Вы находитесь на странице: 1из 14
Received: 31 July 2017 | Accepted: 30 April 2018 DOI: 10.1002/jcp.26788 ORIGINAL RESEARCH ARTICLE Estrogen

Received: 31 July 2017 | Accepted: 30 April 2018

DOI: 10.1002/jcp.26788

ORIGINAL RESEARCH ARTICLE

April 2018 DOI: 10.1002/jcp.26788 ORIGINAL RESEARCH ARTICLE Estrogen inhibits osteoclasts formation and bone resorption

Estrogen inhibits osteoclasts formation and bone resorption via microRNA 27a targeting PPARγ and APC

Lei Guo 1 *

Niandong Qian 1 | Jin Qi 1 | Zhiliang Shao 1

* Niandong Qian 1 | Jin Qi 1 | Zhiliang Shao 1 | Kaizhe Chen 1

| Kaizhe Chen 1 * | Jun Yuan 1 * | Ping Huang 1 | Xing Xu 1

* | Jun Yuan 1 * | Ping Huang 1 | Xing Xu 1 | Changwei

| Changwei Li 1 |

| Lianfu Deng 1 | Chuan He 1 | Jiping Xu 2

1 Shanghai Key Laboratory for Bone and Joint Diseases, Shanghai Institute of Orthopaedics and Traumatology, Shanghai Ruijin Hospital, Shanghai Jiaotong University School of Medicine, Shanghai, China

2 Orthopedic Sevice, Shanghai Fengxian District Center Hospital, Shanghai Jiaotong University Affiliated Sixth People s Hospital South Campus, Shanghai, China

Correspondence Jiping Xu, Shanghai Fengxian District Center Hospital, Shanghai Jiaotong University School of Medicine, No. 6600, The Nanfeng Road, Fengxian District, Shanghai, 201499, China. Email: xujiping2001@yahoo.fr Chuan He and Lianfu Deng, Ruijin Hospital, Shanghai jiaotong University School of Medicine, No.197, The Second Ruijin Road, Luwan District Shanghai 200025, P. R. China. Email: drhechuan@sina.com (C.H.); lfdeng@msn.com (L.D.)

Funding information The National Science Foundation of China, Grant/Award Number: 81300713; Research project of Shanghai municipal health and Family Planning Commission, Grant/Award Numbers: 201640190, 201640105, 201540156; The Natural Science Foundation of Shanghai, Grant/Award Number:

17ZR1425900

Abstract

Inhibition of osteoclasts formation and bone resorption by estrogen is very important in the etiology of postmenopausal osteoporosis. The mechanisms of this process are still not fully understood. Recent studies implicated an important role of microRNAs in estrogenmediated responses in various cellular processes, including cell differentiation and proliferation. Thus, we hypothesized that these regulatory molecules might be implicated in the process of estrogendecreased osteoclasts formation and bone resorption. Western blot, quantitative realtime polymerase chain reaction, tartrateresistant acid phosphatase staining, pit formation assay and luciferase assay were used to investigate the role of microRNAs in estrogeninhibited osteoclast differentiation and bone resorption. We found that estrogen could directly suppress receptor activator of nuclear factor B ligand/ macrophage colonystimulating factorinduced differentiation of bone marrowderived macrophages into osteoclasts in the absence of stromal cell. MicroRNA27a was significantly increased during the process of estrogendecreased osteoclast differentiation. Overexpressing of microRNA27a remarkably enhanced the inhibitory effect of estrogen on osteoclast differentiation and bone resorption, whereas which were alleviated by microRNA27a depletion. Mechanistic studies showed that microRNA27a inhibited peroxisome proliferatoractivated receptor gamma (PPARγ) and adenomatous polyposis coli (APC) expression in osteoclasts through a microRNA27a binding site within the 3′‐untranslational region of PPARγ and APC. PPARγ and APC respectively contributed to microRNA27adecreased osteoclast differentiation and bone resorption. Taken together, these results showed that microRNA27a may play a significant role in the process of estrogeninhibited osteoclast differentiation and function.

KEYWORDS

estrogen, microRNA27a (miR27a), osteoclast, osteoporosis

1 | INTRODUCTION

Estrogen deficiencyinduced osteoporosis is the most common metabolic bone disease, characterized by structure alternations, including

*Lei Guo and Kaizhe Chen contributed equally to this work.

reductions in trabecular bone volume, density and strength, as well as a shift in tissue microenvironment with increasing proinflammatory cytokine levels in bone marrow and the serum (Zaidi, 2007). In osteoporosis, estrogen deficiency leads to increased bone turnover with enhanced bone formation and even greater rates of bone resorption, resulting in a net bone loss (Raisz, 2005). Thus, exploring the mechanisms

2 |

2 | GUO ET AL . by which estrogen decreases bone resorption is critical for understanding
2 | GUO ET AL . by which estrogen decreases bone resorption is critical for understanding

GUO ET AL .

by which estrogen decreases bone resorption is critical for understanding the pathogenesis of postmenopausal osteoporosis and may lead to the development of new therapeutic targets for the treatment of the disease. Normal bone remodeling maintains constant bone mass by an orchestrated balance between the destruction of old bone by osteoclasts and rebuilding by osteoblasts (Yu et al., 2014). Osteoclasts, arising from hematopoietic stem cells, are the sole boneresorbing cells. Osteoclasts undergo differentiation and fusion, resulting in large multinucleated cells in the presence of receptor activator of nuclear factor B ligand (RANKL) and macrophage colonystimulating factor (MCSF), both of them produced by stromal cells/osteoblasts (Shi et al., 2014). Previous studies showed that 17βestradiol opposes the differentiating effects of MCSF and RANKL and reduces the formation of osteoclastlike cells from undifferentiated precursors (Shevde, Bendixen, Dienger, & Pike, 2000). Furthermore, estrogen acts directly on fully differentiated osteoclasts to regulate the osteoclast bone resorbing activity (Nakamura et al., 2007). However, the exact mechanisms by which estrogen inhibits osteoclast differentiation and bone resorption need to be further explored. Recently, noncoding microRNAs (miRNAs) have emerged as key regulators of diverse physiological and pathological processes, includ- ing cell proliferation, apoptosis, and cancer (Couzin, 2007). MiRNAs affect gene expression through the inhibitory engagement of compli- mentary seed sequenceswithin the 3′‐untranslational region (3′‐UTR) of the target messenger RNAs (mRNAs), resulting in translational inhibition and/or mRNA degradation (Zeng, 2006). Many studies have elucidated the important roles of miRNAs in estrogenmediated responses in various cellular processes, including cell proliferation, apoptosis, and differentiation (Midgley, Morris, Phillips, & Steadman, 2016). Furthermore, miRNAs have been confirmed to associate with osteoclast formation (Ji, Chen, & Yu, 2016). However, very few studies have investigated the role of miRNAs in estrogenmediated osteoclast differentiation and bone resorption. In this study, we examined the role of microRNA 27a (miR 27a) in the repression of osteoclast differentiation and bone resorption by estrogen. We profiled the genome wide miRNA expression during estrogen inhibited osteoclast differentiation. Several altered miRNAs were suggested, in which miR 27a was identified as a strong candidate responsible for osteoclast differentiation. Furthermore, further studies found that miR 27a was also involved in estrogen decreased osteoclasts bone resorp- tion. Therefore, miRNAs and miRNA mediated gene silencing may contribute to the inhibition effects of estrogen on osteoclast differentiation and bone resorption.

2 | MATERIALS AND METHODS

2.1 | Animal models

Generation of ovariectomy (OVX) mice was accomplished according to previous reports (Sang et al., 2016). Twomonthold female C57BL/6J mice were divided into an OVX group (the bilateral ovaries of mice were removed) and a SHAM group (the bilateral ovaries of mice were

exposed but left intact). MiR27acarrying chitosan (miR27aCH) and miRNAs negative controlCH (miRNCCH; SigmaAldrich, St Louis) nanoparticles were delivered by intravenous injections at 5 mg per mouse twice a week (Krzeszinski et al., 2014). We established a sample size of at least six mice per group. After eight weeks, the femurs and tibia were acquired from SHAM, OVX, OVX + miR27aCH and OVX + miRNCCH mice for micro computed tomography (microCT), tartrateresistant acid phosphatase (TRAP) staining, and cell culture. We collected blood samples and isolated serums for serology. Serum enzyme linked immunosorbent assay was performed with a mouse TRAP5b assay kit (Westang, Shanghai, China). All animal care and experimental procedures were approved by the Shanghai Jiaotong University Animal Study Committee and were carried out in accordance with the guide for laboratory animalsuse.

2.2 | Skeletal phenotyping

The distal ends of intact femurs from SHAM, OVX, OVX + miR27aCH, and OVX + miRNCCH mice were scanned using microCT (GE Locus, London, UK) to assess bone mass, density, and trabecular microarch- itecture. The sample parameters computed from these data include bone mineral density (BMD), bone volume against tissue volume (BV/TV), trabecular thickness (Tb.Th), and trabecular number (Tb.N).

2.3 | Bone marrow derived macrophages isolation

and osteoclast culture

Primary bone marrow derived macrophages (BMMs) were isolated from the long bones of 8 week old C57BL/6J mice as previously reported (Shi et al., 2014). The cells then were cultured with complete alpha minimum essential medium (αMEM, Invitrogen, Grand Island, NY) in the presences of 10 ng/ml MCSF (Peprotech, Rocky Hill, NJ) for 24 hr. Nonadherent cells were harvested and cultured with fresh medium containing 50 ng/ml MCSF for 3 days to acquire osteoclast precursors (preosteoclasts). Then the preosteo- clasts were seeded and further cultured with complete αMEM medium containing M CSF (20 ng/ml) and RANKL (50 ng/ml) (Pepro- tech) for 7 days. Cell culture media were replaced every two days until mature osteoclasts were formed.

2.4 | Rhodamine phalloidin and TRAP staining

After culture, the cells were fixed in 4% paraformaldehyde. The localization of Factin was observed to confirm differentiation to the active form of osteoclasts. The fixed cells were incubated with 0.1% Triton X for 5 min. Then, the solution was replaced with rhodamine phalloidin solution, and the tissues were kept stationary in a dark room for 30 min, followed by F actin staining. The fluorescence signal was detected by confocal laser scanning microscopy (Carl Zeiss, Oberkochen, Germany), and the number of osteoclasts with a fluorescent ring was counted. For TRAP staining, TRAP solution was added to the well and incubated with the cells at 37°C for 15 min. The number of cells with three or more nuclei was counted under an optical microscope.

GUO ET AL .

GUO ET AL . | 3 2.5 | Pit formation assay Bone resorption activity was measured

|

GUO ET AL . | 3 2.5 | Pit formation assay Bone resorption activity was measured

3

2.5 | Pit formation assay

Bone resorption activity was measured by pit formation assay according to the method of Chen, Ni, Yang, Ye, and Chen (2014) with slight modifications. Purified mononuclear cells were cultured on bovine cortical bone slices in 24 well plates, followed by induction of RANKL and MCSF. After 7 days, the slices were placed for 10 min in 1 M NH 4 OH and were sonicated to remove the cells. The cellfree slices were stained in 1% toluidine blue in 1% sodium borate for 1 min. The experiment was repeated three times. The resorption pits appeared dark blue and were viewed by light microscopy. The percentage of pit area to a random field of view was calculated. Three fields were counted for each group. All data are expressed as mean ± standard deviation (SD; n = 3).

reverse transcriptase (TaKaRa Biotechnology, Japan). Quantitative realtime PCR (qRTPCR) was performed to amplify the cDNA using the SYBR Premix Ex Tag kit (TaKaRa Biotechnology) and an ABI 7500 Sequencing Detection System (Applied Biosystems, Foster City, CA). The mouse primer sequences for TRAP (Accession number:

NM_011611), c fos (Accession number: NM_010234) and βactin (Accession number: NM_007393 ) are described in Table 1.

2.8 | Quantification of miRNA levels

The mirVanaTM qRT PCR miRNA Detection Kit (Ambion, TX) was used in conjunction with qRTPCR with SYBR Green I for quantifica- tion of miR27a transcript, as detailed elsewhere (Luo et al., 2007).

2.6 | MiRNA microarray analysis

Primary BMMs were isolated from the long bones of SHAM and OVX mice. Cells then cultured with complete αMEM medium containing MCSF (20 ng/ml) and RANKL (50 ng/ml) for 7 days to acquire mature osteoclasts. Five microgram of total RNA from cell samples was labeled and hybridized on miRNA microarray chips as previously described (Dore et al., 2008). The Aksomics Company performed the miRNA microarray assay. The fragmentation mixtures were hybri- dized to an Agilent 2100 (Agilent Technologies). Total RNAs were tailed with Poly A and then labeled with Biotin. After that, the labeled RNAs were hybridized onto the microarray. After washing and staining the slides, the arrays were scanned by Affymetrix Scanner 3000 (Affymetrix). Affymetrix GeneChip Command Console software (version 4.0, Affymetrix) was used to analyze array images to get raw data and then offer RNA normalization. Next, Genespring software was applied to precede the following data analysis. Differentially expressed miRNAs were then identified through the fold change as well as the P value calculated using the ttest.

2.7 | RNA extraction and quantitative realtime

polymerase chain reaction

Quantitative polymerase chain reaction (PCR) assay was accom- plished to measure specific gene expression during osteoclast differentiation. Preosteoclasts were seeded in 6 well plates at a density of 1 × 10 5 cells per well and cultured in complete αMEM medium containing 20 ng/ml M CSF and 50 ng/ml RANKL. Total RNA was isolated from the cells using Trizol reagent (Invitrogen, Carlsbad, CA) according to the manufacturer s instruction. Next, complemen- tary DNA (cDNA) was synthesized from 1 μg of total RNA using

2.9 | Western blot analysis

Preosteoclasts were seeded in 6 well plates at a density of 1 × 10 5 cells per well, followed by various treatments under MCSF and RANKL. Cell proteins were harvested according to previous reports (Kang et al., 2016). Protein concentrations were determined by a bicinchoninic acid (BCA) protein assay kit (Pierce Biotechnology, Rockford, IL). Equal amounts of protein lysates were resolved using sodium dodecyl sulphatepolyacrylamide gel electrophoresis (SDSPAGE) on 10% gels, and transferred to polyvinylidene difluoride (PVDF) membranes (Millipore, Bedford, MA). Afterwards, the membranes were blocked with 5% skimmed milk solution for 1 hr and then probed overnight with the following primary antibodies:

antiperoxisome proliferator activated receptor gamma (PPARγ ), antiadenomatous polyposis coli (APC), and anti βactin (Abcam, Cambridge, UK). The membranes were incubated with a horseradish peroxidaseconjugated secondary antibody (Boster, Wuhan, China). The antibody reactivity was visualized using the enhanced chemilu- minescence detection system as recommended by the manufacturer.

2.10 | Cell transfection

The overexpression plasmid vector for mouse PPARγ and APC gene were created by Genechem (Shanghai, China). Preosteoclasts were inoculated into 6well tissue culture plates at a density of 1 × 10 5 cells in complete αMEM medium containing 20 ng/ml MCSF and 50 ng/ml RANKL and incubated for 24 hr prior to transfection. Once preosteoclasts reached approximately 70% confluence, the cells were transfected with miR27a, antimiRNA oligonucleotides (AMO)27a or plasmid DNA using Lipofectamine 3000 reagent (Invitrogen, Paisley, UK) according to the manufacturers protocols. Cells infected with miRNC or empty vector (Mock) worked as control, separately.

TABLE 1 Premiers for qRTPCR analysis

Gene

Forward primer

Reverse primer

TRAP

5 ′‐ CACTCCCACCCTGAGATTTGT3

5′‐ CATCGTCTGCACGGTTCTG 3

c fos

5 ′‐ CGGGTTTCAACGCCGACTA 3

5′‐ TTGGCACTAGAGACGGACAGA 3

βactin

5 ′‐ GGCTGTATTCCCCTCCATCG 3

5′‐ CCAGTTGGTAACAATGCCATGT 3

Note . qRTPCR, quantitative realtime polymerase chain reaction; TRAP , tartrate resistant acid phosphatas.

4 |

4 | GUO ET AL . 2.11 | Dual luciferase reporter assay The 3 ′‐ UTR
4 | GUO ET AL . 2.11 | Dual luciferase reporter assay The 3 ′‐ UTR

GUO ET AL .

2.11 | Dual luciferase reporter assay

The 3′‐ UTR sequences of PPAR γ and APC predicted to interact with

miR 27a were identified using TargetScan (http://www.targetscan.

org). DNA fragments of the 3 ′‐UTRs of PPAR γ and APC mRNA

containing the putative miR 27a binding sequence were synthesized

by Invitrogen. These fragments were then respectively cloned into

the multiple cloning sites downstream the luciferase gene (Hin dIII

and SpeI sites) in the pMIRREPORT TM luciferase miRNA expression

reporter vector (Ambion, Inc.) to generate pMIR PPAR γ, pMIR APC.

After 24 hr starvation in serum free medium, HEK293 cells (110 5

per well) were transfected with pMIR PPAR γ , pMIR APC, and

cotransfected with 100 nM miR 27a mimic or miR NC using

Lipofectamine 3000 reagent. The cells were also transfected with

50 ng pRL TK vector as an internal standard. Luciferase activities

were measured 48 hr after transfection with a dual luciferase

reporter assay kit (Promega) on a luminometer (Lumat LB9507).

assay kit (Promega) on a luminometer (Lumat LB9507). FIGURE 1 Effect of estrogen deficiency on osteoclasts

FIGURE 1 Effect of estrogen deficiency on osteoclasts formation and bone resorption in vivo. (a) Representative micro CT three dimensional reconstructed images from SHAM mice and OVX mice. (b e) BMD, BV/TV, Tb.Th and Tb.N in the region of interest were measured. n = 6 mice per group , **P < 0.01. (f,g) TRAP staining showed that the number of osteoclasts was significantly increased in BMMs from OVX mice, which were induced with 20 ng/ml MCSF and 50 ng/ml RANKL for 7 days. n = 6, ** P < 0.01. (h) BMMs from SHAM mice and OVX mice were induced with 20 ng/ml MCSF and 50 ng/ml RANKL for 7 days, followed by staining with F actin ring. n = 3. (i) Resorption pit formation in BMMs, derived from SHAM mice and OVX mice, were induced with 20 ng/ml MCSF and 50 ng/ml RANKL for 7 days. (j) Summarized data showed that estrogen deficiency induced osteoclasts bone resorption. n = 3, **P < 0.01. BMD, bone mineral density; BMMs, bone marrow derived macrophages; BV/TV, bone volume/tissue volume; micro computed tomography (microCT); MCSF, macrophage colonystimulating factor; OVX, ovariectomized; RANKL, receptor activator of nuclear factor B ligand; Tb.N, trabecular number; Tb.Th, trabecular thickness; TRAP, tartrate resistant acid phosphatase [Color figure can be viewed at wileyonlinelibrary.com]

GUO ET AL .

GUO ET AL . | 5 2.12 | Statistical analysis Data were collected from three or

|

GUO ET AL . | 5 2.12 | Statistical analysis Data were collected from three or

5

2.12 | Statistical analysis

Data were collected from three or more independent experiments

and expressed as mean ± SD. A twosided Student t test was used to

analyze the difference for experiments with two subgroups. Oneway

analysis of variance was performed to show the difference for

experiments with more than two subgroups.

3 | RESULTS

3.1 | Effect of estrogen deficiency on osteoclasts

formation and bone resorption in vivo

Micro CT analysis showed that BMD, BV/TV, Tb.Th, and Tb.N were

decreased in femurs from OVX mice compared with SHAM control,

indicating that estrogen deficiency significantly induced bone loss

(Figure 1ae). Next, BMMs isolated from SHAM and OVX mice were

induced with 20 ng/ml M CSF and 50 ng/ml RANKL to acquire

mature osteoclasts. We found that estrogen deficiency could

promote osteoclast differentiation by TRAP staining and Factin

staining (Figure 1f h). In addition, pits formation assay revealed that

osteoclasts from OVX mice produced a significant increase of pits

area, suggesting that estrogen deficiency promoted osteoclasts bone

resorption (Figure 1i,j).

3.2 | Altered miRNA expression in the

processes of estrogen deficiency induced osteoclast differentiation

MiRNA expression was analyzed with a RNA/cDNAbased micro-

array screening. BMMs from SHAM and OVX mice were induced

with 20 ng/ml MCSF and 50 ng/ml RANKL for 7 days to acquire

mature osteoclasts.

Our results showed that the majority of the miRNAs were

repressed, and only four miRNAs were induced in osteoclasts from

OVX mice compared to the SHAM control (Figure 2a). To confirm the

results of microarray based screening, we measured the expressions

of these identified miRNAs using qRTPCR. Two of these (miR23a,

miR27a) were found to be downregulated by more than four fold,

whereas four (miR21, miR 539, miR 26a, and miR 574) were

upregulated by approximately two fold. Among these differentially

expressed miRNAs, miR 27a was significantly repressed in osteo-

clasts from OVX mice (Figure 2b). Next, we examined the expression

of miR 27a in BMMs from SHAM and OVX mice. The results showed

that miR 27a expression was significantly lower in BMMs from OVX

mice compared with SHAM mice (Figure 2c). To further examine the

effect of estrogen on miR 27a expression, BMMs from SHAM and

OVX mice were induced with 20 ng/ml M CSF and 50 ng/ml RANKL

and treated with or without 10 7 M estrogen for different time

or without 10 − 7 M estrogen for different time FIGURE 2 Altered miRNA expression in

FIGURE 2 Altered miRNA expression in the processes of estrogen deficiencyinduced osteoclasts formation. (a) Heat map representation of miRNAs differentially expressed in BMMs from SHAM mice and OVX mice, which were induced with 20 ng/ml M CSF and 50 ng/ml RANKL for 7 days. Red indicates miRNAs induced, and green indicates miRNAs repressed. n = 3. (b) Gene chip results were validated with qRTPCR in BMMs from SHAM mice and OVX mice, which were induced with 20 ng/ml MCSF and 50 ng/ml RANKL for 7 days. n = 3, ** P < 0.01. (c) Expression of miR 27a was measured by qRT PCR in BMMs from SHAM mice and OVX mice. n = 3, **P < 0.01. (d) Expression of miR 27a was measured by qRTPCR in BMMs from SHAM mice and OVX mice treated with or without 10 7 M estrogen under 20 ng/ml MCSF and 50 ng/ml RANKL for different time points. n = 3. BMMs, bone marrow derived mononuclear phagocytes; E2, estrogen; MCSF, macrophage colonystimulating factor; miRNA, microRNA; OVX, ovariectomized; qRTPCR, quantitative realtime polymerase chain reaction; RANKL, receptor activator of nuclear factor B ligand [Color figure can be viewed at wileyonlinelibrary.com]

6 |

6 | GUO ET AL . points. The results showed that compared with osteoclast from the
6 | GUO ET AL . points. The results showed that compared with osteoclast from the

GUO ET AL .

points. The results showed that compared with osteoclast from the SHAM group, the level of miR27a expression was decreased in osteoclast from OVX mice, which could be obviously alleviated by estrogen. In addition, treatment of estrogen could markedly promote miR 27a expression in osteoclast from SHAM mice in a timedependent manner (Figure 2d). Taken together, we concluded that estrogen could promote miR27a expression during the process of osteoclast differentiation.

3.3 | Involvement of miR 27a in

estrogen inhibited osteoclast differentiation

To investigate whether miR 27a was involved in osteoclast differentiation, we performed loss of function and gain of function experiments, in which we decreased and increased the expressions of miR 27a with AMO 27a and miR 27a in preosteoclasts, respec- tively. Then, preosteoclasts transfected with either AMO 27a or miR 27a were induced with RANKL and M CSF for 7 days. Inhibition of miR 27a with AMO 27a signi cantly enhanced osteoclast differentiation, which was indicated by an obvious increase of TRAP positive staining osteoclasts number and TRAP activity. In contrast, miR 27a could obviously inhibit osteoclast differentiation (Figure 3a c). Furthermore, qRT PCR analysis revealed that the levels of the osteoclast speci c genes TRAP and c Fos were higher in the preosteoclasts transfected with AMO 27a compared with the cells transfected with AMO NC, whereas overexpression of miR 27a significantly inhibited these osteoclast speci c genes expression (Figure 3d,e). To further investigate the effect of miR 27a on estrogen inhibited osteoclast differentiation in vitro, miR 27a was over- expressed or silenced in preosteoclasts, which were then cultured with 50 ng/ml RANKL and 20 ng/ml M CSF for 7 days in the presence of 10 7 M estrogen. TRAP staining and TRAP activity assay showed that miR 27a could further enhance the inhibitory effect of estrogen on osteoclast differentiation. However, AMO27a could attenuate estrogen inhibited osteoclast differentiation (Figure 3f h). Similar results were further confirmed by testing the expression of TRAP and c Fos (Figure 3i,j). Taken together, these results implicated that miR 27a was a critical factor for estrogen inhibited osteoclast differ- entiation.

3.4 | MiR27a inhibited osteoclastic bone

resorption and the formation of osteoclastic

F actin ring

Even though miR27a could impair osteoclasts formation, it was unclear whether miR27a could inhibit osteoclast activity. Therefore, we performed pit formation assay to estimate the effect of miR27a on osteoclastic bone resorption. Preosteoclast transfected with miR27a or AMO27a were cultured on bone slices, and induced by MCSF and RANKL for 7 days. We found that miR27a could significantly decrease pit formation. However, the resorption area was markedly increased in the AMO27a group (Figure 4a,b). In addition, a wellpolarized Factin ring was required for efficient bone resorption. We

found that clear Factin ring structures were observed in the miRNC group. However, overexpression of miR27a significantly disrupted the F actin ring structure (Figure 4c). These results further demon- strated that miR27a could inhibit osteoclastic bone resorption. Next, we test whether miR27a was involved in estrogeninhibited osteoclastic bone resorption. We found that miR27a could enhance the inhibitory effect of estrogen on resorption pit formation by osteoclasts, whereas AMO27a alleviated estrogeninhibited bone resorption, indicating that miR27a was involved in estrogendecreased osteoclast bone resorption (Figure 4d,e).

3.5 | Molecular targets of miR 27a involved

in estrogen decreased osteoclastogenesis and bone resorption

Based on the above observations, miR 27a was involved in estrogen decreased osteoclastogenesis and bone resorption. It is possible that miR 27a targets several regulatory factors associated with osteoclastogenesis and bone re sorption. To address this issue, we used a computation and bioinformatics based approach to predict the putative targets throu gh TargetScan, which is hosted by the Wellcome Trust Sanger Institute. These explorations led to the identification of candidate targets of miR 27a: PPAR γ and APC, which were confirmed to involve in osteoclast differentiation and osteoclastic bone resorption, re spectively. The unique sites of miRNA::mRNA complementarity of miR 27a targeting PPAR γ or APC are shown in Figure 5a,b. Western blot analysis showed that PPAR γ and APC expression were increased in the osteoclasts from OVX mice compared to SHAM mice (Figure 5c,d). MiR 27a lowered markedly the levels of PPAR γ and APC protein in osteoclasts, whereas AMO 27a could significantly increase PPAR γ and APC protein expressions (Figur e 5e,f). In addition, miR 27a enhanced the inhibitory effect of estrogen on PPAR γ and APC protein expressions, whereas AMO 27a alleviated estrogen inhibited PPAR γ and APC protein expression (Figure 5g,h). To further investigate whether miR 27a binds to the 3 ′‐ UTR of PPAR γ and APC, we performed a luciferase reporter assay. We placed the 3 ′‐ UTRs of PPAR γ and APC into the 3 ′‐ UTR of a luciferase reporter plasmid to construct chimeric vectors. Luciferase activity was diminished in the reporter containing the 3 ′‐ UTR of PPAR γ or APC treated with miR 27a compared with pMIR PPAR γ or pMIR APC alone, suggesting that PPAR γ and APC were the target genes of miR 27a (Figure 6a,b).

3.6 | Involvement of PPARγ and APC in osteoclast

differentiation and bone resorption

To further test whether PPAR γ and APC were involved in miR 27amediated osteoclast differentiation and bone resorption, we performed gain of function experiments in which PPAR γ and APC were respectively overexpressed in preosteoclasts. TRAP staining and TRAP activity assay showed that miR 27a signi cantly decreased osteoclast differentiation, whereas overexpressing of PPAR γ obviously alleviated the inhibitory effect of miR 27a on osteoclast

GUO ET AL .

GUO ET AL . | 7 FIGURE 3 Involvement of miR ‐ 27a in estrogen ‐

|

GUO ET AL . | 7 FIGURE 3 Involvement of miR ‐ 27a in estrogen ‐

7

GUO ET AL . | 7 FIGURE 3 Involvement of miR ‐ 27a in estrogen ‐

FIGURE 3 Involvement of miR 27a in estrogeninhibited osteoclast differentiation. (a) TRAP staining was showed in preosteoclasts transfected with either AMO27a or miR 27a under RANKL and M CSF for 7 days. (b) Summarized data showed that overexpression of miR 27a significantly decreased osteoclast differentiation. However, miR 27a depletion significantly increased osteoclastogenesis. n = 6, ** P < 0.01. (c) TRAP activity assessment was accomplished in preosteoclasts transfected with either AMO27a or miR 27a under RANKL and MCSF for 7 days. n = 4, **P < 0.01. (d,e) QRT PCR analysis of osteoclasts formation specific genes, TRAP and c Fos , in preosteoclasts transfected with either AMO27a or miR 27a under RANKL and MCSF for 7 days. n = 4, **P < 0.01. (f) TRAP staining was showed in preosteoclasts treated with 10 7 M estrogen and transfected with either AMO27a or miR 27a under RANKL and MCSF for 7 days. (g) Summarized data showed that overexpression of miR27a significantly promoted estrogeninhibited osteoclast differentiation. However, miR 27a depletion significantly alleviated estrogendecreased osteoclastogenesis. n = 6, ** P < 0.01. (h) TRAP activity assessment was accomplished in preosteoclasts treated with 10 7 M estrogen and transfected with either AMO27a or miR 27a under RANKL and M CSF for 7 days. n = 4, ** P < 0.01. (i,j) QRT PCR analysis of osteoclasts formation specific genes, TRAP and c Fos, in preosteoclasts treated with 10 7 M estrogen and transfected with either AMO27a or miR 27a under RANKL and MCSF for 7 days. n = 4, **P < 0.01. AMO27a, antimicroRNA oligonucleotides 27a; E2, estrogen; MCSF, macrophage colonystimulating factor; NC, negative control; qRTPCR, quantitative real time polymerase chain reaction; RANKL, receptor activator of nuclear factor B ligand; TRAP, tartrate resistant acid phosphatase [Color figure can be viewed at wileyonlinelibrary.com]

differentiation (Figure 7a c). QRT PCR analysis revealed that the

levels of the osteoclast speci c genes TRAP and c Fos were lower in

the osteoclasts overexpressing miR 27a compared with the cells

transfected with the miR NC, whereas overexpression of PPAR γ

significantly alleviated miR 27a decreased osteoclast speci c genes

expression (Figure 7d,e), suggesting that PPAR γ was involved in

miR27a inhibited osteoclast differentiation. In addition, we found

that miR27a could significant decrease pit formation, whereas

8 |

8 | GUO ET AL . FIGURE 4 MiR ‐ 27a inhibited osteoclastic bone resorption and
8 | GUO ET AL . FIGURE 4 MiR ‐ 27a inhibited osteoclastic bone resorption and

GUO ET AL .

8 | GUO ET AL . FIGURE 4 MiR ‐ 27a inhibited osteoclastic bone resorption and

FIGURE 4 MiR27a inhibited osteoclastic bone resorption and Factin ring formation. (a) Resorption pit formation was showed in preosteoclasts transfected with either AMO27a or miR27a under RANKL and MCSF for 7 days. (b) Summarized data showed that overexpression of miR27a significantly decreased resorption pit formation by osteoclasts. However, miR27a depletion significantly increased resorption pit formation by osteoclasts. n = 6, **P < 0.01. (c) Factin ring staining was showed in preosteoclasts transfected with either AMO27a or miR27a under RANKL and MCSF for 7 days. (d) Resorption pit formation was showed in preosteoclasts treated with 10 7 M estrogen and transfected with either AMO27a or miR27a under RANKL and MCSF for 7 days. (e) Summarized data showed that overexpression of miR27a significantly promoted estrogendecreased resorption pit formation. However, miR27a depletion significantly alleviated estrogendecreased osteoclasts bone resorbing. n = 6, **P < 0.01. AMO27a, antimicroRNA oligonucleotides27a; E2, estrogen; MCSF, macrophage colonystimulating factor; miR27a, microRNA27a; NC, negative control; RANKL, receptor activator of nuclear factor B ligand [Color figure can be viewed at wileyonlinelibrary.com]

overexpression of APC alleviated miR 27a decreased resorption pit

formation by osteoclasts (Figure 7f,g). Taken together, these results

indicated that PPAR γ and APC were functional target genes for

miR 27amediated osteoclast differentiation and bone resorption.

3.7 | Overexpression of miR 27a in vivo alleviates

OVX induced osteoporosis

OVX mouse model and miR 27aCH were applied to further

investigate the effect of miR 27a on OVXinduced osteoporosis in

vivo. Micro CT analysis of distal femurs metaphysic revealed that the

BMD, BV/TV, Tb.Th and Tb.N were significantly lower in OVX mice

compared to SHAM control mice. However, injection of miR 27aCH

significantly improved the trabecular bone structures in OVX mice

(Figure 8a e). To examine whether miR 27a CH compounds could

enter the bone marrow, we measured the levels of miR 27a in the

bone marrow of mice from different groups 72 hr post injection with

miR 27aCH or miR NCCH. QRT PCR analysis showed that miR 27a

level in the bone marrow was increased five folds by miR 27aCH,

indicating an efficient miR 27a delivery (Figure 8f). Next, TRAP

staining in the metaphyseal area of femurs bone sections derived

from different groups was applied to observe the effects of miR 27a

on osteoclastogenesis (Figure 8g). Quantification of the TRAP

staining showed a significantly increased osteoclast number and

surface area in OVX mice, whereas it was markedly alleviated in OVX

mice injected with miR 27aCH (Figure 8h). Furthermore, compared

to OVX mice, the serum levels of TRAP5b (bone resorption marker)

were significantly lower in OVX mice injected with miR 27a CH,

suggesting that miR 27a could alleviate OVXinduced bone resorp-

tion in vivo (Figure 8i).

4 | DISCUSSION

Estrogen has been shown to exert direct antiosteoclastic effects at

several stages of osteoclastic differentiation and function, namely

osteoclastogenesis and resorption (Nakamura et al., 2007; Srivastava

et al., 2001). However, the exact mechanisms by which estrogen

GUO ET AL .

GUO ET AL . | 9 FIGURE 5 Molecular targets of miR ‐ 27a involved in

|

GUO ET AL . | 9 FIGURE 5 Molecular targets of miR ‐ 27a involved in

9

GUO ET AL . | 9 FIGURE 5 Molecular targets of miR ‐ 27a involved in

FIGURE 5 Molecular targets of miR27a involved in estrogendecreased osteoclastogenesis and bone resorption. (a) The sequences showed that the unique sites of miRNA::mRNA complementarity between miR27a and PPARγ. (b) The sequences showed that the unique sites of miRNA::

mRNA complementarity between miR27a and APC. (c,d) PPARγ and APC expression were examined by western blot in BMMs from SHAM mice and OVX mice, which were induced with 20 ng/ml MCSF and 50 ng/ml RANKL for 7 days. n = 3, **P < 0.01. (e,f) Western blot analysis of PPARγ and APC expression in preosteoclasts transfected with miR27a mimics and blocker, followed by induction of 20 ng/ml MCSF and 50 ng/ml RANKL for 7 days. n = 3, *P < 0.05, **P < 0.01. (g,h) Western blot analysis of PPARγ and APC expression in preosteoclasts treated with 10 7 M estrogen and transfected with either AMO27a or miR27a under RANKL and MCSF for 7 days. n = 3, *P < 0.05, **P < 0.01. APC, adenomatous polyposis coli; AMO27a, antimicroRNA oligonucleotides27a; BMMs, bone marrowderived macrophages; E2, estrogen; MCSF, macrophage colonystimulating factor; miR27a, microRNA27a; mRNA, messenger RNA; NC, negative control; OVX, ovariectomy; PPARγ, peroxisome proliferatoractivated receptor gamma; RANKL, receptor activator of nuclear factor B ligand [Color figure can be viewed at wileyonlinelibrary.com]

inhibited osteoclast differentiation and bone resorption were not

fully elucidated. In this study, we identified that miR 27a, a

posttranscriptional regulator, was upregulated by estrogen during

the process of osteoclastogenesis. Furthermore, we demonstrated

that estrogen might respectively decrease osteoclast differentiation

and bone resorption via miR 27a targeting PPAR γ and APC.

The increasing of osteoclast differentiation caused by estrogen

deficiency may be due to many mechanisms. First, estrogen with-

drawal following menopause led to an increase in the production of

the proinflammatory cytokines interleukin1 (IL1), IL6, and tumor

necrosis factor, which could stimulate the differentiation of myeloid

precursor cells into osteoclasts (McLean, 2009). Second, estrogen

mediated suppression of osteoclasts involves the regulation of the

RANKL/osteoprotegerin (OPG) ratio. Estrogen has been shown to

increase the transcription of OPG and to affect RANKL localization

and expression in osteoblasts, osteocytes or bone lining cells, resulting

in decrease of osteoclastogenesis (Bord, Ireland, Beavan, & Compston,

2003; Streicher et al., 2017). However, estrogen was also confirmed to

suppress RANKL and MCSFinduced differentiation of myelomono-

cytic precursors into multinucleated TRAPpositive osteoclasts

through an estrogen receptor (ER) dependent mechanism that does

not require mediation by stromal cells (Shevde et al., 2000). Three ERs

10

|

10 | GUO ET AL . FIGURE 6 the 3 ′‐ UTR of PPAR γ (pMIR
10 | GUO ET AL . FIGURE 6 the 3 ′‐ UTR of PPAR γ (pMIR

GUO ET AL .

10 | GUO ET AL . FIGURE 6 the 3 ′‐ UTR of PPAR γ (pMIR

FIGURE 6

the 3 ′‐UTR of PPAR γ (pMIR PPARγ ) and cotransfected with miR 27a mimic or miR NC for 48 hr. The luciferase activity of the reporter containing the 3′‐ UTR of PPAR γ treated with miR 27a mimic decreased significantly compared with that with pMIR PPAR γ alone. n = 6, **P < 0.01. (b) HEK293 cells were transfected with the construct containing the 3′‐ UTR of APC (pMIR APC) and cotransfected with miR 27a mimic or miR NC for 48 hr. The luciferase activity of the reporter containing the 3′‐ UTR of APC treated with miR 27a mimic decreased significantly compared with that with pMIR APC alone. n = 6, ** P < 0.01. APC, adenomatous polyposis coli; miR 27a, microRNA 27a; NC, negative control; PPAR γ, peroxisome proliferator activated receptor gamma; UTR, untranslational region

Verification of PPAR γ and APC as cognate targets of miR 27a. (a) HEK293 cells were transfected with the construct containing

were expressed in osteoclasts. Estrogen, via ERs activation, affects

gene transcription and expression, leading to decreased osteoclasto-

genesis (MartinMillan et al., 2010). In the current study, our results

demonstrated that estrogen could decrease osteoclast differentiation

and osteoclast bone resorption via a stromal cell independent

pathway. These results were consistent with previous studies (Shevde

et al., 2000).

Osteoclast differentiation is reg ulated by transcriptional, post-

transcriptional, and posttranslational mechanisms. MiRNAs, as

fundamental posttranscriptional regulators of gene expression, play

critical roles in osteoclastogenesis (Ji et al., 2016). Many miRNAs

have been demonstrated to involve in osteoclastogenesis and the

bone resorbing activity of osteoclasts, such as miR 34a 5p,

miR 26a 5p, miR 21 5p, miR 31, and miR 29 (Lopes et al., 2016).

Several recent reports have suggested that estrogen exerted

posttranscriptional control through the regulation of miRNAs

processing and expression (Wu et al., 2017). However, very few

studies explored the role of miRNAs in estrogen inhibited osteo-

clast differentiation and bone resorption. Only Sugatani and Hruska

(2013) reported that miR 21 5p was involved in estrogen

decreased osteoclastogenesis. In this study, we present for the

first time results of screening the miRNAs associated with estrogen

deficiency induced osteoclastogenesis and demonstrate that

miR 27a targeting PPAR γ and APC contribute to estrogen mediated

osteoclasts formation and bone resorption.

Our results identified that miR 27a was significantly repressed in

osteoclasts from OVX mice. Furthermore, overexpression of miR 27a

decreased osteoclast formation and bone resorption. The inhibition

of miR 27a with AMO27a resulted in increase of osteoclast numbers

and the bone resorbing activity of osteoclasts. Recent studies also

confirmed that miR 27a was one of the most strongly downregulated

miRNAs in the serum of patients with postmenopausal osteoporotic

(You, Pan, Chen, Gu, & Chen, 2016). Indeed, evidence suggests that

miR27a appears to play an important role in the mountains of bone

homeostasis. Wang and Xu (2010) reported that miR 27a promoted

osteoblast differentiation through activation of Wnt signaling. Pan,

Wang, Jianwei, and Ye (2014) found that miR 27a targeting MAP2K4

via JNK/p38 signaling pathway contributed to the development of

osteosarcoma. Lin, Gao, Alarcon, Ye, and Yun (2009) demonstrated

that miR 27a was essential for the shift of mesenchymal stem cells

from osteogenic differentiation to adipogenic differentiation in

osteoporosis by targeting Mef2c. However, to our knowledge, our

study is the first to elucidate the role of miR 27a in osteoclasto-

genesis.

PPAR γ , which is a member of the nuclear receptor superfamily of

transcription factors, induces target gene expression by binding to

PPAR response elements in the promoter regions (Tontonoz &

Spiegelman, 2008). Growing evidence suggests that PPAR γ could

function as a key regulator of skeletal homeostasis by directly

regulating the differentiation of bone cells. Akune et al (2004) found

that PPAR γ negatively affected osteoblast differentiation and bone

formation (Wei et al., 2010). PPAR γ activation by thiazolidinedione

(TZD) treatment inhibited osteoblast differentiation but promoted

adipocyte differentiation (Rzonca, Suva, Gaddy, Montague, & Lecka

Czernik, 2004). However, the role of PPAR γ in osteoclast differentia-

tion or function remains controversial. Many studies showed that

activation of PPAR γ could stimulate osteoclastogenesis (Wei et al.,

2010), whereas a few studies demonstrated that osteoclast differ-

entiation and function were not affected in PPAR γhaploinsufficient

mice (Akune et al., 2004). In this study, we found that the expression

GUO ET AL .

GUO ET AL . | 11 FIGURE 7 Involvement of PPAR γ and APC in osteoclast

|

GUO ET AL . | 11 FIGURE 7 Involvement of PPAR γ and APC in osteoclast

11

GUO ET AL . | 11 FIGURE 7 Involvement of PPAR γ and APC in osteoclast

FIGURE 7 Involvement of PPARγ and APC in osteoclast differentiation and bone resorption. (a) TRAP staining was showed in preosteoclasts overexpressing PPARγ and miR27a under RANKL and MCSF for 7 days. (b) Summarized data showed that miR27a significantly decreased osteoclast differentiation. However, overexpression of PPARγ significantly alleviated miR27adecreased osteoclastogenesis. n = 6, *P < 0.05, **P < 0.01. (c) TRAP activity assessment was accomplished in preosteoclasts overexpressing PPARγ and miR27a under RANKL and MCSF for 7 days. n = 4, **P < 0.01. (d,e) QRTPCR analysis of osteoclasts formation specific genes, TRAP and cFos, in preosteoclasts overexpressing PPARγ and miR27a under RANKL and MCSF for 7 days. n = 4, **P < 0.01. (f) Resorption pit formation was showed in preosteoclasts overexpressing APC and miR27a under RANKL and MCSF for 7 days. (g) Summarized data showed that overexpression of miR27a significantly decreased the activity of osteoclasts bone resorption. However, overexpression of APC significantly alleviated miR27adecreased the bone resorbing activity of osteoclasts. n = 6, **P < 0.01. APC, adenomatous polyposis coli; miR27a, microRNA27a; MCSF, macrophage colonystimulating factor; NC, negative control; PPARγ, peroxisome proliferatoractivated receptor gamma; qRTPCR, quantitative realtime polymerase chain reaction; RANKL, receptor activator of nuclear factor B ligand; TRAP, tartrateresistant acid phosphatase [Color figure can be viewed at wileyonlinelibrary.com]

of PPAR γ was higher in the osteoclasts from OVX mice compared to

SHAM control mice. Further study confirmed that PPAR γ was a

functional target gene for miR 27amediated osteoclast differentia-

tion. The molecular mechanism by which miR 27a targeting PPAR γ

decreased osteoclast formation needs to be further explored.

APC is classified as a tumor suppressor gene, and its mutations

are known to cause familial adenomatous polyposis (Polakis, 1997).

Previous studies showed that APC could stabilize microtubules

through interacting with microtubules with its microtubule binding,

or through interacting with end binding protien 1 (EB1) (Wen et al.,

2004). APC was confirmed to be important for the formation of

stable microtubules in many cells (Matsumoto et al., 2013). The

inhibition of APC binding to microtubules in osteoclast could lead to

decreased microtubule stability, resulting in a decrease in bone

resorbing activity along with reduced sealing zone formation

(Matsumoto et al., 2013; Zumbrunn, Kinoshita, Hyman, & Nathke,

2001). Consistent with previous studies, our results confirmed that

APC was involved in miR 27a mediated F actin ring formation and

the bone resorbing activity of osteoclasts.

Estrogen regulates diverse phys iological effects through geno-

mic and nongenomic mechanisms involving ER α , ER β . Estrogen

leads to a conformational change of ER, resulting in increase of ER

affinity for DNA. In this conformation, E2 ER compound binding to

specific genes in the nucleus affects their transcription and de novo

protein synthesis (Condliffe, Doolan, & Harvey, 2001). In addition

to this genomic response, estrogen also elicits rapid responses

independent of genome interaction and protein synthesis within

seconds to minutes through some signaling pathways, such as

cAMP dependent protein kinase (PKA) signaling pathway and

protein kinase C signaling pathway (Chen, Ouyang, Ye, Ni, &

Chen, 2014; Condliffe et al., 2001). In this study, our results

showed that estrogen obviously increased the expression of

12

|

12 | GUO ET AL . FIGURE 8 Overexpression of miR ‐ 27a in vivo alleviates
12 | GUO ET AL . FIGURE 8 Overexpression of miR ‐ 27a in vivo alleviates

GUO ET AL .

12 | GUO ET AL . FIGURE 8 Overexpression of miR ‐ 27a in vivo alleviates

FIGURE 8 Overexpression of miR27a in vivo alleviates OVXinduced osteoporosis. (a) Representative figures of microCT analysis of the distal end of intact femurs of SHAM mice, OVX mice, OVX + miR27aCH mice, and OVX + miRNCCH mice. (be) BMD, BV/TV, Tb.Th, and Tb.N in the region of interest were measured. n = 6 mice per group, *P < 0.05, **P < 0.01. (f) The levels of miR27a were measured by qRTPCR in the bone marrow from different group mice after 72 hr post injection with or without miR27aCH and miRNCCH. n = 6 mice per group, **P < 0.01. (g) TRAP staining was showed in the metaphyseal area of femurs bone sections derived from different groups. n = 4. (h) The area of TRAPpositive staining was counted. n = 4, **P < 0.01. (i) The serum levels of TRAP5b (bone resorption marker) were measured by ELISA in different groups. n = 6 mice per group, **P < 0.01. BMD, bone mineral density; BV/TV, bone volume/tissue volume; micro computed tomography (microCT); CH, chitosan; ELISA, enzyme linked immunosorbent assay; miR27a, microRNA27a; NC, negative control; OVX, ovariectomized; qRTPCR, quantitative realtime polymerase chain reaction; Tb.N, trabecular number; Tb.Th, trabecular thickness; TRAP, tartrateresistant acid phosphatase [Color figure can be viewed at wileyonlinelibrary.com]

miR 27a. Further, we found that ER binding sites existed in the

promoter region of miR 27a (data not shown). Future studies will

be accomplished to explore the exact mechanisms of estrogen

regulated miR 27a expression.

In conclusion, our data provided new evidence that miR 27a was

essential for estrogen inhibited osteoclast differentiation and the

bone resorbing activity of osteoclasts. Upregulation of miR 27a by

estrogen leads to PPAR γ and APC targeting and inhibition of

osteoclasts formation and bone resorption. This study is an effort

to establish a molecular mechanism of estrogen deficiencyinduced

bone loss, and to provide insights into the potential contribution of

miRNA in the regulation of osteoclast differentiation and bone

resorption by estrogen.

ACKNOWLEDGMENTS

The authors thank Dr. Lei Zhang for expert technical assistance in

carrying out cells transfection and western blotting analysis.

GUO ET AL .

GUO ET AL . | 13 Contract grant sponsor: The National Science Foundation of China; Contract

|

GUO ET AL . | 13 Contract grant sponsor: The National Science Foundation of China; Contract

13

Contract grant sponsor: The National Science Foundation of China; Contract grant number: No. 81300713. Contract grant sponsor: The Natural Science Foundation of Shanghai; Contract grant number: No. 17ZR1425900. Contract grant sponsor: Research project of Shanghai Municipal Health and Family Planning Commission; Contract grant number: No. 201640105, 201640190, 201540156.

CONFLICTS OF INTEREST

The authors have no conflicts of interest to declare.

AUTHOR CONTRIBUTIONS

All authors contributed to the design of the study. L.G., K.C., J.Y., P.H., L.D., C.H., and J.X. collected the data and performed the analysis. L.G. led the draft of the manuscript. All authors interpreted the findings, revised the manuscript and approved the final version. C.H. and J.X. take responsibility for the integrity of this work.

ORCID

REFERENCES

Akune, T., Ohba, S., Kamekura, S., Yamaguchi, M., Chung, U. I., Kubota, N., Kawaguchi, H. (2004). PPARgamma insufficiency enhances osteogenesis through osteoblast formation from bone

marrow progenitors. The Journal of Clinical Investigation , 113 (6),

846 855.

Bord, S., Ireland, D. C., Beavan, S. R., & Compston, J. E. (2003). The effects of estrogen on osteoprotegerin, RANKL, and estrogen receptor expression in human osteoblasts. Bone , 32(2), 136141. Chen, F., Ni, B., Yang, Y. O., Ye, T., & Chen, A. (2014). Knockout of TRPV6 causes osteopenia in mice by increasing osteoclastic differentiation and activity. Cellular Physiology and Biochemistry: International Journal of Experimental Cellular Physiology, Biochemistry, and Pharmacology , 33 (3), 796809. Chen, F., Ouyang, Y., Ye, T., Ni, B., & Chen, A. (2014). Estrogen inhibits RANKL induced osteoclastic differentiation by increasing the expres- sion of TRPV5 channel. Journal of Cellular Biochemistry , 115(4),

651 658.

Condliffe, S. B., Doolan, C. M., & Harvey, B. J. (2001). 17beta oestradiol acutely regulates Cl secretion in rat distal colonic epithelium. The Journal of Physiology , 530(Pt 1), 47 54. Couzin, J. (2007). Genetics. Erasing microRNAs reveals their powerful punch. Science , 316(5824), 530. Dore, L. C., Amigo, J. D., Dos Santos, C. O., Zhang, Z., Gai, X., Tobias, J. W., Weiss, M. J. (2008). A GATA1 regulated microRNA locus essential for erythropoiesis. Proceedings of the National Academy of Sciences of the United States of America , 105(9), 3333 3338. Ji, X., Chen, X., & Yu, X. (2016). MicroRNAs in osteoclastogenesis and function: Potential therapeutic targets for osteoporosis. International Journal of Molecular Sciences , 17 (3), 349. Kang, H., Yan, Y., Jia, P., Yang, K., Guo, C., Chen, H., Deng, L. (2016). Desferrioxamine reduces ultrahighmolecular weight polyethylene induced osteolysis by restraining inflammatory osteoclastogenesis via heme oxygenase 1. Cell Death & Disease , 7 (10), e2435.

Krzeszinski, J. Y., Wei, W., Huynh, H., Jin, Z., Wang, X., Chang, T. C., Wan, Y. (2014). miR 34a blocks osteoporosis and bone metastasis by inhibiting osteoclastogenesis and Tgif2. Nature , 512 (7515),

431 435.

Lin, Q., Gao, Z., Alarcon, R. M., Ye, J., & Yun, Z. (2009). A role of miR 27 in the regulation of adipogenesis. The FEBS Journal , 276 (8),

2348 2358.

Lopes, H. B., Ferraz, E. P., Almeida, A. L., Florio, P., Gimenes, R., Rosa, A. L.,

& Beloti, M. M. (2016). Participation of MicroRNA34a and RANKL on bone repair induced by poly(vinylidenetrifluoroethylene)/barium titanate membrane. Journal of Biomaterials Science, Polymer Edition, 27 (13), 13691379. Luo, X., Xiao, J., Lin, H., Li, B., Lu, Y., Yang, B., & Wang, Z. (2007). Transcriptional activation by stimulating protein 1 and post transcriptional repression by muscle specific microRNAs of IKs encoding genes and potential imp lications in regional hetero-

geneity of their expressions. Journal of Cellular Physiology , 212 (2),

358 367.

MartinMillan, M., Almeida, M., Ambrogini, E., Han, L., Zhao, H., Weinstein, R. S., Manolagas, S. C. (2010). The estrogen receptoralpha in osteoclasts mediates the protective effects of estrogens on cancellous but not cortical bone. Molecular Endocrinology , 24(2), 323334. Matsumoto, T., Nagase, Y., Hirose, J., Tokuyama, N., Yasui, T., Kadono, Y., Tanaka, S. (2013). Regulation of bone resorption and sealing zone formation in osteoclasts occurs through protein kinase B mediated microtubule stabilization. Journal of Bone and Mineral Research:

The Official Journal of the American Society for Bone and Mineral Research , 28(5), 1191 1202. McLean, R. R. (2009). Proinflammatory cytokines and osteoporosis. Current Osteoporosis Reports, 7(4), 134 139. Midgley, A. C., Morris, G., Phillips, A. O., & Steadman, R. (2016). 17beta estradiol ameliorates ageassociated loss of fibroblast function by attenuating IFN gamma/STAT1 dependent miR7 upregulation. Aging Cell , 15 (3), 531541. Nakamura, T., Imai, Y., Matsumoto, T., Sato, S., Takeuchi, K., Igarashi, K., Kato, S. (2007). Estrogen prevents bone loss via estrogen receptor alpha and induction of Fas ligand in osteoclasts. Cell , 130 (5), 811 823. Pan, W., Wang, H., Jianwei, R., & Ye, Z. (2014). MicroRNA27a promotes proliferation, migration and invasion by targeting MAP2K4 in human osteosarcoma cells. Cellular Physiology and Biochemistry: International Journal of Experimental Cellular Physiology, Biochemistry, and Pharma- cology , 33(2), 402412. Polakis, P. (1997). The adenomatous polyposis coli (APC) tumor suppressor. Biochimica et Biophysica Acta, 1332 (3), F127 F147. Raisz, L. G. (2005). Pathogenesis of osteoporosis: Concepts, conflicts, and prospects. The Journal of Clinical Investigation , 115(12), 3318 3325. Rzonca, S. O., Suva, L. J., Gaddy, D., Montague, D. C., & LeckaCzernik, B. (2004). Bone is a target for the antidiabetic compound rosiglitazone. Endocrinology , 145 (1), 401406. Sang, C., Zhang, Y., Chen, F., Huang, P., Qi, J., Wang, P., Guo, L. (2016). Tumor necrosis factor alpha suppresses osteogenic differentiation of MSCs by inhibiting semaphorin 3B via Wnt/betacatenin signaling in estrogendeficiency induced osteoporosis. Bone , 84 , 78 87. Shevde, N. K., Bendixen, A. C., Dienger, K. M., & Pike, J. W. (2000). Estrogens suppress RANK ligandinduced osteoclast differentiation via a stromal cell independent mechanism involving c Jun repression. Proceedings of the National Academy of Sciences of the United States of America, 97 (14), 7829 7834. Shi, C., Qi, J., Huang, P., Jiang, M., Zhou, Q., Zhou, H., Deng, L. (2014). MicroRNA17/20a inhibits glucocorticoidinduced osteoclast differ- entiation and function through targeting RANKL expression in osteoblast cells. Bone, 68 , 67 75. Srivastava, S., Toraldo, G., Weitzmann, M. N., Cenci, S., Ross, F. P., & Pacifici, R. (2001). Estrogen decreases osteoclast formation by downregulating receptor activator of NF kappa B ligand (RANKL) induced

14

|

14 | GUO ET AL . JNK activation. The Journal of Biological Chemistry , 276 (12),
14 | GUO ET AL . JNK activation. The Journal of Biological Chemistry , 276 (12),

GUO ET AL .

JNK activation. The Journal of Biological Chemistry , 276(12),

8836 8840.

Streicher, C., Heyny, A., Andrukhova, O., Haigl, B., Slavic, S., Schuler, C., Erben, R. G. (2017). Estrogen regulates bone turnover by targeting RANKL expression in bone lining cells. Scientific Reports, 7(1), 6460. Sugatani, T., & Hruska, K. A. (2013). Down regulation of miR 21 biogenesis by estrogen action contributes to osteoclastic apoptosis. Journal of Cellular Biochemistry , 114(6), 1217 1222. Tontonoz, P., & Spiegelman, B. M. (2008). Fat and beyond: The diverse biology of PPARgamma. Annual Review of Biochemistry , 77 , 289 312. Wang, T., & Xu, Z. (2010). miR 27 promotes osteoblast differentiation by modulating Wnt signaling. Biochemical and Biophysical Research Communications , 402(2), 186 189. Wei, W., Wang, X., Yang, M., Smith, L. C., Dechow, P. C., Sonoda, J., Wan, Y. (2010). PGC1beta mediates PPARgamma activation of osteoclastogenesis and rosiglitazoneinduced bone loss. Cell Metabolism, 11(6), 503516. Wen, Y., Eng, C. H., Schmoranzer, J., Cabrera Poch, N., Morris, E. J., Chen, M., Gundersen, G. G. (2004). EB1 and APC bind to mDia to stabilize microtubules downstream of Rho and promote cell migration. Nature Cell Biology , 6 (9), 820830. Wu, J., Xu, L., Sun, C., Zhang, B., Li, J., Sun, J., Sun, D. (2017). Paeonol alleviates epirubicininduced renal injury in mice by regulating Nrf2 and NFkappaB pathways. European Journal of Pharmacology, 795, 8493. You, L., Pan, L., Chen, L., Gu, W., & Chen, J. (2016). MiR 27a is essential for the shift from osteogenic differentiation to adipogenic differentiation

of mesenchymal stem cells in postmenopausal osteoporosis. Cellular Physiology and Biochemistry: International Journal of Experimental

Cellular Physiology, Biochemistry, and Pharmacology , 39 (1), 253265. Yu, B., Chang, J., Liu, Y., Li, J., Kevork, K., Al Hezaimi, K., Wang, C. Y. (2014). Wnt4 signaling prevents skeletal aging and inflammation by inhibiting nuclear factor kappaB. Nature Medicine , 20 (9),

1009 1017.

Zaidi, M. (2007). Skeletal remodeling in health and disease. Nature Medicine, 13 (7), 791 801. Zeng, Y. (2006). Principles of micro RNA production and maturation. Oncogene, 25 (46), 61566162. Zumbrunn, J., Kinoshita, K., Hyman, A. A., & Nathke, I. S. (2001). Binding of the adenomatous polyposis coli protein to microtubules increases microtubule stability and is regulated by GSK3 beta phosphorylation. Current Biology , 11 (1), 4449.

How to cite this article: Guo L, Chen K, Yuan J, et al. Estrogen inhibits osteoclasts formation and bone resorption via microRNA27a targeting PPAR γ and APC. J Cell Physiol . 2018;114. https://doi.org/10.1002/jcp.26788