Journal of Pediatric Surgery 53 (2018) 525–530

Contents lists available at ScienceDirect

Journal of Pediatric Surgery

journal homepage: www.elsevier.com/locate/jpedsurg

Reduction of hydrogen sulfide synthesis enzymes cystathionine-β-synthase

and cystathionine-γ-lyase in the colon of patients with
Hirschsprungs disease
Christian Tomuschat a, Anne Marie O’Donnell a, David Coyle a, Prem Puri a,b,⁎
a
National Children's Research Centre, Our Lady's Children's Hospital, Crumlin, Dublin, Ireland
b
School of Medicine and Medical Science and Conway Institute of Biomedical Research, University College Dublin, Ireland

a r t i c l e i n f o a b s t r a c t

Article history: Purpose: Hirschsprung associated enterocolitis (HAEC) is the most common cause of morbidity and mortality in
Received 20 January 2017 Hirschsprung Disease (HSCR). The pathogenesis of HAEC is poorly understood. In recent years, there is increasing
Received in revised form 30 April 2017 evidence that a compromised intestinal barrier function plays a major role in the pathogenesis of HAEC. Hydro-
Accepted 14 June 2017 gen sulfide, synthesized from L-cysteine by two key enzymes, cystathionine-β-synthase (CBS) and
cystathionine-γ-lysase (CSE) is reported to play a key role in regulating gastrointestinal motility and promoting
Key words:
resolution of inflammation. We designed this study to test the hypothesis that CBS and CSE expression is altered
Hirschsprung disease
Hirschsprung associated enterocolitis (HAEC)
in the colon of patients with HSCR.
Cystathionine-β-synthase (CBS) Methods: We investigated CBS and CSE protein expression in both the aganglionic and ganglionic regions of HSCR
Cystathionine-γ-lysase (CSE) patients (n = 10) versus healthy control colon (n = 10). Protein distribution was assessed by using immunoflu-
orescence and confocal microscopy. Gene and protein expression was quantified using quantitative real-time po-
lymerase chain reaction (qPCR), Western blot analysis, and densitometry.
Main results: qPCR and Western blot analysis revealed that CBS and CSE are expressed in the normal human
colon. CBS and CSE expression was significantly decreased (p b 0.003) in the ganglionic and aganglionic bowel
in HSCR compared to controls. Confocal microscopy revealed that CBS and CSE expression in smooth muscles, in-
terstitial cells of Cajal, platelet-derived growth factor-alpha receptor-positive cells, enteric neurons and colonic
epithelium was markedly decreased in HSCR specimens compared to controls.
Conclusion: We demonstrate for the first time the expression and distribution of CBS/CSE in patients with HSCR.
The observed decreased expression of CBS and CSE may affect mucosal integrity and colonic contractility and
thus render HSCR patients more susceptible to develop HAEC.
© 2017 Elsevier Inc. All rights reserved.

Hirschsprung associated enterocolitis (HAEC) is the most serious
complication of Hirschsprung Disease (HSCR) and can occur pre- and
postoperatively in up to 40% of patients [1]. Although the clinical course
of HAEC with abdominal distension, vomiting, and bloody diarrhea is
well acknowledged, its pathogenesis is poorly understood. In recent
years, numerous theories have been put forward to understand the un-
derlying basis of HAEC [2–4] including intestinal epithelial barrier dys-
function and altered gastrointestinal motility patterns [5]. It is well
recognized that intestinal epithelial barrier dysfunction may allow the
passage of macromolecular antigens or harmful substances through
⁎ Corresponding author at: National Children's Research Centre, Our Lady's Children's
Hospital, Crumlin, Dublin, 12, Ireland. Tel.: +353 14096420; fax: +353 1455 201.
E-mail address: prem.puri@ncrc.ie (P. Puri).
the barrier to reach subepithelial regions, coming in contact with
immune cells and initiating altered immune responses, which in turn
trigger the development of intestinal inflammation [6].
Hydrogen sulfide (H2S) is an important regulator of gastrointestinal
motility and mucosal homeostasis. H2S is endogenously synthesized
from L-Cysteine by the enzymes cystathionine-β-synthase (CBS) and
cystathionine-γ-lyase (CSE). Also, H2S can be produced by sulfate-
reducing bacteria [7]. However, the role of bacterial H2S still has to be
established. The function of H2S has been implicated in smooth muscle
relaxation, increased colonic secretion and the protection of the
intestines from ischemia–reperfusion injury [8–11]. Interestingly,
suppression of colonic H2S synthesis in mice with colitis is reported to
impair mucosal integrity and alter intestinal barrier function [8]. Since
in recent years, damaged intestinal barrier function is being increasingly

http://dx.doi.org/10.1016/j.jpedsurg.2017.06.011
0022-3468/© 2017 Elsevier Inc. All rights reserved.

Downloaded for Socio ACACIP (secretaria@acacip.org.ar) at Asociacion Civil Argentina de Cirugia Infanil - JCon from ClinicalKey.com by Elsevier on January 18, 2019.
For personal use only. No other uses without permission. Copyright ©2019. Elsevier Inc. All rights reserved.
526 C. Tomuschat et al. / Journal of Pediatric Surgery 53 (2018) 525–530

implicated in the pathogenesis of HAEC, we designed this study to test
the hypothesis that the H2S synthesis enzymes CBS/CSE are lacking or
reduced in the colonic specimens from patients with HSCR.
1. Material and methods
1.1. Tissue samples
This study was approved by the Ethics Medical Research Committee,
Our Lady's Children's Hospital (Ref GEN.292/12) and tissue samples
were obtained with informed parenteral consent. HSCR specimens
from 10 patients (7 male, three female, 3–14 months, median 5.5
months) who underwent pull-through surgery were studied
(Table 1). Delphi criteria for HAEC diagnosis were applied [12]. These
specimens were divided into aganglionic and ganglionic samples. Gan-
glionic samples were taken from the most proximal margin of the
pull-through specimen while aganglionic samples were taken from
the most distal margin of the pull through specimens. Normal control
samples included ten specimens from patients who underwent sigmoid
colostomy closure following anorectoplasty for imperforate anus (6
male, four female, 8–19 months, median 8.5 months). Tissue specimens
were either snap-frozen in liquid nitrogen and stored at −80 °C for pro-
tein extraction or embedded in OCT Mounting Compound (VWR Inter-
national, Leuven, Belgium) for immunofluorescence and stored at
−80 °C until use.
1.2. RNA isolation from HSCR specimens
Isolate II RNA Mini Kit (Roche Diagnostics, West Sussex, UK) was
used for the extraction method to isolate total RNA from aganglionic
and ganglionic HSCR as well as controls (n = 10 for each group) accord-
ing to the manufacturer's protocol. Spectrophotometrical quantification
of total RNA was performed using a NanoDrop ND-1000 UV–Vis spec-
trophotometer (Thermo Scientific Fisher, Wilmington, DE). The RNA so-
lution was stored at −80 °C until further use.
1.3. cDNA synthesis and quantitative polymerase chain reaction
Reverse transcription of total RNA was carried out at 25 °C for
10 min, at 37 °C for 120 min and 85 °C for 5 min using a Transcriptor
High Fidelity cDNA Synthesis Kit (Roche Diagnostics, West Sussex, UK)
according to the manufacturer's instruction. The resulting cDNA was
used for quantitative real-time polymerase chain reaction (qRT-PCR)
using a LightCycler 480 SYBR Green I Master (Roche Diagnostics, Mann-
heim, Germany) in a total reaction mix of 25 μl per well. The following
gene-specific primers were used: Human CBS (Eurofins) sense primer
5’TGCCAGAGAAGATGAGCTCC and Human CBS antisense primer
5’GGGATTTCGTTCTTCAGCCG as well Human CSE (Eurofins) sense prim-
er 5’TGACATTGAAGGCTGTGCAC and Human CSE antisense primer
5’GACACCAGGCCCATTACAAC. For normalization purposes, real-time
RT-PCR was performed for Glyceraldehyde 3-phosphate dehydrogenase
(GAPDH). GAPDH sense primer 5’AACGGTTCATGTTGTAATG and
GAPDH antisense primer 5′ ACACAGGTTGTGGAGTAACA has been
used. After 5 min of initial denaturation at 95 °C, 55 cycles of amplifica-
tion for each primer were carried out. Each cycle included denaturation
at 95 °C for 10 s, annealing at 60 °C for 15 s, and elongation at 72 °C for
10 s. Relative mRNA levels of gene expression were determined using a
LightCycler 480 System (Roche Diagnostics, Mannheim, Germany). The
relative changes in gene expression levels of CBS/CSE were normalized
against the level of GAPDH gene expression in each sample (ΔΔCT-
method). Experiments were carried out in triplicate for each sample
and primer.
1.4. Protein extraction and Western blot
Specimens of HSCR colon and control colon were homogenized in
RIPA buffer (Radio-Immunoprecipitation Assay, Sigma-Aldrich Ltd.,
Wicklow, Ireland) containing 1% protease inhibitor cocktail (Sigma-Al-
drich Ireland Ltd., Wicklow, Ireland). Protein concentrations were de-
termined using a Bradford assay (Sigma-Aldrich Ireland Ltd., Wicklow
Ireland). A total volume of 40 μl Laemmli Sample Buffer (Sigma-Aldrich,
Ireland Ltd., Wicklow, Ireland) containing 10 μg Protein was loaded in
the 10% SDS-PAGE gel (NuPAGE Novex Bis-Tris gels, Invitrogen, Carls-
bad, USA) for electrophoretic separation. The electrophoresis was per-
formed in MES SDS (2-(N-morpholino) ethane sulfonic acid, sodium
dodecyl sulfate) running buffer (Invitrogen, Carlsbad, USA). Proteins
were then transferred to 0.45 μm nitrocellulose membrane (Millipore
Corporation, Billerica, USA) by Western blotting. Following Western
blotting, the membranes were blocked with 3% skimmed milk for
60 min before antibody detection. The primary antibodies; rabbit anti-
CBS (Abcam, Cambridge, UK, ab140600, GR103934) dilution 1:1000
and rabbit anti-CSE (Abcam, Cambridge, UK, ab136604, GR188522)
were used, and incubation was performed overnight at 4 °C. Following
extensive washing (four times in PBS (Phosphate-buffered saline)–
0.05% Tween) the membranes were incubated with goat antirabbit
IgG HRP-linked secondary Antibody (dilution 1:10,000, Abcam, Cam-
bridge, UK) followed by washing (four times in PBS-0.05% Tween). De-
tection was performed with the ECL Plus chemiluminescence kit
(Thermo, Fisher Scientific, Dublin, Ireland). We used GAPDH (mouse
anti-GAPDH, dilution 1:1000, Abcam, Cambridge, UK) as an additional
loading control.
Quantification of Western blot has been conducted with ImageJ
software.
(U.S. National Institutes of Health, Bethesda, Maryland, USA) by
measuring the density of each single band.
1.5. Immunofluorescence staining and confocal microscopy
Frozen blocks of HSCR colon and normal control samples were sec-
tioned transversely at a thickness of 10 μm, mounted on Superfrost®

Table 1
Clinical data of patients with Hirschsprung disease.

Age at surgery Gender Associated Extent Colostomy prior to Enterocolitis

(month) anomalies Aganglionosis pullthrough
Preoperative Post pullthrough

1 10 Female Trisomy 21, ASD, PDA Long segment – yes –

2 8 Female Trisomy 21, ASD Rectosigmoid yes – yes
3 3 Male ASD Rectosigmoid – – –
4 14 Female ASD Rectosigmoid – – –
5 5 Male – Rectosigmoid – – –
6 7 Male – Subtotal colonic Yes Yes –
7 4 Male – Rectosigmoid – – –
8 5 Male – Rectosigmoid – – –
9 5 Male – Rectosigmoid Yes Yes –
10 5 Male PDA Ligation Rectosigmoid – – –

Downloaded for Socio ACACIP (secretaria@acacip.org.ar) at Asociacion Civil Argentina de Cirugia Infanil - JCon from ClinicalKey.com by Elsevier on January 18, 2019.
For personal use only. No other uses without permission. Copyright ©2019. Elsevier Inc. All rights reserved.
 C. Tomuschat et al. / Journal of Pediatric Surgery 53 (2018) 525–530 527

Plus slides (VWR International, Leuven, Belgium) and fixed with buff-
ered 10% formalin for 10 min. Sections underwent cell membrane per-
meabilization with 1% TritonX-100 for 25 min at room temperature.
After blocking with 5% BSA (Bovine serum albumin) for 30 min to
avoid nonspecific absorption, sections were incubated with primary an-
tibodies: rabbit anti-CBS (1:500, BSA 5%), (Abcam, Cambridge, UK), rab-
bit anti-CSE (1:400, BSA 5%), (Abcam, Cambridge, UK) mouse anti-α-
smooth muscle actin (1:200, 5% BSA), (Sigma-Aldrich, Ireland), mouse
anti-c-kit (1:300, 5% BSA), (Abcam, Cambridge, UK), mouse anti-
PDGFRα (1:100, 5% BSA), (Santa Cruz, Heidelberg, Germany) and
mouse HuD-1 (1:100, 5% BSA), (Santa Cruz, Heidelberg, Germany) over-
night at 4 °C. Sections were then washed in PBS-0.05% Tween and incu-
bated with corresponding secondary antibodies (antirabbit Alexa Fluor
488 (ab150073, GR226381), dilution 1:1000 and antimouse Alexa Fluor
594 (ab150116, GR232081), dilution 1:1000), (Abcam, Cambridge, UK)
for 1 h at room temperature. After washing, sections were counter-
stained with DAPI (4′,6-diamidino-2-phenylindole) antibody, dilution
1:1000 (Roche Diagnostics GmbH, Mannheim, Germany) for 15 min,
washed, mounted and coverslipped with Fluorescent Mounting Medi-
um (DAKO Ltd., Cambridgeshire, UK). All sections were independently
evaluated by two investigators with an LSM 700 confocal microscope
(Carl Zeiss MicroImaging GmbH, Jena, Germany).
2. Results
2.1. Relative mRNA expression levels of CBS and CSE in HSCR and controls
The relative mRNA expression levels of CBS and CSE were
significantly decreased in aganglionic and ganglionic (HSCR) specimens
compared to normal controls.
(p = .003, Fig. 1 a/b).
2.2. Western blot
Our Western blot results from three independent experiments
showed that CBS and CSE protein was expressed in the colon of patients
with HSCR and the expression was significantly decreased in the
aganglionic and ganglionic bowel compared to healthy controls (p =
.05) (Fig. 1 c/d). Densitometry confirmed significantly decreased CBS
and CSE protein expression in the aganglionic and ganglionic bowel in
HSCR compared to normal controls (p = .05). Equal loading of electro-
phoresis gels was confirmed by GAPDH (Glyceraldehyde 3-phosphate
dehydrogenase) staining of the stripped membranes.
2.3. Immunofluorescence staining and confocal microscopy

1.6. Statistical analysis
A one-way ANOVA was conducted to determine a statistically
significant difference between aganglionic, ganglionic and healthy
controls. Data ± standard error. Hirschsprung specimens were classi-
fied into three groups: Aganglionic (n = 10), Ganglionic (n = 10) and
normal controls (n = 10).
Both CBS and CSE could be detected in interstitial cells of Cajal (ICC)
and platelet-derived-growth-factor-receptor + (PDGFRα +) cells found
in the ganglionic and ganglionic HSCR specimens and control samples.
Compared with the control group, there were significantly fewer CBS−
and CSE + cells in the HSCR specimens (Fig. 2) Furthermore, both en-
zymes have been detected in the colonic epithelium and smooth muscle
fibers. Compared with the control group there was a significantly

Fig. 1. (a/b) qRT-PCR revealed significantly decreased relative mRNA expression levels of CBS and CSE in the aganglionic and ganglionic HSCR specimens (n = 10) compared to normal
control tissue (n = 10). Results are presented as mean ± SEM (*p = .003 by one-way ANOVA). (c/d) Western blotting and densitometry quantification of CBS/CSE protein expression
in HSCR specimens (n = 10) and controls. Western blot results show that the quantitative decrease of CBS and CSE transcripts in HSCR specimens resulted in decreased amounts of
CBS and CSE protein expression compared to normal controls. Equal loading of electrophoresis gels was confirmed by GAPDH staining (*p = .05 by one-way ANOVA). Values are given
as mean ± SEM.

Downloaded for Socio ACACIP (secretaria@acacip.org.ar) at Asociacion Civil Argentina de Cirugia Infanil - JCon from ClinicalKey.com by Elsevier on January 18, 2019.
For personal use only. No other uses without permission. Copyright ©2019. Elsevier Inc. All rights reserved.
528 C. Tomuschat et al. / Journal of Pediatric Surgery 53 (2018) 525–530

Fig. 2. (a) CBS and (b) CSE expression (green) in ICC (red) of HSCR compared to normal controls. C-Kit (red) was used to identify ICC to show coexpression with CBS and CSE (scale bar
25 μm, original magnification ×63). (c) CBS and (d) CSE expression (green) in PDGFRα + cells (red) of HSCR specimens compared to normal controls. PDGFRα (red) was used to identify
PDGFRα + cells to show coexpression with CBS and CSE (scale bar 25 μm, original magnification ×63). A total of 8 specimens were analyzed; only the most representative stainings are
shown.

decreased expression of both enzymes found in the HSCR specimens
(Fig. 3). CBS and CSE have also been detected in the hypertrophic
nerve trunks and ganglion cells of the HSCR specimens. The expression
of both enzymes is reduced compared to healthy control samples
(Fig. 4).
3. Discussion
The functions of H2S in the gastrointestinal (GI) tract have received
much attention in recent years; in animal models it has been shown
that H2S plays an important role in the regulation of gastrointestinal
motility and mucosal homeostasis. To our knowledge, this is the first re-
port describing the colonic expression of CBS and CSE in HSCR. CBS and
CSE are the key enzymes involved in the synthesis of H2S. In the present
study, we quantified CBS and CSE protein levels in the aganglionic, gan-
glionic and normal control specimens, using qPCR and Western blotting.
The substrate of CBS and CSE to produce H2S is L-cysteine. L-cysteine is
found in alimentary sources and in endogenous proteins. Through
transsulfuration it can be synthesized from l-methionine. However, a
quantification of L-cysteine has not been conducted, since an alteration
of CBS and CSE would still lead to reduced production of H2S. In fact de-
creased H2S levels have been reported in CSE−/− and CBS heterozy-
gote mouse models [13].
Our results show that significant differences exist in the relative
levels of CBS and CSE in the colon of patients with HSCR. Further, we
showed the presence of both key enzymes of H2S production in tissue
involved in colon motility and mucosal intestinal barrier function. Con-
focal microscopy revealed that CBS and CSE were strongly expressed in
enteric neurons, smooth muscle cells, ICCs, PDGFRα + cells and the co-
lonic epithelium. The observed expression differences of both enzymes
may lead to differences in the H2S production capacity of these tissues.
H2S as a gaseous mediator promotes tissue repair and resolution of
inflammation; conversely, the inhibition of H2S synthesis leads to gas-
trointestinal (GI) mucosal inflammation and impairment of healing of
injury [11].
The beneficial effects of H2S on mucosal protection are underlined by
Zhao et al.; they showed that a slow-release H2S donor (GYY4137) im-
proved colonic intestinal barrier integrity and attenuated DSS-induced
inflammation in Caco-2 cells. This finding has been further confirmed
by in vivo data which exhibited that GYY4137 alleviated DSS-induced
colonic injury via reducing inflammation and improving colonic barrier
integrity [14]. Furthermore, the beneficial effects of H2S are confirmed
as well in the small bowel and have been shown in the treatment of
neonatal intestinal disease such as necrotizing enterocolitis [15]. A po-
tential mechanism of the anti-inflammatory effects of H2S is the ability
of luminal H2S to modify secreted defensive proteins. Via reduction of
disulfide bonds, H2S releases trefoil factor 3 (TFF3), which plays a key
role in mucosal regeneration and repair processes, from its co-
secreted disulfide-linked partner IgG Fc binding protein. Also, recent ev-
idence suggests that H2S reduces the sulfur groups of β-defensin which
increase the potency of its antimicrobial activity [16].
These findings have implications for our understanding of the path-
ogenesis of HAEC. There is growing evidence that intestinal barrier dys-
function is a critical factor in the pathogenesis of HAEC [17–19]. Changes
in the colonic epithelium have been postulated as a causative factor in
the development of HAEC through perturbations in structure and

Downloaded for Socio ACACIP (secretaria@acacip.org.ar) at Asociacion Civil Argentina de Cirugia Infanil - JCon from ClinicalKey.com by Elsevier on January 18, 2019.
For personal use only. No other uses without permission. Copyright ©2019. Elsevier Inc. All rights reserved.
 C. Tomuschat et al. / Journal of Pediatric Surgery 53 (2018) 525–530 529

Fig. 3. (a) CBS and (b) CSE expression (green) in the colonic epithelium (red) of HSCR specimens compared to normal controls. E-Cadherin (red) was used to identify colonic epithelium to
show coexpression with CBS and CSE (scale bar 25 μm, original magnification ×63). (c) CBS and (d) CSE expression (green) in smooth muscle cells (red) of HSCR compared to healthy
controls. α-SMA (red) was used to identify smooth muscle bundles to show coexpression with CBS and CSE (scale bar 25 μm, original magnification ×63). A total of 8 specimens were
analyzed; only the most representative stainings are shown.

function of the epithelial lining [4]. Recently, we showed that ATP-
sensitive K +-channel (K (ATP)) subunits are which colocalized with
tight junction-proteins were reduced in HSCR specimens [20]. Alter-
ations in the functional anatomic integrity of the intestinal barrier
have been suggested as one of the critical factors in the pathophysiolog-
ical processes of HAEC [2]. The potential intrinsic impairment of K (ATP)
channels in patients with HSCR is extended by the fact that the subunit
SUR2 (sulfunylurea receptor 2) of K (ATP) channels is a target of H2S [21].
It is thought that the resulting transsulfuration of the subunit prevents
the detrimental effects of tyrosine nitration which underlines the anti-
oxidant and therefore protective properties of H2S in the setting of an
acute inflammation [21]. These findings indicate an important mecha-
nism of mucosal protection, involving K (ATP) channels and H2S, which
is potentially disturbed in patients with HSCR.
However, it is agreed to accept that the marked reduction of both
key enzymes cannot solely be explained by the decrease in the colonic
epithelium. In the present study, both enzymes are found in smooth
muscle cells (SMC), ICCs, PDGFRα+ cells and enteric neurons including
ganglia cells. These findings are so far of importance, since H2S is also in-
volved in smooth muscle relaxation. Generally, smooth muscle relaxa-
tion is caused by one or more nonadrenergic noncholinergic (NANC)
transmitters that are released from enteric motor neurons, SMCs, and
ICCs. Normal intestinal motility requires the coordinated interaction of
the enteric nervous system, SMC, ICCs and recently discovered
PDGFRα + cells. Together, the mutual interaction of these cells propa-
gates the proper motility in the healthy human colon [22]. H2S is
identified as one of the major NANC transmitters, and the potential im-
pairment of H2S producing enzymes in the colon of patients with HSCR
may contribute to the dysmotility problems often seen in patients with
HSCR [23]. Zhang et al. showed that in patients with esophageal achala-
sia both enzymes are reduced in the smooth muscles of biopsies taken;
their second observation was that H2S can inhibit esophageal contractile
activity in a concentration-dependent manner and that the contractile
amplitude increased upon the inhibition of H2S [24]. Also, a recent
study demonstrated that endogenous H2S contributes to the resting
membrane potential and spontaneous contractions in the rat colon as
CSE/CBS inhibitors can reduce H2S production, depolarize smooth mus-
cle cells, and increase the frequency of contractions in muscle strips
[16,25]. We clearly showed the presence of both enzymes in the smooth
muscle cells with a marked decrease of expression of both enzymes in
the HSCR specimens. It is conceivable that the reduced expression of
CBS/CSE leads to a reduced production of H2S and therefore to an im-
pairment of smooth muscle relaxation. The presence of CBS and CSE in
ICCs and PDGFRα + cells suggests that both cell types have the ability
to produce H2S. The interplay of SMC, ICC and PDGFRα + cells (SIP) is
summarized in the so-called SIP-syncytium, which represents a func-
tional unit. All three cell types express both key enzymes for H2S pro-
duction. The reported decrease in the present study adds further
evidence that interstitial cells are altered in HSCR which may contribute
to motility disturbances often observed in these patients.
Further, the altered expression of CBS and CSE was not only confined
to the aganglionic colon but also affected the ganglionic bowel.

Downloaded for Socio ACACIP (secretaria@acacip.org.ar) at Asociacion Civil Argentina de Cirugia Infanil - JCon from ClinicalKey.com by Elsevier on January 18, 2019.
For personal use only. No other uses without permission. Copyright ©2019. Elsevier Inc. All rights reserved.
530 C. Tomuschat et al. / Journal of Pediatric Surgery 53 (2018) 525–530
Fig. 4. (a) CBS and (b) CSE expression (green) in enteric neurons/ganglion cells (red) of
HSCR specimens compared to normal controls. HuD1 (red) was used to identify enteric
neurons/ganglion cells to show coexpression with CBS and CSE (scale bar 25 μm,
original magnification × 63). A total of 8 specimens were analyzed; only the most
representative stainings are shown.
Recurrent episodes of enterocolitis and dysmotility problems despite
properly performed pull-through, indicate that the reported alterations
are not restricted to the aganglionic colon but extend proximally into
the ganglionated bowel.
These changes may affect the long-term outcome in a subset of pa-
tients with HSCR. Future studies of factors affecting intestinal barrier
function, mucosal defenses and motility should provide identification
of patients with HSCR who are at risk to develop these complications,
despite a properly performed pull-through.
Downloaded for Socio ACACIP (secretaria@acacip.org.ar) at Asociacion Civil Argentina de Cirugia Infanil - JCon from ClinicalKey.com by Elsevier on January 18, 2019.
For personal use only. No other uses without permission. Copyright ©2019. Elsevier Inc. All rights reserved.
References
[1] Neuvonen MI, Kyrklund K, Lindahl HG, et al. A population-based, complete follow-
up of 146 consecutive patients after transanal mucosectomy for Hirschsprung dis-
ease. J Pediatr Surg 2015;50(10):1653–8.
[2] Austin KM. The pathogenesis of Hirschsprung disease-associated enterocolitis.
Semin Pediatr Surg 2012;21(4):319–27.
[3] Demehri FR, Halaweish IF, Coran AG, et al. Hirschsprung-associated enterocolitis:
pathogenesis, treatment and prevention. Pediatr Surg Int 2013;29(9):873–81.
[4] Gosain A, Brinkman AS. Hirschsprung associated enterocolitis. Curr Opin Pediatr
2015;27(3):364–9.
[5] Tomuschat C, O'Donnell AM, Coyle D, et al. Altered expression of a two-pore domain
(K2P) mechano-gated potassium channel TREK-1 in Hirschsprung disease. Pediatr
Res 2016;80(5):729–33.
[6] Snoek SA, Verstege MI, Boeckxstaens GE, et al. The enteric nervous system as a reg-
ulator of intestinal epithelial barrier function in health and disease. Expert Rev
Gastroenterol Hepatol 2010;4(5):637–51.
[7] Steidle J, Wurner L, Diener M. Altered response to hydrogen sulphide during exper-
imental colitis in rats. J Anim Physiol Anim Nutr (Berl) 2013;97(5):942–50.
[8] Motta JP, Flannigan KL, Agbor TA, et al. Hydrogen sulfide protects from colitis and re-
stores intestinal microbiota biofilm and mucus production. Inflamm Bowel Dis
2015;21(5):1006–17.
[9] Martinez-Cutillas M, Gil V, Mane N, et al. Potential role of the gaseous mediator hy-
drogen sulphide (H2S) in inhibition of human colonic contractility. Pharmacol Res
2015;93:52–63.
[10] Magierowski M, Magierowska K, Hubalewska-Mazgaj M, et al. Exogenous and En-
dogenous Hydrogen Sulfide Protects Gastric Mucosa against the Formation and
Time-Dependent Development of Ischemia/Reperfusion-Induced Acute Lesions
Progressing into Deeper Ulcerations. Molecules 2017:22(2).
[11] Flannigan KL, Agbor TA, Blackler RW, et al. Impaired hydrogen sulfide synthesis and
IL-10 signaling underlie hyperhomocysteinemia-associated exacerbation of colitis.
Proc Natl Acad Sci U S A 2014;111(37):13559–64.
[12] Pastor AC, Osman F, Teitelbaum DH, et al. Development of a standardized definition for
Hirschsprung-associated enterocolitis: a Delphi analysis. J Pediatr Surg 2009;44(1):251–6.
[13] Kabil O, Vitvitsky V, Xie P, et al. The quantitative significance of the transsulfuration en-
zymes for H2S production in murine tissues. Antioxid Redox Signal 2011;15(2):363–72.
[14] Zhao H, Yan R, Zhou X, et al. Hydrogen sulfide improves colonic barrier integrity in DSS-
induced inflammation in Caco-2 cells and mice. Int Immunopharmacol 2016;39:121–7.
[15] Li B, Zani A, Martin Z, et al. Intestinal epithelial cell injury is rescued by hydrogen sul-
fide. J Pediatr Surg 2016;51(5):775–8.
[16] Linden DR. Hydrogen sulfide signaling in the gastrointestinal tract. Antioxid Redox
Signal 2014;20(5):818–30.
[17] Pierre JF, Barlow-Anacker AJ, Erickson CS, et al. Intestinal dysbiosis and bacterial
enteroinvasion in a murine model of Hirschsprung disease. J Pediatr Surg 2014;
49(8):1242–51.
[18] Thiagarajah JR, Yildiz H, Carlson T, et al. Altered goblet cell differentiation and sur-
face mucus properties in Hirschsprung disease. PLoS One 2014;9(6):e99944.
[19] Ward NL, Pieretti A, Dowd SE, et al. Intestinal aganglionosis is associated with early
and sustained disruption of the colonic microbiome. Neurogastroenterol Motil 2012;
24(9): 874-e400.
[20] Tomuschat C, O'Donnell AM, Coyle D, et al. Altered expression of ATP-sensitive K(+)
channels in Hirschsprung disease. J Pediatr Surg 2016;51(6):948–52.
[21] Kang M, Hashimoto A, Gade A, et al. Interaction between hydrogen sulfide-induced
sulfhydration and tyrosine nitration in the KATP channel complex. Am J Physiol
Gastrointest Liver Physiol 2015;308(6):G532–9.
[22] Blair PJ, Rhee PL, Sanders KM, et al. The significance of interstitial cells in
neurogastroenterology. J Neurogastroenterol Motil 2014;20(3):294–317.
[23] Menezes M, Corbally M, Puri P. Long-term results of bowel function after treatment
for Hirschsprung disease: a 29-year review. Pediatr Surg Int 2006;22(12):987–90.
[24] Zhang L, Zhao W, Zheng Z, et al. Reduction of hydrogen sulfide synthesis enzymes in
the esophagus of patients with achalasia: effect of hydrogen sulfide in achalasia.
Neurogastroenterol Motil 2015;27(9):1274–81.
[25] Gil V, Gallego D, Jimenez M. Effects of inhibitors of hydrogen sulphide synthesis on
rat colonic motility. Br J Pharmacol 2011;164(2b):485–98.