites. I did this by going into ApE, selecting the “Enzyme Selection Dialog”,
then double clicking on restriction site’s name. This can be double checked by looking up
the name of the restriction enzyme(which should have the same name as the restriction
site) on google. I went to NEB, where the page for purchasing the enzyme included the
cutting region ( Like this ).
4. Use this website https://nebcloner.neb.com/#!/redigest to verify which buffer to use with
pairs of buffers. Use the buffer that maximizes activity in both, DO NOT ALLOW STAR
ACTIVITY.
a. For example, I’m using BglII and NotI , which both have 100% activity in
NEBuffer 3.1, so I’ll be using that. However, since CYP1a1 has an internal BglII
site, I’ll be using MfeI for the upstream site instead.
5. Also check for compatible sticky ends, reference here
https://www.neb.com/toolsandresources/selectioncharts/compatiblecohesiveendsand
generationofnewrestrictionsites
a. BglII, MfeI, and NotI all check out ✔
6. You’ll be making a forward and a reverse primer. Keep in mind that the forward primer
will include your more upstream restriction site, and your reverse primer will include the
more downstream restriction site.
7. *** use online tool to check “primer melting temperature” for specific polymerase, like
http://tmcalculator.neb.com/#!/main . To properly check, only use the complementary
sequences that will be binding to the DNA (your initial 18 base pairs). If temperature of
one is too low, you can add more bases to the particular primer. Design annealing
temperatures for about 60 degrees C. Try to keep below 72 degrees C.
a. I’m using BglII for our upstream site and NotI for our downstream site.
i. BglII ’s restriction site is AGATCT , and NotI ’s is GCGGCCGC .
8. For the forward primer, we’ll use FGF21 as an example. Copy and paste the sequence
into ApE.
a. To begin, use a string of 6 “ a ” nucleotides. This helps the restriction enzyme bind
to the site.
i. So you’ll have “ aaaaaa”
b. Then, add your restriction site. Since it’s our forward primer, we’re using the
BglII site of “ agatct”
i. Now you will have “ aaaaaaagatct ”

c. Next, add the first 18 bases of the promoter (in this example it’s FGF21, which is
“ gccacccctccccccagg ”
i. Adding this will give you your complete forward primer :
“ aaaaaaagatctgccacccctccccccagg ”
ii. ****** however, upon checking the 18 bases, I found the annealing
temperature is 75 degrees Celsius. This is higher than 72, so we will have
to use an annealing temperature that is lessthanoptimal
9. For the reverse primer, we’ll use FGF21 as an example again.
a. First, use the last 18 nucleotides of your promoter.
i. In this case it’s “ ccaaaaaacaagggtgtt ”
ii. *****When checking this primer’s melting(annealing) temperature, I
found that the 18bp primer binding site had a temperature of only 57
degrees celsius. Since the forward primer’s temperature is much higher, I
added on 9 more complementary bases, making the 27 bases of
“ gcatctatcccaaaaaacaagggtgtt ” have a melting temperature of 70 degrees
Celsius.
b. Then, add the restriction site. Since it’s the reverse primer, we use the NotI site of
“ gcggccgc ”
i. This will give you “ gcatctatcccaaaaaacaagggtgttgcggccgc ”
c. Next, add a string of 6 “ t ” nucleotides, resulting in
“ gcatctatcccaaaaaacaagggtgttgcggccgctttttt ”
d. Finally, take the reverse complement of this sequence. You can do this by putting
“ gcatctatcccaaaaaacaagggtgttgcggccgctttttt ” into ApE and clicking “Reverse
Complement”(found right below the “window” tab).
i. Doing this will give you your complete reverse primer:
“ aaaaaagcggccgcaacacccttgttttttgggatagatgc ”
10. Writhe in the joy of your own greatness, stemming from the fact that you can now make
primers.

Also helpful: https://www.addgene.org/protocols/pcrcloning/
And https://blog.addgene.org/plasmids101restrictioncloning

I found a wonderful database of transcriptional start sites: https://dbtss.hgc.jp/index.html
Another great website that has curated useful bioinformatics tools online:
https://bip.weizmann.ac.il/toolbox/seq_analysis/promoters.html

27. Work Space for Project Development (Team)

Daniel’s work space for MT1 gene

Link to transcriptional start site database entry
https://dbtss.hgc.jp/cgibin/genome_fasta.cgi?SEE=1&UID=2&REGION=02|chr8|94178839|941
79338|1
https://dbtss.hgc.jp/index.html#kero:chr8:94,178,77994,180,448


> M. musculus |chr8|9417883994179338|Plus

CCTGGGCGGAGCTGGTCGCTGCTCAGGAACTCCAGGAAAGGAGAAGCTGAGG
CTGCGAATGGGTTTACGGAGATAGCTGGCTTTCCGGGGTGAGTTCTCGTAAACT
CAGCGATAGGCCGTAATATCGGGGAAAGCACTATAGGGACATGATGTTCCACAC
TGGGTCGTCCTATCCGAGCCAGTCGTGCCAAAGGGGCGGTCCCGCTGTGCACA
TCCAGGGAGCTCTGCACTCCGCCCGAAAAGTGCGCTCGGCTCTGCCAAGGACG
CGTGACTATGCGTGGGCTGGAGCAACCGCCTGCTGGGTGCAAACCCTTTGCGC
CGTCCAACGACTATAAAGAGGGCAGGCTGTCCTCTAAGCGTCACCACGACTTCA
TGAGTACCTTCTCCTCACTTACTCCGTAGCTCCAGCTTCACCAGATCTCGGAATG
CAACTGCTCCTGCTCCACCG

Link to view on NCBI of gene and about 1000 bp upstream of the start codon
https://www.ncbi.nlm.nih.gov/nuccore/NC_000074.6?report=fasta&from=94179084&to
=94180327

First 4 codons of the gene: ATGGACCCCAAC

Link to the paper that is wonderful:
https://www.researchgate.net/publication/5620591_Nuclear_Factor1_and_Metal_Transcription_
Factor1_Synergistically_Activate_the_Mouse_Metallothionein1_Gene_in_Response_to_Metal
_Ions

The important paragraph, found on page 7:

“ To further confirm the function of the NF1 sites in stimulating promoter activity, we used
deletion mutants in transfection experiments. As reported earlier (11, 12), deletion of the mouse
MT1 promoter sequences between 1843 and 590, or 238, did not substantially modify either
basal or metalinduced expression (Fig. 7 B ). However, further deletion to 150 produced a 40%
decrease in basal level but had only a marginal effect on the capacity of the promoter to be
induced by metal ions . Compared with 20fold for the 1843 control reporter plasmid, the
150 deletion mutant was induced 15 fold. However, similar to the NF1a or NF1b mutants, the
overall activity of the promoter was reduced by 50%. This showed that the region between
238 and 150, which includes the NF1a, Ebox1, and Sp1a sites, contains elements required for
the basal level of expression of the gene and maximal metal induction. These results are in
congruence with those obtained with the NF1 mutants. Overall, these results indicate that,
although the NF1 sites are not essential, as expected, to confer metal induction to the mouse
MT1 promoter, their presence is required for maximal constitutive and metalinduced promoter
activity.

(1) Nuclear Factor1 and Metal Transcription Factor1 Synergistically Activate the Mouse
Metallothionein1 Gene in Response to Metal Ions. Available from:
_Ions [accessed Jul 18 2018].”

Negative and positive numbers are in reference to the transcriptional start site (see caption in
below)

This paragraph is also important:
“contain mouse MT1 promoter sequence positions 590 (relative to the transcription start point)
to +68, 238 to +68, and 150 to +68, respectively, in pGL2 basic. To construct the reporter
plasmids (NF1ab)MT1mLUC and (MREdd)MT1mLUC, the double stranded oligonucleotides
NF1ab and MREdd (Table 1), respectively, were inserted in front of a minimal mouse MT1 gene
promoter (MT1m, 34 to +68) (31) in pGL2 basic

(1) Nuclear Factor1 and Metal Transcription Factor1 Synergistically Activate the Mouse
Metallothionein1 Gene in Response to Metal Ions . Available from:
_Ions [accessed Jul 18 2018].”

So the MT1 promoter we want is 238 to +68, relative to the transcriptional start site

>MT1 Promoter (Mus musculus)
TATCTAATGCAGTCCCCACCTAAAATGATCTCTCTGGAGGGAGGGTACCTTGGTTTT
TAAAACCAGCCTGGAGTAGAGCAGATGGGTTAAGGTGAGTGACCCCTCAGCCCTGG
ACATTCTTAGATGAGCCCCCTCAGGAGTAGAGAATAATGTTGAGATGAGTTCTGTTG
GCTAAAATAATCAAGGCTAGTCTTTATAAAACTGTCTCCTCTTCTCCTAGCTTCGATC
CAGAGAGAGA

Calling ATCC to ask about different CHOK1 cell lines.

Same thing, just deposited by different people
CCL61 is the one they generally direct customers to. It’s cheaper, so buy it

Link to something:
https://academic.oup.com/toxsci/article/111/2/202/1640284

Construction of GADD45α promoterdriven luciferase plasmid
The human GADD45α promoter was isolated with primer sequences as follows: Forward primer
5′CTAACCTCGAGTGCTTTCCACCTACAAGTTGCCA3′; reverse primer
5′CTACAAGATCTATTGCAAACTGCAGGTCGCCCA3′. The sequence of human GADD45α
promoter was inserted into the Xho І– BgL П site of pGL4.17 [ luc2 /Neo] (Promega) luciferase
plasmid. The direction and sequence authenticity of the luciferase reporter plasmid were
validated by restriction analysis and direct sequencing

● Ttctggaattcgcggccgct
●
● Steps for Making Oligos for SLIC Cloning
○ This is for the three small MT2 promoters, which are too small to do regular
restriction cloning with. This protocol example was done with the 60bp MT2
(version 1) promoter
○ We will be making a forward and reverse oligo. They need to be a max of 60 bp,
which is how long I made these

1. First, know what restriction sites you are using for the particular construct. For all three
small MT2 promoters, we are using BglII for the upstream site and NotI for the
downstream site.
2. Once you know the restriction sites, find out how the enzymes cut. This information can
be found many ways, but I prefer googling the name of the enzyme, and then finding the
product page on NEB. The page will tell you how it cuts.
3. Since the oligos will be added after the plasmid has been digested with the restriction
enzymes, their complementary sequence must be made with the postdigested sequence
of the plasmid
a. For example, the forward oligo is using BglII . When including the complementary
site, it will only be “AGATC”. If we made the complementary site without
considering the postdigestion sequence, it would have been “AGATCT”, which
would have been wrong.
4. For the forward oligo, we start with taking 20bp upstream of the BglII site, which ends
with “AGATC”.
a. If you look at the sequence of the plasmid pcDNA3EGFP , you will see that the
BglII site is at the very beginning of the plasmid sequence. However, since the
plasmid is circular, we simply take the rest of the needed 20bp from the very end
of the plasmid.
i. This results in: “ cgtcgacggatcgggagatc ”
5. Then, we add the first 40 bases of the MT2 sequence. >
“ acgtcccggctctttctagctataaacactgcttgccgcg”
6. Combine it with the previous 20bp and you get:
a. Forward Oligo:
“ cgtcgacggatcgggagatcacgtcccggctctttctagctataaacactgcttgccgcg ”
7. For the reverse oligo, we start with the last 40bp of the MT2 promoter: >
“ tataaacactgcttgccgcgctgcactccaccacgcctcc ”
8. Then, starting at the “GGCCGC” part of the NotI site, add the downstream 20bp of the
plasmid. > “ ggccgctcgagatggtgagc ”
a. Again, if we didn’t consider the effects of the restriction digest on the sequence,
we would have started with “GCGGCCGC”, which would have been wrong.
9. Combine these sequences and you get
“ tataaacactgcttgccgcgctgcactccaccacgcctccggccgctcgagatggtgagc ”
10. Finally, take the reverse complement of this sequence, and you have your reverse oligo
a. Reverse Oligo:
“ gctcaccatctcgagcggccggaggcgtggtggagtgcagcgcggcaagcagtgtttata ”

Interlab study note:
1. Jolee putting positive control in well 8, A&B
a. Negative control is in well 10, A&B

Note:

Lol we should keep this in mind

Fluorescent proteins such as eGFP lead to catalytic oxidative stress in cells

Notes for measurement

Cell viability
Can be done using alamarblue assay
Transfection efficiency
If a good selection marker is used, this can be ignored probably

Measure every data point in 3 or 4 replicates

“The fluorescence intensity generated by eGFP and ZSGreen was measured using a Varioskan
Flash Multimode Reader (Thermo Scientific) at 497 and 505 nm for excitation and emission,
respectively. The fluorescence images were captured using a Nikon Eclipse fluorescence
microscope Ti (Nikon Instruments Inc., Melville, NY, USA) and an EVO R FL Imaging
System (Thermo Fischer Scientific). The ratio between the fluorescent and nonfluorescent cells
was quantified”

“ Expression Over Time
The production of recombinant hPSA was accompanied by the expression of the eGFP reporter
in transfected HeLa cells using the XtremeGENE method in the presence of 100 μM CuSO4.
The data were measured at 0, 24, 36, and 72 h after transfection ( Figure 4 ). From 48 h, all tested
cells presented the maximum fluorescence in the presence of 100 μM of CuSO4. Basal eGFP
expression was detected in the no induction control.“

“ Cell Viability
Induction of hPSA expression by heavy metals could induce cellular death due to oxidative stress
generated in the presence of heavy metals. Therefore, cell viability should be assessed during
exposure to heavy metals.

The cell viability assay using the alamarBlu R (Thermo Scientific) method allowed us to
identify the strain that was most resistant to heavy metal treatment.”

ny
“The following standard protocol was followed. A 20mM stock of the test chemical was
prepared in 2% (v/v) aqueous dimethyl sulfoxide (DMSO) and used to make two identical
dilution series across the microplate and a ‘control’ (see below). To achieve this, 150 L of the
test chemical solution were put into two microplate wells. Each sample was serially diluted by
transferring 75 L into 75 L of 2% DMSO, mixing and then taking 75 L out and into the next
well. This produced nine serial dilutions of 75 L each. Controls were added as follows: (i) test
compound alone, to provide information on compound absorbance/fluorescence; (ii)
lymphoblastoid cultures diluted with 2% DMSO alone (final concentration, 1% DMSO), to give
a measure of maximum proliferative potential; (iii) methyl methanesulphonate (MMS) as a
genotoxicity and cytotoxic ity control: ‘high’ = 50 g/mL (w/v); ‘low’ = 10 g/mL (w/v); (iv)
assay medium (Gentronix Ltd., Manchester, UK) diluted in 2% DMSO (final concentration, 1%
DMSO), to confirm sterility/lack of contamination, and to provide information on medium
absorbance/fluorescence for correction calculations. Exponential phase cultures of GenMT01
and GenMC01 were washed in phosphatebuffered saline (PBS; GIBCO, Corp., Carlsbad, CA,
USA) and concentrated to 2 × 106 cells/mL in assay medium supplemented with 20% HIDHS.
An aliquot of 75 L of the cell suspension was added to each well of the
diluted chemical (final cell concentration of 1 × 106 cells/mL in assay medium with 1%
DMSO v/v): GenMT01 to one series and GenMC01 to the second series of each compound,
and to appropriate standards and controls. After the plates were filled, they were sealed using
either a gaspermeable mem brane (BreathEasy; Diversifed Biotech, USA) or a plastic lid and
then incubated, without shaking, for 48 h at 37 ◦ C, 5% CO2 , and 95% humidity.

A different protocol was used for the initial experiments on reporter development, as well as the
assessment of a promutagenic compound that requires incubation with S9 to become
DNAreactive. In the modified assay, cell and chemi cal concentrations were the same as those
used in the 96well microplates above, but scaledup to facilitate handling. Cul tures (1 mL) of 1
× 106 cell/mL GenMC01 and GenMT01 cells in RPMI1640 medium (supplemented with 10%
(v/v) HIDHS and 10 mM sodium pyruvate) were grown and exposed to chemicals (with or
without 10% S9 mix, final concentration of 1% S9) in 24well plastic plates. After 24 h
incubation at 37 ◦ C, 5% CO2 , and 95% humidity, cells were pipetted into 1.5mL microfuge
tubes, harvested by centrifugation, washed in PBS, and resuspended in 300 L PBS. Samples of
150 L were transferred to wells of a 96well plate for data collection (see below).”

“All compounds were obtained at analytical purity where avail able (Sigma, Aldrich, Fluka,
BDH and Avocado). Compounds were tested up to a concentration of 10 mM when not limited
by solubility or cytotoxicity. The limit of solubility was set as the top concentration where
precipitate in 2% DMSO was not visible to the naked eye. All compounds were tested at least
four times to corroborate results.”

28. Media Formulation (Team July)

MEDIA specifications

DMEM Major feedstock source in the culture. Contains amino acids, salts,
glucose, and vitamins. DMEM is a modified version of Eagle’s
Minimal Essential Media, with a higher concentration of vitamins,
amino acids, and glucose, as well as phenol red and iron. The phenol
red is used to indicate pH it should normally be pink when culturing
mammalian cells, and if it turns yellow, the solution has become
acidic, usually due to bacterial contamination. We can also order
DMEM without phenol red, as it will interfere when measuring
green fluorescence.
FBS 10% is Fetal bovine serum is commonly used in culturing eukaryotic cells.

most It contains growth factors and a large amount of Bovine Serum
common Albumin (BSA) which is a small and stable, mainly unreactive
, also protein.
5% or
1%
Penicillin 2.5 Antibiotic to prevent bacterial growth.

U/mL
streptomyci 2.5 Antibiotic to prevent bacterial growth.

n ug/mL
gentamicin 5 ug/mL Antibiotic to prevent bacterial growth.

“ Analysis of GFP expression. The specific fluorescence of the cell lines was determined by
fluorometry . One milliliter aliquots of cells that had been cultured for 3 days were transferred to
a 12well plate and lysed by addition of one volume of 1% Triton X100 (Sigma) in PBS. The
plate was incubated under a humidified atmosphere with CO2 for 1 h. The fluorescence was
measured using a Cytofluor 4000 platereading fluorometer (PerSeptive Biosystems,
Framingham, MA) with an excitation wavelength of 485 nm (bandwidth of 20 nm) and an
emission fluorescence of 530 nm (bandwidth of 25 nm). The background fluorescence from
cultures transfected in the absence of plasmid was subtracted from each value to give relative
fluorescence units (RFU). The cell density was assessed with a CASY 1 TTC cell counter
(Schärfe System GmbH, Reutlingen, Germany). The specific fluorescence corresponded to the
RFUs divided by the number of cells multiplied by 100. Once per month, the percentage of
GFPpositive cells and the fluorescence intensity per cell were determined by flow cytometry on
a BD FACS Scan benchtop analyzer (BD Biosciences, San Jose, CA).” from
https://www.sciencedirect.com/science/article/pii/S0006291X05027580 this paper

MEDIA FORMULATION DOCUMENT

CHO DG44 (also known as CHODHFR)

Reagent concentration purpose Further reading
DMEM (no phenol red) Food, nutrients https://www.frontiersin.org/articl

es/10.3389/fmicb.2016.01280/fu
ll%5C
FBS 10% Growth factors, nutrients https://www.intechopen.com/bo

oks/biomedicaltissueculture/cu
ltureconditionsandtypesofgr
owthmediaformammaliancell
s
Penicillin/streptomycin 1% (100 Prevent bacterial contamination https://www.thermofisher.com/o

units/mL pen. , rder/catalog/product/15140122
100 ug/mL https://www.researchgate.net/po
strep.) st/Ideal_quantity_and_of_antibio
tic_used_in_media_for_animal_
cell_culture2
hypoxanthine 0.1 mM Cell line is deficient for this https://www.atcc.org/Products/A

ll/CRL9096.aspx#culturemetho
d
thymidine 0.016 mM Cell line is deficient for this https://www.atcc.org/Products/A

ll/CRL9096.aspx#culturemetho
d

>>CHODG44 cells require glycine, hypoxanthine and thymidine (GHT) for growth
>>Both IMDM and DMEM contain 30.00 mg/L of glycine
>> hypoxanthine and thymidine should be supplied at 0.1 mM hypoxanthine, 0.016 mM
thymidine (for the CHODG44 cell line)
>> get media without phenol red
>> add antibiotics to the media (if media contains serum. If media does not have serum, use 10%
as much antibiotic)
>> IMDM should be used at 5% CO2; DMEM should ideally be used at 10% CO2 but almost
everybody in the field uses 5% CO2. It means that the pH will be 7.6 instead of 7.27.4, and this
doesn’t seem to have much effect on the growth of cells
>> use Penicillin at 2.5 U/mL, streptomycin at 2.5 ug/mL, and gentamicin at 5 ug/mL. This is a
relatively low dose of antibiotics that worked in one paper just fine, and we can adjust it if it
doesn’t work. Alternatively, you can use just penicillin and streptomycin
>>use 10% FBS solution.

From https://www.frontiersin.org/articles/10.3389/fmicb.2016.01280/full%5C this paper
DMEM Major feedstock source in the culture. Contains amino acids,

salts, glucose, and vitamins. DMEM is a modified version of
Eagle’s Minimal Essential Media, with a higher concentration of
vitamins, amino acids, and glucose, as well as phenol red and
iron. The phenol red is used to indicate pH it should normally be
pink when culturing mammalian cells, and if it turns yellow, the
solution has become acidic, usually due to bacterial
contamination. We can also order DMEM without phenol red, as
it will interfere when measuring green fluorescence.
FBS 10% Fetal bovine serum is commonly used in culturing eukaryotic

cells. It contains growth factors and a large amount of Bovine
Serum Albumin (BSA) which is a small and stable, mainly
unreactive protein.
Penicillin 2.5 Antibiotic to prevent bacterial growth.

U/mL
streptomycin 2.5 Antibiotic to prevent bacterial growth.

ug/mL
gentamicin 5 ug/mL Antibiotic to prevent bacterial growth.

>> if we use the above formulation, we want to add 0.1 mM hypoxanthine, 0.016 mM thymidine
because this cell line is DHFR deficient
>> we want media without phenol red added
>> for a relatively low level of antibiotics, use penicillin at 2.5 U/mL, streptomycin at 2.5
ug/mL, and gentamicin at 5 ug/mL. An alternative is to use a mixture of penicillin and
streptomycin.
>> we already have streptomycin, but it is very cheap to buy penicillin and streptomycin in a
mixture

According to ATCC: https://www.atcc.org/Products/All/CRL9096.aspx#culturemethod

Complete media
Iscove's modified Dulbecco's medium with 4 mM Lglutamine adjusted to contain 1.5 g/L
sodium bicarbonate and supplemented with 0.1 mM hypoxanthine, 0.016 mM thymidine,
0.002mM Methotrexate (Amethopterin) and 10% fetal bovine serum

IMDM Major food source. Contains http://jem.rupress.org/conten

salts, amino acids, vitamins, t/147/3/923 paper originally
glucose, sodium pyruvate, describing IMDM. IMDM is
HEPES (a buffer), and widely used in culturing
Phenol red116 eukaryotic cells. Example:
https://www.ncbi.nlm.nih.go
v/pmc/articles/PMC4989492
/
Lglutamine Amino acid
Sodium bicarbonate pH control This reduced level of

sodium bicarbonate
(NaHCO3 , 1.5 g/L) is
intended for use in a 5%
CO2 in air. Additional
sodium bicarbonate may be
required for use in
incubators containing higher
percentages of CO2 117
hypoxanthine Added because this cell line The cells are deficient in

is DHFR deficient dihydrofolate reductase.
They should die in the
absence of HT
(HypoxanthineThymidine)
thymidine Added because this cell line The cells are deficient in

is DHFR deficient dihydrofolate reductase.
They should die in the
absence of HT
(HypoxanthineThymidine)
Methotrexate Used to select for cells that Methotrexate

(Amethopterin) are either dhfr() or are (Amethopterin) is added to
overexpressing the dhfr the cell culture medium to
gene (i.e. compensation by prevent growth of revertant
overexpression of the cells with a low resistance to
enzyme; dosedependent the drug.
response to MTX).

116
https://www.atcc.org/~/media/Attachments/E/9/7/E/4893.ashx
117
https://www.atcc.org/~/ps/302005.ashx
fetal bovine serum Growth factor used in
culturing mammalian cells.
10% is the standard.

subculturing
Volumes are given for a 75 cm2 flask. Increase or decrease the amount of dissociation medium
needed proportionally for culture vessels of other sizes.
Remove and discard culture medium.
Briefly rinse the cell layer with 0.25% (w/v) Trypsin 0.53 mM EDTA solution to remove all
traces of serum that contains trypsin inhibitor.
Add 2.0 to 3.0 mL of TrypsinEDTA solution to flask and observe cells under an inverted
microscope until cell layer is dispersed (usually within 5 to 15 minutes).
Note: To avoid clumping do not agitate the cells by hitting or shaking the flask while waiting for
the cells to detach. Cells that are difficult to detach may be placed at 37°C to facilitate dispersal.
Add 6.0 to 8.0 mL of complete growth medium and aspirate cells by gently pipetting.
Add appropriate aliquots of the cell suspension to new culture vessels.
Incubate cultures at 37°C.
Subcultivation Ratio: A subcultivation ratio of 1:4 to 1:8 is recommended
Medium Renewal: 2 to 3 times per week

Freeze medium: Complete growth medium 95%; DMSO, 5%
Storage temperature: liquid nitrogen vapor phase

Atmosphere: air, 95%; carbon dioxide (CO2), 5%
Temperature: 37°C

Growth Conditions: The cells are deficient in dihydrofolate reductase. They should die in the
absence of HT (HypoxanthineThymidine). Methotrexate (Amethopterin) is added to the cell
culture medium to prevent growth of revertant cells with a low resistance to the drug.

FAQS
Adding Methotrexate, Hypoxanthine, and Thymidine to medium for ATCC® CRL9096
Why do you add Methotrexate, Hypoxanthine, and Thymidine to the medium when culturing
ATCC® CRL9096?
Methotrexate is frequently used to select for cells that are either dhfr() or are overexpressing
the dhfr gene (i.e. compensation by overexpression of the enzyme; dosedependent response to
MTX).
Cells that are dhfr() have an absolute requirement for the addition of HT
(HypoxanthineThymidine) to the growth medium. This is due to the fact that the major synthetic
pathway (where, dhfr converts dihydrofolate to tetrahydrofolate; the active form of folic acid that
is needed for de novo synthesis of thymidine, and purine base synthesis) is shut off, and can only
function via the salvage pathway if, and only if, hypoxanthine and thymidine have been provided
to the cells (i.e. these components do not have to be synthesized). However, dhfr() cells can also
be grown in low levels of MTX since these cells are synthesizing nucleic acid via the salvage
pathway (i.e. there is no need to worry that the major synthetic pathway is being disrupted
because the MTX is binding up dhfr; there just isn't any dhfr to bind, SO the cells will survive).
ATCC® CRL9096 cells are deficient in dihydrofolate reductase and the cells will die in the
absence of HT. The medium formulation and supplements are very important for ATCC®
CRL9096. The medium that we use successfully is IMDM ( ATCC® 302005 ) supplemented
with:
0.1 mM hypoxanthine
0.016 mM thymidine
0.002mM Methotrexate (Amethopterin)
10% high quality, low endotoxin fetal bovine serum ( ATCC® 302020 )
The ATCC uses tested hypoxanthinethymidine, ( ATCC® 71X ) which contains 13.6 mg/L
hypoxanthine and 3.8 mg/L thymidine. The Methotrexate used in our labs is obtained from
Sigma. We initiate the culture in either 10 ml of prewarmed (incubated at least 15 minutes)
medium in a 25cm2 tissue culture flask, or in 15 ml of prewarmed medium in a 75cm2 tissue
culture flask. These cells are sensitive to DMSO therefore it is important that the cryoprotectant
be removed from the cells immediately upon thawing. We recommend gentle centrifugation, 125
xg for 5 to 10 minutes.

Antibiotics

All this data is taken from
https://www.intechopen.com/books/biomedicaltissueculture/cultureconditionsandtypesofgr
owthmediaformammaliancells
antibiotic Storage conditions Stability in culture at 37ºC
Penicillin 20ºC About 3 days
streptomycin 20ºC About 3 days
gentamicin 4ºC About 5 days


According to this publication:
https://www.intechopen.com/books/biomedicaltissueculture/cultureconditionsandtypesofgr
owthmediaformammaliancells

For media containing 1.5 to 2.2 g/L sodium bicarbonate, use 5% CO2
For media containing 3.7 g/L sodium bicarbonate, use 10% CO2.

DMEM contains 3.7 g/L of sodium bicarbonate

But it sounds like we are okay using 5% CO2 because almost everybody does that and the pH is
still within physiological limits so the cells grow just fine

From a comment on ResearchGate:
https://www.researchgate.net/post/Why_does_DMEM_always_contain_37g_L_of_sodium_bicar
bonate

“I also have always used DMEM in 5% CO2 with common cell lines like HeLa Kyoto,
HEK293T, etc. But when you make the calculations based on the buffering equations, DMEM in
a 5% CO2 atmosphere gives a pH of ~7.6 . I think it's still within the range of physiological pH,
which is why there is no problem with the growth of the cells. 10% CO2, however, maintains the
pH at ~7.4. So I thought it would be better to set the incubator to 10% CO2 because to my
knowledge cells should be grown within pH 7.27.4 unless a higher or lower pH is wanted on
purpose.
I couldn't find DMEM low glucose with lower NaHCO3 concentration. I found only powder
DMEM low glucose where I can add the desired amount of NaHCO3 but I don't wanna deal with
its tedious preparation procedure. So I incubated my HeLa cells side by side in DMEM low
glucose from Gibco (3.7g/L) in 5% and 10% CO2 atmosphere. In 10% CO2, the color of the
medium is exactly as if it's taken from a fresh DMEM bottle (orangishred, pH 7.07.4), while in
5% CO2 the color is dark red (pH 7.67.7). This observation is consistent with the calculations.
My colleagues acknowledge now that DMEM requires 10% CO2 but the reason why they don't
want to switch to 10% is because they don't want any additional parameters after having done so
many experiments in 5% CO2. So I'm not going to try to convince anyone, because it's a matter
of keeping all conditions constant throughout their projects. So I wanted to buy DMEM low
glucose with lower NaHCO3 for an ideal pH in 5% CO2 but no one sells that stuff (except the
powder forms). I think I will just stick to 5% CO2 with the regular DMEM low glucose
(3.7g/L).”

Do not add antibiotics to solutions that are serum free as they will be more potent and kill the
cells; if you must, use 10% as much.

From:
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3449951/pdf/10616_2004_Article_201184.pdf

This paper followed ATCC’s recommendations for growing the cells in IMDM with their
modifications

“In addition CHO/dhfr cells (ATCC: CRL9096) were grown in IMDM (Iscove’s modified
Dulbecco’s medium) supplemented with 4 mM Lglutamine, 0.1 mM hypoxanthine and 0.01
mM thymidine and adjusted to contain 1.5 g l−1 sodium bicarbonate and 10% FBS after
adaptation to grow in suspension. This medium was used initially for adaptation to grow in
suspension and subsequently for cell maintenance. During the runs in the DEPchamber reported
here, a serum free medium was used for the CHO/dhfr cells (CHOSSFM II by Gibco/BRL).
The cells were grown in suspension at 37 ◦C in a 5% CO2 and humidity controlled incubator
(Forma Stericult).”

From: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3338941/

This paper also followed ATCC’s recommendations for growing the cells in IMDM with their
modifications

“The new cRFB4 expression plasmid was transfected into dihydrofolate reductasedeficient
Chinese hamster ovary (CHO/DHFR−) cells (ATCC, Cat#CRL9096) using Lipofectamine™
LTX reagent (Invitrogen, Cat#15338100). Stable transfectants were selected in IMDM media
(Sigma, Cat#I3390) supplemented with 10% dialyzed FBS (Invitrogen, Cat#26400036).”

This paper using CRL9096 used a different media formulation:

“The Chinese hamster (Cricetulus griseus) ovary cell line, Chinese hamster ovary (CHO)
DUKXB11, was purchased from the American Type Culture Collection (ATCC; Cat. No.
CRL9096) and cultivated in Pro CHO 5 Medium (Lonza Group AG) supplemented with Phenol
Red (15 mg/L), 0.5 mg/mL Geneticin (G418), 4 mmol/L lglutamine, and methotrexate (0.038
μmol/L). CHO DUKXB11 cells were cultivated under serumfree conditions to ensure that they
grow in suspension and that an easier purification of IgG upon largescale production is
allowed.”
ProCHO5 “ Contains 0.1% Pluronic® F68. Does not contain Lglutamine, phenol red,
hypoxanthine, or thymidine.ProCHOTMAT For adherent culture of CHO cells. Contains
Lglutamine. Does not contain hypoxanthine or thymidine.” and we need our media to contain
hypoxanthine and thymidine.
ProCHO5 is serum free media, which is usually expensive

From this paper: https://www.sciencedirect.com/science/article/pii/S0006291X05027580
“CHO DG44 cells were adapted to serumfree suspension growth in ProCHO5 CDM medium
(BioWhittaker, Walkersville, MD) supplemented with 0.68 mg/L hypoxanthine and 0.194 mg/L
thymidine (HT) (Sigma Chemical, St. Louis, MO).”

They used ProCHO5 media supplemented with hypoxanthine and thymidine

From https://www.biocompare.com/pfu/11868180/soids/2278023/Cell_Culture_Media/IMDM :
“IMDM, or Iscove’s Modified Dulbecco’s Medium, was first developed by N.N. Iscove (1978)
to successfully culture mouse Blymphocytes to maturation without added serum. In the original
IMDM recipe, Dulbecco’s Medium (DMEM) was enriched with selenium and serum
replacements that consist of albumin, transferrin, and soybean lipids. Compared to other basal
media, IMDM is highly enriched, containing greater amounts of amino acids, vitamins, and
glucose. It has been reported to support various mammalian cells and tissue such as bone
marrow, hematopoietic progenitors, and some cell lines.”
Original paper describing IMDM: http://jem.rupress.org/content/147/3/923 (Iscove 1978)
From this paper: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4989492/

In this paper, they modified viruses to contain GFP, and then infected mammalian cells in culture
based on IMDM.

“Mouse melanoma B16F10 (here and after B16), mouse lymphosarcoma RLS, drug resistant
mouse lymphosarcoma RLS40, human cervical carcinoma KB31, drug resistant human
cervical carcinoma KB85, African green monkey kidney fibroblast CV1 cells were obtained
from the Culture Collection of the Institute of Chemical Biology and Fundamental Medicine,
Siberian Branch of the Russian Academy of Sciences. B16, RLS and KB31 cells were cultured
in IMDM containing 10 % foetal calf serum (FCS) and with antibiotic–antimycotic solution (100
U/mL penicillin G, 100 U/mL streptomycin, 250 ng/mL amphotericin B) at 5 % CO2 and 37 °C
(standard conditions). RLS40 and KB85 cells were cultured in IMDM with 40 nM
Vincaleukoblastine sulfate salt (Sigma) under standard conditions.
Vaccinia virus LIVPGFP was modified by deletion of the thymidine kinase gene and by
insertion of the DNA sequence encoding the green fluorescent protein (GFP) protein. The
construction of mutant vaccinia virus LIVPGFP was described recently
[...]

Flow cytometry analysis of GFP protein expression

At 24, 48 and 72 h following viral infection, cancer cells were detached by trypsin (when
applicable), fixed in a 2 % solution of formaldehyde in PBS, and GFP expression was analysed
with a Cytomics FC 500 CXP flow cytometer (Beckman Coulter, United States), no less than
15,000 events/sample. The cells were considered GFPpositive if the level of their fluorescence
exceeded the autofluorescence of cells in the control group by at least a factor of five. The
intensity of fluorescence of individual cells was measured in relative fluorescence units (RFU) at
a laser excitation wavelength of 488 nm.”
In this paper they used DMEM to culture human cells transfected with a plasmid containing GFP,
and used IMEM to culture human cells transfected with a plasmid containing luciferase:

AML12:

Immortalization of AML12:

AML12 is a hepatocyte. Proliferating hepatocytes produce and respond to TGFa in an autocrine
manner.Transforming growth factor a (TGFa) is a polypeptide that regulates normal growth in
epithelial tissues, and its overproduction in cells possessing epidermal growth factor receptors
(EGFRs) is often correlated with malignant transformation.

“Hepatocyte Isolation: Hepatocytes were isolated from livers of 5monthold male homozygous
TGFatransgenic mice (CD1 strain, line MT42), which carry a human TGFa (hTGFa) cDNA
driven by the zincinducible metallothionein 1 promoter (13).”

“Cell Culture: Hepatocytes were plated (8 x 106 cells per 100mm dish) on plastic dishes in
Dulbecco's modified Eagle's medium/Ham's F12 (GIBCO) supplemented with 10% fetal bovine
serum (FBS), a mixture of insulin, transferrin, and selenium (ITS; Collaborative Research),
0.1,tM dexamethasone, and gentamicin at 50 ,ug/ml. After a 2hr attachment period, the culture
medium was replaced and changed every 34 days. After 23 months, colonies were individually
isolated, trypsinized, and expanded;”

According to ATCC:
https://www.atcc.org/Products/All/CRL2254.aspx#culturemethod

Complete Growth Medium
The base medium for this cell line is DMEM:F12 Medium
(ATCC 302006 ). To make the complete growth medium, add
the following component to the 500 mL of the base medium:

Supplemented with:

10% fetal bovine serum (FBS; ATCC 302020 )
10 µg/ml insulin
5.5 µg/ml transferrin
5 ng/ml selenium
40 ng/ml dexamethasone
This medium is formulated for use with a 5% CO2 in air
atmosphere.
Subculturing Volumes used in this protocol are for 75 cm2 flask;
proportionally reduce or increase amount of dissociation
medium for culture vessels of other sizes.

Remove and discard culture medium.

Briefly rinse the cell layer with 0.25% (w/v) Trypsin 0.53 mM
EDTA solution to remove all traces of serum that contains
trypsin inhibitor.

Add 2.0 to 3.0 ml of TrypsinEDTA solution to flask and
observe cells under an inverted microscope until cell layer is
dispersed (usually within 5 to 15 minutes).

Note: To avoid clumping do not agitate the cells by hitting or
shaking the flask while waiting for the cells to detach. Cells
that are difficult to detach may be placed at 37°C to facilitate
dispersal.

Add 6.0 to 8.0 ml of complete growth medium and aspirate
cells by gently pipetting.

Add appropriate aliquots of the cell suspension to new culture
vessels.

Incubate cultures at 37°C.

Subcultivation Ratio: 1:4 to 1:6
Medium Renewal: 2 to 3 times a week.

Population Doubling Time: 37 hrs

According to Literature:

1. https://www.ncbi.nlm.nih.gov/pubmed?cmd=Retrieve&db=PubMed&list_uids=7904757
&dopt=AbstractPlus
2. http://www.jbc.org/content/282/30/22089.full
3. https://stemcellsjournals.onlinelibrary.wiley.com/doi/pdf/10.5966/sctm.20150268 (Uses
AML12+ GFP)
4. https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4267857/pdf/nihms635304.pdf

a. “AML12 cells were maintained in the following media: (normal) DMEM/F12
high glucose (Invitrogen, # 11330–057) supplemented with 10% FBS, 1% ITS,
1% penicillin/ streptomycin antibiotics, and 40 ng/mL dexamethasone;
(starvation) HBSS media with Ca2+ and Mg2+ supplemented with 10 mM
HEPES (Invitrogen, # 15630). mRFPGFPLC3 plasmids were transfected into
AML12 cells grown on Labtek II Chamber Slide (Nunc, # 154461) with
Lipofectamine 2000 according to the manufacturer’s protocol for 24 h followed
by drug treatments for 24 h. “
5. http://diabetes.diabetesjournals.org/content/diabetes/suppl/2014/02/18/db130788.DC1/D
B130788SupplementaryData.pdf
a. “Cell culture. Mouse AML12 hepatocytes were cultured with DMEM/F12
medium (Gibco) supplemented with insulin, transferrin, selenium (ITS; Gibco)
and dexamethasone (DEX) (40 ng/ml; Sigma) in a humidified atmosphere
containing 5% CO2 at 37°C. Primary hepatocytes were prepared from C57BL/6
mice via the collagenase IV (Gibco) perfusion method as described previously
(1).”

Complete Growth Medium
Ingredient Quantity Purpose
DMEM/F12 500 mL DMEM/F12 is a 1:1 mix of

Dulbecco's modified Eagle
medium and Ham's F12
medium.

Major feedstock source in the
culture. Contains amino
acids, salts, glucose, and
vitamins. DMEM is a
modified version of Eagle’s
Minimal Essential Media,
with a higher concentration of
vitamins, amino acids, and
glucose, as well as phenol red
and iron. The phenol red is
used to indicate pH it should
normally be pink when
culturing mammalian cells,
and if it turns yellow, the
solution has become acidic,
usually due to bacterial
contamination. We can also
order DMEM without phenol
red, as it will interfere when
measuring green
fluorescence.

FBS 10% DMEM/F12 contains no

proteins, lipids, or growth
factors. Therefore, it needs to
be supplemented with 10%
FBS.

Fetal bovine serum is
commonly used in culturing
eukaryotic cells. It contains
growth factors and a large
amount of Bovine Serum
Albumin (BSA) which is a
small and stable, mainly
unreactive protein.
CO2 5% DMEM/F12 uses a sodium

bicarbonate buffer system and
therefore requires a 5%10%
CO2 environment to maintain
physiological pH.
Insulin 10 µg/ml Used to stimulate growth and

proliferation of cultured cells.
It is also a component of
serumfree media
formulations used for most
primarycells and cell lines
(for long term growth). In
addition to stimulation of cell
growth, classical insulin
responses such as increased
fatty acid and glycogen
synthesis are seen in
serumfree medium.

Insulin initiates it activity by
binding to glycoprotein
receptors on the surface of the
cell. Binding to the receptor
eventually results in insulin’s
action on glucose, lipid and
protein metabolism.

In hepatocytes, insulin limits
autophagy that occurs after
isolation.
Transferrin 5.5 µg/ml Transferrins facilitate

extracellular iron storage, and
transport.

Transferrins are important
extracellular antioxidants.
They bind iron so tightly
under physiological
conditions that virtually no
free iron exists to catalyze the
production of free radicals.

The delivery of iron to cells
by transferrins is a
receptormediated and
controlled process. Cells
regulate the amount of iron
they receive from the
extracellular environment by
varying transferrin receptor
expression

selenium 5 ng/ml Selenium is an essential trace

element for normal cell
growth and development in
vivo and in vitro. It is
incorporated into enzymes
that protect cells by reducing
peroxides, organic
hydroperoxides, and
peroxynitrites to nonharmful
species. Selenoenzymes with
various antioxidant functions,
and different substrate
specificities are localized
inside, on and outside the
cell, and together these
enzymes provide a
comprehensive range of
defenses against oxidative
damage.
dexamethasone 40 ng/ml Promotes differentiation of

mature hepatocytes from
mouse and human embryonic
stem (ES) cells

Promotes maturation of fetal
mouse hepatocytes

>> get without phenol red

Subculturing

Trypsin 0.53 mM EDTA 23 mL 0.25% Trypsin/0.53 mM
solution EDTA in Hanks Balanced
Salt Solution without calcium
or magnesium. For
Additional Links: dissociation of cell
https://www.atcc.org/~/ps/30 monolayers. (Used in
2101.ashx adherent cells)

● EDTA (disodium
ethylenediaminetetraa
cetic acid) : Adhesion
molecules in the
presence of calcium
determine cellcell
and cellmatrix
interaction. To weaken
the interactions,
EDTA is frequently
included with Trypsin
which chelates the
divalent cations (Ca 2+ ,
Mg 2+ ).
● Phenol red : Optimum
activity of trypsin is
achieved at pH range
from 7 to 9
(5466615). At this
range inclusion of
phenol red gives pink
color. Due to
environmental
conditions the pH of
trypsin may turn
acidic, giving orange
color and renders
trypsin less effective.
By adjusting the pH to
7.4 – 7.6 with NaOH
trypsin activity could
be optimized.
● Diluent: Concentrated
trypsin is being
solubilized or diluted
in a buffered salt
solution that contains
no Ca 2+ or Mg 2+ , such
as Hank's Balanced
Salt Solution (Product
No H9394), which
maintains pH and
osmotic balance.
Besides, some trypsin
products have 0.9%
NaCL as diluent
instead of hanks
balanced salt solution.

Links to Materials
AML12 (Instructions
linked)
F12 Medium (w/o https://www.thermofisher.com/order/catalog/produ
Phenol red) $42.39 ct/21041025
fetal bovine serum
https://www.thermofisher.com/order/catalog/produ
ct/41400045
10 µg/ml insulin 5mL $100.00
5.5 µg/ml transferrin 100mg $100.00
5 ng/ml selenium 5g $46.75

40 ng/ml https://www.sigmaaldrich.com/catalog/product/sig
dexamethasone 100mg $80.00 ma/d4902?lang=en&region=US
Trypsin 0.53 mM https://www.atcc.org/en/Products/Culture_Reagent
EDTA solution $13.30 s/Dissociation_Reagents/302101.aspx

https://www.bioind.com/support/mediaformulations/mediaformulationf12/

29. More Work Space (Team August)

Cells vs. Animals

Cells Animals
cheap More realistic response
Easier to monitor Lasts more than a week
Can be used for a device Bsl 2
Can be used on a smaller scale Difficulty in logistics of keeping animals
More humane Stressed animals make noise in data
BSL1
Can identify smaller amounts of toxins

Why transgenic?
● Can get data faster
● Can measure expression over time
● Potentially easier to measure expression of multiple pathways over time
● Potentially easier to integrate into a device
● Real time data
●

ELISA vs. Assay vs. biosensor

ELISA Assay Biosensor
Real time results

Protocol notes from Metallotheonin paper

Reference paper:

“mouse NIH/3T3 cells were cotransfected with a plasmid containing the Chinese hamster HSP27
gene under the control of the metallothionein promoter and a plasmid containing the neo gene”(a
control they used. “" Control “neo” cell lines were obtained from NIH/3T3 cells
transfected with 0.5 pg of pRSVNEO complemented to 40 pg with
pUC13. After selection with G418 for 3 weeks, stably transfected
clones were isolated from a pooled population of colonies (from 150
to 300) after plating cells at limit dilution in 96well dishes. A total
of seven pMT1 HAtransfected clones, designated clones 8, 10, 11,
14, 15, 18, and 24, and five control cell lines designated neo 1, neo 2,
neo 3, neo 9, and neo 12, were analyzed in the present study. In some
cases, uncloned populations from the pool of pRSVNEOonlytransfected
cells (designated “neopool”) were used. ") “ Stable transfectant cell lines were selected for
resistance to the antibiotic G418. Analyses of several stable transfectant cell lines indicated that
expression of Chinese hamster HSP27 could be selectively induced by exposure to 3 uM CdClp,
a concentration that had no effect on the induction of the endogenous heat shock proteins (HSP)”

Materials and Methods:

“Plasmid ConstructionThe PstI insert of plasmid pH8 (29), which contains near complete cDNA
sequences of Chinese hamster HSP27 mRNA (30), was digested on both sides with Bal31
nuclease keeping 8 bp upstream of the ATG codon and 15 bp downstream of the polyadenylation
site. EglII sites were generated on both ends by ligation to EglII linkers allowing subcloning into
the unique BglII site located downstream of the heavy metal responsive promoter, between the
transcription and translation start sites of the mouse metallothionein gene MT1 (31), cloned into
pUC13. The resulting plasmid has been called pMT1 HA. The plasmid pHs2711 has been
described elsewhere (19). It contains the human HSP27 gene under the control of human HSP27
promoter, and it is expressed constitutively when transfected in Chinese hamster cells.”

(31) > 31. Hamer, D. H., and Walling, M. J. (1982) J. Mol. Appl. Genet. 1,273288

Quick thought: We can use the methods and results in this paper, redo the experiment, and
compare expression levels the reference paper with the level of fluorescence we measure in our
own project.

Experiment steps

Step 0.1: Amplify notyetsynthesized promoters out of the specific cell it comes from (can
likely use the primers that have already been made)

https://link.springer.com/protocol/10.1385/0896034852:143
1. Culturing Cells ~ still not entirely 100% sure about what Andrew and Marc had in mind
for this (for example, I’m not sure how the liquid nitrogen will be stored and utilized
a. However, from what I understand currently:
i. We’ll start with a base culture of what we get from atcc.org
ii. .
iii. .
2. Mini/Midi(?)prep pcDNAEGFP plasmid
http://omegabiotek.com/store/wpcontent/uploads/2013/05/D6904.D6922PlasmidDNA
Midi.MaxiKitComboOnline.pdf
3. PCR our promoters, freeze some and keep some as working stock

For Promoters that are Inserted Into the Plasmid Using Restriction Digest
4. Digest Plasmid & Promoter w/ proper restriction enzymes
5. Ligate promoter into plasmid

For Promoters that are Inserted Using SLIC(the three small MT2 constructs)
Digest plasmid with restriction enzymes
Put in oligos with t4 polymerase
Add in a single dNTP to stop reaction

5. Run a gel to confirm?
6. Once plasmids are made, put into mammalian cells
7. Grow up
8. Expose cells to toxin
9. Measure Fluorescence

● Protocol notes for amplification of genomic DNA (from
https://link.springer.com/protocol/10.1385/0896034852:143 ):
○

Media Prep
Complete Culture Media
AML12 Complete Media (400mL)
● DMEM/F12 351.6 mL
● Penicillin/streptomycin (1%) 4 mL
● FBS (10%) 40 mL
● ITSG 100X (1X) 4 mL
● Dex+DMEM/F12 (40 ng/mL) 400 uL
CHODG44 Complete Media (400mL)
● DMEM 352 mL
● FBS (10%) 40 mL
● Penicillin/streptomycin (1%) 4 mL
● HT 100X (.1 mM/.016 mM) 4 mL
● Filter sterilization is done with a .22 micron filter
● FBS should be thawed overnight. If not possible then thaw FBS at room temperature for
10 minutes, then finish thawing in 37°C water bath

1. Prepare stock solutions
a. Dexamethasone (Dex stock & Dex+DMEM/F12) Dissolve 10 mg of Dex in 5
mL of ethanol(2mg/mL) to make Dex stock solution. Filter sterilize and aliquot
40 uL into a tube, set aside, then aliquot the rest of stock solution into 100 uL
samples and store the 100 uL samples in a 20C freezer. Pipette 1960 uL of
DMEM/F12 into the tube with 40 uL of Dex stock to obtain a new stock (40
ug/mL) and filter sterilize, use this Dex+DMEM/F12 stock when making
complete media. Store at 4C
b. Hypoxanthine/Thymidine (HT 100X) Dissolve 136 mg of hypoxanthine and 38
mg of thymidine in 100 mL of molecular water to make 100x stock solution of
10mM hypoxanthine and 1.6 mM thymidine. Filter sterilize and dispense 4 mL
aliquots into sterile tubes and store at 20C
c. FBS After initial overnight thaw, make 40 mL aliquots of FBS and refreeze
unused aliquots. Making aliquots keeps thawing/refreezing to a minimum
2. Complete media
a. Thaw any frozen reagents, such as FBS
b. Decant media into 500 mL beaker. Pipette other reagents into beaker and mix
using stir rod
c. Filter sterilize solution into 500 mL bottle
Freezing Media
● Complete Media (95%) 9.5 mL
● DMSO (5%) .5 mL

1.
Media
List O’ Media
● CHODG44 Complete Media (final concentrations)(3 to 4 weeks 2 to 8C)
○ Dulbecco's Modified Eagle Medium (DMEM)( 28° C )
○ Fetal Bovine Serum (FBS) 10%
○ Penicillin/streptomycin 1% (100U/mL)( 5°C to 20°C)
○ Hypoxanthine .1 mM
○ Thymidine .016 mM
● AML12 Complete Media (final concentrations)(3 to 4 weeks 2 to 8C)
○ Dulbecco's Modified Eagle Medium/Nutrient Mixture F12, HEPES
(DMEM/F12)( 28° C )
○ Fetal Bovine Serum (FBS) 10%( 5°C to 20°C) thaw overnight at 28C, can be
kept in fridge for 24 weeks, Frozen serum must be mixed after complete thaw to
ensure uniformity, avoid thaw and refreezing
○ Penicillin/streptomycin 1% (100U/mL)( 5°C to 20°C)
○ InsulinTransferrinSelenium (ITSG) 10 µg/mL 5.5 µg/mL5 5 ng/mL ( 28° C )
○ Dexamethasone 40 ng/mL
● Dimethyl Sulfoxide (DMSO)(28C)
● Trypsin 0.53 mM EDTA solution
● Trypan Blue

(make 400mL of complete media assuming 8 passages of one T75 and then a subcult into 4
flasks, leaves 100mL which is enough for any of the protocols, including a 1:4 subcult. It also
still leaves enough for freezing media and relevant stock solutions)46 weeks shelf life
30. Chemicals of Concern (Team August)

Chemical Occupational LD50 Klamath Environmental Cytotoxicology
name limit concentration (In micromoles per liter)
Hydrogen 75 mg/L118 2000 mg/kg119 Relevant dose is 60 uM120

Peroxide
0 uM, 1 uM, 10 uM, 60 uM,
100 uM
118
CDC
119
Drugbank
120
NCBI
Warfarin 0.1 ug/L121 374 mg/kg122mice Qualitatively detected by Relevant dose is 0.0316 – 31.6

186 mg/kg123 rats Tom Young’s lab; μM124
unpublished data
0 uM, 1 uM, 10 uM, 30 uM, 60
uM

2,4D 10 ug/L125 2019 ppm (min) 0.424 7.49 ppm127 0 uM, 10 uM, 20 uM,40 uM,

12979 ppm(max)126 60 uM128
Copper 1 ppb by 30 mg/kg 130 Copper measured at 0 uM, 1 uM, 10 uM, 50 uM,

sulfate inhalation129 concentration of 1967 100 uM 132
ppm131
Metam Limit of irritation 781 mg/kg134 (rat) 131309.21 kg(convert)135 0 uM, 1 uM, 10 uM, 50 uM,

Sodium 22 ug/L 133 1836 ppm (min) 100 uM 136

Note on conversions:
1 g/m 3 = 1 mg/L = 1 ppm
1 mg/m 3 = 1 ug/L = 1 ppb

μg/l = μmol/l × MW

Work space for metam sodium

/GENOTOXICITY/ Metam Sodium was tested for clastogenicity in Chinese hamsters after
single oral doses of 150, 300, and 600 mg/kg. Five animals per sex were sacrificed at 6, 24, and
121
https://www.cdc.gov/niosh/ipcsneng/neng0821.html
122
http://www.inchem.org/documents/pims/chemical/pim563.htm
123
CornellWarfarin
124
https://www.sciencedirect.com/science/article/pii/S0887233311001627
125
CDC
126
USGS
127
USGS
128
129
CDC
130
Cornell
131
USGS
132
Frontiers
133
Paper
134
CADPR
135
USGS
136
Toxnet database: see section on genotoxicity
48 hr postdose for examination of bone marrow cells. At the dose levels tested, metam sodium
was not positive for clastogenicity in Chinese hamster bone marrow …

/GENOTOXICITY/ Chinese hamster CHOK1 cells were exposed to 0, 0.0000464, 0.0001,
0.000215, 0.000464, 0.001, 0.00215, 0.00464 and 0.01 mg/mL of the formulated product,
MetamSodium ( ... purity 42.2%) for 4 hr with and without metabolic activation in an HGPRT
forward mutation assay. Possible adverse effect (equivocal mutagenicity with metabolic
activation).

/GENOTOXICITY/ Metam Sodium (purity = 32.3%) was used in a micronucleus test, which
was performed in 2 phases. Phase I: The max tested dose (MTD) was determined based on
lethalities or toxicity observed over a 4 day period after a single oral dose to CD1 mice
(2/sex/dose) at 0, 800, 1250 and 2000 mg/kg. Subsequently, 5/sex/dose were gavaged with a
single dose at 500, 800 and 1250 mg/kg. Based on results, the MTD for each sex was 500
mg/kg/day. Phase II: The micronucleus study was performed with a single gavage dose to CD1
mice (5/sex/dose) at 0 and 500 mg/kg. Bone marrow samples were taken at 24 and 48 hr after
dosing. Results: Mice displayed the following clinical signs: subdued nature, partial closure of
the eyes and hunched posture. There was no incr in mucronuclei in this study.

/GENOTOXICITY/ The formulated product, MetamSodium ( ... purity = 42.2%) was applied
to duplicate cultures of human lymphocytes at 0, 1, 5, 10 and 20 ug/mL without activation (24
hr) and 0, 10, 20 and 40 ug/mL with activation (2 hr). 200 metaphase cells (100/culture) were
scored for each dose level. Possible adverse effect (increased frequencies of aberrations with and
without activation were observed).

/GENOTOXICITY/ Groups of SH (chin) Ki, SPF Chinese Hamsters (5/sex/group) were dosed
orally with the formulated product, MetamSodium , ( ... purity = 42.2%) at 0, 150, and 300
mg/kg groups (sacrificed at 24 hr) and at 600 mg/kg (sacrificed at 6, 24 and 48 hr). 1000
metaphase cells (100/hamster) were scored for each dose level. Possible adverse effect (incr
frequency of chromosome aberrations in the high dose group with a sacrifice at 24 hr and incr
frequencies of polyploidy in all groups.)

https://onlinelibrary.wiley.com/doi/full/10.1002/tox.22197 ()

Promoters Tentative Chemicals of Concern Cell Lines
Tier 1 Metallothionein 2, CDKN1A, CYP1A1, CuSO4, methyl bromide, metam CHO DG44 ,

HMOX1, GADD45α, HSP90B1, ATF4 sodium , 2,4D , warfarin , AML12
Hydrogen Peroxide
Tier 2 HSP90AB1, HSP90AA2, Metallothionein 1, Glyphosate, tunicamycin, HeLa, Hek, etc

HSP90AA1, HSP 70, HSPB1 thapsigargin

All toxins ever in the Klamath river:
https://www.fws.gov/arcata/fisheries/reports/technical/EaglesSmith%20and%20Johnso
n%202012_Klamath%20contaminants_Final_052312.pdf

Tentative Chemicals of Concern Justification
CuSO4 Copper is known to be present in high concentrations in
Klamath, and CuSO4 induces metallothionein. Relatively
cheap and ubiquitous
methyl bromide Fumigant and pesticide. Used in a high amount in the
Klamath area. 297,717 kg were used in 2009. Inhalation
can lead to lung damage and neurological effects.
metam sodium Commonly used as soil fumigant, pesticide, etc. Used in
a high amount in the Klamath region. 131,309 kg were
used in 2009. It is a sensitizer and has potential for
immunological, developmental, carcinogenic, and
atherogenic effects.
2,4D 2,4D is a herbicide, and currently found in over 1500
herbicide products. 2,4D is linked with fertility problems
and is also a possible carcinogen. This chemical is also
highly toxic to fish. In 2009, there was 5008.92 kilograms
of active 2,4D found in Siskiyou Co., CA (Part of
Klamath Basin).
Warfarin Bioassay data found by Tom Yong’s lab shows the
presence of Warfarin in the water. It is commonly used as
a rat poison and as a heart medication.
Hydrogen Peroxide Very good oxidizer. Used as a positive control for our
project.
Perchlorate Found in many sites the EPA has designated toxic.
Affects the thyroid in animals but has shown no direct
connection to diseases in humans?

31. Work Space (Team August)

To whom it may concern,

Hello, my name is Jacob Lang and I am from the iGEM team at UC Davis. I am contacting you
because my team has a problem concerning the parts we hope to submit. We are working with
mammalian promoters, many of which contain at least one of the illegal restriction sites of the
RFC10 construction. Since these promoters are sequencespecific, as little as one nucleotide
change could potentially change their function. It also means that we are unable to make silent
mutations, since promoters are not read as codons. Because of this, is there any alternative way
we could submit our parts?

Thank you,

Jacob

novozymes
fisher scientific
genentech
amgen
biorad
transcriptic
emerald cloud bio
YCombinator
AgraQuest
Evolve Biosystems
Gingko Bioworks
EpiBiome

Company Description Demands
Novozymes
Fisher Scientific
Genentech
Amgen
Biorad
Transcriptic
Emerald Cloud Bio
Y Combinator
AgraQuest
Evolve Biosystems
Gingko Bioworks
EpiBiome

32. Cloning Progress (Daniel September)

Construct Target Gene Origin Confirm Notes
(EGFP) ed
Colonies
MT1 Metallothionein 1 IDT C3
MT2_1 Metallothionein 2 HEK C2, C3 Has mutations arising from source

(full) gDNA genome (HEK).137
MT2_2 (59 Metallothionein 2 IDT C4 , C5

bp)
MT2_3 Metallothionein 2 IDT C2, C3

(605’)
Consensus sequence is:
137
ACACGGCGGAGGCGCACGGCGTGGGCACCCAGCACCCGGTACACTGTGTCCTCCCGCTGCA
CCCAGCCCCTTCCGCGCCGAGGCGTCCCCGAGGCGCAAGTGGGCCGCCTTCAGGGAACTGAC
CGCCCGCGGCCCGTGTGCAGAGCCGGGTGCGCCCGGCCCAGTGCGCGCGGCCGGGTGTTTCG
CCTGGAGCCGCAAGTGACTCAGCGCGGGGCGTGTGCAGGCAGCGCCCGGCCGGGGCGGGGC
TTTTGCACTCGTCCCGGCTCTTTCTAGCTATAAACACTGCTTGCCGCGCTGCACTCCACCACG
CCTCCTCCAAGTCCCAGCGAACCCGCGTGCAACCTGTCCCGACTCTAGCCGCCTCTTCAGCTC
GCCATGATC
MT2_4 Metallothionein 2 IDT C6, C8

(603’)
GADD45α Growth arrest and HEK C7

DNAdamageinducible protein gDNA
GADD45 alpha
GADD153 DNA damageinducible transcript 3, CHODG C7, C11 Has mutations arising from source

aka CHOP, GADD153 44 gDNA genome (CHODG44).
FGF21 Fibroblast growth factor 21 IDT C4
CMV AddGene
CYP1a1 Cytochrome P450 1a1 AML None Cloning failed.

gDNA
CAG AddGene None Cloning failed.

33. Design Content for Wiki (Daniel September)

Project Design Content for website

I. Background

Superfund Program

The United States Environmental Protection Agency (EPA) is the government agency
responsible for protection of the natural environment and human health [1]. In 1980, Congress
formed the Comprehensive Environmental Response, Compensation and Liability Act
(CERCLA), more commonly referred to as the Superfund program. The Superfund program
identified the most hazardous, contaminated sites in the United States, and marked them as
priorities for cleanup, giving the EPA the authority to step in. There are more than 1300
Superfund sites across the country, and have been linked to increased rates of cancer and other
dangers to human health [2]. Currently, nearly one in six Americans live within three miles of a
superfund site [3].

At the University of California, Davis, there is an established group of researchers who have
been working with the EPA for the past 31 years to “acquire a better understanding of the human
and ecological risks of hazardous substances; and advance the development of new technologies
for the cleanup of contaminated sites” [4]. We had the opportunity to join UC Davis researchers
on a trip to visit a Native American tribe in northern California who live on heavily polluted
land.

Visit with Native American Tribe

The tribe has reported unusually elevated rates of cancer and miscarriage incidence, and has
reason to suspect that the cause may be tied to environmental pollution on their tribal land from
local agricultural and forestry corporations. Researchers from UC Davis have been collaborating
with the tribe’s scientists and governing council to gather data pertaining to environmental and
human health.

In the United States, recognized Native American tribes are selfgoverning bodies, and have the
power to make and enforce laws and regulations on their own lands. The specific Native
American tribe which we visited has expressed their position on genetic engineering in an
ordinance adopted in 2015, which may be accessed here [5]. In the ordinance, the tribe makes
clear that they view the release of genetically modified organisms into their environment to be a
major threat to their cultural values and traditional way of life. Compared to the United States as
a whole, which has relatively tolerant laws regarding the production and use of genetically
modified organisms, the tribe has far stricter laws.

Interestingly, within the ordinance, the tribe makes several exceptions. The first is unusual:
“Genetically engineered or modified organisms do not include organisms created by traditional
selective breeding, [...] or microorganisms created by moving genes or gene segments between
unrelated bacteria” [5]. As much of biotechnology and synthetic biology uses bacteria as a host,
we were surprised to find that the ordinance deemed the majority of the work done in the iGEM
competition as acceptable.

The ordinance also provides exceptions to the prohibition for “State or federally licensed medical
research institutions, medical laboratories, or medical manufacturing facilities engaged in
licensed medical production, or medical research involving genetically engineered or genetically
modified organisms,” as well as for, “Educational or scientific institutes” [5]. This makes it
appear that the major focus of the ordinance is to restrict commercial biotechnology and
agriculture firms and their crops/livestock on tribal lands. The ordinance specifically refers to
transgenic salmon which are referred to as a threat to their way of life and the significance of
the wild salmon to the tribe’s cultural values.

After consideration, we came to the the conclusion that a device or solution made by an iGEM
team with the purpose of being introduced into the environment would be met with strong
resistance, and would be unlikely to benefit society if it were never allowed to be used. Also, we
considered the stance of the tribe, concerning the introduction of genetically modified organisms
as a threat to their cultural values and traditional way of life. While many arguments made by
opponents of GMOs focus on perceived threats to human health, which can be settled
empirically by careful in vivo studies, cultural arguments cannot be dismissed as easily. A
community should have the right to live according their values and uphold traditional ways of
life. If certain communities decide that their values are incompatible with the introduction of
genetically modified organisms on to their land, then their decision should be respected.

The visit with the Native American tribe helped us focus our project and become aware of
human and environmental health problems for which synthetic biology can provide tools to help
resolve. While working on the campus of our university, we were subject only to federal
(America), state (California), and local (Yolo County, City of Davis, University of California)
laws. If we were to return to test our device on tribal lands, we would be required to follow their
specific ordinances and regulations, including seeking prior written permission to use genetically
engineered devices for biomedical research. Likewise, it would be necessary to seek prior written
permission before testing environmental samples taken from tribal lands. A similar procedure
would be required when working with other communities.

With our project thus contained within the lab, we considered how best to use synthetic biology
to help the tribe and other communities facing similar problems with environmental pollution.
The agricultural and forestry corporations in the region surrounding the tribe’s land are currently
operating within legal regulations, however the tribe has indicated that these regulations are not
as strict as they would like. One example a tribal member provided was that currently, herbicides
may be applied within fifty feet of sources of drinking water. A concern is that this distance is
not sufficient to prevent contamination of drinking water supplies. A variety of harmful
chemicals have been found in the waters of the tribal lands, particularly microcystin toxins and
organochlorine pesticides [6]. Analysis of water samples by the Young Lab at UC Davis in 2017
also found the presence of low concentrations of pharmaceuticals, including warfarin, in the
waters of the tribal lands.

If the working hypothesis is found to be supported, that the tribe’s health crises are linked to
environmental pollution of their lands and water, then the remedy would be to tighten regulations
concerning the use of pesticides, herbicides, and other potentially harmful compounds. If this
working hypothesis is not supported by further study, alternative explanations for the tribe’s
health crises should be explored, including predisposing genetic factors within the population
and other factors.

To help collect data to support the working hypothesis, and similar projects involving public
health and environmental toxicology, we decided to develop a way to easily test what effect low
concentrations of potentially harmful chemicals have on the physiological health of mammalian
cells.

II. Bioassay Design

Figure 1. Overview of Bioassay Design
Inducible Promoter From Target Gene > Reporter Gene > Fluorescent Response to Sample

We designed a mammalian cellbased bioassay that reports activation of specific stress pathways
via fluorescence, for use in environmental toxicology. To do this, we selected transcriptionally
regulated target genes which are present in mammalian cells and are involved in stress pathways.
We isolated the promoters with transcription factor binding sites from these target genes and
coupled them to a fluorescent reporter gene. We selected EGFP, a variant of green fluorescent
protein (GFP). GFP is ubiquitous in synthetic biology due to its reliability and ease of
measurement [7]. EGFP is derived from GFP, and has been optimized for use in mammalian
systems. When a chemical of concern is screened using our assay, if it triggers a specific stress
response, the reporter gene will be expressed, causing the assay to fluoresce. The fluorescence of
the assay can be quantitatively measured and analyzed. This assay will provide data on the effect
of chemicals of concern on the physiological health of mammalian cells; measurements may be
easily taken a range of concentrations, durations of exposure, salinities, pH, temperatures,
nutrient availabilities, and other conditions. This also allows for measurement of synergistic or
interfering effects due to multiple chemicals of concern present simultaneously.

We selected 9 promoter constructs derived from 6 target genes (see Figure 2 below) and coupled
them to EGFP. This promoter and reporter gene construct was inserted into a plasmid and
transfected into two cell lines (see Figure 3 below). The resulting 18 bioassays were exposed to 6
different chemicals of concern at a variety of concentrations and conditions (see Figure 4 below).

Why not use whole organisms?

A cellbased approach cannot replace in vivo toxicology studies. However these studies require
extensive funding, time, and other resources. By developing a relatively lowcost, cellbased
bioassay, preliminary data may be quickly gathered, allowing for more informed decision
making as to which in vivo studies are necessary. By using a cellbased preliminary assay, it is
our hope that researchers will be able to quickly gather data, make more informed decisions, and
save resources. Our cellbased bioassay may also be used to add to the body of knowledge
concerning the effect of specific chemicals of concern on the physiological health of mammalian
cells and the mechanism of stress.

Why not use cellfree biochemical assays, such as ELISA?

Antibodybased assays, such as EnzymeLinked Immunosorbent Assay (ELISA), have been very
successful in biomedical research, environmental toxicology, and other fields [8]. These cellfree
methods involve selective binding of a target molecule to a prepared antibody. Such methods are
very successful at identifying single, known compounds in an environmental sample, but do not
provide any data regarding the effect of the chemical of concern on the health of a living cell.
Similarly, the tools of analytical chemistry and organic chemistry may be used to great success
when identifying molecules, but do not provide any data regarding the actual effect on a living
cell.

Why use synthetic biology?

The goal of our bioassay is to create a tool that can be used to better understand the effect on the
physiological health of mammalian cells of environmental toxins. An alternative way to achieve
this knowledge is to expose cells to the chemicals of concern, lyse the cells, isolate the RNA, and
run a quantitativerealtimereversetranscriptPCR in order to characterize and quantify the
mRNAs present in the cell. However, this approach has limitations. It necessarily involves lysing
the cells, and cannot be used to gather realtime data about the behavior of the same cell over
time. By using a fluorescent reporter gene, we can measure the induction of the reporter gene
over time without lysing cells, and can more easily take a large number of data points across
different chemicals of concern, concentrations, and other variables. A fluorescent bioassay also
reduces the amount of work required to measure many data points, compared to PCR based
methods.

Why use mammalian cells?

We chose to use mammalian cells because they make much more accurate models for human
health than bacteria or yeast. Furthermore, within the iGEM competition and the field of
synthetic biology as a whole, there has been relatively little work with mammalian systems,
compared to bacteria, yeast, and algae. Working with mammalian cells brings a variety of new
challenges and opportunities to iGEM: they are more difficult and expensive to culture than
bacteria, they require specialized equipment and safety training, they can be used to produce
proteins suitable for use in human therapeutics (due to similar mosttranslational modifications),
they can be used for more complicated circuits and pathways utilizing spatial/temporal
differentiation, and they are much more sensitive to chemicals in the environment (allowing for
more sensitive biosensors and bioassays).

Why not use human cells?

Although human cell lines would make a superior model for human disease, compared to cell
lines derived from hamsters and mice, for our project we chose not to use human cells. Work
involving human cells requires specialized facilities, equipment, resources, and safety training.
Human cells require a BSL2 lab, which would have been more difficult for our team to use than
our regular wetlab space, which is BSL1. Additionally, as our project took place in the context
of the iGEM competition, we wanted for other teams to be able to easily reproduce our findings
and expand them. By using human cell lines, many teams, which lack access to a BSL2 lab,
would have had more difficulty in expanding upon our project. It would be relatively
straightforward to insert our genetic constructs to a human cell line, and this presents an
opportunity to extend our project.

III. Promoter Constructs

Figure 2 shows the promoter constructs we used and the target genes from which they were
derived. Full FASTA sequences for our promoter constructs are available here .

Figure 2. Promoter Constructs
Construct Target Gene Species of Origin Stress Pathway Size Further
Reading
MT1 Metallothionein 1 Mus musculus Oxidative, heavy metal 305 nucleotides [9]
MT2_1 Metallothionein 2 Homo sapiens Oxidative, heavy metal 377 nucleotides [10]
MT2_2 Metallothionein 2 Homo sapiens Oxidative, heavy metal 59 nucleotides [10]
MT2_3 Metallothionein 2 Homo sapiens Oxidative, heavy metal 60 nucleotides; [10]

construct MT2_2 plus
one base at 5’ end
MT2_4 Metallothionein 2 Homo sapiens Oxidative, heavy metal 60 nucleotides; [10]

construct MT2_2 plus
one base at 3’ end
CYP CYP1A1 Mus musculus Dioxins, organochlorine 1902 nucleotides [11]

biocides
FGF FGF21 Homo sapiens Unfolded protein 695 nucleotides [12]

response (UPR),
endoplasmic reticulum
stress
GD153 GADD153 Cricetulus griseus Organochlorine biocides, 811 nucleotides [13],

genotoxins [14]

GD45 GADD45α Homo sapiens Genotoxins, mechanical 1006 nucleotides [15]

stress

IV. Host Strains

Figure 3. Host Strains
Host Strain Description Supplier
CHODG44 An immortal, adherent cell line derived from chinese hamster ( Cricetulus ATCC: CRL9096 [16]

griseus ) ovary cells. The strain we used is dihydrofolate reductase
deficient.
AML12 An immortal, adherent cell line derived from mouse ( Mus musculus ) liver ATCC: CRL2254 [17]

cells.

V. Chemicals of Concern

Figure 4. Chemicals of Concern
Chemical of Concern Class
Copper Sulfate Heavy metal

Metam Sodium Organosulfur biocide
2,4D Organochlorine herbicide
Warfarin Pharmaceutical anticoagulant, pesticide
Hydrogen Peroxide Oxidizing agent

VI. Plasmid

We used pcDNA3EGFP as our plasmid [18]. The original plasmid is shown in Figure 5 below.

Figure 5. Map of pcDNA3EGFP [19]

To prepare our constructs, we used restriction enzymes to remove the CMV enhancer, CMV
promoter, and the T7 promoter. Promoter sequences were inserted using Sequence and Ligation
Independent Cloning (SLIC). Figure 6 below shows the complete plasmid for construct MT2_1.

Figure 6. Map of pcDNAEGFP_MT2_2 [19]

VII. Measurement

VIII. Extensions

Our project opens up new opportunities for work with mammalian cells in the iGEM
competition. By adding new mammalian parts to the registry, future teams will have the ability to
easily access useful mammalian regulatory elements for use in their own constructs. Future
teams may also benefit from our protocol for measuring fluorescence of adherent mammalian
cells. One extension of our work is to transfect our construct into human cell lines. By using
human cells, the bioassay will be a more accurate model for human health.

IX. References

[1] “About EPA.” EPA, Environmental Protection Agency, 7 July 2018, www.epa.gov/aboutepa.
[2] Johnson, David. “Superfund Sites: 1,317 US Spots Where Toxic Waste Was Dumped.” Time,
Time Inc, 22 Mar. 2017, time.com/4695109/superfundsitestoxicwastelocations/.
[3] Voosen, P. (2018). Wasteland. [online] Nationalgeographic.com. Available at:
https://www.nationalgeographic.com/magazine/2014/12/superfund/ [Accessed 1 Aug. 2018].
[4] "UC Davis Superfund Research Program". UC Davis Superfund Research Program, 2018,
https://www.superfund.ucdavis.edu/. Accessed 1 Aug 2018.
[5] “Ch. 21.15 Genetically Engineered Organisms | Yurok Tribal Code.” Yurok Tribe Tribal
Code, Yurok Tribe, 10 Dec. 2015, yurok.tribal.codes/YTC/21.15.
[6] EaglesSmith, C.A., and B.L. Johnson, 2012, Contaminants in the Klamath Basin: Historical
patterns, current distribution, and data gap identification: U.S. Geological Survey Administrative
Report, 88 p.
[7] “PDB101: Molecule of the Month: Green Fluorescent Protein (GFP).” PDB101, RCSB
PDB, June 2003, pdb101.rcsb.org/motm/42.
[8] Enzyme Immunoassay (EIA)/EnzymeLinked Immunosorbent Assay (ELISA)
Rudolf M. Lequin
Clinical Chemistry Dec 2005, 51 (12) 24152418; DOI: 10.1373/clinchem.2005.051532
[9] Larochelle, Olivier & Labbé, Simon & Harrisson, JeanFrançois & Simard, Carl & Tremblay,
Véronique & StGelais, Geneviève & Govindan, Manjapra Variath & Seguin, Carl. (2008).
Nuclear Factor1 and Metal Transcription Factor1 Synergistically Activate the Mouse
Metallothionein1 Gene in Response to Metal Ions. The Journal of biological chemistry. 283.
8190201. 10.1074/jbc.M800640200.
[10] Santos, Anderson K. et al. "Expression System Based On An Mtiia Promoter To Produce
Hpsa In Mammalian Cell Cultures". Frontiers In Microbiology, vol 7, 2016. Frontiers Media SA,
doi:10.3389/fmicb.2016.01280.
[11] Li, Shuaizhang et al. "Functional Analysis Of The Dioxin Response Elements (Dres) Of
The Murine CYP1A1 Gene Promoter: Beyond The Core DRE Sequence". International Journal
Of Molecular Sciences, vol 15, no. 4, 2014, pp. 64756487. MDPI AG,
doi:10.3390/ijms15046475.
[12] F.G. Schaap, A.E. Kremer, W.H. Lamers, P.L. Jansen, I.C. Gaemers. Fibroblast growth
factor 21 is induced by endoplasmic reticulum stress
Biochimie, 95 (2013), pp. 692699, 10.1016/j.biochi.2012.10.019
[13] Li, Dahui et al. "Genotoxic Evaluation Of The Insecticide Endosulfan Based On The
Induced GADD153GFP Reporter Gene Expression". Environmental Monitoring And
Assessment, vol 176, no. 14, 2010, pp. 251258. Springer Nature,
doi:10.1007/s1066101015807.
[14] Park, Jong Sung et al. "Isolation, Characterization And Chromosomal Localization Of The
Human GADD153 Gene". Gene, vol 116, no. 2, 1992, pp. 259267. Elsevier BV,
doi:10.1016/03781119(92)90523r.
[15] Mitra, Sumegha et al. "Gadd45a Promoter Regulation By A Functional Genetic Variant
Associated With Acute Lung Injury". Plos ONE, vol 9, no. 6, 2014, p. e100169. Public Library
Of Science (Plos), doi:10.1371/journal.pone.0100169.
[16] Cell line available from ATCC at: https://www.atcc.org/Products/All/CRL9096.aspx
[17] Cell line available from ATCC at: https://www.atcc.org/products/all/CRL2254.aspx
[18] More detailed information regarding this plasmid is available from Addgene here:
https://www.addgene.org/13031/ . pcDNA3EGFP was a gift from Doug Golenbock (Addgene
plasmid # 13031)
[19] Plasmid map created with software from SnapGene. Software is available at: snapgene.com

34. Interlab Study Content for wiki (Daniel September)

2018 iGEM InterLab Study

I. Introduction

Interlab studies are a key component of advancing the field of synthetic biology. In past years,
participants in the iGEM competition have conducted large scale studies at research labs across
multiple continents, with the purpose of seeking a better understanding of reproducibility and
variation in synthetic biology [1].

One of the most ubiquitous reporter genes used in synthetic biology is green fluorescent protein
(GFP). Currently, it can be difficult to directly compare measurements of GFP expression
between different labs, or even the same lab over time. This is, in part, due to variation in
protocols and equipment used to make these measurements [2]. The purpose of the 2018 iGEM
interlab study was to gain better understanding of variation and calibration in order to increase
the reproducibility of GFP reporter gene expression level characterization [3].

II.Materials

1. Tecan infinite M200 microplate reader machine (top optics settings were used for this
experiment)
2. Costar® 96 well black with clear bottom assay plates

Figure 1: Settings used for Absorbance
Mode Absorbance
Wavelength 600 nm
Bandwidth 9 nm
Number of Flashes 25
Settle time 0 ms
Temperature 25°C

Figure 2: Settings used for Fluorescence
Mode Fluorescence
Excitation Wavelength 485 nm
Emission Wavelength 525 nm
Excitation Bandwidth 9 nm
Emission Bandwidth 20 nm
Gain 50
Number of Flashes 25
Settle time 0 ms
Integration time 20 µs
Temperature 25°C

III. Methods

All experiments were conducted using the same plates, 100 µL per well (except for the CFU
protocol), and settings.

Calibration 1: OD 600 Reference Point– LUDOX Protocol

We used LUDOX CLX, a 45% colloidal solution of silica, to obtain a OD 600 reference point.
This reference point was used to transform Abs 600 values obtained from our plate reader to
corresponding OD 600 values. 100 µL
of LUDOX solution was aliquoted into a well plate, in 4
replicates. 4 replicate wells of moleculargrade water were used as a blank. Absorbance data was
taken at 600 nm. All subsequent measurements were taken using Costar® 96 well black with
clear bottom assay plates (Costar® Cat. 3631, Corning, NY) and settings on the Tecan infinite
M200 microplate reader machine.

Calibration 2: Particle Standard Curve – Microsphere Protocol

We prepared an 11 step dilution series of monodisperse silica microspheres and measured the
Abs600 in our plate reader using the specified settings. A serial dilution was prepared by
consecutively transferring 100 μl from column to column with good mixing and using 100 μl of
ddH 2 O as the blank. Measurements were made using the microplate reader.

Calibration 3: Fluorescence Standard Curve – Fluorescein Protocol

We prepared a dilution series of fluorescein in four replicates and measured fluorescence in our
plate reader using the specified settings. 10x fluorescein stock solution (100 uM) was prepared
by resuspending in 1 mL of 1x PBS. After the fluorescein was fully dissolved, the stock solution
was diluted to 1x and an 11step, 2fold serial dilution of fluorescein was carried out and
measurements were made using the microplate reader.

Transformation

After calibrating our plate reader, we performed a heat shock transformation of DH5Alpha K12
E. coli with the plasmids supplied in the Distribution Kit (Figure 3). Plasmids from the
Distribution Kit were resuspended in 10 µL of ddH2O and mixed by pipetting. After
transformation, cells were grown for 15 hours in presence of selection (chloramphenicol at a
concentration of 34 mg/L).

Figure 3 : Plasmids Resuspended from Distribution Kit
Device Part Number Plate Location
Negative Control BBa_R0040 Kit Plate 7 Well 2D
Positive Control BBa_I20270 Kit Plate 7 Well 2B
Test Device 1 BBa_J364000 Kit Plate 7 Well 2F
Test Device 2 BBa_J364001 Kit Plate 7 Well 2H
Test Device 3 BBa_J364002 Kit Plate 7 Well 2J
Test Device 4 BBa_J364007 Kit Plate 7 Well 2L

Test Device 5 BBa_J364008 Kit Plate 7 Well 2N
Test Device 6 BBa_J364009 Kit Plate 7 Well 2P

Device Measurement – Abs 600 and Fluorescence

Two colonies of each construct were selected and grown overnight in 5ml LB liquid media
containing 25 µg/mL of chloramphenicol. A 1:10 dilution of each colony was made with 0.5 mL
of culture into 4.5 mL of LB + chloramphenicol. The dilutions were plated and Abs 600 was
measured using the plate reader. The cultures were further diluted to a target Abs 600 value of
0.02, with a final volume of 12 mL LB + chloramphenicol.
Equation used for dilution:
*
V olumei = (0.02 12)/ Abs600x
−
Abs600x = Abscell Absblank

At 0 hours, 500 µL samples were removed from each culture, for a total of 16 samples. These
samples were placed on ice. The remaining portion of the cultures were incubated for an
additional 6 hours at 37℃ and 220 rpm. At 6 hours, 500 µL samples were removed from each
culture, for 16 additional samples, and a total of 32 samples taken over two time points. 100 µL
of each sample was loaded into a well plate in 4 replicates. Abs 600 and fluorescence
measurements were taken. There were 144 resulting data points, representing the 8 constructs
and 1 well of LB and chloramphenicol as a control, with 2 colonies each, in 4 replicates per
colony, at 2 time points.

Device Measurement – Colony Forming Units per 0.1 OD 600 E. coli cultures

OD 600 values were calibrated to Colony Forming Unit (CFU) counts using the following
protocol. The OD 600 value was measured for the 2 colonies of the positive control and for the 2
colonies of the negative control. 25 µL of culture was added to 175 µL of LB with
chloramphenicol in a black 96 well plate with a clear, flat bottom. 200 µL of blank LB with
chloramphenicol was used as the control. The OD600 was then diluted with LB with
chloramphenicol to .1 using the formula given in the protocol. Triplates of the diluted cultures
were plated on the same plate used before and the OD600 was measured to ensure an OD of .1.
Equation used for OD600 of .1 dilution:
(.1)(1000 µL )/((OD 600 blank OD 600 )x8)= µL of culture needed
1000 µL ( µL
of culture needed)= µL of media needed

For each culture, 3 solutions with dilution factors of 8 x 10 4 , 8 x 10 5 , and 8 x 10 6 , respectively,
were plated on LB agar plates with chloramphenicol, and grown for 18 hours at 37º celsius. After
18 hours, visible colonies were counted on each plate.
Equation used to calculate CFU count:
*
# Colonies F inal Dilution F actor = CF U /mL

Figure 4: Overview of CFU Measurement (adapted from [3])

IV. Results and Discussion

Excel sheet turned in for submission

Calibration 1: OD 600 Reference Point– LUDOX

Figure 5: Ludox Calibration Results

After measuring the absorbance of the prepared LUDOX solution, we calculated the arithmetic
mean of the absorbance across 4 replicates (see figure 5). We arrived at a corrected value for the
Abs 600 of our LUDOX solution by subtracting the arithmetic mean of the ddH 2 O blanks from the
arithmetic mean of our LUDOX solution replicates. This gave us a corrected Abs 600 value of
0.017. iGEM supplied us with a reference OD 600 of 0.063. By dividing the reference OD 600 by
our measured Abs 600 value, we arrived at a conversion factor of 3.610.

Calibration 2: Particle Standard Curve – Microsphere

Figure 6: Microsphere Calibration Results


The microsphere calibration is used to estimate the number of cells based off of recorded Abs
600. As particle count increases, the Abs 600 increases nonlinearly.

Calibration 3: Fluorescence Standard Curve – Fluorescein

Figure 7: Fluorescein Calibration Results


As the dilution factor of the Fluorescein decreases there is a linear increase in the concentration
of Fluorescein.

Device Measurement – Abs 600 and Fluorescence

Figure 8: Fluorescence per particle at t = 0 hours and t = 6 hours

After six hours, the cultures showed increased fluorescence, due to increased production of GFP.

Device Measurement – Colony Forming Units per 0.1 OD 600 E. coli cultures

Figure 9: Colony forming units per 1 mL
Dilution
factor Positive A1 Positive A2 Positive A3 Positive B1 Positive B2 Positive B3
8 x 10^4 5280000 5040000 9760000 4160000 7440000 4720000
8 x 10^5 2400000 4000000 9600000 4800000 800000 3200000
8 x 10^6 0 0 0 0 0 0

Dilution
factor Negative A1 Negative A2 Negative A3 Negative B1 Negative B2 Negative B3
8 x 10^4 12400000 9040000 7520000 11520000 2400000 22400000
8 x 10^5 28000000 27200000 9600000 38400000 32800000 58400000
8 x 10^6 64000000 0 0 40000000 8000000 40000000

The number of colonies on each plate was multiplied by the dilution factor of the respective plate
to obtain the CFU value.

V. References

[1] Dy, Aaron. “Student Teams Take on Synbio Reproducibility Problem | PLOS Blogs
Network.” PLOS Synbio , PLOS, 21 Nov. 2016,
blogs.plos.org/blog/2016/11/21/studentteamstakeonsynbioreproducibilityproblem/.

[2] Beal, J., HaddockAngelli, T., Gershater, M., Mora, K. D., Lizarazo, M., Hollenhorst, J., &
Rettberg, R. (2016). Reproducibility of Fluorescent Expression from Engineered Biological
Constructs in E. coli. Plos One, 11(3). doi:10.1371/journal.pone.0150182

[3] “Fifth International Interlab Measurement Study.” iGEM , iGEM Organization,
2018.igem.org/Measurement/InterLab.

UC Davis iGEM Project Design Notebook

Загружено:

Сведения о документе

Авторское право

Доступные форматы

Поделиться этим документом

Поделиться или встроить документ

Параметры публикации

Этот документ был вам полезен?

Это неприемлемый материал?

Авторское право:

Доступные форматы

UC Davis iGEM Project Design Notebook

Загружено:

Авторское право:

Доступные форматы

Cenozoic: iGEM at UC Davis, 2018 Project Design Notebook 1

Project Design Notebook

1,2­dibromoethane (EDB) BrCH 2 CH 2 Br Acute toxicity, suspected reproductive WolframAlpha

1,2­dibromo­3­chloropropane C 3 H 5 Br 2 Cl Acute toxicity, carcinogen, “PAN Bad WolframAlpha

1,2­dichloropropane (DCP) CH 3 CHClCH 2 Cl carcinogen, toxic, classified as “IDLH” WolframAlpha

1,2,3­trichloropropane (TCP) CH 2 ClCHClCH 2 Cl Irritant, carcinogen WolframAlpha

Carbon tetrachloride CCl 4 Toxic, ozone depleting, greenhouse gas, WolframAlpha

Remedial Project Manager Bianca Handley handley.bianca@epa.gov (415)­972­3023

DTSC11 project manager Juan Peng Juan.Peng@dtsc.ca.gov (916)­255­3802

Community Advisory Pam Nieberg pnieberg@dcn.org (530)­756­6856

Easily grown in a lab Commonly used for microbiology, Commonly used in pharmaceutical

Requires only standard, agar, tryptone, NaCl, yeast extract, specialized media available25 (approx.

Doubling time 15­20 minutes 20 hours

Non­hazardous to people E. coli is a naturally occuring bacteria CHO cells are derived from the ovaries

Non­pathogenic Some strains of E. coli are pathogenic, CHO cells are not pathogenic of their

Unlikely to become an E. coli are already commonly found in Unlikely to survive outside of laboratory

Unlikely to undergo Because of the above, this is a real Unlikely to survive outside of laboratory

Can be rendered Commonly used techniques are nutrient Unlikely to survive outside of laboratory

An effective means exists Typically, plasmids are used with Probably use CRISPR to try and do

Community Jackie Lane 5.14.18

Remedial Project Bianca 5.14.18 5.14.18

DTSC project Juan Peng 5.14.18 5.14.18

Community Pam 5.14.18

1 ­ 1000 µL Pipet Centrifuge Competent DH5a cells

HSP90AA141 Implicated in cancer gctgggcgggcccgcctctatataagg

HSP90AB143 Implicated in cancer. Might ccgggctgtgcttcgccttatatagggcg

GADD45α Implicated in cancer; [slightly uncertain]

HMOX1 Oxidative stress accacgtgacccgcgtacttaaagggct

HSPB1 HSP27 3315 22,3 Ubiquitous Neuropathy, Cancer,

HSPB2 MKBP 3316 20,2 Heart and Myopathy, Ischemia/reperfusion

HSPB3 HSPL27 8988 17,0 Heart and

HSPB4 CRYAA 1409 19,9 Eye lens Cataract

HSPB5 CRYAB 1410 20,2 Ubiquitous Neuropathy, Myopathy,

HSPB6 HSP20 126393 17,1 Ubiquitous Neuropathy, Ischemia/reperfusion

HSPB7 cvHSP 27129 18,6 Heart and

HSPB8 Hll and 26353 21,6 Ubiquitous Neuropathy, Cancer, Ischemia

HSPB9 CT51 94086 17,5 Testis Cancer

HSPB1 ODF1 4956 28,4 Testis

HSPB1 HSP16.2 51668 16,3 Placenta Cancer

HSPB1 Chaperone functionality CCCTGAGACGGTCATTG

HSP90AA157 Implicated in cancer gctgggcgggcccgcctctatataagg

HSP90AB159 Implicated in cancer. Might ccgggctgtgcttcgccttatatagggcg

GADD45α Implicated in cancer; ttggctgagggctagccccatatctccg

HMOX1 Oxidative stress accacgtgacccgcgtacttaaagggct

CYP1A1 Metabolic stress caacagacacagagtcctataaaggtg

CDKN1A Activates and responds to p53 gggcggggcctgggccgacgctataa

Metallothionein 166 Sensitive to heavy metals and cggactcgtccaacgactataaagagg

Tier 1 Metallothionein 271, CDKN1A72, CYP1A173, CuSO477, methyl bromide, metam CHO­K1 , AML12

Tier 2 HSP90AB178, HSP90AA279, Metallothionein 180 Glyphosate, tunicamycin, HeLa, Hek, etc

1 ­ 1000 µL Pipet Centrifuge Competent DH5a cells

HSPB1 “Small heat shock protein which functions as a molecular chaperone probably CCCTGAGAC

HSPA1A “This intronless gene encodes a 70kDa heat shock protein which is a member cggggccggtgaa

HSP90AA189 Implicated in cancer, “ Hsp90 (90 kDa heat shock protein) is a molecular gctgggcgggccc

HSP90AB192 Implicated in cancer. Might be constitutively expressed. ccgggctgtgcttcg

HSP90AA295 “ HSP90 proteins are highly conserved molecular chaperones that have key Not found

HSP90B1 “This gene encodes a member of a family of adenosine cccgcccgcaagc

GADD45α Implicated in cancer; Genotoxic stress, Sensitive to 2,4D ttggctgagggcta

HMOX1 Oxidative stress accacgtgacccgc

CYP1A1 Metabolic stress, associated with cancer caacagacacaga

CDKN1A Activates and responds to p53 gggcggggcctgg

Metallothionein 1 Sensitive to heavy metals and possibly oxidative stress, might be involved in cggactcgtccaac

Metallothionein 2 “This gene is a member of the metallothionein family of genes. Proteins cgacccaatactctc

ATF 4 “This gene encodes a transcription factor that was originally identified as a gcgtccctggccga

Gene Species Refseq Forward Reverse

1,2dibromoethane (EDB) BrCH 2 CH 2 Br Acute toxicity, suspected reproductive WolframAlpha

1,2dibromo3chloropropane C 3 H 5 Br 2 Cl Acute toxicity, carcinogen, “PAN Bad WolframAlpha

1,2dichloropropane (DCP) CH 3 CHClCH 2 Cl carcinogen, toxic, classified as “IDLH” WolframAlpha

1,2,3trichloropropane (TCP) CH 2 ClCHClCH 2 Cl Irritant, carcinogen WolframAlpha

Remedial Project Manager Bianca Handley handley.bianca@epa.gov (415)9723023

DTSC11 project manager Juan Peng Juan.Peng@dtsc.ca.gov (916)2553802

Community Advisory Pam Nieberg pnieberg@dcn.org (530)7566856

Doubling time 1520 minutes 20 hours

Nonhazardous to people E. coli is a naturally occuring bacteria CHO cells are derived from the ovaries

Nonpathogenic Some strains of E. coli are pathogenic, CHO cells are not pathogenic of their

1 1000 µL Pipet Centrifuge Competent DH5a cells

Tier 1 Metallothionein 271, CDKN1A72, CYP1A173, CuSO477, methyl bromide, metam CHOK1 , AML12

1 1000 µL Pipet Centrifuge Competent DH5a cells

DMEM (no phenol red) Food, nutrients https://www.frontiersin.org/articl

DMEM Major feedstock source in the culture. Contains amino acids,

Penicillin 20ºC About 3 days

streptomycin 20ºC About 3 days

DMEM/F12 500 mL DMEM/F12 is a 1:1 mix of

Hydrogen 75 mg/L118 2000 mg/kg119 Relevant dose is 60 uM120

2,4D 10 ug/L125 2019 ppm (min) 0.424 7.49 ppm127 0 uM, 10 uM, 20 uM,40 uM,

Tier 1 Metallothionein 2, CDKN1A, CYP1A1, CuSO4, methyl bromide, metam CHO DG44 ,

GADD153 DNA damageinducible transcript 3, CHODG C7, C11 Has mutations arising from source

FGF21 Fibroblast growth factor 21 IDT C4

CMV AddGene

CAG AddGene None Cloning failed.