European Journal of Pharmaceutical Sciences 112 (2018) 79–86

Contents lists available at ScienceDirect

European Journal of Pharmaceutical Sciences

journal homepage: www.elsevier.com/locate/ejps

Milk from transgenic goat expressing human lysozyme for recovery and T
treatment of gastrointestinal pathogens
Igor de Sá Carneiroa, José Nilson Rodrigues de Menezesa, Julyana Almeida Maiaa,
André Marrocos Mirandaa, Victor Bruno Soares de Oliveiraa, James D. Murrayb,
⁎
Elizabeth A. Magab, Marcelo Bertolinic, Luciana Relly Bertolinia,d,
a
Laboratory of Molecular Biology and Development, University of Fortaleza, Avenida Washington Soares, 1321, Edson Queiroz, 60, 811-905 Fortaleza, Ceará, Brazil
b
Department of Animal Science, Department of Population Health and Reproduction, University of California, Davis, CA 95616, USA
c
School of Veterinary Medicine, Federal University of Rio Grande do Sul, Porto Alegre, RS, Brazil
d
Pontifical Catholic University of Rio Grande do Sul (PUCRS), Porto Alegre, RS, Brazil

A R T I C L E I N F O A B S T R A C T

Keywords: Lysozyme is an important non-specific immune protein in human milk, modulating the immune response against
Transgenic goats bacterial infections. The aim of this study was to characterize the milk of a transgenic goat expressing a re-
Lysozyme combinant human lysozyme (rhLZ) in the milk, also testing the in vitro antibacterial activity of the rhLZ milk
Milk against pathogens of the gastrointestinal tract. Milk samples collected from Tg and non-transgenic goats (nTg)
Natural antimicrobial
from the 3rd to the 11th week of lactation were submitted to physicochemical analyses, rhLZ semi-quantifica-
Nutraceutical
tion, and to rhLZ antimicrobial activity against Micrococcus luteus, Shiguella sonnei and Enterococcus faecalis.
Viability and cell migration were studied in ileum epithelial cells (IEC-18) in absence or presence of E. faecalis,
Staphylococcus aureus, Escherichia coli (EPEC) and S. sonnei. The expression of ZO-1 and IL-6 genes was evaluated
in IEC-18 to evaluate the effect of rhLZ milk on intestinal barrier function and intestinal inflammation.
Physicochemical parameters between goat Tg and nTg milk were similar and within normal values for human
consumption, with hLZ concentrations being similar between Tg (224 μg/mL) and human (226 μg/mL) milk. The
Tg milk had bactericidal activity against M. luteus, no bactericidal effect on S. sonnei, and relative to discrete
sensitivity against E. feacalis than controls. Better migrating parameters were observed in cells in culture with
nTg and Tg than controls. In the presence of pathogens, the Tg milk promoted improved migrating parameters
than controls, except for S. sonnei, with lower cell numbers in the presence of nTg samples and E. faecalis and S.
sonnei. No differences in ZO-1 relative expression patterns were observed in cultured cells, with increased ex-
pression in IL-6 in cells exposed to nTg milk than controls, with the Tg group being similar to all groups. In
conclusion, goat milk containing rhLZ demonstrated valid evidence for its potential use as a nutraceutical for
improvement of health and nutrition quality in humans.

1. Introduction between 1 and 4 acetylmuramic acid and N-acetylglucosamine in the

Breast milk is the ideal source of nutrition for infant development,
providing nutrients and factors that promote health and fight infec-
tions. The benefits of human milk are attributed to the antimicrobial
action of milk proteins such as Lysozyme (LZ). Such enzyme is part of
the passive immunity and natural defence against Gram-positive bac-
teria and, with cooperation of other factors present in milk, LZ has also
demonstrated activity against Gram-negative bacteria, viruses, para-
sites and fungi (Rollins et al., 2016; Victora et al., 2016).
Lysozyme is capable of catalyzing the hydrolysis of glycosidic bonds
peptidoglycan layer of the bacterial cell walls. Its antimicrobial activity
results from that cleavage, which causes leakage of the internal com-
ponents of the cells and consequent destruction of bacteria (Norman
et al., 2012). Lysozyme is a globular protein with 129 amino acid re-
sidues and 14.314 kDa, which, besides being present in human milk,
can be found in different concentrations in various species and secre-
tions such as tears, sweat and saliva. In human milk, the typical con-
centration is about 200–400 μg/mL, many fold higher than the content
of LZ present in the milk of goats (0.25 μg/mL), cattle (0.13 μg/mL) and
pigs (0.065 μg/mL), for instance (Cerven et al., 2008; Maga et al., 2012;

⁎
Corresponding author at: Biotechnology and Genetic Engineering Lab, School of Pharmacy, Pontifical Catholic University of Rio Grande do Sul (PUCRS), Av. Ipiranga, 6681 Porto
Alegre, RS, Brazil.
E-mail addresses: nilsonmenezes@unifor.br (J.N.R.d. Menezes), jdmurray@ucdavis.edu (J.D. Murray), eamaga@ucdavis.edu (E.A. Maga), luciana.bertolini@pucrs.br (L.R. Bertolini).

https://doi.org/10.1016/j.ejps.2017.11.005
Received 25 April 2017; Received in revised form 20 October 2017; Accepted 4 November 2017
Available online 08 November 2017
0928-0987/ © 2017 Elsevier B.V. All rights reserved.
I.d.S. Carneiro et al.
Ning et al., 2009; Pupek et al., 2003; Yang et al., 2011).
Considering the benefits of LZ, several research groups have de-
veloped genetically engineered organisms for production of re-
combinant human lysozyme (rhLZ). The rhLZ expression by the trans-
genic brown rice has reached 0.6% of grain weight (Huang et al., 2002).
Transgenic chickens produced an average of 29.90 μg/mL in the egg
white (Wang et al., 2016). The concentrations of rhLZ in the milk of
transgenic mice varied from 250 to 710 μg/mL (Maga and Murray,
1995); transgenic cows and transgenic pigs expressed in their milk
about 25.96 μg/mL (Yang et al., 2011) and 116 mg/mL (Lu et al., 2014)
of rhLZ, respectively.
Milk from transgenic dairy animals expressing rhLZ has potential to
prevent and treat infant diarrhea and some other infectious diseases,
also reducing in the burden of malnutrition (Brundige et al., 2008;
Cerven et al., 2008; Maga et al., 2012). Goat rhLZ milk can indeed
modulate gut microbial populations in a fashion similar to the human
milk (Cooper et al., 2013; Maga et al., 2012). In previous studies, the
fecal microbiota analysis of young pigs fed with pasteurized milk of
rhLZ transgenic goats showed significant increase in the number of
bacteria associated with gut health (Bifidobacteriaceae and Lactoba-
cillaceae) and decreased number of bacteria associated with diseases
(Escherichia coli, Mycobacteriaceae, Streptococcaceae and Campylo-
bacterales; Maga et al., 2006b, 2012). Young pigs have also presented
improved gut morphology and circulating metabolites (Cooper et al.,
2011; Brundige et al., 2010), helping to ameliorate symptoms of diar-
rhea (Cooper et al., 2013). To further investigate and explore the
benefits of human lysozyme, a line of transgenic dairy goats expressing
rhLZ in their milk was produced in Brazil. In this study, we aimed to
validate the potential usefulness of the milk as from such transgenic line
by evaluating the physicochemical characteristics of the milk, also
identifying and quantifying rhLZ in milk, and its enzyme activity in vitro
on intestinal epithelial cell (IEC-18) cultures and against gastro-
intestinal bacterial pathogens. This represents the first necessary step in
testing the milk properties in systematic in vitro and in vivo studies for
future potential use of the rhLZ goat milk as nutraceutic product in
humans.
2. Material and methods
2.1. Ethics statement
This study was conducted in compliance with guidelines of the
Brazilian National Technical Biosafety Committee (Comissão Técnica
Nacional de Biossegurança - CTNBio), in facilities accredited by the
Biosafety Certification Number 0294/10 and the Ethical Principles of
Animal Experimentation described by the Brazilian College of Animal
Experimentation (Colégio Brasileiro de Experimentação Animal - COBEA,
1991). The described experiments were approved by the Research
Ethics Committee of the University of Fortaleza (process number 003/
2016).
2.2. Transgenic animals
A line of transgenic goats expressing rhLZ in milk was generated by
pronuclear microinjection of one-cell stage embryos with a gene con-
struct (23 Kb) consisted of the human lysozyme cDNA (540 bp) under
the bovine αS1-casein promoter and 3′ regulatory elements, according
to Maga et al. (2003). Milk from a female transgenic founder (Tg) and
from two non-transgenic control goats (nTg1 and nTg2) matching the
same breed, parity and stage of lactation was used throughout this
study.
2.3. Milk sample collections
Transgenic and non-transgenic goats were kept in separate stalls,
and provided hay, mineral salt and water ad libitum, and daily exposure
80
European Journal of Pharmaceutical Sciences 112 (2018) 79–86
to sunlight. Milk samples from the Tg goat and from the nTg1 and nTg2
goats were collected once a week, starting at the third week of natural
lactation, and for the subsequent eight weeks. The nTg2 goat was used
only for comparisons in the physicochemical analyses. The collection
procedure was performed manually and under aseptic conditions, with
teats sanitized and dried prior to each collection, as recommended by
biosafety standard protocols. As for the human control milk (hM),
samples were obtained from unidentified donors, approximately at the
fourth month of lactation.
2.4. Physicochemical analyses
Upon each milk collection, during the eight-weeks period, 50 mL of
fresh milk collected from the transgenic and non-transgenic goats were
subjected to physical and chemical analyses in triplicate. Samples from
two nTg were used for substantial equivalence, as previously defined by
the OECD (Organization for Economic Cooperation and Development,
1998). The amount of fat, lactose, protein and non-fat solids, as well as
the pH and the freezing point were verified in each milk sample for
identification of potential alterations in milk composition between
groups, using a milk analyser apparatus (Lactoscan S, Milkotronic Ltd.,
New Zagora, Bulgaria). The lactic acid content was measured by ti-
trating the milk with 0.1 N Sodium hydroxide (Dornic solution) and the
alkaline level was measured in the presence of a phenolphthalein in-
dicator at pH 8.0 (FAO, 2017; Salva et al., 2011). To analyse the specific
gravity of milk, the density was obtained following FAO re-
commendations (Food and Agriculture Organization, 2012) and to de-
termine the proximate analysis for nutrition evaluation, the ash con-
tent, which represents the total mineral content, was obtained by total
incineration of the samples through 24-h heating in an oven at 100 °C,
followed by 6 h in muffle furnace at 550 °C (Nielsen, 2006).
After each weekly physicochemical analyses, the remaining milk
samples were cooled down and pasteurized at 64 °C for 35 min. Samples
were immediately cooled to − 4 °C, being stored at −80 °C and thawed
only at runtime analyses.
2.5. Lysozyme identification and quantification
The rhLZ contents in milk samples were quantified by Western blot
in triplicates. The nTg, Tg and hM were initially diluted 1:1 in Laemmli
buffer and denatured at 95 °C for 3 min, for separation by 15% SDS-
PAGE in electrophoretic run (90 min at 100 V). Commercial re-
combinant human lysozyme (L1667, Sigma-Aldrich, St. Louis, MO,
USA) diluted at 270 μg/mL was used as positive control and also to
quantify the rhLZ in milk. Proteins were transferred to nitrocellulose
membrane for 2 h at 100 V by wet transfer in the Mini Trans-Blot® Cell
device (Bio-Rad, Hercules, CA, USA). Membranes were blocked for 1 h
using TBS-T with 5% non-fat dry milk (8 g/L NaCl, 2.42 g/L Tris, 0.05%
Tween-20 detergent). Subsequently, membranes were rinsed three
times for 15 min in TBS-T, and human anti-lysozyme antibody (DAKO,
Glostrup, Denmark) was diluted to 1:2500 in the blocking solution for
16 h at room temperature (RT). Incubation was then performed with
alkaline phosphatase-labelled anti-rabbit secondary antibody
(Invitrogen®, Carlsbad, CA, USA) diluted to 1:20,000 in TBS-T (at RT
for 1 h). Three additional 15-min washes were carried out in TBS-T,
with the membranes then covered with the NBT/BCIP (Sigma-Aldrich).
After 24 h, semi-quantification of rhLZ expression in milk was de-
termined by the analysis of digitalized and photographed gels, where
the intensity of each specific western blot band diameter was measured
using the Image J software 1.4 (NIH, Bethesda, MD, USA) comparing to
known amounts of commercial rhLZ (S-rhLZ group). Results were
converted into numeric values referring to each measured band.
2.6. Activity test
To assess the biological activity of lysozyme in the milk produced by
I.d.S. Carneiro et al.
the transgenic goat, we assayed its antimicrobial activity analysing the
formation of bacterial inhibitory growth zones into culture plates.
Samples of Tg, nTg, hM, S-rhLZ, and a solution identified as nTg + rhLZ
(a preparation of the nTg sample added with 270 μg/mL of commercial
rhLZ, meant to simulate the rhLZ concentration in human milk) were
subjected to a spot-on-the-lawn activity assay, by incubating 30 μL of
each sample in a punched hole of an agarose plate incorporated with
10% Micrococcus luteus (ATCC 00356). After the 48-h plate incubation
at 37 °C, photographic images were analysed and the inhibitory growth
zone measurement was assessed for each group. The assay was based on
the diffusion procedure adapted from Maga and Murray (1995).
2.7. Bactericidal assay
The ATCC (Rockville, MD, USA) strains used to investigate the
bactericidal activity of lysozyme were Shiguella sonnei (ATCC 25931),
Enterococcus faecalis (ATCC 29212), and M. luteus (ATCC 00356).
Bacteria from each strain were cultivated at 37 °C for 24 h and then
diluted in 0.9% saline solution to a 0.5 concentration in the McFarland
scale. Then, each bacterial suspension was diluted 1000-fold in Luria-
Bertani (LB) broth. Milk samples from the Tg, nTg, S-rhLZ and nTg
+ rhLZ groups were also diluted 20-fold in LB broth, remaining at 37 °C
under 220 × g for 60 min. Then, 15 μL were plated onto two LB-agar
medium plates. After 24 h, the colony-forming units (CFU) were ob-
served, counted and calculated. The experiment was performed in tri-
plicates.
2.8. Cell proliferation assay
Cellular viability, migration and gene expression in presence of Tg
and controls were determined by using rat intestinal epithelial cells
(IEC-18 line, ATCC, Rockville, MD, USA) in culture, at passage 29, as
previously described (Brito et al., 2005). In brief, cells were cultured at
37 °C in 5% CO2 in DMEM (Dulbecco's modified Eagle medium, GIBCO,
Grand Island, NY, USA) containing 10% heat-inactivated fetal bovine
serum, 50 IU/mL penicillin and 50 μg/mL streptomycin (GIBCO). Milk
samples from each group were diluted 1:5, 1:20 and 1:40 in DMEM,
with phosphate-buffered saline (PBS) used as negative control.
2.8.1. Cell viability
To determine cell viability in the presence of different milk dilu-
tions, the MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium
bromide) assay (Sigma-Aldrich) was used to measure the mitochondrial
reductase activity in living cells (Mosmann, 1983). In brief, IEC-18 were
seeded in 96-well plates in a total concentration of 4 × 104 cells/well in
100 μL of culture medium. After 24 h incubation, the media was re-
moved and replaced by DMEM containing PBS or each sample dilution
in triplicate (n = 3). After 24, 48, and 72 h, cells were washed with PBS
and then incubated for 4 h in 100 μL culture medium with 10 μL MTT
solution (5 mg/mL). Plates were centrifuged at 3000 rpm for 15 min,
media containing MTT were removed by fast inversion, and formazan
crystals were diluted with acidified isopropanol solution (0.04 N HCl).
Prior to reading, plates were stirred for 5 min and the absorbance was
measured in a ELISA reader set at 575 nm.
Table A.1
Sequence of PCR primers, melting temperatures (°C) and GenBank accession number for gene products analysed in cells in culture exposed to non-transgenic goat milk (nTg), transgenic
goat milk (Tg), human milk (hM), and commercial rhLZ diluted in saline (S-rhLZ) or in nTg milk (nTg + rhLZ).
Gene Primer sequence 5′-3′
ZO-1 F GAGGCTTCAGAACGAGGCTATTT
R CATGTCGGAGAGTAGAGGTTCGA
IL-6 F ACCACCCACAACAGACCAGT
R ACAGTGCATCATTCGCTGTTC
β-Actin F CCCTGGCTCCTAGCACCAT
R GAGCCACCAATCCACACAGA
81
European Journal of Pharmaceutical Sciences 112 (2018) 79–86
2.8.2. Migration assay
The ability of hrLZ-containing milk to affect the IEC-18 migration in
the presence or absence of bacteria was determined as previously de-
scribed (Carvalho et al., 2012). Briefly, cell migration was evaluated in
the presence of rhLZ in the milk. IEC-18 were transferred to a 12-well
plate at a concentration of 2.4 × 105 cells/well. After a 24 h growth
period, cells were incubated with Mitomycin C (5 μg/mL; Sigma-Al-
drich) for 30 min, the monolayer was scratched with the aid of a sterile
blade, so that cells were dragged from the center to the right-side edge
of the well. Culture medium containing Mitomycin C was discarded and
replaced by fresh medium with PBS or milk dilutions (1:5, 1:20, and
1:40) from each group. After incubation for 24 h, wells were washed
twice with PBS for observation of cell migration across the scratch line
under an inverted microscope at 10× magnification. Cell migration
analysis was based on the number of migrating cells, the migration
distance and growth velocity, after assessment of photographic images
by using the Image J software.
2.8.3. Cell migration in the presence of pathogens
The ability of the milk from transgenic or non-transgenic goats to
modulate cell migration was assessed in the presence of main intestinal
pathogens associated with stomach diseases and diarrhea Escherichia
coli EPEC (ATCC 3905), Shiguella sonnei (ATCC 25931), Enterococcus
faecalis (ATCC 29212) and Staphylococcus aureus (ATCC 6535), based on
van Vuuren et al. (2015). Milk samples were diluted at 1:20 in DMEM,
with bacteria (2.5 × 105 CFU/mL) added to cell cultures. Following
24 h incubation, cells were washed with PBS and examined for CFU, as
described above (Carvalho et al., 2012).
2.8.4. Gene expression
As intestinal inflammation may be associated with intestinal barrier
disruption, qRT-PCR analysis was used to evaluate the expression of
genes for the tight junction protein ZO-1 and the pro-inflammatory
cytokine IL-6 in IEC-18 in culture, using β-actin as housekeeping gene
for normalization. Briefly, IEC-18 were seeded into 12-well plates until
60–70% confluence, when Tg, nTg, nTg + S-rhLZ and S-rhLZ samples
were added in three biological replicates for each treatment, remaining
in culture for additional 24 h. Cells were washed twice with PBS and
harvested by trypsinization. Suspended cells were washed in PBS, and
then stored at − 80 °C. Samples were thawed and total RNA was ex-
tracted using the RNeasy spin column purification kit (Qiagen,
Valencia, CA, USA), following the manufacturer's instructions. RNA
concentration was quantified and purity was checked by UV absorbance
at 260 nm and 280 nm (NanoDrop 2000, Waltham, Massachusetts,
USA). cDNA was synthesized via reverse transcription PCR, using 1 μg
total RNA treated with DNase, oligo (dT) as primers, and Super Script
III enzyme (Invitrogen). RT-qPCR reactions were performed in 20 μL
containing 10 μL Power SYBR® Green PCR Master Mix 2× (Applied
Biosystem, Foster City, CA, USA), 1 μL cDNA with 600 nM of gene-
specific primers designed to assess ZO-1 and IL-6 transcript expression,
and 6.6 μL ultrapure water. Primers were synthetized by Invitrogen
(São Paulo, Brazil), with nucleotide sequences shown in Table A.1.
Amplification consisted of 5 min at 94 °C, followed by 40 cycles of 30 s
at 94 °C, 30 s at the annealing temperature (60 °C), and 30 s at 72 °C,
Melting temperature (°C) GenBank accession number
81.7 NM_001106266.1
77.1 NM_012589.2
78.2 NM_031144.3
I.d.S. Carneiro et al. European Journal of Pharmaceutical Sciences 112 (2018) 79–86

followed by 40 cycles of 0.5 °C increments (10 s each) for the melting

curve, starting at 75 °C. Fluorescence was measured during the an-
nealing step of each cycle. All amplifications were carried out using the
thermocycler StepOne Plus™ (Applied Biosystems, Foster City, CA,
USA).

2.9. Statistical analysis

Fig. A.1. Representative Western blot for the identification of the hLZ in samples of non-
Data obtained from the bactericidal evaluation, cell viability and transgenic goat milk (nTg), transgenic goat milk (Tg), human breast milk (hM) and S-rhLZ
migration, cell number, migration velocity and distance for samples and solution (270 μg/mL of commercial rhLZ from Sigma-Aldrich diluted in saline) used as
pathogens were compared by the χ2 or Fisher's tests. The normality of standard control. L = protein ladder (ProSieve® Color Protein Maker - Lonza).

the quantitative data was analysed by the Kolmogorov-Smirnov test

and, when required, values were normalized by logarithmic transfor- Table A.3
mation on a base 10 and analysed by ANOVA with paired comparisons Quantification of recombinant human lysozyme (rhLZ) present in the milk from the
by the Tukey's test (GLM-Minitab, State College, PA, USA). A simple transgenic founder (Tg), at the third week of lactation, in comparison to milk from non-
transgenic goat (nTg), human breast milk (hM) and commercial rhLZ diluted into saline
correlation (Pearson) test was used to assess relationships between solution (S-rhLZ). Results represent the semi-quantitative conversion of the lysozyme
variables. Graphic figures were produced by GraphPad Prism® software band intensity assessed from the WB relative to the S-rhLZ group (270 μg/mL commercial
(Version 5.01). Gene expression data, representative of three in- rhLZ), analysed by the Image J software.
dependent biological replicates for each treatment, were subjected to
Western blotting nTg Tg, μg/mL hM, μg/mL S-rhLZa, μg/mL
analysis of variance, using Minitab® Statistical Software (Minitab Inc.,
State College, PA, USA), with means compared by the Tukey's test. The 1 – 230 226 270
level of significance was 5%. 2 – 221 231 270
3 – 221 221 270
Mean – 224 226 270
3. Results
a
Saline solution with known amounts of commercial rhLZ (270 μg/mL rhLZ).
3.1. Physicochemical analysis
3.3. Activity test in vitro
Physicochemical analyses showed the mean milk parameter values
for goat Tg milk samples to be similar to goat nTg milk throughout the The M. luteus growth inhibition zone was observed after exposure to
eight consecutive weeks of collection, with all parameters falling well Tg, S-rhLZ, nTg + rhLZ and hM samples, demonstrating a growth re-
within the required values for human consumption, according to straining effect, whereas no inhibition zone was observed for the nTg
minimum quality standards by MAPA (Ministério da Agricultura e milk sample (Fig. A.2), as expected.
Pecuária, Brazil, 2000). However, in spite of the normal range values,
milk from the transgenic goat founder had significantly lower fat and
3.4. Bactericidal assay in vitro
higher protein contents than milk from both non-transgenic control
goats (Table A.2).
The bactericidal activity of the Tg milk group against M. luteus was
demonstrated by a 7- to 8-fold reduction in CFU number observed after
3.2. Lysozyme identification and quantification
incubation in comparison to the Negative Control and to the nTg group.
Additionally, the S-rhLZ and nTg + rhLZ samples completely inhibited
The rhLZ was identified by Western blot in milk samples from Tg,
the M. luteus growth. Samples used against S. sonnei showed no bac-
hM and S-rhLZ (Fig. A.1). After comparing each specific band intensity
tericidal effect, whereas E. feacalis showed a relative sensitivity to nTg
for each sample to the S-rhLZ group (270 μg/mL commercial rhLZ), the
+ rhLZ and a discrete sensitivity to Tg and S-rhLZ samples when
mean concentration values for human lysozyme in Tg milk was 224 μg/
compared to the Negative Control and to the nTg Groups (Table A.4).
mL. Such mean LZ value was similar to that found in the hM control
(Table A.3).
3.5. In vitro cell viability
Table A.2
Physicochemical analysis of milk samples from the transgenic founder goat (Tg) and two The evaluation of the sample dilution effects (1:5, 1:20, and 1:40)
non-transgenic control goats (nTg and nTg2). Results represent mean values obtained for on cell viability showed that the 1:20 and 1:40 dilutions of nTg, S-rhLZ
milk collected during eight consecutive weeks starting at the third week of lactation. and nTg + rhLZ groups significantly reduced the viability after 24 h of
Tg nTg nTg2 Standards by MAPA
exposure when compared to the other groups. After 48 h of exposure,
(2000)c however, cells exposed to Tg samples at 1:5 and 1:20 dilutions had
lower viability when compared to controls and the nTg group. After
Lactic acid (%) 0.16a 0.20a 0.18a 0.13–0.18 72 h, the Tg and nTg dilutions were statistically similar between one
Density at 15 °C (g/mL) 1.02a 1.01a 1.00a 1.02–1.03
another and between groups, with all dilutions used in the control
Cryoscopic constant (°H) − 0.55a −0.55a − 0.55a − 0.55 to − 0.585
Fat (%) 2.2a 2.7b 2.4b ≤ 2.9 group showing increased cell viability. The rhLZ group showed a sig-
Protein (%) 3.5a 2.9b 2.9b ≥ 2.8 nificantly decrease in cell viability when compared to the others group
Lactose (%) 4.5a 4.3a 4.4a ≥ 4.3 after 24, 48 and 72 h of culture (Fig. A.3).
Non-fat solids (%) 8.4a 8.2a 8.2a ≥ 8.2
pH 6.5a 6.4a 6.5a –d
Ashes (%) 0.7a 0.8a 0.9a ≥ 0,7 3.6. In vitro cell migration assay

a,b
:Numbers with different supercripts in the row differ (p < 0.05). The migration features of IEC-18 were not negatively affected by
c
MAPA recommendations (Ministério da Agricultura, Pecuária e Abastecimento,
milk or the presence of human lysozyme. An increase in number of
Brazil).
d
Not described.
migrating cells was observed at the 1:20 dilution for all groups in
comparison to controls. An increase in migrating velocity was observed
at all dilutions for the nTg, Tg and S-rhLZ groups, being similar to

82
I.d.S. Carneiro et al.
controls when rhLZ is added to nTg. The migration distance was also
increased at the 1:20 and 1:40 dilutions for the nTg and Tg groups,
whereas a reduction was seen for the nTg + rhLZ group at 1:5 and 1:40
dilutions. No differences were detected between dilutions within groups
(Table A.5). The 1:20 dilution for the nTg and Tg groups had sig-
nificantly better migrating parameters for cells in culture (p < 0.05)
than controls.
3.6.1. In vitro cell migration assay in the presence of pathogens
In general, and compared to controls, the presence of rhLZ in culture
was favourable for in vitro cell migrating velocity and distance in the
absence or presence of E. faecalis, S. aureus and E. coli, with no positive
effect observed for S. sonnei. In the absence of selected pathogens at
1:20 dilution, the Tg groups improved the number of migrating cells,
the nTg, Tg and S-rhLZ groups improved migrating velocity, and all
groups increased migrating distance in cells in culture when compared
to controls. In the presence of pathogens, the Tg milk, S-rhLZ and nTg-
rhLZ groups at 1:20 dilution promoted an increase in cell number (E.
coli for Tg and S-rhLZ, and S. aureus for S-rhLZ), growth migration
velocity (E. faecalis, S. aureus and E. coli) and distance (E. faecalis, S.
aureus and E. coli) when compared to the control group, except for S.
sonnei (p < 0.05). Conversely, nTg samples showed lower cell numbers
in the presence of E. faecalis and S. sonnei. In the presence of S. sonnei, S-
rhLZ and nTg + rhLZ samples were associated with lower number of
cells, with lower migrating distance (p < 0.05) in the presence of nTg
+ rhLZ samples (Table A.6).
3.7. Gene expression
No differences were observed between groups for the relative ex-
pression patterns of ZO-1 in cultured cells. However, albeit the IL-6
expression pattern was statistically similar between the control (PBS)
and the rhLZ groups, its expression was increased in the group of cells
exposed to nTg milk samples (nTg and nTg + rhLZ), with the Tg group
being similar to all groups (Table A.7).
4. Discussion
Goat (Capra hircus) milk contributes with approximately 2.4% of the
global milk production, representing an important source of proteins in
poor communities (FAO, 2013). Goat milk has more protein and mi-
neral contents than human milk (FAO, 2013), and the easy adaptation
of goats to environments of extreme poverty renders this species at-
tractive for the production of recombinant proteins and nutraceuticals
for human consumption. Consequently, boosting goat milk with human
lysozyme may be an interesting strategy to combat undernutrition and
endemic diseases. In this study, in view of such potentiality, we report
Table A.4
Evaluation of the bactericidal activity of non-transgenic (nTg) and transgenic (Tg) milk samples, commercial rhLZ diluted in saline solution (S-rhLZ) or in nTG milk (nTg + rhLZ) samples
against pathogenic bacteria in culture.
CFU Control nTg
a a
M. luteus 28.0 ± 3.2 32.3 ± 11.9
S. sonnei 117.7 ± 18.8a 140.3 ± 11.5a
E. faecalis 165.3 ± 14.4a 142.0 ± 18.2a
a,b
:Means in the row with different superscripts differ (p ≤ 0.05).
83
European Journal of Pharmaceutical Sciences 112 (2018) 79–86
Fig. A.2. In vitro antimicrobial activity (linear
measurement, in mm, and surface area, in mm2,
of the inhibition zone) of (nTg) non-transgenic
goat milk (0,00 mm, 0,000 cm2), (Tg) transgenic
goat milk (1,29 mm, 0,502 cm2), (hM) human
breast milk (2,30 mm, 0,73 cm2), and commercial
rhLZ diluted (S-rhLZ) in saline (2,39 mm,
0,830 cm2) or (nTg-rhLZ) in nTg milk (1,51 mm,
0,670 cm2) against Micrococcus luteus strain.
the production of a transgenic goat lineage for expression of rhLZ in the
milk and the characterization of the milk produced by the founder
animal, which is an important step in testing the milk properties for
future potential use of the rhLZ goat milk as nutraceutic product. Most
analyses and parameters evaluated in this study indicated features of
great potential for such application.
Food composition is an issue of interest in the food industry for
product development, quality control, or regulatory purposes, to ensure
quality and safety, and the physicochemical milk analysis is an im-
portant requirement for human consumption (Nielsen, 2006). The
proximate composition of foods includes the contents of macro-
nutrients, specifically moisture, ash, lipid, protein, and carbohydrate
(Nielsen, 2006). Fresh milk contains the natural ability to resist to pH
changes, owing to its “natural acidity”; however, the action of bacteria
that normally develop in raw milk produces more or less lactic acid
(FAO, 2017). Physical and chemical properties of fresh milk from the
transgenic goat founder was analysed during eight weeks, being widely
similar to those observed in non-transgenic goats, and in compliance
with the quality standards required by law for human consumption in
Brazil (MAPA, 2000). The significance of the differences in fat and
protein composition observed in the milk from the transgenic goat,
although within normal values, may be related to the animal effect.
Future studies including more animals are necessary to unravel those
findings.
The rhLZ mean content in the milk from the transgenic goat was
about 224 μg/mL, which represents 56% of the typical lysozyme con-
centration found in human breast milk (400 μg/mL; Ning et al., 2009;
Yang et al., 2011). The mean lysozyme concentration values in human
milk varies, as it decreases from the colostrum (370 μg/mL) to the
transitional milk (270 μg/mL), and to the mature milk between 15 and
28 days (240 μg/mL) of lactation. However, lysozyme levels increase in
mature milk from days 29–56 (330 μg/mL) up to days 57–84 (890 μg/
mL) of lactation (Montagne et al., 2001).
The rhLZ present in milk from transgenic goat has been character-
ized in previous studies as capable of modulating microbial population
(Maga et al., 2006a, 2006b; Scharfen et al., 2007). Experiments using
the pig model, where animals were fed with transgenic goats' milk
containing rhLZ at 270 μg/mL, have shown positive impact on the
gastrointestinal morphology, serum metabolites, lymphocyte popula-
tions, and increased anti-inflammatory cytokine expression (Brundige
et al., 2008, 2010; Cooper et al., 2011). In fact, after lactation, the
transgenic goats kept a lower level of somatic cell counts in milk in
comparison to non-transgenic goats. Such measure is used to monitor
infection of the mammary gland, indicating a healthier udder. Such
benefit is probably associated with the antimicrobial activity of lyso-
zyme, resulting in improved milk safety and animal welfare (Carvalho
et al., 2012; Maga et al., 2006a, 2006b).
Tg S-rhLZ nTg + rhLZ
b c
4.0 ± 1.2 0.0 ± 0.0 0.0 ± 0.0c
111.3 ± 5.7a 105.3 ± 10.3a 90.7 ± 5.6a
113.7 ± 12.8ab 110.7 ± 14.7ab 63.3 ± 15.0b
I.d.S. Carneiro et al.
Fig. A.3. In vitro cell viability in the presence of 1:5, 1:20 and 1:40 dilutions of non-
transgenic goat milk (Tg), transgenic goat milk (nTg), human breast milk (hM), and
commercial rhLZ diluted in saline (S-rhLZ) or in nTg milk (nTg + rhLZ) exposed for 24
(A), 48 (B) and 72 h (C) in comparison to LZ-free control sample. a–d:Columns with dif-
ferent superscripts for each dilution differ (p ≤ 0.05).
84
European Journal of Pharmaceutical Sciences 112 (2018) 79–86
The analysis of the antimicrobial effect of the milk showed that Tg,
S-rhLZ and nTg + rhLZ samples had antibacterial and bactericidal ac-
tivity against M. luteus, a Gram-positive strain normally used as re-
ference organism for studies on lysozyme activity (Diler et al., 2011).
The other Gram-positive strain, E. faecalis, showed discreet sensitivity
to the presence of Tg and S-rhLZ samples, whereas the CFU number
decreased significantly in the nTg + rhLZ group, which contained ra-
ther higher rhLZ amounts. The high resistance of E. faecalis to the action
of lysozyme is already well known, which allows survival of the pa-
thogen in the mammalian host (Benachour et al., 2012; Varahan et al.,
2013).
Despite the effective bactericidal effect against Gram-positive
strains, lysozyme was shown effective against Gram negative strains
only when associated with other substances, such as lactoferrin (Cerven
et al., 2008). Both proteins are present in mammalian milk, presenting
synergistic antimicrobial properties. Lactoferrin binds to lipopoly-
saccharides on the outer bacterial membrane, thus contributing to
membrane disruption and allowing lysozyme to have better access to
the peptidoglycan layer in Gram negative bacteria (Leitch and Willcox,
1999). Therefore, as expected for the Gram negative bacteria S. sonnei,
no sensitivity was verified in the sole presence of lysozyme. Our results
corroborate with other studies (Masschalck et al., 2001), in which the
presence of lysozyme (at concentrations of 10 and 100 μg/mL) resulted
in no variation or delay in growth curves for any of the six tested types
of Gram-negative bacteria (Escherichia coli, Pseudomonas fluorescens,
Salmonella enterica serovar Typhimurium, Salmonella enteritidis, Shigella
sonnei, and Shigella flexneri).
The potential antimicrobial effect of lysozyme, with positive mod-
ulation of the microbial population, has been previously described by
multiple studies. Moreover, the stability of LZ to heat treatments and
acidic conditions ensures integrity and effectiveness along the gastro-
intestinal tract (Masschalck et al., 2001; Mcinnins et al., 2015), which
makes the transgenic milk containing rhLZ a promising nutraceutical
product, suitable for consumption as fresh raw or pasteurized milk.
Furthermore, the rhLZ can be purified from milk for use as supplement
to oral rehydration solutions. In fact, the use of transgenic goat milk as
potential nutraceutic product or as supplement to oral rehydration
therapy was reported by Carvalho et al. (2012), which demonstrated
that the presence of nutrients in culture medium, in special proteins and
fat of goat milk, can be beneficial to intestinal cell proliferation in vitro.
Results in the cell assay obtained in this study showed alterations in cell
viability in the presence of diluted samples. After 24 h, the 1:20 dilution
of Tg milk sample was significantly similar to the control group and
different from nTg, showing positive effect on cell migration.
Besides the nutrient source, the antimicrobial ability of the trans-
genic milk was evaluated by comparing cell migration in the presence
of 1:20 sample dilutions, 24 h after the in vitro inoculation of patho-
genic bacteria. Improved cell proliferation was observed in cultures
exposed to samples from the Tg group along with E. faecalis, S. aureus
(statistically similar to S-rhLZ and nTg + rhLZ), and S. sonnei. Although
Tg milk samples showed no bactericidal effect against E. faecalis, the
presence of milk per se was beneficial to cell proliferation. The lower
cell migration effect observed after exposure to samples from the S-rhLZ
and nTg + rhLZ groups may be due to higher LZ protein activity in the
Tg milk than in the rhLZ-supplemented milk, as the lysozyme produced
in vivo in the milk through the mammary gland has been previously
shown to be more potent as antimicrobial agent than the milk supple-
mentation with purified protein (Carvalho et al., 2012; Maga et al.,
2006a).
Tight junction proteins are mainly responsible to function as in-
testinal mucosa barrier against macromolecular diffusion (Zhang and
Gou, 2009). The presence of samples in cell culture did not alter relative
gene expression pattern for ZO-1 protein, suggesting no effect on in-
testinal epithelial permeability in cultured cells. Conversely, the ex-
pression pattern of pro-inflammatory cytokine IL-6 by IEC-18 was in-
creased in the presence of milk samples (nTg, Tg and nTg + rhLZ),
I.d.S. Carneiro et al. European Journal of Pharmaceutical Sciences 112 (2018) 79–86

Table A.5
Number of migrating cells, velocity and distance of cell migration in vitro in the presence of nTg, Tg, S-rhLZ and nTg-rhLZ samples diluted at 1:5, 1:20 and 1:40.

Migration assay Control Dilution nTg Tg S-rhLZ nTg + rhLZ

Migrating cells, n 22.0 ± 0.6a 1:5 23.3 ± 0.9aA 23.7 ± 1.2aA 23.7 ± 0.3aA 22.6 ± 1.2aA
1:20 27.3 ± 2.0bA 32.0 ± 1.5bA 27.7 ± 0.3bA 28.0 ± 2.1bA
1:40 23.3 ± 0.7aA 25.0 ± 1.0aA 23.7 ± 0.7aA 23.0 ± 0.6aA
Migrating velocity 11.3 ± 0.5a 1:5 22.3 ± 1.6bA 23.3 ± 0.0bA 18.9 ± 1.9bA 15.2 ± 1.0aA
1:20 22.2 ± 2.5bA 24.7 ± 2.6bA 19.0 ± 0.0bA 17.0 ± 1.2abA
1:40 21.7 ± 2.6bA 23.6 ± 2.6bA 19.32 ± 1.3bA 15.8 ± 1.5aA
Migrating distance 471.6 ± 12.3a 1:5 518.0 ± 55.2aA 537.2 ± 32.5aA 449.1 ± 26.5abA 381.2 ± 33.6bA
1:20 550.4 ± 55.3bA 593.7 ± 62.7bA 473.0 ± 33.6aA 407.5 ± 28.6aA
1:40 505.6 ± 52.0bA 567.8 ± 61.8bA 438.3 ± 32.7abA 301.2 ± 33.6cA

a,b
:Means in the same row with different superscripts differ (p < 0.05).
A,B
:Means in the same column with different superscripts, for each migration assay, differ (p < 0.05).

Table A.6
Number of migrating cells, velocity and distance of cell migration in vitro in the presence of nTg, Tg, S-rhLZ and nTg-rhLZ samples diluted at 1:20 and pathogenic bacteria.

Migration assay Pathogens Control nTg Tg S-rhLZ nTg + rhLZ

a ab b ab
Migrating cells, n Absent 22.0 ± 0.6 27.3 ± 2.0 34.7 ± 41.2 27.7 ± 0.3 28.0 ± 2.1ab
E. feacalis 21.7 ± 0.3ab 16.0 ± 0.0b 23.0 ± 3.0a 25.0 ± 1.2a 23.3 ± 1.2a
S. aureus 21.3 ± 0.3ab 18.0 ± 1.2a 26.3 ± 1.3bc 30.67 ± 2.7c 26.7 ± 2.3bc
E. coli 20.7 ± 0.3a 24.3 ± 2.4ab 28.3 ± 1.2bc 22.7 ± 1.5ab 29.7 ± 0.7c
S. sonnei 20.3 ± 0.3ab 16.7 ± 1.9b 23.3 ± 1.8a 14.0 ± 1.2b 12.7 ± 3.2b
Migrating velocity Absent 11.3 ± 0.5a 23.2 ± 2.3b 24.0 ± 2.6b 21.4 ± 1.7b 17.0 ± 1.2ab
E. feacalis 11.1 ± 0.1a 9.3 ± 0.0a 17.2 ± 1.6b 19.3 ± 0.8b 17.4 ± 0.4b
S. aureus 11.3 ± 0.0a 15.2 ± 2.4ab 21.6 ± 0.5b 22.1 ± 1.5b 21.6 ± 1.5b
E. coli 11.0 ± 0.1a 16.0 ± 2.6ab 20.1 ± 5.1b 17.5 ± 0.8b 18.8 ± 1.0b
S. sonnei 11.2 ± 0.0ab 15.7 ± 1.5a 17.7 ± 2.1a 12.4 ± 1.6ab 7.2 ± 1.0b
Migrating distance Absent 271.6 ± 12.3a 555.7 ± 55.0b 593.8 ± 62.7b 473.0 ± 33.6b 407.6 ± 28.6b
E. feacalis 270.8 ± 0.5a 222.6 ± 0.0a 412.1 ± 39.4b 412.0 ± 39.4b 417.6 ± 10.1b
S. aureus 270.2 ± 0.2a 394.3 ± 66.0ab 507.6 ± 10.9b 530.0 ± 36.0b 518.2 ± 35.7b
E. coli 269.6 ± 0.2a 383.6 ± 62.1ab 410.0 ± 60.5b 418.87 ± 18.6b 450.8 ± 24.4b
S. sonnei 269.2 ± 0.2ab 402.0 ± 37.3a 425.6 ± 51.2a 297.6 ± 37.9ab 173.6 ± 23.2b

ab
:Means in the same row with different superscripts differ (p ≤ 0.05).

Table A.7
Relative expression levels for the ZO-1 and IL-6 genes in IEC-18 in culture after incubation in the presence of nTg, Tg, S-rhLZ and nTg-rhLZ samples.

Gene expression Control nTg Tg S-rhLZ nTg + rhLZ

ZO-1 1.2 ± 0.1a 0.8 ± 0.1a 0.8 ± 0.2a 1.1 ± 0.1a 0.7 ± 0.1a
IL-6 1.8 ± 0.8b 12.9 ± 0.3a 7.6 ± 3.5ab 1.7 ± 0.3b 10.3 ± 0.5a

a,b
:Means within the same row with different superscripts differ (p < 0.05).

which suggests that transgenic or non-transgenic goat milk may elicit
an intestinal inflammatory process under in vitro conditions (Atreya and
Neurath, 2005). However, the in vivo analysis of gut regions (duodenum
and ileum) of pigs that received an association of pasteurized transgenic
goat milk and pasteurized non-transgenic cow milk, with a final con-
centration of 135 μg/mL rhLZ, showed no increase in the expression of
IL-6 (Cooper et al., 2013). More studies are needed to evaluate the in
vitro and in vivo effects of the Tg and nTG milk on the intestinal epi-
thelium, on pro- and anti-inflammatory molecules, and on gut perme-
ability.
Brazilian Northeast region, where the number of infant deaths due to
malnutrition and infectious diseases is high. The rhLZ produced in milk
has the potential to be used in infant formulas or in natura, as nu-
traceutic product, with the nutritional and medical values comparable
to human milk. Additional in vitro and in vivo studies using animal
models are under way, which are absolutely necessary to be performed
to ensure safety as well as the observation of beneficial effects with no
detrimental or unintended consequences of the use of transgenic goat
milk containing rhLZ.

5. Conclusions
This study focused on the characterization of the goat milk from a
transgenic line that expresses human lysozyme in the milk. The physi-
cochemical properties of milk samples from transgenic and non-trans-
genic goats were similar and in compliance with the minimum quality
requirements for human consumption (MAPA, 2000). Active rhLZ is
present in the milk of the transgenic goat line at amounts comparable to
values found in human breast milk, also demonstrating in vitro anti-
bacterial and bactericidal effects. The transgenic milk did not alter or
affect the in vitro viability, proliferation and migration of intestinal
epithelial cells (IEC-18) in culture. This study was carried out in the
Acknowledgement
This study was funded by the Studies and Projects Funding Agency
(Financiadora de Estudos e Projetos – Finep) of the Ministry of Science
and Technology of Brazil, under grant number 0460.08.
Conflict of interest
Igor de Sá Carneiro, José Nilson Rodrigues de Menezes, Julyana
Almeida Maia, Victor Bruno Soares de Oliveira, James D. Murray,
Elizabeth A. Maga, Marcelo Bertolini and Luciana Relly Bertolini state
that there are no conflicts of interest.

85
I.d.S. Carneiro et al.
Appendix A. Supplementary data
Supplementary data to this article can be found online at https://
doi.org/10.1016/j.ejps.2017.11.005.
References
Atreya, R., Neurath, M.F., 2005. Involvement of IL-6 in the pathogenesis of inflammatory
bowel disease and colon cancer. Clin. Rev. Allergy Immunol. 28 (3), 187. http://dx.
doi.org/10.1385/CRIAI.
Benachour, A., Ladjouzi, R.L.E., le Jeune, A., Hébert, L., Thorpe, S., Courtin, P., Chapot-
Chartier, M.P., Prajsnar, T.K., Foster, S.J., Mesnage, S., 2012. The lysozyme-induced
peptidoglycan n-acetylglucosamine deacetylase PgdA (EF1843) is required for
Enterococcus faecalis virulence. J. Bacteriol. http://dx.doi.org/10.1128/JB.00981-12.
Brito, G.A., Carneiro-Filho, B., Oriá, R.B., Destura, R.V., Lima, A.A., Guerrant, R.L., 2005.
Clostridium difficile toxin A induces intestinal epithelial cell apoptosis and damage:
role of Gln and Ala-Gln in toxin A effects. Dig. Dis. Sci. 50, 1271–1278.
Brundige, D.R., Maga, E.A., Klasing, K.C., Murray, J.D., 2008. Lysozyme transgenic goats'
milk influences gastrointestinal morphology in young pigs. J. Nutr. 138 (5), 921–926.
Brundige, D.R., Maga, E.A., Klasing, K.C., Murray, J.D., 2010. Consumption of pasteurized
human lysozyme transgenic goats' milk alters serum metabolite profile in young pigs.
Transgenic Res. http://dx.doi.org/10.1007/s11248-009-9334-4.
Carvalho, E.B., Maga, E.A., Quetz, J.S., Lima, I.F.N., Magalhães, H.Y.F., Rodrigues, F.A.R.,
Silva, A.V.A., Prata, M.M.G., Cavalcante, P.A., Havt, A., Bertolini, M., Bertolini, L.R.,
Lima, A.A.M., 2012. Goat milk with and without increased concentrations of lyso-
zyme improves repair of intestinal cell damage induced by enteroaggregative
Escherichia coli. BMC Gastroenterol. http://dx.doi.org/10.1186/1471-230X-12-106.
Cerven, D., DeGeorge, G., Bethell, D., 2008. 28-Day repeated dose oral toxicity of re-
combinant human apo-lactoferrin or recombinant human lysozyme in rats. Regul.
Toxicol. Pharmacol. http://dx.doi.org/10.1016/j.yrtph.2008.03.007.
Cooper, C.A., Brundige, D.R., Reh, W.A., Maga, E.A., Murray, J.D., 2011. Lysozyme
transgenic goats' milk positively impacts intestinal cytokine expression and mor-
phology. Transgenic Res. http://dx.doi.org/10.1007/s11248-011-9489-7.
Cooper, C.A., Klobas, L.C.G., Maga, E.A., Murray, J.D., 2013. Consuming transgenic goats'
milk containing the antimicrobial protein lysozyme helps resolve diarrhea in young
pigs. PLoS One. http://dx.doi.org/10.1371/journal.pone.0058409.
Diler, E., Obst, U., Schmitz, K., Schwartz, T., 2011. A lysozyme and magnetic bead based
method of separating intact bacteria. Anal. Bioanal. Chem. http://dx.doi.org/10.
1007/s00216-011-5065-5.
FAO - Food and Agriculture Organization of the United Nations, 2013. Milk and dairy
products in human nutrition. http://www.fao.org/docrep/018/i3396e/i3396e.pdf,
Accessed date: 18 April 2017.
FAO - Food and Agriculture Organization of the United Nations, 2017. Milk processing
guide series - volume 2, published by: FAO/TCP/KEN/6611 - Project training pro-
gramme for small scale dairy sector and dairy training. Institute Naivashahttp://
www.fao.org/ag/AGAInfo/resources/documents/MPGuide/mpguide2.htm, Accessed
date: 18 April 2017.
Huang, J., Nandi, S., Wu, L., Dorice, Y., Bartley, G., Rodriguez, R., Lonnerdal, B., Huang,
N., 2002. Expression of natural antimicrobial human lysozyme in rice grains. Mol.
Breed. http://dx.doi.org/10.1023/A:1020355511981.
Leitch, E.C., Willcox, M.D.P., 1999. Elucidation of the antistaphylococcal action of lac-
toferrin and lysozyme. J. Med. Microbiol. http://dx.doi.org/10.1099/00222615-48-
9-867.
Lu, D., Li, Q., Wu, Z., Shang, S., Liu, S., Wen, X., Li, Z., Wu, F., Li, N., 2014. High-level
recombinant human lysozyme expressed in milk of transgenic pigs can inhibit the
growth of Escherichia coli in the duodenum and influence intestinal morphology of
sucking pigs. PLoS One. http://dx.doi.org/10.1371/journal.pone.0089130.
Maga, E.A., Murray, J.D., 1995. Mammary gland expression of transgenes and the po-
tential for altering the properties of milk. Nat. Biotechnol. http://dx.doi.org/10.
1038/nbt1295-1452.
Maga, E.A., Sargent, R.G., Zeng, H., Pati, S., Zarling, D.A., Oppenheim, S.M., Collette,
N.M., Moyer, A.L., Conrad-Brink, J.S., Rowe, J.D., BonDurant, R.H., Anderson, G.B.,
Murray, J.D., 2003. Increased efficiency of transgenic livestock production.
Transgenic Res. 12, 485–496.
Maga, E.A., Shoemaker, C.F., Rowe, J.D., Bondurant, R.H., Anderson, G.B., Murray, J.D.,
2006a. Production and processing of milk from transgenic goats expressing human
lysozyme in the mammary gland. J. Dairy Sci. http://dx.doi.org/10.3168/jds.S0022-
86
European Journal of Pharmaceutical Sciences 112 (2018) 79–86
0302(06)72114-2.
Maga, E.A., Cullor, J.S., Smith, W., Anderson, G.B., Murray, J.D., 2006b. Human lyso-
zyme expressed in the mammary gland of transgenic dairy goats can inhibit the
growth of bacteria that cause mastitis and the cold-spoilage of milk. Foodborne
Pathog. Dis. http://dx.doi.org/10.1089/fpd.2006.3.384.
Maga, E.A., Desai, P.T., Weimer, B.C., Dao, N., Kultz, D., Murray, J.D., 2012.
Consumption of lysozyme-rich milk can alter microbial fecal populations. Applied of
Environmental Microbiology. http://dx.doi.org/10.1128/AEM.00956-12.
MAPA – Ministério da Agricultura e do Abastecimento, Brazil, 2000. Secretaria de Defesa
Agropecuária. In: Regulamento Técnico de produção, identidade e qualidade do leite
de cabra. Instrução Normativa no 37 de 31 de outubro de 2000. Diário Oficial da
União, Brasília.
Masschalck, B., Van Houdt, R., Van Haver, E.G.R., Michiels, C.W., 2001. Inactivation of
Gram-negative bacteria by lysozyme, denatured lysozyme, and Lysozyme-derived
peptides under high hydrostatic pressure. Appl. Environ. Microbiol. http://dx.doi.
org/10.1128/AEM.67.1.339-344.2001.
McInnins, A.E., Kalanetra, K.M., Mills, D.A., Maga, E.A., 2015. Analysis of raw goat milk
microbiota: impact of stage of lactation and lysozyme on microbial diversity. Food
Microbiol. http://dx.doi.org/10.1016/j.fm.2014.07.021.
Montagne, P., Cuillière, M.L.C., Molé, M.C., Béné, G., 2001. Changes in lactoferrin and
lysozyme levels in human milk during the first twelve weeks of lactation. In: Newburg
(Ed.), Bioactive Components of Human Milk. 501. Springer, US, pp. 241–247.
Mosmann, T., 1983. Rapid colorimetric assay for cellular growth and survival: application
to proliferation and cytotoxicity assays. J. Immunol. Methods. http://dx.doi.org/10.
1016/0022-1759(83)90303-4.
Nielsen, S.S., 2006. Proximate Assays in Food Analysis. Purdue University, West
Lafayette, USA.
Ning, L.A., Qiuyan, L.A.B., Hengxi, W.A., Ying, G.A., Yan, L.B., Rui, Z.B., Yufang, M.,
Zhengquan, Y.A.B.O.T.B., Lei, Z.B., Yunping, D.A.B., 2009. Production of human
lysozyme-transgenic cloned porcine embryos by somatic nuclear transfer a State Key.
Science 19, 699–704.
Norman, K., Pirlich, M., Schulzke, J.D., Smoliner, C., Lochs, H., Valentini, L., Bühner, S.,
2012. Increased intestinal permeability in malnourished patients with liver cirrhosis.
Eur. J. Clin. Nutr. http://dx.doi.org/10.1038/ejcn.2012.104.
OECD, N°., 1998. 407: guideline for the testing of chemicals, section 4: health effects.
Repeated dose 28-day oral toxicity study in rodents. TEST 407, 1–10.
Pupek, M., Mikulewicz, W., Mielnik, J., Batycka, B., Katnick-Prastowska, I., 2003. Time-
dependent observations of secretion marker levels in nasal secretion after histamine
and methacholine provocations. Arch. Immunol. Ther. Exp. 51, 259–265.
Rollins, N.C., Bhandari, N., Hajeebhoy, N., Horton, S., Lutter, C.K., Martines, J.C., Piwoz,
E.G., Richter, L.M., Victora, C.G., 2016. Why invest, and what it will take to improve
breastfeeding practices? Lancet. http://dx.doi.org/10.1016/S0140-6736(15)
01044-2.
Salva, S., Nuñez, M., Villena, J., Ramón, A., Fonta, G., Alvareza, S., 2011. Development of
a Fermented Goats' Milk Containing Lactobacillus rhamnosus: In Vivo Study of Health
Benefits. Wiley Online Library. http://dx.doi.org/10.1002/jsfa.4467.
Scharfen, E.C., Mills, D.A., Maga, E.A., 2007. Use of human lysozyme transgenic goat milk
in cheese making: effects on lactic acid bacteria performance. J. Dairy Sci. http://dx.
doi.org/10.3168/jds.2006-808.
Varahan, S., Iyer, V.S., Moore, W.T., Hancock, L.E., 2013. Eep confers lysozyme resistance
to Enterococcus faecalis via the activation of the extra cytoplasmic function sigma
factor sig V. J. Bacteriol. 195, 3125–3134.
Victora, C.G., Bahl, R., Barros, A.J.D., França, G.V.A., Horton, S., Krasevec, J., Murch, S.,
Sankar, M.J., Walker, N., Rollins, N.C., 2016. Breastfeeding in the 21st century:
epidemiology, mechanisms, and lifelong effect. Lancet 387, 475–490.
van Vuuren, S.F., Nkwanyana, M.N., de Wet, H., 2015. Antimicrobial evaluation of plants
used for the treatment of diarrhoea in a rural community in northern Maputaland,
KwaZulu-Natal, South Africa. In: BMC Complementary and Alternative Medicine,
http://dx.doi.org/10.1186/s12906-015-0570-2.
Wang, H., Wu, H., Wang, K., Cao, Z., Yu, K., Lian, L., Lian, Z., 2016. Expression of re-
combinant human lysozyme in transgenic chicken promotes the growth of
Bifidobacterium in the intestine and improves postnatal growth of chicken. AMB
Express. http://dx.doi.org/10.1186/s13568-016-0280-2.
Yang, B., Wang, J., Tang, B., Liu, Y., Guo, C., 2011. Characterization of bioactive re-
combinant human lysozyme expressed in milk of cloned transgenic cattle. PLoS One
6, 1–3.
Zhang, B., Gou, Y., 2009. Supplemental zinc reduced intestinal permeability by enhancing
occluding and zonula occludens protein-1 (ZO-1) expression in weaning piglets. Br. J.
Nutr. http://dx.doi.org/10.1017/S0007114509289033.