Вы находитесь на странице: 1из 49

FACULTAD DE CIENCIAS EXACTAS

Y NATURALES Y AGRIMENSURA

QUIMICA BIOLÓGICA I

Series de Problemas

Situaciones problemáticas
para desarrollar en clases teórico-prácticas
y seminarios de problemas

Autores
Dra. Laura C. Leiva de Vila
Dra. Soledad Bustillo
Dra. Carolina Gay
Bioq. Silvina Echeverría
Bioq. Gabriela Gomez

 Año 2013 
Química Biológica I
Serie: Introducción a la Química Biológica Año 2013

Serie Nº 0
Introducción a la Química Biológica

El objeto de esta serie es guiar al alumno en el repaso de conceptos adquiridos en el cursado de


asignaturas del primer y segundo año de las Carreras de Bioquímica, Lic. en Cs. Químicas y Prof. en
Ciencias Químicas y del Ambiente. Tales conocimientos son esencialmente requeridos para la com-
prensión de los temas a desarrollar durante el cursado de Química Biológica I.
No será desarrollada en clase sino que está diseñada para el estudio particular de los alumnos. Se
incluyen al final respuestas de algunos de los ítems para facilitar el control. Podrán hacer consultas al
cuerpo docente en horarios establecidos.

A) Compuestos orgánicos. Repaso de hidrocarburos, compuestos oxigenados (alcohol, aldehído,


cetona, ácido carboxílico, éter, éster) y compuestos nitrogenados (aminas y amidas)

A.1) Nombre los siguientes compuestos (el primero se completó a modo de ejemplo)

FORMULA TIPO DE COMPUESTO NOMBRE

alcano heptano

CH3 CH2OH

CH3 CH2 CH2 CHO

CH3 CH2 CH2 CH2 CO CH3

CH3 CH2 COOH

CH3 CH2 COO CH3

CH3 O CH3

CH3 NH2

CH3 CH2 CH2 CONH2

CH3

CHO

COO CH3

A.2) Escriba la fórmula de los siguientes compuestos (el primero se completó a modo de ejemplo)

1/47
Química Biológica I
Serie: Introducción a la Química Biológica Año 2013

NOMBRE TIPO DE COMPUESTO FORMULA

Alcano ó también
3-metil exano
(alifático, ramificado)
CH3
CH3 CH2 CH CH2 CH3

etilbenceno

2-penteno

metanol

2-butanol

1,2,3-propanotriol

éter etílico

etanal

ácido etanoico

ácido exadecanoico

propanoato de butilo

ácido 2-amino butanoico

propanamida

etil-amina

A.3) Escriba la fórmula de los siguientes polialcoholes, cetoácidos, hidroxiácidos y ácido


di/tricarboxílicos (si aun no los conoce debe buscar su formula en libros, aprenderlos y manejarlos
durante el cursado de Química Biológica)
NOMBRE TIPO DE COMPUESTO FORMULA

ácido pirúvico

ácido láctico

ac. oxalacetico

ac. malónico

ac alfa ceto glutárico

ac málico

ac cítrico

glicerol

2/47
Química Biológica I
Serie: Introducción a la Química Biológica Año 2013

B) Estequiometría, preparación de soluciones y conversión de unidades. Manejo de unidades de


pequeñas dimensiones: mmol, mol, l

Recuerde que

1 mol = 1000 mmoles = 1.000.000 moles


1 mol = 103 mmoles = 106 moles

1 mol corresponde a la masa molecular expresada en g (ej: 1 mol de H2O 18 g), 1 mmol es la corres-
pondiente expresada en mg (ej 1mmol de agua 18 mg, así 1 mol de agua tendrá una masa de 18
g)

B.1.) Calcule:
a) cuantos mmoles de NaCl estarán presentes en 0,2 g. de dicha sustancia
b) cuantos g pesaran 325 mol de H3PO4
c) los mmoles de glucosa presentes en 2ml de una solución 0,03M

B.2) Convierta a mM las siguientes concentraciones: a) 0,8 M – b) 4,6 x 10-3 M - c) 57 M - d) 8,375


mg/ml (PM del compuesto 125)

B.3) Indique los pasos y cálculos correspondientes para preparar 100 ml de una solución
a) 0,8M a partir de sacarosa sólida (PM 342)
b) 1,7 mM de NaCl a partir de una solución 0,042M

B.4) 120 l de una solución de glicina (PM 75) 0,064M se llevan a un volumen final de 2ml. Calcule su
concentración final en mM, M y en mg/ml.

B.5.) Invente un problema similar a los anteriores dentro de la temática del item B, resuélvalo y entré-
guelo a la cátedra. Será incluido en próximas guías por lo que tendrá un valor de trascendencia en los
cursados venideros, por ello no olvide de indicar su nombre y apellido.

B.6.) ¿Cómo puedo preparar 250 ml de una solución 0,5mM de glucosa a partir de una solución 1,5
mg/ml? (FM glucosa C6H12O6). Alumna autora: Julieta Abogado (cursante año 2010).

C) Medición de volúmenes y de masas

Las frecuentes torpezas y errores que demuestran los alumnos durantes los trabajos prácticos de
laboratorio conducen a conclusiones equivocadas que afectan su aprendizaje y pérdidas materiales
en nuestros costoso reactivos. Esta experiencia previa nos llevó a inducirlos a repasar y practicar el
manejo de mediciones tan sencillas, básicas y habituales en el trabajo químico y bioquímico como es
la medición de masas y volúmenes. No subestime estos ejercicios, resuélvalos a conciencia, y, si
nota dificultad busque apoyo en el personal docente.

C.1) La Fig. 1 corresponde una pipeta de 5 ml de capacidad con sus graduaciones, Suponga que
esta llena hasta la graduación “0” con solución salina. Marque donde se ubicaría el menisco luego de
que Ud midiera 2,6 ml. ¿Puede medir con este instrumento 1,15 ml? De ser así márquelo.

C.2) La Fig. 2 corresponde una probeta de 50 ml de capacidad con sus graduaciones, Marque donde
se ubicaría el menisco para medir 37 ml. ¿Puede medir con este instrumento 20,5 ml? De ser así
márquelo.

C.3.) Reconozca el tipo de material volumétrico que se presenta en la Figura 3 e indique donde se
ubicará el minisco para medir: a) 0,3 ml, b) 0,45 ml

3/47
Química Biológica I
Serie: Introducción a la Química Biológica Año 2013

Fig. 1 Fig. 2 Fig. 3

C.4) La siguiente imagen representa la lectura de una balanza analítica que posee una bandeja de
papel lista para pesar la droga

0,5327g

¿qué valor mostrará la balanza luego de que Ud. colocara:


a) 500g de cloruro de sodio?
b) 28 mg de glucosa?
c) 8 mg de albúmina?
d) 7,8 g de sulfato de amonio?
e) 350 mg de urea?
f) 12 g de fosfato diácido de sodio?

Dra. Laura C. Leiva de Vila

4/47
Química Biológica I
Serie: Introducción a la Química Biológica Año 2013

RESPUESTAS

A.1.

FORMULA TIPO DE COMPUESTO NOMBRE

alcano heptano

alcano 2-metil butano

alqueno 1,3-butadieno

CH3 CH2OH alcohol etanol

CH3 CH2 CH2 CHO aldehído butanal

CH3 CH2 CH2 CH2 CO CH3 cetona 2-exanona

CH3 CH2 COOH ácido carboxílico ácido propanoico

CH3 CH2 COO CH3 éster propanoato de metilo

CH3 O CH3 éter éter metílico

CH3 NH2 amina metil amina

CH3 CH2 CH2 CONH2 amida butanamida

CH3
metil benceno
hidrocarburo aromático
(tolueno)

CHO

aldehído aromático benzaldehído

COO CH3 éster aromático benzoato de metilo

B.1.) a) 3,42 mmoles de NaCl - b) 0,0318 g - c) 0,06 mmoles de glucosa

B.2) Convierta a mM las siguientes concentraciones: a) 800 – b) 4,6 - c) 0,057 - d) 67

B.3) a) se pesan 27,36g de sacarosa sólida, se disuelven en agua destilada y la solución se lleva en
matraz a volumen final de 100ml

b) se miden con pipeta (5ml de capacidad) 4,05 ml de solución 0,042M de NaCl y se llevan en matraz
aforado (x 100ml) con agua destilada hasta el aforo.

B.4) 3,84 mM - 3840 M - 0,286 mg/ml.

B.6.) 15 ml de la solución 1,5mg/ml (medidos en probeta) son colocados en un matraz aforado de 250
ml, enrasando con agua destilada hasta el aforo.

5/47
Química Biológica I
Serie: Introducción a la Química Biológica Año 2013

1,15 ml
37 ml
0,3 ml

0,45 ml

2,60 ml

20,5 ml

Fig. 1 Fig. 2 Fig. 3

C.3) Es un pipeta de 1 ml de capacidad, de 0,1 ml de graduación.

C.4) a) 0,5332
b) 0,5607
c) 0,5407
d) 8,3327
e) 0,8827
f) 12,5327

Dra. Laura C. Leiva de Vila

6/47
Química Biológica I
Serie Nº 1 – Glúcidos Año 2013

Serie Nº 1: GLÚCIDOS

1) Clasifique las siguientes estructuras (aldopentosa, cetohexosa, etc) aclarando serie (D ó L). Si
conoce el nombre indíquelo.

CHO
CHO
H C OH
HO C H
HO C H
C H2OH
H C OH
C H2OH

a) …………………… b) …………………… c) ……………………….

CH2OH
C O
H C OH
CH2OH

d) ……………………… e) ………………………. f) ……………………….

2) Escriba la estructura de los siguientes monosacáridos:

a) cetotriosa b) aldotetrosa (serie D) c) cetopentosa (serie L)

3) Escriba la fórmula bajo estructura de Fisher y de Haworth .de las siguientes pentosas y hexosas:
a) -D-manosa b) -D-fructosa c) -D-ribosa
d) -D-arabinosa (difiere de la ribosa en la configuración del C2)
e) -L-arabinosa
f) -D-xilosa (difiere de la ribosa en la configuración del C3)

4) Clasifique los siguientes derivados de monosacáridos (aminoazúcar, azúcar ácido, etc) e indique el
nombre correspondiente (si le ofrece dificultad indique al menos el nombre del monosacárido que le
dio origen)

a) ………………………………………………..

……………………………………………..

b) …………………………………………….

………………………………………….

1/47
Química Biológica I
Serie Nº 1 – Glúcidos Año 2013

c) …………………………………………….

………………………………………….

d) …………………………………………….

………………………………………….

5) Escriba la fórmula de la L-Fucosa, para ello siga los siguientes pasos:


a) escriba la estructura, según Fisher de la D-galactosa y luego de la L-galactosa
b) escriba la estructura de Haworth de la L-galactosa
c) escriba la estructura de Haworth de la 6-desoxi-L-Galactosa (fucosa)

6) Escriba la fórmula de la
a) manosamina b) -D-Gal-1P c) GlcNAc
d) desoxirribosa e) ácido manurónico

7) Escriba las siguientes moléculas bajo estructura de Haworth. Indique otro nombre para designar-
las.

a) b)

8) Escriba la fórmula de los siguientes disacáridos:


a) celobiosa (similar a la maltosa pero la unión glucosídica es de tipo  14)
b) trealosa (dos glucosas en conformación  unidas por sus carbonos anoméricos)

9) Serán reductores:
a) 1-metil--D-glucopiranosa (también se lo designa -D-metil glucósido)
b) O--D-glucopiranosil (1-1) -D-fructofuranosa
c) O--D-glucopiranosil (1-4) 3 metil--D-glucopiranosa
d) O--D-galactopiranosil (1-4) -D- metil glucósido

10) Por hidrólisis ácida de un trisacárido se obtiene D-glucosa y D-galactosa en la relación 2:1. La
metilación exhaustiva seguida de hidrólisis produce 2,3,4,6-tetra-O-metilgalactosa, 2,3,4,6-tetra-O-
metilglucosa y 2,3,4-tri-o-metilglucosa. Proponga el/los trisacáridos posibles.

11) ¿Qué función cumplen CuSO4, citrato y Na2CO3 en el reactivo de Benedict. Idem para el rectivo
de Fehling (CuSO4, tartrato e NaOH)

12) ¿Qué modificación introduce el método de Somogy Nelson?

13) Teniendo en cuenta que en suero sanguíneo hay fructosa, galactosa, ¿qué método/métodos utili-
zaría para dosar glucosa en suero?.

2/47
Química Biológica I
Serie Nº 1 – Glúcidos Año 2013

14) ¿Qué método/s utilizaría para:


a) cuantificar fructosa en presencia de glucosa?
b) cuantificar sacarosa ?

15) Al hacer la reacción de Somogyi- Nelson a 0,1ml de las soluciones de cada uno de los azúcares
que se detallan dieron las siguientes absorbancias:
solución de glucosa: 0.300
solución de maltosa: 0.225
Si 0,2 ml de un testigo 0.8 mM de glucosa dio una absorbancia de 0.180, calcule la concentra-
ción de los azúcares en mmoles/l y mg/ml

16) Un laboratorista rotuló 3 tubos como A, B y C. Los tubos contienen sacarosa, fructosa y glucosa,
pero no recuerda el orden en que los colocó en la gradilla antes de marcarlos. Usando un testigo
de fructosa 1 mM, decide hacer determinaciones por las técnicas de Somogyi-Nelson y Roe sobre
los distintos tubos, obteniéndose los valores de absorbancia que se muestran en el cuadro. Las
alícuotas utilizadas en las determinaciones fueron de 0.1 ml para el testigo y 0.3 ml para todas las
muestras.

Técnica Testigo A B C
Roe 0.25 0.11 0.33 0.00
Somogyi-Nelson 0.37 0.16 0.00 0.30
HCl+ Somogyi-Nelson 0.37 0.16 0.96 0.30

a) Indique en qué tubo está cada sustancia. b) Calcule la concentración de sacarosa en el tubo
correspondiente.

17) Por acción enzimática específica se separa la porción glucídica de una glicoproteína y a partir de
la misma se llevan a cabo el siguiente análisis:

- determinación de Somogy-Nelson:

Alícuota Absorbancia
0.2 ml testigo (glucosa 5mM) 0.300
0.1 ml muestra 0.240
10  l de muestra hidrolizada 0.144

- determinación de Roe: dio negativo


- análisis cualitativo mostró sólo la presencia de galactosas y derivados N-acetilados de la
glucosamina entre los glúcidos que forman el oligosacárido
- la metilación exhaustiva seguida de hidrólisis mostró 2,4- di-O-metil galactosa entre otros

Proponga una estructura probable para la porción oligosacárida (indique nombre y tipo de unión).

18) La figura muestra una


porción de polisacarido.
Indique si se trata de homo
ó heteropolisacarido. Se-
ñale las uniones glicosídi-
cas. La unidades intervi-
nientes son monosacári-
dos ó derivados de mono-
sacáridos. Nombrelas.

19) Escriba las siguientes estructuras

3/47
Química Biológica I
Serie Nº 1 – Glúcidos Año 2013

a b

c -D-Gal-(14)-D-Gal-(14)-D-Gal-(14)

20) Identifique el tipo de polisacárido (homo – heteropolisacarido, lineal ramificado) representado en


los ítems 23. a, b, c.

21) Búsqueda bibliográfica:


Marie-Claude BOURIN and Ulf LINDAHL. Glycosaminoglycans and the regulation of
blood coagulation. Biochem. J. (1993) 289, 313-330.

Ejercicios complementarios

1) Identifique las unidades que componen el siguiente disacárido (gentiobiosa), e indique el tipo de unión. Se trata
de la ¿ ó  gentiobiosa?

2) En la trealosa:
a) el enlace glucosídico es de tipo beta
b) puede existir en dos formas anoméricas
c) el enlace glucosídico es de tipo 1-6
d) no es un disacárido reductor

3) En la gentiobiosa participan:
a) glucosa y ribosa
b) galactosa y fructosa
c) dos glucosas
d) las mismas unidades que en la trealosa

4) Indique la/las unidad/es monosacárido/s interviniente/s en cada polisacárido y la unión glicosídica implicada:
a) celulosa b)inulina c) glucógeno d) glucomanano

5) ¿Qué tipo de polisacárido son y qué monosacárido/s compone/n la cadena principal los siguientes polisacári-
dos? a) ramnogalacturano b) dermatansulfato

6) 2 ml de una muestra pura contiene 0.1 mmoles de un oligosacárido, la cual se somete al siguiente análisis:
una alícuota de 0.5 ml se somete a hidrólisis ácida y luego se lleva a cabo la determinación de Somogyi-
Nelson, cuyos resultados fueron: Abs de la muestra 0.375, y del Testigo (fructosa 40 mM, 2 ml) 0.300 a)
Proponga en fórmulas una estructura compatible con los resultados sabiendo que la metilación exhaustiva y
posterior hidrólisis generó solo dos tipos de monosacáridos: galactosas y manosas. Tenga en cuenta que la
manosa se presentó metilada en las posiciones 2 y 6. b) Nombre las uniones glicosídicas en la estructura
propuesta.

4/47
Química Biológica I
Serie Nº 1 – Glúcidos Año 2013

5/47
Química Biológica I
Serie Nº 2 – Lípidos Año 2013

Serie Nº 2: LÍPIDOS

1) Escriba la fórmula e indique el tipo compuesto (fosfolípido, ácido graso saturado, glicolípido, etc):
a) glicerol d) galactosil-ceramida
b) ácido esteárico e) 1,2-dioleil fosfatidil etanolamina
c) 1,2-dipalmitoil-3-linoleil glicérido f) cardiolipina g) GM2

2) Identifique y nombre los siguientes compuestos

a) c)
O

H2C O
O

HC O
H2C OH

b)

3) Una mezcla de 1-palmitoil-2-estearoil-3-lauroil-glicerol y de fosfatidilcolina en benceno se agita con


un volumen igual de agua. Después de dejar que se separen las dos fases, ¿cuál será el lípido
que se halle en mayor concentración en la fase acuosa? ¿Por qué?

4) Considerando estos componentes moleculares: glicerol, ácido graso, fosfato, alcohol de cadena
larga y carbohidrato, responda
a) cuales dos de ellos están presentes en las ceras
b) cuales dos de ellos están presentes en las grasas (acilglicéridos) y en los fosfolípidos
c) cuales dos de ellos están presentes en un glicoesfingolípido y en un gliceroglicolípido

5) De todos los lípidos aprendidos, ¿cuáles son glicolípidos?. ¿En qué se diferencian?

6) Designar los productos de la hidrólisis con Na(OH) diluido de:


a) 1-estearoil-2,3 dipalmitoil-glicérido.
b) 1-estearoil-2-linoleil-fosfatidil-inositol.
c) 1-palmitoil-2-oleil-fosfatidilcolina.

7) Designar los productos de las siguientes reacciones:


a) hidrólisis de la 1-estearoil-2-oleil-fosfatidil-serina con una base concentrada, seguida de una
hidrólisis ácida.
b) tratamiento de la 1-palmitoil-2-linoleil-fosfatidil colina con fosfolipasa D.

8) Los lípidos complejos:


a) están formados sólo por glicerol y ácidos grasos
b) son los menos solubles en agua
c) su función principal es formar membranas
d) el alcohol que forma parte de su estructura puede ser glicerol ó esfingosina

9) Se realizó una electroforesis a pH 7 de una mezcla de lípidos que contenían:


a) ácido fosfatídico b) fosfatidilglicerina c) fosfatidiletanolamina
d) fosfatidilserina .
Indique cómo cree que se desplazarán estos compuestos:
A) hacia el ánodo. B) hacia el cátodo. C) permanecerán en el origen.

1/47
Química Biológica I
Serie Nº 2 – Lípidos Año 2013

10) A partir de las siguientes moléculas: manosa, acido N-acetil neuraminico, N-acetilgalactosamina,
glucosa, ácido linoleico, esfingosina, escriba una estructura posible de los siguientes glicolípidos:
a) GD3; b) glucocerebrósido; c) GM2 indicando las uniones. Escríbalos bajo el formato abreviado.

11) Se cuantificó una solución pura de triacilglicérido natural empleando el método enzimático (ver
Material de apoyo TG color). Se obtuvo una Abs340nm de 0,414 para una alícuota de la muestra de
0,01 ml en un volumen final de reacción de 1 ml. a) Determine la concentración de triacilglicérido
en g/l. Considere: e = 6.22 mM-1.cm-1; PM trioleina = 885. b) ¿Podría dosar por este método un es-
fingolípido? c) ¿y un glicerofosfolípido?. Justifique su respuesta.

12) Una muestra que contiene un lípido puro, componente de la membrana eritrocitaria, luego de ser
hidrolizado por completo arrojó los siguientes resultados:
a) test enzimático para lípidos: 0.25 mM; b) valoración de ácidos grasos: 0.50 mM; c) reacción de
Chabrol-Charonnat (Material de apoyo LIPEMIA): 0.75 mM; d) electroforesis a pH 7.0: el lípido
permanece en el punto de siembra. Proponga una estructura compatible con los resultados obte-
nidos y nómbrelo.

13) A partir de una muestra de tejido se logró purificar un fosfolípido para luego caracterizar.
Sobre el hidrolizado de la muestra se realizaron los siguientes ensayos:
- Titulación de ácidos grasos: 4 ml de muestra fueron neutralizados por 10 ml de NaOH 20 mM.
- La concentración de fósforo inorgánico arrojó un valor de 25 mM
- Para el test enzimático de lípidos se utilizó 25 l de muestra mostrando una absorbancia de
0,844; mientras que 40 l de un testigo 10 mM de tripalmitato de glicerilo presentó una absor-
bancia de 0,270
- La reacción de Chabrol-Charonnat se llevó a cabo sobre 50 l de muestra cuya absorbancia fue
0.438, mientras que 20 l de un testigo de ácido oleico 15 mM mostró una absorbancia de
0.105.
La muestra original, sin hidrolizar, se sometió a la acción de una fosfolipasa A1 y liberó un ácido
graso de 16 carbonos, mientras que la acción de una fosfolipasa A2 liberó un ácido graso de 18
carbonos.
Escriba una estructura compatible con estos resultados y nómbrelo.

14) Una muestra de un lípido llega a su laboratorio para su identificación.


Realiza los siguientes análisis cuyos resultados se mencionan a continuación:
- La reacción de Chabrol-Charonnat sobre 25 l de muestra produce una absorbancia de 0,217 ,
mientras que 40 l del testigo (1-palmitoil-2-oleil- glicerol 5mM) da una absorbancia 0,290
- Valoración de ácidos grasos: 0,5 ml de muestra consumieron 3.8ml de NaOH 0.4mM
- una alícuota de muestra hidrolizada es sometida a la reacción de Roe y dio negativo
- una alícuota de muestra hidrolizada es sometida a la acción de la glucosa oxidasa y dio negati-
vo
- una alícuota de 50 l de muestra hidrolizada es sometida a la reacción de Somogy-Nelson re-
sultando una absorbancia de 0,36, mientras que 100 l de testigo de fructosa 7.2mM dan una
absorbancia de 0,43. (considere que la hidrólisis no afecta la concentración de la muestra)
- la metilación exhaustiva de la porción glucídica, seguida de hidrólisis mostró, entre otros, la pre-
sencia de 2,3-di-O-metil manosa.
Escriba una posible estructura para el compuesto original, señale y nombre cada una de las
moléculas intervinientes en su estructura, y el tipo de enlace que las une.

15) Marque las unidades de isopreno, identifique el modo de unión (cabeza con cola, cola con cola) y
clasifique el terpeno

2/47
Química Biológica I
Serie Nº 2 – Lípidos Año 2013

16) Indique el tipo de compuesto que muestra cada figura y su función biológica

(a) (b)

17) Una muestra que contiene los siguientes lípidos:

monoacilglicéridos, 1,2-diacilglicéridos, 1,3-diacilglicéridos, triacil- glicé-


ridos, ésteres de colesterol, colesterol libre, fosfolípidos, áci- dos
grasos libres.

se somete a una cromatografía en capa fina. La mezcla de solven- tes


empleada es: hexano – éter di etílico – ácido formico (80:20:2
v/v/v).
Luego de revelar las diferentes manchas se obtiene la siguien- te
cromatografía. Prediga a qué compuesto de la mezcla corres- pon-
de cada mancha teniendo en cuenta la hiidrofobicidad de las dife-
rentes moléculas.

ANEXO

3/47
Química Biológica I
Serie Nº 3 - Aminoácidos y Péptidos Año 2013

Serie Nº 3: Aminoácidos y Péptidos

1) Dada la siguiente tabla de clasificación de los aminoácidos

G Y S T C N Q -

K R H - - - - -

A V L I F W M P

D E - - - - - -

- Complete los espacios en blanco con los términos: polares sin carga, apolares, catiónicos (bási-
cos) ó aniónicos (acídicos) según corresponda

- Indique V o F para cada una de las afirmaciones y escriba la versión correcta para las falsas:
a) la lisina es un aminoácido acídico (aniónico)
b) la tirosina es un aminoácido no polar aromático
c) los dos aminoácidos que contienen azufre son no polares

4) Escriba los estados posibles de ionización del aminoácido alanina. a) Indique cual será la estruc-
tura predominante a pH 1, 7 y 13 empleando los valores de pKa para este aminoácido .b) Calcule
el pI.

5) a)Escriba la estructura predominante del glutamato a pH= 3; b)Proponga un pH al cual la carga


neta del aminoácido sea I) - 2. II) 0 ; c) Si estuviera mezclado con lisina y desea separarlos por
electroforesis, proponga un pH adecuado para lograr una separación eficaz.

6) Una gota de solución conteniendo Gly, Ala, Glu, Lys, Arg, His, se colocó en el centro de papel para
electroforesis y se secó. El papel se impregnó con buffer a pH=6 y se aplicó un campo eléctrico.
¿Qué aminoácidos se moverán al ánodo, cuáles al cátodo y cuáles no se moverán?

7) El siguiente aminoácido:
NH3+ - CH2 – CH2 –CH2 – CH2 – CH – COO-
NH3+
es.............................................................., siendo su pI 9.8, en una electroforesis a pH 8,3 mi-
grará al .........................
8) Escriba la fórmula de los siguientes dipéptidos a pH fisfiológico (pH = 7)
a) Ala – Glu Lys - Ser

9) Escriba la fórmula del pentapéptido Gly-Glu-Asp-Trp-Ser. Siendo su pI 3,1 indique hacia qué elec-
trodo migrará cuando se lo someta a electroforesis a pH = 7 y pH = 5,2.

10) Escriba en fórmulas el hexapéptido Tyr-Ala-Arg-Pro-Glu-Ile. Calcule su punto isoeléctrico.. Consi-


dere los siguientes valores de pKa: -NH2 = 9.5; Tyr = 10.0; Arg = 12.5; Glu = 4.2; -COOH = 2.2.

11) Escriba en fórmulas el siguiente péptido: Ile-Asn-Gly-His-Lys-Pro-Phe-Ala-Cys. Calcule su punto


isoeléctrico. Considere los siguientes valores de pKa: -NH2 = 9.5; His = 6.0; Lys = 10.5; Cys = 8.3;
-COOH = 1.7

1/47
Química Biológica I
Serie Nº 3 - Aminoácidos y Péptidos Año 2013

12) ¿Cuál de los siguientes polipéptidos es más soluble en agua? a) Phe20 o Gly20; b) Asp20 o Glu20 a
pH = 6.0; c) Phe20 o Tyr20

13) Dados los siguientes oligopéptidos:


a) Glu-Phe-Met-Tyr-Val
b) Phe-Arg-Ser-Lys-Pro-Asp
a) Escribir los productos de las hidrólisis enzimáticas cuando son tratados con I) tripsina,
II)quimotripsina. B) escribir las estructuras de los productos obtenidos después de la reacción con
bromuro de cianógeno.

14) El octapéptido AVGWRVKS se digirió con tripsina. a) ¿Sería el intercambio iónico la técnica más
apropiada para separar estos productos a pH 7? Explicarlo. b) Suponer que el péptido se digiere
con quimiotripsina. ¿Cuál sería la técnica de separación óptima a pH 7,5? Explicarlo. Considere
los siguientes pKa: -NH2 = 9,5; Arg = 12,4; Lys = 10,6; -COOH = 2,2.

15) Ud. aísla un péptido del cerebro que posee la propiedad de unirse a receptores del opio. Su in-
tención es encontrar la estructura primaria del péptido aislado. Para ello recurre a métodos utiliza-
dos en la química de péptidos y encuentra que: a) Luego de la hidrólisis ácida del péptido, la com-
posición en aminoácidos es: Arg(1) Phe(2) Gly(2) Met(1) Tyr(1). b) El tratamiento del péptido con
quimotripsina generó un aminoácido libre, Phe y dos péptidos cuya composición en aminoácidos
resultó: Gly(2) Tyr(1) y Arg(1) Phe(1) Met(1). c) El tratamiento del péptido con Bromuro de cianó-
geno, seguido de separación cromatográfica de los productos, arroja la presencia de dos péptidos
cuya composición en aminoácidos resulta ser: Arg(1) Phe(1) Met(1) y Gly(2) Phe(1) Tyr(1). Cuan-
do ambos péptidos fueron tratados con Cloruro de dansilo, solamente se encontró Phe dansilada.
Deduzca Ud. la secuencia del péptido.

16) Ud. aisló de un homogenado de cerebro un péptido con actividad de encefalina (opioide). Estos
se unen a receptores localizados en el cerebro, que unen drogas derivadas del opio (morfina) que
disminuyen el dolor. Al analizarlo encuentra que: a) La hidrólisis completa en HCl 6 M, 110°C se-
guida del análisis de aminoácidos indica la presencia de Gly, Leu, Phe y Tyr en una relación
2:1:1:1. b) El tratamiento del péptido con 2,4-dinitrofluorobenceno seguido de hidrólisis completa y
cromatografía indicó la existencia de Tyr-DNP. No se encontró Tyr libre. c) La hidrólisis con qui-
motripsina seguida de cromatografía indicó la presencia de Leu y Tyr libres, y un péptido cuya
composición en aminoácidos indicó la presencia de Gly y Phe en una relación 2:1. Determine la
secuencia de esta encefalina.

17) A partir de los siguientes fragmentos, obtenidos por hidrólisis selectivas, reconstruya la estructura
del péptido original:
Tyr-Val-Phe-Arg-Ser-Lys-Pro-Asp
Glu-Phe-Met-Tyr-Val
Asn-Gly-His-Lys-Pro-Phe-Ala-Cys
Lys-Pro-Asp- Asn-Gly

2/47
Química Biológica I
Serie Nº 3 - Aminoácidos y Péptidos Año 2013

Escisión específica de cadenas polipeptídicas


H H H H
N C C N C C
R1 O R2 O

Aminoácido 1 Aminoácido 2

Método Enlaces peptídicos escindidos


Tripsina Aminoácido 1 = Lys o Arg
Quimotripsina Aminoácido 1 = Phe, Trp o Tyr
Termolisina Aminoácido 2 = Leu, Ile o Val
Bromuro de cianógeno Aminoácido 1 = Met
V8 Aminoácido 1 = Glu o Asp
Carboxipeptidasa Aminoácido 2 = COO- terminal libre
Fenilisotiocianato Aminoácido 1 = NH2 terminal libre
Cloruro de dansilo Aminoácido 1 = NH2 terminal libre
Fluordinitrobenceno Aminoácido 1 = NH2 terminal libre

AMINOÁCIDO Símbolo Símbolo Ka COOH Ka NH2 Ka -R pI carácter

Alanina Ala A 2.3 9.7 6.0 no polar

Arginina Arg R 2.2 9.0 12.5 10.8 básico

Asparagina Asn N 2.0 8.8 5.4 polar

Ácido aspárti- Asp D 2.1 9.8 3.9 3.0 ácido


co
Cisteína Cys C 1.7 10.8 8.3 9.6 polar

Glutamina Gln Q 2.2 9.1 5.7 polar

Ácido glutámi- Glu E 2.2 9.7 4.3 3.3 ácido


co
Glicocola Gly G 2.3 9.6 6.0 no polar

Histidina His H 1.8 9.2 6.0 7.6 básico

Isoleucina Ile I 2.4 9.7 6.1 no polar

Leucina Leu L 2.4 9.6 6.0 no polar

Lisina Lys K 2.2 9.0 10.5 9.8 básico

Metionina Met M 2.3 9.2 5.8 no polar

Fenilalanina Phe F 1.8 9.1 5.5 no polar

Prolina Pro P 2.0 10.6 6.3 no polar

Serina Ser S 2.2 9.2 5.7 polar

Treonina Thr T 2.6 10.4 6.5 polar

Triptofano Trp W 2.4 9.4 5.9 no polar

Tirosina Tir Y 2.2 9.1 10.1 9.6 polar

Valina Val V 2.3 9.6 6.0 no polar

3/47
Química Biológica I
Serie Nº 3 - Aminoácidos y Péptidos Año 2013

4/47
Química Biológica I
Serie Nº 4 - Proteínas Año 2013

Serie Nº 4: Proteínas

Estructura de proteínas

1) Dado el siguiente esquema


 Ubique los términos: estructura primaria, secundaria, terciaria y cuaternaria.
 Indique: tipo de estructura secundaria que se muestra
 Elija los términos correctos para esta proteína:
o fibrosa / globular
o monomérica / oligomérica
o simple / conjugada

2) a) Señale las estructuras secundarias que reconoce en los siguientes modelos de proteínas. b)
Marque los extremos N y C terminal

A B

3) La proteína C del ítem 2, es:


a) conjugada
b) fibrosa
c) oligomérica
d) monomérica

1/47
Química Biológica I
Serie Nº 4 - Proteínas Año 2013

4) La mayoría de los animales son incapaces de digerir la lana por su excesivo entrecruzamiento de
puentes disulfuro. Sin embargo, las polillas tienen elevadas concentraciones de ácido sulfhídrico
(H2S) en su aparato digestivo. ¿Por qué les ayuda este hecho a digerir la lana?

5) a) Se ha aislado un inhibidor de la prolina hidroxilasa a partir de una planta. La adición de este


compuesto a la dieta de una rata provoca fragilidad de los vasos sanguíneos, lesiones en la piel y
encías sangrantes. Explicar por qué.
b) En los seres humanos que sufren deficiencia de vitamina C aparecen síntomas similares a los
descritos en la parte a). Explicar la similitud entre estos síntomas.

6) Analice el siguiente texto que acompaña a la imagen que a continuación se muestra. Subraye
aquella/s frases que no comprende su contenido.

Estudios a nivel molecular del receptor de LDL humano han revelado que
esta proteína de 115 kDa consta de cinco dominios
El dominio amino terminal del receptor maduro contiene una secuencia ri-
ca en cisteína de unos 46 residuos que se repite con algunas variaciones,
siete veces. Una agrupación de cadenas laterales cargadas negativamen-
te de este dominio de unión a LDL interacciona con un lugar positivamen-
te cargado de una moIécula de apo B-100 de la superficie de una partícu-
la de LDL. La protonación de las cadenas laterales de glutamato y aspar-
tato del receptor en los endosomas ácidos conduce a la liberación de la
LDL de su receptor.
El segundo dominio contiene dos cadenas de oligosacárido enlazadas a
N.
El tercer dominio, muy rico en serina a y treonina contiene azúcares enla-
zados a O. Estos oligosacáridos, al igual que los de la glicoforina pueden
funcionar como un andamio para mantener el receptor extendido lejos de
la membrana de modo que el dominio aminoterminal resulte accesible a
la LDL.
El cuarto dominio contiene 22 residuos hídrofóbicos y atraviesa la mem-
brana plasmática.
El quinto dominio, que consiste en 50 residuos, sobresale por la cara ci-
tosólica de la membrana donde controla la interacción del receptor con
las vesículas revestidas y participa en la endocitosis.

Métodos separativos aplicados a purificación y caracterización de proteínas y otras biomolé-


culas

- Metodos electroforéticos

7) A un determinado pH, los diferentes componentes proteínicos de una mezcla compleja como el
plasma pueden manifestar cargas eléctricas de distinto signo y magnitud. Por esta razón, migran
con distinta velocidad hacia uno ú otro electrodo cuando se establece un campo eléctrico en el
medio. En esto se basa la electroforesis, método de separación ampliamente utilizado en el estu-
dio de proteínas de muestras biológicas. Teniendo en cuenta que habitualmente la separación se
realiza a pH 8,6, justifique por qué la albúmina es la que más migra al ánodo mientras que las -
globulinas presentes en el suero sanguíneo permanecen cerca de la línea de siembra. (Consulte
la Tabla 1 – Pág. 11).

8) ¿En qué dirección, es decir hacia el ánodo, hacia el cátodo ó en el origen, migrarán las siguientes
proteínas, en un campo eléctrico al pH indicado: a) seroalbúmina a pH 7; b) pepsina a pH 1, 7 y
11; c) mioglobina a pH 5 y 7. (Utilice los datos de la Tabla 1 – Pág. 11)

9) ¿A qué pH sería más eficaz la electroforesis para la separación de las siguientes mezclas de pro-
teínas?: a) ureasa y lisozima; b) citocromo C y -globulina; c) seroalbúmina, hemoglobina y quimo-
tripsinógeno. (Consulte la Tabla 1 – Pág. 11).

2/47
Química Biológica I
Serie Nº 4 - Proteínas Año 2013

10) A partir de la siguiente SDS-PAGE, determine la masa molecular de las proteínas (la más abun-
dante) sembradas en las calles 1, 2 y 3 por comparación con los marcadores de peso molecular
(PM) cuyos valores de masa molecular son: 14, 20, 24, 29, 36, 45 y 66 kDa.

MM (1) (2)
(kDa)
11) Una proteína de masa 20 kDa fue 10
sometida a una electroforesis SDS- 9
PAGE, sin (1) y con (2) - 8
mercaptoetanol obteniéndose la co-
7
rrida electroforética que se muestra
6
en la Figura. Proponga una estructu-
ra para esta proteína compatible con 5
los resultados. 4
3
2

12) Una proteína bacteriana presenta una estructura cuyo



esquema se muestra en la figura. kDa, =

50 kDa y = 27 kDa S-S
Esquematice cómo se presentarían las bandas en una S-S 
SDS-PAGE de esta proteína en presencia y en ausencia 
de 2-mercaptoetanol. Indique en el esquema la MM de las
bandas.

- Métodos cromatográficos (en columna)

13) Una con flechas los conceptos relacionados:

Superdex G-75 Columna de afinidad


Mono-Q Columna aniónica
Phenyl-Sepharose Intercambiador catiónico
Mono-S Interacción hidrofóbica
DEAE-Sepharose Intercambiador aniónico
Benzamidine Sepharose 6B Tamiz molecular
Sulphopropyl Sephadex Columna catiónica

14) Indicar la secuencia en que las siguientes proteínas eluirán de una columna de exclusión molecu-
lar, cuyo gel posee un intervalo de fraccionamiento de 5000 a 400000 Da: mioglobina, -globulina,
ureasa, seroalbúmina. (Utilice los datos de la Tabla 1)

Gliceraldehído
3-P-Deshidrogenasa
15) El cromatograma de una muestra de
Mioglobina
proteínas en Sephadex G-200 fue el si- Concentración Aldolasa
de proteína Catalasa
guiente: en el eluído
Ovoalbum.

175 213 234 244 285


N° fracción

3/47
Química Biológica I
Serie Nº 4 - Proteínas Año 2013

Las proteínas marcadoras fueron las siguientes:

Proteína MM (x104) N° de fracción


Aldolasa 16 175
Catalasa 6 213
Ovoalbúmina 4 234
Mioglobina 1.6 285

Se recogieron fracciones de 1,6 ml y el volumen vacío de la columna previamente determinado


con azul de dextrano fue de 200 ml; VT = 500 ml. Se quiso determinar la MM de gliceraldehí-
do-3-P-dehidrogenasa. Utilizando la misma columna, en las mismas condiciones se observó que
la enzima apareció en la fracción 244.
Indique la masa molecular de la misma.

16) Usted tiene una mezcla de tres proteínas A, B, C, con pI de 3.5, 6.5 y 10 respectivamente y quie-
re separarlas por una columna de DEAE-celulosa. Si trabaja a pH 8. ¿Cuál/es quedaría/n reteni-
da/s? ¿Cuál/es eluiría/n? ¿Cómo despega la/s que queda/n retenida/s?

17) Usted tiene una mezcla de tres proteínas A, B, C, con pI de 3.5, 6.5 y 10 respectivamente y quie-
re separarlas por una columna de CM-celulosa. Si trabaja a pH 6. ¿Cuál/es quedaría/n retenida/s?
¿Cuál/es eluiría/n? ¿Cómo despega la/s que queda/n retenida/s?

- Purificación/Caracterización de biomoléculas

18) Una proteína se purificó hasta la homogeneidad. La determinación del peso molecular por croma-
tografía de exclusión molecular da 60 kDa. La cromatografía en presencia de urea 6 M da una es-
pecie de 30 kDa. Cuando se repite la cromatografía en presencia de urea 6 M y β-mercaptoetanol
10 mM, aparece una especie molecular única de 15 kDa. Describir la estructura de la molécula.

19) Se llevó a cabo el aislamiento de una proteína enzimáticamente activa a partir de un extracto
vegetal. La figura muestra 2 etapas cromatograficas comprendidas en la purificación de la misma:
A- columna de Phenyl-Sepharose CL-4B, buffer de elución inicial de pH 7 conteniendo (NH4)2SO4
1 M; y B- DEAE-Sepharose, buffer de elución inicial de pH 7 conteniendo NaCl 0.04 mol/L. Indi-
que y justifique:
a) principio separativo de cada cromatografía
b) en qué pico eluyó la proteína de interés en cada procedimiento cromatográfico y el modo de
eluirla (gradiente lineal o en etapas)
c) naturaleza de la proteína (acídica o básica / poco hidrofóbica o muy hidrofóbica)

4/47
Química Biológica I
Serie Nº 4 - Proteínas Año 2013

Referencias: Para cada una de las fracciones se midieron la absorbancia a 280 nm (□) y la actividad
enzimática relativa (●).

Referencias: La línea continua oblicua indica el aumento progresivo de la concentración de NaCl de


0.04 mol/L a 0.14 mol/L NaCl en Tris-HCl 10 mmol/L (pH 7). Para cada una de las fracciones se mi-
dieron la absorbancia a 280 nm (□) y la actividad enzimática relativa (●).

20) Se llevó a cabo el aislamiento de una proteína. A partir de las evidencias experimentales mostra-
das en las figuras:

La Figura 1 (Pág. 9) muestra 3 etapas comprendidas en la purificación de la misma:


A. DEAE-Sephadex A-50 column equilibrated with 0.05 N ammonium acetate, pH 8.5.
B. Hydrophobic interaction chromatography on a FPLC/RESOURCE PHE column equilibrated with
2.0 (NH4)2SO4.
C. Ion exchange chromatography on a FPLC/Mono-Q column equilibrated with 0.02 N Tris buffer,
pH 7.0. Buffer B: 1 N NaCl in Tris buffer, pH 7.0.

La Figura 2 (Pág. 10) muestra:


A. Electrospray ionization mass spectrometry (ESI-MS) spectra of intact protein.
B. Fractionation of the reduced and S-carboxymethylated protein on a reverse phase
HPLC/Waters C8 column.
C. 2D-PAGE analysis of protein subunits from HPLC.

a) Identifique el principio separativo que se aplicó en cada etapa para la purificación de la pro-
teína en cuestión.
b) Distinga en cuales se empleó equipos con alta presión.
c) Explique el modo de elución (gradiente lineal o en etapas) de la proteína de interés en cada
paso cromatográfico.
d) Indique la masa molecular aparente y verdadera, la naturaleza (acídica ó básica), y las carac-
terísticas estructurales de la proteína purificada. Justifique sus respuestas.
e) Explique las diferencias encontradas entre el perfil de RP-HPLC y de 2D-PAGE.

21) Completar la siguiente tabla:

5/47
Química Biológica I
Serie Nº 4 - Proteínas Año 2013

Proteína total Actividad Actividad Factor de Rendimiento


Procedimiento de enzimática enzimática purificación enzimático
purificación mg % total específica (veces) (%)
(……….) (.………)
Extracto puro 20.000 100 4.000.000 1 100

Precipitación con 5.000 3.000.000


(NH4)2SO4
Cromatografía DEAE- 1.500 1.000.000
Celulosa
Cromatografía de ex- 500 750.000
clusión molecular
Cromatografía de afini- 45 675.000
dad

Indicar cuál es el % de la proteína purificada y el % de actividad correspondiente a la misma en el


extracto puro.

22) Artículo para analizar (acceso libre desde cualquier conexión a Internet):

Tae Chul MOON, So Young SON and Hyeun Wook CHANG. Purification and Characterization of
45 kDa PAF Acetylhydrolase from Bovine Colostrum. Biological and Pharmaceutical Bulletin 30
(9) 1668-1673 (2007).

Teniendo en cuenta el procedimiento de purificación descrito en dicho artículo, explique el fundamen-


to de cada una de las etapas, incluyendo la precipitación con (NH4)2SO4. Indique la figura donde se
muestra la pureza y estimación de la masa molecular.

Problemas complementarios

1. ¿Cuál será el peso molecular de una proteína desconocida si los volúmenes de elución del Cito-
cromo C, de la -lactoglobulina, de la proteína desconocida y de la hemoglobina, en una columna
de exclusión molecular son 118, 58, 37 y 24 ml respectivamente. Suponga que todas se encuen-
tran dentro del intervalo de fraccionamiento proteico.

2. Un alumno está estudiando dos proteínas A y B, las dos con un peso molecular de 80000 y com-
puesta por cuatro subunidades idénticas. Sin embargo en A las interacciones entre las subunida-
des son no covalentes mientras que en B está unidas covalentemente. ¿Cómo podría distinguir
entre A y B?

3. La -globulina G (IgG) está constituída por dos cadenas idénticas entre sí de mayor masa, deno-
minadas pesadas ó H, que poseen 440 restos aminoacídicos cada una.; y dos cadenas de menor
masa, iguales entre sí, formadas por 220 aminoácidos denominadas livianas ó L. Las cuatro ca-
denas se mantienen unidas entre sí mediante puentes disulfuro e interacciones no covalentes.
Prediga cómo se observaría esta proteína al ser sometida a una electroforesis en gel de poliacri-
lamida en presencia de dodecil sulfato de sodio (SDS-PAGE), si es previamente hervida en pre-
sencia y en ausencia de -mercaptoetanol.

4. Compare mediante un cuadro la Cromatografía de Interacción Hidrofóbica y HPLC de Fase Re-


versa (RP-HPLC).

5. Luego de analizar las tablas 1, 2, 3 y 4 del siguiente artículo:


Itaru SATO, Hisayoshi KOFUJITA, Shuji TSUDA. Identification of COX Inhibitors in the Hexane Ex-
tract of Japanese Horse Chestnut (Aesculus turbinata) Seeds. The Journal of Veterinary Medical
Science 69 (7) 709-712 (2007)
Explique, apoyándose mediante búsqueda bibliográfica y/o Internet, el fundamento de los
procedimientos cromatográficos utilizados e indique la naturaleza de los componentes aislados.

6/47
Química Biológica I
Serie Nº 4 - Proteínas Año 2013

¿El paso 3 del proceso de purificación descrito en este artículo fue decisivo para la purificación de
los mismos? Justifique su respuesta.

6. Una lectina del veneno de Crotalus ruber (CRL), capaz de causar la aglutinación de eritrocitos de
conejos tripsinizados, se purificó de la siguiente manera: una solución de veneno 50 mg/mL en
TBS (Tris-HCl 10 mM, NaCl 150 mM, pH 7,5) conteniendo NaN3 0,1 mg/mL, se sembró en una co-
lumna de agarosa conjugada con lactosa (4 mL de gel) equilibrada con TBS conteniendo NaN3 0,1
mg/mL. Se llevó a cabo la elución de las fracciones proteicas unidas a la columna con buffer TBS
conteniendo lactosa 100 mM. Se monitoreó la elución de proteínas mediante medida de la absor-
bancia a 280 nm. La fracción eluida con lactosa mostró una única banda de 28 kDa en SDS-PAGE
bajo condiciones no reductoras y una de 15 kDa bajo condiciones reductoras, y fuerte actividad
hemaglutinante (pero solo después del remueve de lactosa). Asimismo, luego de filtración por gel
en una columna Superose 12, CRL eluyó inmediatamente antes que transferrina, lo cual sugiere
que esta proteína tiene una masa molecular aparente levemente superior a 80 kDa en condiciones
no reductoras.
a) Explique el motivo por el cual se decidió usar una columna de esta naturaleza para la purifica-
ción de CRL.
b) ¿Por qué esta proteína no presentó actividad hemaglutinante inmediatamente después de su
elución de la columna, y sí lo hizo luego del remueve de lactosa?
c) Analice la estructura de CRL en condiciones nativa y desnaturalizante.

7. Se ha aislado una hemorragina (pI: 5.5; MM: 57 kDa) y su fragmento de autólisis (MM: 28 kDa),
del veneno de Bothrops jararaca. Para ello se utilizaron las siguientes etapas cromatográficas: 20
mg de veneno crudo fueron fraccionados en una columna de fenil–Superosa (HR 5/5) en un sis-
tema FPLC, equilibrada con buffer sulfato de amonio 1.2 M – Tris/HCl 20 mM, pH 7.4, conteniendo
CaCl2 1 mM para estabilizar la enzima (Fig. 1). La fracción más hidrofóbica, eluída con un gradien-
te lineal de 20 mL de sulfato de amonio 1.2 a 0 M, posee actividades hemorrágica y caseinolítica.
Esta fracción fue luego cromatografiada en una columna Mono-Q (FPLC) usando buffer Tris/HCl
20 mM, pH 6.8, conteniendo CaCl2 1 mM (Fig. 2). La segunda fracción, eluída por gradiente lineal
de NaCl (0–0.35M in 35 mL) mostró una banda homogénea en SDS–PAGE (Fig. 4.1), correspon-
diente a la hemorragina de interés. El fragmento autoproteolítico fue obtenido al cromatografiar la
primer fracción obtenida en la columna Mono-Q a través de un sistema HPLC de fase reversa
(RP-HPLC) utilizando una columna C-18 (Fig. 2), que también mostró homogeneidad en SDS–
PAGE (Fig. 4.2). a) A partir de los estos resultados proponga la naturaleza de esta proteína. b)
Enumere características diferenciales entre el fragmento autoproteolítico y la hemorragina comple-
ta.

Fig. 1. Fraccionamiento del veneno de B. jararaca en fenil-Superosa (FPLC).

7/47
Química Biológica I
Serie Nº 4 - Proteínas Año 2013

Fig. 2. Cromatografía de intercambio iónico en columna Mono-Q (FPLC) de la fracción más hidrofóbica de la etapa
previa.

Fig. 4. SDS-PAGE. 1. Fracción eluída a 0.25 M NaCl


de la segunda etapa de purificación.
2. Fracción eluída en el RP-HPLC.

Fig. 3. RP-HPLC de la fracción no retenida en la Mono-Q.

8. Artículo para analizar (sólo acceso libre desde red UNNE):

Huan-huan SUN, Qi CHEN, Xi LIN, Jia-shu CHEN, Peng-xin QIU, Guang-mei YAN. Purification
and partial characterizations of coagulant protein FIa from Daboia russelli siamensis (Myanmar)
venom. Acta Pharmacologica Sinica 28 (10) 1580-1584 (2007).

a) Teniendo en cuenta la figura 1 de dicho artículo, indique y justifique el principio separativo de


cada una de las etapas cromatográficas utilizadas. ¿El paso 3 se justifica?
b) Teniendo en cuenta la figura 2, calcule, mediante la construcción del gráfico correspondiente, la
masa molecular de la proteína FIa.
c) Teniendo en cuenta la figura 3, calcule, mediante la construcción del gráfico correspondiente, el
punto isoeléctrico de FIa.

9. Teniendo en cuenta la siguiente figura:

8/47
Química Biológica I
Serie Nº 4 - Proteínas Año 2013

a) Indique y justifique el principio separativo de cada una de las etapas cromatográficas utilizadas.
Explique el motivo por el cual se hace necesaria la determinación simultánea de la absorbancia a
205 y 280 nm para la purificación de la proteína de interés.
b) Explique el modo de elución proteica en cada paso cromatográfico.
c) Sabiendo que con los dos procedimientos cromatográficos descritos se consiguió la purificación del
factor plaquetario 4 (PF4) de conejo, estime la masa molecular del mismo en condiciones no reduc-
toras al realizar una tricina-SDS-PAGE. Explique el fundamento de la utilización de esta última me-
todología.

9/47
Química Biológica I
Serie Nº 4 - Proteínas Año 2013

Figura 1. Correspondiente a problema 20.

Referencias: El asterisco indica el pico correspondiente a la proteína de interés. El inserto en C muestra el


patrón SDS-PAGE de la proteína purificada. R: en condiciones reductoras (se observan 2 bandas proteicas a
16,2 y 14,5 kDa); NR: en condiciones no reductoras (se observa 1 banda proteica a 58,8 kDa); Std: marcado-
res de masa molecular.

10/47
Química Biológica I
Serie Nº 4 - Proteínas Año 2013

Figura 2. Correspondiente a problema 20.

11/47
Química Biológica I
Serie Nº 4 - Proteínas Año 2013

ANEXO

Tabla 1. Puntos isoeléctricos y masas moleculares de proteínas


Proteína pI MM (kDa)
Pepsina 1.0 35
Seroalbúmina 4.9 68
Ureasa 5.0 482
-lactoglobulina 5.2 37
-globulina G 6.6 150
Hemoglobina 6.8 64
Mioglobina 7.0 17
Ribonucleasa 9.6 12
Quimotripsinógeno 9.5 23
Citocromo C 10.7 13
Lisozima 11.0 14

12/47
Química Biológica I
Serie Nº 5 - Ácidos Nucleicos Año 2013

Serie Nº 5: Ácidos Nucleicos

1) Identifique cada una de las estructuras que componen los siguientes nucleótidos y nómbrelos

2) Dado el siguiente fragmento: T G A T C A G G T C G A C A A.


- escriba en formulas su estructura
- marque los extremos 5’ y 3’
- ¿cuál es la secuencia de bases de la cadena de ADN complementaria?

3) Una con flechas

pCpGpU Fragmento de ADN


pdGpdCpdUpdApdU Fragmento de ARN
pdGpdCpdT No existe

4) ¿Cuál sería el peso molecular aproximado de una molécula de DNA cuya longitud es 16.4 µm?

5) ¿Cuánto mide el genoma humano en una célula diploide sabiendo que está constituido por 6 x 109
pb?

6) A una preparación pura de ADN se le encontró 30.4 % A y 19.6 % C. a) Calcule la cantidad de G y


T en este ADN, b) calcule la razón de bases púricas con respecto a las pirimidínicas.

7) En muestras de ADN aislados de dos especies de bacterias no identificadas, la adenina represen-


ta el 32 y el 17 % del total de bases respectivamente. ¿Qué proporciones relativas de A, G, C y T
esperaría encontrar en las dos muestras de ADN? Una de las bacterias fue aislada de una vertien-
te caliente (64°C), podría decir qué ADN proviene de esta bacteria? Fundamente su respuesta.

8) El ADN de un virus tiene la siguiente composición de bases: A 23%, G 21%, T 36%, C 20%. ¿Qué
nos dice esta información acerca del ADN de este virus?

9) a) Ordene las siguientes moléculas de ADN según su temperatura de fusión:

I) AAGTTCTCTGAA
TTCAAGAGACTT

II) AGTCGTCAATGCAG
TCAGCAGTTACGTC

III) GCACCTCTCAGG
CCTGGAGAGTCC

c) ¿Cuál de las estructuras siguientes tendrá la temperatura más baja para lograr la separación
de las hebras?

1/47
Química Biológica I
Serie Nº 5 - Ácidos Nucleicos Año 2013

AGTTGCGACCATGATCTG
TCAACGCTGGTACTAGAC

ATTGGCCCCGAATATCTG
TAACCGGGGCTTATAGAC

10) La fosfodiesterasa de veneno de serpiente es una exo (ribo y desoxirribo) nucleasa (clase a) que
actúa desde el extremo 3’ Indique los productos resultantes de acción de la misma sobre los si-
guientes fragmentos:
a) p-G-p-C-p-A-p-U-p-A-p-A-p-C-p-U
b) p-dG-p-dC-p-dA-p-dT-p-dA-p-dA-p-dC-p-T

11) La fosfodiesterasa del bazo es una exo (ribo y desoxirribo) nucleasa (clase b) que actúa desde el
extremo 5’ Indique los productos resultantes de acción de la misma sobre los siguientes frag-
mentos:
a) p-G-p-C-p-A-p-U-p-A-p-A-p-C-p-U
b) p-dG-p-dC-p-dA-p-dT-p-dA-p-dA-p-dC-p-T

12) Usted recibe una muestra de material genético de origen viral para su estudio químico y estructu-
ral. La muestra presentó las siguientes características:
a) fue totalmente insensible a NaOH 5N
b) el tratamiento con una endonucleasa produjo un sólo fragmento de peso molecular 8.105
c) al elevar la temperatura por encima de la temperatura crítica se produjo un marcado aumento
de la absorbancia a 260 nm
Con los datos precedentes caracterice tanto como le sea posible a la muestra, justificando en
cada caso su respuesta.

13) Usted recibe en su laboratorio una muestra de material biológico que presenta las siguientes ca-
racterísticas:
a) PM 22.000
b) fue totalmente insensible al tratamiento con exorribonucleasas
c) fue totalmente hidrolizado con NaOH 5N
d) no presentó efecto hipercrómico
Caracterice lo más posible a la muestra justificando las características de la misma.

14) Relacione cada ARN con su característica correspondiente

ARNt Contiene codones.


ARNr Se asocia a proteínas formando macroestructuras celulares
ARNm Sufre procesado posterior
ARNhn Doble hélice intracatenaria y anticodon.

15) Relacione cada ARN con su función.

ARNm ARN precursor


ARNt Copia de ADN que contiene la información para hacer una proteína
ARNr Forma parte de los ribosomas
ARNhn Portador de aminoácidos

16) Dada la siguiente secuencia correspondiente a una hebra de un oligonucleótido de doble hebra:

5’ ACCGTAAGGCTTTAG 3’

2/47
Química Biológica I
Serie Nº 5 - Ácidos Nucleicos Año 2013

a- Escriba la secuencia de la hebra de ADN complementaria


b- Escriba la secuencia de ARN complementario de la hebra escrita en el item a

17) De acuerdo a la secuencia del ARNm correspondiente a los diez primeros residuos de la Hb de
foca

5’ AUGGGGCUCAGCGACGGGGAAUGGCACUUGGUG 3’

a. Escriba la secuencia de la hebra de ADN que tiene la misma secuencia que el ARNm y la
hebra de ADN complementaria al ARNm a partir de la cual se sintetiza este último.
b. Escriba la secuencia de aminoácidos traducida teniendo en cuenta el código genético

18) Dada la siguiente porción de ARNm, escriba la secuencia de aminoácidos que esta codificada
por:

5’ GCCAUGUUUCCGAGUUAUCCCAAAGAUAAAAAAGAG 3’

19) Escriba el fragmento de ARNm y ADN molde y codificante que se corresponde al siguientes oli-
gopeptidos:

Glu-Leu-Tyr-Val-Phe-Asn

………………………………………………………………………………… ADN codificante


………………………………………………………………………………… ADN molde
………………………………………………………………………………… ARNm

Gln-Ile-Pro-Ser-Cys
………………………………………………………………………………… ADN codificante
………………………………………………………………………………… ADN molde
………………………………………………………………………………… ARNm

20) Se fragmentó una pequeña molécula de ADN con varias nucleasas de restricción diferentes, y se
determinó el tamaño de cada fragmento mediante electroforesis en gel. Se obtuvieron los siguien-
tes datos que se muestran en la tabla. (suponemos que todas las enzimas han producido al me-
nos un corte sobre la molécula de ADN)
a. ¿es la molécula original lineal o circular?
b. Dibuje un mapa de lugares de restricción, indicando las distancias entre los mismos, que
concuerde con los datos presentados
c. ¿qué debería hacerse para localizar los lugares de ruptura sin ambigüedades entre ellos?

3/47
Química Biológica I
Serie Nº 5 - Ácidos Nucleicos Año 2013

Tamaño de los fragmentos


Enzima
(Kb)
Eco RI 1.3 - 1.3
Hpa I 2.6
Hind III 2.6
Eco RI + Hpa I 1.3 – 0.8 – 0.5
Eco RI + Hind III 0.6 – 0.7 – 1.3

21) A continuación se presenta el gen que codifica para una extensina de la Nicotiana silvestres:

1 atggctaaaa tagtctctct tctcgccact cttgtagtgg ctttactgtc ccttagcttt


61 cctttagaat gcaaagcaaa ttactactat agttctcctc ctccaccaac caaaaagtat
121 gtgtactcat caccaccacc tccagtttat aagtacaaat ccccaccacc acccgtttac
181 aaacataagt ctcctccacc acctcctccg gtttacaaat acaaatcacc accaccaccc
241 gtttataaat acaaatcacc accaccgcct cctccggtct acaaatctcc accaccacct
301 atttacaagt acaagtctcc tccaccacct cctccagtct acaaatcccc accaccacca
361 gtttacaagt ataaatcacc gccgccgcct ccaccagttt ataaatctcc accaccccca
421 gtttacaagt ctccaccacc cccttaccac tattattaca catctccacc tcctcctcac
481 tactag

Se emplea la enzima de restricción Hpa II cuya secuencia de reconocimiento es C▼CGG, la


cual produce dos cortes, generando 3 fragmentos de restricción.

a- Ubique la zona de corte y determine el tamaño (pb) de los fragmentos obtenidos (ayuda: las
zonas de corte están entre las bases 180 y 300).
b- ¿Qué tamaño tendrá/n el/los fragmentos resultantes de la acción de la Hae III GG▼CC?.
c- Esquematice cómo se visualizarían en un gel de agarosa estos fragmentos.

22) Una muestra de ADN se amplificó mediante la técnica de PCR y luego se sometió a análisis de
restricción enzimática. Para esto se utilizaron 3 nucleasas de restricción:
- enzima A con la siguiente secuencia de reconocimiento (AA▼TT),
- enzima B (AC/GT▼T)
- enzima C (C▼CGG).
a) Analice el fragmento de ADN amplificado en la Tabla 1 y complete la Tabla 2 de acuerdo a los
fragmentos obtenidos luego de la restricción.
b) Realice un esquema de los resultados en una electroforesis en gel de agarosa

Tabla 1. Secuencia amplificada


1 taacaaggat tcccctagta acggcgagcg aagcgggaag agctcaaatt
51 cacctccggt gtccgcgttg taatctcgag acgagttttc cgtgcggctc

Tabla 2.

Enzimas A,
Restricción con: Enzima A Enzima B Enzima C
ByC
Fragmentos en pa-
res de bases (pb)

4/47
Química Biológica I
Serie Nº 5 - Ácidos Nucleicos Año 2013

b) Electroforesis en gel de agarosa

MPM A B C A+B+C
100 pb

50 pb
.
30 pb

20 pb

10 pb

23) Un fragmento de DNA codificante tiene la siguiente secuencia:

5'-AGCCGAATGCTTCAGTAGCTTACCCATAGG-3'

Si se somete el material a las siguientes enzimas de restricción:

MICROORGANISMO ENZIMA SECUENCIA

Arthrobacter luteus Alu I AG· CT


TC· GA

Escherichia coli RY13 Eco RI G· AATTC


CTTAA· G

a- Indique los fragmentos (en pb) que obtendría si realiza la restricción con ambas enzimas si-
multáneamente.
b- Realice un esquema de una electroforesis en gel de agarosa de los fragmentos obtenidos
luego de la restricción.

24) La siguiente secuencia corresponde a una de las siete especies del género Malassezia. Se ana-
lizó una muestra de piel de un paciente con Pitiriasis versicolor por amplificación de ADN (PCR) y
posterior análisis de restricción enzimática (REA). Se utilizaron los primers: Malup( 5´-AGC GGA
GGA AAA GAA ACT-3´) y Maldown ( 5´-GCG CGA AGG TGT CCG AAG-3´), las enzimas de res-
tricción fueron: Ban I cuya secuencia de reconocimiento es: 5’...GG(T/C)(A/G)C C...3’, Hae II
cuya secuencia de reconocimiento es: 5’...(A/G) GCGC(T/C).3’ y Msp I cuya secuencia de re-
conocimiento es: 5’...C CG G...3’ (la flecha indica donde corta la enzima). De acuerdo al mapa
de restricción (tabla 1) para las siete especies de Malassezia y al fragmento amplificado (tabla 2),
indique de a cual de las siete especies corresponde la secuencia.

Tabla 1. Fragmentos de restricción (bp) utilizando Ban I, Hae II y Msp I, de la subunidad


larga del gen rRNA de las siete especies de Malassezia

Ban I Hae II Msp I

M. furfur 58, 77, 410 73, 109, 113, 250 545


M. obtusa 58, 521 109, 220, 250 65, 514
M. pachydermatis 58, 485 109, 184, 250 543
M. restricta 544 544 544
M. sloofiae 27, 47, 58, 337 87, 101, 109, 250 65, 101, 381
M. globosa 58, 489 547 65, 71, 411
M. sympodialis 58, 75, 408 182, 359 53, 65, 98, 325

5/47
Química Biológica I
Serie Nº 5 - Ácidos Nucleicos Año 2013

Tabla 2. Secuencia amplificada (en negrita se indica donde se pegaron los primers)
1 taacaaggat tcccctagta acggcgagcg aagcgggaag agctcaaatt tgaaagctgg
61 cacctccggt gtccgcgttg taatctcgag acgtgttttc cgtgcggctc tatggacaag
121 tcccttggaa tagggcatcg tagagggtga gaatcccgta cttgccatgg aagaaccgtg
181 ctttgcgata cacgctctaa gagtcgagtt gtttgggatt gcagctcaaa atgggtggta
241 gactccatct aaagctaaat atcggggaga gaccgatagc gaacaagtac cgtgagggaa
301 agatgaaaag cactttggaa agagagttaa aagtacgtga aattgtcgaa agggaagcac
361 ttgaagtcag ccatgctgct tgagactcag cctggccttt gggcttggtg tatttctcgg
421 tggcaagcca gcattggttt gggtcgtcgg agaagcgcat agggaatgta gcgtctccgg
481 acgtgttata gccttatgca ggatacgacg acctggatca aggaacgcag tgtgccctct
541 gggcgggtct tcggacacct tca

ANEXO

6/47
Química Biológica I
Serie Nº 5 - Ácidos Nucleicos Año 2013

Código genético

1º nucleótido 2º nucleótido 3º nucleótido


U C A G
Phe Ser Tyr Cys U
U Phe Ser Tyr Cys C
Leu Ser Stop Stop A
Leu Ser Stop Trp G
Leu Pro His Arg U
C Leu Pro His Arg C
Leu Pro Gln Arg A
Leu Pro Gln Arg G
Ile Thr Asn Ser U
A Ile Thr Asn Ser C
Ile Thr Lys Arg A
Met Thr Lys Arg G
Val Ala Asp Gli U
G Val Ala Asp Gli C
Val Ala Glu Gli A
Val Ala Glu Gli G

Equivalencias:

0,34 nm
1 pb
660 Da

7/47
Química Biológica I
Serie Nº 6 – Vitaminas y Coenzimas Año 2012

Serie Nº 6: VITAMINAS Y COENZIMAS

1) Escriba la reacción entre las siguientes moléculas e indique tipo de reacción:


a- la acetil coenzima A y la colina
b- el fosfato de piridoxal y la alanina
c- el dinucleótido de adenina y nicotinamida (reducido) y el peróxido de hidrógeno;
d- el dinucleótido de flavina y adenina (oxidado) y el ácido succínico (este se transforma en fuma-
rato: COO--CH=CH-COO-)
e- la metil cobalamina y la glicina
f- formil-tetrahidrofolato (ácido polínico) y la metionina.

2) Dadas las siguientes reacciones

R1- CH - COO- R1- C- COO-


l ll
+
NH3 O

Transaminasa

R2 - C - COO- R2 - CH - COO-
ll l
+
O NH3

Responda:
- Cuál es la coenzima involucrada y que cambios presenta en su estructura.
- Qué compuesto intermediario está involucrado en la reacción.
- En el metabolismo de que compuestos tienen importancia estas reacciones.
- Nombre las 2 transaminasas que se determinan en un hepatograma y escriba las reacciones que
catalizan.

3) La oxidación del etanol en el citosol de los hepatocitos se produce por la acción de la enzima alco-
hol deshidrogenasa, en primer lugar, y luego por acción de la acetaldehído deshidrogenasa en las
mitocondrias se llega al producto final acetato.
- Escriba las 2 reacciones y la coenzima involucrada en ambos procesos.1

4) Una de las reacciones del ciclo del ácido cítrico consiste en una descarboxilación oxidativa (pérdida
de CO2 por medio de una oxidación) catalizada por un complejo enzimático denominado α-
cetoglutarato deshidrogenasa, dicho proceso es análogo al que sufre el piruvato en su conversión a
acetilCoA en la vía irreversible de glucólisis a ciclo del ácido cítrico.

α-cetoglutarato + NAD+ + CoA-SH → + CO2 + +

-Complete la reacción.
-Nombre las 4 coenzimas involucradas en el proceso y las enzimas que constituyen el proceso.

5) Luego de leer las siguientes afirmaciones, diga de que vitamina se trata:


- Derivado imidazólico distribuído extensamente en alimentos naturales.
- La síntesis por bacterias intestinales proporciona un gran porcentaje de su requerimiento.
- El gran consumo de huevo crudo puede causar su deficiencia, debido a la proteína avidina de la
clara, que impide su absorción.
- En las reacciones en que participa se necesita además la presencia de HCO3, ATP y Mg++.

1
Nota: algo del metabolismo se lleva a cabo mediante el sistema oxidante del etanol microsomal (MEOS) depen-
diente del citocromo P-450 que involucra O2 y la misma coenzima partícipe del proceso anterior pero fosforilada
(este sistema adquiere importancia en el alcoholismo crónico).

1/47
Química Biológica I
Serie Nº 6 – Vitaminas y Coenzimas Año 2012

6) Si 2 personas consumieran alimentos en recipientes herrumbrados, una de ellas acompañara su


comida con un jugo de naranjas recién exprimidas y la otra solo con un vaso de agua. ¿ qué benefi-
cios tendría la primera respecto a la segunda?. ¿ Por qué?.

7) Qué significa “la trampa del folato”, la deficiencia de qué vitamina involucra y que manifestación
hematológica produce. Explique brevemente.

8) Las reacciones de acetilación son de importancia en el metabolismo de ciertos medica-


mentos. Complete la siguiente reacción con la coenzima involucrada.

H 2N SO2NH2 H 2N SO2NH2 CO CH3


+ +
sulfanilamida N- acetiltransferasa acetil sulfanilamida

2/47
Química Biológica I
Serie Nº 7 – Enzimas Año 2013

Serie Nº 7: ENZIMAS

PARTE I

Cuestionario guía
(libro base: Bioquímica de Harper, cap. 8 – Material de apoyo)

1) ¿Qué son las enzimas? ¿En qué se diferencian de los catalizadores inorgánicos?
Destaque un aspecto biomédico importante de las enzimas que atañe a los bioquímicos.

2) Lea LDH - significación clínica y fundamentos del método. ¿Qué dosa el bioquímico mediante este
método? Con los conocimientos que Ud. reúne hasta el momento: ¿qué rol cumple el piruvato y el
NADH en esta reacción? ¿Cuál es el reactivo que le permitirá seguir el curso de la reacción?

3) Nombre las 6 clases principales en las que se clasifican las enzimas. Busque ejemplos en la litera-
tura que no coincidan con los dados en clase y escriba la reacción que catalizan.

4) Escriba la ecuación que cataliza la enzima identificada según E.C. (Comisión de Enzimas) 2.7.1.1.

5) Lea GLUCOSA ENZIMÁTICA. Complete la numeración para la enzima GOD. ¿Es correcta la nu-
meración para la enzima POD? Dentro de este análisis para glucosa, ¿qué rol cumplen las enzi-
mas?

6) Otro método para el dosaje de la glucosa sérica es mediante la glucosa-deshidrogenasa, la cual


cataliza la siguiente reacción:
-D-glucosa + NAD +  D-Gluconolactona +NADH + H+
Indique: clase, subclase y sub-subclase para la enzima y el nombre de acuerdo a la UIB.

7) Indique, según la Comisión de Enzimas la clase de enzima que cataliza cada reacción:

a. Fru-6P  Glc-6P
b. etanol + NAD+  etanal + NADH + H+
c. acetoacetato  CO2 + acetona
d. Acetil-CoA + CO2 + ATP  Acetoacetil-CoA + ADP + Pi
e. Glc + ATP  Glc-6P + ADP + Pi
f. 3-fosfoglicerato  2-fosfoglicerato
g. Sacarosa + H2O  Glc + Fru
h. 2 Acetil-CoA  Acetoacetil-CoA + CoA-SH
i. Piruvato + NADH + H+  lactato + NAD+
j. ÁCIDO GRASO + CoA-SH + ATP  ACIL-CoA + AMP + PPi

8) La siguiente reacción: L-glutamato + NH4+ + ATP  L-glutamina + + ADP + Pi


Es catalizada por una:
a- transferasa
b- ligasa
c- liasa
d- ninguna es correcta

9) ¿Qué es la holoenzima? ¿Apoenzima? ¿Como definiría Ud. grupo prostético? ¿Y el autor V. W.


Rodwell? (Para aclarar estos conceptos leer Lehninger pág. 576). De un ejemplo de coenzima que
sea grupo prostético.

10) Escriba un ejemplo, de los vistos en la clase sobre coenzimas, para la reacción planteada (1) en el
libro. Idem para (2).

3
Química Biológica I
Serie Nº 7 – Enzimas Año 2013

PARTE II

1) Para la determinación de LDH en el suero de un paciente con presunto infarto de miocardio se


mezclaron 3 ml de solución tamponada de sustratos (piruvato y NADH) preincubada a 37ºC, y
100l suero. Se leyó inmediatamente la absorbancia a diferentes tiempos donde se registraron los
siguientes valores:

tiempo (min) 0 1 2 3
Absorbancia 1,256 1,215 1,176 1,137

a) Sabiendo que el  NADH (340nm) = 6,22 mM-1 determine la concentración de LDH en el suero
del paciente, indicando si su valor es patológico.
Valores normales (UI/l)37ºC: 150-450.
b) A fin de evitar repetir todos los cálculos en una próxima detrminación calcule el factor de con-
versión de A/min  UI/l.

2) El siguiente gráfico corresponde a la cinética michaeliana de una enzima obtenida a partir de un


extracto vegetal. Estime cual sería la VM y la KM para esta enzima.

50
45
40
35
v, mM/min

30
25
20
15
10
5
0
0 50 100 150 200 250
[S], mM

3) Se estudió la dependencia de la actividad enzimática con la [S] y se obtuvieron los siguientes valo-
res de velocidad (µM/min):

[S] (mM) 0,25 0,50 0,67 1,00


v 33 50 57 67

a) A partir de los mismos calcule los valores de KM y VM (exprese la velocidad en UI y en katales).


b) Calcule el número de recambio sabiendo que la concentración de la enzima en la muestra es
de 0,025mM y que la misma tiene 2 sitios activos por molécula.

4) Luego de purificar la enzima gliceraldehído 3-fosfato deshidrogenasa se procedió a determinar el


valor de Vmax y Km del gliceraldehído 3-fosfato a pH 8,0. Los valores obtenidos fueron los siguien-
tes: Vmax = 20 U/ml; Km = 1 mM. Luego se volvieron a determinar estos parámetros cinéticos en
presencia de cuatro sustancias conocidas A, B y C, obteniéndose en cada caso los siguientes va-
lores: ver tabla.
En base a estos datos, indique que tipos de sustancias son A, B y C. Justifique.

Km (mM) Vmax (U/ml)


En presencia de A 2,0 20
En presencia de B 0,5 10
En presencia de C 1,0 10

4
Química Biológica I
Serie Nº 7 – Enzimas Año 2013

5) Se observó que la enzima hexoquinasa que cataliza la siguiente reacción:


Glucosa + ATP  Glucosa-6P + ADP
era inhibida por piruvato. La Tabla muestra los valores de actividad (µmol.min-1) obtenidos cuando
se varía la concentración de sustrato (Glucosa) y/o del inhibidor (Piruvato).

S (mM) 1,00 1,82 2,50 10,00


-1
I (mM) Actividad (µmol.min )
0,0 1,25 2,00 2,50 5,00
0,2 0,83 1,33 1,67 3,33
0,4 0,63 1,00 1,25 2,50
0,6 0,50 0,80 1,00 2,00
0,8 0,42 0,67 0,83 1,67
1,0 0,36 0,57 0,71 1,43

En base a estos datos indique:


a) ¿Qué tipo de inhibidor es piruvato?
b) Calcule el valor de Ki.
c) Calcule el valor de Km para la glucosa.
d) Calcule Vmax de la enzima.

6) Se estudia la hidrólisis de un éster catalizada por una enzima en presencia de un inhibidor no


competitivo. Al representar por el método de Lineweaver-Burk se encontraron los puntos de corte
con los ejes indicados en la tabla:
+ 0,033 mM Inhibidor
Corte OY (min/mM) 0,32
Corte OX (mM-1) 0,35

a) A partir de los siguientes datos determine KM y VM para la reacción en ausencia del inhibi-
dor, sabiendo que Ki es 2.34x10-2 mM. La VM exprésela en UI/L.
b) Si la concentración de la enzima es 0.2M y la misma posee 3 sitios de unión al sustrato, de-
termine el número de moles que cada mol de sitio activo de la enzima transforma por minuto
cuando está saturada y en ausencia de inhibidor.

7) La glutamina sintetasa cataliza la siguiente reacción:


L-Glu + NH3 + ATP  L-Gln + ADP + Pi
Cuando las concentraciones de NH3 y de ATP son saturantes, la enzima manifiesta una cinética
michaeliana respecto al ácido glutámico. Sin embargo, cuando a un preparado enzimático se le
añade L-serina de modo que su concentración resulte ser 16 mM, se observa que tanto Km como
Vmax disminuyen hasta alcanzar 1/3 del valor primitivo. Indicar:
a- ¿qué tipo de inhibición ejerce la serina?
b- ¿cuál será el valor de su Ki?.

5
Química Biológica I
Serie Nº 7 – Enzimas Año 2013

Ejercicios Complementarios

1) La fumarasa cataliza la reacción de hidratación que transforma el fumarato en L- malato. Esta


enzima está constituída por cuatro subunidades idénticas y tiene un peso molecular de 194000 D.
Cuando se utilizó como sustrato el fumarato, una concentración de enzima 2 x 10-6 M, y se midió
la velocidad de la reacción, a 25°C, se obtuvieron los siguientes valores:

Fumarato velocidad inicial


(mM) (mM min-1)
2.0 2.5
3.3 3.1
5.0 3.6
10.0 4.2

a) Determine KM y VMAX (en UI/L) en dichas condiciones. Rta: VM= 5000 UI/L; KM= 2 mM.
b) Determine el número de recambio sabiendo que cada subunidad posee un sitio activo para la
enzima. Rta: Nº recambio= 625 min-1.

2) Una enzima cataliza una reacción con una velocidad máxima de 5 μmoles por minuto, siendo su
Km para el sustrato de 0,5 mM. Si la ponemos en presencia de una concentración 500 mM de sus-
trato, ¿Qué cantidad de sustrato se logrará transformar en 10 min?
Rta.: 50 μmoles

3) Sobre una enzima que cataliza la reacción S  P se prueba el efecto de dos inhibidores X e Y,
obteniéndose los siguientes datos de velocidad. Determine la naturaleza de cada inhibidor hacien-
do un esquema de la inhibición. Calcule Km, Vmax y Ki.

Velocidad (U/ml)
[S] (mM) Sin agregado + 12 µM X + 60 µM Y
2,00 66,67 40,00 22,22
2,50 71,40 45,45 23,81
3,33 76,92 52,63 25,64
4,00 80,00 57,14 26,67

Respuesta
Inhibidor X: Inhibidor competitivo
Esquema de la inhibición: KM’= 3,12 mM
E + S → ES → E + P
KM= 1,1 mM
+
I VM’= VM= 100 U/mL
Ki Ki= 6,53 µM
EI
Inhibidor Y: Inhibidor no competitivo
Esquema de la inhibición:
E + S → ES → E + P
+ +
I I
Ki Ki
EI EI
KM’= KM= 1,1 mM
VM’= 34,5 U/mL
Ki= 31,6 µM

6
Química Biológica I
Serie Nº 8 – Hemoproteinas Año 2013

Este es un caso particular donde los dos valores de Ki son iguales por eso se puede calcular.

4) El número de recambio de una enzima es 3527 min-1. ¿Qué significa este valor? Si agrega al sis-
tema enzimático un inhibidor competitivo, ¿qué valor espera obtener para este índice (mayor, me-
nor, igual)?
Respuesta
- La enzima convierte 3527 moles de sustrato por mol de sitio activo.
- Recordar que la enzima se encuentra saturada, entonces si disminuyo la cantidad de enzima (por ej
de moles a µmoles), va a ser menor la cantidad de sustrato necesaria para saturar la enzima y el
número de recambio no varía.
- Al agregar un inhibidor competitivo no cambia el nº de recambio pues la enzima se encuentra satu-
rada (por definición) y la velocidad máxima es la misma.

5) Estime KM y VM (en UI/L) para cada cinética presentada en el siguiente gráfico. Proponga una cau-
sa para las diferencias observadas (ej, distinta enzima, distinta cantidad de enzima, presencia de
un inhibidor).

50
45
40
35
v, mM/min

30
25
20
15
10
5
0
0 50 100 150 200 250
[S], mM

Rta:
VM1= 45 mM/min y KM1= 10 mM
VM2= 30 mM/min y KM2= 10 mM
Posibles causas:
- Puede ser que la curva 2 corresponda a una cinética que tenga menos enzima que la correspon-
diente a la curva 1 (por ello KM es la misma solo difiere la VM, a más enzima mayor VM).
- O debido a la presencia de in inhibidor no competitivo en la cinética 2, que reduce la VM sin em-
bargo no produce cambio aparente de la KM.

6) Con los siguientes datos determine gráficamente los valores de Km y Vmax en ausencia y presencia
de un inhibidor, e indique el tipo de inhibición.

S (mM) 0,20 0,286 0,40 1,00 2,00


Experimento Velocidad (U/ml)
- Inhibidor 0,0793 0,10 0,119 0,167 0,196
+ Inhibidor 0,04 0,05 0,0595 0,083 0,098
Rta: Inhibidor no competitivo. KM’= KM= 0,38 mM; VM’= 0,12 U/mL; VM= 0,24 U/mL.

1
Química Biológica I
Serie Nº 8 – Hemoproteinas Año 2013

7) Una enzima tiene una actividad máxima de 420 UI/L, esto significa:
a- que transforma 521 moles de enzima por minuto por litro de solución enzimática; F
b- que la concentración de sustrato que provoca una velocidad de conversión de 210 UI/L es el
valor que corresponde a KM para esa enzima; V
c- que la concentración de sustrato es tal que la enzima está saturada; V
d- si la cantidad de enzima se reduce a la mitad su actividad se duplica. F

8) Al estudiar la cinética de inhibición de cierta enzima se han obtenido los resultados de la tabla si-
guiente:
_______________________________________________________
Sustrato (mM) v (μmol/min)
__________________________________________
[I]= 0 [I]= 0,1 mM [I]= 1 mM
_______________________________________________________
0,02 2,90 2,52 1,18
0,05 5,00 4,02 1,43
0,10 6,67 5,02 1,54
0,20 8,13 5,72 1,60
0,50 9,09 6,25 1,64
_______________________________________________________
Determinar gráficamente:
a- tipo de inhibición;
b- el valor de Km del enzima;
c- la Vm (UI);
d- el valor de Ki

Rta: a) Inhibición acompetitiva; b) Km= 0,05 mM; c) Vm= 10 UI; d) Ki= 0,2 mM

2
Química Biológica I
Serie Nº 8 – Hemoproteinas Año 2013

Serie Nº 8: HEMOPROTEÍNAS

1) Los datos que se presentan a continuación describen la unión del oxígeno a la mioglobina humana
a 37 ºC.

Po2 (mm Hg) θ


0.5 0.161
1 0.277
2 0.434
3 0.535
4 0.605
6 0.697
8 0.754
12 0.821
20 0.885

a) A partir de estos datos, estimar:


b) El valor de la P50. ¿Cuál es la implicancia del valor hallado?
c) El porcentaje de saturación de la mioglobina a 30 mm Hg, la presión parcial de O2 en la sangre
venosa.
d) Mediante la representación correspondiente determine el coeficiente de Hill. ¿Qué tipo de inter-
acción establece la mioglobina con el oxígeno?

2) ¿Qué efecto cabría prever que tuviera cada una de las siguientes modificaciones sobre la P50 de la
hemoglobina?
a) Aumento del pH, pasando de 7.2 a 7.4.
b) Aumento de la Pco2, pasando de 20 a 40 mm Hg.

3) Las medidas de la unión del oxígeno por la sangre humana total, a 37 ºC, a pH 7.4, en presencia
de 40 mm Hg de CO2, y con unas concentraciones fisiológicas normales de BPG (5 mmol/L de
células), dan los siguientes resultados:

Po2 (mm Hg) % de saturación (= 100 x θ)


10.6 10
19.5 30
27.4 50
37.5 70
50.4 85
77.3 96
92.3 98

A partir de estos datos, elabore una curva de unión y estime el porcentaje de saturación de oxí-
geno de la sangre a:
a) 100 mm Hg, la presión parcial aproximada de O2 en los pulmones, y
b) 30 mm Hg, la presión parcial aproximada de O2 en la sangre venosa.
c) En estas condiciones, ¿qué porcentaje del oxígeno unido en los pulmones se libera en los
tejidos?

4) ¿Qué efecto produce el pH bajo existente en los tejidos sobre la hemoglobina? ¿Cómo se denomi-
na este efecto? ¿La mioglobina también lo presenta?

5) Se lleva a cabo una electroforesis SDS-PAGE de una muestra que contiene hemoglobina (pI =
7.0; PM = 64 kDa) y mioglobina (pI = 7.0; PM = 17 kDa) a pH = 8.0. ¿Hacia qué electrodo se des-
plazarán las proteínas? ¿Cuál lo hará con mayor rapidez? Justifique sus respuestas.

3
Química Biológica I
Serie Nº 9 – Proteínas de Membrana Año 2013

Serie Nº 9: PROTEÍNAS DE MEMBRANA

1) Observe las siguientes imágenes e indique el tipo de proteína implicada en cada proceso

B C

2)
Es-
que
ma-
tice

a
)
un canal de potasio ubicado en una
membrana donde la concentración del ion es superior en el citosol.
b) Idem para un transportador activo del mismo ión y en la misma membrana.
c) idem b) para un transportador pasivo
d) la misma proteina de membrana del item a) pero sabiendo que dependiente de ligando extrace-
lular

3) Baje de Internet el siguiente artículo:


Martín Martínez Rosas. Los canales iónicos: la biología y patología. Archivos de Cardiología de
México. Vol. 74, Supl. 2, 60 Aniversario/Abril-Junio 2004:S205-S210
en el sitio http://www.medigraphic.com/pdfs/archi/ac-2004/acs042o.pdf
y responda el siguiente cuestionario
a) ¿Cómo clasifica a los canales iónicos?
b) ¿en qué procesos celulares intervienen los canales iónicos?
c) señale en el texto aquellos párrafos donde describen las caracteristicas funcionales de un canal
iónico
d) ¿qué desarrollos tecnológicos permitieron profundizar los conocimientos en el funcionamiento
de los canales ionicos?
e) ¿a qué se denominan canalopatías?
f) ¿qué factores desencadenan canalopatías?
g) cite un ejemplo de canalopatía asociada a cada tipo de canal

1
Química Biológica I
Serie Nº 9 – Proteínas de Membrana Año 2013

4) Investigue acerca de la base molecular de la enfermedad fibrosis quística

5) Indique, para cada una de las estructuras que muestra la figura el tipo de proteína de membrana y
función