Вы находитесь на странице: 1из 27

Pregunta 1

Incorrecta
Puntúa 0,0 sobre 1,0

La interacciones genéticas donde se lleva a cabo un tipo de epistasis recesiva simple


(para dos genes), son aquellas donde se producen tres fenotipos diferentes que van
en proporciones 9:3:4,
PORQUE
Cuando se cruzan individuos portadores de genes mendelianos para dos
características, se obtienen individuos en estas proporciones fenotípicas.
Seleccione una:
a. Marque C si la afirmación es VERDADERA, pero la razón es una proposición
FALSA.
b. Marque D si la afirmación es FALSA, pero la razón es una proposición

VERDADERA.
Las epístasis, son interacciones genéticas que modifican las proporciones
mendelianas características de 9:3:3:1, para el caso de las epístasis recesivas,
donde el gen recesivo enmascara la acción del gen dominante, se obtienen
proporciones de 9:3:4 cuando el efecto es simple; es decir de un solo gen y de 9:7
cuando es de los dos genes.

c. La afirmación y la razón son VERDADERAS y la razón es una explicación


CORRECTA de la afirmación.
d. La afirmación y la razón son VERDADERAS, pero la razón NO es una explicación
CORRECTA de la afirmación.

Retroalimentación
La respuesta correcta es: Marque C si la afirmación es VERDADERA, pero la razón
es una proposición FALSA.

Pregunta 2
Correcta
Puntúa 1,0 sobre 1,0

Enunciado de la pregunta
Un ecosistema se puede definir como el conjunto de seres bióticos y abióticos, en
el cual se dan interacciones y bastante flujo de materia y energía, según el
concepto anterior, usted puede decir que uno de los siguientes ejemplos NO puede
ser considerado un ecosistema
Seleccione una:
a. una laguna

b. una piscina
Correcto
c. un acuario
d. un estanque

Retroalimentación
Una piscina
La respuesta correcta es: una piscina

Pregunta 3
Correcta
Puntúa 1,0 sobre 1,0

Enunciado de la pregunta
El ADN, normalmente se condensa en el momento en que la célula inicia el proceso
de división celular y forma unas estructuras que solamente son visibles al
microscopio en el momento en que la célula va a iniciar la división, estas
estructuras se conocen con el nombre de
Seleccione una:
a. cromatina

b. cromosomas
Correcto

c. eucromatina
d. heterocromatina

Retroalimentación
La respuesta correcta es: cromosomas

Pregunta 4
Incorrecta
Puntúa 0,0 sobre 1,0

Enunciado de la pregunta
Las células de todos los organismos vivientes están provistas de una serie de
estructuras subcelulares (organelos) que les permite funcionar como un organismo
autónomo, capaz de realizar todas las funciones necesarias para mantener la vida.
Las células, dependiendo de su estructura se pueden dividir en procariotas (sin
núcleo definido) y eucariotas (con núcleo definido, protegido por una envoltura
nuclear); estas últimas están presentes tanto en animales como en plantas y sus
diferencias y características dependen de los organelos celulares que presenten y
las funciones que desempeñan.
Las siguientes características le dirían a usted que se esta hablando de una célula
eucariota animal:
1. el material genético está protegido por una membrana nuclear
2. la célula no presenta o esta desprovista de pared celular
3. el material genético está disperso en el citoplasma
4. la célula esta provista de una pared celular que le brinda protección

Seleccione una:
a. las opciones 1 y 2 son correctas

b. las opciones 3 y 4 son correctas


Incorrecto. Las células eucariotas tanto animales como vegetales se caracterizan
por tener un núcleo verdadero, el cual contiene el material genético (DNA)
heredable, que a su vez esta protegido por una membrana nuclear.

c. las opciones 2 y 4 son correctas


d. las opciones 1 y 3 son correctas

Retroalimentación
La respuesta correcta es: las opciones 1 y 2 son correctas

Pregunta 5
Incorrecta
Puntúa 0,0 sobre 1,0

Enunciado de la pregunta
En los experimentos realizados por Mendel, se pudo evidenciar la manifestación de
siete características o rasgos fenotípicos en cada uno de los productos obtenidos
con los guisantes de jardín; los cuales expresaban caracteres dominantes (se
manifiestan con mayor frecuencia) y recesivos (se manifiestan con menor
frecuencia); este tipo de genética opera de manera similar en la gran mayoría de
individuos animales, vegetales y microorganismos. De acuerdo con este texto: si
se cruza un perro de orejas rectas y color rojizo (fenotipos dominantes R y D) con
una hembra de orejas dobladas hacia el frente y color blanco (fenotipos recesivos r
y d), se obtiene en la descendencia F1: 2 perros de orejas rectas y pelaje rojizo, 2
perros de orejas rectas y color blanco, 2 perros de orejas dobladas hacia el frente
y color rojizo y 2 perros de pelaje blanco y orejas dobladas hacia el frente.
Los genotipos tanto del macho como de la hembra cruzados para que den la
descendencia anterior son
1. RrDd
2. rrDd
3. rrdd
4. rrDD
Seleccione una:

a. Las opciones 1 y 2 son correctas.


Incorecto. Analizando la descendencia obtenida se ve que esta en relación 1:1:1:1,
para obtener este tipo de relación o proporción fenotípica como la descrita en el
enunciado, necesariamente se debe cruzar un individuo portador o heterocigoto
para las dos características con otro completamente recesivo para las dos
características. En este caso las opcione correctas son 1 y 3.

b. Las opciones1 y 3 son correctas.


c. Las opciones 2 y 4 son correctas.
d. Las opciones 3 y 4 son correctas.

Retroalimentación
La respuesta correcta es: Las opciones1 y 3 son correctas.

Pregunta 6
Correcta
Puntúa 1,0 sobre 1,0

Enunciado de la pregunta
La pinocitosis es un mecanismo de transporte de sustancias a la célula y consiste
en el:
Seleccione una:
a. Movimiento de solvente (agua) desde la parte más concentrada hacia la menos
concentrada
b. Movimiento de iones y moléculas en contra del gradiente de concentración y
con consumo de energía
c. Transporte de líquidos al interior de la célula mediante movimientos

citoplasmáticos que engloban estas vesículas de líquido


Correcto

d. Movimiento de sustancias a través de la membrana, desde la solución de mayor


concentración hacia la solución de menor concentración

Retroalimentación
La respuesta correcta es: Transporte de líquidos al interior de la célula mediante
movimientos citoplasmáticos que engloban estas vesículas de líquido

Pregunta 7
Correcta
Puntúa 1,0 sobre 1,0

Enunciado de la pregunta
El color rojo de los tomates está determinado por una proteína formada por los
siguientes aminoácidos:
Ala – Cis – Val
En la siguiente tabla se muestra la secuencia de ARN mensajero (ARNm) que
codifica un respectivo aminoácido (a.a.)
aa Ala Cis Val Leu Iso
ARN m GUA UGC GUU CUU AUA

Al cosechar los tomates se observa que algunos presentan manchas blancas en su


superficie. Estas manchas se deben a una mutación en sólo uno de los nucleótidos
del ADN que forma la proteína. ¿Cuál de las siguientes secuencias de ADN
presenta esa mutación?

Seleccione una:

a. CAT ACG GAA.


Correcto: Los codones son CAT ACG GAA.

b. TAT CAT CAA


c. CAT ACG CAA.
d. CAT TAT CAA.

Retroalimentación
Respuesta correcta
La respuesta correcta es: CAT ACG GAA.

Pregunta 8
Incorrecta
Puntúa 0,0 sobre 1,0

Enunciado de la pregunta
Suponga que usted cruzo un par de cerdos cuyo genotipo no es conocido y en la
descendencia obtuvo una población de 20 individuos que expresaron las siguientes
características:
11 Fueron negros y de cola larga
4 Fueron pardos y de cola corta
4 Fueron negros y de cola corta
1 Fueron pardos y de cola corta
De lo anterior, se puede deducir que los genotipos de cada uno de los parentales
que se cruzaron son
1. NNLL
2. NnLl
3. NNLl
4. NnLl
Seleccione una:
a. Las opciones 2 y 4 son correctas
b. Las opciones 1 y 3 son correctas
Incorrecto. Para responder este caso, es necesario tener en cuenta la población de
individuos obtenida en la descendencia, de ahí, por el número obtenido se
determina cuales fenotipos son de carácter dominante y cuales son de carácter
recesivo; se sabe que los que presentan fenotipos dominantes son los que estarán
en mayor proporción y los que estan en menor proporción serán los recesivos; los
intermedios serán los que manifiesten un caracter dominante y uno recesivo y
viceversa. Una vez realizado este análisis, se procede a asignar los genotipos
correspondientes a los parentales que dieron orígen al número de individios
obtenido para cada fenotipo. De esta manera se determina que los genotipos de
los parentales cruzados son: NnLl y NnLl, lo cual produce proporciones cercanas a
la 9:3:3.1,

c. Las opciones 1 y 4 son correctas


d. Las opciones 3 y 4 son correctas

Retroalimentación
Respuesta incorrecta.
La respuesta correcta es: Las opciones 2 y 4 son correctas

Pregunta 9
Correcta
Puntúa 1,0 sobre 1,0

Enunciado de la pregunta
En la ovogénesis se lleva a cabo un proceso de división celular conocida como
meiosis, por ende al final de esta división ovogénica, se
obtienen
Seleccione una:
a. Cuatro células de las cuales, todas son totalmente especializadas para aceptar
al espermatozoide
b. Cuatro células de las cuales, solamente una esta totalmente especializada para

aceptar al espermatozoide
Correcto

c. Cuatro células de las cuales, tres estan totalmente especializada para aceptar al
espermatozoide
d. Cuatro células de las cuales, solamente dos están totalmente especializadas
para aceptar al espermatozoide

Retroalimentación
Cuatro células de las cuales, solamente una esta totalmente especializada para
aceptar al espermatozoide
La respuesta correcta es: Cuatro células de las cuales, solamente una esta
totalmente especializada para aceptar al espermatozoide

Pregunta 10
Incorrecta
Puntúa 0,0 sobre 1,0

Enunciado de la pregunta
En los cruzamientos dihíbridos de tipo Mendeliano (cruzamientos de individuos que
difieren de dos características), se obtienen, cuando se cruzan individuos
heterocigotos para estas dos características, 6 genotípos en diferentes
proporciones, los cuales se expresan en 4 fenotipos que van en la relación
9:3:3:1.
Suponga que usted realizó un cruzamiento entre si de un par de plantas de
genotipo MmNn, que expresan los fenotipos: color rojo para las flores y tamaño
mediano del tronco (considere estos los fenotipos dominantes). La probabilidad de
ocurrencia del genotipo MmNn en la generación de plántulas F1 es
Seleccione una:

a. 100 %
Incorrecto. La probabilidad de tener individuos de genotipo tanto homocigoto
dominante como recesivo para un gen, siempre es de 1/4 y para el heterocigoto
será de 2/4; siendo así y sin necesidad de realizar el cuadrado de punnet para
determinar esta probabilidad, se procede a realizar simplemente el producto de las
dos probabilidades independientes que es de 2/a para cada gen en heterocigosis
así: 2/4 x 2/4 = 4/16 x 100, lo cual es equivalente al 25%.

b. 25 %
c. 50 %
d. 75 %

Retroalimentación
La respuesta correcta es: 25 %

Pregunta 1
Incorrecta
Puntúa 0,0 sobre 1,0

Marcar pregunta

Enunciado de la pregunta
En algunas plantas el color amarillo de las flores es dominante respecto al color blanco y el
tamaño de la planta alto es dominante respecto al tamaño bajo. Los genoitipos para una planta
pura amarilla baja son

Seleccione una:
a. AAbb
b. AABB

c. AABb
Incorrecto

d. Aabb

Retroalimentación
La respuesta correcta es: AAbb

Pregunta 2
Correcta
Puntúa 1,0 sobre 1,0

Marcar pregunta

Enunciado de la pregunta
Las preguntas que encontrara a continuación constan de un enunciado y cuatro opciones de
respuesta identificadas como 1,2,3,4. Dos de estas opciones responden correctamente la
pregunta. Usted debe elegir las respuestas adecuadas y contestarla respuesta de acuerdo a
las siguientes instrucciones:
Si 2 y 3 son correctas marque A
Si 1 y 3 son correctas marque B
Si 2 y 4 son correctas marque C
Si todas son correctas marque D

El Acido Desoxirribo Nucleico (ADN) constituye el material genético de


todo ser vivo, ya que contiene la información para la síntesis de proteínas
especificas que permiten la vida, y además:
1. Es una molécula polimérica formada por
repeticiones de .azúcar desoxirribosa, fosfato y
una base nitrogenada.
2. Entre las bases se establecen siempre tres
puentes de .hidrógeno
3. La doble cadena tiene orientación opuesta es
decir antiparalela
4. El ADN es monocatenario
Seleccione una:
a. D
b. C
c. A

d. B
Correcto. El ADN es una molécula de doble hélice y esta conformado
estructuralmente por repeticiones de moleculas de azucar, grupos fosfato y bases
nitrogenadas.

Retroalimentación
La respuesta correcta es: B

Pregunta 3
Correcta
Puntúa 1,0 sobre 1,0

Marcar pregunta

Enunciado de la pregunta
La mutación en un gen, por consecuencia de la sustitución de una única base en la
estructura del ADN, puede acarrear modificaciones importantes en la actividad
biológica de la proteína codificada por ese gen. Considere que la estructura normal
de un RNA mensajero de un péptido y su estructura alterada en virtud del cambio
de una única base en el gen correspondiente son:
5' AUGUGGUUUGCACACAAAUGAUAA 3' (normal)
5' AUGUGGUUUGAACACAAAUGAUAA 3' (alterada)
La tabla a continuación identifica algunos codones

AMINOACIDO NUCLEOTIDOS

alanina GCC, GCG,GCU,GCA


ácido aspártico GAC,GAU
cisteína UGC, UGU
glicina CGA, GGC, GGG, GGU
ácido glutámico GAA, GAG
fenilalanina UUC, UUU
metionina AUG
triptófano UGG
treonina ACG

Según esta información, los aminoácidos producidos son.

Seleccione una:
a. alanina y ácido glutámico
Correcto. Revisando la información dada en el planteamiento de la pregunta, los
añinoàcidos que se producirían por esta cadena modificada o alterada de RNA son:
alanima y ácido glutámico.

b. treonina y triptófano
c. fenilalanina y ácido aspártico
d. lisina y cisteína

Retroalimentación
La respuesta correcta es: alanina y ácido glutámico

Pregunta 4
Correcta
Puntúa 1,0 sobre 1,0

Marcar pregunta

Enunciado de la pregunta
De un cruzamiento entre plantas de flores rojas con plantas de flores blancas, se obtuvo: 15
plantas de flores rojas, 28 plantas de flores rosadas y 12 plantas de flores blancas; según
estos resultados el cruzamiento obedece a un principio de:
Seleccione una:
a. Alelismo múltiple
b. Herencia Mendeliana

c. Dominancia incompleta
Correcto

d. Elelos letales

Retroalimentación
La respuesta correcta es: Dominancia incompleta

Pregunta 5
Correcta
Puntúa 1,0 sobre 1,0

Marcar pregunta
Enunciado de la pregunta
El pelo corto en los conejos se debe a un gene dominante, sobre el pelo Largo que
es recesivo. Una cruza entre un macho de pelo largo y una hembra de pelo corto
producen 7 conejos de pelo corto y 5 de pelo largo; según estos resultados, el
genotipo más probable de la hembra es:
Seleccione una:
a. a

b. Aa
c. AA
d. aa

Retroalimentación
La respuesta correcta es: Aa

Pregunta 6
Incorrecta
Puntúa 0,0 sobre 1,0

Marcar pregunta

Enunciado de la pregunta
Si una proteína posee 100 aminoácidos, cuantos codones, (que especifican esos
aminoácidos), deben estar presentes en su mRNA?
Seleccione una:
a. 33
b. 99
c. 100

d. 300
Incorrecto. Un codon, esta compuesto por una tripleta de nucleótidos y este
codifica para un aminoácido en específico; si son 100 aminoácidos se requiere un
total de 100 codones.

Retroalimentación
La respuesta correcta es: 100

Pregunta 7
Correcta
Puntúa 1,0 sobre 1,0
Marcar pregunta

Enunciado de la pregunta
Las flores ¨perritos¨ , pueden ser rojas CrCr, rosadas CrCw, o blancas CwCw . Cuando plantas
de flores rojas se cruzan con plantas de flores blancas, la probabilidad de que se produzcan
descendientes en la F2 homocigotos es de:
Seleccione una:
a. 75%

b. 100%
c. 50%
d. 25%

Retroalimentación
La respuesta correcta es: 100%

Pregunta 8
Correcta
Puntúa 1,0 sobre 1,0

Marcar pregunta

Enunciado de la pregunta

En los perros el gene A_ es responsable de la audición normal, en cambio


el gene, aa, provoca la sordera. Orejas dobladas hacia el frente ( F_ ) es
dominante a orejas erectas ( ff ). El pelo negro ( N_ ) es dominante al
pelo marrón ( nn). Si se cruza un perro sordo, orejas erectas y de pelo
marrón con una hembra de audición normal, orejas dobladas hacia el
frente y de pelo negro, homocigota para los tres pares de genes. El
genotipo que tendrá toda la F1 es:
Seleccione una:
a. AAFFNN
b. AAFfNn

c. Incorrecto
Correcto
d. AAffNN

Retroalimentación
La respuesta correcta es: Incorrecto

Pregunta 9
Correcta
Puntúa 1,0 sobre 1,0

Marcar pregunta

Enunciado de la pregunta
El científico británico Francis Crick, uno de los descubridores de la estructura de la
molécula de ADN, muerto en julio de 2004, será recordado como uno de los más
influyentes científicos de todos los tiempos. En 1958, publicó un manifiesto sobre la
síntesis de proteínas, presentando sus hipótesis sobre la estructura teórica de la
biología molecular, lanzando, así, las bases para el descubrimiento del código
genético. Entre las hipótesis presentadas en aquel texto, se destaca el dogma
central de la Biología. Según ese dogma:
Seleccione una:
a. Cada polipéptido tiene una secuencia específica de nucleótidos determinada por
el gen
b. El código genético es degenerado, pues un aminoácido puede ser codificado por
más de un trío de nucleótidos
c. Cada molécula de ADN es formada por la reunión de nucleótidos, que pueden
ser de cuatro tipos diferentes
d. La transferencia de informaciones genéticas ocurre del ADN para el RNA, y de

este para la proteína.


Correcto. El dogma central de la biología molecular, se entiende como la
transcripción de información genética que esta contenida en el DNA a moléculas de
RNAy de estas a proteínas en el ribosoma.

Retroalimentación
La respuesta correcta es: La transferencia de informaciones genéticas ocurre del
ADN para el RNA, y de este para la proteína.

Pregunta 10
Correcta
Puntúa 1,0 sobre 1,0
Marcar pregunta

Enunciado de la pregunta
La probabilidad en estadística, es considerada como la forma o manera en que
puede ocurrir un evento en un determinado experimento. Por regla general, la
suma de probabilidades en un experimento X debe ser igual a:
Seleccione una:

a. Uno (1)
Correcto. La suma de probabilidades independientes evidenciadas en un mismo
experimento debe ser igual a 1 o 100%.

b. Un medio (1/2)
c. Cero (0)
d. Un cuarto (1/4)

Retroalimentación
La respuesta correcta es: Uno (1)

Pregunta 1
Correcta

Puntúa 1,0 sobre 1,0

Marcar pregunta

Enunciado de la pregunta

Un investigador, interesado en producir en un tubo de ensayo una proteína, en


las mismas condiciones en que esa síntesis ocurre en las células, utilizó
ribosomas de células de ratón, RNA mensajero de células de mono, RNA de
transferencia de células de conejo y aminoácidos activos de células de sapo. La
proteína producida tendría una secuencia de aminoácidos idéntica a la de

Seleccione una:

a. Ratón
b. Conejo

c. Mono

Correcto. Recuerde que la información genética proviene directamente del DNA y


por ende la molècula de RNA m que se copia de esta DNA, es quien lleva la
información genética heredable o que finalmente se tradi¡uce en proyeína, así qiue
no interesa que esta se acople con moléculas de RNA de transferencia de otra
especie o individuo diferente o que esta se sintetice en un ribosoma de otro
individuo, la información inicial es la que lleva el RNAm.Por ello la proteína que se
produzca debe tener una secuencia idéntica a la del RNA m del mono.

d. Sapo

Retroalimentación
La respuesta correcta es: Mono

Pregunta 2
Correcta

Puntúa 1,0 sobre 1,0

Marcar pregunta

Enunciado de la pregunta
Al realizar la cruza de prueba a una hembra de pelaje negro portadora, se obtuvo en la
descendencia seis individuos. La probabilidad de que todos ellos salgan con el mismo fenotipo
de la hembra es de:

Seleccione una:

a. 3%

b. 50%

c. 25%

d. 1.56%

Retroalimentación
La respuesta correcta es: 1.56%
Pregunta 3
Incorrecta

Puntúa 0,0 sobre 1,0

Marcar pregunta

Enunciado de la pregunta

Si se cruzan entre si cierto tipo de individuos y se obtiene en la


descendencia los siguientes resultados fenotípicos en la F1 de: 225
negros y 75 blancos, los parentales involucrados en este tipo de
cruzamiento necesariamente deben ser:
Seleccione una:

a. Ambos puros dominantes

b. Ambos portadores

c. Ambos puros recesivos

d. Uno puro dominante y uno puro portador

Incorrecto

Retroalimentación
La respuesta correcta es: Ambos portadores

Pregunta 4
Correcta

Puntúa 1,0 sobre 1,0

Marcar pregunta

Enunciado de la pregunta

En la ley de segregación independiente, las proporciones que


Mendel obtuvo en sus experimentos fueron:
Seleccione una:
a. 3:1

b. 9:3:3:1

Correcto

c. 1:1

d. 27:9:9.9:3.3:3:1

Retroalimentación
La respuesta correcta es: 9:3:3:1

Pregunta 5
Correcta

Puntúa 1,0 sobre 1,0

Marcar pregunta

Enunciado de la pregunta
Los coeficientes numéricos que hacen falta para completar la expresión binomial
siguiente: (a+b) 9 = 1 , 9, 37, 85, …… y …… 85, 37, 9, 1 Son:

Seleccione una:

a. 126 y 126

Correcto. Teniendo en cuenta el triángulo de pascar que hemos plantea do en los


contenidos de la unidad, podemos decir que los coeficientes numéricos son
respectivamente 126 y 126.

b. 122 y 122

c. 116 y 116

d. 100 y 100

Retroalimentación
La respuesta correcta es: 126 y 126

Pregunta 6
Correcta
Puntúa 1,0 sobre 1,0

Marcar pregunta

Enunciado de la pregunta

El genotipo A1A1, es letal, A1A2 produce individuos color canela, A2A2,


produce individuos de color beige, B1B1, produce individuos de cola larga,
B1B2, individuos de cola ligeramente corta y B2B2, individuos sin cola. Si se
cruzan individuos A1A2 B1B2 entre si, el número de descendientes
esperada en la F1 adulta color canela y sin cola de una descendencia
de 12 individuos es:
Seleccione una:

a. 12 individuos

b. 6 individuos

c. 2 individuos

d. 4 individuos

Retroalimentación
La respuesta correcta es: 2 individuos

Pregunta 7
Correcta

Puntúa 1,0 sobre 1,0

Marcar pregunta

Enunciado de la pregunta
Cuando se cruzan individuos portadores para tres genes entre si, la proporción de
cigotos que espero sean: dominante homocigo para el primer gen, heterocigoto
para el segundo gen y heterocigoto para el tercer gen es de:

Seleccione una:
a. 2/64

b. 3/64

c. 4/64

d. 1/64

Retroalimentación
La respuesta correcta es: 4/64

Pregunta 8
Correcta

Puntúa 1,0 sobre 1,0

Marcar pregunta

Enunciado de la pregunta
Una hembra con genotipo desconocido se cruzo con un macho de pelo blanco (A
= pelo blanco es recesivo, A+ = alelo pelo negro es dominante.) de la
descendencia obtenida, se observo que la mitad tanto de los machos como de
las hembras fueron de pelo negro, y la otra mitad de los machos y la otra mitad
de las hembras fueron de pelo blanco. Según estos resultados usted puede decir
que el genotipo de la hembra es:

Seleccione una:

a. XA+XA+

b. XAXA

c. XA+0

d. XA+ XA

Correcto

Retroalimentación
La respuesta correcta es: XA+ XA

Pregunta 9
Correcta

Puntúa 1,0 sobre 1,0

Marcar pregunta

Enunciado de la pregunta
Con relación al código genético y a la síntesis de proteínas, señale la
afirmativa FALSA.
Seleccione una:

a. En la molécula de ADN, encontramos siempre desoxirribosa y cinco tipos de

bases: adenina, guanina, citosina, timina y uracilo

Correcto. La desoxirribosa es el azucar que se requiere para la conformación o


estructura molecular del DNA, de ahí el nombre de ácido desoxirribonucleíco.

b. Los ácidos nucleicos pueden aparecer libres en la célula eucariota o pueden


estar asociados las proteínas, formando los cromosomas y ribosomas en la forma
de moléculas complejas de nucleoproteínas.

c. Las mutaciones no alteran la estructura de los ácidos nucleícos

d. Dos grandes etapas están relacionadas con la síntesis de las proteínas: la


transcripción, que comprende el pasaje del código genético del ADN para el RNA, y
la traducción, que comprende el trabajo del RNA de organizar los aminoácidos en
la secuencia determinada por el código genético

Retroalimentación
La respuesta correcta es: En la molécula de ADN, encontramos siempre
desoxirribosa y cinco tipos de bases: adenina, guanina, citosina, timina y uracilo

Pregunta 10
Incorrecta

Puntúa 0,0 sobre 1,0

Marcar pregunta
Enunciado de la pregunta
las proporciones fenotípicas que se obtinen cuando se cruzan entre si individuos
portadores para tres características son:
Seleccione una:

a. 3:1

b. 27:9:9:9:3:3:3:1

c. 27:9:9:3:3:1

d. 9:3.3.3.1

Incorrecto

Retroalimentación
La respuesta correcta es: 27:9:9:9:3:3:3:1

Pregunta 1
Correcta
Puntúa 1,0 sobre 1,0

Marcar pregunta

Enunciado de la pregunta
Los ciclos celulares de la mayoría de las células también comprenden procesos que conducen
a _______________ y ____________ su masa y sus orgánulos citoplásmicos.

Seleccione una:
a. perder - transformar
b. transcribe - traduce

c. duplicar - dividir
Correcto

d. perder - condensar

Retroalimentación
La respuesta correcta es: duplicar - dividir

Pregunta 2
Incorrecta
Puntúa 0,0 sobre 1,0

Marcar pregunta

Enunciado de la pregunta
La división celular es un mecanismo tan exacto y a la misma vez complejo que
entre otras cosas permite
Seleccione una:
a. La corrección de errores genéticos
b. La propagación y perpetuidad de la especie

c. El apareamiento entre individuos de diferente sexo


Incorrecto: La propagación y perpetuidad de la especie

d. El crecimiento descontrolado de células cancerígenas

Retroalimentación
Respuesta incorrecta.
La respuesta correcta es: La propagación y perpetuidad de la especie

Pregunta 3
Correcta
Puntúa 1,0 sobre 1,0

Marcar pregunta

Enunciado de la pregunta
Las células caracterizadas por ausencia de membrana nuclear y de organelos
subcelulares ligados a membranas se denominan
Seleccione una:

a. Procariotas
Correcto

b. Eucariotas
c. Animales
d. Vegetales
Retroalimentación
La respuesta correcta es: Procariotas

Pregunta 4
Correcta
Puntúa 1,0 sobre 1,0

Marcar pregunta

Enunciado de la pregunta
La herencia de la resistencia a M. phaseolina en frijol está determinada por dos
pares de genes dominantes con efectos complementarios y existe la posibilidad de
que genes con efectos menores influyan también en la resistencia al patógeno.
Estos genes según los investigadores: Mayek-Pérez, Cándido López-Castañeda, et
al presentan
Seleccione una:
a. epistasis recesiva
b. epistasis doble dominante

c. epistasis doble recesiva


Correcto

d. epistasis con efecto acumulativo

Retroalimentación
Respuesta correcta
La respuesta correcta es: epistasis doble recesiva

Pregunta 5
Correcta
Puntúa 1,0 sobre 1,0

Marcar pregunta

Enunciado de la pregunta
Para calcular la heterocigosidad en una población según Forero y Montaño, se
obtiene de
Seleccione una:
a. El número de individuos observados sobre el total de loci analizados
b. El número de individuos esperados sobre el número de loci analizados
c. El número de loci analizados sobre el número de individuos observados (Ho) y
esperados (He)
d. El número de individuos observados (Ho) y esperados (He) para cada población

sobre el número total de loci analizados


Correcto

Retroalimentación
Respuesta correcta
La respuesta correcta es: El número de individuos observados (Ho) y esperados
(He) para cada población sobre el número total de loci analizados

Pregunta 6
Correcta
Puntúa 1,0 sobre 1,0

Marcar pregunta

Enunciado de la pregunta
El seguimiento de estos datos, podrían permitir un manejo integrado de la especie
como recurso pesquero, sensible a la sobreexplotación y alteraciones
medioambientales. La anterior aseveración fue promulgada por
Seleccione una:
a. Corrales y Pinto
b. Lourdes y Dealton
c. Tejada y Valencia

d. Montaño y Forero
Correcto

Retroalimentación
Respuesta correcta
La respuesta correcta es: Montaño y Forero

Pregunta 7
Correcta
Puntúa 1,0 sobre 1,0
Marcar pregunta

Enunciado de la pregunta
El ciclo celular es el periodo de tiempo que dura una división celular hasta el inicio
de la siguiente; por consiguiente la etapa que más tarda la célula en iniciar la
división es
Seleccione una:
a. La telofase

b. La interfase
Correcto

c. La metafase
d. La profase

Retroalimentación
La respuesta correcta es: La interfase

Pregunta 8
Correcta
Puntúa 1,0 sobre 1,0

Marcar pregunta

Enunciado de la pregunta
El instrumento empleado para visualizar las células de los diferentes organismos es
sin lugar a dudas el microscopio, el cual en sus principios fue descubierto por
Seleccione una:
a. Mathias & Shleiden
b. Theodor Shcwann

c. Zacharias Janssen
Correcto

d. Rudolf Virchow

Retroalimentación
La respuesta correcta es: Zacharias Janssen

Pregunta 9
Incorrecta
Puntúa 0,0 sobre 1,0

Marcar pregunta

Enunciado de la pregunta
Los tumores o crecimiento descontrolado de células cancerígenas, depende en
gran medida de
Seleccione una:
a. Factores internos del organismo
b. Desbalance del ciclo celular

c. Alteraciones del ADN y ARN


Incorrecto, es debido al desbalance del ciclo celular

d. Alteraciones hormonales

Retroalimentación
Respuesta incorrecta.
La respuesta correcta es: Desbalance del ciclo celular

Pregunta 10
Correcta
Puntúa 1,0 sobre 1,0

Marcar pregunta

Enunciado de la pregunta
El ciclo celular es el periodo de tiempo que dura una división celular hasta el inicio
de la siguiente; por consiguiente la etapa que más tarda la célula en iniciar la
división es
Seleccione una:
a. La metafase
b. La profase
c. La telofase
d. La interfase
Correcto

Retroalimentación
La respuesta correcta es: La interfase