Study guide for Chp 15:

Be able to describe an experimental procedure that could address a hypothetical

question based on some of the information you have learned this semester.

The Drosophila wt has red eyes. Consider an offspring bearing a null allele named
white. Would color eyes would you expect in white +/ -? In white +? In white white -/ -
?

White+/- = red eyes or pink eyes (dosage dependency)

White + = red eyes
White -/- = white eyes

How come Ac is placed in the same family as Ds if one is an autonomous

transposable element and the other is a nonautonomous element?
Ac- activator
Ds- dissociation
The common genetic behavior of these elements led geneticists to propose new categories
for all the elements. Ac and elements with similar genetic properties are now called
autonomous elements because they require no other elements for their mobility.
Similarly, Ds and elements with similar genetic properties are called non-autonomous
elements.

Why is anyone concerned with a Ds element if it is nontransposable?

mobility of Ds inactivated genes due to insertion

If a 5’ IS sequence reads CGGTAATGCTCGACCTGTCACA, what would the 3’ IS

sequence read? What would happen if a mutation turned this IS into CGGTA? Or
if the mutation turned it into a LTR?

Would you be more concerned about an outbreak at a hospital of a new bacterium if

you were told it contained Long transposable sequences or Short transposable
sequences?
Short sequences that move into new positions; do not carry genes other than those
required for their mobility
→IS elements (insertion sequences)
→can interrupt gene function upon insertion
→insert into operons (what would that effect? Affects gene regulation/expression)

-Longer sequences that carry the genes they require for mobility plus other genes as well,
e.g. transposons
→composite transposons = several genes contained between two IS elements orientated
as inverted repeats; (the IS itself allows the mobility); frequently the carried genes are r-
determinants
→simple transposons = have shorter inverted repeats plus their own transposase gene

Long transposable sequences – bc have more genetic information and able to replicate
itself.

What is the function of a cointegrate?

Considering that transposable elements occur in both prokaryotes and eukaryotes,

would you expect to find more ‘cut and paste’ elements in eukaryotes or ‘copy and
paste’ elements? What is the difference between the two mechanisms?
Copy and paste based on class 1 percentages .. For protection?

Replicative transposition – element replicated and moved to new site, old version stays
behind (copy & paste)

Conservative transposition – element reinserts to new spot but with no replicate left
behind (cut & paste)

What is the difference between replicative and conservative transposition?

Most transposable elements in prokaryotes employ one of two mechanisms of
transposition: replicative and conservative (nonreplicative).

-excision =
→replicative transposition (Class I):
-RNA intermediary reverse transcribed to DNA
-element replicated and moved to new site, old version stays behind, e.g. COPY and
paste
-responsible for genome expansion

→conservative transposition (non-replicative; Class II)

-element reinserts into new spot but with no replicate left behind, e.g. CUT and paste
-responsible only for genomic rearrangements

If the HIS4 mutants derive from retroviruses, why are they ‘trapped’ inside the
yeast genome? Retroviruses generally have the ability to move freely from organism
to organism.

How is it possible someone could be infected with HIV and it was ‘undectable’ and
could only be detected by antibodies?
Hiv is provirus, inserts its genes in host cell, isn’t circulating inside body or blood
stream. Person producing antibodies for it and that how you can detect it

Understand the difference between Class 1 and Class 2 transposable elements.

Class I: retrotransposons (~RNA)
→similar to retroviruses; contain reverse transcriptase
→ss RNA reverse transcribed into ds cDNA that inserts into genome
→utilizes a copy and paste technique; expand genome
→LTRs (long terminal repeats), ~8% of human genome
→or non-LTRs:
-LINES (long interspersed nucleotide elements), (1-5 kb)~18% of human genome
→have reverse transcriptase but lack LTRs

-SINES (short interspersed nucleotide elements), (100-300 bp) ~13% of human genome
→do not encode their own reverse transcriptase;
LINEs may activate them, however
→Alu most abundant human SINE, 1 million++ copies
→a restriction site from Arthrobacter luteus
→most SINEs inactive; some transpose, cause disease
→Alu insertion disrupts VIII & IX (coagulation factors)

-MITES (miniature inverted-repeat transposable elements), plants only?

-many of these are still active in organisms

Class II: DNA transposons

→transpose in manner similar to bacteria
-element moves into new spot (cut & paste)
-no reverse transcriptase like Class 1
→DNA transposons make up 90% of corn’s genome but only ~3% of human genome

Explain the rationale behind the naming of the Sleeping Beauty Class 2 transposon.
Transposons, methylated inactivated

What is the relevance of mC and umC to the C-value paradox? If there is no

relevance, give an example that explains the C-value paradox.
mC = methylated cytosine
umC= us methylated cytosine

C-value paradox : THE LACK OF CORRELATION BETWEEN GENOME SIZE AND

THE BIOLOGICAL COMPLEXITY OF AN ORGANISM IS KNOWN AS THE C-
VALUE PARADOX.

Why is there a difference between the diploid C-value and the haploid C-value in
human males and females?
Diploid: male X Y (Y IS SMALL)
Female X X (X is larger, like double the males)

Haploid: male Y (is small)

Female X (is larger)
Despite their abundance in the human genome, why are SINES like Alu less
problematic than LINES? If so, why is it that some SINES are still associated with
disease phenotypes?

What would be the safest haven for a SINE, centric heterochromatin or telomeric
chromatin? Exonic insertion or intronic insertion? A promoter region or a enhancer
region?

Give an example of something good, benign and horrible about transposons.

Good- gene in front promoter to upregulate

B- no problems, introns or intergenic spacers inserted

H- interrupt function of another gene

If you were a rice breeder, would you be more concerned about MITES, SINES, or
LINES?
Mites bc in plants only?

Why are some genomic regions considered ‘selfish’? Plasmids, toxin, antitoxin, or
linked genes Would you expect a housekeeping gene to be selfish? Depends

Why is premature termination the most common problem with active transposable
elements?