Вы находитесь на странице: 1из 9

FORMATO – GUÍA PÁRA LA PRESENTACIÓN DEL PROTOCOLO DEL

TRABAJO DE GRADO

1. Título del proyecto e investigadores


Detección de genes que codifican para factores de virulencia y perfil de susceptibilidad
de cepas de Enterococcus Faecalis aisladas de muestras de pacientes que asisten a
consulta de endodoncia

Investigador principal
Hugo Diez Ortega
correo electronico: hugo.diez@javeriana.edu.co
numero de telefono:3143326309

Catalina Mendez de la Espriella


correo electronico: catalina.mendez@javeriana.edu.co
numero de telefono: 3102518589

Adriana Rodriguez
correo electronico: aciodaro@gmail.com
numero de telefono :3123053867

Coinvestigadores
Yuri Valeria Delgado S
correo electronico: Delgadosyv@javeriana.edu.co
numero de teléfono: 3153347190
Gianella Priscila Calero O
correo electronico: Giacalero@javeriana.edu.co
numero de teléfono: 3176353413
Alexandra Castillo G
correo electronico: Alexandracastillo@javeriana.edu.co
numero de teléfono: 3178519290

2. Planteamiento del problema, pregunta de investigación, justificación,


pertinencia y posible impacto del proyecto de investigación (máximo 1500
palabras) aumentar (como vendo el proyecto) (no libros) no conceptos, usar
artículos, para que, resumen del estado del arte.

Durante el tratamiento de endodoncia, la Enterococcus faecalis es el microorganismo


patógeno más frecuente que persiste en el sistema de conductos radiculares con la
capacidad de afectar la cicatrización periapical, conllevando al fracaso endodóntico inicial.
(1,2)

Pregunta de investigación

1
¿Cuáles son los patrones de presencia de los genes considerados blancos terapéuticos Esp,
Asa 373, gelE, Cyl A y Efa A y los perfiles de susceptibilidad antibiótica de Enterococcus
faecalis aislados de muestras relacionadas con el tratamiento de endodoncia?

Justificación:

Los Enterococcus son bacterias grampositivas que habitan en el interior del tracto
gastrointestinal y también pueden ser encontrados en la saliva. Han sido identificados en
endodoncia por su capacidad de persistir en los túbulos dentinarios por largos periodos de
tiempo y ser el principal causante de reinfección y por ende del fracaso endodóntico. Por
ello es importante comprender el rol que juegan los factores de virulencia del Enterococcus
faecalis ya que estos promueven la adaptación y supervivencia en condiciones ambientales
adversas y por ende generan una resistencia frente a todos los antimicrobianos disponibles.
Debido a esto es importante definir el perfil de susceptibilidad a antibióticos de esta
bacteria para poder diseñar en un futuro, estrategias terapéuticas para eliminarla.

3. Marco teórico y conceptual. Estado del arte.


Resúmenes de articulos
Una revisión de trabajos de diferentes autores, realizada por Kayaoglu y Orstavik, 2004 (3)
sirvió para postular un modelo de enfermedad endodóntica relacionado con los factores de
virulencia de Enterococcus faecalis y su capacidad para tolerar o adaptarse a condiciones
ambientales adversas, la resistencia natural intrínseca a los antibióticos betalactámicos,
aminoglucósidos, clindamicina y lincomicina, la colonización en el huésped, y la
producción de cambios patológicos producidos directamente por toxinas bacterianas o
indirectamente inducidos a través de la respuesta inflamatoria local (3,4,8,9). Estos
factores pueden comportarse estrictamente como factores de virulencia, contribuir a la
persistencia del microorganismo en la infección endodóntica o incluso integrarse como un
complejo de patogenecidad qué le confiere al microorganismo la ventaja ecológica de
sobrevivir en el sitio donde se desarrolla la infección (3). Entre estos factores se encuentra
la proteína de superficie (ESP), la proteína de unión al colágeno (ACE) y factores que
permiten la secreción de proteasas como la gelatinasa y toxinas como la citolisina (6),
determinantes de feromonas (asa), capaces de modular la respuesta inflamatoria y antígeno
A (EfaA) asociada a la adherencia de bacterias, formación de biopelículas y resistencia
antibiótica. (5,7). Recientemente, Schoreder y colaboradores,2017 (11) realizaron una
revisión sobre la relación entre virulencia y resistencia antibiótica, y postulan qué los
eventos pueden estar estrechamente relacionados, pues se ha observado qué el aumento de
la virulencia de Enterococcus faecalis casi siempre se acompañada de la aparición de
resistencia antibiótica pero a la fecha se ha ignorado la conexión genética entre los dos
eventos (12), razón por la cual es importante descubrir las interacciones genéticas entre los
dos eventos tanto en estado sésil como plactónico, pues estos datos pueden ser nuevas
dianas para el desarrollo de fármacos especialmente para casos crónicos y persistentes de
infección por Enterococcus faecalis.

Recopilar e integrar el conocimiento publicado en libros y revistas que soporten el


tema de investigación, incluyendo teorías y conceptos. En el estado del arte,
describa los artículos publicados que tengan relación con el tema que se está

2
investigando. Este ítem será utilizado para la discusión en el artículo final.
Abordajes de técnicas q vamos a usar
E faecalis
Resumir los artículos, estado del arte

4. Implicaciones ético y legales

Describir mediante una frase si el proyecto se va a desarrollar en humanos, modelo animal


o in vitro.
Si el sujeto de estudio es humano deberá clasificarse el nivel de riesgo de acuerdo
con lo propuesto por la ley 8430. Si se va a utilizar el modelo animal, se deberá
explicar que se ha solicitado el análisis del proyecto por el CICUAL y que se
anexará la certificación de aval correspondiente.
Para las investigaciones in vitro realizadas sobre órganos o tejidos humanos, se
deberá explicar detalladamente de donde se van a obtener las muestras, como se va
a legalizar el procedimiento de donación (si se usará FCI de donación firmado por
cada paciente, o Carta de donación del custodio de las muestras. Esta decisión
deberá ser justificada). Si las muestras van a ser transportadas desde otras
regiones del país o desde otros países, se deberá describir cuáles son los
requerimientos legales que se van a seguir para hacerlo.

Describir el posible impacto en el medio ambiente de acuerdo con la naturaleza de


la investigación.
Norma para laboratorio, desechos de los mo.

5. Objetivos del proyecto (máximo 300 palabras)


Objetivo General

Determinar los patrones de presencia de genes de virulencia y su perfil de susceptibilidad a


antibióticos, de E. faecalis aislados de muestras de pacientes que asistieron a la consulta de
endodoncia.

Objetivos específicos

- Determinar el perfil de susceptibilidad antibiótica de Enterococcus faecalis aislados,


en muestras obtenidas de pacientes que asistieron a la consulta de endodoncia en las
clínicas de la Pontificia Universidad Javeriana.
- Determinar la presencia de genes de virulencia: Esp, Asa, asa373, ace y gelE en
aislados de EF obtenidos de muestras de pacientes que asistieron a la consulta de
endodoncia en las clínicas de la Pontificia Universidad Javeriana.
- Determinar la relación entre el factor de virulencia y resistencia antibiótica de
Enterococcus faecalis

6. Materiales y métodos (máximo 1500 palabras)


“Previa aprobación del Comité de Investigación y Ética de la Facultad de Odontología”.
Este estudio es un estudio observacional descriptivo de corte transversal, con muestreo no

3
probabilístico, intencional, a partir de 50 muestras aisladas de Enterococcus faecalis
provenientes de pacientes que acudieron a consulta de endodoncia en la Facultad de
Odontología de la Pontificia Universidad Javeriana. Obtenidos de trabajos previos de
investigación y de los cuales se cuenta con el respectivo consentimiento informado por
parte de los pacientes y del aval del comité de investigación y ética.

Criterios de inclusión:
La cepa identificada en trabajos previos de investigación como E. Faecalis, mediante
MALDI-TOF siguiendo la metodología de Clark, y colaboradores 2013, que conserven un
100% de pureza y viabilidad al ser sometidas al descongelamiento.

A cada cepa se le realizará un análisis microbiológico por panel semiautomatizado para


determinar el perfil de susceptibilidad antibiótica y extracción de ADN para determinar la
presencia de los genes de virulencia.

Muestras:
Las muestras de Enterococos faecalis proveniente del cepario del laboratorio de
microbiología de Ciencias Básicas de la Pontificia Universidad Javeriana, serán
recuperadas mediante el proceso de descongelamiento gradual propuesto por Daryousb,
2010. Conservadas en caldo BHI con 30 % de glicerol/oxacilina suplementada se
descongelarán 15-20ºC por 30 minutos y posteriormente a temperatura ambiente por 30
minutos. Previa homogenización se sembrarán en medio altamente selectivo, Caldo
Enterococos (Becton Dickinson Microbiology Systems, Cockeysville, MD, USA) e
incubará de 24-48 horas a 37ªC y posterior pase e incubación en Agar Chromocult
Enterococci 37ºC por 24-48 horas. A partir del medio sólido se usarán colonias puras,
aisladas y libres de contaminación para efectuar el proceso.

Metodología objetivo específico 1 - Test de susceptibilidad antibiótica


Para la identificación microbiológica y test de susceptibilidad ser utilizará el sistema de
paneles semiautomático MicroScanSystem de la casa Dade/ MicroScan Pos ID PC34 para
Gram positivos.

Para la confirmación de la identificación de la cepa, el panel incluye un set de 32 pozos


reactivos de sustratos para reacción bioquímica conformado

CV Cristal MS Micrococcus NIT Nitritos NOV PGR B-d


violeta screen Novobiacina glucoronidasa

IDX Indol VP Voges OPT Optoquina PHD fosfatasa BE Bilis


fosfatasa proskawer esculina
PYR ARG Arginina Galactosidasa URE urea MAN Manitol
Pirridolina
LAC lactosa TRE Trehalosa MNS Manosa NaCl Cloruro SOR Sorbitol
de sodio
ARA RBS Ribosa INU Inulina RAF Rafinosa BAC
Arabinosa Bacitracina

4
PRV Piruvato Pozos internos de
control

Para el perfil de susceptibilidad el panel utiliza un set de pozos con antibióticos marcadores
para Gram positivos

como Aug AM A/S ampicilina CfxS Cefoxitin Cax Ceftriaxone


Amoxicilina/ ampicilina8 ug sulbactan 4 ug 32 ug
clavulónico 4/2 16/8ug
ug
Cp Cd Eritromicina
4 Gm GmS
Ciprofloxacina Clindamicina ug gentamicina 8 gentamicina
2 ug ug synercid 500 ug
Icd Lvx Lzd Linezolid 4 Mxf Fd
Clindamicina Levofloxacin 4 ug Moxifloxacina Nitrofurantoina
inducible 4/0.5 ug 4 ug 64 ug
ug
Va Vancomicina Lzd Linezolid 4 Ox Oxacilina 2 P Penicilina 8ug –Rif
16 ug (CLSI, ug ug Rifampicina 2
2017 ug
StS Syn Synercid 2 Te Tetraciclina T/S trimetropin
Estreptomicina ug 8 ug sulfa 2/38 µg
synercid
1000ug

La concentración mínima inhibitoria (CIM) se realizará siguiendo las recomendaciones de


Clinical and Laboratory Standards Instituto (CLSI) y los aislamientos serán consideradas
susceptibles o resistentes de acuerdo a los puntos de corte recomendados por CLSI (Wayne,
PA, USA) vigentes a la fecha.

Como cepa control se empleará EF ATCC 29212 y EF ATCC700802.

Metodología objetivo específico 2 - Presencia de genes de virulencia

Para el cumplimiento del segundo objetivo se buscará evaluar en todos los aislados la
presencia de genes de virulencia en cada uno de los aislados. Las colonias seleccionadas se
someterán a preenriquecimiento en BHI incubado por dos horas hasta alcanzar el tubo 0,5
de MacFarland.

A partir del caldo enriquecido se extraerá el ADN mediante el kit de aislamiento kit
Promega Wizard Genomic DNA Purification Kit™ (Cat # A1125) siguiendo las
instrucciones recomendadas por el fabricante. La concentración del ADN genómico se
determinará espectrofotométricamente a 260/280nm (Nanodrop 2000; thermo Scientific,
Wilmintong, DE, USA). Para la amplificación de los genes se usarán primers específicos
para

5
Asa/Asa373 (producto de sustancia de agregación).
Esp (proteína de superficie).
Ace (Antígeno de unión a colágeno).
gelE (gelatinasa).

Cada detección seguirá los protocolos previamente establecidos por otros autores utilizando
las secuencias y referencias qué a continuación se nombran:

Gen principal Secuencia Referencia


Primer
Asa F: GCACGCTATTACGAACTATGA Dutta, 1995
R: TAAGAAAGAACATCACCACGA
asa F5: GGACGCACGTACACAAAGCTAC-3 Dupre, 2003
R5: CTGGGTGTGATTCCGCTGTTA-3
Ace F5´AAAGTAGAATTAGATCACAC´3´ Dupre, 2003
R5´TCTATCACATTCGGTTGCG´3
gelE F5’- AGTTCATGTCTATTTTCTTCAC-3’ 402 24 Mannu, 2003
R5’- CTTCATTATTTACACGTTTG-3
Esp F5’-TTGCTAATGCTAGTCCACGACC-3’ 933 23 Shankar y col,
R5’-GCGTCAACACTTGCATTGCCGAA-3’ 1999

Los productos de amplificación serán analizados en geles de agarosa al 1% en solución


TBE 1X y analizados en fotodocumentador ChemiDoc TM MP Imaghing System BioRad
Laboratories Inc. El tamaño de cada amplicón será comparado con el patrón de peso
molecular 1Kb Plus ladder (invitrogen).

7. Referencias bibliográficas (relacione únicamente la referida en el texto). Utilice la


norma de la revista Universitas odontologica para referenciar el documento.

8. Cronograma de Actividades:
El cuadro de cronograma de actividades debe reflejar en forma muy concreta el
proyecto, con sus tiempos, secuencia y duración de cada actividad. El tiempo
máximo de duración del proyecto se establece en los términos de referencia de la
convocatoria a la cual aplica.

6
Meses
Actividad a desarrollar
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18
Repique de las sepas
Cultivo de sepas
Extracción de ADN

Para proyectos de mayor duración insertar nueva tabla

7
9. TABLAS DE PRESUPUESTO

FUENTES
RUBROS TOTAL
Investigadores PUJ
PERSONAL 0 19.940.000 19.940.000
USO DE EQUIPOS 0 6.179.666 6.179.666
SOFTWARE 0 0
MATERIALES Y
0 8.000.000 8.000.000
SUMINISTROS
SERVICIOS TÉCNICOS
1.400.000 0 1.400.000
(Microscopia electrónica)
SALIDAS DE CAMPO 0 0 0
MATERIAL
0 0 0
BIBLIOGRÁFICO
PUBLICACIONES Y
0 0 0
PATENTES

TOTAL 1.400.000 34.119.666 34.519.666

Tabla 9.1 Presupuesto global de la propuesta por fuentes de financiación.


FUENTES
RUBROS ENTIDAD CONTRAPARTID TOTAL
FINANCIADORA A
PERSONAL
EQUIPOS
SOFTWARE
MATERIALES Y
SUMINISTROS
SERVICIOS TÉCNICOS
SALIDAS DE CAMPO
MATERIAL
BIBLIOGRÁFICO
PUBLICACIONES Y
PATENTES

TOTAL

Tabla 9.2 Descripción de los gastos de personal


Número RECURSOS
Nombre del
Función de meses Contrapartida
Investigador y Tipo de % de Entida
dentro de Unida TOT
formación vinculaci dedica d Otras
del vinculació d
académica / ón ción Financ fuentes
proyecto n con el acadé
Experto/ Auxiliar iadora *
proyecto mica
Dr. Hugo Diez

TOTAL
* Agregar una columna para cada fuente de financiación diferente de la entidad que presenta
el proyecto.

Tabla 9.4 Descripción y cuantificación de los equipos de uso propio (preguntar al


dr.hugo)
VALOR
EQUIPO
(CONTRAPARTIDA)

TOTAL

Tabla 9.6 Materiales y suministros


Materiales* Justificación Valor
reactivos Extracción de ADN

TOTAL
Pueden agruparse por categorías, ej: vidriería, reactivos, papelería, etc., suscripciones a revistas,
libros, etc.

Tabla 9.7 Servicios Técnicos


Tipo de servicio Justificación Valor
estadísticos Tabulación de datos

TOTAL