Вы находитесь на странице: 1из 375

a)

autoridades

( Rector: Dr. Luis María Desimoni


( Vicerrector: Comisario Gral. (r) Lic. Carlos Daniel Musso
( Decano de la Fac. de Cs. Jurídicas y Sociales: Dr. Horacio Aracama
( Secretario Académico: Dr. Hugo Méndez.
( Secretario Administrativo: Comisario Gral. (r) Angel Juan Antonio Ramírez
icd
investigación científica del delito

( t1)
educación a distancia

( Autor: Lic. Juan Carlos Alegretti


(

( Asesora de Diseño didáctico: Dra. Claudia Cristina Burgos


(

( Diseño Gráfico: Mariela Acorinti y Ariel Ballart


(

( Diagramación: Gabriela del Carmen Garcia


(

( Correctora Jurídica y de Estilo: Dra. María Alicia Muract Gola


(

( Directora del Programa Educ. a Distancia: Dra. María Evangelina Trebolle


(
educación a distancia (instituto universitario de la P.F.A.)

( CARTA AL ALUMNO )

De la misma manera que lo hago en las cátedras presenciales me presento


ante Ustedes. Soy el Licenciado en Criminalística Juan Carlos ALEGRETTI, a quien
se le ha otorgado el privilegio de dictar una materia tan variada como fascinante:
“Investigación Científica del Delito”. A través de la presente deseo brindarles la más
cordial bienvenida a un nuevo ciclo lectivo

El contenido de la materia comprende el conocimiento de una disciplina téc-


nico científica, la Criminalística, desde sus tres puntos de acción: la Investigativa, la
Pericial y la Prevencional.

Soy plenamente consciente que el carácter de esta rama del conocimiento hu-
mano dada su rigidez técnico científica, escapa a los cánones del resto de las mate-
rias de la carrera que han emprendido. Sin embargo su conocimiento presenta, en la
práctica profesional, tan importante interrelación y aporta tantos auxilios, que no sólo
se hace interesante su profundización, sino que lo transforma en imprescindible.

Su desarrollo no tiene como meta el aprendizaje del accionar criminalístico peri-


cial, ya que no es objeto temático de Abogacía ni sería posible esbozarlo en el escaso
tiempo destinado. Sólo pretende brindar una cosmovisión integral de los aportes que
puede brindar esta disciplina, no sólo en el cumplimiento de la difícil tarea del ejercicio
del derecho, sino en un sentido mucho más amplio, ya que sus alcances permiten su
utilización en la vida cotidiana doméstica.

La Criminalística aporta sus conocimientos para el cumplimiento de su fundamental


tarea que es la determinación de la verdad sobre los mecanismos de producción de los
hechos, sean éstos delictivos o no, con el fin de que aquel que tenga a su cargo impartir
justicia pueda hacerlo en forma imparcial dando a cada uno lo que le corresponde, ya que
a través de los testigos mudos o cosas dejadas en el lugar de su concreción o de aquel-
las con las que se ha materializado y a través de la objetividad científica de sus métodos,
se puede arribar a la tan ansiada verdad que ha sido, es y seguirá siendo la tarea más
dificultosa para la resolución de los conflictos provocados por el hombre.

tomo 1 investigación científica del delito ) 5


educación a distancia (instituto universitario de la P.F.A.)

Invoco la protección de Dios para que las partes comprometidas en esta tarea,
Uds. como receptores de la información aportada y yo como guía, podamos cumplir
las metas fijadas y que con el futuro desempeño de los nuevos profesionales veamos
coronados todos los esfuerzos que a ambas partes nos ha significado, el empren-
dimiento de una tarea que implica tantos compromisos como satisfacciones por el
deber cumplido.

Los invito a que conozcan una disciplina científica que, no solo aporta en el desem-
peño profesional así como en el diario vivir, una serie de facilidades para afrontar un mundo
globalizado, cruel, difícil, pero a su vez magnífico para ser vivido y disfrutado en toda su
magnitud.

Cordialmente.

Licenciado Juan Carlos ALEGRETTI

6 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

( CURRICULUM VITAE )

Nombre y Apellido: Juan Carlos ALEGRETTI


Nacionalidad: Argentina
Lugar y fecha de Nacimiento: en Capital Federal, el 20 de Febrero de 1949
Profesión: l Licenciado en Criminalística U.B.A.
l Comisario (r) Policía Federal Argentina
l Profesor
l Ex Presidente de la Asociación Criminalística Argentina (ASCRA)
l Ex Instructor Sumario Administrativo en Procuración del Tesoro de la
Nación.

Actividades docentes

Desde el año 1998 se ha desempeñado como titular de cátedra en diferentes asignaturas en


las facultades de Ciencias Criminalísticas, Ciencias Jurídicas y Sociales y Ciencias de la Seguridad,
todas ellas del Instituto Universitario de la Policía Federal Argentina.

Desde el año 1981 se ha desempeñado como docente en las diferentes escuelas de la


Policía Federal Argentina tales como: Escuela Federal de Policía; Academia Federal Superior; Es-
cuela de Informaciones de la Superintendencia de Interior; Cursos en las divisiones Scopometría
y Balística de la Superintendencia Científica y en otros Institutos Privados y Estatales.

Cursos realizados
l Año 1976: “10º Curso Especial Antisubversivo” en la División C.A.P.E. de la Policía
Federal Argentina.

l Año 1977: “Curso Instructor de Tiro” en el Departamento Escuela de Tiro de la Super-


intendencia de Instrucción.

l Año 1980: “Curso de Perfeccionamiento para Graduados sobre Criminología y Psico-


patología Criminal”, dictado por el Ministerio de Bienestar Social, Dirección de Salud
Mental, Centro Arturo Ameghino.
l Año 1983: a) “Curso de Fotografía” en el Foto Club Buenos Aires.
b) “Curso Investigación de la Muerte” en la División Homicidios de la
Superintendencia de Investigaciones Criminales.

tomo 1 investigación científica del delito ) 7


educación a distancia (instituto universitario de la P.F.A.)

l Años 1984/85: a) “Curso de Grafopsicología aplicada a Investigaciones” en la Escuela


Nuevas Técnicas Psicológicas.
b) “Curso de Perfeccionamiento Docente sobre Grafología Científica y
Test Proyectivos” en Escuela Nuevas Técnicas Psicológicas.

l Año 1991: “Curso de Perfeccionamiento Docente” en la Academia Federal Superior.

l Año 1993: “Curso sobre Derecho Procesal Penal, Nuevo Código y Juicio Oral” en la
Universidad del Salvador.

l Año 1994: “Curso sobre La Defensa Nacional en el Año 2000”. Temario: Globalismo y Region-
alismo; Economía, Ciencia, Tecnología y Medio Ambiente; Derecho y Legislación; Estado y
Defensa, dictado por la Universidad de Buenos Aires, Facultad de Derecho y Ciencias Sociales
y por el Instituto Universitario de Estudios Navales y Marítimos de la Armada Argentina.

l Año 1995: “Curso de Postgrado en Capacitación Docente” dictado en el Instituto Uni-


versitario de la Policía Federal Argentina.

l Año 1997: “Curso de Capacitación en Procedimiento Disciplinario” dictado por la Escuela del
Cuerpo de Abogados del Estado de la Procuración del Tesoro de la Nación.

l Años varios: “Curso Superior Avanzado de Idioma Inglés, Nivel Conversación” en el


Instituto Universitario de la Policía Federal Argentina.

Seminarios -congresos -conferencias -jornadas


Desde el año 1972 hasta la fecha ha participado como disertante, orador, organizador,
moderador, concurrente, asistente, etc. en Seminarios, Congresos, Conferencias y Jornadas de la
especialidad, organizadas por Instituciones Públicas y Privadas, Organismos de los tres Poderes
Constitucionales y Sociedades Científicas, tanto en el país como en el exterior.

Otras actividades
ASOCIACION CRIMINALISTICA ARGENTINA (ASCRA): Por elección de sus socios, en
Asamblea Electoral fue designado Presidente en el año 1986 hasta 1997.

FUNDACION VIDA: Es Miembro Asesor de la Fundación Vida (Resolución I.G.J. nº 1044),


en el programa “Prevención en Drogadependencia y Orientación del Menor”.

Otras representaciones
Fue representante permanente de la Policía Federal Argentina en Cuestiones Criminalísticas.
Designado Institucionalmente como asesor y conferencista en diversos Organismos e Instituciones,
tales como Ejército Argentino, Prefectura Nacional, Registro Nacional de Propiedad del Automotor,
Registro de las Personas, etc.

8 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

Conferencias grabadas en video-caset


Por disposición Institucional en 1981 grabó en video-caset, con fines de instrucción en Aca-
demias de Personal, Conferencia-Debate sobre diferentes temas penales.

Conferencias en medios de difusión pública


Designado institucionalmente para conferencias y entrevistas periodísticas sobre temas
Criminalísticos, especialmente sobre papel moneda nacional y extranjera. En Televisión: para
“Nuevediario”, “Telenoche”, etc.; en Radios: para “Rapidísimo”, “Cordialmente”, etc.; en Prensa
Escrita: para Clarín, etc. Además participación en programas de Interés General con participación
de paneles públicos, como “Con Ustedes”, conducido por Fernando Bravo.

Publicaciones escritas
Publicación de artículos de carácter Criminalísticos, especialmente sobre autenticidad de
papel moneda nacional y extranjera (países integrantes del Mercosur, Estados Unidos de Norte
América y Euro) y sobre documentos de identidad en “Protección & Servicios”, “Ombudsman”
y “Baluarte”.

Como Perito oficial y de parte


Actuación profesional como perito oficial y/o de parte en actuaciones judiciales y ex-
trajudiciales, para particulares y empresas, en pericias Documentológicas, Balísticas, Acciden-
tológicas y de Rastros.

tomo 1 investigación científica del delito ) 9


educación a distancia (instituto universitario de la P.F.A.)

10 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

abogacía a distancia om)


objetivos generales de la materia

l Dimensionar los conceptos de: Información, Conocimiento Global y Conocimiento


Científico; y la forma de adquisición de éstos: Empírica, Inductiva, Deductiva.

l Clasificar las Ciencias según su Objeto, Enunciado y Método. Precisar el alcance del Lenguaje
Científico y los términos de que puede valerse para sus enunciados.

l Comprender los elementos y las interacciones de todo Proceso Semiótico y los niveles que
regulan el lenguaje de signos.

l Conocer los alcances de la disciplina Crininalística. Su evolución histórica, orígenes y precur-


sores. Grandes capítulos que la comprenden y el alcance de su accionar, para que pueda
ser utilizada por los Abogados en el ejercicio de su profesión.

l Delimitar su actuación con las de otras disciplinas como la Criminología y la Medicina Legal,
analizando brevemente el objeto temático de cada una de ellas.

l Detallar los contenidos, componentes y alcances de un Informe Pericial, a fin de comprender


los requisitos legales para actuar como perito, sus diferentes roles, su accionar individual
y conjunto, el análisis del Objeto Pericial y la importancia de su redacción; el detalle de los
Elementos Dubitados e Indubitados aportados para estudio; los análisis, estudios y formali-
dades técnicas y reglamentarias que diferencian la actuación del perito con la del testigo y
los tipos de conclusiones a las que se puede arribar.

l Detallar los recaudos legales y prácticos a cumplimentar en el “Retrato del lugar del Hecho”
o Inspección ocular, en la preservación del lugar, prioridades, documentación, ubicación,
levante, conservación, recaudos legales, transporte y precauciones a tomar con los indicios
o testigos mudos hallados en el lugar.

l Precisar el concepto de Identidad Humana y conocer los principios básicos que sustentan
los sistemas de Identificación que, uno en forma directa y varios en formas indirectas, per-
mite a través de elementos probatorios o de indicios demostrar la presencia de una persona
determinada en esa escena o en esos elementos vinculantes.

l Indicar los conceptos filosóficos y teóricos que permiten la comprobación de autoría


o no, en manuscritos o firmas.

l Introducir al futuro profesional en el conocimiento de las peritaciones y comprobaciones que


pueden realizarse sobre escrituras mecánicas o tipográficas, realizadas con máquinas de
escribir, impresoras, fotocopiadoras y fax.

tomo 1 investigación científica del delito ) 11


educación a distancia (instituto universitario de la P.F.A.)

l Conocer las medidas de seguridad documental en papeles, tintas, sistemas de impresión y


generales que se realizan sobre cualquier tipo de soporte, a fin de reconocer falsificaciones
y adulteraciones.

l Conocer las medidas de seguridad implementadas en los billetes papel moneda nacional y
sus representativos, en dólares y otros países donde se utilizan billetes polímeros.

l Conocer las medidas de seguridad en tarjetas de crédito, documentos de identidad, creden-


ciales, chapas patentes, etc., por su significancia en su accionar profesional.

l Conocer los lineamentos de la intervención pericial balística, desde sus divisiones: interior,
exterior y de efectos. Señalar las características que permiten la identificación del arma
utilizada a través el proyectil y la vaina secuestrada, como asimismo el establecimiento de
distancias de disparo, trayectorias, orificios de entrada y salida, etc.

12 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

abogacía a distancia pa)


presentación de la asignatura

La naturaleza determinantemente social del hombre lo precondiciona a vivir en socie-


dad, ya que sólo a través de ella logra crecer y desarrollarse. Esto ha sido omnicomprendido
desde tiempos remotos, donde para enfrentarse a las pulsiones hostiles del medio, a las
inclemencias del tiempo y para satisfacer sus necesidades básicas de alimento, vivienda y
protección, ha debido nuclearse y conformar pueblos, ciudades y países. Así logró, en base
a la observación y la experimentación, significativos avances y una gran evolución no sólo
de la especie sino también de su hábitat, aunque el costo ha sido a veces excesivo.

El devenir del tiempo sigue demostrando esa necesidad societaria. La globalización


en general y las integraciones internacionales tales como la COMUNIDAD EUROPEA, el
NAFTA y el MERCOSUR, etc. en particular, lo confirman cotidianamente y son ejemplos
orgánicos de esta esencial necesidad humana.

Desde siempre, las relaciones entre los hombres son y seguirán siendo origi-
nadoras de conflictos. Cuanto más heterogéneas son las sociedades, más hipótesis
de conflictos presentan. Si bien su génesis es muy variada, gran parte de los mismos
son provocados por las anómalas relaciones comerciales, donde el endiosamiento
mercantil capitalista cree justificar doctrinas egoístas, individuales o grupales que,
para conseguir ventajas, no dudan en recurrir a acciones marginales o criminosas.
La adopción de oportunas medidas cautelares de prevención suele paliar estas cir-
cunstancias, pero en muchos casos se debe recurrir a planteamientos judiciales ante
fueros nacionales o internacionales para su dilucidación.

Desde las primeras conformaciones clánicas o tribales hasta nuestros días, quienes
debieron o deben administrar justicia (jefes de tribus, consejos de ancianos, jueces) han
necesitado, necesitan y necesitarán la determinación de “LA VERDAD”, es decir conocer
la realidad de la producción de los hechos para poder, en forma imparcial, dar a cada uno
lo que le corresponde ya sea castigando o resarciendo. Para lograr la verdad, el hombre
ha utilizado diversos métodos -cuya revisión histórica será detallada en la unidad corre-
spondiente- hasta llegar a la Criminalística, cuya definición, objeto, alcances y métodos
serán objeto temático de esta materia.

Como anticipo diremos que la Criminalística permite el asesoramiento integral sobre


la conformación de la prueba material específica para cada caso y frente a cada indicio,

tomo 1 investigación científica del delito ) 13


educación a distancia (instituto universitario de la P.F.A.)

a los que se han denominado “testigos mudos”, con la resolución de los interrogantes
periciales que estos presenten; la valoración de los aciertos o deficiencias de las pruebas
obrantes en las causas; la redacción de interrogatorios a peritos o testigos con respecto a
dichas pruebas materiales; la valoración y en su caso la impugnación de peritaciones no
basadas en comprobaciones técnicas o científicas; el contralor de las pruebas cumplidas
y a cumplimentar tanto en hechos judiciales como extrajudiciales, todo ello a través de las
cinco ramas en que se puede englobar su actividad.

Ofrece un amplio campo contributivo que no todos han logrado advertir, recur-
riéndose a ella y a sus peritos sólo en acontecimientos extremos o esporádicos desap-
rovechando así una asistencia que puede ser determinante y que es aplicable en casi
todos los órdenes de la vida y no solamente en el campo litigioso, sino fundamental-
mente en la faz preventiva, tanto en seguridad documental como en la valorización de
actos o procedimientos, debiéndose recurrir a ella no sólo después de un hecho, sino
antes. Es útil tener presente que tanto en SALUD como en SEGURIDAD es mejor y más
económico PREVENIR QUE REMEDIAR.

14 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

abogacía a distancia oa)


organización de la asignatura

La asignatura se encuentra organizada en diferentes unidades. Cada una de ella


nos introduce de manera conceptual y siguiendo un orden sistematizado, a los diferentes
contenidos que en virtud del tiempo asignado para su desarrollo (un cuatrimestre), se consid-
eran de importancia en cuanto a su conocimiento por parte del futuro profesional abogado,
ya que la Criminalística aporta todo su bagaje técnico y científico para el esclarecimiento
del hecho una vez que este ha sido cometido, a través del hallazgo e interpretación de los
testigos mudos, y para la adopción de medidas de seguridad prevencionales que dificulten
el accionar avasallante de aquellos que hacen del delito su medio natural de existencia.

LA UNIDAD I: Tiene como objeto introducirnos dentro de un mundo de objetividad


científica, demarcando la importancia de un lenguaje que puede y debe ser entendido
por conocedores y legos.

LA UNIDAD II: Nos introduce al conocimiento de la Criminalística, sus alcances y dife-


renciaciones con otras disciplinas relacionadas. Asimismo nos demuestra la rigidez con
que debe expresarse el perito a través de su informe a fin de cumplir su cometido, pun-
tualizando las virtudes y falencias que deben mensurarse para solicitar explicaciones y/o
solicitar su impugnación.

LA UNIDAD III: Detalla las formas y precauciones a tenerse en cuenta en la realización


de la Inspección ocular del lugar del hecho a fin de encontrar y preservar los indicios.
Detalla las reglas que deben cumplimentarse en su ejecución fáctica y en toda actividad
criminalística.

LA UNIDAD IV: Nos introduce en la problemática de la Identidad Humana, dando un


escueto panorama de los diferentes recursos indirectos y directos con que es posible
establecerla.

LA UNIDAD V: Señala los basamentos técnicos y científicos que permiten la realización


de pericias sobre escrituras mecánicas realizadas con máquinas de escribir, hasta las
realizadas con impresoras de última generación, con fotocopiadoras y fax.

LA UNIDAD VI: Lo hace con relación a las pericias sobre manuscritos y firmas a fin de
establecer paternidad escritural o no.

LA UNIDAD VII: Detalla, dentro de la criminalística prevencional, las medidas de seguridad


sobre papeles, tintas, sistemas de impresión e impresiones.

tomo 1 investigación científica del delito ) 15


educación a distancia (instituto universitario de la P.F.A.)

LA UNIDAD VIII: Detalla las medidas de seguridad en documentos y billetes de moneda


nacional y extranjera y sus representantes.

LA UNIDAD IX: Nos introduce al mundo de la balística desde sus conceptos globales.
Interior, exterior y de efecto.

A su vez cada unidad específica, desarrolla su contenido y sugiere bibliografía a leer.

16 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

abogacía a distancia oa)


orientación general del aprendizaje

Tal como habrá comprendido, esta materia es netamente técnica y se aparta


de los contenidos de las demás materias, donde el objeto de estudio es el derecho
desde las diferentes ópticas en que debe ser contemplado.

Sin embargo su interrelación es cada vez más estrecha, ya que se convierte en


una importante fuente para la obtención de las formas y mecanismos de producción
de los hechos que son analizados en cualquiera de sus diferentes ramas.

Conocer el abanico de posibilidades que ofrece la disciplina Criminalística en


auxilio del derecho, brinda la posibilidad de su utilización para el esclarecimiento de
los hechos, la identificación de los autores y la conformación de la prueba material.

A través de un superficial panorama permite primero conocerla y luego: saber


que es posible recurrir a ella en cualquier momento o etapa de sustentación de una
causa; entender la importancia de su consulta antes de la redacción de los interrogantes
periciales; de las funciones que cumplen y cómo, en la práctica, se desenvuelven los
peritos, para poder mensurar adecuadamente en cada caso, la necesidad o no de
recurrir a ellos como expertos de parte o consultores técnicos; cómo pueden reali-
zarse los pedidos de explicaciones y en su caso qué es lo que se puede impugnar
de sus actuaciones; comprender las bondades que aporta la valoración del estado
de las causas desde una óptica técnica: visualizar lo casi ilimitado de su accionar, en
cuanto a posibilidades; etc.

Lo importante de la tarea emprendida es, en definitiva, conocer un poco del


mundo criminalístico porque es realmente útil en el ejercicio de la abogacía y no por
la necesidad fáctica de cumplimentar con un número de materias predeterminado
para obtener un título.

Los temas seguramente le interesarán. Si es así trate de indagar lo más que pueda
sobre ellos recurriendo a la diferente bibliografía aportada como obligatoria y sugerida.
Estoy seguro que lo que comienza como una obligación se transformará en una pasión
no sólo gratificante, sino que le aportará gran utilidad profesional.

tomo 1 investigación científica del delito ) 17


educación a distancia (instituto universitario de la P.F.A.)

Si bien su desarrollo será desde la óptica criminalística, el enfoque que debe


dársele es siempre desde el punto de vista práctico, es decir los aportes que pueda
brindar al ejercicio de la profesión y los ataques que puedan ser inferidos desde el
cumplimiento de los diferentes roles que el abogado puede ejercitar, dentro del pro-
ceso litigioso.

La información brindada debe ser racionalizada, valorada, en algunos casos


profundizada y luego asimilada como conocimiento. Para ello se hace imprescindible
la constante y fecunda labor intelectual que debe desarrollar el alumno, a través de la
lectura de los diferentes temarios del manual y de las bibliografías aportadas como
obligatorias y optativas, promoviendo consultas y frecuentes diálogos por cualquier vía
con el titular de la cátedra, para visualizar los temas en particular y en conjunto.

Las lecturas obligatorias, los ejercicios de comprensión y los trabajos prácticos


que se deban desarrollar, serán taxativamente detallados en cada unidad temática,
debiéndose remitir aquellos que se especifiquen, sin que ello impida la remisión de cu-
alquier otro trabajo que por decisión propia se pueda realizar sobre el temario tratado,
como una tarea de autoaprendizaje.

Las evaluaciones tiene como tarea fundamental comprobar el grado de


asimilación y racionalización del amplio temario tratado. No se busca la repetición
sistemática de lo visto, sino su aplicación concreta y de la misma manera en que lo
deberá encarar durante el ejercicio de la profesión que se empeña en alcanzar.

Ello requiere que se le dedique el tiempo y el esfuerzo necesario (los que de-
penderán de cada alumno en particular), teniendo en cuenta que sólo él puede realizar
esa tarea, pero sabiendo que el soporte didáctico está siempre a su disposición y que
no sólo puede, sino que debe ser utilizado en forma permanente.

Es el alumno quien tiene la visión de todas las materias que cursa o ha cursado.
La aplicación de esta disciplina es para todas y cada una de ellas. Trate de interrela-
cionarla; sugiera nuevos emprendimientos; canalice todos sus conocimientos tras el
mismo objetivo: el mejor desempeño de las tareas que pronto deberá ejercer. Recuerde
que todo lo que aprenda será para siempre su mejor patrimonio y que en este nuevo
orden tecnológico nunca se termina de aprender ni se sabe lo suficiente.

18 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

abogacía a distancia pr)


programa

Unidad 1
Concepto de Conocimiento Global y Conocimiento Científico. Caracteres del conocimiento
Científico. Clasificación de las Ciencias según su objeto, enunciado y método. Ciencias fácticas
y formales. Lenguaje científico. Semiótica. Proceso semiótico. Niveles de análisis.

Unidad 2
Evolución de los medios de prueba. Criminalística, orígenes, objeto y precursores Grandes
capítulos que la comprenden. Su relación con otras disciplinas en la conformación de la prueba
material. Concepto de Medicina y Medicina Legal. Concepto de Criminología y principales escuelas.
Informe pericial. Partes constitutivas.

Unidad 3
Inspección Ocular. Importancia, oportunidad y metodología. Técnicas en el lugar del hecho.
Hallazgo, levantamiento, conservación, remisión y recaudos legales sobre rastros y elementos
indiciarios. Diferencia entre prueba testimonial y prueba material. Reglas de Marchessau.

Unidad 4
Identidad Humana, concepto y antecedentes. Medios directo e indirectos de establecerla.
Papiloscopía: fundamentos. Dactiloscopía: topografía del dactilograma, tipos fundamentales y no-
menclatura. Puntos característicos. Requisitos para establecer identidad dactiloscópica. Huellas,
rastros y manchas, su importancia en la identificación humana.

Unidad 5
Pericias mecanográficas. Distintos tipos. Máquinas de escribir: tradicionales y electróni-
cas. Impresoras: de impacto, de chorro a tinta y láser. Identificación de la máquina utilizada.
Pericias sobre fotocopias. Distintos tipos de fotocopiadoras. Proceso de fotocopiado. Fax.
Distintos tipos.

tomo 1 investigación científica del delito ) 19


educación a distancia (instituto universitario de la P.F.A.)

Unidad 6
Pericias manuscritas. Aprendizaje de la escritura. Esenciales constitutivas de personalidad
gráfica. Principios scopométricos sobre elementos dubitados, indubitados y conclusiones. Identi-
ficación de escrituras y firmas. Historia gráfica. Cuerpos de escritura.

Unidad 7
Seguridad documental. Papeles, diferentes clases. Papeles con certificación de origen, de
emisión controlada y de emisión registrada. Tintas, distintos tipos. Sistemas de impresión: offset,
calcográfico, tipográfico y computacional o electrostáticos. Medidas de seguridad documental.
Distintos tipos y usos.

Unidad 8
Características de seguridad en papeles, tintas e impresiones del papel moneda nacional en
todos los valores en circulación. Características de seguridad del papel moneda dólares estadoun-
idenses en todos los valores y tipos. Prevención sobre falsificaciones de billetes. Billetes polímeros.

Unidad 9
Pericias Balísticas. Armas propias e impropias. Balística interior, exterior y de efecto. Con-
cepto de celosidad de un arma. Nociones sobre identificación de las armas de fuego a través del
proyectil y/o la vaina secuestrada. Calibres. Distancias de disparo. Determinación de Impactos.
Trayectorias. Utilización de láser para la determinación de la ubicación del tirador. Identificación de
herramientas.

20 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

( ESQUEMA CONCEPTUAL DE LA ASIGNATURA )

INFORMACIÓN Y CONOCIMIENTO GLOBAL

CARACTERES DEL CONOCIMIENTO CIENTÍFICO

CLASIFICACIÓN DE LAS CIENCIAS

CONOCIMIENTO LENGUAJE Y TÉRMINOS CIENTÍFICOS

INTRODUCCIÓN A LA SEMIÓTICA

ELEMENTOS DEL PROCESO SEMIÓTICO

NIVELES SEMIÓTICOS

EVOLUCIÓN DE LOS MEDIOS DE PRUEBA

CONCEPTO, ORÍGENES Y PRECURSORES

GRANDES CAPÍTULOS QUE LA COMPRENDEN

CRIMINALÍSTICA APORTES SEGÚN SU FUNCIÓN

SU RELACIÓN CON OTRAS DISCIPLINAS

IMPORTANCIA EN LA CONFORMACIÓN DE LA
PRUEBA MATERIAL

FORMAS DEL INFORME PERICIAL

RETRATO DEL LUGAR DEL HECHO

C. INVESTIGATIVA RECOLECCIÓN Y GUARDA DE TESTIGOS MUDOS

REGLAS DE PROCEDIMIENTOS TÉCNICO

tomo 1 investigación científica del delito ) 21


educación a distancia (instituto universitario de la P.F.A.)

IDENTIDAD HUMANA

SISTEMAS DE IDENTIFICACIÓN HUMANA

MEDIOS INDIRECTOS Y DIRECTO

C. PERICIAL IDENTIFICACIÓN DE ESCRITURAS MECÁNICAS

IDENTIFICACIÓN DE MANUSCRITOS Y FIRMAS

BALÍSTICA EN GENERAL

MEDIDAS DE SEGURIDAD EN PAPELES

SISTEMAS DE IMPRESIÓN

TINTAS SEGURIDAD

C. PREVENCIONAL MEDIDAS DE SEGURIDAD DOCUMENTAL

MEDIDAS EN PAPEL MONEDA NACIONAL

MEDIDAS DE SEGURIDAD EN PAPEL MONEDA


EXTRANJERO

22 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

u1
unidad uno

( investigación científica del delito


)

tomo 1 investigación científica del delito ) 23


educación a distancia (instituto universitario de la P.F.A.)

CONTENIDOS DE LA UNIDAD I

( INVESTIGACIÓN CIENTÍFICA DEL DELITO )

Mención sintética de los contenidos

1. Concepto de información. Su canalización a través de los sentidos.

2. Concepto de conocimiento: global y científico.

3. Caracteres del conocimiento científico.

4. Clasificación de las ciencias según su: objeto, enunciado y método.

5. Concepto de hipótesis y axiomas.

6. Lenguaje científico. Términos lógicos, definidos e indefinidos.

7. Concepto de semiótica.

8. Componentes del proceso semiótico. Su interrelación.

9. Niveles de análisis semióticos.

10. Investigación científica y tecnología aplicada.

tomo 1 investigación científica del delito ) 25


educación a distancia (instituto universitario de la P.F.A.)

26 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

abogacía a distancia oa)


objetivos de aprendizaje de la unidad

n Por ser la Criminalística una disciplina técnico – científica, se hace necesario deter-
minar y precisar en forma clara, diferentes conceptos del haber cognoscitivo humano,
diferenciando los alcances y conceptos filosóficos y teóricos de la terminología que se
utilizará.

n Precisar el alcance de términos como “Información”, “Conocimiento”, “Conocimiento


Científico”, “Lenguaje y Términos Científicos”, “Rigor Científico”, etc., ya que ello le per-
mitirá evaluar críticamente el accionar de los peritos quienes, como auxiliares de la justicia,
brindan importantes aportes para la determinación de la verdad, premisa fundamental a
establecer por aquellos que tengan a su cargo la difícil tarea de impartir justicia o colaborar
con ella.

n Conocer y comprender la diferenciación existente entre objetos, enunciados y métodos de


verificación formales y fácticos, que permiten la utilización de distintos procedimientos para
arribar a conclusiones de esas características.

n Precisar el contenido de Semiótica, sus alcances, componentes del proceso semiótico y sus
niveles, con el fin de lograr la correcta interacción comunicativa no sólo dentro del quehacer
profesional específico, sino en cualquier orden.

n Señalar los beneficios del conocimiento científico aplicado en la investigación de un


hecho y el uso de la tecnología derivada del mismo.

tomo 1 investigación científica del delito ) 27


educación a distancia (instituto universitario de la P.F.A.)

28 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

( ESQUEMA CONCEPTUAL DE LA UNIDAD I )

CONOCIMIENTO

Sentidos: medios de comunicación.

Información: estímulo primario de carácter finito.

Conocimiento: información procesada y archivada.

Conocimiento Empírico: de aprendizaje experimental.

Conocimiento Inductivo: pasivo por observación y repetición.

Conocimiento Deductivo: intelequia interna y racional.

Conocimiento Científico: especializado y rigido por normas.

Lenguaje Científico: función informativa de carácter rígido.

Objetos Fácticos o Reales y Formales o Ideales.

Enunciados Relacionando Objetos Concretos o Ideales.

Métodos Verificales o Racionales o Lógicos.

Verdad Fáctica y Formal.

Semiótica: Lenguaje de Signos.

Proceso Semiótico: Requisito Comunicacional.

Niveles de Comprobación.

Aplicación Tecnológica del Conocimiento.

tomo 1 investigación científica del delito ) 29


educación a distancia (instituto universitario de la P.F.A.)

30 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

abogacía a distancia ai )
actividad introductoria

Lea atentamente el primer item del Esquema Conceptual precedente. Analice cada
una de las palabras que lo conforman y teniendo en cuenta el objetivo o los propósitos que
se pretenden alcanzar en esta primera unidad, defina o circunscriba con sus palabras y sin
recurrir a ningún tipo de auxilio externo, el concepto que encierran.

Finalizada esa tarea, repita idénticos procedimientos con los restantes items.

Plasme el resultado de su trabajo en hojas de trabajo de manera que, a medida que se


introduzca en el desarrollo temático y se vayan tratando los diferentes temas, pueda verificar
el resultado de su análisis previo ratificando aquellos que correspondiera, rectificando aquellos
conforme a las diferencias obtenidas, compulsando la bibliografía obligatoria y optativa ofrecida
y sobre todo comunicándose con el tutor a fin de discutir todo aquello que no termine de en-
cuadrar y/o que, según su óptica, merezca análisis y discusión previa, antes de asimilarlo como
conocimiento.

tomo 1 investigación científica del delito ) 31


educación a distancia (instituto universitario de la P.F.A.)

32 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

( DESARROLLO DE LA UNIDAD I )

Introducción

El bagaje de información que, a través de los sentidos, se obtiene en forma


constante -tanto a nivel consciente como subconsciente- es de tal magnitud que el
hombre no ha logrado desarrollar en cantidad y calidad su principal órgano, el cerebro,
de manera tal que la misma se transforme en conocimiento.

Todo el proceso necesario para el almacenaje, resguardo y recuperación del


conocimiento implica la necesidad de tomar conciencia de que se posee. Siendo
absolutamente sinceros, honestos y modestos, debemos tener perfectamente en claro
que sabemos mucho más de lo que creemos y que a veces, creemos saber mucho
más de lo que en realidad conocemos.

Diariamente utilizamos o nos valemos de nuestros conocimientos para solucionar


o enfrentar las pequeñas o grandes dificultades de la vida. Cuando frente a una dificultad
podemos deducir las causales que la provocan y los recursos que tenemos a nuestra dis-
posición para solucionarlas, estamos recurriendo a todo nuestro caudal de conocimientos,
que en forma consciente o no hemos asimilado.

Conocimiento global y científico

Cabe destacarse que dada la complejidad del tema a tratar, su desarrollo temático
tiene como fin una rápida recorrida por un mundo que, no por cotidiano, puede resultarnos
desconocido, simplemente por no haberse reparado en algunos conceptos básicos y de
aplicación corriente. No se intenta hacer un análisis filosófico integral, sólo pretende situarnos
dentro del espacio donde deberemos movernos para interpretar esta materia; hacernos dife-
renciar y precisar cómo y con qué trabajaremos y la forma en que deberemos expresarnos.

Sin duda, estamos conectados con el exterior y con los demás por medio de nuestros
sentidos. A través de ellos estamos recibiendo “Información” en forma permanente de todas
las circunstancias que nos rodean. Pero tales datos no son sino expresiones primarias
de nuestra capacidad sensorial. Todo este caudal informativo de carácter consciente o
subconsciente se pierde si no efectúa un complejo proceso neurocognoscitivo.

tomo 1 investigación científica del delito ) 33


educación a distancia (instituto universitario de la P.F.A.)

Una información teórica (datos metereológicos) o práctica (sensación térmica al


nivel de la piel) nos permite saber por ejemplo la temperatura alta o baja de un lugar y
momento dado. Ese dato es suficiente para que se adopten los recaudos necesarios
para afrontar tales circunstancias. Una vez adoptados dejará de sernos útiles y no
necesitaremos registrarlo como conocimiento, procediendo a su descarte.

Por el contrario, si esta información es procesada por los canales correspon-


dientes, se asimila y se archiva en la memoria como conocimiento. Conocimiento que
formará parte de nuestro haber y que si se ha almacenado correctamente, aun depen-
diendo de diversos factores, estará a nuestra disposición siempre.

El hombre primitivo reunió una cantidad de conocimientos que le ayudaron a


subsistir en medio de una naturaleza inhóspita y aún hostil. Relacionándolos entre sí por
medio de la memoria, la asociación de ideas y un cierto grado de intuición, llegó a tener
un conocimiento empírico o adquirido por sucesivas experiencias y por la conciencia
de sus recuerdos. Posteriormente le sumó todos aquellos que pudiera recibir de sus
semejantes y particularmente de sus mayores a través del aprendizaje.

Todo este caudal de conocimiento, por haberlo recibido en forma pasiva a través de
la observación, repetición o enseñanza, recibe el nombre de conocimiento inductivo. Es
decir un tipo de conocimiento que desde afuera nuestro se incorpora en nuestro interior,
sin otra actividad que la de procesar información y almacenarla como conocimiento.

Aristóteles dejó planteado que el método inductivo caracterizaba a las cien-


cias. A través de minuciosos trabajos científicos determinó que la observación de
numerosos ejemplos de un mismo tipo permite establecer una generalidad, una
ley abarcativa. Francis Bacon sostuvo que la ciencia proviene de la experiencia, la
observación sistemática de la naturaleza, la acumulación de datos a fin de detectar
regularidades, reiteración ordenada de fenómenos, es decir leyes que rigen lo que al
principio parecía caótico.

Pero debemos destacar que hay otro procedimiento para obtener conocimiento
y este lo es a través del razonamiento, es decir desde nuestro interior y sin esperar
la producción de fenómenos naturales o el recibimiento de enseñanza externa. Así
elaboramos información, sometiéndola a la deducción lógica y racional dentro del
proceso cognoscitivo, este tipo recibe el nombre de conocimiento deductivo. Es un
método que a través de la lógica, se ocupa de la derivación de enunciados a partir
de otros enunciados dados.

34 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

Sea un tipo u otro, el verdadero valor filosófico del conocimiento se alcanza,


cuando se adquiere el estado de conciencia de poseerlo y se ubica dentro del mundo
que lo rodea y de los fenómenos naturales que en ese ambiente existen. Cuando llega
el momento en que el hombre tiene conciencia de tales fenómenos naturales, de su
repetición, de la relación entre unos y otros, y de que existen ciertas constantes que
se reiteran, nos encontramos sumergidos en el mundo del conocimiento global y tal
vez en los umbrales del conocimiento sistematizado o conocimiento científico.

A lo largo de la historia de la humanidad, el paso del conocimiento empírico


al conocimiento científico ha sido paulatino y prolongado y ha recibido en oportuni-
dades grandes impulsos, con sus consiguientes adelantos, debido a la inteligencia de
algunos hombres que han marcado hitos decisivos en el desarrollo de la aprehensión
intelectual.

Cuando los Asirios escribían sobre tablillas de arcilla con escritura cuneiforme
(forma de puntas aguzadas de flechas) la posición de los planetas y de las estrellas
y llegaron a predecir ciertos fenómenos celestes, sin saberlo estaban dando origen o
nacimiento a una ciencia, la Astronomía. Los griegos por su parte son los descubridores
de las ciencias naturales, pues aquellos primitivos sabios helénicos eran verdaderos
filósofos de la naturaleza. Thales de Mileto, Aristóteles, Hipócrates, Pitágoras, etc.,
pertenecieron a esa categoría de hombres que dieron gran impulso al conocimiento
científico. Platón y Aristóteles quizás fueron los primeros en plantear el problema del
método científico. Para ellos, el conocimiento basado en los conceptos surgidos de
la observación de los hechos, reflejaba la realidad. Esta posición dogmática no es
puesta en duda hasta el siglo XVI con Descartes quien retoma el problema del método
con el fin de llegar a evitar el error, instalando la duda metódica.

Actualmente entendemos el conocimiento científico como un método experi-


mental. El problema del conocimiento no puede estar separado del otro problema
quizás fundamental, el de la verdad, ya que un conocimiento falso no es conocimiento.
Pero se debe recordar que en el campo del conocimiento muchas veces se trabaja
con premisas consideradas verdaderas en un momento y que luego se demuestra que
son falsas. Debe comprenderse que, para cuando esto ocurre, esos conocimientos
ahora falsos, ya han prestado su utilidad y le han permitido dar al hombre un paso
más en el camino al conocimiento, que como valor absoluto, seguramente seguirá
siendo inalcanzable.

tomo 1 investigación científica del delito ) 35


educación a distancia (instituto universitario de la P.F.A.)

Un ejemplo clásico, la teoría de la relatividad que provoca objeciones a la teoría New-


toniana de las fuerzas gravitacionales. Es clara y veraz la enunciación de que todo cuerpo
que no se encuentra en movimiento está en un estado de reposo. Pero se hace necesario
para un rigor científico absoluto establecer el medio donde se encuentra. En un ambiente
determinado un cuerpo esta en reposo con relación a otro que se encuentra animado
de energía cinética. Pero ambos al ser parte de un sistema que está en movimiento,
(la tierra en sus movimientos de rotación y translación y el sistema solar que se mueve
en las galaxias) independientemente de sus estados individuales, se encuentran en
movimiento relativo.

E = m x c2 donde E es energía =, m es masa y c2 es velocidad de la luz, significa


que una masa diminuta puede convertirse en una cantidad enorme de energía, circun-
stancia que fue probada con la utilización de la energía nuclear. En 1915 Einstein con
su teoría de la relatividad expuso que la masa distorsiona el espacio tiempo de modo
que los cuerpos se influyen mutuamente en sus movimientos.

Al establecer que la velocidad de la luz es igual en cualquier dirección, se produce


un gran desconcierto con relación al éter, ya que la luz debería moverse más rápido o
más lento ya sea que vaya en igual o contraria dirección a éste. En 1905 Einstein aceptó
este hecho negando el éter y demostrando matemáticamente que la medición de espacio,
tiempo y masa en dos sistemas diferentes dependen de sus movimientos relativos, y que
a la velocidad de la luz, la longitud se convierte en cero, el tiempo se detiene totalmente
y la masa se torna infinita.

Introducción a las ciencias


Si bien pretender encasillar un tipo de conocimiento en forma rígida o estructurada
nos esquematizaría de manera tal que quedaríamos atrapados dentro de nuestra propia
rigidez ya que es imposible acotarlo, podemos en forma conceptual y didáctica indicar que
el conocimiento científico se diferencia o se especializa con respecto al conocimiento
global, cuando se cumplen inexorablemente los siguientes cuatro requisitos o caracter-
ísticas que le son propias.

1. Objeto y Objetividad: Aquí se hace necesario diferenciar y conceptuar términos. Al refer-


irnos a objeto, debemos desdoblar su significado. Por un lado el “Objeto Temático” que
hace referencia a la disciplina o al tema o materia analizada o tratada. Por otro lado refiere
al “Objeto propiamente dicho” o cosa real o abstracta sobre la cual trabajaremos.

36 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

Al referirnos a la Objetividad, la estamos diferenciando de la subjetividad, es


decir descartando la intervención del yo. Decir que la ciencia es objetiva, significa afir-
mar que las conclusiones a las que arriba un trabajador científico deben ser detalladas
de manera tal que sea posible individualizar el objeto propiamente dicho (dentro del
concepto de igual a si mismo y distinto a los demás); reproducir las condiciones en la
que fue llevada a cabo la investigación o experiencia; y detallar todas las situaciones
que se hayan producido y que hagan verdaderos sus enunciados. Estos enunciados
deben estar redactados de tal manera que cualquiera pueda tomar idénticos elemen-
tos, reproducir las mismas condiciones utilizadas y realizar los mismos pasos que,
necesariamente, llevarán siempre a los mismos resultados.

Con el fin de clarificar los enunciados, ejemplificaremos los conceptos gráfica-


mente: El objeto temático propuesto es pintar una habitación de color azul, realizando
el trabajo entre varios. Tomada la decisión, cada uno de los trabajadores traerá los
elementos con que cumplirá su tarea, debiendo traer también la pintura de color azul.
Finalizado el trabajo se habrá conseguido seguramente una habitación recién pintada
y de color azul, aunque ¿todas las paredes serán del mismo color azul?. Seguramente
no, porque habrá influenciado la subjetividad de los adquirentes de la pintura com-
prando el azul acorde a su gusto. Para conseguir un rigor científico objetivo debería
haberse especificado gama de azul acorde a su longitud de ondas o bien acorde a
un color comercial, marca y partida predeterminada.

Pero ¿hubiera bastado simplemente precisar color para obtener un trabajo igual
y objetivo?. Seguramente la respuesta será no. Porque también habrá influenciado
el resultado las herramientas con que fue realizado: pincel, rodillo, esponja, etc., la
habilidad o empeño puesto en la ejecución y la cantidad de manos aplicadas. El rigor
científico debe especificar elementos, forma, calidad y cantidad.

2. Verificabilidad: no se pide que la ciencia sea un conocimiento verdadero, sino que el


conjunto de sus enunciados pueda ser verificado, sabiendo para ello las circunstancias que
lo hacen verdadero o falso. Efectuada la verificación por parte de la comunidad científica
en condiciones de practicarla, deja de ser un trabajo científico para transformase en un
conocimiento científico.

3. Sistematicidad: Las afirmaciones de la ciencia no forman un conjunto inconexo de


proposiciones, sino un sistema de enunciados vinculados entre sí por relaciones lógicas,
es decir racional, ordenado, fundado y coherente.

tomo 1 investigación científica del delito ) 37


educación a distancia (instituto universitario de la P.F.A.)

Asimismo sus pasos deben realizarse en forma total, en orden racional y lógico
y asegurando el cumplimiento de todos y cada uno de ellos.

4. Método: todas las investigaciones científicas responden a un plan previo que es el que
dirige el trabajo en el sentido de lo que se quiere encontrar y cómo hacerlo. Ese plan no
es al azar, sino que hay procedimientos predeterminados y están regidos por pautas.

Las ciencias tienen como finalidad, mediante la explicación y la predicción, dar


respuestas a ciertos problemas buscando leyes generales.

El lenguaje a utilizar debe ser científico: este lenguaje no debe ser expresivo ni
directivo, sino simplemente informativo y carente de vaguedad. Debe trasmitir información
a cualquiera que haya sido adiestrado para recibirla. La comunicación científica es po-
sible en virtud de la precisión que pretende alcanzar el lenguaje de la ciencia, precisión
que se logra mediante una clara definición de los términos que se van a usar y que es
a su vez, condición para la verificación de los enunciados. Toda ciencia madura posee,
además de términos que hacen referencia a individuos observables con propiedades
observables, otros vocablos que designan individuos y propiedades que se encuentran
más allá de la observación más o menos directa (átomo, valencia, gen, ego, masa, campo
magnético, etc.) Es decir son vocablos propios de las teorías científicas, distintos del
lenguaje común u ordinario.

Así debemos distinguir diversos tipos de términos. Los términos que se introducen
por medio de definiciones se denominan términos definidos. Con éstos se designan
situaciones no descriptas o inexistentes hasta al momento. Seleccionado el término se
lo define para precisar su significado -que no puede estar contenido en otro término
conocido- y debe describir una condición o situación que será a partir de allí recono-
cida como tal. Por ejemplo: clon o clonación: una vez definido, explicita el alcance de la
situación, la que será reconocida como tal.

Los que conservan su significado habitual, se llaman términos lógicos, es decir


son aquellos que su lectura indica un objeto o situación determinada y conocida que no
requiere más definición ni aclaración, Ej. lápiz, casa, etc. A su vez están los términos
indefinidos o primitivos que son aquellos que no tienen significación estable, que pu-
eden variar y que sólo se utilizan en los esquemas de enunciados. Estos deben también
tener una categoría lógica y se usan como variables de relación Ej. A = B.

38 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

Clasificación de las ciencias

Las ciencias se dividen en Formales y Fácticas y en esta división se tiene en cuenta:


a) el objeto de estudio
b) el tipo de enunciados afirmativos de cada disciplina científica, y
c) el método por el que se verifican o refutan sus enunciados.

Desde el punto de vista del objeto mientras las ciencias fácticas procuran ser
una representación de lo real, de cosas concretas, las ciencias formales (matemática,
lógica) no se ocupan de hechos y por lo tanto no dan información acerca de la reali-
dad, sino que tratan de entes ideales que sólo son construcciones intelectuales que
no existen fuera de la mente de los que especulan acerca de ellos.

Desde el punto de vista de los enunciados, las ciencias fácticas se refieren a


objetos empíricos o afirmaciones acerca de hechos concretos, en tanto que las formales
son meras relaciones entre signos.

Desde el punto de vista del método, las ciencias fácticas son siempre verific-
ables con procedimientos reales, en tanto que las formales, sólo es posible establecer
la verdad o falsedad por métodos puramente lógicos, sin poder recurrir a la prueba
empírica. En las fácticas se necesita recurrir a la experiencia para poder establecer la
falsedad o verdad de sus proposiciones.

Esto nos lleva entonces a dos tipos de verdades, la verdad formal y la verdad
fáctica. Una proposición será formalmente verdadera cuando sea consecuencia lógica
de otras proposiciones verdaderas. En cambio una proposición será fácticamente
verdadera cuando lo afirmado en ella encuentra confirmación práctica y empírica.

El método: En las ciencias formales o deductivas las proposiciones se concluyen


en forma deductiva de otras. No pueden ser probadas, pero no porque experimen-
talmente sea dificultoso o distinto, sino porque no es realmente posible. Esto es una
característica especial de algunas proposiciones que las hace improbables, porque si
pudieran probarse todas las proposiciones sería imposible eludir un círculo vicioso o
una regresión al infinito.

En estas ciencias se pretende que algunas proposiciones que denominaremos


axiomas sirvan como punto de partida para deducir el resto. Utilizando los térmi-
nos indefinidos, definidos y lógicos se construirán esquemas de enunciados. De

tomo 1 investigación científica del delito ) 39


educación a distancia (instituto universitario de la P.F.A.)

estos esquemas se eligen algunos como punto de partida, dándolos por ciertos sin
establecer su verdad o falsedad, denominándolos AXIOMAS. Razonando a través
de ellos se obtienen enunciados que se llaman, por definición, teoremas. Debemos
tener presente que, en todas las ciencias, sólo los axiomas se toman por cierto sin
establecer su verdad.

El método en las ciencias fácticas o ciencias inductivas es siempre verificable.


Esto nos permite afirmaciones singulares (relacionadas con un solo caso) o universales
(generalización a una especie o cosa). Al ser este método siempre verificable, debemos
manejarnos con el concepto de hipótesis: Una HIPÓTESIS es un enunciado que no tiene
aún establecida su verdad o falsedad, pero que se toma como punto de partida para
estudiar sus consecuencias y compararlas con lo que ya está confirmado o refutado.

La hipótesis es entonces un enunciado no verificado que una vez confirmado


dejará de ser hipótesis para ser un enunciado verificado. Los enunciados de las hipótesis
se llaman enunciados directos o básicos.

Establecidos éstos permiten un conjunto de proposiciones en el que es dable


distinguir al menos dos tipos de resultados:
a) uno que habla de un individuo o un conjunto pequeño de individuos, al que podemos
llamar muestra, y de sus propiedades (ejemplo una rata recorre un laberinto y llega a
la comida o al extirpar el páncreas a un perro éste desarrolla diabetes). A estos enun-
ciados, que llamaremos de Nivel I, corresponden a datos o casuística de la actividad
científica;

b) el otro que habla de una población global (ejemplo todos los animales sin páncreas
desarrollan diabetes) Estos enunciados los llamaremos de Nivel II y se corresponden a
las leyes de la ciencia. Según el método inductivo el Nivel II se obtiene generalizando,
haciendo válidos para todos, en todo tiempo y lugar, las observaciones del nivel I, lla-
mado en la jerga filosófica “base empírica” o conjunto de hechos en que se sustenta
el edificio de la ciencia.

Concepto de semiótica

Para el conocimiento se formula un lenguaje. Este lenguaje es un sistema de


signos formado por determinados elementos básicos y por reglas que los regulan. La
SEMIOTICA es la disciplina que estudia los signos, la teoría general de los signos y
los sistemas de signos. Esto conlleva un Proceso de SEMIOSIS. Este proceso posee
varios términos definidos:

40 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

SIGNO: todo aquello que refiere, significa o representa otra cosa. Es un ideograma o
dibujo representativo. Ej. sonido del timbre, bandera. (Es un Dibujo)

DESIGNADO: aquello referido o designado por el signo. Es decir es el objeto o cosa rep-
resentado por el signo. (Es un Objeto o cosa)

INTÉRPRETE: el sujeto para el cual el signo significa o representa algo. (Es una Persona)

INTERPRETANTE: la respuesta ofrecida por parte del intérprete o la disposición a respond-


er de determinada manera por haber captado el significado del signo. (es una Acción)

CONTEXTO: las circunstancias en que se dan las relaciones. (Es la Armonía)

Se puede ensayar una definición o interpretación de este proceso diciendo


que el mismo se cumple cuando: El Interprete (una persona) ejecuta el Interpretante
(acción) dentro de su Contexto (en forma correcta o armónica a los fines deseados) al
reconocer al Designado (objeto) a través de su Signo (ideograma).

Para lograr una comunicación armónica, se hace necesario que esta disciplina veri-
fique el cumplimiento de análisis indispensables (no únicos ni excluyentes) de tres elementos
propios del proceso semiótico.

Niveles de analisis semióticos


PODEMOS DISTINGUIR TRES NIVELES:

l SINTAXIS: considera la relación entre los signos sin tener en cuenta sus significados
y la relación con el intérprete. Es decir sólo trata las relaciones armónicas entre signos,
para que estos puedan interrelacionarse entre sí de manera comprensible, ordenada y
lógica.

l SEMÁNTICO: considera la relación de los signos con los designados. Aquí el análisis
es para que cada signo sólo represente a un designado encuadrándolo dentro de un
significado exclusivo y excluyente.

l PRAGMÁTICO: estudia la relación de los signos con los intérpretes.

tomo 1 investigación científica del delito ) 41


educación a distancia (instituto universitario de la P.F.A.)

42 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

abogacía a distancia sp)


síntesis parcial

El siguiente esquema nos permite una rápida visualización del contenido temático
completo de esta unidad.

INFORMACIÓN Datos que ingresan a través de nuestros sentidos

Son de carácter temporal y nos permiten adoptar recaudos


temporales

CONOCIMIENTO

Información procesada a través de nuestro sistema neurovegetativo

Se conserva en la memoria y forma parte de nuestro haber cultural

Requiere conciencia de poseerlo

SE ADQUIERE En forma inductiva

En forma deductiva

Empíricamente

Por formación

PUEDE SER Global

Científico

GLOBAL Todo conocimiento adquirido

CIENTÍFICO Requiere de Objeto y Objetividad

Verificabilidad

Sistematización

Método

CIENCIA Rama del conocimiento humano especializado. Tantas como ob-


jetos temáticos de Conocimiento especializado.

tomo 1 investigación científica del delito ) 43


educación a distancia (instituto universitario de la P.F.A.)

SE DIVIDEN Por su Objeto

Por su Enunciado

Por su Método

FACTICAS DIVISIÓN POR FORMALES


Concreto, real, existente en naturaleza ß Objeto ß Ideal. Existe sólo en la mente

Relación de objetos concretos ß Enunciado ß Relación entre signos

Siempre verificable Empíricamente ß Método ß Racional o Lógico

LENGUAJE Informativo. Usa términos Lógicos

Definidos

Indefinidos

HIPÓTESIS Enunciados verificables. Pueden dar resultados

Falsos Verdaderos Individual

Universal

AXIOMAS Esquemas dados por ciertos. Permiten enunciar teoremas.

SEMIÓTICA Estudia y regula los signos, su teoría general y los sistemas que
permiten el Lenguaje.

PROCESO SEMIÓTICO REQUIERE Signo (ideograma)

Designado (objeto)

Intérprete (persona)

Interpretante (acción)

Contexto (armonía)

NIVELES Sintaxis (relación signo con signo)


Semántica (relación signo con designado)
Pragmático (relación signo con intérprete)

44 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

abogacía a distancia

actividad final
af)
A modo de ejercicio de autoevaluación realice las siguientes actividades:

a) Luego de interpretado el contenido temático desarrollado, de haber leído y analizado


la bibliografía que se indica como obligatoria, es decir: “Introducción a la Ciencia” de
J. A. THOMSON (parte pertinente) y “Lógica simbólica y Elementos de metodología
de la Ciencia” de Alicia SALAMA, exclusivamente el capítulo de “Elementos de met-
odología de la Ciencia” de Margarita ROULET, y habiendo analizado con el tutor, de
ser necesario, los contenidos y alcances de los conceptos utilizados en el tratamiento
de la presente unidad, efectúe un nuevo desarrollo de todos los items del Esquema
Conceptual, ahora con los nuevos conocimientos asimilados, explicitando con sus
palabras cada uno de ellos.

b) Vuelva a las hojas donde ha plasmado el resultado de su evaluación previa de todos


los items del Esquema Conceptual y compárelos con el obtenido luego de efectuar lo
dispuesto en a).

tomo 1 investigación científica del delito ) 45


educación a distancia (instituto universitario de la P.F.A.)

46 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

( BIBLIOGRAFÍA DE LA UNIDAD I )

Bibliografía obligatoria

n THOMSON, J. A.; “Introducción a la Ciencia”; Ed. Labor; Barcelona; Año 1926.

n SALAMA, Alicia; “Lógica simbólica y Elementos de metodología de la Ciencia”; Ed. El


Ateneo; Bs. As. Año 1986. Debe leerse con carácter obligatorio sólo el capítulo Elemen-
tos de metodología de la Ciencia de Margarita ROULET.

De resultarle interesante los tópicos tratados en la presente unidad y desea profundizar


lo relativo al conocimiento global y científico, se sugiere la siguiente lectura:

n KLIMOVSKY, Gregorio; “Las Desventuras del Conocimiento Científico”; Ed. A-Z; Año
2001.

tomo 1 investigación científica del delito ) 47


u2
unidad dos

( investigación científica del delito


)
educación a distancia (instituto universitario de la P.F.A.)

CONTENIDOS DE LA UNIDAD II

( INVESTIGACIÓN CIENTÍFICA DEL DELITO )

Mención sintética de los contenidos

1. Concepto de Hombre Social. Nucleamientos comunitarios. Evolución de estas comu-


nidades a través del tiempo.

2. Naturaleza conflictiva del hombre. Necesidad de determinar la verdad para la resolución


de los conflictos producidos.

3. Evolución de los medios de prueba, desde sus orígenes místicos hasta los proced-
imientos más modernos.

4. Los indicios o testigos mudos, alcances y contenido.

5. Alcances de la Documentología, de Identidad Humana, de Pericias Químicas, de Acciden-


tología y de Balística.

6. Accionar investigativo, pericial y prevencional. Alcances, obligaciones, recaudos.

7. Confluencias y divergencias con otras disciplinas relacionadas.

8. Los peritos. Distintos tipos acordes a roles desempeñados. Habilitaciones. Designa-


ciones. Inhibición, recusación, responsabilidades.

9. Diferenciar la actuación del testigo y la del perito.

10. Delimitar alcances y formas de los interrogantes periciales.

11. Conceptos y requisitos de los elementos Dubitados e Indubitados.

12. Análisis y comprobaciones profesionales. Presentación del informe. Alcances y obliga-


ciones.

13. Conceptos teóricos temáticos periciales y elementos utilizados.

14. Distintos tipos de conclusiones.

15. Pedidos de aclaraciones e impugnaciones periciales.

tomo 1 investigación científica del delito ) 51


educación a distancia (instituto universitario de la P.F.A.)

52 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

abogacía a distancia oa)


objetivos de aprendizaje de la unidad

n Efectuar un recorrido histórico sobre los distintos procedimientos utilizados por el


hombre en la búsqueda de la verdad acerca de los hechos.

n Definir y comprender el concepto o tarea de la disciplina Criminalística, sus orígenes,


objetivos, alcances y precursores o mentores.

n Diferenciar por sus objetos temáticos los grandes capítulos que la conforman, detal-
lando conceptos y precisando términos relacionados con su quehacer.

n Describir los diferentes enfoques u objetivos que desde su accionar realiza.

n Precisar los alcances de su actuación y la relación o interrelación con otras disciplinas


en la conformación de la prueba material.

n Diferenciar los conceptos y alcances de Medicina y Medicina Legal.

n Precisar el concepto y alcance de la Criminología y su diferencia con la Criminalística.

n Esquematizar didácticamente las principales escuelas criminológicas a fin de com-


prender sus objetos, evolución e interrelación con los códigos penales.

n Analizar el contenido de un informe pericial criminalístico, a fin de conocer cada uno


de los elementos detallados en él, sus alcances, límites y demás circunstancias que
permitan su evaluación.

tomo 1 investigación científica del delito ) 53


educación a distancia (instituto universitario de la P.F.A.)

54 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

( ESQUEMA CONCEPTUAL DE LA UNIDAD II )

HOMBRE Naturaleza Social


Medios hostiles y necesidad de congregarse
Dirimir conflictos en tribus, clanes, sociedades, países
Conocer los mecanismos de producción de los hechos
Impartir justicia

CONFLICTOS Causales de producción


Soluciones pactadas entre las partes
Soluciones por imperio de autoridad competente

VERDAD Por interpretación de indicios o testigos mudos


A través de los Peritos o Intérpretes
Formas de determinación

AUXILIARES Criminalística
Medicina y Medicina Legal
Criminológia
Otras

tomo 1 investigación científica del delito ) 55


educación a distancia (instituto universitario de la P.F.A.)

56 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

abogacía a distancia ai)


actividad introductoria

Lea atentamente la reproducción del informe pericial que se transcribe a continuación.


Su lectura le brindará un ejemplo de la forma que un perito eleva el resultado de sus estudios
y comprobaciones y le servirá, una vez que desarrolle la presente unidad, como referencia
para una gran parte de su contenido.

tomo 1 investigación científica del delito ) 57


educación a distancia (instituto universitario de la P.F.A.)

58 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

( DESARROLLO DE LA ACTIVIDAD INTRODUCTORIA )

BUENOS AIRES, día, mes y año.

Señor Juez
S / D

De mi mayor consideración.

El que suscribe, Licenciado en Criminalística Juan Carlos ALEGRETTI, Libro General de


Grados 68, folio 187, número 9152, U.B.A, tiene el agrado de elevar a vuestra consideración el
resultado de los estudios periciales encomendados.

I. OBJETO DEL PRESENTE INFORME


El presente estudio tiene por objeto establecer si el cheque de pago diferido número 00000468
perteneciente a la cuenta 10084/0, es auténtico. De serlo, si la firma de su librador es auténtica y si
presenta algún tipo de adulteración.

II. ELEMENTOS APORTADOS


Para ello se han aportado los siguientes elementos: como indubitado de cotejo cheque
de pago diferido del Banco XXX número 00000466, con domicilio de pago en Lima 1353 Zárate,
Provincia de Buenos Aires, perteneciente a la cuenta corriente en pesos nº 10084/0 de Elsa Belatriz
Bobe, con domicilio en Conte 676 de Zárate, por la suma de mil pesos ($ 1.000), de fecha 10 de julio
de 2001 a nombre de la Fundación Zárate, con firma indubitada en original de Elsa Belatriz Bobe, y
como dubitado, cheque de la misma entidad bancaria, tipo y moneda, nº 00000468, perteneciente
a la misma sucursal y cuenta, librado el 6 de marzo de 2001, con fecha de pago el 20 de junio de
2001, por la suma de mil treinta y cinco pesos ($ 1.035) con destinatario Editorial Argentina S.A.

III. ANALISIS Y COMPROBACIONES REALIZADAS


Los estudios dieron comienzo con la utilización de elementos ópticos y científicos adecuados
a la experiencia que nos ocupa, tales como lupa binocular estereoscópica de variados aumentos y
luces del espectro visible y ultravioleta acondicionadas desde distintos ángulos de incidencia.

A fin de establecer la autenticidad o no del cheque dubitado, se detallan a continuación


las medidas de seguridad de orden físico que pueden determinarse en el cheque aportado
como indubitado.

tomo 1 investigación científica del delito ) 59


educación a distancia (instituto universitario de la P.F.A.)

Dicho cartular se encuentra realizado en papel de calidad controlada con las características
de diseño utilizado por la firma Ciccone Calcográfica S.A. que presenta filigrana repartida donde
puede leerse “autochequelux” y observarse un dibujo a modo de obelisco. El mismo no presenta
filamentos o confetis de seguridad visibles ni invisibles, pero presenta todas las especificaciones que
para el papel de cheque especifica el Banco Central de la República Argentina.

A los efectos de no alterar en forma significativa dicho cheque, sólo se ha comprobado con
respecto a las tintas empleadas para realizar el diseño del fondo de seguridad, su fugitividad con
respecto al agua en el sector del reverso señalado con el número 1, donde puede observarse la
destrucción de las tintas provocadas por la reacción a este agente.

De su observación macro y microscópica se ha determinado que el mismo presenta tres


sistemas de impresión. El denominado calcográfico (I C) en la guarda en rojo con el nombre y logotipo
del banco; el computacional o láser (I L) para los datos variables, es decir en el número del cheque
tanto en dígitos como en letras; en la sucursalización y domicilio de pago; en el código de ruta; en
el número y datos de la cuenta y del titular; y en el código magnético caracteres siete bastones; y el
offset (O) para el resto de las impresiones.

Además presenta las siguientes medidas de seguridad: Imagen Latente (I Lte) con el
logotipo del banco en el sector destinado a la firma; Microletras (M) en los renglones destinados
al importe en números y letras, destinatario y firma; Tintas de variación cromáticas (O.V.I) en
la roseta ubicada en el sector derecho debajo de la guarda en rojo; Tintas invisibles protecto-
ras del sector de los importes en número y letras y del destinatario; y plaquetas invisibles de
protección de color rojo, sobre los datos variables.

Analizado el cheque dubitado nº 00000468 presenta las mismas medidas de seguridad en


papel, tintas e impresiones que el detallado precedentemente, por lo que debe ser considerado
como auténtico. Ver lámina ilustrativa nº 1.

Antes de la determinación de autenticidad o no de la firma que suscribe el cheque dubitado


y el cotejo de las letras que lo conforman, se hace necesario hacer una breve introducción acerca
de los fundamentos en que se basan este tipo de peritaciones documentológicas. Sin duda las
escrituras manuscritas son gestos. Gestos que resultan de un acto volitivo o de un reflejo y de-
pende en cuanto a su dirección, extensión y fuerza, de factores anátomos-fisiológicos (rapidez de
la transmisión del impulso nervioso a través de los hilos transmisores, fuerza muscular, flexibilidad
de las articulaciones, longitud de las palancas óseas, etc.) y de factores psíquicos (cerebrales o
simpáticos). A pesar de la aparente variedad de los casos particulares, el gesto para una misma
persona acusará una constante que lo hará siempre reconocible y permitirá distinguirlo del gesto
análogo realizado por otro individuo. Así como todo individuo posee una “personalidad psíquico-
social” propia y única, su escritura manuscrita posee “esenciales constitutivas de personalidad
gráfica” subconscientes, espontáneas, propias y únicas.

60 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

La identificación escritural se basa en la concordancia de las particulares características que


forman la denominada personalidad gráfica del escribiente, que éste va adquiriendo a través del
tiempo con el ejercicio de la escritura y que se manifiestan subconscientemente en el acto de escri-
bir, escapando al contralor de su autor y dotando a su escritura de particularidades identificatorias
que permiten distinguirlas de otras. Estas características no son advertidas a simple vista en la que
sólo se repara en el aspecto morfológico, sino que constituyen un cúmulo de particularidades que
se interrelacionan de las más diversas formas, dando origen a la personalidad individual a que nos
hemos referido.

El aprendizaje de la escritura reconoce tres etapas características cuya duración y límites no


pueden ser establecidos con precisión. En la primera etapa se efectúa una verdadera actividad de
copia donde se trata de reproducir el modelo del grafismo que se tiene a la vista; en la segunda o mne-
mónica, ya sin el modelo presente, el aprendiz debe recurrir a la memoria para poder recordar como
se hace tal o cual letra y como se relacionan éstas para conformar la palabra. En la tercera etapa esta
actividad psícomotriz se realiza subconscientemente y el escritor va incorporando elementos propios
que apartan a sus grafismos de los modelos primitivos, es decir incorpora elementos personales que,
dan a los mismos, individualidad. Estos elementos, tales como los diferentes puntos de ataque y es-
cape, el presionado, la evolución de los rasgos, la estructuración alfabética, los ligados y desligados,
la proporcionalidad, los valores angulares, el silabeo, etc., adquieren diversas formas y se combinan
de distintas maneras y es allí donde radica precisamente la identidad escritural, siendo la morfología
general sólo un elemento más, pero absolutamente insuficiente por si mismo.

Como estas esenciales constitutivas son el resultado de una actividad psicomotriz subconsci-
ente, escapan al control y aún a la percepción incluso del mismo autor, manifestándose como automa-
tismos escriturales. Su determinación implica la necesidad de un profundo análisis con el auxilio de
instrumental óptico de microscopía e iluminación adecuada. Lo aquí expresado, se cumple asimismo
con las firmas y posibilita establecer la falsedad de las mismas o su autenticidad, que es lo mismo que
determinar que una persona es la autora de un escrito o de una firma en particular o no lo es.

Por los motivos expuestos, el falsificador no puede reproducir las grafías ni las firmas auténti-
cas con todas sus características, ya que no posee los parámetros psíquicos-motrices del verdadero
autor y además se encuentra condicionado por los propios y sus esenciales constitutivas, de manera
tal que su reproducción de las escrituras y/o firmas auténticas, es sólo una imitación realizada con
mayor o menor habilidad, de aquello que es apreciable a simple vista, la morfología del grafismo
y sus características estructurales de carácter general. Por lo tanto del análisis correlativo entre las
características de las firmas o escrituras auténticas y la de los sospechosos de serlo, es posible
establecer si estas últimas son auténticas o falsas.

Por todo lo expuesto y siguiendo metodológica y sistemáticamente los principios técnico


-científicos que rigen la disciplina Criminalística es posible determinar o descartar autoría de firmas
o manuscritos. Para ello es necesario contar con abundante material indúbito, es decir auténtico

tomo 1 investigación científica del delito ) 61


educación a distancia (instituto universitario de la P.F.A.)

y sin cuestionamiento, de firmas o escrituras pertenecientes a quien o quienes se le/s atribuye/n


los escritos, a fin de establecer primeramente las esenciales constitutivas de personalidad gráfica
emergentes de los mismos, para su posterior cotejo con los dúbitos.

Idealmente dicho material debe ser anterior, posterior y contemporáneo a la fecha del o de
los documento/s dúbito/s a fin de poder conformar su historia gráfica, teniéndose en cuenta que
al igual que la persona, los gestos escriturales también se modifican con el tiempo. Dichos escritos
y/o firmas pueden ser obtenidas de documentos públicos y/o privados. Cuando no sea posible la
obtención de los mismos, se puede recurrir a la realización en presencia del perito, de una plana
escritural extensa realizada por la persona a quien se le atribuye las grafías o firmas.

Confrontada la firma indubitada aportada para estudio de Elsa Belatriz Bobe se ha determinado
que la misma es espontánea, veloz, de orientación horizontal ascendente, de diagramación ilegible,
proporcionada en sus rasgos mayúsculos y minúsculos, con intervalos, ejecutada en varios trazados,
sin signos de puntuación, de conformación curva, inclinación de ejes a la derecha, de irradiación
horizontal, con ataques y remates netos, base de renglón serpenteante y presenta un movimiento
a modo de rúbrica y un rasgo idiótico muy particular de ida y vuelta en ese trazado horizontal. Ver
lámina ilustrativa nº 1.

Analizada la firma dubitada, la misma presenta idéntica morfología, diseño y movimientos


estructurales en ataques, angulaciones y remates, e idénticas esenciales constitutivas de personalidad
gráfica, por lo que debe ser considerada auténtica. Ver lámina ilustrativa nº 1.

Confrontados los dígitos y letras del llenado del cheque dubitado con el llenado del cheque
indubitado, se han detectado (en la mayoría de las leyendas, con excepción de las que se detallarán
más abajo), coincidencias morfocinéticas y estructurales en ataques, angulosidades y remates en
la conformación de letras y dígitos, destacándose las letras “d”, “e”, “r”, “o”; los números “2”, “0” y
el grupo “2000”.

Sin embargo se han determinado discoincidencias estructurales, de ataques y de remates


en las siguientes letras dentro del cheque dubitado:

Letra “M”: las letras capitales de las dos palabras “Marzo” están realizadas con cuatro rasgos.
Su ataque comienza a la altura máxima, descendiendo hasta alcanzar la línea de base del renglón
desde donde asciende separada o casi sobre sí mismo, conformando luego de alcanzar su altura
máxima una meseta recta o cóncava, para descender nuevamente hasta la línea de base donde
remata en forma de gancho a la derecha.

La correspondiente a la palabra “Mil” está realizada en tres rasgos. Su ataque comienza en


la línea de base, asciende hasta su altura máxima donde conforma una meseta más angulosa, para
descender hasta la línea de base rematando a modo de golpe de sable a la izquierda.

Letra “i”: la correspondiente a la palabra “Mil” presenta un doble trazado, una marcada in-
clinación a la derecha y su tilde es a modo de punto, en tanto que en el resto es a modo de guión.

62 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

Letra “l”: todas las indubitadas terminan por encima de la línea de base, en tanto que la de
la palabra “Mil” termina muy por debajo de esta.

Antes de establecer las características físicas de/l/os elemento/s escritor/es utilizado/s para
el llenado de los cheques, se hace necesario hacer un breve comentario sobre este tipo de estudios.
Los diferentes elementos escritores que pueden ser utilizados para la escritura manual poseen un
gavilán o punta, que conjuntamente con la tinta permiten dicha escritura. Dicho gavilán presenta
características propias de fabricación, distintas para una pluma fuente, una birome o una fibra, e
incluso diferentes para un mismo tipo, sea en forma o tamaño.

Dicho gavilán además de las características propias de su fabricación adquiere con el uso
o mal uso, características propias por roturas, desgastes, abolladuras, empastes, etc. De presentar
estas circunstancias, los mismos van dotando a los trazos por ellos ejecutados de particularidades
que permiten vincularlos como realizados por un mismo elemento, ya que producen entintados ir-
regulares, faltantes y/o dibujos anómalos.

Además se debe observar con la utilización de luces del espectro visible acondicionadas
desde distintos ángulos de incidencia, la respuesta que presentan las tintas frente a la absor-
ción de la luz. Asimismo, expuestos a la radiación ultravioleta, se debe verificar la respuesta
fluorescente que cada tipo de tinta presenta.

Analizadas las escrituras de todo el cheque dubitado, no se han determinado diferen-


cias que permitan establecer diferente elemento escritor por deficiencias en el gavilán o por
respuesta a la luz directa o ultravioleta, entre la palabra “Mil” y el número “10” del importe en
números, con relación al resto del llenado.

Dicha falta de características no implica la utilización de un mismo elemento escritor, sino


de un elemento o elementos de similares características de gavilán y tintas. Para la determinación
definitiva de la utilización de igual o distinto elemento escritor y tintas, debería realizarse una pericia
de índole química, la que necesariamente lleva aparejada la toma de muestras de la tinta utilizada y
el consiguiente deterioro del cartular, por lo que se debe autorizar expresamente.

Todo lo expuesto permite inferir que corresponde a una misma mano escritora el llenado completo
del cheque indubitado (con excepción del destinatario) y el llenado del cheque dubitado, incluido su
destinatario, con excepción de la palabra “Mil”, no pudiéndose determinar expresamente, con relación a
los dígitos “1” y “0” del importe en números. Ver señalizaciones en lámina ilustrativa nº 1.

Las diferencias señaladas con respecto a la palabra “Mil” del importe en letras permite inferir
una maniobra de adulteración del cheque que transformó su numero original “treinta y cinco” en
“Mil treinta y cinco”, no determinándose circunstancia alguna con respecto a los dígitos “1” y “0”
del importe en números por falta de elementos. Esta circunstancia fue posible debido al incorrecto
espacio dejado en blanco entre el signo pesos impreso y el importe manuscrito y entre la palabra
pesos y el importe en letras.

tomo 1 investigación científica del delito ) 63


educación a distancia (instituto universitario de la P.F.A.)

A raíz de los análisis y comprobaciones realizadas, el suscrito se encuentra en condi-


ciones de efectuarles a Uds. las siguientes

IV. CONCLUSIONES
EL CHEQUE DUBITADO NUMERO 00000468 ES AUTENTICO, POR PRESENTAR TO-
DAS LAS MEDIDAS DE SEGURIDAD EN PAPEL, SISTEMAS DE IMPRESIÓN Y TINTAS DE LOS
CHEQUES DE PAGO DIFERIDO DEL BANCO XXX, REALIZADOS POR CICCONE CALCOGRAFICA
S.A.

LA FIRMA DUBITADA DEL MISMO, SE CORRESPONDE CON EL GESTO GRAFICO DE


ELSA BELATRIZ BOBE POR LO QUE DEBE SER CONSIDERADA AUTENTICA.

LOS DIGITOS Y LETRAS QUE COMPLETAN EL CHEQUE INDUBITADO (CON EXCEPCION


DE LOS DATOS DEL DESTINATARIO) SE CORRESPONDEN CON EL LLENADO DEL CHEQUE
DUBITADO, (INCLUSO LOS DATOS DEL DESTINATARIO), CON EXCLUSION DE LA PALABRA
“MIL”, NO PUDIENDOSE ABRIR JUICIO DE VALOR CON RESPECTO A LOS DIGITOS “1” Y “0”
DEL IMPORTE EN NUMEROS.

LAS DIFERENCIAS SEÑALADAS CON RESPECTO A LA PALABRA “MIL” DEL IMPORTE


EN LETRAS PERMITE INFERIR UNA MANIOBRA DE ADULTERACION DEL CHEQUE, QUE
TRANSFORMÓ SU NUMERO ORIGINAL “TREINTA Y CINCO” EN “MIL TREINTA Y CINCO”, NO
DETERMINANDOSE CIRCUNSTANCIA ALGUNA CON RESPECTO A LOS DIGITOS “1” Y “0” DEL
IMPORTE EN NUMEROS.

Es cuanto al respecto se puede informar.

Con el presente informe que consta de SEIS (6) fojas y UNA (1) lámina ilustrativa, se
devuelven los elementos aportados para estudio.

Sin otro particular saludo a Uds. con las seguridades de mi mayor estima.

NOTA: Por ser la reproducción de un informe pericial real, los datos de la entidad bancaria, numeración del
cheque, de la cuenta y los de su titular han sido modificados para preservar el secreto. Se ha omitido asimismo
la reproducción de la lámina ilustrativa por idénticas razones. En la presente unidad lo importante es la forma
genérica del informe y no tanto las comprobaciones efectuadas. Debe tenerse en cuenta que es inadmisible
un informe sin la/s ilustración/es donde se demuestre todo lo señalado en el mismo.

64 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

( DESARROLLO DE LA UNIDAD II )

Criminalística

Como brevemente ya hiciéramos referencia en la presentación de la asignatura,


el hombre, por un arrastre atávico de ciertas facultades, está precondicionado a vivir en
forma societaria. Ello constituye su determinante naturaleza social. Para la gestación
de un nuevo ser, su crecimiento, desarrollo, salud y perpetuación, necesita de una
relación comunitaria.

Esta circunstancia ha sido cabalmente comprendida por el hombre ya que,


desde los tiempos más remotos, ha debido nuclearse conformando las primeras for-
maciones grupales. Así pudieron enfrentar las hostilidades de las diferentes regiones
que ocuparon, las inclemencias del tiempo, protegerse de los ataques de las fieras y
de otros hombres y procurar y satisfacer sus necesidades básicas de alimento y vivi-
enda. Estos grupos dieron lugar a las primeras formaciones clánicas o tribales.

Posteriormente, con el paulatino incremento de las mismas y de sus necesidades, confor-


maron pueblos, ciudades y países. Sus permanentes y cada vez más imperiosas necesidades,
su astucia y dedicación les permitió, sobre base de los conocimientos obtenidos a través de la
observación, la experimentación y la deducción, significativos avances y una gran evolución.

Grandilocuente es la obra humana. Las mejoras en cuanto a la calidad, condicio-


nes y tiempo de vida de la especie, son realmente asombrosas, como lo son también los
logros obtenidos con relación a su hábitat. Sin embargo, ese mismo apetito evolutivo
ha impulsado al hombre a cometer excesos no sólo sobre otros hombres, sino en el
planeta donde habita, que a la postre podrá significarle un costo excesivo.

El inexorable transcurso del tiempo ha demostrando fehacientemente esa nece-


sidad societaria. Hoy el hombre comparte un mundo totalmente globalizado, donde lo
que ocurre en algún lugar del planeta, por más remoto que fuere, tiene profunda inter-
relación con el resto. La globalización es una realidad y tanto las naciones como los
hombres, se siguen nucleando a través de tratados internacionales como: la COMUNI-
DAD EUROPEA, el NAFTA y el MERCOSUR entre muchos otros. Esto no sólo confirma
cotidianamente, la naturaleza social hombre, sino que constituyen verdaderos ejemplos
orgánicos de esa esencial necesidad humana.

tomo 1 investigación científica del delito ) 65


educación a distancia (instituto universitario de la P.F.A.)

Sin embargo, la naturaleza social del hombre no lo convierte en un ser con conductas
sociales armónicas. Desde siempre las relaciones entre los hombres son y seguirán siendo
causales de conflictos. Además cuanto más heterogéneas sean esas sociedades, en
cuanto a cultura, educación, niveles económicos, tradiciones, costumbres, etc., más
hipótesis de conflictos presentarán. La génesis de los mismos obedecen a causales
muy variadas, sin embargo gran parte de los mismos, son provocados por anómalas
relaciones comerciales, donde el afán mercantilista provoca y cree justificar doctrinas
egoístas que, en forma individuales o grupales y con el fin de conseguir ventajas, no
dudan en recurrir a acciones marginales o criminosas.

Adoptar oportunas medidas cautelares de prevención, suelen dificultar o


paliar estas circunstancias pero, en muchos casos, no queda otra alternativa que re-
currir a planteamientos judiciales ante fueros nacionales o internacionales para
su dilucidación.

Desde aquellas primeras conformaciones clánicas o tribales hasta nuestros días,


quienes debieron o deben administrar justicia (jefes de tribus, consejos de an-
cianos o nuestros actuales jueces) han necesitado, necesitan y necesitarán de una
precondición para poder expedirse: la determinación de “LA VERDAD”, es decir el
conocimiento de la realidad en la producción de los hechos para poder, en forma
imparcial, dar a cada uno lo que le corresponde, ya sea castigando o resarciendo.

Para lograr la verdad, el hombre ha utilizado diversos métodos. Sin pretender una
profunda revisión histórica, mencionaremos que, primitivamente, se pensaba que la verdad era
revelada por la Providencia o “Dedo de Dios”, que a través de las ordalías o del duelo
judiciario intervenía para exculpar o demostrar la culpabilidad de los sospechados.

Este procedimiento consistía en someter a aquel/los involucrado/s en un conflicto


que debía dilucidarse, a determinadas pruebas físicas. De resultar airoso en ellas era con-
siderado inocente o veraz, en caso contrario era culpable o falaz.

Entre otras pruebas por ejemplo, para la determinación de quien decía la verdad en hechos
de importancia, se les hacía colocar a aquellos cuyas versiones diferían, su puño sobre el fuego. El
que lograba mantenerlo por mayor tiempo era el veraz, ya que por intervención divina o del dedo
de Dios, lograba soportar el dolor y de esa manera “demostrar la veracidad de sus dichos”.

Huelga decir que este medio les permitía a todos aquellos más hábiles o con mayor
estado físico, resistir las duras pruebas a las que eran sometidos, pero en modo alguno ase-

66 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

guraba la determinación de la verdad de los hechos. Este procedimiento por ilógico que pueda
parecernos, fue utilizado por el hombre, en algunas sociedades, hasta hace unos 400 años.

Otro método para obtener la verdad es la Confesión, es decir el reconocimiento


de un hecho y de sus circunstancias por aquel que lo ha cometido. Es tan claro en
teoría esta forma de obtener la verdad, que fue reconocida y denominada por mucho
tiempo como “la reina de las pruebas”. Esto en realidad sería así, ya que si aquél que
a sabiendas que recibiría un castigo por su conducta reconoce la autoría del hecho,
¿qué mayor certeza de estar frente a la verdad se podría obtener?

Sin embargo, no siempre quien “confiesa” es el verdadero autor de un hecho.


La anormal necesidad de algunas mentes enfermizas de recibir castigo, aún por algo
que no han cometido (en muchos casos como reparación por otros hechos no cuestio-
nados, por los que consideran que deberían ser castigados y a sabiendas que nunca
lo serán) o por la anómala necesidad de notoriedad, de revaloración de personalidad,
o por conveniencia pecuniaria, amiguismo, etc., hace que la sola confesión no sea el
camino válido para la determinación de la verdad.

Asimismo, la historia nos ha demostrado que para llegar a una “confesión”, el hom-
bre se ha valido muchas veces de métodos bárbaros y crueles como la tortura, (recordar
la inquisición o santas cruzadas). Frente a tales procedimientos -donde se consideraba
que el fin justificaba los medios- y para escapar de esas circunstancias, muchos ino-
centes no sólo se han reconocido culpables de hechos no cometidos, sino que una vez
aceptado ello, para eludir nuevas torturas aportaban nombres de familiares y conocidos
como cómplices o auxiliadores de los mismos, arrastrando así a otros inocentes.

Ningún Juez en la actualidad, daría por probado un hecho sólo por los dichos del
inculpado, necesitará obviamente de otros elementos probatorios para su dictamen final. La
confesión sin embargo será un medio de prueba más acorde a las disposiciones del Código
de forma en materia Penal para la Capital Federal, cuando la misma se realice en presencia
del Juez, del Secretario, el Ministerio Fiscal y del Abogado defensor (art. 295 CPPN). Pero
debemos recordar que por precepto constitucional nadie está obligado a declarar contra
sí mismo, estando ratificado dicho derecho en el artículo 296 del mismo cuerpo legal.

Si este no es el camino, ¿qué método podemos utilizar para la determinación de la


verdad?. Surge entonces el Testimonio, o dichos de un tercero ajeno a los hechos, es
decir de aquellos que por no tener interés personal en el resultado del proceso sólo
relatan lo que saben, lo que han percibido a través de los sentidos.

tomo 1 investigación científica del delito ) 67


educación a distancia (instituto universitario de la P.F.A.)

Desestimando por su obviedad a los testigos falsos, se debe tener en cuenta que un
testigo relata los hechos acorde como estos impresionaron sus sentidos. ¿Con qué alcances
conoce el hecho? ¿cuánto sabe de él?, ¿desde dónde lo vio?, ¿cómo lo impresionó?, ¿qué
recuerdos o vinculaciones con otros vividos por él o por familiares o amigos le traen?; ¿qué
capacidad de almacenar los detalles propios del hecho posee?; ¿qué posibilidad de abstrac-
ción posee sobre los dichos, comentarios, observaciones, noticias y demás circunstancias
percibidas sobre los mismos?; ¿qué capacidad posee de recordar y relatar los hechos sin
aditamentos o adiciones involuntarias de pequeños detalles que pueden ser fundamentales
para determinar los mecanismos de producción de un hecho? ¿qué grado de capacidad,
memoria, atención, forma de expresión, imaginación, etc. etc., posee?.

De la respuesta a estos y otros muchos interrogantes dependerá el grado de exac-


titud o veracidad de su declaración. Si a esto le sumamos la posibilidad de la actuación de
testigos falaces, se pone en evidencia la fragilidad de este medio como garante de la obten-
ción de la verdad de un hecho. Guardando, empero, las formalidades que el citado código
de forma taxativamente impone en el Capítulo IV “Testigos”, donde señala los deberes,
capacidades, prohibiciones, facultades de abstención, compulsión, citación, formas y las
responsabilidades y medidas a tomar ante falso testimonio, su actuación sigue revistiendo
suma importancia, aunque no sea garantía de verdad por las causales señaladas.

Queda claro que tanto la confesión como el testimonio son verdaderos auxiliares de
la justicia, pero ellos no son por sí, garantía de “la verdad”. Por ello se ha debido recurrir a
las cosas, a los elementos que se encuentran en la escena del hecho. Estos son verdade-
ros testigos mudos que por carecer de sensibilidad no se impresionan, no mienten ni se
modifican, aportando la verdad en forma objetiva.

Surge así la Prueba Indiciaria también llamada de los “testigos mudos”. Testigos
que necesitan de intérpretes especializados para que expresen lo que saben, por lo que
se debe recurrir a la Criminalística y a sus peritos, que aportan todos los conocimientos
técnicos y científicos que permiten el esclarecimiento del hecho. La actuación científica
está contemplada en el citado código entre otros, en el artículo 184 inciso 2 y 4.

Definiremos a la CRIMINALÍSTICA como una disciplina técnico científica


interdisciplinaria cuyo objeto es establecer la identidad de las personas o cosas;
el estado en que estas se encuentran; las causas y medios que provocaron sus
anomalías; las personas o cosas con ellas relacionadas; sus interrelaciones con otros
hechos; y que permite encontrar y asegurar las pruebas. Es decir busca determinar
la existencia de un hecho ilegítimo o irregular, individualizar a su autor o autores

68 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

y conformar la prueba material que asegure el castigo y resarcimiento. Todo ello


a través de la determinación del ¿Dónde?, ¿Cómo?, ¿Cuándo? y ¿Quién? de un
hecho, sea éste delictivo o no.

Para ello se vale de los objetos, cosas o modificaciones de las que debieron
estar, que quedan o son parte de ese hecho y de los intérpretes criminalísticos o
peritos que tienen como función interpretarlos, sacar de ellos conclusiones, utilizando
los medios técnicos y/o científicos a su alcance.

El juez de instrucción austríaco Hans Gross, tras 20 años de silenciosa y fecunda


labor, en 1892 publica su “Handbuch für Untersunchungsrichter als System der Kriminalistik”
o “Manual del Juez de Instrucción como Sistema de Criminalística”, utilizando por primera
vez esta denominación para designar al conocimiento específico y a todas las tareas téc-
nicas y científicas destinadas a conformar la prueba material del delito.

Sin embargo, antes de adoptar en forma definitiva este nombre ha sido denominada
de manera muy diversa. Debe tenerse en cuenta que sus alcances están directamente rela-
cionados con los hechos delictivos y que su aplicación en forma empírica proviene de las
fuerzas policiales como auxiliares de la justicia. De allí el origen de esas denominaciones:
Policía Científica, Técnica Policial, Ciencia de la Policía Judicial, Arte de la Policía Judicial,
Policía Judicial Científica.

Con relación a sus precursores, se hace muy difícil precisar desde cuándo y quiénes
han iniciado esta tarea y además se corre el riesgo de omitir mencionar a alguien. Empero en
lo relacionado a la difícil tarea de la identificación del hombre, no podemos dejar de mencio-
nar a Malpighi, Feré, Testud, Forgeot, Faulds, Herschell, Bertillón, Galton, Vucetich, Henry,
Fortunato, Farina, Preller, Urquijo, Saucedo, Rosset y Lago, de quienes nos ocuparemos
en la unidad correspondiente.

En cuanto a la aplicación de las técnicas y fundamentalmente en la difusión de las


mismas debemos mencionar además de Gross, a Lacassagne, Nicéforo, Södermann y
O’Connell y Locard.

En el orden nacional no sólo por haber sido los iniciadores, sino por la dedicación,
esfuerzo, capacidad, abnegación y total desinterés económico puesto de manifiesto en el
cumplimiento de su labor, logrando dentro de la Policía Federal Argentina la formación de
dependencias especializadas, la invención y donación de patentes de aparatos técnicos
científicos que se han difundido por el mundo entero, como el scopómetro, el fotocom-
parador, la clave de identificación mecanográfica, etc., que permitió durante muchos años

tomo 1 investigación científica del delito ) 69


educación a distancia (instituto universitario de la P.F.A.)

colocar a la institución a la que pertenecían en un puesto de privilegio, al ser reconocida


internacionalmente como la mejor policía del mundo. Cabe mencionar entre muchos otros
a Roberto Albarracín, Enrique Pisano, Roberto Capello, Ernesto Belaunde, Julio Fortunato,
Pedro Lago, Servando Saucedo y al insigne maestro y hombre ejemplar Ricardo Rosset
de quien tuve el honor de ser discípulo, alumno y permítaseme el atrevimiento, amigo. A
todos ellos vayan mi permanente gratitud y reconocimiento, conjuntamente con la de todos
aquellos que con humildad, nos dedicamos al cumplimiento de tareas Criminalísticas.

A título de referencia se hace constar que la Facultad de Derecho y Ciencias Socia-


les por expediente nº°630.729/66, propone al Rector de la Universidad de Buenos Aires
la creación de las Licenciaturas en Criminología y en Criminalística dentro del Instituto de
Derecho Penal y Criminología de dicha facultad. Que en uso de las atribuciones confe-
ridas por el artículo 1º°de la resolución ministerial nº°106/66, con fecha 19 de diciembre
de 1967 el Rector crea ambas licenciaturas, aprobando las condiciones de admisibilidad
para su ingreso, los planes de estudios, condiciones y correlatividades a cumplimentar
para la obtención de los títulos. A partir de allí, otras universidades en todo el país han
proseguido con la tarea de formar especialistas en Criminalística.

La Criminalística permite un asesoramiento integral sobre la conformación de la


prueba material específica para cada caso y frente a cada indicio, con la resolución de los
interrogantes periciales que estos presenten; la valoración de los aciertos o deficiencias
de las pruebas obrantes en las causas; la redacción de interrogatorios a peritos o testigos
con respecto a dichas pruebas materiales; la valoración y en su caso la impugnación de
peritaciones no basadas en comprobaciones técnicas o científicas; el contralor de las
pruebas cumplidas y a cumplimentar tanto en hechos judiciales como extrajudiciales y en
los siguientes tópicos:

Pericias documentológicas: también llamadas documentoscópicas, scopométricas o


caligráficas, donde se cuestiona la autenticidad de firmas y manuscritos; de sus autores;
de abusos de firmas en blanco; superposiciones y órdenes de prelación de escrituras
(antigüedades relativas); determinación de falsificaciones y adulteraciones en documentos
en general; sobre fotocopias y determinación de la fotocopiadora utilizada; testamentos
ológrafos; escritos mecanográficos, determinación de máquinas de escribir, agregados
y tiempos de ejecución; impresoras de todo tipo; autenticidad de papel moneda nacional
y extranjero, títulos y otros valores; sellos, lacres, timbres y marcas; adulteraciones por
borrado, lavado químico, enmiendas, agregado, testados, etc.; sistemas de impresión y
asesoramiento integral sobre seguridad documental.

70 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

Se hace necesario aquí hacer una breve referencia sobre las diferentes denomina-
ciones de este tipo de peritaciones. Por no existir profesionales específicos a fines del siglo
XIX y primera mitad del siglo XX, que pudieran realizar pericias sobre escrituras manuscritas
o firmas, se recurrió a los únicos idóneos que sobre escrituras había entonces, es decir a
los calígrafos. Si bien su tarea era la de hacer buena letra en el llenado de los documentos,
es decir una tarea netamente artística, sus ejecuciones requerían análisis pormenorizados
de las diferentes conformaciones y estilos, lo que conllevaba a profundos estudios sobre el
arte de la escritura. Esto los transformaba en los más conocedores de esa materia.

Posteriormente, dada la necesidad de profesionalización de la tarea pericial, se divide la


carrera en dos ramas de estudios, una artística y una pericial, abarcando entonces lo referente
al asesoramiento sobre todo tipo de escrituras. Si se recurre a los calígrafos para este tipo
de peritaciones, es lógico llamar a sus informes “pericias caligráficas”. Dada la antigüedad
de su uso, también es lógico pensar siempre en primer instancia en esta denominación.

Antes que los jueces comenzaran a requerir cooperaciones periciales sobre estos
estudios a la Policía Federal Argentina, como auxiliar de la justicia, gracias a las inquietudes y
visión de futuro de sus funcionarios, se crean laboratorios con preparación técnico-científica,
que luego fueron perfeccionando y ampliando el ámbito de competencia, denominándoselo
Gabinete Scopométrico, palabra que posee raíz latina Skopein que significa examinar,
estudiar, y metría por las tareas de mensura que implica. Además necesitó formar a su
personal en esta actividad, por lo que se dictaron cursos específicos. Si la oficina policial
se denominaba de esa manera, los cursos formaban técnicos scopómetros, las pericias
lógicamente, se denominaron scopométricas.

Como muchas de ellas requieren estudios y comprobaciones de orden químico, se


hizo común requerir pericias caligráficas, scopométricas y químicas cuando se necesitaba
del auxilio de esta disciplina técnica. Por ser ambas denominaciones específicas de activi-
dades locales, que obviamente no poseen reconocimiento internacional, el nombre genérico
adecuado para todas las pericias relacionadas con todo tipo de documentos, que estudian
y analizan sus soportes, sus tintas, los sistemas de impresión utilizados, las medidas de
seguridad incorporadas, el detalle de las falsificaciones y adulteraciones de todo tipo, es
la de documentología.

Balísticas: Sobre este capítulo, en razón de haber en el programa una unidad que desar-
rolla esta temática, sólo diremos que se ocupa del estudio de las armas, sus municiones,
alcances y dirección de sus proyectiles y los efectos que producen. Para el cumplimiento
de su tarea, se divide en

tomo 1 investigación científica del delito ) 71


educación a distancia (instituto universitario de la P.F.A.)

Balística Interior: donde se estudia y analiza las características de las armas, sus piezas, las
interrelaciones de éstas que permiten su funcionamiento y aptitudes para el disparo, las de
sus municiones, la identificación de proyectiles y vainas y los mecanismos de producción
del disparo hasta que el proyectil abandona la boca del cañón.
Balística Exterior: que se ocupa de las trayectorias, distancias de disparo, posición del tirador,
y las afectaciones que sufre el proyectil por la gravedad, aire y factores climáticos. Y la
Balística de Efecto: que estudia los daños de los impactos, rebotes, etc,

Pericias accidentológicas: se ocupa de este tipo de hechos dividiéndose en dos grandes


grupos: la Accidentología General que se ocupa de caídas al vacío, causales y mecanismos
de producción de accidentes caseros, laborales, etc.; y la Accidentología Vial: referida a
los accidentes automovilísticos, estudiando campos visuales de conductores; distancia
de frenado; velocidades; secuencias de impactos y desplazamientos; roles de embistente
o embestidos, desarrollo y causas del siniestro; etc.

Se hace constar que si bien la definición de accidente es todo hecho casual,


obra de la fatalidad y sin imputación a terceras personas, el capítulo criminalístico que
se dedica a esta temática se denomina así, ya que si el hecho no lo es, se procura la
determinación de sus mecanismos de producción, de las personas involucradas en
ellos y la conformación de la prueba.

Dentro de la accidentología se hace necesaria la determinación de todas las circun-


stancias que afectan a los elementos del llamado triángulo accidentológico

Hombre

Máquina Terreno

El estudio del hombre se ocupa de todos aquellos que de una manera u otra
han intervenido en la producción del hecho. Comprende a/l/os conductor/es y a la/s
víctima/s. Con relación a los conductores se debe determinar y comprobar sus estados

72 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

psíquicos y físicos anteriores y posteriores pero inmediatos al momento del accidente,


sus identidades y si han cumplido con las exigencias necesarias para poder conducir
vehículos: capacidad, estado, idoneidad, habilitación, vigencias de las mismas, segu-
ros, uso de anteojos, etc. Asimismo determinar el grado de atención (uso de celulares,
etc.), ángulos de visión, roles desempeñados, prioridades, etc.

Similares determinaciones, con las especificidades que cada caso requiera, debe
cumplimentarse con otros tipos de hechos accidentales tanto del hogar como del trabajo.
La función, con respecto al hombre, es la de determinar todo aquello que permita a quien
deba juzgar el hecho, comprobar la existencia o no de imprudencia, negligencia, impericia
en su arte o profesión o inobservancia de los reglamentos o de los deberes de su cargo
(acorde a lo taxativamente dispuesto en el artículo 84 del Código Penal).

Con relación a las víctimas, sus estados físicos y la urgente necesidad de atención
médica, sus identidades, estados psíquicos y físicos anteriores al hecho, formas de partici-
pación, lugares que ocupaban antes del hecho, vínculos con los imputados, etc. Asimismo
la determinación de testigos presenciales del hecho y los necesarios de actuación para las
determinaciones, comprobaciones y/o secuestros.

Con relación a las Máquinas, se deben determinar el estado de las piezas que
las componen, sus armonías para el funcionamiento y sus condiciones generales
antes del hecho. Asimismo si se cumplen las disposiciones legales y de habilitación
que autoricen su uso y funcionamiento y todos los daños sufridos con motivo del
accidente.

En lo referente al Terreno, deben efectuarse las comprobaciones desde dos


ópticas diferentes: uno con relación al estado de la pista o calles donde se produjo
el hecho, tendiente a determinar no sólo su composición, sino su estado con respecto
a baches, trabajos en realización, disminución de trochas, obstáculos que dificulten
la visión (por ejemplo, carteles, puestos de diarios, vehículos mal estacionados, etc.)
iluminación, señales de tránsito, prioridades de paso, etc.; o en otros tipos de ac-
cidente conexiones eléctricas, medidas de seguridad implementadas, cumplimiento
de normas, etc.

La otra óptica estará dada por los factores climáticos que inciden sobre las
causales de producción de accidentes, tales como: luminosidad natural, sol enceg-
uecedor, lluvia, nieve, hielo, neblina, inundaciones, estáticas, humedad, etc.

tomo 1 investigación científica del delito ) 73


educación a distancia (instituto universitario de la P.F.A.)

Identidad Humana: Por ser un temario tratado en una unidad de esta materia,
sólo mencionaremos que permite establecer las identidades física, biológica y psíquica
de una persona, utilizando para ello todos los aportes que la ciencia y la técnica of-
rece, que en la práctica, permite identificar en forma directa o indirecta al hombre,
conformando prueba o indicios que posteriormente deberán ser evaluados por quien
tenga que impartir justicia.

Químicas: a través de estudios, análisis y comprobaciones de este carácter


sobre tintas, papeles, pólvoras, pinturas, manchas en general, etc.

El profesional universitario (perito), especializado en uno o varios temas téc-


nicos científicos, una vez realizados los estudios y comprobaciones correspondientes
acorde a los interrogantes planteados, en forma metodológica y sistemática presentará
su resultado en un detallado informe que debe contener y valorar lo siguiente:
Fechado: Debe tenerse en cuenta que el fechado encierra además del día, mes y año, el
lugar en que se realiza el informe, ya que eso implica jurisdicciones judiciales y por ende
el uso de las normas de forma correspondientes.

Autoridad requirente: En caso de ser presentado ante un juez, debe precisar su compe-
tencia ya que ello requiere el cumplimiento de formas especiales. En materia penal según
el artículo 263 del CPPN, “El dictamen pericial podrá expedirse por informe escrito o hac-
erse constar en acta ...”. En materia civil y comercial acorde al artículo 472 del CPCCN
“El perito presentará su dictamen por escrito, con copias para las partes...” debiendo los
consultores cumplir con los mismos requisitos.

Idoneidad del Perito: Para ambos códigos de forma se requiere título habilitante en caso
de que la profesión estuviera reglamentada. En caso contrario o cuando no hubiere peritos
diplomados, se podrá designar cualquier persona con conocimientos en la materia (artículos
254 CPPN y 464 CPCCN). Asimismo los peritos deben inscribirse en las Cámaras de los
diferentes fueros, a fin de ser incorporados en el listado que anualmente se confecciona y
de donde serán seleccionados por sorteo para intervenir en las diferentes causas.

Rol del perito: Acorde a lo dispuesto en ambas normas, el juez podrá ordenar pericias
cuando, para conocer o apreciar algún hecho o circunstancia, se requieran conocimien-
tos especiales en alguna ciencia, arte o técnica. (artículos 253 CPPN y 457 CPCCN). En
virtud de las diferencias que ambos códigos presentan en cuanto:
a) la cantidad de peritos y las denominaciones que reciben acorde su rol; y
b) la forma de realizar los estudios y de las personas que pueden participar en ellos, se
detallará por separado cada circunstancia, comparando cada disposición.

74 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

a) Cantidad y denominación: En materia penal el perito designado por el juez tendrá el rol de
perito de oficio si ha sido sorteado del listado confeccionado por las Cámaras, y el rol
de perito oficial si pertenece a alguna repartición en la cual perciba sueldo por su tarea
como perito. Acorde al artículo 258 del CPPN, “El juez designará de oficio a un perito salvo
que considere indispensable que sean más....” Deberá además notificar de esta resolu-
ción, bajo pena de nulidad, al ministerio fiscal, a la parte querellante y a los defensores
antes de que se inicien las operaciones periciales. En caso de suma urgencia o que la
indagación sea extremadamente simple, se les notificará de su realización y que pueden
hacer examinar los resultados o pedir su reproducción, de ser posible, por otro perito.

Las partes podrán proponer otros, a su costa, dentro de los tres días, los que actu-
arán como peritos de parte. (artículo 259).

En materia civil y comercial el juez podrá designar perito único de oficio, salvo ley
especial, en procesos de declaración de incapacidad y de inhabilitación o por nulidad de
testamento. En estos dos últimos supuestos deberán o podrán (respectivamente), nombrar
de oficio a tres peritos. Además cada parte tiene la facultad de designar a un perito que
cumplirá su función como consultor técnico (artículo 458 CPCCN).
b) Forma: En materia penal “Los peritos practicarán unidos el examen, deliberarán en
sesión secreta, a la que sólo podrá asistir el juez, y si estuvieren de acuerdo redactarán su
informe en común. En caso contrario, harán por separado sus respectivos dictámenes....”
artículo 262 del CPPN. Por el artículo 260 del mismo cuerpo, es facultad del juez la de
dirigir la pericia y fijar los plazos en que debe expedirse el perito.

En la práctica una vez aceptados los cargos, el juez hace entrega de los elementos
a peritar al que cumple el rol de perito oficial o de oficio. Este debe citar a los restantes peri-
tos para iniciar en forma conjunta los estudios. Obtenidas las evaluaciones de los estudios
realizados por cada perito, se sesiona en forma secreta. De estar de acuerdo se suscribe
un único informe. De surgir diferencias las mismas pueden ser parciales o totales.

De ser parciales, se deja expresamente detallada las concordancias y se señalan


las diferencias suscribiendo todos el informe, debiendo aquel que está en discordancia
efectuar un informe individual sobre las mismas, que puede ser presentado al perito oficial
para elevación en forma conjunta, o bien lo puede presentar directamente en el juzgado.

De ser totales, se deja de ello expresa constancia en el informe del perito oficial o
de oficio, que debe ser igualmente firmado por todos como prueba de la realización

tomo 1 investigación científica del delito ) 75


educación a distancia (instituto universitario de la P.F.A.)

de los trabajos en forma conjunta y de las diferencias surgidas, debiendo aquel que
está en discordancia actuar de la manera ya señalada.

En materia civil y comercial la pericia estará a cargo únicamente del perito des-
ignado por el juez o sea el de oficio u oficial. Los consultores técnicos, las partes
y sus letrados podrán presenciar las operaciones técnicas que se realicen y formular
las observaciones que consideraren pertinentes (artículo 471 del CPCCN).

El perito presentará su informe con copia para las partes y los consultores
técnicos podrán presentar por separado sus respectivos informes con iguales
requisitos y plazos, (artículo 472).

Con el fin de completar el espectro referente a los peritos se consigna que tienen


Incapacidad o Incompatibilidad: los incapaces, los que deban o puedan abstenerse
de declarar como testigos, los eliminados del registro por sanción, los condenados o
inhabilitados (artículo 255 del CPPN).

Asimismo son causales de excusación y recusación para los peritos, las mis-
mas establecidas para los jueces (artículos 256 del CPPN y 466 del CPCCN). Con
respecto a la obligatoriedad del cargo, en materia penal, el designado tendrá el deber
de aceptar y desempeñar fielmente el cargo, salvo grave impedimento. Si no acudiere
a la citación o no presentare su informe, incurrirá en las mismas responsabilidades
señaladas para los testigos por los artículos 154 y 247 del CPPN.

En tanto que en materia civil y comercial se dan dos circunstancias distintas:


a) de no aceptar el cargo una vez propuesto o no concurriere dentro del plazo fijado, se
nombrará a otro en su reemplazo y la Cámara determinará el plazo durante el cual
quedará excluido de la lista (artículo 469 CPCCN);
b) el que habiendo aceptado el cargo renunciare sin motivo atendible o no presentara su
informe, será removido de su cargo y el juez lo condenará a pagar los gastos por daños
y perjuicios, perdiendo el derecho de cobrar los honorarios por las tareas realizadas
(artículo 470).

Objeto de la peritación: se transcribirán los interrogantes periciales o dudas


planteadas por quien solicite la pericia, sobre los elementos indiciarios hallados du-
rante la investigación. Debe tenerse en cuenta que no se puede responder a otros
interrogantes que los taxativamente planteados, -ya que hacerlo puede invalidar todo
el trabajo a pedido de alguna de las partes-, salvo que expresamente lo habilitaran a

76 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

extenderse en su participación “a cualquier otro dato de interés que pueda aportar


luz sobre los hechos investigados”.

Tampoco puede dejar de tratar ningún interrogante, debiendo concluir con


algunas de las tres posibilidades que se detallarán oportunamente. Se hace expresa
mención de que en el cumplimiento taxativo de lo ordenado por el juez, debe mensu-
rarse el no inducir a error con la respuesta dada. De ser así no sólo puede sino que
debe efectuar las extensiones correspondientes.

A modo de ejemplo se detalla un caso concreto. El interrogante pericial pretende deter-


minar las adulteraciones que puede presentar un documento. Del estudio realizado surge que
el documento remitido para pericia no presenta ningún tipo de adulteraciones, pero es falso.
Contestar simplemente que no presenta adulteraciones, llevaría al magistrado a considerarlo
sin irregularidades, lo que sería inducirlo a error por omisión de detalles. En esos casos la
opción es indicar simplemente la falsedad o requerir ampliación de los puntos a peritar.

Debe tenerse en cuenta que si bien es el juez quien ordena en definitiva, según la
necesidad planteada en cada causa, los puntos de pericia, las partes pueden requerir
el cumplimiento de todas aquellas peritaciones que puedan aportar apoyo a sus dichos.
En la práctica el juez desestima aquellos que considera improcedentes, ordenando sólo
los interrogantes que considere oportunos, sea a propuesta propia o de las partes.

Ello debe llevar a la reflexión a quienes soliciten los interrogantes o hagan un interro-
gante ómnibus, ya que una vez ordenados, los peritos deben contestarlos a todos, les resulten
favorables o no a los intereses de las partes, aunque éstas sean quienes los han solicitado.

Elementos aportados: es el detalle de los elementos cuestionados o dúbitos


cuya verdad se trata de establecer y de los elementos incuestionables o indúbitos
que se aportan para confrontación. Ambos elementos deben cumplir con los siguien-
tes requisitos:

Elementos dubitados: éstos necesariamente deben aportarse en original por las siguientes
razones:
a) una copia fotográfica, fotostática o efectuada por cualquier medio es el fiel reflejo de
la verdad, salvo intervención culposa o dolosa de quien la efectuó, ya que es muy
simple producir modificaciones a través de algún medio técnico y
b) debe efectuarse siempre sobre el soporte, los estudios necesarios para determinar
si sobre él se han producido maniobras adulterativas por borrado, raspado, lavado,

tomo 1 investigación científica del delito ) 77


educación a distancia (instituto universitario de la P.F.A.)

cortado, etc., circunstancia que no sería posible sobre una reproducción, donde
sólo se podría estudiar el soporte de la copia.

Elementos indubitados: idealmente estos elementos deben ser anteriores, posteriores y


contemporáneos a la fecha del documento dúbito a fin de poder confeccionar una historia
cronológica acerca de las características y condiciones generales, con sus evoluciones
e involuciones a través del tiempo, de/l/os elemento/s a cotejar.

Estos elementos deben provenir de documentos públicos y privados, estos


últimos de fecha cierta, que no tengan relación con el juicio, es decir, que aseguren
las características normales de los mismos, fuera de toda afectación.

Cabe destacar que es imperioso que el profesional abogado que requiera o que esté
interesado en la producción de esta prueba, aporte estos documentos o indique los organis-
mos públicos o privados donde pueden encontrarse, a fin de que el perito, portando el cor-
respondiente oficio judicial, pueda concurrir a los lugares especificados para su examen.

En caso de no existir documentos de estas características, se puede tomar cuerpos


supletorios, los que en principio son inidóneos, debiendo recurrirse a ellos sólo en caso
de extrema necesidad y siempre que se cumplan determinados requisitos. Estos, entre
otros, son: que se realicen con similares elementos escritores manuales o mecánicos,
con similares calidades de tintas, situaciones, características y muy especialmente en
presencia del perito, que debe implementar según cada caso, las técnicas de toma
correspondiente.

Debe tenerse en cuenta que en la realización de los mismos debe vencerse según los
casos, el nerviosismo natural de toda persona que no siendo responsable de un ilícito, se ve
comprometido en actos procesales que pueden afectarlo, o las maniobras tendientes a eludir
las particularidades individualizadoras cuando el actor sea responsable, adoptando las formas
adecuadas que deben ser seleccionadas en el momento, acorde las características que se
vayan produciendo.

Fundamentos, análisis, estudios y comprobaciones realizados: Este es el apartado


fundamental de todo estudio pericial ya que es donde se detallan, en forma metódica y
sistemática, todos y cada uno de los pasos realizados por los peritos. Estos son los que
les permitirán a la postre, arribar a las conclusiones correspondientes. Si bien cada uno
de los pasos detallados precedentemente posee la importancia que de su lectura e inter-
pretación se desprende, todos ellos son de características formales, siendo el presente
el que permite y sostiene con elementos objetivos, las opiniones subjetivas finales.

78 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

Aquí se detallará todo el instrumental óptico-científico utilizado para efectuar


los estudios, como así también las luces, longitudes de ondas, ángulos de inciden-
cia, filtros tonales, etc., y demás circunstancias que hacen a las condiciones en que
fueron realizados. Se consignará además los fundamentos técnicos, científicos o
filosóficos sobre los que se basa la peritación a realizar, como así también el detalle
de todos los estudios físicos y químicos realizados.

Sistemáticamente según los casos, se deben efectuar exámenes extrínsecos


o generalizados de todos los detalles de forma y de características globales, y
exámenes intrínsecos o pormenorizados de todas aquellas características cuya
observación y estudio requiere del uso de aparatos de microscopía. El orden natural,
que puede variar según los casos, es realizar los estudios primero sobre los elementos
indubitados a fin de lograr el conocimiento de éstos, luego igual procedimiento sobre
los dubitados y, posteriormente, efectuar comparación o confronte a fin de determinar
coincidencias o discoincidencias que permitan efectuar las evaluaciones.

Realizada la descripción de las operaciones o estudios y asentados en detalle los hal-


lazgos producidos, se deberá señalizar los mismos en láminas mediante procedimientos
fotográficos, fotostáticos o por escaneado a fin de que, en forma ilustrativa, puedan
ser observados, comprendidos y reconocidos, tanto por conocedores del tema como
por legos.

Debe tener en cuenta el futuro profesional, que las observaciones, pedidos de ex-
plicaciones o impugnaciones que se realizan o pueden realizarse sobre un estudio pericial,
van a estar referidos a este apartado del informe, que es donde el perito puede demostrar
su idoneidad, capacidad, conocimientos, metodología y técnicas.

Todo trabajo realizado con rigor científico debe cumplimentar las características
que distinguen al conocimiento global del científico, es decir debe superar los pasos
de objetividad (objeto), sistematicidad y método a los que nos hemos referido en la
primera unidad, a fin de que dicho trabajo esté en condiciones de ser verificado.

De haberse cumplimentado correctamente tanto los trabajos o estudios realizados


como la descripción de los mismos, no importa la cantidad de peritos que intervengan,
todos deberán haber observado objetivamente lo mismo, ya que la aplicación de
los mismos elementos (aparatos de microscopía y luces) sobre un mismo objeto (el-
ementos dubitados e indubitados), en iguales condiciones (de aplicación y tiempo)
va a producir, inexorablemente las mismas situaciones.

tomo 1 investigación científica del delito ) 79


educación a distancia (instituto universitario de la P.F.A.)

La evaluación de los resultados obtenidos y su valoración cualicuantitativa podrá


ser diferente para cada perito en particular, ya que esa apreciación es de carácter
subjetivo, por no ser una disciplina de las denominadas exactas como las matemáti-
cas.

A fin de una mayor comprensión de lo explicado se incluye el siguiente ejemplo: un


paciente enfermo concurre a consulta y es atendido por dos médicos en forma simultánea.
Ambos, objetivamente, van a observar y mensurar idénticos síntomas sobre ese
paciente. La valoración de los síntomas será de carácter subjetivo y, dentro de los
límites de la sana lógica, se podrá arribar a diagnósticos distintos.

Conclusiones: efectuada entonces esa valoración cualicuantitativa los peritos podrán arribar
a sus conclusiones, las que en forma genérica pueden ser de tres tipos, acorde al siguiente
detalle:
a) CONCLUSIÓN POSITIVA, esto es la contestación categórica de los interrogantes plant-
eados, entendiéndose por ello que las dudas expuestas en la causa y que motivaran el
asesoramiento requerido por el juez, han sido definitivamente resueltas, tanto sea que,
por ejemplo, se haya determinado la participación de una persona en unos escritos
o firma o que se haya comprobado su no participación.
b) CONCLUSION NO POSITIVA: es aquella en que por no haberse contado con los
elementos de cotejo en cantidad y calidad necesaria, no ha podido concluirse en
forma positiva, debiéndose dejar perfectamente aclarado que de conseguirse los mis-
mos, se deberá efectuar un nuevo estudio pericial, y
c) CONCLUSION IMPOSIBLE: que se da en aquellos casos en que a la fecha no ex-
isten fundamentos técnicos y/o científicos que permitan contestar los interrogantes
planteados. A diferencia del caso anterior, acá no depende de la obtención de nuevos
elementos indubitables para cotejo, sino de la determinación de procedimientos de
base técnicas que permitan su resolución. Otras de las causales, es que el elemento
dubitado no reuna las condiciones necesarias para el desarrollo de los estudios.

Efectuado el presente detalle, se hace necesario indicar que un desarrollo no acorde


a ese esquema, en modo alguno indica que el informe o los estudios y comprobaciones
realizadas no sean correctos. Allí se han cumplimentado todos los pasos que corresponde
a un desarrollo completo de la tarea pericial. Su conocimiento le permitirá al profesional
abogado, mensurar las características generales del contenido de un informe, sirviéndole
de base para evaluar futuros informes en las causas en las que intervenga.

Se hace necesario asimismo destacar la gran diferencia que existe entre la tarea
del perito y la del testigo. El testigo debe relatar los hechos acorde a lo captado a

80 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

través de sus sentidos; si el perito tuviera como función hacer hablar a los testigos
mudos y luego contar lo que estos le dicen, no estaría cumpliendo su función de
perito sino la de testigo, ya que estaría relatando los hechos captados a través de sus
sentidos como si esos testigos mudos se los hubieran manifestado.

La tarea del perito tiene un principio básico pero fundamental, que es propio de su
función. Este principio lo obliga a no afirmar nada que no pueda demostrar. Esto indica
que su tarea es puntualizar o señalar lo que esos indicios revelan, en forma objetiva.
Luego de la descripción y señalización en láminas ilustrativas de todo lo hallado, sí
podrá efectuar las evaluaciones, que le permitirán alcanzar sus conclusiones.

Acorde al rigor científico demostrado en su informe, a la claridad de sus dichos en el


uso de un lenguaje informativo, el detalle de los fundamentos teóricos científicos y filosóficos
que para cada tipo de pericia debe consignar, la descripción y señalización efectuada sobre
lo hallado en los testigos mudos relacionados con esos fundamentos, la base que sustente
sus conclusiones y las demostraciones efectuadas, se le podrá solicitar al perito actuante las
explicaciones necesarias que sirvan para esclarecer o sostener sus conclusiones, y
en caso de falta de rigor científico o sustento, se podrá impugnar la pericia.

El juez, o las partes a través de éste, podrán solicitar que el perito efectúe las explica-
ciones necesarias sobre todas aquellas cuestiones que no hayan sido detalladas con precisión
en el informe, o de las condiciones, situaciones o evaluaciones que hubiere efectuado y no
hubieren quedado suficientemente claras. Asimismo sobre extralimitaciones realizadas, ya sea
por haber contestado más de lo requerido o menos. Estas explicaciones según lo determine
el juez, podrán efectuarse por escrito o en forma verbal, pudiendo estar presentes las partes,
peritos o consultores técnicos.

Cuando las explicaciones formuladas, el informe o los estudios realizados no tuvi-


eran sustento técnico científico o se determinaren falencias graves de forma y/o fondo, el
juez, o las partes a través de éste, podrán pedir la impugnación de la pericia en forma total
o parcial. Esta impugnación, de ser acordada, trae aparejada la anulación de la pericia en
todo o en parte y la necesidad de una nueva peritación.

Si bien en materia penal no está expresamente dispuesto en el Capítulo V Peritos,


del Título III, Libro II del Código Procesal Penal de la Nación esta circunstancia, no sólo está
avalado por la jurisprudencia y la sana crítica, sino por la lógica y el raciocinio.

En materia civil y comercial en el Libro II, Título II, Capítulo V, sección 6ta. Prueba de Peritos,
del Código Procesal Civil y Comercial de la Nación, en el artículo 473 taxativamente señala que

tomo 1 investigación científica del delito ) 81


educación a distancia (instituto universitario de la P.F.A.)

“...De oficio o a instancia de cualquiera de ellas (se refiere a las partes) el juez podrá ordenar que
el perito dé las explicaciones que se consideren convenientes, en audiencia o por escrito....”.

El mismo artículo expresa que “si el acto se cumpliera en audiencia y los consultores
técnicos estuvieren presentes, con autorización del juez, podrán observar lo que fuere perti-
nente; si no comparecieren esa facultad podrá ser ejercida por los letrados. Si las explicacio-
nes debieran presentarse por escrito, las observaciones a las dadas por el perito podrán ser
formuladas por los consultores técnicos o, en su defecto, por las partes...” Asimismo indica
que “Cuando el juez lo estimare necesario podrá disponer que se practique otra pericia o
se perfeccione o amplíe la anterior, por el mismo perito u otro de su elección....”

Ese mismo artículo expresa “... La falta de impugnaciones o pedidos de explicaciones


u observaciones a las explicaciones que diere el perito, no es óbice para que la eficacia proba-
toria del dictamen pueda ser cuestionada por los letrados...”. El artículo 477 expresa “La fuerza
probatoria del dictamen pericial será estimada por el juez teniendo en cuenta la competencia
del perito, los principios científicos o técnicos en que se funda, la concordancia de su aplicación
con las reglas de la sana crítica, las observaciones formuladas por los consultores técnicos o
los letrados, ..... y los demás elementos de convicción que la causa ofrezca.”

CRIMINALÍSTICA: teniendo en cuenta su función, esta disciplina utiliza tres tipos de métodos
bien diferenciados uno de otros. El primero es el investigativo es decir, todos los aportes
que la criminalística puede brindar en la escena donde se ha cometido un hecho tendientes
a encontrar, señalizar, levantar, proteger, conservar y asegurar legalmente los elementos
que inexorablemente quedan, de los que nos ocuparemos más adelante al desarrollar el
retrato del lugar del hecho.

Otro es el método pericial, donde los peritos a través de todas los procedimien-
tos técnicos y científicos hacen hablar a esos testigos mudos y donde a través de las
demostraciones efectuadas en sus informes permiten, que aun los legos, visualicen
y comprueben esos dichos.

Por último, el método preventivo. Debe tenerse en cuenta que si es posible


llegar a la verdad sobre un hecho luego de que este ha sido producido, por contrario
imperio también es posible adoptar los recaudos preventivos necesarios antes de su
producción. Esto ha permitido adoptar, entre muchas otras, las medidas de seguridad
documentales que actualmente se utilizan en todos los documentos y en papeles
monedas nacionales y extranjeros y en valores cursables que los representan, temas
que analizaremos en las unidades correspondientes.

82 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

Por todo ello, la Criminalística ofrece un amplio campo contributivo que no todos
han logrado advertir, recurriéndose a ella y a sus peritos sólo en acontecimientos extremos
o esporádicos, desaprovechando así una asistencia que puede ser determinante y que es
aplicable en casi todos los órdenes de la vida, no sólo en el campo litigioso, sino también
en la faz preventiva, tanto en seguridad documental como en la valorización de actos o
procedimientos, debiéndose recurrir a ella no sólo después de un hecho, sino antes.

La Criminalistica y la medicina legal


Actualmente, a diferencia de hace unos años atrás, no se discute que ambas
disciplinas científicas, la Criminalística y la Medicina Legal, son autónomas y tienen
sus propios fundamentos e incumbencias ya que, si bien muchas tareas pueden ser
conjuntas, cada una se realiza dentro de su campo de acción y que, aún estando
íntimamente ligadas, ninguna puede reemplazar a la otra.

Definida ya la Criminalística, resta ahora definir a la Medicina y a la Medicina


Legal para comprender mejor sus interrelaciones y sus diferencias:

Entendemos por Medicina (del latín mederi, curar, cuidar) a la ciencia cuyo objeto
es el estudio de las enfermedades, de su tratamiento y de su prevención. Es decir su
tarea es la de curar el cuerpo y la salud. Acorde a sus diferentes especialidades se
las puede clasificar en: medicina interna o clínica médica que estudia las enferme-
dades y sus tratamientos medicamentosos; la medicina quirúrgica encargada del
tratamiento cruento de las afecciones; la medicina preventiva o de normas higiénicas
y de medidas profilácticas para prevenir las enfermedades; la medicina veterinaria
encargada del tratamiento y curación de las enfermedades de los animales.

La medicina legal trata los problemas biológicos y médico-quirúrgicos en rel-


ación con las ciencias jurídicas y sociales. Es decir su tarea no es la de curar sino la
de informar, requiriendo para ello de un funcionario público para extender certificados
de peritaje o informes forenses.

La medicina legal utiliza diferentes ramas de la medicina y de la antropología. Así


presta una fundamental tarea en la resolución de los innumerables casos concretos donde
el conocimiento médico se torna indispensable, que deben ser dilucidados en los tribunales
de justicia y sin cuya intervención no podrían ser resueltos. Acorde a sus funciones se la
puede subdividir en medicina jurídica y medicina forense.

tomo 1 investigación científica del delito ) 83


educación a distancia (instituto universitario de la P.F.A.)

La jurídica contribuye en todos aquellos casos en que se necesitan conocimientos


médicos y biológicos para la formulación, interpretación y aplicación de disposiciones jurídicas.
La forense trata de resolver aquellas cuestiones concretas que se presentan ante los estrados
judiciales y administrativos. En los siglos XVIII y XIX la medicina legal comienza a diferenciarse
como una ciencia autónoma, transformándose en un verdadero auxiliar de la justicia.

Al igual que la medicina legal, la criminalística es un importante auxiliar de la justicia,


pero como puede apreciarse a través de sus definiciones y de las tareas que cada una de
ellas cumplen, sus diferencias y autonomía quedan perfectamente aclaradas. En casos
especiales como en balística, es posible tanto para un criminalístico como para un médico
legista determinar sobre orificios de entrada y salida, distancias de disparo, calibres utilizados,
etc. Pero obviamente sobre balística interior y exterior, el médico legista no podrá intervenir,
como así tampoco corresponde la intervención del, experto criminalístico en la valoración
de los daños corporales, trayectorias internas y mecanismos de la muerte. Ambos pueden
trabajar en forma independiente o concomitante sin invadir tareas ajenas, pero valorando
circunstancias en forma conjunta como por ejemplo en casos de suicidio, ahorcamientos,
muertes violentas, etc. donde cada uno, en su especialidad, puede relacionar elementos
del lugar del hecho y que, como testigos mudos revelan para quien conoce su lenguaje,
una cantidad de pistas posibles de conducirnos al esclarecimiento de los hechos, también
de las personas con este relacionadas.

Criminalística y criminología

La Criminología estudia al hombre como ser potencialmente capaz de cometer


delitos y las conductas humanas que deben ser tipificadas como tales. A diferencia de
la Criminalística que determina ¿el cómo, el cuándo, el dónde y el quién? del hecho
delictuoso, la Criminología estudia el ¿por qué.?

A los fines de una introducción didáctica al mundo criminológico y a la criminología


en sí (que es una próxima materia de estudio), diremos que la humanidad en toda su exis-
tencia y hasta un tiempo relativamente cercano, sólo había considerado como materia de
análisis criminológico, el estudio de las conductas que debían ser reputadas delictivas.

Así la Escuela Clásica del Derecho Penal consideraba que sólo se debía eval-
uar esas conductas antisociales para reputarlas como delitos, considerando a éstos
como entes jurídicos. Para la concreción de los hechos tipificados como tales, debía
intervenir el libre albedrío, es decir la capacidad humana de decidir la ejecución o no
del mismo. Si en forma libre se decidía cometer un delito, la pena debía establecerse
como responsabilidad moral y debía ser además proporcional al daño cometido. Pe-

84 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

nas éstas que eran aplicadas en forma fija una vez establecida la ejecución fáctica y
racional del hecho. Consideraba a los enfermos mentales como inimputables por no
poder elegir libremente.

Establecido el autor material del hecho mediante las formalidades judiciales


correspondientes a cada época y lugar, se aplicaban las penas previstas y se cumplían
las sanciones correspondientes.

Los delitos por no ser universales ni eternos, varían acorde a culturas, lugares y
tiempo. Las conductas tipificadas como delito en un país determinado hoy, puede no
serlo mañana, o puede no serlo en un país limítrofe. Por eso se hace necesario estudiar las
conductas referidas a cada sociedad y a cada tiempo, evaluar los grados de peligrosidad
de esas conductas y sancionarlas según corresponda, debiéndose estar en permanente
estado de alerta a las necesidades siempre dinámicas de cada lugar y época. Tipificadas
las mismas cualquiera que fuere que las realizara, debía ser sancionado.

No es sino hasta pasada la mitad del siglo XIX, donde comienza la verdadera revo-
lución en esta disciplina. En efecto, el médico forense italiano Don Cesare Lombroso en su
libro “El hombre delincuente”, expresa que había determinado anomalías congénitas de
morfología estructural orgánica en los criminales cuyas necropsias había realizado. Esto le
permitió elaborar su teoría, sustentada en todo su accionar como médico patólogo en la
Morgue Judicial de Roma, donde colige que estas anomalías serían las causales que los
condicionaron o predeterminaron a cometer delitos.

Dedujo así que el hombre no elegía ser delincuente, sino que fuerzas atávicas pro-
vocaban anomalías orgánicas en determinadas personas y estas se veían compelidas a
cometer delitos, aún sin su voluntad. Esta teoría causó profundo efecto en el mundo crimi-
nológico, ya que debía considerarse la concreción de un hecho como resultado de fuerzas
exógenas al hombre predeterminismo- y no como producto de su voluntad. Esto los
transformaba de victimarios en víctimas.

Posteriores determinaciones establecieron por un lado que, algunas personas sin


esos estigmas orgánicos, habían tenido sin embargo una larga trayectoria delictiva y por otro,
que otras personas presentando algunas de esas anomalías, no habían cometido jamás un
delito. Esto que probaba lo erróneo de la teoría lombrosiana y como lógica consecuencia
su refutación, ocasionó como efecto contrario, una verdadera revolución criminológica.
Junto con Garófalo y Ferri crearon una nueva cosmovisión del mundo delictivo naciendo la
Escuela Positiva. Negaron el libre albedrío y consideraron como factor de causalidad

tomo 1 investigación científica del delito ) 85


educación a distancia (instituto universitario de la P.F.A.)

al determinismo atávico o paso atrás en la evolución del hombre. La pena ya no era


una responsabilidad moral del delincuente, sino una medida cautelar contra su pelig-
rosidad. Además no debía ser una pena fija, sino que esta debería fijarse teniendo en
cuenta las particularidades de cada delincuente, según su grado de peligro.

La Criminología moderna, sin perjuicio de las distintas clasificaciones delincuenciales,


teniendo en cuenta los factores psíquicos, sociales, culturales, etc. del hombre, engloba en
la Escuela Ecléctica Pragmática los tres parámetros a tener en cuenta: las conductas
que previamente deben ser tipificadas como delito, el hombre que las realiza valorando
su libre albedrío y las causales endógenas que intervienen en la formación de su per-
sonalidad; a las victimas que la padecen para interpretar su rol y de allí valorar el rol
del delincuente y por último las penas con un amplio margen de mínimos y máximos
para que su aplicación sea tema de estudio y valoración del magistrado en cada caso.
Como se comprenderá esta escuela no hace otra cosa que tomar conceptos de las
otras dos y en forma práctica o pragmática vincula ambos conceptos.

Los códigos penales de la mayoría de los países del mundo, incluyendo la Argentina,
adoptan la postura de esta escuela, valorando el libre albedrío y las circunstancias especiales
de cada hombre delincuente y víctima, sin perder de vista la permanente y dinámica nece-
sidad de evaluar las conductas humanas, tipificar las atípicas y las antisociales y legislarlas
como antijurídicas o delitos, con penas que cumplan funciones de reparación de daños sin
perder de vista la evaluación del grado de peligrosidad individual.

La Criminalística y otras ciencias

En el cumplimiento de cualquiera de sus funciones y en todos los capítulos temáti-


cos detallados, la Criminalística encuentra permanente y fecunda interrelación con otras
disciplinas técnicas y científicas que aportan o pueden aportar auxilio en el cumplimiento
de las tareas que le son propias.

Así recurre a las artes gráficas para la determinación de medidas de seguridad


documentales y en papeles monedas. A la ingeniería y arquitectura en casos espe-
ciales de incendios, explosiones y determinaciones de peligrosidad; al dibujo técnico
en la confección de croquis, planos e identificación de personas; a la fotografía
tanto de lugares, de multitudes o a través de microscopios o aparatología técnica; a
la computación para la comprobación automática de identidad humana; a la física
para el uso de luces, sus longitudes de ondas, frecuencias, mediciones; etc.

86 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

abogacía a distancia sf)


síntesis final

HOMBRE Por naturaleza: eminentemente social


Por conducta: socialmente conflictivo
Por derechos: amparados por ley
Por obligaciones: requiere correctivos

REQUISITOS JUZGADOR

Para autoridad: jurisdicción y competencia


Para juzgar: conocer la verdad
Para imparcialidad: dar a cada uno lo que le corresponda
Para justicia: aplicación de la ley

EVOLUCIÓN MEDIOS DE PRUEBA

La providencia o el juicio de las Ordalías


La Confesión o Reina de las pruebas
El testimonio
La prueba indiciaria o testigos mudos

CRIMINALISTICA Determinación del hecho, sea delictivo o no


Determinación del autor o autores
Conformación de la prueba material
Responde al: ¿Cómo, cuándo, dónde y quién?

CAPITULOS

Documentológico, también llamado caligráfico o scopométrico


Balístico: estudia balística interior, exterior y de efectos
Identidad Humana: sistemas de identificación directo e indirectos
Accidentología: general, del hogar, laboral y vial
Químicas: aplicación de este orden de técnicas

tomo 1 investigación científica del delito ) 87


educación a distancia (instituto universitario de la P.F.A.)

FUNCIONES

Investigativa: aporte de la técnica científica en el lugar del hecho


Pericial: interrogatorio de los testigos mudos por parte de los peritos
Prevencional: aportes técnicos científicos para dificultar fraudes

DIFERENCIAS

Con la Medicina y Medicina Legal


Con la Criminología
Con otras: ingeniería, física, arquitectura, fotografía, dibujo, etc.

PERITOS

Habilitación e indoneidad
Diferentes roles acordes a designaciones y funciones
Excusaciones y recusaciones. Inhabilitaciones
Responsabilidades
Diferencia con los testigos

INFORME PERICIAL

Fechado. Importancia para las jurisdicciones


Autoridad requirente: según competencia
Presentación perito, habilitación y rol desempeñado
Objeto de la peritación: reproducción de interrogantes
Elementos ofrecidos: dubitados e indubitados
Operaciones, estudios y comprobaciones realizadas
Conclusiones periciales
Pedidos de explicaciones e impugnaciones

88 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

( BIBLIOGRAFÍA DE LA UNIDAD II )

Bibliografía obligatoria

n ALBARRACIN, Roberto; “Manual de Criminalística”; Editorial Policial; Bs. As. 1971.

n GUZMAN, Carlos; “Manual de Criminalística”; Ed. La Rocca; Bs. As. 1997.

n BONILLA, Carlos; “La pericia en la Investigación”; Ed. Universidad. Bs. As. 1996.

Bibliografía optativa
n “Revistas Mundo Policial”; Editorial Policial.

n DEL PICCHIA, José; “Tratado de Documentoscopía”; Ed. La Rocca. Bs. As. 1993.

tomo 1 investigación científica del delito ) 89


u3
unidad tres

( investigación científica del delito


)
educación a distancia (instituto universitario de la P.F.A.)

CONTENIDOS DE LA UNIDAD III

( INVESTIGACIÓN CIENTÍFICA DEL DELITO )

Mención sintética de los contenidos

1. La Inspección Ocular. Importancia de no alterar el lugar donde se han producido los


hechos.

2. Estudio de los diferentes métodos que pueden implementarse para asegurar su correcta eje-
cución.

3. Técnicas de ejecución para asegurar el lugar, determinar testigos que puedan aportar
datos y elaborar una hipótesis de producción de los hechos.

4. Prioridades en la intervención. Registro fotográfico o por otros medios para congelar


la escena.

5. Búsqueda, revelado, señalización y registro de los rastros hallados.

6. Formas de levante, conservación y traslado de testigos mudos.

7. Reglas de precisión, integridad y método enunciadas por Marchessau.

8. Planos de Kenyers. Formas de cumplimentarlos para transformar la prueba testimonial


en prueba material.

9. Evaluación de los trabajos oportunamente realizados para sostener o desvirtuar la prueba


producida a partir de la inspección ocular.

10. Concepto absoluto y relativo de los indicios.

tomo 1 investigación científica del delito ) 93


educación a distancia (instituto universitario de la P.F.A.)

94 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

abogacía a distancia oa)


objetivos de aprendizaje de la unidad

n A través del concepto de “El Retrato del Lugar del Hecho”, tomar conciencia que el
mismo permite tanto al Juez, como al Ministerio Fiscal y a los abogados de las partes,
conocer el lugar donde se produjeron los hechos

n Comprendido esto, valorar la importancia de la realización de una Inspección Ocular


hecha en tiempo y forma, y por qué debe ser considerada como un hecho único e ir-
reproducible.

n Introducirnos en la metodología que se debe implementar en su realización, para que


su resultado alcance rigor técnico y científico.

n Al precisarse la importancia del cumplimiento sistemático de cada uno de sus pasos,


se pone al descubierto los errores que su inobservancia puede ocasionar y que en
definitiva, redundan en la posibilidad cierta del esclarecimiento de los hechos.

n Comprender por qué cada una de las partes intervinientes en la misma deben ocupar,
para no alterar o desvirtuar su cometido, un orden de prioridad que debe ser respetado
en toda ejecución.

n Conocer, para poder evaluarlas, las diferentes técnicas a implementarse según los
lugares donde se practique la inspección ocular ya que, acorde a sus características,
deben utilizarse una u otras.

n Conocer qué y cuáles son las formas de búsqueda de los testigos mudos, cómo pueden
encontrarse y qué aptitud se debe adoptar en cada caso para su señalización, su registro y
las formas para su levante, para evitar anomalías que puedan hacerles perder su valor.

n Detallar las normas que imponen su realización, a fin de poder verificar el cumplimiento


de las formas que la ley establece.

n Entender que, una vez hallados esos rastros, deben tomarse ciertos recaudos que
hacen a su conservación, remisión y entrega, para que no pierdan su efectividad.

n Diferenciar los conceptos de prueba testimonial y material, como así también los con-
ceptos de prueba e indicio.

n Comprobar las exactitudes o falencias de los procedimientos cumplimentados, para


poder valorar dentro de las reglas de un sano razonamiento, a este importante medio
investigativo.

tomo 1 investigación científica del delito ) 95


educación a distancia (instituto universitario de la P.F.A.)

96 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

( ESQUEMA CONCEPTUAL DE LA UNIDAD III )

INSPECCIÓN OCULAR

Oportunidad para su realización

Actuación irreproducible

Disposiciones legales a cumplimentar

Adopción de método acorde a circunstancias

Asistencia urgente a las víctimas

Aseguración del lugar para evitar contaminación

Interrogatorio e identificación testigos

Inspección previa para elaboración de hipótesis

Registro fotográfico o fílmico

Participación ordenada y sistemática de peritos

Forma en que se pueden hallar los rastros o testigos mudos

Señalización y registro una vez revelados

Levante acorde a estados y a recaudos legales

Protección, embalaje, aseguración, conservación y traslado

Entrega al tribunal o a peritos

Reglas de procedimiento

tomo 1 investigación científica del delito ) 97


educación a distancia (instituto universitario de la P.F.A.)

98 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

abogacía a distancia ai)


actividad introductoria

Como actividad inicial de esta unidad y para comenzar a familiarizarse con los temas que
se tratarán, lea y analice el siguiente texto tomado del Manual de Criminalística de Roberto ALBAR-
RACIN de la Editorial Policial, donde se detallan los pormenores de una inspección ocular. Si bien
el texto relata un hecho de hace varias décadas atrás, sigue teniendo total vigencia.

Concluida la lectura, efectúe un breve comentario sobre los aciertos que se destacan del
accionar el funcionario interventor y mensure los errores que podría haber cometido. Acorde a sus
conocimientos actuales, evalúe la situación y la forma de encarar la causa, colocándose tanto en el
rol de abogado de la querella, como en el de la defensa.

tomo 1 investigación científica del delito ) 99


educación a distancia (instituto universitario de la P.F.A.)

100 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

( DESARROLLO DE LA UNIDAD III )

Retrato del lugar del hecho

El Retrato del lugar del Hecho o Inspección Ocular debe encuadrarse dentro del
accionar investigativo de la Criminalística, ya que su intervención es requerida luego de
haber ocurrido un hecho delictuoso o de apariencia delictuosa. Tomado conocimiento del
mismo por parte de la autoridad correspondiente, ésta debe abocarse sin demora alguna
a efectivizar todas las diligencias necesarias para su averiguación.

En la casi totalidad de los hechos, es el funcionario policial el primero en arribar al


lugar donde éste se ha producido, tomando conocimiento de las circunstancias que lo
rodean, determinando el tipo de acción penal -acorde a lo dispuesto en el artículo 71
del Código Penal- y de corresponder su participación, debe abocarse a lo dispuesto
en el artículo 184 inciso 2°del Código de Procedimientos en Materia Penal, es decir
a cuidar y conservar los rastros materiales y a preservar de modificaciones el lugar
hasta que lo disponga la autoridad judicial competente.

En la práctica, el arribo o la disposición fáctica de la autoridad judicial en el lugar


de los hechos sólo se efectiviza en muy contadas ocasiones, por lo que la ley le confiere
como atribuciones dentro del mismo artículo en su inciso 4, ante el peligro de que cualquier
demora comprometa el éxito de la investigación, la facultad de hacer constar el estado de
las personas, de las cosas y de los lugares, mediante inspecciones, planos, fotografías,
exámenes técnicos y demás operaciones que aconseje la Policía Científica.

Esta norma surge de la experiencia y del conocimiento, ya que cuando se comete


un hecho, quedan en el lugar un conjunto de rastros, huellas, objetos, señales y manchas
de diversas naturaleza que a prima facie pueden orientar la investigación y que posterior-
mente pueden transformase en las evidencias o las pruebas, que permitan la determinación
fehaciente del hecho y la individualización de sus autores.

Las diligencias practicadas por la autoridad competente y que tienen como finali-
dad la búsqueda, protección, levantamiento, conservación, vinculación y posterior envío a
los laboratorios periciales para su evaluación, de los indicios o huellas que quedaran en el
lugar del hecho, es lo que se denomina Inspección Ocular
Ocular, que por sus características
y resultados toma también el nombre de Retrato del Lugar del Hecho.

tomo 1 investigación científica del delito ) 101


educación a distancia (instituto universitario de la P.F.A.)

Como se viera en la unidad anterior, la búsqueda de la verdad de un hecho debe


hacerse a través de elementos objetivos, donde la subjetividad no pueda alterarla, ni aún en
forma involuntaria. La inspección ocular tiene como objeto entonces, analizar las circunstan-
cias de un hecho en procura de esos “testigos mudos”. Para que su resultado aporte
los múltiples beneficios que de ella se desprende, es de vital importancia efectuarla
en forma metódica y sistemática, cumpliendo las normas de forma que cada jurisdic-
ción imponga.

A fin de precisar con exactitud los términos utilizados, se aclara que se denomina


“lugar de los hechos”, al espacio de forma y extensión variable donde se concretó
el mismo, sus actos preparatorios y/o posteriores. En los mismos, por muy prolija
que haya sido la intervención de su autor o autores, siempre quedarán rastros de su
producción y de sus interventores. El minucioso estudio de esos lugares, contribuirá
a conformar la prueba indiciaria y con ella el probable de la verdad.

Por las circunstancias descriptas debe ser realizada con atención, esmero, minucio-
sidad e imparcialidad. Es tanta y tan diversa la gama de elementos que pueden constituir
evidencia, que requiere de personal altamente capacitado para su realización y de una
alta rigurosidad técnica en su ejecución. Debe tenerse en cuenta que es un acto único
e irreproducible, ya que el mismo accionar de los investigadores y la búsqueda y
recolección de rastros, modifica en forma inexorable ese lugar.

Es entonces, una fuente informativa de los mecanismos de producción y ejecución


de un hecho. Los datos aportados, sin embargo, deben ser descifrados y al igual que las
piezas de un rompecabezas, deben ser interpretados y vinculados correctamente.

Como se comprenderá, la correcta ejecución de estas diligencias es fundamental


para los resultados a obtenerse. Además cuanto más rápido se haga, mejores serán sus
logros. Empero son varias las causales que inciden sobre los mismos. En algunos casos,
la ansiedad por determinar la magnitud de su infortunio hace que la víctima manosee el
lugar, remueva u ordene lo alterado. En otros, los curiosos o familiares que se acercan al
lugar, sacan el arma para evitar que pueda ser tomada por los niños o limpian la sangre
u otras manchas antes que éstas dañen muebles o alfombras.

Todos deberíamos tomar conciencia de que ese lugar no puede ser alterado hasta
que no se realicen sobre él, todas las diligencias técnicas y científicas que permitan el es-
clarecimiento el hecho.

102 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

Cada hecho en particular debe ser considerado como una entidad única, ya
que las circunstancias, personas o cosas involucradas en él, los serán. Sin embargo
la correcta realización de una inspección ocular, requiere cumplir metodológica y
sistemáticamente todos y cada uno de los pasos necesarios en el orden o secuencia
correspondiente. Aún debiéndose tener en cuenta cada caso en particular, el proced-
imiento adecuado recomienda el cumplimiento de los siguientes requisitos:

l Comprobar la necesidad de asistencia a las personas involucradas. Esto es prioritario.


Como es lógico, prestar el urgente auxilio a quien lo requiera se torna primordial, aún a costa
de la pérdida de rastros o huellas fundamentales para el esclarecimiento del hecho.

Todas las personas involucradas en un hecho que presenten lesiones de cu-


alquier tipo deben ser urgentemente examinadas, tratadas o en su caso trasladadas
a nosocomios o lugares adecuados. Bajo ningún pretexto, por grave o riesgoso que
esto pueda resultar para el buen desarrollo de la causa, puede posponerse esta asis-
tencia. Esta regla o premisa es incuestionable.

En los casos en que dicha asistencia no deba cumplimentarse, por más grave
que sea el hecho, por ejemplo un homicidio donde ya no hay nada que se pueda
hacer para ayudar a la víctima, la regla o premisa es que no se puede alterar o
mover nada, hasta que no se hayan realizado todas las cooperaciones técnicas
o científicas posibles.

l Asegurar el lugar por cualquier medio que fuera. Esto implica que no accedan al
lugar del hecho y a sus zonas de influencias personas que, aún con afán de ayudar, lo
contaminan, destruyendo involuntariamente rastros fundamentales o provocando otros
ajenos al hecho, con la consiguiente pérdida de tiempo y esfuerzo que conllevan su
análisis, estudios y descartes.

La técnica más simple es la de cercar con cintas, cuerdas, hilos, personas, etc. el
lugar, debiéndose tener en cuenta que no se debe proteger sólo el lugar exacto donde se
encuentra el cadáver por ejemplo, sino también las zonas perimetrales y adyacentes.

Cuando ocurre un hecho grave y se da cuenta a la autoridad policial, la dependencia


que desplaza móviles autoriza además de los que poseen competencia por lugar, a otros
que estando en las cercanías puedan brindar ayuda o intervenir en el hecho urgente. Esto
en la práctica hace que en muchos casos se reúnan varios funcionarios policiales prestos
a intervenir, auxiliar y participar activamente en hacer cesar el hecho, proteger y auxiliar a
las víctimas y proceder a la detención de los autores.

tomo 1 investigación científica del delito ) 103


educación a distancia (instituto universitario de la P.F.A.)

De estar aún los autores en el lugar o ante la necesidad de auxiliar a las víctimas, su
accionar resulta altamente eficaz, resultando invalorable su presteza y abnegación. Lógica-
mente la determinación de estas circunstancias sólo es posible apreciarlas al llegar al lugar
e intervenir y luego de adoptadas las medidas adecuadas.

En los casos en que se determina que no es necesaria su participación y/o luego


de su participación necesaria, se pone en evidencia las partes negativas de este ac-
cionar, que no sólo no puede repararse en ese caso particular, sino que seguramente
volverá a ocurrir en circunstancias análogas.

La presencia de muchas personas en el lugar donde se ha producido el hecho, trae


aparejado que sus desplazamientos borren, oculten, anulen o destruyan rastros o huellas
que a la postre hubieran podido resultar fundamentales en el esclarecimiento del mismo.
Además así como los autores sin querer dejaron sus rastros, ese personal desplazándose,
dejará de igual manera otros totalmente desvinculados con el hecho.

La pérdida de aquellos y el hallazgo, recolección y estudio de éstos, ocasionan ver-


daderas circunstancias negativas que inciden en el resultado final de la investigación. Sin
embargo, como se comprenderá, esto es inevitable y no puede remediarse. Por ello se hace
indispensable que todo lo que sí pueda evitarse, deba ser cumplido rigurosamente.

Volviendo al ejemplo del rompecabezas, se puede ampliar el concepto del tema


tratado. Consideremos al hecho resuelto como un rompecabezas completo y armado. El
mismo puede estar compuesto de muchas piezas que ocuparán un determinado lugar y que
encastrarán adecuadamente con las otras. La falta de unas pocas piezas no nos impedirá
determinar su dibujo completo, pudiéndose apreciar cabalmente su forma, extensión y
características. Idénticas circunstancias ocurren con un hecho determinado.

Cuando se adquiere este pasatiempo en un negocio, por muchas que sean las pie-
zas que lo componen, tenemos la certeza de que todas les pertenecen y que nuestra tarea
sólo será ubicarles su posición y encastrarlas con las restantes. En un hecho se recogen
en el lugar todos los rastros, huellas y manchas que se detecten, sin saber si pertenecen
al mismo o no. Es decir no están señalizadas cuáles son atinentes y cuáles no. El buscar la
posición de una pieza es tarea no fácil, pero es aún más difícil si esa pieza no corresponde
a ese juego. Esto resulta cuando lo analizado es un rastro o huella dejado por algunas de
las personas que pasaron por el lugar, pero que no participaron del hecho.

Otra circunstancia negativa es la pérdida de rastros o huellas. Algunas piezas del


entretenimiento mencionado pueden resultar imprescindibles como guías de otras. Su falta
puede ser determinante en su armado final. Esto puede ocurrir si se destruye o pierde un
rastro por el accionar de personas no vinculadas con el hecho.

104 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

El armado del hecho necesita sin duda, que no se pierda ninguna pieza fundamental
ni se agreguen otras que nos induzcan a error. Ello requiere proteger el lugar utilizando
para ello el procedimiento o la técnica más fácil, rápida y eficaz.

l Interrogar e identificar a todas las personas que se hallaren en el lugar o en sus


adyacencias, mientras aún tengan frescos los detalles y antes de que puedan alejarse.
Esta necesidad está receptada por el código de forma en materia penal en su artículo
184 inciso 3. Dicho artículo, además, otorga la facultad de no permitírseles, en caso
de necesidad, que se alejen del lugar o que se comuniquen entre sí, debiéndose dar
cuenta inmediata al juez.

Las personas que se encuentran en las inmediaciones o cercanías del lugar del
hecho pueden haber captado a través de sus sentidos, alguna circunstancia que, por si
sola, no permita dilucidar nada, pero que en conjunto con otras puede llegar a aportar datos
valiosos.

Detectar e identificar a éstas oportunamente resulta imprescindible, ya que es sabido


que luego de haber satisfecho sus a veces morbosas necesidades de curiosidad, estas
personas se alejan del lugar porque no desean verse envueltas en todas las incomodidades
que implica la actuación como testigo.

Por otra parte no debe descartarse que entre las mismas se encuentren el o los
autores, cómplices o auxiliadores que no tuvieron oportunidad de alejarse, o los partícipes
por ejemplo de unas lesiones u homicidio en riña. De allí la necesidad de retenerlos aún por
medio de la fuerza pública, siendo asimismo oportuna la reforma dispuesta por Ley 25.434
que agrega que no se deben comunicar entre sí.

l Asegurar con registros fotográficos, fílmicos o por cualquier otro medio tecnológico
la escena completa, a fin de registrarla fidedignamente antes de que sea alterada y
para que en la causa quede debidamente documentada. Se debe tener en cuenta que
la autoridad judicial probablemente sólo conocerá el lugar a través de este medio, al
igual que el ministerio fiscal y los letrados de las partes.

Esta circunstancia, además de ser obligatoria por ley –inciso 4° del artículo 184 del
código citado, aporta un sin número de utilidades. El congelar en forma permanente y por
documentación fidedigna el lugar y las condiciones en que se encontraba al arribo de la
autoridad, permite en caso de alguna alteración involuntaria de parte de esa escena, que
se pueda volver a reconstituir en forma exacta.

tomo 1 investigación científica del delito ) 105


educación a distancia (instituto universitario de la P.F.A.)

Además, conjuntamente con otras cooperaciones como ser croquis, planos, etc.
conforma un verdadero retrato del lugar de los hechos que permite a todos aquellos que de
una manera u otra deban participar en la causa, tener un acabado conocimiento de como
era éste y cuáles eran las condiciones que presentaban luego del hecho.

Una importante tarea criminalística es el estudio y valoración de las causas desde


ese punto de vista, aportando perspectivas diferentes y extrayendo información que pueden
hacer cambiar el rumbo o la estrategia profesional por parte de los abogados de las partes,
ya que aporta una visión específica al atar cabos que por sí solos no indican nada, pero que
aunados y con la amplia visión técnica científica del profesional actuante, logran resulta-
dos sorprendentes. Lógicamente la evaluación se efectúa solamente a través de todas las
circunstancias reunidas en la causa, donde la documentación fotográfica de la inspección
ocular se torna imprescindible.

l Aquél que tenga a cargo la diligencia debe realizar una inspección del lugar sin alterar
nada, con el fin de poder elaborar una hipótesis de cómo pudo producirse el hecho,
por dónde entraron, se desplazaron y salieron el autor o autores, y dónde pueden en-
contrarse rastros o huellas acorde a cada caso en particular.

Acá debe tenerse absolutamente claro que la inspección debe ser dirigida por una sola
persona, aunque sean varias las participantes. La autoridad judicial o aquél que la representa
es la que debe dirigirla. Para ello y luego de una rápida apreciación del lugar y sin provocar
ningún tipo de alteraciones, deberá reconstruir los posibles movimientos de los participantes
del hecho, deduciendo las cosas que pudieron ser utilizadas, movidas, tocadas o dejadas por
ellos. Todos esos datos le permitirán elaborar una hipótesis, pero sin dejar de valorar también
todos los restantes elementos o rastros aunque no concuerden con ella, ya que ellos podrían
hacerla variar y verificarla como falsa, haciendo necesaria la elaboración de una nueva.

Acorde cada hecho en particular, esta primera apreciación le indicará por un


procedimiento deductivo, el orden de prelación en la que deberán intervenir los distintos
técnicos o profesionales.

l Acorde a esa determinación, deberá disponerse el ingreso de los diferentes profesio-


nales o técnicos específicos; médico legista, personal de rastros, de balística, químicos,
planista, etc. Su participación obedece la realización de tareas fundamentales que
deben ser cumplimentadas en el lugar. Debe cumplirse en cada etapa con las formas
dispuestas por la ley. El artículo 138 del Código Procesal Penal de la Nación, estipula
que para dar fe de los actos realizados se labrará acta, debiendo estar asistidos, el juez

106 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

por el secretario y los funcionarios policiales por dos testigos ajenos a la Repartición,
en este tipo de diligencia.

Se hace necesario hacer aquí algunas consideraciones con respecto a la intervención


de los distintos profesionales que deban participar del acto. La intervención en el lugar del
médico legista, por ejemplo, además lógicamente de certificar el deceso de la víctima, es
la de apreciar desde el punto de vista médico legal, todas las circunstancias que rodean al
hecho para establecer si es compatible con las heridas o daños corporales que presenta.

Debe tenerse en cuenta que el o los autores de un hecho poseen información


cierta y saber que aún involuntariamente y a pesar de los múltiples cuidados que pueda
tener, donde se comete un hecho quedan, inexorablemente, rastros o vestigios de él. Por
eso no es infrecuente que una vez cometido el mismo traslade la escena a otro lugar en
procura de dejar los menos posibles.

El médico legista, la mayoría de las veces trabajando en condiciones adversas en cuanto


a luminosidad, comodidad y posibilidades ciertas de poder practicar un examen meticuloso,
debe justipreciar todas las circunstancias exteriores que le permitan apreciar por la posición
de los cuerpos, de las cosas y de las armas empleadas, si puede tratarse de un homicidio o
de un suicidio. De considerar la primer posibilidad, si se ha cometido en ese lugar, valorando
además cantidad de humores humanos, temperatura del cuerpo, heridas mortales, etc.

Todo ello no puede ser realizado fuera de ese ámbito, por lo que se hace imprescindible
su participación en el lugar. En la morgue judicial, ya cubiertas todas las necesidades profesio-
nales, emitirá un informe sobre las causas y mecanismos de la muerte y nuevamente deberá
justipreciar con los datos obtenidos en la inspección “in situ”, si resultan compatibles.

Con respecto al personal técnico de rastros, además de verificar los lugares indicados
por el interventor acorde a su hipótesis, deberá indagar en todos aquellos que su experiencia
le aconseje, en procura de todos aquellos rastros o huellas que en forma directa o indirectas
permitan el esclarecimiento del hecho.

El relevamiento fotográfico y topográfico, como así también el del personal técnico


balístico o accidentológico según los casos, deben cumplimentar idénticos requisitos.
Todas sus actuaciones deberán ser volcadas en un acta, guardando las formalidades que
taxativamente establece el Código Procesal Penal de la Nación en el Libro I, Capítulo IV,
Título V, Actos Procesales.

tomo 1 investigación científica del delito ) 107


educación a distancia (instituto universitario de la P.F.A.)

l Encontrado cada uno de los rastros, huellas, manchas, etc., antes de ser removidos,
deben señalizarse, identificándoselos en el orden en que van siendo hallados a través
de números correlativos.

Esta simple premisa permite en todo momento tener perfectamente identificado a cada
testigo mudo, su procedencia, ubicación, estado y demás circunstancias particulares. Asimismo,
en los casos en que se efectúe la reconstrucción del hecho, verificar las posibilidades fácticas
de su concreción según la forma relatada por las partes y/o documentadas en la causa.

La forma de realización es tan simple, práctica y fácil que no ofrece ninguna dificultad,
porque no requiere de elementos sofisticados ni de complicada ejecución. Una simple hoja
y un elemento escritor común, son suficientes.

Para precisar el significado de los términos utilizados o que se pueden utilizar,


se hace necesario efectuar las siguientes consideraciones acerca de los mismos:

Informaciones: son todos los datos obtenidos en forma investigativa y proveniente de


rumores, informes, exámenes, etc. Pueden procurarse a través de personas u objetos, o
por medio de interrogatorios, entrevistas, análisis, cooperaciones o vigilancias en general.
Es tarea del investigador evaluarlas y descartar errores o mentiras. Pueden obtenerse
altos valores investigativos, aún a través de pequeños fragmentos o detalles.

Evidencias: son todos aquellos medios que permiten que un hecho pueda ser aceptado
o rechazado. Pueden provenir de testimonios, objetos, documentos, antecedentes, etc. y
demuestran, aclaran o confirman hechos. Pueden ser directas: establecimiento o existencia
de hechos a través de los sentidos; circunstanciales: establecimiento por medios indirectos
a través de otras personas; o reales: a través de objetos que hablan por sí mismos. Deben
cumplir con las reglas de pertinencia: relación directa con el caso; de validez: es decir ser
adecuada, suficiente, confiable; y de competencia: física, psíquica, legal, científica, etc.

Rastros: son todas las señales impresas o vestigios dejados por el paso de una persona
o que quedan de una cosa. Es decir todos los elementos dejados en forma consciente o
subconsciente por los actores de un hecho.

Manchas: trazas o marcas dejadas por algo. Se diferencian o se destacan de la superficie


que las contienen, por su color, su olor, aspecto y forma.

Huellas: improntas dejadas por diversas causas ante el apoyo de partes del cuerpo hu-
mano o de las cosas, sobre otras superficies aptas para recibirlas.

Indicios: acciones o señales que dan a conocer lo oculto. Con relación a nuestro estudio
y tal como los vemos podemos decir que son los dichos de los testigos mudos. Estos

108 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

tienen dos valores opuestos. Uno de carácter absoluto y otro de carácter relativo. El ab-
soluto permite excluir a todo aquello que no esté debidamente relacionado. Por ejemplo
de encontrarse rastros de sangre de determinado grupo, factor y características genera-
les, excluye a todos los involucrados que no se ajusten a esas características. El relativo:
indica posibilidad pero no certeza. Siguiendo el mismo ejemplo, los que se ajusten a esas
características son posibles, pero no se puede afirmar categóricamente.

Pueden ser anteriores, concomitantes o posteriores al hecho. Su validez depende de la


sana crítica de aquél que tenga la responsabilidad de juzgar. Acorde a la evaluación en cantidad
y calidad de todos ellos, podrán dar por probada o no una participación o un hecho.

Pruebas: Conclusiones o resultados de los exámenes de las evidencias. Permiten la com-


probación de algo. Ajustándose a las consideraciones analizadas en unidades anteriores,
pueden provenir de la Confesión, del Testimonio y de aportes Técnicos y Científicos a
través de la prueba indiciaria.

l A continuación deben ser constatados por todos los interventores y fotografiados


en el lugar, dejándose expresa constancia en el acta labrada.

Aquí es importante destacar que todos y cada uno de los participantes en el acto
deben observar estos hallazgos, su documentación y descripción en el acta, quedando de
esta manera definitivamente situados, no siendo necesario luego recurrir a la memoria indi-
vidual de los mismos, que pueden llegar a proporcionar datos errados o variados. Además
el interventor confeccionará un croquis a mano alzada, que deberá ser suscripto por
cada uno de los intervinientes en el acto, consignando ubicación de cada rastro o
huella hallada, perfectamente individualizados con sus números.

El cumplimiento taxativo con respecto al croquis realizado por el interventor, sin la


necesidad de efectuar las mensuras y las escalas métricas requeridas en el procedimiento
topográfico, efectuado sobre cualquier papel y acorde a las habilidades individuales y pro-
pias, pero en presencia y con la firma de todos los intervinientes en el acta donde se precisa
la ubicación y situación de todas las evidencias halladas, constituye prueba material por
ser objetiva y no encontrarse supeditada a la capacidad intelectual, de retención de
datos, de redacción o descripción subjetiva por parte de los testigos de actuación.

l Se debe confeccionar plano a través del personal especializado, quien deberá mensu-
rar y dibujar en escala todas las dependencias, consignando todas las circunstancias
halladas.

tomo 1 investigación científica del delito ) 109


educación a distancia (instituto universitario de la P.F.A.)

Este tipo de relevamiento topográfico sí es realizado por personal idóneo con todas
las mensuras, escalas y formas dispuestas para un trabajo técnico especializado. Los datos
que debe tomar el personal en el lugar, serán oportunamente transferidos a dibujos, con-
signándose en ellos nuevamente todos los datos del croquis, pero a diferencia de aquél,
este será firmado sólo por su ejecutante y tomado como prueba testimonial.

l Se procederá luego al levantado de cada uno de los rastros, adoptándose en cada caso
las técnicas que sean más apropiadas, acorde al tipo hallado, su estado y forma.

Acorde al rastro hallado o a su estado, se deberá adoptar los procedimientos o las


técnicas que aseguren de la manera más simple su recolección y guarda. En virtud de la
extensa variedad de rastros o huellas que pueden ser hallados en el lugar de los hechos,
sólo se darán algunos ejemplos, los que sin embargo darán la orientación necesaria sobre
las formas de su realización.

Los testigos mudos dejados en la escena del hecho pueden ser hallados en alguna
de las formas que se detallan a continuación: visibles, latentes y moldeados o plásticos.
Visibles: son todos aquellos rastros, manchas o huellas que pueden ser apreciadas a simple
vista. Es decir que no requiere de ningún procedimiento específico para su observación. Las
causales de producción se deben a diversos motivos, como ser: por la acción de sustancias
colorantes de origen orgánico, inorgánico o sintético. Se detectan por diferencias de color
o contraste con respecto a las superficies que las contienen.

Latentes: son aquellos que no se perciben a simple vista. Para poder observarlos hace falta
que sean revelados, utilizando para ello diferentes longitudes de ondas lumínicas aplicadas
desde diferentes ángulos o reactivos de índole físico, químico u orgánico.

Estos rastros se encuentran en el lugar, pero en razón de no poder observarse a


simple vista requieren de la intervención de personal especializado que los detecte y rev-
ele. Dentro de la extensa variedad de este tipo de rastros, el más común de todos es el
dejado por los dibujos papilares ubicados en los pulpejos de la tercer falange de los dígitos
de la mano, conocidos como impresiones digitales. En la unidad correspondiente se
efectuarán los detalles de formación de estos dibujos. Baste por ahora entender que
tanto en esa falange de los dígitos de la mano, como en las palmas y en las plantas
de los pies se encuentran en forma caprichosa, una serie de dibujos formados por
las crestas y los surcos papilares.

Esas crestas poseen los poros de exudación de las glándulas sudoríporas que
segregan los humores por ellas producidos y que mantienen la superficie de las manos

110 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

permanentemente húmedas. Esa humedad a modo de entinte, permite los estampes de


esos dibujos como los producidos por un elemento sellador. Dado su aspecto transparente
e incoloro, ese estampe no es apreciable a simple vista cuando quedan depositados en
aquellas superficies aptas para su contención.

Estos rastros pasan desapercibidos para todas aquellas personas no acostumbradas


a su búsqueda. Para revelarlos, acorde a la superficie que los contenga, se utilizan diversos
procedimientos. El más práctico es el de la utilización de longitudes de ondas lumínicas
tanto del espectro visible como ultravioleta.

Al respecto debemos recordar algunas consideraciones con respecto a la luz. Los


ojos son sensibles a ella y nos permiten ver objetos y cosas a través de las formas,
colores y movimientos. Su descomposición en longitudes de ondas permite uti-
lizarla para diferentes fines y propósitos. Los Rayos X: poseen longitudes de onda
muy pequeñas; Ultravioleta: entre 40 y 4000 angstroms; Visible: es decir captada por
el ojo humano, va desde el azul hasta el rojo; e Infrarroja: corresponde a las mayores
longitudes de onda. La luz blanca posee todas estas longitudes de onda. Su descom-
posición a través de un prisma muestra el espectro completo.

Al incidir sobre un objeto, la luz nos marca su contorno permitiéndonos ver la forma
del mismo. Además ese objeto absorbe la totalidad de las longitudes de onda reflejando
sólo las correspondientes a su color. Ejemplo: un objeto de color azul recibe la totalidad
de las longitudes de onda de la luz blanca. Las absorbe a todas, reflejando solamente las
correspondientes a su color. Acorde a esto, un objeto blanco recibe todas las longitudes
de ondas y refleja la totalidad de estas ya que así se forma ese color. Un objeto negro por
el contrario absorbe la totalidad de las longitudes de ondas y no refleja o emite ninguna,
ya que ese color está dado por la ausencia de reflejo.

Algunos elementos poseen la propiedad de ser fluorescentes. Esto significa que ex-
puestos a determinadas longitudes de ondas, las correspondientes al espectro ultravioleta
por ejemplo- absorben esas longitudes y emiten bajo esas condiciones luminosidades que
le son propias. Esto determina que algunos elementos que no pueden ser visualizados con
luz blanca, sí lo sean bajo esas longitudes de ondas, por su propiedad fluorescente.

Además la luz blanca puede ser utilizada de diferentes maneras acorde sus ángulos
de incidencia. En forma Directa: la luz incide de pleno sobre el objeto, demarcando
su forma y permitiéndole reflejar su color. Por Transparencia: el objeto a examinar
debe ser colocado entre una fuente lumínica y nuestros ojos. La luz al pasar a través
de él, nos permite comprobar esta cualidad. Forma Tangencial o rasante: utilizando

tomo 1 investigación científica del delito ) 111


educación a distancia (instituto universitario de la P.F.A.)

cualquiera de los ángulos que se forman entre un haz de luz dirigido al objeto en
forma oblicua y otro en forma horizontal. Acorde como la luz incida sobre ese objeto
se podrán apreciar diferentes circunstancias.

Una de las formas de revelar rastros latentes es la utilización de diferentes longi-


tudes de ondas lumínicas, especialmente del espectro ultravioleta y/o con luz blanca en
forma tangencial o rasante. Esto es práctico cuando se trata de rastros en superficies
limpias, lisas y pulidas.

Otro procedimiento es mediante la utilización de reactivos físicos denominados


“polvos adhesivos”. Estos son polvos muy finamente tamizados -para eliminar la
posibilidad de formación de grumos- y que poseen la propiedad de ser adherentes.
Acorde a las superficies donde serán aplicados y para lograr un mayor contraste pu-
eden ser: blancos, negros, de aluminio, rojos, fluorescentes, magnéticos, etc.

También pueden utilizarse reactivos de orden químico. Estos son utilizados sobre
soportes de papel, cartón, madera, etc. y especialmente sobre rastros viejos. Entre los
más utilizados podemos mencionar la ninidrina o nynhidrina, el nitrato de plata, el yodo
metaloideo y vapores de yodo, solución de leucomalaquita en éter y otros.

Entre los más modernos se puede destacar la utilización del rayo láser que
permite su utilización sobre una amplia gama de superficies aunque estas hayan es-
tado expuestas a temperaturas extremadamente calientes o frías e incluso en aquellas
que han sido mojadas en agua. El equipo que se utiliza posee un rayo láser de ión
argón, que revela las huellas en color amarillo o naranja, permitiendo su observación
en forma directa y su fotografiado o proyección por circuito cerrado de televisión.
Otra ventaja que presenta es que no altera o afecta ni la superficie ni a la impresión,
por lo que además pueden utilizarse luego otros procedimientos.

Recientemente en Londres, se ha experimentado con una bacteria orgánica. Es-


tudios realizados sobre diferentes microorganismos, permitió determinar una bacteria
que prolifera en los componentes presentes en una huella, es decir la exudación de
las glándulas ya mencionadas. Esos microbios actúan sobre esos humores revelando
las crestas papilares. La especie bacteriana obtenida fue denominada “acinetobacter
calcoaceticus” que es mezclada con un gel fundido. Este se derrama sobre la huella y
se espera hasta que cuaje. Durante la incubación se forman en el gel unas colonias de
bacterias que coinciden con las crestas papilares, tornándolas visibles y permitiendo
su identificación.

112 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

Plásticas o moldeadas: son rastros visibles hallados sobre superficies blandas como ser:
plastilina, masilla, resina, jabón, chocolate, etc. Estas son producidas por el estampe por
presión de las crestas papilares sobre uno de esos soportes. Debe tenerse especialmente
en cuenta, que el estampe de las impresiones se produce por la diferencia existente entre
crestas y surcos, siendo las primeras las que deprimen las superficies blandas. Como es
lógico suponer lo que son altos relieve en las impresiones, pasarán a ser depresiones o
bajorrelieves en estas huellas. Se hace necesario hacer un contratipo o positivo.

Como surge de lo descrito en todas las posibilidades de encontrar rastros, es de


vital importancia tener en cuenta las distintas superficies donde éstos pueden encontrarse.
Las ideales son superficies lisas y pulidas tales como vidrio, espejos, maderas lustradas,
fórmicas, papeles de diferentes naturaleza, etc. Por ese motivo en una inspección ocular
debe prestarse especial atención a las mismas, especialmente en puertas, marcos, ventanas,
llaves de luz, mesas, vasos, etc. Pero como se ha visto, es posible encontrarlas en cualquier
lugar, por lo que los exámenes deben contemplar todas las posibilidades.

Acorde a sus portabilidades estas superficies pueden ser Móviles: es decir las
transportables o fáciles de mover. Ejemplo: armas, botellas, trozos de vidrio, etc.
También pueden ser Fijas: son aquellas que no pueden ser transportadas ya sea por
su volumen, peso o por ser parte de un inmueble.

De encontrarse, por ejemplo, una mancha se deben efectuar las siguientes


preguntas y consideraciones: ¿de qué es esa mancha?. En caso de pensarse que
es sangre ¿qué nos puede indicar con relación a su forma y tamaño?; ¿es humana
o animal?. ¿es de la víctima o del victimario? ¿de qué parte del cuerpo proviene?
¿qué características presenta?. En el lugar sólo es posible realizar reacciones de
orientación. Para éstas se utilizan diferentes compuestos químicos que al reaccio-
nar provocan coloraciones específicas. De no obtenerse el resultado esperado no se
trata de lo sospechado. De obtenerse, significa que es posible pero para su determi-
nación, se deberán efectuar las reacciones de certeza. Estas últimas se hacen en
los laboratorios criminalísticos correspondientes, luego de haberse procedido a su
levantado y remisión.

Dentro de los ensayos o reacciones de certeza, que en forma específica certi-


fican la presencia o no de sangre en una mancha, acorde a su comprobación pueden
describirse cuatro tipos diferentes:
a) métodos microscópicos;
b) métodos microcristalográficos;

tomo 1 investigación científica del delito ) 113


educación a distancia (instituto universitario de la P.F.A.)

c) métodos cromatográficos y
d) métodos microespectroscópicos.

l Dentro de los microscopicos, se observan por medio de microscopios los elementos


figurados de la sangre, es decir los glóbulos rojos o eritrocitos y/o los blancos o leu-
cocitos. Dentro de los microscristalográficos idéntica observación pero de los cristales
obtenidos por la acción de ciertos reactivos. Los métodos más utilizados son los de
Teichmann y el de Takayama.

l Con el método cromatográfico se utilizan sembrados sobre papel o placa delgada para
uso cromatográfico y con el método microespectroscópico se observa el espectro de
absorción de la oxihemoglobina, mensurándose sus longitudes de onda.

l Siguiendo el orden mencionado primeramente, debe examinarse la mancha en cuanto


a su forma, ya que una gota de sangre podrá tomar diferentes aspectos tanto en sus
bordes como en su tamaño. El análisis de estos datos nos permitirá por ejemplo esta-
blecer altura de caída, si al momento de la misma la persona se hallaba en movimiento
o en reposo, en que dirección y con qué rapidez se desplazaba, etc.

Véase a continuación el ejemplo gráfico de lo detallado. Todas las imágenes


fueron tomadas del Manual de Criminalística, Tomo II, de los autores GOBBI, PADULA.
PALACIOS y otros de la Editorial Policial y corresponden a gotas de sangre caídas sobre
una superficie plana. Debajo de cada una de ellas se consigna la altura de producción.
Nótese tamaños y bordes.

50 cm. Entre 50 y 100 cm. Entre 100 y 150 cm. Superior a 150 cm.

114 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

Cuando una gota de sangre cae en ángulo recto, la imagen resultante es siempre
casi circular. Su imagen va tornándose cada vez más ovoidal a medida que el ángulo de
impacto decrece. Si este es muy pequeño y se desprende una pequeña gota, ésta tomará
la forma de un signo de exclamación. Obsérvese en la figura siguiente el aspecto de gotas
de sangre caídas sobre una superficie con un ángulo de impacto inferior a 90.

En hechos de sangre, esta puede estar a simple vista sobre el cuerpo o ropas de
la víctima, en pisos, paredes, alfombras, etc., siendo fácilmente detectada. Pero también
puede darse que se encuentre enmascarada por un empapelado, en paredes oscuras,
en telas de tapizados, en cerramientos, puertas, bordes inferiores de los muebles, sifones
de lavatorios, en bolsillos, piel, uñas, plantas de pies, cabellos, etc. Debe extremarse la
búsqueda en todos los lugares, sean estos lógicos o no.

Teniéndose en cuenta el tipo de herida que presenta la víctima, con la cooperación


del médico legista se debe determinar si la cantidad es la que corresponde al tipo de lesión,
ya que pudo haberse limpiado el lugar o bien pudo haber sido cometido en otro sitio y
luego trasladado, debiendo adoptarse en cada caso, los procedimientos de búsqueda
correspondientes.

l Acorde a su estado la mancha puede estar en grandes o pequeñas cantidades, fresca,


coagulada, semi seca o seca. Para su levante se deberán adoptar diferentes técnicas. Si
está fresca se recoge en tubos de ensayo o frascos limpios, utilizando de ser necesario,
cucharas o pipetas para su recolección. Si está coagulada debe diluirse con solución fisi-
ológica, se la mezcla suavemente, se la levanta en tubos y se la conserva con hielo. Tam-
bién es posible hacerla absorber con papel o tela. Si está semi seca se la puede solubilizar
con agua destilada y recoger con papel de filtro o secante. Dejar secar al aire para evitar
putrefacción y luego tapar. Si está seca se puede raspar la superficie y recoger sobre papel
blanco. Si la superficie contenedora es móvil se puede secuestrar y remitir al laboratorio,
al igual que en los casos en que se puede recortar en lugar donde ésta se encuentra.

tomo 1 investigación científica del delito ) 115


educación a distancia (instituto universitario de la P.F.A.)

l Todas estas muestras deben ser rotuladas e identificadas, procediéndose además acorde
a disposiciones legales, no debiéndose mezclar las recogidas en diferentes lugares ya que
pueden pertenecer a diferentes tipos y se pueden contaminar. Deben tomarse muestras
de la víctima para cotejo posterior. No cumplir con esta simple diligencia puede ocasionar
la necesidad de posteriores exhumaciones con los consiguientes trastornos y dificultades
que trae aparejada dicha diligencia, especialmente para sus familiares o deudos.

l Ya en los laboratorios periciales se efectúan algunas de las reacciones de certeza ya


mencionadas a fin de establecer si es efectivamente sangre. Luego se debe determinar si
es humana o de animales y de que parte del cuerpo proviene. A título ilustrativo se hace
constar que se puede determinar si la sangre es de una hemorragia nasal por ejemplo,
al encontrarse restos de mucosidades; de origen menstrual por células de la mucosa
uterina que contengan; producto de una violación por la presencia de pelos púbicos o
semen, etc.

Además es posible determinar grupo y factor sanguíneo, enfermedades, uso de


alcohol o drogas, y entre otros y acorde a las características del caso, el genomio o código
genético contenido en los cuarenta y seis cromosomas del núcleo de una cédula, esencial-
mente constituidos por ácido desoxirribonucleico o ADN.

l De tener que levantarse un arma por ejemplo, se debe tener en cuenta que la misma
puede contener impresiones digitales, por lo que hay que prestar atención a su manipuleo.
También debe tenerse en cuenta que para su identificación a través de los proyectiles
disparados, es importante conservar el estado del ánima o interior de su cañón. Nunca
debe ser levantada introduciendo algún elemento por éste, ya que puede modificarlo. La
forma correcta es tomarlo con un lápiz o elemento similar, a través del arco de guarda-
monte que protege la cola del disparador, más comúnmente conocido como gatillo.

l De tener que secuestrarse un proyectil, dependerá donde éste se halle localizado. Si se


encuentra en una persona viva será el médico que determine los riesgos de su extracción o
no. Si no se lo extrae puede ser útil la obtención de una placa radiográfica a fin de efectu-
arse las consideraciones que puedan hacerse a través de este método. Si se extrae será el
médico cirujano, acorde a posibilidades, que buscará las formas de poder asirlo con pinzas
desde su ojiva y culote. De no poder hacerlo sin riesgos para la víctima, deberá extraerlo
como pueda, aún a costa de dañar la zona útil que impida su posterior identificación.

De hallarse sobre un cadáver el médico debe asegurar su extracción sin alterarlo.


De hallarse sobre un objeto móvil debe ser secuestrado y si lo está en una madera o pared,
debe horadarse la zona aledaña para que éste se desprenda, evitando lógicamente su caída
al suelo que podría modificarlo o dañarlo.

116 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

l Una vez levantado debe ser asegurado para evitar su sustitución. La forma más práctica,
efectiva y fácil es la envolver el rastro hallado y hacer firmar sobre el envoltorio a todos
los participantes, asegurando dicho embalaje con cintas adhesivas transparentes.

No importa la forma o tamaño que posea el rastro que se está levantando y secuest-
rando. En su gran mayoría es susceptible de ser envuelto, aunque para ello deba recur-
rirse previamente a la utilización de otro recurso. Debe prestarse especial atención a
la forma en que se realiza este tipo de medida, ya que su incorrecta ejecución puede
ocasionar daños irreparables en el testigo mudo hallado.

Aún los rastros líquidos se pueden envolver luego de ser envasados en tubos o
frascos. Si se trata de un rastro en un vaso, envolverlo significaría que el papel o la bolsa
borre o altere la impresión contenida en él, por lo que previamente debe ser asegurado en
una caja fijándoselo para que no se mueva dentro de ella y, posteriormente, embalarla.

Efectuado esto, debe asegurarse el contenido del embalaje a través de la firma de


todos los intervinientes en el acta. Esas firmas aseguran que es ése y no otro el elemento
secuestrado. Para asegurar además las firmas deben protegerse éstas por medio de
cintas adhesivas transparentes, ya que una vez fijadas su remoción es detectable por
los rastros que dejan sobre las fibras del papel o los daños producidos sobre ellas.

l También se hace necesario verificar la forma de embalaje y conservación. Cada rastro


o huella, sus condiciones y estados deben ser mensurados individualmente y se debe
adoptar la forma más adecuada acorde a esas circunstancias.

Como ya quedara claro, cada rastro debe ser embalado en forma individual para no
contaminar a uno con otro. Pero debe tenerse en cuenta que si se coloca por ejemplo, un
pañuelo embebido con sangre fresca en una bolsa de nylon y esta queda durante determi-
nado lapso de tiempo cerrada, inevitablemente esa sangre se degradará provocando hon-
gos y demás floras o faunas, que terminarán destruyéndola. Iguales inconvenientes traería
aparejado el secuestro de una fruta o porción de queso con el rastro de una dentada.

l El traslado de los elementos secuestrados debe hacerse de manera tal que no pueda
dañarse o modificarse su contenido.

No guardar los recaudos necesarios para el transporte y traslado de los rastros se-
cuestrados, puede hacer que estos se dañen o modifiquen. Por ejemplo, si se rompiera el
vaso que contiene la impresión digital, o se perdiera uno de los tubos contenedores de las

tomo 1 investigación científica del delito ) 117


educación a distancia (instituto universitario de la P.F.A.)

muestras de sangre u otros elementos, o el proyectil tan celosamente resguardado fuera


apretado o presionado por un pie o puerta, por nombrar sólo algunos.

l La conservación debe efectuarse acorde a las necesidades o condiciones de cada


rastro o huella secuestrado.

Cada tipo de testigo mudo, acorde a su composición y estado genérico requerirá


ciertas formas de conservación, hasta que pueda ser examinado. Por ejemplo las muestras
de sangre requerirán para su conservación que se guarde manteniendo una cadena de frío
para evitar su putrefacción. Si el rastro de una pisada hubiera sido levantado con yeso, debe
cuidarse que no se rompa o parta.

l Deben ser entregados a la autoridad judicial correspondiente o a los peritos o labo-


ratorios periciales ordenados por aquellos en tiempo y forma.

Debe asegurase que todos los testigos mudos recogidos en el lugar lleguen al destino
correspondiente no sólo en forma adecuada, sino también en el tiempo correspondiente.
Demorar la remisión de un rastro antes de su peritación o después de efectuada si hubiera
quedado pendiente de remisión, puede ocasionar su pérdida por extravío o por falta de con-
tralor del juzgado o de las partes. Esto, lamentablemente, no es tan infrecuente como a prima
facie pareciera.

Como corolario, es necesario tener una cabal comprensión de que todos los pasos
detallados y otros que acorde a los casos puedan darse, hacen que la realización de la in-
spección ocular deba ser efectuada con suma meticulosidad, minuciosidad e imparcialidad.
Al ser tantos los pasos a seguir, se debe asegurar que todos sean realizados correctamente,
ya que el error en uno sólo de ellos, trae aparejado la anulación de los demás. ¿De qué sirve
ser meticuloso en la inspección para el hallazgo de rastros, si éstos no quedan documentados
de donde son tomados?. De haber hecho esto, ¿si al levantarlo lo dañamos o contaminamos,
o no le damos la forma legal, o no lo protegemos y puede ser sustituido, perdido, dañado o
llegan en mal estado a su estudio?

Para el buen logro de esta diligencia, la misma debe ser realizada por un grupo de
trabajo compuesto por un oficial licenciado en criminalística, un suboficial especializado en
esa disciplina, un técnico en rastros, un fotógrafo, un planista y acorde al tipo de hecho, un
médico legista o un técnico en balística o en accidentología.

118 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

Los rastros o testigos mudos más comunes hallados en el lugar de los hechos son:
l Huellas dactilares o palmares,
l De pisadas con pie calzado, con medias y excepcionalmente descalzo.
l Rastros de fluidos corporales como ser sangre, semen, saliva, orina, etc.
l Rastros de componentes orgánicos: pelos, piel, uñas, etc.
l Rastros de accesiones utilizados por el hombre: fibras, colillas, fósforos, etc.
l Armas de fuego, proyectiles o vainas.
l Rastros de deflagración de pólvora y explosivos.
l Rastros de bebidas, alimentos, drogas, medicamentos, vidrios, etc.
l Rastros de ropas o elementos personales.
l Rastros de efracción
l Otros.

Todos los conocimientos teóricos y prácticos aportados por carreras, cursos y la


experiencia propia y ajena, hacen que aquellos profesionales que deban cumplir estas
tareas se encuentren cada vez más preparados para ejercerla. Sus resultados obviamente
dependerán de la habilidad, sagacidad, paciencia y meticulosidad del interventor. Sin em-
bargo el cumplimiento de la forma metódica y sistemática de las tareas a cumplimentar,
con las consiguientes variaciones propias de cada caso, lugar y ejecutante, ha demostrado
ser el mejor camino para la optimización de los resultados.

Por las características del hecho y las riquezas de elementos, se ha tomado como
caso ejemplificativo de una intervención profesional, un caso de homicidio. El personal
interventor debe tener permanentemente chequeado los elementos básicos que debe
contener el equipo para el cumplimiento de tan importante función. Idealmente son
aconsejables los siguientes elementos: Lupa, tijera, linterna, cuaderno de notas, números
señalizadores, marcadores, lápices, tizas, guantes de goma, sobres de embalaje, tintas
adhesivas de diferentes tamaño, pinzas varias, elementos de mensura tales como reglas,
metros, calibres, brújulas, rayo láser, etc., herramientas varias como ser llaves, destor-
nilladores, cortadores, espátulas, polvos adhesivos, plumones, hilos, plastilina, bolsas
plásticas, etiquetas, lacres, rotuladores, frascos o tubos de vidrios, etc.

Arribado al lugar se debe interiorizar de las diferentes alternativas del hecho a través
de todas las personas que se encontraran allí, efectuando una observación de carácter
genérico sin alterar la escena. Si la víctima está inmóvil se debe comprobar si requiere aux-
ilio inmediato. De no ser necesario se trazará el plan de acción a seguir. Se comenzará la
búsqueda de rastros sin tocar nada, efectuándose las anotaciones que correspondieran.

tomo 1 investigación científica del delito ) 119


educación a distancia (instituto universitario de la P.F.A.)

Posteriormente se tomarán las fotografías o se registrará la escena por cualquier


medio técnico, haciendo constar en forma panorámica todas las dependencias de modo
general y el lugar de los hechos en particular.

El personal de rastros, bajo la dirección del interventor, procederá a la búsqueda,


revelamiento y señalización de los testigos mudos, sin proceder a su levantado o modificación.
Se procederá a su fotografiado en el orden cronológico de su hallazgo y acorde a la numer-
ación asignada en la señalización de los mismos, empleándose las luces, filtros y equipos
adecuados. Es conveniente proceder a la mensura de las ubicaciones o de los objetos de
pequeño tamaño, a través de la colocación de reglas graduadas que deben ser registradas
fotográficamente junto con los objetos. Seguidamente, y acorde a las normas dispuestas
en el código de forma, se debe proceder a su levantado para el envío a los laboratorios de
criminalística correspondientes, labrándose acta de estilo y croquis a mano alzada.

El croquis a mano alzada realizado por el interventor al cual ya nos refiriéramos, debe
hacerse en forma inmediata en el lugar y en presencia de todos los intervinientes en el acto,
debiéndose corroborar todos y cada uno de los rastros hallados e indicando sus ubicaciones.
El mismo se puede realizar sobre cualquier tipo de papel y con cualquier elemento escritor.
Idealmente debería efectuarse de alguna de las dos maneras siguientes:

Croquis en cruz: toma este nombre por la forma que adquiere, similar a ese símbolo reli-
gioso. Dicho croquis debe trazarse desarrollando un cuadrado central que estará repre-
sentando al piso de la habitación donde se realiza la Inspección Ocular. Arriba, abajo, a
la derecha y a la izquierda de éste, deben confeccionarse otros cuadrados similares que
representarán las paredes de la habitación. Sobre cada uno de ellos se efectuarán las
señalizaciones, indicando las distancias correspondientes de los rastros hallados.

En el exterior de un edificio es relativamente sencillo sin contar con una brújula, ubicar
los puntos cardinales para indicar las posiciones de los elementos que se pretende describir.
No siempre ocurre lo mismo estando en el interior de la habitación de un inmueble, máxime
si el mismo no tiene conexión directa con el exterior. De estar absolutamente seguro, debe
utilizarse para demarcación de orientaciones esos puntos, dibujando la rosa de los vientos.
De no estarlo se debe describir las orientaciones, tomando como puntos de referencias
elementos fijos de esa habitación, por ejemplo una puerta o una ventana.

Croquis en Cruz Larga: las características de este croquis son similares a las descriptas
precedentemente. Sólo que debe agregarse un nuevo cuadrado inmediatamente por de-
bajo del cuadrado que representa una de las paredes, ubicado debajo del que representa
al piso de la habitación. Como se deduce, el nombre es por la figura formada y se utiliza

120 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

en los casos en que es necesario efectuar detalles o marcaciones de rastros en el techo


de la habitación. La realización de ambos croquis no ofrece dificultad práctica, aportando
reales beneficios demarcatorios, que permiten a los participantes comprobar en el lugar
fehacientemente los mismos, y recordarlos nuevamente cuando sean interrogados más
adelante, con la sola visualización de éstos.

El médico legista realizará el examen exhaustivo del cadáver y de las circunstancias


que lo rodean. Luego se confeccionará el plano del lugar por el personal técnico espe-
cializado, quien mensurará tamaños llevándolos a escala y detallando la posición de los
elementos acorde a la rosa de los vientos.

Antes de finalizar la tarea se debe efectuar una nueva inspección integral para com-
probar la ejecución total de las actividades. Se deben realizar, asimismo, inspecciones de
las adyacencias en busca de elementos relacionados.

Se dispondrá, luego el traslado del cadáver y de todo lo secuestrado, la clausura o


entrega del lugar, acorde lo dispuesto por la autoridad judicial.

Este tipo de inspecciones debe realizarse siempre desde lo general a lo particular, es


decir indicando los alrededores del lugar de los hechos, donde se determinará la presencia
o no de elementos vinculados, ya sean provenientes de actos anteriores o de preparación,
o bien posteriores con motivo de la fuga o de ocultamiento de indicios. Se hace necesario
detallar ubicación geográfica, indicando calle, número, piso, departamento, etc.

En el interior del inmueble donde hubiera ocurrido el hecho, se debe iniciar la


inspección también desde lo general a lo particular, detallando e inspeccionando todas
las dependencias del mismo en busca de idénticos indicios. Para el final se dejaría como
último paso el registro del lugar exacto de la producción de los hechos, a los efectos
de realizarlo con la meticulosidad debida.

Cualquier procedimiento utilizado que permita el riguroso examen y la completa real-


ización de esta diligencia, debe ser considerado como correcto. Empero se detallará a con-
tinuación lo que se ha denominado el plano de abatimiento de Kenyers, que no es otra cosa
que una serie de ingeniosos, simples y completos métodos de realización sistemática.

Método del Espiral: debe tomarse como centro de este método el preciso lugar de los
hechos o el lugar donde se encuentra, por ejemplo, el cadáver. Teniendo en cuenta este
punto central, el investigador procederá a la inspección de toda la habitación en el sentido
de las agujas el reloj y en forma centrípeta, es decir desde afuera hacia adentro, regis-
trando toda el área. Este método asegura el reconocimiento de toda zona, permitiendo
una exploración total y la posibilidad de señalizar y recolectar indicios.

tomo 1 investigación científica del delito ) 121


educación a distancia (instituto universitario de la P.F.A.)

Método de las Coordenadas: tomando como centro el cadáver o lugar específico de


concreción de un hecho, se traza una coordenada referencial marcando el norte y el sur.
Desde ella se trazan coordenadas hacia los rastros hallados. Esto permite no solamente
detallar las exactas posiciones de cada uno de estos elementos, sino también las distan-
cias que lo separan del cadáver y de los otros elementos.

Método del Damero: o del tablero de ajedrez. Este está especialmente diseñado para
espacios muy grandes. Cualquiera sea la forma y extensión del lugar a inspeccionar, se
procede a cuadricularlo en forma planimétrica, rotulando numéricamente o con letras
cada uno de los espacios resultantes.

Este método puede ser aplicado tanto en lugares abiertos como en cerrados. Es
preciso, simple, objetivo y de fácil interpretación. Permite explorar en forma sistemática,
grandes áreas y obtener registros panorámicos de la misma. Localiza, relaciona y mensura los
diferentes elementos hallados, permitiendo vinculaciones. En grandes extensiones permite
dividir tareas, asegurando la verificación ordenada y eficaz de todos los casilleros. También
es posible mensurar la tarea realizada y la por realizar. Es perfectamente adaptable a cu-
alquier terreno, forma y extensión. Es posible adoptar para la división, la forma geométrica
más adecuada acorde a la topografía del terreno a inspeccionar. Es posible también una
rápida diagramación gráfica o dibujo sobre papel cuadriculado, donde se pueden realizar
todas las anotaciones necesarias.

Todos y cada uno de estos métodos pueden ser utilizados en forma armónica y
conjunta. Por ejemplo en cada uno de los casilleros se puede utilizar el método de las co-
ordenadas o el del espiral. Eso asegura la minuciosidad dentro de cada espacio.

Si bien el riguroso cumplimiento de objetividad científica, encierra el contenido de


los conceptos que a modo de reglas de procedimiento detallara Marchessau, su
conocimiento y/o recordatorio fortalece lo analizado durante la presente unidad. Por
ser mencionadas en la casi totalidad de la bibliografía al respecto y ser parte del
presente programa de estudio, se efectuará un breve comentario sobre las mismas.
Estas reglas, tres en total, están representadas por simples términos que encierran
en sí mismos, todo un bagaje de practicidad y empirismo.

Una de ellas, es la regla o principio de Precisión: Los objetos deben llamarse por su
nombre, los colores han de indicarse con arreglo a las clasificaciones aceptadas corriente-
mente, las distancias han de medirse con exactitud y las direcciones han de indicarse con
auxilio de los puntos cardinales.

122 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

Como se observa la misma hace referencia al cuidado que debe tenerse en el detalle
o descripción de los elementos que deben mencionarse en las actas realizadas para dar fe de
los actos de secuestro o realizados por los interventores. Las descripciones deben contener
las apreciaciones que cualquier persona, sea del nivel intelectual o poseyere los conocimientos
que fueran, sin incorporar detalles que no aportan sino circunstancias subjetivas que pueden
no ser compartidas por todos. La descripción de un elemento puede ser fácilmente efectuada
a través de su tipo, marca, modelo, número de identificación y estado. Esto no crea, en la
práctica, ninguna dificultad. Sin embargo hay otros elementos cuya descripción requiere el
detalle de sus formas o características. En estos casos debe tenerse especial cuidado en no
describir sino lo observable a simple vista por todos, sin hacer comparaciones que puedan
requerir de conocimientos especializados. Conocimiento que puede no ser compartidos por
todos los interventores y que ocasionan interpretaciones individuales.

Principio o regla de Integridad: Las descripciones deben ser completas, sin omitir
detalles aunque, aparentemente, carezcan de importancia. Debe ser fiel en cuanto revele
la marcha misma de la intervención desde la llegada del instructor y en el orden en que la
inspección ocular fue desarrollándose.

Quien efectúe una inspección ocular debe compenetrarse en esa tarea, actuando
minuciosa e imparcialmente. Minuciosamente porque no debe subestimar ni dejar de
analizar nada que se encuentra en la escena del hecho, aunque en apariencia sea insig-
nificante o que no coincida con la hipótesis o primera apreciación sobre los mecanismos
de producción de los hechos. Por ser un hecho de características irrepetibles debe tenerse
presente que es la única oportunidad de recolectar todo aquello que pueda, en definitiva,
aportar luz para el esclarecimiento del hecho.

Imparcial porque no debe despreciar o rechazar por sí o por terceros, nada que
pueda estar relacionado. La premisa es que, si se sabe con lógica razonabilidad que un
elemento tiene relación directa con el hecho, debe considerarlo, vincularlo y secuestrarlo. Si
tiene dudas sobre su vinculación, debe actuar de idéntica manera. De comprobarse luego
su desvinculación se podrá desechar. Pero, lógicamente, no será posible luego su estudio
si no ha sido considerado o levantado oportunamente.

Principio o regla del Método: consiste en realizar la inspección en forma ordenada,


pasando de lo general a lo particular, de la impresión de conjunto a la descripción minuciosa
de las características de cada objeto.

Trabajar con método impone saber desde donde se comienza la tarea, cuál es el
objetivo propuesto y con qué elementos, cosas, lugares o personas se va a trabajar. Se
requiere la preorganización y determinación de los pasos a seguir. El azar no puede ser

tomo 1 investigación científica del delito ) 123


educación a distancia (instituto universitario de la P.F.A.)

considerado en el método, aunque éste se pueda infiltrar ocasionando beneficios o com-


plicaciones. La aplicación práctica a este tipo de tareas, es saber que en esa escena del
hecho, lugar del cual se parte, se intenta llegar al objetivo, que es la determinación del hecho
y de sus autores. Los elementos o testigos mudos que permitirán tal tarea, se encuentran
en el lugar. Sólo hay que saber encontrarlos, interrogarlos y vincularlos. Para ello desde una
óptica pluralizada, se debe ir acotando paso a paso, hasta los más pequeños detalles.

Todo lo explicado en la presente unidad, es sólo un puñado de las muchas cosas


que sobre este acto o diligencia judicial, de significativa importancia en la dilucidación
del caso investigado, pueden decirse o detallarse. La finalidad de su conocimiento es
observar su cumplimiento en las diferentes diligencias de las actuaciones sumariales o
instructorias de la causa, poder valorarlas y criticarlas fácticamente cuando no hayan sido
realizadas con rigurosidad técnica y científica, o saber como actuar en caso de participar
como letrado, fiscal, secretario o magistrado.

Nunca, por mucho que pueda decirse de esta materia, se logrará un desarrollo
completo de esta temática. Tampoco es la finalidad ni la pretensión de esta cátedra. Es
siempre recomendable, empero, profundizarla a través de lecturas afines y desde la óptica
de diferentes autores que, a través de sus conocimientos y experiencias, podrán aportar
datos de real valía.

124 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

abogacía a distancia sp)


síntesis parcial

INSPECCIÓN OCULAR

Tarea de la Criminalística Investigativa

Aportes técnicos científicos para la recolección de testigos mudos

Hecho irreproducible e inmediato

Practicida por autoridad judicial o funcionario policial

Regulada por el Código de forma

De lo general a lo particular. Distintos métodos de ejecución

Arribo al lugar y asistencia a las víctimas

Asegurar el lugar y sus adyacencias para evitar contaminación

Interrogar a testigos. Asegurar no alejamiento e incomunicación

Inspección sin modificaciones para elaboración de hipótesis

Fe por acta de los actos a realizar, acorde a disposiciones legales

Documentación fotográfica panorámica o por otros medios

Acceso de personal profesional o técnico en orden cronológico

Detección y señalización de rastros y huellas

Documentación fotográfica y topográfica de los mismos

Relevamiento topográfico del lugar

Levantamiento, protección, embalaje, rotulación y aseguramiento de rastros

Secuestro, traslado y entrega de testigos mudos hallados en el lugar

Cumplimiento de las disposiciones finales del procedimiento escrito

Entrega o clausura del lugar

REGLAS DE MARCHESSAU Precisión


Integridad
Método

tomo 1 investigación científica del delito ) 125


educación a distancia (instituto universitario de la P.F.A.)

PLANO DE KENYERS Método del Espiral

Método de las Coordenadas

Método del Damero o tablero de ajedrez

AUXILIARES Luces y sus diferentes longitudes de ondas

Luces y sus ángulos de incidencia

Reactivos de orden físico

Reactivos de orden químico

Nuevos métodos de levantamiento

Personal especializado necesario

Equipo auxiliar necesario

TIPOS DE RASTROS Visibles

Latentes

Plásticos o moldeados

DIFERENCIAR Información

Evidencia

Rastro

Mancha

Huellas

Indicios

Prueba

126 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

( BIBLIOGRAFÍA DE LA UNIDAD III )

Bibliografía obligatoria

n ALBARRACIN, Roberto; “Manual de Criminalística”; Editorial Policial; Bs. As. 1971.

n GUZMAN, Carlos; “Manual de Criminalística”; Ed. La Rocca; Bs. As. 1997.

n GOBBI, Eduardo y otros; “Tratado de Criminalística”; Ed. Policial; Bs. As. 1983.

n “Revistas de Policía y Criminalística”; Editorial Policial.

NOTA: los textos obligatorios se encuentran para consulta o préstamo, en la biblioteca del Instituto Universitario
de la Policía Federal Argentina.

tomo 1 investigación científica del delito ) 127


u4
unidad cuatro

( investigación científica del delito )


educación a distancia (instituto universitario de la P.F.A.)

CONTENIDOS DE LA UNIDAD IV

( INVESTIGACIÓN CIENTÍFICA DEL DELITO )

Mención sintética de los contenidos

1. Uso vulgar y científico del término Identidad. Su origen y alcances.

2. Formas de reconocimiento humano desde las primeras conformaciones clánicas o


tribales hasta nuestros días.

3. Conceptos de Antropología y Antropometría. Formas de Identidad Humana.

4. Las aplicaciones de la fotografía, dibujo técnico, computación y otros métodos para el


establecimiento de la Identidad.

5. La necesidad histórica de identificar a los delincuentes. Los beneficios de la Identifi-


cación dual -para delincuentes y honestos-.

6. Diferentes rastros y manchas que pueden conducirnos a la Identidad.

7. Estudio referencial de la piel humana y las particulares conformaciones que producen


las papilas dérmicas y su sistematización papiloscópica.

8. Sus principales precursores hasta llegar a VUCETICH y HENRY.

9. Impresiones papilares naturales y artificiales.

10. Fundamentos técnicos y científicos que sostienen la Papiloscopía.

11. La Papiloscopía y sus alcances. Dactiloscopía, Palametoscopía y Pelmatoscopía.

12. Descripción de los tipos fundamentales dactiloscópicos puros e impuros descriptos


por Juan VUCETICH. Sus conformaciones, partes componentes y topografía de un
dactilograma.

13. Clasificación de un archivo decadactilar. Claves y posibilidades.

14. Identidad Dactiloscópica. Puntos característicos y requisitos.

15. Nociones de Palametoscopía y Pelmatoscopía.

tomo 1 investigación científica del delito ) 131


educación a distancia (instituto universitario de la P.F.A.)

132 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

abogacía a distancia oa)


objetivos de aprendizaje de la unidad

n Comprender los alcances y las necesidades humanas y legales de determinar la Iden-


tidad del Hombre.

n Precisar el concepto riguroso que posee el término Identidad, tanto en su aplicación


humana como para las cosas.

n Hacer un rápido recorrido sobre la evolución del nombre, los apellidos y los efectos
jurídicos que estos presentan.

n Conocer de que medios se ha valido el hombre para obtener un sistema de identificación


que permitiera lograr con absoluta precisión, dicha identidad.

n Comprender el concepto de medios indirectos y directo para determinar Identidad.

n Efectuar una cosmovisión sobre los diferentes medios indirectos, a fin de poder evaluar
la cantidad de pequeños rastros que pueden llevarnos a través de indicios, al estab-
lecimiento de la identidad del o los autores del hecho.

n Diferenciar los antiguos y ver la manera en que los nuevos medios tecnológicos coadyu-
van a lograrla. Además conocer la aplicación y usos de estos avances.

n Introducirnos en el fascinante mundo del único medio que a la fecha, permite lograr la
Identidad Humana.

n Conocer los orígenes de la Papiloscopía, sus pilares sostenedores y sus alcances.

n Obtener una superficial pero completa visión del Sistema Dactiloscópico Argentino
creado por Juan VUCETICH.

n Efectuar una superficial visión de las características identificativas que aporta la Palam-
etoscopía y la Pelmatoscopía.

n Referenciar su aplicación en el mundo y los aportes que la computación brinda para


lograr mayor rapidez y efectividad en su uso.

n Conocer las diferentes aplicaciones biométricas actuales y sus múltiples aplicaciones,


tanto dentro del orden judicial como privado.

tomo 1 investigación científica del delito ) 133


educación a distancia (instituto universitario de la P.F.A.)

134 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

( ESQUEMA CONCEPTUAL DE LA UNIDAD IV )

IDENTIDAD

Concepto y diferenciación con semejanza

Conocimiento de los integrantes de clanes y tribus

Necesidad de reconocimiento en grandes conglomeraciones humanas

Necesidad primaria de identificar a los delicuentes

Diferentes procedimientos utilizados con ese fin

Identificación dual de honestos y delincuentes por la Papiloscopía

Precursores

Otros medios de Identificación Humana

PAPILOSCOPÍA Orígenes, antecedentes y alcances

Conformación de la piel humana

Fundamentos o pilares sostenedores

Ramas que la componen

DACTILOSCOPÍA Tipos fundamentales, descripción y reconocimiento

Topografía de un dactilograma. Su importancia

Partes componentes

Clasificación decadactilar. Claves y posibilidades

Puntos característicos. Descripción y conformaciones

Requisitos para establecer Identidad Dactiloscópica

tomo 1 investigación científica del delito ) 135


educación a distancia (instituto universitario de la P.F.A.)

136 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

abogacía a distancia ai)


actividad introductoria

Lea atentamente el siguiente texto que como “Introducción” fuera incluído en un trabajo
monográfico por alumnos de este Instituto Universitario. Luego de ello y acorde a sus conocimientos
actuales indique que entiende por Persona (humana y jurídica), identidad, semejanza e identificación.
¿Qué significa el nombre civil y qué el antropológico? ¿Cuántos Sistemas de Identificación Humana
conoce? ¿En qué consisten?

tomo 1 investigación científica del delito ) 137


educación a distancia (instituto universitario de la P.F.A.)

138 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

( DESARROLLO DE LA UNIDAD IV )

Identidad humana

El Derecho como ciencia que estudia y regula las acciones del hombre en sociedad,
del hombre con el hombre y del hombre con las cosas, necesita para hacer efectiva su
tarea determinar en forma fehaciente la Identidad Humana, como condición “sine qua
non” para que éstos puedan adquirir derechos y obligaciones.

Para el logro de este Derecho a la Identidad se ha debido transitar un largo


camino. Hoy este derecho está asegurado y cada vez son más las técnicas que de
maneras directa o indirectas permiten establecerlo.

Sin embargo, para una total comprensión, se hace necesario precisar que algunos
conceptos o vocablos pueden alcanzar extensiones o significados distintos en su uso
vulgar y en el uso técnico o científico. Según el diccionario podemos definir a
Igualdad: Como la semejanza o correspondencia de una cosa con otra. Relación
de equivalencia entre dos cantidades o funciones.

Identidad: Igualdad o alto grado de semejanza.

Idéntico: Igual o muy parecido.

Semejanza: Como el conjunto de características que hacen que una persona o cosa
se parezca a otra. Parecido.

El análisis de todas estas definiciones permiten inferir que dichos términos pu-
eden ser utilizados como sinónimos. En el uso cotidiano o vulgar, esto es así. Cuando
nos referimos a dos vehículos de la misma marca, modelo, color y estado; o a un juego
de platos o copas, no resulta incorrecto decir que todos son iguales. Empero en forma
científica, ambos conceptos encierran significados diferentes. Dos gotas de agua de la
misma extensión, tamaño, peso, contenido, etc., serán semejantes pero nunca podrán
ser iguales porque ocupan diferentes lugares en el espacio.

Dentro de este concepto definimos entonces a:


Identidad: Del latín “Identitas” y ésta de “Idem”: como igualdad o calidad de idéntico.
Conjunto de circunstancias que distingue a una persona de otras. O características

tomo 1 investigación científica del delito ) 139


educación a distancia (instituto universitario de la P.F.A.)

y condiciones que distinguen a personas y cosas de otras de la misma naturaleza.


O cualidad de todo ser de ser igual a si mismo y distinto a los demás, “quod est
est” y “quod non est non est”.

Identidad Humana: Encierra cuatro componentes:


a) Cualidad de una persona de ser igual a sí misma;
b) de ser distinta a los demás;
c) en todo tiempo; y
d) en todo lugar. Sólo se puede ser igual a sí mismo.

En las primeras conformaciones humanas tribales o clánicas, todos los integran-


tes se conocían entre sí, siendo de esa manera fácil el reconocimiento indubitable
de una persona. A su vez, estas comunidades se diferenciaban y reconocían una de
otras por su vestimenta, adornos, pinturas, tatuajes, etc., estando unidas por lazos
de sangre, por sus dioses, sus totems clánicos, etc.

Antes que los hombres se comunicaran con el lenguaje hablado, lo hacían a través
de gestos o a través de sonidos guturales. Al evolucionar y utilizar la palabra como medio
de comunicación, necesitaron implementar para referirse y distinguirse uno de otros, lo que
actualmente conocemos como “nombre”. Éstos primeramente fueron tomados de la
naturaleza, de los animales o fueron creados intelectualmente. En la edad media el
Papa Gregorio VII incorpora como nombres, los provenientes del santoral cristiano.

A medida que el número de integrantes de una comunidad crecía, se hizo necesario


para poder distinguirse, incorporar nuevos datos referenciales. Estos datos conformaron
lo que hoy denominamos “apellido” cuyos orígenes más comunes parten de carac-
terísticas de aspecto físico (Cano, Delgado, Rubio); del lugar de origen o residencia
(del Valle, Montaña, Ríos); de la profesión (Escudero, Herrero, Pastor); por significado
(del hebreo Eva = vida, David = amado, Raquel = dulce), (orientales Abd = servidor
de: “Abd-Allah” = servidor de Dios); por derivación del nombre del padre (griegos:
“Aquiles de Peleo = Aquiles Pelíades”); o por defectos (“Platón de platys = ancho de
espaldas” siendo su nombre real Arístocles), etc.

Los españoles por derivados del padre (hijo de Martín, derivó en Martinizi, Martinete,
Martínez; de Sancho en Sánchez, Sánchiz, Saenz, Sanz, Saez, Sáiz. Otros por agregación
del término hijo al final; (en Inglaterra y Suecia “son”, “Adamson”; en Alemania, “shon”, en
Dinamarca “sen”; en Escocia lo antepusieron: “Mc”; en Irlanda anteponían la preposición
“Of”, que luego sustituyeron por la “O’ con apóstrofe, resultando por ejemplo: O´ Donnell.

140 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

Los vascos por armado de datos “echea” casa, “garay” mayor = Echegaray = Casa
mayor; u “orma” tapia = Ormaechea = casa con tapia. A partir del siglo XI se acoplan de-
nominaciones señoriales por feudos o solares, Pedro Pérez de Flores, etc.

Todo ello pasa a formar lo que hoy conocemos como el nombre civil de una per-
sona, que es una individual de orden jurídica pero no física. Esto equivale a decir
que reconoce jurídicamente los derechos a quién lo ostenta, pero hay además que
establecer cuál es la persona física que puede hacerlo por derecho propio.

Antiguamente, cuando algún integrante de esas comunidades cometía hechos por


lo que debía ser sancionado, su reconocimiento a través del nombre civil era suficiente.
Las penas podían ser leves o severas, siendo la más grave el destierro. Aquellos que suf-
rían esta pena debían retirarse para siempre de la comunidad, por lo que emigraban hacia
otras. Si eran conflictivos por naturaleza, en las nuevas comunidades muy pronto incurrían
en conductas que motivaban nuevos destierros. La repetición de estas conductas y las
graves dificultades que esto traía aparejado, hizo que fuera extremadamente difícil que
las comunidades aceptaran extranjeros, dificultándose así las migraciones naturales por
razones de salud o climáticas, por parte de aquellos que no eran expulsados, por lo que se
hizo necesario distinguir uno de otros.

Obviamente las personas honestas eran las que necesitaban de alguna manera
comprobar quienes eran para poder así demostrar su honestidad. Los delincuentes por
su lado, utilizaban el simple recurso de cambiar su nombre civil y de esta manera eludían
sus antecedentes u obligaciones. Como la comprobación de la honestidad es mucho más
dificultosa y menos necesaria socialmente (no así individualmente), desde antaño surgió
como un grave problema a resolver la identificación del delincuente, para evitar su
incorporación a las comunidades y para que no pueda eludir sus responsabilidades,
utilizando para ese fin diferentes, bárbaros y hasta salvajes procedimientos.

Para mencionar algunos, cabe citar que en la India y por aplicación de las leyes de
Manú se les provocaban marcas visibles que provocaban rechazos y abandonos. Además
y según el tipo de delito, le aplicaban mutilaciones de pies o manos y hasta la castración. En
Grecia y Roma le efectuaban marcaciones con hierros candentes en la frente, manos, etc. y
eran considerados estigmáticos. En Francia y Cuba el corte de orejas, marcas tales como V
(voleurs, ladrones), Gal (de Galere, condenado a la pena de galeras) o parafina inyectada en
frío debajo de la piel para detectarla por medio del tacto. En Rusia cortes en la nariz, marcas,
etc. En Inglaterra las letras BC de (bad character) y Bentham creador de la teoría Utilistarista -
donde el fin justifica los medios-, propuso grabaciones del nombre con tatuajes indelebles.

tomo 1 investigación científica del delito ) 141


educación a distancia (instituto universitario de la P.F.A.)

Los tatuajes fueron muy utilizados para este fin, pero también para distinguir tribus
o clanes, cofradías, organizaciones, profesiones (como por ejemplo las prostitutas), etc.

Con el descubrimiento de la fotografía se creyó que el problema estaba por fin


resuelto, ya que registrando a los delincuentes por este medio, éstos ya no podrían
eludir sus identidades ni sus responsabilidades. Sin embargo no tardaron en aparecer
los inconvenientes que este medio producía. Primero los cambios fisonómicos normales
producidos por el paso del tiempo, o por simples modificaciones de estilos: cabellos
largos o cortos, uso de barbas o bigotes, etc. Afortunadamente no existían en esa fe-
cha los recursos actuales, donde el cambio de color del cabello es sólo una nimiedad,
cuando también es posible el cambio de color de los ojos y hasta de la piel.

Otros inconvenientes eran las semejanzas de los rasgos fisonómicos entre individuos;
las características coincidentes entre personas de razas negra o amarilla; y la gran cantidad
de fotografías a comparar con cada uno de los sospechados.

En la permanente búsqueda de métodos que permitieran una eficaz labor y la solu-


ción de los inconvenientes que presentaba el uso de la fotografía, Alfonso Bertillón aplicó
los conocimientos de la Ciencia Antropológica, (que estudia al hombre física y moralmente
a través de la biología, de los tipos físicos, genes, etnias, piel, formas físicas, pigmenta-
ciones, etc) y a través de las Ciencias Sociales (que estudia las costumbres, creencias,
organizaciones de vida, etc.), logrando desarrollar una nueva disciplina, la Antropometría
o Sistema Antropométrico o Bertillonaje.

Este método tenía por objeto la toma de medidas físicas del cuerpo (talla) en
posición de parado, sentado y con los brazos extendidos. Mensuraba sobre la cabeza:
su longitud, ancho, diámetro bicigomático y la oreja derecha y además los miembros
superiores e inferiores. Tomó como base, tres principios fundamentales:
a) fijeza ósea casi absoluta después de los 20 años;

b) la diversidad de las dimensiones del sistema óseo entre individuos; y

c) la relativa facilidad y precisión en la toma de las medidas siguiendo algunos pará-


metros especificados.

Efectuadas estas mediciones se confeccionaba una ficha, a la cual se adosaba la


fotografía. Ante la tarea de identificación de un delincuente, debía verificarse las fichas y las
fotografías, solamente de aquellos cuyas medidas se correspondieran. Esto disminuía consider-
ablemente la cantidad de fotografías que debían compararse. A pesar de los muchos defectos
que su práctica puso en evidencia, fundamentalmente por la aplicación sólo parcial que podía

142 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

efectuarse (no a menores, no a mujeres), por errores de medición; por cambios en la estructura
ósea hasta los 25 años, por enfermedades, por vejez, etc. fue adoptado por muchos países
del mundo, quienes luego de la abolición paulatina pero constante, de los anteriores métodos
vejatorios y bárbaros, no contaban con otro sistema que los auxiliara en esta tarea.

Fue el mismo Bertillón que, ante las falencias de su sistema, crea a modo de comple-
mento el Retrato Hablado (portrait parlé) o expresión oral de las características fisonómi-
cas humanas. En éste, se detallan los siguientes elementos: Filiación Civil: donde se
consignan todos los datos personales: nombre y apellido, sexo, raza, nacionalidad,
ocupación, edad, estatura, peso, si sabe leer y escribir. Filiación cromática: colores
del cutis, cabellos, barba, ojos, cejas, etc. y Filiación morfológica: descripción de sus
rasgos fisonómicos tales como: formas de ojos, cabellos, inserción frontal, cejas, nariz,
barba, bigote, cara, mentón, boca, labios, cuello, orejas, frente, etc.; Señas particulares:
cicatrices, verrugas, características en dientes, tatuajes, marcas de nacimiento, viru-
ela, pecas, etc.; Peculiaridades: tics, andar, pasos, anteojos, bastón, tartamudez, etc.;
Indumentaria: sombrero, zapatos, estilos, pulcritud, etc.; Joyas: tipo, clase, donde las
usa, cantidad, etc.; Lugares: donde vive, vivía, frecuenta o trabaja, de amigos, parientes,
etc.; Enfermedades: crónicas, temporales; Hábitos: bebedor, fumador, adicto al juego,
deportes, recreo, baile; Desplazamientos: en automóvil, bicicleta, moto, camina,; etc.

Estos métodos, a pesar del significativo avance brindado, (tener presente que ac-
tualmente el fotográfico y el retrato hablado siguen siendo utilizados en identidad humana)
estaban condenados a ser prontamente suplantados por el Sistema Dactiloscópico, que
sistematizado primero por Vucetich y poco después por Henry, son los que actualmente
brindan absoluta y precisa exactitud como Sistema de Identificación. Sobre la Papiloscopía
en general y la Dactiloscopía en particular, nos volveremos a referir en la presente unidad.

Efectuado un rápido y cronológico recorrido sobre los Sistemas de Identificación


Humana, se hace necesario antes de la profundización de alguno de ellos, efectuar algunas
precisiones sobre la problemática identificativa.

Establecer en forma indubitable la identidad de las personas, manteniéndola desde


el momento de su nacimiento y hasta más allá de su muerte, les permiten adquirir derechos
y obligaciones. Estas responsabilidades pueden ser de carácter civil (herencias, sufragio,
contrataciones, etc.) o criminal (libertad, pecuniaria, etc.) y en todos los casos es necesario
su determinación, ya que es posible ejercer derechos y obligaciones si se acredita que les
corresponden, asegurando así al honrado su determinación y al delincuente la acreditación
de autorías y reincidencias, evitando que pueda ocultarla o variarla.

tomo 1 investigación científica del delito ) 143


educación a distancia (instituto universitario de la P.F.A.)

El hombre siempre ha sido igual a sí mismo, distinto a los demás, en todo tiempo y lugar.
El meollo de la cuestión fue lograr determinar fehacientemente estas circunstancias. Es decir
el lograr un Sistema de Identificación que permitiera acreditar estas circunstancias.

En sus orígenes, la determinación de la identidad fue empírica, es decir se basaba


en el conocimiento y el reconocimiento de la identidad de una persona. Esto trajo
aparejado como inevitable consecuencia, el error humano involuntario o voluntario.
Había que reconocer a la persona a pesar del tiempo y los cambios producidos. Se hacía
necesario una determinación fehaciente a través de un juicio. No sólo había que deter-
minar mediante juicio la responsabilidad de autoría de un hecho, sino que en la captura
o recaptura de una persona había que probar por igual medio, que ésta era la persona
buscada. Así hubo muchos tristemente célebres casos de suplantación de identidades,
algunas de ellas por error o equivocación y otras por maldad, conveniencia o fraude.

El hombre posee tres tipos de identidades. La identidad física: dada por las
características y particularidades de transmisión genética que se exteriorizan en la
morfología o constitución del hombre; la identidad psíquica: constituida principal-
mente por las vivencias y afectaciones personales, que conforman con intervención
del ego, del yo y del ello, particularidades propias y únicas; y la identidad biográfica:
correspondiente a los datos de nacimiento, madre, padre, lugar, fecha, sexo, etc.

Para poder lograr el establecimiento de la identidad, hay en la actualidad una


gama muy variada de posibilidades. En forma genérica podemos distinguirlas en
procedimientos de carácter indirectos y/o directo. Este último está dado por la
Papiloscopía que como se indicara, será tema a tratar en esta unidad. Los primeros
están constituidos por una serie de elementos y de sistemas, que en forma muy su-
perficial (dada su amplitud y complejidad) trataremos de desarrollar.

Lograr la identidad en forma directa, significa que la identidad está lograda por sí y
en forma indubitable. Es decir es prueba absoluta. Hacerlo en forma indirecta es hacerlo
a través de indicios. Los indicios tienen dos características, una absoluta y otra relativa.
Son absolutos cuando permiten comprobar en forma fehaciente una circunstancia, que
en lo referente a identidad es siempre un descarte por discoincidencias. Esto equivale
a decir que no es la persona buscada. Por su carácter relativo, permite vincular como
posible a una persona, pero no da certeza de identidad ya que otra u otras personas
pueden presentar similares características identificativas. La evaluación en cantidad y
calidad de los indicios encontrados, permitirá a quien tenga la responsabilidad de juzgar
a través de la sana crítica, darle validez probatoria o desechar los mismos.

144 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

Son varios los elementos y métodos que permiten por medios indirectos, establecer
la presencia y/o la participación o no de una persona en un lugar o en un hecho. Muchos de
ellos son antiguos y han tenido escasa o nula utilización. Otros más modernos y técnicos, se
han convertido en verdaderos auxiliares de la justicia. Mencionaremos, entre estos últimos,
los más destacados o importantes. Debe tenerse en cuenta que la reforma constitucional
de 1994 ha establecido como garantía por ella amparada, el Habeas Data o derecho de
privacidad de los datos personales. Esto significa que para la obtención de elementos de
comparación indubitados, que permitan la evaluación y dictamen sobre los rastros o testigos
mudos vinculados con el hecho, se deben guardar las formas legales correspondientes, es
decir la voluntaria prestación ante la autoridad judicial correspondiente o de corresponder,
la orden por ella emanada.

Identificación Odontológica: la dentición es un conjunto de fenómenos que


contribuyen a la formación, salida y crecimiento de los dientes. Presenta normalmente
dos etapas: una primaria a partir del quinto mes de vida y una secundaria a partir de
los cinco años. La dentadura permanente de un adulto es de 32 dientes dispuestos
en cuatro hemiarcadas, conformadas por dos incisivos, un canino, dos premolares y
tres molares. Estos se representan esquemáticamente por una fórmula gráfica llamada
“fórmula dentaria”.

Durante el proceso de dentición se pueden producir anomalías en cuanto a la cantidad


de dientes. Se llaman suplementarios o supernumerarios a los dientes que exceden la canti-
dad ya referida y se denomina oligodoncia a la falta de uno o más dientes. También pueden
ocurrir anomalías de formas como ser: dientes incluidos, radiculares, marcados, etc.

En la fórmula dentaria contenidas en fichas de cartulinas de 20 x 16 cm., en su


anverso se consignan los datos personales y el odontograma o dibujo de la fórmula
dentaria, señalizándose sobre ésta con color rojo los tratamientos anteriores, sean
éstos arreglos, faltantes, prótesis, anomalías, etc. Con azul los trabajos a realizar, ob-
turaciones, material, tratamientos, radiografías, encías, sarro, prótesis, presupuesto,
forma de pago. En el reverso fechas de trabajos, de pagos, de ausencias.

La comparación de los detalles de las fichas con las dentaduras analizadas, permite
identificaciones. Entre sus principales defectos se detallan: las deficiencias por llenado,
traslados de lugares de profesionales o pacientes, fallecimientos del odontólogo, etc. Se ha
propuesto que en los arreglos se incorpore antes de la amalgama, una chapa identificatoria.
En caso de ser necesario por medio de una radiografía se identifica el vástago. Debe tenerse
en cuenta empero, que por ser una prótesis la misma puede ser removida o transferida.

tomo 1 investigación científica del delito ) 145


educación a distancia (instituto universitario de la P.F.A.)

Reconocimiento a través de la Voz Humana: la voz es un fenómeno neurofisi-


ológico, físico, acústico, fonológico y lingüístico que permite la comunicación por len-
guaje oral. Su reconocimiento permite la identificación de una persona. Como primer
antecedente positivo podemos mencionar que en la Biblia, Génesis 27, 1-22, se señala
el reconocimiento por parte de Isaac en su lecho de muerte (pese a los esfuerzos
realizados por su esposa Rebeca, al adherirle vello en el brazo de Jacob tal como lo
poseía Esau, su hermano mayor) de la voz de su hijo segundo, que intentaba recibir
los derechos del primogénito. Como antecedente negativo en 1935 el caso “Lindberg
c/ Haupmann” en los Estados Unidos de Norte América, donde se condena a muerte
por secuestro al imputado, luego de ser reconocida su voz a través del teléfono, de-
terminándose luego de su ejecución su no responsabilidad en el hecho.

Podemos decir que la voz es un conjunto de sonidos modulados en la laringe por las
cuerdas vocales y finalmente emitidos por la cavidad oral. Las teorías actuales concuerdan
que se produce por mecanismos localizados en las vías respiratorias inferiores y superiores,
estando comprendida la primera por los pulmones -que actúan como fuelles lanzadores de
aire-, los bronquios, la tráquea y la porción inferior de la laringe hasta las cuerdas vocales.
Los músculos aritenoideos regulan la tensión de las cuerdas vocales. El aire al pasar por
la glotis -porción superior de la faringe-, produce una vibración sonora que actúa sobre la
voz. El sonido es modificado por las vías superiores, conformadas por la parte superior de la
faringe por encima de las cuerdas vocales, la faringe, la boca (lengua, paladar y labios) y las
vías nasales, conformando una verdadera caja de resonancia que le da sus características.
Esta última vía es normalmente afectada por el polvo, el humo, el alcohol, la humedad, etc.
causando disfonías o afasias.

En el cerebro se producen dos fenómenos: recibida una impresión, se produce la


traducción en sonidos articulados de las ideas que fueron suscitadas por la impresión
recibida. La voz se forma por la variación posicional de los labios, de la mandíbula, la
lengua y el velo del paladar produciendo formantes espectrales, provocando la nariz
y la faringe alteraciones en la resonancia.

Son causales de variación entre las personas las diferencias: anatómicas y fisiológi-
cas; de aprendizaje del habla; de tiempo; de condiciones físicas, psíquicas y anatómicas;
de maneras de emisión; de idioma, de acento; de frecuencias; por simulación, etc.

Su reconocimiento pericial es por medios aurales y espectrográficos. Efectuadas


las depuraciones de las cintas que contienen los registros, se resguardan y se toma la
testigo en las condiciones más similares posibles. Los profesionales involucrados en los

146 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

estudios efectúan reconocimiento aural por medio de escuche, retención en memoria,


reconocimientos y evaluación. Determinan ritmo, entonación, inflexión, modismos, recep-
ción, defectos y pronunciación. Luego por medio de registros espectrográficos con equipos
de señal digital, se obtienen espectrogramas o representaciones gráficas tridimensionales
que representan la relación entre los componentes frecuenciales, de amplitud, tiempo y
armónicas. Sobre el gráfico se determina ubicación, evolución temporal y frecuencia de
formantes, ancho de bandas, amplitudes relativas y frecuencia glótica. La evaluación de
los reconocimientos espectrales y aurales permiten arribar a las conclusiones.

En nuestro país desde hace unos años, este tipo de estudio es realizado por la Policía
Federal Argentina a través de la división Scopometría de la Superintendencia de Policía
Científica, por medio de un equipo de profesionales conformado además de personal técnico
auxiliar, por un ingeniero en sonido y por fonoaudiólogos, que han debido cumplimentar
con los requisitos regulados por el Subcomité de Identificación y Análisis Acústicos de la
Voz (VIAAS) de la Asociación Internacional de Identificación (IAI).

Identificación por la Huella Genética: Genomio es el nombre con que a veces se


denomina al código genético que cada uno de nosotros posee. Salvo algunas excepciones
(como el caso del hematíe), cada célula en su región nuclear, contiene este código con
todas las informaciones indispensables para que nuestro organismo se desarrolle. Para
ello, son necesarios cuarenta y seis cromosomas esencialmente constituidos por Ácido
Desoxirribonucleico o ADN. Este está compuesto por cuatro bases, Citosina, Timina,
Guanina y Adenina representadas por las letras C, T, G y A que al agruparse en una larga
cinta, conforma el cromosoma.

Dada la forma que adoptan estas estructuras de doble cadena helicoidal (recordar
que helicoide es el giro alrededor de un cilindro, mientras que espiral es el giro envolviendo
un cono) reciben el nombre de “doble hélice”, enrollándose una alrededor de la otra. Así
dados sus tamaños sólo pueden unirse la Adenina con la Timina o viceversa y/o la Cito-
sina con la Guanina o viceversa. Las primeras lo hacen a través de un doble puente de
hidrógeno y las segundas por un triple puente de hidrógeno. Estas cadenas no son iguales
sino complementarias una de otras. El ordenamiento sucesivo en secuencias de bases en
la molécula de ADN, es propio y constante en cada especie.

tomo 1 investigación científica del delito ) 147


educación a distancia (instituto universitario de la P.F.A.)

Obsérvese en la figura precedente la formación de las cadenas y las bases descriptas.

El apareamiento específico de estas cadenas le permiten que al separarse,


sirva de molde para la formación de una cadena acompañante similar. Esto se llama
propiedad de autoduplicación y es lo que permite identificar las secuencias o
disposición de las letras CTGA y por consiguiente leer el propio código genético. A
través de técnicas se ha concebido un medio para determinar donde aparecen ciertas
secuencias específicas. En un código genético de una longitud de aproximadamente
tres mil millones de bases, es posible determinar secuencias específicas o combi-
naciones de esas letras en una longitud de 15 a 20 bases. Estas secuencias pueden
repetirse varios miles de veces.

Las secuencias en tándem formadas (repetición de n veces de la secuencia


CTGA, es decir que si “n” es igual a tres, la secuencia será CTGA-CTGA-CTGA) per-
miten secuencias de 2, 3, 4, 5 veces. Los diferentes valores tomados por n, es decir
el número de veces que se repite una misma secuencia, permite la identificación por
el ADN. Obsérvese la conformación de una secuencia.

148 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

AGCTAGCT
AGCTAGCTAGCT
AGCTAGCTAGCTAGCT
AGCTAGCTAGCTAGCTAGCT
AGCTAGCTAGCTAGCTAGCTAGCT
AGCTAGCTAGCTAGCTAGCTAGCTAGCT

Obviamente los elementos repetitivos que se analizan son más complejos que la simple
secuencia mencionada como un ejemplo extremadamente simplificado y sólo para dar una
idea de la amplitud de diferenciación entre individuos. Una unidad que normalmente tiene una
longitud de 15 a 20 bases puede repetirse en tándem entre 200 y 1400 veces. Esto representa
que si en un juego podemos elegir entre 10 y 20 números sobre un total de 200 a 1400, la
probabilidad de elegir todos los mismos números que otra persona son pocas. Con respecto
al ADN esta circunstancia es así salvo en los gemelos, cuyo patrimonio genético es idéntico.

Identificación física a través del Olor: éste es captado a través de uno de los sentidos
humanos y es la sensación que se produce en la mucosa olfatoria por la acción estimula-
toria de las terminaciones nerviosas de los nervios olfatorios a nivel de la mucosa nasal.
Algunas sustancias emiten partículas muy pequeñas que al estimular la mucosa nasal,
provoca una reacción química y ésta estimula el impulso nervioso o sea la sensación del
olor. La especialización de este sentido permite que los técnicos en olores reconozcan
en un ambiente cargado de centenares de perfumes, uno de ellos y sus mezclas.

A través del olor se pueden identificar a personas vivas o muertas, explosivos, estupefa-
cientes, sustancias orgánicas, tumores cancerosos, etc. En la identificación humana la técnica
indica recoger los olores dejados por el autor y fijarlos de manera durable. Teniendo en cuenta
que el olor es una microhuella que el cuerpo exuda y que se deposita en el suelo, en las cosas
tocadas, usadas, etc., es posible su identificación a través de la espectrografía de masa.

Ante la premisa de que no hay dos hombres con olores idénticos y que la transpiración
dispersa moles de olor, se requiere la capacidad y el adiestramiento necesario para su deter-
minación. El hombre si bien es macrómato, es decir que tiene poco olfato, puede lograr una
especialización. El perro es por naturaleza micrómato (mucho olfato) y es normalmente adiestrado
para este tipo de reconocimiento, siendo necesario desarrollar un reflejo condicionado.

Los olores pueden recogerse o fijarse en paños libres de olores, que se colocan por
espacio de 25 minutos sobre objetos sostenidos por una persona por espacio de 10 minutos.
Con pinzas para evitar contaminaciones, se lo dobla hacia adentro y se los conserva en fra-
scos cerrados y rotulados pudiendo durar varios años. La técnica implica hacer oler al perro

tomo 1 investigación científica del delito ) 149


educación a distancia (instituto universitario de la P.F.A.)

adiestrado, libre de todo estímulo que pueda distraerlo, el testigo mudo recogido en el lugar del
hecho. Luego se debe colocar entre cinco frascos distanciados a un metro cada uno, cuatro
olores no relacionados y el sospechado. Olfateados por el animal, se acostará frente al frasco
identificado. Se debe repetir la operación cambiando de lugar los frascos y con otros animales.
El margen de error es de aproximadamente 2%.

El olor se presenta en forma de materia y permanece durante horas, días, semanas


y más. La rama tecnológica que se encarga del estudio y determinación de los olores se
denomina Olfatrónica. El método de determinación es a través de un cromatógrafo
que separa bases gaseosas y líquidas y de su medición se obtiene, lo que se ha dado
en llamar, “firmas olfatrónicas”.

Introducidos los vapores de la muestra a analizar en el cromatógrafo de fase gaseosa,


este es arrastrado por la corriente de gas inerte que en forma lenta y continua se le hace
pasar. Del otro extremo del tubo un indicador ultrasensible controla la salida del elemento.
Se efectúan cromatogramas que luego son comparados.

Otras técnicas más recientes han permitido la invención de un detector de olores por
sensores eléctricos que luego son comparados por medio de computadoras. Todo esto
permite relacionar o descartar sospechosos, relacionar lugares con autor, etc.

Identificación por Reconstrucciones fisonómicas: consiste en el dictado del


rostro de los autores por parte de las víctimas a través de bocetos, o de modificacio-
nes sobre fotografías para actualizar cambios o reconstrucciones de rostros dañados
o tapados por terceros, o sobre cadáveres, etc. Varias son las formas de aplicación,
mencionaremos entre ellas:
El Identi-kit: consiste en más de quinientas transparencias con los diversos rasgos que componen el
rostro. Acorde a los datos suministrados se hacen incidir rasgos sobre guía de contorno del rostro,
la que posee aberturas para sujeción. Su principal inconveniente es la apariencia robotizada que
se obtiene.

El Foto-fit: son dibujos técnicos sobre la configuración del rostro en lo que hace a su forma, dis-
posiciones pilosas, nacimientos de pelo, forma de cejas, bigotes, barbas, etc. Asimismo forma
de ojos, orejas, boca, labios, mentón, frente, nariz, cicatrices, lunares, verrugas, etc. Se efectúa
de frente y perfil.

La aplicación de programas computacionales que incluyen software que permiten


efectuar modificaciones sobre las imágenes logradas, ha aportado un gran auxilio a esta
forma de reconocimiento humano. Entre ellos se destacan el “secon” y el “faces”.

150 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

Otros medios de identificación pueden brindarlos por ejemplo: los puntos de sutura
quirúrgica, los tatuajes, proyectiles retenidos en el cuerpo, marcapasos con marca y nu-
meración registrada en historia clínica, prótesis de todo tipo: ortopédicas, odontológicas,
plásticas, estéticas, etc., marcas de ropa y de lavandería, etc.

Dentro de la amplia gama de rastros o testigos mudos que se pueden recoger en el


lugar de los hechos luego de realizada la inspección ocular, se describirán algunos pocos y se
hará referencia a otros, que en forma indirecta permiten la identificación de una persona.

Rastros de pisadas: pueden ser dejados de tres maneras diferentes. Por pie
calzado, pie con medias o pie desnudo que pueden dejarse en diversos tipos de su-
perficie. En las duras, lisas y pulidas pueden dejarse visibles o latentes. Los primeros
por estar mojados o embarrados o bien por estar coloreados con sangre, pintura, harina,
sustancias grasas, talco, etc. Los segundos deben ser revelados utilizando para ello
los procedimientos más adecuados a cada caso en particular. En superficies blandas
pueden quedar por ejemplo sobre tierra húmeda, barro, arena, nieve, etc. y luego de su
fotografiado se la puede levantar acorde al tipo de superficie, utilizando diversos proced-
imientos, obteniéndose así un moldeado con yeso de rápido fraguado del tipo “París”.

El rastro de pisada dejado por un pie desnudo, por ser parte de la papiloscopía se
detallará más adelante. Con relación al pie calzado es posible obtener, a partir del rastro de-
jado, una serie de datos importantes. Tipo de calzado utilizado: zapatos con suelas y tacos
de goma o de cuero o mixto, deportivos con suelas de goma, otros con suelas de plástico,
de soga, etc. Posible marca del calzado: dado por el diseño o dibujo de la suela, esto espe-
cialmente en los calzados deportivos. Tamaño del pie: a través de la mensura de la huella.
Anomalías: que se evidencien en el andar. Desgastes desparejos: acorde a su composición,
los tacos y las suelas presentan desgastes anormales por incorrecto apoyo de los pies, fric-
ciones desparejas, problemas en columna, peso, modismos ambulatorios, etc. El sexo: dado
por el tipo de calzado o por la forma de apoyo en casos de disimulo. El retrato del paso: nos
puede dar talla por la distancia entre dos pisadas, forma y dirección de la punta del pie al
andar, si hubo más de una persona, si hubo lucha, etc.

Obtenido el moldeado o la reproducción fotográfica, se debe tener en cuenta que los


mismos son el negativo de las suelas y por lo tanto no pueden ser cotejados directamente con
el calzado sospechado. Para dicho cotejo previamente debe obtenerse molde o fotografiado
de las pisadas dejadas por el sospechoso con ese calzado y en similar tipo de superficie
que el dubitado. En concreto siempre debe compararse molde con molde o fotografía con
fotografía, obteniéndose luego otras reproducciones donde se señalarán las coincidencias
o discoincidencias.

tomo 1 investigación científica del delito ) 151


educación a distancia (instituto universitario de la P.F.A.)

Huellas de pie con medias: si bien el tramado de la media utilizada puede quedar estam-
pado en estos rastros y a través de ellos es posible establecer tipo, roturas, zurcidos,
etc., no es mucho lo que en realidad estos datos puedan indicar. Sí resulta importante
los datos que aportan en cuanto a la forma de implantación del pie. Recordemos que por
anomalías en su conformación o en la columna o por apoyo, un pie puede ser normal,
talo o en flexión, plano, etc. Esto puede visualizarse en este tipo de rastro, al igual que
las formas, separación, tamaño, posición y apoyo de los dedos.

Huellas de mordida: este tipo de huella dejada sobre superficies blandas tales como
manzanas, dulces sólidos, quesos, chocolates, etc. o en piel humana, pueden darnos
además del tamaño y forma de la boca, la cantidad de piezas dentarias, sus posiciones
e interrelaciones, estados, defectos, etc., y en algunos casos obtener restos de saliva.
Acorde a cada superficie, cantidad y tiempo transcurrido se puede obtener directamente
o por medio de lavado por hisopado. Su presencia puede darnos una serie de datos que
se describirán a continuación. Al igual que en otros, es necesario obtener su moldeado
utilizando para ello diversos productos de uso odontológico para tomas de moldes de
prótesis.

Huella de saliva: además de los restos que puedan ser arrastrados por ellas desde la cavi-
dad bucal, todos los pertenecientes a su composición, es decir tipos de sales minerales
o sustancias orgánicas como la mucina, urea y albúmina, como así también sus enzimas:
la amilasa y la lisozima. La saliva tiene acciones digestivas, lubricantes y secretoras. A
través de la saliva, de ser secretora la persona, es posible la determinación de sangre, la
ingesta de alcohol o drogas, etc.

Huella de fluidos seminales: se denomina semen o esperma al producto secretado por


el aparato genital masculino después de alcanzada la madurez sexual. Encontrada una
mancha o extraída por hisopado es posible determinar si es semen, si es de origen hu-
mano o animal, la determinación del grupo sanguíneo, si tiene mezcla con otros materiales
biológicos como ser orina, materia fecal, saliva y también el uso de alcohol o drogas. Esto
permite determinar acciones que pueden ser constitutivas de delitos.

Pelos: este simple y frágil rastro es prácticamente indestructible permaneciendo ad-


herido en cadáveres enterrados durante mucho tiempo, conservando información sobre
venenos, edad, sexo, raza, teñidos, enfermedades y a veces hasta la profesión. Se hace
necesario, como con otros rastros, obtener siempre muestras de la o las víctimas para
futuros descartes. Podemos decir que los pelos son filamentos conificados desarrollados
en la epidermis o capa externa de la piel, que presentan entre 0.05 y 0,6 mm de espesor
y largo variado.

152 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

Los mismos se encuentran en casi toda la extensión del cuerpo y presentan


folículo piloso, papila pilosa, raíz, tallo y glándulas sebáceas, sufriendo diferentes
cambios en el transcurso de la vida.

Su morfología está compuesta por tres planos, siendo éstos de afuera hacia adentro:
la cutícula o escamas, la corteza y la médula. La cutícula está formada por escamas compu-
estas por células queratizadas superpuestas y dirigidas hacia la punta del pelo que pueden
presentarse de diferentes maneras. A título ilustrativo puede observarse en la figura siguiente
tomada del Manual de Criminalística de la Editorial Policial, representaciones esquemáticas
de la misma donde pueden apreciarse sus diferentes conformaciones.

Su estudio, luego de la aplicación de la técnica más adecuada según el caso,


es por observación microscópica. Se debe determinar el índice escamoso o cantidad
de escamas por una unidad de longitud tomada en forma arbitraria. Esto permite
efectuar comparaciones. Si bien no presentan demasiadas variaciones en este índice
entre varias personas, su valor reside en el descarte del origen del cabello estudiado.
Obsérvese en las vistas tomadas del mismo manual, las diferencias que presentan a
un mismo aumento, los pelos de distintas especies:

tomo 1 investigación científica del delito ) 153


educación a distancia (instituto universitario de la P.F.A.)

Macrofotografia x 400 - cuticula de cabello humano


FIGURA Nº 1

Macrofotografia x 400 - cuticula simple - pelo de murcielago

FIGURA Nº 5

Macrofotografia x 400 - cuticula crenada - pelo de zorrino

La corteza formada por células corticales en forma de agujas, es la responsable de la coloración


del pelo. La distribución y color de estos gránulos pigmentados aportan importantes puntos de
comparación entre cabellos.

La médula o canal central del cabello presenta, según las especies, diferentes tamaños, siendo
variable entre individuos y aún entre pelos de un mismo individuo. Además no todos los pelos
presentan médula. Se mensura su diámetro total y el diámetro medular. Obsérvese en la figura
siguiente, diferentes tipos de médulas.

Ratificando las apreciaciones mencionadas al comenzar con este tema, desde el


punto de vista criminalístico el pelo permite determinar: si es humano o no; lugar del cuerpo
de donde proviene; si ha sido arrancado, caído, cortado, roto; edad, raza y sexo; color si es
original o teñido; si es de un ser vivo o muerto; profesión a través de los residuos hallados;
traumatología; determinar: venenos; distancia del disparo; grupo sanguíneo; enfermedades;
y enzimas, a través de estudios serológicos y trazas de elementos orgánicos metálicos.

154 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

Se mencionan otros rastros que pueden hallarse en una inspección ocular y que pueden
estudiarse criminalísticamente: pus, materia fecal, meconio (primera defecación del bebé), calos-
tro (primera leche materna), líquido amniótico, orina, sudor, piel, etc. Además formas de uñas, de
manos, de asentaderas, de ropas, de hollado del lecho, de animales, de labios, de efracciones
con distintas herramientas (que será detallado en la unidad referida a balística), etc.

Por último y a modo referencial, se efectuarán algunas consideraciones con relación


a los rastros dejados por vehículos. Los rastros dejados en diferentes tipos de hechos por
el vehículo utilizado para llegar o huir del lugar del hecho o en los casos que ahora han
pasado a ser bastantes frecuentes, de embiste y fuga, la determinación de este tipo de
rastro puede aportar elementos invalorables. El moldeado y levante, acorde a la superficie
donde se encuentra, es similar a lo detallado para el rastro de pisadas.

El estudio de estas huellas nos puede permitir, a través del dibujo dejado, establecer la
marca, modelo, tamaño, etc. del tipo de neumático utilizado. A través de ello, las marcas de
vehículos que pueden utilizarlas. Si además se obtiene el rastro de ambas ruedas delanteras
o traseras o de todas, es posible establecer el tamaño de la trocha y luego determinar los
vehículos que tengan igual correspondencia. Los rastros de pintura determinados en roces,
hebillas, etc. pueden aportar datos de la marca, modelo y llegado el caso a comparaciones
directas con el vehículo sospechado.

Como se comprenderá, los rastros provenientes de la inspección ocular obtenidos


siguiendo las formalidades detalladas en la unidad anterior, permiten de forma variada,
obtener indicios que, en forma absoluta permitirán descartar a un sospechoso y en forma
relativa vincular a otros. Todos los indicios encontrados y peritados serán evaluados en
cantidad y calidad a través de la sana crítica, por aquél que tenga la responsabilidad de
juzgar, pudiendo considerar luego de ello si se encuentra suficientemente probada o no,
la presencia de una persona en el lugar de ocurrencia de los hechos. Por todo ello, son
considerados medios indirectos de establecer la identidad de una persona.

El método más confiable, que permite obtener la identidad de una persona en


forma absoluta, directa, indubitable y conformante de prueba de la presencia de una
persona en el lugar, es la Papiloscopía. Dada su importancia, se efectuará una breve
pero completa descripción de sus principales características, a fin de brindar un pan-
orama de los basamentos técnicos y científicos que hacen de este, el único medio de
identificación directa.

Es a través de la Papiloscopía y con cualquiera de sus tres ramas técnicas “Dactiloscopía”,


“Palametoscopía” y “Pelmatoscopía”, que es posible asegurar la identidad física de una persona,

tomo 1 investigación científica del delito ) 155


educación a distancia (instituto universitario de la P.F.A.)

mediante el sello natural antropológico único, invariable y perenne que lo distingue de cualquier
otra persona, dado por las caprichosas conformaciones del tejido epidérmico de los pulpejos
de la tercer falange de los dígitos, de las palmas de las manos y de las plantas de los pies.

Ese conjunto de particularidades o pequeños detalles anátomonaturales de origen


congénito, aseguran la determinación categórica e indubitable de la identidad física personal
y el derecho a la identidad de todas las personas, desde su nacimiento, durante toda su
vida y aún hasta después de su muerte. Estos relieves papilares son rigurosamente indi-
viduales, no se transmiten por herencia biológica, no se repiten diseños entre ascendientes
y descendientes y constituyen una singular variedad creadora de la Naturaleza.

Dentro de los primeros estudios y principales precursores de este tema y


siguiendo los dichos del doctor Edmond Locard, pueden distinguirse tres períodos;
a) el prehistórico,
b) el período empírico y
c) el período científico. Dentro del primero debe mencionarse que en las cuevas de Auri-
gnac y de Altamira o Gargas entre otras, se encontraron un tipo de arte muy particular
con representaciones humanas-animales y de motivos decorativos variados, entre los
que se destacan representaciones de la mano humana con pinturas en rojo y negro o
humedecidas con óxido de hierro.

Asimismo cabe destacarse el hallazgo en cerámicas japonesas prehistóricas cubiertas


de moldeaduras papilares, o los rastros hallados sobre tejas romas o en los moldes de yeso
pertenecientes a escultores romanos, o sobre ladrillos asirios de la dinastía de Sargón, e
incluso en América sobre ladrillos de adobe sin cocer encontrados en los cerros funerarios
de México. También la reproducción grabada sobre piedra de los dibujos papilares de los
dedos y de las palmas de las manos encontradas en Kejimkoojik de Gavr-Inis. Estos rastros
papilares incitaron a Faulds y Galton entre otros, a iniciarse en el estudio de estos dibujos,
en procura de lograr la identidad antropométrica humana.

Dentro del período empírico cabe destacarse que dentro de las “Leyes Domésti-
cas” de China, el marido para poder divorciarse, debía redactar de su puño y letra una
carta con alguno de los siete motivos que autorizaban al divorcio (desobediencia filial,
esterilidad, relajación de costumbres, celos, lepra, habladuría y robo). En caso de no sa-
ber escribir debía contener su impresión digital, la que era considerada como su firma.
También era utilizada la impresión de los dedos o de las manos en las notificaciones de
las sentencias judiciales; en los contratos de venta de las esposas y de las hijas, donde
además de la mano derecha debían imprimir la planta del pie derecho.

156 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

Acorde a la creencia oriental estas impresiones de dedos, manos o pies no tenían el


concepto de identificación personal, sino un origen místico, al incorporar algo de su personalidad,
de su ser. Otro dato interesante es que los quirománticos chinos a partir del siglo XVIII habían
distinguido en los dedos de la mano dos tipos de conformaciones o dibujos dactilares -que de-
nominaron “lo” y “ki”- que se corresponden con los tipos: verticilo y presilla respectivamente.

Dentro del período científico no es fácil delimitar fechas ni hombres a quienes atribuírsele
semejante prioridad o descubrimiento. Esto fue probablemente la resultante del concurso de
centenares o millares de hombres e inteligencias y como en casi todas las grandes creaciones,
estas suelen ser anónimas.

Nadie ha descubierto el fuego, ni el remo, ni la vela, ni el molino. No han sido Colón ni


Vespucio quienes descubrieron el nuevo mundo, sino innumerables e ignotos esquimales o
groenlandeses que habían ya arraigado y fundado una civilización para esa fecha. Una cosa
se hace cuando todos la piensan. Aquellos a quienes se les atribuye, no han hecho más que
concretar ideas flotantes.

Le corresponde al médico anatomista italiano Marcelo Malpighi (1628-94) la pri-


macía del estudio de los dibujos papilares. Si bien su estudio fue desde un punto de
vista netamente fisiológico, fue el primero es describir las rugas de los dedos y los poros
u orificios sudoríparos que más tarde inspiraría a Locard su método poroscópico.

Este médico italiano hizo un profundo estudio de las diferentes capas de la piel humana,
habiendo descubierto la capa germinativa que lleva su nombre. Fue además inspirador de otros
anatomistas que continuaron su obra, debiendo destacarse entre otros a Christian HINTZE.

Se puede considerar a Marcelo Malpighi como el abuelo de la dactiloscopía, ya que


todos coinciden que el verdadero padre de esta ciencia fue Juan Evangelista Pujkinje. Este
filósofo y médico checo nacido en 1787, en su obra “De examine physiologique organi
visus et sitematis cutanei” efectuó una descripción y clasificación de los dibujos digitales
y un admirable ordenamiento de las crestas, logrando clasificar nueve categorías.

Por su parte el administrador en jefe de Bengala, Sr. William Herschel desde 1858
hacía utilizar en forma práctica las impresiones digitales en la autentificación de contratos.
Su utilización no era con fines de identificación, ya que no parece que hubiera tenido
idea de que una impresión fuera absolutamente individual, sino más bien con un sentido
místico aprovechando la idea de que los hindúes al igual que los chinos atribuían a una
huella corporal una obligatoriedad mucho más fuerte que a la de una firma. Posterior-
mente implementó este método también con los presos, para el servicio de pensiones y
en el registro de defunciones.

tomo 1 investigación científica del delito ) 157


educación a distancia (instituto universitario de la P.F.A.)

El médico escocés Dr. Henry Faulds que se desempeñaba en el hospital de


Tsukiji en Tokio, había observado las numerosas impresiones papilares en cerámicas
prehistóricas, teniendo la idea de compararla con las impresiones de los japoneses
actuales. Descubrió diversas conformaciones que hoy conocemos como puntos car-
acterísticos, efectuando estudios etnológicos y de herencia de los dibujos papilares,
haciendo asimismo comparaciones con la morfología de otros mamíferos.

Es mérito de Faulds, la descripción de una técnica que utiliza una placa de estaño
y tinta para obtener impresiones y efectuar comparaciones. Describió dos casos en la que
había empleado la técnica dactiloscópica, una en la que había identificado una impresión
dejada sobre un vaso y otra en la que determinó no correspondencia de identidad. Acon-
sejó utilizar las impresiones en las fotografías de los criminales, determinando asimismo
que las impresiones eran inmutables.

Sir Francis Galton nacido en 1822 en Duddleston y doctorado en medicina,


comenzó en 1886 sus estudios sobre la identificación por las crestas papilares. En 1890
detalló un método que le permitía la búsqueda de una impresión dentro de una gran
colección. Fue él, que mediante sus pacientes investigaciones estableció y determinó
la existencia de los tres pilares fundamentales de la papiloscopía, pilares sobre los que
descansa la bondad, seguridad e infalibilidad del sistema. Estos son la inmutabilidad,
la perennidad y la variedad. Además efectuó la comprobación matemática de que no
se presentará, salvo después de una astronómica cantidad de años, una impresión
exactamente igual a otra.

Pero fue Juan VUCETICH que naciera el 20 de julio de 1858 en la ciudad de


Lesina de la antigua Dalmacia, radicado en la Argentina en 1882, quien trabajando en
el Departamento Central de la Policía de la Ciudad de La Plata, definitivamente logró
un sistema de identificación humana que en forma directa e indubitable, asegura el
tan preciado derecho a la identidad.

Recibida la orden de abocarse al estudio de establecer un servicio de identifi-


cación antropométrica y luego de leer un ejemplar de la “Revue Scientifique” donde se
publicaban los estudios de Galton, advierte que en las impresiones digitales se hallaba la
única solución integral a la problemática de la identificación humana. En 1891 luego de
prolongadas jornadas de estudio exhaustivo, crea un sistema que bautizó como “icnofa-
langometría” describiendo 101 tipos de dibujos dactilares, tomándose el 1°de septiembre
de ese año por primera vez en el mundo las impresiones digitales de los 10 dedos a 23
procesados. Las fichas así obtenidas fueron luego clasificadas y archivadas.

158 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

Muy pronto un hecho delictuoso iba a confirmar las previsiones de Vucetich. En junio
de 1892 Francisca Rojas denunciaba ante las autoridades policiales de Necochea el asesinato
de sus dos hijos, acusando como autor del hecho a un vecino suyo. Realizada la correspondi-
ente inspección ocular se observó en la puerta de la finca impresiones digitales estampadas
con sangre. Cotejadas esas impresiones con las del vecino y las de la madre de las víctimas,
permitieron establecer que el vecino era completamente ajeno al hecho y que las huellas con
sangre eran de Francisca Rojas, determinándose así la autoría de ésta en el doble filicidio.

El permanente trabajo sobre su sistema buscando empeñosamente mejorarlo, le


permite durante el transcurso del año 1896 reducir aquellos 101 tipos originales a los 4
tipos fundamentales actuales, cuyo conjunto dio lugar a la creación del “Sistema Dac-
tiloscópico Argentino”. Este sistema por sus bondades fue rápidamente difundido por
todo el mundo.

Por último debemos mencionar a Sir Edward Richard Henry, colega y sucesor de
Herschel en Bengala, quien perfectamente al corriente de la cuestión de las impresiones
digitales, al regresar a Europa en 1899 había elaborado un sistema dactiloscópico propio.
En 1900 publica la primera edición de su libro “Clasification and uses of finger print” donde
describe su método, que es utilizado actualmente en los países de habla sajona.

Antes de comenzar con la descripción del sistema dactiloscópico, se hace necesario


efectuar algunas consideraciones sobre la piel humana. Esta reviste la totalidad del cuerpo
siendo el tejido de mayor superficie y peso. Es el órgano de protección sensorial, táctil,
térmico, del dolor y de transmisión nerviosa. Se encuentra formada por tres capas prin-
cipales, una interna denominada “endodermis”, una intermedia profunda denominada
“dermis” que cumple una función conectiva de sostén y una exterior o epiteliar compu-
esta por células renovables denominada “epidermis”. Para nuestro estudio sólo interesan
estas dos últimas.

La Epidermis o capa superficial presenta una capa córnea exterior con células aplanadas
nucleares, otra capa o estrato lúcido con células traslúcidas alargadas, una tercera capa granu-
losa, seguida por otra capa espinosa o de Malpighi con células que aumentan de volumen y
se unen a otras, y una quinta capa basal o germinativa con células irregulares cilíndricas. Se
une a la dermis por la membrana basal que regula el intercambio metabólico. En esta capa,
denominada vítrea, se encuentran unas eminencias cónicas denominadas papilas dérmicas.

La Dermis o capa profunda llamada también Corión, le da a la piel elasticidad, resistencia


y sensibilidad. Presenta una capa vascular y fibrosa con células conectivas y nerviosas. La
dermis papilar tiene crestas vasculares y nerviosas con corpúsculos táctiles. La media pre-
senta vasos sanguíneos y glándulas sudoríparas. La profunda posee células adiposas con
músculos pilosos y bolsas serosas.

tomo 1 investigación científica del delito ) 159


educación a distancia (instituto universitario de la P.F.A.)

Separando ambas capas se encuentra un sustrato traslúcido denominado “capa vítrea”,


donde las papilas dérmicas (unas eminencias circulares) se disponen de a pares -formando hil-
eras de extensión y dirección variable- que se manifiestan en la epidermis como altos relieves,
denominados “crestas papilares”. Las ausencias de ellas conforman a ese nivel, depresiones
o bajos relieves, denominados “surcos interpapilares”. Esta particular disposición se encuentra
en los tejidos epidérmicos de los pulpejos de los dígitos, en la cara anterior de las manos y en
las plantas de los pies.

Tienen como función el levantar el conducto de las glándulas sudoríparas, lo que per-
mite mantener húmedas las manos. Esto le otorga la función de aprehensión de los objetos lisos
y redondos. Posee además la función táctil, conteniendo los corpúsculos de Meissner.

A los efectos de precisar los alcances de cada término se especifican los siguientes:
Dibujo Papilar: figuras conformadas por altos relieves (crestas) y bajo relieves (surcos) en la
epidermis de los pulpejos de la tercer falange de los dígitos, en las palmas de las manos y
en las plantas de los pies, que permiten la identificación humana.

Crestas Papilares: Unión de dos hileras de papilas dérmicas con dirección determinada, que
forman cordones y distintas figuras.

Surco Papilar: espacio en bajo relieve que separa las crestas en forma longitudinal.

Impresión Papilar: resultado de estampar sobre un papel o fondo adecuado, los dibujos
papilares de los dígitos, palmas y plantas.

Rastro Papilar: marca visible que se deja sobre superficies adecuadas, es decir lisas y puli-
mentadas, producto de la humedad secretada por los poros de las glándulas sudoríparas.

Como ya se ha hecho referencia, todo el sistema papiloscópico descansa sobre sus


pilares fundamentales que son los tres elementos que le dan base científica al sistema:
a) inmutabilidad,
b) perennidad y
c) variedad.

Inmutabilidad: los dibujos formados por las crestas y surcos papilares permanecen inalter-
ables durante todo el transcurso de nuestra vida. No son modificados por causas voluntarias
ni involuntarias.

Las lesiones que puedan sufrirse en cualquiera de las regiones donde estos dibujos se
conforman, acorde su grado de afectación podrán: a) si la lesión sólo afecta la epidermis,
una vez sanada la misma las crestas se reproducirán de idéntica manera conservando

160 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

su dibujo original y sin dejar ningún tipo de señal; b) si la lesión daña la capa profunda
o dermis, en los lugares afectados y luego de sanada la misma quedará una cicatriz,
reconstituyéndose todas las crestas no perjudicadas y conformando el mismo dibujo.
La diferencia será a partir de esa lesión, la presencia en forma permanente de una im-
pronta o cicatriz que pasará a ser un nuevo elemento de identificación.

De esto se desprende que las alteraciones que puedan sufrir los rastros papilares son de
carácter temporal, reconstituyéndose los dibujos originales, salvo en las zonas de cicatrices.

Perennidad: Estos dibujos se conforman entre el cuarto y el sexto mes de vida intrauterina,
o sea desde antes de nuestro nacimiento y perduran hasta más allá de la muerte, es decir
hasta que sobrevenga la putrefacción o disgregación cadavérica.

Variedad: No existen dos impresiones dactilares que posean el mismo dibujo papilar. Esto es
tan así que no presentan dibujos iguales ni los ascendientes ni descendientes directos, ni los
hermanos gemelos, ni aún entre dos dedos de una misma persona. Cada uno de nuestros
dedos, palmas o plantas poseen dibujos con características de únicos e irrepetibles.

Un cálculo proyectivo matemático indica que no es probable la repetición de un


dibujo sino en una cifra superior a los sesenta mil millones (60.000.000.000) de personas.
Los estudios preliminares al sistema y su uso en forma mundial después de más de cien
años, han fortalecido todos y cada uno de los pilares descriptos.

Todas las consideraciones efectuadas hasta el momento, son de aplicación a todo


el Sistema Papiloscópico. Sin embargo la sistematización de cada una de las tres ramas
técnicas que lo componen (Dactiloscopía, Palametoscopía y Pelmatoscopía) ha requerido
tratamientos individuales.

Se efectuará, a continuación, la descripción de los principales elementos de


cada uno de ellos, dándose preferente atención a la Dactiloscopía.

Dactiloscopía: ciencia que permite la identificación física indubitable categórica y fehaciente,


de una persona, por medio de los dibujos formados por las crestas y surcos papilares situa-
dos en los pulpejos de la tercer falange de los dígitos de las manos. Para su estudio se hace
necesario distinguir dos conformaciones fundamentales: a) Deltas, b) Asa Central.

Delta: Es la figura formada por la confluencia o convergencia de dos o tres sistemas


de líneas o espacios que se miran por su convexidad o concavidad, conformando
una figura similar a la letra griega “Delta” y de allí su nombre- ubicados a la derecha o
izquierda de los dactilogramas. Pueden ser a) negros o b) blancos. (sus definiciones
quedan igual)

tomo 1 investigación científica del delito ) 161


educación a distancia (instituto universitario de la P.F.A.)

El delta negro está conformado por crestas, las que al entintarse para la toma de
la impresión, provocan líneas de color negro.
El delta blanco se forma cuando en la confluencia de los tres sistemas se forma un
espacio triangular blanco, conformado por los surcos papiloscópicos.

Asa Central: es la línea más central del dactilograma que asciende, forma cúspide
y desciende en la misma dirección de su inicio y conservando cierto paralelismo,
sin importar la extensión de sus ramas.

Se adjuntan ilustraciones sobre los distintos tipos de deltas descriptos y sobre


la conformación de un asa central, tomadas del Manual Práctico de Papiloscopía de
Alberto Perez de la Editorial Policial.

Se denomina Dactilograma Natural al que se observa directamente en los pulpejos


de la tercer falange de los dígitos de las manos. A su vez se denomina Dactilograma Ar-
tificial, al que se obtiene sobre papel por entintado y que se conoce vulgarmente como
“impresión digital”.

El Sistema Dactiloscópico Argentino ideado por Juan Vucetich tiene en cuenta, para
la determinación de los cuatro Tipos Fundamentales en que ha dividido la totalidad de los
dibujos que pueden presentar la epidermis en el pulpejo de los dígitos de las manos, la
presencia o ausencia de deltas. Es decir es un sistema eminentemente déltico.

162 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

El sistema requiere la determinación, encuadramiento y clasificación de las dactilogramas


de los diez dígitos de las manos de una persona, debiendo para ello tomarse la impresión de los
mismos en la ficha decadactilar por él creada. Para el cumplimiento de las normas de clasificación
en los dactilogramas artificiales, se debe determinar la presencia o ausencia de deltas.

Esto da lugar a dos posibilidades:


a) Ausencia de Deltas o

b) Presencia de Deltas. En este último caso deben considerarse, a su vez, dos circunstancias:
a) Cantidad de Deltas y
b) Posición con respecto del observador. Acorde a esto se conforman los cuatro
grupos patrones o tipos fundamentales del sistema: arco, presilla interna, presilla
externa y verticilo.

ARCO: Se denomina así al tipo fundamental que se encuadra dentro de la siguiente definición:
Es todo dactilograma carente de conformación déltica. Puede presentarse en forma Pura
e Impura.
Se denomina Arco Puro, Llano o Simple a todo dactilograma carente de delta que presenta sus
líneas o crestas papilares en forma transversal, algo curvas y paralelas entre sí.
Se denomina Arco Impuro a todos aquellos Arcos no comprendidos dentro de la definición de
Puro. En estos dactilogramas las líneas o crestas papilares se presentan conformando dibujos
variados. Estas pueden adoptar algunas de las siguientes figuras: Piramidal Alto, Piramidal
Bajo, con Inclinación de Líneas a la Derecha, con Inclinación de Líneas a la Izquierda, Piniforme,
Angular o Quebrado, o Pseudos Deltas, etc.

PRESILLA INTERNA: se denomina así al tipo fundamental que responde a la siguiente


definición: Es todo dactilograma que presenta uno, dos o más deltas a la derecha del
observador. Pueden presentarse, asimismo, en forma Pura o Impura.
Se denomina Presilla Interna Pura a todo dactilograma que presenta un solo delta a la derecha
del observador y las líneas o crestas papilares que conforman la región nuclear, entran y salen
por el lado opuesto, conformando un asa central de recorrido normal.
Se denomina Presilla Interna Impura a todos los tipos de Presilla Interna que no se encuadren
dentro de la definición de Pura. Pueden presentarse dos posibilidades diferentes:
a) todos aquellos dactilogramas que tengan dos o más deltas a la derecha del observador.
Ejemplo: Bideltos, Trideltos y
b) todos aquellos dactilogramas que, aún presentando un solo delta a la derecha del ob-
servador, las líneas que conforman su región nuclear tengan irregularidades en su recor-
rido. Ejemplo: las líneas o crestas centrales pueden presentarse: Volcadas, Intervenidas
Parcialmente, Intervenidas Totalmente, Combinadas Arco más Presilla.

tomo 1 investigación científica del delito ) 163


educación a distancia (instituto universitario de la P.F.A.)

PRESILLA EXTERNA: se denomina así al tipo fundamental que responde a la siguiente


definición: Es todo dactilograma que presenta uno, dos o más deltas a la izquierda del
observador. Pueden presentarse en forma Pura e Impura, respondiendo a las mismas
características ya descriptas para la Presilla Interna. Ofrece como único pero fundamental
cambio, que los deltas deben estar ubicados a la izquierda del observador.

VERTICILO: se denomina así al tipo fundamental que responde a la siguiente definición: Es


todo dactilograma que presenta dos o más deltas al menos dos opuestos. Hay, tambien
forma Pura e Impura.
Se denomina Verticilo Puro a todo dactilograma que presenta dos deltas opuestos y enfrentados.
Se denomina Verticilo Impuro a todo Verticilo que no se encuadra dentro de la definición
de Puro. Pueden presentarse de dos maneras:
a) aquellos dactilogramas que posean dos deltas opuestos pero no enfrentados y
b) aquellos dactilogramas que posean más de dos deltas, con al menos, dos opuestos.
Ejemplo: Tridelto, Tetradelto.

Descritos los cuatro tipos fundamentales o patrones, obsérvese en las ilustraciones que
se adjuntan a continuación, las características de cada uno de ellos en su presentación Pura.

ARCO PRESILLA INTERNA

PRESILLA EXTERNA VERTICILO

164 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

Para hacer más fácil la clasificación de los cuatro tipos fundamentales en los diez
dígitos de las manos (lo que permite encontrar la ficha buscada en un fichero conteniendo
por ejemplo, cien millones de fichas), se los ha distinguido con el uso de letras y números.
Las letras corresponden a las mayúsculas de las iniciales de cada tipo, es decir “A”, “I”,
“E” y “V” y se utilizan para clasificar los dígitos pulgares. Los números corresponden a la
correlación de su ordenación fundamental que es la misma en los que fueron descriptos,
es decir “1” para el Arco, “2” para la Presilla Interna, “3” para la Presilla Externa y “4” para
el Verticilo y se aplican en los restantes dígitos de ambas manos.

De presentar algunos de los dígitos una cicatriz de carácter permanente que im-
pida determinar el tipo fundamental se lo clasificará con una letra “X”. De presentar
ausencia de algún dígito por amputación se lo clasificará con la letra “O”.

Con la utilización de esta clasificación que utiliza letras y números, es posible ob-
tener la fórmula correspondiente a los diez dígitos de las manos, que ha sido denominada
“Individual Dactiloscópica”. Dependiendo cuales sean los tipos fundamentales que posea
una persona en cada uno de sus dígitos, las fórmulas a obtenerse, teniéndose en cuenta
que resultan de elevar 4 (cantidad de tipos), a la décima (10 dígitos), da la cantidad de
1.048.576 posibilidades o combinaciones.

De poseer una persona en sus diez dígitos el tipo fundamental Arco, su individual
dactiloscópica será A 1111 A 1111, la que deberá leerse A once - once, A once - once. De
tener en sus diez dígitos el tipo fundamental Verticilo, su individual dactiloscópica será V
4444 V 4444 que deberá leerse V cuarenta y cuatro cuarenta y cuatro, V cuarenta y cuatro
cuarenta y cuatro. La progresión comenzada con la primera individual y terminada con la
otra, es la que posibilita la cantidad detallada. A modo de ejemplo se consignará una se-
cuencia de cómo se obtiene esta progresión, con permuta de los cuatro dígitos (excluido
el pulgar) para observar su forma y luego otra con permuta del pulgar.

Permuta comenzando con dedo meñique de la mano izquierda

tomo 1 investigación científica del delito ) 165


educación a distancia (instituto universitario de la P.F.A.)

Permuta comenzando con el dedo pulgar de la mano izquierda. Ver números 10 y 11

Obtenida la fórmula de la Individual Dactiloscópica de una persona, se separa del


fichero las fichas correspondientes a la misma -descartándose las demás- y dentro de
ellas se establece a quién le corresponde a través de las características que determinan la
Identidad Dactiloscópica de una persona, que se detallarán más adelante. En la práctica
no se repiten con idéntica frecuencia todas las fórmulas, siendo algunas muy comunes,
otras presentan unas pocas fichas y otras aun no se han presentado. En realidad sólo se
han presentado un diez por ciento de las posibilidades.

Para el cotejo de impresiones dactilares, se hace necesario determinar su topo-


grafía Con excepción de los adélticos o sea los Arcos, se distinguen en los otros tipos
fundamentales, tres regiones, grupos o sistemas perfectamente delimitados, conformados
por la distribución de las crestas papilares las que, acorde a su ubicación, han recibido las
siguientes denominaciones:

A) SISTEMA BASILAR: conformado por las crestas papilares transversales o ligeramente


oblicuas que en forma continua o empalmada van desde un limbo lateral al otro, desde la
línea directriz inferior del delta hasta el pliegue de la tercera y segunda falange del dedo.

B) SISTEMA MARGINAL: constituidas por crestas largas y continuadas que comenzando


en la directriz superior del delta, en forma paralela con las crestas basilares, luego se
separan subiendo y describiendo curvas acentuadas para terminar descendiendo por
el lado opuesto del dactilograma, perdiéndose en el limbo. Las mismas conforman el
margen del dactilograma y de allí su denominación.

C) SISTEMA NUCLEAR: conformado por las crestas que se ubican en la región central
delimitada por las directrices inferiores y superiores. Dichas crestas se disponen de
formas muy variadas en cuanto a su dirección, extensión y dibujo y constituye una
región muy importante y rica para la identificación dactiloscópica.

166 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

Obsérvese en la figura siguiente, el detalle de las tres zonas o sistemas de-


scriptos para el tipo fundamental “Presillas” tomado como ejemplo.

Para lograr la Identidad Dactiloscópica, una vez clasificado el dactilograma, se hace


necesario la determinación de lo que se ha dado en llamar “Puntos Característicos”.

Puntos Característicos: Estos están conformados por crestas papilares que,


en su evolución, presentan una diversidad de diseños o dibujos, que sirven como el-
ementos de comparación y referencia en las operaciones de identificación humana.

Encontrados los mismos y cumpliendo ciertos requisitos que serán detallados opor-
tunamente, se puede establecer en forma categórica, fehaciente e indubitable la identidad
física de una persona, a través de la comparación o confronte de los dactilogramas dúbitos
en indúbitos.

Dentro de las diferentes conformaciones que pueden adoptar las crestas papilares
que forman los dibujos dactilares, se han distinguido ocho tipos de puntos característicos,
a saber:
1) PUNTO: es la mínima expresión de una cresta y se corresponde con la impresión de un
poro, debiéndose encontrar aislado es decir que no puede ser la continuación de una línea
interrumpida.

2) ISLOTE: porción de una cresta mayor que el punto, debiendo cumplirse las mismas
condiciones descriptas para el punto. Su tamaño lo constituye la impresión de dos a
cinco poros.

3) CORTADA: cresta aislada o suelta, es decir, sin solución de continuidad que empieza y ter-
mina dentro del dactilograma. Debe cumplir igual requisito que para el punto y el islote.

tomo 1 investigación científica del delito ) 167


educación a distancia (instituto universitario de la P.F.A.)

4) ENCIERRO: cresta que durante su recorrido se abre y se vuelve a cerrar, conformando


un espacio interior. Este espacio interno puede presentarse intervenido o limpio.

5) HORQUILLA: cresta que en un momento de su recorrido vuelve en la misma dirección,


formando una curva. Puede o no, presentar apéndice o cola.

6) BIFURCACIÓN: cresta de la cual se desprende otra, conformando ángulo.

7) EXTREMO O TERMINACIÓN DE LINEA: Está conformada por una cresta que, co-
menzando en el interior del dactilograma, se pierde en el limbo.

8) EMPALME: son dos crestas contiguas que se encuentran unidas por una tercera.

Obsérvese en la siguiente figura la demarcación de los ocho puntos característicos descritos para su
visualización

Los requisitos que deben cumplir los dactilogramas dúbito e indúbito comparados
para establecer Identidad Dactiloscópica, dentro del cotejo o confronte papiloscópico,
deberán ajustarse a las siguientes normas:
1) IDONEIDAD: los dactologramas a comparar deben cumplir con las condiciones de: a)
nitidez y b) integridad.
Nitidez: se deben visualizar perfectamente diferenciados en ambos dactilogramas, las líneas
de los blancos, es decir deben estar bien contrastadas las representaciones de las crestas
(líneas) y de los surcos (blancos)
Integridad: requiere que ambos posean campo suficiente (área completa) para obtener
una apreciación integral de la región a las que pertenecen.

2) SIMILITUD: esta norma se refiere no solamente a que deben pertenecer a un mismo tipo
patrón o fundamental, sino que además guarden parecido o semejanza en la estructura
morfológica del dactilograma.

168 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

3) CANTIDAD SUFICIENTE DE PUNTOS CARACTERÍSTICOS: la cantidad de puntos


requeridos para una identificación categórica depende del tipo de ficha a cotejar, según
el siguiente detalle: a) en una ficha decadactilar (con impresión de los diez dedos), entre
nueve (9) y doce (12) puntos y b) en una ficha monodactilar (impresión de un solo dedo),
entre doce (12) y quince (15) puntos característicos.

4) CALIDAD DE LOS PUNTOS CARACTERÍSTICOS: determinada una cantidad suficiente


de puntos característicos, los mismos deben reunir además los siguientes requisitos
de calidad: a) exacta coincidencia de ubicación; b) exacta coincidencia de situación y
c) exacta coincidencia de dirección.
Exacta coincidencia de ubicación: se refiere que los puntos encontrados deben estar ubica-
dos en idéntica región del dactilograma, es decir en la región Basilar, Marginal o Nuclear.
Exacta coincidencia de situación: los puntos característicos deben estar situados a
igual distancia. La misma se establece mediante el trazado de una recta imaginaria y
por el contaje de todas las líneas por ellas atravesadas.
Exacta coincidencia de dirección: la dirección esta dada por la orientación que posean
los puntos característicos o algunas de sus ramas. Por ejemplo una horquilla posee su
apéndice ubicado de izquierda a derecha y de abajo hacia arriba.

Estos requisitos determinan que los puntos característicos sean CONCURRENTES.


Esta determinación permite arribar a una conclusión categórica, fehaciente e indubitable de
identidad dactiloscópica, determinando así la identidad física de las personas.

Obsérvese a continuación un confronte entre dos impresiones, una dubitada y otra indubitada.

Determinados entre 9 y 12 puntos característicos que cumplan con los requisitos


detallados, se establece en forma absoluta e indiscutible la identidad dactiloscópica de una
persona, de partirse de una ficha decadactilar. Si fuera sobre una ficha monodactilar (es
decir de un solo dedo) la cantidad requerida se sitúa entre 12 y 15 puntos característicos.
tomo 1 investigación científica del delito ) 169
educación a distancia (instituto universitario de la P.F.A.)

Este sistema permite identificar a una persona, confrontando las impresiones hal-
ladas en el lugar del hecho, con las de la ficha correspondiente extraída del fichero luego
de determinada su fórmula; o bien a través del confronte de una impresión dubitada y otra
tomada al sospechoso; entre dos impresiones dactiloscópicas, etc. Tener identificada a la
población por este sistema, permite identificar cadáveres, personas extraviadas o demen-
tes, accidentados, etc.

En virtud de que las bases y los principios técnicos y científicos son los mismos que
para la Dactiloscopía, sólo se efectuará una breve descripción de la identificación humana
a través de los sistemas Palametoscópico y Pelmatoscópico.

El palametograma o conjunto anatómico de crestas papilares que presentan


las palmas de la mano, ha sido dividido por los autores del sistema D.Julio Fortunato
y D. Roberto Albarracín -quienes tomaron como base el del Dr. Gilbert Palmer Pond-
en seis regiones, cuatro regiones interdigitales, una región tenar y otra hipotenar.
A los efectos de la visualización de cada una de estas regiones, se reproduce una
impresión palmar donde se han demarcado las mismas:

170 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

I. PRIMERA REGION INTERDIGITAL: ubicada en el espacio comprendido entre el dedo


índice y el medio.

II. SEGUNDA REGION INTERDIGITAL: es el espacio comprendido entre el dedo medio


y el anular.

III. TERCER REGION INTERDIGITAL: es el espacio comprendido entre el dedo anular y


el meñique.

IV. REGION HIPOTENAR: es el espacio que comprende la eminencia ubicada en el borde


interno de la palma. Dicha eminencia se encuentra formada por los tres músculos motores
del dedo meñique.

V. REGION TENAR: es el espacio que comprende la eminencia ubicada en la base del


dedo pulgar, formada por los músculos motores cortos.

VI. CUARTA REGION INTERDIGITAL: es el espacio comprendido entre el dedo pulgar


y el índice.

Se han determinado seis tipos fundamentales o patrones. Cuatro de ellos reciben


idéntica denominación que los descriptos por Juan VUCETICH para la Dactiloscopía,
aunque no presentan idénticas conformaciones y dos son propios de las palmas.

Así el Arco puede presentarse llano, con inclinación a la izquierda, inclinación a la


derecha, piramidal, trípode o de delta central, etc. Las Presillas son típicas formaciones de
asas que pueden o no presentar deltas. Si las ramas de su asa se dirigen hacia el centro
de la mano, se denominan Presillas Internas. Si las ramas del asa se dirigen hacia fuera de
la palma, se denominan Presillas Externas. Los Verticilos son aquellas conformaciones de
crestas que se agrupan en núcleos, cuyo inicio o centro puede ser espiralado, concéntrico
u ovoidal, sinuoso, o ganchoso. El Dendrítico o Enramada está constituido por una cresta
central común a todas (tronco) de la cual se desprenden otras a modo de ramas. El Mosaico
es el diseño conformado por crestas que, al disponerse transversalmente a las que siguen
la dirección general del dibujo, se entrecortan y conforman dameros o enrejados.

Para la identificación Palametoscópica, se deben establecer entre 12 y 15 puntos car-


acterísticos que reúnan las mismas condiciones que las descriptas para la Dactiloscopía.

Con relación a la identificación Pelmatoscópica o conjunto anatómico de crestas


papilares que presentan las plantas de los pies, deben cumplimentarse similares proced-
imientos y requisitos que los mencionados para la Dactiloscopía y la Palametoscopía es
decir que se deben determinar suficiente calidad y cantidad de puntos característicos.

tomo 1 investigación científica del delito ) 171


educación a distancia (instituto universitario de la P.F.A.)

Por su valor histórico se mencionan dos sistemas creados para este fin: a) Sistema
PRELLER que comprende una clasificación Monozónica y Diez Tipos fundamentales o b)
Sistema URQUIJO que comprende una clasificación de Cuatro Zonas y Cinco Tipos Fun-
damentales. La identificación pelmatoscópica se realiza luego de determinarse entre 12 a
15 puntos característicos que cumplan idénticos requisitos que para la Dactiloscopía.

Desde la década del ´70 países como Alemania, Estados Unidos, Francia y Japón comen-
zaron a desarrollar Sistemas Automáticos de Identificación de Impresiones Digitales, que por sus
( utomatic Fingerprint Identification System).
iniciales en inglés reciben el nombre de A.F.I.S (A

Estos sistemas proceden a la captura de datos, es decir a la toma de los diseños


papilares provenientes de fichas decadactilares, monodactilares o de un dactilograma natu-
ral, codificándolo en lenguaje binario, para proceder luego a su registro archivándolos en
píxeles. Posteriormente a través de un proceso automático de comparación, procede a la
identificación papiloscópica. Todo proceso, cualquiera sea el resultado, debe ser verificado
por un operador humano para minimizar errores.

Estos sistemas que aportan las ventajas de la aplicación de la informática a la compleja


actividad papiloscópica, contribuyen con la detección acelerada de personas ya registra-
das en la base de datos, por identificación y verificación biométrica, frustrando cambios
de identidad e ingreso de duplicaciones. Actualmente son utilizados por la mayoría de las
fuerzas policiales del mundo.

Sin la idea de sustituir a la papiloscopía como sistema de identificación, sino por el


contrario con la idea de verificar toda aplicación tecnológica, técnica o científica que permita
asegurar la identidad humana y pueda ser utilizada como elementos de prevención o de
investigación, estudios recientes desarrollados en países líderes, permiten afirmar que el
organismo humano ofrece un número importante de características variadas, inmutables y
perennes, que pueden ser utilizadas para ese fin. Estas características pueden encerrarse
dentro del concepto de “Biometría”.

La papiloscopía, la identificación genética por A.D.N, por el olor; por la voz humana,
por las rugas palatinas, por datos odontológicos, etc. conforman sistemas de identificación
biométrica modernos. La utilización de la informática permite la lectura de datos a través de
lectores biométricos o escáneres, su registro, comparación e identificación.

Sin que pretendamos incluir una lista taxativa de posibilidades, se detallan algu-
nas aplicaciones biométricas que, debido a su popularización, resultan hoy accesibles.
Identificación dactiloscópica para accesos a lugares físicos reservados (oficinas, hogares,

172 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

clubes, etc.) o para regular accesos informáticos a través del uso de mouse o ratón con
escáner dactiloscópico. Identificación por la Geometría o Tridimensión del rostro; por el
color y diseño del iris; geometría y dimensión de orejas, manos y pies; Morfología, tem-
peratura, presión arterial, y ritmo cardíaco corporal; etc.

El camino por realizar en el campo de la identificación humana, especialmente para


la aplicación criminal, es todavía largo y espinoso, pero es mucho lo que se ha avanzado.
Lógicamente el desarrollo de esta unidad no ha pretendido un detalle pormenorizado de
esta temática, sino un breve recorrido por su historia y sus principales avances, para que
le sirvan de base de aplicación al futuro profesional abogado.

tomo 1 investigación científica del delito ) 173


educación a distancia (instituto universitario de la P.F.A.)

174 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

abogacía a distancia gl )
glosario

Se detallan a continuación el significado de las palabras:

BINARIO: Código numérico utilizado por todos los ordenadores en el que los números
están representados con sólo dos cifras, el “0” y el “1”.

MOLES: Plural de mol o mole, abreviatura de molécula y representa la masa de una sus-
tancia equivalente al peso molecular de la misma tomado en gramos. En un mol siempre
hay la misma cantidad de moléculas, sea cual fuere la sustancia.

PIXELES: Plural de pixel y éste a su vez representa el elemento base más pequeño de
una imagen digital. Proviene de la contracción de “Picture – Element” o “elemento de
imagen”.

tomo 1 investigación científica del delito ) 175


educación a distancia (instituto universitario de la P.F.A.)

176 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

( BIBLIOGRAFÍA DE LA UNIDAD IV )

Bibliografía obligatoria

n ALBARRACIN, Roberto; “Manual de Criminalística”; Editorial Policial; Bs. As. 1971.

n GUZMAN, Carlos; “Manual de Criminalística”; Ed. La Rocca; Bs. As. 1997.

n ROSSET, Ricardo y LAGO Pedro; “El A B C DEL DACTILOSCOPO”; Ed. Policial. Bs.
As. 1984.

n “Revistas de Policía y Criminalística”; Editorial Policial.

NOTA: Los textos obligatorios se encuentran para consulta o préstamo en la Biblioteca del Instituto
Universitario de la Policía Federal Argentina.

tomo 1 investigación científica del delito ) 177


u5
unidad cinco

( investigación científica del delito )


educación a distancia (instituto universitario de la P.F.A.)

CONTENIDOS DE LA UNIDAD V

( INVESTIGACIÓN CIENTÍFICA DEL DELITO )

Mención sintética de los contenidos

1. Distintos tipos de Pericias Mecanográficas.

2. Pasos metodológicos y sistemáticos para determinar Marca y Modelo de la máquina


de escribir utilizada.

3. Idem para la Identificación de la máquina con la que se realizó determinado escrito.

4. Determinación del Fechado de un escrito mecanográfico.

5. Determinación del Dactilógrafo.

6. Pasos metodológicos y sistemáticos para determinar Tiempos de Ejecución Mecanográfica.

7. Detalle de las máquinas de escribir convencionales o a canasta porta tipos.

8. Evolución de las máquinas de escribir y los diferentes tipos de máquinas eléctricas.

9. Primeras Impresoras. Utilización del sistema de computación.

10. Evolución de las impresoras hasta las de última generación.

11. Impresoras Láser.

12. Partes principales y funcionamiento de una máquina fotocopiadora analógica.

13. Partes y funcionamiento de una fotocopiadora Láser.

14. Pericias y determinaciones de fraudes sobre fotocopias.

15. Partes principales y funcionamiento de un fax.

16. Distintos tipos de papeles que pueden utilizarse.

17. Precauciones a implementar acorde al papel y sistema de impresión utilizados por un fax.

tomo 1 investigación científica del delito ) 181


educación a distancia (instituto universitario de la P.F.A.)

182 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

abogacía a distancia oa)


objetivos de aprendizaje de la unidad

n Distinguir los dos tipos de escrituras posibles que puede realizar el hombre. Manuales
y Mecánicas.

n Tomar conocimiento acerca de los orígenes de la escritura mecánica.

n Introducirnos en la historia y creación de las máquinas de escribir.

n Conocer los principales elementos constitutivos de una máquina de escribir.

n Su evolución en el tiempo desde las máquinas de escribir convencionales o a canasta


porta tipos, hasta las impresoras de última generación.

n Los diferentes tipos de pericias mecanográficas posibles, que permiten contestar los
interrogantes que, en las causas judiciales, se puedan presentar.

n Conocer las ventajas que la tecnología aporta constantemente para mejorar la escritura
mecánica y los inconvenientes que plantea en el cumplimiento de la labor pericial.

n Conocer los principios técnicos, principales componentes y funcionamiento interno de


una fotocopiadora.

n Comparar los procesos de producción de una fotocopia, partiendo de una fotocopiadora


analógica o de una digital.

n Ver las diferentes maniobras adulterativas que pueden realizarse con la utilización de
una máquina fotocopiadora y las pericias que se pueden cumplimentar.

n Conocer los principios técnicos, componentes principales y funcionamiento interno de


un fax.

n Tomar conocimiento de los diferentes tipos de papel que se pueden utilizar en un fax,
acorde a su sistema de impresión y los recaudos que deben tomarse frente a cada
uno de ellos.

tomo 1 investigación científica del delito ) 183


educación a distancia (instituto universitario de la P.F.A.)

184 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

( ESQUEMA CONCEPTUAL DE LA UNIDAD V )

PERICIAS POSIBLES Determinación de la marca y modelo

Identificación de la máquina empleada

Determinación del dactilógrafo

Determinación de tiempos de ejecución

Determinación de la fecha del texto

MARCA Y MODELO Diseños de tipos (fabricantes)

Paso mecánico (medición - plantillas)

Paso proporcional (unidad básica)

Examen intrínseco. Determinar fórmula

Descarte por diseño de tipos y mediciones

MÁQUINA Base: personalidad de origen y adquiridas

Examen extrínseco:
a) Determinar paso
b) Determinar diseño letras números y signos

Examen intrínseco:
a) Determinar desalíneos, defectos
b) Fisuras, roturas, empastes, etc.

T/EJECUCIÓN Examen extrínseco: determinar paso y diseño

Examen intrínseco: determinar principios

De Horizontalidad

De Verticalidad

FECHADO Historia gráfica. Requisitos de elementos

Comprobación de características

tomo 1 investigación científica del delito ) 185


educación a distancia (instituto universitario de la P.F.A.)

EVOLUCIÓN Máquinas canasta porta tipos

Eléctricas a bocha

Electrónicas a margarita

Impresoras Cadena

Matriz de punto

Térmicas

A burbujas

A cabezal piezoeléctrico

Cambio de fase

Láser

FOTOCOPIADORAS Distintas clases: analógicas y láser

Principales partes componentes

Funcionamiento y producción del proceso

Distintos tipos de fraudes

Pericias posibles

FAX Principales componentes y funcionamiento

Tipos de papeles que utiliza

Sistemas de impresión

186 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

abogacía a distancia ai )
actividad introductoria

tomo 1 investigación científica del delito ) 187


educación a distancia (instituto universitario de la P.F.A.)

Antes de comenzar con el desarrollo temático de esta unidad y leído el recorte periodístico
del diario “Clarín” del 11 de agosto de 1999 que se adjunta, realice las siguientes tareas:

Analice si la computadora y sus múltiples aplicaciones para la producción o confección de


documentos en general, tanto públicos como privados, traerá ventajas o desventajas. Detalle si
considera que las mismas aportarán más beneficios a la justicia o a los falsificadores y/o adultera-
dores y justifique sus consideraciones.

Además del uso común o tradicional de una computadora, ¿cree que se ha extendido
el mismo a otros asuntos de la vida diaria que pueden ocasionar conflictos, capaces de re-
querir intervención judicial?

Frente a una respuesta afirmativa, piense cuidadosamente tomándose el tiempo nec-


esario para una reflexión profesional y describa ¿cuántos y cuáles pueden ser?

Registre el resultado del presente análisis para una posterior evaluación personal. La
misma debe ser realizada luego de asimilado el contenido temático de la unidad que se desar-
rollará a continuación.

188 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

( DESARROLLO DE LA UNIDAD V )

Escrituras mecánicas

No hay duda que los pasos que el hombre ha dado para mejorar su calidad de
vida han sido muchos, variados y significativos. Los realizados específicamente para
documentar a través del tiempo su palabra, han logrado un estadio superior, aunque
los mismos no sólo no se han detenido sino que, periódicamente, aparecen nuevos
recursos que hacen más fácil el camino y mejoran los resultados.

Desde las primera impresiones religiosas, clánicas o decorativas en las cavernas,


pasando por los grabados de hazañas o actos heroicos en roca o monumentos, hasta
llegar a los pintados o estampados de sellos sobre papiros, pergaminos o papel,
utilizando imágenes, dibujos, jeroglíficos o ideogramas o las escrituras en todos los
alfabetos por él creados, ha recorrido un largo y fructuoso camino.

Primero estas escrituras eran realizadas en forma manual, es decir ejecutadas


con las manos. Pero para poder realizarlas, ha debido crear superficies aptas para el
registro deseado, sea trabajando las que la naturaleza le ofrecía, sea utilizando diversos
recursos de origen vegetal o animal o bien creando técnicas que le permitiesen llegar al
fin buscado.

Asimismo ha debido crear elementos escritores acordes a cada superficie


(punzones, formones, pinceles, lapiceros, etc.) y pinturas, tintas o elementos col-
oreados que permitieran visualizar las ideas plasmadas.

Sólo por destacar un procedimiento que ha perdurado en el tiempo, se hará una breve
referencia a los sellos o troqueles tallados sobre metales o piedras comunes o preciosas.
Estos eran utilizados para marcar documentos u objetos con la señal certificadora de
propiedad u origen. Así los anillos con el rostro, nombre o escudos reales, provocaban
estampes que garantizaban la procedencia de los mensajes y órdenes escritas.

Estos grabados en sobre o bajorrelieves, dejaban impresión o impronta en lacres o


arcillas, y también servían para asegurar el cierre de vasijas, cajas, sacas y fardos. 3.200
años antes de Cristo se utilizaban en la Mesopotamia sellos tallados sobre hueso o piedra
que, con diversos dibujos estampaban a modo de friso, repetitivas imágenes por rodado
sobre arcilla húmeda.

tomo 1 investigación científica del delito ) 189


educación a distancia (instituto universitario de la P.F.A.)

Su uso se extendió a través del tiempo y su empleo fue muy popular no sólo entre
gobernantes y funcionarios, sino también entre pequeños terratenientes. Se han hallado
sellos reales, religiosos, municipales, comerciales y de linaje. Con el aumento de la alfabet-
ización, aumentó también la preferencia por el uso de una firma personal.

Cabe recordar que en un primer momento, el acceso al aprendizaje por ser


oneroso, no estaba al alcance de todos. Baste destacar que cada libro era copiado
a mano, desde su título hasta el texto y las ilustraciones, por monjes o especialistas
que dedicaban meses o años de sus vidas a esta tarea. Como se deduce fácilmente,
no era pues faena sencilla ni económica.

La aparición de la imprenta facilitó la impresión mecánica. Con ese nombre se


distingue a los diferentes procesos que permiten la reproducción de palabras, imágenes
o dibujos sobre una variada gama de superficies, tales como papel, tejido, metal, te-
las y otros materiales. La reproducción idéntica de un original en forma mecánica ha
recibido también el nombre de Artes Gráficas, utilizándose actualmente, además de
la tradicional impresión en relieve, los procesos fotomecánicos y químicos.

Los primeros registros de escritura mecánica aparecen en China poco antes


del año 200 después de Cristo. Los mismos eran obtenidos por estampe de letras e
imágenes talladas en relieve sobre madera. Escritos sagrados chinos que contienen
más de 130.000 páginas, fueron realizados en el siglo X utilizando una técnica de tipos
móviles muy similar al sistema actual. La requisitoria o necesidad de contar con entre
dos mil y cuarenta mil caracteres diferentes en el idioma chino, hizo que éstos no
consideraran práctica esta técnica, abandonando un invento a todas luces genial.

Ciertos historiadores holandeses y franceses aducen que la imprenta en oc-


cidente existía en el valle del río Rhin, cien años antes de Gutenberg y que sus fun-
damentos habían sido desarrollados y utilizados por artesanos textiles europeos para
estampar tejidos. La técnica utilizada en la fundición de tipos fue de precisión tal, que
éstos se mantenían unidos a los extremos del soporte por simple presión. Su principal
defecto era que cualquier tipo que se colocara una fracción de milímetros sobre los
demás, ocasionaba omisión o defecto en la impresión de las letras lindantes.

Empero, la calidad de los libros impresos por el natural de Maguncia (Alemania) de


nombre Johann Gutenberg, considerado tradicionalmente como el inventor de la imprenta
en occidente en el año 1450, especialmente entre ellos el conocido como “La Biblia de
Gutenberg”, es de tal maestría que no admite comparación alguna con los libros de la
época, sean éstos precedentes o no.

190 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

Los libros por él editados fueron de aceptación inmediata, sustituyendo a los incu-
nables o manuscritos. Esto permitió la difusión y el abaratamiento de los libros y que, en un
corto período se imprimieran más de seis mil obras diferentes. Además rápidamente,
se diseminaron por toda Europa una gran cantidad de imprentas.

Las primeras maquinarias transferían la tinta desde las planchas de impresión o


moldes, por presión de los tipos sobre un papel generalmente humedecido, con ayuda
de una superficie móvil o platina. Estas impresiones eran lentas (doscientos cincuenta
impresiones por hora) y sólo imprimían una cara del papel. Posteriormente el sistema de
tornillo fue sustituido por palancas; que al principio se accionaban manualmente , más
tarde pasó al uso del vapor y luego de otras mejoras se llegó a las rotativas alimentadas
por bobinas, que permitían una impresión de dieciocho mil periódicos por hora.

La idea de escribir utilizando una máquina nace a fines del siglo XVII, pero es el
ingeniero inglés Henry Mills quién, en el año 1714, patenta la idea de una máquina
para imprimir letras en forma progresiva de manera similar a la manual, que po-
dría ser de gran utilidad en establecimientos públicos o privados.

Se requirió casi cien años para que la idea se llevara efectivamente a la práctica. Es en
1808 cuando Pellegrino Turri en Italia, crea una máquina de escribir para la hija ciega del
conde de Fantoni. La idea era que ésta pudiera escribir su correspondencia y se distrajera
con ella. No hay registros de cómo estaba construida ni como era su funcionamiento.

Diferentes ensayos crearon máquinas rudimentarias, ingeniosas y notables que


con variados resultados en cuanto a la efectividad de su uso, fueron los que permitieron
llegar a la máquina de escribir convencional que nace en 1872 en Estados Unidos,
de la mano de seis ingenieros que lograron la pionera “Rémington 1” que sólo podía
escribir en letras mayúsculas.

La evolución de la Rémington y los modelos que esos seis ingenieros, en forma


individual comenzaron a fabricar, dieron al mundo una nueva forma de escribir que,
con los adelantos que la tecnología brinda día a día, ha llegado a nuestros días y está
en condiciones de seguir perdurando en el tiempo.

Toda máquina de escribir, además de los accesorios que brindan más y mayores servi-
cios facilitando la escritura mecánica, están compuestas por cuatro órganos fundamentales:
a) un elemento impulsor;
b) un elemento impresor;
c) un elemento entintador y
d) un elemento de movimiento.

tomo 1 investigación científica del delito ) 191


educación a distancia (instituto universitario de la P.F.A.)

El elemento impulsor está constituido por las teclas sobre la que actúan nuestros
dedos. Al presionarlas se hace avanzar la palanca portatipos que constituye el elemento
impresor. Este está compuesto por una barra o palanca así denominada, porque en el
extremo opuesto a la tecla tiene encastrado y soldado un tipo o dibujo en relieve que rep-
resenta a uno de los caracteres numéricos, alfabéticos o de puntuación contenidos en un
idioma. Cada una de estas barras pueden contener uno o más caracteres, generalmente un
número y un signo de puntuación, o dos signos, o una letra en mayúscula y minúscula.

Al avanzar dicha palanca luego de ejercida presión sobre la tecla, el tipo arrastra al el-
emento entintador, constituido generalmente por una cinta que puede ser de papel, tela,
plástico, etc. embebida con una tinta especial, que permite el estampe del contorno del
tipo seleccionado sobre el papel. Al mismo tiempo que se realiza la impresión del carácter
deseado, se mueve la barra espaciadora, poniendo en funcionamiento el elemento de
movimiento que, por medio de una varilla, hace girar una palanca, la que actúa sobre un
trinquete que hace girar a dos ruedas, corriendo la cremallera dentada que desplaza al
carro un intervalo igual que el asignado a los tipos. A este desplazamiento se lo denomina
“Paso” o “Escape”

Las palancas portatipos están dispuestas a modo de abanico abierto, es decir


convergiendo en un punto y estando separadas por el otro, resultando todas reunidas
pero independientes. Así conforman lo que se ha dado en llamar “canasta portatipos”,
que es el nombre genérico de las máquinas de escribir convencionales. Cualquiera sea la
posición de una barra dentro de ese abanico desplegado, cuando es accionada a través
de la tecla correspondiente va a golpear, luego de pasar por la abertura correspondiente
del “ring” o anillo, en un mismo punto, que es el espacio destinado en el papel para la
impresión de ese carácter. De allí es que surge la necesidad de que el papel, una vez
que ha recibido la impresión de un carácter, se desplace hacia la izquierda, para que las
letras se estampen correlativamente a la derecha.

El mecanismo que sostiene y desplaza al papel recibe el nombre de carro, compuesto


esencialmente por uno o dos rodillos, generalmente de caucho, asentado sobre rieles que
le permiten su movimiento. Como se desprende de todo el procedimiento detallado, la
impresión se produce por el impacto del tipo sobre la cinta y ambos sobre el papel. Este
impacto o golpe, deja además de la tinta proveniente de la cinta, una depresión o inden-
tación sobre el papel, que se exterioriza como un surco. Estas impresiones denominadas
por impacto, producen por el permanente golpeteo de los tipos, características sobre los
mismos que se exteriorizan como abolladuras, roturas, fisuras, aplanamientos, etc. que son
las características que permiten la identificación de la máquina utilizada. Al describirse las
diferentes máquinas de escribir e impresoras, se detallará si su impresión es por impacto
o no, debiéndose considerar que las de impacto son siempre identificables.

192 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

Las máquinas de escribir han sufrido constantes avances permitiendo ser


usadas también para música, por ciegos, para matemáticas, para escribir a distancia
(teletipos), para estenografía, etc. Además han evolucionado, desde las máquinas de
escribir tradicionales o a canasta portatipos, pasando por las eléctricas, electrónicas
y los diferentes tipos de impresoras, las que serán detalladas en la presente unidad.

Su uso se ha extendido a todos los países y su costo le ha permitido entrar a casi todas
las casas. Los aportes brindados son indiscutibles y altamente satisfactorios. Pero como ha
sucedido y sucederá siempre, con éste y con todos los avances que el hombre logre, alguien
utilizará sus bondades para efectuar maniobras dolosas o dañosas, que pueden llegar a con-
stituir delito.

Su utilización con fines ilícitos ha requerido que en algunas causas judiciales se


debiera recurrir a peritos, para efectuar diversas determinaciones sobre escritos me-
canográficos. Esto ha provocado a profesionales en la materia a desarrollar técnicas,
las que permiten contestar cinco tipos de interrogantes periciales que abarcan una gran
cantidad de hechos. Se expondrá cada uno de ellos, partiendo por orden cronológico
por las máquinas de escribir convencionales. Luego de detallar las características de las
máquinas eléctricas y de las impresoras, se puntualizará sobre cada una, de corresponder,
las diferencias que pudieran darse por las características distintivas de unas y otras.

Las pericias posibles son:


a) determinación de la marca y modelo de la máquina de escribir utilizada;
b) determinación de la máquina de escribir utilizada;
c) determinación de la fecha del texto mecanográfico;
d) determinación del dactilógrafo; y
e) determinación de tiempos de ejecución mecanográfica.

A continuación se desarrollará cada uno de estos temas.


Determinación de la marca y modelo de la máquina utilizada: Consumado un delito
por medio de un escrito mecanográfico, como por ejemplo una amenaza o una
extorsión, los investigadores si no han logrado rastros papilares u otros caminos
que le permitan llegar al o los autores del hecho, tienen como otra alternativa el
hallar la máquina con la que se realizó el escrito mecanográfico para, a través de
ella, intentar llegar a su autor. Para orientar la búsqueda, se hace necesario deter-
minar las posibles máquinas con las que se pudo realizar, con el fin de no gastar
esfuerzos en otras que, por sus características, no pudieron haber intervenido.

tomo 1 investigación científica del delito ) 193


educación a distancia (instituto universitario de la P.F.A.)

Partiendo entonces de un único escrito dubitado se deben cumplimentar diver-


sos pasos metodológicos y sistemáticos para la determinación deseada, a saber:
a) determinación del Paso o escape;
b) comprobación de la clave acorde el tipo de diseño;
c) determinación de la fórmula;
d) búsqueda de fichas y descarte por diseño; y
e) descarte por mensura.

Se denomina Paso o Escape Mecánico, al espacio constante en que se desplaza


el carro de la máquina de escribir, cada vez que es accionada una tecla que produce
movimiento, salvo el tabulador que lo hace en forma múltiple.

Se aclara “que produce movimiento” porque hay teclas como la del acento y diéresis que
no lo producen. Este espacio o desplazamiento se mide en milímetros. Para su determinación se
efectúa un cálculo matemático o se utilizan plantillas milimetradas. Los pasos mecánicos de las
máquinas más usadas en nuestro país son: 2,00 mm; 2,10 mm; 2,12 mm; 2,17 mm; 2,20 mm; 2,23
mm; 2,54 mm; 2,60 mm y 2,82 mm.

Se denomina Tipo de Diseño a la diferente conformación o dibujo que presentan los carac-
teres (alfanuméricos y signos) asignados a una máquina de escribir. Estos diseños consti-
tuyen estilos y pueden ser de conformación redonda, curva, cuadrada, con o sin serif, etc.
recibiendo nombres identificativos propios como ser: pica, courier, arial, script, elite, etc. En
sus comienzos, cada fabricante de máquinas de escribir confeccionaba sus tipos, eligiendo
un estilo que lo identificaba. Es decir que reconociendo el tipo de diseño era posible deter-
minar la marca de la máquina. Al popularizarse y requerir el mercado una mayor producción
de máquinas, aparecieron empresas que eran más armadoras que fabricantes, que si bien
les daban marca y modelo propio, compraban y utilizaban muchos componentes creados
para otras marcas, lo que motivó que diferentes marcas poseyeran similares características.
De cualquier manera reconocer el tipo de diseño vincula al escrito con ciertas máquinas y
descarta a otras. Nótese a continuación distintos tipos de diseños:

ABC A B C ABC ΑΒΧ ABC ABC


ARIAL COURIER LUCIDA SANS SYMBOL TAHOMA ABADI

194 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

Determinación de la clave y fórmula: se hace necesario destacar aquí a dos técnicos periciales
pertenecientes a la Policía Federal Argentina, los señores Ricardo ROSSET y Roberto CAPELLO,
quienes para el cumplimiento de este paso, en forma pionera crearon una clave local que fue
ampliamente reconocida por INTERPOL. Esa clave fue luego reemplazada por otra Internacional
creada por ese organismo, que consta de los siguientes elementos:
1) comprobación del barral transversal de la letra “t” minúscula. Si es asimétrico, es
decir que no es cortado en su mitad, se le asigna el número 1, en caso contrario (si
es simétrico), se le asigna el 2.
2) comprobación de la morfología o diseño de ciertos números (2 al 6 y el 9). Si son con
bucles le corresponde la letra a; si son cúbicos o abiertos le corresponde la letra b,
ambas en minúscula.
3) comprobación del barral transversal de la letra “f” minúscula. De ser asimétrico se
le asigna el número 1, de ser simétrico el 2.
4) comprobación de las gramas o barrales centrales de la letra “M” mayúscula. Si
alcanzan la línea de base de la letra le corresponde la letra A, si no la alcanzan le
corresponde la letra B, ambas mayúsculas.

Determinada la clave se establece la fórmula junto con el paso. Así por ejemplo podría
resultar la siguiente fórmula: 2,23 1 a 2 B. De no haber en el escrito dubitado alguna de las
letras de la clave, se la conforma cubriendo con una X el espacio correspondiente, debiéndose
luego considerar las fórmulas con las dos posibilidades en ese rubro.

Búsqueda de fichas y descarte por diseño: Debe extraerse del archivo de marcas y modelos de
máquinas de escribir distribuido por INTERPOL, todas las fichas correspondientes a la fórmula
determinada, las que generalmente son muchas. Las mismas además de contener la marca,
modelo, origen, fabricante, lugar y año de aparición, tipo de caracteres y la fórmula, reproducen el
teclado y un texto en mayúsculas y minúsculas y la altura de una grama de algunos caracteres.

A continuación se descartan fichas por comparación o confronte de diseños de los restan-


tes caracteres alfanuméricos y signos no incluidos en la clave, separando aquellas que se
correspondan. Este descarte habrá reducido sensiblemente la cantidad de fichas posibles.

Descarte por mensura: Se debe medir en el escrito dubitado la altura de las gramas de
las letras indicadas en las fichas posibles, descartándose todas aquellas fichas que
no coincidan en mensura. Las restantes, son todas las marcas y modelos de máquinas
de escribir con las que se pudo realizar el escrito dubitado. La búsqueda de la máquina
incriminada se hará exclusivamente dentro de las marcas y modelos posibles, lo que
excluye a la gran mayoría, simplificando notoriamente la labor investigativa.

tomo 1 investigación científica del delito ) 195


educación a distancia (instituto universitario de la P.F.A.)

Determinación de la máquina de escribir utilizada: Acá se trata de establecer la má-


quina –única- con la que se realizó el escrito, con prescindencia de cualquier otra
correspondiente a su misma marca, modelo y/o características. El interrogante puede
plantearse de maneras diferentes: (*) entre un escrito dubitado y una o varias máqui-
nas de escribir o entre los escritos indubitados con ellas realizados; o (**) entre dos
escritos dubitados determinar si fueron confeccionados por una misma máquina.

De contarse con las máquinas de escribir, se hace necesario confeccionar un cuerpo de


escritura. Este debe contener los datos completos de la máquina con la cual se lo confec-
ciona, es decir detallar marca, modelo y numeración. Luego se debe reproducir dos veces el
teclado completo, tanto en mayúsculas como en minúsculas y por último se copia el texto
dubitado u otro texto, para comprobar como se interrelacionan los caracteres entre sí.

Los pasos y comprobaciones a efectuar en todos los casos son los siguientes:
a) determinación de paso;

b) determinación de diseño tipográfico;

c) análisis intrínseco tendiente a determinar las características de fabricación y de uso o mal


uso que determinan la personalidad de una máquina de escribir, debiéndose comprobar
dos circunstancias:
1) desalíneos;
2) defectos en los tipos.

Determinación de paso: Debe realizarse igual procedimiento y comprobación que para el tipo de
pericia ya descrito. El resultado será un paso expresado en milímetros. De no corresponder el mismo
paso entre los escritos dubitado e indubitados (*) o entre los dubitados entre sí (**), se determina
que no pudieron haber sido confeccionados por una misma máquina. De corresponderse se deben
cumplimentar los restantes pasos.

Determinación de diseño tipográfico: Se debe verificar la correspondencia de los diseños tipográfi-


cos entre los escritos estudiados. De no corresponder o de corresponderse, se debe adoptar igual
procedimiento que en la determinación del paso.

Análisis intrínseco: Se deben establecer las características de fabricación y/o de uso o mal uso,
que determinan la personalidad de una máquina de escribir. Si bien los tipos y demás compo-
nentes de una máquina se fabrican en serie, éstos en forma individual requieren pulidos o trata-
mientos especiales. Las máquinas de una misma marca y modelo se fabrican también en serie,
pero su armado se efectúa en forma manual e individual, determinando pequeñas diferencias
no sustanciales. Por ello y al sumar ambas circunstancias, todas las máquinas recién fabricadas
y puestas a la venta, poseen ya pequeñas diferencias que hacen a su personalidad.

196 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

El uso o mal uso de las mismas, determina además, el incremento de esas características
de fabricación, provocando:
a) desalineos: dados por los diferentes mecanismos, resortes, tornillos, engranajes,
cremalleras, dientes, vástagos, etc., es decir por los componentes o piezas de la
máquina que sufren por diferentes causas, tales como: incorrecto traslado al ser
tomadas por el carro, golpes en las barras portatipos, falta de limpieza, excesiva o
incorrecta limpieza, etc., daños o deficiencias que se trasmiten en forma de desali-
neos de los tipos, provocando impresiones hacia arriba y abajo, hacia la derecha e
izquierda, e inclinaciones hacia la izquierda o la derecha; y
b) defectos de tipos: ocasionados por golpeteos anómalos por presión simultanea de
teclas, que provocan daños en los tipos tales como roturas, fisuras, abolladuras y
empastes que se trasmiten a sus impresiones. Estas características sumadas a las de
fabricación, conforman la personalidad distintiva de una máquina de escribir.

A través de un profundo examen microscópico se logran comprobar estas dos


circunstancias las que, evaluadas en cantidad y calidad, permiten establecer si dos es-
critos mecanográficos fueron confeccionados por una misma máquina de escribir.

Determinación de la fecha del texto mecanográfico: muchos interrogantes periciales


requieren establecer la fecha real en que fue confeccionado un escrito mecanográfico,
es decir determinar si realmente fue realizado en la fecha que presenta el documento
dubitado. Esto requiere efectuar algunas consideraciones acerca de las tintas.

Las tintas en general (de las que nos ocuparemos en otra unidad) utilizadas en los
distintos tipos de elementos escritores (plumas, lapiceras, bolígrafos, fibras, cintas de má-
quinas, etc.) no evolucionan con el tiempo, es decir no cambian desde el momento en
que son depositadas sobre el papel. Esto no permite determinar por procedimientos
técnicos o científicos, la fecha cierta en que fue confeccionado un documento, sea
este manuscrito, mecanográfico o realizado por cualquier sistema de impresión.

Frente al interrogante planteado en este tipo de pericias, se pueden efectuar distintos


procedimientos indirectos que orientan sobre la fecha de producción de un documento. Uno es
de orden químico y se realiza mediante los análisis y las comprobaciones correspondientes sobre
los componentes de las tintas, el papel y del elemento escritor con que fuera confeccionado
el documento dubitado. Establecido esto, se establece la fecha de aparición en el mercado de
esos productos. Si son anteriores al fechado del documento, no se puede comprobar circun-
stancia alguna. De ser posteriores al mismo se establece, por imposibilidad fáctica de utilizar
un producto que aún no se había producido, la falsa datación del mismo.

tomo 1 investigación científica del delito ) 197


educación a distancia (instituto universitario de la P.F.A.)

Otro procedimiento para escritos mecanográficos es de orden físico y se deben


cumplimentar los siguientes pasos metodológicos y sistemáticos:
a) obtener historia gráfica de la máquina utilizada,
b) determinar características de personalidad de la máquina por períodos de tiempo y
c) confrontar las características del dubitado con las de la historia gráfica.

Historia gráfica de la máquina utilizada: Para ello se deben suministrar escritos indubitados
realizados por la máquina con que se confeccionara el documento dubitado, debiendo ser
aquellos, anteriores, posteriores y contemporáneos a éste. Esto significa por ejem-
plo, que si el documento sobre el que se requiere establecer el fechado está datado
en marzo de 1998, se deberían obtener indubitados de varios meses de los años 1996,
1997, 1998, 1999 y 2000.

Características de personalidad de la máquina por períodos de tiempo: Sobre cada uno de esos
escritos indubitados se deben determinar las características de personalidad de la máquina,
detectando desalineos y defectos en los tipos. Al hacerlo por períodos de tiempo se podrá
determinar la aparición en fecha aproximada, de nuevas características de personalidad, sean
éstas producto de reparaciones o de deficiencias de uso.

Confronte de las características del dubitado con las de la historia gráfica: resta ahora
establecer si las características de personalidad del escrito dubitado se corresponden
con las que poseía la máquina en los escritos indubitados cercanos a marzo de 1998 o
no. Si las características encontradas corresponden a otro período, se determinará la
falsedad del datado y se podrá establecer la fecha aproximada de su confección.

Determinación del dactilógrafo: en los escritos mecanográficos anónimos, o con-


tinuando el ejemplo detallado que motivara la determinación de la marca y modelo
de la máquina de escribir utilizada para la realización de un texto, donde primero se
determinaron las máquinas posibles, luego dentro de ellas se identificó la máquina
utilizada, si ahora individualizamos al dactilógrafo, la investigación estaría completa y
con óptimos resultados.

Sin embargo este interrogante es de difícil solución, requiriendo para su estableci-


miento contar con un texto lo suficientemente amplio, que contenga suficientes caracter-
ísticas identificatorias. Se deben determinar dos circunstancias:
a) presionado y
b) características de forma.

Presionado: se debe analizar la uniformidad o no de la intensidad de la impresión de los tipos o


de sus indentaciones (surco dejado por la presión del tipo al golpear sobre el papel). Esto estará

198 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

dado por la correcta o incorrecta digitación sobre el teclado, en concordancia con la posición de
las manos, fuerza y manejo de los dedos, velocidad, etc. Se debe tener en cuenta que, acorde
a donde se encuentren ubicadas en el teclado, no en todas las teclas, ni con todos los dedos,
se ejerce una presión o golpeteo constante. Esa presión será diferenciada para cada carácter,
pero constante entre ellos si son realizados por un dactilógrafo acostumbrado, aunque pueden
existir variaciones por diversos factores, tales como nerviosismo, apuro, enfermedades, estados
de ánimo, temperaturas extremas, etc.

Características de forma: Acá se debe tener en cuenta el estilo o forma de efectuar un


escrito, tomándose en consideración los siguientes elementos: márgenes superiores, infe-
riores, izquierdos y derechos; utilización de sangría, si ésta es fija o personal; espaciados;
terminación de párrafos con punto o punto y guión; terminación de renglón compensando
o no los espacios libres; forma de utilización de los signos de puntuación; estilo o manera
de efectuar una composición escritural; el manejo o conocimiento del idioma en cuanto a
estructuración de frases, modismos, faltas de ortografía, sintaxis, etc.

Es necesario contar con abundante material de confronte realizado en distintas fechas,


sobre textos largos y ajenos a la investigación. Es, empero, un tema muy complejo que de-
pende de diversos factores, siendo muy pocos los casos en que se puede lograr la identi-
ficación y menos aún los casos de categóricas afirmaciones. Tener en cuenta que, lo que
hace a la forma, puede ser imitado por alguien que quiera incriminar a otra persona.

Determinación de tiempos de ejecución mecanográfica: un escrito mecanográfico


estará realizado en un solo tiempo de ejecución, si fue confeccionado en su totali-
dad sin retirar el papel de la máquina o sin haber liberado la palanca sujeta
papel, no importando cuanto tiempo cronológico haya transcurrido. Si se sacó el
papel de la máquina o se liberó la palanca, aunque el texto se continúe en forma
inmediata, habrá más de un tiempo de ejecución mecanográfica. Esta determi-
nación es importante para establecer si hubo agregados en un documento.

No es infrecuente que luego de haber suscripto de común acuerdo un documento


confeccionado en forma mecanográfica, una de las partes en forma fraudulenta, contando
para ello con la máquina de escribir utilizada, agregue a ese escrito alguna constancia
que de algún modo modifica el tenor o las condiciones del mismo. De haber utilizado otra
máquina, la maniobra quedaría fácilmente evidenciada, pero al usar la misma máquina, se
requiere una pericia para determinar cuantos tiempos de ejecución presenta ese escrito. De
presentar uno, no queda duda alguna de su legitimidad si las firmas están puestas después
del texto ya que indica que, una vez finalizado, las partes que lo suscriben estuvieron de
acuerdo con el texto.

tomo 1 investigación científica del delito ) 199


educación a distancia (instituto universitario de la P.F.A.)

De haber más de un tiempo de ejecución, no necesariamente implica una maniobra


fraudulenta, pero deberá justificarse las causas en forma firme, si se presentan posiciones
encontradas. Debe tenerse en cuenta que no encierra fraude alguno que una vez leído
un documento, después de haberlo retirado de la máquina y de común acuerdo entre las
partes se decida agregar algo, colocándose para ello la hoja nuevamente en la máquina de
escribir. De ocurrir esto, debería dejarse constancia en el documento para evitar posteriores
argumentos de alguna de las partes.

Pero ante la posibilidad de un fraude por agregado en un texto mecanográfico, ¿es


posible determinar si todo el escrito fue realizado en un solo acto o no? La respuesta es sí.
Deben para ello cumplimentarse los siguientes pasos metodológicos y sistemáticos:
a) determinación del paso;
b) determinación de diseño y
c) verificación del cumplimiento de los principios de Horizontalidad y Verticalidad.

Determinación del paso: esta verificación se efectúa para determinar la intervención o no de más
de una máquina en la confección del texto y para establecer que plantilla milimétrica se debe
utilizar para la experiencia. Recordar que de tratarse de una máquina de escribir convencional, de
establecerse más de un paso se estaría determinando más de una máquina y lógicamente más de
un tiempo de ejecución mecanográfica. Con respecto a la plantilla, determinado el paso se utilizará
la correspondiente al mismo para las comprobaciones a efectuar.

Determinación de diseño: Al igual que con el paso, en una máquina de escribir convencional
si encontramos más de un modelo de diseño tipográfico se estará estableciendo el empleo de
más de una máquina y por ende más de un tiempo de ejecución.

Verificación del cumplimiento de los principios de Horizontalidad y Verticalidad: Determinada la


presencia de una única máquina de escribir en la confección de todo el escrito mecanográfico
dubitado, se debe establecer ahora el cumplimiento de estos dos principios para establecer si se
ha realizado en un solo tiempo de ejecución.

Principio de Horizontalidad: para su determinación deben tomarse dos letras iguales de un mismo
renglón, ubicadas lo más equidistante posible una de otra, es decir una próxima al margen izquierdo
y otra al derecho. Lo ideal sería tomar una letra que tenga una grama (trazo o rasgo de una letra)
horizontal, como por ejemplo el barral de la letra “t” o los de una “i” o “z”.

La plantilla milimétrica correspondiente al paso de la máquina utilizada, posee dibujada


en toda su superficie finas líneas verticales separadas entre sí por una distancia igual al valor
del paso. Por ejemplo, para un paso mecánico de 2,54 mm, cada línea estará separada de la
siguiente por ese valor milimétrico. Además posee tres o cuatro líneas horizontales distribuidas

200 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

en forma equidistante entre sí, denominadas líneas de fe. Haciendo coincidir una de esas
líneas de fe en el centro de la grama horizontal de las dos letras iguales y equidistantes
seleccionadas (esto debe hacerse con la utilización de lupa, para que la coincidencia
entre una y otra sea exacta) y las líneas verticales que encierren o enmarquen a todas las
letras de ese renglón, se efectúa la comprobación de este principio.

De cumplirse el mismo, todas las letras iguales a las tomadas como referenciales
que se encuentren en el mismo renglón, deben tener exacta coincidencia con la línea de fe
que aquellas. Además tenemos una visión general de coincidencia, al quedar las restantes
letras del escrito perfectamente enmarcadas por las líneas verticales.

Principio de Verticalidad: para su determinación deben cumplimentarse similares pasos que para
el principio de horizontalidad, sólo que las letras iguales tomadas como referenciales deben estar
ubicadas en forma equidistante y en igual columna, entre el primer renglón y el último del escrito o
entre dos renglones lo más separados posibles. En este caso lo ideal sería tomar letras que conten-
gan una grama vertical, como por ejemplo las letras “ l ”, “ i ”, “ d ”, etc. De cumplirse dicho principio
todas las letras iguales cortadas por la línea de fe deben coincidir en forma exacta.

Para establecer si todo un escrito fue realizado en un solo tiempo de ejecución


deben cumplirse ambos principios. De no cumplirse uno de ellos, quedará establecida la
presencia de más de un tiempo de ejecución mecanográfica. Estas comprobaciones, al
igual que las detalladas para cada tipo de peritaciones posibles, deben ser señalizadas en
láminas adjuntas al informe pericial, pudiendo obtenerse las mismas por fotografía, fotocopia
o escaneado.

Analizados los diferentes tipos de pericias mecanográficas que pueden realizarse,


faltaría detallar la evolución que han sufrido las máquinas de escribir con el transcurso del
tiempo, indicando las ventajas de su uso y los inconvenientes o modificaciones en los pasos
a seguir para las comprobaciones periciales.

En orden cronológico podemos distinguir los siguientes tipos:


a) máquinas de escribir eléctricas;
b) máquinas de escribir a esferas o Selectric;
c) máquinas de escribir electrónicas;
d) impresora computacional a cadena;
e) impresora a matriz de punto;
f) impresoras térmicas;

tomo 1 investigación científica del delito ) 201


educación a distancia (instituto universitario de la P.F.A.)

g) impresoras a burbujas;
h) impresoras con cabezal piezoeléctrico;
i) impresoras por cambio de fase; e
j) impresoras láser.

Máquinas de escribir eléctricas: Aparecen en el mercado en la década del 40, pero en


nuestro país empiezan a ser vendidas en los 60’, comercializándose primero las IBM y luego
las Olivetti y las Underwood, aunque son muchas las marcas que las fabricaron, como ser
Japy, Olympia, Rémington, Friden y Hermes. Sus impresiones son por impacto.

Estas máquinas contienen los cuatro elementos fundamentales de toda máquina de es-
cribir ya descriptos en las convencionales, más todos aquellos componentes que hacen a su uso
y servicios. Además de ser eléctricas, lo que aportaba beneficios en lo que hace a comodidad y
velocidad de la escritura, permiten mucha mayor calidad escritural, en algunos casos muy similar
a impresos por tipos de imprenta, debido a que acorde al cuerpo del carácter (letra, número o
signo de puntuación) a imprimir, éste ocupa un espacio predeterminado pero diferentes unos a
otros. Las letras de menor cuerpo, es decir las más angostas (“l, i, t,” etc.), ocupan un especio
menor que las medianas (“e, n, o” etc.) y que las de mayor cuerpo o anchas (“m, w” etc.).

Lógicamente esta circunstancia trae aparejado que el paso o escape no puede ser
mecánico o constante, ya que el desplazamiento debe ser acorde al cuerpo del carácter
impreso. Este tipo de máquinas tiene “paso proporcional”, pudiéndoselo definir como;

Paso Proporcional es el espacio proporcional en que se desplaza el carro de


la máquina cada vez que se acciona una tecla que produce movimiento simple.

Para su medición se toma en cuenta la “unidad básica” que es el menor espacio


que recorre el carro, correspondiéndole acorde al ancho de cada carácter 2, 3, 4 o 5
unidades básicas.

A modo de ejemplo y sólo para mencionar algunas de las máquinas más utilizadas, se
detalla que las marca Olivetti poseen unidad básica de 0,8 mm, en tanto que las IBM pueden
presentar tres medidas diferentes según sus modelos, a saber: 1/32 pulgadas (0,793 mm);
1/36 pulgadas (0,705 mm) y 1/45 pulgadas (0,564 mm).

Con relación al diseño o morfología de sus caracteres cada marca y modelo pre-
sentan diseños exclusivos o compartidos por otros modelos. Algunas marcas, como por
ejemplo IBM ha dotado a algunos de sus modelos con características distintivas para su

202 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

fácil determinación. A modo referencial se menciona que es posible determinar que se trata
de una máquina marca IBM, modelo Executive tipo Directory, si su paso proporcional es de
1/32 pulgadas, y las letras “h”, “n” y “u” poseen 4 unidades básicas, ya que ninguna otra
máquina de IBM posee esa mensura en esas letras.

Con relación a los tipos de pericias mecanográficas posibles, que ya fueran detal-
lados para las máquinas de escribir convencionales, se mencionarán las características
diferenciales con respecto a este tipo de máquinas. Como se comprenderá del siguiente
análisis, las diferencias con aquellas están dadas, justamente, por las diferentes característi-
cas que presentan estas nuevas generaciones de máquinas, pero las comprobaciones
son todas similares.

Marca y modelo: además de su posible identificación a través de los caracteres dife-


renciales mencionados “ut-supra”, se deben cumplimentar los pasos metodológicos y
sistemáticos detallados para las máquinas convencionales, es decir: determinación del
paso, que en este caso será proporcional; de diseño; determinación de clave y luego
conformación de fórmula; búsqueda en el fichero de máquinas de paso proporcional y
descarte por diseño y por mensura.

Determinación de la Máquina: al igual que para el tipo anterior, se deben cumplimentar


los pasos metodológicos y sistemáticos vistos para las convencionales: paso; diseño y
características de desalineo y de defectos de tipos. Sólo debe aclararse con respecto a
estos últimos que, debido al ancho y sombreado que presentan, la búsqueda de abol-
laduras, fisuras, empastes, roturas, etc. y de desplazamientos, se torna más dificultosa,
debiéndose agregar además que generalmente son en cantidad, menores en número que
en las convencionales. Dadas estas circunstancias, es posible una identificación positiva
aún hallándose menor número de características.

Determinación del fechado: rigen las mismas consideraciones que para las convencionales.

Determinación del Dactilógrafo: este tipo de pericia a partir de estas máquinas y en las que se
detallarán posteriormente, queda reducido a la determinación de la forma o estilo de escritura,
ya que el presionado no depende del dactilógrafo sino del impulso eléctrico de la máquina por
lo que, lo ya dificultoso se torna casi imposible, no tratándose este tema en lo sucesivo.

Tiempos de ejecución: debe establecerse paso, diseño y los principios de horizontalidad y


verticalidad. Todo conlleva igual procedimiento que en las convencionales, sólo que en el
principio de verticalidad, las letras equidistantes entre dos renglones alejados del escrito, no
deben estar en igual columna, sino a igual cantidad de unidades básicas, ya que no
dependerá de la cantidad de letras desde el margen, sino del cuerpo de éstas o lo que
es lo mismo, de la cantidad de unidades básicas.

tomo 1 investigación científica del delito ) 203


educación a distancia (instituto universitario de la P.F.A.)

Máquinas de escribir a esfera o Selectric: A mediados de 1961 aparece en el mercado un nuevo


tipo de máquinas de escribir carente de barras portatipos, en las que el carro permanece fijo y
es un elemento monoimpresor el que se desplaza de izquierda a derecha a lo largo de aquél.
Ese elemento es de plástico niquelado y está conformado por una esfera achatada en sus polos,
sobre las que están moldeados en relieve la totalidad de los caracteres tipográficos, dispuestos
en cuatro hileras paralelas de veintidós letras, números o signos cada una (en otros modelos
y/o marcas esta disposición y número son variables). Sus impresiones son por impacto.

Accionada una tecla, es el elemento monoimpresor el que girará hacia derecha o izquierda
y el que se inclinará de manera tal que el carácter seleccionado enfrente el rodillo, haciéndolo
luego caer sobre la cinta y el papel, produciendo el estampe. El desplazamiento de este elemento
acorde al tipo de paso que posea la máquina, será constante o proporcional. Esta nueva car-
acterística obliga a una ampliación de la definición de paso para que, en forma genérica, pueda
abarcar a la totalidad de las máquinas de escribir, sean antiguas o modernas. El mismo quedaría
entonces definido así:

Paso es el espacio constante o proporcional en que se desplaza el carro o el


elemento monoimpresor, cada vez que es accionada una tecla que produce mov-
imiento simple.

Algunas de estas máquinas pueden poseer dos o tres pasos diferentes, como por
ejemplo la IBM 82 que posee dos pasos mecánicos, uno de 2,54 mm y otro de 2,12 mm,
pudiéndose optar por uno u otro, accionando una palanca. Además el elemento monoim-
presor resulta fácilmente removible de su encastre, por el simple accionamiento de la palanca
liberadora del retén. Esto da la posibilidad de cambiarlo cuando se deteriora o rompe, o
simplemente cuando se desea cambiar de estilo o tamaño de letras.

Con relación a los diseños de los tipos, inicialmente se fabricaron en tres modelos,
uno tipo pica y tres tipo elite, pero estos no eran puros como en las máquinas convencio-
nales, lo que permite su fácil identificación. De lo expuesto surge que es posible identificar
la marca y el modelo de la máquina utilizada siguiendo los pasos ya indicados, aunque para
este tipo de máquinas es más conveniente tener los catálogos correspondientes a ellas.

La identificación de la máquina presenta como principal dificultad, que la posibilidad de


intercambio de los elementos monoimpesores entre máquinas del mismo modelo y marca y a
veces entre máquinas de distinto modelo, trae aparejado que deban mensurarse por separado lo
que son defectos propios de la máquina y los que pertenecen al elemento impresor o esfera.

204 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

Serán por ejemplo defectos propios de la máquina, entre otros, los siguientes: la
impresión de caracteres torcidos (por estar torcido el sostén de la esfera); impresiones
desparejas (por inadecuada complementación de rodillo y esfera); paso o escape no
ajustado a valores establecidos (por deficiencias en piñón y cremallera); desplazamientos
laterales de los caracteres (por desgaste de la cuña que regula la rotación de la esfera);
desplazamientos verticales de caracteres (por deterioro del retén); defectuoso espacia-
miento de los renglones (por desequilibrio de tamaño de rodillo, aunque también puede
deberse a causas circunstanciales, como ser la realización de varias copias simultáneas
con uso de papeles carbónicos); etc.

Son defectos propios del elemento monoimpresor, entre otros, los siguientes: las
roturas, fisuras, abolladuras y empastes de los caracteres (por idénticas causales que las
ya detalladas); desplazamientos laterales de los caracteres (por desgaste de los dientes
que permiten su rotación); desplazamientos verticales de caracteres (por deterioro de las
muescas de ajuste); etc. Se hace constar que estos desplazamientos laterales o verticales
se producen sólo en los caracteres cuyos dientes o muescas tienen defectos, en tanto
que si son desplazamientos producidos por defecto de la máquina se producen en todos
por presentar defectos el retén o cuña que inciden sobre todos.

Para el resto de los diferentes tipos de pericias mecanográficas, rigen las consideraciones
ya vertidas, siendo posibles sus realizaciones y determinaciones.

Máquinas de escribir electrónicas: las primeras máquinas de este tipo reemplazaron la es-
fera monoimpresora por un disco o margarita, constituido por una rueda plana de engarce
central, que se encuentra dividida en forma de pétalos o rayos, conteniendo en los extre-
mos externos de cada uno de ellos la totalidad de los caracteres. Seleccionado un carácter
la rueda gira en su búsqueda por el camino más corto. Sus impresiones son por impacto.

Estas máquinas poseen diversos pasos, lo que permite obtener mayor o menor can-
tidad de caracteres por pulgadas o lo que es lo mismo mayor o menor tamaño de letras. Ello
se logra moviendo la palanca selectora y cambiando el elemento impresor. Algunos modelos
poseen cartuchos electrónicos que contienen diversos estilos de tipos, lo que permite distintos
tipos de impresiones y uso simultáneo de dos estilos. Entre las principales máquinas de estas
características se destacan dentro de las IBM, los modelos 3 y 5 y Selectric Sistema 2000 y
dentro de las Olivetti las series ET 121, 221, y TES 401.

Posteriormente aparecieron las máquinas de escribir con fuentes electrónicas IBM QUIET
(Quietwriter y Quietwriter 7 Typewriter), que contienen un chip de memoria que les permite
alojar todos los caracteres estándar de la mayoría de los discos o margaritas, en diferentes
idiomas y con símbolos de aplicación especial. Una sola fuente puede contener igual cantidad
de caracteres que 20 discos.

tomo 1 investigación científica del delito ) 205


educación a distancia (instituto universitario de la P.F.A.)

Algunas máquinas electrónicas están equipadas con memoria interna capaz de


almacenar desde un par de líneas de texto hasta más de 40.000 caracteres y pantallas de
cristal líquido que permite visualizar el texto antes de su impresión y hacer por ejemplo,
copias de una misma carta para diferentes remitentes. Son híbridos entre las máquinas de
escribir eléctricas y los ordenadores. No ofrecen particularidades que impidan la realización
de los diferentes tipos de pericias mecanográficas.

En la década de los 80 aparecieron y se popularizaron los procesadores de textos o com-


putadoras que, por medio de un software, se posibilita el manejo de los mismos, insertando, bor-
rando, cortando, moviendo, modificando tipos y tamaño de letras, diseñando formatos, etc.

En estas computadoras, los textos que se confeccionan o modifican a través del


teclado o del ratón o mouse, pueden ser visualizados en una pantalla o monitor y pueden man-
tenerse en una memora virtual o conservarse en distintos tipos de discos archivadores.

Para su volcado al papel, requieren de una impresora conectada a ella a través de


un puerto de conexión. Estas, con relación a las máquinas de escribir, presentan tres de
los cuatros elementos fundamentales para lograr su cometido.

El que no poseen es el elemento impulsor como parte integrante de ella. Dicho elemento
conserva todas las tareas que hasta la fecha tenía que realizar y otras nuevas, pero ahora lo
realiza en forma independiente, encontrándose en conexión con el ordenador y no con la impre-
sora. El resto de los elementos, el impresor, el entintador y el de movimiento, con las variantes
propias para cada tipo y modelo que se detallarán en cada caso, conservan su misión.

Las primera impresoras utilizaron el sistema de impresión por impacto a través de


esfera impresora o disco o margarita. Para ella, en cuanto a los tipos de pericias posibles,
se ratifican las mismas consideraciones que para las máquinas de escribir. Obsérvese en
las figuras siguientes, los detalles y características de estos dos sistemas de impresión.

Impresión a esfera o bocha Impresión a disco o margarita

206 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

Impresora de cadena: presentan los caracteres o tipos en relieve moldeados sobre eslabo-
nes metálicos ordenados en forma sucesiva, montados sobre una cinta sin fin que es ac-
cionada por mecanismos de arrastre. La impresión se produce por impacto al ser disparado
electromagnéticamente el martillo, cuando el carácter seleccionado pasa frente a él. Es una
impresión “al vuelo” y de altísima velocidad, al empujarse el papel sobre la cinta y el tipo.

A lo largo de dicha cadena los caracteres se repiten varias veces, teniendo en cuenta la
frecuencia de uso de los mismos según el idioma, desplazándose por medio de su mecanismo
de arrastre hacia el carácter seleccionado más próximo. La posibilidad de la identificación de
la máquina y de su elemento impresor es positivo. La ventaja de este tipo de impresoras es su
velocidad y la desventaja es la tendencia de la cinta a romperse con el uso. Ver en la ilustración
siguiente la forma y características del elemento impresor en este tipo de impresoras.

Impresora a cadena

Impresora a matriz de punto: Estas impresoras revolucionan definitivamente esta forma


de impresión mecánica, ya que no poseen más tipos fijos representando a los car-
acteres alfanuméricos y a los símbolos. Estos ahora, son formados por agujas que al
ser disparadas por electroimanes imprimen puntos. La sumatoria de estos conforman el
carácter o dibujo. Su cabezal de impresión posee dispuestas en forma vertical entre 8
y 48 agujas, según el modelo y sus circuitos internos controlan el disparo de las agujas
o alambres, mientras que su cabezal se desplaza frente a la platina dibujando los carac-
teres por medio de puntos. Las impresiones las realiza tanto hacia la izquierda como a la
derecha, es decir que imprime mientras se desplaza en ambas direcciones.

La calidad de las impresiones depende de la cantidad de agujas con las que han
sido dotadas. Obviamente si tenemos en cuenta que una recta es una sucesión de puntos,
a mayor cantidad de agujas –puntos, mejor será la calidad de sus impresiones.

tomo 1 investigación científica del delito ) 207


educación a distancia (instituto universitario de la P.F.A.)

Poseen además un controlador de calidad, pudiéndolo hacer en modo normal o


“draft” o en calidad tipo carta “near letter quality”. En esta última calidad la impresora imprime
dos veces cada línea, desplazando medio alambre en sentido horizontal y vertical durante
la segunda pasada, de modo que al haber el doble de puntos impresos, su calidad mejora
semejándose a una buena máquina de escribir.

Por medio de selectores es posible elegir distingos tamaños de letras, de espaciados, se


pueden definir caracteres especiales y hacer gráficos. Algunos modelos permiten impresiones
a color. Obsérvese en las figuras siguientes, las características de estas impresoras.

Núcleo o cabezal de impresión Detalle de las agujas y frente del ca-

Cuando a través del CPU recibe la orden de imprimir un carácter, la impresora selec-
ciona cuales son las agujas que deben ser disparadas, poniendo en funcionamiento a los
electroimanes correspondientes.

Al incidir sobre la cinta y el papel, dibujan una sucesión de pequeños puntos que le
dan su característico aspecto, conformando una buena aproximación del carácter deseado
o de un gráfico. Al dibujar en cada caso a través de puntos la orden recibida, permite la
realización de cualquier tipo de carácter incorporado a su memoria, el que puede ser de-
terminado a través de un panel selector.

208 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

En la figura siguiente puede apreciarse la conformación de un carácter por la im-


presión sucesiva de puntos:

Impresoras más avanzadas de este tipo (las de 48 agujas), pueden alcanzar en la real-
ización de gráficos, calidades resolutivas de 360 x 360 dpi (dot per inch o puntos por pulgada)
al poseer cuatro líneas con doce agujas, las que poseen un diámetro de 0,14 mm. Otras han
sido dotadas con cuatro cabezales de impresión que se reparten el trabajo a realizar, logrando
mayor velocidad. Todos estos tipos de impresoras posibilitan identificaciones positivas.

Impresoras térmicas: Estas impresoras son muy parecidas en cuanto a funcionamiento


a las de matriz de punto, ya que realizan sus impresiones a través una serie de agujas,
las que mediante una sucesión de puntos conforman el carácter alfanumérico, símbolo o
gráfico seleccionado sobre un papel termosensibilizado, el que puede ser de dos tipos,
de base blanca o negra, los que serán descriptos oportunamente.

Estas agujas se encuentran dispuestas verticalmente en el cabezal que se desplaza


horizontalmente igual que en las matriciales, pero ahora son activadas y calentadas elec-
trónicamente y van quemando ennegreciendo el papel, dejando marcados puntos pequeños,
densos, nítidos y sin difusión. Al igual que en aquellas, comenzaron con poca cantidad de
agujas, las que se fueron incrementando hasta las 48 finales que le confieren a sus impresio-
nes gran resolución. Cabe, para este tipo de impresoras, idénticas consideraciones periciales
que para las anteriores.

El papel que requieren, como ya se ha especificado, debe ser termosensible. Dentro de la


gran variedad que se ofrece en el mercado, estos pueden ser de dos tipos: a) de base negra o b)
de base blanca. Los de base negra son papeles oscuros recubiertos por una sustancia de
color blanco o plateado, la que se volatiliza fácilmente al incidir sobre ellas temperaturas
relativamente bajas, como las que alcanzan las agujas de las impresoras de cabezal térmico.
Los de base blanca son papeles comunes que están recubiertos por una sustancia quími-
camente tratada, la que se torna oscura cuando las agujas calientes inciden sobre ella.

tomo 1 investigación científica del delito ) 209


educación a distancia (instituto universitario de la P.F.A.)

Impresoras por Inyección de tinta: este tipo de impresoras tiene, al igual que las descriptas,
un cabezal impresor, pero en lugar de agujas poseen inyectores de tinta, que en número
de 48 o 64 alcanzan resoluciones de hasta 360 dpi. Estas toberas que no entran en
contacto con el papel, eyectan tinta cuando su cabezal se desplaza frente a la platina,
dibujando así los caracteres. Se distinguen tres tipos de tecnologías:
a) a burbujas;
b) con cabezal piezoeléctrico y
c) por cambio de fase.

A burbuja: Estas impresoras poseen boquillas que en su extremo, alojan a un elemento


térmico que calienta la tinta contenida en su interior, la que al hervir, producen burbujas
de tinta que al crecer y a través del inyector, es disparada sobre el papel.

Cabezal Piezoeléctrico: este tipo de impresora es muy utilizado dado su bajo


costo. El sistema es similar al anterior, sólo que al final de cada inyector posee un
elemento piezoeléctrico que bombea la tinta al recibir el impulso o señal eléctrica,
funcionando a modo de una canilla que abre y cierra el paso de un fluido. Obsérvese
en la figura siguiente, las características de este tipo de impresoras.

Cambio de fase: Estas impresoras utilizan tintas sólidas que al ser calentadas a 140
grados por un calefactor, se licuan y son eyectadas por los inyectores del cabezal.
Una vez que la tinta es depositada sobre el papel, unos rodillos trabajando en frío la
secan, fijándola. El resultado es una impresión con colores densos y vivos, propio
de las tintas sólidas. Todas estas impresoras pueden ser identificadas, rigiendo las
mismas consideraciones ya vertidas.

210 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

Las impresoras láser serán descriptas al desarrollarse el tema de las foto-


copiadoras láser color, por lo que queda pendiente su tratamiento.

Antes de describir como se realiza el proceso de fotocopiado, se hace necesario


efectuar algunos recordatorios y consideraciones básicas sobre física.

Un átomo está compuesto por tres tipos de elementos, poseedores de cargas


eléctricas diferentes:
a) Neutrón (de carga neutra);
b) Protón (de carga positiva) y
c) Electrón (de carga negativa). Estos pueden ser aislados y tomados como fuentes
específicas, permitiendo conformar campos electrostáticos.

Campos electrostáticos: Colocados en forma cercana un protón y un electrón,


estos se atraerán por tener cargas eléctricas opuestas, desplazándose las líneas de
fuerza desde el protón hacia el electrón. Cuanto más cerca estén estos dos elementos
o cuanto mayor sea el número de los mismos, mayor será la atracción. El área donde
se manifiestan estas líneas de fuerzas se llama “campo electrostático”.

La intensidad del campo electrostático depende entonces de dos factores:


a) número de electrones y de protones y
b) distancia entre sí. El manejo de la cantidad de unos y otros dentro de una molécula
permite obtener materiales conductores, aislantes o semiconductores.

Conductores: son aquellos materiales cuyas moléculas poseen electrones relativamente


libres desplazándose dentro de ellas.
Aislantes: son aquellos cuyas moléculas tienen pocos electrones libres o bien éstos no
pueden desplazarse dentro de ellas.
Semiconductores: son aquellos donde las moléculas tienden a ser aislantes en su estado
natural, pero se convierten en conductores al recibir fuentes externas de energía.

Por ejemplo un semiconductor puede ser fotoconductor si se comporta como


aislante en la oscuridad, pero como conductor en presencia de la luz.

En una fotocopiadora analógica el fotoconductor está constituido por un cilindro de


aluminio revestido con Cadmio o Selenio, ya que éstos tienen la propiedad de ser fotoconduc-
tores, circunstancia que es utilizada para captar la imagen. Dentro del ejemplo a considerarse
en esta exposición, este cilindro estará iónicamente cargado en positivo, es decir más protones
que electrones.

tomo 1 investigación científica del delito ) 211


educación a distancia (instituto universitario de la P.F.A.)

Cargar electrostáticamente un objeto significa agregarle o quitarle electrones, así lo


hacemos negativo o positivo respectivamente. La molécula en desequilibrio se llama ión,
conformando aires positivos (más protones que electrones) o negativos (más electrones).
Dentro de una máquina fotocopiadora analógica, los encargados de aportar electrones, de
atraerlos, neutralizarlos y dirigirlos son el Corotrón y la Corona.

Son varios los elementos, además de los descriptos, los que intervienen para lograr
que una imagen sea reflejada sobre el fotorreceptor. Estos son:
a) Cristal documentativo;
b) Lámparas de exposición;
c) La lente y
d) La ranura de exposición. Veremos cada uno de ellos.

Cristal documentativo: este puede ser curvo o plano y tiene como misión sostener el
objeto a fotocopiar sin doblez o comba, ayudando a su registro sin áreas deficientes. La
cara del documento a reproducir debe contactar con el mismo.

Lámparas de exposición: estas lámparas tienen como tarea enviar la imagen reflejada al
resto del sistema óptico. Se hace necesario recordar aquí que un objeto negro al recibir
las longitudes de ondas correspondientes a la luz blanca las absorbe en su totalidad, no
reflejando ninguna. Así, al incidir las luces de estas lámparas sobre el texto sostenido por
el cristal, su luz será reflejada en todas las áreas que se encuentran en blanco. Aquellas
que posean ilustraciones o texto absorberán la luz, no produciendo reflexión alguna.

Lente: La luz de esta manera reflejada se desplaza en todas direcciones. Al pasar por
la lente continúa su ruta óptica pero en forma invertida. Para obtener reproducciones
a igual tamaño, la distancia entre el objeto y la lente debe ser igual que entre ésta y el
fotorreceptor. Para evitar máquinas de gran tamaño, se compensan estas distancias por
medio de espejos con superficies reflectoras en su cara anterior.
Tanto la lente como los espejos deben ser de calidad, curvatura y estado adecuado,
para evitar aberraciones ópticas o distorsiones en las reproducciones.

Ranura de exposición: ésta debe estar ubicada entre el último espejo y el fotorreceptor y
cumple tres funciones: limita el área de incidencia sobre el fotorreceptor; regula el tiempo
de exposición y evita o reduce la luz parásita. Ver en la figura siguiente el diagrama de
flujo de estos elementos.

212 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

Aunque el procedimiento que realiza la máquina es un poco más complejo, basta con
entender su síntesis. Cuando la luz pasa por la ranura de exposición, a través de la capa de
captación, llega al fotorreceptor de selenio o cadmio. Este, que se encuentra cargado posi-
tivamente, es neutralizado por los electrones liberados por la luz reflejada correspondiente
a toda la zona del papel sin imagen. Todo ese sector queda entonces con carga neutra,
mientras que en los sectores con imágenes, donde no hubo reflexión de luz por haber sido
absorbidas por éstas, continúa cargado en forma positiva conservando protones.

En resumen se ha formado una imagen latente negativa del original entre las cargas
neutras correspondientes a las zonas del papel y las cargas positivas de las zonas con imágenes,
sean estas de textos, diagramas o dibujos. Resta ahora revelar dicha imagen con tóner, que
es un polvo de carbón (negro de humo) finamente tamizado mezclado con resina y cargado
negativamente.

La unidad de revelado aplica el revelador a través de un cepillo magnético o haciéndolo


caer en cascada sobre el fotorreceptor. Por poseer el tóner carga negativa, es atraído
en todas las áreas donde la imagen latente posee carga positiva, revelando o dibu-
jando todas las constancias escritas en el documento original, formando una imagen
residual.

El paso siguiente es transferir esa imagen. El papel es separado por medio de un


dedo despegador o por un golpe de aire y es llevado a través de un sistema de transporte
de vacío, hacia el área de fusión. El corotrón de polarización positiva efectúa una acción de
pretransferencia, al reducir el campo eléctrico del fotorreceptor que mantenían unidas a él
las partículas de tóner. Justo antes de que el papel entre en contacto con el fotorreceptor,
el corotrón positivo satura sus fibras con iones positivos, efectuándose la transferencia.

tomo 1 investigación científica del delito ) 213


educación a distancia (instituto universitario de la P.F.A.)

Para adherir en forma permanente al papel la imagen transferida, que por ahora sólo
se encuentra retenida por el campo electrostático (ión positivo del papel con el ión negativo
del tóner), se debe fusionar el mismo. Para ello y acorde al tipo de máquina fotocopiadora, se
utilizan cinco sistemas:
a) por presión;
b) por horneado;
c) por irradiación;
d) por horneado e irradiación y
e) por calor y presión.

Por presión: esta fusión la realizan dos rodillos de presión, uno de los cuales suministra
calor y el otro efectúa presión, fijando el tóner al papel.
Por horneado: utiliza un sistema de calefacción convectiva, de similar manera a como se
cocinan los alimentos en un horno. Colocado el papel en la cámara caliente, al alcanzar el
tóner su punto índice de cristalización, se une en forma permanente a las fibras del papel.
Por irradiación: se usa para ello lámparas de cuarzo que elevan por irradiación, es decir
como una estufa, la temperatura del tóner hasta su punto índice de cristalización.
Por horneado e irradiación: se utiliza para ello una varilla de cuarzo y un cojín calefac-
tor que realizan una función combinada.
Por calor y presión: efectúa una combinación de calor por cualquiera de los sistemas
mencionados (irradiación u horneado) y de presión por rodillos.

Por último la máquina efectúa una limpieza del fotorreceptor removiendo el tóner re-
sidual a través de cepillado, frotado o por medio de una cuchilla raspadora de caucho. Luego
se lo carga electrostáticamente dejándolo en condiciones para una nueva operación.

Se enumeran a continuación, algunas de las pericias o determinaciones y por con-


siguiente causas que se investigan que pueden efectuarse sobre fotocopias: Identificación de la
máquina fotocopiadora utilizada; determinación de adulteraciones por armado y composición
de fotocopias; determinación de procedencia de una copia y, dependiendo de varios factores,
es también posible la identificación de marca y modelo de la máquina de escribir; determi-
nación de la máquina; determinación de tiempos de ejecución mecanográfica; identificación
de firmas y manuscritos; identificación de sellos o estampados; lectura de testados; etc.

Las máquinas fotocopiadoras digitales o láser no reproducen por reflexión de objetos


determinados, sino a través del dibujo realizado por un rayo láser modulado y programado en la
memoria de una computadora. Cabe destacar que la palabra láser significa: Light Amplification
(by) Stimulated Emision (of) Radiation, lo que significa amplificación de luz por emisión
estimulada de radiación.

214 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

Estas fotocopiadoras poseen dos unidades separadas pero complementarias, un


lector o explorador o escáner, que lee el original y lo descompone en pequeños puntos de-
nominados píxeles, convirtiéndolos en información eléctrica binaria y una impresora que luego
de recibida la señal del lector, reconstruye el original y produce la copia deseada. Además
por diversos circuitos electrónicos pueden, una vez recibida la imagen, variar el porcentaje
de reproducción; invertir polaridades de la imagen; centrar la copia; erradicar o editar zonas;
deformar la imagen; enmarcar, subrayar, cambiar de color, iluminar, etc. diferentes partes de
la información que será luego reproducida por la impresora, sin modificar el original.

La información recibida del lector, con variaciones o no, viaja a través de un cable de
interconexión hacia la impresora, donde se modula un haz de rayos láser que acorde con
la información binaria recibida, lo enciende y apaga, descargando puntualmente el cilindro
e impresionando por barrido, el cilindro fotorreceptor sensible.

Dicho haz lumínico es enviado por medio de un espejo octogonal que gira con-
stantemente, teniendo como misión dirigirlo para que realice un barrido de líneas sobre
el objetivo. Éste es un tambor fotorreceptor sensible cargado positivamente, que al reci-
bir luz se neutraliza formando la imagen latente de manera similar a las fotocopiadoras
analógicas ya descriptas. Las unidades de impresión, transferencia y fijación, revelan la
imagen en el tambor y luego la transfieren al papel, fijándolo. Algunas de estas máqui-
nas alcanzan hasta 1200 dpi de resolución. Véase en las figuras siguientes sus partes
constitutivas, donde se aprecia las formas de su funcionamiento.

Elementos lector e impresor Modulación y transferencia de la imagen

Los cilindros de estas máquinas son convencionales y el color y la densidad del original
son obtenidos por medio del principio de separación y de información de los tres colores
primarios, es decir el cyan, el amarillo y el magenta, siendo el negro opcional como un cuarto
color o por conformación con la sumatoria de los demás. Al reconstruirse la imagen en el
cilindro, el color es transferido al papel uno detrás del otro. La superposición y complemen-
tación en las cantidades correspondientes, dan la totalidad de los colores y tonalidades.

tomo 1 investigación científica del delito ) 215


educación a distancia (instituto universitario de la P.F.A.)

Estas fotocopiadoras están diseñadas para reproducir sobre cualquier tipo de


soporte, sean éstos papeles comunes, especiales, satinados, fotográficos, radiográficos,
de diferentes espesores, plásticos, transparencias, etc., logrando excelente calidad en
su nitidez y colores, tanto en tonos como en semitonos.

Debido a la alta temperatura que alcanza en la fusión de la resina del tóner, en el orden
de los trescientos grados centígrados, no admiten copias doble faz, ya que el hacerlo provoca
corrimientos del tóner primario. Lo que sí permite es acrecentar los tonos y con ello la carga de
tóner en determinados sectores, lo que provoca sobrerrelieves similares al sistema calcográfico.
Esta circunstancia es aprovechada por los falsificadores que las utilizan para realizar billetes
de moneda nacional y extranjera. En otra unidad de este manual se abundará sobre el funcio-
namiento de este tipo de impresión y por ende del reconocimiento de estas falsificaciones.

Lo más importante en estas fotocopiadoras es que permiten sin alterar el original y


sin retirarlo de la máquina, mejorar fondos, iluminar, agregar o sustraer colores en forma total
o parcial. Esto permite obtener copias distintas del original, pudiéndoselas utilizar en forma
fraudulenta, ya que mediante una simple desviación de cables pueden ser operadas en el
lugar o a distancia. Esto debe ser debidamente tenido en cuenta para evitar ser sorprendidos
en la buena fe y para poder interpretar los dichos de algún patrocinado, cuando relate las
circunstancias en que fueron realizados los documentos afectados a una causa.

Se hace expresa mención, que el tema pendiente de la impresora láser ha que-


dado detallado en el funcionamiento de la fotocopiadora láser, las que como se reitera,
poseen dos componentes independientes pero relacionados, uno lector o escáner y
otro impresor. Ese elemento impresor no es otra cosa que una impresora láser incor-
porada a la máquina por lo que huelgan más detalles al respecto.

Para completar el tema de escrituras mecánicas, se hace necesario hacer una breve
referencia a otro elemento que por su utilidad, bondades y precio ha pasado a ser un in-
strumento común y de utilización popular y diaria, el “fax”.

Su uso, que primeramente consistió en la transmisión de imágenes periodísticas,


se difundió dentro del mundo empresarial en las décadas del 70 y del 80 pasando a ser
hoy una tecnología de uso normal en muchos hogares gracias a su facilidad de uso,
costos, velocidades y practicidad, ya que muchas tramitaciones que antes requerían
actuaciones personales, se hacen ahora por este medio, como por ejemplo denuncias
de siniestros a compañías aseguradoras, comunicaciones entre empresas o entre su-
cursales, etc., resultando un medio válido y considerado como documento.

216 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

Para cumplir con su cometido requiere de un equipo emisor, que es el encargado de


traducir el contenido de un documento a impulsos eléctricos de lenguaje binario, los que son
captados por un equipo sincronizado de recepción que decodifica esos impulsos y reproduce
la copia del documento original.

Esta circunstancia se logra mediante motores simultáneos de frecuencia común o


mediante una serie de impulsos sincrónicos que el equipo transmisor emite, controlando o
sincronizando la velocidad del equipo receptor. No importa la diferencia de posibilidades o cali-
dades entre uno y otro, el transmisor regula al receptor adaptando posibilidades y velocidades
a valores que puedan asumir ambos.

El equipo emisor está dotado de una parte lectora conformada por un cilindro giratorio
que enrolla el original a transmitir y a medida que éste gira, un rayo de luz emitido por una fuente
proyectora barre por sectores la totalidad del documento. Cuando el rayo ilumina una zona con
caracteres o dibujos, es decir oscura, es absorbido por éstos. Cuando ilumina una zona clara,
sin contenido, la luz se refleja y es captada por una célula fotoeléctrica que genera un impulso
de corriente eléctrica. Si ilumina una zona gris la reflexión captada por la célula fotoeléctrica
es proporcional a la claridad de sus tonos y por ende es también proporcional el impulso de
corriente eléctrica generado.

La señal de este impulso de corriente eléctrica captada por la célula, conforma una
imagen en negativo del original que luego se amplifica en un dispositivo de conexión, modu-
lando una onda portadora o produciendo una transmisión a través de pulsos telefónicos.

El equipo receptor posee un cilindro análogo que gira en sincronismo con el transmisor,
desplazándose a igual velocidad que el haz de luz de intensidad variable, acorde a claros,
semitonos y oscuros que inciden sobre él, recomponiendo y reproduciendo la imagen en el
papel sensibilizado que es ennegrecido acorde a la intensidad de luz recibida.

Este papel sensibilizado puede ser al igual que en las impresoras térmicas ya analizadas,
de base blanca o base negra recubiertas por una sustancia volátil. En algunos equipos la repro-
ducción o copia es realizada por sistema láser, utilizando tóner al igual que las fotocopiadoras o
impresoras de este tipo, poseyendo un sistema similar de transmisión y recepción de imágenes
que aquellas.

Otras máquinas que poseen similares tecnologías son utilizadas para funciones automáti-
cas de cobro y emisión de boletos, tiques, constancias de pagos, etc. Ellas poseen un CPU
controlador, impresoras matriciales o térmicas, pantallas de cristal líquido, lectores ópticos de
tarjetas, validadores de moneda, etc. y las constancias que emiten sirven de documento, por
lo que deben ser tenidas en cuenta cuando se necesiten sobre ellos, cualquier tipo de compro-
bación pericial dentro del espectro detallado para impresiones mecánicas.

tomo 1 investigación científica del delito ) 217


educación a distancia (instituto universitario de la P.F.A.)

Se deja expresa constancia que la utilización de impresoras, equipos de fax o má-


quinas automáticas que utilicen sistema de impresión térmico sobre papeles sensibilizados,
presentan como inconvenientes que debido a su sistema de fijación, los mismos tienden
a borrarse con el transcurso del tiempo o por el trato dado a un documento. Por ello se
hace necesario que todos aquellos documentos, afectados o no a una causa judicial, pero
especialmente aquellos que conforman parte probatoria en una causa, que hayan sido
realizados por algunos de estos sistemas de impresión y sobre ese tipo de papel, sean
asegurados por otro sistema y fedatados por autoridad competente, para evitar cualquier
pérdida de información o de prueba por esa causal.

218 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

( BIBLIOGRAFÍA DE LA UNIDAD V )

Bibliografía obligatoria

n ALBARRACIN, Roberto; “Manual de Criminalística”; Editorial Policial; Bs. As. 1971.

n GOBBI, Eduardo; PALACIOS y otros; “Manual de Criminalística”; Ed. Policial; Bs. As.
1983.

n “Revista de Policía y Criminalística”; Editorial Policial.

NOTA: todos los textos señalados se encuentran en la Biblioteca del Instituto Universitario de la
Policía Federal Argentina.

tomo 1 investigación científica del delito ) 219


u6
unidad seis

( investigación científica del delito )


educación a distancia (instituto universitario de la P.F.A.)

CONTENIDOS DE LA UNIDAD VI

( INVESTIGACIÓN CIENTÍFICA DEL DELITO )

Mención sintética de los contenidos

1. Distintos tipos de Pericias Manuscritas.

2. Pasos metodológicos y sistemáticos que deben cumplimentarse en la realización de


este tipo de pericias.

3. Ratificar contenidos de la semiótica y entender cómo se adquiere el hábito de la escritura


y cuáles son las diferentes etapas que deben cumplimentarse.

4. Determinar qué es y cómo se conforman las “esenciales constitutivas de personalidad


gráfica” de una persona.

5. Determinar cuáles son y el por qué de los Principios Scopométricos que rigen a esta
disciplina documentológica.

6. Pasos metodológicos y sistemáticos que deben cumplimentarse para determinar pa-


ternidad o no de escrituras o firmas.

7. Detalle de los principales elementos que se valoran en forma cualicuantitativa para


establecer autoría de escrituras o firmas.

8. Cómo se forma una Historia Gráfica y dónde reside su valor identificativo con relación
a los cuerpos de escritura.

9. Cómo influyen los elementos escritores en la producción de escrituras y firmas.

10. Cómo se determinan los elementos escritores utilizados y su importancia para el es-
tablecimiento de maniobras adulterativas.

11. Qué es un documento, cómo es una falsificación material y cómo una ideológica, y
cuáles son públicos y cuáles privados.

12. Cuándo y cómo deben tomarse los Cuerpos de Escritura.

13. Participación del perito en la toma de Cuerpos de Escrituras.

tomo 1 investigación científica del delito ) 223


educación a distancia (instituto universitario de la P.F.A.)

224 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

abogacía a distancia oa)


objetivos de aprendizaje de la unidad

n Introducirnos en el mundo de las escrituras manuales producidas por el hombre.

n Tomar conocimiento acerca de cómo se originan.

n Conocer las diferentes etapas del aprendizaje de la escritura.

n Conocer los diferentes elementos del cuerpo que intervienen en su producción.

n Ver los diferentes tipos posibles de pericias manuscritas que permiten contestar los
distintos interrogantes que, en las causas judiciales, se pueden presentar.

n Conocer las causas que ocasionan variaciones transitorias o permanentes en las es-
crituras y los inconvenientes que plantea en el cumplimiento de la labor pericial.

n Conocer los principios técnicos que rigen este tipo de peritaciones.

n Conocer los diferentes estudios que deben realizarse sobre el soporte de los docu-
mentos a peritar.

n Conocer las diferentes maniobras adulterativas que pueden realizarse sobre un docu-
mento y cómo se determinan acorde a los rastros dejados sobre el soporte.

n Definir qué es un documento manuscrito y precisar qué es falsificación y qué adulter-


ación.

n Ver las diferentes maniobras de falsificación y adulteración realizardas sobre escrituras


y firmas.

n Conocer qué es y cómo se conforma la Historia Gráfica de una persona.

n Tomar conocimiento de como deben obtenerse los cuerpos de escrituras en las causas
para que resulten idóneos para el cotejo.

n Tomar conocimiento de los diferentes elementos escritores que se utilizan en la confec-


ción de un documento.

tomo 1 investigación científica del delito ) 225


educación a distancia (instituto universitario de la P.F.A.)

226 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

( ESQUEMA CONCEPTUAL DE LA UNIDAD VI )

DOCUMENTO Instrumento escrito que prueba un hecho


Que le da vida, lo modifica o extingue
O a los dichos de un sujeto
Dotándolo de significación jurídica

TENOR Expresión del pensamiento de un sujeto


Que esté realmente expresado por él (firma/letra)

DELITO Hacer en todo o en parte un documento falso


Adulterar uno verdadero
De modo que pueda ocasionar perjuicio

REQUISITOS Ser idóneo, mantener confianza, apariencia verdad


Que la confianza que infunden sea para todos

FALSEDAD Material: alteración signos de autenticidad


Ideológica: deformación de la verdad

MATERIAL Mienten sobre signos de autenticidad o contenidos


Sea imitando, creando o alterando verdaderos
Ataca la verdad, menoscabando autenticidad

IDEOLÓGICA Formas y signos externos auténticos


Hechos por quienes deben expedirlos
Mienten sobre aquello que deben probar

ATACA Documentos públicos (agravante)


Documentos privados

tomo 1 investigación científica del delito ) 227


educación a distancia (instituto universitario de la P.F.A.)

PÚBLICO Esfera en que se produce

Por el sujeto Por acción creadora (juez)

Función fedataria (escribano)

PRIVADO Todo documento que no sea público

HACER UN DOCUMENTO ES Imitar signos de autenticidad

Imitar es igual a copiar

HACER En todo: crearlo atribuyéndolo a otro

En parte: incluir manifiestaciones no formuladas

ADULTERAR Alterar un documento verdadero

Transforma su tenor, borrando y sustituyendo

ACCIÓN Ataque: tenor no verdadero como verdadero

Presentación que pueda causar peligro cierto

De concretrase hecho pueden concurrir otros

TESTAMEN- Ológrafo: escrito, fechado y firmado a mano

Cerrado: firmado, dado a escribano con 5 testigos

ELEMENTOS ESCRITORES Lapiceros Plumas, gavilanes

Bolígrafos

Fibras

Lápices Grafíticos

Copiativos

Crayones

ESCRITURA Gesto Acto volitivo o reflejo

Anátomo - fisiológico

Psíquico

Etapas Copiado

Mnemónica

Subconsciente

228 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

PERSONALIDAD Psíquica y social

Escritural (esenciales constitutivas)

NO ES POSIBLE Copiar o reproducir ajenas

Desprenderse de las propias

PRINCIPIOS Dúbitos Sobre originales

Indúbitos Anteriores, etc.

Públicos o privados

Fuera de juicio

Igual característica

Conclusio- No firmas con letras

Se deben demostrar

PASOS Determinar cumplimiento de principios

Estudio del soporte

Extrínseco Sobre elemento dubitado


Sobre indubitado
Comparativo
Intrínseco Sobre elemento dubitado

Sobre indubitado

Comparativo
Evaluación

ESTUDIO SOPORTE

Borrado Enmiendas - agregados

Raspado Testados

Lavado Cortados

tomo 1 investigación científica del delito ) 229


educación a distancia (instituto universitario de la P.F.A.)

ANÁLISIS EXTRINSECO

RITMO DE ESCRITURA Velocidad


Presionado
Grosor de trazos y rasgos
Continuidad

EJES Verticales
Con inclinación derecha
Con inclinación izquierda

ORIENTACIÓN Ascendente
Horizontal
Descendente

DIAGRAMACIÓN Legible
Medianamente legible
Ilegible

IRRADIACIÓN Movimientos horizontales


Movimientos verticales

CALIBRES Ingladiados
Gladiolados
Crecientes

PROPORCIONES Entre letras cortas y largas


Entre mayúsculas y minúsculas

INTERVALOS Entre gramas


Entre letras
Entre palabras

CULTURA GRÁFICA Excelente manejo del elemento escritor


Buen manejo del elemento escritor
Mediano manejo del elemento escritor
Mal manejo del elemento escritor

230 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

ANÁLISIS INTRÍNSECO

ESPONTANEIDAD Hesitaciones o dudas


Detenciones y retormas
Retoques
Temblores

TRAZOS Y RASGOS Iniciales o ataques


Finales o remates

ENLACES Ligados entre gramas y letras


Desligados entre gramas y letras

MORFOLOGÍA Conformaciones Angulosa

Curva

Base de renglón Recta

Curva

Serpentina

SIGNOS DE PUNTUACIÓN Ubicación


Situación
Dirección
Forma

ORTOGRAFÍA Normal
Anormal

DIMENSIÓN Altura Cortas: A - M - N - R - C - S

Sobresalientes: F - G - H - K -

Ancho Angostas: I - L-

Anchas: M - N

Medianas: letras restantes

tomo 1 investigación científica del delito ) 231


educación a distancia (instituto universitario de la P.F.A.)

232 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

abogacía a distancia ai )
actividad introductoria

Antes de comenzar el desarrollo de toda la temática relacionada con la identificación de


firmas y manuscritos, se propone como actividad introductoria buscar antecedentes sobre uno de
los más emocionantes e injustos procesos de la historia judicial relacionado, obviamente, con el tema
a tratar. No se busca el minucioso detalle de las muy variadas causales que se complementaron
para el desarrollo del acontecimiento que se inscribió para siempre en la historia de Francia y de la
civilización toda, sino simplemente el recordar un caso que sigue siendo referente jurídico.

Se trata del caso por espionaje que involucró a uno de los integrantes del Estado Mayor del
Ejército Francés, el Capitán Alfredo DREYFUS (1859-1935). El citado oficial fue condenado en 1894
tras un célebre proceso que suscitó grandes polémicas. Luego de haber cumplido cárcel en la tam-
bién célebre prisión conocida como la “Isla del Diablo” fue rehabilitado y reivindicado en 1906.

Busque y ubique los antecedentes del caso y luego efectúe un análisis y conjuntamente
con las consideraciones que crea oportuno efectuar, remítalos junto al trabajo de autoevaluación
requerido a la finalización de esta unidad.

tomo 1 investigación científica del delito ) 233


educación a distancia (instituto universitario de la P.F.A.)

234 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

( DESARROLLO DE LA UNIDAD VI )

Escrituras manuales

La temática de esta unidad está centrada obviamente en el tratamiento de los


documentos en general y de los documentos manuscritos en particular. Por ello se hace
necesario efectuar algunas consideraciones sobre “documentos”, aunque sin intentar
agotar su significancia jurídica.

Podemos considerar documento a todo instrumento que acredita los dichos de


una persona -volcados en palabras escritas- o que acredita la existencia de un hecho
-al que le da vida, lo modifica o extingue, dotándolos de significación jurídica.

Los mismos se encuentran protegidos en el Libro Segundo, Título XII, Delitos contra
la fe pública del Código Penal de la Nación Argentina, ya que toda maniobra fraudulenta
relacionada con ellos afecta a la credibilidad pública, haciendo perder la confianza colectiva
sobre lo que representan. Al vulnerarse su autenticidad, hacen que parezca verdadero lo
que no lo es. Para que esto ocurra, lógicamente, deben guardar las formas y ser lo sufici-
entemente idóneos para producir engaño a cualquier sujeto.

Los documentos pueden ser públicos o privados.

Documentos públicos a todos aquellos en que el Estado le ha dado con su función


jurídica, la característica de instrumentos de fe:
a) por las formas de su representación o
b) por las personas que intervienen.

Por la representación, son los otorgados o autorizados por oficiales públicos


luego de haberse cumplimentado las formalidades, es decir que son avalados como
tales por la esfera donde se producen; por las personas son los producidos por
aquellos que, sin ser oficiales públicos, están debidamente legitimados por el derecho
vigente para cumplir funciones como tales, tanto por su acción creadora (la sentencia
de un Juez) o como fedatarios (escrituración ante escribanos públicos).

tomo 1 investigación científica del delito ) 235


educación a distancia (instituto universitario de la P.F.A.)

Por exclusión podemos entonces definir a los documentos privados: como todos
aquellos a los que no pueda asignárseles la categoría de públicos.

Normalmente son sus tenores los objetos de ataque, pudiéndose decir que:

Tenorr es la expresión escrita de una persona por medio de la cual crea, modifica
o extingue un hecho, avalándolo con su firma.

Estos ataques son los estudiados por la disciplina criminalística desde tres
frentes distintos:
a) el investigativo: tratando de encontrar los documentos o testigos mudos que puedan
aportar luz al caso;
b) el pericial: determinando todos los ataques que pueden sufrir: y
c) el prevencional: incorporando medidas de seguridad que dificulten o desalienten las
falsificaciones o adulteraciones.

El artículo 292 del Código Penal penaliza al “que hiciere en todo o en parte un docu-
mento falso o adultere uno verdadero de modo que pueda resultar perjuicio”. Entendemos
que “hacer” es imitar los signos de autenticidad de un documento y que imitar es igual a
reproducir, simular, plagiar, copiar algo.

Aclara el código “en todo o en parte”. Hacerlo en todo, es crearlo falsamente atribuyé-
ndoselo a otro hacedor debidamente autorizado. En tanto que hacerlo en parte significa
incluirle manifestaciones no formuladas. Por su parte adulterar requiere primero contar con
un documento auténtico y luego alterarlo, transformándolo por medio del borrado o lavado,
o bien sustituyendo o cercenando su tenor.

La acción se ejecuta al hacer pasar como verdadero un documento que no lo es, de


manera tal que su presentación pueda causar un peligro cierto. El delito queda consumado
por la sola ejecución –falsificación o adulteración. Su uso y consecuencias pueden, de
concretarse, hacer concurrir otros delitos.

Como único requisito se requiere que sean idóneos, es decir ser capaces de man-
tener la confianza que deben inspirar debido a su apariencia de verdaderos. Se aclara que
esa confianza infundida debe ser genérica, es decir que debe ser para todos y no para un
determinado grupo o sector.

236 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

La falsedad puede ser, dentro de sus multifacéticas formas, de dos tipos bien
diferenciados: a) material y b) ideológica.

La material se concreta con la imitación o alteración fáctica de los signos de autenticidad,


es decir ejecutando la falsificación o la adulteración de un documento, ya sea mintiendo
sobre sus signos de autenticidad o contenidos, o imitando, creando o alterando los
verdaderos. Con ello se ataca la verdad, menoscabando su autenticidad.

La ideológica por su parte, se concreta por la deformación de la verdad ejecutada justa-


mente por aquellos que debían asegurarla, mintiendo sobre aquello que deben probar.
Pero los signos externos y sus formas no parecen auténticos, lo son.

Dentro de la amplia gama de documentos podemos citar como ejemplo, debido a


su especial tratamiento legal, a los testamentos. Estos pueden ser efectuados de diferentes
maneras: a) cerrado y b) ológrafo.
Los cerrados deben darse firmados a un escribano en presencia de cinco testigos, quienes
dan fe del acto, de las facultades y de la voluntad del firmante.

Los ológrafos deben ser escritos, fechados y firmados por el puño y letra del testador. Frente
a cuestionamientos legales deberán realizarse los estudios periciales correspondientes para
establecer su autenticidades.

Los documentos pueden estar realizados sobre diferentes soportes. Si bien la gran may-
oría están realizados sobre papel, también pueden estar contenidos sobre plástico: –tarjetas de
créditos y otras; metales: –chapas patentes, motor de un auto, un arma; otros materiales: pare-
des –escritos con amenazas, ocasionando daños, etc. Esta circunstancia obliga a que, desde
el punto de vista criminalístico, deban efectuarse estudios de los componentes de cada uno de
esos soportes para establecer, primero, si son auténticos y luego si presentan adulteraciones.

Sería largo y fatigoso describir todos y cada uno de los soportes posibles. Lógicamente
el papel requiere su tratamiento, pero será analizado en la próxima unidad donde se descri-
birán los pasos, desde su fabricación hasta la aplicación de las medidas de seguridad que
pueden incorporárseles, los sistemas de impresión y los diferentes tipos de tintas utilizados
en la seguridad documental.

Lo que se desarrollará a continuación, será una breve referencia a los distintos elemen-
tos escritores que pueden ser utilizados. Primero debe especificarse que existen elementos
escritores propios e impropios.
Son propios aquellos que fueron creados para cumplir con esa función específica.
Son impropios aquellos que no habiendo sido creados para ello pueden utilizarse con ese
fin, como por ejemplo: pintura, un ladrillo, carbón, lápices de labios o de ojos, etc.

tomo 1 investigación científica del delito ) 237


educación a distancia (instituto universitario de la P.F.A.)

Dentro de la amplia gama de elementos escritores propios, casi imposible de


enumerarlas, se destacarán por grupos las principales especies: a) lápices; b) plumas;
c) bolígrafos y d) fibras.

Lápices: estos instrumentos escritores están compuestos generalmente de grafito dispuesto en


barra o mina, que pueden estar recubiertas por madera, metal o plástico. Además de:
a) el lápiz común, deben distinguirse:
b) los copiativos: aquellos que poseen en su constitución además de grafito y arcilla, frag-
mentos de un colorante orgánico, sustancia que, por humidificación, permite la copia
de las escrituras con ellos realizadas y
c) los crayones: conformados por sustancias grasas o cerosas con parafina y colorantes
orgánicos liposolubles, que pueden estar o no recubiertos.

Plumas: estos elementos son dispositivos aguzados terminados en astas o gavilanes casi
siempre divididos en el medio. En sus orígenes fueron plumas de aves, principalmente de
patos o gansos y de allí su denominación. Hoy se las sigue denominando así aún cuando
ya no guarden esa forma primitiva. Las plumas de aves eran tratadas en su extremo libre,
aguzándolas y chanfleándolas para hacerlas más aptas para la escritura.

Aproximadamente en 1830 y posiblemente por la corta vida para las escrituras que
poseían estas plumas, se las comenzó a fabricar en metal, acero u otras aleaciones, incluso oro,
lo que les aportaba mucha mayor duración. Existen de éstas una variada cantidad de especies,
con distintos tamaños, formatos, tipos de puntas, marcas, calidades, etc.

A partir de 1884, a ciertos modelos se les adiciona un almacén cargador de tinta


obliterado con un cono, que mediante la presión ejercida al escribir se retrae, permitiendo
fluir la tinta. A estas plumas se las denominó fuentes o estilográficas.

En algunos países, como por ejemplo la India, utilizan además una pluma de caña
preparada sobre pequeños bambúes adecuadamente cortados.

Bolígrafos: estos elementos escritores fueron creados por BIRO -de allí el nombre de birome, un
húngaro que a mediados de la década del 30 emigró a la Argentina donde comenzó a fabricarlos
en serie. Se trata de un tubo contenedor de tinta que, en uno de sus extremos, posee una bolilla
que gira sobre su eje tomando tinta del depósito y depositándola sobre el papel. Su uso hoy
predomina en casi todos los países del mundo.

Fibras: aparecen en la década del 60. Poseen una punta fibrosa cortada en chanfle que se co-
necta con un fieltro embebido en tinta a la anilina, que a su vez se halla contenido en un tubo
plástico o de otros materiales. Su principal particularidad es que no produce surcos o indenta-
ciones. Actualmente se fabrican con puntas muy finas denominadas microfibras. Una variante

238 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

de ellas son los marcadores, que poseen tintas fluorescentes o al agua de rápido secado y de
diversos colores.

Cada uno de estos elementos escritores dejan sobre el papel las características propias
del medio de producción del trazo o rasgo y la influencia que ocasiona sobre él, circunstancias
que son determinadas y precisadas por los peritos y que acorde a la naturaleza de los casos
tratados, a solicitud del magistrado es posible su determinación precisa.

Efectuada una rápida recorrida por los principales tipos de elementos escritores propios
– por razones obvias, sobre los impropios no se efectuará referencia alguna, se impone hacer
algunas consideraciones sobre las escrituras manuscritas y las firmas.

Sin lugar a dudas, tanto las escrituras manuscritas como las firmas son gestos.
Gestos que resultan de un acto volitivo o de un reflejo y depende en cuanto a su dirección,
extensión y fuerza de dos factores: a) anátomos-fisiológicos y b) psíquicos.
Los anátomos-fisiológicos: están representados, entre otros, por la rapidez de la transmisión
del impulso nervioso; de la fuerza muscular que permite sostener los elementos escritores y
dirigir los movimientos necesarios para su producción; de la flexibilidad de las articulaciones;
de la longitud de las palancas óseas, etc.

Estos factores rigen una serie de movimientos imprescindibles para la escritura:


movimientos del hombro, del antebrazo, del pulso, de los dedos, de traslación, que puede
ser: plana, a la izquierda, a la derecha, arriba, abajo, etc.

Los factores psíquicos: donde tienen principal importancia todos los componentes cerebrales
o simpáticos que permiten tanto la producción de las ideas, como la codificación y decodifi-
cación de sonidos y su correlatividad con el proceso semiótico y la transmisión de las órdenes
escriturales.

A pesar de la aparente variedad de los casos particulares, el gesto para una misma
persona acusará una constante que lo hará siempre reconocible y permitirá distinguirlo del
gesto análogo realizado por otro individuo. Así como todo individuo posee una “personalidad
psíquico-social” propia y única, su escritura manuscrita posee “esenciales constitutivas de
personalidad gráfica” subconscientes, espontáneas, propias y únicas.

La identificación escritural se basa en la concordancia de las particulares características


que forman la denominada personalidad gráfica del escribiente, que va adquiriendo a través
del tiempo con el ejercicio de la escritura y que se manifiestan subconscientemente en el acto
de escribir, escapando al contralor de su autor y dotando a su escritura de particularidades
identificatorias que permiten distinguirlas de otras.

tomo 1 investigación científica del delito ) 239


educación a distancia (instituto universitario de la P.F.A.)

Estas características no son advertidas a simple vista, donde sólo se repara en el


aspecto morfológico de las letras, sino que constituyen un cúmulo de particularidades que
se interrelacionan de las más diversas formas, dando origen a la personalidad individual a
que nos hemos referido.

El aprendizaje de la escritura reconoce tres etapas características cuya duración y


límites no pueden ser establecidos con precisión ya que dependen de muchos factores,
pero que se cumplen una a continuación de la otra. Estas etapas son:
a) de copia;
b) nemónica y
c) subconsciente.

Etapa de copia: en esta primera etapa se efectúa una verdadera actividad copiativa donde
se trata de reproducir, lo más fielmente posible, la forma del grafismo que se tiene a la
vista. Aquí la actividad está centrada simplemente en la de adquirir la habilidad de manejo
del elemento escritor y la de poder realizar los trazos de una manera similar al modelo.
Requiere atención en un nivel absolutamente consciente.

Etapa nemónica: en esta segunda etapa el ejecutante ya no tiene ante su vista el modelo
a reproducir, debiendo el aprendiz recurrir a su memoria para recordar cómo se hace o
cómo es la morfología de tal o cual letra y recordar, además, cómo se relacionan unas con
otras para conformar cada una y todas las palabras.

Etapa subconsciente: en esta tercera etapa la actividad psícomotriz se realiza subconsci-


entemente, ya que el escritor no está consciente de cómo escribe sino de lo que escribe.
Es aquí donde de una manera instintiva, involuntaria, mecánica, el escritor va incorporando
elementos individuales o propios que apartan a sus grafismos de los modelos primitivos,
predeterminados y rígidos de la etapa de copia. Ahora le incorpora elementos netamente
personales que dan a los mismos, y con ellos a las escrituras o firmas, su individualidad.

Estos elementos, tales como los diferentes puntos de ataque y escape, el presionado,
la evolución de los rasgos, la estructuración alfabética, los ligados y desligados, la proporcio-
nalidad, los valores angulares, el silabeo, etc, adquieren diversas formas y se combinan de
distintas maneras y es allí donde radica precisamente la identidad escritural, siendo la morfología
o estructuración general sólo un elemento más para la identidad manuscrita, pero un elemento
absolutamente insuficiente por si mismo para lograr su cometido.

Como estas esenciales constitutivas son el resultado de una actividad psicomotriz


subconsciente, escapan al control y aún a la percepción incluso del mismo autor, manifestán-
dose como automatismos escriturales. Su determinación implica la necesidad de un profundo
análisis con el auxilio de instrumental óptico de microscopía e iluminación adecuada.

240 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

Lo aquí expresado se cumple, asimismo, con las firmas y posibilita establecer la falsedad
de las mismas o su autenticidad, que es lo mismo que determinar que una persona es o no es
la autora de un escrito o de una firma en particular.

Por los motivos expuestos, el falsificador no puede reproducir las grafías ni las firmas autén-
ticas con todas sus características, ya que no posee los parámetros psíco-motrices del verdadero
autor y además se encuentra condicionado por los propios y sus esenciales constitutivas.

Esto motiva que la reproducción de las escrituras y/o firmas auténticas, es sólo una
imitación realizada con mayor o menor habilidad de aquello que es apreciable a simple vista,
la morfología del grafismo y sus características estructurales de carácter general. Por lo tanto
del análisis correlativo entre las características de las firmas o escrituras auténticas y la de los
sospechosos de serlo, es posible establecer si estas últimas son auténticas o falsas.

Por todo lo expuesto y siguiendo metodológica y sistemáticamente los principios téc-


nicos y científicos que rigen la disciplina Criminalística –que serán detallados oportunamente- es
posible determinar o descartar la autoría de firmas o manuscritos.

Para ello se hace necesario contar con abundante material indúbito, es decir, auténtico y
sin cuestionamiento, de firmas o escrituras pertenecientes a quién o quiénes se les atribuyen los
escritos, a fin de establecer en un primer análisis, las esenciales constitutivas de personalidad
gráfica emergentes de los mismos y posteriormente cotejarlos con los dúbitos.

Antes de comenzar con el detalle de todas las características que deben ser analiza-
das y valoradas para la identificación de manuscritos y firmas dentro del método y sistema
scopométrico, se hace necesario efectuar algunas precisiones sobre ciertos términos que
serán frecuentemente utilizados y detallar las leyes que rigen la escritura.

Documento: sin perjuicio de las consideraciones legales vertidas, se considera docu-


mento a toda pieza donde se registra una idea o un hecho. Su composición y soporte
puede ser de muy variada naturaleza.

Alfabeto: Conjunto de signos o ideogramas convencionales debidamente clasificados


y metodizados que permiten la representación escrita de la palabra oral.

Letra: signo alfabético representante de un sonido que depende de estilos, usos y países.

Trazos: partes esenciales de una letra, sin los cuales la misma no quedaría constituida.

Rasgos: son partes no esenciales de una letra, adquieren diversas formas y representan
adornos o modismos personales.

tomo 1 investigación científica del delito ) 241


educación a distancia (instituto universitario de la P.F.A.)

Grama: es cada una de las partes esenciales de una letra ejecutada sin inversión de
movimiento. Es la unidad gráfica de la letra, así como ésta es la unidad del alfabeto.

Grafismo: representación del gesto gráfico humano mediante el cual se fija el pensamiento.

Documentología, caligrafía, scopometría: disciplinas técnicas científicas que estudian


los grafismos humanos para la determinación de paternidad.

El maestro francés Solange Pellat sintetizó a la escritura en un postulado y cuatro leyes.

Postulado: Las leyes de la escritura no dependen de los alfabetos utilizados. Esto deja perfecta-
mente aclarado que las consideraciones alcanzan a todos los tipos de grafismos y no dependen
de los signos que éstos requieran.

Primera Ley: El gesto gráfico está bajo la influencia directa del cerebro. Su forma no es modi-
ficada por el órgano escritor, si éste funciona normalmente y se encuentra suficientemente
adaptado a su función.
Esta ley indica que, si se está en condiciones físicas adecuadas, es el cerebro el que regula
la escritura, el que preside la función gráfica y los automatismos. De adquirir habilidad para escribir
con la boca o con los pies, conservará siempre las mismas características gráficas.
Cada escritura posee particularidades definidas que permiten su identificación. A pesar
de los cambios graduales durante la vida, mantendrá las individualidades de cada uno.

Segunda Ley: Cuando se escribe, el “yo” está en acción, pero el sentimiento casi inconsciente de
que el “yo” obra, pasa por alternativas continuas de intensidad y de debilidad. Está en su máxima
intensidad donde existe un esfuerzo a realizar, esto es, en los inicios; y en su mínima, donde el
movimiento escritural está secundado por el impulso adquirido, esto es, en los finales.
Esta ley regula el automatismo gráfico, y fundamentalmente, representa que existe esfuerzo
cuando la voluntad interfiere, pero que después va decayendo.

Tercera Ley: No se puede modificar voluntariamente, en un momento dado, la escritura natu-


ral, sino introduciendo en el trazado la propia marca del esfuerzo que se hizo para obtener la
modificación.
Esto es que no se puede superar la escritura ni su destreza, sin reflejar los esfuerzos real-
izados o sin una preparación por largos períodos de automatización.
Esta ley preside los disfraces y las imitaciones. El esfuerzo realizado por el simulador,
fatalmente lo traicionará y quedará plasmado a través de una señal como ser una detención,
una hesitación, un desvío, etc.
La deformación de la escritura por cualquier motivo, afecta a todas las propiedades de la
misma, no sólo algunas de ellas. Sin embargo aquí deben mensurarse las causales por declinación
física por edad o por enfermedades transitorias o permanentes.

242 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

Cuarta Ley: El escritor que actúa en circunstancias en que el acto de escribir es particular-
mente difícil, traza instintivamente formas de letras que le son más habituales o más simples,
de esquema más fácil de ser construido.
Esta ley preside las simplificaciones de los gestos gráficos. Frente a una dificultad escritural,
el escritor adopta formas más simples, más familiares que las adoptadas normalmente.
La falta de uniformidad en la ejecución y forma, especialmente en textos extensos, es
típica de imitación, ya que las variaciones son propiedades esenciales de cada escribiente.

Como surge de los contenidos de estas leyes, las características particulares de la es-
crituras y firmas de una persona, pese a las variaciones naturales que se producen, son estables
y por ello serán siempre reconocibles. Sin embargo existen causales que provocan variaciones
las que, acorde a la naturaleza de los cambios físicos y psíquicos que las motivan, pueden ser
de carácter: naturales o accidentales, transitorias o permanentes, voluntarias o involuntarias.

Son naturales: aquellas que se producen acompañando los cambios normales desde la infancia
a la madurez, donde se destacan las evoluciones, la estabilidad y las involuciones. Estos cambios
no son fijos ni regulares y no acompañan taxativamente la edad cronológica. Debe tenerse en
cuenta que no es posible establecer la edad de una persona a través de sus grafías.

Como características más saliente se destacan: que en la edad escolar, las escrituras
son lentas, muy similares en formas a los modelos caligráficos y más rústicos o quebradizos.
En la edad madura, son mucho más automáticas, veloces, polimorfas, sin indecisiones ni
temblores. En la edad senil, aparecen temblores, trazos polidireccionales, de mayores cali-
bres y mucho más simplificadas.

Las accidentales: son aquellas que se producen bajo la acción de elementos circunstanciales,
tales como: defectos del elemento escritor o del apoyo sobre el que se escribe, por incorrectas
posiciones o movimientos bruscos, etc.

Son transitorias: aquellas producidas bajo la acción de emociones depresivas o eufóricas,


o por disturbios físicos pasajeros dados por: frío, calor, dolores, alcohol, drogas, medi-
camentos, temblores, enfermedades redimibles, calambres, espasmos, delirios, etc.

Son permanentes: las causas por afectaciones en: accidentes traumáticos, por enferme-
dades no redimibles, intoxicaciones crónicas, neurosis, degradaciones físicas, incoordinación
muscular, senilidad, perturbaciones motrices, etc.

Son voluntaria: aquellas realizadas con intención de disfrazar, simular o fraguar escrituras,
bajo el efecto de intoxicaciones premeditadas, realizadas con mano no acostumbrada, etc.

Son involuntaria: además de otras ya señaladas en los rubro: accidentales, transitorias o


permanentes, las ocasionadas por tics o trastornos psíquicos convulsivos, sobresaltos,
choques, cansancio, por síndrome del suicida, etc.

tomo 1 investigación científica del delito ) 243


educación a distancia (instituto universitario de la P.F.A.)

Los análisis y estudios requeridos para la identificación de manuscritos y firmas, como se


comprenderá, son variados, objetivos y minuciosos. Para su realización deben cumplimentarse todos
y cada uno de los pasos metodológicos dispuestos, respetándose su ordenamiento sistemático.

Lo primero a verificar es que el material aportado para estudio, cumpla con las
exigencias de los principios de orden scopométrico. Estos principios están referi-
dos a los materiales dubitado, indubitados, a los estudios y la conclusión, y ya fueron
tratados anteriormente, por lo que sólo se efectuará un breve recordatorio.

Elementos dubitados: los mismos deben ser aportados en original, no aceptándose re-
producciones o copias por cualquier medio que fueren. Sólo se trabajará sobre una copia
cuando exista una imposibilidad fáctica, real y concreta de contar con el original.

Sobre los elementos indubitados:


a) los documentos indubitados deben provenir de documentos de fechas anteriores,
posteriores y contemporáneas al dubitado, para poder realizar una historia gráfica del
escribiente y señalizar sobre ellos las esenciales constitutivas o características perma-
nentes y transitorias que hacen a su personalidad gráfica;
b) deben provenir de documentos públicos y privados, debiendo estos últimos ser de
fecha cierta;
c) no deben estar relacionados con la causa que se investiga, es decir que deben estar
realizados fuera de juicio y
d) deben estar confeccionados con elementos similares a los contenidos en el dubitado,
tanto en cuanto a los materiales - papeles, elementos escritores y tintas- como en la
forma -mayúsculas, imprenta, etc.

Es aquí donde los profesionales abogados que asistan a las partes involucradas en una causa,
deben extremar sus habilidades en procura de los documentos que cumplan con los requisitos o de
los datos que conduzcan a ellos para aportarlos al perito. Se debe tener en cuenta que los cuerpos
de escrituras tomados en las actuaciones judiciales, aún cuando cumplan con los requisitos legales,
no lo hacen con los técnicos, por lo que por principio no son idóneos.

Frente a las dos factibilidades posibles:


a) autor de las grafías cuestionadas o
b) no autor de las mismas, la realización del acto judicial causa diferentes, pero valederas
razones, para incidir en cambios o alteraciones en las grafías.
En el primer caso las variaciones pueden ser de carácter voluntario y premeditado para im-
pedir la posterior identificación.
En el segundo, el nerviosismo propio de estar involucrado en una causa puede motivar cambios
escriturales que podrían ser valorados como intentos de disfraces.

244 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

Lo ideal, de tener que recurrirse al mismo, es que sea realizado en presencia del perito que
tomará las prevenciones estratégicas correspondientes para evitar uno y atemperar o calmar al
otro. Como corolario final se especifica que los cuerpos de escritura podrán ser considerados
idóneos sólo en los casos en que permitan arribar a una conclusión positiva.

Los correspondientes a los estudios y conclusiones indican que:


a) no se pueden comparar textos con firmas o viceversa y
b) no debe afirmarse nada que no pueda ser debidamente demostrado por medios
fácticos.

El siguiente paso es el estudio del soporte. Se debe tener presente que el so-
porte, según se ha dicho, puede ser de distintos materiales. De tratarse, por ejemplo,
de papel, debe establecerse si:
a) se trata de un papel original o auténtico y
b) si ha sufrido algún tipo de adulteración. Para la primera comprobación, de ser requerida, debe
contarse con elementos indubitados de cotejo para establecer las características y medidas con-
tenidas en los auténticos y luego compararlas. Para el segundo, debe determinarse si presenta
algún tipo de adulteración por: a) borrado, b) raspado, c) cortado, d) agregados, e) testados, f)
retoques y g) lavados.

Borrado: es toda erradicación por remoción abrasiva de algun elemento obrante en un docu-
mento. Para lograr su cometido generalmente se utilizan gomas y acorde a la calidad de las tintas
que se pretende eliminar, se utilizan gomas blandas, semiduras y duras, realizadas con caucho
vulcanizado al que se le agrega yeso, talco, azufre, cuarzo, piedra pómez y arena.

Esta acción, si bien logra la eliminación de las tintas con que fueron realizadas las constancias
que se desean erradicar, trae aparejada subsidiariamente la alteración del satinado que recubre el
papel y que lo hace apto para la escritura y el erizamiento de las fibras celulósicas que lo conforman.
Esta circunstancia es comprobable en forma microscópica y por transparencia, al observarse pérdida
de sustancia y mayor paso de luz en las zonas afectadas.

Debe tenerse en cuenta que los falsarios, antes de asentar las nuevas constancias, tratan
de disimular la zona afectada por medio de fricción a presión con un objeto liso, duro y curvo, que
al producir una acción mecánica y calor, alisa la superficie produciendo una regeneración del brillo,
disminuyendo además la difusión de la tinta con la que se producirán los nuevos asentamientos.

Raspado: esta maniobra de erradicación por abrasión es muy similar a la anteriormente


descripta, variando únicamente por el utensilio utilizado para su concreción. Para lograrlo

tomo 1 investigación científica del delito ) 245


educación a distancia (instituto universitario de la P.F.A.)

se requiere un filo metálico como ser el de una hoja de afeitar, de bisturí, cortaplumas, etc.
que debe ser manejado hábilmente, presentando como ventaja sobre el anterior, el hecho
de permitir un mejor control de la zona a trata. Generalmente sus resultados son más de-
limitados pero más profundos, produciendo similares alteraciones en el papel.

Cortado: esta maniobra se consuma por el cercenamiento de parte de un documento, lo


que puede alterar significativamente su tenor. Su determinación se efectúa mediante el
estudio de los bordes del papel, ya que diferentes métodos de corte, ocasionan diferentes
resultados, apreciables en forma microscópica.

A modo de ejemplo se detallan: por tijera: producen escalonamiento con cada abrir y
cerrar de hojas; por guillotina: diferente tracción de fibras desde el inicio al final, provocado
por la hoja en su descenso; por elemento cortante: como ser hoja de afeitar o de bisturí,
provoca pequeños enganches de fibras; por tracción: obviamente es el más visible o detect-
able, por el anómalo corte de las fibras que sufren estiramientos o roturas desparejas.

Agregados: se trata de la incorporación de nuevas constancias que alteran, por ejemplo,


los importes o destinatarios de un cheque. Para su determinación se deben establecer
las características que producen los elementos escritores utilizados, la reacción de las
tintas a las diferentes ondas lumínicas y de requerirse, por análisis químicos sobre los
componentes y colores de las tintas utilizadas.

Testados: es la anulación total o parcial de un escrito mediante la superposición de


trazos realizados con la misma o distinta tinta, impidiendo con ello la lectura o visu-
alización de lo tachado. Esto puede ser fraudulento o legítimo, requiriendo para esto
último el debido salvado acorde a las formas legales establecidas.

Las tintas utilizadas para efectuar los testados pueden ser de diferentes naturaleza,
por lo que para su revelado, se debe recurrir a diferentes análisis, métodos y estudios. Entre
los recursos más efectivos se destacan: luces de diferentes espectros –ultravioleta, visible
e infrarroja- y desde distintos ángulos de incidencia –directa, por transparencia y tangencial
hasta rasante; suaves lavados con soluciones o reactivos idóneos y recursos fotográficos.

Retoques o enmiendas: consisten en la transformación de ciertas constancias por otras.


De esta manera es posible cambiar la morfología de algunas letras o números y con
ellas el tenor de un documento. Se determinan de manera similar a los agregados.

Lavados: esta maniobra se realiza por medio de solventes adecuados que se aplican en
forma lenta y progresiva sobre los trazos a eliminar, por medio de hisopos o de conos
de papel de fieltro, lográndose buen resultado con tintas solubles al agua y a solventes
orgánicos. Las tintas a la anilina se erradican con suave fricción de hisopos embebidos en
agua. Las tintas grasas de los bolígrafos son más difíciles de erradicar por este medio.

246 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

Otra forma de producir erradicaciones por lavado pero ya no por medios físicos sino
químicos -utilizada para erradicar constancias realizadas con tintas fluidas penetrantes- es la
utilización de reactivos especiales asociados, denominados borratintas que, aplicados con
mesura, logran una adecuada eliminación. Estos reactivos actúan como oxidantes suaves,
haciendo que sustancias coloreadas se tornen incoloras.

Acorde a la intensidad de las erradicaciones por medio físicos o químicos, es posible


por medios analíticos mediante la utilización de reactivos y métodos específicos, recuperar
parciales de letras y palabras de los textos erradicados llegando, en muchos casos por
asociación, a determinarse el texto suplantado.

Determinada o no la presencia de falsificaciones o adulteraciones del o sobre el


documento, se deben realizar dos tipos de exámenes, uno de carácter generalizado o ex-
trínseco y otro pormenorizado, microscópico o intrínseco.

Para ambos exámenes, de contarse con los elementos ideales de carácter indu-
bitados ya referidos, debe efectuarse primeramente sobre todos ellos el análisis, a fin de
establecer las características generales y particulares y las esenciales constitutivas de per-
sonalidad gráfica. Luego deben realizarse similares estudios sobre el material dubitado y,
posteriormente, debe efectuarse la comparación cualicuantitativa entre ambos.

Debido a la especificidad técnica de cada uno de estos exámenes, se efectuará sola-


mente una breve referencia a los diferentes elementos que se analizan sobre las escrituras
y firmas, detallándose sólo aquellas que sean necesarias para su comprensión.

Nota: sobre los pormenores de estos exámenes, el alumno sólo deberá incorporarlos como información, no

requiriéndose su estudio minucioso, ya que no es tarea que deberá cumplimentar. Sí, se hace necesario su

conocimiento, para poder evaluar oportunamente los informes que deba analizar en el ejercicio profesional y para

conocer los diferentes elementos que son considerados por los peritos documentólogos.

tomo 1 investigación científica del delito ) 247


educación a distancia (instituto universitario de la P.F.A.)

Dentro del análisis extrínseco se evalúan los siguientes elementos: a) ritmo de


escritura; b) inclinación de ejes; c) orientación; d) diagramación; e) irradiación; f)
f calibre
de trazos y rasgos; g) proporciones; h) intervalos; e i) cultura gráfica.

Ritmo de escritura: este está conformado por diferentes factores que deben ser evaluados
y mensurados por separado, a saber:
l Velocidad: la ejecución de una escritura puede ser muy veloz, medianamente veloz y lenta.
l Presionado: es la fuerza ejercida por el escribiente sobre el elemento escritor y éste a
su vez sobre el papel y se trasunta por las indentaciones o surcos dejados sobre este
último. Pueden ser intensos, medianos o leves y se los estudia con diferentes ángulos
lumínicos, con lupas y por examen del reverso. Se debe determinar, asimismo, el grado
de continuidad de este presionado, ya que el mismo puede ser continuo o discontinuo.
La integración de estos dos elementos permite seis tipos de combinaciones.
l Grosor de trazos y rasgos: Si bien debe ser valorado en función del tipo de elemento es-
critor utilizado, su análisis debe coadyuvar a la valoración del presionado ya detallado.
l Continuidad: se hace necesario aquí aclarar que se denomina “trazado”, a todo desarrollo
gráfico que se realiza sin levantar el elemento escritor del papel. Así, para producirlos, se
hace necesario apoyar el elemento escritor sobre el soporte, ejecutar un gesto gráfico
y luego levantar dicho elemento. Acorde a la cantidad de veces que se ejecuten estos
movimientos, serán las cantidades de trazados producidos. Si para la ejecución de una
firma o de una palabra se han producido varios trazados, las mismas serán discontinuas,
si se los ha producido en pocas oportunidades, serán medianamente continuas y en
caso de que no se hubieran producido, serán continuas.

Inclinación de ejes: Las posiciones de los ejes o líneas de equilibrio de las letras o firmas, pueden
ser a) verticales; b) inclinados a la derecha; c) inclinados a la izquierda y d) heterogéneos.
l Verticales: serán así cuando mantengan la perpendicularidad con la línea de base
de la firma o escritura, formando ángulos de 90 grados.
l Inclinados a derecha: serán así cuando las líneas de equilibrio de las firmas o letras
presenten inclinación hacia derecha, debiéndose mensurar si presentan leve, me-
diana o pronunciada inclinación.
l Inclinados a la izquierda: serán cuando los ejes se inclinen hacia ese lado, debiendo
mensurarse iguales valores.
l Heterogéneos: cuando la relación entre las letras o gramas de una escritura o cuando una
firma presente inclinaciones mixtas, indican automatismos subconscientes que hacen a
la personalidad gráfica de su autor, revistiendo una importante función identificativa.

248 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

Orientación: Esta circunstancia surge del trazado de una línea unificadora de la base de
las letras de una escritura o de una firma, independientemente de los renglones o líneas
pautadas. Puede ser ascendente, descendente u horizontal, destacándose para las dos
primeras que además pueden ser: leves, medianas o muy ascendentes o descendentes.

Diagramación: esta circunstancia es más destacable en las firmas que en las escrituras
y está dada por su mayor o menor legibilidad, pudiendo ser calificada como: legibles,
medianamente legibles e ilegibles.

Irradiación: en los idiomas como el nuestro en que la escritura va de izquierda a derecha,


la ejecución de las firmas o escrituras requiere movimientos hacia arriba y abajo y hacia
la derecha. Esto provoca equilibrios o no entre los movimientos horizontales y verticales,
los que pueden ser a su vez expansivos, medianamente expansivos y poco expansivos,
dando lugar sus vinculaciones a nueve tipos de posibilidades.

Calibre: es el espacio comprendido entre la línea de base de las letras de la escritura o


firma y las cúspides de las letras minúsculas y se estudia trazando una línea en cada uno
de esos sectores. El resultado de las mismas puede dar tres tipos de características:
a) ingladiolado;
b) gladiolado y
c) creciente.

Ingladiolado o constante: se denomina así al calibre resultante cuando las dos líneas
trazadas quedan paralelas.
Gladiolado o disminuido: es el calibre determinado cuando las dos líneas se van cerrando
a la derecha.
Creciente: es el calibre determinado cuando las dos líneas se van abriendo hacia la derecha.

Proporciones: se analiza esta circunstancia en lo que hace a las letras largas y cortas
minúsculas y entre las mayúsculas y minúsculas.

Intervalos: es el espacio comprendido entre dos gramas de una letra, entre dos letras consecu-
tivas de una palabra, o entre la finalización de una palabra y el comienzo de la siguiente.

Cultura gráfica: está dada por el grado de habilidad de manejo del elemento escritor. Esto
determina variaciones de excelente, bueno, regular y mal manejo del elemento escritor,
aunque también admite estadios intermedios.

tomo 1 investigación científica del delito ) 249


educación a distancia (instituto universitario de la P.F.A.)

Dentro del análisis intrínseco se valoran los siguientes elementos: a) espontaneidad;


b) estudio de trazos y rasgos; c) enlaces; d) morfología; e) signos de puntuación; f) orto-
grafía y g) dimensiones de las letras.

Espontaneidad: una escritura natural presenta una total y absoluta pureza y franqueza de
movimientos que determinan su espontaneidad. Por ello se hace necesario establecer si
presenta algunas de las características que ponen en evidencia la falta de ella y, de po-
seerla, verificar las posibles causales de producción. Estos signos son: a) hesitaciones; b)
detenciones; c) retomas; d) retoques, y e) temblores.

l Hesitaciones: son dudas o vacilaciones que efectúa el escritor durante el trazado de algu-
nas letras o en partes de la firma y se traducen en pequeños quebrados, especialmente
en la dirección que lleva el elemento escritor, e indican desaliento o intranquilidad durante
la ejecución, normalmente por incertidumbre de cómo continuar dicho trazado. Estas
hesitaciones son un claro signo de falta de espontaneidad.

l Detenciones: son las paralizaciones momentáneas o altos producidos durante la ejecución


de un trazado y pueden deberse a varios factores: como normales se puede indicar los
debidos a un cambio de dirección del elemento escritor; y como fraudulentos a las provo-
cadas por dudas en la forma o continuidad del trazado que se está ejecutando. En ambos
casos dejan como señal un mayor depósito de tinta que se traduce en un notorio punto,
si el elemento escritor no es levantado del soporte.

l Retomas: De levantarse el elemento escritor luego de una detención, para poder continuar
con la ejecución de las letras o firmas se deberá hacer incidir nuevamente el mismo sobre
el papel. La retoma efectuada se pondrá de manifiesto por el trazado independiente pro-
ducido, el que puede estar continuado, encimado, separado, etc.

l Retoques: son las modificaciones efectuadas tendientes a mejorar o modificar los trazados
ejecutados. Estos pueden tener causas fraudulentas, para reparar la ejecución de los trazos
o rasgos realizados -por diferir de los imitados en angulosidades, evoluciones, involuciones,
trayectorias, etc.; para disimular los rastros de una retoma o simplemente para definir o
aclarar una letra que no ha resultado lo suficientemente legible.

l Temblores: son las vacilaciones o movimientos anormales producidos por la falta de


naturalidad o espontaneidad en la producción de manuscritos o firmas.

Estudio de trazos y rasgos: como ya se especificara, los trazos son los componentes
esenciales de una letra sin los cuales no quedaría definida, pudiendo ser curvos, rectos
o mixtos y perfilados –ascendentes- o magistrales –descendentes-.

Los rasgos son partes no esenciales de las letras y pueden ser iniciales, finales y de en-
laces. Los iniciales y finales pueden ser ascendentes, descendentes, horizontales, cortos o largos y

250 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

presentan dos porciones bien definidas, recibiendo según el caso, las siguientes denominaciones:
a) punto de ataque; b) ataque; c) remate y d) terminal.
Punto de ataque: es el rasgo inicial producido al tomar contacto el elemento escritor con el papel
y puede adoptar diversas formas: ganchosa: es un movimiento anguloso curvo sin vértice; arpo-
nado: es un movimiento que conforma un ángulo agudo con su vértice bien definido; acerado:
movimiento que comienza con una punta muy delgada; y en reposo: o movimiento formado por
un breve apoyo del elemento escritor sobre el papel, lo que produce o conforma un punto.
Ataque: es el primer sector del rasgo inicial que se realiza inmediatamente después de producido
el punto de ataque y también puede adoptar diversas formas: en maza: movimiento de forma
triangular producto del engrosamiento producido por presión excesiva del elemento escritor;
golpe de sable: es un movimiento terminado en punta acerada o fina; golpe de látigo: es un
movimiento menos presionado, más extenso y sin terminación acerada; envolvente: es cuando
el rasgo vuelve sobre sí mismo; además del ganchoso y el arponado ya descriptos.
Remate: es el rasgo final de una letra o firma y puede adoptar las formas descriptas
para el ataque.
Terminal: es el último sector del remate y puede adoptar similares formas que las descriptas
para el punto de ataque.
Rasgos de enlaces: son los rasgos que sirven de nexo entre dos letras y pueden ser
curvos, rectos o mesetados.

Enlaces: se denomina así, a las uniones que vinculan entre sí a las gramas de una misma
letra o las uniones que vinculan a las diferentes letras de una palabra. Acorde a las distintas
modalidades escritoras, estos se presentan a) ligados o b) desligados.
l Ligados: son los rasgos que sirven de nexo a dos gramas o a dos letras de una misma
palabra.
l Desligados: es la falta de rasgos que sirven de nexo entre dos gramas o letras.

Morfología: como su nombre lo indica, es la construcción, constitución o configuración de


dos aspectos importantes de una firma o de un manuscrito: a) su forma o conformación
genérica y b) la línea o base de renglón.

l Forma o conformación: este estudio se centra en el análisis predominante de las formas


curvas o angulosas. Con relación a las curvas se determina asimismo si éstas son evo-
lucionadas o involucionadas.

l Línea o base del renglón: es independiente de que el papel donde se encuentren los escritos
o firmas posea o no rayado o renglonado. Es la línea imaginaria que vincula la totalidad de
las bases de las letras de un renglón de un manuscrito o de las diferentes partes de una
firma. Acorde a su trazado, la misma puede ser: a) recta; b) curva y c) serpentina.
Será recta: cuando la línea que toque la base de todas las letras o de todas las partes de
la firma resulte el camino mas corto o casi el más corto, entre el punto inicial y el final.

tomo 1 investigación científica del delito ) 251


educación a distancia (instituto universitario de la P.F.A.)

Curva: cuando la resultante adquiera diferentes alturas en creciente y decreciente,


pudiendo ser cóncava o convexa.
Serpentina: cuando la línea sea una sucesión de concavidades y convexidades.

Signos de Puntuación: Estos aportan una gran cantidad y variedad de datos donde interviene, además
de la forma, su ubicación, posición y dirección. Tómese a modo de ejemplo el punto de la letra “i
”, este puede estar representado como un punto, una raya, un tilde, un redondel, una coma, etc.
Además puede estar ubicado sobre el eje de la letra, a su izquierda o derecha, próximo o alejado
y en los casos que corresponda por su forma, se debe verificar la dirección asignada.

Ortografía: debe verificarse en este rubro las faltas ortográficas que posea, tanto en lo que
hace a la construcción de las palabras como a su gramática, determinándose su grado de
normalidad o anormalidad y la coherencia de repeticiones en cada texto y comparativamente
entre los dubitados e indubitados.

Dimensión de letras: donde se considera con relación a su altura si son cortas o sobresalientes
y con relación a su ancho sin son angostas, medianas o anchas.

La evaluación pormenorizada en forma cualicuantitativa de todos y cada uno de los


items que se han detallado, permiten al perito una profunda compenetración de las esenciales
constitutivas o gestos idióticos subconscientes que conforman una personalidad gráfica y
con ello la determinación de autoría o paternidad en manuscritos o firmas.

Tal como fácilmente habrá comprendido el alumno, la temática de la identificación de


manuscritos y firmas es sumamente compleja y técnica, por lo que sólo se requiere la lectura
y comprensión de los diferentes temas que componen los estudios extrínsecos e intrínsecos
y su conservación material, para poder oportunamente, cuando la actividad profesional así se
lo imponga, contar con los elementos que el perito debió tener en cuenta y de allí valorar su
actividad en procura de sostener o rebatir el informe presentado.

Debe asimismo tener en cuenta que todo lo detallado en el informe debe ser debidamente
señalizado en las láminas complementarias, ya que es función específica del perito demostrar
todo aquello que dictamine en sus conclusiones, para diferenciar sus dichos de los del testigo.

Se requiere, también, comprender que la diferencia fundamental con la determinación de


identidad papiloscópica ya analizada, es que para la mayoría de las cuestiones criminalísticas, en
general, se arriba a las conclusiones luego de mensurar en calidad y en cantidad pero no en forma
matemática, las características aportadas por los testigos mudos o cosas en su interrogatorio.
Para su ilustración, podría llegar a parangonarse con los síntomas aportados por el paciente a
un profesional médico, que son los que le permitirán a éste, arribar a un diagnóstico.

252 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

Como corolario, es bueno aclarar que todos los peritos que analicen los mismos el-
ementos, bajo las mismas condiciones y con similares técnicas e instrumental, deberán efectuar
objetivamente idénticas determinaciones. La diferencia entre ellos estará dada en las
evaluaciones subjetivas de esas determinaciones las que, según los casos, permitirán
concluir en forma diferente dentro de un marco de buena fe, tal como dos médicos frente
a los mismos síntomas, pueden arribar a dos diagnósticos o terapias diferentes.

tomo 1 investigación científica del delito ) 253


educación a distancia (instituto universitario de la P.F.A.)

254 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

( BIBLIOGRAFÍA DE LA UNIDAD VI )

n Enciclopedia Universal, Tomo XX, páginas 929 a 980.

Dada la especificidad del tema tratado, el resto de la bibliografía de esta unidad debe
ser considerada optativa y se indica sólo para ilustración o consulta específica del alumno.

n GUZMAN, Carlos; “El Peritaje Caligráfico”; Ed. Policial; Bs. As. 1997.

n DEL PICCHIA, José; “Manual de Documentoscopía”; Ed. La Rocca. Bs. As. 1993.

n CREUS, Carlos; “Falsificación de Documentos en General”; Ed. Policial; Bs As. As-


trea.

n “Revistas de Policía y Criminalística nº 2”; Ed. Policial.

Nota: todos los textos mencionados se encuentran para consulta y/o préstamo en la Biblioteca del
Instituto Universitario de la Policía Federal Argentina.

tomo 1 investigación científica del delito ) 255


u7
unidad siete

( investigación científica del delito )


educación a distancia (instituto universitario de la P.F.A.)

CONTENIDOS DE LA UNIDAD VII

( INVESTIGACIÓN CIENTÍFICA DEL DELITO )

Mención sintética de los contenidos

1. Qué es Seguridad Documental.

2. Dónde, para qué y cuáles son los beneficios que aporta su implementación.

3. Evolución sufrida desde los primeros elementos utilizados como papel hasta la fecha.

4. Definición de papel y su constitución genérica.

5. Fuentes de recursos para la obtención de materia prima.

6. Fabricación del papel y los diferentes procesos a los que se someten.

7. Distintos tipos de papeles.

8. Distintos tipos de tintas en general y de seguridad.

9. Tintas especiales para funciones determinadas.

10. Distintos tipos de sistemas de impresión.

11. Reconocimiento de los principales sistemas utilizados en seguridad documental.

12. Distintas medidas de seguridad documental.

13. Aplicación de las mismas acordes a destinos, usos y costos.

14. Aplicación de estas medidas en los documentos de identidad y otros.

15. Conocimiento y reconocimiento de las distintas medidas en los documentos a analizar.

16. Aplicación de estas medidas de seguridad en diferentes tipos de soportes.

17. Verificación visual en prevención de falsificaciones y adulteraciones.

tomo 1 investigación científica del delito ) 259


educación a distancia (instituto universitario de la P.F.A.)

260 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

abogacía a distancia oa)


objetivos de aprendizaje de la unidad

n Introducirnos en el mundo de la Criminalística Prevencional.

n Dentro del amplio espectro que comprende, específicamente en la protección docu-


mental.

n Conocer cuáles son los componentes del papel, soporte base de los documentos
analizados en esta unidad.

n Conocer las fuentes de materia prima y su importancia acorde al uso a que posterior-
mente esté destinado.

n Hacer un breve comentario de las diferentes maneras en que se fabrica el papel.

n Comprender uno de los procesos de fabricación del papel.

n Conocer las medidas de seguridad que sobre él pueden incorporarse en el momento


de su fabricación.

n Distinguir esas medidas auténticas de las imitaciones realizadas por los falsarios.

n Conocer las categorías de calidad dada a los papeles según el uso al que esté desti-
nado y sus regulaciones.

n Conocer la mecánica de trabajo de los principales sistemas de impresión sobre papel.

n Reconocer en los documentos la presencia de estos sistemas.

n Tomar conocimiento de algunas tintas denominadas de seguridad.

n Comprender qué otras funciones cumplen algunas tintas específicas en determinados


documentos.

n Detallar las principales medidas de seguridad utilizadas para la protección documental


en la mayoría de los países del mundo.

n Conocer algunas de las diferentes medidas de seguridad aplicadas en los distintos


documentos de identidad o pertenencia.

n Distintos usos de las medidas de seguridad y formas de reconocimiento.

tomo 1 investigación científica del delito ) 261


educación a distancia (instituto universitario de la P.F.A.)

262 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

( ESQUEMA CONCEPTUAL DE LA UNIDAD VII )

SEGURIDAD: ES LA CONFIANZA Y TRANQUILIDAD QUE SE POSEE ANTE LA IDEA DE


QUE NO HAY PELIGROS QUE TEMER.

PAPEL: “PRODUCTO FOLIOLAR DE FIBRAS ENTRELAZADAS”, O “AGLOMERACIÓN DE


FIBRAS CELULÓSICAS DISPUESTAS EN FORMA LISA Y PLANA”.

HISTORIA Papiro o junco 3.500 A.C. en Alejandría

Pergamino: piel de oveja, cabra: en Asia

Papel: bambu + seda: en China 200 D.C.

Papel vegetal: damasco, 710 D.C.

FUENTES Trapos: lino, algodón, cáñamo

Maderas: bosques naturales o cultivados

Bagazo de la caña de azucar

Residuos agrícolas: paja de trigo

Reciclaje

PASTA Trozado y descortezado de la madera

Molino con agua

Tamizado en cribas

Depurado y mezclado

Prensado: 60% agua y 40% pasta

PASOS Amasado y formación de la hoja

Prensado por rodillos y secado

Amalgamamientos y santinados

Bobinado en cilindros

Rebobinados y cortes

tomo 1 investigación científica del delito ) 263


educación a distancia (instituto universitario de la P.F.A.)

CALIDAD Gramaje: gramos por metro cuadrado

Resistencia a la tracción = Tensión KG/CM.

Espesor: exactitud de 0,01 MM.

P H.

Rasgado: fuerza necesaria para rotura

Opacidad: paso de la luz

Permeabilidad: a tintas

Doble plegado: resistencia al doblado

Suavidad o lisura: acorde elemento escritor

Brillo: acorde a destino

Penetración: por absorción

Compresión: disminución del espesor

FILIGRANA Claroscuro puestos durante la fabricación

Localizada: ubicada en un sector predeterminado

Repartida: distribuida en todo el papel

TIPOS PAPEL Común: sin filigrana, distintos usos

Certificación de origen: identifica fabricante

Emisión controlada: identifica a impresor

Emisión registrada: regulada por ley

MEDIDAS SEGURIDAD Fluorescentes o no

Filigranas o marcas de agua

Fibras: Hilos nylon 5 MM visibles o no

Localizada por zonas o tiras fijas

Confetis: 1 MM distintos colores = distribución

Otros: cenizas de papel, fibras especiales

Sensibilizado

Hilo de seguridad

264 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

TINTAS: VEHÍCULOS COLORANTES QUE POR EVAPORACIÓN O REACCIÓN QUÍMICA


DEJAN COLORES INTENSOS Y PERENNES..

TIPOS Fugitivas
Variación cromática u O.V.I.
Electrostáticas
Magnéticas (óxidos de hierro)
Termosensibles
Secretas o simpáticas
Antifotográficas o antirreflex
Fotocromáticas
Reactivas al agua

IMPRESIONES Offset: indirecto y plano


Tipográficas
Calcográficas
Computacionales

MEDIDAS Fondos de seguridad


Fondos iridiscentes
Microletra o microcalco
Imagen latente
Registro perfecto o simultán
Leyendas invisibles
Leyendas fotocromáticas con tintas O.V.I.
Holografías
Plaquetas de seguridad
Film transparente de seguridad
Film con microesferas
Botones de seguridad
Sellos secos
Códigos de barras
Perforaciones

tomo 1 investigación científica del delito ) 265


educación a distancia (instituto universitario de la P.F.A.)

266 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

abogacía a distancia ai )
actividad introductoria

Lea atentamente el artículo periodístico que se adjunta a continuación, extraído del


diario La Nación del 15 de abril de 2001.

Aplicando sus conocimientos de derecho, califique la o las figura/s delictiva/s imputable/s


a los integrantes de la organización delictiva desbaratada.

Mensure a continuación todo el espectro delictivo que puede desprenderse de la utilización


de documentos falsificados.

Califique nuevamente las nuevas y variadas figuras delictivas que se desprenden de


esa utilización y mensure la gravedad de la maniobra, no tanto desde el punto de vista es-
trictamente de derecho, sino desde un enfoque social.

Valorada la magnitud del daño ocasionado, se entenderá el por qué de la obligación de


todo Estado en dotar a sus documentos públicos y/u oficiales de suficientes medidas de seguri-

tomo 1 investigación científica del delito ) 267


educación a distancia (instituto universitario de la P.F.A.)

dad para que éstos sean fácilmente reconocibles (recordar dentro de qué capítulo está protegido
este tipo de delitos en el Código Penal), y el por qué de la necesidad por parte de los usuarios de
conocerlas y reconocerlas.

Esta unidad tiende a detallar las medidas de seguridad que se pueden utilizar y las formas
de su reconocimiento.

268 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

( DESARROLLO DE LA UNIDAD VII )

Seguridad documental

Debemos comenzar el tratamiento de esta unidad definiendo el concepto de


“Seguridad” y luego ampliar su significado a un contexto mucho más amplio.

Seguridad: según el Diccionario Ilustrado de Ramón GARCIA-PELAYO Y GROSS, Ediciones


Larousse, de la Editorial Policial, año 1988, es la “Confianza, tranquilidad de una persona
procedente de la idea de que no hay ningún peligro que temer....”; “Ramo de la Adminis-
tración Pública que vela por la tranquilidad de los ciudadanos...”; “Conjunto de leyes, y de los
organismos que las aplican, que tienen por objeto proteger contra determinados riesgos..”

Si bien el concepto en sí es lo suficientemente claro, también lo es el concepto de que


nada ni nadie puede “asegurar seguridad”, ya que siempre habrá factores internos o externos;
intencionales o accidentales; dolosos o culposos; naturales o no, que pueden hacer variar las
condiciones o mecanismos de funcionamiento de la compleja maquinaria resultante, pero
absolutamente necesaria para el cumplimiento de una función tan amplia como ardua.

Dotar, por ejemplo, a una casa de cerraduras especiales, rejas, sistemas de alarmas
y aún vigilancia efectiva por medios electrónicos y físicos, no garantiza en modo terminante
que no pueda ser objeto de un hecho delictuoso o accidental. Lo que sin duda produce, es
una minimización de riesgos y es así como debemos entender el concepto de Seguridad
dentro de este desarrollo temático.

Acorde al tipo de protección que se pretenda brindar y sobre quiénes o qué


se efectivizará, se deberán implementar diferentes aportes tecnológicos y se deberá
recurrir a los profesionales idóneos correspondientes.

Se ha detallado, en unidades anteriores, los diferentes aportes que la disciplina


Criminalística puede brindar. Si es posible determinar y esclarecer un hecho y sus autores
luego de que éste se ha producido a través de la aplicación de conocimientos técnicos y
científicos, utilizando de los mismos medios se podrán prevenir vulneraciones a la seguridad,
adoptando las medidas que fueren necesarias.

tomo 1 investigación científica del delito ) 269


educación a distancia (instituto universitario de la P.F.A.)

Asimismo se ha definido y comprendido el concepto de “documento” y se han de-


tallado las formas mecánicas y manuales que se utilizan para su confección, los ataques a
que son sometidos y las comprobaciones que sobre ellos pueden realizarse. La aplicación
de la ciencia y la tecnología a la prevención de fraudes contra los documentos, es lo que
se denomina “Seguridad Documental”.

Los documentos pueden estar realizados sobre diversos tipos de elementos, es


decir confeccionados sobre diferentes soportes. En este capítulo nos referiremos fun-
damentalmente a los realizados sobre papel, efectuando algunas consideraciones
sobre otros, como ser plásticos o metales.

Con relación al papel se hace necesario efectuar una breve mención sobre qué es,
cuáles fueron sus precursores, sus orígenes, sus fuentes de materia prima, las formas de
su producción y sus distintos tipos.

Papel: se podría definir como una hoja delgada producto de una combinación de materias
fibrosas en su mayoría de origen vegetal, -porque también pueden ser de origen animal o
mineral-, sometidas a diversos procesos y destinada a diferentes usos. Este conjunto foliolar
de fibras celulósicas, lignocelulósicas o ambas, entrecruzadas y/o aglutinadas entre sí en
forma de láminas flexibles u hojas lisas, planas, homogéneas y suaves, de diferentes durezas,
color, satinado, duración, etc. -según el uso al que será destinado-, puede estar dispuestos
en forma delgada o gruesa, constituyendo así papel o cartón respectivamente.

Obviamente este producto artificial puede adaptarse a diferentes funciones acorde al tipo
de superficie que se le asigne, pudiéndose mencionarse, entre otros, para envoltorio, escritura,
absorbentes, etc., lo que hace que el papel sea un material de suma utilidad para el hombre.

Sin intentar hacer un resumen histórico, se puede mencionar que antes que los árabes
introdujeran la fabricación manual del papel en Europa en la Edad Media, en la antigüedad
se emplearon otros materiales de manera similar al papel. Desde los más antiguos hasta el
papel como lo conocemos hoy, podemos mencionar: a) el papiro, b) el pergamino, c) el
papel chino y d) el papel árabe.

El papiro: nombre egipcio que significa “producto del río”, data de tres mil quinientos
años antes de nuestra era y se obtenía de un arbusto o junco, el “Cyparus papyrus L”
que brindaba a esa antigua civilización múltiples beneficios y usos. El papiro además de
servir para la escritura, se lo utilizaba para la alimentación humana, para la fabricación
de utensilios domésticos, embarcaciones, productos medicinales, etc.

270 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

La industria del papiro alcanzó gran desarrollo, especialmente en Alejandría, donde se


utilizaba para su producción, además de la pulpa celulósica del arbusto o junco mencionado,
una sustancia aglutinante a modo de encolado extraída del tallo del mismo, agregándose luego
harinas que actuaban como “carga”, logrando uniformidad.

El pergamino: para muchos autores su origen se remonta al siglo III o II antes de Cristo y
su invención se la adjudican al rey Eumenes de Pérgamo (antigua ciudad del Asia Menor,
hoy Bergama). Sin embargo, estos materiales de origen animal obtenidos por depilación,
secado, estiramiento y otros procedimientos de la piel de animales jóvenes tales como ove-
jas, corderos, asnos, cerdos, cabras, etc. fueron utilizados anteriormente por los jonios y los
israelitas según los clásicos Herodoto y Muspratt. Aunque sus orígenes sean inciertos, sobre
él se han registrado códices, escritos monacales y los acontecimientos más importantes de
la Edad Media.

El papel chino: sus orígenes datan del Siglo II después de Cristo y consistía en hojas
obtenidas por el alisamiento de las fibras de bambú y trapos de seda deshilachados
amalgamados en agua. De su evolución surge un papel de fibras vegetales muy similar
al hoy utilizado, fabricado en Samarcanda por prisioneros chinos, en el Siglo VIII.

El papel árabe: en el Siglo VIII un árabe de nombre Amru, en conocimiento del secreto
de fabricación del papel chino, comenzó su producción en tierras árabes, convirtiendo a
Damasco en el centro de una nueva industria cuyo producto fue exportado primeramente a
Italia y España y luego por todo el Mediterráneo, a comienzos del Siglo IX. El agregado de
“encolados” y “cargas” a base de almidón de trigo introdujo mejoras en la calidad del papel
de esta procedencia.

Además de lo detallado existen referencias históricas que, en diferentes países de Eu-


ropa, se utilizaban papeles confeccionados con fibras de algodón y lino y que en Alemania se
estableció, en la ciudad de Ravensburg en el año 1290, el primer molino y fábrica de papel.

La aparición de la imprenta y el avance de las industrias, hicieron notar que el pro-


gresivo aumento del consumo de papel requeriría a la brevedad de fuentes naturales y de
cultivo de materias primas celulósicas y del desarrollo de nuevas tecnologías aplicables en
el proceso de fabricación, lográndose con su incorporación mejores calidades, incremento
de producción y baja de costos y precios.

Actualmente las principales materias primas de las cuales se obtienen las fibras ce-
lulósicas o lignocelulósicas aplicables a esta industria, son del reino vegetal: provenientes de
bosques naturales y cultivados; del bagazo o cáscara de la baga de la caña de azúcar; y
de residuos agrícolas tales como pajas de trigo, lino, el linter o borra del algodón, etc.

tomo 1 investigación científica del delito ) 271


educación a distancia (instituto universitario de la P.F.A.)

El reino animal ofrece también materiales fibrosos de origen proteicos no


celulósico, como pelos, lana, seda, etc. que se utilizan como complemento de las
vegetales, ya que de por sí no satisfacen las necesidades exigibles de flexibilidad,
finura y tenacidad requerida para la fabricación del papel.

Dentro del reino mineral debe mencionarse al asbesto o amianto que, si bien no
se utiliza para el uso corriente del papel, se fabrican con sus fibras papeles y cartones
para uso industrial por sus propiedades de alta resistencia a las temperaturas.

Debe mencionarse asimismo otros aportes o fuentes: los trapos, es decir los
restos de tejidos, telas, redes, etc. confeccionados con fibras de lino, cáñamo y algodón
los cuales, luego de su vida útil para los fines predeterminados para los que habían sido
creados, se utilizan para la fabricación del papel y el reciclado de papeles en desuso.

La utilización de las distintas fuentes de recursos de materias primas para la obten-


ción del papel, da diferentes calidades y deben ser especialmente tenidas en cuenta en el
primer momento de su elaboración.

Para la fabricación del papel se hace necesario, primeramente, transformar la materia


prima, desfibrando o separando sus fibras. Realizado ésto se obtiene la pasta o base del papel
que, acorde a las características del tipo de papel que se desea fabricar puede ser: a) “pasta
mecánica”, b) “pasta semi-química”, c) “pasta quimi-mecánica” y d) “pasta química”.

Pasta mecánica: esta pasta puede ser utilizada cruda para la obtención de cartones y
papel para diarios, o cocida para la obtención de cartulinas y papel obra de segunda. Por
no ser el tipo de papel de interés para el tratamiento de esta unidad, no se especificarán
las diferentes etapas de su fabricación.

Pasta semiquímica en crudo: se obtiene papel de embalaje, corrugado y cartones y


blanqueada, papeles para escribir e imprimir. Por obtenerse con ésta y con la pasta
quimi; mecáncias papeles de menor calidad que con la pasta química, sólo se describirá
el proceso de fabricación para aquellas.

Pasta quimi-mecánica en crudo: se obtienen papeles para diarios y para empapelar; y


blanqueada: papel para libros, o papeles tisú o higiénicos.

Pasta química: para la obtención de esta pasta partiendo de la madera, deben realizarse,
en general, los siguientes pasos:

Trozado de troncos: este paso consiste en el seccionado de los troncos en segmentos de


unos sesenta centímetros de longitud.

272 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

Descortezado: procedimiento por el cual se separa la corteza de los troncos mediante el uso
de cuchillas en un tambor giratorio o por medio de presión de agua.

Chipeado: es el astillado o desmenuzado de la madera realizado a través de dos discos me-


tálicos estriados y enfrentados que giran en sentido contrario a gran velocidad. Esto provoca
el chipeado, que no es otra cosa que hacer pedazos menudos de una cosa.

Cocción: luego de almacenados en depósitos, los chips son colocados en recipientes me-
tálicos de gran capacidad denominados digestores, donde son sometidos a la acción del
vapor de agua, presión y determinados reactivos químicos.

Tanque de soplado: luego de la cocción las astillas son descargadas en un tanque denomi-
nado “Blow Tank” donde son tratadas.

Lavado: luego de ser tratadas en el tanque de soplado se procede al lavado de la pasta


con filtros de lavajes o espesadores, que tienen como tarea separar el denominado “licor
negro” o líquido resultante de la cocción. Separado este licor es enviado a recuperación,
recomenzando su ciclo en la cocción.

Depurado: la pasta lavada es depurada, filtrada y espesada a través de diferentes cribas, refinán-
dose aquellos trozos que no estén lo suficientemente desmenuzados. Aquí, según el resultado ob-
tenido y/o deseado, se divide el proceso para obtener la “pasta cruda” o “pasta blanqueada”.

Prensa pasta: el material resultante de la refinación es tratado para su desecado con filtros
al vacío o en mesas especiales con secado por aire, conformando la denominada “pasta
celulósica cruda”. Con esta pasta se obtienen papeles resistentes, afiche, embalaje, etc.

Blanqueado: Si lo que se desea es “pasta celulósica blanqueada”, después del depurado se


somete la pasta obtenida a un proceso de blanqueo. Con esta pasta se obtienen papeles
para escribir, imprimir y para envases especiales.

tomo 1 investigación científica del delito ) 273


educación a distancia (instituto universitario de la P.F.A.)

Obsérvese en la figura siguiente, el esquema secuencial de los diferentes pasos


que deben seguirse para la obtención de pasta química.

Las pastas así obtenidas son sometidas a lavado, decolorado, secado y prensado en
láminas, para ser trasladadas al molino para la fabricación del papel. Allí se las introduce con
agua en una máquina llamada hidrodesfibradora o hidropulpar obteniéndose una suspensión
acuosa homogénea.

Según la calidad de papel que se desee obtener, se procede a su refinado para hacerla
más flexible, siendo durante este proceso donde pueden agregarse distintas sustancias para
mejorar la calidad y modificar el aspecto del papel. De este proceso dependerá su lisura,
color, resistencia, etc.

La pasta así mejorada pasa a una máquina continua donde fluye en un altísimo por-
centaje de agua (entre un 60 y un 90 por ciento), siendo posteriormente depositada en una
tela metálica sinfín de reticulado muy fino que permite el drenaje por succión, convirtiendo
a la pasta en una membrana húmeda.

274 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

Esa membrana es prensada por distintos tipos de rodillos -algunos de ellos calentados
al vapor- que la aplastan y reducen su humedad a un cinco por ciento, para luego ser sometida
a otros rodillos secadores más pesados que la aplanan, alisan y la convierten en hojas de papel
que, luego de su secado final, es enrollado en bobinas.

Durante su recorrido por esta máquina continua y cuando el papel aún está mojado, se
pueden incorporar distintas medidas de seguridad -que veremos a continuación- o se lo puede
someter a diferentes procesos: para darle rugosidad –por raspado de cuchilla luego de pasar
por los rodillos, obteniéndose así el papel tisú; o al relleno de las pequeñas irregularidades que
puedan presentar por los variados tamaños de las fibras de la madera, mediante el agregado de
una mezcla de materiales arcillosos, adhesivos, colorantes, etc., que producen el revestimiento
del papel de imprenta fino destinado a la escritura; o por medio de un rodillo de acero pulido
calentado al vapor proceder a su abrillantado o satinado; etc.

Dentro de los distintos tipos de calidades físicas que pueden determinarse sobre el
papel se mencionarán entre muchas, las siguientes: a) Gramaje; b) Resistencia a la tracción;
c) Opacidad o transparencia; d) Espesor; e) Permeabilidad; f) pH; g) Lisura h) Fluores-
cencia; i) Resistencia al doble plegado; y j) Compresibilidad.
Gramaje: esta cualidad se expresa en gramos sobre metro cuadrado y es usado en toda operación
comercial.

Resistencia a la tracción: se mide en los metros de papel necesarios para que por el esfuerzo
de la tracción o estiramiento, se produzca la rotura por efecto de su propio peso.

Opacidad o transparencia: esta cualidad refiere al resultado de la medición fotométrica de la


cantidad de luz que pasa a través de las fibras del papel.

Espesor: por ser el papel un cuerpo sólido, se determina su grosor, anchura, corpulencia o
carácter macizo por valores comparativos en toda su extensión.

Permeabilidad: es la capacidad de ser penetrado por un medio líquido como ser las diferentes
calidades de tinta.

pH: es la abreviatura de “potencial Hidrógeno” e indica el coeficiente que caracteriza el grado de acidez
de un medio. Su número indica el logaritmo inverso de la concentración de iones H. Si este número
es 7 su valor es neutro, de éste hacia abajo será ácido y de éste para arriba será alcalino o base. El
control del pH en el papel permite su sensibilizado al ataque de sustancias químicas.

Lisura: es la calidad de acabado superficial del papel, acorde a los diferentes procesos de impresión
a los que estén destinados.

Fluorescencia: es la respuesta luminosa que presentan algunos cuerpos o sustancias cuando


reciben la acción de ciertas longitudes de ondas lumínicas. El uso de radiaciones ultravioletas

tomo 1 investigación científica del delito ) 275


educación a distancia (instituto universitario de la P.F.A.)

permite diferenciar composiciones blanqueadas o no blanqueadas y la presencia de otros


elementos que posean esta propiedad.

Resistencia al doble plegado: es el número de veces que puede ser doblado un papel, antes de
su rotura por causa de esos dobleces.

Compresibilidad: es la disminución del espesor que se produce sobre el papel cuando sobre
él se ejerce una fuerza perpendicular a su superficie.

Dentro de las medidas de seguridad que pueden incorporarse al papel en el


momento de su fabricación se describirán las siguientes: a) Filigrana o marca de agua;
b) Fibras de seguridad; c) Confetis o letenjuelas de seguridad; d) Hilos o bandas de se-
guridad; e) Fluorescencia; y f) Sensibilizado.

Filigrana o marca de Agua: se realiza durante el proceso de fabricación del papel mientras
se encuentra en la máquina continua y antes de su secado. La presión ejercida por las matri-
ces de las máquinas fourdinier o las de bombo, producen distintos grados de debilitamientos
por agrupación o separación de fibras, originando claroscuros que facilitan o dificultan el
paso de la luz y, por contraste, determinan figuras, letras, logos, dibujos, etc.

El uso de una u otra de las máquinas detalladas permite su confección en forma


localizada –es decir en un sector predeterminado del papel- o bien repartida –dispuesta
en toda su superficie-. La ausencia o el reconocimiento del tipo de filigrana produce cuatro
tipos genéricos de papel, a saber: a) papel común; b) papel con certificación de origen;
c) papel de emisión controlada; y d) papel de emisión registrada.

a) Papel común: este tipo de papel no posee filigrana y acorde a la fuente de materia
prima utilizada y a las sustancias y pasos de rodillos utilizados durante el proceso
de fabricación determinan diferentes calidades, pudiéndose citar entre ellas: el de
envolver en todas sus variantes; el de escrituras comunes tanto manuscritas como
mecánicas; los higiénicos; los de uso escolar tipo calcar, glacé, cartulinas; etc.

b) Papel con certificación de origen: posee filigranas que identifican al fabricante del papel y
según su destino pueden ser de variadas calidades, no existiendo ningún tipo de regulación
para su adquisición y/o utilización.

c) Papel de emisión controlada: posee filigranas que identifican al impresor, siendo éste respon-
sable de la utilización del mismo y puede destinarse a diferentes productos o emisiones.

d) Papel de emisión registrada: posee filigranas especiales, exclusivas y registradas del emisor
y es suya la responsabilidad de fabricación y emisión, ya que dicho papel esta destinado
exclusivamente para sus productos.

276 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

Este tipo de papel posee regulaciones para su adquisición tanto en la faz legal como para
su comercialización. Su importación está regulada por la Ley 19.174 que establece en su artículo
1º°que toda operación debe contar con la autorización previa de la Casa de la Moneda.

Las filigranas se imitan por estampado con sustancias oleosas o por impresión en una
capa central de papel delgado, sobre la que se adhieren por arriba y abajo otras dos capas de
papel. Se distinguen de las auténticas por observarse más de un lado que del otro –lado del
estampe- o por su falta de calidad y nitidez.

Fibras de seguridad: son hilos de material sintético -generalmente nylon- y de un tamaño


aproximado de 5 milímetros de largo. Pueden tener diferentes colores y ser visibles a
simple vista o invisibles, es decir que sólo será posible visualizarlos al exponerlos a una
radiación ultravioleta.

Se adicionan a la pasta en el momento de su fabricación y su distribución puede ser


localizada u homogénea en toda su superficie. Se los imita mediante la impresión de líneas
de colores visibles o invisibles a simple vista o por pegado de fibras con sustancias adhesivas
sobre el papel. Se distinguen de las auténticas porque las primeras están dentro de la masa del
papel y las falsas o están impresas o están adheridas sobre el papel.

Confetis o lentejuelas de seguridad: son pequeños círculos de papel de aproximadamente


un milímetro de diámetro, pueden ser de diversos colores, visibles, invisibles y estar dis-
tribuidos en forma localizada u homogénea.

Hilos o bandas de seguridad: pueden ser de diferentes materiales –metálicos, plásticos,


sintéticos, papel, etc.-, de diversos colores, fluorescentes, sin o con microimpesiones
entre dos capas de material celulósico, con señales morse, con leyendas, total o entre-
cruzadamente incorporados a la masa del papel, etc.

Estas dos últimas medidas de seguridad se imitan y se distinguen de manera semejante


a las detalladas para las fibras de seguridad.

Fluorescencia: esta capacidad lumínica es de carácter neutro en los papeles de seguri-


dad para no producir enmascaramientos, permitiendo la visualización de tintas u otros
elementos fluorescentes impresos o incorporados al papel.

Sensibilizado: Mediante el control y manejo del potencial Hidrógeno (pH) se sensibiliza el


papel para que reaccione en forma notoria a través de manchas, cuando éste es atacado
con reactivos especiales. Estos reactivos son normalmente utilizados para la erradicación
fraudulenta de constancias escritas en los documentos y la maniobra queda delatada por
las manchas que ocasiona la acción de esas sustancias ante el sensibilizado del papel.

tomo 1 investigación científica del delito ) 277


educación a distancia (instituto universitario de la P.F.A.)

Detalladas las principales medidas de seguridad que se incorporan al papel en el mo-


mento de su fabricación, se hace necesario ahora detallar las principales tintas de seguridad
o no utilizadas en este tipo de documentación. Entre ellas señalaremos: a) tintas fugitivas;
b) tintas de variación cromáticas; c) tintas electrostáticas; d) tintas magnéticas; e) tintas
invisibles o simpáticas; f) tintas termosensibles; g) tintas antifotográficas o antiréflex; h)
tintas fotocromáticas e i) tintas reactivas al agua.

Tintas fugitivas: son tintas sensibilizadas al agua, alcohol y a otros reactivos químicos y
procesos físicos, de manera tal que al entrar en contacto con ellos desaparecen, sufren
deformaciones, manchas o ligeras fluorescencias. Se utilizan normalmente en fondos de
seguridad y es una importante medida contra las adulteraciones de los documentos, ya que
al intentar eliminar alguna constancia por cualquier medio, se destruyen o desaparecen las
impresiones realizadas con ellas poniendo en evidencia la maniobra.

Tintas de variación cromática u O.V.I.: son tintas que poseen microcomponentes químicos
que cambian de color según el ángulo de incidencia de la luz –de allí su denominación o.v.i.
resultante de las iniciales de “optical variation ink” o “tintas de variación ópticas”. Para su
determinación se debe inclinar suavemente los sectores impresos con este tipo de tintas.
Constituyen una excelente medida contra la falsificación, ya que no pueden ser copiadas
por escáner o fotocopiado.

Tintas electrostáticas: son tintas que poseen cargas u iones eléctricos –como ser el tóner- y
ya fueron detalladas cuando se describieron las fotocopiadoras. Se utilizan en un documento
para la incorporación de los datos variables, como ser: los de filiación, reproducción de foto-
grafías, de impresiones digitales y numeraciones o datos en general que lo particularizan. Si
bien son tintas de fácil erradicación por borrado o raspado, su uso se ha generalizado por
las bondades que brinda su sistema de aplicación a través de impresoras láser.

Tintas magnéticas: son tintas que poseen en suspensión material magnetizable –partículas
o limaduras de hierro- que son detectadas por lectores automáticos que reaccionan en su
presencia. Se utilizan, por ejemplo, para la confección del código magnético al pie de los
cheques. Son tintas que brindan protección contra las falsificaciones y las adulteraciones.

Tintas invisibles o simpáticas: son tintas que no pueden visualizarse a simple vista y que
requieren para su lectura un agente revelador. Ejemplos de estos agentes son la luz ul-
travioleta, los rayos infrarrojos y los X, vapores de yodo, calor, etc. Con ellas se efectúan
escrituras o cubiertas de sectores predeterminados o textos de los documentos. Estas
tintas también dificultan las falsificaciones y las adulteraciones.

Tintas termosensibles: son tintas que tienen la propiedad de virar de color o desapa-
recer, cuando son sometidas a temperaturas variables como por ejemplo el calor de la

278 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

piel humana. Desaparecido el estímulo vuelven a recuperar su color o estado. Son tintas
que protegen contra la falsificación al favorecer el reconocimiento de los documentos
que las utilizan.

Tintas antifotográficas o antireflex: son tintas que dificultan su captación por medios fotográ-
ficos, lo que convierte su utilización en un medio importante contra las falsificaciones, al no
poder lograrse la base negativa para la obtención de una plancha de impresión.

Tintas fotocromáticas: son tintas que poseen un componente que reacciona frente a una
fuente lumínica ultravioleta o similar, cambiando de color por excitación fotocromática.
Quitado el estímulo, recupera gradual y espontáneamente su color original.

Tintas reactivas al agua: son tintas de impresión de color negro que al entrar en con-
tacto con el agua, cambian su tonalidad al azul, rojo o amarillo. Son tintas que brindan
una adecuada protección contra las adulteraciones.

Existen en la actualidad, una variada gama de métodos gráficos posibles que se


encuentran a disposición relativamente fácil de los falsarios, logrando así sorprender a
los desprevenidos con los efectos visuales de autenticidad que producen. Por ello es que
ahora resulta extremadamente importante conocer los principales sistemas de impre-
sión utilizados en la confección de documentos de seguridad, para adquirir las bases de
compresión y reconocimiento de los mismos. Entre ellos se mencionarán por sus par-
ticulares características, los siguientes: a) sistema offset o plano; b) sistema tipográfico;
c) sistema calcográfico; y d) sistema computacional.

Sistema Offset o plano: su nombre deriva del término inglés “offsetting” con el que se
designa el transporte o medio que transfiere la imagen de la plancha al papel dando la
idea de calco y reporte y el sistema en sí deriva de un procedimiento anterior denominado
“Litografía”, del griego “litos” igual a piedra.

La litografía fue incorporada en 1798 por Aloys Senefelder quién determinó que la pie-
dra caliza tratada con procesos físicos y químicos formaba dos tipos de zonas, una hidrófoba
–que rechaza el agua y acepta la tinta- y otra hidrófuga –que acepta el agua y rechaza la tinta,
circunstancia ésta que la hacía útil como placa impresora.

El procedimiento que empleaba era el de estampar sobre esa piedra debidamente


tratada, la imagen a reproducir por medio de un material graso hidrófobo. Luego humedecía
toda la superficie con agua -la que era rechazada en todos los sectores donde se encontraba
la imagen- y posteriormente aplicaba las tintas –que no eran absorbidas en las zonas húme-
das-, obteniendo una imagen entintada que luego por presión, era transferida al papel.

tomo 1 investigación científica del delito ) 279


educación a distancia (instituto universitario de la P.F.A.)

En el sistema offset se reemplaza la piedra caliza por planchas o delgadas hojas de


cinc, aluminio o bimetálicas presensibilizadas, sobre las que se estampa en forma invertida o
en espejo la imagen a reproducir por medio de una placa obtenida por reproducción fotográfica
del original y la acción de procesos químicos, las que luego se ajustan a la máquina impresora
alrededor de un cilindro portaplancha.

En este sistema la impresión es indirecta ya que la plancha no entra en contacto con el


papel, sino que la imagen entintada se traslada a una mantilla o rodillo de caucho que la calca
y la transfiere luego al soporte preseleccionado. Como consecuencia las áreas impresas y las
no impresas se hallan en un mismo plano y de allí su otra denominación.

Si bien existen diversas calidades de impresión, este es el sistema que se utiliza en


forma única en la mayoría de los impresos sobre cualquier tipo de soporte que lo admita. Hoy
resulta muy económico y fácil de utilizar, por lo que se encuentra al alcance de todos los que
lo requieran, incluso los falsificadores.

Brinda especialmente ventajas en impresiones donde haya combinación de textos e


imágenes en uno o varios colores. Las planchas son durables y fáciles de almacenar lo que
ofrece economía en trabajos que se deban repetir.

Sistema tipográfico: de este sistema se ha hecho referencia en la unidad anterior, por lo


que sólo se reiterará que, debido a la presión que ejercen los tipos sobre el soporte, se de-
terminan sobre él bajorrelieves, depresiones o indentaciones que lo hacen reconocible.

Este sistema resulta particularmente apto en operaciones de numeración, donde


no haya combinaciones de colores o ilustraciones que requieran de una alta calidad.

Sistema calcográfico: en sus orígenes este sistema de huecograbado utilizaba planchas de


cobre grabadas -lo que dio origen a su nombre: “chalcós” del griego cobre. Actualmente el
grabado se efectúa a buril sobre una planchuela de acero que luego es atacada por ácidos,
circunstancia que permite obtener diferentes profundidades de grabado. Luego de obtenida
la plancha grabada, por diversos procesos galvánicos se obtiene la matriz.

Aunque el proceso es un poco más complejo que lo narrado, basta comprender que la
matriz es el negativo de la imagen a imprimir y está conformada por surcos de profundidades
variables donde se deposita la tinta, la que luego es transferida por presión al papel quedando
depositada sobre él y provocando sobrerrelieves sensibles al tacto.

280 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

Su principal desventaja es el costo por la tecnología y mano de obra requerida, por lo


que su uso se justifica en casos de largos tirajes o en impresos de alta calidad y seguridad.

Sistema computacional: Sobre la forma de producción de las impresiones con este sistema
ya se ha hecho referencia en la unidad anterior y al hablar sobre tintas electrostáticas. Se
utiliza este sistema para imprimir en los cheques todos los datos variables es decir los
siguientes: nombre y dirección de la sucursal bancaria; número de cheque; códigos de
ruta; número, nombre, dirección y datos de registro impositivo de los titulares y el código
magnético caracteres siete bastones –C.M.C.7-.

Enumerados los principales tipos de papeles, tintas y sistemas de impresión utilizados


en la confección de documentos de seguridad, se hace necesario ahora detallar las medidas
de seguridad de impresión que pueden realizarse en los mismos. De ellas mencionar-
emos: a) fondos de seguridad; b) microletras o microcalcos; c) imagen latente; d) registro
perfecto o impresión simultán; e) impresiones invisibles; f) impresiones citocromáticas; g)
holografías; h) plaquetas de seguridad; i) film de seguridad; j) botones de seguridad; k)
grabado en seco; l) perforaciones; m) códigos de barra; n) ornamentaciones; ñ) patrones
geométricos; o) laminados; p) imagen retrorreflexiva; q) indicia confusa; r) encuadernación
o costura; s) caracteres magnéticos; y t) banda iridiscente.

Fondos de seguridad: es la impresión de un diseño elegido por estética gráfica que a


modo de subtinte se realiza sobre el papel destinado a ser un documento de seguridad.
El motivo y los colores seleccionados permiten además identificar al documento –ejemplo
Cédula de Identificación del Automotor que por color del fondo de seguridad o impresión
es conocida vulgarmente como la Cédula Verde del Automotor.

Esta impresión se realiza con tintas fugitivas en aquellos documentos susceptibles


de ser adulterados, los que ante cualquier maniobra de erradicación de constancias hacen
que estas desaparezcan o degraden. La complejidad, dibujos y o colores utilizados en este
tipo de impresiones y las tintas utilizadas para ello, lo convierte en una muy buena medida
de seguridad contra las falsificaciones y las adulteraciones.

Microletras o microcalcos: son letras sumamente pequeñas que no pueden ser visualizadas
a simple vista –debiéndose recurrir para ello a un instrumental óptico adecuado como ser
una lupa. Con este tipo de letra se reproduce sin solución de continuidad una leyenda o el
nombre de una entidad o institución, como por ejemplo “policíafederalargentinapolicíafed-
eralargentinapolic”. Como no es posible descifrarlas a simple vista aparentan ser una fina
línea impresa a modo de renglón que, en lugares seleccionados estratégicamente -como ser
donde se detalla el importe en número y letras y el destinatario en un cheque- actúan como
medida de seguridad contra las falsificaciones y las adulteraciones.

tomo 1 investigación científica del delito ) 281


educación a distancia (instituto universitario de la P.F.A.)

Su implementación requiere de una adecuada capacidad y tecnología –lo que dificulta


su reproducción- no siendo posible su fotocopiado, escaneado o reinsertado, sufriendo de-
terioros imposibles de reparar en caso de ser borradas al tratar de eliminar constancias para
sustituirlas por otras.

Si el sistema utilizado para su impresión es offset, se denominarán microletras, si el


sistema utilizado es el calcográfico se las denomina microcalco, pero una u otra denominación
indica la misma medida de seguridad.

Imagen latente: son imágenes impresas que para su visualización requieren ser reveladas.
Están conformadas por líneas horizontales y verticales que conforman unas, las letras, figuras,
logotipos, etc, que se desee realizar y las otras el marco o caja contenedora. Se revelan acorde
al ángulo de incidencia de la luz que, al chocar contra las líneas dispuestas en una forma las de-
stacan y permiten verlas y por oposición se revelan las líneas dispuestas de la otra manera.

Se realizan con sistema calcográfico no pudiéndose ser imitada con sistemas planos
ni por fotocopiado, por lo que constituyen una buena medida contra las falsificaciones.

Registro perfecto o impresión simultán: son dos imágenes complementarias que se realizan en
forma simultánea en el anverso y el reverso del documento –de allí una de sus denominaciones-
que se corresponden perfectamente al ser observadas por transparencia. Su implementación
requiere de máquinas especiales. Los falsarios imprimen por separado una y otra cara del
documento, no lográndose así perfecta complementación o alineo de imágenes por lo que
se pone en evidencia la maniobra. Es una excelente medida contra las falsificaciones.

Impresiones invisibles: son impresiones realizadas con sistema offset y tintas simpáticas que
no pueden ser visualizadas a simple vista. Para su revelado requieren longitudes de ondas
determinadas– normalmente ultravioletas- o calor. Pueden reproducir imágenes, leyendas,
dibujos, logotipos, etc. Es una medida contra las falsificaciones al constituir un método de
reconocimiento de un documento.

Impresiones citocromáticas: son impresiones realizadas en un solo proceso y con diversos colores
que no presentan una definida separación ya que fueron fusionados gradualmente unos con otros.
Su confección requiere de tecnología adecuada siendo una medida contra la falsificación.

Holografías: son imágenes tridimensionales que brindan espectacular colorido y profundi-


dad, produciendo, acorde al ángulo de incidencia de la luz, sensaciones de movimientos
o cambios de color. Conforme a su destino, se las efectúa con estampado en color con
sistema de registro láser o con autoadhesivos. Para lograr su impresión se divide un rayo de
luz láser en dos haces. El primero se refleja sobre el objeto en una toma fotográfica espe-
cial. Esa placa es luego iluminada directamente por la otra luz láser. Ambas luces brillantes
interactúan reflejadas y direccionadas sobre una superficie plana formando el holograma.

282 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

Debe distinguirse esta medida de otra denominada “símil holograma”, que es una
novedosa creación de efectos especiales o pigmentados con la cual se reproducen textos,
logotipos o rosetas de autenticidad en color plata o transparente. Ambas son irreproducibles
por fotocopiado color o por escáner, lo que las convierten en buenas medidas de seguridad
contra las falsificaciones.

Plaquetas de seguridad: es una impresión con tintas invisibles de color rojo que se obser-
van bajo la acción de luz ultravioleta que protegen los datos variables y con otros colores
todas aquellas zonas susceptibles de ser adulteradas. En caso de efectuarse una manio-
bra de borrado o por cualquier tipo de abrasión sobre esos datos o zona, esta cobertura
también se erradica poniendo en evidencia la maniobra al provocar manchas.

Film de seguridad: son filmes o finas películas transparentes de aplicación térmica sobre
los datos que se pretende resguardar contra las adulteraciones, cumpliendo similar pro-
tección que las plaquetas ya descriptas. Un procedimiento casero es el empleo de cintas
transparentes autoadhesivas. Una vez adheridos sobre el papel no es posible despegarlas
ni su repegado sin que la maniobra sea fácilmente detectable.

Este film puede contener, además, imágenes impresas o imágenes retroflexivas con
microesferas que permiten ser visualizadas según los ángulos de incidencia de la luz.

Botones de seguridad: son accesorios metálicos que pueden contener o no marcas,


logotipos, siglas o leyendas estampadas sobre ellos y tienen como función asegurar
elementos agregados a un documento como por ejemplo, una fotografía. Estos botones
una vez hermanados no se pueden volver a abrir y su extracción implica la rotura del
soporte donde se encuentran adheridos.

Grabado en seco: son impresiones a modo de estampado sin tinta que pueden reproducir
leyendas, iniciales, escudos, etc. Producen desnivelado del papel por compresión de
fibras y es una medida contra la falsificación.

Perforaciones: se realiza a través del empleo de punzones o agujas que en un solo paso,
perforan el soporte del documento reproduciendo números, leyendas, etc. Es una me-
dida de fácil aplicación y económica. Su principal contra es que si las perforaciones son
grandes suelen romper el soporte y si son muy pequeñas pueden adulterarse por pegado
y posterior perforación.

Códigos de barra: son códigos que utilizan combinación de líneas verticales, con varia-
ciones de grosor, altura, espaciado, colores, etc. y que además se complementan con
dígitos, letras o signos. Actualmente se le incorporan distintos tipos de tintas, códigos
morse, rastreadores, etc. Las impresoras utilizadas para su realización al dividir cada barra
en píxeles, le asigna a este código una casi infinita posibilidad de combinaciones.

tomo 1 investigación científica del delito ) 283


educación a distancia (instituto universitario de la P.F.A.)

La lectura de sus datos puede efectuarse por lectores lumínicos de contacto o aproxi-
mación –lectores en supermercados- o a distancia –telepeajes. Su utilización es sencilla y
económica y permite un importante número de usos.

Ornamentaciones: son también denominados guilloches y son imágenes decorativas


compuestas por un conjunto de líneas finas curvas, próximas y entrelazadas que detallan
o definen los dibujos reproducidos. Es una importante medida de seguridad contra las
falsificaciones ya que el sistema de impresión requerido es de alta calidad y los falsarios
al utilizar el offset empastan, unen o pierden estas finas líneas, obteniendo impresiones
de baja calidad.

Patrones geométricos: se utilizan normalmente como figuras del fondo de seguridad ya


tratado y se trata de una serie de formas recurrentes de neto corte geométrico. Acorde a
su calidad de impresión representa una medida de seguridad contra las falsificaciones.

Laminados: son coberturas de un material sintético y transparente conformado en forma


de láminas u hojas que se adhieren –normalmente con adhesivos o por termofusión - que
protegen las hojas, firmas o datos de un documento contra las adulteraciones. También
pueden tener imágenes o impresiones retroflexivas.

Imagen retrorreflexiva: son imágenes invisibles incorporadas en algunos tipos de soportes


y requieren para su visualización el uso de visores retrorreflexios. Es una importante me-
dida contra la falsificación.

Indicia confusa: son imágenes visibles que, como su nombre lo indica, fueron realizadas
con impresión confusa y que para poder ser visualizadas requieren de un visor especial
que altere la trayectoria o paso de la luz. Debe usarse tecnología especial para su incor-
poración en un documento, siendo una medida contra la falsificación.

Encuadernación o costura: la realización de la encuadernación o armado a través de cos-


tura de un documento compuesto por varias fojas, constituye un elemento de seguridad
ya que disminuye los riesgos de desarmado, sustitución y rearmado. Para esta tarea se
utilizan hilos de costura especiales que reaccionan a la luz ultravioleta y que no deben
dejarse muy flojos. Su reconocimiento a simple vista o bajo la luz ultravioleta los convierten
en una medida de seguridad contra las falsificaciones y las adulteraciones.

Caracteres magnéticos: estos pueden hacerse por impacto o por sistema láser y con
tintas magnéticas. Se utilizan entre otros documentos, en los cheques para el código
denominado Caracteres Magnéticos Codificado 7 bastones -C.M.C.7-, compuesto por
siete líneas verticales o bastones separadas entre sí por seis intervalos “cortos y largos”,
es decir más juntos o más distantes, diseñados de manera tal que el conjunto configura
la forma de un carácter convencional.

284 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

La combinación de los intervalos largos y cortos permiten la determinación del


código que consta de diez caracteres numéricos y cinco símbolos que resultan de la
combinación de dos intervalos largos y cuatro cortos.

La combinación de uno o tres intervalos largos con cinco o tres intervalos


cortos permiten construir las veintiséis letras del alfabeto. Ver la familia completa en
el cuadro siguiente:

Banda iridiscente: es la impresión de una banda que bajo la acción de una fuerte luminosidad adqui-
ere un brillo característico y cambia ligeramente de color. Es una medida contra la falsificación.

La combinación de estas medidas de seguridad incorporadas al papel, en las tintas,


en la interacción de los distintos sistemas de impresión y las medidas incorporadas al docu-
mento, brindan a éste protección contra las falsificaciones y las adulteraciones. Su elección
y cantidad dependerá del tipo de documento y del costo que se destine a su confección.

El conocimiento de las mismas y su reconocimiento cuando se los aplica en los distintos


documentos de seguridad que se deban manejar acorde a los diferentes ejercicios profesio-
nales, es la única manera infalible de no ser perjudicado por el accionar de una delincuencia
cada vez más organizada y con más medios tecnológicos a su disposición. Recordar que
no existe, pese a las propagandas comerciales, ningún producto en el mercado que pueda
detectar falsificaciones o adulteraciones documentales. El mejor detector es el ojo humano
al reconocer las medidas utilizadas.

tomo 1 investigación científica del delito ) 285


educación a distancia (instituto universitario de la P.F.A.)

En el ejercicio profesional de un escribano, por ejemplo, no sólo debe dar fe del acto
realizado, sino también de las personas que forman parte del mismo en la fórmula “persona de
mi conocimiento doy fe”. La globalización hace imposible conocer a todas las personas con las
que debe intervenir, por lo que debe conocerlas a través de su documento de identidad.

La única posibilidad cierta de estar frente a un documento auténtico es cuando se


tiene una pericia comparativa y el informe del organismo que lo expidió, ya que de esa
manera se asegura tanto la autenticidad material como la ideológica. Como es lógico
deducir no resultaría práctico, rápido, fácil, ni económico cumplir estos requisitos en cada
actuación. Por ello se hace necesario el conocer y reconocer estas medidas de seguridad y
determinarlas en los documentos presentados. El reconocimiento de varias de ellas brinda
la suficiente seguridad como para un tranquilizador ejercicio profesional.

Se detallará a continuación la aplicación de estas medidas de seguridad en los


siguientes documentos:
a) pasaporte argentino;

b) chapa patente de identificación del automotor y

c) tarjetas de crédito.

PASAPORTE ARGENTINO

Para la confección de este tipo de documento, cada país impone y adopta sus
propias normas en lo relativo al formato, diseño y modo de incorporación de los datos de
su titular. En nuestro país la tarea de Identificación, Registro y Clasificación del Potencial
Humano, fue asignada al Registro Nacional de las Personas por las Leyes 17.671 y 20.974,
que disponen además que es el organismo encargado de la expedición de documentos,
certificados e informes. Sin embargo las funciones de emisión de documentos de viajes
(pasaportes) y cédulas de identidad fueron atribuidas a la Policía Federal Argentina a través
del Decreto 2015 del año 1966.

Acorde a las variables exigencias globales, necesidades y nuevas tecnologías, los


formatos y contenidos de los pasaportes fueron cambiando y modernizándose en todos
los países, incorporándose por decisión de la Organización Internacional de Aviación Civil
(O.A.C.I.) en muchos de ellos un sistema de lectura mecánica de datos, lo que permite en
forma inmediata cotejarlos con los bancos de información.

286 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

Las avanzadas metodologías de falsificación y adulteración que brindan los es-


peciales aprovechamientos dolosos de altas tecnologías, derivaron en la necesidad de
reestructurar estos documentos. La información aportada por la O.A.C.I., por empresas
líderes en el plano nacional e internacional dedicadas a la producción de documentos de
seguridad, las reuniones y congresos llevados a cabo por Interpol y los conocimientos y
experiencias criminalísticas dieron origen al nuevo pasaporte argentino, que presenta la
incorporación de las siguientes medidas de seguridad:
Papel: de seguridad de emisión controlada, de alta resistencia y fluorescencia neutra.

Hilo o banda de seguridad: dispuesta en forma vertical conteniendo en su interior en


microimpresión el texto “República Argentina Pasaporte”.

Fibrillas de seguridad: fluorescentes con la aplicación de luz ultravioleta en colores amarillo


y azul.

Filigrana: multitonal centralizada en cada una de sus fojas que ofrece con excelente
definición la visión por transparencia del Escudo de la Policía Federal Argentina.

Ver en ilustración siguiente un ejemplo de la filigrana utilizada en el documento


que se está describiendo:

Fondo de seguridad: todas las hojas poseen fondos de seguridad realizados con tintas
fugitivas que brindan protección contra las adulteraciones.

Fondo Irisado: las impresiones del fondo de seguridad contienen delgadas líneas que confor-
man las palabras “REPUBLICA ARGENTINA” separadas entre sí por dos soles situados a los
laterales de una formación geométrica. El color azul de los laterales varía progresivamente
hacia el centro donde predomina el color rosa. Es una medida contra las falsificaciones y
las adulteraciones. En la figura siguiente se pueden observar estas dos últimas medidas.

tomo 1 investigación científica del delito ) 287


educación a distancia (instituto universitario de la P.F.A.)

Impresión Offset: las caras internas de la tapa y contratapa presentan impresiones pla-
nas bicolor que alternadamente, en forma expansiva y comprimida con efecto ondulado,
reproducen las palabras “REPUBLICA ARGENTINA”

Impresiones Calcográficas: o en relieve, en guilloches u ornamentaciones dispuestas en


espacios no destinados a escrituras.

Microcalco: la línea interior del marco del dibujo de la cara interna de la tapa y la línea
que subraya la palabra MERCOSUR en la foja tres, están conformadas por la repetición
sin solución de continuidad de la leyenda “REPUBLICAARGENTINAREP”

Ver en ilustraciones siguientes ejemplos de esta medida de seguridad.

Imagen Latente: en la franja ancha con soles de la cara interna de la tapa y en las figuras
azules en la parte superior –en el anverso en la primera mitad y en el reverso en la segunda
mitad, se encuentra esta medida que permite visualizar según el ángulo de incidencia de
la luz la palabra “REPUBLICA ARGENTIA” y la sigla “RA” respectivamente. Es una medida
contra las falsificaciones. Ver ejemplos de esta medida.

288 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

Tintas O.V.I.: en las mismas fojas donde se encuentra la imagen latente, en forma central
y por encima del número indicador de página, se ha estampado con tintas de variación
cromática una figura que, acorde el ángulo de incidencia de la luz y de la posición del
observador, cambian de un azul a dorado y de un verde a violeta. Es una excelente me-
dida contra las falsificaciones. Ver la siguiente ilustración.

Registro Perfecto: próximas a estas impresiones O.V.I., a igual nivel pero sobre el extremo
externo de las hojas, se han impreso con sistema offset de alta definición dos impresiones
simultáneas en anverso y reverso que se complementan perfectamente al ser observadas
por transparencia. La figura siguiente muestra las dos imágenes perfectamente comple-
mentadas de esta medida de seguridad contra las falsificaciones.

Diseño Fotocromático: en el lado opuesto de estas impresiones O.V.I. en el mismo nivel y próximas
a la costura, se han estampado figuras con tintas fotocromáticas que con luz blanca se visualizan
en color rosa y con luz ultravioleta en color azul, lo que constituye una excelente medida contra las
falsificaciones. En la siguiente ilustración pueden observarse el diseño con ambas coloraciones.

tomo 1 investigación científica del delito ) 289


educación a distancia (instituto universitario de la P.F.A.)

Impresiones Invisibles: con tintas invisibles que pueden ser visualizadas con luz ultravio-
leta se han estampado con una misma tonalidad fluorescente la leyenda en dos líneas
“REPUBLICA ARGENTINA” en la parte superior de la foja y en su parte inferior el número
correspondiente a la página y la palabra “PASAPORTE” y con otra tonalidad fluorescente
entre ambas leyendas, dos líneas de escudos nacionales.

Hilo de seguridad: la costura de armado del pasaporte fue realizada con hilo de seguridad
que con luz normal se visualiza blanco y con luz ultravioleta en color rojo.

En la siguiente ilustración pueden observarse parciales de estas dos últimas


medidas contra las falsificaciones descriptas.

Impresión Láser: los datos que individualizan al titular, su imagen, impresión digital y firma
son digitalizadas y transferidas al pasaporte por sistema láser.

Codificación de datos: los datos mencionados precedentemente son codificados al pie de


la página lo que permite su lectura inmediata facilitando las tramitaciones migratorias.

Laminado de página 3: esta página que contiene los datos del titular del documento -
incorporados por sistema láser- se encuentra protegida contra las adulteraciones y las
falsificaciones por un laminado de características especiales. Al ser iluminado con una
lámpara retrorreflectiva el film permite visualizar en toda su superficie y dispuestos en forma
lineal, el escudo o emblema de la Policía Federal Argentina y las iniciales “PFA” encerrada
dentro de círculos. Obsérvese en ilustración siguiente la imagen retroreflexiva

290 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

Laminado de página 4: esta página que también contiene datos del titular en blanco y
negro se encuentra protegida por un film con hologramas que representan el emblema
de la Policía Federal Argentina. Si al documento se le realiza un movimiento se podrá
captar el efecto tridimensional del diseño con cambios de color.

Estos laminados son protecciones contra las falsificaciones ya que los mismos
no pueden ser adquiridos por terceros, ni imitados; y lo son contra las adulteraciones
porque no es posible su despegado y repegado. Ver reproducción de la última medida
descripta en la figura siguiente.

Perforado: las fojas del pasaporte presentan con perforado la numeración correspondiente
al documento.

tomo 1 investigación científica del delito ) 291


educación a distancia (instituto universitario de la P.F.A.)

CHAPA PATENTE DE IDENTIFICACIÓN DEL AUTOMOTOR

Dentro de los delitos contra la propiedad un alto índice lo ocupa la indebida apropi-
ación de automotores, la que a su vez da lugar a una multiplicidad de otros ilícitos conexos
como ser, la duplicación de vehículos y la falsificación y adulteración de los documentos que
hacen a su titularidad, circunstancia que se veía favorecida por la indiscriminada producción
de chapas patentes y por la vulnerabilidad de los documentos.

En el nuevo sistema de identificación del parque automotor que hoy rige, se ha con-
siderado no sólo la inclusión de medidas de seguridad en las documentaciones propiamente
dichas sino también en las chapas patentes, lográndose así una mancomunada relación
entre el vehículo y su identificación.

Se han incorporado a las patentes estrictas normas y éstas sólo pueden ser entrega-
das por el Registro Nacional de la Propiedad del Automotor. Estas patentes son reflectivas
con marca de seguridad y poseen los siguientes resguardos:
Composición: son de aluminio aleación 1100, anticorrosivas y poseen especiales
características de temple, resistencia y elongación que las hacen más durables.

Pintura: al thiner color negro mate desarrollada especialmente para las patentes ya
que deben ser compatibles con las láminas reflexivas protectoras que las recubren.

Formato y Características: poseen códigos de seguridad e impresión gráfica con el


Escudo Nacional y la leyenda “ARGENTINA”. El código está conformado por tres
letras y tres dígitos, habiendo comenzado con AAA 000 en los vehículos de primer
patentamiento y con RAA 000 para los repatentados.

Estos seis caracteres indicadores están en el mismo plano superficial de la plancha.


El efecto tridimensional en sentido contrario que en las placas anteriores se logra produci-
endo relieve sólo en el sector que luego será pintado con negro.

En caso de pérdida, robo o destrucción de las placas originales el Registro proveerá


de otras incluyendo una letra más pequeña en el espacio existente entre el indicativo alfa y
el numérico, que simbolizará la inicial de repetición: “D” = duplicado; “T” = triplicado, etc.
En la figura siguiente se puede apreciar el formato de una chapa patente.

292 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

Lámina reflectiva autoadhesiva: Esta lámina cubre el sustrato metálico adhiriéndose


por termoimpresión, es decir con una combinación de calor e impresión que las fija en
forma permanente. Ante cualquier intento de remoción se destruye anulando el elemento
y evitando su reutilización.

Esta lámina está compuesta por elementos ópticos que combinan índices de re-
fracción que pueden visualizarse desde un adecuado ángulo de observación. Teniendo en
cuenta la altura del vehículo y del observador se debe conformar un ángulo de 30 grados
con respecto de la perpendicular y con una iluminación suficiente –diurna o artificial a través
de linternas, faros de vehículos, alumbrado público, etc.- podrá revelarse la “imagen de
identificación positiva direccional” conformada por las siglas “RNPA”” distribuidas en toda
la superficie de la placa, excepto en los espacios con pintura negra.

La técnica de determinación de estas imágenes para comprobar su autenticidad es que las


mismas deben verse y dejar de verse, al cumplir o no –respectivamente- el ángulo de observación.
La no visión desde ese ángulo o la visión en forma permanente son indicadores de falsificación.

La falta de este material reflectivo de seguridad convierte en falsas las patentes


aunque los datos identificadores del vehículo fueran correctos. La comercialización de este
laminado es restrictivo al Registro Nacional de la Propiedad del Automotor, lo que implica
que éste es el único organismo autorizado para el otorgamiento de chapas patentes.

El material reflectivo es, además, un elemento de importancia en la seguridad


vial pues aumenta la visibilidad nocturna al refractar los faros de otros vehículos sobre
la patente, otorgando la facultad de ver y ser visto al mismo tiempo.

Obsérvese en la siguiente figura la forma de visualizar la imagen positiva direccional

tomo 1 investigación científica del delito ) 293


educación a distancia (instituto universitario de la P.F.A.)

TARJETAS DE CRÉDITO

Sus orígenes se remontan a 1914 cuando la Unión Occidental emitió la primera tarjeta de
cargo al consumo para proveerlas a clientes especiales, a quienes les brindaba una serie de ventajas
entre las que figuraba el pago diferido gratuito. En 1950 fue introducida la tarjeta Diners Club donde
los usuarios debían pagar mensualmente a la recepción de la cuenta el total de lo gastado.

El Banco de América en el Estado de California –Estados Unidos de Norte América-


otorga las Bank Americard en 1958 para funcionar como tarjetas de crédito en forma local, ex-
tendiéndose luego su uso en otros Estados al asociarse otros bancos, creándose así las tarjetas
de Pago Maestro. Estas dos tarjetas se transforman luego en Visa y Master respectivamente y
para 1979 más de 1.400 bancos dentro y fuera de los Estados Unidos adoptaban este sistema
como medio de pago.

Podemos definirlas como documentos intransferibles de pago pactado,


donde el Emisor otorga crédito pactado al Titular y a su vez pacta el pago con los
Comerciantes Adheridos.

Los contratos entre las partes son por adhesión, es decir el Emisor impone las reglas
y los solicitantes, empresas y comercios las deben aceptar. Las tarjetas son el medio
de efectivizar dichos contratos -que son celebrados entre el Emisor y el Titular y entre el
Emisor y los Comercios- y los cupones son los documentos que prueban la conformi-
dad de las partes en las operaciones realizadas. Las operaciones se dan por válidas con
la firma del titular o por la lectura de la banda magnética, aunque recientemente se ha
generalizado su uso al dictado de datos.

Dentro de las obligaciones es responsabilidad del titular el pago de todas las


operaciones realizadas con las tarjetas otorgadas, tanto a su nombre como la de todas
las extensiones solicitadas. Con respecto a los titulares de las extensiones sólo son re-
sponsables solidarios por la utilización de su extensión, aunque puede acordarse con la
entidad estas otras dos posibilidades si así se estableciera en los contratos celebrados,
requiriendo obviamente la conformidad y firma de todos: a) solidario por el uso total de
todas las tarjetas, o bien b) no solidario ni aún con la extendida a su nombre.

Se ha estandarizado sus medidas que responden a las siguientes características:


Altura: 53,975 mm; Ancho: 85,725 mm; Grosor: 0,762 mm; Peso: 5 grs; Primera Línea Impresa: 5
mm; Segunda Línea Impresa: 3 o 4 mm; Relieve de Impresión: 0,5 mm y Radio de Curvatura en
Esquinas: 3,175 mm. Son grabadas sólo en el anverso por impresoras Farrington 7 B de pasos
mecánicos de 3,60 mm en la primera línea y de 2,54 mm en la segunda línea.

294 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

El soporte es de baquelita sobrelaminada con opacidad de un 70% y el em-


bozado o datos que contienen son:
a) clave numérica del banco;
b) número de cuenta del cliente;
c) crédito y monto; y
d) nombre del cliente y tiempo de validez de la tarjeta.

La mayor parte de las tarjetas son de origen importado provistas por Data Card y Sill-
cocks y las importa Ciccone S.A. La empresa Nacional que tiene a su cargo la fabricación de
las tarjetas es Multimac S.A. y utiliza para su impresión dos sistemas: offset y serigrafía.

Con offset se realizan los fondos de seguridad tanto en las planchas del anverso como en
las del reverso, las que luego se unifican por medio de una película transparente. Algunas presen-
tan hologramas distintivos y diferentes colores. La firma del titular se realiza en el reverso de
la tarjeta sobre un papel de características especiales de inviolabilidad denominado “safetig”
que se destruye o cambia de color al ser sometido a maniobras de borrado, raspado o lavados
adulterativos.

Poseen además banda magnética con información codificada electrónicamente que


posee tres pistas o tracks que son bloques de información impresos magnéticamente por
algoritmos que requieren un lector específico y compatible. El primer track posee caracteres
alfanuméricos con el nombre del titular y datos de la cuenta. El segundo sólo caracteres nu-
méricos con información sobre la cuenta –datos, validez, etc. El tercero encripta información
algorítmica que se utiliza en los cajeros automáticos –ATM- que le permite comunicación con
la cuenta y que en caso de no estar en línea, graba los movimientos realizados.

A modo de ejemplo se detallan las principales características de una tarjeta Visa:


1) Número de la tarjeta: Comienza con un grupo de cuatro dígitos siendo el primero siempre
un “4” y se continúa con tres grupos de cuatro dígitos más (16 en total) o de tres dígitos
más (13 en total). Se debe verificar la no existencia de maniobras de planchado o enmen-
dado de números.

2) Número de Identificación del Banco Emisor: posee cuatro números y se lo denomina BIN –Bank
Identification Number-, debe ser idéntico que los primeros cuatro números de la tarjeta y se
encuentra impreso por encima o debajo de éstos. Se debe comprobar esta coincidencia.

3) Holograma: representa una paloma que por su efecto tridimensional cambia de color y
posee movimiento. Se debe verificar ese efecto y ese dibujo.

tomo 1 investigación científica del delito ) 295


educación a distancia (instituto universitario de la P.F.A.)

4) Vigencia: pueden presentar fecha de iniciación o no, pero siempre se debe verificar que
se encuentre dentro del período de validez.

5) Símbolo de seguridad: todas las tarjetas Visa llevan grabadas en relieve una “v”. Veri-
fique que sea de igual diseño.

6) Panel de firma: posee impresa la palabra “VISA” en toda su superficie realizadas en


color azul y oro. Se debe verificar que posea estas características, sin raspaduras, que
no aparezcan las palabras “VOID” o “ANULADO” y que posea la firma estampada.

7) Código de Seguridad: está impreso sobre el papel de la firma y esta constituido por tres
dígitos con caracteres inclinados hacia la izquierda. Obsérvese en la siguiente figura el
detalle de las características señaladas.

Actualmente se están implementando otros tipos de tarjetas:


a) con códigos de barra;
b) con bandas magnéticas;
c) con microchips o inteligentes; y
d) biométricas.

Con códigos de barra: son meros instrumentos de control que sirven para identificar y/o
transferir artículos. Son de bajo costo, desechables, precisas, recopilan información y evitan
errores, se pueden recomponer, hay variadas técnicas de marcado y lectura que puede ser
por contacto o no contacto y se aplican por impresión láser. Sus barras pueden ser lineales,
gruesas, finas, con números, de barras acumuladas, con colores, manejada por pixeles, etc.,
lo que brinda una amplia gama de usos y una casi infinita capacidad de combinaciones.

Con bandas magnéticas: de utilización con fines financieros, de crédito, familiares, de


identificación personal, tributaria, membresías, de aperturas de puertas o contraseñas de
empleados, etc. Requieren grabación digital o encording en bandas magnéticas con codifi-
cador y lectores binarios que pueden estar encriptados o no. Son más confiables que las de
barras, codifican información y poseen gran capacidad de almacenaje de datos, son fáciles
de hacer y los equipos necesarios son hoy accesibles.

296 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

Con microchips o inteligentes: comienzaron en 1970 en Japón creadas por Kunitake Arimura
y presentaban un circuito integrado. Evolucionan en los 80´ denominándoselas tarjetas inteli-
gentes –Inteligent Card, Smart Card o Chip Card. Las hay con memoria no borrable o fija o
borrables y actualizables. Poseen igual formato que las de crédito, contactos metálicos con
capa de oro, cuyas posiciones están regulados por normas ISO 150 y poseen circuito inte-
grado solidario con los contactos. Incluyen claves de acceso, algoritmos cifrados, claves de
autentificación de algoritmos y ejecutan protocolos, es decir evitan lecturas no autorizadas.

Biométricas: son de alto costo y complejidad por lo que se utilizan en alta seguridad. Pu-
eden ser extensibles a usos bancarios, de salud, laborales, archivos, etc. Capturan datos
biométricos cuyas descripciones y tipos se han efectuado en una unidad anterior.

En todas estas tarjetas y en papeles monedas (que serán analizados en la


siguiente unidad) o en sus representativos como ser: títulos de deudas, acciones,
cheques, plazos fijos y documentos en general, se utilizan las medidas de seguridad
detalladas en prevención de falsificaciones y adulteraciones.

El acopio de estos conocimientos e información por parte del alumno le permitirá


no sólo enfrentar los inconvenientes que traen estos tipos de delitos en el ejercicio de
la profesión, sino también resolver las dudas que puedan presentarse en la recepción
de este tipo de exponentes documentales.

tomo 1 investigación científica del delito ) 297


educación a distancia (instituto universitario de la P.F.A.)

298 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

( BIBLIOGRAFÍA DE LA UNIDAD VII )

Bibliografía obligatoria

n CAPELLO, Roberto; GOBBI, Eduardo; Celia POGGIO de PALACIOS y otros; “Tratado


de Criminalística”; Tomo I. Documentos; Ed. Policial; Bs. As.

n GUZMAN, Carlos; “Manual de Criminalística”; Ed. La Rocca; Bs. As. 1997.

n MACHADO SCHIAFFINO, Carlos; “Pruebas Periciales”; Ed. La Rocca; Bs. As. 1989.

n “Revista de Policía y Criminalística”; Números 1 y 2; Ed. Policial.

tomo 1 investigación científica del delito ) 299


u8
unidad ocho

( investigación científica del delito )


educación a distancia (instituto universitario de la P.F.A.)

CONTENIDOS DE LA UNIDAD VII

( INVESTIGACIÓN CIENTÍFICA DEL DELITO )

Mención sintética de los contenidos

1. Qué es el “Trueque”.

2. Dónde, para qué y cuáles son los beneficios o inconvenientes de su implementación.

3. Orígenes y concepto de “Moneda”

4. Evolución sufrida desde los primeros elementos utilizados como valores de cambio
hasta la fecha.

5. Cuáles son sus propiedades.

6. Cuáles son las condiciones que deben reunir.

7. Orígenes del “Dinero”.

8. Diversos tipos de dinero.

9. Antecedentes en nuestro país.

10. Primeras monedas y billetes Argentinos.

11. Cronología y devaluación histórica de nuestro Papel Moneda.

12. Características del Papel Moneda actual.

13. Características del Patacón.

14. Características del Dólar estadounidense.

15. Cronología histórica de los billetes Dólares estadounidenses.

16. Distintos tipos de dólares.

17. Características diferenciales de los distintos tipos de emisiones.

18. Descripción de las principales medidas de seguridad.

19. Reconocimiento de las medidas de seguridad utilizadas en los billetes de estas monedas.

20. Distintos tipos de falsificaciones.

21. Billetes polímeros.

tomo 1 investigación científica del delito ) 303


educación a distancia (instituto universitario de la P.F.A.)

304 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

abogacía a distancia oa)


objetivos de aprendizaje de la unidad

n Conocer acerca de los “Orígenes del Dinero”

n Conocer la aplicación de las medidas de seguridad -detalladas en la unidad anterior- en


los billetes de Papel Moneda Nacional.

n Conocer cuáles son los componentes del papel utilizado y su reconocimiento.

n Conocer las tintas de seguridad que para su fabricación se utilizan.

n Conocer los sistemas de impresión que se utilizan.

n Detallar las principales medidas de seguridad en ellos utilizadas.

n Efectuar idénticos reconocimientos sobre las Letras de Tesorería para Cancelación de Ob-
ligaciones de la Provincia de Buenos Aires denominadas “Patacón” en sus series A y B.

n Detallar iguales características sobre los billetes dólares estadounidenses.

n Detallar sobre los dólares estadounidenses, tipos de billetes y las variaciones sufridas
a través del tiempo.

n Recordar la protección legal que posee en nuestro país, el Papel Moneda.

n Tomar conocimiento del soporte polímero para billetes de papel moneda.

tomo 1 investigación científica del delito ) 305


educación a distancia (instituto universitario de la P.F.A.)

306 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

( ESQUEMA CONCEPTUAL DE LA UNIDAD VIII )

REFERENCIAS Orígenes de la Moneda y del Dinero

Historia del Papel Moneda Argentino

Cronología de devaluaciones y tipos de papeles monedas

Creación de los Patacones

Historia del Dólar estadounidense

Cronología, tipos y valores de dólares estadounidense

MONEDA NACIONAL Medidas de seguridad en el papel

Medidas de seguridad en las tintas

Sistemas de impresión utilizados

Medidas de seguridad incorporadas

DOLAR ESTADOUNIDENSE Medidas de seguridad en el papel

Medidas de seguridad en las tintas

Sistemas de impresión utilizados

Medidas de seguridad incorporadas

Distintos tipos y características de billetes

BILLETES POLÍMEROS Características Generales

tomo 1 investigación científica del delito ) 307


educación a distancia (instituto universitario de la P.F.A.)

308 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

abogacía a distancia ai )
actividad introductoria

Lea el siguiente párrafo tomado del libro “Falsificación de Moneda” de los autores
Silveyra – Lozano – Díaz, de la Editorial Policial, Volumen 334, Página 18.

Si bien las primeras falsificaciones de moneda datan desde antes de Cristo, de la lectura
del párrafo precedente surge que los daños que ocasionan pueden ser de tal magnitud para un
país, que puede llegar a desestabilizarlo. Esto fue cabalmente comprendido por todos los estados
emisores, quienes han debido legislar al respecto.

Como ejercicio introductor al tema de esta unidad, determine el articulado de nuestro


Código Penal que trata sobre falsificación de moneda y realice un cuadro sinóptico de sus
principales resguardos.

tomo 1 investigación científica del delito ) 309


educación a distancia (instituto universitario de la P.F.A.)

310 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

( DESARROLLO DE LA UNIDAD VIII )

Papeles moneda

La atención de muchos filósofos sociales, juristas, historiadores y economistas


prácticos se ha centrado en un fenómeno difundido desde hace mucho tiempo en todos
los rincones del mundo, que es la aceptación de piezas de oro y plata -y luego de unos
documentos que las representaban- como medios o valores de cambio universales.

El trueque, intercambio o permuta de una mercadería -excedente para una


persona y necesaria para otra a la que le será de mayor utilidad- es una circunstancia
racional y lógica, pero el cambio de una mercadería útil por pequeños discos metálicos
sin una aparente utilidad es un acontecimiento tan opuesto a un curso natural, que
su uso y universalización fue definida por el distinguido pensador Savigny como un
fenómeno “misterioso”.

El problema del trueque es que se necesita lo que se ha dado en llamar “la doble co-
incidencia de deseos”, es decir la casualidad de que dos personas tengan bienes o servicios
que quiera la otra. Una economía de este tipo tiene normalmente problemas en distribuir
eficientemente sus recursos. La utilización de esas piezas metálicas o documentos que las
representan –dinero- facilita el comercio. El flujo del dinero de una persona a otra a
cambio de mercaderías más útiles facilita la producción, la especialización –cada uno
realiza lo que mejor hace- y eleva el nivel de vida de la gente.

Para Aristóteles el dinero es una mercadería intermediaria que facilita los intercam-
bios. Sin embargo para los economistas:

Dinero: es el conjunto de activos que utilizan los individuos para comprar bienes y
servicios a otras personas.

Debe cumplir estas tres funciones:


a) debe ser un medio de cambio;

b) una unidad de cuenta y

c) un depósito de valor.

tomo 1 investigación científica del delito ) 311


educación a distancia (instituto universitario de la P.F.A.)

Medio de cambio: actúa como artículo que es aceptado gustosamente a cambio de los
bienes o servicios que se compran, permitiendo la realización de la transacción.

Unidad de cuenta: actúa como patrón para la regulación de precios y permite registrar
las deudas teniendo como base una unidad monetaria y no por la acumulación de can-
tidades de bienes o servicios.

Depósito de valor: actúa como artículo que permite transferir poder adquisitivo del pre-
sente al futuro.

Para cumplir con su objetivo el dinero, debe reunir ciertas condiciones. Entre ellas se
destacan las siguientes: que convenga a todos, en todo tiempo y con el mismo grado; útil por
sí mismo, con valor propio e incorruptible; homogéneo en todas sus partes pero sumamente
divisible para facilitar cambios; de manejo sencillo y en cantidad suficiente –ni mucho ni poco;
que no esté sujeto a variaciones bruscas de valor y que sea de fácil y segura acuñación.

Siguiendo un orden evolutivo, la mercancía de cambio que reemplazó al trueque eran


pequeñas piezas de metales preciosos -oro y plata- que tenían valor intrínseco. La dificultad de
su implementación la representaba el difícil contralor de sus grados de pureza, lo problemático
de comprobar la exactitud de su peso y lo problemático de su divisibilidad para cambios. Esto
limitaba el crecimiento del comercio y la industria, por lo que se hizo necesario que el Estado
avalara estas piezas y rediseñara sus formas, naciendo así la moneda.

Si bien no está perfectamente determinado el origen de este nombre, el término provi-


ene de la voz latina “moneta”. En el templo de la diosa Juno -apodada Moneta- en Roma, se
hallaba el lugar donde eran acuñadas esas piezas metálicas, circunstancia que derivó en que
a los trabajadores se los denominara “monetari” y a las piezas acuñadas “monéates” o su
equivalente “almoneda” y de allí su derivación.

Sin embargo hay que destacar que desde antes del uso de las piezas metálicas y
de la acuñación de la moneda –y también mucho después-, diferentes culturas utilizaron
otros tipos de monedas consideradas como no acuñadas, como por ejemplo: en Egipto
y Babilonia los cereales; en Grecia e Italia los animales domésticos; en África la sal; en
otras regiones el cuero, esclavos, café, cacao; etc.

Según Herodoto fueron los Lidios –pueblo comerciante del Asia Menor- los que antes del año
700 aC acuñaron piezas metálicas de oro, de plata y de ambos metales. Rápidamente comenzaron a
aparecer en China, Engina, Atenas, Corinto y en el Imperio Persa. En Italia, y especialmente en Roma,
la moneda metálica tuvo una aparición tardía -los romanos utilizaban el ganado como moneda- pero
fueron los que la homogeneizaron en tamaños, pesos y valores y prohibieron la acuñación por par-
ticulares, convirtiéndola en monopolio estatal.

312 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

En América comenzaron a funcionar las casas de acuñación o cecas –de la palabra árabe
zicah = troquel- a partir de la orden del emperador Carlos V (Carlos I de España) en 1525. A partir
de ella se instalaron cecas en México en 1537, en Santo Domingo en 1542 y en Lima en 1565.

Debido a la dificultad, peso y costo del transporte de grandes cantidades de mone-


das metálicas en transacciones comerciales de importancia entre distintas regiones -lo
que implicaba un alto riesgo en seguridad- y el advenimiento del papel, se sustituyeron las
monedas metálicas por papel moneda, que carecía de valor por sí mismo, no significaba
incremento de riqueza sino, simplemente, el reemplazante circulatorio que requería
de aval por acopio del metal.

Es en el siglo IX en China durante la dinastía Tang, cuando los bancos privados


comenzaron a emitir papel moneda, hasta que en el siglo XI la dinastía Song convirtió la
emisión en un monopolio del Estado. En Europa cada banco emitía su propia moneda res-
paldando sus emisiones con oro y plata. Más tarde con la aparición de los Bancos Centrales
se empezaron a emitir con el respaldo del gobierno de cada país.

El origen del papel moneda privado surge como constancias de depósitos. Los
inconvenientes del traslado y resguardo de las monedas metálicas provocó que hábiles
comerciantes crearan casas seguras para su depósito. Los depositantes debían abonar
un cargo por el servicio, recibiendo como certificación de los valores depositados docu-
mentos que acreditaban su propiedad. Estas acreditaciones eran emitidas por cada banco
y comenzaron a ser utilizadas como dinero en pago de servicios o bienes.

Cuando esos comerciantes –hoy denominados banqueros- comprendieron que no


era necesario tener la totalidad del dinero depositado en sus arcas y que con un porcentaje
de los mismos alcanzaba para los movimientos requeridos, comenzaron a otorgar créditos,
cambiando sus comisiones por intereses.

Al comenzar los gobiernos la emisión de papel moneda, estos debían estar respalda-
dos con reservas de metales preciosos. Al ser mayor la necesidad de circulante que éstas
y al emitirse sin su respaldo, se comienza con una interminable consecuencia inflacionaria.
Después de la segunda guerra mundial sólo los Estados Unidos tenían equiparado su res-
paldo en oro o plata, el que fue abandonado en 1971.

PESOS: Como antecedentes en nuestro país cabe indicar que luego de la gesta de Mayo de
1810, Buenos Aires y las Provincias del Río de la Plata comenzaron la campaña por la indepen-
dencia, combatiendo a la resistencia realista en el Alto Perú, tomando la Villa Imperial y su casa
de moneda y cambiando los tipos de monedas emitidos suplantando el busto real y emblemas
hispánicos por otros que ostentaban símbolos patrios de Unión y Libertad.

tomo 1 investigación científica del delito ) 313


educación a distancia (instituto universitario de la P.F.A.)

La Asamblea General Constituyente aprueba, el 13 de abril de 1813, el proyecto de


Ley de Moneda presentado por el diputado Pedro José Agrelo disponiéndose la acuñación de
monedas de oro y plata en la Villa de Potosí que, con el sol radiante y la leyenda “PROVINCIAS
DEL RIO DE LA PLATA” en el anverso y con el Escudo Nacional y la leyenda “UNION Y LIBER-
TAD” en el reverso, se acuñaron hasta fines de ese año cuando por los reveses de Vilcapugio
y Ayohuma los españoles recuperaron la ceca y retornaron a los modelos anteriores.

Lograda la independencia argentina, las continuas batallas que se debieron efectuar en


toda la región provocaron el agotamiento de las reservas del nuevo gobierno. El pronunciamiento
del General Alvear contra las autoridades bonaerenses motivó que el gobernador de la Provincia
de Buenos Aires Don Manuel de Sarratea el 28 de enero de 1820 publicara su histórico bando
justificando la emisión de papel moneda en los artículos 4º°y 5º°que textualmente dicen:
4º) “Siendo como es constante que el erario de la provincia no sólo se halla exhausto
sino que absolutamente no tiene recursos con que auxiliar al General del Ejército que
debe moverse en el día con todas las fuerzas de su mando espera que el vecindario de
Buenos Aires no se desentenderá de la cruel situación en que se halla su Gobierno para
presentarle toda clase de auxilios pecuniarios”.

5º) “Todo individuo que quiera hacer suplementos o donativos al Gobierno para sacar a
la patria del desastre que le amenaza, deberá presentarse con ellos al Exmo. Cabildo,
quien dispondrá de su recibo en la forma acordada, quedando ambas autoridades con la
obligación de reintegro tan sagrado luego que pasen los presentes momentos del apuro,
y de los primeros fondos públicos que se recolecten”.

Estos recibos a modo de “vales” -tanto de la primera como de la segunda emisión-


tuvieron el carácter de moneda corriente y se podían canjear por moneda metálica, aunque
en la práctica su utilización fue funesta, ya que no eran aceptados por los comerciantes o
si lo admitían lo hacían con una sensible disminución de valor.

Hasta 1840 sólo el gobierno de la Provincia de Buenos Aires había emitido papel
moneda, pero luego del pronunciamiento del General Gregorio de Lamadrid contra
Rosas se forma la Unión de las Provincias Aliadas del Norte que a través del Banco
Hipotecario de Tucumán emite billetes con la promesa que serán pagados después
del triunfo, condenando a la pena de muerte a sus falsificadores.

Las diferencias políticas y las ansias independentistas de muchas provincias mo-


tivaron que fueran muchas las que acuñaran monedas – además de Tucumán, La Rioja,
Santiago del Estero y Mendoza- lo que trajo como consecuencia un importante flujo de
variados modelos y tipos y con ellos un gran caudal de moneda falsa.

314 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

Terminadas las rencillas internas y a través de los pactos de unión nacional celebra-
dos por Urquiza y Mitre en el año 1860, se comienza a normalizar la economía doméstica
emitiendo los Bancos Provinciales, Privados y casas Comerciales circulantes con promesas
de canje en pesos fuertes o plata.

La primera moneda nacional en oro y plata aparece en el año 1881 y se dispone


que los billetes de papel deben indicar su valor en esa moneda. En 1886 se crean los
Bancos Garantidos y es la Nación la que responde por las emisiones de todos los
bancos provinciales autorizados disponiéndose, asimismo, su curso forzoso.

Creada por Ley del 20 de septiembre de 1897 la Caja de Conversión, se emiten


los nuevos billetes denominados “Del Progreso” caducando así todas las emisiones
anteriores y siendo la República Argentina la que garantiza y paga por intermedio del
Banco de la Nación sus billetes, que serán canjeados por monedas de oro y plata.
Se reproduce a continuación la unidad de ese tipo de moneda.

Este papel moneda presentaba diferentes tamaños para cada denominación. El billete
de un peso era de 130 x 65 milímetros, en el anverso presentaba la Efigie del Progreso y puede
leerse “República Argentina”, “La Nación”, “pagará al portador y a la vista Un Peso” y en el
reverso presenta el Escudo Nacional y las leyendas “República Argentina” y “Un Peso”.

Mediante la sanción de la Ley número 1.130 modificada por Ley 3.871 del 4 de noviem-
bre de 1899 se establece como unidad monetaria argentina el “Peso Moneda Nacional” cuyo
símbolo es m$n. Se reproduce a continuación la unidad de este tipo de moneda.

tomo 1 investigación científica del delito ) 315


educación a distancia (instituto universitario de la P.F.A.)

Esta moneda también presentaba diferentes colores y tamaños según su denomi-


nación. El billete de un peso era de igual medida que la serie Del Progreso y presentaba
en el anverso a La Justicia y en el reverso La Casa de Tucumán. Estos billetes tuvieron
curso legal hasta diciembre de 1969.

En enero de 1970 por disposición de la Ley 18.188 se crea el Peso Ley ($L) que reem-
plaza a su equivalente 100 pesos moneda nacional. Los billetes presentan igual tamaño
155 x 75 milímetros difiriendo en color y motivos del reverso. Los billetes de 1, 5 y 10
pesos tienen la figura del General Manuel Belgrano –los de 50, 100, 500, 1.000, 5.000,
10.000, 50.000, 100.000, 500.000 y 1.000.000 de pesos tienen la figura del General San
Martín-. Esta moneda circula hasta mayo de 1983.

Se reproduce a continuación la unidad de este tipo de moneda que en el re-


verso presenta el Hotel Llao Llao en Bariloche.

En junio de 1983 se emite el Peso Argentino ($a.) que reemplaza a su equivalente


de 1.000 pesos ley 18.188 y presenta igual tamaño que los anteriores. En los billetes de
1, 5, 10, 50, 100, 500 y 1.000 pesos argentinos, está la figura del General San Martín,
el de 5.000 la de Juan Bautista Alberti y el de 10.000 la del General Manuel Belgrano.
Poseen diferentes colores y motivos en el reverso.

Se reproduce a continuación la unidad de este tipo de moneda que tuvo cir-


culación legal hasta mayo de 1985.

316 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

En junio de 1983 comienza la vigencia del Austral (A) que reemplaza a su equivalente de
1.000 pesos argentinos. Estos billetes mantienen el tamaño anterior, cambiando el color y figuras
del retrato en todas las denominaciones. En sus reversos presentan la Efigie del Progreso.

Se reproduce a continuación la unidad de este tipo de moneda que presenta


el retrato de Bernardino Rivadavia. Esta moneda circuló hasta diciembre de 1991.

En enero de 1992 el signo monetario Peso ($) reemplaza a su equivalente de 10.000


australes. De esta manera las sucesivas depreciaciones monetarias hicieron perder
un total de trece ceros, los que precedidos de la unidad da esta impresionante cifra:
10.000.000.000.000 que indica la conversión de peso moneda nacional a peso actual.

Se reproduce a continuación la unidad de este tipo de moneda que ya no tiene


circulación legal pero que sigue manteniendo su valor.

Los primeros billetes de esta moneda puestos en circulación -dado el avance tecnológi-
co actual- han debido ser modificados para dificultar su falsificación a través de procesos de
fotocopiado o escaneado y reproducción láser. A partir de 1997 se ha dispuesto una nueva serie
que si bien conservan las principales características de formato, color y motivos principales
del anverso y reverso de los anteriores, se le han introducido nuevas medidas de seguridad.
Su impresión está a cargo de la Sociedad del Estado Casa de la Moneda Argentina.

Todos los billetes tienen 155 x 65 milímetros y se hallan realizados en papel de


calidad “emisión registrada” de 90 gramos por metro cuadrado y presentan:
Filigrana o marca de agua localizada: en el sector sin impresión del anverso y reverso que
reproduce la figura del prócer del retrato y sus iniciales. Presentan una excelente definición de
claros-oscuros multitonales y pueden ser observadas con igual calidad desde ambas caras.

tomo 1 investigación científica del delito ) 317


educación a distancia (instituto universitario de la P.F.A.)

Fibras de seguridad invisibles con luz directa y visibles en colores rojo, azul y amarillo con luz ul-
travioleta diseminados en toda la masa del papel, que pueden ser levantadas con una aguja.

Hilo de seguridad: En los valores desde 10 pesos en adelante se les incorpora esta medida
sobre el que puede leerse a trasluz la leyenda BCRA, el signo $ y el número indicador del
valor. Pueden estar incorporados totalmente a la masa del papel o en forma entrecruzada y
al ser observados con luz ultravioleta presentan distintas respuestas fluorescentes: el de diez
pesos en color azul; los de veinte pesos en color rojo; los de cincuenta pesos también en
color rojo, pero son visibles a simple vista en color metálico en forma entrecruzada y los de
cien pesos también visible y entrecruzado en color metálico y fluorescentes en color azul.

Fondos de seguridad están realizados en offset con los colores determinados para cada
valor. Con ese mismo sistema presenta en el anverso reproducción parcial de manuscritos
del personaje del retrato y en el reverso una síntesis biográfica del mismo.

Calcografía: con este sistema se confeccionan los retratos, los motivos que lo acompañan
y otras impresiones reconocibles al tacto. Estas impresiones centrales están realizadas
con tintas que cambian de color al ser observadas con luz ultravioleta.

Tipografía: este sistema es utilizado para la realización de las numeraciones de los billetes que se
encuentran en dos posiciones, una en forma vertical y en tintas de color rojo en el sector izqui-
erdo y otra en forma horizontal con números de diferentes tamaños y en color negro en el sector
superior derecho. Estas tintas también cambian de color al ser observadas con luz ultravioleta.

Tintas O.V.I.: el número indicador del valor del billete ubicado en el sector superior izqui-
erdo del anverso está realizado con tintas dicroicas o de variación óptica o cromática
que, según el ángulo de observación pueden verse verdes o azules.

Microletras: los billetes de 2, 5 y 10 pesos presentan microletras que repiten las siglas BCRA
en el interior del número indicador del valor ubicado en el sector inferior derecho del anverso
y en ambos números del reverso. Los restantes billetes poseen microletras en los números del
reverso y en el del anverso tienen Imagen Latente que reproduce el mismo número en forma
más pequeña, los que pueden ser visualizados a la altura de los ojos frente a una luz.

Identificación para no videntes: presentan este tipo de identificación por medio de rombos
en relieve ubicados en el sector superior lado izquierdo. La presencia de seis de ellos le
corresponde al billete de dos pesos y se resta uno a medida que el billete es de mayor
valor, terminando con un rombo en el billete de cien pesos.

Registro Perfecto: diferentes motivos geométricos, alegorías o números a la derecha del


retrato, conforman un registro perfecto o complementación frente-dorso. La perfecta inter-
relación entre los dibujos en ambas caras del billete al ser observados a tras luz indica una
impresión simultánea en ambos lados que no pueden lograr los falsificadores al imprimir por
separado los anversos y los reversos.

318 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

A fin de visualizar la ubicación de las distintas medidas de seguridad detalladas,


se señalarán en dos billetes tipos, las mismas:

Identificación para Numeración

no videntes Fluorescente con U.V.

Tintas O.V.I. Impresiones Calcográficas


Filigrana

Numeración Impresión Offset


Impresiones con tintas
Microletra
reactivas a U.V.
Registro Perfecto

Impresiones Offset Síntesis Biográfica Fibra de Seguridad

tomo 1 investigación científica del delito ) 319


educación a distancia (instituto universitario de la P.F.A.)

Hilo de Seguridad Numeración Fluorescente

Tintas O.V.I. Identificación No Videntes Impresiones Calcográficas


Filigrana

Fibra de Seguridad Impresiones con tintas Impresión Offset


Imagen Latente
Reactivas a U.V.
Registro Perfecto
Microletra Síntesis Biográfica

Impresiones Offset Impresiones Calcográficas Fibra de Seguridad Microletra

Se debe recordar que para determinar autenticidad o falsedad en papeles monedas hay
que verificar las medidas de seguridad que éstos presenten, requiriéndose idealmente para ello una
lupa y una luz ultravioleta -ambos elementos son de bajo costo y fácil adquisición. Teniendo
en cuenta las diferencias que presentan las distintas denominaciones, en nuestros billetes se
debe verificar lo siguiente:

Por medio de la vista la presencia de una nítida filigrana desde ambas caras; el hilo
de seguridad; el cambio cromático de las tintas O.V.I.; la imagen latente y la coincidencia
del registro perfecto. Por medio del tacto reconocer las impresiones calcográficas por el
sobrerrelieve que producen.

Con una lámpara de luz ultravioleta se determinan las fibras de seguridad fluorescentes
en rojo, azul y amarillo; la distinta respuesta fluorescente -según las denominaciones- de los
hilos de seguridad; la reacción de las tintas fluorescentes y la fluorescencia neutra del papel.

320 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

Por medio de una lupa se deben determinar las leyendas en Microletras; las finas
líneas del fondo de seguridad y el reconocimiento de los distintos tipos de impresión.

Los falsificadores tratan de reproducir lo más fielmente posible todas estas medidas de segu-
ridad. Algunas son logradas de manera aceptable, pero lo difícil es lograr que todas tengan suficiente
idoneidad para producir engaño a las personas que lo examinen bajo las pautas indicadas.

Dentro de las características más sobresalientes en algunas falsificaciones se


pueden mencionar las siguientes:
l Ausencia de filigrana o impresión simulada en forma gráfica o manual.

l Ausencia de fibras de seguridad o imitación con líneas de colores impresas o pegado


superficial de fibras.

l Ausencia o simulación de hilos de seguridad por medio de impresión de una línea


oscura, sin leyenda interior y sin respuesta fluorescente.

l Falta de los sobrerrelieves de las impresiones calcográficas ya que están realizados


en sistema offset o por impresión láser.

l Las líneas del fondo de seguridad están realizadas por puntos separados.

l Falta de interrelación entre los dibujos o diseños del registro perfecto -por haberse
realizado las impresiones por separado-.

l Variaciones en las tonalidades de las tintas.

l Cortes irregulares del papel.

l Gran luminosidad del papel al ser sometido a radiaciones ultravioletas.

Por último y a los efectos de diferenciar las calidades de realización de las filigranas
o marcas de agua, se ilustra las diferencias entre una auténtica y una falsa.

Filigrana Auténtica Filigrana Falsa

tomo 1 investigación científica del delito ) 321


educación a distancia (instituto universitario de la P.F.A.)

DÓLAR ESTADOUNIDENSE: Su origen se remonta al año 1519 cuando luego de descubierta una mina
de plata en Sankt Joachimsthal –Valle de San Joaquín en el Imperio Germánico-, el conde Schlick
acuñó una moneda de plata que recibió el nombre de “Joachimsthaler”, que luego se abrevió a “Tha-
ler” o “Taler”. En 1520 Carlos I de España al asumir como soberano del Imperio Germánico dispuso la
acuñación de monedas españolas de igual valor denominándola “Talero”, para ser utilizadas durante
el intercambio comercial con las colonias inglesas en América del Norte, donde fueron traducidas al
inglés como “Dollar”, moneda que tuvo gran circulación en esa parte de América.

Lograda la independencia el 4 de julio de 1776 y luego de su constitución como país,


el pueblo de los Estados Unidos de Norte América elige como primer presidente a George
Washington, quien el 2 de abril de 1792 sanciona la Ley de Acuñación que designa al dólar
como unidad monetaria nacional y al signo “U$S” como su representación, formado por las
iniciales del país “United” y “States” y las dos columnas de Hércules con las cintas liadas con
la leyenda “Plus Ultra” como símbolo de fuerza y solidez.

A partir de esa Ley los Estados Unidos han emitido siete categorías de billetes: a) Silver
Certificates; b) Gold Certificates; c) United Stated Notes; d) Treasury Notes -en 1890 y 1891-;
e) Federal Reserve Notes; f) Federal Reserve Bank Notes y g) National Bank Notes. Si a estas
emisiones se les suman las constancias de depósitos bancarios que circulaban paralelamente,
al no estar uniformado ni el tamaño, ni el color, ni las figuras o dibujos, el total de circulante tenía
miles de diseños, siendo fácil comprender las dificultades que ocasionaba su reconocimiento
y la cantidad de billetes falsos que había.

En 1865 la Tesorería estableció el Secret Service, sección que tenía como fin el control
de las falsificaciones. Después de los pánicos financieros de 1893 y 1907, se crea en 1913
el Sistema de la Reserva Federal como el Banco Central de la Nación siendo autorizado
para emitir los billetes de la Reserva Federal -que se concretan en 1914, siendo ahora los
únicos billetes que se producen y constituyen el 90% del circulante.

En 1928 se estandarizaron los tamaños, papel, color de tintas, retratos, emblemas


y diseños del reverso, los que reúnen las siguientes características:
Tamaño: los billetes presentan el mismo tamaño 155 x 65 milímetros en todas las denominaciones.
Papel: especial de fórmula secreta, se sabe que posee el 75% de algodón y un 25% de lino, que
junto con encolantes sintéticos le confieren resistencia al manipuleo. Posee una tonalidad blanco
mate; fluorescencia neutra y filamentos visibles azules y rojos. Al ser observado por medio de un
microscopio se revelan pequeños puntos luminosos.
Calidad y color de tintas: también son de fórmulas secretas, presentan la cualidad especial de ser
del tipo “nunca seco” -por lo que se corren al ser frotadas- sin que esto deba ser considerado
como una medida de seguridad, y algunas tienen componentes metálicos. Las mismas son de color
verde, con un intenso sombreado en negro en el anverso.

322 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

Con relación a los retratos, diseños del reverso y emblemas, los mismos serán
analizados oportunamente.

Desde 1928 el Gobierno de los Estados Unidos ha impreso cinco tipos de billetes:
a) Federal Reserve Notes;
b) United States Notes;
c) Silver Certificates;
d) Gold Certificates; y
e) National Currency Notes.

Federal Reserve Notes: presentan el sello de la Tesorería y el número de la serie en color


verde. Este tipo de billete constituye entre el 90 y el 99% del circulante.

United States Notes: presentan el sello de la Tesorería y el número de la serie en color rojo.

Silver Certificates: presentan el sello de la Tesorería y el número de la serie en color azul. Estos
dos últimos tipos detallados constituyen la diferencia porcentual del circulante actual.

En la siguiente figura se puede visualizar en detalle estos tres tipos de billetes donde
se observa la posición del sello del tesoro y de los números de serie.

tomo 1 investigación científica del delito ) 323


educación a distancia (instituto universitario de la P.F.A.)

Gold Certificates: presentan el sello de la Tesorería y el número de la serie en color oro.

National Currency Notes: presentan el sello de la Tesorería y el número de la serie en color mar-
rón. Estos dos últimos tipos actualmente no se imprimen, habiendo pocos en circulación.

Se describen a continuación las principales características de los billetes: a) impre-


siones; b) retrato; c) sello del tesoro; d) sello del banco; e) guilloches; f) viñetas; g) nu-
meración o serie; h) letra de control o número de cuadrante; i) series; y j) reversos.

Impresión: se realizan en intaglio o calcografía y tipografía. Se imprimen primero los diseños


básicos del anverso y todos los del reverso con calcografía y después con tipografía se
realiza la numeración, los sellos y los datos variables como ser firmas de los funcionarios
y series. El reverso presenta una impresión de menor tamaño. Luego de su control se lo
apresta para darle mayor resistencia al manoseo y a la suciedad, alargándole su vida útil
estimada en unos dieciocho meses.

Retrato: corresponde a una conocida figura norteamericana y están enmarcados con un óvalo. La
calidad de impresión de éstos es observable en los detalles del cabello, barba, nariz, vestimenta,
reticulado del fondo y fundamentalmente en los ojos, que le dan una real apariencia de vida. Asi-
mismo debe prestarse especial atención a las finas líneas de color blanco de las ornamentas.

Sello del tesoro: según el tipo de billete, como ya se especificara, este sello se encuentra sobre-
impreso en el color correspondiente al número de serie. La fecha que presenta (1789) recuerda el
año de la creación del Departamento del Tesoro, es una rueda dentada y contiene los siguientes
elementos: una balanza de doble platillo que representa a la igualdad y a la justicia; una figura
a modo de “V” invertida con trece estrellas que representan los primeros Estados de la Unión;
una llave como representación de la autoridad oficial y un escudo que simboliza la rectitud.
Se encuentra ubicado en el sector medio del lado derecho del anverso y se distinguen
dos modelos conteniendo los mismos elementos. Las diferencias están en los bordes del escudo
interior que en los primeros eran curvos y ahora son rectos, y que antes tenía una leyenda en
latín “Thesaur Amer Septent Sigil” y ahora tiene una en inglés “The Departant Of Treasury”. La
fecha de cambio de un sello a otro fue en 1963 para los de un dólar y para 1969 ya había sido
incorporado en todos los valores.

324 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

Sello del Banco: este sello se encuentra ubicado en el sector medio del lado izquierdo del
anverso y está conformado por una rueda de bordes dentados en cuyo centro se ubica
la letra asignada a la entidad emisora, realizada en color blanco. En forma circular en su
parte superior lleva impreso “Federal Reserve Bank” y en su parte inferior la ciudad y el
estado en que se encuentra la entidad o banco emisor.
Se hace necesario indicar aquí que son doce los bancos de la Federal Reserve que
emiten dinero y cada uno de ellos está identificado con un número correlativo al que le cor-
responde una letra en orden alfabético, que sigue al orden numeral. Se detalla a continuación
los bancos, ciudad, estado y los números y letras que le corresponden:
1 A Boston, Massachussets; 2 B Nueva York, Nueva York; 3 C Philadelphia, Pennsyl-
vania; 4 D Cleveland, Ohio; 5 E Richmond, Virginia; 6 F Atlanta, Georgia; 7 G Chicago,
Illinois; 8 H Saint Louis, Missouri; 9 I Minneapolis, Minnesota: 10 J Kansas City, Mis-
souri; 11 K Dallas, Texas; y 12 L San Francisco, California.

Filigrammas o tramados: los bordes del billete -tanto del anverso como del reverso- es-
tán enmarcados por filigrammas o tramados ejecutados con excelentes detalles. Estos
tramados tienen una perfecta definición y están constituidos por líneas negras o verdes
muy finas que en forma nítida se entrecruzan -sin nudos ni manchas- en forma de tejidos
continuos y uniformes a modo de telarañas sobre un fondo blanco.

Guilloches: este sistema aporta la posibilidad de efectuar dibujos muy delicados y artísti-
cos con finas líneas de color blanco. Estas líneas son muy difíciles de copiar por otros
sistemas de impresión que las empastan o unen.

Viñetas: con impresión de medios tonos se logra una excelente gama de grises que
elimina los contrastes muy marcados y sombreados claroscuros, como las que rodean
el borde del valor del billete.

Numeración o serie: esta numeración está conformada por ocho dígitos precedidos y
seguidos de una letra. La primera es la letra correspondiente al banco emisor y la última
indica grupo de cien millones de billetes impresos. Se utilizan veinticinco letras -no la “O”
para evitar ser confundida por un dígito “0”. Este número se imprime con el mismo color
de tinta que el sello del tesoro, tal como ya se indicara anteriormente.

Letra de Control o Número de cuadrante: los billetes anteriores al año 1963 presentan una letra
en el ángulo superior izquierdo del anverso que indican la posición del billete en la plancha.
Al imprimirse por hoja 12 o 18 billetes, su posición es indicada en la misma por esta letra de
control. Después de esa fecha al imprimirse 32 billetes por plancha se hizo necesario -al no
haber tantas letras- cambiar este control por el de número de cuadrante. Ahora se divide la
hoja en cuatro cuadrantes identificados con los dígitos 1 a 4 y la posición de los ocho billetes
por cuadrante se indican por las letras “A” hasta la “H”, por ejemplo B2.

tomo 1 investigación científica del delito ) 325


educación a distancia (instituto universitario de la P.F.A.)

Desde 1992 a modo de prueba y mediante el sistema “Web-Fed Intaglio” se imprimen


96 billetes en forma simultánea del anverso y del reverso en papel continuo en cilindros, reu-
bicándose el número de control a la derecha de la palabra “TRUST”

Número de lámina: en el ángulo inferior derecho, tanto del anverso como del reverso, se
visualiza el número de control de la plancha. Ese número, que aparece en el margen de
la plancha, es el que controla la cantidad de hojas de papel, indicador que se corta y se
perdería al seccionar los billetes.

Serie de emisión: las más comunes en circulación son las siguientes: 1963, 1966, 1974,
1977, 1981, 1985, 1990 y 1996. Con respecto a estas dos últimas series se detallarán sus
características por separado, por presentar diferencias entre sí y con las anteriores.

En las siguientes ilustraciones del anverso y reverso de un billete de cien dólares


de las series anteriores a 1990, se detallan la ubicación de las características descriptas
para su fácil visualización.

Tipo de Billete
Sello del Banco Reticulado del Retrato

Nº de Cuadrante Fibra de Seguridad

Nº del Banco Sello del Tesoro

Numeración

Filigramma

Letra del Banco Guilloches Firmas de Funcionarios Serie de Emisión

Impresión Intaglio Efecto Cielo

Fibra de Seguridad

Nº de Lámina
Impresión de Menor Tamaño

Independencia Hall Viñeta

326 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

A los efectos de una mayor identificación se aclara que las impresiones realizadas
en sistema intaglio o en calcografía presentan sobrerrelieves que pueden ser detectadas
por el tacto. El efecto cielo -también realizado en ese sistema- está conformado por líneas
muy finas con interrupciones que son muy difíciles de imitar con cualquier otro sistema
de impresión.

Existen doce valores de billetes dólar, de los cuales los cinco de más alta denomi-
nación son de circulación interbancaria restringida, no circulando entre el público. Se detal-
lan a continuación la nómina y las características diferenciales del anverso y del reverso.

VALOR RETRATO REVERSO

1 dólar Presidente George Washington Gran sello de los Estados Unidos

2 dólares Presidente Thomas Jefferson Monticello. Declaración Independencia.

5 dólares Presidente Abraham Lincoln Monumento a Lincoln -en Washington-

10 dólares Secretario Alexander Hamilton Edificio del Tesoro de los EE.UU.

20 dólares Presidente Andrew Jackson Casa Blanca -en Washington-

50 dólares Presidente Ulises Grant Capitolio, Congreso -en Washington-

100 dólares Legislador Benjamín Franklin Salón de la Independencia -Philadelfia-

500 dólares Presidente William McKinley Número del valor, ornamentado

1.000 dólares Presidente Grover Cleveland Valor ornamentado

5.000 dólares Presidente James Madison Valor ornamentado

10.000 dólares Secretario Salmon Chase Valor ornamentado

100.000 dólares Presidente Woodrow Wilson Valor ornamentado

tomo 1 investigación científica del delito ) 327


educación a distancia (instituto universitario de la P.F.A.)

Para establecer si el billete es legítimo o no deben efectuarse las siguientes comprobaciones:


1) Resistencia, flexibilidad y sonido del papel.
2) Presencia de fibras de seguridad rojas y azules. De tenerse dudas acerca de su legit-
imidad se las puede desprender con una aguja.
3) Calidad del retrato en lo que hace a su nitidez, expresión de vida y brillo en los ojos y
la limpieza de las líneas de su fondo o reticulado.
4) Las finas líneas blancas de las ornamentaciones o guilloches.
5) Relieve de las impresiones en intaglio o calcografía.
6) Superposición del Sello del Tesoro hecho en tipografía y con tinta color verde, con el
valor del billete hecho en calcografía.
7) La nitidez de los dibujos del anverso y reverso especialmente en filigrammas y ornamentas.

En la serie de 1990 se han implementado dos medidas de seguridad sobre el


mismo formato -en todas las denominaciones menos en el billete de un dólar que se
mantiene igual. Estas medidas son a) hilo de seguridad y b) microletras.
Hilo de seguridad: se ha incorporado durante el proceso de fabricación del papel un hilo de
seguridad de poliéster entre el retrato y el borde izquierdo del billete que se puede visualizar
por transparencia, conteniendo en su interior la sigla USA y el valor del billete -en número para
el de 100 dólares “USA 100” y en letras para el resto de los billetes por ejemplo “USA Fifty”.
Microletras: la tercera línea externa del marco del retrato está constituida por la repetición
de la leyenda “THEUNITEDSTATESOFAMERICA” sin solución de continuidad. Esta medida
de seguridad sólo se puede ver con el uso de una lupa u otro elemento óptico.

El uso de modernas tecnologías por parte de los falsificadores y con el fin de facilitar


el reconocimiento de los billetes auténticos motivó la aplicación de nuevas medidas que
obligaron a un cambio más pronunciado del modelo de billete. Se detalla a continuación
las características de los nuevos billetes dólares de la serie 1996:
Filigrana o marca de agua: se incorpora durante el proceso de fabricación del papel y
cuando aún las fibras están húmedas. Esta marca la realizan máquinas especiales que
separan o juntan las fibras formando claroscuros que pueden ser observados por trans-
parencia y que reproducen la misma fisonomía de la figura del retrato.
Retrato: amplificado y descentrado hacia la izquierda de las mismas figuras ya detalladas
para cada valor, que coincide con la filigrana. El reticulado del fondo es reemplazado por
líneas concéntricas que dificultan su reproducción en las falsificaciones.
Microletra: esta medida de seguridad se mantiene pero no ya en la tercera línea externa del
marco del retrato, sino en el sombreado del número indicador del valor en el sector izquierdo
y en diferentes posiciones acorde al valor del billete: en los de 100 dólares se encuentra

328 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

conformando la línea de la solapa de la chaqueta de Franklin; en el de 50 dólares en la parte


inferior del marco y en el resto de los billetes en diferentes adornos del marco.
Hilo de seguridad: se mantiene esta medida con las mismas características, pero presentan
diferentes ubicaciones y fluorescencias al ser expuestos a la luz ultravioleta, en cada valor. En
los billetes de 100 dólares la respuesta fluorescente es en color rojo; en los de 50 en amarillo:
en los de 20 en verde amarillento; en los de 10 en blanco y en los de 5 en azul.
Tintas O.V.I.: se ha impreso con tintas de variación cromática o dicroicas el número indica-
dor del valor del billete ubicado en sector inferior derecho del anverso. Estas tintas tienen la
propiedad de cambiar de color según el ángulo de incidencia de la luz y de observación. Al ser
observadas de frente se las visualiza en color verde pero al variar el ángulo cambia a negro.
Sello del banco: se unifica este sello para todos los bancos emisores, universalizando así
el símbolo del Sistema de la Reserva Federal. Los bancos siguen conservado sus letras
pero no dentro de este sello. La letra y el número que identifica al banco emisor aparecen
debajo del número de serie del lado izquierdo.
Números de serie: a este número se le ha añadido una letra más -resultando una combinación al-
fanumérica de once caracteres- y aparece dos veces en el anverso, en el sector superior izquierdo y
en el sector inferior derecho. La segunda letra sigue siendo la correspondiente al banco emisor.
Serie de emisión: el año de la serie cambia de posición ubicándose a la izquierda del retrato.
Ayuda visual: en los billetes de 50 dólares y en los de menor denominación se incorpora
en el reverso, el número del valor con caracteres más grandes.
Efecto cielo: el efecto cielo está ahora constituido por líneas concéntricas que dificultan su
falsificación.

Se reproduce para su visualización el anverso y el reverso de un billete de cien


dólares de la serie 1996.

Letra Banco Hilo de Seguridad Filigrana o marca de agua


Tipo de Billete Fondo Retrato

Microletra Serie Emisión Tinta Dicroica

Sello Federal Reserve Numeración 2º Letra del Banco

tomo 1 investigación científica del delito ) 329


educación a distancia (instituto universitario de la P.F.A.)

Filigrana Impresión más pequeña Efecto Cielo

Fibra de Seguridad Nº de Lámina

Cómo verificar los elementos de seguridad: a) con la vista; b) por el tacto;


c) con luz ultravioleta; y d) con lupa.
Con la vista: verificar la presencia y calidad de la filigrana o marca de agua, la pres-
encia del hilo de seguridad con la inscripción USA y el valor del billete; y las tintas
dicroicas o de variación cromática.

Por el tacto: los sobrerrelieves de las impresiones calcográficas que son fácilmente
detectables por este sentido.

Con luz ultravioleta: la opacidad o fluorescencia neutra del papel.

Con lupa: las leyendas microimpresas; las fibras de seguridad azules y rojas; el efecto
cielo y las líneas del fondo del retrato; los guilloches; las viñetas; etc.

Otros datos: Por ley sancionada el 11 de julio de 1955 se estipuló la leyenda “In God
We Trust – En Dios Confiamos-” en el reverso de los billetes dólar. Esta leyenda aparece en
los billetes de un dólar a partir del 1º°de octubre de 1957 y a partir de 1963 en todas las de-
nominaciones. Los billetes anteriores a esa fecha sin esa leyenda conservan su valor.

Billetes estrella: Una estrella siguiendo el número de serie indica que ese billete es
sustituto de otro que fue impreso en forma defectuosa. También son usados para reemplazar
el billete número cien millones -para que no se emita un billete con el número 00.000.000-.

Con miras de proteger el dinero de sus habitantes, el gobierno de los Estados Unidos
de Norteamérica en el año 2003, comenzó progresivamente a emitir billetes que serán más
confiables, seguros e inteligentes. Aseguran que los nuevos diseños son más confiables
porque poseen medidas de seguridad más fáciles de verificar y más difíciles de falsificar.
Son más inteligentes porque estarán un paso delante de los falsificadores y se utilizarán las
tecnologías más modernas, y más seguros para proteger la integridad y la economía del país.
Planean cambiar los diseños cada 7 o 10 años. A finales del 2003 reemplazaron los billetes

330 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

de 20 dólares, en el 2004 los de 50 dólares y en el 2005 los de 10 dólares, planeando hacer


lo propio con los de 100 y de 5 dólares, pero no los de un dólar. El gobierno estadounidense
considera que el dólar es un símbolo mundial de seguridad y que se ha ganado merecidam-
ente la confianza de la gente. A modo de ejemplo se describirá el billete de 20 dólares.

Los nuevos billetes de 20 dólares tienen la figura del presidente Andrew Jack-
son en el anverso y la Casa Blanca en el reverso y como los actuales, conservan su
tamaño, su diseño genérico y cuentan con las siguientes medidas de seguridad:
Papel: de formula secreta, contiene además de amalgamadores sintéticos, fibras de algodón y lino
para aumentar su resistencia. Su particular textura produce un sonido característico denominado
“carteo”, verificándose su flexibilidad, resistencia a roturas y tolerancia a los dobleces a través
de instrumentos de precisión. Posee fluorescencia neutra, fibrillas de seguridad rojas, azules y
amarillas y al observarse al microscopio presenta diminutos puntos luminosos.

Presenta filigrana o marca de agua localizada -es decir en el sector medio del lado
derecho visto desde el anverso- con una imagen que se desvanece, similar a la del retrato,
que puede ser visualizada con idéntica nitidez por transparencia desde ambos lados. Además
presenta hilo plástico de seguridad incrustado en forma vertical en el papel, visualizándose
también a trasluz y de ambos lados, las palabras “USA TWENTY” y una pequeña bandera. Este
hilo presenta fluorescencia verde bajo la acción de longitudes de ondas ultravioletas.

Tinta de Impresión: también de composición secreta son testeadas su reacción al calor


y frente a luces potentes y también su viscosidad, densidad y penetración.

En el número “20” -representativo de la denominación- ubicado en la esquina inferior


derecha del anverso, se ha utilizado tinta de variación óptica (o.v.i.). Esto permite que al
mover el billete hacia arriba y abajo, en forma más radical o drástica vire de color pasando
del cobre al verde y viceversa.

Se han utilizado colores tenues para la impresión del fondo del billete que ahora
presenta los colores verde, durazno y azul en ambos lados, siendo la primera vez desde la
época histórica moderna -1929 en adelante- que se abandona la exclusividad de los tradi-
cionales colores verde y negro. Estos colores -distintos para cada denominación-, permitirán
un más rápido reconocimiento.

Sistemas de impresión: se ha utilizado el sistema calcográfico que produce sobrerrelieve


por depósito de tinta a presión -cuatro toneladas por centímetro, lo que produce intima
penetración, en todo el billete menos en el sello del Tesoro, las firmas, las numeraciones
y la letra y numeración indicadora del banco emisor, que es tipografía.

tomo 1 investigación científica del delito ) 331


educación a distancia (instituto universitario de la P.F.A.)

Anverso del billete: Además de las características generales que se indicaran con relación
al papel y las tintas, se detallan las siguientes:

El retrato no posee más los bordes ovalados que lo enmarcaban, ni las líneas finas que
lo rodeaban. Andrew Jackson (1767-1845) elegido dos veces presidente (1829 a 1837) sigue
siendo la figura principal, pero ahora se halla desplazado más arriba y presenta los hombros ex-
tendidos hasta el borde inferior de la viñeta, la que presenta detalles adicionales en su fondo.

Se le ha incorporado los siguientes elementos -que serán distintos para cada de-
nominación, que fueron designados como “Símbolos de la Libertad”. En el fondo del billete
y a la izquierda del retrato, “el águila americana” -ejecutada con la forma de los dibujos y los
esculpidos usados durante el período del presidente Jackson-, en gran tamaño y en color azul.
A la derecha, abajo y próximo a los hombros del retrato, se halla impreso en realce un águila
más pequeña -de diseño más reciente- y un escudo, ambos en color verde metalizado.

Además en el fondo a la derecha del retrato, la palabra “Twenty Usa” en color azul.
Con microletra presenta dos nuevas impresiones. Una con la leyenda “Usa20” en color
azul, bordeando las tres primeras letras de “Twenty Usa” de dicha cinta; y la segunda con
la leyenda “theunitedstatesofamerica20usa20” en color negro, en el borde inferior de la
firma del funcionario del Tesoro.

El sello universal de la Reserva Federal se halla ubicado a la izquierda del retrato


y a la izquierda de éste, debajo del número de serie de ese lado, una letra y un número
representativo del banco emisor. La combinación de once números y dos letras que
identifican el número del billete se incorpora dos veces, una en la parte superior izquierda
ya mencionada y otra en el sector inferior lado derecho. La serie con el año de emisión
“2003” se ubica abajo y a la derecha del retrato.

Reverso del billete: Se le ha quitado las líneas que rodeaban la viñeta de la Casa Blanca y
a ambos lados de esa figura se le ha incorporado varias cifras “20” en pequeño tamaño,
con tintas visibles en color amarillo.

Se mantiene la cifra “20” de gran tamaño en la esquina inferior lado derecho,


como característica facilitadota en caso de baja visión, ya que facilita su lectura.

332 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

BILLETES POLÍMEROS O DURANOTE: el polímero es un sustrato transparente de película plástica


que ha sido utilizado por los australianos en la producción de papel moneda, reemplazando al
papel a base de fibras celulósicas. Este soporte brinda mucha mayor durabilidad –cuadriplica su
vida útil lo que significa un importante ahorro en los costos de impresión; son más limpios –me-
joran el funcionamiento de cajeros automáticos y máquinas de recuento- y son reciclables.

Para hacerlo apto para ese destino, una vez cortado el polímero en planchas, se
lo debe opacar con capas de tinta -salvo en las ventanas o lugares que adrede se desea
mantener transparentes, pudiéndose utilizar los tradicionales sistemas de impresión de bil-
letes, es decir el offset, el calcográfico y el tipográfico.

Se les pueden incorporar durante el proceso de fabricación imágenes sombreadas


que actúan a modo de filigrana, lográndose diferentes efectos al poder utilizar un completo
rango multitonal del claro al opaco. Asimismo se les pueden incorporar fibras e hilos de
seguridad con o sin inscripciones o códigos.

Admiten las mismas tintas que las utilizadas sobre el papel, es decir visibles, invisibles,
fluorescentes, fosforescentes, cromáticas, metálicas y de variación cromática u ópticas.

Los billetes están constituidos por un núcleo y dos capas externas que son las que
reciben el tratamiento de opacidad -las que luego de ser unidas no pueden ser deslaminadas
debido a la alta resistencia de la unión. La transferencia de los diseños al sustrato puede
hacerse en frío, utilizando adhesivos curables o mediante estampados en caliente.

Las medidas de seguridad que se les incorporen dependerán del costo de producción,
pero admite las mismas que para el papel. A modo de ejemplo se detallarán las medidas
implementadas sobre el billete de diez reales realizado en conmemoración de los quinientos
años de la fundación de Brasil.
Registro Perfecto Impresiones en Relieve
Ventana Transparente Hilo de Seguridad Fondo de Seguridad

Marca Táctil Imagen Latente Imagen Oculta

Filtro Verificador Nº 10 Visible a U.V.

tomo 1 investigación científica del delito ) 333


educación a distancia (instituto universitario de la P.F.A.)

Imágenes de Brasileros Registro Perfecto Fondos Especiales de Seguridad

Microletras Impresiones en Relieve

Registro Perfecto: cuando la rosa de los vientos es observada a contraluz, la exacta co-
incidencia del anverso y reverso permite apreciar un cambio de color en sus puntas.

Ventana Transparente: es parte del diseño de la rosa de los vientos –centro y puntas-
combina áreas transparentes con medios tonos.

Marca Táctil: la impresión sin tinta del número diez sobre la ventana transparente es
perceptible al tacto.

Hilo de Seguridad: incorporado al sustrato en el momento de su fabricación tiene la propiedad de


ser magnético lo que permite su lectura por máquinas electrónicas de conteo y selección.

Filtro Verificador: es el área roja sobre la ventana transparente y presenta en su interior el


número diez, cuyo realce puede visualizarse al doblar el billete a la mitad y hacer incidir
el filtro sobre la embarcación impresa en el anverso.

Imagen Oculta: una de las embarcaciones de Pedro A. Cabral se visualiza por transparencia en
el sector superior derecho cuando el billete es observado a contraluz. El efecto tridimensional
dado por el manejo de claros y oscuros es similar a una filigrana efectuada sobre papel.

Impresiones en Relieve: el sobrerrelieve dejado por las tintas de impresión es perceptible en el


retrato, en las leyendas “Banco Central do Brasil”, en los números y las leyendas “Dez Reais” del
anverso y del reverso, en el mapa “Terra Brasilis” y en las imágenes de brasileros del reverso.

Número 10 visible con Luz Ultravioleta: ese número es visible sobre el mapa “Terra Brasilis”
bajo la radiación de luz ultravioleta.

Fondos Especiales de Seguridad: estos fondos están conformados por líneas coloreadas
multidireccionales.

Imagen Latente: en el azulejo portugués ubicado en el sector inferior izquierdo del anverso, con
abundante luz y colocando el billete a la altura de los ojos, se visualizan las letras “BC”.

334 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

Microletras: en el sector inferior izquierdo del reverso se ha impreso con microletras


“Brasil 500 anos”, las siglas de los estados brasileros, las letras “BC” y el número “10”.

A estos billetes, una vez que se le han realizado todas las impresiones, se los
recubre con un barniz que los protege contra la suciedad y el manoseo.

La descripción de los billetes pesos, dólares y polímeros tiene como fin que el alumno
sepa cómo buscar las medidas de seguridad que permiten el reconocimiento de un billete
auténtico. Este conocimiento es útil tanto en la vida profesional como en la cotidiana por lo
que se recomienda su difusión entre familiares y amigos.

tomo 1 investigación científica del delito ) 335


educación a distancia (instituto universitario de la P.F.A.)

336 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

( BIBLIOGRAFÍA DE LA UNIDAD VIII )

Bibliografía

n SILVEYRA, Jorge y otros; “Dólar, La moneda del Siglo”; Editado por Aplicación Tribu-
taria S.A. Bs. As. 2000.

n SILVEYRA, Jorge y otros; “Falsificación de Moneda”; Ed. Policial; vol. 334. Bs. As. 2001.

n MACHADO SCHIAFFINO, Carlos; “Pruebas Periciales”; Ed. La Rocca; Bs. As. 1989

n “Revista de Policía y Criminalística”; Ed. Policial.

n Publicaciones del Banco Central de la Nación Argentina.

tomo 1 investigación científica del delito ) 337


u9
unidad nueve

( investigación científica del delito )


educación a distancia (instituto universitario de la P.F.A.)

CONTENIDOS DE LA UNIDAD IX

( INVESTIGACIÓN CIENTÍFICA DEL DELITO )

Mención sintética de los contenidos

1. Distintos tipos de peritajes balísticos.

2. Concepto de Armas.

3. Armas Propias e Impropias.

4. Tipos de armas.

5. Tipos de armas de fuego.

6. Balística en general.

7. División de la Balística según su objeto de estudio.

8. Componentes de algunas armas de fuego.

9. Identificación de las armas de fuego.

10. Aptitudes y funcionamiento de las armas de fuego.

11. Aptitudes y funcionamiento de los cartuchos a bala.

12. Partes componentes de un cartucho a bala.

13. Identificación de un arma a través de los proyectiles secuestrados.

14. Identificación de un arma a través de las vainas secuestradas.

15. Calibres.

16. Determinación de distancias de disparo.

17. Determinación de impactos.

18. Determinación de trayectorias.

19. Formas y equipos técnicos para la determinación de trayectorias.

20. Celosidad de las armas de fuego.

21. Determinación de las herramientas utilizadas en el delito.

tomo 1 investigación científica del delito ) 341


educación a distancia (instituto universitario de la P.F.A.)

342 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

abogacía a distancia oa)


objetivos de aprendizaje de la unidad

n Introducirnos en el mundo de la Balística

n Conocer su temática y principios.

n Partes en que se divide para el cumplimiento de sus objetivos.

n Conocer el concepto de Armas.

n Distinguir los distintos tipos de armas señaladas por la Ley.

n Dentro de las armas en general destacar las armas de fuego.

n Dentro de las armas de fuego, sus diferentes categorías.

n La importancia de la determinación del calibre de un arma de fuego.

n Partes constitutivas de algunas armas de fuego.

n Posibilidades de Identificación de las armas de fuego.

n Partes constitutivas de algunos cartuchos a balas.

n Aportes que pueden brindar los proyectiles y las vainas secuestradas en el lugar de los hechos.

n Orientación investigativa.

n Trayectorias de proyectiles.

n Distancias de disparo.

n Medios técnicos utilizables para sus determinaciones.

n Celosidades de las armas de fuego.

n Herramientas. Tipos e Identificación.

tomo 1 investigación científica del delito ) 343


educación a distancia (instituto universitario de la P.F.A.)

344 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

( ESQUEMA CONCEPTUAL DE LA UNIDAD IX )

BALÍSTICA Balística Interior

Balística Exterior

Balística de Efectos

ARMAS Impropias

Propias Distintos Tipos

Especialmente de Fuego

IDENTIFICACIÓN A través de los proyectiles

A través de las vainas

DETERMINACIÓN Distancias de los Disparos

Trayectorias

Celosidades

Efracciones con Herramientas

tomo 1 investigación científica del delito ) 345


educación a distancia (instituto universitario de la P.F.A.)

346 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

abogacía a distancia ai )
actividad introductoria

El ataque cotidiano –y lamentablemente también más salvaje y violento- de la delin-


cuencia, hace que hechos de real importancia sólo ocupen un pequeño lugar en la prensa.
Lea el siguiente artículo tomado del diario “Publimetro” del 30 de abril de 2001.

La muerte de un joven de 23 años asesinado con el uso de un arma de fuego, dada su


frecuencia, ya casi no es tomada en consideración ni causa la conmoción que debiera, a pesar
de que el accionar policial logra -según se desprende del mismo- la identificación del autor.

Como profesional abogado son muchos los roles que en un caso similar se puede de-
sempeñar: Juez y/o personal del juzgado, Fiscal, Defensor, Querella. Para ello es necesario
tener conocimientos esenciales en balística que hacen a la conformación o desnaturalización
de la prueba. Ese el objeto de esta unidad.

En un tema tan amplio como es la balística, sólo se podrá reseñar brevemente sus
principales lineamientos los que, empero y sin lugar a dudas, les aportarán un apreciable
auxilio en las tareas que deban desempeñar.

Reflexione, antes de introducirse en el tema cuáles, son sus conocimientos actuales


y después vuelva a revisar los resultados obtenidos.

tomo 1 investigación científica del delito ) 347


educación a distancia (instituto universitario de la P.F.A.)

348 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

( DESARROLLO DE LA UNIDAD IX )

Balistíca

Tratar un tema tan extenso como “Balística” en una unidad es una tarea tan compleja
como ilusoria, ya que sus alcances son muy variados y el tratamiento de todos y cada uno
de los temas requiere conocimientos prácticos de Física, de Química, de Criminología, de
Medicina, de Medicina Legal, del Derecho, etc.

Como se desprende de la síntesis de contenidos y del objeto de aprendizaje de esta


Unidad, sólo se efectuará un recorrido sobre los principales tópicos, con el fin de que el
alumno se mimetice con el entorno balístico y que, de resultarle de interés, lo profundice
con la amplia variedad de textos que desarrollan la temática.

Si bien de las acepciones de balística –que serán aportadas oportunamente- surge


que corresponde su intervención ante cualquier elemento lanzado por el medio que fuera
o que caiga libremente por efecto de la gravedad, en el presente desarrollo, se tratarán
únicamente los referidos a intervenciones con armas y dentro de ellas las de fuego.

Se hace necesario, entonces, definir el concepto de armas. Muchas son las defini-
ciones aportadas por aquellos que han tratado y/o tratan sobre el tema. Particularmente por
su simpleza y alcances, se estima que la siguiente cumple acabadamente con su misión,
sin que por ello se desmerezcan las otras:

Arma: es todo elemento que aumenta el poder ofensivo o defensivo del hombre.

Dentro de este alcance se encuentran las armas propias y las impropias, a las
que se puede definir de la siguiente manera:

Armas propias: son todos aquellos elementos que han sido creados para aumentar el
poder ofensivo o defensivo del hombre.

Armas impropias: son todos aquellos elementos que, no habiendo sido creados para aumentar
el poder ofensivo o defensivo del hombre, pueden ser utilizados para ese fin.

Son ejemplos de estas últimas entre otros: un palo de golf, un martillo, una madera,
una piedra, un hacha, etc.

tomo 1 investigación científica del delito ) 349


educación a distancia (instituto universitario de la P.F.A.)

Genéricamente las armas propias se las puede clasificar, entre otras, en: a) armas blancas
blancas;
b) armas arrojadizas; c) armas de proyección; d) armas de contusión y f) armas de fuego:

Armas blancas: son armas de puño que poseen una hoja de acero con o sin filo, de dis-
tintos tamaños y formas. A su vez por su acción, se las clasifican en:
1) de punta y 2) de punta y corte.
De punta: la hoja de acero sólo presenta filo o aguzamiento en su punta y como su
nombre lo indica deben ser utilizadas como armas de penetración o perforación por
incidencia de la misma. El ejemplo más claro de este tipo de armas es el florete, que
actúa por introducción de su punta provocando un orificio lesivo. De no ser utilizado
de esa manera, debe ser considerado como un arma impropia.
De punta y corte: la hoja de acero presenta además de una punta aguzada, filo en uno o
más bordes y en forma parcial o en toda su extensión, por lo que además de penetrar pro-
voca cortes laterales. El ejemplo más claro es un cuchillo o una espada. Una u otra forma
de lesionar –punta o corte- pueden ser utilizadas en forma conjunta o separada.

Armas arrojadizas: son armas de utilización manual por arrojamiento y pueden presentar
distintas formas, tamaños y composiciones, como por ejemplo: las boleadoras, el bumerán,
la lanza, la jabalina, etc.

Armas de proyección: son armas que poseen mecanismos que dotan de fuerza impulsora a
elementos especialmente preparados para causar daños. A diferencia de las anteriores están
compuestas por dos partes vinculantes: el arma de proyección y los elementos o municiones
para ser arrojados. Ejemplos: arcos y flechas; cerbatana y dardos; honda y piedras; etc.

Armas de contusión: son armas que provocan lesiones por golpe, choque o incidencia
directa. Ejemplos: el látigo, la fusta, el bastón -tonfa, la cachiporra, etc.

Armas de fuego: son armas que arrojan proyectiles a distancia, utilizando para ello la
energía resultante de la deflagración de la pólvora. Al igual que las armas de proyección
requieren de dos partes vinculantes: el arma y la munición.

Según la forma de su carga pueden ser: a) de avancarga y b) retrocarga.

Avancarga: la colocación de su carga o proyectil se efectúa por la boca del cañón, de-
pendiendo del tipo de arma el grado de complejidad de esta operación. Ejemplos: obús,
mortero, cañón, etc.

Retrocarga: son armas que se cargan por la parte posterior de su mecanismo y normalmente
tienen un almacén cargador. Ejemplos: revólver, pistola, escopeta, etc.

350 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

Las armas de fuego están reguladas por la Ley Nacional de Armas y Explosivos número
20.429 del año 1973 y su Decreto Reglamentario 395 del año 1975. Según estas disposicio-
nes las armas de fuego se clasifican en: a) armas de lanzamiento; b) armas portátiles; c)
armas no portátiles; d) armas de puño; e) armas de hombro; f) armas de carga tiro a
tiro; g) armas de repetición; h) armas semiautomáticas; e i) armas automáticas.

Armas de lanzamiento: se denominan así a aquellas armas que arrojan proyectiles o elementos
autopropulsados, granadas y municiones químicas o explosivas. Son algunos ejemplos: lan-
zamisiles, lanzagases, lanzallamas, torpederos, etc.

Armas portátiles: son todas aquellas armas que pueden ser transportadas y/o disparadas por un
solo hombre, sin requerir ayuda alguna. Ejemplos: fusiles, pistolas, revólveres, escopetas, etc.

Armas no portátiles: son todas aquellas armas que para ser transportadas o disparadas requi-
eren de la participación de más de un hombre o la cooperación de un animal o mecanismos
diversos. Ejemplos: tanques, cañones de gran porte, artillería pesada, etc.

Armas de puño: también denominadas armas cortas. Son armas de empuñe diseñadas
para ser utilizadas por un solo hombre con una sola mano, no requiriendo apoyo de otra
parte del cuerpo ni externo. Ejemplos: pistolas, revólveres, etc.

Armas de hombro: también denominadas armas largas. Son armas que requieren el uso
de ambas manos o del apoyo en el hombro del tirador y de allí su nombre. Ejemplos:
escopetas, fusiles, etc.

Armas tiro a tiro: son todas aquellas armas donde el tirador debe efectuar para cada disparo, toda
la operación de carga y descarga en forma manual. Ejemplo: escopetas, pistolón de caza, etc.

Armas de repetición: al igual que en las armas de tiro a tiro, toda la operación de carga y des-
carga la debe efectuar el tirador con cada disparo, la diferencia está en que estas armas poseen
almacén cargador para alojar los cartuchos facilitando así esta operación. Ejemplo: fusil Mauser,
escopetas a repetición.

Armas semiautomáticas: son todas aquellas armas que poseen el ciclo de descarga y carga en
forma automática y donde el tirador debe presionar la cola del disparador para cada disparo.
Ejemplo: pistolas.

Armas automáticas: son armas donde el ciclo de carga y recarga es automático y dependiendo
de la presión ejercida sobre la cola del disparador, se puede realizar desde varios disparos hasta
agotar la carga del almacén cargador. Ejemplo: pistolas ametralladoras.

tomo 1 investigación científica del delito ) 351


educación a distancia (instituto universitario de la P.F.A.)

Por su ánima –hueco conformado por las paredes interiores del cañón de las armas
de fuego, estas armas pueden ser de ánima lisa o ánima rayada. En las correspondientes al
primer tipo, las paredes interiores del cañón son lisas y pulidas no presentando ningún tipo
de relieve. Las que poseen ánima rayada presentan estriado o depresiones hechas por un
troquel, que tienen como función dotar al proyectil de un movimiento helicoidal giroscópico
que lo estabiliza, asegurando una correcta trayectoria direccional.

Son ejemplos: el pistolón de caza, las escopetas, etc. para las armas de ánima lisa,
y las pistolas, revólveres, ametralladoras, etc. para las de ánima rayada.

Efectuadas estas consideraciones se hace necesario ahora introducirnos en el concepto


de Balística (vocablo cuya etimología es de origen latino, proveniente de la palabra “balista” -y
ésta del griego “ballein” arrojar, denominándose así a una máquina de guerra antigua -especie
de ballesta grande- que servía para arrojar saetas, balas, etc.) definiéndosela como:

Balística: es la ciencia o arte de calcular la dirección y alcance de los proyectiles.

Estudia asimismo en forma integral a las armas de fuego, a sus municiones, y den-
tro del amplio concepto que abarca el término proyectil, engloba a cualquier cuerpo que
pueda ser lanzado al aire por cualquier medio –manual o neumático- o bien que caiga por
su propio peso y también a los efectos que éstos provocan.

En base a los objetos temáticos que abarca, se la divide en tres grandas ramas o
partes fundamentales: a) balística interior; b) balística exterior y c) balística de efecto,
las que se analizarán por separado.

Balística Interior: tiene a su cargo el estudio de todas y cada una de las partes o piezas com-
ponentes de un arma, tendiente a determinar sus estados, sus calidades y capacidades y las
interrelaciones sincrónicas con las demás. Asimismo la realización de idénticos estudios con
relación a los cartuchos a bala correspondientes al arma. Del análisis surgido se determina las
aptitudes para el disparo y el funcionamiento de las armas de fuego y de sus municiones.

Corresponde también a la balística interior, todas las determinaciones mecánicas


y fácticas que hacen a la producción de un disparo hasta que el proyectil abandona la
boca del cañón, es decir, desde que el percutor activado por el accionamiento de la cola
del disparador provoca la electricidad o chispa necesaria para la combustión de la carga
propulsora, que dota al proyectil -a través de la fuerza expansiva de los gases producidos-,
del necesario ángulo de inclinación para su entallado en las estrías, de velocidad, de giro
alrededor de su eje, de forzamiento y dirección para que abandone el ánima del cañón a

352 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

través de su boca, hasta –en las armas semiautomáticas o automáticas- realizar los mov-
imientos de expulsión de la vaina servida y el alojamiento del nuevo cartucho, para dejar al
arma preparada para efectuar un nuevo disparo.

Balística Exterior: comienza cuando el proyectil, así dotado de velocidad y rotación sobre su eje
–que le permitirá dirigirse hacia el blanco con estabilidad y precisión, inicia su trayectoria inme-
diatamente después de abandonar la boca del cañón. A partir de allí irá sufriendo las incidencias
de las fuerzas de resistencia del aire y de la gravedad, que le hacen perder velocidad y, por ende,
alcance y lo atraen hacia el suelo, provocando que la trayectoria sea una curva parabólica.

También influyen sobre el proyectil los siguientes factores atmosféricos: a) el peso del
aire: que depende de la presión atmosférica, de su densidad, del coeficiente de hume-
dad, de la temperatura y de la altura a nivel del mar; y b) el viento: que frena, aumenta
su velocidad o lo desvía lateralmente, ya sea que influyan de frente, desde atrás o de los
costados respectivamente.

Corresponde entonces a la balística exterior, el comportamiento del proyectil desde


que abandona la boca del cañón hasta que alcanza el blanco o cae por su propio peso.

Balística de efecto: como su nombre lo indica estudia la acción o efectos que el proyectil
provoca al impactar -sea en el blanco deseado o no- sobre personas, animales o cosas.
Además de los factores que intervienen sobre el proyectil en los dos componentes de la
balística –interior y exterior- ya analizados, la penetración y/o perforación que provocará
al impactar, estará en relación directa con la naturaleza constitutiva del objeto alcanzado,
del proyectil y de otros factores imponderables.

El blanco puede ser de naturaleza blanda –cuerpos humanos, animales, etc.- o dura –cu-
erpos rígidos-. Dentro de las propiedades físicas del blanco o del proyectil que influyen sobre los
efectos que éste puede provocar, se pueden mencionar las siguientes: dureza; flexibilidad; aus-
encia de defectos o anomalías constitutivas; rebotes o saltos sufridos luego de haber impactado
sobre otra superficie; deformaciones; lugares de impacto –músculos, huesos, plegados, dobleces,
soldaduras, bordes, etc.-; ángulos de tiro, de impacto o incidencia y de penetración; etc.

Como se comprenderá de lo detallado, la problemática balística es realmente muy amplia.


A los efectos de esta materia se efectuará un recorrido sobre los principales temas. De todas
las armas detalladas -por la frecuencia de su uso en el campo delictivo- sólo nos referiremos a
las de puño o cortas, y en ellas a las diferencias fundamentales entre sus dos principales tipos:
los revólveres y las pistolas.

tomo 1 investigación científica del delito ) 353


educación a distancia (instituto universitario de la P.F.A.)

Revólveres: a pesar de la gran cantidad de modelos, marcas, calibres y largos de cañón


existentes, su funcionamiento es, básicamente, común a todos. La totalidad de los modelos
poseen una armadura que sostiene todas las piezas y permite su empuñe. El resto de su
descripción requiere pormenores de sus: a) calibres; b) largos de cañones y de municiones;
c) mecanismos de disparo; d) sistemas de percusión y e) sistemas de carga.

Calibre: es una de las características más relevante de un arma de fuego y se refiere al diámetro
interior de sus cañones o diámetro de sus ánimas y por extensión al diámetro de los proyectiles
por ellas disparados. La boca del cañón o abertura que da al exterior se denomina “boca de
fuego”, cuya medida es la que conforma o determina el calibre del arma. La bala del
cartucho es de dimensión superior a la boca de fuego para poder recibir, al ser impulsada
por los gases de la deflagración de la pólvora, el forzamiento requerido para adquirir, en
forma aumentada, el impulso que lo arroja a gran distancia.

En los cañones de ánima rayada el calibre se mide a nivel de los macizos –ya
que corresponde a la medida del ánima virgen, es decir, antes de efectuarse el estriado.
Por contrario imperio en los proyectiles se mide sobre los campos, que corresponde
al diámetro del proyectil antes de su deformación por el forzamiento producido por
la deflagración de la pólvora. En las figuras adjuntas se observa la forma de medir el
calibre en un proyectil y en el ánima de un cañón.

Calibre tomado sobre los campos del proyectil.

Calibre tomado desde los macizos del ánima del cañón

354 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

Largo del cañón y de las municiones: se debe tener en cuenta que la longitud del cañón permite
una mayor precisión en la trayectoria del proyectil. Dentro de un mismo calibre pueden presen-
tarse distintos largos de cañón (2, 4, etc. pulgadas) y de los cartuchos a bala, denominándoselo
por ejemplo: 32 corto o 32 largo.

Sobre el cañón se encuentra el sistema de puntería compuesto por el guión y el alza.


La correcta utilización de estos elementos corrige el efecto de la gravedad sobre el proyectil
(alza) y facilita una correcta puntería.

Mecanismo de disparo: pueden ser de simple o doble acción. En los primeros para poder
concretar un disparo, se hace necesario primeramente montar el martillo –desplazándolo hacia
atrás. En los de doble acción el disparo se produce simplemente al ejercer presión sobre la
cola del disparador.

La acción del martillo sobre el percutor produce el estallido de la cápsula fulminante


que da comienzo al proceso de disparo, el que será descrito conjuntamente con las partes
de los cartuchos a bala. Dentro de las diferencias en el mecanismo de disparo se aclara que
el percutor puede estar fijo en forma solidaria o conjunta con el martillo, móvil –es parte del
martillo pero tiene posibilidades limitadas de movimiento y/o flotante –separado del martillo
y dentro de un resorte que permite su recuperación.

Sistemas de percusión: se distinguen tres sistemas de percusión: percusión de fuego central,


periférico o anular y lateral. Los primeros –central- poseen la cápsula con el fulminante en la
zona central del culote de la vaina. Los segundos –periféricos o anular- el anillo periférico externo
posee el fulminante y en cualquier sector de éste que incida el percutor se produce la ignición
y el consecuente disparo. Los de percusión lateral son muy antiguos y constituyen verdaderas
piezas de museo -como los denominados “Lafouchette”-. Los cartuchos poseen una púa o
pivote en el lateral de la vaina y próxima al culote, que al ser golpeado por el martillo se desplaza
al interior golpeando sobre el fulminante, provocando la ignición.

Sistemas de carga: el almacén cargador de un revolver se denomina “tambor” y los compartimien-


tos para alojamiento de cada uno de los cartuchos a bala se denominan “alvéolos”. Para su carga
debe procederse según el sistema que posea, distinguiéndose entre otros los siguientes:

a) de tambor volcable a la izquierda o a la derecha. Esto permite extraer las vainas y


colocar los cartuchos en cada alvéolo;

b) de tambor extraíble es decir que para la carga y descarga se debe extraer el tambor
de la armadura;

tomo 1 investigación científica del delito ) 355


educación a distancia (instituto universitario de la P.F.A.)

c) de cañón y tambor articulables en una sola pieza que se quiebra y se desplaza hacia
abajo dejando al descubierto los alvéolos para su carga y

d) de retén volcable donde a la izquierda o derecha del tambor hay un retén que se
puede desplazar dejando al descubierto un alvéolo para su carga, girando el tambor
luego de cargar cada alvéolo individualmente.

Obsérvese en la figura siguiente las partes principales de un revólver.

Pistolas: son armas de puño semiautomáticas donde el tirador una vez accionada la corredera
y colocado el cartucho a bala en posición, sólo debe efectuar pulsaciones sobre la cola del
disparador para provocar tantos disparos como cartuchos permita su almacén cargador.
Acorde a los diferentes modelos y marcas pueden variar en calibre, cantidad de cartuchos en
el almacén cargador, ser de simple o doble acción, tener martillo a la vista u oculto, siendo
su percutor normalmente flotante.

Colocado el cartucho en posición –por accionamiento de la corredera que lo extrae


del almacén cargador- el arma se encuentra en condiciones de ser disparada. Producido el
disparo, la acción de los gases provocados por la deflagración de la pólvora no sólo expulsa
al proyectil, sino que desplaza hacia atrás la corredera permitiendo la expulsión de la vaina
servida y la carga de un nuevo cartucho durante el movimiento de recuperación del resorte.

Las piezas básicas de una pistola son:


a) la armadura, que sostiene las diversas piezas del arma;
b) la corredera, que contiene el aparato de puntería y que se desplaza -por acción de los
gases de la deflagración de la pólvora y del resorte o espiral recuperador- hacia atrás
y hacia delante sobre las guías ubicadas en la armadura;
c) el retén de la corredera, que la traba y la mantiene abierta una vez que se agotó la carga
del almacén;

356 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

d) el cañón, normalmente desmontable ubicado en el interior de la corredera;


e) el extractor, ubicado en la corredera y que a través de su uña extractora tiene como
misión extraer las vainas servidas de la recámara, arrastrándolas hasta su expulsión;
f) el botador, ubicado en la parte posterior de la armadura que tiene como misión expulsar
las vainas servidas por la ventana de la corredera;
g) el almacén cargador ubicado en la empuñadura, que tiene como tarea el contener los
cartuchos a bala que luego serán desplazados por la corredera a la recámara y
h) el mecanismo de disparo que produce una vez accionada la cola del disparador, la caída
del martillo sobre el percutor, que al golpear la cápsula fulminante produce el disparo.

Obsérvese en la figura siguiente las partes principales de una pistola.

Munición y /o cartuchos a bala: El inciso 22 del artículo 3º del Decreto reglamentario 395/75
–de la Ley 20.429- enuncia como munición a la designación genérica de un conjunto de
cartuchos o tiros. En tanto que el término cartucho que –deriva del italiano cartoccio y éste
del latín charta (papel)- significa carga de pólvora y municiones o de pólvora sola que cor-
responde a cada tiro de un arma de fuego. Podemos definir entonces:

Cartucho a bala; es la unidad de carga de un arma de fuego y puede ser de fuego


anular, central y periférico.

tomo 1 investigación científica del delito ) 357


educación a distancia (instituto universitario de la P.F.A.)

Se hace necesario aquí aclarar dos términos que normalmente son mal utilizados.
Se denomina bala a la parte integrante de un cartucho a bala –cuyas características
topográficas se describirán a continuación- mientras no haya sido disparado. Se denomina
proyectil a la bala que ha sido separada del cartucho y disparada por acción de los gases
de la deflagración de la pólvora. Asimismo se aclara que el término deflagración indica
la acción y efecto de arder súbitamente una sustancia con llama pero sin explosión.

Se ilustra con la siguiente figura a modo de detalle de sus componentes, la topografía


y la nomenclatura de un cartucho a bala de calibre. 45 tomado como ejemplo:

Dentro de los diferentes componentes de un cartucho a bala un lugar muy especial


lo ocupan las vainas que parten de un disco metálico que tratado en forma sucesiva con
prensas, tornos y taladros alcanza su configuración final. Sus partes no poseen igual es-
tructura, ya que requieren zonas elásticas –cuello y hombro- y otras de gran dureza –parte
trasera- para cumplir eficazmente con su tarea. Entre los materiales utilizados en su fabri-
cación pueden mencionarse: el latón, el acero, el acero recubierto con estaño o tungsteno,
aluminio, níquel y el amplio campo que presenta la utilización de plásticos sintéticos.

358 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

El culote de las vainas de las pistolas posee un reborde y un canto de reborde


que sirve de enganche a la uña extractora. Todas tienen una cápsula con el fulminante
enfrentada a un yunque. Cuando el percutor golpea sobre ella se deforma y al incidir
sobre el yunque se produce la chispa necesaria para iniciar el proceso del disparo. La
ignición se trasmite al interior de la vaina a través de dos oídos comunicantes, iniciando
la deflagración de la pólvora allí alojada.

La pólvora que se encuentra en estado sólido, al combustionarse pasa a un estado


gaseoso requiriendo mucho más espacio, por lo que ejerce presión hacia todas direcciones.
La parte más vulnerable, la que ofrece menos resistencia, es la del cuello de la vaina donde
se encuentra engarzada la bala de plomo.

La bala posee un núcleo que puede estar o no recubierto por una camisa metálica pre-
sentando una punta y una ojiva las que son de menor diámetro que el resto, separado por el
resalto de forzamiento. Entre este resalto y el chaflán del culote de la bala se encuentra la zona de
forzamiento o zona útil del proyectil donde se estampan las características del ánima del arma.

INVESTIGACIONES BALÍSTICAS CRIMINALÍSTICAS: Ocurrido un hecho, al practicarse la inspec-


ción ocular o retrato del lugar se dispondrá prioritariamente la intervención de los diferentes
peritos, que determinarán los testigos mudos que han quedado en el lugar y a partir de los
cuales se tratará de dilucidarlo. Dentro del tema balístico específico de esta unidad, se deberán
efectuar durante esa inspección y en los laboratorios periciales, todas las diligencias tendientes a
dilucidar algunos interrogantes que aportarán datos de interés para la investigación del caso.

Dentro de las muchas determinaciones balísticas a realizar se pueden men-


cionar las siguientes:
a) determinación de trayectorias del disparo;
b) determinación del tipo de arma utilizada partiendo de los proyectiles o de las vainas
secuestradas;
c) determinación de fecha del disparo;
d) determinación de celosidad del arma;
e) determinación del arma utilizada a través del proyectil o vaina secuestrado y
f) determinación del orificio de entrada y de distancias del disparo.

Determinación de trayectorias del disparo: se denomina trayectoria a la línea que describe


un proyectil en el espacio y su determinación dependerá, fundamentalmente, de la dis-
tancia y del tipo de lugar donde se produzcan. Tomando como lugar una ciudad y sus
características edilicias, en distancias superiores a setenta metros los cálculos se efectúan

tomo 1 investigación científica del delito ) 359


educación a distancia (instituto universitario de la P.F.A.)

en base a tablas balísticas de caídas de proyectiles. Cuando no se supera esos valores


–salvo en cartuchos destinado a fines específicos- su recorrido será no parabólico, es
decir rectilíneo, lo que permite su establecimiento.

La determinación de la trayectoria de un proyectil puede ser precisa o relativa depen-


diendo de la cantidad de puntos afectados. De determinarse al menos dos puntos afectados
por el mismo proyectil sin desviaciones, la trayectoria será precisa, es decir se puede establ-
ecer el lugar de donde partió el mismo. Para ello se debe trazar una línea imaginaria entre los
centros de ambos puntos de impacto. La prolongación de esa línea hacia el lado contrario del
recorrido original del proyectil, nos indicará el lugar exacto desde donde partió el disparo.

La reconstrucción de esa línea se efectúa a través de un hilo o cuerda que pasa por
el interior del centro geométrico de ambos orificios lo suficientemente tensada como para no
formar curvatura. Alineando ambos ojos con la cuerda hacia el lado exterior del primer impacto,
se establece en forma precisa la trayectoria. Actualmente se sustituye el tendido de la cuerda
por una luz láser bidireccional, que colocada en una posición intermedia a ambos puntos de
impacto y haciéndosela pasar por sus centros, su prolongación señala la posición del tirador.

Para ello deben establecerse las siguientes angulaciones:


a) ángulo de tiro: es el conformado por la recta paralela al suelo (horizontal) y el eje longi-
tudinal del cañón del arma, tomándoselo desde el centro de la boca de fuego y

b) ángulo de incidencia: es el formado por la horizontal del orificio de entrada –en cuerpos
móviles (personas, animales, vehículos, etc.) debe tenerse en cuenta su posición en el
momento del alcance- y la trayectoria del proyectil.

En la siguiente figura se observa la demarcación de la línea de trayectoria de un


proyectil que ha ingresado por la ventana de una habitación perforando su vidrio e impac-
tando sobre una pared para caer luego al suelo por falta de fuerza de penetración.

360 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

De contarse con un solo punto de impacto de un proyectil –por ejemplo sobre el


vidrio de la ventana pero sin impactar sobre la pared por falta de fuerza- la trayectoria se
busca de igual manera pero su determinación no será precisa sino relativa, por falta de
datos técnicos para su medición.

Determinación del tipo de arma utilizada partiendo de los proyectiles o de las vainas se-
cuestradas: ocurrido un hecho y secuestradas en el lugar vainas o proyectiles de armas
de fuego, se puede orientar la investigación en la búsqueda de los posibles tipos de armas
que pudieron haberlas disparado. Como en todos los casos de determinación indirecta de
identidad, los estudios son por descarte, es decir por eliminación de todas aquellas armas
que no pudieron haber disparado esos elementos. Como las características son diferentes,
si se parte de vainas o de proyectiles, se los tratará por separado.

Datos que aportan las vainas: normalmente en el lugar del hecho las vainas encontradas
son de pistolas o armas semiautomáticas en las que, como ya se indicara, sus descargas
y cargas son automáticas. Sin embargo también es posible hallar vainas correspondi-
entes a revólveres –cuando se ha efectuado el recambio de la carga de su tambor-. Las
presencias de reborde y de su canto que son indicadoras de vainas de pistolas –para
enganche de la uña extractora-, no indican que hayan sido disparadas por ellas, ya que
pueden utilizarse en revólveres como por ejemplo las de calibre 32 y 45.

Se debe determinar primeramente el calibre de las vainas –de esta manera se


descartan todas aquellas armas que posean calibre distinto. Si bien muchas vainas tienen
estampado en sus culotes el calibre y la marca del fabricante, su determinación se efectúa
por medición y comparación con el muestrario de colección de todas las municiones o
cartuchos a bala de producción nacional o extranjera que, debidamente clasificados por
calibres y armas, debe tener todo profesional balístico. Determinado así, debe verificarse
por comparación de una vaina disparada con armas de ese calibre.

Si la vaina hubiera sido disparada por un revólver, únicamente se encontrarán sobre


ella las marcas dejadas por la acción de la aguja del percutor y de la fricción contra su es-
paldón, siendo muy difícil la determinación de los tipos posibles de arma empleada, ya que
sólo se poseen los datos de calibre, tipo de sistema de percusión –central, anular, lateral- y
su forma. De cualquier manera se habrán descartado varias marcas y modelos.

Si las vainas fueron disparadas por pistolas, además de los datos ya mencionados
se determinarán sobre ellas las marcas del extractor, del botador –salvo en aquellas pis-
tolas que esta tarea es ejercida por los labios del cargador o el extractor-, de los labios del
almacén cargador y de la recámara.

tomo 1 investigación científica del delito ) 361


educación a distancia (instituto universitario de la P.F.A.)

Las diversas huellas que dejan en el culote de las vainas –en sus bordes o en su
porción central- el percutor, la fricción sobre el espaldón, la uña y/o el extractor, y el botador
son muy útiles para la determinación del arma empleada, especialmente las ubicaciones
relativas del botador y el extractor, ya que las angulaciones que forman son características
de marcas y modelos de armas. A esto se le deben sumar los surcos o estrías que sobre
su superficie cilíndrica, dejan los labios del almacén cargador y la recámara.

Si bien en la mayoría de las armas semiautomáticas las expulsiones de las vainas


son hacia la derecha, en unas pocas son a la izquierda y en otras hacia arriba. Estos
sistemas se pueden establecer, teniendo en cuenta la posición de la vaina dada por
la huella circular provocada en los bordes del culote por el cañón. Teniendo en cuenta
esto, los autores Metzger, Hees y Heslacher han distinguido seis tipos de huellas de
expulsión y ocho tipos de huellas provenientes del cañón, efectuando tablas por los
diámetros del alojamiento del percutor y por el sistema de expulsión.

La sumatoria de todos estos elementos permiten descartar las armas que no


han podido disparar esas vainas, detallándose según los casos, las marcas y modelos
que sí son compatibles con su disparo.

Datos que aportan los proyectiles: son generalmente más precisos que los aportados por
las vainas. Se hace mención que los proyectiles incriminados secuestrados en el lugar del
hecho o extraídos de las víctimas pueden encontrarse: a) íntegro y sin deformaciones;
b) íntegro pero con deformaciones parciales o totales y c) incompleto.

Acorde el estado en que se encuentran, la determinación del calibre presentará o no


dificultades. De estar íntegro y sin deformaciones se obtiene midiendo con un calibre dos estrías
opuestas y determinando su peso –los de igual aleación- o su peso específico –los de distinta o
desconocida aleación, a través de una balanza hidrostática. De estar completo, pero deformado
o aplastado en forma total o parcial en su parte útil de manera tal que no sea posible medir dos
estrías opuestas, se lo debe medir por su culote, el que normalmente no sufre deformaciones y
efectuarse idénticas determinaciones de peso. Si está incompleto se efectuarán las mediciones y
pesos posibles, acorde a los porcentuales estimativos de pérdidas sufridas y se compararán con los
valores de las tabulaciones de aquellos proyectiles que lógicamente pudieran ser compatibles.

Obtenido el calibre quedan automáticamente descartadas todas aquellas armas que no


coincidan con él. Del estudio del proyectil se pueden determinar, además, los siguientes elementos
que aportaran datos para la determinación del tipo –marcas y modelos- del arma utilizada:
a) cantidad de estrías; b) ancho de las estrías; c) dirección de las estrías y d) paso de la espira.

362 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

Con respecto a a) cantidad de estrías, –lo común es que sean cinco o seis pero pueden
ser entre cuatro y ocho-, debe determinarse cuantos macizos y cuantos campos posee
teniéndose en cuenta que éstos son fijos pero no excluyentes para una determinada marca
y modelo de arma. En cuanto a b) su ancho, también lo son, pero debe considerarse que,
dentro de una misma marca y modelo, -por desgastes de troquel empleado- pueden llegar
a tener diferencias de 0,002 de pulgada. Por c), la dirección o inclinación más común es de
izquierda a derecha, pero también puede ser de derecha a izquierda como en las pistolas
Colt calibres 25, 32, 38 y 45. Con relación a d) el paso de la espira, se obtiene midiendo
el recorrido de un campo y su relación con una vuelta o recorrido completo ideal.

Obtenidos estos datos y del cotejo con el fichero de armas de fuego, se descartan
aquellas que se diferencien y se detallan las que se correspondan. Teniendo en cuenta que
el fichero puede estar desactualizado, se debe informar -al igual que con las máquinas de
escribir analizadas en la unidad correspondiente- que puede tratarse además, de otra arma
que presente las mismas características de las detalladas.

Determinación de fecha del disparo: el paso del proyectil por el ánima del cañón al ser dis-
parado, va acompañado de residuos o productos originados por la deflagración completa o
incompleta de la pólvora, sus gases, etc. Como estos restos no son inertes, la teoría indica
que de su correcta interpretación se podría determinar lo que se ha dado en llamar “fecha
o tiempo del disparo”. Sin embargo, hasta el presente no se ha logrado un método técnico
científico que permita responder a esa requisitoria en forma categórica y fundada.

Una serie de factores intrínsecos, extrínsecos e inciertos dados por las diferencias en los
tipos de armas, en sus municiones, la cantidad de disparos efectuados, temperatura y humedad
ambiente, la falta de mantenimiento o cuidados sobre el arma, etc. conspira para la determinación
de una ecuación que permita mensurar la evolución o transformación de esos residuos.

Del hisopado del ánima del cañón y de los alvéolos en los revólveres, se podrán
recoger los restos allí depositados, los que serán sometidos a reconocimientos físicos y
químicos. Acorde a lo hallado, se podrá determinar: a) la presencia de partículas de dife-
rentes formas y tamaños, de color negruzco, sin restos de lubricantes u óxidos, que
podrían corresponder a restos de deflagración de pólvora. Su fehaciente determinación
se efectúa con procedimientos químicos, que procuran la identificación de sustancias
oxidantes, preferentemente nitratos o nitritos. Determinados los mismos se establecerá
que el arma fue disparada; b) la presencia de herrumbre. Por medio de sensibles téc-
nicas analíticas se podrá determinar la aparición o ausencia de sustancias oxidantes
y nitritos. De no determinarse se afirmará que el arma no ha sido disparada; y c) la

tomo 1 investigación científica del delito ) 363


educación a distancia (instituto universitario de la P.F.A.)

presencia de aceites lubricantes. Esto es determinante de una limpieza del arma, por
lo que se puede informar que la misma no ha sido disparada después de su limpieza,
no pudiéndose determinar la fecha en que ésta ha sido realizada.

De lo expuesto surge que hasta que nuevos métodos o técnicas permitan otras
determinaciones, sólo es posible informar que un arma a) ha sido accionada; b) que no
lo ha sido; o c) que ha sido limpiada y por lo tanto no es posible expedirse.

Determinación de celosidad del arma: se denomina celosidad a la fuerza de tracción


que se debe ejercer sobre la cola del disparador de un arma de fuego, para que el
disparo se produzca. Lógicamente, debe mensurarse en toda arma de doble acción, la
fuerza necesaria para producir el disparo estando el martillo montado (acción simple)
y la necesaria si no lo estuviera (doble acción).

Los procedimientos de mensura que brindan mayor exactitud son los obtenidos me-
diante el promedio de los valores logrados en repetitivas experiencias, con la utilización de
dinamómetros u otros instrumentos de tecnología electrónica. Cotejados dichos resultados
con la tabla de valores promedio de celosidades obtenida con diferentes armas o con los
datos originales de fábrica, se podrá cotejar si son coincidentes, mayores o menores. En
caso de resultar un valor inferior se podrá concluir que el arma es celosa.

Determinación del arma utilizada a través del proyectil o vaina secuestrada: se hace
necesario aquí hacer una breve referencia sobre lo que se ha denominado personalidad
de un arma de fuego. Toda arma de fuego posee una personalidad bien definida que
la diferencia y distingue de las demás armas de la misma marca y modelo y puede ser
identificada a través de las representaciones que se imprimen en la zona de forzamiento
o útil del proyectil y en el cuerpo de la vaina por ella disparada.

Lógicamente habrá semejanza –recordar la diferencia con identidad- en todas aquel-


las armas de la misma marca y modelo que fueron producidas en la misma serie y por las
mismas herramientas. Esas semejanzas estarán dadas en su diámetro, número, ancho y
dirección de las estrías y el paso de su espira, empero cada una de ellas tendrá caracter-
ísticas individuales que las hacen únicas.

El rayado o estriado efectuado al ánima del cañón de un arma para que los proyectiles
disparados por ella adquieran un giro sobre su eje y un movimiento giroscópico que le da
más efectividad, le confieren asimismo la personalidad necesaria para identificar al arma
con la cual fueron disparados.

364 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

Para su realización se utilizan los siguientes métodos:


a) fresa por raspado: es una barra de diámetro más pequeño que el ánima del cañón que
presenta una o dos secciones de acero endurecido, que por raspado efectúa una –en
caso de tener estriado impar- o dos estrías por pasada;

b) fresa en forma de gancho: es una barra también de diámetro más pequeño que el
ánima, que presenta un sistema de corte en forma de gancho –similar a una aguja de
croché- que produce el estriado en forma muy lenta –uno por vez-;

c) por broca o escariado: consiste en una barra con anillos de acero endurecido –entre 25
y 30- que presenta diferentes diámetros y se encuentran dispuestos de menor a mayor,
formando talladores múltiples al tener ranuras intercaladas a intervalos regulares. Todas
las estrías se realizan en una sola pasada;

d) por trefilado: este puede ser por varilla o por mandril de acero duro que entra ajusta-
damente comprimiendo el ánima a presión y provocando el estriado y

e) por martelado: que se realiza con máquinas que poseen martillos que en forma conjunta
golpean sobre la superficie externa del cañón y sobre un peregrino con la forma del
estriado, ubicado en su interior.

Los dos primeros sistemas dejan, además, en cada estriado un complejo de rayas pro-
ducido por las irregularidades de las secciones de corte, que presentan muescas por la acción
del afilado. Si bien con una sola fresa –por raspado o en forma de gancho-, broca, trefilador o
martelado se pueden realizar muchos rayados –lo que a prima facie podría suponer la producción
de iguales características- cada pasada ocasiona desgastes por fricción sobre esos elementos,
modificándolos y modificando consecuentemente las formas del siguiente estriado.

Los cañones si bien están confeccionados en serie, el acero -a pesar de pertenecer


a una misma colada- no siempre se distribuye en forma homogénea provocando zonas de
durezas diferentes. Además las herramientas de corte, de lijado y tallado, en su accionar,
dejarán sobre los mismos características que lo hacen únicos y diferentes por el arrastre
de virutas y movimientos de entrada y salida. Si a ello se le suman las características pro-
vocadas por el estriado, cada cañón habrá adquirido su propia personalidad.

Identificación de proyectiles: como se ha detallado en la descripción de los cartuchos a


bala, ésta última presenta su punta y su ojiva de un tamaño menor que el ánima del cañón,
pero su zona de forzamiento o útil de tamaño mayor. Esto provoca que al pasar por el
cañón estriado a muy alta presión se expanda y lo ocupe completamente, registrando así
las marcas o huellas del cañón tanto en sus campos como en sus macizos.

tomo 1 investigación científica del delito ) 365


educación a distancia (instituto universitario de la P.F.A.)

Estas marcas pueden ser reiteradas o accidentales. Las primeras son las que de-
terminan identidad y se detallarán a continuación. Las segundas pueden ser útiles a la in-
vestigación de un hecho en particular, pero al no producirse en forma regular en todos los
proyectiles disparados por una misma arma, no sirven a los fines de la identificación.

Lo ideal sería que las marcas se reproduzcan exactamente igual en todos los campos y
macizos de todos los proyectiles disparados por una misma arma. Sin embargo en la práctica,
esto se da muy pocas veces debido a múltiples factores: encamisado, dureza del plomo, tamaño
y estado de los proyectiles; irregularidades en el comienzo del estriado o en la boca del cañón
por constricción o rebabas; desalineo de los alvéolos del tambor del revólver con el ánima del
cañón, etc., las que pueden constituirse a su vez en particularidades identificativas.

Para lograr la identificación del proyectil incriminado se requiere la obtención de


proyectiles testigos, utilizando para ello el mismo tipo de munición en cuanto a marca, año de
fabricación, características, etc., y de ser posible, la proveniente de la munición secuestrada
con el arma. Estos deben obtenerse de manera tal que estén completos y que no adquieran
características o huellas adicionales. Los procedimientos más utilizados son los de efec-
tuar disparos sobre algodón limpio, aserrín aceitado, estopa o lana, utilizando dispositivos
recuperatorios especiales. También es posible su recuperación utilizando un medio líquido
como ser, por ejemplo, agua o –acorde al espacio de los recipientes- otros líquidos de mayor
peso específico obtenido mediante el agregado de sustancias apropiadas.

Si bien se han utilizado distintos procedimientos y métodos para la comparación de


los proyectiles incriminados y testigos, desde el advenimiento de la extraordinaria herramienta
que es el microscopio de comparación, la tarea del perito es más simple y precisa. Este
microscopio es, en realidad, dos microscopios unidos por un puente donde se proyecta la
imagen de ambos objetivos que pueden ser observadas, yuxtapuestas y comparadas simul-
táneamente. Los más modernos poseen además documentación fotográfica computarizada
y adaptadores para videocámaras que permiten estudios indirectos por monitores color.

De esta manera es posible colocar los proyectiles –incriminado y testigo- uno en cada
platina observando su imagen proyectada. Localizada sobre el incriminado una zona –campo o
macizo- donde puedan visualizarse los complejos lineales formados por su paso forzado por el
ánima del cañón, se debe girar el testigo hasta localizar la misma zona –campo o macizo. Yux-
tapuestas ambas imágenes se debe verificar la presencia de características coincidentes.

De hallarse características, éstas deben reunir los mismos requisitos exigidos para
establecer identidad papiloscópica. Las líneas, puntos o detalles característicos deben estar

366 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

igualmente situados –campo o macizo, ubicados –arriba, abajo o centro de un campo o de


un macizo- y dirigidos -las angulaciones o ramas deben estar orientadas de igual manera.

Obsérvese en las figuras siguientes las correspondencias estriales determi-


nantes de identidad, entre dos proyectiles yuxtapuestos comparados.

Identificación de vainas servidas: Por similares características de producción o fabricación


de las diferentes piezas constitutivas de las armas de fuego -el acero no distribuido en
forma homogénea, la acción de las herramientas de corte, de lijado y tallado, posiciones,
encastres, etc. -a lo que se le suma la insuficiente o incorrecta limpieza u oxidaciones-, le
confieren desigualdades, rugosidades, asperezas, etc. a la superficie del espaldón, que
se transmiten a las vainas cuando éstas retroceden y golpean contra él bajo la presión de
los gases de la deflagración de la pólvora. Estas marcas son normalmente semejantes a
las dejadas por un proceso de impresión por cuño.

La forma -extremos planos, romos, redondeados, ahusados, puntiagudos, rotos,


desgastados; ubicación –ángulo de golpe- y complejos lineales –de fabricación y de uso-
producidos por el golpe del percutor o –según el tipo de arma- de la aguja del percutor,
del extractor y no muy frecuentemente del botador, constituyen junto con las del espaldón,
el medio para identificar las vainas servidas.

tomo 1 investigación científica del delito ) 367


educación a distancia (instituto universitario de la P.F.A.)

Obsérvese en la siguiente figura, la yuxtaposición de las marcas dejadas por el percutor


de un arma de fuego, donde se puede visualizar la correspondencia de los complejos lineales.

Determinación del orificio de entrada y de distancias del disparo: las heridas causadas
por armas de fuego se caracterizan por las lesiones que provocan sus proyectiles, las
altas temperaturas y los gases y restos de la pólvora deflagrada, a lo que hay que sumarle
los elementos neorformados como son los torbellinos, las ondas sónicas, etc.

Dentro de la balística criminalística se encuentra la determinación de los orificios de


entrada y salida en cuerpos orgánicos y la determinación de las distancias de los disparos.
Este accionar criminalístico tiene estrecha vinculación con el médico legal que trata los
mismos temas, además de las trayectorias internas de los proyectiles.

A los efectos de determinar desde donde fue alcanzado un cuerpo por el proyectil, se
hace necesario distinguir entre el orificio de entrada y el de salida. Debido a la musculatura que
poseen los cuerpos humanos y animales y por ser esta elástica, no es posible determinar el
calibre de los proyectiles que ingresaron al mismo a través de estos orificios, ya que sus medidas
pueden ser mayores, iguales o menores, dependiendo del tipo de proyectil, de sus movimientos,
de los factores neoformados, ángulos de posición y de llegada, zonas de ingreso -que pueden
presentar diferencias elásticas, de grosor o partes óseas, penetración, deformaciones, etc.

Téngase presente que si el proyectil presenta una ojiva aguda y penetra en forma
perpendicular, el orificio de entrada será redondeado y de diámetro más pequeño; pero si
penetra tangencial u oblicuamente producirá equimosis, escoriación y herida en canal o lesión
semilunar, respectivamente. Además, acorde a la fuerza de penetración –mucha o poca-,
producirá lesiones en fondo de saco o sólo una contusión sin penetración.

368 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

El orificio de entrada: se determina por la presencia del denominado halo o zona de Fish. Este halo
está conformado por dos anillos que puede presentarse en forma completa o no y se conforman
por el paso del proyectil a través de la piel y musculatura. El primero lo conforma el golpe o choque
de la ojiva o punta de ingreso del proyectil, que provoca una zona de contusión por la depresión,
estiramiento y escoración de la piel. El segundo es por el enjugamiento o limpieza del proyectil
efectuada por la elasticidad de la piel por él perforada. El anillo de enjugamiento se sobrepone
al anillo de contusión y retiene las impurezas que portaba el proyectil –metales, restos de
pólvora deflagrada, semi o sin deflagrar, restos de lubricantes u óxidos del arma, etc.

El orificio de salida: es irregular y/o desgarrado y de tamaño igual o mayor que el de entrada,
por desvío, deformación, esquirlas o arrastres del proyectil. No presenta halo de Fish, pero en
algunos casos puede presentar –si al salir golpea sobre una superficie rígida apoyada o muy
próxima a la piel, por ejemplo un cinturón de cuero- el signo de Romanese, constituido única-
mente por un anillo de contusión.

Determinación de distancias: al producirse un disparo en un lugar oscuro es posible ver en la


boca del cañón, la llama o fuego que acompaña la salida del proyectil, cuya intensidad depend-
erá del tipo de pólvora empleado. Si el arma se apoya o está a menos de un centímetro de la
piel, ese fuego o llamarada y los restos de la pólvora despedidos -que la alcanzan y en ella se
incrustan- ocasionarán quemaduras de distintas intensidades, que permiten determinar esa
distancia del disparo denominada “zona de llama”.

Si el disparo abocado se produce sobre una zona donde haya un hueso subyacente
-como por ejemplo la sien, se produce lo que se denomina “golpe de mina” o “golpe de
Hofmann”. Esto se produce porque los gases y los restos de pólvora en diferentes estados
que ingresan conjuntamente con el proyectil, al no poder seguir su camino por impedimento
del hueso subyacente, golpean sobre él y retroceden con violencia, provocando desgarros
de adentro hacia fuera similar a los que produce el estallido de una mina.

A un centímetro, los granos de pólvora que salen del cañón ingresan al orificio en
forma de bala –todos agrupados-, no provocando tatuaje a su alrededor pero sí en el interior
del orificio, los que no desaparecen ni aún con el lavado. A partir de allí y dependiendo de
la cantidad de detritos de los gases de la pólvora, se producirán zonas de tatuajes –restos
que se depositan sobre la piel y vestimentas formando puntos oscuros- en una zona vecina
y concéntrica al orificio de entrada, que se va ampliando -pero perdiendo en intensidad- a
medida que el arma se aleja.

tomo 1 investigación científica del delito ) 369


educación a distancia (instituto universitario de la P.F.A.)

A una distancia que no supera los treinta centímetros –en armas de puño- aparece la
“zona de ahumamiento” formada por el humo o suciedad producida por el depósito de
los restos de la combustión de la pólvora que se deposita por encima y más allá del tatuaje
y que desaparece por fricción o lavado. Por confronte de las experiencias realizadas -con
un arma y municiones del mismo tipo-, se podrá establecer la distancia del disparo.

Entre esta distancia y los sesenta centímetros, se encuentra la “zona de deflagración” donde
se podrá determinar la presencia de pólvora deflagrada, semi y sin deflagrar, estableciéndose
la distancia de disparo a través de la realización de similares experiencias y cotejos.

Disparos con escopetas: debe tenerse en cuenta que los perdigones y el taco que los impulsa
salen a modo de bala en la boca del cañón, comenzando a distancias variables lo que se deno-
mina “la rosa de dispersión”. De no haberse iniciado la dispersión, toda la munición pasa por un
mismo lugar provocando un solo orificio de entrada. Dependiendo del tipo de escopeta se puede
considerar –aunque no siempre es exacto- que los perdigones o municiones entran a modo de
bala hasta un metro. A partir de allí se comienzan a separar abriéndose cada vez según la distancia
recorrida. Mensurando esa dispersión es posible establecer la distancia de disparo, realizando
para ello experiencias y cotejos a diferentes distancias con igual tipo de arma y munición.

Huellas de herramientas: si bien este no es un tema balístico, se efectúa su tratamiento dentro


de esta unidad porque la determinación de correspondencia o no de los rastros de efracción
con sus herramientas, se rigen por similares principios técnicos científicos. Las huellas de
las herramientas utilizadas, por ejemplo, para forzar una puerta, un cajón, una cerradura o
cortar un candado, pueden cotejarse con las herramientas secuestradas al sospechoso y
de su resultado puede finalmente lograrse su vinculación y procesamiento.

Del estudio de las huellas producidas sobre las diferentes superficies vulneradas, es
posible determinar el tipo de herramienta utilizado, acordes a las características de impresión
–tamaño, forma, etc- lo que permite reducir la búsqueda, eliminando todas aquellas que
no pudieron haber participado. Secuestradas aquellas que presentan igual tipo deben ser
cotejadas con las huellas, de manera similar a lo que se ha detallado para la identificación
de las vainas y proyectiles disparadas por armas de fuego.

Al igual que las armas, las herramientas de un mismo tipo, marca y modelo son
realizadas en serie, pero las características ya detalladas que hacen a la personalidad de
aquellas también se cumplen en las herramientas. La falta de homogeneidad del metal
utilizado, su corte, pulido, armado, etc. y luego las características de uso o mal uso, van
dotando a cada utensilio de una personalidad única que lo distingue de todos sus iguales
y la identificación puede realizarse también en forma directa o indirecta.

370 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

Se hará en forma directa cotejando las huellas del hecho con las huellas producidas sobre
una superficie similar con las herramientas secuestradas. Será indirecto si el cotejo se realiza sobre
la huella dubitada y sobre una indubitada aunque no se posea la herramienta. Por ejemplo si en la
casa del sospechoso no se halla la herramienta –porque la hizo desaparecer- pero se establecen
huellas de una herramienta similar en un trabajo de reparación efectuado por el sospechoso y
éstas se corresponden entre sí, se habrá determinado identidad en forma indirecta.

La determinación se efectúa por comparación microscópica -de manera similar que


en balística, de los complejos estriales o lineales y/u otras huellas o marcas características
-restos de pinturas, barnices o sustancias- que producen o quedan sobre las herramientas
o distintas superficies, en los casos de fracturas, roturas, cortes, etc.

Se deja constancia que según el tipo de herramienta utilizado se deben efec-


tuar varias muestras testigo, ya que la posición o ángulo de acción de éstas y el de
la superficie sobre la que se actúa, pueden hacer variar su aspecto.

En la figura siguiente pueden observarse los complejos lineales producidos por


un cuchillo sobre una madera durante una efracción y su correspondencia con los
obtenidos como testigo, con el cuchillo secuestrado al sospechoso.

tomo 1 investigación científica del delito ) 371


educación a distancia (instituto universitario de la P.F.A.)

Al igual que en balística, no siempre es posible determinar correspondencias lineales


como la del ejemplo, pero siempre como resultado de los estudios, análisis y comprobaciones
realizadas se podrá, en toda la temática tratada, arribar a conclusiones categóricas que:
a) identifiquen al arma o la herramienta como la empleada en el hecho;

b) determinen la no identidad del arma o la herramienta o

c) que no se determinen características que permitan la identificación o descarte del arma


o la herramienta.

Se debe tener siempre presente que la realización del hallazgo del testigo mudo,
su resguardo, levantamiento formal y técnico, transporte, custodia, peritación y evaluación
de resultados, siempre será una tarea del profesional criminalístico, pero la de impulsar,
disponer, valorar, pedir explicaciones, impugnar o aceptar como prueba los resultados peri-
ciales de cualquier tipo que fuere, siempre será tarea del profesional abogado, por lo que el
conocimiento criminalístico genérico no sólo es útil, sino que es IMPRESCINDIBLE.

372 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

abogacía a distancia ib )
integración bibliográfica

Dada la extensión del tema balístico imposible de desarrollar en una unidad temática, se
propone luego de haber asimilado el desarrollo de esta última Unidad y como tarea extrapro-
gramática, leer los temas que le intereses y que no hayan sido desarrollados, de la bibliografía
que se detalla a continuación:

Manual de Criminalística de Roberto ALBARRACIN de la Editorial Policial.

Manual de Criminalística de Carlos A. GUZMÁN de Ediciones La Rocca.

Nota: Ambos textos se encuentran para consulta y/o préstamo en la Biblioteca del Instituto
Universitario de la Policía Federal Argentina.

tomo 1 investigación científica del delito ) 373


educación a distancia (instituto universitario de la P.F.A.)

374 ( tomo 1 investigación científica del delito


educación a distancia (instituto universitario de la P.F.A.)

( BIBLIOGRAFÍA DE LA UNIDAD IX )

Bibliografía obligatoria

n ALBARRACIN, Roberto; “Manual de Criminalística”; Editorial Policial; Bs. As. 1971.

n GUZMAN, Carlos; “Manual de Criminalística”; Ed. La Rocca; Bs. As. 1997.

n GOBBI, Eduardo y otros; “Tratado de Criminalística”; Ed. Policial; Bs. As. 1983.

tomo 1 investigación científica del delito ) 375