Вы находитесь на странице: 1из 112

Республиканский Специализированный научно-практический

медицинский центр дерматологии и венерологии


Министерства Здравоохранения Республики Узбекистан
АССОЦИАЦИЯ ДЕРМАТОВЕНЕРОЛОГОВ УЗБЕКИСТАНА

Dermatovenerologiya
va estetik tibbiyot
I l m i y- a m a l i y j u r n a l

Дерматовенерология
и эстетическая медицина
Научно-практический журнал

Основан в 2008 году

  №  2 / 2016 (30)

Ташкент. 2016
Адрес редакции:
Узбекистан, г. Ташкент, 100109,
Алмазарский район, ул. Фароби, д. 3.
Тел.: (8–998–71) 214–50–01;
(8–998–71) 150–71–05
Факс: (8–998–71) 214–50–98
E-mail: niidiv@mail.ru
www.dermatology.uz

Редакционная коллегия

Главный редактор У. Ю. Сабиров


Зам. гл. редактора С. С. Арифов
Отв. секретарь А. И. Исмагилов
Редактор Г. Е. Полещикова

Абдуллаходжаева М. С., Абидов А.М., Абидова З.М., Ваисов А.Ш., Ибрагимов Ш.И.,
Мавлянова Ш.З., Маннанов А.М., Набиев Т.А., Порсохонова Д.Ф., Рахимов И.Р.,
Рахматов А.Б., Туйчиев Л.Н., Эшбаев Э.Х., Юлдашев К.А.

Редакционный совет

Абдуллаев М.И. (Ташкент) Ешимов У.И. (Казахстан) Полеско И.В. (Россия)


Абдуллаев Т.У. (Ташкент) Исамухамедова Н.Р. (Ташкент) Рейимкулиев Б.Р. (Туркменистан)
Абдусаматов У.А. (Ташкент) Исмаилова Г.А. (Ташкент) Рубинс А.Я. (Латвия)
Азимова Ф.В. (Ташкент) Кабулов Ш.М. (Ташкент) Садыков А.А. (Ташкент)
Акаки Т. (Грузия) Керимов С. Г. (Азербайджан) Степаненко В.И. (Украина)
Акилов Ф.А. (Ташкент) Ким Э.Г. (Ташкент) Султанов С. Н. (Ташкент)
Алимов Б.Д. (Ташкент) Кубанов А.А. (Россия) Тищенко А.Л. (Россия)
Аллаева М.Д. (Ташкент) Кубанова А.А. (Россия) Халидова Х.Р. (Ташкент)
Аннели Уускула (Эстония) Львов А.Н. (Россия) Хамидов Ш.А. (Андижан)
Антонов В.Б. (Россия) Мавлянов И.Р. (Ташкент) Шодиев Х.К. (Ташкент)
Балтабаев М.К. (Киргизия) Молочков А.В. (Россия) Якубович А.И. (Россия)
Батпенова Г.Р. (Казахстан) Пакирдинов А.Б. (Андижан)
Гранштейн Р. (США) Панкратов О.В. (Белоруссия)

Журнал входит в Перечень ведущих рецензируемых научных журналов и изданий,


рекомендованных ВАК при Кабинете Министров Республики Узбекистан
при защите докторских диссертаций.

Журнал зарегистрирован в Узбекском агентстве по печати и информации.


Регистрационный номер №  0546 от 03.09.2008 г.
Журнал выходит 4 раза в год.

Редакция не несет ответственности за достоверность излагаемых фактов


и не всегда разделяет точку зрения авторов публикуемых материалов.
Ответственность за содержание рекламы несут рекламодатели.

Подписано в печать 10.11.2016. Формат 60 × 841/8. Печать офсетная.


Усл. п.л. 14  +  вкл. Тираж 500. Заказ № 666.

Отпечатано в ООО «Niso Poligraf». Ташкентская область, Уртачирчикский район,


ССГ «Ок-Ота», махалля Машъал, ул. Марказий, д. 1.
Содерж ание

ОБЗОР ЛИТЕРАТУРЫ
У.Ю. Собиров, Ф.В. Азимова, Н.Б. Ходжаева. Современное состояние проблемы фотостарения.......................5
А.М. Маннанов, К.Н. Хаитов, Х.А. Абидов. Современные аспекты лечения псориаза........................................ 14

ОРИГИНАЛЬНЫЕ СТАТЬИ
Ш.З. Мавлянова, К.Т. Бобоев, С.Р. Муминова, З.З. Ибрагимов . Разработка систем молекулярного
тестирования и анализа взаимосвязи полиморфизма gln551arg гена A — цепи рецептора
интерлейкина-4 (il4ra) с атопическим дерматитом...........................................................................................23
Д.Т. Равшанова, А.Б. Рахматов. Актуальные вопросы ониходистрофий: клиника,
диагностика, лечение..............................................................................................................................................26

ОБМЕН ОПЫТОМ

Ш.З. Мавлянова, М.С. Ибрагимов, А.И. Исмагилов, З.С. Юнусова, Ж.Б. Муллаханов, С.Р. Муминова.
Клиническая характеристика аллергодерматозов в Хорезмской области.......................................................32
З.М. Абидова, У.Б. Нурматов. Микотические поражения кожи и слизистых оболочек
у ВИЧ-инфицированных больных..........................................................................................................................34
А.Б. Рахматов, И.Б. Нурматова. Актуальные вопросы розацеа............................................................................40
Д.Ф. Порсохонова, А.М. Абидов, Ю.А. Алимухамедова. Перспективы использования отечественных
лекарственных препаратов «Гозалидон» и «Кобавит» при лечении осложненных форм
урогенитальных инфекций......................................................................................................................................46
Н.С. Ибрагимова, Х.Я. Каримов, А.А. Садиков, К.Т. Бобоев. Анализ ассоциации полиморфизма
481C/T гена NAT2 с развитием кожного зуда.......................................................................................................50
Д.Г. Абдуллаева. Применение современных методов диагностики при диетотерапии
аллергических заболеваний...................................................................................................................................54
Э.Х. Эшбоев, С.С. Умаров, С.Э. Эшбоев. Қизил югурук касаллигининг лаборатория диагностикаси.................59
З.М. Абидова, Т.А. Набиев, О.В. Извекова, А.А. Розиков, Х.Т. Исраилов, С.С. Салиходжаева.
Результаты внедрения комплексного метода терапии кожного лейшманиоза................................................63
С.Ф. Аляви. Оценка эффективности эрбисола в терапии псориаза.......................................................................68
У.Б. Беркинов, Д.П. Сахибоев. Буйрак усти бези яхши сифатли ўсмаларида лапароскопик
адреналэктомияни косметик аҳамияти................................................................................................................. 71
Б.Т. Саатов, Х.Я. Каримов, С.С. Арифов, Т.С. Саатов, З.З. Ибрагимов, К.Т. Бобоев.
Исследование связи полиморфизма 308 G/А гена TNF-α с риском развития витилиго................................. 75
М.Н. Солметова, М.Д. Аллаева, Д.Ж. Юлдашева. Распространенность рака кожи в Ташкенте
и опыт его лечения в Ташкентском городском онкологическом диспансере...................................................82
Б.Ш. Фаттахов, У.Ю. Сабиров, А.М. Абидов. Изучение влияния препарата «ЦелАгрип»
на состояние иммунной системы у больных урогенитальным уреаплазмозом и хламидиозом...................86

КОСМЕТОЛОГИЯ
а.Б. Рахматов, И.Р. Рахимов, Д.Т. Равшанова, О.А. Хужамбердыев. Современные проблемы
лечения послеожоговых и косметических рубцов...............................................................................................90

В помощь практическому врачу


Ш.М. Кабулов., Ш.Б. Турсунов., Н.Ш. Кабулов., Н.Б. Ходжаева, У.Б. Нурматов. Применение
гепатопротекторов в комплексной терапии при кожных заболеваниях у взрослых и детей..........................92

3
Дерматовенерология и эстетическая медицина № 2 / 2016

случаи из практики

А.М. Абидов, Г.Р. Ибрагимова, Б.Ш. Фаттахов, М.А. Назарова. Клинические случаи
пеллагроидного дерматита.....................................................................................................................................95
з.М. Абидова, И.Р. Рахимов, Н.А. Абдурахманова, Ж.А. Алимжанов, Г.С. Бабакулова.
Клинический случай течения лейшманиоза при наличии вич-инфекции.......................................................99
Ш.З. Мавлянова, З.С. Юнусова, З.Н. Мавлянова. Случай синдрома Шегрена–Ларссона
у 8-летней девочки................................................................................................................................................. 101
и.Р. Рахимов, И.Т. Карабаева, Ш.Ф. Садыкова. Клинический случай микроспории у взрослых......................104
Ф.М. Гафарова, Х.А. Алимова, З.М. Абдужабарова, Н.А. Исраилова, З.У. Абдухаликова,
К.А. Гафарова. Клинический случай врожденного ихтиоза у новорожденного ...........................................108
К.А. Юлдашев, Ю.Н. Исматова. Случай нейросифилиса с поражением органов зрения................................. 110

4
Обзор Литературы

Обзор литературы

УДК:616.5-017.44

Современное состояние проблемы фотостарениЯ

У.Ю. Собиров, Ф.В. Азимова, Н.Б. Ходжаева

Республиканский специализированный научно-практический медицинский центр


дерматологии и венерологии МЗ РУз

ХУЛОСА
Фотокариш муоммоларининг замонавий ҳолати
У.Ю. Собиров, Ф.В. Азимова, Н.Б. Ходжаева
Мақолада адабиётлар таҳлили бўйича фотоқаришнинг патогенези, зарарланиш шакллари ва замо-
навий даволаш тўғрисидаги тушунчалар берилган.
Калит сўзлар: фотоқариш, ультрабинафша нурланиш, пилинг, гиперпигментация.

S UMMARY
T he c urrent state of photoaging problems
U.Yu. Sobirov., F.V. Azimova., N.B. Khodjaeva
This article is dedicated to the investigation of the current stage of the pathogenesis of the photoaging, its
molecular-genetic aspects and methods of the treatment on the bases of the new scientific achievements by
the local and foreign researchers.
Keywords: Photoaging, UV-light, hyperpigmentation, pilings.

РЕЗЮМЕ
Современное состояние проблемы фотостарениЯ
У.Ю. Собиров, Ф.В. Азимова, Н.Б. Ходжаева
В статье на основе анализа последних научных достижений отечественных и зарубежных ученых
рассмотрены и изучены патогенез, молекулярно-генетические аспекты и современные методы ле-
чения фотостарения.
Ключевые слова: фотостарение, ультрафиолетовое облучение, пилинг, гиперпигментация.

С тарение кожи является актуальной про-


блемой современной дерматокосметоло-
гии. В настоящее время принято отдельно рас-
молодость», больные часто ищут кремы и про-
цедуры, которые могут улучшить вид их кожи.
В 2004 г. США начали продажу косметических
сматривать такие разновидности старения кожи, товаров, продуктов, подразумевающих, что они
как менопаузальное, связанное с изменением имеют медицинскую или подобную лекарствам
гормонального фона при менопаузе, и фотоста- пользу, рассчитанную на более чем 12,4 млрд
рение, связанное с ультрафиолетовым облучени- долл. США. К 2010 г. ожидалось, что рынок анти-
ем. Адекватная коррекция фотостарения посто- старения даст более 16,5 млрд долл. от продаж
янно находится в центре внимания специалистов (Choi  & Berson, 2006). Исследование старения
из-за высокой частоты этого феномена, что об- кожи также существенно продвинулось в по-
условлено активным использованием соляриев, следние 2 десятилетия. Клинические проявле-
экологическими изменениями климата и популяр- ния старения кожи, механизмы которого лежат
ностью отдыха в регионах с активной инсоляци- в основе этих клинических изменений, и подхо-
ей [3]. ды к лечению будут разъяснены далее. Среди
Одна из наиболее общих дерматологических агрессивных факторов окружающей среды наи-
проблем больных — стареющая кожа. В куль- более губительное действие на кожу оказывает
туре, которую часто называют «мучительная солнечное излучение. Совокупность признаков

5
Дерматовенерология и эстетическая медицина № 2 / 2016

старения кожи, обусловленных действием уль- прямыми лучами солнца, злоупотребление соля-
трафиолетового излучения, называют фотоста- рием неминуемо влечет за собой фотостарение
рением. Фотостарение существенно отличается кожи — патологический процесс, характеризую­
от старения хронологического. Хронологическое щийся неблагоприятными морфологическими из-
старение происходит с течением времени, а фо- менениями в эпидермисе. Воздействие ультра-
тостарение — от «меры» инсоляции (облучения фиолетовых лучей А (UVA) вызывает в коже уси-
солнечным светом) и кожной пигментации [1]. ленное деление материнских клеток эпидермиса
Экспонированные на солнце участки кожи, — кератиноцитов, участвующих в ороговении
такие как лицо, шея, верхняя часть груди и пред- (кератинизации) эпидермиса и его постоянном
плечья, — места, где эти изменения наиболее обновлении. Нарушение дифференцировки (по-
часты. В начале XIX в. исследователи обнару- следовательного развития) кератиноцитов приво-
жили глубокие различия в коже лица фермеров дит к неравномерному ороговению и утолщению
и моряков по сравнению с лицами рабочих в по- эпидермиса. Изменения эпидермиса влекут за
мещениях (Urbach, Forbes, Davies & Berger, 1976). собой изменения в более глубоких слоях кожи.
Было отмечено, что работники на свежем воз- Так, в дерме начинается процесс, именуемый
духе имеют более толстое и коричневатое вы- «солнечным эластозом» — происходит разруше-
цветание на экспонированной свету коже; эти ние эластиновых волокон (их уплотнение, нару-
изменения были также связаны с повышенным шение структуры, фрагментация, закручивание,
числом раков кожи (Urbach et al., 1976). Было до- уменьшение количества), возникают очаги хрони-
казано, что длительная экспозиция UVA (напри- ческого воспаления, застойные явления в капил-
мер, чрезмерное использование солярия) вызы- лярах, что приводит в дальнейшем к изменению
вает структурные изменения кожи, аналогичные русла капиллярного кровотока и возникновению
длительной экспозиции на солнце. Здесь умест- телеангиэктазий.
но подчеркнуть важность дозированного исполь- Клинические признаки фотостарения вклю-
зования соляриев [9]. Ультрафиолетовые лучи чают: сухость; нерегулярную, темную/светлую
обладают кумулятивным эффектом, поэтому раз- пигментацию; землистость; глубокие борозды,
витие признаков солнечной геродермии наблю- тяжелую атрофию; телангиэктазии; предзлока-
дается у лиц, подвергавшихся интенсивной инсо- чественные разрушения; вялость; дряблый вид
ляции в молодом возрасте, даже если впослед- (Yaar, Eller & Gilchrest, 2002). Другие признаки
ствии они избегали солнечных лучей [11]. включают эластоз — грубый, желтый, эффект
Энергия, которой обладают фотоны, обрат- «булыжного камня» на коже и актиническую пур-
но пропорциональна длине волны, поэтому наи- пуру — легкий кровоподтек, связанный с хрупко-
большим биологическим эффектом обладают стью сосудистой стенки в дерме (Gilchrest, 1990).
лучи в коротковолновой части спектра. Ультра- Хронологическое старение кожи, напротив,
фиолетовое излучение в зависимости от его характеризуется вялостью и тонкой морщинисто-
физических свойств и характера биологическо- стью, а также развитием доброкачественных ро-
го действия на организм делят на три отрезка: стов, таких как себорейные кератозы и ангиомы,
УФ-А  — от 320 до 400 нм; УФ-В — от 290 до 320  нм; но оно не связано с повышенной пигментацией
УФ-С — от 200 до 290 нм. Наиболее агрессивно или глубокими морщинами, которые характерны
воздействующие на кожу лучи с длиной волны для фотостарения (Yaar et al., 2002).
короче 290 нм (УФ-С) практически полностью по- Группа немецких исследователей выясни-
глощаются в озоновом слое атмосферы. В свя- ла роль еще одного активного биологического
зи с тем, что УФ-С-излучение не доходит до по- агента, так называемого «фибулина–2», внекле-
верхности Земли, а способность лучей спектра точного протеина, который может влиять на нор-
от 360 нм и выше вызывать эритему в 1000 раз мальную организацию волокон эластина. Иными
слабее таковой УФ-В, эритематозное действие словами, чем больше в дермальном слое фибу-
оказывает практически только средневолновая лина-2, тем сильнее страдает правильная струк-
часть ультрафиолетового облучения (УФ-В) [5, тура эластина [31]. Хотя фибулин-2 был обнару-
11]. Термин «фотостарение» был впервые отчека- жен достаточно давно, ему не придавали боль-
нен в 1986 г. и описывает эффекты хронической шого значения в контексте фотостарения кожи,
ультрафиолетовой (UV) световой экспозиции на поскольку его содержание в нормальной и фото-
кожу (Kligman & Kligman, 1986). Независимо от поврежденной коже примерно одинаково. Однако
того, подвергается кожа воздействию солнечных теперь доказано, что повышенная солнечная экс-
лучей или нет, она неизбежно стареет. Возраст- позиция заметно тормозит процессы естествен-
ные изменения организма в целом и кожи в част- ного распада фибулина-2, тем самым усиливая и
ности предопределены генами. дезорганизацию эластина [28].
Солнечный свет необходим для всего живого. Группа японских авторов изучила факторы
Благотворное влияние солнечных лучей на кожу кожной микроваскуляризации (капиллярного
неоспоримо. Но все хорошо в меру. Чрезмерное кровоснабжения) у 15 женщин в возрасте от 58
увлечение загаром, длительное пребывание под лет до 81 года. Сравнивались сосудистые пока-
6
Обзор Литературы

затели кожи перед ушной раковиной (наиболее Мышам из другой группы перед фотооблу-
фотоуязвимой) и кожи сзади нее (фотозащищен- чением на побритую кожу наносился витамин D
ной). Было выяснено, что фотоповрежденная определенной разновидности (1,25 (OHJ2D3)).
кожа имеет депрессию эндотелия мелких сосу- Последующее гистологическое исследование по-
дов, что неминуемо приводит к нарушению ми- казало принципиально иную морфологическую
кроциркуляции. Это провоцирует образование картину: адипоциты и фибробласты были сохра-
нового сосудистого рисунка, который преимуще- нены при отсутствии признаков фиброза.
ственно проявляется ненормальными кожными Новые информации об деформации колла-
сосудистыми образованиями (микроангиома- гена при избыточной инсоляции были опубли-
ми, телеангиоэктазиями и пр.) [26]. Кроме того, кованы в американском журнале «The American
нарушение нормальной васкуляризации дер- Journal of Pathology». Было доказано, что в
мального слоя крайне негативно отражается на фотоповрежденной коже значительно наруша-
состоянии эластина, который начинает терять ется синтез проколлагена 1-го и 3-го типов  —
свои нормальные параметры, утолщаясь и деф- веществ, необходимых для формирования
рагментируясь. Одно из наиболее выраженных нормальных коллагеновых волокон. При этом на-
проявлений фотостареющей кожи — снижение рушении может быть заметно ускорение распада
ее эластичности и упругости. Изучая биохимию ферментов металлопротеиназ, также играющих
фотостарения, японские авторы выяснили, что заметную роль в формировании коллагена и под-
во время липидных окислительно-восстанови- держания тонуса в нем.
тельных реакций, помимо прочих веществ, обра- Для изучения этих явлений обследовалась
зуются акролеин и 4-гидрокси-2-ноненал (HNE). кожа открытых (лицо, предплечья) и закрытых
Антитела, вырабатываемые на эти вещества, участков тела. Было выявлено снижение содер-
очевидно губительны для фибриновых волокон, жания протеиназ на 57–65  % на участках кожи,
которые, как показывают исследования, оказы- подвергавшихся избыточной инсоляции. При
ваются в значительной степени нарушенными. этом (что, кстати, противоречит данным других
В гораздо большей степени эти явления выра- исследователей) количественный и качествен-
жены на участках лица и тела, подвергающихся ный состав фибробластов на участках фотопов-
солнечной экспозиции. режденной кожи существенно не отличался от
Таким образом, под повышенным воздействи- этих же показателей на фотозащищенной коже.
ем солнца скорость липидных окислительно-вос- Тем не менее, нарушение синтеза проколлагена
становительных реакций является дополнитель- приводит к однозначным изменениям и в самом
ным фактором риска для образования синдрома коллагене. При фотоповрежденной коже колла-
фотостареющей кожи. Это доказывает эффек- геновые волокна располагались не упорядочен-
тивность антиоксидантов, применение которых но, а хаотично и при этом были более короткими,
оказывается часто оправданным при кожных ин- тонкими и ломкими. Кроме того, коллаген на этих
волюционных процессах. участках кожи имел выраженную тенденцию к
В одной из работ приведены интересные све- деградации, из чего делается вывод, что при ис-
дения о влиянии витамина D на факторы кожной пользовании средств (имеется ввиду лекарствен-
защиты при фотоагрессии. Как известно, вита- ных, для создания которых существуют все тео-
мин  D является физиологическим регулятором ретические и практические предпосылки), спо-
пролиферации («размножения») и дифференциа- собных воздействовать на нормальную функцию
ции клеток кожи, включая кератиноциты, фибро- проколлагенов, клинические проявления фото-
бласты и адипоциты. старения кожи могут быть значительно сглажены.
В основу работы положены эксперименты над Неинвазивное сравнительное изучение фо-
белыми мышами. В одну группу входили мыши, у топоврежденной и фотонеповрежденной кожи
которых была сбрита шерсть на спине. Они под- было проведено в работе Kikuchi-Numagami К.,
вергались солнечной иррадиации на протяжении Suetake  T. с соавт., 2000 г. Для этого изучались
20 недель 5 раз в день (в публикации не указа- предплечья игроков в гольф. Гольфисты были
на продолжительность каждого сеанса). По ис- удобной группой для исследования, так как во
течении контрольного времени были отчетливо время игры одна рука находится в длинной пер-
видны проявления кожного увядания, выражаю- чатке, а другая — без, что приводит к принципи-
щиеся в виде усиленного морщинистого рисунка. альной разнице в дозе инсоляции. Было обна-
Гистологические и биохимические исследования ружено значительное уменьшение гидратации
показали почти полное исчезновение адипоци- поверхности кожи на открытых участках при не-
тов, угнетение синтеза коллагена, гиалуроновой изменной трансэпидермальной потере влаги и
кислоты и хондроитина, которые ответственны нормального функционирования водного барье-
за синтез фибробластов. На этом фоне были вы- ра рогового слоя. Это доказывает, что морфо-
явлены признаки тотального внутридермального логические изменения фотоповрежденной кожи
фиброза (избыточное разрастание соединитель- имеют не столько механический, сколько клеточ-
ной ткани). ный и внутриклеточный характер.
7
Дерматовенерология и эстетическая медицина № 2 / 2016

В работе румынского ученого Taranu T. (1998) бробласты синтезируют проколлаген, превраща-


акцентируется внимание на том, что структур- ясь в коллаген. Имеются два важных регулятора
ные и функциональные изменения кожи под воз- коллагеновой продукции: фактор трансформирую-
действием солнечной радиации (дерматохелиоз) щего роста (TGF)-b и белок-активатор (AP)-1.
усугубляются после 50 лет, когда начинаются об- TGF-b — это цитокин, который промовирует
щие инволюционные изменения. В это же время продукцию коллагена (Massagu E, 1998), AP-1 —
начинаются нарушения дифференциации кера- транскрипционный фактор, который ингибирует
тиноцитов. Все эти факторы, кроме ухудшения продукцию коллагена и сверхрегулирует распад
общего состояния кожи, чреваты и онкологиче- коллагена (Kang, Fisher, Voorhees, 1997).
скими последствиями, в первую очередь плоско- Коллаген в коже подвергается продолжитель-
клеточным раком кожи. ному кожному ремоделированию и переворачи-
На этом фоне является доказанным влияние ванию с TGF-b и AP-1. Когда кожа экспонируется
витамина А (ретинола) на рост и деление клеток. солнечному свету, UV облучение абсорбирует-
Использование ретиноидов (комбинации витами- ся молекулами кожи, генерирующими вредные
на А и ретиноевой кислоты) может значительно составные части, называемые «реактивными
снизить риск кожных проблем как эстетического, кисло­родными видами (ROS)», которые затем
так и онкологического характера. Причем, обла- обусловливают «окислительное повреждение»
дая хорошей проницаемостью, эти вещества спо- клеточных компонентов, подобных клеточным
собны действовать не только на эпидермис, но стенкам, липидным мембранам, митохондри-
также собственно на дерму и даже субдермаль- ям и ДНК. Эти ROS также играют важную роль
ные слои. в молекулярных путях. Облучение кожи ягодиц
Кроме превентивного воздействия, ретинои- человека 2 MED (два раза доза UVA/UVB, кото-
ды, обладая пролиферативным эффектом, могут рая обусловливает заметное покраснение кожи,
оказаться достаточно эффективными и при лече- минимальная доза эритемы) повышает генера-
нии рака эпителиального слоя. цию перекиси водорода, ROS в течение 15 минут
На эпидермальном слое сконцентрировали (Kang et al., 2003). В рамках этого же времени AP-
свое внимание и Toyoda M. и Morohaski M. (1998), 1, который ведет к повышенной ломке коллагена,
изу­чая меланоциты эпидермиса современным повышается и остается повышенным по крайней
цитоморфометрическим способом. Сравнивая мере на 24 часа после UV облучения (Fisher et
меланоциты фотоповрежденной и фотозащищен- al., 1996). Коллаген-деградирующие MMPs, кото-
ной кожи одного и того же человека под элек- рые сверхрегулируются AP-1, также значительно
тронным микроскопированием, они выявили их повышаются в течение 24 часов UV облучения
характерные изменения при фотоповреждении  — (Fisher et al., 1996). В течение 24 часов един-
значительное увеличение их числа, деформацию ственной дозы UV облучения может быть пока-
клеточного ядра и пр. зан распад коллагена (Fisher et al., 1997).
Также доказаны и дегенеративные изменения Суммируя сказанное, можно сделать вывод,
кератиноцитов. Эти данные показывают одно- что UV облучение ведет к генерированию ROS и
значность изменений при фотостарении на кле- индукции AP-1, которые обусловливают продук-
точном уровне эпидермального слоя, вслед за цию MMPs с последовательно повышающимся
чем начинаются и изменения более глубоких распадом коллагена. Также UV облучение ведет
слоев. к пониженной выраженности TGF-b 2, члена се-
Имеются микроскопические различия в двух мьи TGF-b. Как отмечалось ранее, TGF-b промо-
процессах старения: как и в хронологически ста­- вирует образование коллагена и таким образом
реющей коже, эпидермис атрофичен, с разгла- снижает выраженность TGF-b, что обусловливает
женным дермально-эпидермальным соединением сниженную продукцию коллагена. Исследовате-
и потерей сетевых колышков (Kurban & Bhawan, ли продемонстрировали сниженный синтез про-
1990). Дерма также становится тоньше, со сни- коллагена в течение 8 hours UV облучения (Quan,
женным количеством фибробластов и уровнем He, Kang, Voorhees, Fisher, 2002). Повышенный
коллагена (Varani et al., 2000). Фотостареющая распад и сниженная продукция коллагена — это
кожа, напротив, может быть связана или с повы- угловые камни фотостарения. Каждое поврежде-
шенной эпидермальной толщиной, или выражен- ние UV индуцирует ответ раны с последователь-
ной эпидермальной атрофией. Наиболее харак- ным несовершенным восстановлением, оставляя
терным гистологическим изменением является ак- невидимый «солнечный рубец».
кумулирование эластинсодержащего материала, Повторяющееся повреждение UV в течение
только нижедермально-эпидермального соеди- жизни в конце концов ведет к развитию видимого
нения, известного как солнечный эластоз (Lavker, «солнечного рубца», проявляя видимую морщин-
1995). Коллаген, состоящий более чем на 90  % из ку (Kang, Fisher & Voorhees, 2001).
общих кожных белков, становится дезорганичным Как было отмечено выше, под воздействием
(Bernstein et al., 1996). А это один из главных стро- солнечных лучей происходит утолщение рогово-
ительных блоков кожи человека. Дермальные фи- го слоя эпидермиса как защитной реакции кожи
8
Обзор Литературы

на повреждающее действие ультрафиолетового повреждение ведет к невидимому «солнечному


луча. Наблюдается также акантоз, сочетающий- рубцу». Общепринято, что повышенная природ-
ся с клеточной атипией, потерей полярности и ная пигментация (более темный тон кожи) свя-
неодинаковым размером клеток. В целом от- зана с защитой от солнечного повреждения. Ме-
мечается утолщение эпидермиса (в отличие от нее вероятно, что у темнокожих людей возникнет
его истончения при внутреннем старении) как солнечный ожог после солнечной экспозиции, и у
следствие хронической стимуляции ультрафио­ них более низкая частота рака кожи. К тому же,
летового луча (Kligman L.N., 1986). И только в ко- темно-пигментированные субъекты значительно
нечной стадии фотостарения кожи наблюдается меньше вызывают распад коллагена и меньше
атрофия эпидермиса. Кроме того, под воздей- повреждение ДНК, чем светло-пигментирован-
ствием ультрафиолетового луча нарушается про- ные субъекты (Fisher et al., 2002). Эти молекуляр-
цесс созревания кератиноцитов, проявляющийся ные данные поддерживают клиническое наблю-
сухостью и шелушением кожи — ксерозом. дение, что темная пигментация кожи защищает
В эпидермисе могут появляться также ати- от фотостарения.
пичные кератиноциты, что обусловливает разви- В общем, считается, что молекулярные изме-
тие солнечного кератоза, относящегося к пред- нения фотостарения — это увеличение и усиле-
раковым заболеваниям. На открытых участках ние молекулярных изменений, связанных с хро-
кожи (лицо, уши, шея, предплечья, тыльная по- нологическим старением кожи (Fisher et al., 2002).
верхность кистей, голени) отмечается появление В стареющей коже есть прирост AP-1 по сравне-
жестких, ороговевших чешуек желто-коричнево- нию с молодой кожей (Chung et al., 2000). Актив-
го цвета, плотно спаянных с подлежащей кожей. ность MMP также усиливается в стареющей коже
Удаление чешуек болезненно, что является важ- человека и ассоциируется с повышенными уров-
ным диагностическим признаком заболевания нями распадающегося коллагена (в 4 раза выше
[17]. у взрослых, чем у молодых субъектов) (Fisher et
Меланоциты под действием солнечного света al., 2002). К тому же синтез проколлагена типов
не претерпевают каких-либо структурных изме- I и III редуцируется в стареющей коже человека
нений, однако количество их в базальном слое (Varani et al., 2000). Сочетание усиленного рас-
эпидермиса и размеры увеличиваются. В резуль- пада коллагена и сниженного синтеза нового
тате пролиферации меланоцитов на коже обра- коллагена результирует в общем снижении уров-
зуются желто-коричневые и коричневые пятна, ней коллагена в дерме. Эти молекулярные изме-
которые называются старческим или солнечным нения в хронологически стареющей коже имеют
лентиго. Изменения пигментации кожи при сол- сходство с изменениями, связанными с фотоста-
нечной геродермии могут проявляться помимо рением. Это поддерживает понятие о том, что
солнечного лентиго также веснушками, имеющи- фотостарение накладывается и усиливает изме-
ми меньшую сезонную зависимость, в отличие от нения, связанные с хронологическим старением
веснушек, которые возникают у людей молодого кожи.
возраста, а также мелкими гипопигментирован- Лечение стареющей кожи включает меры за-
ными пятнами [14]. щиты от UV повреждения, медикации и процеду-
Повреждение ультрафиолетовыми лучами ры для устранения существующего повреждения.
клеток Лангерганса, располагающихся преиму- Первое, что нужно сделать для предотвращения
щественно в шиповатом слое эпидермиса, об- фотостарения — уменьшить количество фото-
ладающих антигенпрезентирующей функцией и нов, достигающих кожу. Для этого следует, по
осуществляющих иммунный надзор, приводит к возможности, избегать солнца и использовать
нарушению механизмов иммунологической защи- солнцезащитные средства.
ты кожи. В связи с тем, что повреждающим действием
Количество клеток Лангерганса уменьшается, обладает не только УФ излучение, идущее с пря-
снижается также их функциональная активность мыми лучами солнца, но и отраженное от земли
(Gilchrest В.A. et al., 1982). В результате повыша- и окружающих предметов, проходящее сквозь
ется риск развития таких злокачественных ново- облака, воду и легкую одежду, необходимо еже-
образований, как меланома, базалиома, плоско- дневно, независимо от времени года, использо-
клеточный ороговевающий рак на подверженных вать косметику, содержащую УФ фильтры.
воздействию солнечных лучей участках кожи. Все УФ фильтры делятся на химические (или
Модель, рисующая эффект ультрафиоле- органические) и физические, или экраны, содер-
тового облучения на кожу. Острая УФ радиация жащие частички, рассеивающие, отражающие и
ведет к генерации ROS, сверхрегуляции AP-1 и поглощающие УФ излучение. К органическим от-
сниженной регуляции TGF-b. AP-1 ведет к ломке носятся УФВ фильтры — цинкоматы, бензофе-
коллагена, в то время как сниженная активность нол, парааминобензойная кислота (РАВА) и ее
TGF-b ассоциируется со сниженной продукцией производные — салицилаты, камфоры и др., УФА
коллагена. Ни одно повреждение кожи не вос- фильтры — дибензоилметан, бензофенон, произ-
станавливается превосходно; острое солнечное водные камфоры.
9
Дерматовенерология и эстетическая медицина № 2 / 2016

Природные солнцезащитные средства — экс- Антиоксиданты в косметике, как и в коже, де-


тракты алоэ, ромашки, кофейная кислота, масло лятся на жирорастворимые (липофильные) и во-
каритэ, 1-, 3-бета-глюканы и др. В качестве не- дорастворимые (гидрофильные).
органических УФ фильтров используют диоксид Из жирорастворимых чаще всего используют
титана (TiO2), оксид цинка (ZnO), оксиды железа альфа-токоферол, каротиноиды, сквален, убихи-
(Fe2O3, Fe3O4) и т. д. Помимо использования УФ нон, из водорастворимых — витамин С, а также
фильтров существуют другие меры защиты кожи растительные полифенолы (флавоноиды).
от фотостарения. Источником флавоноидов, оказывающих анти-
В коже в процессе эволюции сформировались оксидантное, противовоспалительное и сосудо-
защитные механизмы, позволяющие снизить по- суживающее действие, чаще всего являются экс-
вреждающее действие УФ лучей. Часть из них тракт зеленого чая, виноградных косточек, коры
работает также по принципу фильтров и позво- приморской сосны, гинкго, ромашки приморской,
ляет снизить число фотонов, достигающих уяз- календулы лекарственной, василька синего и др.
вимые структуры кожи. В качестве химических растений.
фильтров выступают вещества, поглощающие В связи с тем, что реакции с участием свобод-
УФ излучение — меланин, уроканиновая кислота. ных радикалов, вызванные УФ излучением, раз-
Роль физического фильтра берет на себя рого- ворачиваются в коже достаточно быстро, важно
вой слой, который утолщается в ответ на интен- обеспечить надежную защиту до начала дей-
сивное УФ излучение. ствия повреждающего фактора. Поэтому антиок-
Прямое повреждающее действие УФ излуче- сиданты и УФ фильтры стали обязательным ком-
ния на биоткани лишь отчасти ответственно за понентом дневных и солнцезащитных кремов, а
фотостарение. Более серьезный вклад в этот также средств декоративной косметики.
процесс вносят реакции с участием свободных Постоянно используя косметические сред-
радикалов, образующихся как в результате пря- ства, содержащие антиоксиданты, и избегая сол-
мого действия УФ излучения, так и сопровождаю­ нечных ванн, можно существенно замедлить ско-
щих вызванную им воспалительную реакцию. рость старения кожи.
Поэтому большую роль в защите кожи от УФ из- При имеющихся уже признаках фотостарения
лучения играют антиоксиданты — вещества, (морщины, пигментные пятна, телеангиоэктазии
обезвреживающие свободные радикалы и блоки- и т.  д.) целесообразно применять не только за-
рующие реакции с их участием. щитные, но и лечебные средства. Фотозащита
В коже существует надежная антиоксидант- относится к мерам, которые могут быть приня-
ная система, состоящая из жирорастворимых ты для защиты от UV поражения, и достигается
антиоксидантов, поступающих на поверхность солнцезащитными кремами, защищающей от
кожи с кожным салом — альфа-токоферол, бе- солнца одеждой и воздержанием от попадания
та-каротин, сквален, и защищающая кератин и прямых лучей солнца. Солнцезащитные кремы
липиды эпидермиса от свободнорадикального определяются как препараты, защищающие от
окисления. UV повреждения и солнечного ожога, морщин
Кроме того, в клетках эпидермиса присут- и пигментных изменений (Gilchrest, 1996). Фак-
ствует целый набор антиоксидантов фермент- тор защиты от солнца (SPF) относится к уровню
ной и неферментной природы. К первым отно- защиты от ультрафиолета B и не считается за-
сятся супероксиддисмутаза (СОД), каталаза, щитой от ультрафиолета A. Следует выбирать
глутатионпероксидaза. В мембранах кератино- солнцезащитное средство с SPF 15 или выше,
цитов много альфа-токоферола, блокирующего солнцезащитные кремы следует использовать
реакции перекисного окисления липидов. В ци- каждые 2–3 часа, особенно при деятельности на
топлазме клеток содержится аскорбиновая кис- свежем воздухе.
лота, которая является восстановителем для Теория фотостарения появилась в середине
альфа-токоферола. 80-х годов XIX в. и вскоре стала сенсацией. То,
Кроме того, антиоксидантными свойства- что всегда считалось необратимыми возраст-
ми обладают также женские половые гормоны, ными изменениями кожи, борьба с которыми —
серосодержащие аминокислоты, растворимые удел безумцев или шарлатанов, оказалось чем-
предшественники меланина, мелатонин. Однако то вроде болезни, которая поддается лечению.
антиоксиданты белковой природы, как и другие И уже в 1986  г. появились работы А.М.  Клигмана,
белки, повреждаются УФ излучением и снижают которые продемонстрировали способность пре-
свою активность. Другие антиоксиданты в про- паратов транс-ретиноевой кислоты (третиноина)
цессе борьбы со свободными радикалами окис- устранять многие признаки фотостарения и вос-
ляются и требуют восстановления. станавливать нормальную структуру кожи. Вслед
Поддержать естественную антиоксидантную за работами Клигмана на страницы медицинских
систему кожи на должном уровне можно с помо- журналов хлынул поток публикаций, посвящен-
щью косметических средств, содержащих антиок- ных лечению фотостарения. Как только способ-
сиданты. ность третиноина устранять признаки старения
10
Обзор Литературы

получила подтверждение, внимание производи- 4 баллов — рекомендован косметический


телей косметики обратилось в сторону как тре- уход; сумма 5–9 баллов — поверхностный хи-
тиноина, так и других соединений сходного дей- мический пилинг гликолевой, молочной кис-
ствия (ретиноидов). лотой, пилинг раствором Джесснера; сум-
Ретиноиды, которые ранее использовались ма 10–14 — срединный химический пилинг;
в дерматологической практике для лечения сумма выше 15 баллов — глубокий химический
акне и некоторых других кожных заболеваний, пилинг или лазерная шлифовка кожи.
сопровож­дающихся дискератозом (например, их- Основным принципом наружной коррекции
тиозом), перешагнули пропасть, отделяющую ле- признаков фотоиндуцированного старения кожи
карства от косметических средств, и открыли эру является отшелушивание поверхностных слоев
космецевтики [18]. эпидермиса и стимуляция образования кератино-
Учитывая многообразие факторов, участвую- цитов.
щих в патогенезе фотостарения, коррекция этого Методом выбора №  1 является проведение
состояния кожи должна носить комплексный под- поверхностного химического пилинга альфа-ги-
ход и включать как общие, так и местные мето- дроксикислотами (гликолевая, молочная, лимон-
ды лечения. Разработка комплексной программы ная). Назначение пилинга требует знания опре-
лечебных мероприятий зависит от того, насколь- деленных параметров — тип кислоты в данном
ко правильно и полно поставлен диагноз. В этом продукте, метод и степень нейтрализации, кон-
специалисту помогают различные классифика- центрация и т.д.
ции, определяющие степень выраженности кли- Процедуры проводят с постепенным повы-
нических признаков увядания. К наиболее часто шением концентрации гликолевой кислоты (от 25
используемым относят классификации Глогау, до 70  %) и с обязательным дополнительным при-
Монгейта и Фултона. менением в домашних условиях эмульсии, со-
Классификация Глогау предусматривает 4 держащей 12–15  % гликолевой кислоты (на ночь)
типа или стадии увядания: и эмульсии с витамином С (20  %) и фотозащитой
1-я стадия — отсутствие морщин. Преждевре- (утром). Если кожа клиентки «привыкшая» к по-
менное фотостарение с легкими расстройства- верхностному химическому пилингу, допустимо
ми пигментации, отсутствием кератоза и мелких доведение содержания гликолевой кислоты до
морщин. Наблюдается в возрасте от 20 до 35 70  % уже с первой–второй процедуры.
лет; Проведение поверхностного химического
2-я стадия — закладка морщин. Фотостарение пилинга альфа-гидроксикислотами позволяет
средней степени выраженности, начало развития уменьшить плотность рогового слоя, выражен-
сенильного лентигиноза, кератоза, формирова- ность морщин, улучшить гидратацию кожи, цвет и
ние мимических морщин вокруг рта. Наблюдает- текстуру.
ся в возрасте от 35 до 50 лет; Методом выбора при гелиодермите средней
3-я стадия — морщинистая стадия. Фотостаре- степени выраженности является ретиноевая кис-
ние выраженное, видимые признаки дисхромии, лота. Начальная схема применения варьирует в
телеангиэктазии, кератоз, морщины видимы даже зависимости от фототипа кожи, степени фото-
в покое. Наблюдается в возрасте старше 50 лет; сенсибилизации и выраженности признаков фо-
4-я стадия — окончательное формирование тостарения. В первый месяц лечения проводят
морщин. Фотостарение крайней степени выра- ежедневные аппликации 0,02  % ретиноевой кис-
женности. Кожа желто-серого цвета, единичные лоты, затем переходят на концентрацию 0,05  %.
образования эпителиального рака кожи, по всей При нанесении эмульсии периорбитальную зону
поверхности выраженные морщины, проявляю- следует обходить. При хорошей переносимости,
щиеся и в покое. Наблюдается в возрасте от 60 отсутствии эритемы, жжения и зуда кожи еже-
до 80 лет. дневные аппликации следует продолжать в те-
Классификация Монгейта и Фултона предус­ чение года (с остановкой на период инсоляции).
матривает оценку в баллах, а также наличие Установлено, что видимый эффект наблюдается
сле­дующих признаков: не ранее чем через 6 месяцев после непрерыв-
—  эпидермальные образования (веснушки, ного лечения и достигает максимума через де-
пигментные пятна, телеангиэктазии, себорейный сять месяцев.
и актинический кератоз, рак кожи, сенильные ко- При более выраженном гелиодермите моноте-
медоны); рапии ретиноевой кислотой недостаточно. Реко-
—  дермальные повреждения (морщины, попе- мендуется сочетать применение ретиноевой кис-
речная исчерченность, нарушение общего тона лоты с лазерным или химическим пилингом.
кожи, ее огрубение, атрофия, миллиум). Процедуры по шелушению усиливают топи-
Каждый из признаков оценивается в бал- ческим применением энзимов, жирорастворимых
лах от 1 до 4 и исходя из полученной сум- антиоксидантов (альфа-токоферол, бета-каротин)
мы определяется необходимая глубина про- и водорасторимых антиоксидантов (аскорбино-
ведения химического пилинга: сумма от 1 до вая кислота, глютатион).
11
Дерматовенерология и эстетическая медицина № 2 / 2016

Общая терапия и защита кожи от агрессии но сокращает признаки фотостарения. Активация


ультрафиолетового излучения. Первые ис- регенеративных процессов в коже является эф-
следования, проведенные более 10 лет назад, фективным методом в борьбе с фотостарением.
продемонстрировали, что пищевые добавки, со- В этом ключе целесообразно использовать раз-
стоящие из комплекса витаминов и олигоэлемен- личные отшелушивающие средства — пилинги
тов, способны оказывать действие на внешние как химические (фенолом, трихлоруксусной кис-
признаки фотостарения, а также замедлять их лотой (ТСА), альфа-гидроксильными кислотами
развитие. Экспериментальным путем было уста- (АНА)), так и аппаратные — дермобразия, лазер-
новлено, что органический кремний играет в этом ная шлифовка (эрбиниевые и СО2-лазеры). На-
плане ключевую роль. Витамин А ответствен ряду со стимуляцией регенерации кожи эти ме-
за обновление кератиноцитов. Под действием тоды являются высокоэффективными в борьбе
ультра­фиолетового излучения наблюдается яв- с гиперпигментацией, которая является одним из
ление дискератоза (повреждение структуры ке- характерных признаков фотостарения кожи и не
ратиноцитов), которое можно корректировать пу- поддается консервативной терапии 2–4  % гидро-
тем введения дополнительных доз витамина А. хиноном, койевой, аскорбиновой, фитиновой, ли-
Белки коллагеновых структур чрезвычайно монной, гликолевой кислотами.
чувствительны к воздействию на них свободных С давних пор известно, что контролируемое
радикалов. При этом возможно как прямое, так повреждение верхнего слоя кожи может давать
и опосредованное повреждение коллагеновых омолаживающий эффект. В ответ на повреж-
волокон через развитие вторичного воспаления дение происходит активация регенеративных
(острого или хронического), что в конечном сче- процессов, и в результате наблюдается не толь-
те изменяет качество кожи. Витамины С и Е уча- ко заживление раны, но и общее улучшение
ствуют в восстановлении поврежденных клеточ- структуры стареющей кожи. Поэтому наряду с
ных мембран, а ассоциация витамина Е с органи- ретинои­дами для лечения фотостарения приме-
ческим кремнием повышает реакцию иммунной няется пилинг фенолом (глубокий) и трихлорук-
системы. сусной кислотой (средний).
В настоящее время существует большой вы- Альтернативой фенолу являются концентри-
бор пищевых добавок, действие которых направ- рованные препараты α-гидроксикислот (АНА).
лено на лечение и профилактику фотостарения. Здесь наиболее часто используется гликолевая
Большинство из них представляют собой сочета- кислота в концентрациях 50–70  %. Считается, что
ние «физиологических» доз олигоэлементов (ор- она действует не столько как отшелушивающий
ганический кремний и сульфат меди) с витамин- агент, сколько как прямой стимулятор синтеза
ным комплексом (токоферола ацетат, ретинола межклеточного вещества дермы [23].
пальмитат, никотинамид, перидоксин, рибофла- Отшелушивание кожи можно осуществлять
вин, аскорбиновая кислота). аппаратными методами — дермабразией и ла-
При назначении комплексных мероприятий зерной шлифовкой. Особую популярность здесь
следует учитывать также тесную связь фотоста- завоевали лазеры на углекислоте (СО2-лазеры)
рения с хронобиологическим, и при необходимо- и эрбиевые лазеры. Лазерное излучение погло-
сти сочетать вышеперечисленные процедуры с щается водой, содержащейся в коже, его энергия
заместительной гормональной терапией как на- переходит в тепло, в результате чего эпидермис
ружной, так и общей. почти мгновенно испаряется (или вапоризуется,
Основным средством против фотостарения от англ. vapor — пар). В зоне воздействия лазер-
являются ретиноиды. Еще в 1986 г. А.М.  Клигма- ного луча наблюдается не только вапоризация,
ном была впервые продемонстрирована способ- но и более или менее глубокая коагуляция тка-
ность транс-ретиноивой кислоты (третиноина) ни, затрагивающая дерму. Постепенно на месте
устранять многие признаки фотостарения и вос- испарившегося эпидермиса появляется новый,
станавливать нормальную структуру кожи. Впо- а в зоне коагуляции происходит усиленный син-
следствии эта способность ретиноидов была тез коллагеновых волокон. Если зона коагуля-
многократно подтверждена другими авторами. ции слишком обширна, нормальная регенерация
Ежедневное применение кремов, содержащих становится невозможной, и на коже образуются
ретиноиды, в частности, третиноина 0,1  %, замет- шрамы.

ЛИТЕРАТУРА

1. Xu Y., Shao Y., Voorhees J.J., Fisher G.J. Oxi- tivates epidermal growth factor receptor (EGFR)
dative inhibition of receptor type protein-tyrosine in human keratinocytes // J. Biol. Chem. 2006.
phosphatase kappa by ultraviolet irradiation ac- 281(37): 27389–97.

12
Обзор Литературы

2. Олисова О.Ю., Громова С.А., Смиренная В.А. 16. Quan T., He T., Kang S., Voorhees J.J., Fisher
Фотостарение кожи: современный взгляд на G.J. Solar ultraviolet irradiation reduces collagen
проблему // Российский журнал кожных и ве- in photoaged human skin by blocking transform-
нерических болезней. 2010. №  2. С.  58–62. ing growth factor-beta type II receptor/ Smad sig-
3. Снарская Е.С. Фотостарение кожи: современ- naling // Am. J. Pathol. 2004. 165(3): 741–51.
ные аспекты // Вестник дерматологии и вене- 17. Quan T., He T., Shao Y., Lin L., Kang S., Voor-
рологии. 2011. №  2. С.  98–103. hees J.J., Fisher G.J. Elevated cysteine-rich
4. Yasui H., Sakurai H. Chemiluminescent detection 61 mediates aberrant collagen homeostasis in
and imaging of reactive oxygen species in live chronologically aged and photoaged human skin
mouse skin exposed to UVA // Biochem. Biophys. // Am. J. Pathol. 2006. 169(2): 482–90.
Res. Commun. 2000. 269(1): 131–6. 18. Kang S., Chung J.H., Lee J.H., Fisher G.J., Wan
5. Pandel R., Poljsak B., Godic A., Dahmane R. Y.S., Duell E.A., Voorhees J.J. Topical N-acetyl
Skin photoaging and the role of antioxidants in its cysteine and genistein prevent ultraviolet-light-
prevention // ISRN Dermatol. 2013: 930164. induced signaling that leads to photoaging in
6. Снарская Е.С., Молочков В.А., Франк Г.А., За- human skin in vivo // J. Invest. Dermatol. 2003.
валишина Л.Э. Матриксные металлопротеи- 120(5): 835–41.
назы и их тканевые ингибиторы при базаль- 19. Kligman AM, Grove GL, Hirose R, Leyden JJ
но-клеточном и метатипическом раке кожи Topical tretinoin for photoaged skin // J. Am.
// Архив патологии. 2005. №  3. С.  141–6. Acad. Dermatol. 1986. 15(4Pt2):836–59.
7. Warmuth I., Harth Y., Matsui M.S., Wang N., De- 20. Goldfarb M.T., Ellis C.N., Weiss J.S., Voorhees
Leo V.A. Ultraviolet radiation induces phosphor- J.J. Topical tretinoin and photoaged skin // Cutis
ylation of the epidermal growth factor receptor 1989. 43(5):476–82.
// Cancer Res. 1994. 54(2): 374–6. 21. Kligman A.M. Current status of topical tretinoin in
8. Xu Y., Voorhees J.J., Fisher G.J. Epidermal the treatment of photoaged skin // Drugs Aging.
growth factor receptor is a critical mediator of 1992. 2(1):7–13.
ultraviolet B irradiation-induced signal transduc- 22. Stuzin J.M., Baker T.J., Gordon H.L. Treatment of
tion in immortalized human keratinocyte HaCaT photoaging. Facial chemical peeling (phenol and
cells // Am. J. Pathol. 2006. 169(3): 823–30. trichloroacetic acid) and dermabrasion // Clin.
9. Rittié L., Fisher G.J. UV-light-induced signal Plast. Surg. 1993. 20(1):9–25.
cascades and skin aging // Ageing Res. Rev. 23. Moy L.S., Howe K., Moy R.L. Glycolic acid modu-
2002. 1(4): 705–20. lation of collagen production in human skin fibro-
10. Peus D., Vasa R.A., Meves A., Pott M., Bey- blast cultures in vitro // Dermatol. Surg. 1996.
erle  A., Squillace K., Pittelkow M.R. H2O2 is 22(5): 439–441.
an important mediator of UVB-induced EGF- 24. Фержтек О. Косметика и дерматология. — М.:
receptor phosphorylation in cultured keratino- «Медицина». 1990. С  55–65.
cytes // Invest. Dermatol. 1998. 110(6): 966–71. 25. Bhawan J., Andersen W., Lee J., Labadie R., So-
11. Xu Y., Shao Y., Zhou J., Voorhees J.J., Fisher lares G. Photoaging versus intrinsic aging: a mor-
G.J. Ultraviolet irradiation-induces epidermal phologic assessment of facial skin // J. Cutan.
growth factor receptor (EGFR) nuclear transloca- Pathol. 1995. 22(2):154–159.
tion in human keratinocytes // J. Cell Biochem. 26. Kligman L.H. Photoaging. Manifestation, preven-
2009. 107(5): 873–80. tion and treatment // Clin. Geriatr. Med. 1989.
12. Jean C., Blanc A., Prade-Houdellier N., Ysebaert 5(1): 235–251.
L., Hernandez-Pigeon H., Al Saati T. et al. Epi- 27. Dalle Carbonare M., Pathak M.A. Skin photo-
dermal growth factor receptor/ beta-catenin/T- sensitizing agents and the role of reactve oxigen
cell factor 4/matrix metalloproteinase 1: a new species in photoaging // J. Photochem. Photobiol.
pathway for regulating keratinocyte invasiveness 1992. 30; 14(1–2):105–124.
after UVA irradiation // Cancer Res. 2009. 69(8): 28. Tedesco A.C., Martinez L., Gonzalez S. Photo-
3291–9. chemistry and photobiology of actinic erythema:
13. El-Abaseri T.B., Fuhrman J., Trempus C., Shen- defensive and reparative cut а neous mechanisms
drik I., Tennant R.W., Hansen L.A. Chemopreven- // Braz. J. Med. Biol. Res. 1997. 30(5):561–75.
tion of UV light-induced skin tumorigenesis by 29. Fisher G.J., Wang Z.Q., Datta S.C., Varani J.,
inhibition of the epidermal growth factor receptor Kang S., Voorhees J.J. Pathophysiology of pre-
// Cancer Res. 2005. 65(9): 3958–65. mature skin aging induced by ultraviolet light // N
14. Massague’ J., Blain S.W., Lo R.S. TGFb aignal- Engl. J. Med. 1997. 337(20):1419–1428.
ing in growth control, cancer, and heritable disor- 30. Voss W. Sun protection: dermatological and cos-
ders // Cell. 2000. 103(2): 295–309. metical aspects // SOFW-Journal. 2000. 126 (7):
15. Quan T., He T., Kang S., Voorhees J.J., Fisher G.J. 16–27.
Ultraviolet irradiation alters transforming growth fac- 31. Nordlund J.J., Abdel Malek Z.A. Pigment cell bi-
tor beta/smad pathway in human skin in vivo // J. ology: an historical review // J. Invest. Dermatol.
Invest. Dermatol. 2002. 119(2): 499–506. 1989. 92: 53  с –60  с.
13
Дерматовенерология и эстетическая медицина № 2 / 2016

32. Hill H.Z., Li W., Xin P. and Mitchell D.L. Melanin: 37. Владимиров Ю.А., Арчаков А.И. Перекисное
a two edged sword? // Pigment Cell. Research. окисление липидов в биологических мембра-
1997. 10:158–161. нах. — М.: «Наука». 1972.
33. Polo K.F. A short textbook of cosmetology // 38. Shindo Y., Witt E., Packer L. Antioxidant defense
Verlag fur chemische industrie, H.  Ziolkowsky mechanisms in murine epidermis and dermis and
GmbH, D-86150. Augsburg, 1998. P. 86–128. their responses to ultraviolet // J. Invest. Derma-
34. Giacomoni P.U., Gan D., Ingrassia M., Muizzud- tol. 1993. 100(3):260–265.
din N., Maes D., Marenus K., Mammone T. Pro- 39. Steenvoorden D.P., van Henegouwen G.M.
tection against indirect photodamage in human The use of endogenous antioxidants to improve
skin and in living skin equivalents // SOFW-Jour- photoprotection // Photochem. Photobiol. 1997.
nal. 2000. 126 (7): 2–5. 41(1–2):1–10.
35. Kelly G.S. Squalene and its potential clinical uses // 40. Jarnicka A., Arct J., Mojski M. Cosmetic appli-
Altern. Med. Rev. 1999. 4(1):29–36. cation of flavonoids — practical aspects // CHI
36. Thiele J.J., Schroeter C., Hsieh S.N., Podda M., Cosmetic&Housenhold ingrediends. Warsaw:
Packer L. The antioxidant network of the stratum Proceedings. 2000. P.  26–37.
corneum // Curr. Probl. Dermatol. 2001. 29: 26–42.

СОВРЕМЕННЫЕ АСПЕКТЫ ЛЕЧЕНИЯ ПСОРИАЗА

А.М. МАННАНОВ, К.Н. ХАИТОВ, Х.А. АБИДОВ

Ташкентский педиатрический медицинский институт

ХУЛОСА
ПСОРИАЗНИ ДАВОЛАШНИНГ ЗАМОНАВИЙ ТАМОЙИЛЛАРИ
А.М. Маннанов, К.Н. Хаитов, Х.А. Абидов
Ушбу мақола псориаз касаллигини даволашнинг замонавий тамойилларини ўрганишга
бағишланган. Унда псориазни даволанишида қўлланиладиган маҳаллий терапия, систематик тера-
пия, фототерапия ва биологик терапия усулларининг самарадорлигини илмий адабиётда ўрганиб
чиқилгани ёритилиб берилган.
Калит сўзлар: псориаз, маҳаллий терапия, систематик терапия, фототерапия.

S UMMARY
MO DERN ASPECTS OF THE PSORIASIS TREATMENT
A.M. Mannanov, K.N. Khaitov, Kh.A. Abidov
The issues devoted to studying the modern principles of the psoriasis treatment are considered in the arti-
cle. The article highlights the study of the efficiency of external therapy, systemic therapy, phototherapy and
biologic therapy of psoriasis in the scientific literature.
Keywords: psoriasis, external therapy, systemic therapy, phototherapy.

РЕЗЮМЕ
СОВРЕМЕННЫЕ АСПЕКТЫ ЛЕЧЕНИЯ ПСОРИАЗА
А.М. Маннанов, К.Н. Хаитов, Х.А. Абидов
В статье рассматриваются вопросы о современных методах лечения псориаза. Представлены
данные из научных литературных источников об изучении эффективности наружной, системной
биологической и фототерапии псориаза.
Ключевые слова: псориаз, наружная терапия, системная терапия, фототерапия.

Псориаз — хронический дерматоз мульти-


факториальной природы — характеризу-
ется длительным рецидивирующим течением и
заболевание, которое встречается у 2–4  % насе-
ления мира всех возрастов [22, 25, 26, 54].
Частота псориаза среди населения развитых
имеет тенденцию не только роста заболеваемо- стран Европы составляет 1,4–2,8  %, а всего в
сти, но и увеличения числа резистентных к ле- Европе псориазом болеют около 5 млн человек
чению форм [19, 20]. По данным различных ав- [34]. Частота заболеваемости детей до 16 лет
торов, это распространенное дерматологическое составляет 4,1  % [64]. Необходимо подчеркнуть,

14
Обзор Литературы

что в последние 15 лет наблюдается рост коли- го 15 инъекций или 2 мл 6  % раствора витамина
чества больных, поражение появляется в более В1, внутримышечно ежедневно или через день,
молодом возрасте, увеличивается доля тяжелых всего 15
инъекций, или цианкобаламин по 500
форм псориаза, резистентных к различным ме- мкг внутримышечно через день,
всего 15 инъек-
тодам терапии (псориатическая эритродермия, ций.
псориатическая артропатия) [60], что приводит Среди препаратов, обладающих дезинтокси-
к инвалидизации больных и значительному сни- кационным свойством, наиболее часто исполь-
жению качества их жизни. Целью лечения псо- зуют реамберин, реополиглюкин, изотонический
риаза является стабилизация и купирование раствор хлорида натрия, которые при прогресси-
проявлений кожного процесса, сохранение или ровании заболевания вводят по 400 мл 1–4 раза
восстановление трудоспособности и повышение в неделю, на курс 5–7 вливаний.
качества жизни больных. При выборе тактики ле- Детоксицирующая гемосорбция в течение
чения необходимо учитывать возраст и пол боль- многих лет применяется
для лечения тяжелых
ного, стадию заболевания, клиническую форму, форм псориаза в комплексе с традиционными
распространенность и локализацию псориати- методами лечения. Она способствует в даль-
ческого процесса, наличие сопутствующей пато- нейшем более доброкачественному
течению
логии, эффективность и переносимость предше- дерматоза у больных псориатическим артритом,
ствующей терапии [5]. Так, при локализации вы- псориатической эритродермией, пустулезным и
сыпаний на открытых участках кожного покрова экссудативным псориазом. По принципу эффе-
(лицо, волосистая часть головы, кисти) болезнь рентного воздействия используется и плазмафе-
оказывает значительное влияние на качество рез, дающий выраженный терапевтический эф-
жизни и вызывает тяжелые психоэмоциональ- фект [5, 21].
ные переживания [67]. По данным исследования При нарушениях функции печени, липидного
G. Krueger и соавт. (2001), 40  % больных псори- обмена показаны
гепатопротекторы (эссенциа­
азом были разочарованы неэффективностью ле, ЛИВ-52, дипромоний, фосфаден и др.). М.М.
получаемого лечения и 32  % считали лечение Хобейш [26] и Ю.С. Бутов с соавт. [2] отмеча-
недостаточным [49]. ют положительную динамику кожного процесса
Лечение псориаза должно быть комплексным при применении гепатопротекторов (гептрала
и сочетать применение препаратов как для мест- и фосфоглива соответственно) у больных псо-
ной (наружной), так и системной терапии. риазом с функциональными нарушениями гепа-
Современная дерматология располагает ши- тобилиарной системы. Применение гепанорма
роким спектром средств для лечения больных показано при назначении больным системной
псориазом. терапии (метотрексата, ретиноидов, Пува-те-
Применяемые в настоящее время методы рапии) с целью нивелирования гепатотоксиче-
терапии включают дезинтоксикационное и се- ского воздействия. Этот способ комплексной
дативное воздействие, транквилизаторы, вита- терапии позволяет повысить эффективность и
мины, иммуномодуляторы и иммуносупрессан- сократить сроки лечения больных псориазом
ты, физио­терапию и наружные средства [1, 21, [6].
27]. Больным псориатическим артритом назначают
В прогрессирующей стадии назначают ги- нестероидные противовоспалительные средства:
посенсибилизирующие препараты — 30  % рас- ибупрофен, индометацин (метиндол),
ортофен,
твор натрия тиосульфата по 10 мл внутривен- напросин, мефенамовую кислоту.
но, всего 10–15 вливаний; 25  % раствор магния Результаты проведенных исследований сви-
сульфата по 5–10 мл внутримышечно (10–12 детельствуют, что у больных псориазом повы-
инъекций);
10  % раствор кальция глюконата по шение фактора роста эндотелия сосудов (ФРЭС)
5,0–10,0 мл внутримышечно
(10–12 инъекций), играет важную роль в сосудистом звене патоге-
антигистаминные средства (1 раз в день фексо- неза дерматоза, отражает избыточный ангиоге-
фенадин, 180 мг, или лоратадин, 0,01, или эба- нез и, как следствие, нарушение функции эндо-
стин, 10 мг). При выраженном зуде,
невротиче- телиальных клеток. Иммунные нарушения могут
ских жалобах и нарушениях сна рекомендуют поддерживаться и усугубляться расстройствами
антигистаминные препараты с седативным дей- микроциркуляции, что приводит к утяжелению
ствием: хлорпирамин по 0,025 г, или
клемастин и хронизации патологического процесса. При-
по 0,001 г, или хифенадин по 0,025 г 2–3 раза в менение цитостатической терапии в сочетании
день. В тяжелых случаях (ночной зуд, бессонни- с сулодексидом оказывает нормализующее дей-
ца) показано парентеральное введение антиги- ствие на дисфункцию эндотелия и гемостаз, спо-
стаминных препаратов: 2  % раствор хлорпирами- собствуя более быстрому улучшению или разре-
на, 0,1  % раствор
клемастина по 1–2 мл на ночь шению патологического процесса [17, 28]. Кроме
[5, 21]. Также назначают витамины, активно вли- того, улучшению микроциркуляции способству-
яющие на метаболические функции: ретинол + ют ксантинола никотинат
по 0,15 г внутрь после
витамин Е по 1 капсуле 2 раза
в день в течение еды в течение 4–6 недель или пентоксифиллин
3–4 недель, пиридоксин по 2 мл 5  % раствора по 0,2  г 3 раза внутрь также после еды в течение
внутримышечно ежедневно или через день, все- 4–6 недель [21].

15
Дерматовенерология и эстетическая медицина № 2 / 2016

Системная терапия. Из средств системной ские последствия. Во-первых, системная терапия


терапии используют цитостатические препараты, псориаза может негативно влиять на обменные
иммунодепрессанты, ретиноиды и генно-инже- сопутствующие заболевания, особенно в случае
нерные препараты. Побочные эффекты систем- непрерывного и длительного лечения. В частно-
ной терапии больных псориазом могут быть ми- сти, метотрексат следует назначать с осторож-
нимизированы, а эффективность повышена пу- ностью при ожирении, сахарном диабете, не-
тем комбинации различных методов лечения [5]. алкогольной жировой болезни печени в связи с
Более 40 лет при лечении псориаза приме- повышением риска фиброза печени [59]. Циклос­
няется метотрексат. Механизм его действия порин  А может вызвать появление или усугубить
связан с ингибированием дигидрофолатредукта- течение артериальной гипертензии, усилить ин-
зы, превращающей дигидрофолиевую кислоту в сулинорезистентность и повлиять на метаболизм
тетрагидрофолиевую и являющейся донором од- жирных кислот, так как обладает нефротоксично-
ноуглеродных групп в синтезе пуриновых нукле- стью.
отидов и тимидилата, необходимых для синтеза Ацитретин также способствует гипертриглице-
ДНК. В связи с этим одновременное назначение ридемии и/или гиперхолестеринемии [40].
фолиевой кислоты помогает избежать метаболи- Таким образом, при ведении больных псориа-
ческой анемии [53]. зом необходимо учитывать все данные.
Циклоспорин А — циклический полипептид, Фототерапия. Особое место в лечении псо-
выделенный из гриба Tolypocladium inflatum gams, риаза отводится фототерапии. Целебные свой-
обладает иммуносупрессивным действием по- ства солнечного света известны еще со времен
средством подавления активности Т-клеток и Гиппократа. Наиболее активной частью солнеч-
снижения их антигенной чувствительности за ных лучей является ультрафиолетовое излуче-
счет интерлейкинового механизма. Препарат об- ние, спектр которого подразделяют на три диа-
ладает высокой эффективностью при лечении пазона: коротковолновый (диапазон УФС, длина
распространенного торпидно протекающего псо- волн 100–280 нм), средневолновый (диапазон
риаза, псориатической эритродермии [13, 33]. УФВ, длина волн 280–320 нм) и длинноволновый
С 1997 г. для лечения рефрактерных форм (диапазон УФА, длина волн 320–400 нм) [4].
псориаза используются ароматические ретино- С созданием искусственных источников света
иды II поколения, основой химической формулы появилась возможность дозированного использо-
которых является ацитретин. Препарат тормо- вания с лечебной целью ультрафиолетового из-
зит пролиферацию клеток эпидермиса, нормали- лучения, что легло в основу создания различных
зует процесс ороговения, оказывает иммуномо- методов фототерапии. В дерматологической прак-
дулирующее действие. Эффективность средства тике используются, главным образом, диапазоны
зависит от дозы: более высокие дозы приводят к УФВ и УФА. Каждый из них имеет некоторые осо-
более быстрому разрешению псориатических вы- бенности фотобиологического действия [4].
сыпаний [42]. Положительный эффект ультрафиолета на
Лечение среднетяжелых и тяжелых форм псориатическую кожу связан с избирательным
псориаза (более 10  % поверхности тела) прово- угнетением Т-клеточного звена иммунитета. По
дят с учетом коморбидных состояний, таких как данным литературы, выделяют следующие на-
метаболический синдром, сердечно-сосудистые правления действия фототерапии:
заболевания, сахарный диабет, неалкогольная —  противовоспалительное;
жировая болезнь печени, дислипидемия. По дан- —  иммуносупрессивное;
ным статистических исследований, подобные ко- —  антипролиферативное [14].
морбидные состояния при псориазе наблюдают- Фотоиммунологическое воздействие связано
ся чаще, чем в общей популяции [29]. Также при с глубиной проникновения ультрафиолетовых
лечении тяжелых форм псориаза целесообразно лучей. УФБ лучи воздействуют на эпидермаль-
применение малых доз сандиммуна, оказываю- ные кератиноциты и клетки Лангерганса, УФА
щего иммуномодулирующее действие и имеюще- лучи проникают в более глубокие слои кожи и
го более высокую терапевтическую эффектив- оказывают действие на дермальные фибро-
ность [3]. бласты, дендритные клетки и клетки иммунной
Таким образом, при лечении псориаза необ- системы. Положительный эффект ультрафи-
ходимо учитывать риск побочных эффектов от олетового излучения обусловлен апоптозом
проводимой системной терапии соответственно Т-клеток, снижением количества клеток Лан-
коморбидным состояниям, выявляемым инди- герганса, изменением продукции цитокинов,
видуально у каждого больного. Действительно, факторов роста (EGF, VEGF), молекул адгезии
некоторые фармакологические препараты мо- и нейропептидов [12, 65]. Назначение фототе-
гут негативно влиять на сердечно-сосудистые и рапии целесообразно при распространенном
метаболические сопутствующие заболевания. кожном процессе.
Связь между псориазом и сердечно-метаболи- Широко используется фотохимиотерапия
ческими расстройствами имеет важные клиниче- (ПУВА-терапия), методы которой основаны на
16
Обзор Литературы

комбинированном применении псораленовых фо- В конце прошлого века T. Fischer, затем


тосенсибилизаторов (фурокумаринов) и длинно- J.A.  Par­rish и K.F. Jaenicke показали, что при ле-
волнового ультрафиолетового излучения (длина чении больных псориазом узкополосное (311–
волн 320–400 нм). Лечение проводится по методи- 313  нм) средневолновое ультрафиолетовое из-
ке 3- или 4-разового облучения в неделю, в сред- лучение дает более значимый клинический эф-
нем на курс 20–30 процедур [14]. фект, чем широкополосное [39, 58]. С учетом
Первые исследования, выявившие эффектив- этих данных фирма «Филипс» (Нидерланды) раз-
ность метода ПУВА-терапии, были проведены в работала УФ лампы, излучающие в диапазоне
1974  г. J.  Parrish с соавт. [57]. В дальнейшем по- волн 310–315 нм, с максимальной эмиссией на
лученные данные были подтверждены многочис- длине волны 311 нм. Новый вид лечения получил
ленными исследованиями, проведенными в раз- название узкополосной средневолновой ультра-
ных странах. В настоящее время ПУВА-терапия фиолетовой терапии 311 нм [41, 62]. Дальней-
прочно вошла в практику дерматовенерологов и шими исследованиями была показана высокая
является одним из наиболее эффективных мето- эффективность этого метода и в настоящее вре-
дов лечения распространенных и тяжелых форм мя фототерапия 311 нм практически полностью
псориаза. Достаточно сказать, что она приводит вытеснила из клинической практики селективную
к клиническому разрешению или значительному [32, 35, 36, 44].
улучшению у 70–95  % больных [4]. В последние годы появилась новая аппа-
В мировой практике при проведении ПУВА- ратура (с использованием как лазерных, так и
терапии в качестве фотосенсибилизаторов наи- ламповых источников), позволяющая проводить
более часто применяются 8-метоксипсорален, лечение монохроматическим средневолновым
5-метоксипсорален и 4-, 5-, 8-триметилпсо- ультрафиолетовым излучением на длине вол-
рален, а также их производные. Псораленовые ны 308 нм. Благодаря наличию оптоволоконного
фотосенсибилизаторы активируются только по- световода она позволяет дозировать излучение
сле УФА облучения, метаболизируются в печени отдельно на каждый очаг поражения и не затра-
и выводятся с мочой в течение 12–24 ч. Один из гивать окружающую здоровую кожу, что способ-
основных механизмов действия ПУВА-терапии ствует повышению эффективности лечения и
заключается во взаимодействии активированно- уменьшению риска отрицательного действия УФ
го фотосенсибилизатора с ДНК клеток, в резуль- света (канцерогенного и потенцирующего фото-
тате чего образуются монофункциональные, а старения) на участки тела, свободные от высы-
затем бифункциональные связи с пиримидиновы- паний [4].
ми основаниями, что приводит к формированию Механизмы действия средневолнового уль-
перекрестных сшивок между цепями ДНК, по- трафиолетового излучения на кожу больных
давлению синтеза нуклеиновых кислот и белков псориазом до конца не выяснены. Основными из
и торможению, таким образом, клеточной про- них являются фотомодификация молекул ДНК и
лиферации. Возбужденные молекулы фотосен- опосредованная через генерацию свободных ра-
сибилизатора могут взаимодействовать также дикалов стимуляция перекисного окисления ли-
с молекулярным кислородом, в результате чего пидов. Поглощение УФ лучей нуклеотидами ве-
образуются активные формы кислорода, в част- дет к формированию фотопродуктов (в большей
ности синглетный кислород, который повреждает степени пиримидиновых димеров) и способству-
мембраны клеток и активизирует циклооксигена- ет подавлению синтеза ДНК в клетках [38, 48,
зу и арахидоновую кислоту [30]. Фотохимические 66]. Одним из главных хромофоров эпидермиса,
реакции приводят к нарушению экспрессии ци- абсорбирующим УФ лучи, является уроканино-
токинов и их рецепторов в коже, снижению про- вая кислота [56]. При абсорбции ультрафиоле-
лиферативной активности и нормализации кера- тового излучения транс-уроканиновая кислота,
тинизации эпидермальных клеток, стимуляции присутствующая в роговом слое эпидермиса,
апоптоза лимфоцитов и кератиноцитов [45, 61]. изомеризуется в цисуроканиновую кислоту, ко-
Добиться более быстрого регресса псориати- торая стимулирует образование супрессорных
ческих высыпаний можно также путем комбина- Т-лимфоцитов и продукцию клетками кожи ме-
ции ПУВА-терапии с другими системными (гемо- диаторов, дающих иммуносупрессивный эффект
дез, эссенциале, витамины, глюконат кальция [43, 44].
и др.) и топическими (кальципотриол, салицило- Биологическая терапия. Относительно не-
вая мазь, препараты дегтя, антралина) лечеб- давно появилась новая группа препаратов —
ными средствами [4]. биологические, к которым относят рекомбинант-
В настоящее время селективная фототерапия ные белковые субстанции, синтезированные
(комбинация средневолнового излучения 280– биотехнологическим путем из живых клеток жи-
320  нм) уступила свои позиции и назначается все вотных, растений и микроорганизмов. Показани-
реже для лечения псориаза. Показанием для ее ем к их назначению являются тяжелые формы
назначения является псориаз, характеризующий- псориаза, резистентные к другим системным пре-
ся слабоинфильтрированными бляшками [15]. паратам [8, 9].
17
Дерматовенерология и эстетическая медицина № 2 / 2016

Исследования псориаза в последнее деся- зания к применению. Кроме того, инфликсимаб


тилетие привели к появлению новых, высоко- применяют для лечения активного прогрессирую-
эффективных и узконаправленных (таргетных) щего псориатического артрита.
средств и методов лечения тяжелых форм псо- Препарат обладает высокой специфичностью
риаза. Биологическая терапия обладает це- в отношении ФНО-α. Он взаимодействует с рас-
ленаправленной фармакологической активно- творимым и связанным с рецепторами ФНО-α.
стью в отношении специфических молекулярых Связывание растворимого ФНО-α приводит к ней-
структур, ответственных за развитие псориаза. трализации его провоспалительной активности.
Эти средства и методы используют последние Взаимодействие с ФНО-α на поверхности клеток
данные о том, как иммунокомпетентные клетки приводит к лизису последних, возможно, в резуль-
(Т-клетки, дендритные клетки и макрофаги) ин- тате активации комплемента и/или антителозави-
фильтрируют кожу больных псориазом, как они симой клеточной цитотоксичности. Период полу-
взаимодействуют при помощи химических сиг- выведения инфликсимаба составляет 8–9,5 дня,
налов (цитокинов) друг с другом, как происходит полное выведение происходит в течение 6 ме-
ангиогенез в коже, что именно вызывает воспа- сяцев [52]. Высокая эффективность препарата в
ление и повышенную пролиферацию кератиноци- монотерапии данного дерматоза и низкая токсич-
тов кожи [46]. ность показаны в работах M. A. Menter, J. M. Cush.
В основном, уже имеющиеся новые и еще Адалимумаб — селективное иммунодепрес-
разрабатываемые средства лечения псориаза сивное средство — представляет собой реком-
следуют одной из двух главных стратегий: анти- бинантное моноклональное антитело, пептидная
Т-клеточная и антицитокиновая терапия. последовательность которого идентична IgG1 че-
В биологических методах лечения псориати- ловека. Зарегистрирован к применению у взрос-
ческого артрита и тяжелых форм псориаза при- лых больных с активным псориатическим артри-
меняются препараты, действие которых направ- том в режиме монотерапии или в комбинации с
лено непосредственно на клетки, участвующие в метотрексатом или другими базисными противо-
развитии болезни. К числу этих препаратов отно- воспалительными препаратами. Препарат селек-
сятся этанерсепт (энбрел), адалимумаб (хуми- тивно связывается с фактором некроза опухоли
ра), эфализумаб (раптива) и инфликсимаб (ре- (ФНО) и нейтрализует его биологические функ-
микейд). ции за счет блокады взаимодействия с поверх-
Существует несколько видов моноклональ- ностными клеточными р55- и р75-рецепторами к
ных антител (МАТ). Их названия оканчиваются на ФНО-α.
«-mab» (от англ. Monoclonal antibodies): адалиму- Адалимумаб модулирует также биологиче-
маб, базиликсимаб, инфликсимаб, натализумаб, ские ответные реакции, которые индуцируются
омализумаб, тоцилизумаб и др. Различить ис- или регулируются ФНО-α, включая изменения
точник получения таких антител позволяют до- уровней молекул адгезии, вызывающих мигра-
полнительные буквы в окончаниях названий пре- цию лейкоцитов. Вызывает быстрое снижение
паратов. МАТ грызунов оканчиваются на «-омаб» уровней острофазных показателей воспаления
(-omab), химерные — на «-ксимаб» (-ximab), гума- (С-реактивного белка и скорости оседания эри-
низированные — на «-зумаб» (-zumab), рекомби- троцитов) и сывороточных уровней цитокинов
нантные человеческие — на «-умаб» (-umab). (ИЛ-6). Кроме того, отмечается снижение сыворо-
Одними из наиболее часто применяемых пре- точной активности матриксных металлопротеи-
паратов этой группы на сегодняшний день явля- наз (ММР-1 и ММР-3), вызывающих ремоделиро-
ются ремикейд (инфликсимаб), хумира (адалиму- вание тканей, которое лежит в основе разруше-
маб) и стелара (устекинумаб). ния хряща [11].
Инфликсимаб — селективный антагонист Использование в лечении дерматоза препа-
фактора некроза опухоли альфа (ФНО-α), пред- ратов alefacept, efalizumab, etanercept и infliximab
ставляющий собой химерные моноклональные является одним из наиболее перспективных на
антитела IgG1, которые на 75  % состоят из чело- сегодняшний день направлений в иммунодерма-
веческого и на 25  % из мышиного белка. Препа- тологии [7]. Вместе с тем, недостаточное количе-
рат быстро связывается и образует устойчивое ство данных о возможных побочных эффектах и
соединение с обеими формами (растворимой и отдаленных результатах данного вида терапии, а
трансмембранной) человеческого ФНО-α и бло- также высокая стоимость лечения ограничивают
кирует его взаимодействие со специфически- их широкое использование в реальной клиниче-
ми рецепторами, что приводит к значительному ской практике.
уменьшению псориатических высыпаний на коже Новейший подход к лечению больных псориа­
и суставных проявлений заболевания [50]. зом состоит в подборе специфических антител к
Инфликсимаб применяют для лечения взрос- общей для IL-12 и IL-23 субъединице p40. В на-
лых больных тяжелым и среднетяжелым псориа- стоящее время проводится исследование препа-
зом, если они не отвечают на другие системные ратов устекинумаб и АВТ-874.
методы терапии (включая циклоспорин, ацитре- Устекинумаб представляет собой полностью
тин, метотрексат и ПУВА-терапию), отмечается человеческие моноклональные антитела класса
их непереносимость или имеются противопока- IgG1k с молекулярным весом около 148  600 даль-

18
Обзор Литературы

тон, продуцируемые рекомбинантной клеточной Широкий выбор лекарственных форм позво-


линией и проходящие многоступенчатую очист- ляет подобрать препарат в зависимости от лока-
ку, включая инактивацию и удаление вирусных лизации псориатических высыпаний. При лока-
частиц. Обладает высоким сродством и специ­ лизации высыпаний на волосистой части головы
фичностью к субъединице р40 интерлейкинов че- чаще используют шампуни, аэрозоли, лосьоны,
ловека ИЛ-12 и ИЛ-23. Препарат блокирует био- на кожу лица назначают кремы, на кожу тулови-
логическую активность ИЛ-12 и ИЛ-23, предот- ща и конечностей — мази или кремы [5].
вращая их связывание с рецептором ИЛ-12R-β1, При выраженном гиперкератозе и обильном
экспрессируемым на поверхности иммунных кле- шелушении применяют кератолитические сред-
ток. ства, такие как 2–10  % салициловая мазь 1–2
Устекинумаб не может связываться с ИЛ-12 и раза в сутки. При выраженной инфильтрации ис-
ИЛ-23, уже связанными с рецептором ИЛ-12R-β1. пользуют мази, содержащие 5–20  % нафталан-
Поэтому он вряд ли будет воздействовать на ской нефти, ихтиола, березового дегтя, которые
комплемент- или антителозависимую цитотоксич- наносят на пораженные участки 1–2 раза в сут-
ность клеток, несущих эти рецепторы. Примене- ки. Высокие концентрации препаратов не должны
ние препарата приводит к значительному осла- применяться при острой стадии заболевания [5].
блению гистологических проявлений псориаза, Топические кортикостероиды остаются пре-
включая гиперплазию и пролиферацию клеток паратами первой линии для лечения псориаза
эпидермиса. Эти данные согласуются с клиниче- всех возрастных групп и поэтому нашли широ-
ской эффективностью. Устекинумаб не оказыва- кое применение в дерматологической практике.
ет существенного влияния на соотношение цир- Эта группа препаратов применяется при любых
кулирующих в крови иммунных клеток, включая формах псориаза в качестве монотерапии или в
клетки памяти и неактивированные Т-клетки, а комбинации с другими наружными или систем-
также на концентрацию цитокинов в крови. ными средствами [23]. Эффективность топиче-
Анализ мРНК, выделенной из биопсийных ских кортикостероидных препаратов при лечении
образцов кожных очагов псориаза исходно и че- псориаза основана на выраженном противовос-
рез 2 недели лечения, показал, что применение палительном и иммуномодулирующем действии,
устекинумаба приводило к снижению экспрессии связанном с механизмом гормонорецепторно-
генов, кодирующих его молекулярные мишени, — го комплекса, который проникает в ядро клетки
ИЛ-12 и ИЛ-23, а также генов, кодирующих вос- мишени кожи и увеличивает экспрессию генов,
палительные цитокины и хемокины, — моноци- кодирующих синтез пептидов, ингибирующих
тарный хемотаксический фактор (МСР)-1, фактор активность фосфолипазы. Этот механизм при-
некроза опухоли (TNF)-альфа, интерферон — водит к снижению образования медиаторов вос-
-индуцибельный белок (IP)-10 и ИЛ-8. Эти дан- паления из фосфолипидов. Особенно предпо-
ные согласуются со значительным клиническим чтительны комбинированные кортикостероидные
эффектом лечения. мази и кремы с салициловой кислотой. Местные
Улучшение, по-видимому, зависит от концен- кортикостероидные препараты не показаны для
трации устекинумаба в плазме крови. У пациен- длительного непрерывного лечения и предпо-
тов с лучшим результатом по шкале PASI сред- лагают комбинированные и ротационные схемы,
нее значение концентрации устекинумаба в плаз- т.  к. длительное применение может привести к
ме крови было выше, чем у больных с меньшим развитию побочных эффектов, таких как атрофия
клиническим эффектом. В целом, доля пациен- кожи, гипертрихоз, телеангиэктазии, стероидные
тов, у которых улучшение по шкале PASI достига- акне и угнетение функции надпочечников [16].
ло 75  %, увеличивалась по мере повышения кон- Глюкокортикостероидные препараты для на-
центрации устекинумаба в плазме крови [7]. ружного применения наносят на пораженные
Наружная терапия. При любой клинической участки 1–2 раза в сутки в течение 1–4 недель.
форме псориаза оправданным является назна- Курс лечения сильнодействующими кортикостеро-
чение наружной терапии. При ограниченных вы- идными препаратами (бетаметазон, флутиказон,
сыпаниях, занимающих не более 5  % кожного флуоцинолон, клобетазол и др.) не должен превы-
покрова, возможно достижение выраженного шать 2–4 недель, а их суммарная доза не должна
клинического эффекта применением только на- быть более 50 г в неделю. Сильнодействующие
ружных средств. кортикостероиды не рекомендуется назначать на
Наружная терапия псориаза включает в себя кожу лица и складок. По возможности следует
топические кортикостероиды, препараты избегать их применения у детей, поскольку они
кальципотриола, активированного цинка пири- дают ряд побочных эффектов и при длительном
тионата, салициловой кислоты, серы, нафта- использовании могут вызывать атрофию кожи,
ланской нефти, ихтиола, березового дегтя. телеангиэктазии, стероидные акне, гипертрихоз,
При выборе топической терапии важен инди- стрии, вторичную пиодермию. Детям назначают
видуальный подход, от которого и зависит комп­ нефторированные кортикостероидные препараты
лаентность больного псориазом. Так, в связи с слабой или умеренной степени активности (гидро-
косметической неприемлемостью лечения 40  % кортизон, гидрокортизона 17-бутират, мометазона
пациентов не соблюдают режим назначения [63]. фуроат, метилпреднизолона ацепонат и др.) [47].

19
Дерматовенерология и эстетическая медицина № 2 / 2016

Использование наружных комбинированных ского эффекта возможно комбинированное назна-


препаратов, содержащих кортикостероиды в ком- чение кальципотриола и топических стероидов.
бинации с салициловой кислотой или кальципо- В терапии вульгарного псориаза используют
триолом, повышает эффективность лечения [37]. наружные препараты, содержащие кальципотри-
Салициловая кислота усиливает проникновение ол [55]. Для усиления действия кальципотриола
других лекарственных средств, в том числе на- и уменьшения побочных эффектов (в частности,
ружных кортикостероидов (бетаметазона, моме- раздражения кожи) целесообразно применять
тазона, флуметазона) [51]. Препараты наносят на его в сочетании с бетаметазоном [37]. Комбини-
пораженные участки кожи 1–2 раза в сутки в те- рованный препарат, содержащий кальципотриол
чение 1–4 недель. и бетаметазон, назначают в прогрессирующую
В современном мире до сих пор продолжа- стадию заболевания 1 раз в сутки, не более 100  г
ются исследования по разработкам наружной в неделю в течение 4 недель. В стационарную и
терапии больных псориазом, когда на смену то- регрессирующую стадии переходят на лечение
пическим кортикостероидным препаратам приш- кальципотриолом 2 раза в сутки не более 100 г в
ли кальципотриол и другие наружные средства, неделю (площадь обработки должна составлять
которые в определенной степени решили про- не более 40  % кожного покрова). Препарат не ис-
блемы данного дерматоза. Одним из таких пре- пользуют на кожу лица, с осторожностью приме-
паратов является 0,1  % мазь такролимуса, ко- няют на кожу складок.
торый обладает сильным иммуносупрессивным Активированный цинк пиритионат в виде
свойством и зарекомендовал себя эффективным 0,2  % крема и аэрозоля, а также 1  % шампуня
в лечении псориаза. дает противовоспалительный и антипролифера-
Возможность такролимуса оказывать выра- тивный эффект и с успехом применяется для ле-
женный противовоспалительный эффект за счет чения кожи как туловища и конечностей, так и во-
ингибирования кальциневрина является патоге- лосистой части головы [10]. Крем и аэрозоль при-
нетическим обоснованием его использования у меняют 1–2 раза в сутки с постепенной отменой
больных псориазом, в то же время до минимума по мере улучшения кожного процесса. Шампунь
сведены системные побочные эффекты, свой- применяют 2–3 раза в неделю в течение первых
ственные для сильных иммуносупрессантов. Та- 2 недель, затем 1–2 раза в неделю, курс лече-
ким образом, у больных псориазом целесообраз- ния  — 5 недель.
но использование топических иммуносупрессан- Значение использования эмольянтов, или
тов, исключающих известные побочные эффекты смягчающих средств, при лечении псориаза не
кортикостероидов, когда в большинстве случаев вызывает сомнений: они смягчают кожу, умень-
достигается стабильная ремиссия псориатиче- шают шелушение и сухость, усиливают ее ги-
ского процесса. дратацию, особенно после ультрафиолетового
Методика использования 0,1  % мази такроли- воздействия, способствуют уменьшению зуда.
муса заключается в следующем: на пораженные Наибольший эффект достигается при нанесении
участки кожи наносится мазь тонким слоем 2 раза эмольянтов на влажную кожу после контакта с
в день в течение 15–20 дней. При этом отмеча- водой (ванна, душ). Использование эмольянтов
ется клинический эффект (уменьшение эритемы, в комплексной терапии псориаза снижает общую
шелушения и появление псевдоатрофического стоимость лечения в результате достижения ста-
ободка вокруг папулезных элементов). Отсутствие билизации заболевания и наступления ремиссии
каких-либо побочных эффектов от применения за более короткие сроки, что способствует сокра-
мази является очередным положительным ар- щению пребывания больных в стационаре [40].
гументом в пользу этого препарата при лечении В тех случаях, когда высыпания носят рас-
больных псориазом [18]. пространенный характер или отмечается неэф-
Синтетические аналоги витамина Д3 хорошо фективность наружной терапии, назначают либо
зарекомендовали себя в качестве высокоэф- фототерапию, либо системные препараты.
фективных антипсориатических средств. Наи- Таким образом, резюмируя данные литера-
более известен из этой группы кальципотриол. турных источников, можно сделать вывод, что
Принцип действия препарата основан на кера- проблема лечения псориаза сохраняет свою ак-
топластическом эффекте витамина Д3: он тормо- туальность и остается комплексной задачей, на-
зит пролиферацию кератиноцитов и моделирует правленной в первую очередь на персонифици-
эпидермальную дифференцировку, а также об- рованный подход к терапии, от которой зависит
ладает иммуномодулирующим эффектом, в част- комплаентность больного псориазом и проспек-
ности, уменьшая экспрессию ИЛ-2 и ИНФ- [31]. тивное ведение пациентов с учетом коморбидно-
Кальципотриол обладает кумулятивным действи- сти. Арсенал современных средств и методов те-
ем, в связи с чем терапевтический эффект на- рапии больных псориазом позволяет подобрать
блюдается через 1–2 недели от начала лечения. для каждого пациента оптимальное и наиболее
В отличие от топических стероидов возможно рациональное лечение с учетом клинической
длительное применение данной группы препара- картины, течения заболевания, а также наличия
тов. Для достижения максимального терапевтиче- сопутствующей патологии.

20
Обзор Литературы

Литература

1. Бутов Ю.С. Кожные болезни и инфекции, пе- дерматовенерологии и репродуктивного здо-


редающиеся половым путем. Учебное посо- ровья. 2008. №  2. С.  94–96.
бие. — М.: «Медицина»ю 2002. 400 с. 18. Рахматов А.Б., Рахматова Д.В. Такролимус
2. Бутов Ю.С., Васенова В.Ю., Шмакова А.С., в терапии псориаза // Медицинский журнал
Ипатова О.М. Клинико-биохимический статус Астаны. 2013. С.  121–122.
у больных псориазом и методы его коррекции 19. Рахматов А.Б., Рахматов Т.П., Маннанов М.М.
// Российский журнал кожных и венерических Эпидемиология псориаза в Узбекистане //  Но-
болезней. 2009. №  5. С.  23–27. вости дерматологии и венерологии. 2002. №  2.
3. Ваисов А.Ш., Рахматов А.Б., Расулева Н.Р. С.  69–71.
Сандимун в лечении тяжелых форм псо- 20. Самсонов В.А. Псориаз // Медицина для всех.
риаза // Вестник дерматологии и венероло- 2001. №  2. С.  9 –12.
гии. 1998. №  6. С.  33–34. 21. Скрипкин Ю.К., Кубанова А.А., Акимов В.Г.
4. Жилова М.Б. и др. // Vestn Dermatol Venerol. Кожные и венерические болезни. Учебник. —
2010. Vol. 3. P.  27–32. М.: «ГЭОТАР-Медиа». 2009. С.  302–314.
5. Знаменская Л.Ф., Яковлева С.В., Волнухин 22. Умерова А.Р., Дорфман И.П., Думченко В.В.,
В.А., Пирогова Е.В. Современные методы те- Макухина Л.П. Современные подходы к ле-
рапии больных псориазом // Vestn Dermatol чению псориаза у детей и подростков // Регу-
Venerol. 2011. Vol.  1. P.  11–14. лярные выпуски «РМЖ». 2015. №  19. С.  1156.
6. Капкаев Р.А., Любан Б.Л., Азизов Б.С., Ар- 23. Федеральные клинические рекомендации
тыков А.Ф., Исамова Д.И. Опыт применения по ведению больных псориазом. Российское
оте­чественного препарата «Гепанорм» в ком- общество дерматовенерологов и косметоло-
плексном лечении хронических дерматозов гов.  — Москва. 2013.
//  Новости дерматовенерологии и репродук- 24. Федоров С.М. Псориаз: клинические и тера-
тивного здоровья. 2008. №  2. С.  97–98. певтические аспекты // Русский медицинский
7. Кондратьева Н.Н. Рассказов Я.А., Баку- журнал. 2001. Т. 9. №  11. С.  447–452.
лев  А.Л. Терапия больных псориазом: совре- 25. Хобейш М.М. Гептрал в терапии псориаза
менный взгляд на проблему // Практическая // Вест­ник дерматологии. 2009. №  3. С.  84–86.
медицина. 2013. №  1–4 (73). С. 28–32. 26. Хобейш М.М., Мошкалова И.А., Соколовский
8. Кочергин Н.Г., Кондратов Г.В., Румянцева Е.Е. Е.В. Псориаз. Современные методы лечения
Инфликсимаб — новые биотехнологии в те- // Вест­ник дерматологии. №  9. С.  70–134.
рапии псориаза // Клиническая дерматология 27. Чистякова И.А. Современные проблемы тера-
и венерология. 2003. №  3. С. 65–68. пии и профилактики псориаза // Регулярные
9. Кочергин Н.Г., Смирнова Л.М. Современная выпуски «РМЖ». 1997. №  11. С.  6.
иммуннотропная терапия рефрактерных дер- 28. Штода Ю. М. О коррекции нарушений ангио-
матозов. — М.: «Триада». 2004. С.  9 –45. генеза и гемостаза у больных псориазом в
10. Кубанов А. А, Матушевская Ю. И. Опыт при- процессе цитостатической терапии // Практи-
менения препарата инфликсимаб в лечении ческая медицина. 2014. №  8. С.  66–68.
больных тяжелыми формами псориаза // Вест- 29. Armstrong E.J., Harskamp C.T., Armstrong A.W.
ник дерматологии и венерологии. 2008. №  6. Psoriasis and major adverse cardiovascular
С.  75–80. events: a systematic review and meta-analysis
11. Кубанова А.А., Кисина. В.И. Рациональная of observational studies // J. Am. Heart Assoc.
фармакотерапия заболеваний кожи и инфек- 2013. 2(2):e000062.
ций, передаваемых половым путем. Руковод- 30. Averbeck D. Recent advances in psoralen photo-
ство для практикующих врачей. — М.: «Лите- toxicity mechanism // Photochem Photobiol 1989.
ра». 2005. С.  365–378. Vol. 50. P. 859–882.
12. Олисова О.Ю. Псориаз: эпидемиология, пато- 31. Bennett S.R., Carbone F.R., Karamalis F. et
генез, лечение // Consilium medicum. 2010. № 5. al. Help for cytotoxic-T-cell responses is me-
13. Олисова О.Ю. Циклоспорин А в дерматоло- diated by CD40 signalling // Nature. 1998.
гической практике // Фарматека. 2008. №19 Vol.  393(6684). P.  478–480.
(173). С. 74–78. 32. Berneburg M., Rocken M., Benedix F. Photother-
14. Олисова О.Ю., Смирнов К.В., Пинсон И.Я. Фото- apy with narrowband versus broadband UVB. //
терапия псориаза // Российский журнал кожных Acta Derm Venereol. 2005. Vol. 85(2). P. 98–108.
и венерических болезней. 2006. № 3. С. 38–42. 33. Christophers E. Psoriasis-epidemiology and clini-
15. Олисова О.Ю., Теплюк Н.П., Пинегин В.Б. Со- cal spectrum // Clin. Exp. Dermatol. 2001. Vol.
временные методы лечения псориаза // Регу- 26(4). P.  314–320.
лярные выпуски «РМЖ». 2015. №  9. С.  483. 34. Christofers E., Sterry W. Psoriasis. In: Dermatolo­-
16. Пирузян Е.В., Тогоева Л.Т., Аветикян С.С. и др. gy in general medicine. 4-th ed. Eds. A.Z. Fitz-
Этапы наружной терапии разных форм псо- pathrich Essen, K. Wolff et al. — New York: Mc
риаза // Клиническая дерматология и венеро- Graw Hill Inc. 1993. P.  489–514.
логия. 2007. №  2. С.  71–74. 35. Coven T.R., Burack L.H., Gilleaudeau R. et al.
17. Рахматов А.Б. Значение коррекции микро- Narrowband UV-B produces superior clinical and
циркуляции у больных псориазом // Новости histopathological resolution of moderate-to-se-
21
Дерматовенерология и эстетическая медицина № 2 / 2016

vere psoriasis in patients compared with broad- 51. Lebwohl M.G. The role of salicylic aсid in the
band UV-B // Arch Dermatol. 1997. Vol. 133: treatment of psoriasis // Int Dermatol. 1999.
P.  1514–1522. Vol.  38. P.  16–24.
36. Dawe R.S. A quantitative review of studies com- 52. Leonardi C.L. Etanercept as monotherapy in pa-
paring the efficacy of narrow-band and broad- tients with psoriasis / C.L. Leonardi, J.L. Powers,
band ultraviolet B for psoriasis // Br J Dermatol. R.T. Matheson // N. Engl. J. Med. 2003. Vol.  349.
2003. Vol. 149. P.  669–672. P.  2014–2022.
37. Douglas W.S., Lowson D., Mascara J.M. et al. 53. Menter A., Korman N.J., Elmets C.A. et al.
A new calcipotriol /betamethasone dipropionate Guidelines of care for the management of psoria-
formulation (Daivobet) is an effective once-daily sis and psoriatic arthritis: section 4. Guidelines of
treatment for psoriasis ulgaris // Dermatology. care for the management and treatment of pso-
2002. Vol. 205(4): P.  389–93. riasis with traditional systemic agents // J. Am.
38. Epstein W.L., Fukuyama K., Epstein J.H. Early Acad. Dermatol. 2009. Vol. 61. P. 451–485.
effects of ultraviolet light on DNA synthesis in hu- 54. Michael P., Schun M.P., Henning W., Boehncke
man skin in vivo // Arch Dermatol. 1969. Vol.  100. M.D. Medical progress. Psoriasis // N Engl J
P.  84–89. Med. 2005. Vol.  352. P.  1899–1912.
39. Fischer T. UV-light treatment of psoriasis // Acta 55. Nast A., Kopp I., Augustin M. еt al. German ev-
Derm Venereol. 1976. Vol. 56. P.  473–479. idence-based guidelines for the treatment of
40. Gisondi P., Cazzaniga S., Chimenti S. et al. Psoriasis vulgaris // Arch Dermatol Res. 2007.
Metabolic abnormalities associated with initia- Vol.  299. P.  111–138.
tion of systemic treatment for psoriasis: evidence 56. Noonan F.P., De Fabo E.C. Immunosupression by
from the Italian Psocare Registry // J. Eur. Acad. ultraviolet B radiation: initiation by urocanin acid
Dermatol. Venereol. 2013. Vol. 27. P.  30–41. // Immunology Today. 1992. Vol.  13(7). P.  250–254.
41. Green C., Ferguson J., Lakshmipathi T., Johnson 57. Parrish J.A., Fitzpatrick T.B., Tanenbaum L.,
B.E. 311 nm UVB phototherapy — an effective Pathak M.A. Photochemotherapy of psoriasis with
treatment for psoriasis // Br J Dermatol. 1988. oral methoxsalen and longwave ultraviolet light
Vol.  119. P.  691–696. //  N Engl J Med. 1974. Vol.  291(23). P.  1207–1211.
42. Gudjonsson J.E., Ding J., Johnston A. et al. As- 58. Parrish J.A., Jaenicke K.F. Action spectrum for
sessment of the psoriatic transcriptome in a large phototherapy of psoriasis // J Invest Dermatol.
sample: additional regulated genes and compari- 1976. Vol.  76. P.  359–362.
sons with in vitro models // J. Invest. Dermatol. 59. Rosenberg P., Urwitz H., Johannesson A. et al.
2010. Vol.  130(7). P. 1829–1840. Psoriasis patients with diabetes type 2 are at
43. Gupta G. The efficacy of narrowband UVB pho- high risk of developing liver fibrosis during meth-
totherapy in psoriasis using objective and subjec- otrexate treatment // J. Hepatol. 2007. Vol.  46.
tive outcome measures // Br J Dermatol. 1999. P.  1111–1118.
Vol.  140(5). P.  887–890. 60. Schuhlmeyer M. Neurodermitis und Psyche —
44. Ibbotson S.H., Bilsland D., Cox N.H. et al. An update Stuttgart. 1977. 256  p.
and guidance on narrowband ultraviolet B photother- 61. Vallat V.P., Gilleaudeau P., Battat L. et al. PUVA
apy: a British Photodermatology Group Workshop bath therapy strongly suppresses immunological
Report // Br J Dermatol. 2004. 151(2). P.  283–297. and epidermal activation in psoriasis: a possible
45. Johnson R. Staiano-Coico L., Austin L. et al. cellular basis for remittive therapy // J Exp Med
PUVA treatment selectively induces a cell cycle 1994. Vol. 180(1). P. 283–296.
block and subsequent apoptosis in human T-lym- 62. Van Weelden H., De La Faille H.B., Young E. et al.
phocytes // Photochem Photobiol. 1996. Vol.  63. A new development in UVB phototherapy of pso-
P.  566–571. riasis // Br J Dermatol. 1988. Vol.  119. P.  11–19.
46. Katugampola R.P., Lewis V.J., Finlay A.Y. The 63. Vekony M.A., Holder J.E., Lee A.J. et al. Selec-
Dermatology Life Quality Index: assessing the ef- tive amplification of T-cell receptor variable re-
ficacy of biological therapies for psoriasis // Brit. gion species is demonstrable but not essential
J. Dermatol. 2007. Vol.  156 (5). Р.  945–950. in early lesions of psoriasis vulgaris: analysis by
47. Katz H.I., Hien N.T., Prawer S.E. et al. Super- anchored polymerase chain reaction and hyper-
potent topical steroid treat of psoriasis vulgaris variable region size spectratyping // J. Invest Der-
— clinical efficacy and adrenal function // J Am matol. 1997. Vol. 109(1). P. 5–13.
Acad Dermatol. 1987. Vol.  16. P.  804–811. 64. Verbov J. Psoriasis in childhood // Arch Dis Child.
48. Kramer D.M., Pathak M.A., Kornhauser A., 1992. Vol.  67. P.  75–76.
Wiskemann A. Effects of ultraviolet radiation on 65. Weatherhead S.C., Farr P.M., Reynolds N.J.
biosynthesis of DNA in guinea pig skin // J Invest Spectral effects of UV on psoriasis // Photochem.
Dermatol. 1974. Vol.  62. P.  388–393. Photobiol. Sci. 2013. Vol. 12(1). P. 47–53.
49. Krueger G. The impact of psoriasis on qual- 66. Weichenthal M., Schwarz T. Phototherapy: how
ity of life: Results of a 1998 National Psoriasis does UV work? // Photodermatol Photoimmunol
Foundation patient-membership survey // Arch. Photomed. 2005. Vol. 21. P.  260–266.
Dermatol. 2001. Vol. 137. P.  280. 67. Weiss S.C., Kimball A.B., Liewehr D.J. et al.
50. Langley R.G. et al. Biologic therapeutics in the Quantifying the harmful effect of psoriasis on
treatment of psoriasis. Part 1: review // J. Cutan. health-related quality of life // J. Am. Acad.
Med. Surg. 2007. Vol. 11 (3). Р.  99–122. Dermatol. 2002. Vol.  47. P.  512–518.

22
ОРИГИНАЛЬНЫЕ СТАТЬИ

Оригина льнЫЕ статьИ

РАЗРАБОТКА СИСТЕМ МОЛЕКУЛЯРНОГО ТЕСТИРОВАНИЯ И АНАЛИЗА


ВЗАИМОСВЯЗИ ПОЛИМОРФИЗМА GLN551ARG ГЕНА α — ЦЕПИ РЕЦЕПТОРА
ИНТЕРЛЕЙКИНА-4 (IL4RA) С АТОПИЧЕСКИМ ДЕРМАТИТОМ

Ш.З. Мавлянова1, К.Т. Бобоев2 , С.Р. Муминова1, З.З. Ибрагимов2

Республиканский специализированный научно-практический медицинский центр


дерматологии и венерологии МЗ РУз1;
Научно-исследовательский институт гематологии и переливания крови МЗ РУз2

ХУЛОСа
IL4RA генининг Gln551Arg полиморфизмининг тест-тизимларини ишлаб чиҚиш
ва атопик дерматит ривожланиши билан боғлиқлигини таҳлил этиш
Ш.З. Мавлянова, К.Т. Бобоев, С.Р. Муминова, З.З. Ибрагимов
Ушбу маколада атопик дерматит билан хасталанган беморларда IL4RA гени Gln551Arg
полиморфизмининг молекуляр-генетик таҳлил натижалари келтирилган. Ўтказилган ПЗР текшируви
натижасида ушбу генетик маркернинг атопик дерматит билан боғлиқлиги ишончли тасдиқланган.
Калит сўзлар: атопик дерматит, атопия, ген IL4RA,SNP, полиморфизм Gln551Arg.

S UMMARY
Development of molec ular tests an d analysis of relationship polymorphism
GLN551ARG α-chain gene interleukin-4 (IL4RA) with atopic dermatitis
Sh.Z. Mavlyanova, K.T. Boboev, S.R. Muminova, Z.Z. Ibragimov
The article presents the data of molecular-genetic study of polymorphism Gln551Arg IL4RA gene in
patients with atopic dermatitis. As a result of the analysis it is installed molecular-genetic significant
association of this marker with the development of atopic dermatitis.
Keywords: atopic dermatitis, atopy, IL4RA gene, the SNP, polymorphisms Gln551Arg.

РЕЗЮМЕ
РАЗРАБОТКА СИСТЕМ МОЛЕКУЛЯРНОГО ТЕСТИРОВАНИЯ И АНАЛИЗА ВЗАИМОСВЯЗИ
ПОЛИМОРФИЗМА GLN551ARG ГЕНА α — ЦЕПИ РЕЦЕПТОРА ИНТЕРЛЕЙКИНА-4 (IL4RA) С АТО-
ПИЧЕСКИМ ДЕРМАТИТОМ
Ш.З. Мавлянова, К.Т. Бобоев, С.Р. Муминова, З.З. Ибрагимов
В статье приведены данные молекулярно-генетического исследования полиморфизма Gln551Arg
гена IL4RA у больных атопическим дерматитом. В результате проведенного ПЦР-исследования
была установлена достоверная ассоциация данного гентического маркера с развитием
атопического дерматита.
Ключевые слова: атопический дерматит, атопия, ген IL4RA,SNP, полиморфизм Gln551Arg.

В последние годы подробно освещается


роль цитокинов в возникновении клиниче-
ских проявлений атопического дерматита (АД).
непосредственное участие в развитии атопи-
ческого дерматита. α-цепь рецептора цитокина
интерлейкина-4 IL4RА играет важную роль в
Различными исследователями изучались ассо- развитии атопических заболевний. Были описаны
циации полиморфизма аллельных вариантов различные полиморфизмы в гене IL4RА. В
генов цитокинов с атопическим дерматитом. Вы- частности, –33C>TIL4 и 576Q>R гена IL4RA были
явлены как положительные ассоциации [1, 6, 7], достоверно связаны с атопией и бронхиальной
так и их отсутствие [5, 8]. В развитии и клиниче- астмой [2, 3].
ском течении атопических заболеваний немало- Цель исследования. Оптимизировать работу
важную роль играют также гены рецепторов систем олигопраймеров для тестирования поли-
данных цитокинов. В связи с этим целесообраз- морфизма Gln551Arg гена IL4RA и изучить вклад
но проанализировать аллельный полиморфизм данного маркера в развитие АД.
генов цитокинов и их рецепторов, принимающих

23
Дерматовенерология и эстетическая медицина № 2 / 2016

Материал и методы исследования. Матери- Статистический анализ результатов прове-


алами для исследования явились образцы ДНК, ден с использованием пакета статистических
выделенные из периферической крови больных программ «OpenEpi 2009, Version 2.3». Частоту
АД и условно здоровых доноров — лиц без вариантов аллелей и генотипов (f) вычисляли по
каких-либо признаков атопических заболеваний. формулам:
Общее количество изученных Gln551 и Arg551 f = n/2N;
аллелей составило 150 (100 — хромосомы боль-
ных и 50 — хромосомы здоровых лиц). f = n/N
Выделение ДНК проводили по стандартной где n — встречаемость варианта (аллеля или
методике с некоторыми модификациями. Реак­ генотипа), N — объем выборки.
тивы и ферменты были приобретены у ведущих
Результаты исследования. Начальным эта­
фирм мира («Serva», «Sigma» т.  д.) и России
пом работы был подбор и синтез олигопрай­
(ДНК-технология, сибэнзим и т.  д.). Амплифика-
меров для выявления полиморфизма (Gln551Arg)
ция полиморфных локусов проводилась с ис-
гена IL4RA. Синтез олигопраймеров осущест-
пользованием полимеразной цепной реакции
влен на базе Федерального медико-генетическо-
на программируемом термоциклере фирмы
го центра НИИ акушерства и гинекологии РАМН
«Applied Biosysteems» (США). Специфичность
(зав.  — член. корр. РАМН проф. Баранов В.С.) при
синтезированного фрагмента и количество
консультативной помощи с.н.с., к.б.н. Асеева М.В.
амплификата проверяли методом электрофореза
Молекулярно-генетическое исследование (ПЦР)
в 2  % агарозном геле и затем проводили
данного генетического маркера проводилось в
гидролиз полученного фрагмента с помощью
лаборатории молекулярной медицины и клеточ­-
рестриктазы «Avail». Рестрикцию ПЦР-продукта
ных технологий НИИ ГиПК МЗ РУз. Инфор­
проводили при +37°С в течение 12 ч как указано
мация о генных последовательностях и структу­
в рекомендациях производителя. Продукты
ре праймеров была получена с учетом ориги­
амплификации фрагментов ДНК и полноту
нального литературного источника [5] и в Gene-
рестрикции разделяли в 2–3  % агарозном геле
Bank. Характеристика генетического маркера и
и оценивали после окраски этидиум бромидом в
последовательность синтезированных олиго-
проходящем УФ свете.
праймеров приведены в таблице 1, интерпрета-
ция полученного результата — на рисунках 1 и 2.
Таблица 1
Последовательность олигонуклеотидных праймеров, использованных для проведения ПЦР

Ген, Полимор- Структура использованных Аллельные варианты


локализация физм олигопраймеров после рестрикции

IL4RA CCCCCACCACCAGTGGCTAC Gln551 (125 + 9 п.н.)


Gln551Arg
16p12.1 CCAGGAATGAGGTCTTGGAA Arg551 (116 п.н.)

В результате исследования нам удалось опти­ми­зировать температурный режим работы


олигопраймеров при следующих условиях:

1 цикл:     96°С — 2 минуты; +К   1   2   3   4  М


        95°С — 15 секунд;
12 циклов:   65°С — 20 секунд;

        95°С — 10 секунд;


20 циклов:   61°С — 20 секунд;
        72°С — 30 секунд; 125 п.н. — 150 п.н.
элонгация:     72°С — 3 минуты. 116 п.н.
— 90 п.н.

Рис. 1. Электрофореграмма ПЦР-продуктов полиморфизма 590C > T гена IL-4 (после рестрикции).


+
К – контроль; 1 и 3 — нормальные генотипы; 2 — гетерозиготный генотип; 4 — гомозиготный мутантный генотип;
М — маркер, определяющий размер ПЦР-фрагментов.
Аллель 9 п.н. выходит за пределы геля вследствие маленького размера фрагмента.

Как видно, в результате ПЦР-анализа маркер виде фрагмента размером 116 п.н. После ре-
мутантного аллеля Arg/Arg синтезировался в стрикции у пациентов с нормальным геноти-

24
ОРИГИНАЛЬНЫЕ СТАТЬИ

пом Gln/Gln образуются фрагменты 116 + 9п.н., С целью анализа распределения частот


но отсутствует фрагмент 125 п.н., а у гетерози- аллелей и генотипов полиморфного варианта
готных носителей амплифицируются все три –590С > Т гена IL4 в объединенных выборках
фрагмента (125 п.н. и 116 + 9 п.н.). больных АД и контрольной группы проведена
апробация данной тест-системы (табл. 2).
Таблица 2
Аллельные варианты гена IL4RА после амплификации и рестрикции

Продукты ПЦР с праймерами Аллельные варианты


До рестрикции
для гена IL 4RА после рестрикции с Avail
Норма 125 п.о. 125 п.о.
Гетерозигота 116 п.о 125 п.о.+ 116 п.о.
Гомозигота по мутации 116 п.о.+9 п.о.

+К К. 23 24 25 26 27 28 29 30 31 32 При анализе распределения аллелей и


Start
генотипов полиморфизма Gln551Arg гена IL4RA
было выявлено достоверное преобладание
частоты мутантного аллеля Arg551 в группе
125 b.q больных АД по сравнению с группой условно
здоровых доноров. В исследованных основной и
контрольной группах мутантный аллель Arg551
был обнаружен в 42/100 (42  %) и в 14/50 (28  %)
случаях соответственно. Частота дикого аллеля
Gln551 в этих группах составила 58/100 (58  %) и
36/50 (72  %) соответственно. При этом рассчи-
танная вероятность риска развития (OR) АД у
Ген альфа рецептор интерлейкин 4(IL 4RA) носителей данного полиморфизма оказалась в
Длина амплифицируемого фрагмента — 125 п.н. 2,8 раза выше, чем у носителей дикого аллеля
Gln551. Полученные данные являются статисти-
Рис. 2. Электрофореграмма ПЦР-продуктов чески достоверными (Х 2=2,79; Р=0,09; OR=1,86;
полиморфизма Gln551Arg гена IL4RA (до рестрикции). 95  % СI 0,89–3,88) (табл. 3).

Таблица 3
Частоты аллелей и распределения генотипов полиморфизма Gln551Arg
гена IL4RA среди больных АД и контрольной группы

Частота аллелей Частота распределения генотипов


Группа n(Х) Gln551 Arg551 Gln/Gln Gln /Arg Arg/Arg
n % n % n % n % n %
50
Основная группа 58 58 42 42 14 28 30 60 6 12
(100)
25
Контрольная группа 36 72 14 28 13 52 10 40 2 8
(50)

П р и м е ч а н и е: n и Х — количество исследованных лиц и хромосом соответственно.

Вывод. Сравнительный анализ распределе­ связи, то есть ассоциации между полиморфизмом


ния генотипов показал, что доля лиц с гетеро+ Gln551Arg гена IL4RA и форми­ро­ванием АД.
гомозиготными мутантными генотипами «Gln/Arg Необходимо подчеркнуть, что при сравнении
и Arg/Arg» среди больных и здоровых доноров здо­рового генотипа Gln/Gln у пациентов с АД по
составляет 36/100 (36  %) против 12/50 (24  %) соот- сравнению со здоровыми лицами было обнару­
ветственно. Рассчитанная вероят­ность развития жено более чем 5-кратное достоверное снижение
АД среди носителей данных генотипов в 4 раза частоты встречаемости здорового генотипа Gln/Gln
достоверно выше по сравнению с группой контроля (OR=0,54, 95  %СI 0,26–1,12). Эти данные подтверж­
(Х2=4,17; Р=0,04; OR=2,79; 95  % СI 1,03–7,56). Досто­ дают правильность полученных нами ре­зуль­татов,
верное преобладание числа носи­телей мутант­ доказывающих, что аллель IL4RA- Gln551 является
ных аллелей и генотипов в группе больных мо­жет маркером пониженного риска развития АД у
свидетельствовать о наличии пато­генетичес­кой пациентов.
25
Дерматовенерология и эстетическая медицина № 2 / 2016

Таким образом, в результате проведенного для установления дальнейшего варианта его


иссле­дования полиморфизма Gln551Arg гена клинического течения и предрасположенности к
IL4RA установлено, что данный ДНК-локус ассо­ тяжелым формам заболевания. Лечение атопи­
циирован с АД в Узбекистане. На начальных ческого дерматита рекомедуется проводить с
этапах постановки диагноза АД рекомедуется учетом генетических данных о преимущественном
проводить генотипирование исследованных поли­ характере его клинического течения и выражен­
морфизмов генов цитокинов и их рецепторов ности нарушений иммуного статуса.

ЛИТЕРАТУРА

1. Алимходжаева П.Р., Каримов Х.Я., Муминова 5. Bottini N., Borgiani P., Otsu A., Saccucci P. et all.
С.Р., Мавлянова Ш.З., Туйчибаева Н.М., Шам- IL4 receptor alpha chain genetic polymorphism and
сутдинова Д.Б., Бобоев К.Т. Разработка си- total IgE levels in the English population: two-locus
стем молекулярного тестирования и анализа haplotypes are more informative than individual
взаимосвязи полиморфизма 590C>T гена IL4 SNPs // Clin Genet. 2002. Vol.  61. P.  288–292.
с атопическим дерматитом. // Медицинский 6. Cui T., Wang L., Wu J., Hu L., Xie J. Polymor-
журнал Узбекистана 2012. №  1. C.  19–21. phisms of IL4, IL4R alpha / and AICDA genes in
2. Sandford A.J., Chagani T., Zhu S., Weir T.D. et adult allergic asthma J Huazhong Univ Sci Tech-
al. Polymorphisms in the IL4, IL4RA and FCERIB nolog Med Sci. 2003. Vol. 23. P.  134–137.
genes and asthma severity // J Allergy Clin Immu- 7. Isidoro-Garcia M., Davila I., Moreno E. et all. IL-
nol. 2000. Vol. 106. P.  135–140. 4RA gene polymorphism (Q576R) is associated
3. Kauppi P., Lindblad-Toh K., Sevon P. et al. A se­ with higher total IgE levels in Spanish patients
cond-generation association study of the 5q31 cy- with family history of atopy // Med Clin (Barc).
tokine gene cluster and the interleukin-4 receptor 2005. Vol. 124. P.  211–212.
in asthma // Genomics. 2001. Vol. 77. P.  35–42. 8. Hytonen A.M., Lowhagen O., Arvidsson M.,
4. Wjst M., Kruse S., Illig T., Deichmann K. Asthma Balder B. et all. Haplotypes of the interleukin-4
and IL-4 receptor alpha gene variants // Eur J Im- receptor alpha chain gene associate with suscep-
munogenet. 2002. Vol. 29: P.  263–268. tibility to and severity of atopic asthma. // Clin Exp
Allergy. 2004. Vol. 34. P.  1570–1575.

УДК:616-056.253:616.596-07/036

Актуальные вопросы ониходистрофий:


клиника, диагностика, лечение
Д.Т. Равшанова, А.Б. Рахматов

Республиканский специализированный научно-практический медицинский центр


дерматологии и венерологии Мз РУз;
Самаркандский кожно-венерологический диспансер

ХУЛОСА
ОниходистрофиЙнинг актуал саволлари: клиника, диагностика, даволаш
Д.Т. Равшанова, А.Б. Рахматов
Ониходистрофиянинг замонавий диагностикаси муаммолари, лнихомикозларни аниқлашда микро­
биологик текширувларни ўтказиш адекватлиги ва клиник куринишининг полиморфизми кўриб
чиқилмоқда. Юқорида келтириб ўтилган ониходистрофияни келтириб чиқарувчи омилларни ино­
батга олиб, бу патологиянинг даволаш алгоритми тақдим этилмоқда.
Калит сўзлар: ониходистрофия, онихомикозлар, диагностика, клиника, даволаш, профилактика.

Su mmary
The actual questions of the onychodystrophy: clinical picture, diagnosis, treatment
D.T. Ravshanova, A.B. Rakhmatov
This report deals with theconsideration of the problems of the timely diagnosis of the onychodystrophy,
adequate performance of microbiological investigations for identification of onychomycosis, polymorphism
of clinical manifestations. There have been proposed algorithms of the treatment of onychodystrophy in
relation to causative factors of this pathology.
Keywords: onychodystrophy, onychomycosis, diagnosis, clinical picture, treatment, prevention.

26
ОРИГИНАЛЬНЫЕ СТАТЬИ

Резюме
Актуальные вопросы ониходистрофий: клиника, диагностика, лечение
Д.Т. Равшанова, А.Б. Рахматов
В статье рассматриваются проблемы своевременной диагностики ониходистрофий, адекватность
проведения микробиологических исследований для выявления онихомикозов, полиморфизма
клинических проявлений. Предлагаются алгоритмы лечения ониходистрофий в зависимости от
причинных факторов данной патологии.
Ключевые слова: ониходистрофия, онихомикозы, диагностика, клиника, лечение, профилактика.

О ниходистрофии представляют собой тро­


фи­ческие нарушения, происходящие в
ногтевом аппарате под воздейст­вием эндогенных
кровеносных сосудов. Кожные валики непосредст­
венно соприкасаются с ногтевой пластинкой и
часто участвуют в патологических процессах
и экзогенных факторов. Деформация ногтевых ногтевого аппарата. На заднем кожном валике
пластин зачастую является частью симптомо­ располагается тонкая кожица — эпонихий, ко­
комплекса болезней внутренних органов, что может торый выполняет важную функцию в защите
иметь важное диагностическое и прогностическое самых крупных онихобластов, поэтому травмы
значение [1, 2, 3]. Ониходистрофии могут иметь этой зоны нередко приводят к серьезным дистро-
самостоятельный характер, а также регистрируются фическим изменениям ногтевой пластинки [1, 2].
при многих кожных заболеваниях (псориаз, экзема, При патологии ногтей (онихозы, онихии,
КПЛ и др.) [4]. По определенной симптоматике онихопатии) выделяют, как правило, ониходис­
ониходистрофий можно заподозрить то или трофии, изменение формы и размера ног-
иное заболевание, а, проведя соответствующее тей, цвета или пигментации ногтевых пла-
обследование, можно выявить серьезное забо- стин. Согласно МКБ-10 болезни ногтей класси­
ле­вание на ранних его стадиях. Изменения фицируются следующим образом:
ногтевых пластин возникают в первую очередь L.60.0 — Вросший ноготь;
вследствие трофических расстройств различного L.60.1 — Онихолиз;
происхождения. Следует указать, что на долю L.60.2 — Онихогрифоз;
ониходистрофий приходится 40–60  % патологии L.60.3 — Дистрофия ногтя;
ногтей, остальные — онихомикозы [5]. На сегод- L.60.4 — Линии Бо;
няшний день существуют серьезные проблемы в L.60.5 — Синдром желтого ногтя;
плане диагностики и лечения патологии ногтей, так L.60.8 — Другие болезни ногтей;
как практика показывает необоснованное назна- L.60.9 — Болезнь ногтя неуточненная.
чение системных противогрибковых препаратов (в В отечественной классификации рассмат­
случаях обнаружения условно-патогенной флоры, а риваются варианты патологии ногтей, вызванные
также грибов-контаминантов), что может привести к следующими факторами:
повышению коморбидности у данных пациентов. —  инфекционные заболевания ногтей (гриб­
Ногтевой аппарат состоит из ногтевой ковые, бактериальные);
пластинки, ногтевого матрикса и ложа, скопления —  онихии и паронихии при кожных забо­
кровеносных сосудов и нервных волокон, кожных леваниях;
валиков. Ногтевая пластинка представляет —  поражение ногтей при внутренних, эндо­
собой плотную роговую структуру, состоящую из кринных заболеваниях;
белка кератина, липидов, минеральных веществ —  травматические и профессиональные они­
и воды. В конечном итоге ногтевая пластинка хии и паронихии;
является продуктом онихогенеза, который про- —  новообразования аппарата ногтя (мела­
исходит в матриксе и ногтевом ложе. Этот про- нома);
цесс напоминает кератинизацию эпидермиса. —  врожденные, наследственные онихии.
Специфические клетки, которые находятся в Рассмотрим отдельные клинические проявле-
матриксе и ногтевом ложе, постоянно делятся на ния ониходистрофий.
материнскую и дочернюю, которая, отделяясь, Ногти Гиппократа — это форма гипертрофи-
собственно и превращается в ногтевую пластину, ческого поражения, при которой ногти несколько
пройдя ряд биохимических трансформаций. утолщаются и деформируются, часто сочетаются
Эти клетки называются онихобластами. Круп- с пальцами в форме «барабанных палочек».
ные онихобласты располагаются в области Впервые данный симптом описал Гиппократ в
матрикса, мелкие — в ногтевом ложе, за счет I веке до н.э. у больных с эмпиемой плевры.
крупных клеток ноготь растет в длину, за счет Клинически отмечается расширение концевых
мелких — в ширину. Деление клеток происходит фаланг пальцев, они увеличиваются в размерах,
постоянно в результате нейротрофических про­ становятся широкими, выпуклыми, округлыми, а
цессов, ввиду чего в матриксе и ложе распо­ ногти приобретают куполообразную форму или
лагается большое количество нервных волокон и форму часового стекла, блестящая поверхность
27
Дерматовенерология и эстетическая медицина № 2 / 2016

и нормальная окраска сохраняются, но нередко остается гладкой, нормальной толщины. Койлони­


изменяется упругость — ногти становятся более хия развивается на отдельных ногтевых пластин­
мягкими. Кривизна ногтевой пластинки усилена ках и может носить врожденный и при­обретенный
в поперечном, продольном направлении, ино- характер.
гда свободный край ногтя несколько изогнут кни-
зу, задний и боковые валики имеют синюшную,
застойную окраску.

Наблюдается при железодефицитных ане­


Данная патология часто наблюдается у миях, сосудистой пато­логии конечностей, ревма­
больных с бронхиальной астмой, сердечно- тоидных заболе­ваниях.
сосудистой патологией и желудочно-кишеч­ными Онихогрифоз характеризуется резким утол­
заболеваниями. щением ногтевой пластинки и встречается чаще
Онихолизис (onycholysis) — часто встре­ на первых пальцах стоп; отмечаются резкая
чающийся в практике вид ониходистрофии ног­ гипертрофия, изменение текстуры, цвета и на­
тей, который характеризуется нарушением правления роста ногтя. Ноготь становится вы­
связи ногтевой пластины с ногтевым ложем пуклым, загибается наподобие птичьего клюва.
при сохранении целостности последнего. Сле- Поверхность ногтя обычно неровная, шероховатая,
­до­вательно, речь идет о неспособности ногтя нередко бугристая и принимает грязно-желтый
прирастать к ногтевому ложу. Данную разно­ цвет. В развитии онихогрифоза большое значение
видность ониходистрофии впервые описал в придается местным травмирующим факторам,
1910  г. Геллер. при которых ногтевое ложе и матрикс отвечают
Отделение ногтевой пластины от ногтево- избыточным образованием быстро ороговевающих
го ложа происходит по свободному краю и пос­ онихобластов.
тепенно прогрессирует в проксимальном на­прав­
лении до области луночки ногтевой плас­тинки.
В большинстве отделяется только ног­тевой сег-
мент, весь ноготь отделяется крайне редко. По
этой причине рассматривается час­тичный или то-
тальный онихолизис.

Данная патология чаще встречается у лиц по-


жилого и старческого возраста. В формировании
онихогрифоза имеет значение и плоскостопие.
Описаны случаи резкой гипертрофии и дефор­
мации ногтей по типу онихогрифоза у больных
онихомикозами.
Склеронихия характеризуется выраженной
твердостью ногтевой пластинки, она утолщается,
Данная патология может наблюдаться при отмечается полная потеря эластичности,
системных и эндокринологических заболева­ниях. при этом ногти приобретают желтоватый или
Койлонихия (koilonychias) сопровождается коричневатый цвет, луночка исчезает. Рост ногтя
образованием блюдцеобразного вдавления раз­ резко замедляется, ногтевая кожица исчезает.
личной степени выраженности на поверхности Процесс обычно развивается на всех пальцах
ногтевой пластинки, причем последняя обычно одновременно.

28
ОРИГИНАЛЬНЫЕ СТАТЬИ

борозды могут иметь прерывистый характер


и напоминать «бусы из бисера» (симптом
бисера).
Срединная каналиформная дистрофия
ногтей имеет полиэтилогический характер и
проявляется образованием глубокой канали­
формной борозды шириной в 4–5 мм в централь­
ной части ногтевой пластинки, которая начинается
в проксимальной ее части и продолжается до
краевой зоны, в результате чего сама ногтевая
Поперечная борозда ногтя (борозда Бо, пластинка разделяется на две равные части.
борозда Бо-Рейля) характеризуется образова- Для данной разновидности ониходистрофии
нием поперечной, точнее дугообразной бороз- характерен симптом «елки», заключающийся
ды, которая пересекает поверхность ногтевой в образовании угловых полосок, отходящих от
пластинки от одного бокового валика до друго- центральной борозды. Поражаются, как правило,
го. Это одна из самых распространенных форм ногтевые пластинки первых пальцев кистей.
ониходистрофии. Поперечная борозда, иногда Онихорексис (onychorrhexis: онихо + греч.
со слегка возвышающимся гребешком по за- rhexis — ломка) — образование глубокой про­
днему ее краю, образуется на поверхности ног- дольной трещины на поверхности ногтевой плас­
тевой пластинки после перенесенных воспа- тинки, но в отличие от срединной кана­ли­формной
лительных процессов (через 1–2 недели) или дистрофии начинается не с проксимальной,
после травмирования ногтевой кожицы во время а с дистальной части ногтя. Довольно часто
проведения маникюра. При воспалительных онихорексис сочетается с симптомом «наперст­
процессах, как считается, приостанавливается ка», а из дерматозов ука­зывается на красный
процесс деления, вследствие чего ногтевая плоский лишай. Они­хорексис часто развивается у
пластинка становится тоньше и на поверхно- лиц, контакти­рующих с химичес­кими вещест­вами.
сти ногтя может появляться вдавление в виде Онихошизис (onychoschizis: онихо + греч.
борозды, причем по ее глубине можно судить о schizis — расщепление) — расщепление ног­
тяжести повреждения матрицы ногтя. Иногда тевой пластинки в поперечном направлении
аналогичного расположения могут появляться параллельно свободному краю ногтя. По сво­
линии Ми — поперечные белые полоски, которые бодному краю происходит расщепление на
захватывают лишь часть ногтевой пластинки и 2–3 слоя, лежащих друг на друге, причем
существуют недолго. воспалительные явления отсутствуют. Наибо­
Онихомадез (onychomadesis; онихо + греч. mad- лее часто поражаются ногти 2,3 и 4 пальцев
esis — облысение) является довольно редким кистей. Если ногти коротко остричь, проявления
проявлением ониходистрофии, когда происходит они­хо­шизиса исчезают, а при отрастании
отслоение ногтевой пластинки не по свободному симпто­матика вновь появляется. Онихошизис
краю (онихолизис), а с проксимального отдела. возникает под воздействием различных хими­
Онихомадез развивается быстро и, как правило, ческих фак­торов у женщин (при маникюре —
может наблюдаться на одном пальце, чаще на лаки и ацетон).
больших. Трахионихия (trachyonychia) является свое­
Процесс отделения ногтевой пластинки от образной ониходистрофией, проявляющейся
матрикса зависит от характера заболевания образованием шероховатостей и мелкого
и может протекать остро с воспалительными шелушения на поверхности ногтевой пластинки.
проявлениями (болезненность). Довольно часто Данная разновидность ониходистрофии наиболее
онихомадез встречается у больных с псо­риазом часто регистрируется у больных экземой.
и при тяжелых формах алопеции. Основная при- Лейконихия (leuconychia) — изменение
чина возникновения онихомадеза — нарушение окраски ногтей от белого до светло-желтого,
кровообращения и развитие патологии матрикса коричневого до красного, синего, зеленого и
ногтя, причем восстанов­ление указанных функ­ черного. Различают следующие разновидности
ций приводит к отрастанию нормальной ногтевой лейконихий:
пластинки. —  точечная, пятнистая;
Продольные борозды ногтя возникают при —  полосовидная (расположены поперечно по
нарушениях периферического кровообращения, отношению к длинной оси ногтя);
травматизации матрикса ногтя, а также при —  тотальная (побеление всей ногтевой плас­
некоторых дерматозах (псориаз, красный плос­ тинки);
кий лишай) и ревматических заболеваниях. —  частичная, субтотальная.
Продольные борозды располагаются чаще в Следует указать, что на одной и той же
центральной, но могут занимать и всю поверх­ ногтевой пластинке одновременно могут
ность ногтевой пластинки. Иногда продольные встречаться различные формы лейконихии.
29
Дерматовенерология и эстетическая медицина № 2 / 2016

При точечной и полосовидной формах пятна вого или красного цвета, располагающихся в
продвигаются в дистальную часть ногтя и дистальной части ногтевой пластинки. Описаны
затем исчезают, при субтотальной и тотальной случаи появления продольных кровоизлияний в
изменения носят стойкий характер, причем центральной части ногтевого ложа после инфек­
появляются эти проявления еще в детском ционного эндокардита.
возрасте. Наиболее часто к таким изменениям
ногтей приводят тяжелые заболевания, При лечении ониходистрофий возникают
отравление солями тяжелых металлов, а также определенные сложности, которые во многом
детские инфекции. связаны с трудностями установления причины
Линии Мюрке — это две белые полосы на заболевания и длительным отрастанием
ногтевой пластинке, располагающиеся парал- ногтевой пластинки, что, естественно, снижает
лельно луночке. Эти линии являются признаком качество жизни пациентов. Не во всех случаях
гипоальбуминемии, причем восстановление сы- пациенты до конца выполняют предписания
вороточного альбумина приводит к исчезнове- врача, что сказывается на терапевтической
нию линий Мюрке. Наиболее часто эти явления эффективности того или иного метода лечения.
встречаются у лиц с нефротическим синдромом. Следует указать, что полное отрастание
Симптом Терри и двухцветный ноготь ногтевых пластинок на руках происходит за 5–6
характеризуется окрашиванием в белый цвет месяцев (при среднем возрасте пациента), на
2/3 ногтевой пластинки с проксимальной части, стопах — за 9–12 месяцев. В настоящее время
а 1/3 в дистальной части остается розовой. разработан следующий алгоритм лечения
Данный симптом встречается при сердечно- больных с ониходистрофиями:
сосудистых заболеваниях, циррозе печени —  общий режим;
(гипоальбуминемия). Подобный двухцветный но- —  диета;
готь может выявляться у 10  % больных с уремией. —  общая терапия;
Гиперпигментации обусловлены накоплением —  местное лечение;
в ногтевых пластинках меланина, гемосидерина —  физиотерапевтические процедуры;
и других пигментов. Гиперпигментированной —  санаторно-курортное лечение.
может быть вся ногтевая пластинка или ее часть В общем режиме пациентам рекомендует-
(в виде полос). К изменению окраски ногтей могут ся ограничить контакт с моющими средствами
приводить различные эндогенные и экзогенные и различными химикатами. При частом контак-
факторы. Гиперпигментации могут встречаться те с водой и детергентами пациенты должны в
при надпочечниковой недостаточности, отравле- обязательном порядке использовать резиновые
нии солями тяжелых металлов. При подногтевой перчатки с хлопчатобумажной осно­вой. В пище
меланоме возможна черно-коричневая окраска необходимо использовать боль­шое количество
заднего и боковых ногтевых валиков, всего фруктов и овощей, содер­жа­щих разнообразные
ногтевого ложа, причем ноготь постепенно микроэлементы. Общая терапия должна быть
разрешается. При поражении грибами из рода направлена на улуч­шение обменных процессов в
Trichophyton ногти способны приобретать грязно- матриксе ногтя, так как наружные средства плохо
желтоватый оттенок, при плесневых грибах имеют проникают в данный отдел ногтевой пластинки.
черноватый цвет, при поражении синегнойной В общей терапии могут быть использованы
палочкой происходит окрашивание в зеленый цвет вазопро­текторные и антигистаминные средства.
(симптом «зеленых ногтей»). При тяжелых формах ониходистрий назначают
Синдром желтых ногтей включает в себя препараты хинолинового ряда, системные
следующие признаки: дистрофия и желтая кортикостероидные средства, ароматические
окраска ногтей, патологические изменения со ретиноиды и даже метотрексат.
стороны лимфатической системы, заболевания Следует указать, что основными средствами,
внутренних органов (чаще органов дыхания). так называемыми «ускорителями роста ногтей»
Пигментации ногтей (медикаментозные) являются комбинированные витаминно-мине­
раз­виваются после приема определенных ле­ ральные комплексы, которые способствуют
карст­венных средств. Так, тетрациклиновые ускоренному делению онихобластов. К группе
препараты могут окрашивать ногтевые пластинки таких препаратов относятся специальное драже
в корич­неватый цвет, препараты фенолфталеина «МЕРЦ» и «Пантогар», представляющие со-
вызы­вают появление на ногтях голубоватых бой комплекс разнообразных витаминов, мине-
или синих полос, препараты серебра вызы- ральных веществ и микроэлементов (Se, Cu, Fe,
вают аргирию — ногтевое ложе принимает Zn). Пантогар обладает общеукрепляющим и
голубовато-серую окраску. Резорцин приводит к регенерирующим свойствами, антиоксидантным
окрашиванию ногтей в оранжевый или оранжево- действием, восполняет дефицит серосодержащих
красный цвет. аминокислот и витаминов в организме. Активация
Продольные подногтевые кровоизлияния метаболизма изменяет внутриклеточные окис­
характеризуются образованием полос коричне- лительно-восстановительные процессы в они­
30
ОРИГИНАЛЬНЫЕ СТАТЬИ

хобластах, что приводит к снижению воспри- В наружной терапии ониходистрофий исполь­


имчивости рецепторного аппарата клеток к не- зуются питательные мази и масла. Мази, как
гативным эндогенным влияниям. В пантогаре правило, наносятся на кожу заднего кожного
активные ингредиенты дополняют друг друга. валика, возможно нанесение под окклюзию.
К этим составляющим относятся: 60 мг тиа- Масла втираются в ногтевую пластинку. Сле­
мина, 100 мг экстракта медицинских дрожжей, дует помнить, что измененный вследствие дис-
60   мг кальция пантотената, 20 мг кератина, 20 мг ­тро­фического процесса ноготь является хоро­
L-цистеина, 20 мг парааминобензойной кислоты. шей средой для контаминации грибковой
Кератин — это основной структурный белок при- или бактериальной инфекции. В этой связи
датков кожи (волосы и ногти). L-цистеин — один часто используются противогрибковые и анти­
из главных компонентов, он как поставщик атомов бактериальные растворы. При ониходистрофиях
серы участвует в синтезе ацетилхолина. Цистеин, дерматологической этиологии (псориаз, экзема)
наряду с глицином и глутамином, участвует в назначают наружные кортикостероиды. Физио­
образовании глутатиона — ключевого звена терапевтические методы заключаются в
антиоксидантной системы. Кальция пантотенат использовании УФО, ПУВА, электрофореза, игло­
участвует в углеводном, липидном и белковом рефлексотерапии.
обменах, синтезе ацетилхолина, стероидов, вы- Таким образом, больные ониходистрофиями
полняя функции единственного незаменимого требуют углубленного обследования с испо­
компонента ацетилирования. Ионы кальция также ль­зованием современных технологий (конфо­
нормализуют образование коллагена, стимулируя каль­ная микроскопия, ангиография и др.), что
матричные клетки к делению. Тиамин активно позволит на ранних этапах выявить соответст­
участвует в углеводном, липидном и белковом вующие этиологические факторы и проводить
обменах, а также предохраняет мембраны кле­ корригирующую терапию. В отдельных случаях,
ток от токсического воздействия продуктов пе­ как показали собственные исследования, доста-
рекисного окисления и является источником точным бывает лечение указанными витамин-
энергии для строения и роста ногтевой пластинки. но-минеральными комплексами в течение 3–6
Как природный комплекс витаминов группы В, месяцев. Для практической дерматологии наибо-
энзимов, аминокислот и минеральных веществ, лее важным является выявление на ранних ста-
в состав препарата включен экстракт медицин- диях тех видов дистрофий, которые сочетаются
ских дрожжей, обеспечивающий матрикс ногтя с патологией внутренних органов, так как в этих
соответствующей энергией при его активации. случаях необходимо вмешательство смежных
Пантогар принимают от 4 до 8 месяцев по одной специалистов.
капсуле 3 раза в день.

литература
1. Беран Р., Ханеке Э. Дифференциальная диаг­ 4. Руденко И.Б., Свирид С.Г. Клиническое значе-
ностика поражений ногтей. — М.: «ГЭОТАР- ние специфической онихопатии при псориазе
Медиа». 2011. 200 с. // Успехи медицинской микологии. 2004. №  4.
2. Зоиров П.Т. Болезни кожи. — Душанбе. 2002. С.  128–130.
С.  671–681. 5. Рукавишникова В.М. Частота и характер онихо­
3. Рахматов А.Б., Рахматов Б.Р. Псориаз — дист­ро­фий, трактуемых как онихомикозы
системное заболевание. — Ташкент. 2001. // Успехи медицинской микологии. 2004. №  4.
223  с. С.  131–134.

31
Дерматовенерология и эстетическая медицина № 2 / 2016

ОБМЕН ОПЫТОМ

УДК: 616.5-056.43(575.171)

Клиническая характеристика аллергодерматозов


в Хорезмской области

Ш.З. Мавлянова, М.С. Ибрагимов, А.И. Исмагилов, З.С. Юнусова,


Ж.Б. Муллаханов, С.Р. Муминова

Республиканский специализированный научно-практический медицинский центр


дерматологии и венерологии МЗ РУз;
Хорезмский кожно-венерологический диспансер

ХУЛОСА
Хоразм вилоятида аллергодерматозларнинг клиник кечиниши хусусиятлари
Ш.З. Мавлянова, М.С. Ибрагимов, А.И. Исмагилов, З.С. Юнусова, Ж.Б. Муллаханов, С.Р. Муминова
Мақолада Хоразм вилоятининг айрим худудларида яшовчи аллергодерматит касаллигига дучор
бўлган беморларда олиб борилган клиник текшириш ишлари кўрсатилган. 80 та мурожаат қилган
беморлар орасида аллергодерматит касаллиги 57 нафар беморда аниқланди ва у 71,3  % ни таш-
кил этди. Бунда аллергодерматитларни — 30, атопик дерматитни — 17 та бемор ташкил этди ва
эшакем касаллиги эса — 6 та ва токсикодермия — 3 нафар беморларда қайд этилди. Аллерго-
дерматозларни зўрайишига олиб келган асосий сабалардан алиментар омилиташкил этди ва
80,7  %да кайд этилди. Аллергодерматозларда наслий омили курсаткичи — 28,8  % ни ташкил
этди.
Калит сўзлар: аллергодерматозлар, атопик дерматит, эшакем, дерматологик симптомлар шкаласи-
нинг индекси.

Su mmary
C linical feat ures of allergo dermatosis in the K horezm region
Sh.Z. Mavlyanova, M.S. Ibragimov, A.I. Ismagilov, Z.S. Yunusova, J.B. Mullakhanov, S.R. Muminova
The article presents the data of the clinical studies of patients with allergic dermatoses, living in some areas
of Khorezm region. Among the converted 80 patients with skin diseases allergic dermatoses were found in
57 patients, accounting for 71,3  %. Given the clinical form in 30 of cases diagnosed allergodermatity, 17  —
atopic dermatitis and 6 — urticaria. The main precipitating factor of acute allergic factor was the food —
80,7  %. Hereditary factor was — 28,8  %.
Keywords: allergodermatosis, atopic dermatitis, urticaria, dermatological symptoms index scale.

РЕЗЮМЕ
Клиническая характеристика аллергодерматозов в Хорезмской области
Ш.З. Мавлянова, М.С. Ибрагимов, А.И. Исмагилов, З.С. Юнусова, Ж.Б. Муллаханов, С.Р. Муминова
В статье приводятся данные клинического обследования больных с аллергодерматозами, проживаю­-
щих в Хорезмской области. Среди 80 обращенных лиц с кожными заболеваниями аллергические
дерматозы выявлены у 57 больных (71,3  %). По клинической форме аллергодерматит (АлД) диа-
гностирован у 30, атопический дерматит — у 17, крапивница — у 6, токсикодермия — у 3 больных.
Провоцирующими факторами обострения аллергодерматозов в основном были пищевой (80,7  %) и
наследственный (28,8  %).
Ключевые слова: аллергодерматозы, крапивница, атопический дерматит, клиника, дерматологиче-
ский индекс шкалы симптомов.

А ллергические заболевания в настоящее


время представляют серьезную проблему
для практического здравоохранения. В послед-
ние годы наблюдается резкий подъем аллергиче-

32
ОБМЕН ОПЫТОМ

ских заболеваний во всем мире, их распростра- клиническим проявлениям заболевания: эрите-


ненность составляет от 25 до 40  % (Караулов ма, отек, мокнутие, лихенификация, папулы, су-
A.B. и др., 1999; Хаитов P.M. и др., 2001; Емелья- хость, шелушение, трещины, зуд. ДИШС оце-
нов A.B. и др., 2002). нивался по трем степеням тяжести клиническо-
Научная группа проектного исследования го проявления: легкая степень — до 15 баллов,
АДСС-15.19.3 «Иммуногенетические, метаболиче- средняя — 16–25 баллов, тяжелая — более 25
ские и микробиологические маркеры в развитии баллов (от 26 до 36 баллов).
аллергодерматозов и пути усовершенствования Результаты исследования. Среди 80 об-
методов их диагностики и терапии» была коман- следованных аллергические дерматозы выявле-
дирована в Хорезмскую область для изучения ны у 57 больных (71,3  %), из них лица мужского
клинического течения аллергических заболева- пола  — 21  (36,8  %), женского — 36  (63,2  %). Воз-
ний кожи и оценки микробиологического статуса раст больных колебался от 2 до 65 лет.
кожи у больных аллергодерматозами. По клинической форме аллергодерматит
Цель исследования. Оценка клинического (АлД) диагностирован у 30, атопический дерма-
течения аллергических заболеваний кожи и мик­ тит (АД) — у 17, крапивница — у 6, токсикодер-
робиологического статуса кожи у больных аллер- мия — у 3 больных.
годерматозами. Из провоцирующих факторов 46  (80,7  %) боль-
Материал и методы исследования. Обсле- ных указали на пищевой, 17  (29,8%) — на на-
дованы 80 больных (лица мужского пола — 32, следственный, 7  (12,3 %) — на лекарственный и
женского — 48) с различными кожными заболева- 3 (5,3 %) — на солнечный фактор.
ниями в возрасте от 2 до 65 лет. Всем больным В зависимости от нозологии аллергодерма-
проведены клинические и микробиологические тозов пищевой фактор превалировал в группе
исследования. Контрольную здоровую группу со- больных аллергодерматитами — 26  (45,6  %) и
ставили 18 человек в возрасте от 15 до 66 лет. атопическим дерматитом — 15  (26,3  %), наслед-
Клинические исследования характеризовались ственный фактор в основном отмечен у больных
сбором анамнеза, осмотром общего состояния и с аллергодерматитами — 22,8  % (13 из 57).
кожно-патологического процесса, определением По возрастой категории до 10 лет были 10 боль-
дерматологического индекса шкалы симптомов ных, 11–19 лет — 12, 20–29 лет — 9, 30–39 лет  —
(ДИШС). Показатель оценивался по 9 основным 11, 40–49 лет — 14 и более 50 лет — 1 больной.
Таблица 1
Показатель выявляемости аллергодерматозов с учетом пола больных

Больные АД АлД Крапивница Токсикодермия


Мужчины 6 13 — 1
Женщины 11 17 6 2

По давности заболевания атопическим дер- более 5 лет — 1 больной; токсикодермией в те-


матитом до года страдали 6  (35,3  %), от года до чение 10 дней — 2 больных и один — в течение
5  лет — 7  (41,2  %) и более 5 лет — 4  (23,5  %) боль- года.
ных; алергодерматитом до года — 16  (53,3  %), По индексу ДИШС у больных аллергодермато-
от года до 5 лет — 9  (30  %) и более 5 лет — зами в 50,8  % случаев выявлена среднетяжелая и
5  (16,6  %) больных; крапивницей до года  — 5 и в 43,8  % — тяжелая степень тяжести заболевания.

Диаграмма 1. Показатель индекса ДИШС в зависимости от нозологии аллергодерматозов (абс.)

33
Дерматовенерология и эстетическая медицина № 2 / 2016

Как видно из диаграммы, тяжелой степе- По клинической форме аллергодерматит диаг-


нью АД страдали 64,7  % (11 из 17), среднетяже- ­ остирован у 30 больных, атопический дерма­тит
н
лой  — 35,3  % (6). В группе больных аллергодер- — у 17, крапивница — у 6, токсикодермия — у 3
матитами 16 пациентов страдали среднетяжелой больных.
(53,3  %), 12 — тяжелой 12  (30  %) и 2  (6,6  %) — лег­- Провоцирующими были пищевой (80,7  %), на-
кой степенью тяжести заболевания. следственный (29,8  %), лекарственный (12,3  %) и
Таким образом, в Хорезмской области среди солнечный (5,3  %) факторы.
80 дерматологических больных аллергические Клиническое течение аллергодерматозов ха-
дерматозы выявлены у 57  (71,3  %) больных, из рактеризовалось среднетяжелой степенью тяже-
них лица женского пола — 36  (63,2  %), мужского сти (50,8  %), тяжелая степень заболевания выяв-
пола — 21  (36,8  %). лена у 43,8  % больных АлД.

Литература

1. Емельянов, А.В. Крапивница и отек Квинке. — 5. Рахматов А.Б. Вопросы клинической оценки
С-пб: изд-во гос. мед. ун-та им. акад. И.П. Пав- тяжести течения дерматозов // Дерматовене-
­лова. 2002. 28  с. рология и эстетическая медицина. №  1/2016
2. Мавлянова Ш.З. Атопический дерматит. Моно- (29) C.  25–32.
графия. — Ташкент. 2014. 165  с. 6. Хаитов P.M. Иммунопатология и аллерголо-
3. Мавлянова Ш.З., Ибрагимов О.А., Мумино- гия. Стандарты диагностики и лечения. — М.:
ва  С.Р., Абдусаматов У.А. К выявляемости ато­- «Медицина». 2001. 105 с.
пического дерматита в Ферганской области 7. Hanifin J.,Turston M.,Omoto M. et al. The ecze-
//  Дерматовенерология и эстетическая меди- ma area and saverity index (EASI): assessment
цина. №  3 –4/2013 (20). С.  4 –48. of reliability in atopic dermatitis) // Exp Derma-
4. Мавлянова Ш.З., Хужамбердиев О.А., Мул- tol. 2001. Vol.  10. P.  8 –11.
лаханов Ж.Б., Юнусова З.С. К результатам 8. Schafer T., Kramer U., Vieluf D. et all. The ex-
клинических исследований больных аллер- cess of atopic eczema in East Germany is relat-
годерматозами в Самаркандской области. ed to the intrinsic type // Br.J. Dermatol. 2000.
//  Дерматовенерология и эстетическая меди- Vol.  143. P.  9 92–998.
цина. №  1/2016 (29). С.  32–35.

УДК:616.992.282:616.5:616.76:616.98:578.828.6

Микотические поражения кожи и слизистых оболочек


у ВИЧ-инфицированных больных

З.М. Абидова, У.Б. Нурматов

Республиканский специализированный научно-практический медицинский центр


дерматологии и венерологии МЗ РУз

ХУЛОСА
ИТВ/ОТИС да шиллиҚ Қават ва тери замбуруҒи билан хасталанган беморлар
З.М. Абидова, У.Б. Нурматов
Ушбу мақолада ИТВ/ОИТС да замбурухли инфекциясининг оппортунистик касалликлар сифатида
учраш даража сифатида маълумот берилган. Замбуруғли инфекциясининг кўпайиши ва у чақирган
касалликлар кечишини оғирлашувининг муҳим факторларидан бири бу, ИТВ томонидан вужудга
келган иккиламчи иммунтанқислиги, тери қатламининг резистентлиги ва замбуруғ инфекциясининг
иммун тизимига таъсиридир. Шунинг учун ИТВ/ОИТВ билан зарарланган беморларда
микотикинфекцияларни ўрганиш, хусусан замбуруғ касалликларини қўзғатувчи замбуруғлар
турларини аниқлаш ва уларни замбуруғга қарши дори воситаларига сезгирлигини аниқлаш орқали
бу беморларни генераллашган микотик инфекциясидан ўлимини анча камайтиришга имкон яратади.
Калит сўзлар: замбуруг кассалликлари, ИТВ/ОИТВ, патогенез, диагностика.

34
ОБМЕН ОПЫТОМ

S UMMARY
Mycotic lesions of the skin and mucous membranes in HIV/ AIDS
Z.M. Abidova, U.B. Nurmatov
This articleshowsanin crease of defeats opportunistic fungi in HIV/AIDS. One of the important factors
contributing to fungal contamination, and the weighting of course, is the presence of secondary
immunodeficiency caused, by HIV, decreased skin resistance and the impact of most fungal infection on
the immune system. Therefore, the study of fungal infections in HIV/AIDS, in particular, the identification of
the species spectrum of pathogens fungal diseases with the establishment of their sensitivity to different
antimikoticheskim drugs reduce mortality from generalized fungal infect.
Keywords: fungal diseases, HIV/AIDS, diagnosis, pathogenesis.

РЕЗЮМЕ
Микотические поражения кожи и слизистых оболочек у ВИЧ-инфицированных
больных
З.М. Абидова, У.Б. Нурматов
В статье приводятся данные о частоте встречаемости грибковых инфекций в качестве оп­пор­
тунистических заболеваний при ВИЧ/СПИДе. Одним из важных факторов увеличения встре­
чаемости грибковых инфекций и осложнений вызываемых ими заболеваний являются вторичное
иммунодеффицитное состояние организма, резистентность кожного покрова и действие грибковой
инфекции на иммунную систему. Поэтому изучение микотических поражений у ВИЧ/СПИД
инфицированных больных, в частности, определение видов возбудителей грибковых инфекций и
их чувствительности к противогрибковым препаратам, дает возможность значительно уменьшить
смертность от генерализованной грибковой инфекции у этих больных.
Ключевые слова: грибковые заболевания, ВИЧ/СПИД, патогенез, диагностика.

М икозы регистрируются у 58–81  % больных


СПИДом. Они могут наблюдаться
не только в манифестном периоде, но и во
симость частоты кожных заболеваний у этих
больных от количества CD4+ клеток в крови,
однако детального анализа влияния уровня
время латентной стадии ВИЧ-инфекции. Ми­ CD4+ клеток на частоту развития дерматомико­
ро­вая тенденция роста микозов кожи и ногтей зов не проводили. Реальные масштабы рас­
среди населения сформировалась, в том пространенности грибковых заболеваний, так
числе, за счет увеличения доли иммуноском­ и ВИЧ носительство до сегодняшнего времени
проментированных лиц, страдающих ВИЧ-ин­ неизвестны в связи со сложностями массо­вого
фекцией [3, 17]. Структура поверхностных диагностического охвата населения, разно­
микозов у ВИЧ-инфицированных пациентов образия форм клинической манифестации гриб­
имеет особенности и отличается от таковой ковых заболевании и ВИЧ/СПИДа, выхода групп
у иммунокомпетентных лиц [13, 14]. К настоя­ риска за пpeделы социально неадаптированного
щему времени ВИЧ-инфекция приобретает контингента и связи с многообразием путей
размах широкомасштабной эпидемии в развитых передачи инфекции.
странах мира. Бразильские исследователи Нарастающая несостоятельность иммунной
установили, что наиболее распространенной системы (стадия III) приводит к развитию двух
клинической формой дерматомикозов является основных клинических проявлений СПИДа:
онихомикоз (31  %), микоз стоп — у 4  %, в оппортунистических инфекций, вызван­н ых
единичных случаях был зарегистрирован микоз условно патогенной флорой, и новообразова­
туловища и крупных складок, отрубевидный ний. У 90  % больных ВИЧ в разные сроки
лишай [14]. Индийские исследователи показали, заболевания регистрируются поражения кожи
что у вич-инфицированных пациентов онихоми- и слизистых покровов, вызванные инфекциями
коз стоп был диагностирован у 26,5  %, причем условно патогенной флоры. Чаще всего
у 30  % больных он был в ассоциации с микозом оппортунистические инфекции вызывают Pneu-
стоп, микоз туловища — у 15  %, микоз крупных mocystis carinii, Mycobacterium avium-intracellu-
складок и стоп — у 10  % и 7  % соответственно. lare, Mycobacterium tuberculosis, Cryptococcus
В единичных случаях зарегистрирован отрубе- neoformans, Candida spр., Toxoplasma gondi,
видный лишай и микоз кистей (2  %). Следует от- Histoplasma capsulatum, Coccidio desimmitis,
метить, что у ВИЧ-инфицированных пациентов ДНК- содержащие вирусы, например цитомега-
регистрируется сочетание двух и более микозов ловирус, вирус гепатита В, вирус простого гер-
кожи и ногтей [1, 3, 4]. песа [5]. Одними из наиболее тяжело протека-
Факторы риска возникновения дерматоми­ ющих оппортунистических инфекций являются
козов у ВИЧ-инфицированных изучены недоста­ грибковые поражения (табл. 1).
точно. Единичные исследования показали зави­

35
Дерматовенерология и эстетическая медицина № 2 / 2016

Таблица 1
Наиболее часто регистрируемые грибковые инфекции у ВИЧ-инфицированных пациентов

Возбудитель Вызываемые заболевания


Aspergillus spp. Аспергиллезный трахеобронхит;
инвазивный легочный аспергиллез
Candida spp., в основном, Оральный и/или вагинальный кандидоз;
C. albicans кандидозный эзофагит;
кандидозная фунгемия;
легочный кандидоз (в основном, у детей)
Coccidiodides immitis Диссеминированный кокцидиоидомикоз
Oyptocccus neoformans Криптококкозный менингит;
криптококкозная пневмония;
диссеминированный криптококкоз
Histoplasma capsulatum Гистоплазиозная пневмония;
диссеминированный гистоплазмоз
Pneumocystis carinii Пневмоцистная пневмония: в завершающей стадии или на фоне профилактики —
неспецифическая картина, в том числе полиорганное поражение
Penicillium marneffei Пенициллиоз кожи;
диссеминированный пенициллиоз (эндемичен для юго-восточного азиатского
региона).

Важными факторами, способствующими нарушение сознания, реже — эпилеп­тические


грибковой контаминации и утяжелению течения, припадки и кома. Криптококкоз также может
являются наличие вторичного иммунодефицита, протекать с поражением легких, сетчатки, кожи,
вызванного ВИЧ, снижение резистентности костей, предстательной железы и других органов
кожных покровов и воздействие самой грибковой [1, 2].
инфекции на иммунную систему. Гистоплазмоз возникает у ВИЧ-инфици­
Аспергиллез может быть подразделен на три рованных, проживающих в местности с широким
категории: распространением этого гриба. В США — это
поверхностный — инфекции слухового про­ северо-восточные и северо-западные штаты.
хода, роговицы глаза, также первичное пора­ При СПИДе гистоплазмоз может возникнуть даже
жение кожи; после кратковременного пребывания в такой
неинвазивный — аллергический бронхит и местности. Клинические проявления обычно не-
аспергиллемы у пациентов с предшествующим спецефичны и включают головную боль, кашель,
кавернообразующим легочным заболеванием (в лихорадку, похудение, увеличение лимфоузлов и
первую очередь, с туберкулезом); спланхномегалию [1, 2].
инвазивный обнаруживаемый, как правило, Пневмоцистная пневмония — самая рас­
у пациентов с нейтропенией; различают острую пространенная оппортунистическая инфекция
инвазивную и хроническую некротизирующую дыхательных путей у ВИЧ-инфицированных.
формы. Основными симптомами при легочном Возникает у 60–80  % больных СПИДом, однако
поражении являются кашель и постепенно современные методы профилактики позволили
нарастающая одышка; при поражении печени — снизить ее тяжесть. Риск пневмоцистной пнев­-
увеличение уровня контролируемых ферментов монии особенно высок, когда число лимфоци­
в сыворотке. Без лечения хронический некро­ тов CD4 опускается ниже 200 мкл 1. Клини­чески
тизирующий аспергиллез может привести к характерны лихорадка, одышка и непродуктив­
летальному исходу [1, 2]. ный кашель. Лабораторное исследо­вание выяв­
Кокцидиоидоз обычно встречается у ВИЧ- ляет гипоксемию. На рентгено­граммах грудной
инфицированных, проживающих в местности с клетки у большинства больных выяв­ляются
широким распространением Coccidio idesimmitis, двусторонние ограни­ченные или обширные за­
например на юго-западе США. Заболевание про- тем­нения с некоторыми особеннос­тями  — по­ра­
является поражением легких и менингитом [1, 2]. жение верхушек легких, образова­ние полос­тей и
Криптококкоз — повсеместно распространен­ пневмоторакс.
ный дрожжевой гриб. Он занимает второе место В структуре микотических осложнений на
(после Candida albicans) среди возбудителей долю кандидоза приходится 80–90  % случаев.
грибковых инфекций у ВИЧ-инфицированных, Считается, что кандидоз ротовой полости
наблюдается у 5–10  % из них и проявляет- и пищевода является одним из «визитных
ся менингитом. Для криптококкового менин- карточек» СПИДа. (Т.Л. Лапина, В.Т. Ивашкин,
гита характерны: головная боль, лихорадка, 2001). В зависимости от стадии заболевания

36
ОБМЕН ОПЫТОМ

кандидоз ротовой полости регистрируются у поражении пищевода характерны пленчатые


больных в стадии ВИЧ в 21–32,7  % случаях, в налеты, что приводит к сужению и даже полной
стадии СПИД — в 74–84,6  % случаев [6, 7]. По- закупорке просвета пищевода. У больных воз­
смертно диссеминированный кандидоз вы- никают анорексия, рвота. Появление кандидоза
является у 90  % больных СПИДом. У ВИЧ- является неблагоприятным клиническим симп­
серопозитивных людей частота носительства томом ВИЧ-инфекции. Некоторые компоненты
грибов рода Candida на слизистой оболочке по- гриба (гликопротеин клеточной стенки) обладают
лости рта достигает 77,8  %, причем почти у по- иммуносупрессивной активностью, вследствие
ловины носителей (49,1  % случаев) выявляются чего кандидоз усугубляет иммунодефицитное сос­
мицелиальные формы гриба без каких-либо кли- тояние больных.
нических проявлений кандидоза. Полагают также, что кандидоз слизистой
Выделяют четыре формы поражения рта и оболочки полости рта является промежуточной
глотки: молочницу (псевдомембранозный канд­и ­ стадией между СПИД-связанным комплексом
доз), гиперпластический кандидоз (канди­д озная и периодом вторичных осложнений основного
лейкоплакия), атрофический канди­д оз и заеду заболевания (пневмоцистной пневмонии, крипто­
(кандидозный хейлит). Кандидоз пищевода, коккоза, токсоплазмоза, вирусных и опухолевых
трахеи, бронхов и легких разви­в ается при заболеваний).
выраженом иммунодефиците. Отрубевидный лишай клинически прояв­
Стойкий кандидоз слизистой оболочки полости ляется в виде небольших с четкими границами
рта и кожи перианальной области является ранним пятен или слегка приподнятых над поверхностью
симптомом ВИЧ-инфекции и при отсутствии других кожи папул. Пятна могут быть от желтовато-
предрасполагающих факторов (терапия глюко­ розового до коричневого цвета разных оттенков,
кортикостероидами и цитостатиками, эндокри­ часто сливаются, образуя крупные очаги с
нопатии) относится к типичным маркерам СПИДа. фестончатыми краями. На поверхности очагов
Чаще всего у больных СПИДом отмечаются можно заметить легкое «отрубевидное»
кандидоз слизистой оболочки полости рта и шелушение. Также можно наблюдать депиг­
кандидозный эзофагит, реже наблюдаются ментированные пятна (псевдолейкодерма). Ти­
кандидоз на интертригоперианальной складке, пич­ная локализация высыпаний — богатые
онихии и паронихии, вульвовагинит и баланит. сальными железами участки кожи (грудь, спина,
В целом клиническая картина всех этих плечи, шея). Реже в патологический процесс
поражений соответствует типичным тяжелым вовлекаются подмышечные, паховые области,
прояв­лениям поверхностного кандидоза кожи и предплечья, голени и живот. Изменения на коже,
слизистых оболочек, наблюдаемым у больных с как правило, не сопровождаются какими-либо
выраженными иммунодефицитными состояниями субъективными ощущениями. Для заболевания
(со злокачественными лимфомами, у получающих характерно длительное, рецидивирующее тече­
массивную терапию глюкокортикостероидными ние [8, 9]. Отрубевидный лишай может возни­
гормонами или цитостатиками и т.  п.). Однако кать в любом периоде ВИЧ-инфекции. Харак­
выделяют ряд особенностей кандидоза у больных терны диссеминированные поражения кожи
СПИДом: поражение лиц молодого возраста, с тенденцией к развитию в области пятен
особенно мужчин; преимущественное вовле­ инфильтрации и лихенизации кожи.
чение в процесс слизистых оболочек полости Микозы, вызываемые дерматофитами.
рта, гениталий и перигенитальной области; тен­ У ВИЧ-инфицированных микозы кожи и ногтей
денция к образованию обширных очагов, сопро­ регистрируют в возрасте от 21 до 40 лет [13, 16, 18].
вождающихся болезненностью, склонностью к Распространенные грибковые заболевания
эрозированию и изъязвлению. этой этиологии сравнительно часто возникают при
Кандидозный эзофагит является второй по инфицировании ВИЧ. Дерматомикозы выявляют
частоте клинической разновидностью кандидоза у 8–29  % ВИЧ-инфицированных больных и не
при СПИДе и также входит в число основных намного чаще, чем у ВИЧ-негативных лиц [10,
СПИД маркерных заболеваний. Клиническими 11, 12]. Заболевание может протекать в виде
признаками кандидозного поражения пищевода типичных для микозов поражений кожи стоп,
являются дисфагия и боли за грудиной, боли кистей, голеней и других участков тела, а также
во время приема пищи, затруднение глотания. атипично.
Кандидозные поражения пищевода, как пра­ Факторы риска возникновения дерматоми­
вило, сочетаются с кандидозом слизистых козов у ВИЧ-инфицированных изучены недос­
оболочек полости рта. Описан бессимптомный таточно. Единичные исследования показали
кандидозный эзофагит без сопутствующего зависимость частоты кожных заболеваний у
кандидоза слизистых оболочек. больных ВИЧ-инфекцией от количества CD4+
При кандидозе ротовой полости, глотки и клеток в крови [14], однако детального анализа
пищевода возбудитель активно размно­жается, влияния уровня CD4+ клеток на частоту развития
но не диссеминирует во внутренние органы. При дерматомикозов не проводилось.
37
Дерматовенерология и эстетическая медицина № 2 / 2016

Атипичные проявления микозов, вызываемых грибы/недерматофитные формы как 73/2/2


дерматофитами, у больных СПИДом обычно соответственно, причем в Канаде дерматофиты
возникают на лице и шее и по клинической картине составляют 95,5  % против 90,9  % в Бразилии,
могут напоминать многоформную экссудативную дрожжевые виды — 3  % против 0  %, а недер­
эритему, себорейный дерматит, фолликулиты. матомицетные плесени — 1,5  % против 9  % [19].
Микоз, обусловленный Т. rubrum, на коже ладоней По данным Arenas R. et al., основными возбуди-
и подошв нередко приобретает признаки ладонно- телями онихомикозов у ВИЧ-инфицированных
подошвенной или гонорейной кератодермии. больных являлись T. rubrum (74  %), Candida spp.
Микоз стоп у ВИЧ-инфицированных пациентов (13  %), T. rubrum + Candida spp. (6  %), Acremonium
на фоне иммуносупрессии протекает по типу spp. (2  %), Trichophyton spp. (2  %), E. floccosum, T.
«мокасин» с вовлечением в патологический tonsurans, T. mentagraphytes (0,8  %). Микоз туло-
процесс тыльной поверхности стопы или в вища был обусловлен T. rubrum (92  %), M. canis
хронической гиперкератотической форме [9, 13]. У (8  %), микоз кис­тей в 50  % случаев — ассоци-
иммунокомпетентных пациентов в микотический ацией T. rubrum и T. mentagraphytes и в 50  % —
процесс, как правило, вовлекаются обе стопы и M.  canis [6, 19].
одна кисть. Цель исследования. Изучение видового со-
Микоз кистей при ВИЧ-инфекции протекает с става грибов, выделенных в соскобах слизистой
двусторонним поражением [6]. полости рта у больных ВИЧ-инфекцией.
Онихомикозы у больных СПИДом возникают Материал, методы и результаты исследо­
изолированно или в сочетании с поражениями ва­ния. Обследованы 82 больных ВИЧ-инфек­
кожи ладоней и подошв. Причиной их чаще всего цией в возрасте от 18 до 36 лет (мужчин — 48,
является Т. rubrum. женщин — 34). В основном больные находи-
Чаще всего поражаются ногтевые пластины лись во II Б и III А стадии (92,1  %) заболевания.
I пальцев стоп [2], но могут вовлекаться ног- Клинически у всех больных зарегистрирован
ти II, III, IV, V пальцев стоп без поражения I офорингиальный кандидоз: слизистая полости
ногтевой пластины. Также наиболее харак- рта была гиперемирована и покрыта белыми
терно тотальное поражение ногтей [10, 13]. бляшками 1–2 мм и более, которые легко
Особенность этих онихомикозов — нередкое соскабливались с помощью тампона или
развитие паронихий. шпателя. У 64,7  % больных наблюдалась картина
Cпектр возбудителей микозов кожи и ногтей у псевдомембранозного кандидоза, при котором
ВИЧ-инфицированных на фоне иммунодефицита удаленные некротические массы содер­жали
может существенно отличаться от возбудителей десквамированный эпителий, а на месте их
дерматомикозов у иммунокомпетентных пациен- образовывались кровоточащие поверхности.
тов [3, 11]. Исследование этиологии дермато- Наряду с этим отмечались трещины в углах рта
микозов у ВИЧ-инфицированных больных про- (заеды), покрытые характерным белым налетом.
водили на разных территориях (Индия, Европа, Больные также предъявляли жалобы на
Северная и Южная Америка), однако опубли- загрудинные боли при глотании и дисфагию, что
кованные данные разнятся. Основными воз- свидельствовало о кандидозе пищевода. Диагноз
будителями дерматомикозов у больных ВИЧ- кандидоза ставили при выявлении дрожжевых
инфекцией выступают T. rubrum, вместе с тем грибов в нативных препаратах, приготовленных
наряду с дерматомицетами причиной дерма- из соскоба со слизистой полости рта. Соскоб с
томикозов довольно часто являются дрожжи и пораженного участка слизистой помещали на
нитчатые недерматомицеты [14, 15, 16, 18]. Так, предметное стекло и обрабатывали раствором
Surjushe A. et al. отметили, что возбудителями гидроксида калия. При микроскопии препарата
поверхностных микозов у ВИЧ-инфицированных выявлялись почкующиеся дрожжевые грибы.
пациентов выступают: около 40  % дерматофи- Для дифференциации видов Candida при­
ты (Trichophyton rubrum — 84,6  %, Trichophyton менялась тест-система HiCrome фирмы Himedia,
mentagrophytes — 15,4  %) и 59,4  % — не дер- которая способна быстро дифференцировать
матомицеты (Candida spp., Aspergillus niger, колонии грибов за счет содержания в ней
Cladosporium spp., Scytalidium hyalinum, Penicillium специального пептона, дрожжевого экстракта,
spp. и Gymnoascus dankaliensis) [17]. Украин- хлорамфеникола. Анализ видового состава
ские исследователи выявили, что у 67,6  % боль- кандидозного поражения слизистой полости рта
ных возбудителем дерматомикозов являлся показал высокую частоту высева С. Krusei (36,2  %)
T.  rubrum, у 8,8  % — T. mentagrophytes, у 5,9  % — и C. glabrata (28,4  %). C. albicans высеяна лишь
E.  floccosum. У 87,3  % пациентов с поражением в 16,8  % случаях. У 15 ВИЧ-инфицированных с
кожи и слизистых обнаружены Candida spp. [16]. клиническими проявлениями слизистой полости
Исследования, проведенные в клиниках рта результаты микологического исследования
Канады и Бразилии, показали следующее со­ были отрицательными (18,6  %).
отношение этиологических факторов микозов Таким образом, вышеуказанные клинические
стоп и онихомикозов: дерматофиты/дрожжевые проявления грибковых инфекций у больных
38
ОБМЕН ОПЫТОМ

ВИЧ-инфекцией имеют существенные различия интерес, в частности, определение видового


распространенности и характер течения в состава возбудителей грибковых заболеваний
зависимости от биологически популяционных, с усилением их чувствительности к различным
климато-географических особенностей. микотическим препаратам, что безусловно
В связи с этим изучение микозов при ВИЧ-ин­ тормозит смертность от генерализованных ми­
фекции в рамках узбекской популяции является козов.
актуальной проблемой и представляет огромный

Литература

1. Абидова З.М., Азимова Ф.В. Микозы в с­ком крае // Проблемы медицинской


структуре оппортунистических заболеваний микологии. 2013. №  2. С.  115.
при ВИЧ/СПИД // Дерматовенерология и 11. Тертышникова В.В. Клинико-эпидемиологи-
эстетическая медицина. №  1–2/ 2010. ческая характеристика некоторых микозов
2. Абидова З.М., Азимова Ф.В. Определение у ВИЧ-инфицированных женщин, находя-
видового состава возбудителей орофа- щихся в условиях пенитенциарной системы
ренгиального кандидоза у больных ВИЧ- //  Фундаментальные исследования. 2009.
инфекцией // Дерматовенерология и эстети- №  5. C.  113–117.
ческая медицина. №  1–2/ 2011. 12. Чемич, Н.Д., Поддубная А.И. Грибковые по-
3. Баринова А.Н., Плавнинский С.П.. Зайцева ражения у ВИЧ-позитивных лиц в Северо-
Е.Е. Микозы у ВИЧ-инфицированных больных Восточном регионе Украины. Материалы на-
// Проблемы медицинской микологии. 2012. учно-практической конференции с междуна-
№  14 (2). C.  34–38. родным участием (XIV Кашкинские чтения).
4. Горячкина М.В. и др. Сертоконазол в местном // Проблемы медицинской микологии. 2011.
лечении поверхностных микозов кожи // Кли­ Т.  13. №  2. С.  102.
ническая дерматология и венерология. 2012. 13. Чернова, Т.А. и др. ВИЧ/СПИД в сочетании с
№  5. С.  46–51. инфекциями, передаваемыми половым пу-
5. Котрехова Л.П. и др. Особенности течения тем, и некоторыми дерматозами // Здравоох-
микозов кожи на современном этапе и их ранение Чувашии. 2009. №  1. C.  53–58.
рациональная терапия // Consilium medicum. 14. Цинзерлинг В.А., Аравийский Р.А., Василье-
2014. №  1. C.  3 –6. ва М.В. и др. Наблюдение аспергиллезного
6. Кравченко А.В. и др. Дерматомикозы на фоне сепсиса при ВИЧ-инфекции в стадии СПИД
ВИЧ // Вестник дерматологии и венерологии. // Проблемы медицинской микологии. 2008.
2003. №  2. С.  17–20. Т.  10. №  4. С.  6 –8.
7. Макарова Н.Ю., Покровский В.В. и др. 15. Arenas R. et all. Onychomycosis // Eur J
Оценка колонизации условно-патогенными Dermatol. 2010. Vol.  20. №  5. P.  611–614.
бактериями и грибами рук медицинского 16. Blanes M. et all. Current Prevalence and
персонала в стационаре для больных ВИЧ- Characteristics of Dermatoses Associated
инфекцией // Эпидемиология и инфекцион­ with Human Immunodeficiency Virus Infection
ные болезни. 2003. №  3. C.  22–24. // Actas Dermosifiliogr. 2010. Vol.  10. №  8.
8. Райденко О.В. и др. Распространенность P.  702–709.
микозов кожи и ее придатков у ВИЧ-инфи­ 17. Cambuim I.I. et all. Clinical and mycological
цированных пациентов // Проблемы меди­ evaluation of onychomycosis among Brazilian
цинской микологии. 2010. Т.  12. №  2. С.  129– HIV/AIDS patients // Revista Da Sociedade
130. Brasileira De Medicina Tropical. 2011. Vol.  44.
9. Райденко О.В. Клинические особенности по- №  1. P.  40–42.
верхностных микозов у ВИЧ-инфицированных 18. Rupp J. et all. Diagnostics for fungal infections
пациентов в зависимости от этиологического of the lungs // Pneumologie. 2010. Vol.  64. №  5.
фактора. Материалы XV Юбилейной всерос- P.  300–310.
сийской медико-биологической конференции 19. Schaeffer L. et all. Mucocutaneous mycoses in
молодых исследователей «Фундаментальная acquired immune deficiency syndrome (AIDS)
наука и клиническая медицина — человек и patients hospitalized in a tertiary healthcare
его здоровье». 2012. С.  245–246. centre in the state of Amazonas Brazil
10. Райденко О.В., Иванова Ю.А. Дерматомикозы //  Scientific Research and Essays. 2012. Vol.  7.
у ВИЧ-инфицированных пациентов в Алтай­- (42). P.  3621–3624.

39
Дерматовенерология и эстетическая медицина № 2 / 2016

УДК:616.5-007.61-092-085

Актуальные вопросы розацеа

А.Б. Рахматов, И.Б. Нурматова

Республиканский специализированный научно-практический медицинский центр


дерматологии и венерологии МЗ РУз

Хулоса
Розацеада актуал саволлар маколасига
А.Б. Рахматов, И.Б. Нурматова
Қўшимча йўлдош хасталиклар ҳолатини инобатга олган ҳолда қуйидаги келтириб ўтилган
дерматокосметологик муаммонинг этиопатогенези, клиникаси ва даво муолажалари саволлари
ўрганиб чиқилмоқда.
Калит сўзлар: розацеа, патогенези, даволаш, йўлдош хасталиклар.

Su mmary
A ct ual aspects of rosacea
A.B. Rakhmatov, I.B. Nurmatova
There are described some aspects of the etiopathogenesis, clinical picture and treatment of this
dermatocosmetologic problem taking into account the possible premorbid states.
Keywords: rosacea, pathogenesis, treatment, premorbid states.

Резюме
Актуальные вопросы розацеа
А.Б. Рахматов, И.Б. Нурматова
В статье рассматриваются вопросы этиопатогенеза, клиники и лечения такой дерматокос­
метологической проблемы, как розацеа, с учетом возможных преморбидных состояний.
Ключевые слова: розацеа, патогенез, лечение, преморбидные состояния.

Р озацеа (акне розовые, розовые угри) —


распространенное поражение кожи с
частотой встречаемости в разных странах от 5
Следует указать, что женщины болеют нес­
колько чаще, чем мужчины, причем у послед­них
заболевание протекает более тяжело, выражена
до 15  % [1, 4, 6, 7]. Розацеа с исключительным склонность к гиперплазии сальных желез и
поражением кожи лица, развивающееся в соединительной ткани с формированием фимы
основном в возрасте наибольшей социальной различной локализации (ринофима и др.). Пре-
активности, на фоне разнообразной, ассо­ имущественно поражаются лица старше 30 лет,
циированной с возрастом соматической пато­ чаще со светлой кожей [1, 2, 3].
логии, с многочисленными триггерными факто­ Следует отметить, что этиология данного
рами и хроническим рецидивирующим течением дерматоза до настоящего времени остается
представляет как медико-социальную, так и неуточненной. В развитии розацеа выделяют
эстетическую проблему, требующую длительных два ведущих звена патогенеза, на которые на­
и повторяемых терапевтических воздействий, правлена терапевтическая коррекция [1, 4]:
косметологической реабилитации, преемствен- во-первых, наличие вазомоторных реак-
ности тактики ведения как врачами различных ций и вазодилятация мелких сосудов (кожно-
специальностей (дерматологи, врачи общей сосудистый синдром); во-вторых, формирование
практики, гинекологи-эндокринологи и др.), так воспалительных изменений в сально-волосяных
и специалистов эстетической медицины, в том фолликулах и перифолликулярно.
числе косметологов [7]. В развитии розацеа большое значение имеют
Розацеа (МКБ-10: L-71) является хрониче- сосудистые изменения, которые обусловливают
ским рецидивирующим заболеванием кожи развитие основных клинических проявле­ний
лица с прогредиентным стадийным течением и заболевания, а именно, эритемы и телеангиэк­
характеризуется эритемой, телеангиэктазиями, тазии. Считается, что расширение кровеносных
эпизодами воспалительных папул и пустул, раз- и лимфатических сосудов обусловлено нейроэн­
витием в тяжелых случаях гиперплазии сальных докринными влияниями, а не первичным их
желез и соединительной ткани [6]. поражением [1]. Это может быть обусловлено

40
ОБМЕН ОПЫТОМ

пищевыми факторами, раздражающими рецепторы время как венулы и посткапиллярные сфинктеры


желудка, особенно на фоне хронического гастрита, остаются интактными или дилатируются. Это
ассоциированного с хеликобактерной инфекцией, приводит к нарушению проницаемости микро-
изменениями метаболизма половых гормонов на циркуляторного русла, вызывает и поддерживает
фоне патологии матки и/или яичников, нарушением эритему и отек [1, 4].
функции щитовидной железы, вегетативной иннер­ В развитии розацеа важное значение зани­
вации сосудов с преобладанием тонуса симпа­ мают воспалительные изменения в сально-воло­
тической нервной системы и последующим спаз­ сяных фолликулах, клинически проявляющиеся
мом артериол и понижением тонуса вен. образованием папул и пустул. Можно выделить
Розацеа рассматривается как ангионевроз несколько клинически значимых фактов, лежа­
с преимущественным поражением сосудов щих в основе патогенеза розацеа. Во-первых,
лица (один из вариантов вегетососудистой у больных розацеа в секрете сальных желез
дистонии с преобладанием признаков венозной повышено содержание порфиринов, что приво-
недостаточности). Замедление кровотока и дит при инсоляции к фотодинамическому пора-
венозный в области оттока Venae facialis sive an- жению структур кожи, и уже на ранней стадии
gularis, свойственные розацеа, объясняют харак- дерматоза возможно развитие актиническо-
терное для заболевания поражение централь- го эластоза. Это объясняет связь обострений
ной части лица. В свою очередь, локализация розацеа с УФО и определяет необходимость
высыпаний над неактивной мускулатурой лица обязательной фотозащиты кожи (SPF не ниже
приводит к тому, что формирующийся отек 15), ограничений инсоляции, в том числе в
ткани не дренируется сокращением мышц (это соляриях [6, 7]. Во-вторых, определенную роль
обосновывает целесообразность применения в инициативе воспаления сально-волосяного
лимфодренажного массажа в этапном лечении фолликула при розацеа отводят активации De-
больных). В область оттока лицевой вены modex folliculorum (демодексу, клещу-железни-
включается также конъюнктива, что объясняет це), являющемуся облигатным представителем
частое вовлечение в патологический процесс флоры сально-волосяного фолликула, который
верхних и нижних век (офтальморозацеа). Дли- отсутствует у детей, появляется в пубертатном
тельный отек в сочетании с венозным застоем периоде и увеличивается с возрастом [3].
и тканевой гипоксией приводит к гиперплазии Следует отметить, что демодекс относится
соединительной ткани и сальных желез в этих к классу паукообразных клещей, описано
топографических регионах, что обусловливает около 65 их видов, обитающих в том числе на
формирование фиматозных изменений кожи: некоторых млекопитающих (овцы, лисы, крупный
ринофимы (шишковидный нос), гнатофимы рогатый скот). У человека выделен только De-
(подбородок), метафимы (лоб), отофимы (ушные modex folliculorum, но в двух подвидах: Demo-
раковины), блефарофимы (веки). dex folliculorum longus (заселяет в основном
Формированию сосудистых изменений при фолликулы в области носа, лба, периорально,
розацеа, длительной эритемы на фоне харак- наружного слухового прохода) и Demodex fol-
терных приливов способствуют нарушения liculorum brevis (обитает в мейбомиевых
метаболизма половых гормонов (эстрогенов/ железах, вызывая офтальморозацеа). Плотность
андрогенов), особенно у женщин перименопау­ заселения клеща и его активация зависят от
заль­ного возраста. Патологический климакс с топографического региона, возраста, состава
частыми приливами усиливает проявления эри­ кожного сала, биохимических особенностей и рН
темы при розацеа. Это обосновывает целесо­ гидролипидной мантии кожи. Именно изменения
образность гормональной коррекции у женщин с биохимических свойств и рН поверхностного
патологическим климаксом или другими ассоции- слоя кожи, развивающиеся из-за патологии
рованными с возрастом гормональными наруше- системы пищеварения или вследствие нару­
ниями. шения метаболизма половых гормонов, являют­
Персистенции эритемы при розацеа спо­ ся одним из важных факторов увеличения
собствуют вазоактивные пептиды и медиаторы плотности заселения клеща и повышения его
воспаления (эндорфины, брадикинин, субстан- активности. Это, с одной стороны, диктует
ция Р и др.). Считают, что повышенная чув- необ­ходимость обследования пациента, с дру­
ствительность брадикининовых рецепторов гой, может быть причиной отсутствия тера­
в области лица объясняет типичную для певтического эффекта или его нестойкого ре­
розацеа локализацию эритемы в центральной зуль­тата [3].
его части [1, 2, 4]. Именно с этим связаны со- Жизненный цикл клеща-железницы состоит
судистые приливы у больных розацеа после из 4–5 фаз общей продолжительностью 25 дней
стресса, употребления горячей или острой (самка откладывает яйца, в последующем об-
пищи. Показано, что брадикинины способствуют разуются личинка, нимфа I стадии, нимфа
стойкому расширению мелких артериальных II   стадии и взрослые половозрелые особи) [3].
сосудов и прекапиллярных сфинктеров, в то В фолликуле головная часть клеща с жеватель-
41
Дерматовенерология и эстетическая медицина № 2 / 2016

ной поверхностью находится в верхней трети ста­дии: прерозацеа (периодические приливы


выводного протока сальной железы, а хвосто- или преходящая эритема); сосудистая розацеа
вая — в устье фолликула. Патогенные свойства (эритема и телеангиэктазии); воспалительная
клеща-железницы заключаются в механическом розацеа (папулы и пустулы на фоне
разрушении эпителиальных клеток фолликула с персистирующей эритемы и телеангиэктазий);
последующим развитием воспалительного пери- поздняя розацеа (ринофима и/или другие
­фолликулярного лимфо-гистиоцитарного инфильт- фиматозные изменения кожи).
рата. Клинически это проявляется воспалитель­ —  наиболее востребованная современная клас­-
ными фолликулярными папулами с последую­ сификация G.  Plewig, Th.  Jansen, A.M.  Kligman,
щим возможным развитием пустул. При по­ выделяющая три стадии дерматоза: эри­те­
па­дании клеща или его фрагментов в поверх- матозно-телеангиэктатическую (стойкая, умерен-
­ностные слои дермы может развиваться гра­- ­ная эритема, немночисленные телеан­гиэкта­зии);
нулематозное воспаление (гранулематозное ро­- папуло-пустулезную (персис­тирую­щая эри­тема,
зацеа). Необходимо подчеркнуть, что клещи рас- телеангиэктазии, папулы, пустулы); папу­лезно-
сматриваются проводниками различной инфек­- узловатую (персистирующая эритема, телеан­
ции, вследствие чего образуются пустулы, гиэктазии, папулы, пустулы, отечные узлы).
хотя содержимое этих пустул в большин- Помимо этого, выделяют особые формы ро­
стве случаев бывает стерильным [1, 3, 4]. До- зацеа: стероидную, гранулематозную, конгло­бат­
казано, что продукты жизнедеятельности ус- ную, фульминантную, грамнегативную офта­ль­мо-
ловно-патогенной микрофлоры кожи способ- розацею, розацею с выраженным персис­
ствуют выработке медиаторов воспаления и тирующим плотным отеком за счет хронического
фор­мированию Т-клеточной воспалительной ин­ воспаления с фиброзом и лимфостазом (болезнь
фильтрации кожи, клинически проявляющейся Морбигана).
воспалительными папулами, пустулами и узлами Дебютом розацеа могут быть эритема в виде
[3]. приливов, продолжительность которых варьирует
Учитывая патогенетическую значимость кле­ от нескольких минут до нескольких часов, реже
ща-железницы в развитии воспалительной сыпи дней (стойкая эритема), или небольшие четко
при розацеа оправдано назначение про­тивовоспа­ ограниченные воспалительные папулы, в центре
лительных препаратов антибакте­риальной и ан­ти­ которых из них образуются микропустулы. По-
протозойной активности (напри­мер, группы нитро­ явление эритемы зависит от изменения тем-
имидазола) [3, 5]. пературы, употребления горячей пищи, алко-
В развитии дерматоза определенное зна­ голя, экстрактивной пищи. Телеангиэктазии
чение придают фоновой соматической пато­логии, обычно небольших размеров локализуются
особенно заболеваниям органов пищеварения преимущественно в центральной части лица.
(хеликобактерассоциированному гаст­ри­ту, язвен­ Отек преимущественно является вторичным
ной болезни желудка и/или две­надца­типерст­ной и сопровождает воспалительные изменения
кишки, нарушению микро­биоценоза кишечника), (воспалительные папулы и пустулы) или может
эндокринопатиям. быть изолированным проявлением розацеа
Клинические проявления розацеа доста­ (болезнь Морбигана). Отек охватывает область
точно характерны и сопровождаются пораже­ лба, центральную часть лица, периорбитальную
нием центральной части лица в виде стойкой область, но может распространяться на все
или преходящей эритемы с телеангиэктазиями лицо, в том числе подбородок, щеки, ушные
на поверхности, эпизодами воспалительных раковины. Длительный отек может приводить к
папул и пустул, иногда узлов, при длительном фиматозному утолщению кожи с формированием
течении — с формированием фиматозных тканевой гиперплазии в области носа и щек
изме­н ений кожи (ринофимы, гнатофимы, ме­ (ринофима), подбородка (гнатофима), лба
та­ф имы, отофимы). Субъективные ощуще- (метафима), ушных раковин (отофима).
ния умеренно выражены и проявляются жже­ Ринофима является наиболее гротескным
нием, зудом, может быть повышенная фото­ осложнением розацеа, сопровождается резкой
чувствительность. гиперплазией сальных желез с формировани-
С учетом клинических признаков и ем шишковидного носа, несколько чаще встре-
стадийности течения дерматоза в практической чается у мужчин. Указывают, что ринофима
дерматологии были предложены следующие может развиться без предшествующих эпизодов
классификации розацеа [1, 2, 4, 6]. воспалительных папул и пустул, при этом даже
—  клинико-морфологическая классификация частые эпизоды воспалительных изменений
Е.И.  Рыжковой (1975), выделяющая эритематоз­ не всегда заканчиваются формированием
ную, эритематозно-папулезную, папуло-пусту­ ринофимы.
лезную и инфильтративно-продуктивную стадии. Критериями диагностики розацеа являются:
—  клиническая классификация J.  Wilkin, 1) анализ анамнеза: рецидивирующий ха­рактер
пред­полагающая четыре последовательные течения заболевания, возраст дебюта, связь
42
ОБМЕН ОПЫТОМ

дебюта и/или обострений с гормональной или 2) исключение горячей пищи. При ее приеме
эндокринной дисфункцией, характером пищи. включаются терморегуляционные механизмы в
2) характерные клинические проявления: полости рта, которые могут привести к распро-
поражение центральной части лица, полимор­ страненной вазодилятации сосудов лица и по-
физм сыпи с персистирующей эритемой и следующей эритеме;
телеангиэктазиями, эпизодами воспалительных 3) рациональное питание. Дробный прием
папул и пустул. пищи малыми порциями (возможно появление
3) лабораторные исследования: общекли­ эритемы лица после обильного приема пищи).
нические, микроскопические (выделение клеща- Исключить томаты, плотные сорта сыра, пиво,
железницы), биопсия и гистологическое обсле- дрожжи, шипучие напитки;
дование показаны только при особых формах 4) УФО (инсоляция, в том числе солярии)
розацеа (гранулематозной, болезни Морбигана) может способствовать появлению или пер­
или для дифференциальной диагностики с дру- систенции эритемы лица, увеличению коли­
гими дерматозами (туберкулид, красная волчан- чества телеангиэктазий, дистрофии колла-
ка, саркоидоз кожи и др.). гена кожи. Фотовоздействие целесообразно
Дифференциальную диагностику прово­ ограничить, проводить с учетом фототипа кожи,
дят с вульгарными угрями, себорейным и пери­ при этом защита должна быть и зимой, и летом,
оральным дерматитом, красной волчанкой, дер­ солнцезащитный фактор — не менее 15;
матомиозитом, саркоидозом, телеангиэктатичес­ 5) вазодилататорные средства. При лечении
кой формой мастоцитоза, розацеаподобным сопутствующей соматической патологии необ­
туберкулидом Левандовского, болезнью Прингла- ходимо избегать приема препаратов, содер­
Бурневиля. жащих никотиновую кислоту или ее дериваты,
Общеклиническое обследование назнача- нитриты, нифедипин;
ют с целью выявления фоновой соматичес­ 6) особенности косметического ухода. У
кой патологии: развернутый общий анализ больных розацеа обычно кожа становится
крови, билирубин, трансаминазы, глюкоза, об- чувствительной, поэтому для ежедневного
щий анализ мочи, исключение хеликобакте­р ­ ухода необходимо использовать косметическую
ассоциированного гастрита, выявление демо­ продукцию с маркировкой для чувствительной
декса с очагов поражения, УЗИ органов малого кожи. Исключают косметические средства,
таза для исключения патологии матки и яични- содержащие спирт, вяжущие тоники, щелочные
ков, УЗИ щитовидной железы с последующей мыла, осторожно используют эксфолиирующие
консультацией эндокринолога. Учитывая много- средства. Избегают применения косметических
факторность обострений, обследование целе- средств с ментолом, маслом эвкалипта. Умыва-
сообразно проводить каждый раз при рецидиве ются теплой или контрастной водой, исключают
дерматоза. тепловые процедуры, в том числе распаривания
Выбор тактики лечения больных розацеа при программах косметологического ухода. Кожу
зависит от клинической стадии и формы дерма­ очищают специальными мягкими гелями (можно
тоза, морфологии сыпи, длительности заболе­ с серой или сульфацетамидами). Показан еже-
вания, тяжести течения и предшествующей вечерний ротационный массаж носа, щек, под-
терапии, переносимости препаратов, сопутствую­ бородка, а также лимфодренажный массаж.
щей патологии, возраста, пола, психоэмоцио­ Декоративная косметика — специальная, с
нального состояния пациента [1, 3, 5]. При всех зеленым покрытием для маскировки эритемы и
клинических вариантах розацеа обязательны телеангиэктазий.
программы образования пациента и модификация Наружная терапия зависит от стадии и кли-
образа жизни, в том числе ухода за кожей. нической формы дерматоза. При начальной
Учитывая рецидивирующий характер дерма- эритематозной/эритематозно-телеангиэктати­
тоза и разнообразие провоцирующих факторов, ческой стадии для наружной терапии назначают
необходимо информировать пациента об инди- топические противовоспалительные средства:
видуальных факторах риска обострений, форми- холодные примочки с 1–2  % раствором резор­
ровать мотивацию и осознанный выбор к измене- цина, борной кислоты, настоями трав (ромашка,
нию режима питания и ухода за кожей, соблюде- зверобой, шалфей и др.), вариант выбора —
нию рекомендаций врача: термальная вода в виде аэрозоля. Показаны
1) исключение алкоголя. Вазодилататорное противовоспалительные нестероидные кремы
действие алкоголя на сосуды лица приводит с декспантенолом («Пантестин») или средства
к развитию эритемы с последующими воспа­ дерматокосметологии («Cu-Zn+крем» и др.). Учи-
лительными изменениями, особое внимание тывая особенности поражаемого топического
необходимо обратить на красное вино, которое региона и частоту встречаемости клеща-же­
обладает гистаминолиберирующим действием и лезницы, а также его роль в инициации воспа­
противопоказано пациентам с розацеа даже при лительных изменений в коже, даже на этой
длительной ремиссии; ста­дии показано применение топических про-
43
Дерматовенерология и эстетическая медицина № 2 / 2016

тивовоспалительных лекарственных средств 10–20  % эмульсия или крем; серы: 5–10–30  %


с антибактериальным и антипротозойным эф- мазь, 2  % ихтиол-резорциновая паста и др.
фектом. Например, доказано, что метронидазол Успешно применяемые для лечения чесоточно-
обладает бактериостатическим действием на го клеща, они далеко не всегда обеспечивают
широкий спектр микробной флоры кожи, в том элиминацию клеща-железницы. Возможно, это
числе анаэробной, а также антипаразитарным связано с тем, что погибают только поверхностно
действием относительно Demodex folliculorum расположенные особи, а клещи, находящиеся
spp. Показано, что метронидазол в синергизме глубоко в сально-волосяном фолликуле, ока­
с ненасыщенными жирными кислотами кожи зываются недоступными для действия топи­
подавляет образование медиаторов воспаления ческого акарицидного средства. К тому же
и функциональную активность нейтрофилов — применение акарицидных средств более 7 дней
клеток воспалительного инфильтрата дермы, может привести к синдрому раздраженной или
оказывая противовоспалительное действие [3]. чувствительной кожи.
Наряду с адекватным выбором активно- Топические стероиды, особенно фториро­
го вещества при топической терапии очень ванные кортикостероидные препараты, боль-
важен правильный выбор его лекарствен- ным розацеа противопоказаны, так как усили­
ной формы [1, 4]. Для лечения дерматозов вают проявления телеангиэктазий, эрите-
кожи лица предпочтительны кремы, эмуль- мы, могут привести к развитию стероидной и
сии или лосьоны, не нарушающие процессов фульминантной розацеа, периорального дер­
перспирации кожи. Так, препаратом выбора матита.
лекарственной формы метронидазола может К альтернативным режимам лечения относят
быть «Акнил». При папуло-пустулезной ста- препараты азелаиновой кислоты в виде 15  %
дии розацеа к наружному лечению подключают геля или 20  % крема «Скинорен», который
топические противовоспалительные средства назначают 1–2 раза в сутки в течение 2–4
антибактериального и антипаразитарного дейст­ месяцев. Азелаиновая кислота нормализует
вия, топические ретиноиды, фиксированные процессы кератинизации в протоках сальных
комбинации. Вариантом стартовой терапии мо- желез, уменьшает содержание свободных
жет быть фиксированная комбинация — крем жирных кислот в липидах кожи. Режим при­
«Пимафукорт», содержащий негалогенезирован­ менения — тандем-терапия: «Скинорен» наносят
ный топический стероид гидрокортизон, анти­ на чистую сухую кожу 2 раза в сутки 2–3 дня, че-
микробные состав­ляющие натамицин и нео­ редуя с применением в последующие 4–5 дней
мицин. Препарат назначают 1–2 раза в сутки топических антибиотиков или антипаразитарных
в течение 1–2 недель, затем переходят к дру- средств.
гим противомикробным и антипаразитарным Помня о риске формирования повышен-
средствам. Другим вариантом терапии является ной чувствительности кожи у пациентов с
использование препарата «Санакут». С целью розацеа и возможности индивидуального
антибактериального воз­действия используют реаги­рования на традиционные топические
местные формы клин­дамицина или крем с средства, необходимо проводить еженедельный
фузидиновой кислотой 1–2 раза в сутки 1–2 не- мониторинг переносимости и эффективности
дели с последующим переходом к противовос- лечения, особенно многонедельного. Учитывая
палительным негормональным топическим пре- международные рекомендации по лечению
паратам. розацеа, производные метронидазола, анти-
Вариантом выбора топической патогенетиче- биотики и ретиноиды остаются «золотым стан­
ской терапии может быть фиксированная комби- дартом» в терапии данного дерматоза [2, 6].
нация в виде геля «Изотрексин», содержащего Для проведения общей терапии при розацеа
топический ретиноид (изотретиноин) и эритроми­ используют антибиотики, метронидазол, изотре­
цин. Препарат назначают 1 раз в сутки вечером тиноин, а также адъювантную или терапию
в течение 8–12 недель. Топические препараты сопровождения (седативную, гепатопротекторы,
изотретиноина способствуют удли­нению сроков ферменты, пре- и пробиотики). Антибакте­
ремиссии при розацеа, однако могут вызы- риальная терапия показана при папуло-пус­
вать сухость кожи и последующее раздраже- тулезной форме розацеа. Предпочтение от-
ние. При выраженной чувствительности кожи дают антибиотикам тетрациклинового ряда  —
через 4 недели применения можно перейти на доксициклину моногидрату. Обоснованием
интермиттирующий режим (через день, чередуя выбора этой группы антибиотиков является
с увлажняющими про­тивовоспалительными их соответствие следующим требованиям:
средствами, или 2 раза в неделю). широкий спектр противомикробного действия,
До настоящего времени обсуждается эффек­ охватывающий всех представителей флоры
тивность и целесообразность применения при сально-волосяных фолликулов; тропность к
розацеа классических акарицидных средств сально-волосяному фолликулу; высокая био­
(«Спрегаль»), препараты бензилбензоата — дос­тупность и возможность длительного прие­ма
44
ОБМЕН ОПЫТОМ

(до 12 недель). Для уменьшения риска развития Гормональная терапия: заместительная


побочных эффектов и раздражающего действия гормональная терапия (по показаниям женщинам
на слизистую оболочку желудка была предложена с патологическим климаксом или другой
растворимая форма доксициклина моногидрата  — гинекологической эндокринной патологией);
«Юнидокс солютаб». Препарат назначают по 100 спиронолактон (антагонист альдостерона с
мг 2 раза в сутки в течение 10–14 дней, затем антиандрогенным эффектом) может применяться
поддерживающую дозу 100 мг/сут. до 12 недель [5]. как у женщин, так и у мужчин. Расчет дозы —
Антипаразитарная терапия показана при 0,5–1–2  мг/кг массы тела в сутки в течение 2–6
папуло-пустулезной форме дерматоза, ослож- месяцев.
ненной демодекозом. Назначают препараты Преднизолон применяется при молниеносной
группы нитроимидазола (метронидазол, орнида­ форме розацеа в сочетании с антибиотиками или
зол) ввиду их бактериостатического действия в комбинации с изотретиноином. Расчет дозы  —
в отношении грамнегативных анаэробных 0,5–1  мг/кг массы тела в сутки в течение 5–7
бактерий, антипаразитарного — в отношении De- дней с последующим ступенчатым снижением до
modex folliculorum, а также способности влиять на полной отмены препарата.
клеточно-опосредованный иммунитет, вегетатив- Плаквинил показан при выраженной фо­
ную нервную систему, стимулируя адренергиче- точувствительности, назначают по 200  мг 1–2
ские структуры, что уменьшает застойные явле- раза/сут. 5-дневными курсами с 2–3-дневным пе-
ния, эритему и телеангиэктазии [3]. рерывом 30–60 дней.
Метронидазол назначают по 0,5  г 2–3 ра­за/сут. в Терапия сопровождения (адъювантная) вклю­
течение 10–14 дней. При глубоких воспалительных чает гипосенсибилизирующие и антигиста­минные
элементах возможно ступен­чатое назначение средства, седацию, коррекцию нарушений функ-
препарата: первые 3–5 дней — парентерально ционирования различных внутренних органов
(«Метрогил» по 100  мг внутривенно 3 раза/сут.), за- и систем (энтеросорбенты, гепатопротекторы,
тем перорально. Учитывая длительность приема, ферментные и энзимные препараты, пре- и про­
возможны по­боч­ные эффекты: тошнота, рвота, биотики).
головная боль, крапивница. Дополнительные методы лечения заклю-
Орнидазол назначают по 500  мг 2 раза/сут. чаются в возможности использования элек-
в течение 10–14 дней. При выраженных воспа­ тро- и фотокоагуляции, лазерного воздействия,
лительных изменениях возможен ступен­чатый особенно при телеангиэктазиях, криотерапии
путь применения препарата: утром по 500  мг (противовоспалительный и сосудосуживающий
внутривенно капельно, вечером — 500  мг внутрь эффект).
в течение 3–5 дней, затем только перорально. В На практике врачами могут допускаться сле-
отличие от препаратов метронидазола орнидазол дующие ошибки:
лучше переносится, спектр и выраженность —— недооценка анамнеза, наличие сопутствую-
побочных эффектов меньше, что делает щей фоновой патологии и результатов лабо-
возможным проведение курса лечения в полном раторного обследования.
объеме. —— назначение топических кортикостероидов,
Системные ретиноиды (изотретиноин) приме­ особенно при повторяющихся рецидивах дер-
няют для лечения резистентных или тяжелых матоза.
форм розацеа. Расчет дозы — 0,6–0,8  мг/кг —— длительное использование топических анти-
массы тела в сутки в течение 3–6 месяцев. бактериальных и антипаразитарных средств
Кумулятивная курсовая доза составляет до при последующих рецидивах дерматоза.
100  мг/кг массы тела и является достаточной для —— отсутствие преемственности ведения пациен-
достижения стойкой ремиссии и эффективного та при наличии фоновой соматической пато-
подавления функционирования сальных желез логии.
[7]. Через 2–3 недели приема препарата отмеча- Таким образом, розацеа является полиэтио­
ется нарастающая сухость кожи, слизистых обо- логическим заболеванием со множеством со­
лочек, в том числе конъюнктивы, что требует со- пут­ствующих заболеваний, что значительно
ответствующей коррекции наружной терапией. осложняет не только диагностику, но и лечение.
Побочные действия дозозависимы, учитывая те- Наличие определенной стадий­ности позволяет
ратогенный эффект, препарат противопоказан во при своевременном лечении приостанавливать
время беременности и лактации, планируемая бе- дальнейшее развитие пато­ло­ги­ческого процесса
ременность должна быть отсрочена (не ранее ме- и решать данную дермато­косме­тологическую
сяца после окончания приема препарата). проблему.

45
Дерматовенерология и эстетическая медицина № 2 / 2016

Литература

1. Адаскевич В.П. Акне вульгарные и розовые. — 4. Потекаев Н.Н. Розацеа: этиология, клиника,
М.: «Медицинская книга». 2003. 160  с. терапия. — Москва. 2000. 143 с.
2. Дерматовенерология: клинические рекомен­ 5. Проценко Т.В., Проценко О.А. Розацеа.
дации. Под ред. А.А. Кубановой. — М.: «ДЭКС- Учебное пособие. — Донецк. 2009. 15 с.
Пресс». 2010. 428  с. 6. Katsambas A.D., Lotti T.M. European Handbook
3. Коган Б.Г., Степаненко В.И. Розацеа, демодекоз, of Dermatological Treatments: Springer. 1999.
дерматит периоральный — обоснование стан­ 846  p.
дартных подходов к диагностике и рацио­ 7. Textbook of Cosmetic Dermatology. Ed.  by
нальной терапии // Дерматология, косметоло- R.  Baran, H.I. Maibach. — Martin Dunitz. 1998.
гия, сексопатология. 2003. №  1. С. 57–70. 754  p.

УДК:616.61-002-022-06-085.254

Перспективы использования отечественных лекарственных


препаратов «Гозалидон» и «Кобавит» при лечении осложненных форм
урогенитальных инфекций

Д.Ф. Порсохонова, А.М. Абидов, Ю.А. Алимухамедова

Республиканский специализированный научно-практический медицинский центр


дерматологии и венерологии МзРУз

Хулоса
Газолидон ва Кобавит махалий дори воситаларини асоратлаган урогенитал
инфекцияларда қўллаш истиқболлари
Д.Ф. Порсохонова, А.М. Абидов, Ю.А. Алимухамедова
Мақолада ҳозирги пайтда асоратланган урогенитал хламидиоз ва уреамикоплазмоз инфекция-
ларнинг, герпесвируслар билан биргаликда учрашиши кўпайганлиги ва ўз навбатида бу холатлар-
ни даволаш учун янги дори воситаларини қўллаш йўлларини изланишлар ёрдамида кенгайтириш
мақсадга мувофиқлиги таъкидланган. Муалифлар махалий дори воситаларидан гозалидон ва ко-
бавитларни асоратланган урогенитал инфекцияларни даволашда қўлланилишидан сўнг, клиник-ми-
кробиологик ва иммунологик кўрсаткичларни ижобий самара берганлигини изоҳланган.
Калит сўзлар: урогенитал хламидиоз, уреамикоплазмоз инфекция, герпес вирусли инфекциялар,
махсус иммуноглобулинлар, газолидон, кобавит, даволаш.

Su mmary
Prospects for the u se of d omestic me dicines G ozali don an d K obavit in the treatment
of complicate d forms of urogenital infections
D.F. Porsokhonova, A.M. Abidov, Ju.A. Alimukhamedova
This article contains some interesting data about the growing frequency of complicated forms of Chlamydia
infection and Ureamycoplasma infections, flowing background on herpes virus infection. The author sub-
stantiates the need to find new ways to treat complicated multicomponent infection. Domestic herbal drug
Gozalidon in combination with the proven hepatoprotector Kobavit offered as the best means of therapy.
The result of this combination of the authors obtained good clinical and microbiological effects and a signifi-
cant reduction in the titer of specific antiviral immunoglobulin.
Keywords: urogenital chlamydia, specific antiviral immunoglobulin, ureamycoplasma infections, herpes virus
infection, gozalidon, kobavit, treatment.

Резюме
Перспективы использования отечественных лекарственных препаратов «Гозалидон»
и «Кобавит» при лечении осложненных форм урогенитальных инфекций
Д.Ф. Порсохонова, А.М. Абидов, Ю.А. Алимухамедова
Статья содержит интересные данные о растущей частоте осложненных форм хламидийной и
уреа­микоплазменной инфекции, протекающей на фоне герпесвирусной инфекции. Авторами обо-
сновывается необходимость поиска новых способов лечения осложненной многокомпонентной

46
ОБМЕН ОПЫТОМ

инфекции. В качестве оптимального средства терапии предлагается отечественный препарат рас-


тительного происхождения «Гозалидон» в сочетании с хорошо зарекомендовавшим себя гепатопро-
тектором «Кобавит». В результате применения такой комбинации авторами получен положитель-
ный клинико-микробиологический эффект и значимое снижение титра специфических противови-
русных иммуноглобулинов.
Ключевые слова: уреамикоплазмозные инфекции, герпесвирусные инфекции, специфические им-
муноглобулины, газолидон, кобавит, лечение.

З а последнее десятилетие значительно из-


менилась количественная и качественная
структура инфекций, передающихся половым
влечением жизненно важных органов и систем в
патологический процесс лечение хламидийного,
микоплазменного и вирусного воспаления пред-
путем (ИППП). Если раньше ключевые позиции, ставляет определенные сложности. Необходим
определяющие высокие цифры регистрации учет сроков заражения, особенностей гестаци-
ИППП, занимали сифилитическая, гонококковая онного анамнеза, характера предшествующей
и трихомонадная инфекции, то на современном терапии, сопутствующего микробного фона, им-
этапе эпидемиологическая ситуация указывает мунологических и биохимических особенностей
на смену приоритета ведущих возбудителей. На организма. Особенностью терапии негонококко-
первый план по частоте встречаемости и тяже- вых ИППП на современном этапе является мно-
сти вызываемых осложнений выступают хлами- гоступенчатая антибиотикотерапия, назначае-
дийно-уреамикоплазменные и герпесвирусные мая различными специалистами. Эффект от на-
инфекции [4, 6, 7, 9]. Их рост и распространен- значения даже сильных антибиотиков далеко не
ность не имеют тенденции к снижению, и законо- всегда достигает цели. В то же время свобод-
мерно увеличивается число хронических, реци- ный доступ к медикаментам и широкая их пре-
дивирующих, осложненных, трудно поддающихся зентация в аптечной сети позволяют использо-
лечению форм. На основании предшествующих вать антибиотики бесконтрольно и неограничен-
грантовых исследований нами получены убеди- но. Часто приходится сталкиваться с проблемой
тельные данные о достаточно высокой встречае- неадекватной дозировки антибактериальных
мости хламидий и уреамикоплазм (до 25%) у лиц препаратов, что также приводит к персистенции
молодого и активного репродуктивного возраста возбудителя и формированию антибиотикоре-
среди жителей республики. Нами также получе- зистентности. Такое может происходить даже в
ны данные о клинической роли некоторых видов тех случаях, когда антибиотик подобран в соот-
уреамикоплазм, таких как Ureaplasma urealyticum ветствии со спектром антимикробного действия.
Parvo и Mycoplasma genitalium в генезе репродук- В этом случае ятрогенный фактор способству-
тивных нарушений. Отсутствие обязательного ет переходу инфекции в хронические и ослож-
мониторинга за хламидийными, уреамикоплаз- ненные формы. Предшествующими исследо-
менными и герпесвирусными инфекциями не по- ваниями отечественных и зарубежных авторов
зволяет определить реальные цифры распро- многократно доказана необходимость проведе-
страненности и придать проблеме требуемый ния иммунокоррекции при лечении осложнен-
статус. В настоящий момент патогенными и вы- ных и рецидивирующих форм бактериальных и
зывающими наибольший процент клинических вирусных ИППП [7]. Клиничес­к ие проявления
проявлений и осложнений среди урогенитальных хламидиоза, также как и уреамикоплазмоза и
и вирусных возбудителей являются Chlamydia иммунозависимых инфекций, напрямую связа-
trachomatis, Ureaplasma urealyticum Parvo, Myco- ны не только со степенью микробной агрессии,
plasma genitalium, Gardnerella vaginalis, герпесви- но и состоянием защитных систем организма.
русные инфекции (вирус простого герпеса II типа Следовательно, для достижения наилучшего
(ВПГ II), цитомегаловирус (ЦМВ)) [4]. результата в лечение включают иммунокоррек-
Среди наиболее часто встречающихся ослож- торы, биостимуляторы, витамины. Таким обра-
нений урогенитальных и вирусных ИППП отмече- зом, полноценная терапия осложненных форм
ны воспалительные заболевания органов малого хламидийно-уреаплазменных и герпесвирус-
таза (ВЗОМТ), репродуктивные нарушения, такие ных инфекций представляет собой достаточно
как бесплодие, самопроизвольные аборты, вне- громоздкий многоступенчатый процесс. В этой
маточная беременность, преждевременные роды, связи поиск лекарственных препаратов, со-
врожденные перинатальные инфекции, которые вмещающих в себе разнообразные свойства,
могут стать причиной слепоты, умственной от- обоснованность их применения научными ис-
сталости детей и других аномалий развития [3, 5]. следованиями является одной из приоритет-
Также доказана связь отдельных урогенитальных ных задач для практического здравоохранения.
ИППП с проблемой бездетного брака. Помимо этого, весьма желательными были бы
В связи с многообразием патологическо- минимальные побочные эффекты и компла-
го воздействия хламидий и уреамикоплазм на ентность искомых медикаментов. В настоящее
фоне торпидного течения заболевания и во- время на рынке Узбекистана зарегистрировано

47
Дерматовенерология и эстетическая медицина № 2 / 2016

множество лекарственных препаратов, причем ных анемиях, гепатитах, язвенной болезни же-
доля отечественных в их рядах увеличивается. лудка и 12-перстной кишки, в составе комплекс-
Гозалидон, впервые синтезированный учены- ной терапии острого гломерулонефрита [8].
ми лаборатории полифенольных соединений Материал и методы исследования. Под на-
института биоорганической химии Академии шим наблюдением находились 45 больных (25
наук РУз, является производным госсипола. женщин и 20 мужчин) с диагнозом хронической
Он стимулирует образование эндогенного a- и осложненной хламидийной, уреамикоплазмен-
g-интерферонов в организме, подавляет рост ной, герпесвирусной инфекцией, у которых имели
хламидийной инфекции и является одновремен- место гинекологические осложнения, нарушения
но противовирусным препаратом. В настоящее репродуктивной функции по типу невынашивания
время утверждены и успешно используются в беременности, первичного и вторичного беспло-
медицинской практике таблетки гозалидона по дия, простатиты, патологии спермы, очаги экс-
0,1  г [1]. В ранее проведенных НИИ эпидемио- трагенитальной локализации инфекции. Диагноз и
логии, микробиологии и инфекционных заболе- критерий излеченности устанавливались на осно-
ваний исследованиях указывалось на бактерио­ вании клинических, бактериологических, ПЦР (по-
статические свойства гозалидона в отношении лимеразная цепная реакция) методов исследова-
сальмонеллеза и бруцеллеза. По эффектив- ния. С этой же целью проведена идентификация
ности антимикробного действия гозалидон со- фона сопутствующих герпесвирусных инфекций с
поставим с импортируемым антибиотиком «Су- определением количественного содержания спе­
мамед», а по стоимости в 4–5 раз дешевле. С цифических иммуноглобулинов IgG к ВПГ и ЦМВ,
учетом данных предшествующих исследований а также состояние оппозитных цитокинов TFN-a и
по применению гозалидона при лечении инфек- IL-8 в сыворотке крови методом ИФА (иммунофер-
ционных заболеваний, а также опираясь на соб- ментный анализ) с помощью коммерческих тест-
ственный опыт эффективного использования систем (ЗАО «Вектор-Бест», РФ).
данного препарата [2] при лечении осложнен- Результаты исследования. Первичное бес-
ных форм бактериальных и вирусных инфекций плодие было диагностировано у 13 (28,9  %) боль-
нами был использован этот отечественный пре- ных, вторичное — у 19 (42,2  %). У всех больных
парат. Основной целью исследования явился отмечались признаки хронического восходящего
подбор оптимального режима терапии сочетан- воспалительного поражения УГТ. Выраженность
ного хламидийно-уреамикоплазменного и гер- воспалительных проявлений была различной:
песвирусного инфицирования и его осложнен- от скудных до обильных выделений из половых
ных форм с учетом клинико-иммуно-микробио- путей и болевого синдрома. Так хронический
логических осо­бен­н остей. эндометрит был диагностирован у 10 женщин,
Принимая во внимание хронический инток- эндоцервицит — у 25, сальпингоофорит — у 14,
сикационный синдром, неизбежно возникающий уретрит — у 28 мужчин и женщин, хронический
при длительно персистирующей инфекции [6], простатит — у 17 мужчин. У 4 женщин до об-
патогенное воздействие вирусной инфекции на ращения к нам была произведена контрастная
печень, иммунодефицитное состояние и необ- рентгенография фаллопиевых труб и установ-
ходимость гепатопротекторной терапии в усло- лена их полная и частичная непроходимость. На
виях частого использования антибиотиков, мы снижение либидо и эриктильной функции жало-
предпочли включить в состав лечения препарат вались 13 мужчин. Патология спермы установле-
отечественного производства «Кобавит» — ком- на у 15 мужчин, в том числе астенозооспермия  —
плексное соединение кобальта с глутаминовой у 6 больных, олигоспермия различной степени  —
кислотой и витамином U. Он обладает выра- у 9 больных, у остальных пациентов выявлены
женной гепатопротекторной, антианемической и изолированные нарушения спермы в виде повы-
противоязвенной активностью. Под его влиянием шенного лейкоцитоза, снижения биохимических
существенно повышается антитоксическая функ- показателей (фруктоза, лимонная кислота, цинк)
ция печени и регенераторный потенциал тканей, и вязкости.
в том числе печеночной паренхимы, интенсивно В процессе проведенных исследований уста-
снижается активность печеночных ферментов новлено, что Ur. urealyticum как моноинфекция
(АлАТ и АсАТ), маркеров холестаза, интенсивно наблюдалась у 13  (28,9  %) пациентов, Myc. geni-
уменьшается содержание билирубина в сыво- talium в виде моноинфекции — у 10  (22,2  %), Chl.
ротке крови, восстанавливается желчеобразова- trachomatis в виде моноинфекции — у 6  (13,3  %)
тельная и желчевыделительная функции печени. пациентов. Ur. urealyticum в сочетании с Myc.
Кобавит обладает антиоксидантной и мембрано- genitalium наблюдалась у 9  (20  %) пациентов, с
стабилизирующей активностью, а также иммуно- Chl. trachomatis — у 5  (11,1  %), с Tr. vaginalis — у
модулирующим действием, под его влиянием в 2  (4,4  %). Среди женщин: у 23  (92,0  %) в результа-
короткие сроки проходят явления астенизации. тах микроскопии были обнаружены грибы рода
К настоящему времени имеется положительный Candida, у 18  (72,0  %) пациенток хламидийно-уре-
опыт применения кобавита при железодефицит- амикоплазменная инфекция сочеталась с Gard-
48
ОБМЕН ОПЫТОМ

nerella vaginalis. При изучении сопутствующей муноглобулинов IgG к ВПГ отмечалось снижение
микробной флоры наиболее часто встречались его содержания в сыворотке крови, что в сред-
St epidermidis — у 28  (62,2  %), St haemolyticus — у нем составило 1,201 ± 0,91 пг/мл по сравнению с
9  (20,0  %), Enterococci — у 8  (17,8  %) пациентов. таковыми до лечения. Такие же данные наблю-
Исследование количественного содержания дались при исследовании количественного со-
противовирусных специфических иммуноглобу- держания специфических иммуноглобулинов   IgG
линов показало, что у больных с осложненными к ЦМВ, что в среднем составило 1,312 ± 0,88  пг/
и рецидивирующими формами урогенитальных мл. Со стороны цитокиновых молекул отмечено
инфекций наблюдался повышенный уровень значительное снижение их содержания в сыво-
специфических иммуноглобулинов G к ВПГ, что в ротке крови больных. Так, среднее содержание
среднем составило — 2,394 ± 0,9  пг/мл, в группе TNF-α составило 12,1 ± 2,2 пг/мл, содержание IL-8  —
здоровых лиц — 0,332 ± 0,02 пг/мл. Также отме- 30,3 ± 11,2 по сравнению с показателями до ле-
чен повышенный уровень специфических имму- чения. Отмечалось 2–3-кратное снижение титра
ноглобулинов G к ЦМВ инфекции, что в среднем специфических иммуноглобулинов по классу М
составило 2,287 ± 0,7 пг/мл, в группе контроля — и G, значительное снижение уровня TFN-a и IL-8,
0,339 ± 0,03 пг/мл. существенно сократились эпизоды герпетических
Результаты исследования состояния цито- экзантем и энантем, купировались общие сим-
киновых молекул TFN-a и IL-8 показали, что у птомы интоксикации, такие как слабость, голов-
больных с осложненными формами сочетанных ная боль, субфебрилитет, мышечные боли.
инфекций наблюдалось статистически достовер- Следовательно, противобактериальный, про-
ное повышение концентрации IL-8, что состави- тивовирусный и иммуномодулирующий эффект
ло 62,3 ± 11,8 пг/мл по сравнению с данными кон- гозалидона реализуется в основном посредством
трольной группы (24,2 ± 0,6 пг/мл). Содержание стимуляции естественных защитных сил орга-
TFN-a в сыворотке крови также было повышено низма, что является залогом стойкой эффектив-
по сравнению с контрольной группой, составив ности лечения. Учитывая, что большинство ле-
41,8 ± 10,1 пг/мл против 2,5 ± 0,8 пг/мл. карственных средств, эффективных в отношении
Для лечения пациентов нами использовались хламидиоза, воздействуют также и на микоплаз-
гозалидон и кобавит по следующей схеме: гоза- менную инфекцию в связи с общностью биоло-
лидон — по 2 табл. 3 раза в день в течение 5-ти гических особенностей данных возбудителей,
3-дневных курсов с 3-дневными интервалами; ко- расширение спектра применения гозалидона, на
бавит по 0,01  г 2 раза в сутки в течение 15 дней. наш взгляд, является весьма перспективным. По
В результате проведенного лечения микробная этой же причине препарат может применяться и
негативация отмечена у 42 (93,3  %) больных. при лечении осложненных и сочетанных с виру-
Клиническая эффективность, выражавшаяся в сами поражениях хламидийной и микоплазмен-
прекращении выделений из половых путей, зуда, ной природы.
дизурии, болей в нижней части живота и в про- Таким образом, использование отечественных
межности достигнута у 37 (82,2  %) больных, что препаратов растительной природы — гозалидона
является положительным показателем при лече- и кобавита — призвано максимально снизить ме-
нии пациентов с осложненным течением инфек- дикаментозную агрессию, неизбежно предшест­
ции. У 5 больных сохранялись периодические вующую развитию осложненных и рецидивиру-
боли в нижней части живота и в промежности. У ющих форм бактериальных и вирусных ИППП,
11 из 13 мужчин восстановились либидо и эрик- добиться коррекции иммунологического статуса,
тильная функция. Значительное улучшение каче- сочетать антибактериальный, противовирусный
ственных и количественных показателей спермы иммункорригирующий и общеукрепляющий эф-
отмечалось у 12 из 15 мужчин. При исследовании фекты данных препаратов, а также снизить фи-
количественного содержания специфических им- нансовые затраты на лечение.

Литература

1. Абидов А.М., Амбарцумов А.Г., Канн Ю.И. Го- 3. Каримова Д.Ф., Братанова М.Л., Ниязметов
залидон в терапии урогенитального хлами- Р.Э. Урогенитальный хламидиоз и беремен-
диоза. Сборник научных трудов, посвященный ность (вопросы этиопатогенеза и клиники)
100-летнему юбилею засл. деят. науки Узбе­ //  Медицинский журнал Узбекистана. 2003.
кистана проф. Аковбяна А.А. 2000. С.  1. №  3. С.  82–85.
2. Абидов А.М. Урогенитал хламидиозни даво- 4. Ибрагимов Ш.И., Абидов А.М., Набиев Т.А., Из-
лашда гозалидоннинг терапевтик самарадор- векова О.В. К вопросу о современной трактов-
лиги // Новости дерматологии и венерологии. ке TORCH-инфекции. / Дерматовенерология и
2001. №  1–2. С.  61–62. эстетическая медицина. 2009. №  4. С.  18–20.

49
Дерматовенерология и эстетическая медицина № 2 / 2016

5. Кулаков В.И. Инфекции, передаваемые поло- логия и эстетическая медицина. 2010. №  1–2.
вым путем, — проблема настоящего и будущего С.  91–92.
// Акушерство и гинекология. 2003. №  6. С.  3 –5. 8. Султанов, Ж.А. Эффективность включения ко-
6. Порсохонова Д.Ф., Мавлянов Б.Р. Изучение бавита в комплексную терапию острого гломе-
показателей эндогенной интоксикации при рулонефрита с нефротическим синдромом на
хламидийной и уреаплазменной патологии. фоне нарушений функции щитовидной желе-
//  Украинский журнал дерматологии, венеро- зы // Нефрология. 2004. Т.  8. №  4. С.  68–72.
логии и косметологии. 2002. №  2(5). С.  71–72. 9. Хрянин А.А., Решетников О.В., Кандрушкина
7. Сабиров У.Ю., Абидов А.М., Фаттахов Б.Ш. Ле- М.П. Многолетние тенденции в распростра-
чение больных хроническим простатитом, ас- ненности вируса простого герпеса в популя-
социированным с урогенитальным хламидио- ции Сибири // Вестник дерматологии и венеро-
зом и уреамикоплазмозом // Дерматовенеро- логии. 2010. №  5. С.  96–101.

УДК: 616-009.613.7:616.8-009.613.7+616.895.4

Анализ ассоциации полиморфизма 481C/T гена NAT2


с развитием кожного зуда

Н.С. Ибрагимова1, Х.Я. Каримов2 , А.А. Садиков1, К.Т. Бобоев2

Ташкентская медицинская академия, кафедра кожных и венерических болезней1;


Имунно-исследовательский институт гематологии и переливания крови МЗ РУз2

Хулоса
Тери қичиши ривожланишида 481C/T NAT2 гени полиморфизм ассоциацияси тахлили
Н.С. Ибрагимова, Х.Я. Каримов, А.А. Садиков, К.Т. Бобоев
Мақолада тери қичишига чалинган кекса ва қариялар ёшидаги беморларда ўтказилган тадқиқотлар
кўрсатилган. Муаллифлар ўзбек популяциясида тери қичиши билан касалланган беморлар ва
соғлом донорларнинг ўзига хос генетик хилма-хиллиги ҳамда кутилган ва кузатилган аллеллар
ва генотип rs1799929 NAT2 ген полиморфизмининг частоталарини кузатиб олинган натижаларни
намойиш этдилар. Тери қичиши билан касалланган беморларда функционал — ноқулай генотип
481T/T частотаси сезиларли ўсиши кузатилган.
Калит сўзлар: тери қичиши, полиморфизм 481C/T, NAT2 гени.

Su mmary
Analysis of polymorphism association 481C / T NAT2 gene with the development
of pr urit us
N.S. Ibragimova, H.Yа. Karimov, A.A. Sadikov, K.T. Boboev
The article shows a study group of patients of elderly and senile age, suffering from skin itch. The authors
presented the distribution of data, expected and observed frequencies of allele and genotype polymorphism
rs1799929 NAT2 gene, as well as indicators of their genetic diversity in patients with pruritus and healthy
donors in Uzbek population. There was a significant increase in the frequency of functional unfavorable
genotype 481T / T in patients.
Keywords: skin itch, polymorphism 481C/T, NAT2 gene.

Резюме
Анализ ассоциации полиморфизма 481C/T гена NAT2 с развитием кожного зуда
Н.С. Ибрагимова, Х.Я. Каримов, А.А. Садиков, К.Т. Бобоев
В статье приведено исследование группы пациентов пожилого и старческого возраста, страдающих
кожным зудом. Представлены данные распределения ожидаемой и наблюдаемой частот аллелей
и генотипов полиморфизма rs1799929 гена NAT2, а также показатели их генного разнообразия у
больных кожным зудом и здоровых доноров в узбекской популяции. Отмечено значительное воз-
растание частоты функционально неблагоприятного генотипа 481Т/T у больных.
Ключевые слова: кожный зуд, полиморфизм 481C/T, ген NAT2.

Х ронический зуд является частым симпто-


мом в дерматологии и значительно снижает
качество жизни пациентов. Причинами зуда мо-
гут быть не только дерматологические заболе-
50
ОБМЕН ОПЫТОМ

вания, он ассоциируется с системными, невро- Материалы и методы исследования. Ма-


логическими, а также психогенными болезнями, териалом для исследований явились образцы
при этом считается, что при старении кожа ста- ДНК 20 больных с кожным зудом. Для выделе-
новится более восприимчивой к зуду. Результаты ния ДНК из лимфоцитов периферической кро-
последних эпидемиологических исследований ви применен модифицированный метод фе-
показали, что 10–20  % взрослых страдают хрони- нольно-хлороформной экстракции, а также на-
ческим зудом, причем заболевание значительно бор «РНК/ДНК-сорб» ООО «ИнтерЛабСервис»
превалирует в более старшем возрасте [1]. (Россия). В качестве контроля для молекуляр-
В связи с тем, что NAT2 обладает генетиче- но-генетического скрининга использованы пре-
ским полиморфизмом, его активность значи- параты геномной ДНК, как выделенные само-
тельно варьирует у различных индивидов. Необ- стоятельно, так и хранящиеся в банке ДНК НИИ
ходимо отметить, что распределение генотипов ГиПК МЗ РУз (44 образца).
и фенотипов N-ацетилтрансфераз в различных Анализ образцов ДНК проведен путем стан-
популяциях в настоящее время подвергается дартной полимеразной цепной реакции на тер-
весьма активному изучению. Эти исследования моциклере «Applied Biosystems» 2720 (США) с
позволяют определить не только предрасполо- использованием наборов ООО «Литех» (Москва)
женность каждого человека к тому или иному за- согласно инструкции производителей.
болеванию, но и его индивидуальную реакцию на Статистический анализ результатов выпол-
лекарственное средство. нен с помощью пакета статистических программ
NAT2 относится к генам систем биотранс- «OpenEpi 2009, Version 2.3».
формации веществ (II фазы детоксикации). Ал- Результаты исследования. На начальном
лельные варианты NAT2 связаны в основном с этапе исследования проанализированы особен-
точечными мутациями, большинство из которых ности полиморфного варианта 481C/T (rs1799929)
нарушают каталитическую функцию и/или ста- гена NAT2 в генетической структуре узбекской
бильность фермента. Это приводит к снижению популяции.
скорости ацетилирования в организме, в резуль- Распределение аллелей и генотипов по по-
тате чего снижается эффективность инактивации лиморфизму 481C/T гена NAT2 в популяционной
токсических метаболитов, что ведет к развитию выборке и в группе пациентов проверяли на со-
«оксидативного стресса» [2]. ответствие равновесию Харди-Вайнберга (РХВ) с
Ген NAT2 расположен в 8-й хромосоме 8p22 помощью точного теста Фишера.
[4, 5]. Этот ген кодирует проальфа-цепь коллаге- В таблицах 1 и 2 представлены данные рас-
на 1-го типа, состоящую из 3-х альфа-цепей [6]. пределения ожидаемой и наблюдаемой частот
Распространенность полиморфного варианта аллелей и генотипов полиморфизма rs1799929
481C/T в различных популяциях варьирует от 30 до гена NAT2, а также показатели их генного раз-
57  % [3]. нообразия. Распределения генотипов в ис-
Цель исследования. Изучение особенностей следованных выборках для данного ДНК-мар­
распределения генотипов полиморфизма 481C/T кера находились в равновесии Харди-Вайнбер-
гена NAT2 у здоровых доноров и у больных с га (РХВ), о чем свидетельствовало значение
кожным зудом без сыпи. p>0,05.
Таблица 1
Ожидаемая и наблюдаемая частоты распределения генотипов по РХВ
полиморфизма rs1799929 гена NAT2 в основной группе больных
Частота генотипов
Генотипы χ2 Р
наблюдаемая ожидаемая
С/С 65,00 64,00 0,003
С/Т 30,00 32,00 0,025
Т/Т 5,00 4,00 0,050
Всего 100,00 100,00 0,078 0,8

Таблица 2
Ожидаемая и наблюдаемая частоты распределения генотипов по РХВ
полиморфизма rs1799929 гена NAT2 в популяционной группе
Частота генотипов
Генотипы χ2 Р
наблюдаемая ожидаемая
С/С 65,91 68,81 0,054
С/Т 34,09 28,28 0,525
Т/Т 0,00 2,91 1,278
всего 100,00 100,00 1,858 0,2

51
Дерматовенерология и эстетическая медицина № 2 / 2016

Как видно из таблиц 1 и 2, полиморфизм таты анализов достоверно коррелируют между


rs1799929 гена NAT2 в изученных группах харак- собой, что позволяет говорить о действительном
теризовался очень низкой частотой функцио­ отсутствии отклонений от РХВ для данного поли-
нально неблагоприятного генотипа 481Т/Т. В морфизма.
исследуемой группе больных наблюдалась На следующем этапе исследования было
тенденция к незначительному увеличению на- оценено состояние популяционного разнообра-
блюдаемой частоты данного генотипа по срав- зия полученных данных путем вычисления ин-
нению с ожидаемыми значениями (5,0  % против декса относительного отклонения (D) наблюдае­
4,0  %, соответственно). При этом наблюдаемое мой гетерозиготности от ожидаемой (табл. 3).
распределение данного генотипа согласуется с Для каждой группы были рассчитаны наблюдае­
ожидаемыми частотами распределения (Р > 0,05). мая гетерозиготность (Hobs), ожидаемая гете-
В популяционной группе несмотря на отчетливые розиготность (Hexp) и индекс отклонения Hobs от
различия ожидаемой и наблюдаемой частоты не- Hexp (D). Как известно, гетерозиготность поли-
благоприятного генотипа 481Т/Т (2,91  % против морфизмов обусловливает высокую жизнеспо-
0,0  %) статистический анализ показал, что такие собность организмов, хорошую приспособляе-
различия также имеют недостоверный характер мость к изменяющимся условиям среды. Чем
(Р > 0,05). выше уровень гетерозиготного состояния поли-
В группе больных наблюдаемая частота нор- морфизмов, тем выше их приспособляемость к
мального генотипа С/С оказалась статистически внешней среде. При сравнении различий между
незначимо выше по сравнению с теоретическим теоретической и фактической частотами гете-
значением (65,0  % против 64,0  % при Р > 0,05), в розиготности в группе больных выявлено, что
популяционной группе, напротив, она была более данный маркер имеет не очень высокий индекс
низкой (65,9  % против 68,8  % при Р > 0,05). гетерозиготного дефицита (D = –0,06) за счет из-
Для гетерозиготного генотипа С/Т выявлен не бытка гомозигот (65,0  % против 64,0  %). Соот-
очень высокий уровень теоретической гетерози- ветственно, можно прогнозировать не очень вы-
готности (от 32,0  % до 28,3  % соответственно). сокий риск подверженности к зуду у пациентов
Фактическое количество гомозиготного генотипа этой группы. Таким образом, для данного локуса
в группе больных статистически незначимо было показатель D оказался отрицательным, т.е. на-
снижено по сравнению с теоретическим (30,0  % и ходящимся <0.
32,2  % соответственно, χ2 =  0,04; р > 0,05), а наблю- Однако уровень наблюдаемой гетерозигот-
даемая частота данного генотипа в группе контро- ности данного полиморфизма в группе контроля
ля недостоверно выше, чем ожидаемая (34,1  % и был выше ожидаемого (34,09  % и 28,28  % соот-
28,28  % соответственно, χ2 =0,03; р > 0,05). ветственно, D = +0,2), что свидетельствует о бо-
Полученные данные указывают на однород- лее высоких частотах наблюдаемых гетерозигот,
ность исследованной выборки групп, а резуль- а не вычисленных теоретически.

Таблица 3
Различие между ожидаемой и наблюдаемой частотами гетерозиготности

Группы Наблюдаемая гетерозиготность Ожидаемая гетерозиготность D*

Основная группа 30,00 32,00 –0,06

Контрольная группа 34,09 28,28 +0,2

Примечание: *D = (0,3–0,32)/0,32 = 0,14 для основной группы;


    D =  (0,34–0,28)/0,28 =  +0,2 для контрольной группы.

В таблице 4 представлены результаты срав- здоровых доноров была незначительно выше,


нительного анализа частот генотипов полимор- чем у больных (65,0  % и 65,0  % соответственно;
физма rs1799929 NAT2 между группами больных χ2 = 0,004; Р = 0,8; OR = 0,96; 95  %CI 0,316–2,92), а
зудом и здоровых доноров. Анализ ассоциаций частота гомозигот мутантного аллеля 481ТТ, на-
исследуемого полиморфного варианта rs1799929 против, была недостоверно выше у больных по
гена NAT2 был проведен при помощи сравнения сравнению со значением контрольной группы
двух выборок по типу «случай–контроль». При (5,0  % и 0,0  % соответственно; χ2 =  2,1; Р =  0,1). Ге-
анализе распределения частоты аллелей и ге- терозиготный генотип 481С/Т гена NAT2 встре-
нотипов в группе больных и контроля не было чался незначительно чаще у здоровых лиц
выявлено статистически значимых отличий. Ча- (34,1  % против 30,0  % соответственно; χ2=2,3;
стота гомозигот дикого типа 481С/С гена NAT2 у Р=0,1; OR=0,3; 95  %CI 0,05536, 1,378).

52
ОБМЕН ОПЫТОМ

Таблица 4
Анализ распределения аллелей и генотипов полиморфизма rs1799929 гена NAT2

Частота распределения Частота распределения


аллелей генотипов
Группа n
С Т С/С С/Т Т/Т
n % n % n % n % n %
Основная группа 20 32 80,0 8 20,0 13 65,0 6 30,0 1 5,0
Контрольная группа 44 73 82,9 15 17,1 29 65,9 15 34,1 0 0,0

Таким образом, распределение частот алле- тельного вывода о его роли в развитии заболева-
лей и генотипов полиморфизма rs1799929 гена ния и в выраженности и характере клинических
NAT2 соответствует РХВ. Исследованные группы проявлений необходимо увеличение численно-
больных с зудом и контроля характеризовались сти данной выборки.
средним уровнем гетерозиготности и генетиче-
ской изменчивости. Был получен относительно Вывод
не очень высокий уровень гетерозиготности (Hexp
и Hobs) данного полиморфизма, что, возможно, 1) распределение частот генотипов изученно-
связано с относительной «молодостью» данного го полиморфизма rs1799929 гена NAT2 у боль-
полиморфизма. ных с кожным зудом и условно здоровых доноров
В результате проведенной работы не обнару- было сопоставимо и в целом соответствовало
жена ассоциация полиморфизма rs1799929 гена ожидаемой частоте, соответствующей закону
NAT2 с развитием зуда, однако отмечено возрас- РХВ (р > 0,05);
тание частоты функционально неблагоприятного 2) проведенное исследование не выявило до-
генотипа 481Т/T среди больных хроническим зу- стоверной ассоциации полиморфизма rs1799929
дом. Отсутствие убедительной достоверности, гена NAT2 с развитием кожного зуда, однако от-
по-видимому, можно связать с тем, что гомози- мечено значительное возрастание частоты функ-
готный вариант 481Т/T гена NAT2 в популяцион- ционально неблагоприятного генотипа 481Т/T в
ной выборке отсутствовал (0,0  %) и для оконча- группе больных.

литературА

1. Львов А.Н., Грундманн С., Штендер С. Хрони- 4. Vatsis K.P., Weber W.W., Bell D.A. et al. Nomen-
ческий зуд: старые проблемы, новые решения clature for N-acetyltransferases // Pharmacoge-
// Российский журнал кожных и венерических netics. 1995; 5: 1–17.
болезней. 2010. №  4. С.  7–12. 5. Ruiz J.D., Martínez C., Anderson K. et al. The
2. Dupret J.M., Rodríguez-Lima F. Structure and Reg- differential effect of NAT2 variant alleles permits
ulation of the Drug-Metabolizing Enzymes Ary­ refinement in phenotype inference and identifies
lamine N-Acetyltransferases // Curr Med Chem. a very slow acetylation genotype. // PloS One.
2005; 12(3): 311–8. 2012; 7: e44629.
3. Taja-Chayeb L. et all. Arylamine N-acetyltransfer- 6. Walraven J.M., Zang Y., Trent J.O. and Hein D.W.
ase 2 genotypes in a Mexican population // Ge- Structure/function evaluations of single nucleotide
netics and Molecular Research. 2012; 11 (2): polymorphisms in human N-acetyltransferase 2
1082–1092. // Curr. Drug Metab. 2008; 9: 471–486.

53
Дерматовенерология и эстетическая медицина № 2 / 2016

УДК:613.2:615.874.2:616-056.3-02-07

ПРИМЕНЕНИЕ СОВРЕМЕННЫХ МЕТОДОВ ДИАГНОСТИКИ


ПРИ ДИЕТОТЕРАПИИ АЛЛЕРГИЧЕСКИХ ЗАБОЛЕВАНИЙ
Д.Г. Абдуллаева

Ташкентский институт усовершенствования врачей

ХУЛОСА
Иссиқ иқлим шароитида аллергик касалликлар ташХисоти ва парҳез даволашнинг
ўзига хослиги
Д.Г. Абдуллаева
Аллергик касалликлар, жумладан, овқат аллергиясида ташхисот усулларни яхшилаш мақсадида
аллерген махсус иммуноглобулин Е ни аниқловчи in vitro панеллар амалиётга татбиқ қилинди. Ушбу
панеллар таркибига иссиқ иқлим шароитига хос бўлган озиқ-овқат, ўсимлик ва дарахт чанглари,
эпидермал, маиший, замбуруғ аллергенлари киритилди. Аллергик касалликлар билан касалланган
беморларда озиқ-овқат ҳамда ўсимлик чанглари, латекс, замбуруғ аллергенлари орасида кесишган
аллергик реакциялар аниқланди.
Калит сўзлар: овқат аллергияси, in vitro диагностика, аллерген-махсус IgE, озиқ-овқат, ўсимлик
аллергенлари, замбуруғ, латексга нисбатан кесишган реакциялар.

S UMMARY
T he use of mo dern metho ds of diagnosis in d iet therapy of allergic d iseases
D.G. Abdullaeva
It was introduced into clinical practice allergens panel to determine the allergen-specific immunoglobulin
E in order to improve the diagnosis and diet therapy of allergic diseases, including food allergy. The
composition of these panels we have included typical in hot climate food, plant, epidermal, household
allergens, fungi. Determined cross-allergic reactions between food and plant allergens, latex, fungi.
Keywords: food allergy; in vitro diagnostics, allergen-specific IgE, cross-reaction to food, plant, fungi, latex.

РЕЗЮМЕ
ПРИМЕНЕНИЕ СОВРЕМЕННЫХ МЕТОДОВ ДИАГНОСТИКИ ПРИ ДИЕТОТЕРАПИИ АЛЛЕРГИЧЕСКИХ
ЗАБОЛЕВАНИЙ
Д.Г. Абдуллаева
Внедрены в клиническую практику in vitro панели аллергенов для определения аллерген-специ­
фических иммуноглобулинов Е в целях усовершенствования диагностики и диетотерапии
аллергических заболеваний, в том числе пищевой аллергии. В состав этих панелей включены
характерные для жаркого климата пищевые, растительные, эпидермальные, бытовые аллергены,
грибки. Определены перекрестные аллергические реакции между пищевыми и растительными
аллергенами, латексом, грибками у больных аллергическими заболеваниями.
Ключевые слова: пищевая аллергия, in vitro диагностика, аллерген-специфические IgE, пере­
крестные аллергические реакции к пище, растительными, грибковым аллергенам, латексу.

Н а сегодняшний день отсутствуют точные


данные о распространенности пищевой
аллергии (ПА) в мире. Это связано, с одной
кие реакции на пищевые продукты отме­чаются
у пациентов с атопическим дер­матитом  — до
48  %, поллинозом — до 45  %, бронхиальной
стороны, с многочисленными проявлениями за­ астмой — до 15  %, аллергическим ринитом —
бо­левания, затрагивающими многие органы и 15  %. Среди больных с заболе­ваниями ЖКТ и
системы, с другой стороны — трудностями точной гепатобилиарной системы рас­пространенность
верификации диагноза в клинической практике. аллергии к продуктам питания выше и может
Предположительно в мире насчиты­вает­ся при­ достигать 50  % и более [3].
мерно 220–520 млн человек, стра­даю­щих ПА [9]. Цель исследования. Оптимизировать дието­
Реакции на пищу известны со времен терапию аллергических заболеваний, в том числе
античности. Аллергия является проблемой об­ ПА, с помощью современных методов in vitro ал-
щественного здравоохранения глобальных масш- лергодиагностики.
­табов и требует своего решения на уровне как Материал и методы исследования. Модифи­
отдельных государств, так и мирового сооб­ кация in vitro иммуноблот панелей R-Biopharm (Ger-
щества. По литературным данным, аллер­гичес­ many) для определения аллерген-специфических
54
ОБМЕН ОПЫТОМ

IgE-антител к пищевым, пыльцевым, грибковым, гистаминных препаратов и т.  д. В связи с этим


бытовым аллергенам, особенно у детей и под- врачам необходима информация о свойствах
рост­ков, а также у взрослых, с учетом регио­ аллергенов и перекрестных реакциях между
нальных особенностей распространения раз­ ними для успешной диетотерапии. Прежде чем
личных аллергенов. Учи­тывая, что состав панелей назначить конкретный метод специфической аллер­
аллергенов характерен для населения Европы и го­логической диагностики, необходимо учесть
не подходит к климато-географическим характе­ особенности иммунологического механизма реа­
ристикам нашего региона и характеру питания ли­зации аллергической реакции у пациента и
населения, мы включили в состав панелей харак­ определить круг предполагаемых аллергенов. Для
терные для жаркого климата пищевые, расти­ этой цели врач должен проанализировать анамнез,
тельные, эпидермальные, бытовые, профес­сио­ клинические проявления заболевания в прошлом
нальные аллергены. и настоящем, ориентировочно предполагая спектр
Результаты исследования. Диагностика пи­ аллергенов и тип реакции иммунной системы.
щевой аллергии в нашей республике ограни­ Данный тест позволяет количественно измерять
чи­валась in vivo методами диагностики, к кото­ концентрацию аллерген-специфических IgE (МЕ/
рым было много ограничений: детский возраст, мл) в сыворотке крови методом иммунного анализа.
беременность и лактация, обострение аллергичес­ Результаты выражаются также в RAST (radioal-
кого и других хронических заболеваний, психи­ lergo sorbent test) классах (табл. 1). Положительной
ческие заболевания, кожный демографизм, острые считается концентрация аллерген-специфических
аллергические реакции в анамнезе, прием анти- IgE выше 0,35 МЕ/мл (1 RAST класс и выше).
Таблица 1
Соотношение между определяемыми классами и содержанием в сыворотке пациента
соответствующих аллерген-специфических IgE

МЕ/мл RAST класс Содержание аллерген-специфических IgE

0,00–0,34 0 (0,0–0,9) Отсутствует или обнаруживается с трудом

0,35–0,69 1 (1,0–1,9) Низкое

0,70–3,49 2 (2,0–2,9) Увеличенное

3,50–17,49 3 (3,0–3,9) Существенно увеличенное

17,50–49,99 4 (4,0–4,9) Высокое

50,00–99,99 5 (5,0–5,9) Очень высокое

≥ 100,00 6 (³ 6,0) Чрезвычайно высокое

Диагностика аллергических заболеваний за­ Основные классы аллергенов,


труднена в связи с отсутствием единых методи­ включенных в состав панелей
(международное обозначение)
ческих подходов и унифицированных методов
диагностики, позволяющих выявить механизмы Пыльцевые аллергены: G 1, G2 …, G n — пыль-
развития аллергии. Учитывая разного характера ца луговых трав (каждый вид имеет индивидуаль-
клинические формы аллергопатологии и возраст ный порядковый номер, например, G 8 — мятлик
пациента, применяются ингаляторные, педиатри­ луговой); W1, W2…, Wn — пыльца сорных трав; T 1,
ческие, смешанные (см. образец 1) и пищевые T 2…, T n — пыльца деревьев и кустарников.
(см. образец 2) иммуноблот-панели, которые со­ К развитию аллергических заболеваний при­-
держат по 20 аллергенов. водит контакт с пыльцой ветроопыляемых рас­
Ниже приведен перечень аллергенов, вклю­ тений. Вес и размер пыльцевых зерен имеет
чен­ных в панели, их краткая характеристика и большое значение. Так, пыльца большого
некоторые перекрестные аллергические реак­ции диаметра (от 60 до 100 мкм и более) из-за тяжести
между разными классами аллергенов. задерживается при вдыхании на слизистой
В 1994 г. классификация аллергенов была оболочке верхних дыхательных путей, а пыльца
унифицирована номенклатурным субкомитетом диаметром от 20 до 30 мкм проникает в слизистую
ВОЗ по аллергенам. В обозначении названия оболочку средних и мелких бронхов, что облегчает
аллергена участвуют первые буквы рода сенси­билизацию организма, индуцирует lgE-ответ.
и вида, арабская цифра обозначает гомо­ Среди злаковых и луговых трав ярко выраженной
логичные аллергены (порядок открытия) разных аллергенной активностью обладает пыльца тимо­
видов. феевки, среди пыльцевых аллергенов сложно­
цветных и сорных трав преобладает пыльца полы-

55
Дерматовенерология и эстетическая медицина № 2 / 2016

Рис. 1. Смешанная панель

Рис. 2. Пищевая панель

56
ОБМЕН ОПЫТОМ

ни и амброзии. Профилины, впервые обнаружен- Аллергены животных (шерсть, перхоть, экс­


ные в пыльце березы, обладают выраженными кре­менты) и птиц обладают высокой лету­
перекрестно реагирующими свойствами со честью и они прикреплены к мелким частицам
многими группами аллергенов и часто являются пыли. Самыми мощными аллергенами являются
причиной анафилактических реакций, особенно аллергены кошек. У людей с IgE–сенсибилизаци-
у детей, на сою и арахис. У больных поллинозом ей к аллергену кошек встречается перекрестная
профилины могут способствовать развитию ал­ аллергия на другие виды животных, например,
лер­гических реакций на морковь, картофель, сель­ на собак и лошадей. Симптомы аллергии могут
дерей, томаты и др. появиться уже через 5 минут после контакта с
Аллергены условно-патогенных микроорга­ домашним животным и достигают максимума
низмов и грибов (плесеней): M1, M2…, Mn. через 3 часа. Появление клинических симптомов
Условно-патогенные микроорганизмы, мик­ро­ аллергии не всегда зависит от концентрации
грибы и плесени, обитающие в жилых поме­ аллергенов: в частности, одежда владельцев
щениях, часто служат причиной кругло­годичных кошек является средством переноса основного
аллергических заболеваний. Они активно заселяют аллергена (Fel d 1) в среду, где нет кошек.
сырые помещения, ванные комнаты, туалеты, Даже в таком случае может развиться приступ
сантехнику, старую мебель, испорченные продукты бронхиальной астмы у сенсибилизированных
и органические отходы. Грибы, обитающие в людей. Всех больных с аллергией на домашних
природе, паразитируют на коре деревьев, в почве животных следует отнести к группе риска по
и листьях. Споры грибов разносятся ветром, развитию тяжелой аллергической реакции.
водой, животными и человеком. Как правило, Лучшая рекомендация — исключение контакта с
грибы поражают дыхательные пути и вызывают животными [4].
тяжелые аллергические заболевания, такие как Ингаляционные аллергены: D1, D2 …, Dn —
бронхолегочный аспергиллез, круглогодичный микроклещи. Компоненты аллергена домашней
аллер­гический ринит, бронхиальная астма. На­ пыли — клещи Dermathophagoides pteronyssimus
ряду с дермагофагоидными клещами плесне­ и Dermathophagoides farinae — крошечные чле­
вые грибы являются одним из основных ком­ нистоногие, невидимые невооруженным глазом,
понентов домашней пыли. Аллергия на плесень с диаметром тела около 0,3 мм. Количество
часто протекает совместно с другими аллер­ микроклещей возрастает осенью. Эти клещи
гическими заболеваниями и в основном харак­ питаются чешуйками слущенного рогового слоя
теризуется непереносимостью пылевых клещей и кожи человека, который составляет наибольшую
растительной пыльцы. Плесневые грибки обитают часть компонентов домашней пыли, и живут в
повсеместно, некоторые грибы образуют спору симбиозе с микро­с ко­пическими плесневыми гри-
круглый год (Penicillum), другие весной, летом, ­бами, обитающими в матрасах и других пос-
осенью (Cladosporum, Alternaria). Аллергические тельных принадлежностях. Экскременты кле­
реакции возникают прежде всего у больных с щей также являются идеаль­ными аллер­генами.
атопией, повышенная влажность и температу- Антигены клещей достаточно крупные, поэтому
ра в помещениях могут способствовать разви- аллергические реакции на них воз­никают не так
тию респираторных симптомов, так как в закры- быстро, как на эпидермис кошек. Аллергия на
том помещении грибы хорошо перемещаются домашнюю пыль наиболее часто проявляется в
(особенно Penicillum и Aspergillus, реже Rhizopus виде бронхиальной астмы, ринита, реже, конъ-
и Mucor). Aspergillus fumigatus часто вызывают юнктивита. Аллергенные свойства и состав
иммунодефицит у человека, flavus и fumigatus — пыли известны уже нес­колько сто­летий. Derma-
основной продуцент канцерогенного афлотоксина tophagoideus pteronissimus и farinaе — наиболее
у зерновых культур, орехов, семян вызывает аспер­ аллергенные представители, характерные для
гиллез, аллергические заболевания. Следует от­ нашего региона, могут вызвать пищевую кле­
ме­тить, что профессиональные факторы также щевую анафилаксию. В 1 г домашней пыли мо­
могут влиять на развитие сенсибилизации к гут со­держаться до нескольких тысяч клещей и
плесневым грибам. Это работники микробио­ло­ продуктов их жизнедеятельности. Dermatopha-
гического профиля, сельского хозяйства, фер­меры, goideus pteronissimus обитают в постели, коврах,
пивовары, шахтеры, библиотекари. Cladosporum вызывают сенсибилизацию у лиц с атопией,
являются широко распространенными в ре­гионах бронхиальной астмой, аллергическим ринитом,
с умеренным климатом и включают извест­ных атопическим дерматитом.
сапрофитов и паразитов шпината, бана­нов и Респираторные симптомы дебютируют, как
помидоров. правило, после года (в дошкольном) возрасте
Эпидермальные аллергены: E 1, E2 …, и ассоциируются с сезонным аллергическим
E n — индивидуальные аллергены животных. ринитом и/или конъюнктивитом. Дебюту почти
Они обладают очень большой активностью, и всегда предшествует сенсибилизация пыльцой,
даже кратковременный контакт с ними может содержащей белки, гомологичные тем, что
спровоцировать бурный аллергический ответ. К находятся в определенных фруктах и овощах.
наиболее активным эпидермальным аллергенам При этом пациент, сенсибилизированный
относят антиген эпидермиса кошек. к пыльце, может реагировать на пищевой

57
Дерматовенерология и эстетическая медицина № 2 / 2016

аллерген без предшествовавшего с ним аллергических реакций между аллергеном


контакта. Сенсибилизация к пыльце амброзии мяса и аллергенами сывороточных и других
полыннолистной может сочетаться с оральным препаратов, полученных от этих животных
аллергическим синдромом (ОАС) после упот­ (например, говядины и бычьего сывороточного
ребления дыни, а сенсибилизация к пыльце альбумина).
березы может приводить к появлению этого Пищевые антигены содержат эпитопы, при-
синдрома после употребления яблок, персиков сутствующие в структуре профилина, и общие с
и вишни. Кроме того, могут быть перекрестные эпитопами некоторых видов пыльцы (деревьев,
реакции между латексом и бананом, авокадо, трав, злаковых), поэтому аллергические реакции
персиком, киви, абрикосом, грейпфрутом, ма­р а­ на фрукты и овощи хотя и могут появляться
куйей, ананасом, каштаном. Белки, индуцирую­ всякий раз, когда потребляются данные пищевые
щие ОАС, термолабильны, поэтому употребле- продукты, но протекают значительно тяжелее в
ние фруктов и овощей, прошедших кулинарную сезон цветения соответствующих растений [1].
обработку, не приводит к появлению симпто- Результаты тестов могут дать информацию о
мов. Диагностика ОАС базируется на типичном перекрестных реакциях между растительными
анамнезе и на основании результатов prick- и пищевыми аллергенами в плане дальнейшего
тестов и IgE в сыворотке крови [5]. лечения и диетотерапии.
Профессиональные аллергены: K1, K2…, Овощи и фрукты играют важную роль в
K n — профессиональные аллергены; К82 — развитии пищевой аллергии у детей старшего
латекс. Белки натурального латекса, некоторые возраста и взрослых. В качестве основных
фрукты и овощи (банан, томаты, картофель, антигенов в данном случае выступают, как
морковь, арбуз) содержат гомоло­гичные белки, правило, определенные белки фруктов, овощей и
которые могут приводить к возникновению орехов, аллергическая реакция к которым часто
«латекс-фрукт» синдрома у сенсибилизированных обусловлена предварительной сенсибилизацией
пациентов, проявляюще­го­ся в виде крапивницы, к пыльце некоторых растений. Пациентов с
дерматитов, анафи­лаксии и желудочно-кишечных аллергией к этим продуктам наиболее часто
расстройств. Доказана способность главных бел- беспокоят зуд, покалывание, чувство жжения
ков латекса индуцировать перекрестные реакции слизистой оболочки щек, десен, верхнего неба
с пищевыми продуктами (бананы, киви, авока- и губ в сочетании с появлением микропапул и
до, дыня, инжир, томаты, картофель, яйца, ябло- везикул в ротовой полости. В редких случаях
ки, груши и др.), что получило название «латекс- возможно развитие анафилактического шока.
фрукт синдром» [2, 6, 8]. Важно отметить, что часто аллергические реак­
При наличии пищевой аллергии и сенси­ ции возникают в ответ на употребление свежих
билизации к латексу рекомендуется элими­ овощей и фруктов; термическая обра­ботка или
нация пищевых продуктов, дающих перекрест­ консервирование устраняют их аллергенные
ные реак­ц ии. Все дети с аллергическими реак­ свойст­ва [1].
циями на латекс должны быть направлены к Можно достоверно назвать ряд неоспоримых
аллергологу, который в дальнейшем выбирает преимуществ in vitro тестирования с помощью
подход лечения индивидуально для каждого иммуноблот панелей по сравнению с in vivo
пациента. Для профилактики анафилаксии и тестами:
развития аллергических реакций немедленного — возможность выявлять только строго
типа при непереносимости пищевых продуктов, аллерген-специфические IgE-антитела в таких
имею­щ их перекрестные антигены с латексом, низких концентрациях, которые лежат за поро-
целе­с ообразно своевременное выявление гом обнаружения их биологическими методами
сен­с ибилизации для организации в последую­ in vivo;
щем профилактических мероприятий и про­ф - — выявление специфических причинно-зна­
о­р иентации пациентов [1]. чимых пищевых аллергенов широкого спектра у
Пациенты, сенсибилизированные к одному беременных, детей раннего возраста, больных
из представителей семейства орехов (кешью, при наличии тяжелых кожных аллергических
фисташки, грецкий орех, фундук), имеют ко­с ен­ процессов (атопического дер­матита, крапивницы),
сибилизацию к пыльце деревьев и рас­тений [7]. в период обострения бронхиальной астмы,
Пищевые аллергены: F1, F2 …, F n. — это аллергического ринита или поллиноза, при не­
компоненты гликопротеиновой природы с возможности отмены антигистаминных препа­
молекулярным весом 10–70 кДа, хорошо рас- ратов, после перенесенного в прош­лом анафи­
творимые в воде. Они устойчивы к температу- лактического шока, а также если клини­ческие
ре, действию кислот, протеаз и пищеварению. методы оказались малоинформа­тивны. Метод
В литературе имеются данные о развитии ста­билен, стандартизован, обла­дает высокой
аллергических реакций при проведении специфичностью и чувстви­тель­ностью.
профилактических прививок вакцинами, Таким образом, для своевременной диаг­
содержащими примеси тканей кури­ного ностики аллергических заболеваний и успешной
эмбриона, у больных с пищевой аллергией к реабилитации больного требуются тщательно
яйцу. Также установлено наличие перекрестных собранный анамнез, комплексное обследование

58
ОБМЕН ОПЫТОМ

с привлечением современных методов in vi- льтаты нужно сравнить с данными анамнеза


tro с учетом возраста, особенностей клиники для подтверждения клинической значимости
заболевания, правильный выбор спектра аллер­ выявленной сенсибилизации.
генов. Полученные в ходе обследования резу­

ЛИТЕРАТУРА

1. Абдуллаева Д.Г. Перспективы in vitro диаг­ 5. Новик Г.А., Ткаченко М.А. Гастроинтестиналь­
ностики пищевой аллергии в Узбекистане ные проявления пищевой аллергии у детей
// Российский аллергологический журнал. // Лечащий врач. 2012. №  1. С.  16–24.
2016. №  1. С.  2–4. 6. Brehler R., Theissen U. «Latex-fruits syndrome»:
2. Колхир П.В. Доказательная аллергология — frequency of cross-reacting IgE antibodies // Al-
иммунология. — М.: «Практическая медици- lergy. 1997. Vol. 52. P.  404–410.
на». 2010. 528  с. 7. Breitender H., Ebner C. Molecular and
3. Лусс Л.В., Сидорович О.И., Успенская К.С. biochemical classification of plant-derived food
Проблемы пищевой аллергии в гастроэнте- allergens // J.  Allergy Clin. Immunol. 2000. Vol.
рологии // Лечащий врач. 2007. №  4. С.  6 8– 106. P.  27–194.
73. 8. Holme S.A. Asthma, latex hypersensitivity and po-
4. Мачарадзе Д.Ш., Беридзе В.Д. Аллергия к tatoes // Contact. Dermatit. 2000. Vol. 43.1. P.  54.
домашним животным: особенности диаг­ 9. World Allergy Organization (WAO). Diagnosis
ностики и лечения // Лечащий врач. 2009. and Rationale for Action against Cow_s Milk Al-
№  11. С.  72–74. lergy (DRACMA) Guidelines // Pediatr Allergy Im-
munol. 2010. Vol. 21 P.  1–125.

УДК:616.5-002.525.2-074/078

ҚИЗИЛ ЮГУРУК КАСАЛЛИГИНИНГ ЛАБОРАТОРИЯ ДИАГНОСТИКАСИ

Э.Х. Эшбоев, С.С. Умаров, С.Э. Эшбоев

Республика ихтисослаштирилган дерматология ва венерология


илмий-амалий тиббиёт маркази

РЕЗЮМЕ
Лабораторная диагностика красной волчанки
Э.Х. Эшбоев, С.С. Умаров, С.Э. Эшбоев
В статье описана лабораторная диагностика красной волчанки, дан анализ методов лабораторной
дигностики, используемых в практике.
Ключевые слова: красная волчанка, LE-клетки, лабораторная диагностика.

S UMMARY
L aboratory diagnosis of l upus erythematos us
E.H. Eshbaev, S.S. Umarov, S.E. Eshbaev
On this article described laboratory diagnosis of lupus erythematosus. Data was analized and methods of
laboratory diagnosis in practice.
Keywords: lupus erythematosus, LE-cell, laboratory diagnosis.

ХУЛОСА
Қизил югурук касаллигининг лаборатория диагностикаси
Э.Х. Эшбоев, С.С. Умаров, С.Э. Эшбоев
Мақолада терининг тизимли касалликларидан бўлмиш қизил югурук хасталигининг лаборатория
диагностикаси баён қилинган. Шу билан биргаликда амалиётда ишлатилаётган услубларнинг
таҳлили берилган.
Калит сўзлар: қизил югурук, LE-ҳужайралари, лаборатория диагностикаси.

59
Дерматовенерология и эстетическая медицина № 2 / 2016

Қизил югурук (Lupus erythematos) этиоло­


гияси аниқланмаган ва мураккаб пато­
генезга эга бўлган системали касалликдир.
беморларнинг қон зардоби таркибида LE
ҳужайралар, ревматоид омил, шу билан бирга-
ликда ДНК, РНК га қарши кўплаб антитаначалар-
Яна айтиш жоизки, бу касалликка чалинган нинг топилиши асосий диагностик манбалардан
беморлар қуёш нурига ёки аксинча совуққа ўта ҳисобланади.
сезувчанлиги билан ажралиб туради. Касаллик Касалликнинг клиник кечиши икки хил кўри­
белгилари полиморф кечади ва айнан терининг нишга ажратилади. Биринчи хили — сурункали
қуёш тегадиган очиқ жойларида авж олади.(1) қизил югурук. Унга халқасимон (дискоид) ва
Касалликни дастлаб 1827 йилда P.  Royer «flux тарқалган (диссеминирлашган) хил­лари киради,
sebace» номи билан таърифлаб берган. Орадан иккинчи хили — ўткир (системали) қизил югурук.
йигирма тўрт йил ўтгандан (1851 йил) сўнг Айрим олимлар ўткир ости хилини ҳам тафовут
A.Cazqenave ушбу касалликни чуқурроқ ўрганиб қилишади.
«қизил югурук» номини берган. Кейинчалик каса­ Лаборатория диагностикаси. Дискоид ва
ллик жуда кўп олимлар томонидан ҳар қанақа диссеминирлашган қизил югурукда касалликнинг
бошқа номлар («эритематоз», «чан­диқланувчи теридаги тошма элементлари клиник манзара
эритематоз») билан аталмасин, A.  Caz­qenave сифатида шунчалик кўзга ташланадики, бу
берган «қизил югурук» атамаси тиббиёт олим­ албатта мутахассиснинг ишини анча енгиллаш­
лари орасида муҳрланиб қолди. тиради. Булар эритема, фолликуляр гиперкератоз
1872 йилда M.Kaposi касалликнинг икки хил ва чандиқли атрофия каби ўзига хос типик
клиник кўриниши борлигини, биринчиси — оғир белгилардир. Офтоб нурига ёки аксинча изғирин
системали ўткир кечувчи ва сурункали хили бор- шамол ва совуққа ҳаддан зиёд сезгир бўлиб
лигини исботлаб берган. Қизил югурукнинг одам- қолиш (инсоляция, УФ-нурланиш, совуқ уриши,
лар орасида нақадар тарқалганлиги жуда кўп ҳар хил шикастланишлар ва б.) касалликни
олимлар томонидан ўрганилган, у барча дерма- қўзғатадиган омиллардан ҳисобланади.
тозларнинг 1,4–1,8  % ни ташкил қилади. [2, 3] Лаборатория тадқиқот натижаларидан анемия,
Замонавий тушунчаларга қараганда, қизил лейкопения, лимфопения, гипергаммаглобули­
югурукнинг патогенези ўта мураккаб жараённи, немия, гипергаптоглобулинемия, ЭЧТ нинг юқори
жумладан иммун, ирсий, метаболитик, бўлиши, ядрога қарши антитаначаларнинг ва
нейроэндокрин ва экзоген омилларни ўз ичига LE-ҳужайраларининг топилиши ташхисни аниқ
олади. қўйишда катта аҳамиятга эга. Ундан ташқари,
Қизил югурукнинг пайдо бўлишида қонни Вассерман реакциясига текшириш зарур.
қуйидагиларни эътиборга олиш зарур: Бунда захмга текшириладиган реакциялар (РИТ,
—  аксарият навқирон ёшда учрайди; РИФ, РИБТ) манфий, аксинча Вассерман реакци-
—  аёллар кўпроқ касалланади; яси эса (комплементни боғлаш реакцияси +1+2)
—  ирсий омилнинг аҳамияти бор; кучсиз мусбат чиқади. Ушбу реакцияларнинг нати-
—  порфирин алмашинувидаги жаларини таҳлил қилиш жараёнида беморнинг 6
ўзгаришларнинг таъсири бор; ой давомида захмга чалинмаганлигини эътиборга
—  ультрабинафша нурлар таъсири; олиш керак бўлади.
—  аутоиммун жараён. Тўғри умум клиник тадқиқотлардан ЭЧТ,
Ҳозирги пайтда қизил югурук бириктирувчи серомукоид, фибриноген ва альфа, гаммагло­
тўқималарнинг диффуз зарарланиши билан булинлар миқдорини аниқлашнинг ташхисотда
кечадиган касалликлар гуруҳига киритилган. аҳамияти катта, албатта. Айниқса, фаол яллиғ­
Унинг асосида эса ўзининг антигенларига ланиш жараёни билан кечаётган вазиятларда
иммунологик толерантликни йўқотиш ётади. ушбу лаборатория изланиш натижалари шифокор­
Айниқса, қизил югурук билан касалланган нинг кўмакчисига айланади.

Системали қизил югурукнинг фаоллик кўрсаткичлари


№ Тадқиқотнинг номи I II III
(енгил) (ўртача енгил) (оғир)
1 Гемоглобин, г/л 12 ва ундан ортиқ 10–11 10
2 ЭЧТ, мм/соат 16–20 30–40 45 ва ундан ортиқ
3 Фибриноген 0,5 0,5 0,6
4 Умумий оқсил 9 8–9 7–8
5 Альбумин 48–60 40–45 30–35
Глобулин: α-альфа 10–22 11–12 13–17
6
γ-гамма 20–23 24–25 30–40
7 LE-ҳужайралари (1000 та лейкоцитга) 0–1 1–2 5 ва ундан юқори
8 Антинукляр омилнинг титри 1:32 1:64 1:128 ва ундан
юқори
9 Ёритиш типи гомогенли гомогенли ва қиррали қиррали

60
ОБМЕН ОПЫТОМ

Беморларнинг ярмидан кўпида лейкопения Лаборатория амалиётида қизил югурук LE-


аниқланади ва унинг миқдори 1,2×109 г/л даражага- ҳужай­раларини аниқлашнинг бир қанча усуллари
ча тушади, лейкоформулада промиелоцит, миело- мавжуд.
цит ва метамиелоцитлар пайдо бўлади, ҳатто лим- Цинкхам ва Қонли усули. Новоселова то­
фопения (5–10  % лимфоцитлар) кузатилади. Жа- мо­нидан модификация қилинган. Услуб юма­
раённинг фаоллиги билан боғлиқ равишда баъзан лоқ шишадан тайёрланган мунчоқлар билан
гипохром анемия ташхиси қўйилади. Стероид қонни қаттиқ чайқатиб аралаштиришга асос­
препаратларни кўп қабул қилиш оқибатида меъда ланган. Мақсад, иложи борича қоннинг тарки­бида
яраси пайдо бўлиб, ундан қон кетиши мумкин. юзага келган гомоген таначаларни лейко­цитлар
Натижада камқонлик янада ривожланади. Жигар томонидан фагоцитоз қилинишини фаоллаштириш.
етиш­мовчилиги ва тромбоцитопения вужудга Натижада бўялган препаратларда LE-ҳужайра­
келиши кузатилади. Геморрагик синдром, айрим ларини аниқлаш тезлашади.
пайт­ларда ҳатто Кумбс реакцияси мусбат бўлиб, Керакли идишлар, реактивлар ва аппарату­
гемолитик анемия ривожланади. Ушбу берилган ралар. 1) 10 мл шприц; 2) эни 18–20 мм ли про­
маълумотларнинг барчасини даволовчи шифокор бирка ва унинг учун резина тиқин; 3) 3–4 мм
иш жараёнида эътиборга олиши керак. катталикдаги 6–8 та юмалоқ мунчоқсимон шиша­
1948 йили олимлардан Харгрейвс, Ричмонд ва чалар (рус, бусинки); 4) Пипеткалар; 5) Центри­
Мартон, 1949 йили Хезерк қизил югурукка чалин- фуга пробиркалари; 6) Дақиқасига 1000 марта
ган беморларнинг қонидан ўзига хос гомоген тана- айлантирадиган центрифуга; 7) Буюм ва ёпқич
чаларини топишга муваффақ бўлишди. Кейинча- ойналар; 8) Суртмалар ва пробиркалар учун
лик бу таначалар люпус эритематоз ҳужайралар алоҳида штативлар; 9) Оксалат натрий; 10) 96° этил
деб номлана бошланди. Ушбу ҳужайраларнинг спирти; 11) Романовский-Гимза бўёғи; 12) Микроскоп.
вужудга келишини назарий жиҳатдан қуйидагича Услубни бажариш техникаси. Беморнинг
тушунтириш мумкин. Қандайдир номаълум экзо- вена томиридан эрталаб оч қоринга 8–10 мл қон
ген ёки эндоген омиллар таъсирида қизил югурук- олинади ва натрий оксалат солинган пробир-
ка чалинган беморларнинг қонидаги айрим лейко- кага қуйилади. Қонни олиш ва қуйиш вақтида
цитларнинг ядроси зарарланади. Бир қанча вақт кўпик ва гемолиз бўлишига йўл қўймаслик ло-
ўтгандан сўнг худди шу лейкоцитларнинг ядроси зим. Пробирканинг оғзи резина тиқин билан
шишади ва юмалоқ шаклга ўтади. Ядро ичидаги маҳкам беркитилади, сўнгра пробиркани у ёқ,
хроматин иплар парчаланиб кетади. Аста-секин бу ёққа ағдариб пробирка ичидаги натрий ок-
зарарланган лейкоцитлар ўзининг мутлоқ струк- салат эритмаси билан қон яхшилаб аралаш-
турасини йўқотади, уларнинг ўрнида юмалоқ тирилади ва 1–1,5 соатга хона ҳароратида
пуштинамо қизил аморф массали гомоген тана- тинч сақланади. Кейин пробирка ичига 3–4 мм
чалар вужудга келади. Кейинчалик бошқа лей- катталикдаги 6–8 та мунчоқсимон шишачалар
коцитлар ушбу таначаларни «бегона» сифатида солинади. Сўнгра резина тиқин билан пробирка
қабул қилади ва уларга қарши фагоцитоз жараёни оғзи маҳкам беркитилади. Ўнг қўлнинг бош
бошланади. Фагоцитозда битта ёки бир нечта бармоғи билан резина тиқин маҳкам босилган
лейкоцитлар қатнашиши мумкин. Агарда бир не- ҳолда пробирка худди маятниксимон ҳолатда
чта лейкоцитлар келиб таначани фагоцитоз қилиб 30 дақиқа давомида чайқатилади. Сўнг зардоб
қамраб олса ҳар томонлама ярим халқали струк- ҳосил бўлгунча хонада қолдирилади. Кейин
тура, яъни «розетка» юзага келади. Дерматоло- зардоб тоза пипеткада сўриб олинади ва цен­
гияда бу ҳужайралар LE-ҳужайралар (LE-lupus трифуга пробиркасига солиниб, 5 дақиқа да­
erythematodes) деб аталади. Erytema — қизил, вомида центрифугада айлантирилади. Ҳосил
lupus — югурук деган маънони англатади. (1–2 бўлган чўкмадан бир нечта (4–6 та) суртмалар
расмларга қаралсин). тайёрланади, улар спиртда фиксация қилиниб,

1 расм. LE — ҳужайраси (ўртада ўнгда тасвирланган). 2 расм. LE — ҳужайралари (ўртада тасвирланган).


Романовский — Гимза бўёғи. Кат. 100×10 Романовский — Гимза бўёғи. Кат. 100×10

61
Дерматовенерология и эстетическая медицина № 2 / 2016

сўнгра Романовский-Гимза усулида 15–20 дақиқа Мутахассис синчиклаб оқиш-қизил ёки


давомида бўялади. Препарат сувда ювилиб қизил-бинафша рангдаги юмалоқ шаклдаги
ташланади ва қуригандан сўнг иммерсион гомоген элементларни қидириш лозим. Улар
тизимда кўздан кечирилади. доим лейкоцитлар орасида якка-якка бўлиб
Химмер-Харчейс усули. Тоза, қуруқ оддий жойлашади.
пробиркага беморнинг билак венасидан 8–10 Гомоген элементлар алоҳида жойлашиши
мл қон олинади. Одатда, қон эрталаб бемор ҳам мумкин, лекин уларни битта-иккита ёки уч-
овқатланмасдан олдин оч қоринга олиниши тўртта лейкоцитлар фагоцитоз қилмоқчи бўлиб
керак. Олинган қон 5–10 дақиқа давомида ўраб олган шаклларига кўзингиз тушади. Ушбу
1000 маротаба айланадиган тезликда центри­ феномен LE-ҳужайралар дейилади. Бир пайтда
фугаланади. гомоген элементни тўрт томондан лейкоцитлар
Ажралиб чиққан оч-сариқ рангдаги зардоб қамраб олган бўлса ўхшатиш сифатида
бошқа идишга қуйилади, пробирка остидаги «розеткасимон» LE-ҳужайралар деб аташ одат
тўқ қизил рангдаги қуюқ эритроцитар масса эса бўлган (рангли расмларга қаралсин).
майда металл тўрдан чинни (форфор) болғача Юқорида таъкидлаганимиздек, бир хил
билан эзиб ўтказилади. Ушбу муолажа тўғридан- тусдаги гомоген элементлар кўрув майдони
тўғри чинни косача устида амалга оширилади. бўйлаб алоҳида жойлашган бўлса, демак уларни
Металл тўрдан эзиб ўтказилган қон массаси ҳали лейкоцитлар қамраб олмаган этап деб
қайтадан эни 8–10 мм ли агглютинацион 2 ҳисоблаш керак. Лекин бундай элементларни
та пробиркаларга қуйилади ва 5–10 дақиқа Тарта ҳужайраларидан (Тарта — шу касаллик
центрифугада айлантирилади. Сўнгра пробир­ билан оғриган беморнинг исми) фарқлай
калар устида пайдо бўлган қон зардоби резина билиш зарур. Дарҳақиқат, Тарта ҳужайралари
нокчали пипетка билан сўриб олиб ташланади. ҳам полиморфядер лейкоцитлар ядросининг
Шу жойда таъкидлаш жоизки, пробиркалар­ бўлакчаси бўлиб, улар таркибида хроматин
даги қон зардоби билан эритроцитар масса ипчалар ва ядро структураси сақланиб қолади.
оралиғида юпқа лейкоцитар қоплам (плёнка) Улар LE-ҳужайралар каби гомоген массали бир
вужудга келади. Ушбу лекоцитар қоплам пип­ хил тусга ўтмайди.
текада жуда эҳтиётлик билан сўриб олинади LE-феномен кучли бўлганда ва препаратлар
ва улардан 4–6 та суртма тайёрланади. Пре­ сифатли тайёрланса, суртмаларнинг ҳар кўрув
паратлар Романовский-Гимза услубида 15–20 майдонида 1–2 та қизил югурук ҳужайраларини
дақиқа давомида бўялади, сўнгра иммерсион топиш мумкин. Аммо элементлар онда-сонда
тизимда кўздан кечирилади. учраб қоладиган ва эркин ётган овал шаклдаги
Суртмалар худди лейкоформула учун тайёр­ аморф элементларга қараб мусбат натижа
ланадиган қон препаратлари каби тайёрла­ бериш ярамайди. Фақатгина суртмаларда жуда
нади. Одатда суртмалар Романовский услубида кўп кўрув майдонини шошилмасдан кўздан
бўялганда лаборатория хоналарида ҳарорат кечирибгина хулоса бериш мумкин.
эътиборга олиниши керак. Хоналар ҳарорати Баъзан бўялган препаратларни микроскопда
18–24°С атрофида бўлса суртмалар 20–30 дақи­ кузатганимизда, авваламбор LE-ҳужайралар
қагача бўялади. топилмайди, аксинча лейкоцитларнинг ичида
LE-ҳужайраларининг топилиш кўрсаткичи фагоцитоз қилинган кокклар, таёқчалар ҳатто
юқори фоизларда бўлиш учун мутахассис спорали микроорганизмларга кўзимиз тушади.
препаратларни тайёрлаш чоғида қуйидагиларга Бу ҳолатни шундай таърифлашимиз мумкин.
амал қилиш керак: қон топшириш эрталаб оч Биринчидан, қон тоза стерилланган пробир­
қоринга амалга оширилади; 8–10 мл ҳажмда каларга олинмаган ёки лаборатория идишлари
олинган қонни узоғи билан ярим соат ичида стерилланмаган бўлиши мумкин; иккинчидан
лабораторияга етказиш лозим; Шу давр муолажа хонасида ёки палатада олинган қон бир
мобайнида бемордан олинган қон тоза қилиб неча соат, баъзан бир неча кун давомида очиқ
ювилган стерил оғзи ёпиқ ҳолатдаги пробиркада ҳолда қолиб кетган бўлиши мумкин. Дарҳақиқат,
сақланиши керак; хона ҳароратини инобатга бемордан қон олингандан сўнг 80–90 дақиқа «in
олиш ҳам мақсадга мувофиқдир. vitro» шароитида фагоцитоз давом этади. Шунинг
Препаратлар микроскопияси: Бўялган учун лаборатория таҳлил натижалари сифатли
препаратлар бир четлама, аввал юпқа жойидан, ва ишонарли бўлишини таъминлаш мақсадида,
кейинчалик қалин жойлари кўздан кечирилади. яъни LE-ҳужайраларини тўғри ва самарали
Агарда, препарат тўғри тайёрланган бўлса, унда аниқлаш учун текширилиши керак бўлган қон шу
лейкоцитлар сони жуда юқори бўлиши лозим. заҳоти лабораторияга етказилиши ҳамда таҳлил
Дастлаб микроскопнинг х40 катталигидаги ишларини бошлаш керак. Акс ҳолда кутилган
объективи билан лейкоцитларнинг тўп-тўп бўлиб натижа олинмайди.
жойлашган қисми аниқлаб олинади, кейин ×90 LE-ҳужайраларини аниқлаш амалиётида энг
(ёки ×100) объектив билан иммерсион тизимда мақбул ва ҳаммабоп информатив услуб ҳисоб­
кўздан кечирилади. ланади. Ўткир системали қизил югурукда LE-
62
ОБМЕН ОПЫТОМ

ҳужайраларининг топилиши 40–95  % гача етади. Ревматологик касалликларда LE-ҳужайралар­


Яна айтиб ўтиш керакки, суяк кўмигининг пункта- нинг аниқланиш даражаси 0,8–1,0  % дан
тида, оқсилли суюқликлар (эксудат, зарарланган ошмайди. Қизил югурукнинг тери формаларида
буйраклардан ажратилган оқсил ) таркибида ҳам ҳам LE-ҳужайралар кам топилади. Масалан, Ки­
бўлиши мумкин. се­лева  М.Л. LE-ҳужайраларни диссерминир­лаш­
Насонова В.А. нинг тадқиқотларида касаллик ган хилида — 25  %, дискоид хилида — 6  %, сис­
системали қизил югурукнинг оғир фаол формасига темали хилида эса 73,2  % беморларда то­пишга
чалинган беморларнинг 88  % ида, ўртача оғир муваффақ бўлган.
хили билан касалланганларнинг 65  % ида ва LE-ҳужайралар камдан-кам ҳолларда плазма-
енгил кўринишдаги беморларнинг 15–20  % ида цитомада, жигарнинг оғир зарарланишида, ўткир
LE-ҳужайралар аниқланган. Hills F. нинг фикрича, лейкозда, ўткир ревматизмда, эритродермияда,
LE-ҳужайраларнинг лаборатория изланишларида миллиар силда, пернициноз ва гемолитик анеми-
топилиши қизил югурук ташхисини тасдиқлайди, яда, тугунли периартрит ҳамда тромбоцитопеник
лекин уларнинг аниқланмаслиги клиник диагнозни пурпурада ҳам топилиши мумкин.
инкор қилмайди.

АДАБИЁТЛАР

1. Клиническая дерматовенерология. Под ред. 3. Ошибки в лабораторной диагностике. Под


Скрипкина Ю.К., Бутова Ю.С. — М.: «ГЭОТАР». редакцией Громашевской Л.Л. — Киев: «Здо-
2009. 720 с. ровье». 1990. 262 с.
2. Неменова Ю.М. Методы лабораторных клини­
ческих исследований. — М.: «Медицина».
1972. 420 с.

УДК: 616.993.162-085.26

Результаты внедрения комплексного метода терапии


кожного лейшманиоза

З.М. Абидова, Т.А. Набиев, О.В. Извекова, А.А. Розиков,


Х.Т. Исраилов, С.С. Салиходжаева

Республиканский специализированный научно-практический медицинский центр


дерматологии и венерологии МЗ РУз

ХУЛОСА
ТЕРИ ЛЕЙШМАНИОЗИНИ КОМПЛЕКС ДАВО УСУЛИНИ ҚЎЛЛАШ НАТИЖАЛАРИ
З.М. Абидова, Т.А. Набиев, О.В. Извекова, А.А. Розиков, Х.Т. Исраилов, С.С. Салиходжаева
Мақолада терилейшманиози (Боровский касаллиги) нинг Ўзбекистон Республикасининг эндемик
ҳудудларида комплекс давоусулиниқўллашнатижаларикелтирилган.
Калит сўзлар: лейшманиоз, Боровский касаллиги, давоусули, гозалидон.

S UMMARY
THE RES ULTS OF THE IMPLEMENTATION OF THE COMPLE X METHO D OF TREATMENT
OF C UTANEO US LEISHMANIASIS
Z.M. Abidova, T.A. Nabiev, O.V. Izvekova, A.A. Rozikov, X.T. Israilov, S.S. Salikhodjaeva
This article provides information about the results of the implementation of the complex method of therapy
of cutaneous leishmaniasis (disease Borovskogo) in endemic areas of the Republic of Uzbekistan.
Keywords: leishmaniasis, Borovskiy’sdisease, method of therapy, gozalidon.

РЕЗЮМЕ
РЕЗУЛЬТАТЫ ВНЕДРЕНИЯ КОМПЛЕКСНОГО МЕТОДА ТЕРАПИИ КОЖНОГО ЛЕЙШМАНИОЗА
З.М. Абидова, Т.А. Набиев, О.В. Извекова, А.А. Розиков, Х.Т. Исраилов, С.С. Салиходжаева
В статье приведены данные о результатах внедрения комплексного метода терапии кожного
лейшманиоза (болезни Боровского) в эндемических районах Узбекистана.
Ключевые слова: лейшманиоз, болезнь Боровского, метод терапии, гозалидон.

63
Дерматовенерология и эстетическая медицина № 2 / 2016

К ожный лейшманиоз, или болезнь Боровского


(син.: кожный лейшманиоз Старого Света —
болезнь Боровс­кого; кожный лейшманиоз Нового
Leishmania (тельца Боровского) относятся
к простейшим — Protozoa. Возбудители забо-
левания попадают в организм человека при
Света — аме­риканский кожный лейшманиоз; укусах его переносчиками — кровососущими
висцеральный лейшманиоз — кала-азар) — москитами флеботомусами (только самками)
трансмиссивное, протозойное заболевание с Phlebotomus papatasii, sergenti. В мире известно
эндемическим рас­прост­ранением в странах с более 600 видов москитов, однако полагают,
жарким, тропи­ческим и субтропическим климатом что 70 видов из них могут участвовать в пере-
[1, 2, 3]. даче лейшманий. Москиты встречаются во
В настоящее время лейшманиозы распрост­ всех частях света в зоне тропиков и субтро-
ра­нены в 80 странах субтропического и тропи­ пиков. В западном полушарии они обитают во
ческого поясов. По данным ВОЗ, по распрост­ влажных тропических лесах, в восточном — в
раненности они занимают одно из первых мест пустынной и полупустынной зонах. Передача
среди заболеваний паразитарной этиологии. В от одного хозяина к другому осуществляется с
Узбекистане КЛ является одной из распростра- помощью кровососущих москитов, где в желу-
ненных природно-очаговых болезней, имеющих дочно-кишечном тракте москита лейшмании
большой удельный вес в краевой патологии ре- находятся в промастиготной (жгутиковой) стадии,
спублики. В эндемических зонах Узбекистана откуда, попадая в организм человека, переходят
(Бухара, Кашкадарья, Джизак, Сурхандарья, в амастиготную (безжгутиковую) стадию. Тельца
Каракалпакстан) также отмечается довольно Боровского, будучи внутриклеточными паразита-
высокое распространение зоонозного кожного ми, часто располагаются в протоплазме макро-
лейшманиоза, где ежегодно регистрируются де- фагов (гистиоцитов), в которых хорошо окраши-
сятки новых случаев данного заболевания [5, ваются по методу Рамоновского–Гимзе [2, 3, 4].
6]. В различных географических зонах разные Классификация кл (по Фицпатрику Т., 1999  г.):
серотипы лейшманий вызывают поражение • кожный лейшманиоз Старого Света:
кожи, слизистых оболочек и внутренних ор­ —  антропонозный кожный лейшманиоз (го­
ганов. В очагах этой болезни нередко воз­ родской, сухой, поздно изъязвляющийся), раз­
никают крупные вспышки с поражением 60– но­вид­ность — туберкулоидный кожный лейш­
90  % неиммунизированных людей. При этом маниоз;
значительная часть заболевших (до 30  %) —  зоонозный кожный лейшманиоз (сельский,
теряет трудоспособность, иногда на длительный влажный, остронекротизирующийся);
срок, что приносит государству большой эконо­ • лейшманиоз Нового Света:
мический ущерб [7]. Существующие методы —  кожный лейшманиоз Нового Света;
борьбы с кожным лейшманиозом, направленные —  кожно-слизистый лейшманиоз;
на истребление резервуаров возбудителя и —  диффузный кожный лейшманиоз;
переносчиков, трудоемки, требуют значительных • висцеральный лейшманиоз.
материальных затрат и не всегда дают Клиническая форма заболевания определяет­
желаемый эффект. Рост заболеваемости, уве­ ся видом возбудителя.
ли­чение частоты осложнений, отсутствие совре­ Возбудителями КЛ Нового Света являются
менной диагностики делают эту проблему Leishmaniamexicana (язва Чиклеро), Leishmania­
актуальной, многие вопросы, касающиеся пато­ amazonensis (амазонский лейшманиоз), Leish­ma­
генетических аспектов, диагностики, лечения niavenezuelensis, Leishmanialainsoni, Leishma­niape­
и профилактики КЛ остаются нерешенными ruviana (Ута), Leishmaniacolombiensis, Leishma-
[5, 6, 8]. В частности, отсутствуют высо­коэф­ ­niaguyanensis (лесная фрамбезия); кожно-сли­
фективные методы не только амбулатор­ного, но зистого лейшманиоза — виды лейшманий, отно-
и стационарного лечения [9]. Как свидетельству- сящиеся к подроду Viannia: Leishmaniabrasiliensis
ют материалы Всемирной организации здраво- (эспундия), Leishmaniapanamensis, Leishmania­
охранения, из-за относительной токсичности guyanensis; диффузного кожного лейшманио-
и необходимости длительного назначения ни за — Leishmaniapifanoi (Венесуэла), Leishmania­
один из применяющихся для лечения КЛ пре- amazonensis (Бразилия, остров Гаити), Leish­ma­
паратов не удовлетворяет практическое здра- nia­mexicana (остров Гаити), Leishmaniaaethiopica
воохранение [10]. Применяемые в настоящее (Африка); висцерального лейшма­ниоза — Leish­
время специфические препараты для лечения maniadonovani, Leishmaniain­fantum, Leishma­nia­cha­
кожного лейшманиоза в Узбекистане не заре­ gasi.
гистрированы. Поэтому изучение различных Дифференциальная диагностика. Укусы насе­
вопросов, связанных с кожным лейшманиозом, с комых, импетиго, фурункул, карбункул, эктима,
последующей разработкой научно обоснованных сибирская язва, контагиозный пустулезный дер-
эффективных методов терапии и внедрение их матит, ложная коровья оспа, туляремия, грану-
в практическое здравоохранение имеет обще­ лема купальщиков, туберкулез кожи, третичный
государственное значение. сифилис (гумма), фрамбезия, споротрихоз, се-
64
ОБМЕН ОПЫТОМ

вероамериканский бластомикоз, лепра, миаз, Цель работы. Внедрение комплексного пато­


контагиозный моллюск, бородавки, телеанги- генетического метода лечения кожного лейш­
эктатическая гранулема, флегмона, рожа, язва маниоза в спе­циа­лизированные кожно-вене­
Бурули, гранулематоз Вегенера, кератоакантома, рологические учреж­де­ния некоторых эндеми­чес-
туберкулезная волчанка, дискоидная красная ­ких регионов Узбекис­тана (Бухарская, Джизакс­
волчанка базальноклеточный и плоскоклеточный кая, Кашкадарь­инс­кая области).
рак кожи, метастазы в кожу, лимфомы, лейкоз [1, 3]. Материал и методы исследования. Прове­
Лечение. В настоящее время в общей терапии дено лечение разработанным патогенетическим
КЛ используются препараты сурьмы (сурьмя­ методом 55 больным кожным лейшманиозом
нокислый меглумин, стибоглюконат натрия), ряд в возрасте от 2 до 65 лет (в Шахрисабзском
антибактериальных препаратов (мономицин, городском КВД и КВД Кашкадарьинской об­
мета­циклин, доксициклин, рифам­пицин и др.), ласти  — 25 больных, Джизакском ОКВД — 20
аро­мати­ческие ретиноиды (роак­к утан, тигазон), больных и Бухарском ОКВД — 10 больных). Из
кетоконазол, делагил и др. В упорных случаях них 24 — дети до 14 лет, 30  (54,5  %) — лица жен-
клинического течения применяется амфотери- ского пола и 25  (45,5  %) — мужского. Количество
цин В или пентамидин в сочетании с препаратами язв варьировало от 1–3 до 5 и более очагов. У
интерферона [9, 11, 12]. В иммунотерапии детей язвы локализовались на открытых участ-
заболевания исполь­зуется введение БЦЖ в ках тела, в основном на коже лица, в области
смеси с убитыми промастиготами, вакцинация носа, щек, у взрослых — на коже нижних и верх-
рекомбинантной БЦЖ, экспрессирующей поверх­ них конечностей. У 9  (16,4  %) больных по ходу
ност­ный антиген лейшманий [8]. В местной тера- лимфатических сосудов наблюдался симптом
пии применяют крио-, лазерную, ультразвуковую четок. У одного больного установлена осложнен-
терапию, хирургическое иссечение, электрокоагу- ная форма — металейшманиоз (туберкулоидная
ляцию, смазывание очагов смесью паромомицина форма лейшманиоза). В Джизакской области
и метилбензетония хлорида, примочки с дезин­ и в г. Шахрисабзе Кашкадарьинской области
фицирующими растворами, анилиновые краси­ диагностирована антропонозная форма заболе­
тели, антисептические мази, содержащие корти­ вания с длительностью от 3–4 до 9 месяцев.
косте­роиды, а также препараты, ускоряю­щие эпи­ В Бухарской области установлена зоонозная
те­лизацию и рубцевание язв. форма с давностью заболевания от 2–3 недель
На сегодняшний день медикаментозная до 4–5 месяцев. Бугорковая стадия кожного
профи­лактика лейшманиоза не разработана лейшманиоза отмечалась у 49  % и язвенная ста-
[10, 13, 14]. Одной из важных проблем в дерма­ дия у 51  % больных. При микробиологическом ис-
то­логии является поиск эффективных, мало­ следовании у 49  (89,1  %) больных в очагах пора-
токсичных средств и методов терапии КЛ, так жения найдены тельца Боровского.
как препараты пятивалентной сурьмы (стибоглю­ Наблюдения показали, что с антропонозной
конат натрия (стибофен, стибенил), меглю­мина формой КЛ (45 больных) у 23 отмечена бугор­
антимонат (глюкантим, пентоксам)) имеют ряд по- ковая стадия заболевания, у 22 — бугорково-
бочных действий (кардио-, гепато-, нефро­токсич­ язвенная. Характерным явилось то, что всего
ность и др.). у 10 из 45 больных с антропонозной формой
Профилактика предусматривает проведение отмечался специфический лимфангоит или лим­
комплекса дератизационных работ и затравку фаденит. У всех больных с сельским типом КЛ
мест выплода москитов в местах природной был представлен язвенными и ослож­ненными
очаговости. Большое значение имеют своевре- формами. Бугорки от машевого зерна до вишневой
менное выявление и лечение больных, примене- косточки имели ярко-красную окраску, кожа вокруг
ние индивидуальных средств защиты от моски- была окружена воспалительным валиком умеренно
тов [5, 6]. плотной консистенции. Лейш­маниозные язвы имели
В последние годы участились случаи атипич­ типичную картину раз­мером от 0,3×0,5 см до 1,5×2,0
ных и осложенных форм кожного лейшманиоза, см в диаметре и в 100  % случаев осложнялись
трудно подающихся существующим методам вторичной пио­кок­ковой инфекцией. Изъязвленные
лечения. Поэтому разработка и внедрение но­вых лейшма­ниомы без осложнений отмечались у 20
эффективных методов терапии будет способст­ (36,5  %) больных, с бугорками обсеменения, лим­
вовать предупреж­дению воз­никновения ослож­нен­ фан­гоитами и лимфаденитами — у 8 (14,5  %)
ных его форм и улуч­шит качество жизни па­циен­ больных, у остальных 27 (49  %) пациентов отме­
тов. чалась бугорковая стадия лейшманиоза. Коли­
На базе РСНПМЦ ДиВ за оставить 2012–2014  гг. чество очагов варьировало от одного до трех, что
разработан комплексный, патогенетический ме­ характерно для антропонозного лейш­маниоза. В
тод терапии кожного лейшманиоза (Уведомле­ одном случае установлена ослож­ненная форма
ние Агентства по интеллектуальной собст­вен­ КЛ — металейшманиоз (больной страдает лейш­
ности Республики Узбекистан от 22.08. 2014 г. маниозом в течение 12 лет) с проявлениями новых
№  IАР  201 40344). бугорковых элементов вокруг старого рубца.
65
Дерматовенерология и эстетическая медицина № 2 / 2016

Комплексный метод терапии включал непря­ 1-я группа (35 больных, группа сравне-
мое лимфатропное введение канамицина ния, или контрольная) получала антибиотики
сульфата 1,0×1 раз в сутки, №  5 –7 в сочетании (цефтриаксон, доксациклин) в виде внутримышеч-
с лидазой в дозе 32 ЕД и гозалидоном 0,1 по 2 ных инъекций или внутрь в соответствующих до-
табл. 3 раза в день 3-дневными циклами и с 3- зировках в течение 7–10 дней, наружно использо-
дневным перерывом (курс терапии составлял вались дезинфицирующие и противовоспалитель-
21 день). Для наружной терапии использован ные мази (дерматоловая, ихтиоловая и др.).
гель гиалуроната цинка (куриозин), обладаю- Во 2-й группе (55 больных) на фоне базисной
щий противовоспалительным, противоотечным и терапии был использован новый комплексный
ранозаживляющим эффектом. патогенетический метод терапии.
Результаты исследования. Больные были Критериями эффективности явились сроки
распределены на 2 группы в зависимости от уменьшения инфильтрата, очищения лейшма­
метода получаемой терапии. Группы были ре­ ниом от некротических и гнойных масс, элими­
пре­зентативные по возрасту, клиническим фор­ нации возбудителя из очагов поражения и
мам, длительности заболевания, что позволило полное разрешение лимфаденита.
получить объективные и достоверные резуль­ Установлено, что сроки очищения и заживления
таты. Контрольную группу составили больные, лейшманиозных бугорков и язв зависят от кли­
получавшие ранее лечение в трех областных нической формы и давности заболевания (табл. 1).
КВД.
Таблица 1
Сравнительные результаты проведенной терапии у больных КЛ

Лимфатропная терапия
Традиционная терапия
с гозалидоном
Клинические формы
лейшманиоза кол-во сроки начала кол-во сроки начала
больных, разрешения больных, разрешения
n = 35 лейшманиом, в днях n=55 лейшманиом, в днях
Бугорковые лейшманиомы 14 20,3 ± 1,15 27 15,1 ± 0,12*
Изъязвленные лейшманиомы
13 25,8 ± 1,21 20 18,6 ± 0,10*
без осложнений
Лейшманиомы с лимфангоитами
8 28,2 ± 2,18 8 19,4 ± 0,25*
и бугорками обсеменения

* Достоверность по сравнению с данными группы контроля (P<0,05).

Как видно из таблицы, лечение способст­ трольной группе заживление происходило на


вовало регрессу всех элементов с образованием 25,8 ± 1,21 и 28,2 ± 2,18 дни с момента лечения, то
поверхностной легкой рубцовой атрофии кожи, у больных, получавших комплексную терапию, на
причем лучший эффект был достигнут у боль­ 18,6 ± 0,10 и 19,4 ± 0,25 дни (Р < 0,05). То есть сроки
ных, получавших антибиотик «Канамицин» и заживления и регресса патологических элемен-
энзимный препарат «Лидаза» методом непря­ тов во 2-й группе больных сократились на 7,2 и 8,8
мой лимфатропной терапии в сочетании с гоза­ дней соответственно.
лидоном. Так, если у больных с осложненными Также проанализирована эффективность комп­
формами (изъязвленная и бугорки обсеменения лекс­ной терапии в зависимости от давности забо­
с лимфангоитами) кожного лейшманиоза в кон- левания (табл. 2).
Таблица 2
Зависимость срока рассасывания воспалительного процесса от давности заболевания

Лимфатропная терапия
Традиционная терапия
Давность с гозалидоном
заболевания, кол-во сроки рассасывания кол-во сроки рассасывания
в месяцах больных, воспалительного больных, воспалительного
n = 35 процесса, в днях n = 55 процесса, в днях
До 3 месяцев 10 18,5 ± 0,14 18 12,1 ± 0,12*
От 4 до 6 месяцев 16 20,3 ± 0,20 25 13,6 ± 0,10*
От 7 месяцев до года
9 25,8 ± 0,18 12 18,2 ± 0,15*
и более

* Достоверность по сравнению с данными группы контроля (P<0,05).

66
ОБМЕН ОПЫТОМ

Из таблицы видно, что сроки рассасывания преобладание городского типа забо­левания,


воспалительного процесса (очи­щение язв что необходимо учитывать при проведении
от некротических и гнойных наслоений) во эпидемиологических мероприятий в данных
многом зависят от давности патологического регионах. Одним из характерных особенностей
процесса, начатое лечение в срок заболевания современного течения кожного лейшманиоза
до 6 месяцев значительно укорачивает период является в большинстве случаев отсутствие
выздоровления. специфического лимфаденита, чаще при го­
При контрольном анализе в динамике родском типе заболевания. Внедрение нового
лечения у 91,4  % больных с язвенных элементов комплексного патогенетического метода лече­
тельца Боровского найдены не были, тогда как ния кожного лейшманиоза, особенно при его
у больных контрольной группы этот показатель осложненных формах, способствует повыше­нию
составил 76,7  %. терапевтической эффективности путем уско­
Внедрение комплексного метода терапии и рения сроков заживления язвенных элементов
клинические наблюдения за больными продол- и рассасывания воспалительных инфильт­­ра­тов,
жаются. а также более ранней элимина­ции возбудителя
Таким образом, проведенные исследования из очагов поражения. Это позволяет проводить
показали наиболее частую регистрацию сельс­ данный метод лечения в амбулаторных усло­
кого типа (зоонозный) кожного лейшманиоза виях, что в свою очередь показывает его клини­
в Бухарской области, а в г.  Шахрисабзе Каш­ ческую и экономическую эффективность.
кадарьинской области и в Джизакской области

Литература

1. Капкаев Р.А., Скрипкин Ю.К., Борисенко К.К. 8. Арустамян Т.А. О стойкости и продолжи-
и др. Справочник дерматовенеролога. — Т.: тельности иммунитета при кожном лейшма-
«Ибн Сина». 1992. С.  179–182. ниозе // Вестник дерматологии. 1965. №  5.
2. Скрипкин Ю.К., Бутова Ю.С. Клиническая С.  6 6–68.
дерматовенерология. — М.: «ГЭОТАР-Медиа». 9. Ваисов А.Ш. Применение коллаген-моно­ми­
Т.  1. 2009. С.  350–372. цинового комплекса в терапии остронекроти­
3. Фицпатрик Т., Джонсон Р., Вулф К., Полано М., зирующего кожного лейшманиоза. Автореф.
Сюрмонд Д. Дерматология. Атлас-справочник. дисс. к.м.н. — Ташкент. 1977. 16  с.
McGraw-Hill. Практика. 1999. С.  870–877. 10. Ваисов А.Ш. Применение лазеротерапии в
4. Данилов С.И., Нечаев В.В. Актуальные кожные комплексной терапии зоонозного кожного
инфекционные болезни тропиков. — С-Пб: лейшманиза // Новости дерматологии и вене-
ГМА им. Мечникова. 2001. С.  34–53. рологии. 2009. №  2. С.  13–14.
5. Шарипов М.К., Раззаков Ш.А., Краснонос 11. Аковбян А.А., Мухаммедов С.М. Лечение кож-
Л.Н. и др. Зоонозный кожный лейшманиоз ного лейшманиоза остронекротизирующегося
в Узбекистане и его профилактика // Меди­ типа мономицином // Вестник дерматологии.
цинская паразитология и паразитарные бо- 1968. №  1. С.  74–76.
лезни. 1987. №  1. С.  39–45. 12. Аляви С.Ф. Клинико-экспериментальное обо-
6. Краснонос Л.Н., Улематов А.И., Абдуллаев снование применения мази «Лешмицин» при
И.В. и др. Зоонозный кожный лейшманиоз и зоонозном кожном лейшманиозе. Автореф.
перспективы его профилактики в Узбекской дисс. к.м.н. — Ташкент. 2000. 24  с.
ССР // Медицинский журнал Узбекистана. 13. Koff A.B., Rosen T. Treatment of cutaqneou-
1978. №  10. С.  12–15. sLeishmaniasis // J. Amer. Acad. Dermatol. 1994.
7. Shahbasi F., Shababi S., Kasemi B. Evalution of Vol.  31. P.  693–708.
PCR assay in diagnosis and identification of cu- 14. Van der Snoek E., Robinson D., van Hellemond
taneous leishmaniasis: a comparison with the J. A review of photodynamic therapy in cutane-
parasitological methods // Parasitol. Res. 2008. ous leishmaniasis // J. Eur. Acad. Dermatol. Ve-
Vol.  103. P.  1159–1162. nerol. 2008. Vol.  14. P.  87–89.

67
Дерматовенерология и эстетическая медицина № 2 / 2016

УДК: 616.517-085.26

ОЦЕНКА ЭФФЕКТИВНОСТИ ЭРБИСОЛА В ТЕРАПИИ ПСОРИАЗА

С.Ф. Аляви

ООО «ГОСПИТАЛЬ DOCTOR D»

ХУЛОСА
ПСОРИАЗНИ ДАВОЛАШДА ЭРБИСОЛНИНГ САМАРАДОРЛИГИНИ БАҲОЛАШ
С.Ф. Аляви
Псориаз билан огриган беморларда «Эрбисол» дори воситасини қўллаш билан даволашнинг янги
усули биринчи бор амалга оширилган. Мақолада псориаз билан оғриган беморларни комплекс да-
волашда «Эрбисо»нинг клиник самарадорлиги курсатилган.
Калит сўзлар: псориаз, терапия, эрбисол.

S UMMARY
ESTIMATION OF EFFICIENCY «ERBISOL» IN THERAPY OF PSORIASIS
S.F. Alyavi
For the first time the new method of treatment of patients with psoriasis with medicine «Erbisol» is
developed. Clinical effects erbisol in complex therapy of patients with psoriasis are submitted in article.
Keywords: psoriasis, therapy, erbisol.

РЕЗЮМЕ
ОЦЕНКА ЭФФЕКТИВНОСТИ ЭРБИСОЛА В ТЕРАПИИ ПСОРИАЗА
С.Ф. Аляви
Впервые разработан новый метод лечения больных псориазом с использованием препарата «Эр-
бисол». В статье представлена его клиническая эффективность в комплексной терапии больных
псориазом.
Ключевые слова: псориаз, терапия, эрбисол.

Псориазу принадлежит одно из ведущих


мест в структуре дерматологической па-
тологии, его популяционная частота по данным
При распространенных формах псориаза ос-
новными средствами терапии остаются препа-
раты системного действия (небиологические), к
разных авторов составляет от 0,5 до 2,5  %, в вы- которым относятся ретиноиды, метотрексат, ци-
сокоразвитых странах — до 3  % [9, 18]. Вопросы клоспорин. Они продемонстрировали свою эф-
этиологии и патогенеза окончательно не выясне- фективность даже при тяжелых формах заболе-
ны и продолжают дискутироваться. Мультифак- вания [10, 13].
ториальная природа псориаза с участием гене- Кроме того, в ряде работ сообщается о вы-
тических и средовых факторов, аутоиммунный и соком уровне неудовлетворенности пациентов
системный характер развития с вовлечением па- традиционными схемами системного лечения и
тохимических механизмов в различных органах и развитии различных осложнений со стороны вну-
системах определяют клиническое разнообразие тренних органов [7, 15, 17].
течения заболевания. Препараты, обладающие иммунокорригиру-
К настоящему времени в литературе накопи- щим действием, находят широкое применение в
лись данные, свидетельствующие о серьезных терапии псориаза [1, 2, 3, 4, 5, 14].
сдвигах в иммунном статусе больных псориазом Данная работа посвящена оценке терапевти-
со стороны как иммунорегуляторных, так и имму- ческой эффективности лекарственного препара-
ноэффекторных звеньев, позволяющих рассма- та «Эрбисол» при лечении больных псориазом.
тривать эту проблему с точки зрения иммунопа- Эрбисол относится к иммуномодулирующим пре-
тологии [6, 16]. паратам, фармакологическая активность кото-
Современные данные указывают на то, что рого определяется содержанием в нем низкомо-
псориаз является прежде всего иммунозависи- лекулярных биологически активных пептидов (а
мым заболеванием. Одним из ключевых патоге- также гликопептидов, нуклеотидов и аминокис-
нетических звеньев при этом является поляри- лот), активизирующих природные, эволюционно
зация цитокинового профиля с преобладанием сформированные контролирующие системы ор-
провоспалительных цитокинов, продуцируемых ганизма, ответственные за поиск и устранение
клетками типа Th-1 [8, 11, 12]. патологических изменений. Эрбисол активизи-

68
ОБМЕН ОПЫТОМ

рует иммунную систему, ускоряет восстановле- симптомов: уменьшение и исчезновение зуда; от-
ние поврежденных и уничтожение аномальных сутствие свежих высыпаний; наличие гиперкера-
клеток и тканей. Основной иммуномодулирую- тоза и экссудации; сроки появления псевдоатро-
щий эффект препарата проявляется на уровне фического «ободка» Воронова. У всех пациентов
макрофагального звена, ответственного за репа- до и после лечения оценивали тяжесть заболе-
рацию поврежденных клеток и восстановление вания с использованием индекса PASI, снижение
функциональной активности органов и тканей, которого на 75–99  % трактовали как значитель-
а также на уровне N- и Т-киллеров, ответствен- ное улучшение, на 50–74  % — как улучшение, на
ных за уничтожение поврежденных клеток, не 25–49  % — как незначительное улучшение. На-
способных к регенерации, или аномальных кле- ряду с общеклиническим и рутинным биохимиче-
ток (мутантных, злокачественных, клеток-виру- ским обследованием у всех пациентов изучали
соносителей) и тканей. В то же время эрбисол иммунный статус в динамике.
обладает иммунокорректирующим действием В результате проведенной терапии в пер-
и при нарушениях иммунологического состоя- вой группе клиническая ремиссия достигнута в
ния способствует его нормализации, активируя 9  (24,3  %), значительное клиническое улучше-
Т-лимфоциты, Тh1-хелперы и Т-киллеры и инги- ние — в 12  (32,4  %), клиническое улучшение — в
бируя активность Тh2-хелперов и В-лимфоцитов, 14  (37,9  %) и без изменений — в 2  (5,4  %) случаях.
что важно для восстановления баланса между У больных с вульгарной формой псориаза клини-
клеточным и гуморальным иммунитетом и для ческая ремиссия наблюдалась у 7  (31,8  %), значи-
остановки аутоиммунных и аллергических про- тельное клиническое улучшение — у 8  (36,4  %),
цессов. В зависимости от иммунного статуса улучшение — у 7  (31,8  %) больных. Среди боль-
организма препарат корректирует активность и ных с экссудативной формой заболевания кли-
некоторых других факторов гуморального и кле- ническая ремиссия отмечена у 1  (33,3  %), значи-
точного иммунитета: индуцирует синтез α-, β- и тельное клиническое улучшение — у 1  (33,3  %) и
γ-интерферонов, фактора некроза опухолей. улучшение — у 1  (33,3  %) больного. При артро-
Впервые в терапии псориаза препарат был патической форме дерматоза клиническая ре-
применен нами в клинике РСНПМЦ ДиВ МЗ РУз, миссия наблюдалась у 1  (12,5  %) пациента, зна-
ООО «Госпиталь DOCTOR D». чительное клиническое улучшение — у 2  (25  %),
Под нашим наблюдением находились 78 и улучшение — у 4  (50  %), без изменений — у
больных с различными формами псориаза (31 1  (12,5  %) больного. У больных с эритродермией
женщина, 47 мужчин) в возрасте от 18 до 55 клиническая ремиссия не была достигнута, зна-
лет. Длительность заболевания составляла от чительное клиническое улучшение наблюдалось
2 месяцев до 50 лет. У 46 больных была диа- у 1  (25  %), клиническое улучшение — у 2  (50  %),
гностирована вульгарная форма псориаза, у без изменений — у 1  (25  %) больного.
7 — экссудативная, у 16 — артропатическая, у В группе больных, получавших комплекс-
9 — псориатическая эритродермия. При посту- ную терапию с использованием эрбисола, кли­
плении в стационар у всех больных выявлена ническое выздоровление наступило у 19  (46,3  %),
прогрессирующая стадия псориаза. Ранее боль- значительное клиническое улучше­н ие — у
ные получали разнообразное лечение ( ПУВА- и 14  (34,2  %), клиническое улучшение — у
УФО-терапию, метотрексат, диклофенак, десен- 8  (19,5  %) больных. У больных с вульгарной
сибилирузующие препараты, витамины), что сви- формой псориаза клиническая ремиссия наблю-
детельствовало о тяжести течения патологиче- далась у 14  (58,3  %), значительное клиническое
ского процесса. улучшение — у 6  (25  %), улучшение — у 4  (16,7  %)
Первую группу составили 37 больных, полу- больных. С экссудативной формой клиническая
чавших традиционную терапию, включающую ремиссия отмечена у 2  (50  %), значительное кли-
введение тиосульфата натрия (30  %, 10,0, в/в, ническое улучшение — у 1  (25  %) и улучшение у
№  10), глюконата кальция (10  %, 5–10  мл, в/в, 1  (25  %) больного. При артропатической форме
№  10), антигистаминные препараты (димедрол, дерматоза клиническая ремиссия наблюдалась у
супрастин, цетиризин), дезинтоксикацию (0,9  % 2  (25  %), значительное клиническое улучшение  —
изотонический раствор NaCl, 200–400 мл), эс- у 4  (50  %) и улучшение — у 2  (25  %) пациентов. У
сенциале (по 5  мл в/в и/или по 1 капсуле 3 р/сут.), больных с эритродермией клиническая ремиссия
витаминотерапию, ретинол пальмитат (400  тыс. была зафиксирована у 1  (20  %), значительное
сут.) ПУВА-терапию. Наружно применялись гор- клиническое улучшение — у 3  (60  %) и улучше-
мональные и салициловая мази в соответствую- ние — у 1  (20  %) больного.
щих концентрациях. В первый день лечения в первой группе боль-
Вторая группа (41 пациент), получила ком- ных значение индекса PASI составило 30,8±1,12,
плексное лечение: традиционную терапию + эр- по окончании терапии констатировано статисти-
бисол по 2  мл в/в, №  20). чески значимое снижение на 67  % абсолютных
При оценке терапевтической эффективности значений индекса PASI до 10,16±0,62. Анализ
учитывали динамику следующих клинических индекса PASI по клиническим формам выявил
69
Дерматовенерология и эстетическая медицина № 2 / 2016

следующее: у больных с вульгарной формой псо- Оценка влияния эрбисола на клеточные и гу-
риаза данный индекс снизился на 75,2  % (до ле- моральные факторы иммунитета при псориазе
чения — 27,7±3,6, по окончании — 6,87±1,41); при показала его иммунокорригирующее действие.
экссудативной форме уменьшился на 66,36  % (до Показатели иммунологического статуса в актив-
лечения — 32,4±2,9, по окончаний — 10,9±2,3); ную стадию процесса характеризовались дис-
при артропатической форме — на 50,1  % (с балансом субпопуляций Т-лимфоцитов с умень-
26,1±2,3 в начале лечения до 13,02±2,1 в конце шением хелперного звена. Комплексная терапия
терапии); при псориатической эритродермии — с применением эрбисола оказала выраженный
на 46,2  % (до начала терапии — 43,3±3,7, при за- клинико-иммунологический эффект, который
вершении — 23,29±1,9). проявлялся снижением аутоиммунных процес-
Было установлено, что во второй группе при- сов: нормализацией уровня эффекторных кле-
менение эрбисола в составе терапии эффек- ток (CD8 цитотоксических Т-лимфоцитов и есте-
тивно уменьшило тяжесть псориатического про- ственных клеток-киллеров), иммунорегуляторно-
цесса: индекс PASI снизился на 77,4  % (до ле- го индекса, а также нормализацией экспрессии
чения  — 32,6±2,01, после лечения — 7,37±0,68). маркера апоптоза CD95.
Так, у больных с вульгарной формой псориаза Последующее наблюдение позволило отме-
индекс PASI уменьшился на 84,6  % (с 28,7±0,57 тить удлинение сроков ремиссии от 6 месяцев и
в начале лечения до 4,42±0,74 в конце тера- более, а также сокращение числа рецидивов.
пии). При экссудативной и артропатической Данные клинического наблюдения и индекса
формах дерматоза этот показатель снизился PASI показали, что комплексная терапия с при-
на 78,6  % и 62,5  % соответственно (до начала менением эрбисола способствует быстрому ре-
лечения — 33,8±1,73 и 25,8±1,04, в конце тера- грессированию кожно-патологического процесса.
пии — 7,23±1,22 и 9,67±1,71 соответственно), при Препарат обладает иммунотропным действием и
псориатической эритродермии — на 66,5  % (до способствует коррекции иммунологических пока-
начала терапии — 45,51±3,24, по завершении — зателей, что лежит в основе его терапевтического
15,24±2,6). эффекта.

ЛИТЕРАТУРА

1. Короткий Н.Г., Уджуху В.Ю., Абдуллаева А.Э., 7. Christophers E., Griffiths C.E., Gaitanis G. et al.
Шарова Н.М., Кубылинский А.А. Комплексная The unmet treatment need for moderate to severe
иммуномодулирующая терапия больных псо- psoriasis: results of a survey and chart review
риазом // Российский журнал кожных и вене- //  J Eur Acad Dermatol Venereol. 2006. Vol.  20.
рических болезней. 2001. №  1. С.  14–16. P.  921–925.
2. Кубанова А.А., Кубанов А.А., Николас Дж.Ф. 8. Gaspari A.A. Innate and adaptive immunity and
и др. Иммунные механизмы псориаза. Но- the pathophysiology of psoriasis // J. Am. Acad.
вые стратегии биологической терапии // Вест- Dermatol. 2006. Vol.  5 4. P.  67–80.
ник дерматологии и венерологии. 2010. №  1. 9. Griffiths CEM, Barker JNWN. Pathogenesis
С.  35–47. and clinical features of psoriasis // Lancet. 2007.
3. Кунгуров Н.В., Филимонкова Н.Н., Тузанки- Vol.  370. P.  263–271.
на И.А. Иммуномодулятор Полиоксидоний в 10. Heydendael V.M., Spuls P.I., Opmeer B.C. et al.
терапии больных псориатической болезнью Methotrexate versus cyclosporine in moderate-to-
//  Иммунология. 2003. №  1. С.  38–42. severe chronic plaque psoriasis // N Engl J Med.
4. Новиков А.И., Охлопков В.А., Правдина О.В. 2003. Vol.  349(7). P.  658–665.
и др. Тимодепрессин при лечении среднетя- 11. Krueger J.G. The immunologic basis for the
желых и тяжелых форм псориаза. Материалы treatment of psoriasis with new biologic agents
научно-практической конференции, посвящен- //  J.  Am. Acad. Dermatol. 2002. Vol. 46. P.  1–23.
ной 85-летию кафедры дерматовенерологии 12. Lebwohl M. Psoriasis // Lancet. 2003. Vol.  361.
Омской государственной медицинской акаде- P.  1197–1204.
мии. — Омск. 2006. С.  45–47. 13. Lee C.S., Koo J. A review of acitretin, a system-
5. Павлова О.В. Новые аспекты патогенетиче- ic retinoid for the treatment of psoriasis // Expert
ской терапии псориаза // Вестник дерматоло- Opin Pharmacother. 2005. Vol.  6(10). P.  1725–
гии и венерологии. 2005. №  6. С.  36–39. 1734.
6. Coimbra S., Figueiredo A., Castro E., Rocha- 14. Lowes M.A., Bowcock A.M., Krueger J.G. Patho-
Pereira P., Santos-Silva A. The roles of cells and genesis and therapy of psoriasis // Nature. 2007.
cytokines in the pathogenesis of psoriasis // In- Feb 22: 445(7130):866–73.
ternational Journal of Dermatology. Vol. 51. №  4. 15. Menter A., Smith C., Barker J. Psoriasis // Oxford.
P.  389–398, 2012. Health Press. 2004. 104 p.

70
ОБМЕН ОПЫТОМ

16. Nestle F.O., Kaplan D.H., Barker J. Psoriasis al survey // J Am Acad Dermatol. 2005. Vol.  52
//  N  Engl J Med. 2009. Vol.  361: P.  496–509. P.  434–444.
17. Nijsten T., Margolis D.J., Feldman S.R. et al. Tra- 18. Parisi R., Griffiths CEM, Ashcroft DM: Systematic
ditional systemic treatments have not fully met the review of the incidence and prevalence of psoria-
needs of psoriasis patients: results from a nation- sis // Br J Dermatol. 2011. Vol.  165: P.  e5.

УДК: 616.45-008.64-006-072.1-089

БУЙРАК УСТИ БЕЗИ ЯХШИ СИФАТЛИ ЎСМАЛАРИДА ЛАПАРОСКОПИК


АДРЕНАЛЭКТОМИЯНИ КОСМЕТИК АҲАМИЯТИ
У.Б. Беркинов, Д.П. Сахибоев
Тошкент тиббиёт академияси
РЕЗЮМЕ
Косметическое значение лапароскопической адреналэктомии
при доброкачественных опухолях надпочечников
У.Б. Беркинов, Д.П. Сахибоев
В статье описано практическое косметическое значение лапароскопической адреналэктомии при
доброкачественных опухолях надпочечников. В практической медицине достигается 7–8-кратное
уменьшение хирургического разреза в сравнении с открытой адреналэктомией, что является про-
грессивным достижением эстетической медицины.
Ключевые слова: доброкачественные опухоли надпочечников, лапароскопическая адреналэктомия,
открытая адреналэктомия.
S UMMARY
C osmetic val ue of laparoscopic a drenalectomy for benign a drenal t umors
U.B. Berkinov, D.P. Sahiboev
In this article, we sanctified practical cosmetic value of laparoscopic adrenalectomy for benign adrenal
tumors. In practical medicine reached 7–8 fold decrease surgical incision in comparison to open
adrenalectomy that is progressive achieving aesthetic medicine.
Keywords: benign tumors of the adrenal gland, laparoscopic adrenalectomy, open adrenalectomy.

ХУЛОСА
БУЙРАК УСТИ БЕЗИ ЯХШИ СИФАТЛИ ЎСМАЛАРИДА ЛАПАРОСКОПИК АДРЕНАЛЭКТОМИЯНИ
КОСМЕТИК АҲАМИЯТИ
У.Б. Беркинов, Д.П. Сахибоев
Ушбу мақолада буйрак усти бези хавфсиз ўсмаларида лапароскопик адреналэктомия амалиётининг
яққол косметик аҳамияти ёритилган. Бу амалиётда очиқ адреналэктомияга нисбатан теридаги кесма­нинг
7–8 баробар камайишига эришилади. Бу эса эстетик тиббиётда илғор ютуклардан бири ҳисобланади.
Калит сўзлар: буйрак усти бези хавфсиз ўсмалари, лапароскопик адреналэктомия, очиқ адрена-
лэктомия..

Д олзарблиги. Буйрак усти бези хавфсиз


ўсмаларида жарроҳлик амалиёти билан
даволаш натижаларини яхшилаш замонавий
Жарроҳликни асосий ва мақсадли вазифаси
бу жараённи радикал олиб ташлашдан иборат.
Бу мақсадда ҳар бир органда бажариладиган
жарроҳликда катта аҳамиятга эга. Ҳозирги амалиётлар учун шу жараённи тўлиқ олиб
вақтда жуда ҳам аниқлик билан жараён ташлаш имконини берадиган, кам жароҳатли, шу
характерини аниқлай оладиган замонавий органга тез ва энг енгил йўл билан бориладиган
ташхис асбоб-ускуналарини пайдо бўлиши жарроҳлик кесмаси ишлаб чиқилган. Олдинги
буйрак усти бези яхши сифатли ҳосилаларини вақтларда жарроҳлик кесмасини танлашда кесмани
эрта аниқлаш имкониятини бермоқда. Турли ўлчамига қарамасдан энг яқин, хавфсиз ва
муаллифларни маълумотларига кўра, буйрак жарроҳ учун қулай йўллар танланган. Жарроҳлик
усти бези ўсмалари 0,01–1  % одамларда амалиёти ўтказиладиган орган қанчалик чуқур
учрайди, популяцияда учраш ҳолати 1 : 100 минг жойлашган бўлса шу органга етиб бориш имконини
кишидан 5–7 : 100 минг кишини ташкил қилади берадиган оптимал кесмани танлаш мақсадида
[1]. 10  % ҳолларда буйрак усти бези ҳосилалари шунча кўп усуллар таклиф қилинган, жумладан
клиник жиҳатдан ҳеч қандай белги билан намоён адреналэктомия амалиётини бажариш учун ҳам
бўлмайди, бу турдаги ҳосилалар замонавий 100 га яқин жарроҳлик кесмалари мавжуд [6].
тиббиётда «инциденталома» деб номланади [2]. Қачонлардир жарроҳлар орасида «катта кесма–

71
Дерматовенерология и эстетическая медицина № 2 / 2016

катта жарроҳ» ҳазиломуз ибораси тарқалган Хусусан буйрак усти безлари патологиясида
эди, лекин замонавий жарроҳликда бу ибора биринчи лапароскопик адреналэктомия 1992
тўлиқ ўз аҳамиятини йўқотган. Охирги пайтларда йилда Майкл Гагнер томонидан бажарилган [4].
жарроҳликда хавфсизлиги ва эффектлилигини Мақолада охирги 6 йил ичида Тошкент Тиб­
йўқотмаган ҳолда иложи борича кичик кесмалар биёт Академияси 2-клиникасида 184 та бе­
ёрдамида жарроҳлик амалиётларини бажариш морда бажарилган очиқ ҳамда лапароскопик
олдинга ўринда турмоқда, яъни охирги 30 йилда адренал­э ктомия амалиётларида кам инвазия
жарроҳлик амалиётини косметик аҳамиятига ҳам амалиёт турини косметологик аҳамияти ёритиб
катта эътибор берилмоқда, ҳатто баъзи амалиёт­ берилган.
ларда косметик натижа олдинги ўринларга Материал и даволаш усуллари. Ўтказил­ган
қўйилмоқда. Бу мақсадни амалга оширишда ҳо­ даволаш турига қараб беморлар 2 гуруҳга бўлинди.
зирги вақтда эндовизуал жарроҳлик йўналиши Биринчи гуруҳга торакофренолюмботомия (ТФЛ)
катта аҳамият касб этмоқда. Эндоскопик жарроҳлик йўли билан традицион усулда буйрак усти безида
жуда кўп тўқималар ичида ва чуқур жойлашган, амалиёт ўтказган беморлар киритилган. Шу вақт
амалиёт бажариш учун етарли ишлаш майдони да­вомида 18 ёшдан 66 ёшгача бўлган 104 бе­
талаб қиладиган органларда бажариладиган морда очиқ усулда адреналэктомия амалиёти
амалиётларда янада катта аҳамиятга эга, жумладан бажарилган.
буйрак усти безлари ҳам жойлашиши бўйича шу Иккинчи гуруҳга 80 бемор киритилган бўлиб
органлар гуруҳига киради [5]. уларга лапароскопик адреналэктомия (ЛАЭ)
Замонавий эндоскопик хирургия тарихи 1805 бажарилган. Бизни клиника, умуман Ўзбекистон
йилда Франкфуртлик акушер-гинекологни уретрани Республикасида биринчи ЛАЭ 2009 йил июнь
махсус мослама билан ёритиб кўришдан бошланган ойида бажарилган. Бу гуруҳдаги беморлар ёши
бўлса, ҳақиқий эндоскопик амалиёт бошланиши 1987 22 дан 72 гача ташкил қилади. Амалиёт ўтказган
йилда Францияда Филипп Мурени лапароскопик эркак ва аёл беморлар нисбати таблицада
холецистэктомия бажаришига тақалади [3]. кўрсатилган (жадвал 1).
1 жадвал
Беморларни жинс ва ёшга қараб тақсимланиши

1 гуруҳ 2 гуруҳ Ҳаммаси


Ёш
Э А Э А (%)

19 ёшгача 1 1 1 3 (1,6  %)

20–44 ёш 11 15 15 13 54 (29,4  %)

45–59 ёш 37 36 23 18 114 (62,0  %)

60–74 ёш 2 2 4 5 13 (7,0  %)

Хаммаси 50 54 43 37 184

Гармонал актив ва актив бўлмаган буйрак усти 118  (64,1  %) беморда турли босқичдаги семиз­
бези хавфсиз ўсмалари очиқ адренaлэктомияга лик аниқланиб, бу ҳолат амалиёт бажаришда
кўрсатма ҳисобланади. Клиникамизда ЛАЭ етарли техник қийинчиликлар туғдирди, айниқса
йўлга қўйилгандан кейин 2 см дан 8 см гача бу очиқ адреналэктомияда яққол сезилди.
бўлган буйрак усти бези ўсмалари шу усул учун АГ давомийлиги 2 ойдан 10 йилгача (ўр­тача
кўрсатма ҳисобланади, бундан катта ўсмалар 2,1 ± 0,8 йил) бўлган вақтни ташкил қилди. Бунда
ҳали ҳам очиқ адреналэктомияга кўрсатма ўртача «ишчи» систолик қон босим (ҚБ) 155 ± 10  мм
бўлади. см.ус. ни, диастолик ҚБ 103 ± 3,5 мм см.ус.
Умуман буйрак усти бези ўсмалари ўлчамлари нини ташкил қилди. Шуни таъкидлаш лозимки,
2–16  см ни ташкил қилди. 114  (61,95  %) беморда дастлабки вақтларда ҚБ кризли кўринишда
жараён чап томонда, 68  (36,95  %) беморда ўнг намоён бўлган бўлса, охирги вақт­ларда дориларга
томонда ва 2  (1,09  %) беморда жараён иккала таъсирчанлигини йуқолиши беморларни шифо­
томонда жойлашган. корга мурожаат қилишга маж­бур қилган.
Текширувдаги беморлардан фақатгина 7 та­ Буйрак усти бези ўсмалари диагностикасида
сида инциденталома аниқланди, қолган бемор­ умумклиник текширувлар, қон ва сийдикдаги
ларда буйрак усти бези ўсмаси гармонал актив гармонлар миқдорини аниқлаш, УТТ ва айниқса,
эди. Бу ўсмаларни асосий клиник намоён бўлиши мультислайсли компьютер томография (МСКТ)
— бу артериал гипертензиядир (АГ). катта аҳамиятга эга бўлди (1 ва 2 расмлар).

72
ОБМЕН ОПЫТОМ

1 расм. МСКТ — чап буйрак усти бези ўсмаси 2 расм. МСКТ — ўнг буйрак усти бези ўсмаси

Адреналэктомия амалиётлари буйрак усти без­ Ҳамма беморларда жарроҳлик амалиёти уму­
лари аденомаси, альдостерома, феохромо­цитома мий оғриқсизлантириш ҳамда миорелаксант­лар
ва кисталар бўйича бажарилди (жадвал 2). ёрдамида ўтказилди.
2 жадвал
Буйрак усти бези ўсмалари турлари

Ўсма тури 1 гуруҳ 2 гуруҳ Хаммаси


Аденома 44 (23,9  %) 38 (20,7  %) 82 (44,6  %)
Феохромоцитома 25 (13,6  %) 21 (11,4  %) 46 (25,0  %)
Альдостерома 22 (11,9  %) 15 (8,2  %) 37 (20,1  %)
Киста 13 (7,1  %) 6 (3,3  %) 19 (10,4  %)

Биринчи гуруҳда очиқ усулдаги адренал­ ЛАЭ ёнлама трансабдоминал йўл билан
эктомия 15 см дан 32 см гача бўлган (ўртача бажарилди. Бу йўл кўпчилик жарроҳлар фикрига
24 ± 2,5 см) ТФЛ кесмаси билан бажарилди. кўра ҳамма талабларга жавоб беради. ЛАЭ да
Жарроҳлик амалиётлари ўтказган беморларда бемор жараёнга қарама-қарши ён томонлама
ўсма ўлчамлари 80  % ҳолларда 5 см дан кам жойлаштирилади. ЛАЭ амалиётида 25–30 см
бўлишига қарамасдан ЛАЭ амалиёти йўлга кесма ўрнига 4 та троакар (3 та 10 мм ли ва керак
қўйилгунча бўлган даврда кесма патологик бўлса яна 1 та 5 мм) учун кесмалар бажарилади.
жараёндан 5–6 марта узун ўлчамни ташкил Ҳамма нуқталар 1 та қовурғалараро соҳада
қиларди, бу ҳолатга буйрак усти безларини жуда жойлашади (расм. 3 ва 4).
ҳам катта мушак-суяк қоплaми тагида чуқур
жойлашгани сабаб бўлди.

3 расм. Очиқ усулдаги адреналэктомияда кесма ўлчами ва кўриниши

73
Дерматовенерология и эстетическая медицина № 2 / 2016

4 расм. ЛАЭ да бемор ҳолати ва кесмалар ўрни

Натижалар ва муҲокама Иккинчи гуруҳдаги беморларда кесмани


Жарроҳлик амалиёти жароҳатлилиги бўйича умумий узунлиги бор-йўғи 3–4 см ни ташкил
текширувлар кўрсатдики, албатта очиқ усулдаги килади, бу ҳолатни очик адреналэктомия (25–32
амалиёт кўпроқ жароҳатли, яъни кесма ўлчами см) билан солиштирадиган бўлсак, жуда катта
25–32 см (патологик жараён кўп ҳолларда 4–5 тафовутга олиб келади. Амалиётдан кейин
см), кўп миқдордаги тўқималар кесилади, иккита беморлар 1 чи куни активлаштирилади, оғриқ
катта бўшлиқ (кўкрак ва қорин бўшлиғи) очилади. синдроми кам бўлиб 2 кун­дан деярли йўқолади.
Шунга кўра амалиётдан кейин оғриқ кучли Амалиёт давомийлиги деярли тенг вақтни
бўлиб, 2–3 кун давомида наркотик препаратлар ташкил қилади: очиқ адреналэктомияда ўртача
билан оғриқсизлантиришга тўғри келади. 110 ± 15,2 мин, ЛАЭ да 114 ± 15,8 минутни ташкил
Энг асосийси 25–32 см ли кесма кейинчалик қилди.
ўзидан кейин қўпол чандиқ қолдиради, бу ҳолат Амалиёт давомида йўқотилган қон миқдори
беморларда хаётини кейинги даврида салбий очиқ адреналэктомияда 300 мл дан 600 мл гача
психологик таъсир кўрсатади, оммавий ечиниш (ўртача 380 ± 25 мл), ЛАЭ да 30 мл дан 200 мл гача
ва чўмилиш жойларида керакли ноқулайликлар (ўртача 75 ± 35 мл) бўлган хажмни ташкил қилди.
туғдиради, айниқса аёл беморларда жуда катта Эрта амалиётдан кейинги даврда қуйидаги
ноқулайликларга сабаб бўлиб, баъзи ҳолатларда асоратлар кузатилди (жадвал 3).
амалиётдан бош тортишгача олиб борган.
3 жадвал
Эрта амалиётдан кейинги асоратлар

Асорат турлари 1 гуруҳ 2 гуруҳ


Панкреатит – 1 (1,25  %)
Қорин орти гематомаси – 1 (1,25  %)
Плеврит 5 (4,8  %) –
Пневмония 2 (1,9  %) –
Жароҳат йиринглаши 5 (4,8  %) –
Миокард инфаркти 1 (0,9  %) –
Ичаклар парези 3 (2,9  %) –
Ҳаммаси 16 (15,3  %) 2  (2,5  %)

Шундай килиб, 1 гуруҳдаги беморларда эрта Иккинчи гуруҳ беморларда 2 ҳолатда катта
амалиётдан кейинги даврда 16  (15,3  %) беморда булмаган асоратлар кузатилиб, консерватив
асорат кузатилди. 5  (4,8  %) беморда жароҳат даво­лаш билан енгил ҳал қилинди.
йиринглаши кузатилиб, шу ҳисобига жароҳат 1 гуруҳ беморлар ўртача 13 ± 1,8 кун, 2 гуруҳ
кечи­киб ва энг ачинарлиси косметик жиҳатдан 3,1 ± 0,8 кун стационарда қолишга мажбур бўлди.
қўпол чандиқ ҳосил қилиб битишга сабаб бўлди. Адреналэктомиядан кейин ҳамма — беморларда
8 беморда ўпка-юрак етишмовчилиги кузатилиб, ҚБни тушиши кузатилди, баъзи ҳолларда гипотен­
бундан бир бемор вафот этди. зив препаратларда енгил бошқариладиган бўлди.

74
ОБМЕН ОПЫТОМ

Хулоса. Юқоридаги таққосий таҳлиллар ташқари АКБ ни турғун стабиллашишига олиб


кўрсатдики, буйрак усти бези хавфсиз ўсмаларида келиб, АГ билан боғлиқ асоратларни камайишига
лапароскопик адреналэктомия амалиёти яққол сабаб бўлди. Шубхасиз афзалликларидан: кам
косметик аҳамиятга эга экан: биринчидан 25–32 жароҳатлилиги, оғриқ синдромини камлиги, тез
см кесма ўрнига бор-йўғи умумий 3–4 см ли кесма, активлашиши ва стационар даврни қисқариши,
иккинчидан кесмалар ўлчами кичик бўлганлиги амалиёт ичи ва амалиётдан кейинги асоратларни
сабабли битиши тез, учинчидан йиринглаш умуман камлиги.
кузатилмади, тўртинчидан амалиётдан кейинги Шундай қилиб ҳозирги вақтда ЛАЭ косметик
чандиқ нозик, бешинчидан алоҳида кесмалар жиҳатдан буйрак усти хавфсиз ўсмаларида
узунлиги 1 см дан ортмаганлиги сабабли 3–4 танлов амалиёт усули ҳисобланади, очиқ
ойдан кейин табиий бурмалар орасида кўринмай адренлэктомияга нисбатан теридаги кесмани 7–8
кетади ва шундан келиб чиқиб кейинги ҳаётида баробар камайишига олиб келмоқда, бу эстетик
психологик ноқулайликка сабаб бўлмайди. Бундан тиббиётда илғор ютуқлардан ҳисобланади.

АДАБИЁТЛАР

1. Богданов Д.Ю., Матвеев Н.Л, Курганов И.А., гии. // Онкологическая колопрок­тология. 2012.
Садовников С.В. Эндовидеохирургическая №  2. С.  35–39.
адреналэктомия: современное состояние и 4. Zacharias M., Нaese A., Jurczok A. el al. Transperi-
перспективы развития // Эндоскопическая хи- toneal laparoscopic adrenalectomy: outline of the
рургия. 2008. №  5. С.  41–49. preoperative management, surgical approach, and
2. Ветшев П.С., Ипполитов Л.И., Коваленко Е.И. outcome // Eur Urol. 2006. Vol.  49. P.  448–459.
Оценка методов диагностики новообразова- 5. Zorafos G.N., Markou A., Ageli C. et al. Laparoscop-
ний надпочечников // Хирургия. 2002. №  1. ic surgery for adrenal tumors. Al retrospective analy-
С.  37–40. sis // Hormones (Athens). 2006. №  5. Р.  52–56.
3. Хатьков  И.Е., Барсуков  Ю.А., Атрощенко  А.О. и др. 6. Sapienza P., Cavallaro A. Persistent hyperten-
История развития лапароскопи­чес­кой хирур­ sion after removel of adrenal tumors // Eur J Surg.
1999. Vol. 165(3): P.  187–92.

УДК: 616.5-003.829.85:575.21-07

Исследование связи полиморфизма 308 G/А гена TNF-α


с риском развития витилиго

Б.Т. Саатов1, Х.Я. Каримов2 , С.С. Арифов1, Т.С. Саатов3, З.З. Ибрагимов1, К.Т. Бобоев2

Республиканский специализированный научно-практический медицинский центр


дерматологии и венерологии МЗ РУз1;
Научно-исследовательский институт гематологии и переливания крови МЗ РУз2;
Институт биоорганической химии АН РУз3

Хулоса
TNF-α гени 308 G/A полиморфизмининг витилиго ривожи хавфи билан алоқадорлигини
ўрганиш
Б.Т. Саатов, Х.Я. Каримов, С.С. Арифов, Т.С. Саатов, З.З. Ибрагимов, К.Т. Бобоев
Ўзбек миллатига мансуб 74 соғлом шахс ва витилигога учраган 93 беморларда ўсма некроз фактори-α
(TNF-α) гени полиморфизмининг тарқалиши ўрганилди. Беморлар ва соғлом шахслар TNF-α гени
rs1800629 полиморфизми аллел ва генотиплари кенг даражадаги хилма-хиллик билан характерлана-
ди. TNF-α гениполиморфизми А аллелининг тарқалиш даражаси витилиголи беморларда назоратга
нисбатан 2,2 марта кўп. TNF-α гени полиморфизмида генотиплар учраш эҳтимоллигини аниқлаш
генетик мутацияларнинг анчагина юқори даражада мавжудлигини кўрсатди. Витилигода TNF-α гени
полиморфизмининг функционал номақбул G/A генотипи учрашининг даражаси нормага нисбатан 2
маротаба юқори эканлиги аниқланди, бу эса, ўз навбатида, витилигонинг ривожланиш эҳтимолига ўз
ҳиссасини қўшади. TNF-α гени G-308 A полиморфизмида номақбул генотип А/А нинг учраш даражаси
витилиголи беморлар гуруҳида назорат гуруҳига нисбатан 8 марта кўп эканлиги аниқланди. Шуни
алоҳида таъкидлаш лозимки, А/А генотип соғлом шахслар гуруҳида учрамайди. Олинган натижалар
TNF-α гени G-308 A полиморфизми билан витилиго ривожланишига мойиллик ўртасида боғлиқлик
мавжудлигини исботлайди.
Калит сўзлар: ўсма некроз фактори — α (TNF-α), TNF-α гени полиморфизми, витилиго, генотип.

75
Дерматовенерология и эстетическая медицина № 2 / 2016

Su mmary
Study on association between TNF-α gene 308 G/A polymorphism
an d risk of onset an d progression of vitiligo
B.T. Saatov, Kh.Ya. Karimov, S.S. Arifov, T.S. Saatov, Z.Z. Ibragimov, K.T. Boboev
Prevalence of TNF-α gene rs1800629 polymorphism was studied in 93 Uzbek patients with vitiligo and 74
healthy controls. Both in patients with vitiligo and healthy subjects TNF-α gene rs1800629 polymorphism
was found to exhibit a variety of alleles and genotypes. In patients with vitiligo frequency of TNF-α gene
A allele was found to be 2.2 times higher than the one in the controls. Analysis of TNF-α gene genotype
frequency in patients with vitiligo demonstrated sufficiently high level of genetic mutations. As in patients
with vitiligo frequency of unfavorable TNF-α gene rs1800629 G/A genotype was found 2 times higher than
the one in the controls, this genotype was hypothesized to contribute to onset and progression of vitiligo. In
our study in patients with vitiligo unfavorable A/A genotype of G-308 А polymorphism of TNF-α gene was
registered 8 times more frequently than it used to be registered naturally, while in the controls A/A genotype
was not registered at all. All above is indicative of an association between TNF-α gene G-308 A polymor-
phism and risk of onset and progression of vitiligo.
Keywords: a genotype, tumor necrosis factor-alpha (TNF-α), TNF-α gene polymorphism, vitiligo.

Резюме
Исследование связи полиморфизма 308 G/А гена TNF-α с риском развития витилиго
Б.Т. Саатов, Х.Я. Каримов, С.С. Арифов, Т.С. Саатов, З.З. Ибрагимов, К.Т. Бобоев
Исследована распространенность полиморфизма rs1800629 гена TNF-α у 93 больных витилиго и
у 74 здоровых лиц узбекской национальности. Полиморфизм rs1800629 гена TNF-α у больных
витилиго и здоровых лиц характеризуется широким разнообразием аллелей и генотипов. Частота
распределения аллеля А полиморфизма гена TNF-α у больных витилиго в 2,2 раза выше,
чем в группе контроля. Определение частоты встречаемости генотипов TNF-α при витилиго
свидетельствует о наличии довольно высокого уровня генетических мутаций. Функционально
неблагоприятный генотип rs1800629 G/A гена TNF-α при витилиго по частоте распределения почти
в 2 раза превышает контрольную группу и вносит свой вклад в риск развития витилиго. Частота
возникновения неблагоприятного генотипа А/А полиморфизма G-308 A гена TNF-α оказалась в
8 раз выше у больных витилиго, чем в норме. При этом генотип А/А в контрольной группе отсут-
ствовал. Полученные результаты указывают на наличие ассоциации между полиморфизмом G-308
A гена TNF-α и риском развития витилиго.
Ключевые слова: фактор некроза опухоли α (TNF-α), полиморфизм гена TNF-α, витилиго, генотип.

В итилиго — часто встречающееся забо­


левание кожи человека — характеризуется
отсутствием или недостаточной степенью
ке  — 4  %, в Индии — 8,8  % (Salinas-Santander M.
et al., 2012). Эпидемиологическими исследованиями
установлено, что распростра­ненность витилиго
выработки меланина вследствие исчезновения среди населения Узбекистана составляет 1,2  %,
или нарушения функциональной деятельности а среди кожных заболеваний — 8,2  % (Арифов  С.,
меланоцитов (Hammound Sh.M. et al., 2016; Nie G. Арифова М., 2006). В последние годы отмеча-
et al., 2015). Меланоциты — клетки, расположенные ется интенсивный рост числа больных витили-
в различных слоях эпидермиса и дермы, а также в го, особенно среди детей, молодежи и лиц тру­-
сетчатке и волосяных луковицах. При нарушении доспособного возраста. Однако, несмотря на
выработки меланина человек не только обладает достаточное количество публикаций, посвя­щен-
характерным внешним видом, но также теряет ­ных проблеме витилиго и поиску новых эф­фек-
способность противостоять ультрафиолетовому тивных методов его лечения, многие вопросы
излучению, так как меланин, наряду с красящей этиопатогенеза этого дерматоза остают­ся нерешен­
функцией, обеспечивает еще защиту кожного ными, а методы лечения несовершен­ными.
покрова. Витилиго внешне проявляется в воз­ Витилиго является иммуноопосредованным,
ник­новении на коже белых пятен различной многофакторным заболеванием, в патогенезе
формы и размеров, имеющих тенденцию к пери­ которого особую роль играют генетическая
ферическому росту. детерминированность и факторы внешней среды
Распространенность витилиго среди популя­ (Симонова  Н.И., Ломоносов  К.М., Бабешко О.А.
ции в мировом масштабе составляет в среднем 2012).
0,5–2,0  % (Ortonne J.P., Bose S.K., 1993; Al-Harthi В настоящее время существует множество
F. et al., 2013; Taieb A., Picardo M., 2009). Однако теорий о механизме развития витилиго. Среди
среди отдельных этнических групп это значение них наиболее популярными и обоснованными
значительно различается: например, в России  — являются нейроэндокринная, аутоиммунная,
0,14  %, в США и Японии — 1,0–2,5  %, в Мекси- теория аутодеструкции, а также генетическая

76
ОБМЕН ОПЫТОМ

и оксидативный стресс (Жаворонкова Е.В., вклада их генотипических вариантов в механизм


Горностаева М.А., Корсунская И.М., 2009). Появ- развития заболеваний.
ление витилиго обусловлено генетической пред- Следует отметить, что исследования,
расположенностью, а также воздействием неко- направленные на выявление ассоциации
торых иммунных и биохимических расстройств. между полиморфизмом гена 308 G/А TNF-α
Следовательно, витилиго возникает при соче­ и патогенезом витилиго, остаются малочис-
тании предрасполагающих и провоцирующих ленными, а полученные результаты являются
факторов (Верхогляд И.В., 2014). несовпадаю­щими и противоречивыми. В неко-
В последние годы благодаря результатам­ торых исследованиях продемонстрирована яв-
крупномасштабных генетических исследований ная ассоциация TNF-α-308 G/А полиморфизма
витилиго отнесено к числу забо­леваний нас­ с предрасположенностью к развитию витилиго
ледственной природы (Spritz  R.A., 2007; Jin Y. et (Аl-Harthi F. et al., 2013; Laddha N.C. et al., 2012),
al., 2011). Уже достигнут значительный прогресс тогда как в других публикациях представле-
в выявлении генов, отвечающих за склонность к ны противоположные результаты (Yazici A.C.
развитию витилиго. К их числу можно отнести ген et al., 2006; Wu D. et al., 2015). Поэтому тре-
фактора некроза опухоли-α (TNF-α). По данным буются дополнительные исследования, что-
ряда исследователей, ген, кодирующий TNF-α, бы получить адекватные, статистически
играет важную роль в патогенезе аутоиммунных достоверные результаты и тем самым разрешить
заболеваний, в том числе и витилиго (Namian A.M. несовпадающие и противоречивые взгляды в
et al., 2009; Salinas-Santander M. et al., 2012). TNF-α отношении ассоциации между TNF-α-308 G/А
участвует в патогенезе витилиго как паракринный полиморфизмом и развитием витилиго. Изучение
ингибитор пролиферации меланоцитов человека полиморфного варианта — 308 G/А гена TNF-α и
и меланогенеза. Многофункциональный провоспа­ определение роли этого полиморфизма в пато-
лительный цитокин TNF-α впервые был выде- генезе витилиго среди этнических узбеков ранее
лен из сыворотки крови лабораторных мышей не проводилось.
в 1975 г. и индуцировал некроз опухоли у этих Цель исследования. Изучение возможной
животных (Дунаев П.Д., 2012; Ржевский А.В., ассо­циации между TNF-α-308 G/А полимор­физмом
2013). TNF-α — гликопротеин с молекулярной и предрасположенностью к витилиго и оценка
массой 17,4 кDa обладает самостимулирующим вклада отдельных генотипи­ческих вариантов этого
и стимулирующим соседние клетки действием. полиморфизма в патогенезе заболевания.
Клетками-продуцентами TNF-α являются макро- Материал и методы исследования. Обсле-
фаги, моноциты, лимфоциты, гепатоциты, фибро- дуемая группа состояла из 93 пациентов с диа-
бласты, эндотелиальные, эпителиальные и другие гнозом витилиго, проживающих на территории
клетки, а также жировая ткань (Дунаев П.Д., 2012; Узбекистана: 50 больных с генерализованной
Ржевский А.В., 2013). Показано, что 308 G/А по- формой, 43 — с локализованной. Все больные
лиморфизм в промоторной области гена TNF-α проходили обследование и лечение в РСНПМЦ
ассоциирован с повышенным уровнем этого ДиВ МЗ РУз. Контрольная группа состояла из 74
цитокина в плазме крови и повышенным риском здоровых лиц узбекской национальности, соот-
развития ряда заболеваний человека (Salinas- ветствующих по полу и возрасту обследованной
Santander M. et al., 2012; Wu D. еt al., 2015). Дан­ группе пациентов и не имеющих в анамнезе кож-
ные литературы свидетельствуют, что TNF-α-308 ной патологии.
G/А полиморфизм вносит вклад в развитие рака Геномную ДНК из образцов периферической
желудка, шейки матки, аутоиммунного гепатита, крови (Vacutainer Becton Dickinson Interna-
акне вульгарис, псориаза, ревматоидного арт­ tional c ЭДТА) выделяли с использованием
рита, сахарного диабета II типа, силикоза, кар­ набора «ДНК-сорб» ООО «Интер Лаб Сервис»
диомиопатии и др. (Wu D. et al., 2015; Rokkas (Россия) в соответствии с инструкцией.
T. et al., 2014; Yang J.K. et al., 2014; Zhuang I. Спектрометрический анализ геномной ДНК
et al., 2013; Song G.G. et al., 2014; Perez-Luque проводили на приборе NanoDrop 2000 (Ther-
E. et al., 2012). Как видно из представленных mo, США). Амплификация ДНК проводилась
данных, полиморфизм TNF вовлечен во мно­ на термоциклере фирмы «Сorbett Research»
гие заболевания человека, а TNF-α-308 G/А (QUAGEN, Германия) с использованием тест-
полиморфизм (rs1800629) считается одним из системы компании ООО НПФ «Литех» (Россия)
наиболее важных TNF-полиморфизмов в пред- по инструкции производителя.
расположенности человека к различным забо- Для генотипирования полиморфизма rs1800629
леваниям. В связи с этим в настоящее время гена TNF-α использовались локусспецифические
значительно возрос интерес к исследованию олигонуклеотидные праймеры (табл. 1).
генетических полиморфизмов и установлению

77
Дерматовенерология и эстетическая медицина № 2 / 2016

Таблица 1 числяли коэффициент соотношения шансов (OR)


Нуклеотидная с 95  %CI доверительным интервалом.
Название Амплификацию проводили при условиях при­
Праймеры последовательность
полиморфизма
праймера ве­денных в таблице 2.
Таблица 2
F: 5’ AATAGGTTTT-
Forward Название Количество Темпе-
G308A GAGGGCCATG-3’ Время
полиморфизма циклов ратура
rs1800629 R: 5 ATCTGGAG-

Reverse 1 94°С 1 мин.
GAAGCGGTAGTG-3’
94°С 10 сек.
G308A
Полученные продукты ПЦР разделяли с 35 68°С 30 сек.
rs1800629
помо­щью электрофореза на 3,5  % агарозном 72°С 20 сек.
геле с последующим окрашиванием бромистым 1 72°С 1 мин.
этидием.
Статистический анализ результатов проведен Результаты исследования. Сравнительный
с использованием пакета статистических про­ анализ частот аллелей и генотипов полимор­
грамм «Open Epi 2009, Version 2.3» и «Doctor Stat физма rs1800629 G-308A гена TNF-α между груп-
2013, Version 1.9». В случае наличия различий пой больных витилиго и группой контроля пока-
между контролем и исследуемой группой, вы­ зал статистически значимые различия.

Рис. 1. Электрофореграмма детекции полиморфизма G-308А гена фактора некроза опухоли TNF-α

П р и м е ч а н и е: К+ — гетерозиготный контроль; К — отрицательный контроль; 1, 3, 4, 5, 6, 8, 9, 10, 11, 12 — дикие


генотипы (G/G); 2, 7 — гетерозиготные генотипы (G/A).

При этом частота выявления неблагоприят­ (при обеих формах заболевания) заметно ниже,
ного аллеля А этого полиморфизма у больных чем в контрольной группе.
витилиго была значительно выше, чем в группе При сравнительном анализе частот распре­
контроля — 23,7  % и 10,8  % соответственно деления различных генотипов G308-А гена
(х2 =9,23; р = 0,002; OR = 2,56; 95  % CI 1,38–4,75). TNF-α у больных витилиго и в группе контро-
При локализованной форме витилиго часто- ля установлены определенные различия. Ча-
та встречаемости аллеля А составила 19,8  % стота распределения дикого rs 1800629*G/G
(х2 = 3,60; р = 0,06; OR = 2,03; 95  % CI 0,97–4,27), генотипа в основной группе была заметно ниже,
при генерализованной форме — 27,0  % (х2 =  10,91; чем в контроле, что может защитить от риска
р = 0,001; OR = 3,05; 95  % CI 1,54–6,03). развития заболевания у носителей данного
Частота встречаемости аллеля G в генотипа. Следует подчеркнуть, что частота
основной группе больных составила 76,3  %, встречаемости генотипа G/G полиморфизма
в контрольной группе — 89,2  %, т.  е. на 15  % 308 G/А гена TNF-α у больных с локализованной
меньше. Частота распределения G у больных с и генерализованной формами витилиго была
локализованной и генерализованной формами также значительно ниже, чем в группе контроля
составила 80,2  % и 73  % соответственно. Как (табл. 3).
видно, частота выявляемости аллеля G 308 G/А
полиморфизма гена TNF-α в основной группе
78
ОБМЕН ОПЫТОМ

Таблица 3
Частота распределения аллелей и генотипов полиморфизма G-308 А гена TNF-α
у больных витилиго и в группе контроля

Частота распределения генотипов


Частота аллелей
TNF-α
Группа n
G А G/ G А/ G А/А
n % n % n % n % n %
Основная группа больных 5 из них: 93 142 76,3 44 23,7 53 57,0 36 38,7 4 4,3
с генерализованной формой 50 73 73,0 27 27,0 26 52,0 21 42,0 3 6,0
с локализованной формой 43 69 80,2 17 19,8 27 62,8 15 34,9 1 2,3
Контрольная группа 74 132 89,2 16 10,8 58 78,4 16 21,6 — 0

В основной группе больных витилиго частота взаимоотношения между экспрессией TNF-α


выявления неблагоприятного гетерозиготного и частотой витилиго. В ранних исследованиях,
генотипа rs1800629* G/А гена TNF-α была более проведенных in vitro, было показано, что TNF-α
чем в 2 раза выше, чем в контрольной группе. Из ингибирует меланогенез и стимулирует апоптоз
93 больных у 36 встречался генотип G/А, что со- меланоцитов (Swope et al., 1991; Kim et al., 2007),
ставило 38,7  %, в контрольной группе — 21,6  % в последующих публикациях продемонстрирова-
(OR =  2,29; p =  0,007; x 2=9,88; 95  % CI–1,14–4,58): но наличие высокого уровня TNF-α в коже и сы-
при генерализованной и локализованной формах воротке крови у больных витилиго (Yu et al., 1997;
витилиго данный генотип составил 42  % и 34,9  % Moretti et al., 2002; Tu et al., 2003). Продукция
соответственно (x 2 = 11,66; p = 0,003; OR = 2,63; цитокина TNF-α напрямую связана с геном TNF-α
95  % CI–1,19–5,78; x 2 =  4,44; p =  0,11; OR–1,94; 95  % (Ройтберг и др., 2011). В молекулярно-генетиче-
CI–0,84–4,48 соответственно). ских исследованиях показано, что в промоторной
Анализ результатов проведенных исследо­ зоне гена TNF-α определяется несколько поли-
ваний однозначно подтвердил наличие небла­ морфизмов (Allen, 1999; Brown, 2008). Наиболее
гоприятного генотипа А/А G 308 А гена TNF-α, часто полиморфизм встречается на позиции 308
что может приводить к гиперпродукции цито­ (TNF-α-308 G/А) и оказывает воздействие на про-
кина TNF-α у больных витилиго. Частота встре- дукцию этого цитокина (Louis et al., 1998; Abra-
чаемости генотипа А/А полиморфизма гена hamand Kroeger, 1999; Nie et al., 2015). При этом
TNF-α в основной группе больных витилиго со- показано, что повышенная продукция TNF-α
ставлял 4,3  %, т. е. данный генотип был выяв- ассоциирована с полиморфизмом G-308 А гена
лен в 4 случаях у больных с генерализованной TNF-α (Roitberg et al., 2011). В последние годы
формой — 6  %, т. е. из 50 больных в 3 случаях; проведен ряд исследований для выявления
при локализованной форме из 43 больных — 1 ассоциации между полиморфизмом TNF-α-308
случай т. е. 2,3  %. В контрольной группе данный G/А и риском развития витилиго (Yazici et al.,
генотип не обнаружен. 2006; Namian et al., 2009; Laddha et al., 2012; Sa-
Таким образом, исследование ассоциации linas-Santander et al., 2012; Al-Harthi et al., 2013;
полиморфизма G 308 А гена TNF-α с различны- Aydingoz et al., 2015; Wu et al., 2015). Однако, ре-
ми формами витилиго у пациентов узбекской зультаты этих работ являются несовпадаемыми
национальности достоверно свидетельствует и противоречивыми. Некоторые исследователи
о наличии ассоциации между носительствами обнаружили значи­тельную ассоциацию между
аллеля rs1800629* А и генотипов rs1800629*G/А TNF-α-308 G/А полиморфизмом и риском
и 1800629* А/А и риском развития витилиго. развития витилиго (Namian et al., 2009; Laddha
Обсуждение. Отсутствие функционирующих et al., 2012; Al-Harthi et al., 2013), тогда как дру-
меланоцитов в эпидермисе является основным гие не смогли выявить такую ассоциацию (Yazici
патологическим признаком витилиго. Этиопато­ et al., 2006; Wuetal., 2015). Имеется мнение, что
генез витилиго все еще остается нерешенным, такое противоречие можно отнести к малому
однако большинство исследователей считают, числу образцов иссле­дований или этнических
что он ассоциирован с аутоиммунным процессом различий, а также различий окружающей среды
(Ortonne and Bose, 1993; Kovacs, 1998; Nie (Nie et al., 2015).
et al., 2015). TNF-α является плейотропным Заключение. Полиморфизм rs1800629 гена
иммуномодулятором и провоспалительным цито­ TNF-α у больных витилиго и здоровых лиц уз-
кином и вовлечен в патогенез ряда аутоиммун­ бекской национальности характеризуется широ-
ных и воспалительных заболеваний, в том числе ким разнообразием аллелей и генотипов. Функ­
витилиго (Eigler et al., 1997; Roy et al., 1997; Sul- ционально неблагоприятный генотип rs1800629
livan et al., 1997; Kim et al., 2003). В литерату- G/A гена TNF-α при витилиго по частоте рас-
ре имеются исследования, направленные на пределения почти в 2 раза превышает контроль-
79
Дерматовенерология и эстетическая медицина № 2 / 2016

ную группу и вносит свой вклад в возник­новение генотипов TNF-α при витилиго показало наличие
и развитие витилиго, при этом данный гено- довольно высокого уровня генетических мутаций.
тип больше ассоциируется с генерализованной При изучении ассоциации полиморфизма G-308  А
формой заболевания. Риск развития витилиго гена TNF-α с различными формами витилиго
при носительстве генотипа G/A G-308 А было отмечено, что частота возникновения не-
полиморфизма гена TNF-α может возрастать благоприятного генотипа А/А этого полиморфизма
более чем в 3 раза, а шансы на появление выявляется в 8 раз больше у больных витилиго,
генерализованной формы болезни увеличиваются чем в норме. Впервые установлено, что генотип
еще больше. А/А у пациентов с генерализованной формой
Носительство аллеля А полиморфизма гена витилиго выявлен в 11 раз, а с локализованной
TNF-α может вносить существенный вклад в риск формой в 5 раз чаще, чем в контрольной группе.
развития витилиго. По нашим данным, часто- Необходимо указать, что генотип А/А в контроль-
та распределения аллеля А в основной группе ной группе отсутствовал.
больных витилиго, а также при генерализованной Таким образом, результаты исследования
и локализованной формах превышает в 2,2; 2,5; указывают на наличие однозначной ассоциации
1,83 раза соответственно по сравнению с группой между полиморфизмом G-308 А гена TNF-α и ри-
контроля. Определение частоты встречаемости ском развития витилиго.

Рис 2. Частота распределения генотипов полиморфизма G308 A гена TNF-α в основной группе и группе контроля

Рис 3. Частота распределения аллелей полиморфизма G308 A гена TNF-α в основной группе и группе контроля

80
ОБМЕН ОПЫТОМ

Литература

1. Hammound Sh.M., Kruis R.W.J, Sigurdsson and rick for vitiligo: a meta-analysis // Interna-
V. Prediction of the Occurence of Melanoma tional Journal of Dermatology. 2015. Vol. 54  (9).
and non-melanoma skin cancer in patients with P.  1045–1053.
vitiligo // Acta Derm Venereol. 2016. Vol.  96. 17. Rokkas T., Sechopoulos P., Pistiolas D. et all.
P.  106–107. Population differences concerning TNF-α gene
2. Nie G., Qi J.H., Huang C.W., Yang T., Shi N., polymorphism in gastric carcinogenesis based on
Chen Y.J. Meta-analysis of the TNF-α-308 G/A meta-analysis // Ann. Gastroenterol. 2014. Vol. 27.
polymorphism and vitiligo rick // Genetics and Mo- P.  139–148.
lecular Research. 2015. 14 (4). P.  17296–17304. 18. Yang J.K., Wu W.J., Qi J. et all. TNF-308 G/A
3. Ortonne J.P., Bose S.K. Vitiligo: where do we polymorphism and rick of acne vulgaris: a meta-
stand? // Pigment Cell Res. 1993. Vol. 8. P.  61–72. analysis PLoS One. 2014. Vol. 9. P.  e87806.
4. Al-Harthi F., Zouman A., Arfin M., Tariq M., Al- 19. Zhuang L., Ma W., Cai D. et all. Association be-
Asmari A. Tumor necrosis factor-α and β genetic tween tumor necrosis factor-α polymorphisms
polimorphisms as a rick factor in Saudi patients and rick of psoriasis: a meta-analysis // PLoS
with vitiligo // Genetics and Molecular Research. One. 2013. Vol.  8. P.  e68827.
2013. Vol. 12(3). P.  2196–2204. 20. Song G.G., Bae S.C., Kim J.H. et all. Associa-
5. Taieb A., Picardo M. Clinical practice. Vitiligo tions between TNF-α promoter-308 G/A polymor-
// N. Engl. J. Med. 2009. Vol.  360. P.  160–169. phism and rheumatoid arthritis: a meta-analysis
6. Salinas-Santander M., Diaz-Garcia D., Rojas- // Reumatol Int. 2014. Vol.  34. P.  465–471.
Martinez A. et all. Tumor necrosis factor-α-308 21. Perez-Luque E., Malacara J.M., Garay-Sevilla
G/A polymorphism is associated with active viti- M.E. et all. Association of the TNF-α-308- G/A
ligo vulgaris in a northeastern Mexican popula- polymorphism with family history of type 2 diabe-
tion // Experimental and therapeutic medicine. tes mellitus in a Mexican population // Clin. Bio-
2012. Vol.  3. P.  893–897. chem. 2012. Vol. 45: P.  12–15.
7. Арифов С.С., Арифова М.Х. Витилиго. — T.: 22. Laddha N.C., Dwivedi M., Begum R. Increased
«O‘qituvchi». 2006. C.  7–10. tumor necrosis factor (TNF)-α and its promoter
8. Симонова Н.И., Ломоносов К.М., Бабешко  О.А. polymorphisms correlate with disease progres-
Генетические аспекты витилиго // Российский sion and higher susceptibility towards vitiligo
журнал кожных и венерических болезней. // PLoS One. 2012. Vol. 7. P.  e52298.
2012. №  5. C.  56–59. 23. Yazici A.C., Erdal M.F., Kaya T.I. et all. Lack of
9. Жаворонкова Е.В., Горностаева М.А., Кор- association with TNF-α-308 promoter polymor-
сунская И.М. Опыт применения элтамина в phism in patients with vitiligo // Arch. Dermatol
терапии витилиго // Клиническая дерматология Res. 2006. Vol.  298. P.  46–49.
и венерология. 2009. №  4. C.  9 –12. 24. Kovacs S.O. Vitiligo // Am. Acad. Dermatol. 1998.
10. Верхогляд И.В. Баланс микронутриентов у Vol.  38. P.  647–666.
больных витилиго // Дерматология и венеро- 25. Eigler A., Sinha B., Hartmann G., Endres S.
логия. 2014. №  17. C.  11–13. Taming TNF: strategies to restrain this proinflam-
11. Spritz R.A. The genetics of generalized vitiligo matory cytokine // Immunol. Today. 1997. Vol.  18.
and associated autoimmune diseases // Pigment P.  487–492.
Cell Res. 2007. 20 (4). P.  271–278. 26. Roy S., Mc Guire W., Mascie-Taylor C.G. et all.
12. Jin Y., Birlea S.A., Fain P.R., Gowan K. et al. Tumor necrosis factor promoter polymorphisms
Genome-Wide Analysis Identifies a Quantitative and susceptibility to lepromatous leprosy // J. In-
Trait Locus in the MHC Class II Region Associat- fect Dis. 1997. Vol.  176. P.  530–532.
ed with Generalized Vitiligo Age of Onset // Jour- 27. Sullivan K.E., Wooten C., Schmeckpeper B.J. et
nal of Investigative Dermatology. 2011. Vol.  131. all. A promoter polymorphism of tumor necrosis
P.  1308–1312. factor-alpha association with systematic lupus
13. Namian A.M., Shahbaz S., Salmanpoor R. et all. erythematosus in African-Americans // Arthritis
Association of interferon-gamma and tumor ne- Rheum. 1997. Vol.  40. P.  2207–2211.
crosis factor alpha polymorphism with suscepti- 28. Kim T.G., Pyo C.W., Hur S.S. et all. Polymor-
bility to vitiligo in Ipanian patients // Arch. Derma- phisms of tumor necrosis factor (TNF) alpha and
tol. Res., 2009. Vol. 301 (1). P.  21–25. beta genes in Korean patients with psoriasis
14. Дунаев П.Д., Бойчук С.В., Мустафин И.Г. // Arch. Dermatol Res. 2003. Vol.  295. P.  8 –13.
Свойства и роль фактора некроза опухолей 29. Swope V.B., Abdel-Malek Z., Kassem L.M., Nord-
альфа в патогенезе вич-инфекции // Казан- lund J.J. Interleukins 1 alpha and 6 and tumor ne-
ский медицинский журнал. 2012. Vol. 93(2). crosis factor-alpha are paracrine inhibitors of hu-
C.  290–293. man melanocyte proliferation and melanogenesis
15. Ржешевский А.В. Смертельная «триада»: // J. Invest. Dermatol. 1991. Vol.  96. P.  180–185.
липотоксичность, окислительный стресс и 30. Kim N.H., Leon S., Lee A.Y. Impaired PI3K/Akt
феноптоз // Биохимия. 2013. №  78  (9). C.  1265– activation-mediated NF-kappa B inactivation un-
1277. der elevated TNF-α is more vulnerable to apop-
16. Wu D., Shi D., Zhu X. The association between tosis in vitiliginous keratinocytes // J. Invest. Der-
tumor necrosis factor-α-308 G/A polymorphism matol. 2007. Vol.  127. P.  2612–2617.

81
Дерматовенерология и эстетическая медицина № 2 / 2016

31. Yu H.S., Chang K.L., Yu C.L., Li H.F. et all. Al- diversity? // Mol. Immunal. 1999. 36. P.  1017–
terations in IL-6, IL-8, GM-CSF, TNF-α and IFN- 1027.
gamma release by peripheral mononuclear cells 36. Brown M.A. A novel gene variation of TNF-
in patients with active vitiligo // J. Invest. Derma- alpha associated with ankylosing spondylitis:
tol. 1997. Vol.  108. P.  527–529. a reconfirmed study. // Ann. Rheum. Dis. 2008.
32. Moretti S., Spallanzani A., Amato L., Hautmann Vol.  67. P.  434–436.
G. et all. New insights into the pathogenesis of 37. Louis E., Franchimont D., Piron A., Gevaert
vitiligo: imbalance of epidermal cytokines at sites Y. et all. Tumor necrosis factor (TNF) gene
of lesions // Pigment Cell Res. 2002. Vol.  15. polymorphism influences TNF-alpha production
P.  87–92. in lipopolysacharide (LPS)-stimulated whole
33. Tu C.X., Gu J.S., Lin X.R. Increased interleukin-6 blood cell culture in healthy humans // Clin Exp.
and granulocyte-macrophage colony stimulating Immunal. 1998. Vol.  113. P.  401–406.
factor levels in the sera of patients with non- 38. Abraham L.J., Kroeger K.M. Impact of the-
segmental vitiligo // J. Dermatol Sci. 2003. 308 TNF promoter polymorphism on the
Vol.  31. P.  73–78. transcriptional regulation of the TNF gene:
34. Roitberg G.E., Dorosh Zh.V., Sharkhun O.O., relevance to disease // J. Leukoc. Biol. 1999.
Ushakova T.I., Serebryakova O.E. Relationship Vol.  66. P.  562–566.
between the TNF- α gene polymorphism and the 39. Aydingoz I.E., Kanmaz-Ozer M., Gedikbasi A.,
clinical and laboratory manifestations of insulin Vural P. et all. The combination of tumor necrosis
resistance syndrome // Profilac. Medicine. 2011. factor- alpha-308 A and interleukin-10-1082 G
Vol.  2. P.  62–66. gene polymorphisms and increased serum levels
35. Allen R.D. Polymorphisms of the human TNF- of related cytokines: susceptibility to vitiligo //
alpha promoter-random variation or functional Clin. Exp. Dermatol. 2015. Vol.  40. P.  71–77.

УДК:616.5:616-006.03+616-006.04-08

РаспространЕнность рака кожи в Ташкенте и опыт его лечения


в Ташкентском городском онкологическом диспансере

М.Н. Солметова, М.Д. Аллаева, Д.Ж. Юлдашева

Ташкентская медицинская академия, кафедра кожных и венерических заболеваний

ХУЛОСА
Тери ва лаб ҳавфлисимон касалликларнинг тарқалиши ва Тошкент шаҳар
онкология диспансерида унинг даволаш тажрибаси
М.Н. Солметова, М.Д. Аллаева, Д.Ж. Юлдашева
Ушбу мақолада тери ва унинг ҳосилаларини ёмон сифатли ўсмаси билан аҳолини популяцион за-
рарланиши ёритиб берилган. 2006 йилдан 2016 йилгача бўлган маълумотлар Тошкент шаҳар онко-
логик диспансеридан олинган. Ушбу изланишда клиник структура, этник таркиб ва даволаш сама-
радорлиги ўрганилди. Қуйида берилган маълумотлар профилактика ва даволаш комплекс чора тад-
бирларини ишлаб чикиш — онкологлар, дерматологлар ва соғликни сақлаш ташкилотчилари учун
муҳим аҳамиятга эга.
Калит сўзлар: дерматоонкология, тери рак ва саркаматоз касалликлари, Канцер-регистр, мелано-
ма, этник урганиш, 5-йил тирик колиш, 1 йиллик улим.

Su mmary
The spread of skin and lips malignant diseases, and its treatment in Oncology
Dispensary C enter of T ashkent C ity
M.N. Solmetova, M.D. Allaeva, D.J. Yuldasheva
In the article was shown the analysis of population defeat of people with malignant disease of skin and
its appendages during 2006—2016. Materials were taken from Oncological Center of Tashkent City. It has
been studied the clinical structure, ethnic composition and the results of treatment. The data are of interest
to oncologists, dermatologists and the organizers of healthcare for the development of complex measures
of prevention and treatment.
Keywords: dermatooncology, skin cancer and skin sarcoma, Сancer-register, melanoma, population’ ethnic
revue, 5-year survival, 1-year mortality.

82
ОБМЕН ОПЫТОМ

Резюме
РаспространЕнность РАКА кожи в Ташкенте и опыт его лечения в Ташкентском
городском онкологическом диспансере
М.Н. Солметова, М.Д. Аллаева, Д.Ж. Юлдашева
В статье показан анализ популяционного поражения населения злокачественными заболеваниями
кожи и ее придатков за 2006–2016 гг. по материалам Ташкентского городского онкологического дис-
пансера. Исследованы клиническая структура, этнический состав и результаты лечения. Данные
представляют интерес для онкологов, дерматологов и организаторов здравоохранения для разра-
ботки комплексных мер профилактики и лечения.
Ключевые слова: дерматоонкология, раковые и саркаматозные поражения кожи, Канцер-регистр,
меланома, этнический срез, 5-летняя выживаемость, годичная летальность.

Ц ель исследования. Описание эпидемио-


логической ситуации, состояния раннего
выявления и эффективности лечения злокаче-
структуре онкозаболеваемости (4-е место после
рака молочной железы, легких и желудка), за-
нимает 2-е место в структуре болезненности —
ственных заболеваний кожи. 13,2  % всех онкобольных (учетный контингент).
Материал и методы исследования. Подвер- Так, по данным компьютерной базы 2006–2016  гг.
гнуты анализу данные Канцер-регистра, приема в г.  Ташкенте зарегистрировано 2  742 жителя с
хирургического кабинета и кабинета близкофо- установленным диагнозом «Злокачественные
кусной рентгентерапии ТашГОД. заболевания покровных тканей», т. е. верхней и
По данным компьютерной базы, рак кожи (РК), нижней губы, кожи туловища, головы/шеи и ко-
являясь одной из доминирующих патологий в нечностей.

Локализация всего мужчины женщины


Рак губы (верхней и нижней) 115 78 37
Саркомы производных кожи (дерматосаркомы, саркома Капоши,
30 24 6
трихосаркома)
Меланома кожи (пигментная и беспигментная) 266 107 159
Рак кожи (туловища, головы/шеи, конечностей) 2126 902 1224
Первично-множественные раки (сочетание рака кожи и губы с
другой злокачественной патологией — раком молочной железы, 205 93 112
легкого, прямой кишки и т. д.)
Итого 2  742 1  204 1  538

При отслеживании судьбы этой категории белой кожей — русские, украинцы, евреи и т. д.).
больных важное значение имел месячник патро- При этом судьба этих больных продолжает от-
нажа, проведенный по указанию руководства ре- слеживаться по Канцер-регистру. Для данного
спублики. На основании приказа Министерства исследования это немаловажно, так как интерес
здравоохранения РУз от 22.02.2016 г. №  86 март представляет не столько территориальное рас-
был объявлен месяцем активного посещения на пределение онкозаболевания к моменту иссле-
дому учетных больных с социально значимыми дования, а его частота в популяции за 10 лет
заболеваниями, в том числе онкологических. В (2006–2016 гг.).
свете решения этого вопроса с учета сняты 506 В ходе исследования у 2  742 больных отсле-
больных в результате миграции населения за жена судьба с 5-летней выживаемостью и годич-
последние 10 лет (в основном лица с этнически ной летальностью. Установлено:

Годичная
Локализация Всего %
летальность
Рак губы (верхней и нижней) 115 6 5,2
Саркомы производных кожи (дерматосаркомы, саркома
30 3 10,0
Капоши, трихосаркома)
Меланома кожи (пигментная и беспигментная) 266 31 11,7
Рак кожи (туловища, головы/шеи, конечностей) 2126 33 1,6
Первично-множественные раки (сочетание рака кожи и
губы с другой злокачественной патологией — раком молоч- 205 30 14,6
ной железы, легкого, прямой кишки и т. д.)
Итого 2742 103 3,8

83
Дерматовенерология и эстетическая медицина № 2 / 2016

Грозные цифры годичной смертности высо- нако при анализе данных было выявлено, что
ки, как и ожидалось, среди агрессивных сарка- истинной причиной смерти у больных пожилого
матозных патологий: при саркоме производных (более 72 лет) и старческого (более 80 лет) воз-
кожи каждый 10-й больной умирал в течение раста оказалась преимущественно сердечно-со-
года. При меланоме этот показатель оказался судистая недостаточность. Раковое поражение
еще выше: 11,7  % первичных больных мелано- кожи, как таковое, не повлияло на длительность
мой умирали, не прожив и года. Одногодичная жизни этих больных.
летальность при раке кожи составила 1,6  %. Од-

Годичная летальность
14,6
11,7
10

5,2
3,8
1,6

жи
бы

мы

жи

е
ра тве чн о
ко

о
гу

ы
ко

ко

ог
к и нн
к

а
ар

ес ви

Ит
Ра

к
ом

Ра
С

ож е р
ан

П
ел
М

мн

При изучении такого благоприятного признака, как 5-летняя выживаемость, отмечена зеркально-
противоположная ситуация:

5-летняя
Локализация Всего %
выживаемость
Рак губы (верхней и нижней) 115 67 58,3
Саркомы производных кожи (дерматосаркомы, саркома
30 13 43,3
Капоши, трихосаркома)
Меланома кожи (пигментная и беспигментная) 266 103 38,7
Рак кожи (туловища, головы/шеи, конечностей) 2126 1135 53,4
Первично-множественные раки (сочетание рака кожи
и губы с другой злокачественной патологией — раком 205 67 32,7
молочной железы, легкого, прямой кишки и т. д.)
Итого 2742 1385 50,5

5-летняя выживаемость, %

58,3 53,4
60 50,5
43,3
50 38,7
32,7
40
30
20
10
0
жи
бы

жи
мы

е
ко

ра тве чно

о
ы
гу

ко
ко

ог
к и нн
а
к

ом

ес ви
к
ар

Ит
Ра

Ра

ож е р
ан
С

П
ел
М

мн

84
ОБМЕН ОПЫТОМ

При этническом анализе выделенного контингента установлено, что наибольшая заболеваемость


раком кожи отмечена у лиц с белой кожей.
Перечень национальностей, Перечень национальностей,
отнесенных к этнически темной коже отнесенных к этнически светлой коже
Буряты, дунганы, иранцы, киргизы, туркмены, удмурты, Греки, поляки, белорусы, мордва, немцы, корейцы,
цыгане, башкиры, турки, чуваши, азербайджанцы, евреи, армяне, украинцы, татары, русские
уйгуры, таджики, казахи, узбеки
691 (из них узбеков — 650) 2 051 (из них русских — 1 633)
Всего 25,2  % (из них узбеков — 23,7  %) Всего 74,8  % (из них русских — 59,5  %)

По данным Канцер-регистра, в 2015 г. диагноз базе ТашГОД пролечены 129 больных. При ана-
«Злокачественное заболевание кожи и губы» лизе стадийности установлено:
установлен 152 больным (И.П. — 6,4), из них на

Клиническая
Нозология TNM Кол-во
стадия
Рак губы, в том числе: 7

I
II Т2N 0 M 0 4
III Т3 N 0 M 0 1
IV Т4NXM 0 2
Саркомы производных кожи 4
(дерматосаркомы, саркома Капоши, трихосаркома),
в том числе:
I
II Т2N 0 M 0 1
III Т3 N 0 M 0
IV Т4NXM 0 3
Меланома кожи (пигментная и беспигментная), 41
в том числе:
I Т1N0M 0 3
II Т2N0M 0. Т3N0M 0. 18
III Т3N1M 0. Т3N2M0 13
IV Т4NXM 0 7
ТлюбоеNлюбоеM1
Рак кожи (туловища, головы/шеи, конечностей), 90
в том числе:
I Т1N0M 0 28
II Т2N 0 M 0 52
III Т3N0M 0 Т4N0M 0 7
IV ТлюбоеNлюбоеM1 3
Первично-множественные раки 10
(сочетание рака кожи и губы с другой злокаче-
ственной патологией — раком молочной железы,
легкого, прямой кишки и т.д.)
Итого 152

Большие цифры онкозаболеваемости дан- сультированы 1  150 больных. Среди них РК уста-
ной патологией подразумевают, в свою очередь, новлен у 116, фибропапиломы — у 142, пигмент-
высокие цифры обратившихся в поликлинику ный невус — у 151 и т.  д.
ТашГОД с доброкачественными опухолевыми Лечение опухолевой патологии кожи требует
процессами. За 2015 г. доброкачественными и дифференцированного подхода. По данным Кан-
злокачественными заболеваниями кожи прокон- цер-регистра, завершили лечение 102 больных.

85
Дерматовенерология и эстетическая медицина № 2 / 2016

Всего пролечено леваемость раком кожи — 74,8  % зарегистриро-


Метод лечения ванных больных с этнически белой кожей;
абс. %
2) отмечена корреляция с мировыми данными
Близкофокусная терапия 55 53,9 об агрессивном течении саркоматозных и мела-
Комбинированная комплексная номатозных поражений кожи, существенно сокра-
29 28,4
терапия щающих продолжительность жизни;
Криодеструкция 2 2,0 3) в лечении злокачественных заболеваний
Хирургическое лечение 16 15,7 кожи и губы в ТашГОД используется весь спектр
Итого 102 100,0 лечебных подходов, обеспечивающих высокие
цифры выживаемости при несаркаматозных их
поражениях в то же время при саркоматозных и
Вывод
меланоматозных опухолях кожи эти цифры не
1) По анализу данных Канцер-регистра можно столь высоки вследствие запоздалой диагнос-
сказать о влиянии этнического фактора на забо- тики.

Литература

1. Hunter Shain, Boris C. Bastian. From melanocytis to 4. Давыдов М.И., Ганцев Ш.Х. Онкология. Учеб-
melanoma // Nature Reviews Cancer. 2016. P.  345–358. ник. 2010. C.  651–667.
2. Госотчетность Ташкентского городского онко- 5. Юлдашева Д.Ю., Гафур-Ахунов М.А. Состоя-
логического диспансера за 2005–2016 гг. ние онкологической службы г. Ташкента. Сбор-
3. Costin G.E., Hearing V.J. Human skin pigmenta- ник трудов III Конгресса онкологов Узбекиста-
tion: melanocytes modulate skin color in response на. — Ташкент. C.  62.
to stress // FASEB J. 2007. Vol. 21. P.  976–994.

УДК: 616.61-002-022.7:616.98:579.882.1:612.017.1-085.281

ИЗУЧЕНИЕ ВЛИЯНИЯ ПРЕПАРАТА «ЦЕЛАГРИП» НА СОСТОЯНИЕ ИММУННОЙ


СИСТЕМЫ У БОЛЬНЫХ УРОГЕНИТАЛЬНЫМ УРЕАПЛАЗМОЗОМ И ХЛАМИДИОЗОМ

Б.Ш. ФАТТАХОВ, У.Ю. САБИРОВ, А.М. АБИДОВ

Республиканский специализированный научно-практический медицинский центр


дерматологии и венерологии МР РУз

ХУЛОСА

УРОГЕНИТАЛ УРЕАПЛАЗМОЗЛИ ВА ХЛАМИДИОЗЛИ БЕМОРЛАРДА ЦЕЛАГРИПНИНГ ИММУН


ТИЗИМИ ҲОЛАТИГА ТАЪСИРИНИ ЎРГАНИШ
Б.Ш. Фаттахов, У.Ю. Сабиров, А.М. Абидов
Мақолада урогенитал уреаплазмоз ва хламидиозли беморларда маҳаллий препаратлардан
бўлмиш ЦелАгрипнинг иммун тизимига таъсири илмий тадқиқодлар натижаси келтирилади.
Калит сўзлар: урогенитал уреаплазмоз, хламидиоз, ЦелАгрип, иммун тизими, зардоб иммуноглобу-
линлар.

S UMMARY

ST UDYING OF INFL UENCE OF TSELAGRIP ON THE CON DITION OF IMM UNE SYSTEM AT PATIENTS
WITH UROGENITAL UREAPLASMOSIS AND CHLAMYDIOSIS
B.Sh. Fattakhov, U.Yu. Sabirov, A.M. Abidov
Scientific researches on studying of influence of a domestic preparation of Tselagrip on a condition of
immune system at patients with urogenital ureaplasmosis and chlamydiosis are given in article.
Keywords: urogenital ureaplasmosis, chlamydiosis, Tselagrip, immune system, serumal immunoglobulins.

86
ОБМЕН ОПЫТОМ

РЕЗЮМЕ
ИЗУЧЕНИЕ ВЛИЯНИЯ ПРЕПАРАТА «ЦЕЛАГРИП» НА СОСТОЯНИЕ ИММУННОЙ СИСТЕМЫ
У БОЛЬНЫХ УРОГЕНИТАЛЬНЫМ УРЕАПЛАЗМОЗОМ И ХЛАМИДИОЗОМ
Б.Ш. Фаттахов, У.Ю. Сабиров, А.М. Абидов
В статье приведены научные исследования по изучению влияния отечественного препарата
«ЦелАгрип» на состояние иммунной системы у больных урогенитальным уреаплазмозом и хлами-
диозом.
Ключевые слова: урогенитальный уреаплазмоз, хламидиоз, «ЦелАгрип», иммунная система, сыво-
роточные иммуноглобулины.

И нфекции, передающиеся половым путем,


являются важной медико-социальной
проблемой в большинстве стран мира, а в не-
стирован урогенитальный уреаплазмоз, у 19 —
хламидиоз. Контрольная группа состояла из 17
практически здоровых лиц.
которых странах приобрели характер эпидемии. Оценку состояния общего иммунитета про-
Сведения об урогенитальных инфекциях и их ос- водили с использованием моноклональных
ложнениях за последние годы существенно из- антител методом розеткообразования соглас-
менились и расширились. В настоящее время с но рекомендациям Института иммунологии АН
этими инфекциями связывают не только заболе- РУз [5], идентифицируя СD3 — для рецепторов,
вания мочеполовых органов, глаз, суставов, но и Т — лимфоцитов, СD4 — Т-хелперов, СD8 —
респираторные нарушения и ряд системных про- Т-супрессоров и СD19 — В-лимфоцитов. Коли-
явлений [2, 4, 8, 10]. чественное определение концентрации сыворо-
Уретриты различной этиологии относятся к точных иммуноглобулинов проводили методом
самым распространенным заболеваниям, пере- радиальной иммунодиффузии по Mancini G.
дающимся преимущественно половым путем. [11].
Установлено распространение хламидийной и Для коррекции выявленных нарушений в им-
уреаплазменной инфекций у мужчин и женщин мунной системе использовали отечественный
активного полового возраста, чаще всего у лиц иммунокорригирующий препарат «ЦелАгрип».
20–45 лет [6, 9]. Основным механизмом действия ЦелАгрипа
Наряду с разнообразием клинического тече- является способность индуцировать продукцию
ния уреаплазменные и хламидийные инфекции интерферона практически во всех популяциях
урогенитального тракта оказывают определен- клеток, принимающих участие в противовирус-
ное влияние на иммунную систему организма. ном ответе организма: Т- и В-лимфоцитах, ма-
Внедрение в организм инфекций, независимо от крофагах, гранулоцитах, фибробластах, эндоте-
этиологии заболевания, сопровождается возник- лиальных клетках.
новением общих и местных изменений. Установ- Препарат назначали по 2 таблетки 3 раза в
лено, что у больных воспалительными заболева- день в течение 5 дней. Результаты исследова-
ниями урогенитального тракта, обусловленными ния статистически обрабатывали с помощью
урогенитальным уреаплазмозом и хламидиозом, стандартных методов вариационной статистики с
отмечается снижение функциональной актив- применением t-критерия Стьюдента по приклад-
ности клеточного и активация гуморального зве- ной программе «Excel-Office-2010» на компьюте-
ньев иммунитета [1, 3, 7]. ре Pentium IV.
Несмотря на разработку новых лекарственных Результат исследования. Анализ состояния
препаратов и создание на их базе современных иммунной системы показал (табл. 1), что у боль-
подходов к лечению больных инфекциями уро- ных урогенитальным уреаплазмозом и хламидио­
генитального тракта, наблюдаются случаи не- зом до начала лечения со стороны клеточного
эффективной терапии, рецидивов заболевания, звена иммунной системы отмечено снижение
побочных действий препаратов. В этой связи относительного количества CD3- и CD4-клеток в
исследование состояния иммунной системы у 1,2 раза и повышение процентного содержания
больных урогенитальным уреаплазмозом и хла- CD8-клеток в 1,1 раза.
мидиозом и разработка новых методов лечения Анализ состояния гуморального звена имму-
данной патологии являются актуальной пробле- нитета показал, что у больных при данных пато-
мой дерматовенерологии. логиях относительное число CD19-клеток повы-
Цель исследования. Изучение влияния оте- шается в 1,3 раза по отношению к данным группы
чественного препарата «ЦелАгрип» на состояние контроля.
иммунной системы у больных урогенитальным При исследовании концентрации сывороточ-
уреаплазмозом и хламидиозом. ных иммуноглобулинов выявлено, что у больных
Материал и методы исследования. Под на- наблюдалось достоверное снижение уровня IgA
блюдением находились 44 больных обоего пола (p < 0,05), повышение IgG (p < 0,05), а содержание
в возрасте от 19 до 35 лет. У 25 больных диагно- IgM оставалось на уровне контроля.

87
Дерматовенерология и эстетическая медицина № 2 / 2016

Таблица 1
Показатели иммунной системы у больных урогенитальным
уреаплазмозом и хламидиозом (М±m)

Показатели Контрольная группа, Больные уреаплазмозом, Больные хламидиозом,


иммунитета n = 17 n = 25 n = 19
CD3, % 58,65 ± 0,81 51,04 ± 0,54* 51,29 ± 0,75*
CD19, % 16,59 ± 0,41 22,21 ± 0,47* 22,14 ± 0,55*
CD4, % 38,59 ± 0,38 31,28 ± 0,52* 31,02 ± 0,49*
CD8, % 18,70 ± 0,47 21,08 ± 0,45* 21,36 ± 0,48*
IgA, г/л 2,35 ± 0,05 2,04 ± 0,04* 2,13 ± 0,05*
IgM, г/л 1,41 ± 0,06 1,51 ± 0,04 1,56 ± 0,05
IgG, г/л 12,11 ± 0,31 18,12 ± 0,54* 18,47 ± 0,54*

*Достоверность данных по отношению к контролю (p < 0,05).

Полученные данные свидетельствуют, что у С этой целью больные были разделены на


больных урогенитальным уреаплазмозом и хла- две группы: первая группа сравнения (21 боль-
мидиозом наблюдается нарушение в работе им- ной) получила традиционное лечение анти-
мунной системы, выражающееся дисбалансом биотиками, витаминами, биогенными стиму-
как клеточного, так и гуморального звеньев им- ляторами и местно — 0,25  % азотнокислым
мунной системы. серебром в виде инстилляции; вторая группа
Далее было изучено влияние отечественного (23 больных) наряду с традиционной терапией
препарата «ЦелАгрип» на состояние иммунной принимала препарат «ЦелАгрип» (табл. 2).
сис­темы у исследуемых больных.
Таблица 2
Влияние применяемых методов лечения на показатели системы иммунитета
у больных урогенитальным уреаплазмозом и хламидиозом (M ± m)

Урогенитальный уреаплазмоз Урогенитальный хламидиоз


Показатели Методы лечения
иммунитета традиционное, комплексное, традиционное, комплексное,
n = 12 n = 13 n = 9 n = 10
51,25 ± 0,60 50,87 ± 0,97 50,50 ± 0,94 51,88 ± 0,97
CD3, %
53,75 ± 0,78 56,86 ± 0,42** 53,20 ± 0,76 56,78 ± 0,68**
22,50 ± 0,66 22,12 ± 0,85 23,40 ± 1,69 21,44 ± 1,12
CD19, %
20,08 ± 0,54 18,14 ± 0,35** 20,20 ± 0,96 17,07 ± 0,94**

30,33 ± 0,85 32,16 ± 0,78 29,30 ± 0,83 32,54 ± 0,87


CD4, %
34,42 ± 0,58* 35,98 ± 0,47** 34,20 ± 0,93* 36,65 ± 0,92**

21,92 ± 0,93 20,68 ± 0,57 21,20 ± 1,16 21,76 ± 0,78


CD8, %
19,00 ± 0,51* 18,42 ± 0,49* 19,10 ± 0,72* 17,61 ± 0,56*

1,97 ± 0,08 2,12 ± 0,06 1,90 ± 0,06 2,15 ± 0,06


IgA, г/л
1,90 ± 0,07 1,84 ± 0,06 1,92 ± 0,06 1,95 ± 0,05

1,62 ± 0,08 1,52 ± 0,05 1,42 ± 0,09 16,68 ± 0,92


IgM, г/л
1,45 ± 0,04 1,43 ± 0,05 1,29 ± 0,07 14,26 ± 0,58

18,77 ± 0,63 17,44 ± 0,96 20,56 ± 0,79 16,68 ± 0,92


IgG, г/л
16,11 ± 0,74 15,88 ± 0,64 18,47 ± 0,72 14,26 ± 0,58

Примечание: в числителе — данные до лечения;


в знаменателе — данные после лечения;
р — достоверность данных по сравнению с показателями до лечения.
*р < 0,05;  **p < 0,01.

Результаты исследования показали, что у лась склонность к увеличению относительного


больных урогенитальным уреаплазмозом и хла- количества СD3-клеток по сравнению с данными
мидиозом после традиционной терапии отмеча- до лечения (р > 0,05).

88
ОБМЕН ОПЫТОМ

Изучение субпопуляционного состава Т-лим­ чением в иммунной системе больных отмечалось


фоцитов свидетельствовало, что у больных дан- более выраженное восстановление выявленного
ных групп после лечения наблюдалось досто- дисбаланса. После окончания комплексной те-
верное увеличение относительного количества рапии у больных отмечалось достоверное повы-
СD4-клеток и снижение содержания СD8-клеток шение относительного количества СD3-и СD4-
по отношению к данным до лечения (р < 0,05). клеток (p < 0,01) и снижение содержания СD8-
При исследовании состояния гуморально- клеток (р < 0,05).
го звена иммунитета после лечения отмечено Изучение состояния гуморального звена им-
снижение процентного содержания СD19-кле­ мунитета показало, что под влиянием комплекс-
ток, однако оно было статистически недостовер- ной терапии наблюдалось статистически досто-
ным. верное снижение относительного содержания
Концентрация в крови иммуноглобулинов трех СD19-клеток по сравнению с показателями до
классов — IgА, IgM и IgG была склонна к сниже- лечения (р < 0,01).
нию по сравнению с данными до лечения (р > 0,05). Уровень IgА и IgG в сыворотке крови был
Несмотря на положительные сдвиги в иммунной склонен к снижению по сравнению с данными до
системе у больных показатели гуморального зве- лечения (р>0,05), а концентрация IgM оставалась
на иммунитета после окончания лечения остались на уровне данных до лечения.
ниже данных практически здоровых лиц. Таким образом, результаты исследования
Следовательно, полученные данные свиде- свидетельствуют, что разработанный нами ком-
тельствуют, что на фоне традиционной терапии у плексный метод терапии больных урогениталь-
больных урогенитальным уреаплазмозом и хла- ным уреаплазмозом и хламидиозом способ-
мидиозом со стороны иммунной системы отмеча- ствует более выраженному восстановлению
ются некоторые положительные сдвиги в сторону выявленных нарушений в иммунной системе ор-
восстановления, однако выявленный дисбаланс ганизма. Отечественный препарат «ЦелАгрип»
в иммунной системе сохраняется. оказывает положительный терапевтический
При использовании разработанного нами ме- эффект при лечении больных урогенитальным
тода терапии по сравнению с традиционным ле- уреа­плазмозом и хламидиозом.

ЛИТЕРАТУРА

1. Абидов А.М., Алимухамедова Ю.А., Исроилов плазменной инфекций // Актуальные вопросы


Х.Т. Различные лабораторные методы иссле- бесплодного брака, обусловленного БППП. Те-
дования в диагностике урогенитального хла- зисы докладов. — Свердловск. 1994. С.  71.
мидиоза // Актуальные проблемы дерматове- 7. Миколаускас В.П. Исследования клеточного
нерологии. Сборник трудов научно-практиче- иммунитета у больных урогенитальным хла-
ской конференции дерматовенерологов. 2001. мидиозом // Клиническая лабораторная диа-
С.  46–47. гностика. 2004. №  4. С.  36–38.
2. Арифов С.С., Курбанов Д.Д., Хасанова М.А. 8. Солиев Т.С., Порсохонова Д.Ф., Курбанов Д.Д.,
Ровамицин в лечении больных хламидиозом Алимов Б.Д. Значение хламидийной и уреа-
// Новости дерматологии и венерологии. 1999. микоплазменной инфекций в развитии репро-
№  3. С.  60–61. дуктивных и висцеральных нарушений //  Ме-
3. Базарный В.В., Левчик Н.К. Особенности кле- дицинский журнал Узбекистана. 2004. №  3.
точного иммунитета больных урогенитальным С.  117–119.
хламидиозом в зависимости от уровня пора- 9. Титова Т.М., Карпухин И.В., Ли А.А., Семенова
жения половых путей // Иммунология. 2001. Е.В. Комплексное применение антибиотиков,
№  3. С.  45–46. иммуномодуляторов и физиотерапии при уро-
4. Евсюкова И.И., Королева Л.И. Актуальные про- генитальных инфекциях у мужчин // Вопросы
блемы диагностики и лечения внутриутробной курортологии, физиотерапии и лечебной физ-
хламидийной инфекции // Педиатрия. Журнал культуры. 1999. №  1. С.  45–47.
им. Г.Н. Спиранского. 2003. №  2. С.  82–87. 10. Hurwitz H. A gold standard of treatment and cure
5. Залялиева М.В. Методы оценки субпопуляций for chlamydia // Manag. Care Q. 2003. Vol.  11.
лимфоцитов периферической крови у челове- №  3. Р.  8 –10.
ка. Методические рекомендации. — Ташкент. 11. Mancini I., Carbonara A.O., Aeromans J.F. Immu-
2004. 15  с. nochemical guantiration of antigen by single radial
6. Мавров И.И. Влияние на репродуктивную спо- immunodiffusion // Immunochemistry. 1965. № 2.
собность урогенитальной хламидийной и уреа­ P.  235–248.

89
Дерматовенерология и эстетическая медицина № 2 / 2016

Косметология

УДК:616-003.92-08-084

СОВРЕМЕННЫЕ ПРОБЛЕМЫ ЛЕ