Fish and Shellfish Immunology 81 (2018) 168–175

Contents lists available at ScienceDirect

Fish and Shellfish Immunology

journal homepage: www.elsevier.com/locate/fsi

Full length article

Functional domains of Litopenaeus vannamei transglutaminase and their T

involvement in immunoregulation in shrimp
Zhou Zheng1, Wenning Xu1, Jude Juventus Aweya1, Mingqi Zhong, Shangjie Liu, Jingsheng Lun,
Jiehui Chen, Yueling Zhang∗
Department of Biology and Guangdong Provincial Key Laboratory of Marine Biotechnology, Shantou University, Shantou, 515063, China

A R T I C LE I N FO A B S T R A C T

Keywords: Shrimps, which mainly rely on their innate immune system to response to infectious pathogens, have clottable
Litopenaeus vannamei proteins as an important component of this system. While transglutaminases (TGase) are found in Litopenaeus
Transglutaminase vannamei and constitute part of the coagulation system, the specific immune-related roles played by its func-
Ig-like domain tional domains in the immunoregulation of shrimp has not been well understood. In the present study, we report
Immunoregulation
that the Ig-like domain of L. vannamei transglutaminase (TGase-C) is the main immune-related domain among
CAP-3
Apoptosis
the three functional domains, as it had higher bacterial agglutinative activity against Vibrio parahaemolyticus and
Streptococcus iniae. Using Co-immunoprecipitation and LC-MS/MS analysis, TGase-C was shown to interact with
474 proteins, of which 52 proteins were annotated to L. vannamei. More than half of the L. vannamei annotated
proteins have immune-related functions, including apoptosis. Further analysis using pull-down assay revealed
that TGase-C interacted with CAP-3 (a homologue of caspase 3). In addition, siRNA-mediated knockdown of
LvTGase significantly (p < 0.01) increased the expression level of LvCAP-3 coupled with a significant
(p < 0.01) increase in caspase 3/7 activity, suggesting that probably LvTGase participates in shrimp immune
response by modulating the activity of LvCAP-3. These findings thus suggest the Ig-like functional domain of L.
vannamei's transglutaminase is the domain that is involved in immunoregulation in shrimp.

1. Introduction immunity. Some immune-related molecules including antimicrobial

The Pacific white shrimp, Litopenaeus vannamei, is the most im-
portant farmed shrimp species in the world, constituting over two-third
of the annual global aquaculture shrimp produce [1]. Shrimp aqua-
culture is however faced with numerous and devastating bacteria and
viral pathogens [2], prominent ones being Vibrio parahaemolyticus and
white spot syndrome virus (WSSV) infections, which have caused great
economic losses to the industry [3,4]. It is mainly for this reason that a
better understanding of the immunology of L. vannamei is very im-
portant, as this would lay a good foundation for developing and es-
tablishing prudent disease control strategies in shrimp aquaculture.
As invertebrates, L. vannamei lacks adaptive immunity and mainly
rely on its innate immune system to protect itself and respond to pa-
thogen infections. In the last couple of years, great research attention
has sought to gain a better understanding of the innate immune system
of L. vannamei [5]. Literature from these studies have shown that a
growing number of immune-related molecules and signal transduction
pathways have been discovered and shown to be relevant in shrimp
peptides, serine proteinases and inhibitors, hemocyanin, phenolox-
idases, oxidative enzymes, clotting proteins, pattern recognition pro-
teins, lectins, Toll receptors as well as other humoral factors are be-
lieved to participate in the innate immune response of shrimp [6]. For
instance, ALFs (anti-lipopolysaccharide factors) are antimicrobial pep-
tides identified as effectors of the innate immune system and have been
characterized in many crustaceans [7,8], while clip domain serine
proteinases and their homologs are members of a proteinase family that
are involved in shrimp innate immunity [9]. Similarly, hemocyanin,
which is traditionally regarded as an oxygen transport protein, has been
shown to act as a frontline molecule in innate immune defense [10,11],
with phenoloxidase, antiviral, antimicrobial, hemolytic, agglutinative
and antitumor activity [12–15]. In terms of signal transduction path-
ways, the Toll, IMD and JAK/STAT pathways have been implicated as
some of the main pathways regulating the immune response of shrimp
[16,17]. Of special interest in this study is transglutaminase (TGase),
which is not only part of the coagulation system [18–22], but also plays
a prominent role in inhibiting the entry of pathogens into the body

∗
Corresponding author. Department of Biology, School of Science, Shantou University, Shantou, Guangdong, 515063, China.
E-mail address: zhangyl@stu.edu.cn (Y. Zhang).
1
These authors contributed equally to this work.

https://doi.org/10.1016/j.fsi.2018.07.024
Received 3 May 2018; Received in revised form 8 July 2018; Accepted 11 July 2018
1050-4648/ © 2018 Published by Elsevier Ltd.
Z. Zheng et al. Fish and Shellfish Immunology 81 (2018) 168–175

[23,24], for which reason it is considered an important immune factor Table 1

in shrimp. However, up until now the domain(s) or motifs of TGase Sequence of primers and siRNA used in this article.
with immune-related functionality as well as the specific role that these Primer Sequence (5′-3′) Restriction
domain(s) play in the immune regulatory network of shrimp is not well enzyme
understood.
cDNA cloning
In the present study, we characterized the functional domains of
TGase-N-F GAATTCGTCAACCACCACTGCGAGAT EcoR I
transglutaminase from the shrimp L. vannamei and explored their in- TGase-N-R AAGCTTGATAGAACCGAGCCATTTAG Hind III
volvement in shrimp immune modulation. To the best of our knowl- TGase-M-F GAATTCGCTAAATGGCTCGGTTCT EcoR I
edge, this is the first time the immune-related functions of TGase do- TGase-M-R AAGCTTGGCGCTGAGGATGCTGAC Hind III
mains in invertebrates have been characterized, hence, our findings TGase-C-F GAATTCGACATCACGTGGGACTACA EcoR I
TGase-C-R AAGCTTCACCCTTATGGGAACAGCC Hind III
could further our understanding on the immune system of shrimp.
LvCAP-3-F GAATTC GATGCAGCGAGAGCCGAG EcoR I
LvCAP-3-R GCGGCCGCTTAACGGAGGAGTGTCGAGTGG NotI
2. Materials and methods siRNA
siLvTGase-F AUGGAGAGAGAGACGUUGGTT
siLvTGase-R CCAACGUCUCUCUCUCCAUTT
2.1. Experimental animals
siNon-F UUCUCCGAACGUGUCACGUTT
siNon-R ACGUGACACGUUCGGAGAATT
Healthy L. vannamei (average weight 5 g) were obtained from a local Real-time PCR
farm, Shantou Huaxun Aquatic Product Corporation (Shantou, QLvTGase-F CCACGACCTTATCAAGAGCA
Guangdong, China), and cultured in laboratory tanks filled with aerated QLvTGase-R AGGACACCCTTATGGGAACA
QLvCAP-3-F CGGTTCAGACGGACAGCATA
seawater at room temperature. Shrimps were acclimatized for 2–3 days
QLvCAP-3-R CTGGCACAGTTCTTGAGGTTC
prior to the experiments. QLvEF-F TATGCTCCTTTTGGACGTTTTGC
QLvEF-R CCTTTTCTGCGGCCTTGGTAG
2.2. Domain analysis of L. vannamei TGase (LvTGase)

The TGase protein sequence of L. vannamei (GenBank ID:
ABN13875.1), previously reported by Yeh et al. [20], was obtained
from the NCBI database. The simple modular architecture research tool
(SMART, http://smart.embl-heidelberg.de) was used to analyze the
LvTGase protein domains.
2.3. Total RNA extraction and cDNA synthesis
Total RNA was extracted from the hepatopancreas of L. vannamei
using the RNAFAST 200 Kit (FeiJie, Shanghai, China) according to the
manufacturer's instructions. The cDNA samples were synthesized using
the PrimeScript™ RT reagent Kit with gDNA Eraser (TaKaRa, Japan)
following the manufacturer's instructions.
2.4. Cloning, expression and purification of recombinant LvTGase domain
proteins
Bioinformatics analysis revealed that LvTGase had three domains,
an N-terminal domain, a protease-like homology domain and an Ig-like
domain. In order to further analyze the functions of these domains, we
selected the main sequences of each domain for cloning, N-terminal
domain (181-918bp), protease-like homology domain (898-1575bp)
and Ig-like domain (1510-2037bp), defined as TGase-N, TGase-M and
TGase-C, respectively. The specific primers used are listed in Table 1,
and using shrimp hepatopancreas cDNA as template. The PCR mixture
and reaction conditions were as follows: 1.0 μL cDNA (0.5 mg/mL),
1.0 μL forward primer (10 μM), 1.0 μL reverse primer (10 μM), 10.0 μL
2 × Taq PCR buffer Mix (containing Taq DNA polymerase, dNTPs and
reaction buffer, Genstar, Beijing, China) and 7.0 μL ddH2O. The PCR
cycling program was set at 30 cycles with 94 °C for 3 min, 94 °C for 30 s,
55 °C for 30 s and 72 °C for 1 min, and a final elongation at 72 °C for
10 min. The quality and size of PCR products were checked on 1%
agarose gel electrophoresis, following by extraction and purification
using the EasyPure Quick Gel Extraction Kit (TransGen, Bejing, China)
according to the manufacturer's instruction. The purified DNA was
quantified using NanoDrop 2000 spectrophotometer (Nano-drop
Technologies, Wilmington, DE), after which about 1 μg was digested
with EcoR I and Hind III restriction enzymes (TaKaRa, Japan), then
ligated into the vector pET-32a (Amersham Biosciences, Chalfont, UK)
and the recombinant plasmid transformed into Escherichia coli BL21
(Promega, Madison, WI). Recombinant clones grown on MacConkey
agar (Sigma, St. Louis, MO) were picked and confirmed by sequencing.
The expression of the recombinant proteins were induced with 1 mM
IPTG (isopropylthio-β-galactoside) for 4 h at 37 °C, followed by soni-
cation for 15 min with burst duration of 3 s each. The sonicated lysates
were centrifuged at 20000 g for 30 min at 4 °C, and the supernatants
and precipitates analyzed on 10% SDS-PAGE. Since the three re-
combinant proteins were mostly expressed in the precipitate, next, the
precipitates were denatured and renatured as follows: denaturing buffer
(50 mM Tris-HCl pH 8.0, 150 mM NaCl, 8 M urea, 20 mM DL-Dithio-
threitol (DTT), 5 mM TritonX-100) was added to the precipitates and
placed on a rotator at 4 °C for 12 h, after which samples were cen-
trifuged at 20000 g, 4 °C for 30 min, and the supernatants collected. To
renature the proteins contained in the supernatants, the collected su-
pernatants were subjected to a series of dialyses against a buffer con-
taining 50 mM Tris-HCl pH 8.0, 150 mM NaCl, 1 mM Ethylenediami-
netetraacetic acid disodium salt (EDTA-Na2), 1 mM DTT, 5% Glycerine,
and decreasing concentrations of urea (8 M, 4 M, 2 M, 1 M, 0.5 M, and
0 M urea) at 4 °C for 12 h. Finally, the renatured recombinant proteins
were purified with nickel column chromatography (Qiagen, U.S.A) and
identified via SDS-PAGE and Western blot analysis.
2.5. SDS-PAGE and western blot analysis
All the recombinant proteins were separated on SDS-PAGE, under
reducing conditions on a 10% separating gel (pH 8.8) with a 3%
stacking gel (pH 6.8), and transferred onto a polyvinylidene fluoride
(PVDF) membrane. The PVDF membrane were blocked with 5%
skimmed milk dissolved in TBST (20 mM Tris, 150 mM NaCl, 0.1%
Tween 20, pH 7.6) for 2 h at room temperature, followed by incubation
with mouse anti-His (1:1000, Beyotime-BioTech, China) and mouse
anti-TGase-C antisera (1:5000, generated in-house as described in
subsection 2.7 below), at room temperature for 2 h and then washed 3
times (15 min) with TBST. Next, membranes were incubated with HRP-
linked goat anti-mouse secondary antibodies (1:1000, Sigma-Aldrich,
USA) for 1 h at room temperature. The membranes were developed
with 3′3-diminobenzidine (DAB) substrate.
2.6. Agglutination assays
Agglutination assay was performed as previously described [25].
Briefly, two bacterial species, V. parahaemolyticus (Gram-negative) and
S. iniae (Gram-positive) were separately cultured in Luria-Bertani (LB)
medium (1% tryptone, 0.5% yeast extract, and 1% NaCl) overnight at

169
Z. Zheng et al.
37 °C. After the overnight culture, bacteria cells were harvested, wa-
shed, and diluted to 108 CFU/mL in TBS-Ca2+ (0.05 M Tris, 0.75%
NaCl, 0.05 M CaCl2). Next, 20 μL of each of the diluted bacteria was
mixed with an equal volume of rTGase-N, rTGase-M, and rTGase-C
(200 μg/mL), which were diluted 2-fold in TBS-Ca2+, and then in-
cubated at 37 °C for 30 min. The agglutination was read on a light
microscope (Olympus BX51, Olympus Corporation) and scored as po-
sitive (+) or negative (−) compared to control bacteria incubated with
TBS-Ca2+ buffer. Agglutinative titer was defined as the highest dilution
of the test sample.
2.7. Preparation of LvTGase-C antisera
To obtain the antisera against TGase-C, rTGase-C expressed and
purified as explained in subsection 2.4 above, was used to immune mice
as previously reported [26]. Briefly, the recombinant protein was
concentrated to 1 mg/mL with an ultracentrifuge filter. Equal volumes
of rTGase-C (0.5 mL) and complete Freund's adjuvant (Sigma-Aldrich,
USA) were mixed thoroughly and each of 5 Kunming mice (kind gift
from Dr. ZhiJu Wei of Shantou University) hypodermically injected
with 0.1 mL of the inoculum mixture. Injection was repeated five times
at seven days interval, and replacing the complete Freund's adjuvant
with incomplete Freund's adjuvant (Sigma-Aldrich, USA) from the
second injection onwards. Three days after the final injection, blood
was collected from the mice and tested for anti-TGase-C titer and spe-
cificity. The collected anti-TGase-C antiserum was stored at −80 °C for
further use.
2.8. Preparation of shrimp hemocytes lysate
Shrimp hemolymph was withdrawn with a sterile needle and syr-
inge into an equal volume of ACD anticoagulant (336 mM NaCl,
115 mM glucose, 27 mM sodium citrate, 9 mM EDTA-Na2, pH 7.0), and
immediately centrifuged at 800 g at 4 °C for 10 min. The cells were
thoroughly washed 3 times with chilled PBS (140 mM NaCl, 10 mM
sodium phosphate, pH 7.4), lysed in 1 × lysis buffer (1mL/100 mg cell
pellet, Beyotime BioTech, China), vortexed 3 times (one time/3 min),
then centrifuged at 20000 g, 4 °C for 30 min. The supernatant was
collected and stored at −20 °C until further analysis.
2.9. Co-immunoprecipitation (IP) assays
The Co-IP assays were performed using the IP Kit, Protein A/G Plus
Agarose (Sangon-Biotech, Shanghai, China) according to the manufac-
turer's instructions. Briefly, 20 μL Protein A agarose beads were added
to a column containing a filter and washed four times with PBS (one
time/700 μL). Then 300 μL hemocytes lysate was mixed with 10 μg
mouse anti-rTGase-C antibody, 7 μL PMSF and three different con-
centrations of purified rTGase-C protein (50 and 250 μg/mL), followed
by overnight incubation at 4 °C. Samples were then centrifuged at
12000 rpm, 4 °C for 1 min and the supernatant removed. Next, the
beads were washed seven times with 1 × IP buffer, then three times
with 0.1 × IP buffer, then centrifuged at 12000 rpm, 4 °C for 30 s and
resuspended in 1 × loading buffer. Several parallel control experiments
were also performed including: mixture of ddH2O, hemocytes lysate
and Protein A beads; mixture of anti-rTGase-C antibody, BSA (bovine
serum albumin, 50 μg/mL), ddH2O, hemocytes lysate and Protein A
beads; only hemocytes lysate; and two different concentrations of only
purified rTGase-C protein. The protein samples were then used for SDS-
PAGE analysis under the same conditions as described in subsection 2.5
above.
2.10. Protein identification by mass spectrometry
To analyze and identify the different protein band with about
35 kDa on the SDS-PAGE, which was only found in the Co-IP sample
170
Fish and Shellfish Immunology 81 (2018) 168–175
when the hemocytes lysate mixed with mouse anti-rTGase-C antibody
and rTGase-C in comparison with the other five negative controls, li-
quid chromatography electrospray ionization tandem mass spectro-
metry (LC-MS/MS) analysis was performed at Beijing Genomics
Institute (BGI) Genomics Center (Shenzhen, China), as previously de-
scribed [25,27]. Briefly, the 35 kDa protein band was excised, digested
with digest buffer (50% C2H3N, 25 mM NH4HCO3) and dried. Next,
10 mM DTT was added and incubated at 56 °C for 1 h. After cooling
down to room temperature, the proteins were alkylated with 55 mM
Iodoacetamide (IAM) at room temperature protected from light for
45 min. Then proteins were washed with the digest buffer and 25 mM
NH4HCO3 and dried. Finally, the enzymatic digestion was performed
with 4 μg trypsin in 40 μL of 20 mM NH4HCO3 overnight at 37 °C. The
peptides were then mixed with 0.1% formic acid to stop the digestion.
Then the peptide mixture (5 μg) was loaded onto a Strata-X C18 column
(Phenomenex, Torrance, CA, USA), and performed on a prominence
nano-HPLC system coupled with Triple TOF 5600 (SCIEX, Framingham,
MA, USA). The generated LC-MS/MS spectra was searched against the
NCBI database (http://www.ncbi.nlm.nih.gov/) using the MASCOT
(V2.3.02) [28] and downloaded. For the search, the mass tolerance for
peptide and fragment were set as 0.05 and 0.1 Da, respectively. All
procedures, methods and analysis were done following standard com-
mercial pipeline of BGI-MSI (BGI, Shenzhen, China).
2.11. Cloning, expression and purification of recombinant L. vannamei
CAP-3 (LvCAP-3)
The nucleotide sequence encoding LvCAP-3 gene (GenBank #:
DQ988351.1) was amplified, using primers designed (Table 1) and
synthesized by BMI-College (Shenzhen, China), using shrimp hepato-
pancreas cDNA as template and ligated into the vector pGEX-4T-1
(Amersham Biosciences, Chalfont, UK). The recombinant plasmid
(pGEX-4T-1-LvCAP-3) was transformed into Escherichia coli BL21 (DE3).
The expressed recombinant LvCAP-3 protein (denoted rLvCAP-3) was
purified using ProteinIso GST Resin kit (TransGen Biotech, China) ac-
cording to the manufacturer's instructions, and used immediately or
stored for subsequent experiments. The rLvCAP-3 protein was detected
using Western blot analysis as described in subsection 2.5, with mouse
anti-GST primary antibody (1:1000, Transgen BioTech, China) and
HRP-linked goat anti-mouse secondary antibody (1:1000, Sigma-Al-
drich, USA).
2.12. Pull down assays
The pull down assays was performed as previously reported with
modification [29]. First, 1 mL pellet of the pET-32a-TGase-C extracted
from E. coli BL21 was incubated with Ni-NTA agarose beads (Beijing
RuiDa HengHui Science & Technology Development Co., Ltd., China)
for 4 h at 4 °C followed by washing with 50 mM Tris-HCl (pH 8.0) until
the optical density at 280 nm (OD280) was equal to zero. Next, 1 mL
pellet of the pGEX-4T-1-LvCAP-3 extracted from E. coli BL21 was in-
cubated with the Ni-NTA beads overnight at 4 °C, after which beads
were washed with 50 mM Tris-HCl (pH 8.0) until the OD280 was equal
to zero. Finally, the beads were washed with 50 mM Tris-HCl (plus
50 mM imidazole), the eluent were collected and analyzed using SDS-
PAGE and Western blot as described in subsection 2.5, with mouse anti-
GST primary antibody (1:1000, Transgen-BioTech, China) or mouse
anti-TGase-C antisera (1:5000, generated in-house, see subsection 2.7)
and HRP-linked goat anti-mouse secondary antibody (1:1000, Sigma-
Aldrich, USA).
2.13. RNAi mediated knockdown of LvTGase
The RNAi-mediated knockdown assay was performed as previously
described [30]. The siRNA targeting LvTGase (siLvTGase) and scram-
bled control siRNA (siNon) was designed and synthesized by
Z. Zheng et al.
GenePharma (Suzhou, China) (Table 1). Shrimps (10 shrimps per
group) were intramuscularly injected with 100 μL of 5 μg siLvTGase or
scramble siRNA per shrimp. At 24 h post siRNA injection, total RNA was
extracted from the hepatopancreas of six shrimps, first-strand cDNA
synthesized as explained in subsection 2.3, and the knockdown effi-
ciency of LvTGase analyzed using real-time quantitative PCR (qPCR).
2.14. qPCR analysis
The cDNA (1.0 μL) prepared in subsection 2.3, was used for qPCR
analysis of the relative express levels of LvTGase and LvCAP-3, with
LvEF1α as internal control, using gene-specific primers shown in
Table 1. The qPCR reaction was carried out using the Master SYBR
Green I system on LightCycler 480 (Roche, Switzerland) with the fol-
lowing program: one cycle at 95 °C for 10 min, 45 cycles of 95 °C for 15s
and 60 °C for 30s. The qPCR was carried out in triplicates for each
sample, and six shrimps were analyzed per group. The relative ex-
pression was calculated using the 2-ΔΔCT method.
2.15. Hemocytes apoptosis detection after LvTGase knockdown
For the hemocytes apoptosis detection experiments, 90 shrimps
were divided into three experimental groups (30 shrimps per group),
each shrimp was injected with 100 μL RNase free ddH2O, or 5 μg
siLvTGase or siNon RNA, respectively. Hemocytes from ten shrimps for
every group collected at 24, 48, 72 h post injection (hpi), respectively,
were analyzed for caspase 3/7 activity using the Caspase-Glo® 3/7
Assay kit (Promega, Madison, WI, USA). About 6000 cells were seeded
onto 96-well plates in a volume of 30 μL anticoagulation buffer (1.97 g
NaCl, 0.80 g Sodium citrate, 0.34 g EDTA-Na2 and 2.28 g C6H12O6 dis-
solved in 100 mL ddH2O) and 30 μL Caspase 3/7 assay mixture added
followed by incubation on a shaker for 3 h at room temperature. The
Caspase 3/7 activity (luminescence) was measured with the Infinite
200 PRO multimode plate reader (Tecan Group Ltd., Switzerland).
3. Results
3.1. The Ig-like domain of L. vannamei TGase has bacteria agglutination
activity
Analysis of the domain structure of LvTGase shows that it consists of
three functional domains (Fig. 1A) including an N-terminal domain
(TGase-N), a protease-like homology domain (TGase-M) and an Ig-like
domain (TGase-C). The genes encoding for these functional domains
were cloned into the plasmid vector pET-32a and expressed in E. coli
(BL21). Purified recombinant proteins (rTGase-N, rTGase-M and
rTGase-C) were ascertained by SDS-PAGE and Western blot analysis,
and found to have approximate molecular weights of about 47, 45 and
40 kDa, respectively (Fig. 1B). Next, the bacterial agglutination activity
of the three recombinant proteins against V. parahaemolyticus and S.
iniae, was determined with the results showing great differences in the
agglutination activity. It was observed that rTGase-C had the strongest
agglutination activity towards the two pathogens (Fig. 1C). For in-
stance, while the agglutinative efficiency of rTGase-C towards V.
parahaemolyticus and S. iniae was 256 and 64, respectively, that of
rTGase-N was 64 and 16, respectively, while the agglutinative effi-
ciency of rTGase-M was 16 and 32, respectively (Table 2). These results
thus suggest TGase-C (Ig-like domain of LvTGase) is that portion of
LvTGase that performs the main immune-related functions in shrimp.
3.2. TGase-C interacts with immune-related proteins
To further explore the immune regulatory functions of TGase-C, Co-
IP assay was used to first examine the possible interaction partners of
rTGase-C in shrimp. As shown in Fig. 2A, when the Co-IP samples were
resolved on SDS-PAGE, one band with approximate molecular weight of
171
Fish and Shellfish Immunology 81 (2018) 168–175
35 kDa was observed (boxed red in Fig. 2A), with the size of this band
increasing with increase in rTGase-C concentration (lanes 2 and 3).
Given that this 35 kDa size band was not observed in the control sam-
ples, it was excised for identification by LC-MS/MS. All the spectra
generated from the LC-MS/MS analysis were searched against the NCBI
database using MASCOT software (version 2.3.0.2), identifying a total
of 474 proteins (Supplementary Table S1), which could be categorized
according to their biological functions into 22 groups (Fig. 2B). Further
analysis of the LC-MS/MS data teasing out proteins annotated to L.
vannamei yielded proteins, 33 proteins of which had immune-related
functions (Table 3). Since the protein band that was excised for iden-
tification had an approximate molecular mass of 35 kDa, all proteins
with molecular masses in the range of 33–36 kDa from the L. vannamei
annotated proteins (Table 3) were chosen and further analyzed. Five
proteins, typed in italic type and shaded in gray in Table 3, were
identified including CAP-3, which had the highest protein score. The
CAP-3 protein was therefore selected for further analysis as the putative
interacting partner of rTGase-C in shrimp.
3.3. TGase-C interacts with LvCAP-3
Once CAP-3 was identified as the possible interaction partner of
LvTGase in L. vannamei, we went about to further study this interaction.
First, the LvCAP-3 protein was cloned, expressed in E. coli BL21, in-
duced with IPTG and purified. SDS-PAGE and Western blot analysis of
the recombinant protein showed a single protein band with approx-
imate molecular weight of 55 kDa (Fig. 3A) signifying that good pur-
ification of rLvCAP-3 protein was attained, and the protein can be used
for the next step of experiments. Next, the protein-protein interaction
between rTGase-C and rLvCAP-3 was determined using the technique of
pull-down assay. Following the pull-down assay, the eluent collected
was then subjected to SDS–PAGE and Western blot analysis together
with rTGase-C and rLvCAP-3. The results showed bands corresponding
to both TGase-C and LvCAP-3 (Fig. 3B), therefore, suggesting some
possible interaction between TGase-C and LvCAP-3 in shrimp.
3.4. LvTGase modulates LvCAP-3 expression to regulate apoptosis
Given that we observed some protein-protein interaction between
LvTGase and LvCAP-3, we sought to further explore the significance of
this, by employing the technique of RNA interference (RNAi) to silence
the expression of LvTGase and determine its consequence on LvCAP-3.
First, more than 90% (p < 0.01) knockdown efficiency of LvTGase was
attained at 24 h post injection of shrimps with siLvTGase but not in
shrimps injected with control siNon (Fig. 4A–i). Next, the effects of
LvTGase depletion on LvCAP-3 mRNA expression was determined by
qPCR. The qPCR results showed that, the expression of LvCAP-3 was
significantly (p < 0.01) increased by about 4-fold following LvTGase
knockdown as compared to control (Fig. 4A–ii). These results thus
suggest LvTGase might have a negative regulatory effect on LvCAP-3
expression. In order to further understand the relationship between
LvTGase and apoptosis, the LvCaspase 3/7 activity was detected using
hemocytes after LvTGase depletion. As shown in Fig. 4B, there was a
significant increase (p < 0.01) in LvCaspase 3/7 activity at all time
points examined in LvTGase depleted hemocytes relative to control
(RNase free dH2O and/or siNon).
4. Discussion
Transglutaminases (TGase) are a family of calcium-dependent pro-
teins/enzymes, comprising of transglutaminase TG1-7 (TG1, TG2, TG3,
TG4, TG5, TG6 and TG7), coagulation factor XIII-A (FXIII-A), and the
structural protein, proteins 4.2, that lacks catalytic activity [31,32].
These enzymes catalyze the formation of cross-link bonds between
glutamine and lysine residues in various proteins, and thus participate
in blood coagulation, skin barrier formation and biological process of
Z. Zheng et al. Fish and Shellfish Immunology 81 (2018) 168–175

Fig. 1. Functional domains of L. vannamei TGase and their immune activity. The conserved domain of LvTGase(GenBank ID: ABN13875.1). The domain is divided
into N-terminal domain (TGase-N, length 61-306aa), protease-like homology domain (TGase-M, length 299-525aa), and Ig-like domain (TGase-C, length 503-679aa).
(B) SDS-PAGE and Western blot analysis of recombinant LvTGase domain proteins. (i) rTGase-N; (ii) rTGase-M; (iii) rTGase-C. (C) Bacterial agglutination activity of
rTGase-N, rTGase-M, and rTGase-C against Vibrio parahaemolyticus and Streptococcus iniae, respectively. Bright field images were taken with a light microscope
(Olympus BX51) at 400 × magnification.

extracellular matrix assembly and other important biological processes
[33]. Lately, it is demonstrated that transglutaminases are not only
involved in the coagulation system, but also participate in the immune
response to bacteria and viruses [18,19,23,34,35]. However, until now
the specific immune-related roles played by the functional domains of
LvTGase in the immunoregulation of shrimp has not been explored and
therefore not well understood, hence, the basis for this study.
Akin to other transglutaminase [21,22], LvTGase has three func-
tional domains, i.e., N-terminal domain (TGase-N), protease homo-
logous domain (TGase-M) and an Ig-like domain (TGase-C). Given that
TGases are reported to participate in the immune response to microbes
[34,35], we tested whether or not the recombinant proteins of these
three domains differed in their agglutinative activity against the Gram-
negative bacteria, V. parahaemolyticus and the Gram-positive bacteria,
S. iniae. Interestingly, rTGase-C, the Ig-like domain protein, had the
strongest agglutinative activity, as compared to rTGase-N and rTGase-
M. This finding is synonymous with previous studies, were the Ig-like
domains of L. vannamei hemocyanin have been shown to have strong
bacterial agglutinative activity [12,13], while in the red swamp cray-
fish Procambarus clarkia, the Ig-like domain of C-type lectin (PcLec3)
promotes phagocytosis of hemocytes [36]. It thus suggests that the
TGase-C domain of LvTGase, which is Ig-like, is the part involved in the

Table 2
Bacteria agglutination activity of recombinant proteins of LvTGase domains.
Bacterium Agglutinative efficiency Agglutinative activity (μg/mL)

rTGase-N rTGase-M rTGase-C rTGase-N rTGase-M rTGase-C

Vibrio parahaemolyticus 64 16 256 3.12 12.5 0.78

Streptococcus iniae 16 32 64 12.5 6.25 3.12

172
Z. Zheng et al. Fish and Shellfish Immunology 81 (2018) 168–175

Fig. 2. Interaction partners of the Ig-like domain protein of LvTGase. (A) Co-immunoprecipitation analysis using anti-rTGase-C antibodies, with hemocytes lysate,
protein A/G beads and purified rTGase-C (a 50 μg/mL or b 250 μg/mL). BSA and ddH2O were used as controls. (B) Venn diagram depicting the annotated biological
functions of all the LC-MS/MS identified proteins.

Table 3
Summary of identified L. vannamei annotated proteins with immune-related functions.
Protein ID Descriptiona Scoreb MW (Da)c Peptidesd Spectrae

gi|124518460|gb|ABN13875.1| Hemocyte transglutaminase 9672.24 85603.8 27 292

gi|115345804|gb|ABI95361.1| Hemolymph clottable protein 2698.88 189370.8 33 91
gi|162295911|gb|ABX83902.1| Type II hemocyte transglutaminase 2291.4 86345.25 21 60
gi|402536580|gb|AFQ62791.1| Bip 2247.77 72757.32 10 69
gi|40217870|gb|AAR82846.1| Actin E partial 1546.53 26322.04 1 59
gi|124626536|gb|AAT66425.2| Actin T2 1518.24 42125.83 1 55
gi|51872141|gb|AAU12180.1| G protein beta 1 subunit 1195.38 38169.14 2 29
gi|854403|emb|CAA57880.1| Hemocyanin 1180.59 74991.51 14 45
gi|118421169|gb|ABK88280.1| CAP-3 912.86 35536.89 11 25
gi|334690638|gb|AEG80154.1| Tcp-1-beta 641.88 58312.36 10 15
gi|115492980|gb|ABI98020.1| Arginine kinase 578.31 40419.59 1 16
gi|340842896|gb|AEK78307.1| Adenine nucleotide translocase 2 546.46 33788.68 6 27
gi|111572543|gb|ABH10628.1| Laminin receptor 431.77 34184 10 16
gi|629633476|gb|AHY86471.1| Hemocyanin subunit L1 partial 418.04 77287.46 1 20
gi|685509834|gb|AIO11840.1| HtrA2 383.23 47737.91 7 11
gi|298370749|gb|ADI80349.1| Cathepsin B 353.23 37632.94 6 11
gi|414151636|gb|AFW98991.1| Prophenoloxidase activating enzyme 347.15 51292.93 3 3
gi|414151634|gb|AFW98990.1| Mas 242.2 38736.48 3 5
gi|442556682|gb|AGC54836.1| Leucine-rich repeat flightless-I-interacting protein 2 A 158.36 49018.25 2 2
gi|147724160|gb|ABQ45957.1| Prophenoloxidase 2 146.1 78984.64 4 5
gi|124665660|gb|ABK60045.2| Alpha-2-macroglobulin 121.6 168586.4 3 3
gi|540070879|gb|AGV04659.1| Galectin 114.98 34271.54 3 3
gi|498923333|gb|AGL61582.1| Caspase 3 75.53 57726.5 4 4
gi|815932149|gb|AKE50481.1| AMP-activated protein kinase subunit gamma 72.88 110946.8 2 2
gi|557316934|gb|AGZ91893.1| Serine proteinase inhibitor 7 67.51 46432.54 1 1
gi|223954136|gb|ACN30235.1| Heat shock protein 60 48.48 61014.95 1 1
gi|57490752|gb|AAW51360.1| Prophenoloxidase 47.95 78436.52 1 2
gi|532019016|gb|AGT63068.1| Retinoblastoma family-like protein 45.93 123002.4 1 1
gi|47059511|gb|AAT09421.1| Kazal-type proteinase inhibitor 36.66 25531.07 2 2
gi|498923331|gb|AGL61581.1| Caspase 2 31.24 34754.6 1 1
gi|3024416|sp|P81058.1| Penaeidin-3a; Flags: Precursor 26.99 9198.57 1 1
gi|261286629|gb|ACX68557.1| Chid1 partial 21.26 22324.69 1 1

Proteins with molecular masses in the range 33–36 kDa from L. vannamei are italicized with gray background shading.
a
Description of annotated protein.
b
Scores obtained with Mascot search engine.
c
Theoretical protein molecular weight.
d
Number of unique peptides matching the identified proteins.
e
Total number of peptides identified.

immune response activity in shrimp. pathways. For instance, the third Ig-like domain of Necl-5 and the fifth
The immunoglobulin superfamily (IgSF) is a large group of mole- Ig-like domain of the PDGF receptor β are involved in the ERK signaling
cules participating in a variety of immune functions [37]. Recently, it pathway [38], while the third Ig-like domain of nectin-4 and the second
also has been found that it participates in the regulation of some signal fibronectin type III domain of the prolactin receptor are required for the

173
Z. Zheng et al. Fish and Shellfish Immunology 81 (2018) 168–175

Fig. 3. L. vannamei TGase modulates LvCAP-3 expression. (A) SDS-PAGE and Western blot analysis of recombinant LvCAP-3 expression. (B) Protein-protein inter-
action between rTGase-C and rLvCAP-3 analyzed by Pull down assay. Lane 1: protein markers; Lane 2: pET-32a-TGase-C pellet extracted from E. coli BL21; Lane 3:
pGEX-4T-1-CAP-3 pellet extracted from E. coli BL21; Lanes 4 and 5: pET-32a-TGase-C and pGEX-4T-1-CAP-3 pellets combined. The protein band marked "I" represents
rLvCAP-3, while "II″ represents rTGase-C. The band "III″ was observed after probing with anti-rTGase-C antibody, while band "IV″ was observed with anti-GST
antibody probing.

Fig. 4. L. vannamei TGase regulates apoptosis. (A) The relative expression levels of LvTGase (i) and LvCAP-3 (ii) in shrimp hepatopancreas samples after siRNA-
mediated knockdown of LvTGase. (B) LvCaspase 3/7 activity of shrimp hemocytes at 24, 48, and 72 h post injection with RNase free H2O, siNon or siLvTGase.
**Denotes significant statistical difference (p < 0.01).

direct interaction and regulate the feedback inhibition of SOCS1 in the
JAK2-STAT5 signaling pathway [39]. Kinase Insert Domain Receptor
Ig-like domains 4–7 contains structural features that inhibit receptor
dimerization and signaling, and the binding of VEGF to KDR relieves
that inhibition, allowing for receptor activation [40]. Here, we found
that the Ig-like region of LvTGase could interact with about fifty-two L.
vannamei annotated proteins, which are involved in numerous physio-
logical and pathophysiological functions, with more than half of these
proteins directly or indirectly involved in immune-related functions,
including apoptosis. These observations were in accordance with other
previous reports [38–40].
Apoptosis is an important part of the immune-related pathways that
is executed by caspases, a family of cysteine proteases [41]. As one of
the most important executioner caspases in the apoptosis pathway,
caspase 3 plays a key role in this process [42]. It had previously been
reported that tissue transglutaminase is the enzyme responsible for
cross-linking caspase 3 and suppressing apoptosis in HCT116 cells [43].
Besides this, some studies have reported that transglutaminase 2 sup-
presses apoptosis by modulating caspase 3 activity in hypoxic tumor
cells [44]. In this study, the caspase-3 homologue (CAP-3) of L. van-
namei [45] was found to interact with LvTGase-C, the Ig-like domain of
L. vannamei TGase. Intriguingly, while TGase-C interacted with LvCAP-
3, siRNA-mediated silencing of LvTGase significantly increased the
expression of LvCAP-3 transcript, which consequently resulted in he-
mocytes apoptosis, observed as high caspase 3/7 activity. This ob-
servation is in accordance with previous reports [43,46], which have
indicated that LvTGase can participate in the regulation of apoptosis by
modulating CAP-3 activity.
Taken together, the present study has revealed that the Ig-like re-
gion of TGase is the main immune-related functional domain in L.
vannamei, and is important in immune response in terms of bacteria
agglutination and apoptosis induction. While the findings here are very
interesting and thought provoking, the specific regulatory mechanisms
involved have not been explored and would form the basis for future
research.
Acknowledgments
This work was sponsored by National Natural Science Foundation of
China (No. 31672689), Natural Science Foundation of Guangdong
Province (No. 2017A030311032) and Key Basic Research Project of
Guangdong Province College (No.2017KZDXM033).
Appendix A. Supplementary data
Supplementary data related to this article can be found at https://
doi.org/10.1016/j.fsi.2018.07.024.
References
[1] D. Sookying, D. Davis, Pond production of Pacific white shrimp (Litopenaeus van-
namei) fed high levels of soybean meal in various combinations, Aquaculture 319
(1–2) (2011) 141–149.
[2] D. Lightner, R. Redman, C. Pantoja, K. Tang, B. Noble, P. Schofield, L. Mohney,
L. Nunan, S. Navarro, Historic emergence, impact and current status of shrimp
pathogens in the Americas, J. Invertebr. Pathol. 110 (2) (2012) 174–183.
[3] L. Tran, L. Nunan, R. Redman, L. Mohney, C. Pantoja, K. Fitzsimmons, D. Lightner,

174
Z. Zheng et al.
Determination of the infectious nature of the agent of acute hepatopancreatic ne-
crosis syndrome affecting penaeid shrimp, Dis. Aquat. Org. 105 (1) (2013) 45–55.
[4] D. Lightner, Virus diseases of farmed shrimp in the Western Hemisphere (the
Americas): a review, J. Invertebr. Pathol. 106 (1) (2011) 110–130.
[5] N. Borregaard, P. Elsbach, T. Ganz, P. Garred, A. Svejgaard, Innate immunity: from
plants to humans, Immunol. Today 21 (2) (2000) 68–70.
[6] A. Tassanakajon, K. Somboonwiwat, P. Supungul, S. Tang, Discovery of immune
molecules and their crucial functions in shrimp immunity, Fish Shellfish Immunol.
34 (4) (2013) 954–967.
[7] H. Nagoshi, H. Inagawa, K. Morii, H. Harada, C. Kohchi, T. Nishizawa, Y. Taniguchi,
M. Uenobe, T. Honda, M. Kondoh, Y. Takahashi, G. Soma, Cloning and character-
ization of a LPS-regulatory gene having an LPS binding domain in kuruma prawn
Marsupenaeus japonicus, Mol. Immunol. 43 (13) (2006) 2061–2069.
[8] E. La Vega, N. O’ Leary, J. Shockey, J. Robalino, C. Payne, C. Browdy, G. Warr,
P. Gross, Anti-lipopolysaccharide factor in Litopenaeus vannamei (LvALF): a broad
spectrum antimicrobial peptide essential for shrimp immunity against bacterial and
fungal infection, Mol. Immunol. 45 (7) (2008) 1916–1925.
[9] W. Charoensapsri, P. Amparyup, I. Hirono, T. Aoki, A. Tassanakajon, Gene silencing
of a prophenoloxidase activating enzyme in the shrimp, Penaeus monodon, increases
susceptibility to Vibrio harveyi infection, Dev. Comp. Immunol. 33 (7) (2009)
811–820.
[10] C. Coates, H. Decker, Immunological properties of oxygen-transport proteins: he-
moglobin, hemocyanin and hemerythrin, Cell. Mol. Life Sci. 74 (2) (2016) 293–317.
[11] C. Coates, J. Nairn, Diverse immune functions of hemocyanins, Dev. Comp.
Immunol. 45 (1) (2014) 43–55.
[12] Y. Zhang, S. Wang, A. Xu, J. Chen, B. Lin, X. Peng, Affinity proteomic approach for
identification of an IgA-like protein in Litopenaeus vannamei and study on its ag-
glutination characterization, J. Proteome Res. 5 (4) (2006) 815–821.
[13] Y. Zhang, B. Peng, H. Li, Y. Yan, H. Wu, X. Zhao, X. Lin, S. Min, Y. Gao, S. Wang,
Y. Li, X. Peng, C-terminal domain of hemocyanin, a major antimicrobial protein
from Litopenaeus vannamei: structural homology with immunoglobulins and mo-
lecular diversity, Front. Immunol. (8) (2017) 611.
[14] Y. Zhang, Y. Yan, Z. Hu, X. Zhao, S. Min, Z. Du, X. Ye, Y. Li, Hemocyanin from
shrimp Litopenaeus vannamei shows hemolytic activity, Fish Shellfish Immunol. 27
(2) (2009) 330–335.
[15] S. Liu, L. Zheng, J. Aweya, Z. Zheng, M. Zhong, J. Chen, F. Wang, Y. Zhang,
Litopenaeus vannamei hemocyanin exhibits antitumor activity in S180 mouse
model in vivo, PLoS One 12 (8) (2017) e0183783.
[16] F. Li, J. Xiang, Signaling pathways regulating innate immune responses in shrimp,
Fish Shellfish Immunol. 34 (4) (2013) 973–980.
[17] M. Yan, C. Li, Z. Su, Q. Liang, H. Li, S. Liang, S. Weng, J. He, X. Xu, Identification of
a JAK/STAT pathway receptor Domeless from Pacific white shrimp Litopenaeus
vannamei, Fish Shellfish Immunol. 44 (1) (2015) 26–32.
[18] R. Wang, Z. Liang, M. Hal, K. Söderhall, A transglutaminase involved in the coa-
gulation system of the freshwater crayfish, Pacifastacus leniusculus. Tissue localisa-
tion and cDNA cloning, Fish Shellfish Immunol. 11 (7) (2001) 623–637.
[19] X. Lin, K. Söderhäll, I. Söderhäll, Transglutaminase activity in the hematopoietic
tissue of a crustacean, Pacifastacus leniusculus, importance in hemocyte homeostasis,
BMC Immunol. (9) (2008) 58.
[20] M. Yeh, C. Liu, C. Hung, W. Cheng, cDNA cloning, identification, tissue localisation,
and transcription profile of a transglutaminase from white shrimp, Litopenaeus
vannamei, after infection by Vibrio alginolyticus, Fish Shellfish Immunol. 27 (6)
(2009) 748–756.
[21] J. Arockiaraj, A. Gnanam, R. Palanisamy, V. Kumaresan, P. Bhatt, M. Thirumalai,
A. Roy, M. Pasupuleti, M. Kasi, A. Sathyamoorthi, A. Arasu, A prawn transgluta-
minase: molecular characterization and biochemical properties, Biochimie 95 (12)
(2013) 2354–2364.
[22] Y. Liu, F. Li, B. Wang, B. Dong, Q. Zhang, W. Luan, X. Zhang, J. Xiang, A trans-
glutaminase from Chinese shrimp (Fenneropenaeus chinensis), full-length cDNA
cloning, tissue localization and expression profile after challenge, Fish Shellfish
Immunol. 22 (5) (2007) 576–588.
[23] Y. Zhu, D. Li, X. Zhang, X. Li, W. Li, Q. Wang, Role of transglutaminase in immune
defense against bacterial pathogens via regulation of antimicrobial peptides, Dev.
Comp. Immunol. (55) (2015) 39–50.
[24] C. Liu, C. Chang, Y. Chiu, W. Cheng, M. Yeh, Identification and cloning of a
transglutaminase from giant freshwater prawn, Macrobrachium rosenbergii, and its
175
Fish and Shellfish Immunology 81 (2018) 168–175
transcription during pathogen infection and moulting, Fish Shellfish Immunol. 31
(6) (2011) 871–880.
[25] Y. Wen, S. Zhan, H. Huang, M. Zhong, J. Chen, C. You, F. Wang, Y. Zhang,
Identification and characterization of an 18.4kDa antimicrobial truncation from
shrimp Litopenaeus vannamei hemocyanin upon Vibrio parahaemolyticus infection,
Fish Shellfish Immunol. 56 (2016) 450–458.
[26] P. Ning, Z. Zheng, J. Aweya, D. Yao, S. Li, H. Ma, F. Wang, Y. Zhang, Litopenaeus
vannamei notch affects lipopolysaccharides induced reactive oxygen species, Dev.
Comp. Immunol. 81 (2018) 74–82.
[27] Y. Yi, X. You, C. Bian, S. Chen, Z. Lv, L. Qiu, Q. Shi, High-throughput identification
of antimicrobial peptides from Amphibious mudskippers, Mar. Drugs 15 (11)
(2017).
[28] M. Brosch, L. Yu, T. Hubbard, J. Choudhary, Accurate and sensitive peptide iden-
tification with Mascot Percolator, J. Proteome Res. 8 (6) (2009) 3176–3181.
[29] M. Yang, X. Shi, H. Yang, J. Sun, L. Xu, X. Wang, X. Zhao, J. Wang, Scavenger
receptor C mediates phagocytosis of white spot syndrome virus and restricts virus
proliferation in shrimp, PLoS Pathog. 12 (12) (2016) e1006127.
[30] C. Li, F. Wang, J. Aweya, D. Yao, Z. Zheng, H. Huang, S. Li, Y. Zhang, Trypsin of
Litopenaeus vannamei is required for the generation of hemocyanin-derived pep-
tides, Dev. Comp. Immunol. 79 (2018) 95–104.
[31] H. Tatsukawa, N. Abe, S. Ohashi, K. Hitomi, Distribution of transglutaminase family
members in mouse whole body sections, Biochem. Bioph. Res. Co 467 (4) (2015)
1046–1051.
[32] S. Iismaa, B. Mearns, L. Lorand, R. Graham, Transglutaminases and disease: lessons
from genetically engineered mouse models and inherited disorders, Physiol. Rev. 89
(3) (2009) 991–1023.
[33] L. Lorand, R. Graham, Transglutaminases: crosslinking enzymes with pleiotropic
functions, Nat. Rev. Mol. Cell Biol. 4 (2) (2003) 140–156.
[34] C. Chang, H. Chang, K. Liu, W. Cheng, The known two types of transglutaminases
regulate immune and stress responses in white shrimp, Litopenaeus vannamei, Dev.
Comp. Immunol. 59 (2016) 164–176.
[35] F. Fagutao, M. Maningas, H. Kondo, T. Aoki, I. Hirono, Transglutaminase regulates
immune-related genes in shrimp, Fish Shellfish Immunol. 32 (5) (2012) 711–715.
[36] X. Zhang, Y. Wang, X. Wang, L. Wang, Y. Mu, J. Wang, A C-type lectin with an
immunoglobulin-like domain promotes phagocytosis of hemocytes in crayfish
Procambarus clarkii, Sci Rep-UK 6 (2016) 29924.
[37] A.F. Williams, A.N. Barclay, The immunoglobulin superfamily-domains for cell
surface recognition, Annu. Rev. Immunol. 6 (1988) 381–405.
[38] Y. Ueda, S. Kedashiro, M. Maruoka, K. Mizutani, Y. Takai, Roles of the third Ig-like
domain of Necl-5/PVR and the fifth Ig-like domain of the PDGF receptor in its
signaling, Gene Cell. (2018) 1–11.
[39] M. Maruoka, S. Kedashiro, Y. Ueda, K. Mizutani, Y. Takai, Nectin-4 co-stimulates
the prolactin receptor by interacting with SOCS1 and inhibiting its activity on the
JAK2-STAT5a signaling pathway, J. Biol. Chem. 292 (17) (2017) 6895–6909.
[40] Q. Tao, M. Backer, J. Backer, B. Terman, Kinase insert domain receptor (KDR)
extracellular immunoglobulin-like domains 4-7 contain structural features that
block receptor dimerization and vascular endothelial growth factor-induced sig-
naling, J. Biol. Chem. 276 (24) (2001) 21916–21923.
[41] H. Chen, X. Ning, Z. Jiang, Caspases control antiviral innate immunity, Cell. Mol.
Immunol. 14 (9) (2017) 736–747.
[42] O. Julien, J. Wells, Caspases and their substrates, Cell Death Differ. 24 (8) (2017)
1380–1389.
[43] H. Yamaguchi, H. Wang, Tissue transglutaminase serves as an inhibitor of aoptosis
by cross-linking caspase 3 in thapsigargin-treated cells, Mol. Cell Biol. 26 (2) (2006)
569–579.
[44] G. Jang, J. Jeon, S. Cho, D. Shin, C. Kim, E. Jeong, H. Bae, T. Kim, S. Lee, Y. Choi,
D. Lee, S. Park, I. Kim, Transglutaminase 2 suppresses apoptosis by modulating
caspase 3 and NF-Kappa β activity in hypoxic tumor cells, Oncogene 29 (3) (2010)
356–367.
[45] A. Rijiravanich, C. Browdy, B. Withyachumnarnkul, Knocking down caspase-3 by
RNAi reduces mortality in Pacific white shrimp Penaeus (Litopenaeus vannamei)
challenged with a low dose of white-spot syndrome virus, Fish Shellfish Immunol.
24 (3) (2008) 308–313.
[46] G. Wang, L. Fu, F. Chen, Study of the mechanism underlying the inhibitory effects of
transglutaminase II on apoptosis in the osteosarcoma MG-63 cell line under hypoxic
conditions, Oncol. Lett. 10 (6) (2015) 3425–3428.