Helicobacter ISSN 1523-5378

Prevalence and Risk Factors of Atrophic Gastritis and Intestinal

O r2008
i giet
ncompilation
Prevalence
Kim
Blackwell
Oxford,
©
1523-5378
1083-4389 aUK
Helicobacter
HEL
Journal
XXX Thel Publishing
al. AAuthors
r t i cRisk
and l e©
s Ltd
Factors of Intestinal
2008 Blackwell Metaplasia
Publishing Ltd, Helicobacter XX: xx–xx

Metaplasia in a Korean Population Without Significant

Gastroduodenal Disease
Nayoung Kim,*‡ Young Soo Park,*‡ Sung-Il Cho,§ Hye Seung Lee,† Gheeyoung Choe,† In Wook Kim,¶
Yoo-Deok Won,¶ Ji Hyun Park,‡ Joo Sung Kim,‡ Hyun Chae Jung‡ and In Sung Song‡
Departments of *Internal Medicine and †Pathology, Seoul National University Bundang Hospital, Seoungnam, Gyeonggi-do, South Korea;
‡
Department of Internal Medicine, Seoul National University College of Medicine and Liver Research Institute, Seoul, South Korea; §School of
Public Health and Institute of Health and Environment, Seoul National University, Seoul, South Korea; ¶GCMS Research Institute, Green Cross Medical
Science Corp, Eumseong, South Korea

Keywords Abstract
Helicobacter pylori, atrophic gastritis, intestinal
Background and Aim: The prevalence of gastric cancer and Helicobacter pylori
metaplasia, Korea.
infection is unacceptably high in Korea. This study was performed to evaluate
Reprint requests to: Hyun Chae Jung, Department the prevalence of atrophic gastritis (AG) and intestinal metaplasia (IM) and
of Internal Medicine, Seoul National University to identify their risk factors with respect to H. pylori virulence factors, and
College of Medicine, 28 Yongon-dong, environmental and host factors, in Korean population without significant
Chongno-gu, Seoul 110-744, South Korea. gastroduodenal disease.
Tel.: +82-2-740-8112; Fax: +82-2-743-6701; Methods: The study cohort consisted of 389 subjects (≥ 16 years). AG and IM
E-mail: hyunchae@plaza.snu.ac.kr
were scored histologically using the Sydney classification in the antrum and
body, respectively. Prevalences and bacterial factors (i.e. cagA, vacA m1, and
Nayoung Kim and Young Soo Park equally
contributed to this work. oipA), environmental factors (i.e. smoking and alcohol), and host factors (i.e.
genetic polymorphisms of IL-1B-511, IL-1RN, TNF-A-308, IL-10-592, IL-10-819,
IL-10-1082, IL-8-251, IL-6-572, GSTP1, p53 codon 72, and ALDH2) were evaluated.
Results: Prevalences of AG in the antrum and body were 42.5% and 20.1%,
and those of IM were 28.6% and 21.2%, respectively. The presences of AG and
IM were significantly higher in H. pylori-positive than in the H. pylori-negative
subjects. Multivariate analysis showed that the risk factors for AG were H. pylori
infection, age ≥ 61 years, and cagA and vacA m1 positivity. For IM the risk factors
were H. pylori infection, age ≥ 61 years, a smoking history (rather than current
smoking), strong spicy food, occupation (unemployed or nonprofessional vs.
professional), and the presence of IL10-592 C/A as opposed to A/A. In addition,
IL6-572 G carrier was found to have a protective effect against IM development
as compared with C/C.
Conclusion: H. pylori infection was most important risk factor of AG and IM.
Bacterial factors were found to be important risk factor for AG but
environmental and host factors were more important for IM.

The pathogenesis of gastric cancer (GC) involves a unlike the intestinal type, usually arises independently of
multistep and multifactorial process [1,2]. The Correa IM, which raised doubts about association between IM and
hypothesis postulates a progression from chronic gastritis GC development [6].
to gastric atrophy and intestinal metaplasia (IM), and The risk of GC varies among countries and even within
dysplasia, and finally to cancer [3]. For example, the Asia Pacific region [7]. Gastritis with more predomi-
Helicobacter pylori-infected individuals with IM were found nant corpus atrophy and IM has been reported to be more
to have a c. 6.5-fold higher risk of developing GC [4], prevalent in Japanese than British patients [8]. A number
which suggests that IM acts as an excellent surrogate of etiological factors have been proposed to account for
marker for an elevated risk of GC development. Similarly, these differences, e.g. H. pylori and its virulence [9–11],
atrophic gastritis (AG) has also been regarded as a as well as dietary factors [12], and genetic variations
precancerous condition [5]. However, diffuse-type GC, [11,13,14]. However, few detailed reports regarding the

© 2008 The Authors

Journal compilation © 2008 Blackwell Publishing Ltd, Helicobacter 13: 245–255 245
Prevalence and Risk Factors of Intestinal Metaplasia
prevalences of AG and IM and few comprehensive
analyses have conducted on the risk factors of AG or IM in
the subjects without diseases like GC, dysplasia, mucosa-
associated lymphoid tissue (MALT) lymphoma, peptic
ulcer, or reflux esophagitis. The aim of this study was to
evaluate the prevalences of AG and IM in the antrum and
body, respectively, in a Korean population without
significant gastroduodenal diseases regardless of dyspeptic
symptoms or gastritis. In addition, the possible risk factors
of AG and IM were evaluated, comprehensively, with
respect to H. pylori virulence factors, and environmental
and host factors with a view toward establishing a strategy
to prevent AG and IM, and thus to reduce the incidence of
GC in Korea, where the prevalences of H. pylori and GC
remain unacceptably high.
Subjects and Methods
Three hundred and eighty-nine subjects residing in
Gyeonggi province (near Seoul) or in Seoul who registered
consecutively at Seoul National University Bundang
Hospital from May 2003 to July 2007 were enrolled in the
present study after applying the exclusion criteria detailed
below. All subjects were of Korean origin, and had
undergone standard gastroscopy as part of a screening
program for premalignant gastric mucosa lesions or GC.
Subjects (≥ 16 years) were included if gastroscopy showed
normal gastric mucosa or gastritis in the absence of any
significant gastroduodenal disease such as GC, dysplasia,
MALT lymphoma, peptic ulcer, or reflux esophagitis
regardless of dyspeptic symptoms. Of the 386 subjects, 135
(35.0%) stated that they had experienced epigastric
discomfort, epigastric pain, epigastric fullness, or indigestion
on at least a few occasions during the previous year.
Subjects with a history of H. pylori eradication, proton
pump inhibitor medication, a peptic ulcer, or GC were also
excluded. The study protocol was approved by the Ethical
Committee at Seoul National University Bundang
Hospital. All subjects, who provided informed consent,
were asked to complete a questionnaire under the
supervision of a well-trained interviewer. The questionnaire
included questions regarding demographic data (age,
sex, and residence not only present but also in the
childhood), socioeconomic data (monthly income,
education level, and occupation), diet (regularity, eating
speed, salty, spicy, fast food, fruits, and vegetables), and
histories of H. pylori eradication therapy and peptic ulcer
disease.
H. pylori Tests and Histology
To determine the presence of current H. pylori infection, 10
biopsy specimens were taken for the three kinds of test
246
Kim et al.
(histology, CLOtest, and culture). Three biopsy specimens
were taken from the lesser curvature of the mid-antrum
(mid-portion between the pyloric ring and the angularis
incisura) and the mid-body of the stomach (mid-portion
between the angularis incisura and upper line of high
body, respectively, and two were taken from the greater
curvature of the mid-antrum (mid-portion between the
pyloric ring and the lower end of mucosal folds) and the
mid-body (mid-portion between the lower end of mucosal
folds and upper line of high body), respectively. Of these
10 specimens (five from the mid-antrum and five from the
mid-body), four specimens were for histology. That is, one
from the greater curvature and one from the lesser
curvature of mid-antrum were fixed in formalin, together.
Similarly, one from the greater curvature and one from the
lesser curvature of the mid-body were fixed in formalin,
together. The presence of H. pylori was assessed by modified
Giemsa staining. Moreover, the degrees of inflammatory
cell infiltration (activity and chronic inflammation),
atrophy (loss of appropriate glands), and metaplasia were
determined by hematoxylin and eosin (H&E) staining by
averaging score of biopsy specimen from the greater and
lesser curvature. Histological features of gastric mucosa
were recorded using the updated Sydney scoring system
(i.e. 0 = none, 1 = slight, 2 = moderate, and 3 = marked)
[15]. All biopsies were examined independently by two
experienced pathologists (H.S.L. and G.C.), who were
unaware of patient details. In the event of disagreement,
biopsies were re-examined by these two pathologists until
agreement was reached. In the next, two of the 10 biopsy
specimens were used for rapid urease testing (CLOtest,
Delta West, Bentley, Australia). That is, one specimen from
the lesser curvature of the mid-antrum and one from the
mid-body were inserted in a separate CLOtest kit. Finally,
four of the 10 biopsy specimens were used for culture. That
is, one specimen from the lesser and one from the greater
curvature of the mid-antrum, and one specimen from the
lesser and one from the greater curvature of mid-body
were used for culturing H. pylori, respectively. In brief,
H. pylori strains were cultured at 37 °C on brain–heart
infusion plates containing 7% horse blood under
microaerobic conditions (5% O2; 10% CO2; 85% N2) for
three to five days. Antral and corpus biopsy specimens
were evaluated separately, and organisms were identified
as H. pylori by Gram staining, colony morphology, and by
positive oxidase, catalase, and urease reactions. If any one
of these three H. pylori tests was positive the host was
regarded to have an ongoing H. pylori infection. Anti-
H. pylori immunoglobulin G was determined qualitatively
using an enzyme-linked immunosorbent (ELISA) assay
(Genedia H. pylori ELISA; Green Cross Medical Science
Corp, Seoul, South Korea), especially when the three
abovementioned H. pylori tests were negative. These
© 2008 The Authors
Journal compilation © 2008 Blackwell Publishing Ltd, Helicobacter 13: 245–255
Kim et al. Prevalence and Risk Factors of Intestinal Metaplasia

Genedia kits used H. pylori antigen obtained from Korean
H. pylori strains, and had a sensitivity and specificity of
97.8% and 92.0%, respectively, in Korean adults [16]. The
cut-off optical density (OD450 nm) used for H. pylori IgG was
the mean value of a negative control plus 0.400, as
described by the manufacturer. In 36 subjects the H. pylori
serology was positive but no bacteria were found by
histology, CLOtest, or culture, and thus these subjects
were regarded as having past H. pylori infection without an
ongoing infection, and were classified as H. pylori positive.
H. pylori Genotypes and Genetic Polymorphisms
Genomic DNA was extracted directly from antral biopsy
specimens [17]. In brief, specimens were homogenized
in proteinase K solution (20 mmol/L Tris-HCl (pH 8.0),
10 mmol/L ethylenediaminetetraacetic acid, 0.5% sodium
dodecyl sulfate, and 10 mg/mL proteinase K) using a
sterile micropestle, and then incubated for 3 hours at
52 °C. DNA was isolated from homogenates by phenol/
chloroform extraction and ethanol precipitation. Analyses
for cagA, vacA and oipA were conducted after polymerase
chain reaction (PCR) amplifications had been performed,
as described previously [18,19]. The primers used for PCR
amplification and for the direct sequencing of the entire
coding regions of cagA, vacA and oipA are listed in Table 1.
The following polymorphisms were evaluated by PCR-
restriction fragment length polymorphism (PCR-RFLP)
analysis, using a Perkin Elmer model 9600 (Perkin Elmer
Co., Norwalk, CT, USA): IL-1B-511 [20], TNF-A-308 [21],
IL-10-592 [22], IL-10-819 [23], IL-10-1082 [24], IL-8-251
[25], IL-8-781 [26], IL-6-174 [27], IL-6-572 [28], p53 codon
72 [29], GSTP1 [30], and ALDH2 [31]. All restriction
enzymes used were purchased from New England Biolabs

Table 1 Polymerase chain reaction (PCR) primers and PCR products

Size Restriction
Region Primer sequence (5′→3′) (bp) Amplification cycles enzyme

cagA F: GATAACAGGCAAGCTTTTGAGG 349 35 cycles (30 s at 95 °C, 30 s at 52 °C, and 30 s at 72 °C)

R: CTGCAAAAGATTGTTTGGCAGA
vacA m1 F: CAATCTGTCCAATCAAGCGAG 570 35 cycles (1 min at 95 °C, 1 min at 52 °C, and 1 min at 72 °C)
R: GCGTCTAAATAATTCCAAGG
vacA m2 F: CAATCTGTCCAATCAAGCGAG 645 35 cycles (1 min at 95 °C, 1 min at 52 °C, and 1 min at 72 °C)
R: GCGTCTAAATAATTCCAAGG
oipA F: CAAGCGCTTAGATAGGC 427 35 cycles (1 min at 95 °C, 1 min at 52 °C, and 1 min at 72 °C)
R: AAGGCATTTTCTGCTGAA
IL-1B-511 F: GCCTGAACCCTGCATACCGT 40 cycles (1 min at 94 °C, 1 min at 54 °C, and 1 min at 72 °C) AvaI
R: GCCAATAGCCCTCCCTGTCT
TNF-A-308 F: AGGCAATAGGTTTTGAGGGCCAT 35 cycles (15 s at 95 °C, 30 s at 60 °C) NcoI
R: ACACTCCCCATCCTCCCGGCT
IL-1RN F: CTCAGCAACACTCCTAT 35 cycles (1 min at 94 °C, 1 min at 54 °C, and 1 min at 72 °C)
R: TCCTGGTCTGCAGGTAA
IL-10-592 F: GACTCCAGCCACAGAAGCTTA 35 cycles (40 s at 94 °C, 45 s at 54 °C, and 30 s at 72 °C) RsaI
R: TAAATATCCTCAAAGTTCC
IL-10-819 F: GACTCCAGCCACAGAAGCTTAC 40 cycles (40 s at 94 °C, 45 s at 54 °C, and 30 s at 72 °C) MaeIII
R: AGGTCTCTGGGCCTTAGT
IL-10-1082 F: CCAAGACAACACTACTAAGGCTGGT 35 cycles (40 s at 95 °C, 40 s at 56 °C, and 40 s at 72 °C) EcoNI
R: GCTTGTTATATGCTAGTCAGGTA
IL-8-251 F: TCATCCATGATCTTGTTCTAA 35 cycles (30 s at 95 °C, 1 min at 54 °C, and 1 min at 72 °C) MfeI
R: GGAAAACGCTGTAGGTCAGA
IL-8-781 F: CTCTAACTCTTTATATAGGAATT 35 cycles (30 s at 95 °C, 30 s at 52 °C, and 30 s at 72 °C) EcoRI
R: CATTGATTTTATCAACAGGCA
IL-6-174 F: GCT TCT TAG CGC TAG CCT CAA TG 35 cycles (1 min at 94 °C, 1 min at 55 °C, and 1 min at 72 °C) NlaIII
R: GGA CTG GAG ATG TCT GAG GC
IL-6-572 F: AGATTCCAAGGGTCACTTG 35 cycles (1 min at 94 °C, 1 min at 55 °C, and 1 min at 72 °C) BsrBI
R: AGAAGCAGAACCACTCTTC
p53 F: TTGCCGTCCCAAGCAATGGATGA 35 cycles (30 s at 95 °C, 30 s at 60 °C, and 30 s at 72 °C) BstU1
codon 72 R:TCTGGGAAGGGACAGAAGATGA
GSTP1 F: ACCCCAGGGCTCTATGGGAA 35 cycles (30 s at 94 °C, 30 s at 54 °C, and 30 s at 72 °C) BsmA1
R: TGAGGGCACAAGAAGCC CCT
ALDH2 F: CAAATTACAGGGTCAACTGCT 35 cycles (30 s at 94 °C, 45 s at 58 °C, and 30 s at 72 °C) MboII
R: CCACACTCACAGTTTTCTCTT

© 2008 The Authors

Journal compilation © 2008 Blackwell Publishing Ltd, Helicobacter 13: 245–255 247
Prevalence and Risk Factors of Intestinal Metaplasia
Inc. (Beverly, MA, USA). For the IL-1RN penta-allelic
variable number of tandem repeat (VNTR), genomic DNA
was amplified by PCR using the primers listed in Table 1
[32]. Alleles were coded as follows: allele 1 = 4 repeats of
the 86-bp region (410 bp); allele 2 = 2 repeats (240 bp);
allele 3 = 5 repeats (500 bp); allele 4 = 3 repeats (325 bp);
and allele 5 = 6 repeats (595 bp). The rare alleles 3, 4, and
5 were grouped with allele 1 and are described as long (L)
allele.
Statistical Analysis
Data were analyzed using the χ2-tests and logistic
regression models in the SAS statistical package. The
effects of cagA, vacA, oipA, and DNA polymorphisms of
IL-1B-511, IL-1RN, TNF-A-308, IL-10-592, IL-10-819, IL-
10-1082, IL-8-251, IL-8-781, IL-6-174, IL-6-572, p53 codon
72, GSTP1, and ALDH2 alleles on the risks of AG and IM in
the antrum and body were expressed as odds ratios (ORs)
and 95% confidence intervals (CI). Covariates that
showed a significant association by χ2 test were subjected
to multiple logistic regression analyses. Multivariate
models were adjusted for sex and age in tertiles
(≤ 47 years, 48–60 years, ≥ 61 years). Model fits were
assessed using Hosmer–Lemeshow goodness-of-fit tests.
Variables found to be significant were included in final
models. All analyses were performed using SAS statistical
software. Differences were considered significant when
p-values were < .05.
Results
Characteristics of Participants
Of the 389 subjects (mean age: 51.3 years; male 117
(30.1%), female 272 (69.9%)), 254 (65.3%) were H. pylori
positive. Demographic data regarding smoking, alcohol,
current residency, residency in childhood (rural/urban),
current water source (bottled/boiled/well), drinking water
source during childhood, number sharing a room during
childhood, current income, social level during childhood,
education, occupation, and diet (i.e. consumption of salty
or spicy food) are shown in Table 2, which also contains
details of subject numbers with bacterial factors (i.e. cagA,
vacA m, oipA), and genetic polymorphisms (i.e. IL-1B-511,
TNFA-308, IL10-592, IL10-1082, IL8-251, IL-8-781, IL6-
572, IL6-174, p53 codon 72, GSTP1, and ALDH2).
Prevalence Rates of Atrophic Gastritis and
Intestinal Metaplasia
When atrophy and metaplasia were classified using the
updated Sydney system, and after excluding indefinite for
248
Kim et al.
atrophy cases (196 in the antrum and 140 in the body),
atrophy was found to be present in 42.5% (82 of 193) in
the antrum and in 20.1% (50 of 249) in the body (Table 3).
When the specimens were not prepared well enough to
evaluate full-thickness gastric mucosa due to problems
such as improper fixation, inaccurate orientation, and
section inappropriateness, or whenever inflammation
prevented a clear distinction between nonatrophic and
atrophic phenotypes, samples were classified as indefinite
for atrophy [33]. In addition, gastric atrophy was found to
be associated with IM in the antrum in 35 of the 193
(18.1%) subjects, and body atrophy was found to be
associated with IM in 32 of the 249 (12.9%) subjects. IM
was found in 28.6% (110 of 385) and 21.2% (82 of 386)
of patients in the antrum and body, respectively (Table 3).
When subjects were classified by H. pylori positivity, no
differences in sex or age distribution were found between
H. pylori-negative (n = 135) and H. pylori-positive patients
(n = 254) (Table 3). However, a significant difference was
found between these two groups in terms of mean grade
and presence of inflammation activity, chronic inflamma-
tion, atrophy, or metaplasia in either antrum or body
(Table 3). In cases of chronic inflammation a significant
difference was also found between these two groups in
terms of mean grade. However, H. pylori-negative cases
frequently showed a mild degree of chronic inflammation,
and no significance was found in terms of presence (%)
between H. pylori-positive and H. pylori-negative groups.
In addition, when the prevalences of AG in antrum and
body were compared with respect to age (categorized in
deciles), they were found to increase from 25% and 0%,
respectively, for those in their twenties, to 50%, and
35.3% in those older than 70 (p < .001 for both) (Fig. 1A).
Moreover, when these prevalences of AG by age group for
H. pylori-negative subjects were analyzed, no definite
increase of AG with age was observed in the antrum
(p = .139) or body (p = .090) (Fig. 1C). In contrast, in
H. pylori-positive subjects the observed increase with age
was prominent in antrum and body (p = .001 for both)
(Fig. 1E). In the case of IM, though its prevalence was
lower than that of AG, its increasing prevalence with age
was obvious. That is, IM gradually increased from 11.3%
and 6.4% in the antrum and body, among those in their
thirties to 50%, and 42.9% in those older than 70 (p < .001
for both), respectively (Fig. 1B). When the prevalence of
IM with age was analyzed with respect to H. pylori positiv-
ity, a linear increase of IM with age was observed in the
H. pylori-negative group in the antrum (p = .011) and body
(p = .025) (Fig. 1D). Moreover, this increase in the preva-
lence of IM in antrum and body with age was marked in
the H. pylori-positive group, and reached 50% and 55.6%,
in those older than 70, respectively (p < .001 for both)
(Fig. 1F).
© 2008 The Authors
Journal compilation © 2008 Blackwell Publishing Ltd, Helicobacter 13: 245–255
Kim et al. Prevalence and Risk Factors of Intestinal Metaplasia

Table 2 Baseline characteristics of the 389 subjects

Age (mean ± standard deviation) 51.3 ± 13.4 years %

Sex (male : female) 117 : 272 30.1 : 69.9
H. pylori (positive : negative) 254 : 135 65.3 : 34.7
Smoking (current : previous : never) 36 : 68 : 285 9.2 : 17.5 : 73.3
Alcohol (current : previous : never) 154 : 14 : 197 42.2 : 3.8 : 54
Current residency (urban : rural area) 228 : 36 86.4 : 13.6
Residency in the childhood (urban : rural area) 137 : 127 51.9 : 48.1
Current drinking water (bottled : boiled : well) 171 : 78 : 9 66.3 : 30.2 : 3.5
Drinking water during childhood (bottled : boiled : well) 75 : 100 : 78 29.7 : 39.5 : 30.8
No. of persons sharing a room during childhood (≤ 1 : > 1) 148 : 105 58.5 : 41.5
Current income US$/month (< 1000 : 1000–5000 : > 5000) 16 : 162 : 64 6.6 : 66.9 : 26.5
Social level during childhood (low : moderate : high) 62 : 127 : 67 24.3 : 49.8 : 25.9
Education (elementary : middle-high : university) 22 : 128 : 103 8.7 : 50.6 : 40.7
Occupation (unemployed: salesmen or farmer: professional) 64 : 62 : 118 26.2 : 25.4 : 48.4
Salty food (low : moderate : severe) 60 : 53 : 145 23.3 : 20.5 : 56.2
Spicy food (low : moderate : severe) 66 : 64 : 128 25.6 : 24.8 : 49.6
Bacterial factors (in case of H. pylori positive)
cagA (positive : negative) 96 : 94 50.5 : 49.5
vacA m (m1 : m2 : negative) 104 : 21 : 65 54.7 : 11.1 : 34.2
oipA (positive : negative) 97 : 92 51.3 : 48.7
Genetic polymorphism
IL1B-511 (C/C : C/T : T/T) 57 : 159 : 83 19.1 : 53.2 : 27.7
IL1RN-511 (L/La : 1/2 : 2/2) 226 : 43 : 1 83.7 : 15.9 : 0.4
TNFA-308 (G/G : G/A : A/A) 227 : 40 : 3 84.1 : 14.8 : 1.1
IL10-592 (A/A : C/A : C/C) 113 : 121 : 32 42.5 : 45.5 : 12.0
IL10-1082 (A/A : G/A : G/G) 230 : 38 : 1 85.5 : 14.1 : 0.4
IL8-251 (T/T : A/T : A/A) 121 : 119 : 25 45.7 : 44.9 : 9.4
IL8-781 (C/C : C/T : T/T) 125 : 111 : 29 47.2 : 41.9 : 10.9
IL6-572 (C/C : C/G : G/G) 144 : 98 : 21 54.7 : 37.3 : 8.0
IL6-174 (G/G:G/C:C/C) 268 : 0 : 0 100 : 0 : 0
p53 codon 72 (Arg/Arg : Arg/Pro : Pro/Pro) 101 : 112 : 57 37.4 : 41.5 : 21.1
GSTP1 (A/A : A/G : G/G) 184 : 79 : 5 68.6 : 29.5 : 1.9
ALDH2 (1/1 : 1/2 : 2/2) 159 : 79 : 5 65.4 : 32.5 : 2.1

a
L indicates a long variable number tandem repeat consisting of more than two 86-bp repeats. Allele 1 of this polymorphism consists of four repeats and
is the commonest allele. Alleles 3 (five repeats), 4 (three repeats), and 5 (six repeats) are very rare. Alleles 3, 4, and 5 grouped with allele 1 are referred to
as “L” (long alleles) for analysis purposes.

1.34–6.78), a smoking history (OR 3.49, 95% CI 1.39–

Multivariate Analysis and the Identification of the
Risk Factors of Atrophic Gastritis
The risk factors of AG in the antrum were identified as;
H. pylori (OR 5.69, 95% CI 1.87–17.3), age (≥ 61 vs. ≤ 47;
OR 3.75, 95% CI 1.31–10.9), and the presence of cagA (OR
2.67, 95% CI 1.05–6.84) (Table 5). The risk factors of AG
in the body were H. pylori (OR 3.63, 95% CI 1.58–8.34),
age (48–60 vs. ≤ 47; OR 3.90, 95% CI 1.36–11.2; and ≥ 61
vs. ≤ 47; OR 4.94, 95% CI 1.61–15.2), and the presence of
vacA m1 (OR 3.48, 95% CI 1.54–7.87) (Table 4).
Multivariate Analysis and the Identification of the
Risk Factors of Intestinal Metaplasia
The risk factors of IM in the antrum were H. pylori (OR
8.22, 95% CI 3.27–20.7), age (48–60 vs. ≤ 47; OR 2.28,
95% CI 1.04–4.98; and age ≥ 61 vs. ≤ 47; OR 3.02, 95% CI
8.75), and the consumption of strong spicy food (OR 2.38,
95% CI 1.16–4.88). The presence of IL6-572 G was found
to protect against IM in the antrum was versus the C/C
genotype (OR 0.50, 95% CI 0.26–0.94) (Table 5). Risk
factors of IM in the body were H. pylori (OR 3.65, 95% CI
1.51–8.87), age (≥ 61 vs. ≤ 47; OR 9.98, 95% CI 3.78–
26.3), a smoking history (OR 7.10, 95% CI 2.48–20.3), a
nonprofessional versus a professional job (OR 3.53, 95%
CI 1.17–10.7), unemployed versus a professional job (OR
3.79, 95% CI 1.28–11.2), and the presence of IL10-592
C/A versus the A/A genotype (OR 3.69, 95% CI 1.65–8.21)
(Table 5).
Discussion
Atrophic gastritis (AG) and intestinal metaplasia (IM) are
regarded as a precancerous conditions [4,5,34], and thus a

© 2008 The Authors

Journal compilation © 2008 Blackwell Publishing Ltd, Helicobacter 13: 245–255 249
Prevalence and Risk Factors of Intestinal Metaplasia Kim et al.

Table 3 Prevalences of activity, chronic

p-value between inflammation, atrophy, and metaplasia
H. pylori-negative H. pylori-positive Total H. pylori-negative according to the presence of H. pylori
(n = 135) (n = 254) (n = 399) and -positive

Sex (%) .416

Male 33 (24.4) 84 (33.1) 117 (30.1)
Female 102 (75.6) 170 (66.9) 272 (69.9)
Age (years) (%)
20–29 10 (7.4) 6 (2.4) 16 (4.1) .547
30–39 29 (21.5) 34 (13.4) 63 (16.2)
40–49 31 (23.0) 65 (25.6) 96 (24.7)
50–59 24 (17.8) 73 (28.7) 97 (24.9)
60–69 31 (23.0) 58 (22.8) 89 (22.9)
≥ 70 10 (7.4) 18 (7.1) 28 (7.2)
Activity
Antrum
Mean grade 0.20 1.39 0.98 < .001
Presence (%) 16/133 (12.0) 196/252 (77.8) 212/385 (55.1) < .001
Body
Mean grade 0.20 1.47 1.03 < .001
Presence (%) 23/133 (17.3) 192/253 (75.9) 215/386 (55.7) < .001
Chronic inflammation
Antrum
Mean grade 1.17 1.95 1.68 < .001
Presence (%) 131/133 (98.5) 251/252 (99.6) 382/385 (99.2) .997
Body
Mean grade 1.17 1.85 1.62 < .001
Presence (%) 131/133 (98.5) 253/253 (100) 384/386 (99.5) .998
Atrophy
Antrum
Mean grade 0.19 0.73 0.54 < .001
Presence (%) 11/67 (16.4) 71/126 (56.3) 82/193 (42.5) < .001
Body
Mean grade 1.17 1.43 1.33 .003
Presence (%) 8/92 (8.7) 42/157 (24.8) 50/249 (20.1) .002
Metaplasia
Antrum
Mean grade 0.16 0.60 0.45 < .001
Presence (%) 14/133 (10.5) 96/252 (38.1) 110/385 (28.6) < .001
Body
Mean grade 0.13 0.42 0.32 < .001
Presence (%) 11/133 (8.3) 71/253 (28.1) 82/386 (21.2) < .001

precise knowledge of the prevalences of AG and IM is of
considerable importance. This is especially the case in
Korea, wherein there is a high prevalence of GC and a high
seroprevalence of H. pylori, 59.6% among asymptomatic
Korean adults in 2005 [35]. H. pylori infection is an
important contributor to the development of gastro-
duodenal diseases, e.g. chronic AG, peptic ulcers, and GC
[4,36,37]. However, fewer than 20% of those infected
present with clinical diseases, which strongly suggests that
disease severity depends on interactions between the host,
the environment, and bacterial virulence factors. In the
present study, the prevalences of AG and IM and their
relations with H. pylori virulence factors, and with
environmental and host factors were investigated in a
Korean population without significant gastroduodenal
diseases. The study shows that the mean prevalences of
AG in the antrum and body in our study cohort were
42.5% and 20.1%, respectively, and that those of IM were
28.6% and 21.2%, respectively, which were lower than
expected. Actually, many Korean gastroenterologists
believe that AG and IM are present in almost all Koreans
older than 70, because gastric atrophy and IM are
invariably encountered during gastroscopy in such
subjects.

© 2008 The Authors

250 Journal compilation © 2008 Blackwell Publishing Ltd, Helicobacter 13: 245–255
Kim et al.
Figure 1 Prevalences of atrophic gastritis and
intestinal metaplasia. (A) Atrophic gastritis
regardless of H. pylori positivity. (B) Intestinal
metaplasia regardless of H. pylori positivity. (C)
Atrophic gastritis with H. pylori negativity. (D)
Intestinal metaplasia with H. pylori negativity.
(E) Atrophic gastritis with H. pylori positivity.
(F) Intestinal metaplasia with H. pylori positivity.
A prospective study concluded that H. pylori eradication
significantly reduces GC development in a subgroup of
H. pylori carriers without a precancerous lesion (e.g. gastric
atrophy and IM, or dysplasia) [38]. In addition, a Korean
study found that the eradication of H. pylori could not stop
GC development in a patient with IM [39]. This finding
encapsulates the concept of “point of no return”. In the
present study, AG prevalences of those aged 20–29 years
were 25% and 0% in the antrum and body, respectively,
but rates of AG and IM in antrum and body were 0% in
those aged 16–20 years. In addition, there was a report
that 24% of children older than 10 years became reinfected
after eradication of H. pylori [40]. The above findings lead
us to suggest that H. pylori eradication treatment should be
undertaken in 20–29 years old in Korea.
© 2008 The Authors
Journal compilation © 2008 Blackwell Publishing Ltd, Helicobacter 13: 245–255
Prevalence and Risk Factors of Intestinal Metaplasia
Several studies have been conducted on the risk factors
of AG and IM [10,11] but no previous study has evaluated
the risk factors of these two conditions comprehensively
with respect to H. pylori virulence factors, and environ-
mental and host factors in subjects without significant gas-
troduodenal diseases. In the present study, the greatest risk
factors for AG and IM in both antrum and body were
H. pylori infection and an age ≥ 61 years by multivariate
analysis, which concurs with the findings of a previous
report, which also found that IM progressed with age in
the H. pylori-positive subjects [41]. Furthermore, our study
shows that bacterial virulence genes such as cagA and vacA
m1 (bacterial cytotoxin genes) are the risk factors of AG in
the antrum (OR, 2.67; 95% CI, 1.05–6.84) and body (OR,
3.48; 95% CI, 1.54–7.87), respectively, but they are not
251
Prevalence and Risk Factors of Intestinal Metaplasia Kim et al.

Table 4 Risk factors of atrophic gastritis by

AG grade 0a AG grade 1–3a Adjusted OR 95% CI p-value multivariate analysis

Antrum
H. pylori (%)
Negative 56 (83.6) 11 (16.4)
Positive 55 (43.7) 71 (56.3) 5.69 1.87–17.3 < .001
Age (years) (%)
≤ 47 58 (69.9) 25 (30.1)
48–60 32 (48.5) 34 (51.5) 2.23 0.87–5.70 .094
≥ 61 21 (47.7) 23 (52.3) 3.75 1.31–10.9 .014
cagA (%)
Negative 52 (64.2) 29 (35.8)
Positive 22 (40.7) 32 (59.3) 2.67 1.05–6.84 .040

Body
H. pylori (%)
Negative 84 (91.3) 8 (8.7)
Positive 115 (73.2) 42 (26.8) 3.63 1.58–8.34 .003
Age (years) (%)
≤ 47 91 (90.1) 19 (9.9)
48–60 64 (74.4) 22 (25.6) 3.90 1.36–11.2 .011
≥ 61 44 (71.0) 18 (29.0) 4.94 1.61–15.2 .005
vagA m (%)
Negative 80 (84.2) 15 (15.8)
m1 37 (62.7) 22 (37.3) 3.48 1.54–7.87 .003
m2 9 (83.3) 1 (16.7) 1.04 0.10–11.0 .973

a
Updated Sydney system scores, 0 = none, 1 = slight, 2 = moderate, 3 = marked.
AG, atrophic gastritis; OR, odds ratio; 95% CI, 95% confidence interval.

risk factors for IM. The vacA gene encodes a vacuolating
cytotoxin that damages epithelial cells [42]. This gene is
present in all H. pylori strains and is composed of two
variable parts. Its m-region (middle region) is composed of
an m1 or m2 allele, and the presence of the m1 allele has
been associated with greater gastric epithelial damage than
m2 strains [10]. This supports a finding of the present
study, namely, vacA m1 is a risk factor of AG in the antrum.
On the other hand, cagA (a cytotoxin-associated gene) is
considered to be a marker of the presence of a ~35 kbp
pathogenicity (cag) island [45], and infection by a cagA+
strains has been reported to increase the risks of AG and
GC development [10,44,45], which is in line with our
findings. However, oipA (outer membrane protein), which
has been linked with the clinical outcome of H. pylori infec-
tion [19], was not found to be a risk factor of AG or IM in
the present study.
In terms of host genetic polymorphisms, the extensively
explored polymorphisms are related to the IL-1 gene
cluster (IL-1B and IL-1RN) and the TNF-A gene. Studies in
Caucasians have shown that IL-1B-511 T/T, IL-1RN 2/2,
and TNF-A-308 A carriers are at significantly greater risk of
GC [46], but Asian studies do not support these associations
[17]. Similarly, IL-1B-511, IL-1RN, and TNF-A-308 were
not found to be risk factors of AG or IM in the present study.
Other cytokines, like IL-6, IL-8, and IL-10, are also deeply
involved in immune response to H. pylori infection. In
particular, IL-10 polymorphisms (-1082, -819, -592) have
been reported to be associated with GC risk [46,47]. In
addition, IL-8-251 A allele has been reported to increase
IL-8 expression [48], and this allele has been associated
with gastric atrophy progression in H. pylori-infected
patients and with a greater risk of GC [25,47]. Moreover,
recently, inheritance of the IL-6-174 G allele was found to
be associated with an elevated risk of GC [49]. Given the
above background, we investigated the effects of seven
polymorphisms, i.e. three in the IL-10 gene (-592/-819/-
1082), two in IL-8 (-251/-781), and two in IL-6 (-174/-572),
on the susceptibility to AG or IM. IL6-572 genotype G
carrier was found to be a protective factor against IM in
the antrum (OR, 0.50; 95% CI, 0.26–0.94), whereas the
IL10-592 C/A genotype was found to be a risk factor of IM
in the body (OR, 3.69; 95% CI, 1.65–8.21), which suggests
that genotypes of host inflammation-associated cytokines
are closely related with the development of IM but not
with the development of AG. However, the finding that
the IL10-592 C/A genotype increases the risk of body IM
versus A/A is somewhat difficult to explain, because IL-10 is
a potent immunosuppressive cytokine that downregulates
the expressions of Th1 cytokines. In particular, patients
harboring an IL-10 polymorphism, which promotes
expression of IL-10, were found to be less likely to develop

© 2008 The Authors

252 Journal compilation © 2008 Blackwell Publishing Ltd, Helicobacter 13: 245–255
Kim et al. Prevalence and Risk Factors of Intestinal Metaplasia

Table 5 Risk factors of intestinal metaplasia

by multivariate analysis IM grade 0a IM grade 1–3a Adjusted OR 95% CI p-value

Antrum
H. pylori (%)
Negative 119 (89.5) 14 (10.5)
Positive 156 (61.9) 96 (38.1) 8.22 3.27–20.7 < .001
Age (years) (%) 133 (88.1) 18 (11.9)
≤ 47
48–60 102 (78.5) 28 (21.5) 2.28 1.04–4.98 .039
≥ 61 69 (65.7) 36 (34.3) 3.02 1.34–6.78 .008
Smoking (%) 34 (19.0)
Never 145 (81.0)
Current 33 (91.7) 3 (8.3) 0.39 0.05–4.58 .372
Past 46 (67.6) 22 (32.4) 3.49 1.39–8.75 .008
Spicy food (%)
Low 51 (79.7) 13 (20.3)
Moderate 90 (70.3) 38 (29.7) 0.78 0.66–1.34 .788
Strong 37 (58.7) 26 (41.3) 2.38 1.16–4.88 .017
IL6-572 genotype (%)
C/C 92 (64.8) 50 (14.3)
G carrier 88 (74.6) 30 (25.4) 0.50 0.26–0.94 .033

Body
H. pylori (%)
Negative 122 (91.7) 11 (8.3)
Positive 182 (71.9) 71 (28.1) 3.65 1.51–8.87 .004
Age (years) (%)
≤ 47 133 (88.1) 18 (11.9)
48–60 102 (78.5) 28 (21.5) 2.47 0.96–6.35 .061
≥ 61 69 (65.7) 36 (34.3) 9.98 3.78–26.3 .005
Smoking (%) 235 (78.8) 51 (21.2)
Never
Current 39 (92.9) 3 (7.1) 0.18 0.02–1.34 .093
Past 21 (46.7) 24 (53.3) 7.10 2.48–20.3 < .001
Occupation (%)
Professional 103 (81.1) 24 (18.9)
Nonprofessional 43 (72.9) 16 (27.1) 3.53 1.17–10.7 .025
Unemployed 20 (64.5) 11 (35.5) 3.79 1.28–11.2 .017
IL10-592 genotype (%)
A/A 91 (82.0) 20 (18.0)
C/A 83 (68.6) 38 (31.4) 3.69 1.65–8.21 .001
C/C 24 (75.0) 8 (25.0) 1.32 0.41–4.21 .639

a
Updated Sydney system scores, 0 = none, 1 = slight, 2 = moderate, 3 = marked.
IM, intestinal metaplasia; 95% CI, OR, odds ratio; 95% confidence interval.

H. pylori-related inflammation [50]. Further research is
required to determine the relations between cytokine
polymorphisms and the developments of AG and IM.
In terms of environmental factors, a smoking history
(OR, 3.49; 95% CI, 1.39–8.75) and the consumptions of
strong spicy food (OR, 2.38; 95% CI, 1.16–4.88) were
found to be risk factors of IM in the antrum, but current
smoking was not. In terms of IM in the body, a smoking
history (OR, 7.10; 95% CI, 2.48 –20.3), a nonprofessional
job (OR, 3.53; 95% CI, 1.17–10.7), and being unemployed
(OR, 3.79; 95% CI, 1.28–11.2) were identified as risk
factors. This result regarding a smoking history as a risk
factor instead of current smoking is supported by a study
that found that the risk of GC is elevated in past smokers
for up to 14 years after cessation [51], and could be related
to the fact that many people have recently quit smoking
after a long period of exposure. The relations between a
nonprofessional or unemployed status and IM in the body
might reflect a poor socioeconomic state, which has
also been reported to affect H. pylori infection [35].
Unexpectedly, strong spicy food was found to be a risk
factor of IM, rather than salty food, which is a well-known

© 2008 The Authors

Journal compilation © 2008 Blackwell Publishing Ltd, Helicobacter 13: 245–255 253
Prevalence and Risk Factors of Intestinal Metaplasia
risk factor of AG and IM. Thus, further research is required
to probe the mechanism linking IM and the consumption
of strong spicy foods.
Taken together, our study shows that the loss of
appropriate glands (atrophy) is directly related to the
effects of bacterial products, but environmental and host
factors are important for IM. These results suggest that the
pathogeneses of atrophy and IM differ, and apparently
contradict the hypothesis that IM is a sequela of AG. When
surgical specimens containing H. pylori gastritis and
duodenal ulcer were subjected to a systematic histological
work-up, focal IM was inevitably observed, usually in the
nonatrophic mucosa of the antrum [6]. Furthermore, IM
also occurred in chemically induced reactive gastritis [52],
a form of gastritis that only rarely progresses to diffuse
atrophy. Accordingly, it appears that IM arises in response
to various different etiopathogenetic injuries to the gastric
mucosa during the course of regeneration, which has been
reported to be due to the “switching” of stem cells in the
neck of the gland, which results in the replacement of
normal gastric epithelium by IM epithelium [6]. Conse-
quently, many are of the opinion that IM is not necessarily a
sequela of atrophy in the sense of the atrophy–metaplasia
sequence. Moreover, our findings that bacterial factors are
important for AG development but that environmental
and host factors are important for IM development
support criticisms of the atrophy–metaplasia hypothesis.
In conclusion the present study shows that the preva-
lence rates of AG and IM were not as high as were
expected and that they both increased with age. The most
important risk factor for both AG and IM development was
identified to be H. pylori infection. Furthermore, bacterial
factors were found to be important for the development of
AG, but environmental and host factors were found to be
important for IM development.
This study was supported by grant of the Korea Health 21 R&D
Project, Ministry of Health and Welfare, Republic of Korea (no.
A060266).
References
1 Rugge M, Farinati F, Baffa R, et al. Gastric epithelial
dysplasia in the natural history of gastric cancer:
A multicenter prospective follow-up study. Interdisciplinary
Group on Gastric Epithelial Dysplasia. Gastroenterology
1994;107:1288–96.
2 Siurala M. Gastritis, its fate and sequelae. Ann Clin Res
1981;13:111–3.
3 Correa P. Human gastric carcinogenesis: A multistep and
multifactorial process – First American Cancer Society Award
Lecture on Cancer Epidemiology and Prevention. Cancer Res
1992;52:6735–40.
4 Uemura N, Okamoto S, Yamamoto S, et al. Helicobacter pylori
infection and the development of gastric cancer. N Engl J Med
2001;345:784–9.
254
Kim et al.
5 Sipponen P, Kekki M, Haapakoski J, Ihamäki T, Siurala M.
Gastric cancer risk in chronic atrophic gastritis: Statistical
calculations of cross-sectional data. Int J Cancer 1985;35:173–7.
6 Meining A, Morgner A, Miehlke S, Bayerdörffer E, Stolte M.
Atrophy-metaplasia-dysplasia-carcinoma sequence in the
stomach: A reality or merely a hypothesis? Best Pract Res Clin
Gastroenterol 2001;15:983–98.
7 Parkin DM, Bray F, Ferlay J, Pisani P. Global Cancer Statistics,
2002. CA Cancer J Clin 2005;55:74–108.
8 Naylor GM, Gotoda T, Dixon M, et al. Why does Japan have a high
incidence of gastric cancer? Comparison of gastritis between UK
and Japanese patients. Gut 2006;55:1545–52.
9 Parsonnet J, Friedman GD, Orentreich N, Vogelman H. Risk for
gastric cancer in people with CagA positive or CagA negative
Helicobacter pylori infection. Gut 1997;40:297–301.
10 Nogueira C, Figueiredo C, Carneiro F, et al. Helicobacter pylori
genotypes may determine gastric histopathology. Am J Pathol
2001;158:647–54.
11 Leung WK, Chan MC, To KF, et al. H. pylori genotypes and
cytokine gene polymorphisms influence the development
of gastric intestinal metaplasia in a Chinese population.
Am J Gastroenterol 2006;101:714–20.
12 Joossens JV, Hill MJ, Elliott P, et al. Dietary salt, nitrate and
stomach cancer mortality in 24 countries. European Cancer
Prevention (ECP) and the INTERSALT Cooperation Research
Group. Int J Epidemiol 1996;25:494–504.
13 Figueiredo C, Machado JC, Pharoah P, et al. Helicobacter pylori
and interleukin 1 genotyping: An opportunity to identify
high-risk individuals for gastric carcinoma. J Natl Cancer Inst
2002;94:1680–7.
14 Rad R, Prinz C, Neu B, et al. Synergistic effect of Helicobacter pylori
virulence factors and interleukin-1 polymorphisms for the
development of severe histological changes in the gastric mucosa.
J Infect Dis 2003;188:272–81.
15 Dixon MF, Genta RM, Yardley JH, Correa P. The participants on the
International Workshop on the Histopathology of Gastritis,
Houston 1994. Classification and grading of gastritis: The Updated
Sydney System. Am J Surg Pathol 1996;20:1161–81.
16 Kim SY, Ahn JS, Ha YJ, et al. Serodiagnosis of Helicobacter pylori
infection in Korean patients using enzyme-linked immunosorbent
assay. J Immunoassay 1998;19:251–70.
17 Kim N, Cho SI, Yim JY, et al. The effects of genetic polymorphisms
of IL-1 and TNF-A on Helicobacter pylori-induced gastroduodenal
diseases in Korea. Helicobacter 2006;11:105–12.
18 Yamaoka Y, Kodama T, Gutierrez O, Kim JG, Kashima K, Graham
DY. Relationship between Helicobacter pylori iceA, cagA, and vacA
status and clinical outcome: Studies in four different countries.
J Clin Microbiol 1999;37:2274–9.
19 Yamaoka Y, Kwon DH, Graham DY. A M(r) 34,000
proinflammatory outer membrane protein (oipA) of Helicobacter
pylori. Proc Natl Acad Sci USA 2000;97:7533–8.
20 Kato S, Onda M, Yamada S, Matsuda N, Tokunaga A, Matsukura
N. Association of the interleukin-1 beta genetic polymorphism and
gastric cancer risk in Japanese. J Gastroenterol 2001;36:696–9.
21 Galbraith GM, Pandey JP. Tumor necrosis factor alpha (TNF-α)
gene polymorphism in alopecia areata. Hum Genet 1995;96:433–6.
22 Rad R, Dossumbekova A, Neu B, et al. Cytokine gene
polymorphisms influence mucosal cytokine expression, gastric
inflammation, and host specific colonisation during Helicobacter
pylori infection. Gut 2004;53:1082–9.
23 Moraes MO, Santos AR, Schonkeren JJ, et al. Interleukin-10
promoter haplotypes are differently distributed in the Brazilian
versus the Dutch population. Immunogenetics 2003;54:896–9.
© 2008 The Authors
Journal compilation © 2008 Blackwell Publishing Ltd, Helicobacter 13: 245–255
Kim et al.
24 Zhang DL, Zheng HM, Yu BJ, Jiang ZW, Li JS. Association of
polymorphism of IL and CD14 genes with acute severe pancreatitis
and septic shock. World J Gastroenterol 2005;11:4409–13.
25 Ohyauchi M, Imatani A, Yonechi M, et al. The polymorphism
interleukin 8 -251 A/T influences the susceptibility of Helicobacter
pylori related gastric diseases in the Japanese population.
Gut 2005;54:330–5.
26 Heinzmann A, Ahlert I, Kurz T, Berner R, Deichmann KA.
Association study suggests opposite effects of polymorphisms
within IL8 on bronchial asthma and respiratory syncytial virus
bronchiolitis. J Allergy Clin Immunol 2004;114:671–6.
27 Addas-Carvalho M, de Paula EV, Lima CS, Saad ST.
Polymorphisms of interleukin-1 gene complex, IL6 and tumor
necrosis factor genes in chronic idiopathic neutropenia of adults.
Ann Hematol 2005;84:709–14.
28 Hwang IR, Hsu PI, Peterson LE, et al. Interleukin-6 genetic
polymorphisms are not related to Helicobacter pylori-associated
gastroduodenal diseases. Helicobacter 2003;8:142–8.
29 Pérez-Pérez GI, Bosques-Padilla FJ, Crosatti ML,
Tijerina-Menchaca R, Garza-González E. Role of p53 codon 72
polymorphism in the risk of development of distal gastric cancer.
Scand J Gastroenterol 2005;40:56–60.
30 Harries LW, Stubbins MJ, Forman D, Howard GC, Wolf CR.
Identification of genetic polymorphisms at the glutathione
S-transferase Pi locus and association with susceptibility to bladder,
testicular and prostate cancer. Carcinogenesis 1997;18:641–4.
31 Harada S, Zhang S. New strategy for detection of ALDH2 mutant.
Alcohol Alcohol 1993;1A (Suppl):11–3.
32 Mansfield JC, Holden H, Tarlow JK, et al. Novel genetic association
between ulcerative colitis and anti-inflammatory cytokine
interleukin-1 receptor antagonist. Gastroenterology
1994;106:637–42.
33 Rugge M, Correa P, Dixon MF, et al. Gastric mucosal atrophy:
Interobserver consistency using new criteria for classification and
grading. Aliment Pharmacol Ther 2002;16:1249–59.
34 Morson BC, Sobin LH, Grundmann E, Johansen A, Nagayo T,
Serck-Hanssen A. Precancerous conditions and epithelial dysplasia
in the stomach. J Clin Pathol 1980;33:711–21.
35 Yim JY, Kim N, Choi SH, et al. Seroprevalence of Helicobacter pylori
in South Korea. Helicobacter 2007;12:333–40.
36 Kuipers EJ, Uyterlinde AM, Peña AS, et al. Long-term sequelae of
Helicobacter pylori gastritis. Lancet 1995;345:1525–8.
37 Hopkins RJ, Girardi LS, Turney EA. Relationship between
Helicobacter pylori eradication and reduced duodenal and gastric
ulcer recurrence: A review. Gastroenterology 1996;110:1244–52.
38 Wong BC, Lam SK, Wong WM, et al. China Gastric Cancer Study
Group. Helicobacter pylori eradication to prevent gastric cancer in a
© 2008 The Authors
Journal compilation © 2008 Blackwell Publishing Ltd, Helicobacter 13: 245–255
Prevalence and Risk Factors of Intestinal Metaplasia
high-risk region of China: A randomized controlled trial. JAMA
2004;291:187–94.
39 Kim N, Park RY, Cho SI, et al. Helicobacter pylori infection and
development of gastric cancer in Korea: Long-term follow-up.
J Clin Gastroenterol 2008, in press.
40 Halitim F, Vincent P, Michaud L, et al. High rate of Helicobacter
pylori reinfection in children and adolescents. Helicobacter
2006;11:168–72.
41 Leung WK, Lin SR, Ching JY, et al. Factors predicting progression
of gastric intestinal metaplasia: Results of a randomized trial on
Helicobacter pylori. Gut 2004;53:1244–9.
42 Cover TL. The vacuolating cytotoxin of Helicobacter pylori. Mol
Microbiol 1996;20:241–6.
43 Censini S, Lange C, Xiang Z, et al. cag, a pathogenicity island of
Helicobacter pylori, encodes type I-specific and disease-associated
virulence factors. Proc Natl Acad Sci USA 1996;93:14648–53.
44 Blaser MJ, Perez-Perez GI, Kleanthous H, et al. Infection with
Helicobacter pylori strains possessing cagA is associated with an
increased risk of developing adenocarcinoma of the stomach.
Cancer Res 1995;55:2111–5.
45 Kuipers EJ, Pérez-Pérez GI, Meuwissen SG, Blaser MJ. Helicobacter
pylori and atrophic gastritis: Importance of the cagA status. J Natl
Cancer Inst 1995;87:1777–80.
46 El-Omar EM, Rabkin CS, Gammon MD, et al. Increased risk
of noncardia gastric cancer associated with proinflammatory
cytokine gene polymorphisms. Gastroenterology
2003;124:1193–201.
47 Lu W, Pan K, Zhang L, Lin D, Miao X, You W. Genetic
polymorphisms of interleukin (IL)-1B, IL-1RN, IL-8, IL-10 and
tumor necrosis factor {alpha} and risk of gastric cancer in a Chinese
population. Carcinogenesis 2005;26:631–6.
48 Hull J, Thomson A, Kwiatkowski D. Association of respiratory
syncytial virus bronchiolitis with the interleukin 8 gene region in
UK families. Thorax 2000;55:1023–7.
49 Gatti LL, Burbano RR, Zambaldi-Tunes M, et al. Interleukin-6
polymorphisms, Helicobacter pylori infection in adult Brazilian
patients with chronic gastritis and gastric adenocarcinoma. Arch
Med Res 2007;38:551–5.
50 Bodger K, Wyatt JI, Heatley RV. Gastric mucosal secretion of
interleukin-10: Relations to histopathology, Helicobacter pylori
status, and tumour necrosis factor-alpha secretion. Gut
1997;40:739–44.
51 Koizmi Y, Tsubono Y, Nakaya N, et al. Cigarette smoking and the
risk of gastric cancer: A pooled analysis of two prospective studies
in Japan. Int J Cancer 2004;112:1049–55.
52 Soballa GM, King RF, Axon AT, Dixon MF. Reflux esophagitis in
the intact stomach. J Clin Pathol 1990;43:303–6.
255