1.

Lucy Ostrowski, Mateo Eusebio, Chase McAndrew 5/6 Period

2. Disease: ALS Disease
3. List of tasks:
● Research Disease
● Assign jobs
● Choose form of presentation
● Make gantt chart
● Gather information
● Form presentation

ALS Information:
What does ALS stand for?
Amyotrophic Lateral Sclerosis

What is ALS?
Amyotrophic lateral sclerosis, is a progressive neurodegenerative disease that affects nerve cells
in the brain and the spinal cord. It weakens your muscles and after a while you are basically
paralyzed.

Kind of disease: a progressive neurodegenerative disease that affects nerve cells in the brain and
the spinal cord.
- The muscle loses nutrients, and starts to deteriorate
- There are two kinds of ALS: Sporadic and Familial: “Sporadic, which is the most
common form of the disease in the U.S., accounts for 90 to 95 percent of all cases. It may
affect anyone, anywhere. Familial ALS (FALS) accounts for 5 to 10 percent of all cases
in the U.S. Familial ALS means the disease is inherited. In those families, there is a 50%
chance each offspring will inherit the gene mutation and may develop the disease. French
neurologist Jean-Martin Charcot discovered the disease in 1869.”(The ALS Association)
-
Symptoms:
- Trouble grasping small objects
- Change in voice
- Weakness
- Change in motor neurons
- Inability to speak or swallow
Long term effects:
- People may not be able to speak, eat, move, or breathe
Diagnosis:
 ➔ Electrodiagnostic tests including electromyography (EMG) and nerve conduction
velocity (NCV)
➔ Blood and urine studies including high resolution serum protein electrophoresis,
thyroid and parathyroid hormone levels and 24-hour urine collection for heavy
metals
➔ Spinal tap
➔ X-rays, including magnetic resonance imaging (MRI)
➔ Myelogram of cervical spine
➔ Muscle and/or nerve biopsy
➔ A thorough neurological examination

Who it affects:

● Over 6,000 people in the U.S. are diagnosed with ALS a year
● According to the ALS CARE database, 60% with ALS in the database are men
● 93% of the ALS patients in the database are caucasian
● The disease was found to be 20% more common in men than women
● Military veterans much more likely to develop ALS.

Treatments:
- Depends on stage
- No cure
- Physical therapy
- Can’t reverse, only slow down the process
- Medications: ​Riluzole (Rilutek) , Edaravone (Radicava)
- Other medications used to help other symptoms, such as Muscle cramps and spasms,
Spasticity, Constipation, Fatigue, Excessive salivation, Excessive phlegm, Pain,
Depression, Sleep problems, and Uncontrolled outbursts of laughing or crying
- Coping and support groups
DNA changes:

- The protein collects in membrane-less organelles

 - loss of function of the angiogenin protein due to mutation in the gene is thought to be
linked to some cases of ALS. A gain of a new and toxic function of the superoxide
dismutase 1 (SOD1) protein is probably how mutation of the SOD1 gene causes ALS.
- the C9ORF72 gene may cause ALS due to accumulations of RNA that occur when the
gene is mutated. FUS and TDP43 mutations may impair the normal processing of RNA
from a wide variety of genes, leading to ALS.
- Main reason: mutant SOD1 (DNA mutant sequence 1​- ATGGTTCAAG
CAGTCGCAGT GTTAAAGGGT GATGCCGGTG TCTCTGGTGT TGTCAAGTTC)
- Normal sequence: AGCCACTGTGCCTGGGAAAACCCTCAACTTTTCTTTTAAA
- mRNA sequence- UACCAAGUUC GUCAGCGUCA CAAUUUCCCA
CUACGGCCAC AGAGACCACA ACAGUUCAAG
- six homozygous SOD1 mutation locations: (L84F, N86S, D90A, L117V, L126S and
G27delGGACCA)
SOD1:
- Als is from altered SOD1
- Aggregation
-
Protein synthesis:
~ Transcription- in nucleus, mRNA is made and leaves nucleus, then attaches to a
ribosome.
~ Translation- on ribosome, transfer RNA comes to ribosome, bringing an amino acid,
amino acids become protein, proteins fold into a specific shape, and make up a being

Protein Folding: ​A protein folds to perform its biological function. There are four stages of
protein folding, primary, secondary, tertiary and quaternary. It starts in the cytoplasm. The
primary structure ​is the sequence of amino acids held together by peptide bonds. It then moves
into the rough ER. The ​secondary structure ​is the protein beginning to fold up. It can have two
types of structure: the alpha helix, a coil shape held by hydrogen bonds in the same direction as
the coil. The beta sheet is an S shape pattern, also with hydrogen bonds holding the structure
together. The hydrogen bonds are between NH and CO groups on the peptides. The ​tertiary
structure​ is the protein folded into its precise 3D structure, relating to the function. Hydrophilic
or hydrophobic dictates more folding. This takes place in the ER and golgi body. This is held
together by a range of non-covalent interactions between side groups, including ionic
interactions, disulphide bridges, hydrophobic interactions, Van der Waals forces and hydrogen
bonds. The ​quaternary​ structure is when single peptides bond to other peptides, for example in
haemoglobin. This happens in the golgi body.
Gantt Chart:

Tues Wed Thurs Fri Sat/sun Mon Tues Wed

Create Doc Research Start Research Work on Finalize Present to

further conducting protein final poster final teacher
presentatio folding project
n form
=poster

Research Figure out 3D model Start poster

ALS presentatio
n

Figure out Assign jobs

presentation

Day 1 reflection: ​Today we made progress on formatting the overall document and researching
our given disease. We are about ⅔ of the way done with research.
Day 2 reflection: ​Finished the research on the actual disease.
Day 3 reflection: ​We started research on protein synthesis
Day 4 reflection:​​We researched the protein folding specific to our disease.
Day 5 reflection:
Day 6 reflection:​​Today we combined all of our research together into our final project, which is
two posters.
Day 7 reflection:

Day 8 reflection:

Works cited:
http://www.alsa.org/about-als/
http://webma.alsa.org/site/PageServer/?pagename=MA_1_WhoGets.html
https://www.mayoclinic.org/diseases-conditions/amyotrophic-lateral-sclerosis/diagnosis-treatme
nt/drc-20354027
https://www.sciencedaily.com/releases/2018/01/180118142543.htm
http://www.alsa.org/about-als/what-is-als.html
http://www.alsa.org/research/focus-areas/genetics/
https://chem.libretexts.org/Textbook_Maps/Biological_Chemistry/Proteins/Protein_Structure/Pro
tein_Folding
https://www.mytutor.co.uk/answers/5581/A-Level/Biology/Explain-what-the-stages-of-protein-f
olding-are-and-how-the-protein-is-held-in-its-3D-shape/

What needs to be included:

Disease info:
● What is it- ALS Disease
● What parts of the body does it affect,
symptoms- muscle failure
● What protein is affected- SOD1
● Who is likely to get it - It is rarely
familial, but it is possible to get it
from family.
● What are the treatments? Cure?-
There is no cure, but there are
treatments to slow the process.
These are ​Medications: ​Riluzole
(Rilutek) , Edaravone (Radicava),
Other medications used to help other
symptoms, such as Muscle cramps
and spasms, Spasticity, Constipation,
Fatigue, Excessive salivation,
 Excessive phlegm, Pain, Depression,
Sleep problems, and Uncontrolled
outbursts of laughing or crying,
Coping and support groups
● What are the barriers to curing it?-
there is no permanent cure.
● Any interesting research going on
now?- there are still searches for a
cure, so lots of research

Protein Synthesis Detail:

Use this to help explain the difference
between normal and diseased protein
For each stage:
What is happening→ how and why
Where is it happening
What are the major players
What is the code/ sequence
End with a 3D model of the protein