You are on page 1of 15

Actividad: Dramatización del proceso de síntesis de proteínas

Autor: Steve Tester©, 2005


Referencia: http://www.iit.edu/~smile/guests/Protein_Synthesis_Drama_Outline.html,
Accedido 16 de septiembre de 2007
Adaptado por: Michelle Borrero, Ph.D., para el Proyecto ALACiMa

Sinopsis
Luego de introducir el tema de síntesis de proteínas se asignan roles a los
estudiantes para que representen las distintas partes del proceso para la
síntesis de la subunidad beta de la proteína hemoglobina.

Materiales
Transparencia con la figura del código genético (Figura 1)
32 moléculas de tARN laminadas (Figura 2)
32 moléculas de amino ácidos laminadas (Figura 3)
Cinta adhesiva
Transparencia o cartulina con la secuencia de ADN que codifica para la
subunidad beta de la proteína hemoglobina (Figura 4)
Hoja de trabajo del estudiante
Lápices

Preparación
1. Escribir el anticodón correspondiente a cada una de las 32 figuras de
los tARN
2. Colocar en una mesa las 32 figuras laminadas de los amino ácidos.
3. Imprimir el documento que contiene los códigos de la actividad para el
uso del instructor (Figura 5)

Instrucciones
1. Describa el proceso de síntesis de proteínas a los estudiantes dando
énfasis en el lugar en la célula donde ocurren los procesos de
transcripción y traducción.
2. Proyecte o escriba en la pizarra la secuencia de ADN que codifica para
la subunidad beta de hemoglobina
3. Entregar a cada estudiante la “hoja de trabajo del estudiante”. En la
misma los estudiantes procederán a:
a. “transcribir” el mARN a partir de la secuencia de ADN
b. identificar y enumerar los codones (tripletes) que componen el
mARN
4. Junto con sus estudiantes, escriba en la pizarra el producto del
proceso de transcripción y delinee los codones en la molécula de ARN
que se transcribió.
5. Sin borrar la secuencia del mARN, proyecte o escriba en la pizarra o
en un papelote el código de ADN (Figura 1) para que los estudiantes lo
puedan utilizar
6. Asignar las figuras de los tARN’s a los estudiantes.
7. Solicite a los estudiantes que encuentren en la mesa los amino ácidos
que corresponden a su tARN y que los unan con cinta adhesiva.
8. Escoja a un estudiante para ser el ribosoma o el profesor puede hacer
este rol
9. Permita que el “ribosoma” lea el codigo en el mARN y proceda a
solicitar a los estudiantes “¿quién tiene el el tARN que corresponde a
este código?”
10. Permita que el estudiante vaya a la pizarra con su tARN y se “asocie” al
ribosoma.
11. Repita esto para el próximo codón (pasos 9 y 10).
12. Enlace el primer amino ácido al segundo con cinta adhesiva (describa lo
que esta pasando)
13. Haga que el estudiante que represento el primer tARN se siente
14. Repita el procedimiento anterior hasta que llegue al codón de
terminación.
15. Describa como se remueve metionina del péptido
16. Enrosque la proteína para demostrar los distintos niveles de la
estructura de proteínas (Figura 6 y 7)

Preguntas para discutir


1. Compara y contrasta un codón y un anti-codón.
Ambos están compuestos por 3 ribonucleótidos. El codón se encuentra en
el mARN y codifica para un amino ácido en particular. El anti-codón se
encuentra en el tARN. El anti-codón contiene la secuencia
complementaria al codón; el codón es complementario a una de las cadenas
del ADN (la que se transcribió, i.e., contiene la secuencia del promotor).

2. Explica la relación entre el código genético y los codones.


El código genético esta “definido” por codones tal y como estos se
encuentran en la molécula (mARN) que contiene la información
(proveniente del ADN) durante el proceso de traducción.
3. De acuerdo a la actividad, ¿que características puedes atribuirle al
código genético?
a. Hay múltiples codones para un mismo amino ácido, i.e., es
degenerado.
b. La diferencia entre un codon y otro para un mismo amino acido
es en la tercera posición (“wobble”)

4. Explica el rol del ribosoma y los tARN’s en el proceso de traducción


El proceso de traducción es “coordinado” por el ribosoma. En él se
encuentran el mARN y los tARN’s cargados con sus respectivos amino
ácidos. El lugar P y A del ribosoma se “aseguran” de comenzar la
traducción en el lugar especificado en el mARN, y que solo el tARN que
contiene la secuencia complementaria al ARN (i.e., anti-codón) pueda
asociarse a este y “donar” el amino acido correspondiente a la cadena
peptídica que se esta formando. En el ribosoma se forma la cadena
peptídica mediante la formación de enlaces covalentes entre los amino
ácidos que componen la cadena. Al finalizar el proceso de traducción el
ribosoma “libera” la cadena peptídica.

5. ¿Qué relación hay entre la secuencia de bases en el ARN y la


secuencia de aminoácidos en el polipéptido?
Cada 3 nucleótidos (desde que se encuentra el marco de lectura que
contiene el mayor número de amino ácidos y comienza con AUG)
representan un codón que a su vez “codifica” para un amino acido en
particular. La secuencia lineal de codones dentro del marco de lectura =
secuencia lineal de amino ácidos del polipéptido.

6. Si en la secuencia de bases del ARN mensajero no se encuentra el


codón AUG ¿qué ocurrirá?
No comienza la traducción.

7. Explica que sucede si el segundo codón en el ARN se sustituye por:


a. AUG – se coloca el amino acido metionina en esa posición
b. UAA- se detiene la traducción (codón de terminación)
c. UGG- se coloca el amino acido triptófano en esa posición
Actividad de “assessment”
Realiza un dibujo de un modelo de célula eucariota y una procariota. Señala
en cada una de éstas donde ocurren los procesos de transcripción y
traducción.
Figura 1. Código genético

Figura 2. tARN’s para rotular y laminar


Figura 3a. Amino ácidos para laminar
Figura 3b. Amino ácidos para laminar
Figura 3c. Amino ácidos para laminar
3’ TACCAAGTAGAATGAGGAGTTGTCTTTTCACGACAGTGGCGGGAG

Figura 4. Secuencia de ADN que codifica para la cadena beta de


ATACCATTCCATTTACACTTGGTTCAACCGCCTGTTCGTAATCCA
GCAAACATC 5’

hemoglobina
CAA GTT GUU
CAG GTC GUC

asn AAU TTA UUA

asn AAC TTG UUG


CAA GTT GUU

CAA GTT GUU

Figura 5. Códigos correspondientes a ADN, mARN, tARN, y amino ácidos de


la actividad
Figura 6. Clasificación de los niveles estructurales de las proteínas
Figura 7. Estructura cuaternaria de la proteína hemoglobina
Hoja de trabajo del estudiante
Instrucciones:
1. Transcribe la siguiente secuencia de ADN a mARN
2. Identifica cada uno de los codones que se encuentran en el mARN.

GCAAACATC 5’

ATACCATTCCATTTACACTTGGTTCAACCGCCTGTTCGTAATCCA

3’ TACCAAGTAGAATGAGGAGTTGTCTTTTCACGACAGTGGCGGGAG
Preguntas para discutir
1. Compara y contrasta un codón y un anti-codón.

2. Explica la relación entre el código genético y los codones.

3. De acuerdo a la actividad, ¿que características puedes atribuirle al


código genético?

4. ¿Qué relación hay entre la secuencia de bases en el ARN y la


secuencia de aminoácidos en el polipéptido?
5. Explica el rol del ribosoma y los tARN’s en el proceso de traducción

6. Si en la secuencia de bases del ARN mensajero no se encuentra el


codón AUG ¿qué ocurrirá?

7. Explica que sucede si el segundo codón en el ARN se sustituye por:


a. AUG

b. UAA

c. UGG