See discussions, stats, and author profiles for this publication at: https://www.researchgate.

net/publication/7213544

High Throughput Detection of Bluetongue Virus by a New Real-Time Fluorogenic

Reverse Transcription--Polymerase Chain Reaction: Application on Clinical
Samples from Current Mediterr...

Article  in  Journal of veterinary diagnostic investigation: official publication of the American Association of Veterinary Laboratory Diagnosticians, Inc · February 2006
DOI: 10.1177/104063870601800103 · Source: PubMed

CITATIONS READS

62 115

11 authors, including:

Miguel Ángel Jiménez-Clavero Montserrat Agüero

Instituto Nacional de Investigación y Tecnología Agraria y Alimentaria Laboratorio Central de Veterinaria, Spain, Algete, Madrid
119 PUBLICATIONS   2,320 CITATIONS    28 PUBLICATIONS   795 CITATIONS   

SEE PROFILE SEE PROFILE

Elena San Miguel Tomas Mayoral

Government of Spain LABORATORIO CENTRAL DE VETERINARIA
11 PUBLICATIONS   222 CITATIONS    46 PUBLICATIONS   405 CITATIONS   

SEE PROFILE SEE PROFILE

Some of the authors of this publication are also working on these related projects:

Flavoenzyme dependent systems: from action mechanisms to biotechnological and sanitary applications. View project

Neem Tree (Azadirachta indica A. Juss) as Source of Bioinsectides, View project

All content following this page was uploaded by Miguel Ángel Jiménez-Clavero on 31 May 2014.

The user has requested enhancement of the downloaded file.

 Journal of Veterinary Diagnostic
Investigation http://vdi.sagepub.com/

High Throughput Detection of Bluetongue Virus by a New Real-Time Fluorogenic Reverse Transcription−−
Polymerase Chain Reaction: Application on Clinical Samples from Current Mediterranean Outbreaks
Miguel Angel Jiménez-Clavero, Montserrat Agüero, Elena San Miguel, Tomás Mayoral, Maria Cruz López, María José
Ruano, Esther Romero, Federica Monaco, Andrea Polci, Giovanni Savini and Concepción Gómez-Tejedor
J VET Diagn Invest 2006 18: 7
DOI: 10.1177/104063870601800103

The online version of this article can be found at:

http://vdi.sagepub.com/content/18/1/7

Published by:

http://www.sagepublications.com

On behalf of:

Official Publication of the American Association of Veterinary Laboratory Diagnosticians, Inc.

Additional services and information for Journal of Veterinary Diagnostic Investigation can be found at:

Email Alerts: http://vdi.sagepub.com/cgi/alerts

Subscriptions: http://vdi.sagepub.com/subscriptions

Reprints: http://www.sagepub.com/journalsReprints.nav

Permissions: http://www.sagepub.com/journalsPermissions.nav

Downloaded from vdi.sagepub.com by guest on May 21, 2011

J Vet Diagn Invest 18:7–17 (2006)

High throughput detection of bluetongue virus by a new

real-time fluorogenic reverse transcription–polymerase
chain reaction: Application on clinical samples from
current Mediterranean outbreaks
Miguel Angel Jiménez-Clavero,1 Montserrat Agüero, Elena San Miguel, Tomás Mayoral,
Maria Cruz López, Marı
´a José Ruano, Esther Romero, Federica Monaco, Andrea Polci,
Giovanni Savini, Concepción Gómez-Tejedor

Abstract. A real-time reverse transcription–polymerase chain reaction (RT-PCR) assay was developed for
the detection of bluetongue virus (BTV) in blood samples. A combination of primers specific for a highly
conserved region in RNA segment 5 (based on Mediterranean BTV sequences) and a DNA probe bound to 59-
Taq nuclease-39 minor groove binder (TaqManq MGB) was used to detect a range of isolates. This real-time
RT-PCR assay could detect 5.4 3 1023 tissue culture infectious doses (TCID50) of virus per milliliter of sample,
which was comparable to our current BTV diagnostic nested RT-PCR assay. The assay detected all recent
Mediterranean isolates (including serotypes 2, 4, and 16), BTV vaccine strains for serotypes 2 and 4, and 15
out of the 24 BTV reference strains available (all serotypes), but did not detect the related orbiviruses epizootic
hemorrhagic disease and African horse sickness viruses. Following assay evaluation, the ability of this assay
to identify BTV in recent isolates (2003, 2004) from ovine and bovine samples from an epizootic outbreak in
Spain was also tested. Minor nucleotide changes (detected by sequencing viral genomes) within the probe-
binding region were found to have a profound effect on virus detection. This assay has the benefits of being
fast and simple, and the 96-well format enables large-scale epidemiological screening for BTV, especially when
combined with a high-throughput nucleic acid extraction method.

Key words: Bluetongue virus; diagnosis; high throughput; real-time reverse transcription–polymerase chain
reaction.

Introduction graphically distinct evolutionary lineages, or topo-

types,11,12 allowing the differentiation of BTV variants
Bluetongue virus (BTV) is the prototype member of
from different origins, even within the same serotype.
the genus Orbivirus within the family Reoviridae, and
The emergence of new BTV variants is considered to
its primary route of transmission among sheep and
be driven by reassortment of RNA segments (i.e., ge-
other ruminants is via the arthropod vector Culicoides
netic shift),24,30,31 whereas individual gene segments
(midge). Cattle are suspected to be the predominant
evolve independently by genetic drift due to immu-
reservoir for this virus, as BTV infection is asymptom-
nological pressure from the infected host.6
atic in cattle, but results in a prolonged viremia.8,9 The
The distribution of Bluetongue disease is deter-
BTV genome consists of 10 double-stranded RNA
mined by the geographic distribution of the arthropod
segments that encode 7 structural proteins (VP1 to
vector and includes both tropical and temperate areas,
VP7) and 4 nonstructural (NS1, NS2, NS3, and NS3a)
including Africa, southern Asia, Australia, the Middle
proteins. Not only is there marked genetic variation
East, and the Americas. Due to the serious socioeco-
among the 24 known BTV serotypes, but also among
nomic consequences of BTV outbreaks on the inter-
the virus strains within each serotype.7,12 In addition,
national trade of animals and animal products, it has
this group of viruses exhibits genetically and geo- been included in the Office International des Epizo-
oties (OIE) list of notifiable diseases (formerly List
From the Laboratorio Central de Veterinaria, Algete, Spain A).25 Epizootic episodes of BTV, which occur infre-
(Jiménez-Clavero, Agüero, San Miguel, Mayoral, Cruz López, Ru- quently, result in large losses through required control
ano, Romero, Gómez-Tejedor), and Istituto Zooprofilattico Speri- measures of infected and cohoused livestock. In au-
mentale dell’Abruzzo e del Molise ‘‘G. Caporale,’’ Teramo, Italy
tumn 2003, several outbreaks of BTV serotype 4 virus
(Monaco, Polci, Savini).
1Corresponding author: Miguel Angel Jiménez-Clavero, Departa- were reported in the western Mediterranean region
mento de Enfermedades Emergentes, Laboratorio Central de Veter- (Corsica, Sardinia, and Menorca) (OIE-Handistatus II,
inaria, Ctra. Algete km 8, 28110, Algete, Madrid, Spain. http://www.oie.int/hs2 [accessed June 2005]) and BTV
7

Downloaded from vdi.sagepub.com by guest on May 21, 2011

8 Jiménez-Clavero et al.
serotype 2 outbreaks had been previously reported in
this area in 1999–2000.13,22,38 Although BTV had never
been detected in this area before 1999, the presence of
the Culicoides vectors23,32,37 and theoretical modeling
based on climate data37 and satellite remote sensing35
predicted that this region was at high risk for BTV
epizootic infections. In autumn 2004, these predictions
were borne out by new epizootic outbreaks of BTV
serotype 4, first reported in northern Morocco, and
soon after in the Iberian Peninsula, which had been
free of BTV since the 1950s. Other areas of the Med-
iterranean region where BTV outbreaks have been re-
ported in the last 7 years include Albania, Algeria,
Bosnia and Herzegovina, Bulgaria, Croatia, Cyprus,
Greece, Israel, Italy (mainland), Kosovo, Macedonia,
Serbia and Montenegro, Tunisia, and Turkey (OIE-
Handistatus II, http://www.oie.int/hs2 [accessed June
2005]).
The speed of the assays to detect BTV is directly
related to the ability to detect viremic animals and
therefore to limiting the spread of disease. Viremia can
be demonstrated in blood of infected animals by either
virus isolation or nucleic acid detection methods. Al-
though virus isolation in embryonated chicken eggs is
reliable and sensitive, it is technically cumbersome and
requires significantly longer to yield a result than nu-
cleic acid–based detection assays. For these reasons,
the latter have become the method of choice for BTV
detection. Several reverse transcription–polymerase
chain reaction (RT-PCR) methods have previously
been described,1–4,10,15,17,33 and the BTV segment 5 (en-
coding the NS1 protein) is the most commonly tar-
geted gene due its high degree of conservation across
BTV serogroups (segment 10 has also been used).
Current RT-PCR methods for BTV detection are rapid
and show satisfactory sensitivity and specificity; how-
ever, this methodology is not well suited to high-
throughput analysis, limiting its use in large-scale ep-
idemiological surveillance. For these reasons, we have
examined the use of real-time fluorogenic RT-PCR
methodologies in a 96-well format for high-throughput
sample monitoring.
We developed a real-time fluorogenic RT-PCR
method using a 59-Taq nuclease-39 minor groove bind-
er18 (TaqManq MGB) DNA probe for the detection of
BTV in a 96-well format. We then evaluated the use-
fulness of the assay using laboratory and previously
characterized BTV serotypes (isolated from western
Mediterranean outbreaks) and tested the assay against
samples from recent Spanish BTV outbreaks.
Materials and methods
Viruses, vaccines, cells, and virus propagation in
cell cultures
The following BTV strains were used in this study: pro-
totype strains for all 24 BTV serotypes from the European
Downloaded from vdi.sagepub.com by guest on May 21, 2011
Union (EU) reference laboratory for BTV (Pirbright, UK)
(http://www.iah.bbsrc.ac.uk/dsRNApviruspproteins/ReoID/
BTV-isolates.htm [accessed June 2005]); field isolates from
the Mediterranean region: SPA2000 (Majorca, Spain) and
SAD2000 (Sardinia, Italy), both belonging to serotype 2;
SPA2003 (Menorca, Spain), SAD2003 (Sardinia, Italy),
SPA2004 (Cádiz, Spain), and MOR2004 (Morocco), belong-
ing to serotype 4; ITL2002 (Puglia, Italy), belonging to se-
rotype 16; and live attenuated monovalent vaccines for se-
rotypes 2 and 4 (OBPa, Onderstepoort, South Africa). Virus-
es were propagated and virus concentrations were deter-
mined by microtitration assay28 using Vero cells, which were
cultured in Eagle medium (EMEM) supplemented with L-
glutamine, antibiotics (100 U/ml penicillin, 100 mg/ml strep-
tomycin) and 5% fetal calf serum. Assay specificity was as-
sessed using phylogenetically or symptomatically related vi-
ruses (or both): African horse sickness virus (AHSV sero-
type 4, isolate SPA’87, from the National Reference
Laboratory for African Horse sickness virus, Central Veter-
inary Laboratory, Algete, Spain); epizootic hemorrhagic dis-
ease virus (EHDV North American prototype serotypes 2
and 4)c; foot-and-mouth disease virus, FMDV serotypes A,
O, C, Asia-1, SAT-1, SAT-2, and SAT-3d; and contagious
ecthyma virus (field isolate, Central Veterinary Laboratory,
Algete, Spain, unpublished).
Samples
Ethylenediamine tetraacetic acid was used to stop the co-
agulation of blood collected from sheep or cattle suspected
of having BTV and from sentinel cattle during recent out-
breaks in Spain during either October–December 2003
(Mediterranean island of Menorca, Balearic Islands) or Oc-
tober–December 2004 (mainland [Andalusia and Extremad-
ura]) (OIE-Handistatus II, http://www.oie.int/hs2 [accessed
June 2005]). Tissue samples (spleen, heart blood, and gut)
from a sheep fatally infected with BTV during one of these
outbreaks were also tested. Virus isolated from this sheep
was identified as serotype 4 by the European Reference Lab-
oratory for BTV at Pirbright, UK, and is referred to as
SPA2003 isolate in the Results section. Control ovine blood
samples were obtained from 50 healthy BTV-seronegative
(as determined by enzyme-linked immunosorbent assay
[ELISA]b testing) sheep from areas where BTV has never
been reported. Control bovine blood samples were obtained
from 300 healthy BTV ELISAb-negative cattle, used in the
Spanish surveillance program for BTV, in areas where the
disease was absent at the time of testing.
Sample processing and total nucleic acid extraction
Single tube-spin protocol. Five hundred microliters of
each blood sample was lysed with 1 ml of sterile water,
incubated for 10 minutes on ice, and then centrifuged at
16,000 3 g for 5 minutes at 48C. The supernatant was then
removed and the pellet was resuspended in 0.2 ml of binding
buffer that had been provided by the High Pure Viral (HPV)
nucleic acid extraction kit.e The total RNA extraction was
completed as indicated in the manufacturer’s instructions us-
ing 50 ml as the elution volume. Tissue samples (approxi-
mately 0.5 g) were homogenized in 1 ml of phosphate-buff-
ered saline (PBS) and following a 10-minute centrifugation
 High throughput detection of bluetongue virus by real-time RT-PCR
at 16,000 3 g, 1 volume (0.2 ml) of supernatant was mixed
with 1 volume of binding buffer (from the same kit as
above), and nucleic acid extraction was achieved in the same
way. Total RNA extraction of infected cell culture superna-
tants containing BTV serotypes or control viruses at titers
of at least 1 3 104 TCID50 /ml (starting volume, 20–200 ml),
was achieved in the same way.
Nucleic acid extraction in 96-well format. Two separate
formats were used: 1) The Nucleospin Multi-96 virus nucleic
acid extraction kitf was applied as follows: 0.1 ml of blood
and 0.2 ml of distilled water was added to each well in the
96-well lysis microplate. Following centrifugation as above,
the cell pellet that was resuspended in 0.4 ml of RAV1 buffer
plus 20 ml (1 mg/ml) of proteinase K and RNA extraction
completed according to the manufacturer’s instructions. 2)
High Pure viral nucleic acid extraction kite in 96-well format
(HPV-96): samples were prepared essentially according to
the manufacturer’s instructions except that Whatman 96-well
Unifilter microplatesg were used instead of the spin columns
provided in the kit. The final protocol was as follows: 0.1-
ml blood samples were lysed in the same way as described
above for Nucleospin Multi-96, but using a Whatman 800-
ml round-bottom 96-well Uniplate.h The cell pellet was re-
suspended in 0.1 ml of binding buffer plus 20 ml (1 mg/ml)
of proteinase K (provided in the kit), and subjected to a 10-
minute incubation at 728C, followed by the addition of 50
ml of isopropanol to each well. After gentle mixing, the en-
tire contents of each well was removed from the 96-well
Uniplate, transferred to a Unifilter microplate,g and placed
over another 800-ml round-bottom 96-well Uniplateh for col-
lection of the filtrates, following centrifugation for 15 min-
utes at 2,250 3 g. The filtrates were discarded and 250 ml
of inhibitor buffer (provided in the kit) was added to each
filter well and the plate was centrifuged for 4 minutes at
2,250 3 g. The filter wells were then washed twice with 250
ml of wash buffer (provided in the kit) and subjected to 2
centrifugation steps for 4 minutes and 15 minutes at 2,250
3 g. The filtrate was discarded and the filters were then dried
by centrifugation at 2,250 3 g for a further 5 minutes. The
recovery plate was changed to a Whatman 250-ml V-bottom
96-well Uniplate,i and 50 ml of nuclease-free water was add-
ed to each filter well and the plate centrifuged for 10 minutes
at 2,250 3 g to elute the nucleic acids from the filters. The
eluted nucleic acids were either immediately analyzed by
RT-PCR or stored at 2208C for future use.
Comparison between single-tube and 96-well nucleic acid
extraction methods. BTV-seropositive blood samples (1
from sheep, 2 from cattle) were serially diluted in BTV-
seronegative blood from the same species, whereas the vac-
cine was diluted in PBS. All samples were subjected to nu-
cleic acid extraction in parallel.
Nested RT-PCR for BTV and RT-PCR for
other viruses
Nested RT-PCR for BTV detection was performed ac-
cording to the method described by Aradaib et al.2 We also
used PCR or RT-PCR methods already described for the de-
tection of African horse sickness virus,34 epizootic hemor-
rhagic disease virus,2 contagious ecthyma virus,14 and foot-
and-mouth disease virus.29 In the case of control viruses,
Downloaded from vdi.sagepub.com by guest on May 21, 2011
9
nucleic acid extraction was performed as described in the
single tube-spin protocol (see above).
Sequence analysis
To analyze the detection range of the real-time RT-PCR
method in more detail, the RNA regions corresponding to
nucleotide positions 316–790 (numbered according to
GenBank AY137387) within segment 5 were sequenced for
the following isolates: BTV-2 SPA2000, BTV-4 SPA2003,
BTV-4 SPA2004, BTV-4 MOR2004, BTV-4 ITL2002, BTV-
4 (vaccine straina), BTV-4 reference strain, BTV-16 refer-
ence strain, BTV-24 reference strain, BTV-19 reference
strain, BTV-10 reference strain, BTV-13 reference strain,
and BTV-7 reference strain. RNA sequence was determined
following amplification by nested RT-PCR,2 which was bi-
directionally sequenced using the inner primers of the nested
reaction, the Big Dye Terminator (version 3.1) Cycle Se-
quencing Kit, j and an ABI 3730 XL DNA Analyzer.k Elec-
tropherograms were analyzed using the Sequencing Analysis
(version 5.1) softwarel and sequences have been submitted
to GenBank under accession numbers AY741396 (BTV-2
SPA2000), AY741397 (BTV-4 SPA2003), DQ098094 (BTV-
4 ITL2002), DQ098092 (BTV-4 MOR2004), DQ098093
(BTV-4 SPA2004), DQ098095 (BTV-4 vaccine straina),
DQ098096 (BTV-4 reference strain), DQ098097 (BTV-7 ref-
erence strain), DQ098098 (BTV-10 reference strain),
DQ098099 (BTV-13 reference strain), DQ098100 (BTV-16
reference strain), DQ098101 (BTV-19 reference strain), and
DQ098102 (BTV-24 reference strain). The sequences ob-
tained were aligned with the following BTV NS1 sequences
available in GenBank: AY137387 (BTV-2 Corsica 2002),
Y00422 (BTV-10, US prototype strain), X17041 (BTV-17,
US prototype strain), M97681 (BTV-11, US prototype
strain), M97762 (BTV-13, US prototype strain), M97680
(BTV-2, US prototype strain), AY462225 (BTV-2 KN, Tai-
wan), and X56735 (BTV-20, Australia) using the CLUSTAL
W 1.6 program.36
Real-time fluorogenic RT-PCR
Oligonucleotide primers and a Taqman-MGB fluorogenic
probe were designed using Primer Express (version 2.0.0)
softwarem based on the BTV-2 (SPA2000) and BTV-4
(SPA2003) isolate sequences; however, homology to the
same region of the BTV genome (GenBank accession num-
bers AY137387, AY138895, M97762, X17041, X15891,
Y00422, M97681, M97680, and X56735) were also con-
firmed. The CLUSTAL W 1.6 program36 was used to design
conserved sequence primers: forward (59-GTTGAGAGA-
CAAATTAACACATGTCC-39) and reverse (59-AATGCT
TCGCAAAATCATCCAT-39). These primers amplified a re-
gion comprising nucleotides 606–723 of BTV segment 5,
and a fluorogenic TaqMan-MGB probe (6-FAM-CGATT-
CAGCTGATCAAT-MGB) was designed to hybridize nucle-
otides 676–692 (nucleotide position numbering according to
the AY137387 sequence). The final protocol consisted of an
initial denaturation step during which primers (final concen-
tration: 0.5 mM each) and viral RNA (2 ml) were heated at
958C for 5 minutes in a volume of 7 ml of RNAase-free
water, and then chilled on ice. This denaturation step was
followed by the addition of 18 ml containing (per reaction)
10 Jiménez-Clavero et al.

Figure 1. Comparative sensitivity analysis of BTV-2 RNA (SPA2000 isolate) using fluorogenic real-time RT-PCR and nested RT-PCR
methods. Tenfold dilutions of the viral extract were subjected to both real-time fluorogenic RT-PCR and nested RT-PCR analysis in parallel.
The results of the fluorogenic RT-PCR analysis are plotted as curves of fluorescence (matching the course of the amplification) as a function
of PCR cycle number. The insert within the plot shows the result of the nested RT-PCR as a photograph of gel electrophoresis stained with
ethidium bromide. The equivalent viral units (TCID50/ml) of each dilution are indicated both on the right side of the plot and above the
corresponding lanes in the gel. The same experiment was repeated twice with identical results.

12.5 ml of TaqMan 23 universal PCR master mix, 0.6 ml of
403 Multiscribe and RNase inhibitor mix, both from the
commercial RT-PCR amplification kit TaqMan One-step RT-
PCR Master Mix Reagents,n 0.12 ml of the TaqMan-MGB
probe (final concentration: 0.25 mM), and RNase-free water.
The final reaction volume was 25 ml.
The reactions were analyzed in 96-well optical PCR plates
using an ABI PRISM 7000 Sequence Detection System
(SDSo) apparatus and the SDS 7000 (version 1.1) softwarep.
Reverse transcription was carried out at 488C for 25 minutes
followed by 10 minutes at 958C (‘‘hot start’’) and 40 PCR
cycles of 15 seconds at 958C and 1 minute at 618C (total
reaction time 2 hours 11 minutes). Samples were considered
positive for BTV if they yielded Ct values lower than 40
(threshold set automatically following the instructions of the
SDS 7000 analysis software, version 1.1). The sensitivity of
the fluorogenic real-time RT-PCR assay was assessed using
10-fold dilutions from the control BTV-2 isolate RNA
(SPA2000 isolate), comparing detection of viral extract for
both real-time fluorogenic RT-PCR and nested RT-PCR anal-
ysis in parallel.
Sensitivity was determined as the highest dilution giving
a positive result: for nested RT-PCR this was the highest
dilution at which a band was visible on an ethidium bro-
mide–stained gel; for real-time RT-PCR this was the highest
dilution to yield a Ct value below 40. All determinations
were confirmed by repeating the experiment at least once.
The sensitivity of the assay including the RNA extraction
was also assessed by repeating the above experiment on 10-
fold dilutions of the viral stock, which were then processed
for nucleic acid extraction and analyzed by both the real-
time and nested RT-PCR methods.
Results
Detection of BTV by a new real-time RT-PCR
method was compared with an existing nested RT-PCR
method (Fig. 1). Both methods were able to detect a
1025 dilution of the BTV RNA (equivalent to 0.0054
TCID50 /ml of sample) extracted from 1,080 TCID50 of
cell-cultured BTV serotype 2 (SPA2000). As shown in
Fig. 2, the detection achieved by the real-time RT-PCR
assay showed a linear relationship between signal and
the concentration of template present in the sample
(correlation coefficient of 0.9948, and a slope of
23.334) over a range of 102 to 1023 TCID50 /ml. To
assess whether the nucleic acid extraction step affected
the performance of the method, 10-fold dilutions of
the viral stock (instead the purified RNA) were also

Downloaded from vdi.sagepub.com by guest on May 21, 2011

 High throughput detection of bluetongue virus by real-time RT-PCR 11

Figure 2. Linearity and efficiency of the real-time RT-PCR assay for BTV. The experiment shown in Fig. 1 is plotted here as Ct
(threshold value) as a function of quantity of viral RNA (equivalent TCID50 infectious units per milliliter) on a log scale.

analyzed. A comparable level of sensitivity (0.001
TCID50 /ml) and linearity (dynamic range, 102 to 1023;
r2, 0.9941; slope, 23.592) was obtained, indicating
that the nucleic acid extraction does not significantly
affect the overall performance of the method, at least
with this type of sample.
The specificity of the new method was determined
by analyzing reference BTV isolates from all 24 se-
rotypes (obtained from the EU reference laboratory for
BTV disease, Pirbright, UK), as well as vaccine strains
(OBP, Onderstepoort, South Africa) and field variants
isolated in recent years from the Mediterranean region.
We also determined whether our real-time RT-PCR
method cross-reacted with other members of the Or-
bivirus genus (AHSV serotype 4, EHDV serotypes 2
and 4); viruses that cause symptoms similar to blue-
tongue (contagious ecthyma virus, a member of Pox-
viridae); or foot-and-mouth disease virus (serotypes A,
O, C, Asia, SAT1, SAT2, and SAT3; Picornavirus fam-
ily) (Table 1). The real-time RT-PCR assay detected
all recent BTV field variants from the Mediterranean
region (serotypes 2, 4, and 16); vaccine strains from
BTV serotypes 2 and 4, and 15 out of 24 serotype
BTV reference strains. No cross-reactivity was ob-
served for non-BTV virus samples by our real-time
RT-PCR assay, regardless of whether they belong to
the Orbivirus genus or have similar pathogenic se-
quelae. However, the integrity of the nucleic acids iso-
lated from the negative control viruses was confirmed
by positive results for their own specific PCR or RT-
PCR detection assays (not shown).
Although the BTV serotype 4 reference strain was
not detected by our real-time RT-PCR assay, all other
BTV serotype 4 field isolates and the vaccine strain
were detected (Table 1). Similarly, a field isolate of
BTV serotype 16 was detected even though the ref-
erence strain was not (Table 1). These results indicate
that the inability to detect the reference strains does
not rule out its effectiveness at detecting these sero-
types in the field. The failure of our assay to detect

Downloaded from vdi.sagepub.com by guest on May 21, 2011

12 Jiménez-Clavero et al.

Table 1. Specificity of the real-time fluorogenic RT-PCR assay in the BTV-4 reference strain, for which a single mis-
for BTV. Analysis of BTV cell culture supernatants, vaccines, and match in the probe region and 2 more in the forward
other viruses to assess specificity.
(59) primer resulted in a loss of detection. In other
Virus (serotype) Isolate/origin Result nondetected reference strains (serotypes 7, 10, 13, 16,
BTV-1 494 2E (reference strain) positive
19, and 24), the differences in nucleotide sequence
BTV-2 reference strain positive ranged from 1 to 3 mismatches in the forward (59)
BTV-2 field isolate SPA/2000 positive primer, 1 to 5 mismatches in the probe, and at least 1
BTV-2 field isolate SAD/2000 positive mismatch in the reverse (39) primer. It is remarkable
BTV-2 vaccine (South Africa) positive that there was a low homology in the target region
BTV-3 reference strain positive
BTV-4 reference strain negative
between the BTV-16 reference strain and the BTV-16
BTV-4 field isolate SPA2003 positive field isolate used in this study. Table 2 shows the nu-
BTV-4 field isolate SAD2003 positive cleotide sequence alignments of BTV serotypes used
BTV-4 field isolate SPA2004 positive in this study, but also includes the available sequences
BTV-4 field isolate MOR2004 positive for prototype strains from US BTV serotypes, BTV-2
BTV-4 vaccine (South Africa) positive
BTV-5 reference strain positive
from Taiwan, and BTV-20 from Australia. Given the
BTV-6 reference strain positive homology, we would expect viruses showing 100%
BTV-7 reference strain negative identity within the probe region (US BTV-11, -13, and
BTV-8 reference strain positive -17) and almost complete nucleotide sequence identity
BTV-9 reference strain positive within the primer regions would be detected, whereas
BTV-9 vaccine (South Africa) positive
BTV-10 reference strain negative
those BTV strains showing at least 1 mismatch within
BTV-11 reference strain positive the probe region (US BTV-2, and BTV-10, Australian
BTV-12 reference strain positive BTV-20, and Taiwan BTV-2) would likely remain un-
BTV-13 reference strain negative detected. These expectations are supported by a much
BTV-14 reference strain positive larger number of mismatches in the primer and probe
BTV-15 reference strain positive
BTV-16 reference strain negative
regions in published sequences for EHDV and AHSV
BTV-16 puglia 2002 positive (not shown), which were not detected by our real-time
BTV-17 reference strain positive RT-PCR assay (Table 1).
BTV-18 reference strain positive To assess the performance of the new BTV detec-
BTV-19 reference strain negative tion method under normal diagnostic laboratory con-
BTV-20 reference strain negative
BTV-21 reference strain negative
ditions, 76 sheep and 21 cattle blood samples from the
BTV-22 reference strain positive 2003 Menorca outbreak (previously identified as BTV-
BTV-23 reference strain positive positive by the nested RT-PCR method) were analyzed
BTV-24 reference strain negative by real-time fluorogenic RT-PCR. In addition, spleen,
AHSV-4 SPA/1987 negative heart blood, and gut homogenates from a symptomatic
EHDV-2 reference strain negative
EHDV-4 reference strain negative
sheep that died as a consequence of BTV disease in
Contagious ecthyma virus field positive sample negative this outbreak were also tested. As a control, blood
FMDV-A reference strain negative samples from 50 BTV-seronegative sheep in BTV-free
FMDV-O reference strain negative areas were also tested by nested RT-PCR and the new
FMDV-C reference strain negative real-time fluorogenic RT-PCR. Similarly, 300 BTV-se-
FMDV-Asia reference strain negative
FMDV-SAT1 reference strain negative
ronegative blood samples collected from sentinel cattle
FMDV-SAT2 reference strain negative in BT-free areas during the 2004 Spanish BTV sur-
FMDV-SAT3 reference strain negative veillance program were also tested. As shown in Table
3, there was complete agreement between the results
obtained with both nested and real-time fluorogenic
some BTV isolates was investigated by comparing the RT-PCR methods. All 97 BTV blood samples found
sequence of the primer and probe target regions from positive by the nested RT-PCR assay were also posi-
undetected BTV isolates and a selection of the detect- tive by the real-time fluorogenic RT-PCR method.
ed viruses (Table 2). Although the primer binding re- BTV was detected by both methods from spleen and
gions were found to allow 1 (e.g., BTV-2 SPA2000) heart blood, but not gut tissue samples. All BTV-neg-
or 2 (e.g., BTV-4 and BTV-2 vaccine strains, BTV-16 ative samples yielded negative results in both assays
ITL2002) mismatches without loss of detection, higher (i.e., a zero false-positive rate).
stringency was found for the probe-binding sequence, The real-time fluorogenic RT-PCR method can be
as a single mismatch resulting in loss of detection for performed in a 96-well format, and this feature opens
1 isolate. The lowest number of nucleotide sequence the possibility of using RT-PCR methodology in the
changes that rendered a strain nondetectable was found high-throughput screening of field samples. As nucleic

Downloaded from vdi.sagepub.com by guest on May 21, 2011

 Table 2. Primer and probe-binding sequences from genome segment 5 from different BTV isolates, and correlation with real-time RT-PCR (RRT-PCR) detection.

GenBank Primer 39 (reverse

accession RRT-PCR Primer 59 Taqman MGB-probe complementary sequence)
BTV isolate† number detection 606-631* 676–692* 702–723*

BT2 COR2002 AY137387 not tested GTTGAGAGACAAATTAACACATGTCC CGATTCAGCTGATCAAT ATGGATGATTTTGCGAAGCATT

BT4 SPA2003 AY741397 1 —————————————————————————— ————————————————— ——————————————————————
BT4 SPA2004 DQ098093 1 —————————————————————————— ————————————————— ——————————————————————
BT4 MOR2004 DQ098092 1 —————————————————————————— ————————————————— ——————————————————————
BT2 SPA2000 AY741396 1 ———————————————————————C—— ————————————————— ——————————————————————
BT2 VAC AY138895 1 ————————G————————————————— ————————————————— —————————————————A————
BT4 VAC DQ098095 1 ———————————————————————C—— ————————————————— ————C—————————————————
BT4 REF DQ098096 2 —————————————————T—————C—— ——————————A—————— ——————————————————————
BT16 IT2002 DQ098094 1 ————————G————————————————— ————————————————— —————————————————A————
BT16 REF DQ098100 2 ——A—————G————————T———————— —A——C——AA————A——— ———————————C————————C—
BT24 REF DQ098102 2 —————————————————T—————C—— ——————————A—————C ——————————————————————
BT19 REF DQ098101 2 ———————————G—————T—————C—— ——————————A—————— —————————N—NNN————————
BT10 REF DQ098098 2 ————————G——————————————C—— —————————————T——— ——————————————————————
BT13 REF DQ098099 2 ————————G————————————————— ————————T———————— —————————————————A————
BT7 REF DQ097097 2 ————————G——————————————C—— —N————NNT———————— —————N——N————————A————
BT10 US Y00422 not tested ———————————————————————C—— ——————————A—————— ——————————————————————
BT17 US X17041 not tested ———————————————————————C—— ————————————————— ——————————————————————

Downloaded from vdi.sagepub.com by guest on May 21, 2011

BT11 US M97681 not tested ———————————————————————C—— ————————————————— ———————————————————G——
BT13 US M97762 not tested ———————————————————————C—— ————————————————— ——————————————————————
BT2 US M97680 not tested ———————————————————————C—— —A——————————————— ——————————————————————
BT2 Taiw AY462225 not tested ————————G————————T———————— —A——C——AA————A——— ——————————————————————
BT20 AUS X56735 not tested ————————G——G——C—————T——C—— —A—————A——A——A——C ——————————————A——A————
* Nucleotide position (numbering according to GenBank AY137387 sequence).
High throughput detection of bluetongue virus by real-time RT-PCR

† Isolates marked as ‘‘VAC’’ are vaccine strains; ‘‘REF’’ are the prototype strains from the EU reference collection; ‘‘US’’ are US prototype strains, ‘‘Taiw’’ is a BTV-2 isolate from
Taiwan, and ‘‘AUS’’ is the Australian BTV-20 isolate.
13
14 Jiménez-Clavero et al.

Table 3. Assessment of the performance of the real-time fluorogenic RT-PCR assay for BTV detection using clinical samples from the
Menorca 2003 outbreak, as well as BTV-free control samples.

Real time fluorogenic

Nested RT-PCR RT-PCR
Type of
sample Origin n Positive Negative Positive Negative

ovine blood outbreak 76 76 0 76 0

ovine blood BTV-free 50 — — 0 50
bovine blood outbreak 21 21 0 21 0
bovine blood BTV-free (sentinel) 300 — — 0 300
ovine heart BTV-free (sentinel) 1 1 0 1 0
ovine gut BTV-free (sentinel) 1 0 1 0 1

acid extraction represents a bottleneck when large
numbers of samples are to be analyzed by RT-PCR,
the efficacies of 2 high-throughput (96-well format)
nucleic acid extraction methods were also evaluated.
Tenfold dilutions of each of 4 different samples, 3 of
them field BTV-positive blood samples from the recent
BTV-4 Menorca outbreak (1 from sheep, 2 from cat-
tle), and a control BTV-2 attenuated vaccine isolate
were subjected to nucleic acid extraction by the 3
methods in parallel, and analyzed by real-time RT-
PCR for BTV RNA. As shown in Table 4, the results
obtained with both high-throughput RNA isolation
methods were comparable to those obtained with the
conventional single-tube method; if differences in start
volume and elution volumes are taken into account,
the high-throughput methods appear to have a slightly
higher yield than the single spin-column protocol (Ta-
ble 4). However, Ct values for 1 of the bovine blood
samples (cattle blood-1) and the vaccine control were
higher than expected at the higher dilutions for all
RNA extraction methods, suggesting that further op-
timization of the nucleic acid extraction step may be
required for these types of samples. These findings
were confirmed by reanalysis on a separate day.
Based on the satisfactory correlation between results
from the new fluorogenic real-time RT-PCR method
and the RT-PCR method currently used in our labo-
ratory, and the high-throughput capacity of the new
assay, a decision was made to apply the real-time fluo-
rogenic RT-PCR in the large-scale monitoring of BTV
circulation in Spain during 2004 and 2005. A total of
47,532 blood samples (34,170 cattle and 12,142 sheep)
were tested between January 2004 and June 2005.
Some of these samples came from the surveillance
program established in Spain in 2004 using strategi-
cally located sentinel cattle. This surveillance was suc-
cessful in detecting a BTV outbreak in cattle on the
Spanish mainland in October 2004, 9 days before it
was detected in sheep. In the period between October
2004 and March 2005, after the BTV outbreak in pen-
insular Spain was first detected, 26,787 blood samples
have been tested in our laboratory by this technique,

Table 4. Comparison of the efficiency of 3 nucleic acid extraction methods, 2 high-throughput (96-well format) systems (Nucleospin-
96 and HPV-96), and 1 conventional single tube-spin column (HPV-col) kit.

HPV-col
HPV-96 (Ct*) Nucleospin-96 (Ct*)
(Ct*)
Sample Dilution Observed Observed Normalized† Observed Normalized†

BTV-2 vaccine 1:10 28.83 27.92 25.62 26.93 23.63

1:100 33.40 31.82 29.52 33.39 30.09
1:1000 37.87 37.01 34.71 38.80 35.50
1:10000 not detected not detected not detected
Sheep blood-1 1:1 33.16 35.08 32.78 35.82 32.52
1:10 35.64 38.21 35.91 38.82 35.52
1:100 not detected not detected not detected
Cattle blood-1 1:1 29.50 29.76 27.40 31.15 27.85
1:10 37.21 35.01 32.71 35.56 32.26
1:100 not detected not detected not detected
Cattle blood-2 1:1 32.83 33.70 31.40 34.00 30.70
1:10 35.72 38.90 36.60 37.92 34.62
1:100 not detected not detected not detected
sample volume (ml) 500 100 100
elution volume (ml) 50 50 100
* Ct: Threshold cycle.
† The normalization accounts for the different starting and elution volumes of each method, indicated in the bottom of the table.

Downloaded from vdi.sagepub.com by guest on May 21, 2011

 High throughput detection of bluetongue virus by real-time RT-PCR
which has reached as high as 2,635 samples in a single
week.
Discussion
Real-time RT-PCR methods (especially those based
on fluorogenic probe hybridization, such as TaqMan
probes,19 molecular beacons,20 and fluorescence reso-
nance energy transfer (FRET) probes26) are gaining
popularity in the diagnosis of animal viral diseases. As
well as providing higher sensitivity and comparable,
or even higher, specificity than traditional nucleic acid
detection methods, they are much faster and less cum-
bersome because they do not require electrophoresis
in agarose gels. In addition, some real-time instru-
ments allow the use of 96-well plate formats, which
further increases the capacity and speed of analysis.
The BTV diagnostic assay developed in this study is
suitable for screening large numbers of samples con-
sistent with those analyzed in recent BTV outbreaks.
The only real-time RT-PCR method for BTV previ-
ously described in the literature is a recent protocol
that restricted its analysis to the differentiation of vac-
cine and field variants of a single BTV serotype (BTV-
2).26 When attenuated BTV vaccines are used to pro-
tect livestock from BTV infection, the ability to dis-
tinguish between wild-type and vaccine strains of BTV
makes it possible to know whether an RT-PCR positive
result is derived from an acquired wild-type virus or
is the result of vaccination. While the real-time RT-
PCR that distinguishes wild-type infections from vac-
cinations is a useful diagnostic tool, it has a different
purpose than our real-time RT-PCR method, which is
the first method designed to screen field samples for a
wide range of BT viruses. Furthermore, the method
developed in this study represents a great improvement
over previous conventional (i.e., nonfluorogenic) RT-
PCR methods, because it can be performed on a large
scale to monitor virus circulation in animal popula-
tions. The sensitivity of the new assay was comparable
to that of the established nested RT-PCR protocol (Fig.
1) that can detect 0.1 fg of BTV RNA.2 This level of
sensitivity is also comparable to virus isolation in em-
bryonated chicken eggs,2 which takes considerably
longer to yield results. However, results of PCR-based
BTV diagnosis, including the fluorogenic method de-
scribed here, need to be interpreted with caution as
BTV has been detected by RT-PCR from the blood of
infected calves and sheep for at least 30 days, and
sometimes longer (up to 90 days) after the virus iso-
lation ceases to be positive.5,16,21 Transmission of BTV
by biting midges fed with this noninfectious blood,
even though it is RT-PCR positive, is poor.5,16,21 Thus
detection of virus-specific nucleic acid by these meth-
ods indicates recent viral infection, but does not nec-
Downloaded from vdi.sagepub.com by guest on May 21, 2011
15
essarily indicate the presence of contagious virus in
the animal.
The data presented herein demonstrates that this
new method is capable of detecting a wide range of
BTV isolates, including those currently circulating in
the western Mediterranean. However, 9 out of 24 ref-
erence BTV serotypes strains were not detected. Al-
though EU reference strains of serotypes 4 and 16
were among those not detected, our assay did detect
all 4 BTV-4 field isolates previously identified, 1 vac-
cine BTV-4 strain, and the only BTV-16 field isolate
available. We determined the primer and probe se-
quence requirements for detection by comparing the
gene segment 5 sequences between detected and un-
detected BTV strains. Although this region is fairly
highly conserved, it does exhibit enough sequence var-
iation among isolates to render some of them unde-
tectable. Our investigation found that minor nucleotide
changes within the probe region were more detrimen-
tal to detection by the assay than changes in the prim-
er-binding region. It is important to note, however, that
the fewest changes resulting in loss of signal included
1 mismatch within the probe region as well as 2 mis-
matches in the primer-binding region, whereas a single
nucleotide mismatch within each of the primer-hybrid-
izing regions did not cause loss of detection. The BTV-
4 undetectable EU reference BTV-4 strain and the de-
tectable vaccine strain differed only by 2 nucleotides
within the target region, 1 of which is located in the
probe-hybridizing region. The ability of this method
to detect a majority of BTV serotypes is likely due to
its detection of RNA segment 5, rather than segment
2, which contains the serotype determinant sequence.27
It is noteworthy that all nondetected BTV variants had
also been previously isolated from regions that were
geographically or temporally distant (or both) from the
variants currently circulating in the Mediterranean re-
gion.
Taken together, these results suggest that the devel-
opment of a real-time RT-PCR with fluorogenic probes
that is capable of detecting all BTV variants might not
be an easy task. However, our assay is currently used
as the standard to identify new BTV outbreaks and
monitor the spread of epizootic infections in Spain.
This approach can be adapted to other geographic lo-
cations by 1) identifying the local BTV variants cir-
culating in the affected area, 2) obtaining sequence
data from conserved regions (here we propose a short,
conserved stretch within RNA segment 5) of the BTV
variants identified, and 3) designing a set of primers
and fluorogenic Taqman probe for real-time RT-PCR,
taking into account that a single nucleotide mismatch
in the probe-binding region could result in a dramatic
loss of detection. In this regard, the use of an MGB
group linked to the Taqman probe can be of great help,
16 Jiménez-Clavero et al.
because it increases the binding strength of the probe
to the nucleic acid,18 allowing the selection of shorter
target sequences. In this study, this approach was suc-
cessful at detecting all BTV variants currently circu-
lating in the western Mediterranean. Whether or not
our assay could be applied to other BTV epizootics
occurring in different parts of the world would depend
on the nucleotide sequence similarity within the primer
and probe-binding regions in RNA segment 5 of the
BTV variant(s) involved. For instance, based on nu-
cleotide sequence similarity, it is predicted that only 3
out of 5 US BTV prototype strains (BTV-11, -13, and
-17) are likely to be detectable by our assay.
The specificity of the new real-time fluorogenic RT-
PCR assay was further confirmed by the lack of de-
tection of non-BTV orbiviruses (AHSV and EHDV)
and phylogenetically unrelated viruses that cause sim-
ilar symptoms to BTV (foot-and-mouth disease virus
and contagious ecthyma virus). Consequently, this as-
say could be of great help in the differential diagnosis
of bluetongue disease, once it is ascertained that BTV
variants circulating in the affected region are detect-
able by this method.
The fluorogenic real-time RT-PCR assay described
here yields levels of sensitivity and specificity com-
parable to virus isolation and conventional nested RT-
PCR methods used for BTV nucleic acid detection. In
addition, the new assay presents 2 major advantages
over conventional nested RT-PCR methods. First, it
can be used in large-scale screening because of its abil-
ity to simultaneously analyze up to 96 samples per run.
In fact, the nucleic acid extraction protocol for 2
blocks of 96 samples can be carried out in less than 2
hours, which together with sample preparation and the
time required for each real-time RT-PCR (2 hours 11
minutes), gives a processing capacity of 192 samples
in approximately 6 hours. Currently, testing capacity
in the authors’ laboratories has been increased to up
to 500 blood samples per day by using 2 real-time
thermal cyclers working in parallel with 96-well
plates. With a working scheme like this, testing ca-
pacity reached 2,600 samples per week in peak periods
during the recent BTV outbreaks in Spain. Further op-
timization, including a fully automated system for nu-
cleic acid extraction, and adaptation to a recently avail-
able 384-well format, is ongoing in the authors’ lab-
oratories and testing capacity is expected to reach
1,000 samples per day. Second, the real-time fluoro-
genic RT-PCR is less susceptible than nested RT-PCR
to potential contamination problems, which often pre-
vent many laboratories from using nested RT-PCR
methods.
In summary, the real-time fluorogenic RT-PCR
method developed and applied in this study represents
a new analytical tool that allows large-scale monitor-
Downloaded from vdi.sagepub.com by guest on May 21, 2011
ing of the introduction and spread of BTV in a large
population of cattle and sheep at risk. This technique
is currently being used to monitor BTV outbreaks in
Spain.
Acknowledgements
We are indebted to O. Brad Spiller for critically reviewing
the manuscript, C. Hambling for providing BTV prototype
strains, M. El Harrak for providing the field samples from
which the MOR2004 BTV isolate was obtained, and W. C.
Wilson for providing EHDV isolates. We thank Roche Di-
agnostic Systems Spain, for advice and technical assistance
in the adaptation of the HPV nucleic acid extraction kit from
single column to 96-well format.
Sources and manufacturers
a. BTV live attenuated vaccines (serotypes 2 and 4), OBP Onder-
stepoort Biological Products, Onderstepoort, South Africa.
b. Bluetongue Virus Antibody test kit, VMRD, Pullman, WA.
c. EHDV North American prototype serotypes 2 and 4, kindly pro-
vided by W. C. Wilson, Arthropod-Borne Animal Disease Re-
search Laboratory, Laramie WY.
d. Foot-and-mouth disease virus, FMDV serotypes A, O, C, Asia-
1, SAT-1, SAT-2, and SAT-3, provided by the World Reference
Laboratory for foot-and-mouth disease, Institute for Animal
Health, Pirbright, UK.
e. High Pure Viral (HPV) Nucleic Acid extraction kit, Roche Di-
agnostics, Indianapolis, IN.
f. Nucleospin Multi-96 Virus nucleic acid extraction kit, Machin-
ery-Nagel, Düren, Germany.
g. 96-Well Unifilter GF/F microplate, Whatman, Clifton, NJ.
h. 800-ml round-bottom 96-well Uniplate, Whatman, Clifton, NJ.
i. 250-ml V-bottom 96-well Uniplate, Whatman, Clifton, NJ.
j. Big Dye Terminator (version 3.0) Cycle sequencing kit, Applied
Biosystems, Branchburg, NJ.
k. 3730 XL DNA Analyzer, Applied Biosystems, Branchburg, NJ.
l. Sequence Analysis (version 5.1) software, Applied Biosystems,
Branchburg, NJ.
m. Primer Express (version 2.0.0) software, Applied Biosystems,
Branchburg, NJ.
n. TaqMan One-step RT-PCR Master Mix Reagents, Applied Bio-
systems, Branchburg, NJ.
o. ABI PRISM 7000 Sequence Detection System SDS, Applied
Biosystems, Branchburg, NJ.
p. SDS 7000 (version 1.1) software, Applied Biosystems, Branch-
burg, NJ.
References
1. Akita GY, Chinsangaram J, Osburn BI, et al.: 1992, Detection
of bluetongue virus serogroup by polymerase chain reaction. J
Vet Diagn Invest 4:400–405.
2. Aradaib IE, Smith WL, Osburn BI, Cullor JS: 2003, A multiplex
PCR for simultaneous detection and differentiation of North
American serotypes of bluetongue and epizootic hemorrhagic
disease viruses. Comp Immunol Microbiol Infect Dis 26:77–87.
3. Aradaib IE, Schore CE, Cullor JS, Osburn BI: 1998, A nested
PCR for detection of North American isolates of bluetongue
virus based on NS1 genome sequence analysis of BTV-17. Vet
Microbiol 59:99–108.
4. Billinis C, Koumbati M, Spyrou V, et al.: 2001, Bluetongue
virus diagnosis of clinical cases by a duplex reverse transcrip-
tion PCR: a comparison with conventional methods. J Virol
Methods 98:77–89.
 High throughput detection of bluetongue virus by real-time RT-PCR
5. Bonneau KR, DeMaula CD, Mullens BA, MacLachlan NJ:
2002, Duration of viraemia infectious to Culicoides sonorensis
in bluetongue virus-infected cattle and sheep. Vet Microbiol 88:
115–125.
6. Bonneau KR, Mullens BA, MacLachlan NJ: 2001, Occurrence
of genetic drift and founder effect during quasispecies evolution
of the VP2 and NS3/NS3A genes of bluetongue virus upon pas-
sage between sheep, cattle, and Culicoides sonorensis. J Virol
75:8298–8305.
7. Bonneau KR, Zhang N, Zhu J, et al.: 1999, Sequence compar-
ison of the L2 and S10 genes of bluetongue viruses from the
United States and the People’s Republic of China. Virus Res
61:153–160.
8. Brewer AW, MacLachlan NJ: 1992, Ultrastructural characteriza-
tion of the interaction of bluetongue virus with bovine eryth-
rocytes in vitro. Vet Pathol 29:356–359.
9. Brewer AW, MacLachlan NJ: 1994, The pathogenesis of blue-
tongue virus infection of bovine blood cells in vitro: ultrastruc-
tural characterization. Arch Virol 136:287–298.
10. Dangler CA, De Mattos CA, De Mattos CC, Osburn BI: 1990,
Identifying bluetongue virus ribonucleic acid sequences by the
polymerase chain reaction. J Virol Methods 28:281–292.
11. Gould AR: 1987, The complete nucleotide sequence of blue-
tongue virus serotype 1 RNA3 and a comparison with other
geographic serotypes from Australia, South Africa and United
States of America, and with other orbivirus isolates. Virus Res
7:169–183.
12. Gould AR, Pritchard LI: 1990, Relationships amongst blue-
tongue viruses revealed by comparisons of capsid and outer coat
protein nucleotide sequences. Virus Res 17:31–52.
13. Gregory M, Zientara S, Hendrikx P: 2002, La fièvre catarrhale
du mouton en Corse en 2000 et 2001. Bulletin Epidémiologique
du Ministére de l’Agriculture et de la Pêche 4:1–3.
14. Inoshima Y, Morooka A, Sentsui H: 2000, Detection and diag-
nosis of parapoxvirus by the polymerase chain reaction. J Virol
Methods 84:201–208.
15. Johnson DJ, Wilson WC, Paul PS: 2000, Validation of a reverse
transcriptase multiplex PCR test for the serotype determination
of U.S. isolates of bluetongue virus. Vet Microbiol 76:105–115.
16. Katz J, Alstad D, Gustafson G, Evermann J: 1994, Diagnostic
analysis of the prolonged bluetongue virus RNA presence found
in the blood of naturally infected cattle and experimentally in-
fected sheep. J Vet Diagn Invest 6:139–142.
17. Katz JB, Alstad AD, Gustafson GA, Moser KM: 1993, Sensitive
identification of bluetongue virus serogroup by a colorimetric
dual oligonucleotide sorbent assay of amplified viral nucleic
acid. J Clin Microbiol 31:3028–3030.
18. Kutyavin IV, Afonina IA, Mills A, et al.: 2000, 39-minor groove
binder-DNA probes increase sequence specificity at PCR exten-
sion temperatures. Nucl Acids Res 28:655–661.
19. Lanciotti RS, Kerst AJ, Nasci RS, et al.: 2000, Rapid detection
of West Nile virus from human clinical specimens, field collec-
tion mosquitoes, and avian samples by a TaqMan reverse tran-
scriptase-PCR assay. J Clin Microbiol 38:4066–4071.
20. Lanciotti RS, Kerst AJ: 2001, Nucleic acid sequence-based am-
plification assays for rapid detection of West Nile and St. Louis
encephalitis viruses. J Clin Microbiol 39:4506–4513.
21. MacLachlan NJ, Nunamaker RA, Katz JB, et al.: 1994, Detec-
tion of bluetongue virus in the blood of inoculated calves: com-
Downloaded from vdi.sagepub.com by guest on May 21, 2011
View publication stats
17
parison of virus isolation, PCR assay, and in vitro feeding of
Culicoides variipennis. Arch Virol 136:1–8.
22. Mellor PS, Whittmann EJ: 2002, Bluetongue virus in the Med-
iterranean basin 1998–2001. Vet J 164:20–37.
23. Miranda MA, Borrás D, Rincón C, Alemany A: 2003, Presence
of Culicoides imı´cola and Culicoides obsoletus in the Balearic
Islands. Med Vet Entomol 17:1–4.
24. Oberst RD, Stott JL, Blanchard-Channell M, Osburn BI: 1987,
Genetic reassortment of bluetongue virus serotype 11 strains in
the bovine. Vet Microbiol 15:11–18.
25. OIE Terrestrial animal health code, 13th ed., 2004: OIE Orga-
nization International des epizooties. Office International des
Epizooties: 2004, Terrestrial Animal Health Code. Thirteenth
Edition, Office International des Epizooties, Paris.
26. Orru G, De Santis P, Solinas F, et al.: 2005, Differentiation of
Italian field and South African vaccine strains of bluetongue
virus serotype 2 using real-time PCR. J Virol Methods 122:37–
43.
27. Pritchard LI, Gould AR: 1995, Phylogenetic comparison of the
serotype-specific VP2 protein of bluetongue and related orbi-
viruses. Virus Res 39:207–20.
28. Reed LJ, Muench H: 1938, A simple method of estimating fifty
percent endpoints. Am J Hyg 27:493–497.
29. Reid SM, Ferris NP, Hutchings GH, et al.: 2000, Primary di-
agnosis of foot-and-mouth disease virus by reverse transcription
PCR. J Virol Methods 89:167–176.
30. Samal SK, El-Hussein A, Holbrook FR, et al.: 1987. Mixed
infection of Culicoides variipennis with bluetongue virus sero-
types 10 and 17: evidence for high frequency reassortment in
the vector. J Gen Virol 68:2319–2329.
31. Samal SK, Livingston Jr CW, McConnell S, Ramig RF: 1987,
Analysis of mixed infection of sheep with bluetongue virus se-
rotypes 10 and 17: evidence for genetic reassortment in the ver-
tebrate host. J Virol 61:1086–1091.
32. Sarto I, Monteys V, Sáiz-Ardanaz M: 2003, Culicoides midges
in Catalonia (Spain), with special reference to likely bluetongue
virus vectors. Med Vet Entomol 17:288–293.
33. Shad G, Wilson WC, Mecham JO, Evermann JF: 1997, Blue-
tongue virus detection: a safer reverse-transcription polymerase
chain reaction for prediction of viremia in sheep. J Vet Diagn
Invest 9:118–124.
34. Stone-Marschat M, Carville A, Skowronek A, Laegreid WW:
1994, Detection of African horse sickness virus by reverse tran-
scription-PCR. J Clin Microbiol 32:697–700.
35. Tatem AJ, Baylis M, Mellor PS, et al.: 2003, Prediction of blue-
tongue vector distribution in Europe and North Africa using
satellite imagery. Vet Microbiol 97:13–29.
36. Thompson JD, Higgins DG, Gibson TJ: 1994, CLUSTAL W:
improving the sensitivity of progressive multiple sequence
alignment through sequence weighting, position-specific gap
penalties and weight matrix choice. Nucleic Acids Res 22:4673–
4680.
37. Whittmann EJ, Mellor PS, Baylis M: 2001, Using climate data
to map the potential distribution of Culicoides imicola (Diptera:
Ceratopogonidae) in Europe. Rev Sci Tech Off Int Epiz 20:731–
740.
38. Zientara S, Sailleau C, Dauphin G, et al.: 2002, Identification
of bluetongue virus serotype 2 (Corsican strain) by reverse-tran-
scriptase PCR reaction analysis of segment 2 of the genome.
Vet Rec 150:598–601.