126
) AND COLLABORATORS
Identification of Pasteurella multocida
and molecular diagnosis of haemorrhagic
septicaemia in Iranian camels
Y. TAHAMTAN1*, O. AMRABADI2, R. SHAHRYARI2
Bacteriology Department, Razi Vaccine and Serum Research Institute-Shiraz, Sanaye Sq. Shiraz, Iran
1
Veterinary Organization of Fars Province, Moshir St, Shiraz, Iran
2
Corresponding author: yahyatahamtan@yahoo.com
ABSTRACT
Pasteurella multocida, a gram-negative coccobacillus in the Pasteurellaceae
family is associated with hemorrhagic septicaemia in camels, also known
as ‘Pneumonic Head’. Hemorrhagic septicaemia is a disease with unclear
etiology which is very probably caused by P. multocida. Sudden climatic
changes, poor management practices, exposure to various diseases, over
traveling and low grade nutrition are the most important predisposing
factors for hemorrhagic septicaemia . Although P. multocida serotype B
is known as a causal agent of respiratory disease in camels, its role as the
causative agent for hemorrhagic septicaemia in camels remains unclear and
needs further investigation. This paper looks at the isolation and molecular
aspects of pasteurellosis in camels from October 2010 to April 2012 in the
southern part of Iran. Sixty nine nasal swabs and blood specimens from
clinical cases and One hundred and fifteen nasal discharge swabs from
apparently healthy camels, and a lung sample from a 10 dead camel were
taken for bacterial isolation and PCR assay. Pasteurella multocida was
isolated from 80% of the internal organs of the dead camel. The isolation rate
of P. multocida in the clinical cases was 68% while 7% of healthy camels were
shown to be infected with P. multocida. Bacteria species and P. multocida
serotype were identified in Pasteurella isolates by amplification of a 460 pb
PCR product using  KMT1SP6  -KMT1T7 primers for all pass. Serotype B
represented the main P. multocida serotype. It was concluded from this
investigation that P. multocida infection can be diagnosed with different
methods such as biochemical and molecular assays and may be the primary
organism associated with severe respiratory signs and septicaemia in camels.
Kewwords: Pasteurella multocida, Haemorrhagic
septicaemia, Camel, Iran.
Introduction
Amongst domestic ruminants, camel has been for a long
time a neglected species (22).The camel is an important
domestic animal in many parts of Iran because of its
adaptation to adverse climatic conditions and to shortage
of water and forage. Camels are living in arid and semi-arid
areas particularly eastern, middle and southern parts of Iran.
Globally, Except for some parasitic diseases, there is only
few information on camel diseases [1, 2, 7, 24]. Furthermore
camel respiratory infections have received little attention
in Iran. According to author’s knowledge, no studies in
Iranian camels have been extensively communicated in
comparison with other livestock species. Further studies have
been  advocated on etiology and identification of causing
TAHAMTAN (Y.
RÉSUMÉ
Identification de Pasteurella multocida et diagnostic moléculaire de
septicémie hémorragique chez des chameaux en Iran.
Pasteurella multocida, un coccobacille Gram négatif de la famille des
Pasteurellaceae responsable de septicémies hémorragiques chez les
chameaux. La septicémie hémorragique est une maladie d’étiologie
incertaine très probablement causée par P. multocida dont l’apparition
fait suite à des changements climatiques brutaux, de mauvaises pratiques
d’élevage, l’exposition à diverses maladies, de sdéplacements, et une faible
qualité de nutrition. Bien que P. multocida sérotype B soit connu comme un
agent de la maladie respiratoire chez les chameaux, son rôle en tant qu’agent
de la septicémie hémorragique dans cette espèce reste incertain et doit être
approfondi. Ce document se penche sur l’isolement et la caractérisation
moléculaire de divers cas de pasteurellose chez les chameaux d’octobre 2010
à avril 2012 dans la partie sud de l’Iran. Soixante-neuf écouvillons nasaux
et des échantillons de sang provenant de cas cliniques et 115 tampons
d’écoulement nasal à partir de chameaux apparemment en bonne santé, et
un échantillon du poumon de 10 chameaux morts ont été analysés utilisés
pour l’isolement des bactéries et diagnostic par PCR. Pasteurella multocida
a été isolé à partir de 80% des organes internes des chameaux morts. Le
taux d’isolement de P. multocida dans les cas cliniques était de 68%, tandis
que 7% des chameaux en bonne santé étaient porteurs de P. multocida. Les
espèces bactériennes ont été identifiées et le serotypage de P. multocida a été
réalisé par amplification PCR d’un produit de 460 pb en utilisant les amorces
KMT1SP6 -KMT1T7. Le sérotype B représentait le principal sérotype de
P. multocida. Il a été conclu de cette enquête que l’infection à P. multocida
peut être diagnostiquée avec différentes méthodes telles que des analyses
biochimiques et moléculaires et que ce germe peut être l’organisme principal
associé à des signes respiratoires graves et la septicémie hémorragique chez
les chameaux.
Mots-clés : Pasteurella multocida, septicémie,
hémorragie, chameau, Iran.
pathogens including a variety of viruses, fungi, bacteriae and
parasites (3) in camel respiratory outbreaks. In recent years,
camel research received more attention worldwide. His ability
to adapt to varying harsh environmental conditions has made
it breeding possible especially in the arid and semi arid areas,
especially in areas where a moisture deficit exists. It provides
meat, means of transport and plays an important role for the
socio-cultural structure of the community (3, 33).
Haemorrhagic septicaemia also called pasteurellosis is a
disease caused by Pasteurella multocida (22). P. multocida in
camels was considered a hazardous disease that drastically
affects productivity of camels and may even cause death (8, 21,
41). Symptoms of the disease include very high temperature,
increased respiratory and heart pulse rates and general
Revue Méd. Vét., 2016, 167, 5-6, 126-132
PASTEURELLA MULTOCIDA IN IRANIAN CAMELS WITH HAEMORRHAGIC SEPTICAEMIA
depression. (18). In camels subcutaneous tissue , mandibular
and/or cervical lymph nodes are usually enlarged (34).
Affected animals seldom recover and usually die in the next
24 to 48 hours (31). Signs of dyspnea such as dilated nostrils
or open mouth breathing and cyanotic mucous membranes
are currently seen (11).
Respiratory diseases remain a major threat to the camel
population in the southern parts of Iran where more than
5000 camels are living. Respiratory disease and sudden death
occurred in this region during 2009-2011. Some Veterinary
Institutions have tried to isolate and isolate the etiological
agent of the disease. Before that, a respiratory disease
outbreak associated with sudden death has occurred in the
Afar and Oromia regions during 2005/2006 (9, 17, 30). In a
recent study conducted in Lapur division of Turkana district,
hemorrhagic septicaemia was ranked as the fourth most
important disease in camels (25). Carter (1959) recorded
Pasteurellacae associated with disease in Sudan and in a
snow leopard in the Himalayas (5, 10, 12, 13, 14, 47).
This study described for the first time isolation and
molecular epidemiology of respiratory disease in camels
according to capsular types of bacterial species in central
region of the South of Iran.
Material and Methods
The study was carried out from October 2010 to April
2012 in 194 camels the Fars province, a middle region of
southern part of Iran. The climate of this area is semi-arid. It
is located at about 250 km south of Shiraz, the capital of the
Fars province.
SAMPLING AND PROTOCOL
The sampling was made by Fars Veterinary organization
notification. Three different types of samples were collected
in the presence of respiratory signs after camel outbreaks
notifications: 1) Tissues of pneumonic lungs, draining
lymph nodes, liver, spleen, heart, kidney, and other affected
organs from 10 dead camels less than 5 years of age with
natural history and course of severe respiratory disease with
symptoms such as distress, pyrexia, and nasal mucopurulent
discharge were collected using sterile procedure. Bacteria
were grown on blood agar (BA) (5% sheep red blood cell)
after overnight (O/N) incubation at 37°C.
2) Peripheral blood samples, nasal mucopurulent
Primer gene Primer sequence 5’-3’
Allpass KMT1 ATCCGCGATTTACCCAGTGG
GCTGTAAACGAACTCGCCAC
Capsular type hydD-hydC TGCCAAAATCGCAGTCAG
A TTGCCATCATTGTCAGTG
Cap B bcbD CATTTATCCAAGCTCCACC
GCCCGAGAGTTTCAATCC
Table I: Primers used for the detection of virulence-associated genes in strains of P. multocida.
Revue Méd. Vét., 2016, 167, 5-6, 126-132
127
discharge and nasal swabs were also collected from 69
clinically ill live camels with respiratory problems. Samples
were then transported to the laboratory using ice box.
3) 115  nasal discharge  swabs and 115 blood samples
were  aseptically  obtained  from different apparently
healthy  camels as controls. They were inoculated directly
on Brain Heart Infusion (BHI) broth and incubated O/N at
37°C. After that, O/N culture was streaked onto BA plates.
According to Mutters et al (1985), suspected colonies were
identified by morphologically and biochemically current
methods (26).
BACTERIA COLONIES
Bacteria colonies were identified by colony shape, Gram
staining, and further characterized by biochemical testing.
Biochemical tests were carried out using Entero rapid – 24
test kits as described by Tefera (2002) for the identification of
clinically important members of P. multocida (42).
PCR ASSAY
Suspected colonies were cultured in BHI broth and
incubated O/N at 37ºC for additional identification by
PCR method. DNA was extracted as described in Jabbari
et al (2005) with minor modifications (20). Briefly, one
ml O/N BHI culture was centrifuged. The supernatant was
discarded and the pellets were washed twice and centrifuged
again. Bacteria pellets were re-suspended in sodium tris-
EDTA (NTE) buffer (pH = 7.4). Then proteinase K (Gibco
BRL) was added to the bacterial suspensions. The cell
lysate was extracted using ultrapure phenol (Gibco BRL)
previously saturated with tris (pH: 8.3). The mixture was
rotated vigorously for 5 min at room temperature and then
centrifuged again. The upper phase was transferred to a clean
1.5-ml microtube. This phase was mixed with one volume of a
phenol/chloroform mixture and centrifuged again. DNA was
precipitated by the addition of sodium acetate and absolute
ethanol. The DNA was then washed with 70% ethanol, dried
at room temperature and re-suspended in TE buffer (pH:
8) and stored at-20°C until used.
PCR was performed using previously described primers
as inidcated in table I (32, 44). These include KMT1 for species
identification, hydD-hydC and bcbD for capsular typing. The
master mix PCR was prepared by mixing deoxynucleoside
triphosphate, PCR buffer, MgCl2, Taq DNA polymerase,
primers, DNA template and distilled water. PCR procedure
Amplicon size (bp)
460
1044
760
128 TAHAMTAN (Y.) AND COLLABORATORS

was conducted on a Eppendorf PCR system (master gradient

Eppendorf, Germany). Amplified PCR products were run
on 1.2% agarose gel by electrophoresis and visualized by gel
documentation system (Kodak) after staining by ethidium
bromide.

MICE BIOASSAY

To determine pathogenicity of the isolates, a mice bioassay

was applied. Identified Bacteria were inoculated into BHI
broth and incubated in a shaking incubator (120 rpm) O/N
at 37°C. Inoculum was injected (0.2ml) into the peritoneal
cavity of Balb/c mice and fatality rates were recorded during
the next 24 hrs.

Results Figure 1: A camel clinically affected with haemorrhagic septicaemia. Note

the dull appearance and rough coat and the prominent submandibular
swelling and extended neck.
Rate of infection. Report on the investigation of
bacteriological examination was summarized in table II.
P. multocida was isolated from 80% (8/10) of dead camels.
Lungs from 10 dead camels were showing various types of
lesions. Pneumonia, bronchitis, emphysema, pulmonary
edema, congestion, and serous secretion were observed in
affected lungs. Sixty-nine clinically ill camels with clinical
signs including increased temperature up to 40°C, dyspnea,
bad mouth odor, swelling of the lips and around the neck
and mandible, anorexia and pneumonia (figure 1). The
isolation rate of P. multocida in the clinical cases was 68%
(47/69). Subcutaneous serous edema around the neck and
fibrin clots around nostril (figure 2) were also noticed. Of
115 apparently healthy camels, P. multocida was isolated
from almost 7% of nasal swabs, indicating that nasal carriage
is not frequent . P. multocida was not isolated from blood
samples collected on apparently healthy camels. Although
no P. multocida isolation was possible from blood samples,
Figure 2: Fibrinous nasal discharge in a camel suffering from haemorrhagic
bacteriological examination from nasal swabs from the septicaemia.
clinical cases and apparently healthy camels elucidated
similar isolation pattern.
PCR analysis. The isolates were tested by PCR.
An amplification  product of  460  pb is expected
when  KMT1SP6  -KMT1T7 are used amplifying a broad
range of bacterial species. P. multocida serotypes A and B
were identified by the specific primers for capsular types A
and B amplifying 1044 and 760 bp respectively.

In the PCR assay, an amplicon size of 460 bp was observed

from all the isolates in agarose gel electrophoresis (figure 3),
while two isolates from distressed camels were negative with

Camel condition No. of isolates P. multocida isolates (%) PCR

Dead 10 8(80) 80
Clinical sign 69 47(68.11) 65.21 (45/69)
Healthy 115 8(6.95) 6.34
Organs 60 52(86.66) 87

Table II: Frequency of dead, clinical sign and healthy camel and affected organs due to P. multocida.

Revue Méd. Vét., 2016, 167, 5-6, 126-132

PASTEURELLA MULTOCIDA IN IRANIAN CAMELS WITH HAEMORRHAGIC SEPTICAEMIA
this assay. In the capsular PCR assay, 80% (8/10) isolates
from dead camels and 65.21% (45/69) from camels with
respiratory distress gave a product of 760 bp and correspond
to capsular type B (figure 4). No capsular type A except one
was detected (figure 5).
Figure 3: PCR assay on Pasteurella multocida isolates. Gel electrophoresis
of PCR product in a 1.2% agarose gel using specific all pass primer for P.
multocida species. Lanes M: 100bp molecular wt marker (Fermentas),
C-: Negative control, C+: positive control, 1-3: P. multocida isolates.
Figure 4: Agarose gel electrophoresis of PCR products of P. multocida cap-
sular type B from camel Pasteurellosis. Lane M: 100 bp DNA ladder
(Fermentas); Lane +: Positive control; C-: Negative control; 1-6: P. mul-
tocida capsular type B isolates.
Revue Méd. Vét., 2016, 167, 5-6, 126-132
129
Figure 5: Agarose gel electrophoresis of cap A-amplified PCR products ob-
tained from P. multocida isolalates. Lanes M represents for DNA mar-
ker, C-, +: Control positive and negative, 1: Capsular type A Positive P.
multocida isolates, 2-3: Negative isolates.
Discussion
A variety of viruses, fungi, bacteriae and parasites
may possibly cause respiratory diseases in camels, but the
definitive etiology has not yet been determined (21, 35). All
test results whether biochemical or morphological suggested
the involvement of P. multocida. P. multocida infection in
camels was accompanied most of the time by heavy economic
losses (23, 39, 40).
Species determination reported by Townsend et al
(2001) revealed PCR amplification of 460 bp band for P.
multocida(44), and similar assay has also been used by
others. Dutta et al. (2001) carried out all pass primers for
identification of P. multocida (16, 19). Dey et al (2007)
presented the usefulness of PCR amplifying KMT1 gene
for the identification of P. multocida isolates (15). A 760 bp
amplicon size corresponds to capsular type B. This finding
has also been reported before by Vidhya et al (2007) for the
B serogroups of P. multocida (45).These finding demonstrate
that a majority of camel isolates belong to serogroup B.
Kebede and Gelaye (2010) has reported that this serogroup is
mainly responsible for haemmorhagic septicaemia in camels
(21).
130
Although respiratory diseases usually pertaining to
various factors, it is due to a secondary infection by bacteria
following parainfluenza virus infection (4, 37). In this study
the actual reason of the respiratory disease in camel in the
current area was identified. P. multocida has been found as
the primary agent responsible for the camel respiratory
disease. This finding is in disagreement with Kebede and
Gelaye (2010) who reported pasteurellosis as a bacterial
complication following parainfluenza exposure (21). In
Iran, no studies were carried out before that with the aim
of identifying respiratory problems in camels compared to
other livestock species.
Camels infected with P. multocida showed symptoms of
pneumonia which might be accompanied by septicaemia,
pyrexia and mucopurulent nasal discharge (8, 29). The
pleurisy, observed at post-mortem, and clots of fibrin
around the nostrils and mouth in distressed camels might
be due to the interaction of P. multocida with mononuclear
leukocytes and alveolar macrophages. These dying cells
release histamine, prostaglandin and fibroblastic elements,
all of which can cause inflammation and deposition of fibrin
(27, 28).
Schwartz (2003) indicated that the most important
predisposing factors are sudden climatic changes, poor
management practices, exposure to various diseases,
over traveling and low grade nutrition (34). According to
Seifert (1996), change in climatic conditions and stress in
combination with a viral infection like paraifluenza increase
the incidence of Pasteurellosis (36).
The isolation rate of P. multocida in this study was
compatible with the results of other studies [2, 3,6, 8,11]. In
the current study, P. multocida species were isolated from the
lungs of all dead camels. The variation rate of P. multocida in
camel may result in different sample size, method of sample
collection and differences amongst geographical areas (6).
In the present study, the lack of bacteriological isolation in
pneumonic lung samples might be due to involvement of
other organisms commonly involved in respiratory problems
such as Mycoplasma, viruses, parasite, fungi or other
anaerobic bacteria.
Although P. multocida serotype B has been isolated
before from affected camels, its role as the causative agent
for hemorrhagic septicaemia in camels remains unclear
(47). Yet, there is an urgent need to identify the causes of
respiratory diseases in camels in order to design better
control strategies (43).
In conclusion, up to now, P. multocida Carter serotype
B has been isolated once from affected camels, and was
associated with respiratory disease in camel, but the
detailed epidemiological information and identification of a
primary agent, if any, and its role as the causative agent for
hemorrhagic septicaemia in camel remain unclear and need
further investigation.
TAHAMTAN (Y.) AND COLLABORATORS
Acknowledgement
The authors acknowledge Razi Vaccine and Serum
Research Institute-Shiraz for the funds provided for this
paper (project no. 89069-18-14-2). The authors also thank
Dr M Hayati, Moleculler Dep Shiraz Razi Institute for her
help rendered in carrying out this research study.
References
1. -  ABEBE, W.: Traditional husbandry practices and major
health problems of camels in the Ogaden. Nomadic
Peoples, 1991, 29, 21-31.
2. -  AHMAD, S., YAQOOB, M., HASHMI, N., AHMAD, S.,
ZAMAN, M.A., TARIQ, M.: Economic Importance of
Camel: Unique Alternative under Crisis Pakistan. Vet.
J., 2010, 30, 1-7.
3. -  AL-TARAZI, Y.H.: Bacteriological and pathological
study on pneumonia in the one humped camel (Camelus
dromedarius) in Jordan. Revue d’Elevage et de Med.Vet.
des pays Tropicaux, 2001, 54, 93-97.
4. -  ARORA, A.K., VIRMANI, S. J., OBEROI, M.S.: Isolation,
characterization and antibiogram of Pasteurella
multocida isolates from different animal species. Indian
J. Anim. Sci., 2005, 75, 749-752.
5. -  BAIN, R.V.S., DE ALWIS, M.C.L., CARTER, G.R.,
GUPTA, B.K.: Haemorrhagic septicaemia. Animal
Production and Health Paper No. 33. FAO, Rome. 1982
6. -  BEKELE, S.T.: Gross and Microscopic lesions of camels
from Eastern Ethiopia. Trop. Anim. Health Product.,
2008, 40, 25-28.
7. -  BEKELE, T.: Survey on the distribution of ticks of
domestic animals in the eastern zone of Ethiopia. Trop.
Anim. Health Product., 1996, 28, 145-146.
8. -  BERELE, T.: Studies on the respiratory diseases in
camels in the eastern low land of Ethiopia. Trop. Anim.
Health Product., 1999, 31, 333-345.
9. -  BROWN, C.,: Hemorrhagic septicemia. In: Foreign
animal diseases. Boca Raton, FL: United States Animal
Health Association. p. 297-300, 2008.
10. -  CARTER, O.R.: Studies of Pasteurella multocida. IV.
Serological types from species other than cattle and
swine. Ame. J. Vet. Res., 1959, 21, 173-175.
11. -  CHAUDHARY, Z.I., AKBAR, S.J.: The Camel and its
Diseases. Al Bayan Press, Printing and Publishing Est.,
Dubai, United Arab Emirates. 2000.
12. -  CHAUDHURI, S., MUKHERJEE, S.K., CHATTERJEE,
A., OANGULI, J.L.: Isolation of Pasteurella multocida
serotype F:3,4 from a still-born snow Jeopard. Vet. Rec.,
1992, 130, 36.
13. -  De ALWIS, M.C.L., SUMANADASA, M.A: Naturally
acquired immunity to haemorrhagic septicaemia
among cattle and buffaloes in Sri Lanka. Trop. Anim.
Health Product., 1982, 14, 27-28.
14. -  De ALWIS, M.C.L., THAMBITHURAL, V.: A case of
haemorrhagic septicaemia in a wild elephant. Ceylon
Vet. J., 1965, 13, 17-19.
Revue Méd. Vét., 2016, 167, 5-6, 126-132
PASTEURELLA MULTOCIDA IN IRANIAN CAMELS WITH HAEMORRHAGIC SEPTICAEMIA
15. -  DEY, S., SINGH, V.P., KUMAR, A.A., SRIVASTAVA,
S.K., SINGH, N.: Molecular identification of Indian
isolates of Pasteurella multocida serotype B: 2 by different
PCR assays. Indian J. Anim. Sci., 2007, 77, 317-319.
16. -  DUTTA, T.K., SINGH, V.P., KUMAR, A.A.: Rapid and
specific diagnosis of Haemorrhagic septicemia by using
PCR assay. Indian J. Anim. Health , 2001, 40, 101-107.
17. -  DZIVA, F., MUHAIRWA, A.P., BISGAARD, M.,
CHRISTENSEN, H.: Diagnostic and typing options
for investigating diseases associated with Pasteurella
multocida. Vet. Microbiol., 2008, 128, 1-22.
18. -  ENGELHARDT, W.V.: The camel−an exciting animal
for basic research. In: Proceedings of the International
Workshop on Camel Research and Development:
Formulating a Research Agenda for the Next Decade,
held in Sudan in December, 2002. 2003.
19. -  HASSAN, A.K.M., MUSTAFA, A.A.: Isolation of
Pasteurella multocida type B from an outbreak of
haemorrhgic septicemia in camels in Sudan. Revue
d’élevage et de médecine vétérinaire des pays tropicaux
1985, 38, 31-33.
20. -  JABBARI, A.R., ESMAELIZADEH, M.: Molecular
Typing of Avian Pasteurella multocida lsolates by PCR-
RFLP of ompH Gene. Iranian J. Biotechnol., 2005, 3, 99-
103.
21. -  KEBEDE, F., GELAYE, E.: Studies on major respiratory
diseases of Camel (Camelus dromedarius) in
Northeastern Ethiopia. Afr. J. Microbiol. Res., 2010, 4,
1560-1564.
22. -  KHAN, B.B., IQBAL, A., RIAZ, M.: Production and
Management of Camels. PakistanT. M. Printers, Al
Rahman Plaza, Aminpur Bazar, Faisalabad, Pakistan.
2003.
23. -  MANOHARAN, S., JAYAPRAKASAN, V., PILLAI,
R.M., SULOCHANA, D.: Immunization of mice with
antigens of Pasteurella multocida of rabbit origin. Indian
Vet. J., 1997, 74, 1-4.
24. -  MELAKU, T., FESSEHA, G.: Observation on the
productivity and disease of the Issa camel. Proceedings
of 2nd National Livestock Improvement Conference,
Ethiopia Institute of Agricultural Research, Addis
Ababa. 1988, 3, 235-238.
25. -  MOCHABO, K,O.M., KITALA, P.M., GATHURA, P.B.,
OGARA, W.O., CATLEY, A., EREGAE, E.M., KAITHO,
T.D.: Community perception of important camel
diseases in Lapur division of Turkana district, Kenya.
Trop. Anim. Health Product., 2005, 37, 187-204.
26. -  MUTTERS, R., IHM, P., POHL, S., FREDRIKSIN, W.,
MANNHEIM, W.: Reclassification of genus Pasteurella
on the basis of desoxyribonucleic acid homology with
proposal for the new species. J. Systematic Bacteriol.,
1985, 35, 309-322.
27. -  PERREAU, P., MAURICE, Y.: Epizootiologie de
la pasteurellose des chameaux au Tchad. Enquete
serologique. Revue d’élevage et de médecine vétérinaire
des pays tropicaux, 1968, 21, 451-454.
28. -  RADOSTITS, O.M., GAY, C.C., HINCHCLIFF, K.W.,
CONSTABLE, P.D.: Veterinary Medicine: A text Book
Revue Méd. Vét., 2016, 167, 5-6, 126-132
131
of the diseases of cattle, sheep, pigs, Goats and Horses,
10th ed. Saunders Company, Philadelphia, U.S.A., 2007,
pp.471-541.
29. -  RICHARD, B.: Etude de la pathologie dudromadaire
dans la sous-province du Borana (Ethiopie). These
Doct. Vet. E.N.V. Alfort, Creteil Paris 75. 1975.
30. -  RIMLER, R.B., WILSON, M.A.: Re-examination
of Pasteurella multocida serotypes that caused
haemorrhagic septicaemia in North America. Vet. Rec.,
1994, 5, 256-267.
31. -  ROLLEFSON, K. P. M.I, MATHIAS, E.: A Field Manual
of Camel Diseases. I.T.D.G. Publishing, 103-105
Southampton Row, London, UK. 2001.
32. -  SAHRAGARD,I., TAHAMTAN, Y., VALADAN, M.,
HYATI, M., MOAZENI, F., SHIRAZI, Z.: Development
of rapid PCR method for simultaneous identification
of species, specific capsular type, and toxigenicity of
Pasteurella sp. isolates. Comp. Clin. Pathol., 2012, 21,
333-336.
33. -  SAMUEL, B.: Gross and microscopic pulmonary lesions
of camels from Eastern Ethiopia. Trop. Anim. Health
Product., 2008, 40, 25-28.
34. -  SCHWARTZ, H.J.: Proceedings of the International
Workshop on Camel Research and Development:
Formulating a Research Agenda for the Next Decade,
held in Sudan in December, 2002. 2003.
35. -  SCHWARTZ, H.J., DIOLI , M.: The one humped camel
in Eastern Africa. A pictorial guide to diseases, health
care and Management. Verlag. Josef, Margraf Scientific
books, Berlin. pp. 261-267, 1992.
36. -  SEIFERT, H.S.H.: Tropical Animal Health (CTA, Kluwer
Academic, Dordrecht). 12, 373-378, 1996.
37. -  SELEIM, R.S., TOS, A.R., MOHAMED, S.R., NADA,
H.S., GOBRAN, R.A.: Elisa and other tests in the
diagnosis of Pasteurella multocida infection in camels.
Conference on international Agricultural Research for
Development 2003.
38. -  SHEMSEDIN, M.: Bacterial species isolated from
respiratory tract of camels slaughtered at Dire Dawa
abattoir, Eastern Ethiopia, DVM thesis, AAU, FVM,
Debre Zeit, Ethiopia, Unpublished. pp.1-25, 2002.
39. -  SINGH, R., JAYPRAKASAN, V.: Use of different
antigenic preparations of Pasteurella multocida in
enzyme immuno assay. Indian Vet. J., 2001, 78, 379-381.
40. -  SRIVASTAVA, S.K.: Characteristics of whole cell
proteins of Pasteurella multocida serotype B:6 Indian
Vet. J., 1998, 75, 395-398.
41. -  SUNDER, J., KUMAR, A.A.: Studies on toxigenic
strains of Pasteurella multocida of goat origin. Indian
Vet. J., 2001, 78, 184-188.
42. -  TEFERA, G., SMOLA, J.: The utility of Entero Rapid
24 Kit for the identification of P. multocida and M.
haemolytica. Vet. Med., 2002, 47, 99-103.
43. -  TIGANI, T.A., HASSAN, A.B., ABAKER, A.D.:
Bacteriological and pathological studies on condemned
lungs of one humped camels (Camelus dromedarius)
slaughtered in Tamboul and Nyala abattoirs, Sudan. pp.
1-13, 2006.
132
44. -  TOWNSEND, K.M., BOYCE, J.D., CHUNG, J.Y.,
FROST, A.J., ADLER, B.: Genetic Organization of
Pasteurella multocida cap Loci and Development of
a Multiplex Capsular PCR Typing System. J. Clin.
Microbiol., 2001, 39, 924–929.
45. -  VIDHYA, M., CHANDRAN, N.D.J., PAUL, W.M.,
RAJ, G.D.: Molecular identification of serogroups of
Pasteurella multocida isolated from sheep by capsular
PCR typing. Tamilnadu J. Vet. Anim. Sci., 2007, 3, 140-
143.
TAHAMTAN (Y.) AND COLLABORATORS
46. -  WERNERY, U., METWALLEY, S., MOHAMED, F.:
Camel disease investigation in Ethiopia. 8-17, January
2006. Report to Ministry of Agriculture and Rural
Development, Ethiopia. 2006.
47. -  WICKREMASURIYA, U.O.J.S., KENDARAGAMA,
K.M.T.: A case report of haemorrhagic septicaemia in a
wild elephant. Sri Lanka Vet. J., 1982, 30, 34.
Revue Méd. Vét., 2016, 167, 5-6, 126-132