[CANCER RESEARCH 60, 2745–2748, May 15, 2000]
Unique Transcription Pattern of Epstein-Barr Virus (EBV) in EBV-carrying
Gastric Adenocarcinomas: Expression of the Transforming BARF1 Gene1
Axel zur Hausen, Antoinette A. T. P. Brink, Mikael E. Craanen, Jaap M. Middeldorp, Chris J. L. M. Meijer, and
Adriaan J. C. van den Brule2
Department of Pathology, Section Molecular Pathology [A. z. H., A. A. T. P. B, J. M. M., C. J. L. M. M., A. J. C. v. d. B.], and Department of Gastroenterology [M. E. C.],
University Hospital Vrije Universiteit, 1007 MB Amsterdam, the Netherlands
ABSTRACT
Approximately 10% of gastric adenocarcinomas worldwide are associ-
ated with human EBV. These carcinomas generally do not express the
latent membrane protein 1 (LMP1), the major known EBV oncogene.
Recently, another EBV gene [i.e., BARF1 (BamHI A rightward open
reading frame)] was shown to have transforming and immortalizing
capacities. Therefore, in this study, we investigated the expression of
BARF1 in EBV-carrying gastric adenocarcinomas in relation to the ex-
pression of other latent EBV transcripts.
In the present study, 10 of 132 gastric adenocarcinomas tested positive
for EBV using EBER1/2-RNA in situ hybridization. We demonstrate
BARF1 gene transcription in nine EBV-carrying gastric adenocarcinomas
(with sufficient RNA quality) using the BARF1-specific nucleic acid se-
quence-based amplification assay. In addition, we also detected other
latent EBV transcripts (i.e., BARF0-, LMP2A-, and Q/K-driven EBNA1
transcripts in these carcinomas using reverse transcription-PCR analysis.
No expression of LMP1, EBNA2, and ZEBRA (either at transcription or
protein level) was found. In addition, two cases were positive for BHRF1
transcripts, the viral bcl-2 homologue. Thus, together with BARF1 tran-
scription, a unique and distinct EBV latency type has been found in
EBV-associated gastric adenocarcinomas.
Because BARF1 exerts immortalizing effects on human epithelial cells
in vitro and EBV-carrying gastric adenocarcinomas lack the expression of
LMP1, the BARF1 gene might act as the viral oncogene in EBV-carrying
gastric carcinomas. The BARF1 gene offers an alternative way for EBV-
mediated oncogenesis other than LMP1.
INTRODUCTION
Gastric cancer is the second leading cause of cancer-related mor-
tality worldwide, and clinical prognosis is very poor. Apart from the
accepted role of Helicobacter pylori in the pathogenesis of gastric
carcinomas, the human ␥-herpesvirus EBV is present in ⬃10%
(range, 2–16%) of human gastric adenocarcinomas worldwide (1–3).
Furthermore, EBV is associated with 80 –100% of the rare lympho-
epithelioma-like gastric carcinomas (4) and is also present in ⬃35%
of the gastric stump carcinomas (5). The pathogenic role of EBV in
gastric adenocarcinomas remains still undefined. The latency type of
EBV in gastric adenocarcinomas is distinct from the known EBV
latency types (e.g., in Burkitt’s lymphomas and nasopharyngeal car-
cinomas; Ref. 6). This is mainly due to the expression of LMP2A3 and
the absence of LMP1 expression in gastric adenocarcinomas. EBV-
carrying gastric adenocarcinomas generally do not express the major
Received 10/8/99; accepted 3/21/00.
The costs of publication of this article were defrayed in part by the payment of page
charges. This article must therefore be hereby marked advertisement in accordance with
18 U.S.C. Section 1734 solely to indicate this fact.
1
Supported by Grant VU-99-1990 from the Dutch Cancer Society.
2 EBER1/2-RISH. Paraffin-embedded tissue from 132 gastric carcinomas
To whom requests for reprints should be addressed, at Department of Pathology,
Section Molecular Pathology, University Hospital Vrije Universiteit, P.O. Box 7057, 1007
MB Amsterdam, the Netherlands. Phone: 31-20-4440503/4023; Fax: 31-20-4442964;
E-mail: vandenbrule@azvu.nl.
3
The abbreviations used are: LMP2A, latent membrane protein 2A; LMP1, LMP 1;
NASBA, nucleic acid sequence-based amplification; RT-PCR, reverse transcription PCR;
RISH, RNA in situ hybridization; BARF1, BamH1 A rightward open reading frame; CSF,
colony-stimulating factor; IHC, immunohistochemistry; NPC, nasopharyngeal carcinoma.
Downloaded from cancerres.aacrjournals.org on March 22, 2019. © 2000 American Association for Cancer
Research.
EBV oncogene LMP1 (7), although LMP1 expression has been oc-
casionally reported (8, 9).
Apart from LMP1, another EBV gene (i.e., BARF1) has recently
been determined as a transforming and immortalizing EBV gene (10,
11). The BARF1 open reading frame is located within a 40-kb
fragment of the EBV genome and encodes a Mr 33,000 protein. This
40-kb fragment encompasses the BamHI D to BamHI A regions of the
EBV genome and is able to immortalize primary monkey and human
epithelial cells in vitro (12, 13). Wei et al. (11) recently demonstrated
that BARF1 is involved in the immortalization of primary monkey
epithelial kidney cells. Furthermore, it has been demonstrated that
transfection of BARF1 into the rodent fibroblast cell line BALB/c 3T3
or in the EBV-negative B cell line Louckes resulted in tumorigenic
transformation (10, 14). Injection of the transfected murine fibroblasts
into newborn rats led to the development of aggressive BARF1-
expressing tumors, whereas injection of the transfected Louckes cell
line induced only small tumors that disappeared 3 weeks after injec-
tion.
Recently, Strockbine et al. (15) reported that BARF1 is a functional
homologue of the human CSF receptor. The CSF receptor is the gene
product of the human proto-oncogene c-fms. This homology between
BARF1 and c-fms is especially interesting in the context that c-fms
and CSF1 have been suggested to modulate neoplastic mammary
epithelial cell proliferation (16).
Because LMP1 is generally not expressed in EBV-carrying gastric
adenocarcinomas, we studied here the expression of BARF1 as an
alternative way for EBV-mediated oncogenesis in relation to the
expression of other latent EBV genes.
MATERIALS AND METHODS
Cell Lines. The EBV-positive lymphoblastoid B cell line JY was used as a
positive control for the expression of the EBV transcripts.
The EBV-negative Louckes cell line, Louckes1–5, transfected with a
BARF1 expression construct (14), was kindly provided by Dr. T. Ooka
(Laboratoire de Virologie Moléculaire, Centre National de la Recherche Sci-
entifique, Lyon, France). The EBV-positive C15 tumor cell line derived from
a nasopharyngeal carcinoma was kindly provided by Dr. B. Griffin (Imperial
College School of Medicine, London, United Kingdom; Ref. 17).
Clinical Material. Paraffin-embedded gastric adenocarcinomas (n ⫽ 132),
of which also frozen material was available, collected at the Department of
Pathology of the University Hospital Vrije Universiteit (Amsterdam, the Neth-
erlands), were tested by EBER1/2-RISH for the presence of EBV. Correspond-
ing snap-frozen material of these EBV-positive gastric carcinomas and 10
gastric control tissues, including 5 EBV-negative gastric carcinomas and 5
specimens of normal gastric epithelium, were used for the RNA EBV-tran-
script analysis. Before RNA isolation, the sandwich frozen sections (of this
material) were H&E stained and microscopically checked for the presence of
tumor cells.
was subjected to a nonradioactive EBER1/2-RISH using the Digoxygenin-
labeled antisense and sense EBER1/2 probe, as described previously (18).
Oligonucleotide Primers and Probes. All EBV-specific primers (i.e.,
EBNA1, EBNA2, BARF0, LMP1, LMP2A, BHRF1, and ZEBRA; Ref. 19) and
primers specific for the U1 small nuclear ribonucleoprotein-specific A protein
(20) have been described previously.
2745
 BARF1 TRANSCRIPTION IN EBV-CARRYING GASTRIC CARCINOMAS

0.2 mg/ml diaminobenzidine, 0.003% H2O2, and 0.12% NickelAmmonium-

sulphate in 50 mmol/L Tris-HCl (pH 7.6), followed by silver enhancement of
the diaminobenzidine-nickel precipitate, as described previously (26).

RESULTS

EBER1/2-RISH. Ten (7.6%) of 132 gastric adenocarcinomas

tested positive for EBV by EBER1/2-RISH. Using the EBER1/2
antisense probe, nuclear EBER1/2 expression was detected in the
majority of, if not all, neoplastic cells of these gastric adenocarcino-
mas (Fig. 1). Nuclear staining was also found in the positive controls
used (i.e., JY cell line and one EBV-positive Hodgkin’s lymphoma).
No expression was seen using the EBER1/2 sense probe.
Assessment of RNA Quality. Of the corresponding snap-frozen
tissues of the 10 EBV-positive gastric adenocarcinomas, 9 revealed a
Fig. 1. EBER1/2-RISH in a gastric adenocarcinoma. EBER1/2 signals (antisense
sufficient RNA quality for further transcript analysis (summarized in
Dig-labeled riboprobes) are located in the nuclei of the carcinoma cells. Table 1), as was shown by clearly visible 18S and 28S rRNA bands
and U1 small nuclear ribonucleoprotein-specific A protein mRNA
RT-PCR.
The primers for the BARF1-NASBA assay were: primer 1.2, GGCTGT- BARF1 Transcription by NASBA. The nine remaining EBV-
CACCGCTTTCTTGG (nt. 165560 –16579); and primer 2.1, T7-AGGTGTT- positive gastric adenocarcinomas were tested for BARF1 transcription
GGCACTTCTGTGG (nt. 165762–165743). As probe, the oligonucleotide using the NASBA (i.e., an alternative RNA amplification method that
CTGGTTTAAACTGGGCCCAGGAGAGGAGCA (nt. 165644 –165673) was enables a reliable and sensitive detection of target RNA in the pres-
used. A detailed protocol has been described recently (21). NASBA primers ence of DNA independent of splice sites). Indeed, all nine EBV-
were polyacrylamide purified to guarantee pure, full-length primers. positive gastric adenocarcinomas did show expression of BARF1-
RNA Isolation and RT-PCR. RNA was isolated from twelve 5-␮m thick
RNA using the sensitive BARF1-NASBA assay, revealing a 203-bp
cryosections using 1 ml of the guadinium-phenol-based RNAzol reagent
(Cinna Biotecx, Houston, TX). The purity and concentration of the isolated
fragment (Fig. 2a). In contrast, EBV-negative gastric adenocarcino-
RNA were determined spectrophotometrically; the integrity of the RNA was mas (Fig. 2b) and normal gastric control tissue (data not shown) did
determined by agarose gel electrophoresis, the presence of 18S/28S rRNA not show transcription of BARF1. As shown in Fig. 2, a and b, the
bands being an index for good RNA quality. The isolated RNA was stored as positive controls (i.e., Loukes1–5 cell line and C15 tumor cell line)
isopropanol precipitates at ⫺80°C. Before the RT reaction, an amount of the showed BARF1 transcripts, whereas the negative control (distilled
precipitate equivalent to 1 ␮g of RNA was centrifuged for 15 min, washed with water) was negative.
70% ethanol, and air dried. RT and subsequent PCR were performed as EBV Transcript Analyses by RT-PCR. Using RT-PCR all nine
described previously (22), and PCR products were analyzed on 1.5% agarose carcinomas expressed BARF0 transcripts. Furthermore, we found
gels, transferred to nylon filters by alkaline Southern blotting, and hybridized Q-promoter-driven EBNA1 transcription in eight of the nine cases. In
to specific ␥ 32P-ATP-labeled oligonucleotide probes to determine their spec-
contrast, no Cp/Wp-promoter-driven EBNA1 transcripts could be
ificity.
BARF1-NASBA. The NASBA assay (23) is an isothermal in vitro ampli-
demonstrated. In accordance with previously published results, no
fication method with simultaneous activity of reverse transcriptase, T7-RNA- LMP1 and EBNA2 transcripts were found, whereas seven of nine
polymerase, and RNase H, which enables a reliable and sensitive detection of cases displayed LMP2A expression at the RNA level (shown in Fig.
target RNA in the presence of DNA independent of splice sites (21). 3). Two cases actually displayed BHRF1 transcripts driven by the
The BARF1-NASBA reaction was carried out as described previously (21). H2/HF-promoter (data not shown). In contrast, no Cp/Wp-promoter-
Briefly, 100 ng of total RNA per reaction was amplified at 41°C in 20-␮l driven BHRF1 transcripts were found and no expression of ZEBRA
reaction volumes containing 4 pmol of either primer, 15% DMSO, 40 mM transcripts. All RT-PCR and NASBA results are summarized in
TRIS-HCL (pH 8.5), 12 mM MgCl2, 70 mM KCl, 4 mM DTT, 1 mM of each Table 1.
dNTP, 2 mM rATP, rUTP, rCTP, 1.5 mM rGTP, and 0.5 mM ITP. Reagents
were kindly supplied by Organon Teknika (Boxtel, the Netherlands).
Reaction products were evaluated by gel electrophoresis using 1.5% agarose
in Tris-borate EDTA, transferred from the gels to the nylon filters (Qiabrane; Table 1 Summary of results in nine EBV-positive gastric carcinomas
Qiagen, Chatsworth, CA) via capillary blotting in 10* SSC, and hybridized to EBV-positive gastric carcinomas
specific ␥ 32P-ATP end-labeled oligonucleotide probes.
The absolute sensitivity of the BARF1-NASBA assay was determined to 1 2 3 4 5 6 7 8 9
detect 10 –100 RNA templates. EBER1/2-RISH ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹
IHC. To detect EBV-specific proteins, monoclonal antibodies against RT-PCR
U1A ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹
LMP1 [CS1– 4 (DAKO) and S12 (Organon Teknika)] and ZEBRA (DAKO) EBNA1 (Q/K) ⫹ ⫹ ⫹ ⫹ ⫺ ⫹ ⫹ ⫹ ⫹
were used. The antibodies were visualized with an avidin-biotin-horseradish EBNA1 (Y3/U/K) ⫺ ⫺ ⫺ ⫺ ⫺ ⫺ ⫺ ⫺ ⫺
peroxidase complex and diaminobenzidine/H2O2 staining method, as described EBNA2 ⫺ ⫺ ⫺ ⫺ ⫺ ⫺ ⫺ ⫺ ⫺
previously (24). BARF0 ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹
LMP2A ⫹ ⫺ ⫹ ⫹ ⫺ ⫹ ⫹ ⫹ ⫹
EBNA1 expression was detected in paraffin-embedded tissues with a re- LMP1 ⫺ ⫺ ⫺ ⫺ ⫺ ⫺ ⫺ ⫺ ⫺
cently generated anti-EBNA1-specific rat monoclonal antibody, 2B4 –1 (25). BHRF1 (H2/HF) ⫹ ⫺ ⫺ ⫹ ⫺ ⫺ ⫺ ⫺ ⫺
To increase sensitivity, a few adjustments were made. Before incubation with BHRF1 (Y2/HF) ⫺ ⫺ ⫺ ⫺ ⫺ ⫺ ⫺ ⫺ ⫺
the anti-EBNA1 antibody, tissues were boiled for 15 min in a citrate buffer [0.1 ZEBRA ⫺ ⫺ ⫺ ⫺ ⫺ ⫺ ⫺ ⫺ ⫺
BARF1-NASBA ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹
M/l (pH 6.0)]. Incubation with the antibody was done overnight at room IHC
temperature with a 1:50 diluted antibody (final concentration, 44 ␮g/ml). EBNA1 ⫺ ⫺ ⫺ ⫹ ⫹ ⫺ ⫹ ⫺ ⫹
Detection of the antibody was performed with an avidin-biotin-horseradish LMP1 ⫺ ⫺ ⫺ ⫺ ⫺ ⫺ ⫺ ⫺ ⫺
peroxidase complex. The peroxidase was visualized by incubation for 3 min in ZEBRA ⫺ ⫺ ⫺ ⫺ ⫺ ⫺ ⫺ ⫺ ⫺

2746

Downloaded from cancerres.aacrjournals.org on March 22, 2019. © 2000 American Association for Cancer
Research.
 BARF1 TRANSCRIPTION IN EBV-CARRYING GASTRIC CARCINOMAS

tion of the transforming BARF1 gene, EBER1/2, Q-promoter-driven

EBNA1, BARF0, LMP2A, and the absence of LMP1 and EBNA2
transcription. Although BARF1 is designated as an early gene in lytic
infection in B-lymphocytes, the transforming BARF1 is exclusively
transcribed as a latent gene in EBV-associated epithelial maligancies
(i.e., NPC; Refs. 21 and 27) and gastric carcinomas (this study).
Sbih-Lammali et al. (27) previously demonstrated weak BARF1 tran-
scription in two of five North African NPCs using a reverse Northern
blotting technique. In addition, Brink et al. (21) and Hayes et al. (28)
used a more sensitive technique (i.e., NASBA) and found BARF1
expressed in almost all NPCs and not in lymphoid malignancies or
productive EBV infection (oral hairy leukoplakia).
Additional IHC studies using BARF1-specific monoclonal antibod-
ies are needed to show expression at the protein level in EBV-carrying
gastric adenocarcinomas.
Because gastric adenocarcinomas generally do not express
Fig. 2. Northern blot analysis of the BARF1-NASBA products. a, BARF1 transcription
LMP1— until now the major EBV oncogene—BARF1 expression in
in EBV-positive gastric adenocarcinomas. The EBV-negative Louckes cell line trans- EBV-carrying gastric carcinomas may be an alternative way for
fected with BARF1 served as positve control and revealed a band at the expected size (203 EBV-mediated gastric carcinogenesis. BARF1 has recently been de-
bp). b, BARF1-NASBA results in EBV-negative gastric adenocarcinomas. The EBV-
positive NPC cell line C15 was used as positive control. termined as a transforming gene in rodent fibroblasts and as an
immortalizing gene in primary monkey epithelial cells (10, 11). In this
context, it is interesting that Strockbine et al. (15) recently demon-
strated that the BARF1 gene encodes a novel CSF-1 receptor. BARF1
shares a subtle, highly localized region of homology with several
members of the tyrosine kinase receptor family, including the cellular
proto-oncogene c-fms, which encodes the CSF-1 receptor. CSF-1 and
c-fms expression have been suggested to be involved in the modula-
tion of neoplastic mammary epithelial cell proliferation (16). Accord-
ing to Storga et al. (29), c-fms is expressed in gastric adenocarcino-
mas, but the role of c-fms in gastric carcinogenesis has not been
further elucidated. Theoretically, BARF1 might act as a homologue of
c-fms proto-oncogene in immortalizing gastric epithelium, but addi-
tional studies concerning the role of c-fms and BARF1 in gastric
carcinomas need to support this hypothesis. Only recently, Cohen and
Lekstrom (30) demonstrated that BARF1 is dispensable for B-cell
transformation and interacts with the cellular IFN production. How-
ever, the recombinant EBV mutant used by Cohen and Lekstrom (29)
still contained the transforming domain of BARF1 (AA 1–54), which
was recently determined (31), and this might have influenced their
results. As shown by the in vitro immortalizing and transforming
Fig. 3. Southern blot analysis of EBV RT-PCR products in EBV-positive gastric
adenocarcinomas. The EBV-positive LCL JY cell line served as positive control. Tran- capacities in epithelial cells (Ref. 11; and supported by our data in
scription of Q-promoter-driven EBNA1 (236 bp), BARF0 (240 bp), and LMP2A (280 bp) vivo), we suggest that BARF1 exerts different functions in lymphoid
and the absence of LMP1 (240 bp) transcription characterize the EBV latency type in
EBV-associated gastric carcinomas. Bottom, U1A RT-PCR as RNA quality control.
and epithelial cells: in the latter BARF1 might be involved in the lytic
cycle, acting as an early protein, whereas in epithelial cells BARF1
has immortalizing/transforming capacities.
IHC. EBV-carrying gastric adenocarcinomas were tested immuno- In this study, we found EBV in 7.6% of the gastric adenocarcino-
histochemically for EBNA1, LMP1, and ZEBRA. Using the anti-
EBNA1-specific rat monoclonal antibody 2B4 –1, 5 of 10 carcinomas
showed protein expression of EBNA1. Interestingly, one gastric car- Table 2 Expression of EBV genes in different EBV-associated diseases
cinoma that was tested negative by RT-PCR for EBNA1 did show Latency I Latency II Latency III
protein expression using the 2B4 –1 anti-EBNA1 antibody. None of Gastric Burkitt’s T-cell
the 10 carcinomas revealed staining for LMP1 or ZEBRA. Data are EBV genea carcinomas lymphoma NPC HDb lymphomas ARL PTLD
summarized in Table 1. EBV-positive control (i.e., JY cell line) tested EBER1/2 R R R R R R R
positive for EBNA1, LMP1, and ZEBRA. EBNA1 R, P R, P R, P R, P R, P R, P R, P
EBNA2 R, P R, P
LP R R
DISCUSSION BARF0 R R R R R R R
BARF1 R R
LMP1 R, P R, P R, P R, P R, P
In the present study, we demonstrate a novel EBV latency pattern LMP2A R R R R R R
in EBV-carrying gastric adenocarcinomas (Table 2), predominantly LMP2B R R R R R
based on the presence of BARF1 transcripts and the absence of LMP1 a
EBV gene expression at RNA (R) and protein (P) level. These data are derived from
expression. This is the first time that transcription of the transforming both our own laboratory (Refs. 19, 21, 24, 26, and 28) and from other laboratories (Refs.
1, 3, 4, 6, 17, 22, 25, 27, 33, and 34).
BARF1 gene has been demonstrated in EBV-carrying gastric adeno- b
HD, Hodgkin’s disease; ARL, AIDS-related lymphoma; PTLD, posttransplant lym-
carcinomas. The novel latency pattern is characterized by transcrip- phoproliferative disease.
2747

Downloaded from cancerres.aacrjournals.org on March 22, 2019. © 2000 American Association for Cancer
Research.
 BARF1 TRANSCRIPTION IN EBV-CARRYING GASTRIC CARCINOMAS
mas investigated. This is within the worldwide reported frequency of
EBV-carrying gastric carcinomas, which is approximately 10% (1–3).
In contrast to the absence of LMP1 and ZEBRA protein tested by
IHC, four of nine EBV-carrying gastric carcinomas expressed EBNA1
protein using the 2B4 –1 anti-EBNA1 antibody. One gastric carci-
noma that did show EBNA1 protein expression tested negative in
RT-PCR for EBNA1. This result might reflect nonspecific binding of
this antibody, as has been described and discussed extensively re-
cently by Cruz et al. (32). The EBNA1 protein expression in EBV-
carrying gastric adenocarcinomas has also been demonstrated previ-
ously by other groups using IHC (33, 34). The absence of LMP1
(either at the transcription and protein level) and the presence of
BARF0 is in line with recently published data of Suguira et al. (6).
The absence of LMP1 in these carcinomas distinguishes this novel
EBV latency type from the EBV latency type seen in NPCs, which is
another EBV-associated epithelial malignancy. Interestingly, we also
found BHRF1, the viral bcl-2 homologue, in two cases. The meaning
of this remains to be determined.
In conclusion, in this study we showed that a novel EBV latency
pattern in EBV-carrying gastric adenocarcinomas is present, espe-
cially characterized by BARF1 transcript expression and the absence
of LMP1 (either at the RNA and protein level). BARF1 might act as
the viral oncogene in the development of EBV-carrying gastric ade-
nocarcinomas. Additional studies are needed, including the develop-
ment of BARF1-specific antibodies and the application of morpho-
logical techniques like RISH and IHC. Functional assays with BARF1
are necessary to determine its role in (gastric) carcinogenesis. BARF1
might be a novel therapeutic target for EBV-carrying gastric adeno-
carcinomas.
ACKNOWLEDGMENTS
We thank A. Groothuis and M. Vervaart for excellent technical assistance.
REFERENCES
1. Takano, Y., Kato, Y., Saegusa, M., Mori, S., Shiota, M., Masuda, M., Mikami, T., and
Okayasu, I. The role of the Epstein-Barr virus in the oncogenesis of EBV(⫹) gastric
carcinomas. Virchows Arch., 434: 17–22, 1999.
2. Rowlands, D. C., Ito, M., Mangham, D. C., Reynolds, G., Herbst, H., Hallissey,
M. T., Fielding, J. W., Newbold, K. M., Jones, E. L., and Young, L. S. Epstein-Barr
virus and carcinomas: rare association of the virus with gastric adenocarcinomas.
Br. J. Cancer, 68: 1014 –1019, 1993.
3. Shibata, D., and Weiss, L. M. Epstein-Barr virus-associated gastric adenocarcinoma.
Am. J. Pathol., 140: 769 –774, 1992.
4. Nakamura, S., Ueki, T., Yao, T., Ueyama, T., and Tsuneyoshi, M. Epstein-Barr virus
in gastric carcinoma with lymphoid stroma. Special reference to its detection by the
polymerase chain reaction and in situ hybridization in 99 tumors, including a mor-
phologic analysis. Cancer (Phila.), 73: 2239 –2249, 1994.
5. Baas, I. O., van Rees, B. P., Musler, A., Craanen, M. E., Tytgat, G. N., van den Berg
F. M., and Offerhaus, G. J. Helicobacter pylori and Epstein-Barr virus infection and
the p53 tumor suppressor pathway in gastric stump cancer compared with carcinoma
in the non-operated stomach. J. Clin. Pathol., 51: 662– 666, 1998.
6. Sugiura, M., Imai, S., Tokunaga, M., Koizumi, S., Uchizawa, M., Okamoto, K., and
Osato, T. Transcriptional analysis of Epstein-Barr virus gene expression in EBV-
positive gastric carcinoma: unique viral latency in the tumour cells. Br. J. Cancer, 74:
625– 631, 1996.
7. Osato, T., and Imai, S. Epstein-Barr virus and gastric carcinoma. Semin. Cancer Biol.,
7: 175–182, 1996.
8. Gulley, M. L., Pulitzer, D. R., Eagan, P. A., and Schneider, B. G. Epstein-Barr virus
infection is an early event in gastric carcinogenesis and is independent of bcl-2
expression and p53 accumulation. Hum. Pathol., 27: 20 –27, 1996.
9. Kida, Y., Miyauchi, K., and Takano, Y. Gastric adenocarcinoma with differentiation
to sarcomatous components associated with monoclonal Epstein-Barr virus infection
and LMP-1 expression. Virchows Arch. A Pathol. Anat. Histopathol., 423: 383–387,
1993.
10. Wei, M. X., and Ooka, T. A transforming function of the BARF1 gene encoded by
Epstein-Barr virus. EMBO J., 8: 2897–2903, 1989.
11. Wei, M. X., de Turenne-Tessier, M., Decaussin, G., Benet, G., and Ooka, T.
Establishment of a monkey kidney epithelial cell line with the BARF1 open reading
frame from Epstein-Barr virus. Oncogene, 14: 3073–3081, 1997.
12. Griffin, B. E., and Karran, L. Immortalization of monkey epithelial cells by specific
fragments of Epstein-Barr virus DNA. Nature (Lond.), 309: 78 – 82, 1984.
2748
Downloaded from cancerres.aacrjournals.org on March 22, 2019. © 2000 American Association for Cancer
Research.
13. Karran, L., Teo, C. G., King, D., Hitt, M. M., Gao, Y. N., Wedderburn, N., and
Griffin, B. E. Establishment of immortalized primate epithelial cells with subgenomic
EBV DNA. Int. J. Cancer, 45: 763–772, 1990.
14. Wei, M. X., Moulin, J. C., Decaussin, G., Berger, F., and Ooka, T. Expression and
tumorigenicity of the Epstein-Barr virus BARF1 gene in human Louckes B-lympho-
cyte cell line. Cancer Res., 54: 1843–1848, 1994.
15. Strockbine, L. D., Cohen, J. I., Farrah, T., Lyman, S. D., Wagener, F., DuBose,
R. F., Armitage, R. J., and Spriggs, M. K. The Epstein-Barr virus BARF1 gene
encodes a novel, soluble colony-stimulating factor-1 receptor. J. Virol., 72:
4015– 4021, 1998.
16. Sapi, E., Flick, M. B., Gilmore-Hebert, M., Rodov, S., and Kacinski, B. M. Tran-
scriptional regulation of the c-fms (CSF-1R) proto-oncogene in human breast carci-
noma cells by glucocorticoids. Oncogene, 10: 529 –542, 1995.
17. Hitt, M. M., Allday, M. J., Hara, T., Karran, L., Jones, M. D., Busson, P., Tursz, T.,
Ernberg, I., and Griffin, B. E. EBV gene expression in an NPC-related tumour.
EMBO J., 8: 2639 –2651, 1989.
18. Jiwa, N. M., Kanavaros, P., van der Valk, P., Walboomers, J. M., Horstman, A., Vos,
W., Mullink, H., and Meijer, C. J. L. M. Expression of c-myc and bcl-2 oncogene
products in Reed-Sternberg cells independent of presence of Epstein-Barr virus.
J. Clin. Pathol., 46: 211–217, 1993.
19. Oudejans, J. J., Jiwa, M., van den Brule A. J. C., Grässer, F. A., Horstman, A., Vos,
W., Kluin, P. M., van der Valk, P., Walboomers, J. M., and Meijer, C. J. L. M.
Detection of heterogeneous Epstein-Barr virus gene expression patterns within indi-
vidual post-transplantation lymphoproliferative disorders. Am. J. Pathol., 147: 923–
933, 1995.
20. Bijl, J., van Oostveen, J. W., Kreike, M., Rieger, E., van der Raaij-Helmer, L. M.,
Walboomers, J. M., Corte, G., Boncinelli, E., van den Brule A. J. C., and Meijer,
C. J. L. M. Expression of HOXC4, HOXC5, and HOXC6 in human lymphoid cell
lines, leukemias, and benign and malignant lymphoid tissue. Blood, 87: 1737–1745,
1996.
21. Brink, A. A., Vervoort, M. B., Middeldorp, J. M., Meijer, C. J. L. M., and van den
Brule, A. J. C. Nucleic acid sequence-based amplification, a new method for analysis
of spliced and unspliced Epstein-Barr virus latent transcripts, and its comparison with
reverse transcriptase PCR. J. Clin. Microbiol., 36: 3164 –3169, 1998. (Published
erratum appears in J. Clin. Microbiol., 37: 3788, 1999.)
22. Brink, A. A., Oudejans, J. J., Jiwa, M., Walboomers, J. M., Meijer, C. J., and van den
Brule, A. J. C. Multiprimed cDNA synthesis followed by PCR is the most suitable
method for Epstein-Barr virus transcript analysis in small lymphoma biopsies. Mol.
Cell. Probes, 11: 39 – 47, 1997.
23. Kievits, T., van Gemen, B., van Strijp, D., Schukkink, R., Dircks, M., Adriaanse, H.,
Malek, L., Sooknanan, R., and Lens, P. NASBA isothermal enzymatic in vitro nucleic
acid amplification optimized for the diagnosis of HIV-1 infection. J. Virol. Methods,
35: 273–286, 1991.
24. Jiwa, N. M., Oudejans, J. J., Dukers, D. F., Vos, W., Horstman, A., van der Valk, P.,
Middledorp, J. M., Walboomers, J. M., and Meijer, C. J. L. M. Immunohistochemical
demonstration of different latent membrane protein-1 epitopes of Epstein-Barr virus
in lymphoproliferative diseases. J. Clin. Pathol., 48: 438 – 442, 1995.
25. Grässer, F. A., Murray, P. G., Kremmer, E., Klein, K., Remberger, K., Feiden, W.,
Reynolds, G., Niedobitek, G., Young, L. S., and Mueller-Lantzsch, N. Monoclonal
antibodies directed against the Epstein-Barr virus-encoded nuclear antigen 1
(EBNA1): immunohistologic detection of EBNA1 in the malignant cells of Hodgkin’s
disease. Blood, 84: 3792–3798, 1994.
26. Jiwa, N. M., Kanavaros, P., De Bruin, P. C., van der Valk, P., Horstman, A., Vos, W.,
Mullink, H., Walboomers, J. M., and Meijer, C. J. L. M. Presence of Epstein-Barr
virus harbouring small and intermediate-sized cells in Hodgkin’s disease. Is there a
relationship with Reed-Sternberg cells? J. Pathol., 170: 129 –136, 1993.
27. Sbih-Lammali, F., Djennaoui, D., Belaoui, H., Bouguermouh, A., Decaussin, G., and
Ooka, T. Transcriptional expression of Epstein-Barr virus genes and proto-oncogenes
in north African nasopharyngeal carcinoma. J. Med. Virol., 49: 7–14, 1996.
28. Hayes, D. P., Brink, A. A., Vervoort, M. B., Middeldorp, J. M., Meijer, C. J. L. M.,
and van den Brule, A. J. C. Expression of Epstein-Barr virus (EBV) transcripts
encoding homologues to important human proteins in diverse EBV associated dis-
eases. Mol. Pathol., 52: 97–103, 1999.
29. Storga, D., Pecina-Slaus, N., Pavelic, J., Pavelic, Z. P., and Pavelic, K. c-fms is
present in primary tumors as well as in their metastases in bone marrow. Int. J. Exp.
Pathol., 73: 527–533, 1992.
30. Cohen, J. I., and Lekstrom, K. Epstein-Barr virus BARF1 protein is dispensable for
B-cell transformation and inhibits ␣ interferon secretion from mononuclear cells.
J. Virol., 73: 7627–7632, 1999.
31. Sheng, W., and Ooka T. Oncogene encoded by Epstein-Barr virus. Presented at the
24th International Herpesvirus Workshop, Abstract 16025, July 17–23, 1999.
32. Cruz, I., van den Brule A. J. C., Brink, A. A., Snijders, P. J. F., Walboomers, J. M. M.,
van der Waal, I., and Meijer, C. J. L. M. No direct role for Epstein-Barr Virus in oral
carcinogenesis: a study at the DNA, RNA and protein levels. Int. J. Cancer, 86:
356 –361, 2000.
33. Imai, S., Koizumi, S., Sugiura, M., Tokunaga, M., Uemura, Y., Yamamoto, N.,
Tanaka, S., Sato, E., and Osato, T. Gastric carcinoma: monoclonal epithelial malig-
nant cells expressing Epstein-Barr virus latent infection protein. Proc. Natl. Acad. Sci.
USA, 91: 9131–9135, 1994.
34. Murray, P. G., Niedobitek, G., Kremmer, E., Grässer, F., Reynolds, G. M., Cruchley,
A., Williams, D. M., Müller-Lantzsch, N., and Young, L. S. In situ detection of the
Epstein-Barr virus-encoded nuclear antigen 1 in oral hairy leukoplakia and virus-
associated carcinomas. J. Pathol., 178: 44 – 47, 1996.
Unique Transcription Pattern of Epstein-Barr Virus (EBV) in
EBV-carrying Gastric Adenocarcinomas: Expression of the
Transforming BARF1 Gene
Axel zur Hausen, Antoinette A. T. P. Brink, Mikael E. Craanen, et al.

Cancer Res 2000;60:2745-2748.

Updated version Access the most recent version of this article at:
http://cancerres.aacrjournals.org/content/60/10/2745

Cited articles This article cites 32 articles, 10 of which you can access for free at:
http://cancerres.aacrjournals.org/content/60/10/2745.full#ref-list-1

Citing articles This article has been cited by 18 HighWire-hosted articles. Access the articles at:
http://cancerres.aacrjournals.org/content/60/10/2745.full#related-urls

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications
Subscriptions Department at pubs@aacr.org.

Permissions To request permission to re-use all or part of this article, use this link
http://cancerres.aacrjournals.org/content/60/10/2745.
Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)
Rightslink site.

Downloaded from cancerres.aacrjournals.org on March 22, 2019. © 2000 American Association for Cancer
Research.