10.1007@978 1 4939 9210 2 PDF

Methods in
Molecular Biology 1971
Joachim Clos Editor
Leishmania
Methods and Protocols
Methods in M o l e c u l a r B i o lo g y
Series Editor:
John M. Walker
School of Life and Medical Sciences
University of Hertfordshire
Hatfield, Hertfordshire, AL10 9AB, UK
For further volumes:

http://www.springer.com/series/7651
Leishmania
Methods and Protocols
Edited by
Joachim Clos
Bernhard Nocht Institute for Tropical Medicine , Hamburg, Germany
Editor
Joachim Clos
Bernhard Nocht Institute for Tropical Medicine
Hamburg, Germany
ISSN 1064-3745 ISSN 1940-6029 (electronic)

Methods in Molecular Biology
ISBN 978-1-4939-9209-6 ISBN 978-1-4939-9210-2 (eBook)
https://doi.org/10.1007/978-1-4939-9210-2
Library of Congress Control Number: 2019935497
© Springer Science+Business Media, LLC, part of Springer Nature 2019

This work is subject to copyright. All rights are reserved by the Publisher, whether the whole or part of the material is
concerned, specifically the rights of translation, reprinting, reuse of illustrations, recitation, broadcasting, reproduction
on microfilms or in any other physical way, and transmission or information storage and retrieval, electronic adaptation,
computer software, or by similar or dissimilar methodology now known or hereafter developed.
The use of general descriptive names, registered names, trademarks, service marks, etc. in this publication does not
imply, even in the absence of a specific statement, that such names are exempt from the relevant protective laws and
regulations and therefore free for general use.
The publisher, the authors, and the editors are safe to assume that the advice and information in this book are believed
to be true and accurate at the date of publication. Neither the publisher nor the authors or the editors give a warranty,
express or implied, with respect to the material contained herein or for any errors or omissions that may have been
made. The publisher remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Cover Caption: Scanning electron micrograph of a Leishmania donovani promastigote, taken by Dr. Monica Hagedorn
at the electron microscope facility of the University of Ulm, Germany.
This Humana Press imprint is published by the registered company Springer Science+Business Media, LLC, part of
Springer Nature.
The registered company address is: 233 Spring Street, New York, NY 10013, U.S.A.
Preface
The Aims
Parasites of the genus Leishmania and other Trypanosomatidae are causative for three of
the most important neglected tropical diseases (NTDs), affecting the lives of millions of
humans in the tropical and subtropical regions of the world. New drugs against these obli-
gate parasites and new tools for the control of their vectors are urgently needed, especially
since all existing treatments have serious drawbacks and limitations. Therefore, additional
efforts are needed; meaning, more researchers must enter the field, not only in applied
science but also in basic research. This is often hampered by a lack of understanding of these
organisms and the particular methodological challenges and chances with which they con-
front “newbies” and even established parasitologists. Fortunately, the last years have seen
tremendous methodological advances, e.g., by the introduction of deep sequencing
approaches and their combination with established strategies but also by the introduction
of state-of-the-art genome editing strategies, and awareness for these new opportunities
must be raised. This compendium is therefore aimed at established parasitologists wishing
to broaden their spectrum but also for scientists from other disciplines who wish to enter
Leishmania research or plan to collaborate with Leishmania researchers in the framework
of multidisciplinary R&D consortia. Its long-term and ambitious goal is to help in getting
leishmaniasis off the list of the NTDs by promoting research.
The contributing authors and I also entertain the hope that this compendium will help
to implement experimental standard procedures. More often than not, similar experimental
strategies are performed following diverse protocols in different laboratories, making direct
comparisons of the results difficult and even impossible. Offering this collection of experi-
mental protocols, we hope to reduce the inconsistency of procedures, to make results more
comparable and to avoid confusion.
The Scope
The various chapters of this book cover a wide range of experimental strategies and tech-
niques contributed by colleagues from the field. They deal with the cultivation of axenic
amastigote forms (Chapter 1) and cover phylogeny and comparative genomics (Chapters 2
and 3) and other strategies collectively known as systems biology (Chapters 4–7). Also
offered are the protocols for genetic manipulation of Leishmania, both classic and new
(Chapters 8–11). A large part of this book is also dedicated to in vitro and in vivo infection
models and their interpretation (Chapters 12–19), ranging from host cell lines to mamma-
lian and arthropod hosts. This compendium cannot cover the entire range of experimental
strategies that are used in Leishmania research. Some expert colleagues had no time to
contribute, and some research fields are too diverse and complex to be covered by one or
two chapters. On the whole, however, I entertain the hope that the protocols found in this
v
vi Preface
book will be a help and a starting point for established and emerging researchers. In addition
to the core target group, Leishmania researchers, colleagues working with other protozoa
of the order Trypanosomatida may also find the book useful, in particular Chapters 3–11,
as most molecular techniques can be applied to those organisms as well.
Hamburg, Germany Joachim Clos

Acknowledgments
For the completion of this compendium, I depended on the willingness of a large number
of colleagues to contribute their expertise and to invest their time and that of their col-
laborators. I am happy to state that they embraced the idea of this book with enthusiasm,
and I thank them for their readiness to open their lab manuals for the community. I also
have to thank my colleagues at the Bernhard Nocht Institute for Tropical Medicine for
their readiness to be test readers of selected chapters during the review process.
vii
Contents
Preface. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . v
Acknowledgments . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . vii
Contributors . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . xi
1 Host-Free Systems for Differentiation of Axenic Leishmania �� 1

Dan Zilberstein and Roni Nitzan Koren
2 Phylogenetic Studies�� 9
Katrin Kuhls and Isabel Mauricio
3 A Guide to Next Generation Sequence Analysis of Leishmania Genomes�� 69
Hideo Imamura and Jean-Claude Dujardin
4 Quantitative RNA Analysis Using RNA-Seq�� 95
Peter J. Myler, Jacqueline A. McDonald, Pedro J. Alcolea,
and Aakash Sur
5 Ribosome Profiling in Trypanosomatids�� 109
Amelie J. Kraus and Raúl O. Cosentino
6 Cosmid Library Construction and Functional Cloning�� 123
Joachim Clos and Dorothea Zander-Dinse
7 Cos-Seq: A High-Throughput Gain-of-Function Screen for Drug
Resistance Studies in Leishmania�� 141
Jade-Eva Potvin, Philippe Leprohon, Elodie Gazanion, Mansi Sharma,
Christopher Fernandez-Prada, and Marc Ouellette
8 Gene Replacement by Homologous Recombination �� 169
Henner Zirpel and Joachim Clos
9 LeishGEdit: A Method for Rapid Gene Knockout and Tagging
Using CRISPR-Cas9�� 189
Tom Beneke and Eva Gluenz
10 DiCre-Based Inducible Disruption of Leishmania Genes �� 211
Samuel M. Duncan, Elmarie Myburgh, Eliza V. Alves-Ferreira,
and Jeremy C. Mottram
11 DiCre-Based Inducible Gene Expression�� 225
Jeziel D. Damasceno, Luiz R. O. Tosi, Renato E. R. S. Santos,
12 Generation of Bone Marrow-Derived Macrophages for In Vitro
Infection Experiments�� 237
Eugenia Bifeld
13 Quantification of Intracellular Leishmania spp. Using Real-Time
Quantitative PCR (qPCR)�� 249
Eugenia Bifeld
ix
x Contents
14 In Vitro Infections of Macrophage-Like Cell Lines

with Leishmania infantum for Drug Screening �� 265
Nuno Santarém, Joana Tavares, and Anabela Cordeiro-da-Silva
15 Quantification of Parasite Loads by Automated Microscopic
Image Analysis�� 279
Carolina Borsoi Moraes and Laura Maria Alcântara
16 Quantification of Leishmania Parasites in Murine Models
of Visceral Infection�� 289
Joana Tavares, Nuno Santarém, and Anabela Cordeiro-da-Silva
17 Syrian Hamster as an Advanced Experimental Model for Visceral
Leishmaniasis�� 303
María Dolores Jiménez-Antón, Montserrat Grau, Ana Isabel Olías-Molero,
and José Mª Alunda
18 Experimental Cutaneous Leishmaniasis: Mouse Models for Resolution of
Inflammation Versus Chronicity of Disease �� 315
Christian Bogdan, Andrea Debus, Heidi Sebald, Baplu Rai, Johanna Schäfer,
Stephanie Obermeyer, and Ulrike Schleicher
19 Establishment, Maintenance of Phlebotomus spp. in the Laboratory,
and Infection with Leishmania spp.�� 351
Ifhem Chelbi and Elyes Zhioua
Index�� 369
Contributors
Laura Maria Alcântara • Department of Microbiology, Institute of Biomedical Sciences,

University of São Paulo, São Paulo, SP, Brazil
Pedro J. Alcolea • Center for Global Infectious Disease Research, Seattle Childrens
Research Institute, Seattle, WA, USA; Department of Cellular and Molecular Biology,
Centro de Investigaciones Biológicas (CSIC), Madrid, Spain
José Mª Alunda • Department of Animal Health, ICPVet Research Group, Faculty of
Veterinary Medicine, Universidad Complutense de Madrid, Madrid, Spain; Instituto de
Investigación Hospital 12 de Octubre, Madrid, Spain
Eliza V. Alves-Ferreira • Department of Biology, York Biomedical Research Institute,
University of York, York, UK
Tom Beneke • Sir William Dunn School of Pathology, University of Oxford, Oxford, UK
Eugenia Bifeld • Bernhard Nocht Institute for Tropical Medicine, Hamburg, Germany;
altona Diagnostics GmbH, Hamburg, Germany
Christian Bogdan • Mikrobiologisches Institut–Klinische Mikrobiologie, Immunologie
und Hygiene, Friedrich-Alexander-Universität (FAU) Erlangen-Nürnberg and
Universitätsklinikum Erlangen, Erlangen, Germany; Medical Immunology Campus
Erlangen, FAU Erlangen-Nürnberg, Erlangen, Germany
Ifhem Chelbi • Unit of Vector Ecology, Institut Pasteur de Tunis, Tunis, Tunisia
Joachim Clos • Bernhard Nocht Institute for Tropical Medicine, Hamburg, Germany
Anabela Cordeiro-da-Silva • i3S-Instituto de Investigação e Inovação em Saúde,
Universidade do Porto, Porto, Portugal; IBMC–Instituto de Biologia Molecular e
Celular, Parasite Disease Group, Universidade do Porto, Porto, Portugal; Departamento
de Ciências Biológicas, Faculdade de Farmácia, Universidade do Porto, Porto, Portugal
Raúl O. Cosentino • Department of Veterinary Sciences, Experimental Parasitology,
Ludwig-Maximilians-Universität München, Munich, Germany; Department of
Physiological Chemistry, Biomedical Center Munich, Ludwig-Maximilians-Universität
München, Planegg-Martinsried, Germany; Research Center for Infectious Diseases,
University of Würzburg, Würzburg, Germany
Jeziel D. Damasceno • The Wellcome Trust Centre for Molecular Parasitology, Institute
of Infection, Immunity and Inflammation, University of Glasgow, Glasgow, UK
Andrea Debus • Mikrobiologisches Institut–Klinische Mikrobiologie, Immunologie und
Hygiene, Friedrich-Alexander-Universität (FAU) Erlangen-Nürnberg and
Universitätsklinikum Erlangen, Erlangen, Germany
Jean-Claude Dujardin • Department of Biomedical Sciences, Institute of Tropical
Medicine, Antwerp, Belgium; Department of Biomedical Sciences, Faculty of
Pharmaceutical, Biomedical and Veterinary Sciences, University of Antwerp, Antwerp,
Belgium
Samuel M. Duncan • Division of Biological Chemistry and Drug Discovery, Wellcome
Trust Centre for Anti-infectives Research, University of Dundee, Dundee, UK
Christopher Fernandez-Prada • Département de Pathologie et Microbiologie, Faculté de
Médecine Vétérinaire, Université de Montréal, Saint-Hyacinthe, QC, Canada
xi
xii Contributors
Elodie Gazanion • Université de Montpellier, IRD, CNRS, MIVEGEC, Montpellier,

France
Eva Gluenz • Sir William Dunn School of Pathology, University of Oxford, Oxford, UK
Montserrat Grau • Instituto de Investigación Hospital 12 de Octubre, Madrid, Spain
Hideo Imamura • Department of Biomedical Sciences, Institute of Tropical Medicine,
Antwerp, Belgium
María Dolores Jiménez-Antón • Department of Animal Health, ICPVet Research
Group, Faculty of Veterinary Medicine, Universidad Complutense de Madrid, Madrid,
Spain; Instituto de Investigación Hospital 12 de Octubre, Madrid, Spain
Roni Nitzan Koren • Faculty of Biology, Technion-Israel Institute of Technology, Haifa,
Israel
Amelie J. Kraus • Department of Veterinary Sciences, Experimental Parasitology, Ludwig-
Maximilians-Universität München, Munich, Germany; Department of Physiological
Chemistry, Biomedical Center Munich, Ludwig-Maximilians-Universität München,
Planegg-Martinsried, Germany; Research Center for Infectious Diseases, University of
Würzburg, Würzburg, Germany
Katrin Kuhls • Molekulare Biotechnologie und Funktionelle Genomik, Technische
Hochschule Wildau, Wildau, Germany
Philippe Leprohon • Département de Microbiologie, Infectiologie et Immunologie, Faculté
de Médecine, Centre de Recherche en Infectiologie du Centre de Recherche du CHU de
Québec, Université Laval, Québec, QC, Canada
Isabel Mauricio • Global Health and Tropical Medicine (GHTM), Instituto de Higiene e
Medicina Tropical (IHMT), Universidade Nova de Lisboa (UNL), Lisbon, Portugal
Jacqueline A. McDonald • Center for Global Infectious Disease Research, Seattle
Childrens Research Institute, Seattle, WA, USA
Carolina Borsoi Moraes • Department of Microbiology, Institute of Biomedical Sciences,
University of São Paulo, São Paulo, SP, Brazil
Jeremy C. Mottram • Department of Biology, York Biomedical Research Institute,
Elmarie Myburgh • Department of Biology, York Biomedical Research Institute,
Peter J. Myler • Center for Global Infectious Disease Research, Seattle Childrens Research
Institute, Seattle, WA, USA; Department of Global Health, University of Washington,
Seattle, WA, USA; Department of Biomedical Informatics and Medical Education,
University of Washington, Seattle, WA, USA
Stephanie Obermeyer • Mikrobiologisches Institut–Klinische Mikrobiologie, Immunologie
Ana Isabel Olías-Molero • Department of Animal Health, ICPVet Research Group,
Faculty of Veterinary Medicine, Universidad Complutense de Madrid, Madrid, Spain;
Instituto de Investigación Hospital 12 de Octubre, Madrid, Spain
Marc Ouellette • Département de Microbiologie, Infectiologie et Immunologie, Faculté
Jade-Eva Potvin • Département de Microbiologie, Infectiologie et Immunologie, Faculté
Contributors xiii
Baplu Rai • Mikrobiologisches Institut–Klinische Mikrobiologie, Immunologie und

Nuno Santarém • i3S-Instituto de Investigação e Inovação em Saúde, Universidade do
Porto, Porto, Portugal; IBMC–Instituto de Biologia Molecular e Celular, Parasite Disease
Group, Universidade do Porto, Porto, Portugal
Renato E. R. S. Santos • Department of Cell and Molecular Biology, Ribeirão Preto
Medical School, University of São Paulo, Ribeirão Preto, Brazil
Johanna Schäfer • Mikrobiologisches Institut–Klinische Mikrobiologie, Immunologie und
Ulrike Schleicher • Mikrobiologisches Institut–Klinische Mikrobiologie, Immunologie
Universitätsklinikum Erlangen, Erlangen, Germany; Medical Immunology Campus
Erlangen, FAU Erlangen-Nürnberg, Erlangen, Germany
Heidi Sebald • Mikrobiologisches Institut–Klinische Mikrobiologie, Immunologie und
Mansi Sharma • Département de Microbiologie, Infectiologie et Immunologie, Faculté de
Médecine, Centre de Recherche en Infectiologie du Centre de Recherche du CHU de
Aakash Sur • Center for Global Infectious Disease Research, Seattle Childrens Research
Institute, Seattle, WA, USA; Department of Biomedical Informatics and Medical
Education, University of Washington, Seattle, WA, USA
Joana Tavares • i3S-Instituto de Investigação e Inovação em Saúde, Universidade do
Porto, Porto, Portugal; IBMC–Instituto de Biologia Molecular e Celular, Parasite Disease
Group, Universidade do Porto, Porto, Portugal
Luiz R. O. Tosi • Department of Cell and Molecular Biology, Ribeirão Preto Medical
School, University of São Paulo, Ribeirão Preto, Brazil
Dorothea Zander-Dinse • Bernhard Nocht Institute for Tropical Medicine, Hamburg,
Germany
Elyes Zhioua • Unit of Vector Ecology, Institut Pasteur de Tunis, Tunis, Tunisia
Dan Zilberstein • Faculty of Biology, Technion-Israel Institute of Technology, Haifa, Israel
Henner Zirpel • Bernhard Nocht Institute for Tropical Medicine, Hamburg, Germany
Chapter 1
Host-Free Systems for Differentiation of Axenic

Leishmania
Dan Zilberstein and Roni Nitzan Koren
Abstract
This chapter describes, in detail, the method our laboratory developed to differentiate L. donovani pro-
mastigotes into amastigotes in a host-free culture. This method is based on previous observations that
Leishmania promastigotes can combine two environmental signals, typical to lysosomes, acidic pH (~5.5)
and body temperature (37 °C), into a signal that induces differentiation. Based on this concept, we have
modified medium 199 to make it into an amastigote-specific medium. Shifting promastigotes to this
medium, followed by incubation in a CO2 incubator, induced differentiation. Axenic amastigotes reach
maturation within 5 days, resembling the time it takes in vivo. This chapter provides a complete protocol
that should be useful for both Old and New World species of Leishmania.
Key words Development, Phagolysosome, Differentiation, Signaling, Promastigote, Amastigote
1 Introduction
During their life, Leishmania parasites reside and proliferate in two

distinct environments, both of which are hydrolytic. The vector’s
midgut, where procyclic promastigotes reside, has a slightly alka-
line pH, is rich in amino acids and sugar, and has a mean tempera-
ture of 26 °C [1]. In phagolysosomes, where amastigotes reside,
the pH is acidic (~5.5), major nutrients are amino and fatty acids,
and sugar is scarce [2]. Hence, in order for Leishmania to success-
fully develop in both host and vector, they established tools to
rapidly adjust to each of these environments [3]. Investigating
each life stage is possible but require isolation of parasites from
either vector or model animal. However, in order to investigate the
process of development inside the host, an in vitro model system
that enables time course analysis of promastigote to amastigote dif-
ferentiation was required.
In the early 1990s we hypothesized that macrophage-invading
promastigotes identify their lysosome target by merging two physi-
cal cues, the lysosome acidic environment and high temperature of
Joachim Clos (ed.), Leishmania: Methods and Protocols, Methods in Molecular Biology, vol. 1971,
https://doi.org/10.1007/978-1-4939-9210-2_1, © Springer Science+Business Media, LLC, part of Springer Nature 2019
1
2 Dan Zilberstein and Roni Nitzan Koren
the host body [4]. Growing promastigotes at pH 5 at 26 °C

induced expression of amastigote-specific genes, but their
morphology did not change [5]. Interestingly, growing promasti-
gotes of L. donovani at 37 °C and pH 7 in a 100% fetal calf serum
medium resulted in amastigote-shaped cells [6]. These cells grew
at the same rate as promastigotes and released amastigote-type acid
phosphatase. This experiment suggested that amastigote medium
should contain serum at a concentration higher than in the pro-
mastigote media. Elevating the growth temperature of L. donovani
promastigotes to 37 °C in a medium that contained 25% fetal calf
serum, without changing the pH, resulted in growth arrest and cell
aggregation, but without morphological change [7]. Interestingly,
shifting this culture from pH 7 to 5.5 released promastigotes from
growth arrest; they immediately doubled and subsequently started
to differentiate into amastigote-shaped cells [7]. The analyses indi-
cated that Leishmania promastigotes process the two distinct sig-
nals, 37 °C and pH 5.5 into a single signal that initiated promastigote
differentiation into amastigotes [4, 8].
Over two decades ago Paul Bates and colleagues established
the first axenic host free culture for L. mexicana amastigotes [9]. A
few years later our laboratory established the first method for
axenic L. donovani amastigote culture [8]. Both employed the
same principle that exposing promastigotes to a lysosome like envi-
ronment induce promastigote transformation into amastigote-like
parasites. Other laboratories used the same principles to design
their own L. donovani amastigote culture [10, 11]. These studies
used stage-specific markers to show that their axenic amastigotes
resembled animal-derived amastigotes.
To date, the axenic experimental system is widely used in our
field, helping to understand and predict in vivo processes.
According to PubMed (www.pubmed.com), to date (mid-2018),
172 research papers that have used axenic amastigotes have been
published. These describe the use of both Old and New World spe-
cies. On the one hand, it is a great benefit to being able to use this
system to investigate many processes in the amastigotes that are
free of host molecules. But, on the other hand, many laboratories
developed their own protocol and culture conditions. Lack of a
consensus method for in vitro cultivation of axenic Leishmania cul-
ture is problematic as it makes it difficult to repeat experiments
that use diverse in vitro axenic amastigote protocols. Being the
leading laboratory in characterizing the process of promastigote to
amastigote differentiation, we decided to provide an in-depth
description of the method and quality control assays for axenic
amastigote culture. The aim of this chapter is to describe, in detail,
the method we use to differentiate in culture L. donovani promas-
tigotes into amastigotes. This method should work for all Old
World species as well as for most New World species.
Host-Free Systems for Differentiation of Axenic Leishmania 3
2 Materials
2.1 Promastigote 1. Earls based medium 199 (M4530, Sigma-Aldrich Ltd., MO)
Growth Medium supplemented with 10% heat inactivated fetal bovine serum,
0.1 mg/ml streptomycin, and 100 U/ml penicillin.
2. In many cultures, hemin, adenine, and biotin are added, as in
many strains they are essential for promastigote growth.
3. We recommend that each laboratory use their own protocol
for axenic growth of promastigotes.
2.2 Amastigote 1. Earls based medium 199 supplemented with 10 mM succinic
Growth Medium acid, 25% fetal bovine serum, 0.1 mg/ml streptomycin, and
100 U/ml penicillin. Titrate to pH 5.5 with HCl and finally
filter to sterilize.
2. Additional supplements such as hemin, adenine, and biotin
should be added according to local protocols.
2.3 Serum 1. When purchasing a new batch of serum we recommend that

for Amastigote Media you check aggregate formation at 5–8 h of differentiation. As
indicated below, aggregation is essential for successful differen-
tiation. The factor that induces cell aggregation is sensitive to
heat (Zilberstein, unpublished).
2. We recommend purchasing and use of non-heat-inactivated
serum.
3 Methods
3.1 Protocol 1. The following protocol was designed for L. donovani. However,
for Axenic it should work equally well for all Old World species such as L.
Promastigote infantum and L. tropica. Interestingly, efforts to differentiate
to Amastigote axenic L. major promastigotes into amastigotes failed. They do
Differentiation differentiate inside macrophage cell lines but not in axenic cul-
ture [12].
2. Spin down late log phase promastigotes (2-day-old culture,
1 × 107 cells/ml) at 1200 × g in a swing out centrifuge (10 min,
room temperature).
3. Discard supernatant and then suspend pellet in a room tem-
perature prewarmed amastigote medium to the same cell
density.
4. Transfer the cell suspension into sterile plastic flasks and subse-
quently incubate at 37 °C in a 5% CO2 incubator for 24 h.
5. On the second day, dilute the culture 1:10 by adding a 37 °C
prewarmed amastigote medium and then transfer to larger
flasks. (Note: Do not exceed the recommended volume indi-
cated on each flask.)
Fig. 1 Axenic amastigotes (a) and promastigotes (b) of L. donovani. Immunofluorescence of mature parasite of
each stage. Cells were stained with anti-membrane antibodies kindly provided by Dr. Dennis, M. Dwyer [8] and
DNA with propidium iodide
6. Continue incubation in the CO2 incubator for additional

4 days. Amastigotes should mature by 5 days (120 h) after
exposure to amastigote differentiation conditions (Fig. 1).
7. We highly recommend following morphological progression
of differentiation using microscopy at 40× magnification (see
details below).
8. In our experience, growth rate of mature axenic amastigotes is
24 h per generation. For experimental use, we recommend
diluting the cell culture 1:3 at the fourth day (96 h) of differ-
entiation. If parasites are used later than the time of matura-
tion, that is, longer than 5 days, we recommend diluting them
1:3 once every 3 days, using prewarmed amastigote medium.
9. In our hands, the axenic amastigotes are at their best as soon as
they mature (120 h). They will stay amastigotes for a few addi-
tional days, sometime a few weeks. In many cases they become
unstable; amino acid transport is less effective and RNA and
DNA extraction less efficient.
3.2 Morphological 1. Our analyses of two decades indicated that L. donovani pro-
Assessment mastigote to amastigote differentiation is a highly regulated
of Differentiation process [13]. Barak et al., [7], determined time course of mor-
phological development. They divided differentiation into
four phases (Table 1): Phase 1 (t = 0–4 h), signal perception
and processing period. During this time parasites undergo cell
cycle arrest at G1 [7]. Phase 2 (t = 5–9 h) cells cease move-
ment, aggregate, and start rounding. Phase 3 (t = 10–23 h)
Table 1
Morphological time course of L. donovani promastigote to amastigote
differentiation
Time in differentiation (hours) Description Picture

Phase 1: 0–4 Signal perception
Phase 2: 5–9 Movement secession

and aggregation
Phase 3: 10–23 Morphogenesis
Phase 4: 24–120 Amastigote maturation
parasites undergo morphogenesis, they get rounded and sub-

sequently lose their flagella. In phase 4 (t = 24–120 h) parasites
become mature amastigotes.
2. To make sure that axenic differentiation is successful, we look
at the culture under the microscope at three time points: at
5–7 h to make sure that parasites cease movement and start to
aggregate.
3. Next, at 24 h, most cells are in large aggregates that have deep
brown-grey color. If cells are not viable the aggregates will
look clear inside and transparent.
4. The third time we assess differentiating parasites is at the end
of maturation, at 120 h. Cells should be in large aggregates, no
single cells in the field should be visible (Fig. 2). If the latter is
checked positively, axenic amastigotes are ready to use.
3.3 Cell Aggregation 1. We found that in the second phase of axenic differentiation the
Is Essential parasites start to aggregate. In an unpublished study we observed
for Differentiation that at around 5–7 h after differentiation initiated parasites
Progression release an adhesion molecule that induces aggregation.
Fig. 2 Axenic amastigotes aggregate during differentiation in culture. Phase

microscope of mature amastigote aggregate
2. We observed that the serum contains a heat sensitive factor that

induces parasites to release the adhesion factor. We found that
heating the serum at 70 °C for 30 min inactivate this factor and
as a result parasite do not aggregate. The same happens if heat
inactivation at 60 °C is longer than 60 min. These parasites do
not differentiate and die after a few days if remaining in amasti-
gote medium at 37 °C. Hence, to avoid any difficulty, the amas-
tigote medium should contain non-heat-inactivated serum.
3.4 Quality Control 1. Differentiating axenic amastigotes back to promastigotes:

Following a blood meal from an infected mammal, amastigotes
encounter the slightly alkaline environment in the sand fly gut
and then differentiate to procyclic promastigotes. Similarly,
axenic amastigotes should be able to differentiate back to pro-
mastigotes by subjecting them to promastigotes growth condi-
tions. We have recently demonstrated that shifting axenic
amastigotes to promastigote medium followed by incubation at
26 °C resulted in parasite differentiation into promastigotes
[14]. It takes almost 48 h for axenic amastigotes to complete
differentiation into mature promastigotes. Furthermore, we
observed that at any time point during promastigote differentia-
tion into amastigotes, parasites can be shifted to promastigote
growth conditions and they will differentiate back to promasti-
gotes [7] (unpublished results). Hence, this phenomenon is a
great tool to assess parasite viability and quality during and at the
end of axenic differentiation. The protocol is very simple;
take an aliquot of the axenic amastigotes and dilute 1:20 into
promastigote medium and then incubate at 26 °C [14].
Fig. 3 Expression of LdteCi during L. donovani promastigote to amastigote differentiation. Western blot of
L. donovani at indicated time point of differentiation. Cell lysate proteins was subjected to Western bolt and
then interacted with anti-LdreCi that we raised [14]
2. 2,3-trans-enoyl CoA isomerase: We propose this protein as a

reliable marker of differentiation progression. The putative
2,3-trans-enoyl CoA isomerase, mitochondrial precursor
(LdteCi, LinJ.31.2400) abundance increases sevenfold at late
stages of promastigote to amastigote differentiation [13, 15].
The L. donovani genome contains two genes encoding isoforms
of this protein: LdteCi.2 (LinJ.31.2320) is 89% identical to
LdteCi.1, but lacks seven amino acids near its N-terminus and
has a divergent C-terminal region. Antibodies that we raised
against LdteCi.1 detect both isoforms. As shown in Fig. 3,
axenic promastigotes express predominantly LdteCi.1. The
level of expression decreases gradually until 15 h of differentia-
tion. LdteCi.2 start to appear 2.5 h after differentiation initi-
ated and stay unchanged until amastigotes mature (Fig. 3).
Following LdteCi.1 expression provides reliable information
on differentiation progression. Interestingly, using LdteCi
expression for the reverse process of amastigote to promasti-
gote differentiation provide the point where amastigotes turn
into promastigotes [14]. Polyclonal antiserum against LdteCi is
available to the public. We will send them upon request.
3. LPG expression. Lipophosphoglycan (LPG) forms a thin layer
that cover Leishmania promastigote cells. Saar et al. [8] showed
that like in vivo, axenic promastigote shed this layer. Hence,
we propose that LPG expression in axenic parasite will be
assessed at least once when you establish the method. Protocols
for quantitative assessment of LPG can be found in [8, 16].
4 Notes
1. Over the years we learned that short passage animal derived

promastigotes (e.g., that have recently been recovered from
mice or hamster) are difficult to differentiate in culture. We
recommend passaging these parasites a few weeks in culture
before your next attempt.
2. Counting axenic amastigotes in culture might be difficult

because they are in large aggregates. We recommend breaking
the aggregates using a 25G needle to break the aggregates and
then count.
3. To differentiate a small aliquot of promastigote culture you
may dilute promastigote into amastigote medium at 1:20 and
then incubate at 37 °C without further dilution. Amastigotes
will mature by day 5.
References
1. Zilberstein D (2018) Nutrient transport and ization of Leishmania mexicana amastigote-
sensing as pharmacological targets for leish- like forms. Parasitology 105(Pt 2):193–202
maniasis. In: Rivas L, Carmen G (eds) Drug 10. Debrabant A, Joshi MB, Pimenta PF, dwyer
discovery for leishmaniasis, Drug discov- DM (2004) Generation of Leishmania don-
ery, vol 60. The Royal Society of Chemistry, ovani axenic amastigotes: their growth and
Cambridge, UK, pp 282–296 biological characteristics. Int J Parasitol 34(2):
2. Harms E, Gochman N, Schneider JA (1981) 205–217
Lysosomal pool of free-amino acids. Biochem 11. Goyard S, Segawa H, Gordon J, Showalter M,
Biophys Res Commun 99(3):830–836 Duncan R, Turco SJ, Beverley SM (2003) An
3. Burchmore RJ, Barrett MP (2001) Life in in vitro system for developmental and genetic
vacuoles--nutrient acquisition by Leishmania studies of Leishmania donovani phosphogly-
amastigotes. Int J Parasitol 31(12):1311–1320 cans. Mol Biochem Parasitol 130(1):31–42
4. Zilberstein D, Shapira M (1994) The role of 12. Zilberstein D (2008) Physiological and bio-
pH and temperature in the development of chemical aspects of Leishmania develpment.
Leishmania parasites. Annu Rev Microbiol In: Myler PJ, Fasel N (eds) Leishmania after
48:449–470. https://doi.org/10.1146/ the genome: biology and control. Horizon
annurev.mi.48.100194.002313 Scientific Press and Caiser Academic Press,
5. Zilberstein D, Blumenfeld N, Liveanu V, New York, pp 107–122
Gepstein A, Jaffe CL (1991) Growth at 13. Rosenzweig D, Smith D, Opperdoes F, Stern
acidic pH induces an amastigote stage- S, Olafson RW, Zilberstein D (2008) Retooling
specific protein in Leishmania promastigotes. Leishmania metabolism: from sand fly gut to
Mol Biochem Parasitol 45(1):175–178. human macrophage. FASEB J 22(2):590–602.
doi:0166-6851(91)90040-D [pii] https://doi.org/10.1096/fj.07-9254com
6. Doyle PS, Engel JC, Pimenta PF, da Silva 14. Bachmaier S, Witztum R, Tsigankov P, Koren
PP, Dwyer DM (1991) Leishmania donovani: R, Boshart M, Zilberstein D (2016) Protein
long-term culture of axenic amastigotes at kinase a signaling during bidirectional axenic
37 degrees C. Exp Parasitol 73(3):326–334. differentiation in Leishmania. Int J Parasitol
https://doi.org/0014-4894(91)90104-5 46(2):75–82. https://doi.org/10.1016/j.
[pii] ijpara.2015.09.003
7. Barak E, Amin-Spector S, Gerliak E, 15. Saxena A, Lahav T, Holland N, Aggarwal G,
Goyard S, Holland N, Zilberstein D (2005) Anupama A, Huang Y, Volpin H, Myler PJ,
Differentiation of Leishmania donovani in Zilberstein D (2007) Analysis of the Leishmania
host-free system: analysis of signal perception donovani transcriptome reveals an ordered pro-
and response. Mol Biochem Parasitol 141(1): gression of transient and permanent changes in
99–108 gene expression during differentiation. Mol
8. Saar Y, Ransford A, Waldman E, Mazareb Biochem Parasitol 152(1):53–65. https://
S, Amin-Spector S, Plumblee J, Turco SJ, doi.org/10.1016/j.molbiopara.2006.11.011.
Zilberstein D (1998) Characterization of S0166-6851(06)00332-X [pii]
developmentally-regulated activities in axenic 16. Mengeling BJ, Zilberstein D, Turco SJ (1997)
amastigotes of Leishmania donovani. Mol Biosynthesis of Leishmania lipophosphogly-
Biochem Parasitol 95(1):9–20 can: solubilization and partial characterization
9. Bates PA, Robertson CD, Tetley L, Coombs of the initiating mannosylphosphoryltransfer-
GH (1992) Axenic cultivation and character- ase. Glycobiology 7(6):847–853
Chapter 2
Phylogenetic Studies
Abstract
Phylogenetics is an important component of the systems biology approach. Knowledge about evolution of
the genus Leishmania is essential to understand various aspects of basic biology of these parasites, such as
parasite–host or parasite–vector relationships, biogeography, or epidemiology. Here, we present a compre-
hensive guideline for performing phylogenetic studies based on DNA sequence data, but with principles
that can be adapted to protein sequences or other molecular markers. It is presented as a compilation of
the most commonly used genetic targets for phylogenetic studies of Leishmania, including their respective
primers for amplification and references, as well as details of PCR assays. Guidelines are, then, presented to
choose the best targets in relation to the types of samples under study. Finally, and importantly, instruc-
tions are given to obtain optimal sequences, alignments, and datasets for the subsequent data analysis and
phylogenetic inference. Different bioinformatics methods and software for phylogenetic inference are pre-
sented and explained. This chapter aims to provide a compilation of methods and generic guidelines to
conduct phylogenetics of Leishmania for nonspecialists.
Key words Leishmania, Phylogenetics, Genetic markers, DNA sequence analysis, Single locus
approaches, Multilocus approaches, Taxonomic levels, Phylogenetic inference methods, Phylogenetic
inference software
1 Introduction
The history of the classification as well as the phylogeny and molec-

ular evolution of the genus Leishmania has been reviewed in detail
in several publications [1–4]. The first attempts to classify the
genus Leishmania between 1916 and 1961 were based on few
hierarchical characters and were monothetic Linnean classifica-
tions. Multilocus enzyme electrophoresis (MLEE) was the first
method applied to infer phylogenetic relationships within the
genus Leishmania, using phenetic and cladistic classification meth-
ods. Leishmania strains were characterized by their enzymatic pro-
files, and they were grouped in homogeneous electrophoretic
taxonomic units termed zymodemes. Revised phylogenetic classifi-
cations for the Old and New World based on these zymodemes
were proposed since 1984 [5–9]. This method was the reference
9
10 Katrin Kuhls and Isabel Mauricio
technique for classification for a long time, despite several

disadvantages as it is time-consuming, requires cultivation of para-
sites, posttranslational modifications can influence electrophoretic
mobility and enzymes with different amino acid composition but
similar charge can have indistinguishable electrophoretic mobility.
Although useful for classification and identification of many species,
MLEE-based classification began to be questioned as the use of
DNA markers increased thanks, mostly, to the use of the polymerase
chain reaction (PCR) and automated DNA sequencing.
Currently, inference of phylogenetic relationships of the genus
Leishmania is based mainly on sequence analysis of genetic markers.
Depending on the required level of resolution, from class and order,
down to the subspecies taxonomical level, different molecular mark-
ers should be applied [2, 10–12] (Tables 1 and 2). Slowly evolving
sequences, such as the small and large subunit ribosomal RNA genes
(SSU and LSU rDNA) [13–29] and the glycosomal glyceralde-
hyde phosphate dehydrogenase (gGAPDH) [13, 23, 28–32]
genes, have been used for phylogenetic inference in Kinetoplastida
and Trypanosomatidae and to investigate the origin of the genus
Leishmania. Between more closely related organisms (e.g., species
of the genus Leishmania), these slowly evolving genes (e.g., SSU
and gGAPDH) do not provide the necessary resolution [33, 34];
however, SSU has been used to infer some general relationships
(e.g., at subgenus level), differentiating Euleishmania and
Paraleishmania [16, 28].
Since the late 1990s, various other moderately evolving markers
have been used, including single-copy housekeeping genes involved
in basic cellular functions, such as the catalytic polypeptide of
the DNA polymerase α (POLA)[20, 34, 35, 36], the RNA poly-
merase II largest subunit (RPOIILS) [20, 34, 35, 37–40], the
N-acetylglucosamine-1-phosphate transferase (NAGT) [41], the
mitochondrial cytochrome b (CYTB) [27, 42–48], the mitochon-
drial cytochrome oxidase subunit II (kDNA COII) [47, 49, 50],
and the mitochondrial cytochrome c [47]. Other targets used are
the 7SL RNA gene [26, 51–53], the 5S rRNA gene [32, 54], the
L23a ribosomal protein intergenic region [38, 40], the miniexon
(or spliced-leader RNA gene) [32, 53–58], and the heat shock
proteins 20 (HSP20) [59] and 70 (HSP70) [13, 27, 48, 53, 60–66]
(Table 1). Among fast evolving sequence targets, which can, thus,
be used for discrimination at intraspecies level, are the multicopy
noncoding ribosomal internal transcribed spacers 1 and 2 (ITS1,
ITS2) [27, 36, 48, 53, 56, 67, 79–86]. Among the most frequently
used targets for inferring the phylogeny of the genus Leishmania
are the ITS1, HSP70, RPOIILS, CYTB, SSU, and, to a some-
what lesser extent, the miniexon, 7SL RNA and POLA. The target
with the highest discriminative power is HSP70. ITS has the
highest potential at complex and intraspecies level, but it has
Table 1
Molecular markers used in single locus approaches for phylogenetic studies of the genus Leishmania
Applicable for
Marker clinical/biological
Gene category Product category symbol Marker’s full name Copy number Chromo-some material Technical remarks
Nuclear
Ribosomal rRNA SSU Small subunit Multicopy 27 Yes Different authors have used different
DNA ribosomal DNA (10-20) nonoverlapping fragments; working
(18S rDNA) with clinical material might be
problematic in case of coinfections
with different Trypanosomatids
because most primers are highly
conserved
ITS1, ITS2 Internal transcribed Multicopy 27 Yes Alignment of distantly related
spacer 1 and 2 (10-20) taxa is often problematic due to many
indels; sequencing can be problematic
because of homopolymer or
microsatellite tracks and copy
heterogeneity or heterozygosity
SL RNA Miniexon Spliced Multicopy Various Yes Sequencing problems due to differences
SL RNA leader-miniexon (100-200) in copies and due to homopolymer
stretches
Small nuclear snRNA 7SL RNA 7SLRNA Single copy 5 (Yes)a Originally small fragment (~180 bp),
RNA improved method by Stevenson et al.
coding [52] (extended fragment of ~385 bp)
validated only with few strains
Protein Ribosomal protein L23a L23a intergenic Single copy 6 Not tested
coding intergenic region of 60S
genes region ribosomal protein
(continued)
Table 1
(continued)
Applicable for
Marker clinical/biological
Gene category Product category symbol Marker’s full name Copy number Chromo-some material Technical remarks
Antigenic proteinb HSP70 Heat shock protein Multicopy 26, 28, 30, 35 Yes One of the best validated markers with
70 (5-10) high sensitivity; PCR-G primers not
optimal for subgenus L. (Leishmania)
Enzymes RPOIILS RNA polymerase II Single copy 31 (30 Lmex) (Yes)a
largest subunit
POLA DNA polymerase I α Single copy 16 (Yes)a
catalytic subunit
gGAPDH Glycosomal Single copy 30 Not tested
glyceraldehyde
phosphate
dehydrogenase
NAGT N-acetylglucosamine- Single copy 36 (Lmaj, Not tested
1-phosphate Linf), 35
transferase (Lbra)
Kinetoplast (mitochondrial)
kDNA CYTB Cytochrome b Multicopy Maxicircle Yes
maxicircle (25-50)
COII Cytochrome oxidase Multicopy Maxicircle (Yes)a
subunit II (25-50)
CYTC Cytochrome c Multicopy Maxicircle (Yes)a
(25-50)
a
Amplification of clinical material has been shown to be possible, however, it has not been extensively validated for phylogenetic studies;
b
Metalloprotease glycoprotein 63 (GP63) (Major surface protein - MSP) [68–72] and Cysteine protease B (CPB) [72, 73], both multicopy genes that are frequently used for RFLP-typing of
Leishmania at species level, can be impractical for phylogenetic analysis by sequencing due to the occurrence of nonidentical isogenes. Lmex - L. mexicana; Lmaj - L. major; Linf - L. infantum;
Lbra - L. braziliensis
Phylogenetic Studies 13
Table 2
Taxonomic levels covered by the most frequently used markers for phylogenetic studies of the genus
Leishmania
Taxonomic levelb
Family Trypanosomatidae
Genus Leishmaniac
Sections
Markera All genera (EuL, ParaL) Subgenera Complexes Species Intraspecies
SSU x x (x)d
ITS x x x x x
Miniexon (x)e n.a. xf xf xf, g (x)
7SL RNA n.a. xh (x)i
HSP70j n.a. x x x x
RPOIILS k
x x x (x) n.a.
POLAk x x x (x) n.a.
gGAPDH x n.a.
NAGT k
n.a. x x (x) n.a.
L23a x x x
CYTBk n.a. x x x (x) n.a.
COXII k
x x (x) (x)
CYTC k
x x (x) (x)
MLSTl n.a. x x x x x
a
Used with the presented protocols
b
Differentiation of the taxonomic units of this level
c
According to the recently updated taxonomy [12, 13]
d
Subgenera partially differentiated—not fully validated
e
Studied only with primers ME-1/ME-2
f
Only subgenera L. (Leishmania) and L. (Viannia) studied
g
Nearly all species differentiated (not BRA/PER; GUA/PAN; no sequence obtained for LAI)
h
Only subgenera L. (Viannia) and L. (Leishmania) studied so far
i
Different results according to the fragment used: LeishFW/LeishRV (465 bp fragment) differentiates the studied com-
plexes (MAJ, TRO, DON, MEX, BRA, GUA—but not all species were included), TRY7SL.FOR1/TRY7SL.REV1
(185 bp) partially discriminates the complexes of subgenus L. (Leishmania); but not of subgenus L. (Viannia)
j
HSP70 has not been used for studies of Paraleishmania nor for subgenus L. (Sauroleishmania). For subgenus L.
(Mundinia) only L. siamensis has been sequenced
k
Not all complexes including all species (especially for subgenus L. (Viannia)) and a representative set of strains per
species have been studied so far
l
Paraleishmania and subgenera L. (Sauroleishmania), L. (Mundinia) and Porcisia poorly studied; n.a.—not studied;
(x)—not validated, only single strains per species studied. EuL—Euleishmania; ParaL—Paraleishmania
some limitations in the subgenus L. (Viannia) and alignments of

more distantly related taxa are difficult because of many insertions
or deletions (Table 1). A comparison of the discriminative power
of the most commonly used markers is shown in Table 2 and the
protocols for PCR amplification of these targets are presented
herein (Table 3).
Phylogenies based on a single marker are, however, not enough
to understand the evolution of the Trypanosomatidae because of
different mutation rates between lineages or instances of recombi-
nation, thus representing the history of that marker and not neces-
sarily the history of the organism. To infer organism phylogenies
multilocus approaches have been used, which are based on the com-
bination of several independent, preferably nonlinked genes dis-
playing different evolutionary histories (Table 4). There are
different combinations of genes that have been used by different
authors (e.g., concatenated sequences of some of the abovemen-
tioned single markers [13, 32, 34, 88] as well as multilocus
sequence typing (MLST) or multilocus sequence analysis (MLSA)
systems based on housekeeping genes) (Tables 4 and 5). MLST or
MLSA is considered to be one of the methods with the highest
resolution, only surpassed by whole genome analysis. There is,
however, one disadvantage of this method as it needs cultured par-
asites or at least high amounts of parasite DNA since it is based on
single copy genes. There are several such MLST or MLSA systems
developed by different authors, applying different primers devel-
oped specifically for the subgenera L. (Viannia) or L. (Leishmania),
or primers that amplify over the whole genus. The first system
developed is based on ten loci for genes that are used for MLEE
[96, 102, 107, 108]. In later studies, only subsets of 4–5 of these
targets were applied [98–100]. Other multilocus approaches based
on seven housekeeping genes were presented by Baidouri et al. in
[53, 104, 105], subsets of which were used in various studies [88,
106]; by Herrera et al. in [97] and Marco et al. in [103].
Development of high-throughput genotyping techniques and,
in particular, next-generation sequencing methods have enabled
genome-wide studies of the genus Leishmania and phylogenetic
inference based on several thousands of genome-wide single-
nucleotide polymorphisms (SNPs). So far, there are only few such
studies available, which have focused on only a single species com-
plex or a geographic region [109–112], given the complexity of
analysis and because such data are particularly suitable for popula-
tion genetics studies of closely related organisms. It is expected
that, as whole genomes of representatives from more species are
sequenced, whole-genome phylogenies will be produced for the
genus Leishmania.
Table 3
Detailed information for PCR amplification of the targets used in single locus approaches for phylogenetic studies of Leishmania
Marker Product Complete or Reference Position in reference

name Forward primer Sequence 5′–3′ Reverse primer Sequence 5′–3′ Tann [°C] size [bp] partial gene sequence sequence Referencesa
SSU rRNAb S1 GAT CTG GTT GAT S4 GAT CCA GCT GCA 55 2200 Complete L. donovani 1-2200 Uliana et al. [87]
TCT GCC AG GGT TCA CC X07773c
S12 GGT TGA TTC CGT S4 GAT CCA GCT GCA n.d. 539 Partial L. donovani 1661-2200 Uliana et al. [87]; Bualert
CAA CGG AC GGT TCA CC X07773c et al. [88]; Leelayoova et al.
[27]
R222 TAT TGG AGA TTA R333 AAA GCG GGC GCG 50 392 Partial L. donovani 961-1353 Van Eys et al. [33]; Guan
TGG AGC TG GTG CTG X07773c et al. [26]
R221 GGT TCC TTT CCT R332 GGC CGG TAA AGG 60 603 Partial L. donovani 790-1393 Van Eys et al. [33];
GAT TTA CG CCG AAT AG X07773c Meredith et al. [89]
Schönian et al. [90]
R223 TCC CAT CGC AAC R333 AAA GCG GGC GCG 65 358 Partial L. donovani 995-1353 Van Eys et al. [33]
CTC GGT T (Leishmania GTG CTG (Leishmania X07773c Schönian et al. [90]
specific) specific)
S-763 CAT ATG CTT GTT S-762 GAC TTT TGC TTC 50 2138 Nearly complete L. donovani 25-2163 Maslov et al. [14]
TCA AGG AC CTC TAW TG X07773c
609F CAC CCG CGG TAA 706R CTG AGA CTG TAA 48 842 Partial L. donovani 618-1460 barcoding da Silva et al. [91];
TTC CAG C CCT CAA X07773c region V7-V8 Marcili et al. [28]
Lei70L CGC AAC CTC GGT Lei70R CGC GGT GCT GGA 65 ~345 Partial L. infantum 381-725 Spanakos et al. [74, 84]
TCG GTG TG CAC AGG GTA M81429
ITS1 LITSR CTG GAT CAT TTT 5.8S TGA TAC CAC TTA 53 ~320 Complete ITS1 L. donovani LITSR starts in p. 2184 El Tai et al. [80]
CCG ATG TCG CAC TT X07773 of SSU gene; 5.8S
p. 71-52 in 5.8S gene
LeF TCC GCC CGA AAG LeR CCA AGT CAT CCA 65 ~350 Complete ITS1 L. donovani LeF starts in p.2117 of Spanakos et al. [84]
TTC ACC GAT A TCG CGA CAC G X07773 SSU gene; LeR
p. 3–24 in 5.8S gene
ITS2b 5.8SR AAG TGC GAT AAG LITSV ACA CTC AGG TCT 53 ~600 Complete ITS2 L. donovani 5.8SR: p.52–68 of 5.8S El Tai et al. [80, 92]
TGG TA GTA AAC X07773 gene; LITSV: ends in
p. 1–14 of LSU gene
LGITSF2 GCA TGC CAT ATT LGITSR2 GGC CAA CGC GAA 60 370- Partial ITS2 L. donovani LGITSF2: p. 147–167 de Almeida et al. [86]
CTC AGT GTC GTT GAA TTC 450 AJ634378.1 of 5.8S gene; LGITSR2
p. 377–397 of ITS2
LGITSF2 GCA TGC CAT ATT LGITSR1 GAA TTC TCG TTT 60 370- Partial ITS2 L. donovani LGITSF2: p. 147–167 de Almeida et al. [86]
CTC AGT GTC TGG TTT TTT G 450 AJ634378.1 of 5.8S gene;
LGITSR1: p. 361–382
of ITS2
(continued)
Table 3
(continued)

ITS1+2 IR1g GCT GTA GGT GAA IR2g GCG GGT AGT CCT 55 1000- Complete L. braziliensis IR1: p. 33–1 of 3′ end Cupolillo et al. [67]
CCT GCA GCA GCT GCC AAA CAC TCA 1200 ITS1+ITS2 JQ061322.1 of SSU gene; IR2:
GGA TCA TT GGT CTG p. 2–31 in LSU gene
Miniexon Fme TAT TGG TAT GCG Rme ACA GAA ACT GAT 54 221- Complete unit L. major Friedlin 271.227-271.680 in Marfurt et al. [55]; van
SL RNA AAA CTT CCG ACT TAT ATA GCG 442 chr.2 units 4/5 as example der Auwera et al. [53]
FR796398.1
FME2 ACT TCC GGA ACC ME2R CAG AAA CTG ATA 55 variable Partial unit L. major Friedlin 271.217-271.689 in Roelfsema et al. [58]
TGT CTT CC CTT ATA TAG CGT chr.2 units 4/5 as example
(subgenus Leishmania) TA FR796398.1
ACT TCC GGG ACC
CGT CTT CC (subgenus
Viannia)
ME-1 TTC TGT ACT TTA ME-2 CAA TAA AGT ACA 65/50 variable Complete unit L. major Friedlin 271.227-271.680 in Podlipaev et al. [54];
TTG GTA GAA ACT G chr.2 units 4/5 as example Fernandes et al. [75, 76];
FR796398.1 Svobodova et al. [32]
7SL RNA TRY7SL. gta aaa cga cgg cca gt TRY7SL. cag gaa aca gct atg ac 65 ~ 185d Partial L. tropica 160-343 Zelazny et al. [51]; van
FOR1 GC TCT GTA ACC REV1 GGC TGC TCC GTY FJ525420 der Auwera et al. [53];
TTC GGG GGC T NCC GGC CTG ACC Guan et al. [26]
(lower case = M13 tail) C (lower case = M13
tail)
LeishFW gta aaa cga cgg cca g LeishRV cag gaa aca gct atg ac 65 ~465 Partial L. tropica part of tRNA gene and Stevenson et al. [52]
CAT CCG TGA CAG CGT GGG GCT CAA FJ525420.1 a 98 bp spacer region
GAT TCG AAC C GTG CGG ACA TG followed by partial 7SL
RNA gene
L23a RD6LF gta aaa cga cgg cca gtg RD6LR cag gaa aca gct atg ac C 58 595 Complete L. major 201.161-202.755 Dougall et al. [38];
intergenic GAA GGT CAA CAC TTC TTG GCG GTC intergenic region FR796402.1 Kwakye-Nuako et al. [40]
region 60S CCT GAT CC (lower TTC TGA (lower case (459) chromosome 6
ribosomal case letter = M13 tail) letter = M13 tail)
protein
HSP70b HSP70-F25 GGA CGC CGG CAC HSP70-R1310 CCT GGT TGT TGT 61 1286 Partial PCR-F L. major 480-1765 Montalvo et al. [65]; van
GAT TKC T TCA GCC ACT C XM_001684512 der Auwera et al. [66]
HSP70-F25 GGA CGC CGG CAC HSP70-R617 CGA AGA AGT CCG 61 593 Partial PCR-N L. major 480-1072 Montalvo et al. [65], van
GAT TKC T ATA CGA GGG A XM_001684512 der Auwera et al. [66]
HSP70-F251 GAC AAC CGC CTC HSP70-R991 GTC GAA CGT CAC 65 741 Partial PCR-C L. major 706-1446 Montalvo et al. [65],
GTC ACG TTC CTC GAT CTG C XM_001684512 van der Auwera et al. [66]
HSP70-6F GTG CAC GAC GTG HSP70-R1310 CCT GGT TGT TGT 61 766 Partial PCR-T L. major 1000-1765 van der Auwera et al. [66]
GTG CTG GTG TCA GCC ACT C XM_001684512
HSP70sen= GAC GGT GCC TGC HSP70ant= CCG CCC ATG CTC 61 1422 Partial PCR-G L. major 435-1856 Garcia et al. [60];
HSP70for CTA CTT CAA HSP70rev TGG TAC ATC XM_001684512 Montalvo et al. [63],
Fraga et al. [61]
Hspf TGC GCA TCA TCA Hspr ATC TGG GTC ATG 55 1327 Partial (complete L. major 512-1838 Espinosa et al. [13]
ACG AGC C ATC GGG TT G C 1977) XM_001684512
POLAb DNAP AAC GAG CGC GCR DPO2 GCC GAG GCA GCC 53 1050 Partial (complete L. donovani 1522-2571 Croan et al. [35] (rev
CTG CTY GAC TGG ATA CAT 4023) XM_00385980 primer); Noyes et al. [34]
and Noyes pers. comm. (fw
primer); Kuhls et al. [36]
RPOIILSb RPOF1 GAC ACA GCC GTC RPOR1 GCA GCC GCA CAA 56 (60)f 1300 Partial (complete L. donovani 2413-3712 Croan and Ellis [93];
AAG AC TGC GCT 4989) XM_003863307 Croan et al. [35]; Dougall
et al. [38]; Kwakye-Nuako
et al. [40]; Pothirat et al.
[39]
“RPOF1HN” GTA AGC GAG CCA RPOR1 GCA GCC GCA CAA nd 833 Partial L. donovani 2879-3712 Noyes et al. [34]
GGT GT TGC GCT XM_003863307
M172 CGA CAC AGC CGT M173 GGA CGC AGC CGC 70 1305 Partial L. donovani 2412-3716 Yurchenko et al. [30, 31]
CAA GAC GTC CGA C ACA ATG CGC TGG XM_003863307
gGAPDH G1 CGC GGA TCC ASG G2 CGC GGA TCC CCB 55 ~600 Partial L. major nd Hannaert et al. [94];
GYC TYM TCG GBA ACV GCY TTS GCS (complete 1086) FR796426.1 Hamilton et al. [23],
MKG AGA T CGR CCA GT Marcili et al. [28]
G3 TTY GCC GYA TYG G4a GTT YTG CAG SGT 55 927 Partial L. donovani 31-957 Hamilton et al. [23]
GYC GCA TGG CGC CTT GG XM_024473481
G3 TTY GCC GYA TYG G4b CCA MAG SAC VAY 55 969 Partial L. donovani 31-999 Hamilton et al. [23]
GYC GCA TGG CTT GAA GAA XM_024473481
G3 TT YGCC GYA TYG G5 ACM AGR TCC ACC 55 1013 Partial L. donovani 31-1043 Hamilton et al. [23]
GYC GCA TGG ACR CGG TG XM_024473481
(continued)
Table 3
(continued)

NAGTb L1 TCA TGA CTC TTG L4 CTC TAG CGC ACT 58 1405 Complete L. mexicana 1497-2901 Akman et al. [77];
GCC TGG TAG TCA TCG TAG (1401) M96635 Waki et al. [41]
CYTB COIIIF taa tac gac tca cta taG MURF4R ggg ttt tcc cag tca cga 50 1338 Complete L. tarentolae 5271-6609 Luyo Acero et al. [42];
kDNAb TTT ATA TTG ACA cgA ATC TCT CTC (complete 1079) M10126 Asato et al. [45]; Yang et al.
TTT TGT WGA TTe TCC CTTe [46]
Lcyt-S = GGT GTA GGT TTT L.cyt-R = CTA CAA TAA ACA 55 865 Partial L. tarentolae 5456-6321 Kato et al. [43]
LCBF1 AGT YTA GG LCBR2 AAT CAT AAT ATR M10126 Luyo-Acero et al. [42]
CAA TT
LEI-CYTB9 TTA TGG TGT AGG LEI-CYTB10 CCA TCC GAA CTC 55 539 Partial L. tarentolae 5452-5991 Foulet et al. [44]
TTT TAG TYT AGG TT ATA AAA TAA TGT M10126 (first part of over-
lapping fragments of
total size of 939 bp)
LEI-CYTB11 TTT GTT ATT GAA LEI-CYTB12 TGC TAA AAA ACC 55 544 Partial L. tarentolae 5847-6391 Foulet et al. [44]
TWT GAG GWA GTG A ACT CAT AAA TAT M10126 (second part of
ACT over-lapping fragments
of total size of 939 bp)
CytB/F1 ATG CAT TTR TTT CytB/R2 GAA CTT CKA CAA 52 377 Partial L. tarentolae 5951-6327 Lopes et al. [47]
TGT TTA CAT TAT TAH ACA AAT CAT M10126
TTT A AAT A
COII COII-F ATG GCT TTT ATA COII-R GGC ATA AAT CCA 50 606 Partial (complete L. tarentolae 9496-10102 Ibrahim and Barker [49];
kDNA TTA TCA TGT AAG 629) M10126 1-606 Cao et al. [50]
L. major
EF633106.1
CytOxII/F1 TGG CTT TTA TWT CytOxII/R2 GCA TAA ATC CAT 52 604 Partial L. tarentolae 9497-10101 Lopes et al. [47]
TAT CAT TTT GAA TG GTA AAA CAC CAC A M10126 2-605
L. major
EF633106.1
a
References in bold: first description of the assay with the respective primers; in italics: applied by these authors for phylogenetic inference
b
Additional internal sequencing primers are listed in Table 6
c
Sequence published by Looker et al. [95]
d
Size is slightly variable depending on the species
e
Lower case bases do not form part of the consensus sequences found for parasites of the order Kinetoplastida
f
Annealing temperature 60 °C according to [93]
g
Assay developed for L. (Viannia); nd—not defined; Tann - annealing temperature; all primer combinations described in detail in the methods part are marked (bold)
Table 4
Detailed information for PCR amplification of the targets used in multilocus approaches (MLST) for phylogenetic studies of Leishmania
Gene and Internal

Forward Tann amplicon size Position in Reference sequencing
Marker name primer Sequence 5′–3′ Reverse primer Sequence 5`–3` Chromosome [°C] [bp]a Sequence (amplicon) primers Referencesf
Aspartate ASAT ASAT-F2new ACG AGC GCC ASAT-R2new TTC CYM CAT 24, 34 or 35 60 1239 (1283) 1-1283 Yesb Mauricio et al. [96];
aminotransferase GTC CGY AA CCA CCA AGC [Ldon AJ620798] Herrera et al. [97]
Glucose-6-phosphate GPI GPI-F3 GAA TCC CTT TTC GPI-R4 CCC CTG AGA 12 58 1818 (1971) 293715-295685 Yesb Mauricio et al. [96]
isomerase AAG ATG AGC GAT GGC AAT CAC AG [Lmaj FR796408]
TAT
GPIextF AAT GTT CTT CAT GPIextR TTC CGT CCG 12 53 1746 (2085) 197250-199334 Yesc Tsukayama et al. [98]
ACC CCT CT TCT CCT G [Lper LN609242]
Nucleoside hydrolase 1 NH1 NH1-F1 CTT GCT TAC GCC NH1-R3 GAA AAA AAA GAC 18 65 945 (1103) 695227-696329 Yesb Mauricio et al. [96]
GCA GAT AC GCT TCA CAC [Ldon FR799605]
AAG C
Nucleoside hydrolase 2 NH2 NH2-F10 ACG TGG GCG NH2-R6 GCC ATC TAC ACC 14 60 1059 (1272) 32239-33510 Yesb Mauricio et al. [96]
AAC GCA C TTC AGT GCC [Lmaj FR796410]
TCG GTC
6-phosphogluconate 6PGD PGD-F1 GAA CGA ATC CCT PGD-R2 GGA ACC GGT 35 60 1440 (1508) 1363319-1364826 Yesb Mauricio et al. [96];
dehydrogenase TAT TCT CYA TG TGA GCG GC [Lmaj FR796431] Zhang et al. [99]
c
6PGDextF CAC CAG TCC GCT 6PGDextR GCC TCT GTA TTT 34 53 1440 (1730) 1298520-1300249 Yes Tsukayama et al. [98]
CCC T CAC GCT TC [Lper LN609261]
PGD-F- CTC AAG GAA CAT PGD-R- TTG TCC TTGACT 34 55 1440 (836) 1299154-1299989 Boité et al. [100];
VIAN GAG CAC GA VIAN TGC TCA CG [Lper LN609261] Marlow et al. [101]
Isocitrate ICD ICD-F ATG TTC CGC CAT ICD-R TTA CGC GCT CAT 33,10 55 1308 (1308)e 1-1308 Yesd Zemanová et al. [102];
dehydrogenase GTT TCG GC CGC CTT [Ldon DQ449696.1] Zhang et al. [99]
ICD-F-VIAN GAA TCG GGA ICD-R-VIAN CAT CAT AGC CCC 33,10 55 1278 (1022)e 1125372-1126393 Boité et al. [100];
AGG AGA TCA CA AGA GAG GA [Lper LN609230.1] Marlow et al. [101];
Herrera et al. [97]
Cytosolic NADP-malic ME ME-F CGC AAC CGC TTC ME-R CAA CTC CTT CTC 24 50 1722 (1644) 1-1644 Yesd Zemanová et al. [102]
enzyme ACC AAT AAG GGC CAG GTA GTA GTT [Ldon DQ449725.1]
Mannose phosphate MPI MPI-F ATG TCT GAG CTC MPI-R CTA CCT GTC 32 55 1266 (1266) 1-1266 Yesd Zemanová et al. [102];
isomerase GTA AAG CT GCT CAA GTC [Ldon DQ449761.1] Zhang et al. [99]
MPI-F-VIAN GGC AAG ATG TAT MPI-R-VIAN CTC CCC AGG 32 58 1287 (681) 109-789 Boité et al. [100];
GCG GAG TT AAC CAT CTG TA [Lper EU327917.1] Marlow et al. [101];
Herrera et al. [97]
MPIextF CCC TTT GGT TGT MPIextR TCA TAC GCA TAG 53 1266 (1463) 636737-638199 yesc Tsukayama et al. [98]
CGG T GAG CA [Lper LN609248.1]
(continued)
Table 4
(continued)
Gene and Internal

Forward Tann amplicon size Position in Reference sequencing
Marker name primer Sequence 5′–3′ Reverse primer Sequence 5`–3` Chromosome [°C] [bp]a Sequence (amplicon) primers Referencesf
Glucose 6-phosphate G6PDH G6PDH-F ATG TCG GAA GAG G6PDH-R TCA CAG CTT ATT 34 50 1689 (1689) 1-1689 Yesd Zemanová et al. [102];
dehydrogenase CAG TCT CGA GGG AA [Ldon DQ449794.1] Zhang et al. [99]
G6PDH-F- ATG GAA GCG TGT G6PDH-R- GGC TCAA CAC 20 55 1686 (881) 53052-53932 Boité et al. [100];
VIAN GAT CGA AT VIAN ACT TCA GCA A [Lper LN609251.1] Herrera et al. [97]
Fumarate hydratase FH FH-F AGC GTC TTG TGT FH-R GAG CCC GTG 24, 28,29 58 1707 (1780) 880070-881849 Yesd Zemanová et al. [102];
TTC CCA TAA GGA GGC [Ldon FR799616.2] Zhang et al. [99]
Phosphoglucomutase PGM PGM-F CAG AGA AGC TGA PGM-R GAC GGG TTC 21 55 1770 (529) 196977-197505 Marco et al. [103];
CGT CCC AG ACG AAG AAG CG [Linf FR796453] Herrera et al. [97]
Alanin aminotransferase ALAT ALAT-F GTG TGC ATC AAC ALAT-R CGT TCA GCT 12 55 1494 (586) 349132-349617 Marco et al. [103];
CCM GGG AA CCT CGT TCC GC [Linf FR796444.1] Herrera et al. [97]
Cytochrome b CYTB Cytb-F AGC GGA GAG Cytb-R GYT CRC AAT AAA kDNA 60 1079 (620) 5404-6023 Herrera et al. [97]
RAR AGA AAA GG ATG CAA ATC [Ltar M10126]
Elongation initiation EF-2α EF-F TTC CAG TTG ACT EF-R GAC GGA GAG 3 58 1299 (859) 221-1080 [Lmaj El Baidouri et al. [104];
factor 2 alpha subunit GCA GAA CG GTG GAT CTG AG XM_003721726] Bualert et al. [88];
381480-382338 Chaara et al. [105];
[Lmaj FR796399] Shaw et al. [106]
Spermidine synthase 1 SRM1 SRM1-F CAG GCC CTG SRM1-R GTG CAT GTC 4 58 903 (851) 239226-240076 El Baidouri et al. [104];
GTC TTC TGC GCT GCT GTA AT [Lmaj FR796400] Bualert et al. [88]
Chaara et al. [105]
SPDSYN.F CGA ACC TGT SPDSYN.R GAY TCG CCC 4 55 903 (394) 239455-239848 Marco et al. [103]
CGC TGA CGT G TGG TTG CAC AC [Lmaj FR796400]
Zinc-binding DH-like DH-like-F GAG AAG CCA DH-like-R GAA GAC GTA 10 58 1116 (858) 285563-286420 El Baidouri et al. [104];
dehydrogenase-like GCC TTG AAG TG GTG CAC CGA CA [Lmaj FR796406] Chaara et al. [105]
protein
Translation initiation TIFα TIF-F AGA GGA TGG TIF-R CAG AAG GAG 12 58 1011 (891) 2825-3715 El Baidouri et al. [104];
factor alpha subunit ACG TCC CAA G CCG TGT GAA A [Lmaj FR796408] Chaara et al. [105];
Shaw et al. [106]
Nucleoside hydrolase- NH-like NH-like-F GAA CCA GGG AAT NH-like-R TTC CAA GAA 14 58 1059 (898) 32482-33379 El Baidouri et al. [104];
like protein GGA GAA CA GCG AGC GTT AT [Lmaj FR796410] Chaara et al. [105];
Shaw et al. [106]
Conserved hypothetical consHP consHP-F ATG AGG CGT CTC consHP-R CGG CGT TCT 31 58 1026 (1000) 73972-74971 El Baidouri et al. [104];
protein CTT CAC AA TGA GTG CTT [Lmaj FR796427] Chaara et al. [105]
Largest subunit of RPOLIILS RPOLIILS-F AAG TAC CAG CAG RPOLIILS-R GCA GCC GCA 30 or 31 58 4989 (567) 3145-3712 El Baidouri et al. [104];
RNA polymerase II TCC CTC ATC CAA TGC GCT [Ldon Bualert et al. [88];
XM_003859800] Chaara et al. [105];
Shaw et al. [106]
Heat shock protein 70 HSP70 HSP70for GAC GGT GCC HSP70rev CCG CCC ATG 1, 28, 61 1977 (1422) 435-1856 Yes Zhang et al. [99]; Marlow
TGC CTA CTT CAA CTC TGG TAC ATC 29,34, 35 [Lmaj (Table 6) et al. [101] Garcia et al.
XM_001684512] [60]; Fraga et al. [61]
Aconitase ACO ACO.F CAA GTT CCT GRC ACO.R GAG TCC GGG 18 55 2691 (579) 203986-204564 Marco et al. [103]
GTC TCT GC TAT AGC AKC CC [Linf FR796450]
Enolase ENO ENOL.F GCT GCC GAT CCT ENOL.R ACC CGT TCT 14 55 1290 (431) 663-1093 Marco et al. [103]
GAT GGA GG CCA TGC ACA GC [Linf
XM_001464266]
Hypoxanthine-guanine HGPRT HGPRT.F GCT CTA CCT GCT HGPRT.R ATC GCG CAG 21 55 636 (412) 311121-311532 Marco et al. [103]
phosphoribosyl- GTG CGT GC CTC GCG RTA CG [Linf FR796453]
transferase
Phosphomannomutase PMM PMM.F TTC AAG CTT GGC PMM.R TAA TCG TTR CCG 35,36 55 744 (536) 112-647 Marco et al. [103]
GTC GTC GG CCC TCT GA [Linf
XM_001469750]
Leishmania homolog of LACK Lack-F ACC ATG AAC TAC Lack-R TTA CTC GGC 28 41 939 (942) 1080458-1081399 Gonzalez-Aseguinolaza
receptors for activated GAG GGT CAC CT GTC GGA GAT [Ldon FR799615.2] et al. [78]; Zhang et al.
protein kinase [99]
Mitochondrial malate MDHMT Mdhmt-F TGC CGA CCT CTT Mdhmt-R GAG TGA GGT 34+20 52 978 (821) 1813-2633 Marlow et al. [101]
dehydrogenase CCA TAT TC GCG TCT TCA CA [Lbra FR798994.1]
Nuclear malate MDHNC Mdhnc-F TCA CAA CCG CAA Mdhnc-R CTA CTC ACG ATA 34+20 52 954 (1156) 9165-10320 Marlow et al. [101]
dehydrogenase CTA CGA ACG GCA GA [Lbra FR798994.1]
MDH MDHextF TCA CAA CCG CAA MDHextR CTA CTC ACG ATA 34+20 53 954 (1156) 9165-10320 Yesc Tsukayama et al. [98]
CTA CGA ACG GCA GA [Lbra FR798994.1]
a
Gene size in bold, amplicon size in parentheses
b
Sequences of the internal primers used for sequencing is given in Mauricio et al. [96]
c
Sequences of the internal primers used for sequencing is given in Tsukayama et al. [98]
d
Sequences of the internal primers used for sequencing is given in Zemanová et al. [102]
e
ICD has two genes, one located at chromosome 10 (1308 bp), the other at 33 (1278 bp)
f
References in bold: first description of the assay with the respective primers; in italics: applied by these authors for phylogenetic inference; Tann - annealing temperature; Lbra - L. braziliensis, Ldon -
L. donovani, Linf - L. infantum, Ldon - L. donovani, Lper - L. peruviana, Ltar - L. tarentolae
Table 5
22
MLST sets used in phylogenetic studies of the genus Leishmania
MLST Set Marker symbol Species included in the phylogenetic treea References
Set 1 EF-2α, SRM1, DH-like, TIF-2α, L. infantum, L. donovani, L. tropica, L. killicki, L. aethiopica, L. major, L. El Baidouri et al. [104];
NH-like, ConsHP, RPOIILS turanica, L. gerbilii Chaara et al. [105]
Set 1-sub EF-2α, SRM1, RPOIILS L. siamensis, L. enrietti, L. tarentolae, L. braziliensis, L. panamensis, L. lainsoni, Bualert et al. [88]
L. naiffi, L. amazonensis, L. mexicana, L. donovani, L. infantum, L. tropica, L.
killicki, L. aethiopica, L. major, L. gerbilli, L. turanica, L. arabica (outgroup
Leptomonas culicidarum)
Set 1-sub EF-2α, TIF-2α, NH-like, L. waltoni, L. mexicana, L. amazonensis, L. venezuelensis (outgroup L. infantum) Shaw et al. [106]
RPOIILS
Set 2a ASAT, GPI, NH1, NH2, 6PGD L. donovani complex (outgroup L. tropica, L. major, L. gerbilii) Mauricio et al. [96]
Set 2b ICD, ME, MPI, G6PDH, FH L. donovani complex (outgroup L. tropica, L. aethiopica, L. arabica, L. killicki, L. Zemanová et al. [102]
major, L. turanica)
Set 2c G6PDH, 6PGD, MPI, ICD L. braziliensis, L. guyanensis, L. shawi, L. naiffi, L. lainsoni Boité et al. [100]
Set 3 FH, G6PDH, ICD, MPI, L. donovani, L. infantum, L. tropica, L. aethiopica, L. major, L. turanica, L. Zhang et al. [99]
6PGD, HSP70, LACK major, L. braziliensis
Set 4 G6PDH, PGM, MPI, ALAT, L. braziliensis, L. panamensis (outgroup L. tropica, L. major, L. donovani, L. Herrera et al. [97]
ASAT, ICD, CYTB, amazonensis, L. mexicana)
Set 5 MDHMT, MDHNC, 6PGD, L. braziliensis Marlow et al. [101]
MPI, ICD, HSP70
Set 6 MPI, MDHNC, GPI, 6PGD L. braziliensis, L. peruviana, L. guyanensis, L. panamensis, L. lainsoni Tsukayama et al. [98]
Set 7 ACO, ALAT, ENOL, HGPRT, L. braziliensis, L. guyanensis, L. peruviana, L. panamensis, L. major, L. turanica, Marco et al. [103]
PGM, PMM, SPDSYN (SRM) L. arabica, L. gerbilli, L. tropica, L. aethiopica, L. infantum, L. donovani, L.
amazonensis, L. mexicana (outgroup L. enrietti)
a
Sequences for some of the species included in the presented trees were retrieved from GenBank and were sometimes sequenced by other authors with different primers for the
respective marker as in the actual study. Sometimes the amplicon size differs and sequences have to be trimmed to the same length
1.1 Most Commonly SSU: The SSU rRNA gene is one of the two targets of choice for
Applied Markers Used establishing the phylogenetic position of trypanosomatid flagellates
in Single Locus because it is informative for higher level taxonomy and sufficient for
Approaches, Protocols genus-level ranking. However, for intragenus levels it is not suffi-
of Which Are ciently discriminative. The primers in use for PCR amplification of
Presented Herein this target are conserved and suitable for all trypanosomatids.
Because of the multicopy nature of this target, PCR is very sensitive
1.1.1 Conserved Markers and allows for the direct detection, without prior cultivation, of the
flagellates, including Leishmania in different types of biological
material including clinical samples. PCR amplification of this target
is available in different formats. In the various published phyloge-
nies, different, and often not overlapping, parts of the SSU gene
(total size ca. 2200 bp) have been amplified and sequenced (Fig. 1g)
[26–28, 47, 88, 113]. One of these fragments is also widely used in
leishmaniasis diagnostics of clinical samples or the detection of
Leishmania parasites in sandflies [90]. Another of these fragments
(amplified by primers 609F/706R) corresponds to the so-called
V7V8 SSU rDNA named trypanosomatid barcode [28, 47, 91].
Whole SSU gene sequencing (applying different internal primers)
has been applied mainly in studies addressing the overall phylogeny
of trypanosomatids or kinetoplastids [21–25, 29, 30, 32, 114, 115]
and in two studies on Leishmania [13, 34]. The respective primers
for the different SSU fragments are listed in Table 3.
gGAPDH: The glyceraldehyde-3-phosphate dehydrogenase is
an essential and ubiquitous glycolytic enzyme, the genes for which
have a slow rate of evolution, making it suitable for studies at
higher taxonomical ranks. There are three GAPDH genes in
Trypanosomatids, two of which encode a glycosomal enzyme and
the third encodes a cytosolic one. In Leishmania there are two
copies of the gGAPDH gene, which are in tandem repeat and
identical in sequence. This target has been applied mainly for stud-
ies of the evolution of trypanosomatids in general [23, 94], but in
recent times also for the genus Leishmania in relation to closely
related genera as well as with focus on the phylogenetic relation-
ship between Euleishmania and Paraleishmania and the respective
subgenera including the new subgenus L. (Mundinia) and the new
genus Porcisia [13, 28].
1.1.2 Polymorphic ITS: High levels of interspecies and intraspecies variation have been
Markers observed in Old- and New-World Leishmania species in the inter-
nal transcribed spacers (ITS1 and ITS2) present in the nuclear
multicopy ribosomal operon. This marker combines highly sensi-
tive Leishmania diagnostic PCR suitable for use with different
types of clinical samples (including filter paper with bone marrow
or lymph node aspirates, peripheral blood, skin scrapings, smashed
sandflies, etc.) and subsequent species differentiation by sequenc-
ing and phylogenetic inference. The assay presented herein was
originally reported by El Tai et al. [80] and has been extensively
Fig. 1 Schematic overviews of the different markers and respective fragments amplified by different primer
combinations used in respective phylogenetic studies (references in italics) of the genus Leishmania.
References in which the primers were described for the first time are indicated in bold. PCR primers are indi-
cated in red, internal sequencing primers in blue. Annealing positions of internal primers are given in Table 6.
(a) HSP 70—green numbers indicate the position of the fragments according to the L. major HSP70 gene
sequence (XM_001684512); (b) ITS rDNA; (c) CYTB—green numbers indicate the position of the fragments
according to the L. tarentolae sequence (M10126). Dotted line indicates the sequence used for tree inference
for the COIIIF/MURF4R fragment; (d) miniexon region (spliced leader)—amplicon sizes of unit 4 of L. major
Friedlin (FR796398.1 chromosome 2) are indicated. Respective primer positions for sl RNA units 4–5
Fig. 1 (continued) are given in Table 3; (e) RPOIILS—green numbers indicate the position of the fragments
according to the L. donovani RPOIILS gene sequence (XM_003863307); (f) POLA—green numbers indicate
the position of the fragments according to the L. donovani POLA gene sequence (XM_003859800); (g) SSU
rRNA—green numbers indicate the position of the fragments according to the L. donovani SSU sequence
published by Looker et al. [95] (X07773) (or L. braziliensis JX030136.1). References in brackets indicate selected
studies of different Trypanosomatid genera and the relationship between these genera. The fragment amplified
by primers 609F/706R corresponds to the V7V8 locus used for SSU barcoding of Trypanosomatids
validated [53, 83, 90]. Other authors have developed alternative

primers, mainly covering the same region or only the ITS1 [84–86,
116] (Fig. 1b). This marker shows a considerable amount of intra-
species variability and is suitable for analyses within species com-
plexes. ITS2 has been less used and evaluated and intraspecies
variability has not been extensively tested for all species.
HSP70: This marker combines the sensitivity of diagnostic
PCR applicable for clinical and other biological material and a high
discriminatory power at interspecies and intraspecies levels.
Sequencing of the HSP70 gene is used for direct identification of
Leishmania species present in clinical samples and the inference of
phylogenetic relationships. Hsp70 encodes for a major antigen and
thus allows probing for genetic diversity of molecules possibly
involved in immunopathology. The PCR protocols for this marker
have been extensively validated and it has turned out to be one of
the best targets for high-resolution species discrimination and phy-
logenetic studies [53, 60, 61, 65, 66] (Fig. 1a). HSP70 has also
been used as part of some MLST approaches [99, 101].
Miniexon: The tandemly repeated miniexon (or spliced leader)
is present in 100–200 copies in the Leishmania genome, making it
an excellent target for analysis of clinical and environmental sam-
ples. Each repeat consists of a 39 bp exon, an intron (55–101 bp)
and a non-transcribed spacer. The exon encodes an RNA fragment
that is added to the 5′ end of all protein-encoding RNAs. Intron
and exon are conserved in all Leishmania species, whereas the non-
transcribed spacer is highly variable in sequence and length and,
therefore, applicable in phylogenetic studies (Fig. 1d). This marker
has been used to study various trypanosomatids [32, 54]. A recent
validation study, including a pilot check of the intraspecies variabil-
ity, showed that almost all 17 tested species from the Old and New
World can be differentiated [53]. However, not all Leishmania
species (including the subgenera L. (Sauroleishmania) and L.
(Mundinia) as well as Paraleishmania) were included in this study.
This is a very GC rich region with many homopolymer stretches,
and with a high degree of diversity between the multiple copies,
which is, therefore, difficult to sequence and use for phylogenetic
analyses.
RPOIILS: This nuclear single copy marker encodes the largest
subunit of a multi-subunit enzyme needed for DNA transcription
and is frequently used in phylogenetic studies of various organ-
isms. It has been shown to be suitable to resolve evolutionary
relationships among closely related taxa. Several authors have used
this marker for studies of the genus Leishmania [34, 35, 37–40,
93] (Fig. 1e), however a comprehensive validation of the discrimi-
native power of this marker including all species represented by
several strains is still lacking. It has been applied especially to study
the phylogenetic relationships between Euleishmania and
Paraleishmania, as well as the position of L. (Sauroleishmania)
species within the genus. Recently, it has been successfully used to
study the subgenus L. (Mundinia) [13, 117]. RPOIILS has also

been used as part of some MLST approaches [88, 104, 105].
POLA: The catalytic subunit of DNA polymerase α is a nuclear
single copy marker encoding one of the four subunits of the Pol α
complex, which is essential for DNA replication. POLA has been
used only in few studies on Leishmania [34–36] (Fig. 1f). It is
comparable to the RPOIILS marker, as it has shown a good poten-
tial for discrimination of Euleishmania and Paraleishmania, as well
as of the subgenera L. (Sauroleishmania) and L. (Mundinia).
Species complexes can be differentiated. Further validation studies
are needed, however, including all Leishmania species, each repre-
sented by several additional strains.
CYTB: This marker is located in the maxicircle of the kinetoplast
DNA (the homologue in Kinetoplastids of the mitochondrial
genome of other organisms), of which there are about 50 copies.
CYTB is, because of its multicopy nature, a suitable target for direct
detection with high sensitivity and analysis of Leishmania in clinical
or sand fly samples, without the need for laboratory cultivation. The
cytb gene consists of two regions, of which the first undergoes RNA
editing (5′ region of 23 bp), but not the second (1056 bp region).
This gene encodes the central catalytic subunit of an enzyme of the
respiratory chain of mitochondria and it has been widely used in
phylogenetic studies of different organisms. In the genus Leishmania
it discriminates most of the tested species [27, 42, 43, 45–47]
(Fig. 1c). The sequences can be easily analyzed and aligned, as no
sequence length variation has been reported. A validation of intra-
species diversity is still necessary, since few strains per species have
been sequenced so far, thus not taking into account the known
genetic diversity or geographical range of occurrence of the studied
species. Herrera et al. used CYTB also in MLST [97].
COXII: This gene, which encodes an enzyme of the respira-
tory chain of mitochondria, is a widely used target in phylogenetic
studies of various classes of organisms. This marker is located in the
maxicircles of the kinetoplast DNA. Because of its multicopy nature
it can be used for clinical material and environmental samples, such
as sandflies. Nevertheless, only few phylogenetic studies of the
genus Leishmania have included this marker and its discriminative
power has not been established in detail [47, 49, 50]. Pilot studies
have shown it to be useful for the discrimination of subgenera or
species complexes, but its applicability for species delimitation has
to be further studied.
7SL RNA: The 7SL RNA is a small target of 250–300 bp. It
plays an essential role as part of a ribonucleoprotein complex in the
translocation process of proteins across the endoplasmic reticulum.
In a recent validation study, however, it showed poor resolution in
New- and Old-World species. Only some of the species complexes
could be delimited [26, 52, 53]. 7SL RNA sequence trees have
shown lower bootstrap values than other markers.
Phylogenetic methods have evolved over time, becoming more

refined, thanks to more complex and realistic mutation models and
improvements in computational power, which has allowed heavy
duty statistical analysis such as Bayesian inference [118].
Phylogenetics has also become more accessible to the non-initiated
thanks to user-friendly freeware packages and programs, such as
MEGA [119]. Many publications now include simple phylogenetic
trees. However, it is often the case that such researchers, new to
the field, are not fully aware of how to prepare data for analysis, of
the disadvantages or pitfalls of some methods, or how to best pres-
ent their results. Here, we present an overview of methodology
and resources to conduct basic but solid phylogenetic analyses in
Leishmania.
2 Materials
2.1 PCR— 1. DNA extracted from cultured promastigotes or from clinical

Amplification samples or other biological material as sandflies.
of Genetic Targets 2. Clinical samples can be biopsies/tissue material, fresh blood
for Phylogenetic samples, blood samples on filter paper, unstained/stained
Inference smears on slides, sandflies.
3. DNA of (WHO) reference strain(s) (from culture) for positive
and inhibition controls.
4. Adjust the concentration of the DNA isolated from parasite
cultures and of the reference strains to 10 ng/μl using
TE-buffer. In some PCR protocols higher amounts of DNA
are used—prepare DNA solutions of higher concentrations if
necessary. Store at −20 °C.
5. TE-buffer pH 8.0: mix 2 ml of 1 M Tris–HCl pH 8.0, 400 μl
of 0.5 M EDTA pH 8.0, and 170 ml of ddH2O. Check the
pH and adjust to 8.0 with 1 M HCl, and complete the volume
to 200 ml. Sterilize by autoclaving and store at room
temperature.
6. 0.5 M EDTA pH 8.0: dissolve 93.05 g of disodium salt
dihydrate in 400 ml of ddH2O. While stirring on a magnetic
stirrer, adjust the pH to 8.0 by adding NaOH. Adjust the
volume to 500 ml. Store at room temperature.
7. 1 M Tris–HCl pH 7.4: dissolve 121.1 g of Tris base in 800 ml
of ddH2O. Adjust the pH to 7.4 by adding concentrated HCl
slowly while stirring and adjust the final volume to 1 l with
ddH2O.
8. Sterile distilled water (ddH2O or PCR grade H2O).
9. Taq DNA Polymerase (optional high fidelity Taq DNA
Polymerase, see Note 1) and 10× standard PCR buffer
(100 mM Tris–HCl pH 8.3, 500 mM KCl, 15 mM MgCl2).

Store at −20 °C.
10. 2.5 mM dNTP mix containing all four dNTPs. Store at −20 °C.
11. Alternatively, PCR can be performed using 2× PCR master
mix containing PCR buffer, Taq DNA polymerase, and dNTPs
or equivalent mixes.
12. Q-solution (QIAgen, Hilden, Germany) (for some of the PCR
protocols).
13. LightCycler® 480 SYBR Green I Master mix (Roche).
14. Respective forward and reverse primer of the molecular tar-
get: primer sequences are given in Tables 3 and 4. Store at
−20 °C.
15. DMSO—dimethylsulfoxide (HPLC grade) (see Note 2): use
an aliquot of 1 ml in a sterile tube and store at room
temperature.
16. Spectrophotometer (e.g., NanoDropTM).
17. Micropipettes and tips with filter (10, 100, 200, 1000 μl),
tubes (0.2, 0.5, 1.5 ml).
18. Clean bench, vortexer, and microfuge.
19. PCR thermocycler or real-time PCR instrument (e.g., Roche
LightCycler480).
2.2 Electrophoresis 1. 10× TBE buffer: Mix 108 g Tris, 55 g boric acid, and 40 ml of
of PCR Products 0.5 M EDTA pH 8.0 and adjust to 1 l with distilled water. For
electrophoresis prepare 1× TBE.
2. 50× TAE buffer: Mix 242 g Tris, 57.1 ml glacial acetic acid,
and 100 ml 0.5 M EDTA pH 8.0 and adjust to 1 l with dis-
tilled water. For electrophoresis prepare 1× TAE.
3. Gel loading buffer: mix 10 mg bromophenol blue, 10 mg
xylene cyanol, 5 ml glycerin, 2 ml of 0.5 M EDTA pH 8.0,
0.1 ml of 1 M Tris–HCl buffer pH 8.0 and adjust to a volume
of 10 ml with ddH2O. Store at 4 °C.
4. Staining the gels: Stain G (Serva, Heidelberg, Germany) or,
alternatively, 10 mg/ml ethidium bromide: dissolve 100 mg
of ethidium bromide in 10 ml ddH2O and stir until the dye
has dissolved (Important: Wear appropriate gloves when work-
ing with solutions that contain this dye). Store in a dark bottle
at 4 °C.
5. Agarose for gel electrophoresis (e.g., Sigma-Aldrich/Merck,
Darmstadt, Germany, or Biozym Scientific GmbH, Hessisch-
Oldendorf, Germany).
6. Low melting point agarose for gel extraction of PCR
fragments.
7. Molecular size marker depending on the size of the studied

marker (e.g., GeneRuler 1 kb ladder or Low Range, Thermo
Fisher Scientific, Waltham, USA).
8. Equipment for horizontal electrophoresis (small or middle
size chamber) including power supply.
9. Transilluminator and photo camera or other image acquisition
system.
10. Microwave, water bath, magnetic stirrer.
2.3 Sequencing 1. QIAquick PCR-product purification kit (QIAGEN, Hilden,

of PCR Products Germany) or equivalent (e.g., Wizard SV Gel and PCR
Clean-Up System (Promega, Madison, USA)).
2.3.1 Preparation of PCR
Products for DNA 2. QIAquick gel extraction kit (QIAGEN, Hilden, Germany) or
Sequencing equivalent (e.g., Wizard SV Gel and PCR Clean-Up System
(Promega, Madison, USA)).
3. pCR2.1-TOPO vector TOP10 Kit (Invitrogen-Thermo Fisher
Scientific) (TOPO TA Cloning Kit, with pCR2.1-TOPO, One
Shot TOP10 Chemically Competent E. coli, and PureLink
Quick Plasmid Miniprep Kit) (if applicable).
4. For PCR products with insufficient amounts of DNA for direct
sequencing: pGEM®-T Vector Systems (including E. coli
competent cells JM109), Wizard® Plus SV Minipreps DNA
purification system (Promega, Madison, USA), universal primers
T7 and SP6.
2.3.2 DNA Sequencing 1. Primers for direct cycle sequencing (including internal primers
Reactions if applicable) (Tables 3, 4, and 6).
2. M13 sequencing primers M13-for 5′-GTA AAA CGA CGG
CCA GT-3′ and M13-rev 5′-CAG GAA ACA GCT ATG
AC-3′.
3. Direct cycle sequencing kit (e.g., BigDye™ Terminator v3.1
Cycle Sequencing Kit (Applied Biosystems, CA, USA) or CEQ
chemistry (Beckman Inc.)).
4. PCR thermocycler.
5. Automated sequencer (e.g., ABI PRISM (Applied Biosystems,
CA, USA), CEQ 8000 (Beckman Coulter, CA, USA)) or
sending the products for commercial Sanger sequencing.
6. Data collection software and DNA Sequencing Analysis soft-
ware (e.g., Applied Biosystems, CA, USA).
2.4 Bioinformatics 1. Exclusive use of computer with high processing speed and
storage capacity, or access to a server for very large datasets
(long DNA sequences, and, in particular, many sequences).
2. Internet access.
Table 6
Internal sequencing primers for the most frequently used single locus markers
Marker Direction Primer name Primer sequence 5′–3′ Position Reference sequence References
SSU Forward S-823 CGA AYA ACT GCY CTA TCA GC 342-361 X07773 Maslov et al. [14]
S-713 CCG CGG TAA TTC CAG CTC C 630-649 X07773 Maslov et al. [14]
S-825 ACC GTT TCG GCT TTT GTT GG 929-949 X07773 Maslov et al. [14]
S-827 GAT TAG AGA CCA TTG TAG TC 1245-1264 X07773 Maslov et al. [14]
S-757 TCA GGG GGG AGT ACG TTC GC 1457-1476 X07773 Maslov et al. [14]
S-828 CAA CAG CAG GTC TGT GAT GC 1822-1841 X07773 Maslov et al. [14]
Reverse S-829 GCA TCA CAG ACC TGC TGT TG 1841-1822 X07773 Maslov et al. [14]
S-714 CGT CAA TTT CTT TAA GTT TC 1502-1482 X07773 Maslov et al. [14]
S-662 GAC TAC AAT GGT CTC TAA TC 1264-1245 X07773 Maslov et al. [14]
S-826 CCA ACA AAA GCC GAA ACG GT 949-929 X07773 Maslov et al. [14]
S-755 CTA CGA ACC CTT TAA CAG CA 680-661 X07773 Maslov et al. [14]
S-824 GCT GAT AGR GCA GTT RTT CG 361-342 X07773 Maslov et al. [14]
ITS2 Forward LIS2MV ATA CAC ACA TGC ACT CTC 173-190 in ITS2 AJ634378.1 El Tai et al. [68, 79]
Reverse LIS2MR AGA GTG CAT GTG TGT AT 190-174 in ITS2 AJ634378.1 El Tai et al. [80, 92]
HSP70 Forward HSP70-F335 CAC GCT TCG TCC GCG ACG 825-843 XM_001684512 Montalvo et al. [63];
Fraga et al. [61]
HSP70-F893 GTT CGA CCT GTC CGG CAT CC 1383-1402 XM_001684512 Montalvo et al. [63];
Fraga et al. [61]
HSP70-2F CTG AAC AAG AGC ATC AAC CC 1084-1103 XM_001684512 Fraga et al. [61]
Reverse HSP70-R429 AAC AGG TCG CCG CAC AGC TCC 938-918 XM_001684512 Montalvo et al. [63];
Fraga et al. [61]
HSP70-R1005 GTG ATC TGG TTG CGC TTG CC 1514-1495 XM_001684512 Montalvo et al. [63];
Fraga et al. [61]
HSP70-2R CTT GAT CAG CGC CGT CAT CAC 1254-1234 XM_001684512 Fraga et al. [61]
POLA Forward L1023-F AAC CTG TGG AGC CGT AC 2029-2045 XM_ 003859800 Noyes et al. [34]
Reverse L1023-R GTA ATG AAC TTR AGR TCG TGG 2117-2097 XM_ 003859800 Noyes et al. [34]
Phylogenetic Studies
RPOIILS Forward RPO-3F CAC RAC RAT GGG TAA GC 2868-2884 XM_003863307 Noyes et al. [34]
RPO-5F CAG CAG TCM CTC ATC AC 3151-3168 XM_003863307 Noyes et al. [34]
Reverse RPO-2R CTG CAG CTC CCG CAC 2943-2829 XM_003863307 Noyes et al. [34]
31
RPO-4R RAT RAA CTG CTG YGC CTC 3402-3384 XM_003863307 Noyes et al. [34]
(continued)
Table 6
32
(continued)
Marker Direction Primer name Primer sequence 5′–3′ Position Reference sequence References
NAGT Forward L3 ATC TAC CTC GGT CCC GTC TAC 2216-2236 M96635 Akman et al. [77];
Waki et al. [41]
Reverse L2 TGC AGA AGA TGC ACA GCA TGG 2270-2250 M96635 Akman et al. [77];
Waki et al. [41]
CYTBa Forward LCBF4 TGT TATT GAA TAT GAG GTA GTG 5849-5870 M10126 Luyo-Acero et al. [42];
Asato et al. [45]
Reverse LCBR4 GAA CTC ATA AAA TAA TGT AAA CAA AA 5985-5960 M10126 Luyo-Acero et al. [42];
Asato et al. [45]
a
Eight additional internal sequencing primers can be found in Luyo-Acero et al. [42]
3. Bioinformatic programs (for more details see the respective

sections of the Methods part):
(a)
Resources can be found at databases such as ExPASy
(https://www.expasy.org/) or sites such as http://evolu-
tion.genetics.washington.edu/phylip/software.html.
(b)
Programs can be freeware, such as BioEdit, MEGA,
BEAST, and SplitsTree; or paid, such as Geneious,
DNAStar, and PAUP.
(c)
Programs can be more or less user friendly. BioEdit,
MEGA, SplitsTree are Windows user friendly, whereas
others require a Command Prompt and some knowledge
of MS-DOS commands.
(d) Manual for each program, which can be downloaded from
their website.
3 Methods
3.1 Establishment There are several points that have to be considered for planning
of the Study’s the strategy of the study (see Note 3):
Strategy—Selecting
1. Definition of the Taxonomic level of the study:
the Right Markers
and the Appropriate (a) Choose the most appropriate markers for the taxonomic
Sample Set
level under study (Table 2) (see Note 4).
(b) Evaluate all pro and cons of each marker (e.g., technical
limitations) (Tables 1, 3 and 4) (see Note 3).
(c) Check the specificity of the chosen primers (e.g., are the
primers family specific, genus specific, or subgenus spe-
cific?) (see Note 4).
(d) How frequently is the selected marker used, how many
sequences are already available in GenBank for analysis,
do these sequences cover the same sequence positions?
(see below).
(e)
Check which parts of the markers have been used for
which questions or studied taxa—possibilities of comple-
menting the own study with existing data.
(f) Are these markers validated in terms of protocol and per-
formance as well as of discriminative power in the genus
Leishmania?
2. Definition of the sample material:
(a) Applicability of the markers also depends on the kind of
samples—DNA from cultured parasites (all markers are
suitable), clinical samples or other biological material as
sandflies (rather multicopy markers)—check the sensitivity
and specificity of the selected marker (Tables 1 and 2).
(b) MLST needs DNA from cultured parasites.
3. Define the appropriate sample set: including a representative

sample set per taxonomic unit (several strains per species—
intraspecies diversity), several strains from a specific region
(geographic diversity) (for more details see Subheading 3.6).
4. Other points that have to be considered are the laboratory
capacities (personnel, equipment), costs, and time limitations
(e.g., in the case of multilocus approaches, WGS SNPs).
3.2 PCR— 1. Several of the PCR protocols used for phylogenetic studies of
Amplification Leishmania, especially those targeting multicopy regions, can
of Genetic Targets be applied using both cultured parasites and clinical samples,
for Phylogenetic including filter paper with bone marrow or lymph node aspi-
Inference rates, peripheral blood, spleen aspirates, skin scrapings, or other
biological material as smashed sandflies etc. (see Note 2). For
DNA extraction use the most commonly applied protocols [89,
90, 92, 120] or alternatively commercial DNA-extraction kits
(e.g., QIAgen—QIAamp DNA Mini Kit; DNeasy Blood and
Tissue Kit, QIAgen, Hilden, Germany).
2. Prepare 10 ng/μl DNA solutions from cultured parasites.
In most PCRs 5–50 ng genomic DNA should be sufficient
(some authors use up to 150 ng). Use undiluted DNA (2–4 μl)
if extracted from clinical material (see Note 2).
3. It is important that positive and negative controls (including
negative extraction controls in case of biological samples) are
used in all PCR reactions (see Note 5).
4. PCR products should be stored at 4 °C or −20 °C until use.
3.2.1 Single Markers The HSP70 locus has been identified as one of the best for
high-resolution species discrimination and phylogenetic analy-
HSP70
sis. The available protocols have been extensively optimized and
validated. The original PCR described by Garcia et al. [60] has
been further improved with respect to sensitivity and specificity
by Montalvo et al. and van der Auwera et al. [65, 66]. (A detailed
protocol is available from www.itg.be/LeishmaniaHSP70.) All
protocols analyze a partial gene. The respective PCRs can be
performed using the following primer combinations, depending
on the chosen fragment for phylogenetic analysis (Fig. 1a,
Table 3) (position within the hsp70 gene of L. major
XM_001684512.1):
PCR-G: position 435-1856: Hsp70sen/Hsp70ant Size 1422 bp Garcia et al. [60]
PCR-F: position 480-1765: F25/R1310 Size 1286 bp Montalvo et al. [65]
PCR-N: position 480-1072: F25/R617 Size 593 bp Montalvo et al. [65]
PCR-T: position 1000-1765: p6F/R1310 Size 766 bp van der Auwera et al. [66]
In most phylogenetic studies PCR-G or PCR-F are used

(Fig. 1a). Because of the large size of the amplicons internal
sequencing primers are required (preferable) or two overlapping
fragments (e.g., PCR-N+ PCR-T) can be amplified and sequenced.
1. PCR-G
(a) Set up the PCR amplification reaction containing the fol-
lowing reagents (final concentration): 1× PCR standard
PCR buffer (incl. 1.5 mM MgCl2), 200 μM dNTPs, 5%
DMSO, 0.8 μM of each primer, 2.5 U Taq DNA
Polymerase (see Note 1), ddH2O, and the DNA sample.
(b) For a 25 μl PCR reaction use 2.5 μl 10× PCR buffer,
1.25 μl DMSO, 2.0 μl dNTP mix (2.5 mM), 2 μl forward
primer (10 μM), 2 μl reverse primer (10 μM), 0.25 μl Taq
DNA polymerase (5 U/μl), and 13 μl ddH2O. Vortex and
centrifuge the master mix shortly and dispense it in pre-
chilled labeled PCR-tubes (see Note 6).
(c) Add 2 μl of template DNA (10 ng/μl solutions if DNA
extracted from parasite cultures or undiluted DNA if
extracted from biological or clinical material). Vortex and
centrifuge the mixture briefly.
(d) Run the following thermocycler program: initial denatur-
ation step of 94 °C for 5 min followed by 33 cycles of
94 °C for 30 s, 61 °C for 60 s, 72 °C for 3 min and a final
elongation step at 72 °C for 10 min.
2. PCR-F
(a) Set up the PCR amplification reaction containing the fol-
lowing reagents (final concentration): 1× PCR buffer, 1×
Q-solution (QIAgen, Hilden, Germany), a total of
2.5 mM MgCl2, 200 μM dNTPs, 0.8 μM of each primer,
1U HotStarTaq Plus DNA Polymerase (QIAgen, Hilden,
Germany), ddH2O, and 10 ng of the DNA sample
(respectively 2–4 µl of undiluted DNA extracted from
biological material) (see Note 6). Vortex and centrifuge
the mixture briefly.
(b) Run the following thermocycler program: initial denatur-
94 °C for 40 s, 61 °C for 60 s, 72 °C for 2 min and a final
3. PCR-N and PCR-T
(a) Set up the PCR as for PCR-F using the respective primers
(see Note 6). Run the PCRs with annealing temperatures
61 °C and use an elongation time of 60 s.
ITS rDNA 1. This PCR, based on a validated protocol first presented by el

Tai et al. [92], can be performed using the following primer
combinations, depending on the chosen fragment for phylo-
genetic analysis (Fig. 1b, Table 3):
ITS1+5.8S+ITS2: LITSR/LITSV (Size 950–1130 bp)

ITS1: LITSR/L5.8S (Size 300–350 bp)
ITS2: L5.8SR/LITSV (Size 700–750 bp)
2. Set up the PCR amplification reaction containing the follow-

ing reagents (final concentration): 1× PCR buffer (incl.
1.5 mM MgCl2) (supplied by the manufacturer), 200 μM
dNTPs, 12.5 pmol of forward primer, 12.5 pmol of reverse
primer,1 U Taq DNA polymerase (see Note 1), ddH2O, and
the DNA sample. If using clinical or biological material also
add DMSO to a final concentration of 2.5% (optional).
3. For a 25 μl PCR reaction use 2.5 μl 10× PCR buffer, 2 μl
dNTP mix (2.5 mM), 1.25 μl forward primer (10 μM), 1.25 μl
reverse primer (10 μM), 0.2 μl Taq DNA polymerase (5 U/μl),
and 15.8 μl ddH2O (see Note 6). Vortex and centrifuge the
master mix shortly and dispense it in prechilled labeled
PCR-tubes.
4. Add 2 μl of template DNA (10 ng/μl solutions if DNA
extracted from parasite cultures or undiluted DNA if extracted
from biological or clinical material). Vortex and centrifuge the
mixture briefly.
5. Run the following thermocycler program: initial denaturation
step of 95 °C for 2 min followed by 33 cycles of 95 °C for
20 s, 53 °C for 30 s, 72 °C for 60 s and a final elongation step
at 72 °C for 6 min.
RPOIILS 1. This PCR based on a protocol first presented by Croan and

Ellis [93] is performed using the following primers: RPOF1/
RPOR1 and amplifies a 1300 bp fragment (Fig. 1e; Table 3).
2. Set up the PCR amplification reaction containing the following
reagents (final concentration): 1× PCR buffer (incl. 1.5 mM
MgCl2) (supplied by the manufacturer), 200 μM dNTPs,
12.5 pmol of forward primer RPOF1, 12.5 pmol of reverse
primer RPOR1, 1 U Taq DNA polymerase (see Note 1),
ddH2O, and the DNA sample. In case of the use of clinical
or biological material also add DMSO to a final concentration
of 2.5% (optional).
dNTP mix (2.5 mM), 1.25 μl forward primer RPOF1 (10 μM),
1.25 μl reverse primer RPOR1 (10 μM), 0.2 μl Taq DNA
polymerase (5 U/μl), and 15.8 μl ddH2O (see Note 6). Vortex

and centrifuge the master mix shortly and dispense it in pre-
chilled labeled PCR-tubes.
extracted from parasite cultures or undiluted DNA extracted
mixture briefly.
CYTB 1. This PCR based on a validated protocol first presented by

Luyo-Acero et al. [42] can be performed using the following
primer combinations, depending on the chosen fragment for
phylogenetic analysis (Fig. 1c, Table 3):
Complete cytb gene: COIIIF/MURF4R (Amplicon size 1338 bp,

gene size 1079 bp)
Partial cytb gene: LCBF1/LCBR2 (Amplicon size 865 bp)
2. LCBF1 and LCBR2 are identical to Lcyt-S and Lcyt-R in Kato

et al. [43] (Table 3).
ing reagents for the partial gene (final concentration): 1× PCR
buffer (incl. 1.5 mM MgCl2) (supplied by the manufacturer),
200 μM dNTPs, 0.5 μM of each primer, 1 U Taq DNA poly-
merase (see Note 1), ddH2O, and the DNA sample.
4. For a 25 μl PCR reaction use 2.5 μl 10× PCR buffer, 2 μl dNTP
mix (2.5 mM), 1.25 μl forward primer (10 μM), 1.25 μl reverse
primer (10 μM), 0.2 μl Taq DNA polymerase (5 U/μl), and
15.8 μl ddH2O (see Note 6). Vortex and centrifuge the master
mix shortly and dispense it in prechilled labeled PCR-tubes.
mixture briefly.
60 s, 53 °C (for LCBF1/LCBR2) or 50 °C (for COIIIF/
MURF4R) for 60 s, 72 °C for 60 s and a final elongation step
Miniexon Spliced Leader 1. This PCR, based on a protocol first presented by Marfurt et al.
RNA [55], is performed using the primers Fme and Rme and ampli-
fies a fragment ranging from 221 to 442 bp (Fig. 1d, Table 3).
It was validated with a representative set of strains including

17 Leishmania species by van der Auwera et al. [53].
ing reagents (final concentration): 50 mM PCR buffer,
1.5 mM MgCl2, 40 mM tetramethylammonium chloride, 12%
DMSO, 200 μM dNTPs, 0.5 μM of each primer, 0.5 U Taq
DNA polymerase (see Note 1), ddH2O, and the DNA sam-
ple (see Note 6). Vortex and centrifuge the master mix shortly
and dispense it in prechilled labeled PCR-tubes.
mixture briefly.
30 s, 54 °C for 30 s, 72 °C for 45 s.
7SL RNA 1. The 7 SL RNA PCR is based on a protocol first described by

Zelazny et al. [51] and it is performed using the primers
TRY7SL.FOR1 and TRYSL.REV1 (Table 3). The size of the
amplified fragment varies slightly depending on the species
(~185 bp). This protocol was validated with a representative
set of strains including 17 Leishmania species by van der
Auwera et al. [53].
POLA 1. This PCR is based on a protocol first presented by Noyes et al.

and Croan et al. [34, 35]. The forward primer used in the
present protocol is different from that originally reported by
Croan et al. [35] and slightly modified in comparison with the
DPO1 primer used by Noyes et al. [34]. The present protocol
uses the following primers: DNAP/DPO2 and generates a
1050 bp fragment (Fig. 1f, Table 3).
dNTPs, 12.5 pmol of forward primer DNAP, 12.5 pmol of
reverse primer DPO2, 1 U Taq DNA polymerase (see Note 1),
ddH2O, and the DNA sample. In case of the use of clinical or
biological material also add DMSO to a final concentration of
2.5% (optional).
dNTP mix (2.5 mM), 1 μl forward primer DNAP (10 μM),
1 μl reverse primer DPO2 (10 μM), 0.2 μl Taq DNA poly-
merase (5 U/μl), and 16.3 μl ddH2O (see Note 6). Vortex and
centrifuge the master mix shortly and dispense it in prechilled
labeled PCR-tubes.

mixture briefly.
SSU With respect to phylogenetic studies of Leishmania there is no

consensus fragment used. Commonly, the following different,
often non-overlapping parts of the SSU gene (1–2200) are studied
(Table 3, Fig. 1g):
Position 618-1460: Primer 609F/706R (Size 842 bp) da Silva et al. [91]

Position 790-1393: Primer R221/R332 (Size 603 bp) van Eys et al. [33]
(or a sub-fragment): 961-1353: Primer R222/R333 (Size 392 bp) van Eys et al. [33]
Position 1661-2200: Primer S12/S4 (Size 539 bp) Uliana et al. [87]
For amplification of the whole gene (or nearly the complete

gene) the following primers are commonly used:
Position 1-2200: Primers S1/S4 (Size 2200 bp) Uliana et al. [87]
Position 25-2163: Primers S-763/S-762 (Size 2138 bp) Maslov et al. [14]
1. R221/R332 PCR:
(a) Amplification of the R221/R332 fragment is based on a
validated protocol specific for Trypanosomatids frequently
used for diagnosis of Leishmaniasis [33, 89, 90].
(b) Set up the PCR amplification reaction containing the fol-
lowing reagents (final concentration): 1× PCR buffer
(incl. 1.5 mM MgCl2) (supplied by the manufacturer),
2.5 mM MgCl2, 250 μM dNTPs, 1 μM of each primer,
1 U Taq DNA polymerase (see Note 1), ddH2O, and the
DNA sample.
(c) For a 25 μl PCR reaction use 2.5 μl 10× PCR buffer,
1.25 μl MgCl2 (50 mM), 2.5 μl dNTP mix (2.5 mM),
2.5 μl forward primer (10 μM), 2.5 μl reverse primer
(10 μM), 0.2 μl Taq DNA polymerase (5 U/μl), and
11.55 μl ddH2O (see Note 6). Vortex and centrifuge the
master mix shortly and dispense it in prechilled labeled
PCR-tubes.
(d) Add 2 μl of template DNA (10 ng/μl solutions if DNA
extracted from parasite cultures or undiluted DNA
extracted from biological or clinical material). Vortex and
centrifuge the mixture briefly.
(e) Run the following thermocycler program: initial denatur-

94 °C for 30 s, 60 °C for 60 s, 72 °C for 120 s and a final
2. 609F/706R PCR
(a) Amplification of the 609F/706R fragment is based on a
protocol frequently used for analysis of Trypanosomes
[91] (Trypanosomatid barcoding fragment V7V8), firstly
applied for Leishmania by Marcili et al. [28].
200 μM dNTPs, 200 pM of each primer, 2.5 U Taq DNA
polymerase (see Note 1), ddH2O, and 100 ng of the DNA
sample (see Note 6).
(c) Run the following thermocycler program: 30 cycles of
94 °C for 60 s, 48 °C for 120 s, 72 °C for 60 s. A modified
cycling program was used by Lopes et al. [47]: initial
denaturation step of 94 °C for 3 min followed by 40 cycles
of 94 °C for 30 s, 55 °C for 30 s, 72 °C for 30 s and a final
3. S12/S4
(a) Amplification of the S12/S4 fragment is based on a pro-
tocol firstly presented by Uliana et al. [87], slightly modi-
fied by Savani et al. [121] (see below S1/S4).
lowing reagents (final concentration): 1× PCR buffer (incl.
1.5 mM MgCl2) (supplied by the manufacturer), 2 mM
MgCl2, 200 μM dNTPs, 200 pM of each primer, 2 U
Taq DNA polymerase (see Note 1), ddH2O, and 20 ng of
the parasite DNA sample (see Note 6).
(c) Run the following thermocycler program: initial denatur-
4. S1/S4
(a) Amplification of the whole SSU gene with primers S1/S4
is based on a protocol firstly presented by Uliana et al.
[87]. Analysis of only the S12/S4 fragment (see above) is
performed by sequencing the S1/S4 fragment with the
internal sequencing primer S12.
200 μM dNTPs, 250 pM of each primer, 1.5 U Taq DNA
polymerase (see Note 1), ddH2O, and 20 ng of the para-

site DNA sample (see Note 6).
5. S-763/S-762
(a) Amplification of the S-763/S-762 fragment is based on a
protocol frequently used for analysis of Trypanosomatids,
developed by Maslov et al. [14].
250 μM dNTPs, 20 μM of each primer, 2.5 U Taq DNA
polymerase (see Note 1), ddH2O, and 10–100 ng of the
parasite DNA sample (see Note 6).
ation step of 95 °C for 5 min followed by 5 cycles of 95 °C
for 60 s, 45 °C for 30 s, 65 °C for 60 s and 35 cycles of
95 °C 60 s, 50 °C 30 s, 72 °C 60 s and a final elongation
step at 72 °C for 5 min.
gGAPDH 1. The gGAPDH PCR is based on an assay by Hannaert et al.

applied and further developed by Hamilton et al. [23, 94],
used also in a recent phylogenetic analysis of the whole genus
Leishmania including subgenera L. (Sauroleishmania) and L.
(Mundinia) and the genus Porcisia [13]. Respective primers
are given in Table 3.
1.5 mM MgCl2) (supplied by the manufacturer), 4.5 mM
MgCl2, 200 μM dNTPs, 1 μM of each primer, 2.5 U Taq
DNA polymerase (see Note 1), ddH2O, and the parasite DNA
sample (see Note 6).
3. Run the following thermocycler program for primer combina-
tions G1 or G3 (forward) and G4a, G4b or G5 (reverse): ini-
tial denaturation step of 95 °C for 3 min followed by 30 cycles
of 95 °C for 60 s, 55 °C for 30 s, 72 °C for 60 s and a final
4. Run the following thermocycler program for primer combina-
tions G1 or G2: first cycle: 94 °C for 3 min, 55 °C for 60 s,
61 °C for 20 s, 72 °C for 20 s; followed by 10 cycles of 94 °C
for 30 s, 55 °C for 60 s, 61 °C for 20 s, 72 °C for 20 s, fol-
lowed by 30 cycles of 94 °C for 30 s, 50 °C for 60 s, 72 °C for
60 s and a final cycle of 94 °C for 30 s, 50 °C for 60 s, 72 °C
for 10 min.
3.2.2 MLST/MLSA 1. Set 1

(a) This MLST approach, based on a protocol first presented
by El Baidouri et al. [104], combines seven housekeeping
genes: EF-2α, SRM1, DH-like, TIF-2α, NH-like,
ConsHP, RPOIILS (Table 5). Some studies used only
subsets of 3–4 of these markers [88, 106]. PCR primers
are given in Table 4.
dNTPs, 0.5 μM of forward primer, 0.5 μM of reverse
primer, 1 U Taq DNA polymerase (see Note 1), and ddH2O
and the DNA sample (see Note 6). Vortex and centrifuge
the mixture briefly. Alternatively, if used with a real-time
PCR instrument use the LightCycler® 480 SYBR Green I
Master mix (Roche) and 0.5 μM of each primer.
ation step at 95 °C for 5 min followed by 45 cycles of
elongation step at 72 °C for 10 min. If a real-time cycler is
used run the following program: initial denaturation step
at 95° for 5 min followed by 45 cycles of 95° for 10 s, 58°
for 10 s, 72° for 30 s and a final step at 40° for 10 min.
2. Set 2a:
(a) This MLST approach based on a protocol firstly presented by
Mauricio et al. [96] combines five housekeeping genes: asat,
gpi, nh1, nh2, and 6pgd used for MLEE (Tables 4 and 5).
200 μM dNTPs, X mM MgCl2 (see below), 0.5 μM of
forward primer, 0.5 μM of reverse primer, 2.5 U Taq DNA
polymerase (see Note 1), and ddH2O and the DNA sam-
ple (usually 125 ng) (see Note 6). Vortex and centrifuge
(c) Run the following thermocycler program: 30 cycles of
95 °C for 60 s, Tann for 60 s, 72 °C for Z s.
(d)
The following primer combinations and respective
annealing temperatures and MgCl2 concentrations are
used (Table 4):
asat: ASAT-F2new/ASAT-R2new 1 mM MgCl2 Tann = 60 °C Z = 90 s
gpi: GPI-F3/GPI-R4 1 mM MgCl2 Tann = 58 °C Z = 120 s
nh1: NH1-F1/NH1-R3 2 mM MgCl2 Tann = 65 °C Z = 60 s
nh2: NH2-F10/NH2-R6 1 mM MgCl2 Tann = 60 °C Z = 90 s
6pgd: 6PGD-F1/6PGD-R2 1 mM MgCl2 Tann = 60 °C Z = 90 s
3. Set 2b:
(a)
This MLST approach, based on a protocol first pre-
sented by Zemanová et al. [102], combines five house-
keeping genes used for MLEE: icd, me, mpi, g6pdh, and fh
(Tables 4 and 5).
250 μM dNTPs, 0.4 μM of forward primer, 0.4 μM of
reverse primer, 0.5 U Taq DNA polymerase (see Note 1),
and ddH2O and the DNA sample (usually 10–20 ng) (see
Note 6). Vortex and centrifuge the mixture briefly.
ation step at 96 °C for 5 min followed by 30 cycles of 96 °C
for 60 s, Tann for 60 s, 72 °C for 90 s and a final elongation
step at 72 °C for 10 min. The annealing temperatures
are 55 °C (ICD-F/ICD-R), 50 °C (ME-F/ME-R), 55 °C
(MPI-F/MPI-R), 50 °C (G6PDH-F/G6PDH-R), 58 °C
(FH-F/FH-R) (Table 4).
4. Set 2c:
(a) This MLST approach, based on a protocol first presented by
Boité et al. [100], combines four housekeeping genes and
respective primers: g6pdh (G6PDH-F-VIAN/G6PDH-R-
Vian), 6pgd (pgd-F-VIAN/pgd-R-VIAN), mpi (MPI-F-
VIAN/MPI-R-VIAN), and icd (ICD-F-VIAN/
ICD-R-VIAN) (Tables 4 and 5). The primers are different
from those used by other authors for the same markers.
dNTPs, 0.1 mM of forward primer, 0.1 mM of reverse
primer, 1 U Taq DNA polymerase (see Note 1), and
ddH2O and the DNA sample (usually 50 ng) (see Note 6).
Vortex and centrifuge the mixture briefly.
94 °C for 30 s, 55 °C (icd, 6pgd, g6pgd) or 58 °C (mpi)
for 30 s, 72 °C for 60 s and a final elongation step at 72 °C
for 5 min.
5. Set 3:
(a) This MLST approach is based on an approach presented
by Zhang et al. [99]. The authors used a combination of
previously described protocols for the five enzyme coding
genes fh, g6pdh, icd, mpi, and 6pgd and one new proto-
col for a Leishmania homolog of receptors for activated
protein kinase C (lack- primers Lack-F/Lack-R) (Tables

4 and 5).
(b) PCR amplification reactions for the five enzyme coding
genes have been described previously in Set2a and Set2b,
and for hsp70 under single markers Garcia et al. [60].
95 °C for 60 s, Tann for 60 s, 72 °C for 90 s and a final
elongation step at 72 °C for 10 min. Annealing tempera-
tures are given under (a) or (b). Tann for lack is 41 °C for
hsp70 60 °C.
6. Set 4:
(a) This MLST approach is based on an approach presented
by Herrera et al. [97]. The authors used a combination of
different previously described protocols combining the
following seven housekeeping genes and their respective
primers: g6pdh (G6PDH-F-VIAN/G6PDH-R-Vian),
pgm (PGM-F/PGM-R), mpi (MPI-F-VIAN/MPI-R-
VIAN), alat (ALAT-F/ALAT-R), asat (ASAT-F2new/
ASAT-R2new), icd (ICD-F-VIAN/ICD-R-VIAN), and
cytb (Cytb-F/Cytb-R) (Tables 4 and 5).
reverse primer, 1 U Taq DNA polymerase (see Note 1),
and ddH2O and the DNA sample (usually <250 ng)
(see Note 6). Vortex and centrifuge the mixture briefly.
7. Set 5:
(a) This MLST approach presented by Marlow et al. [101] is
based on a combination of the four previously developed
markers (and their respective primers) 6pgd (pgd-F-
VIAN/pgd-R-VIAN), mpi (MPI-F-VIAN/MPI-R-
VIAN), icd (ICD-F-VIAN/ICD-R-VIAN), and hsp70
(HSP70for/HSP70rev) and two additional newly devel-
oped PCR protocols targeting mitochondrial and nuclear
mdh (Mdhmt-F/Mdhmt-R and Mdhnc-F/Mdhnc-R)
(Tables 4 and 5).
(b) PCR amplification reactions for the four targets 6pdg, mpi,
icd, and hsp70 have been described previously (e.g., set
2c and for hsp70 under single markers Garcia et al. [60]).
Set up the PCR amplification reaction for mitochondrial

and nuclear mdh containing the following reagents (final
concentration): 1× PCR buffer (incl. 1.5 mM MgCl2)
(supplied by the manufacturer), 250 μM dNTPs, 0.2 mM
of forward primer, 0.2 mM of reverse primer, 1 U Taq
DNA polymerase (see Note 1), and ddH2O and the DNA
sample (usually 50 ng) (see Note 6). Vortex and centrifuge
8. Set 6:
(a) This MLST approach developed and applied by Tsukayama
et al. [98] includes four previously used housekeeping genes,
however using different primers: mpi (MPIextF/MPIextR),
gpi (GPIextF/GPIextR), 6pgd (6PGDextF/6PGDextR),
mdhnc (MDHextF/MDHextR) (Tables 4 and 5).
(b) Set up the PCR amplification reaction containing the
following reagents (final concentration): 1× PCR buffer
200 μM dNTPs, 1 μM of forward primer, 1 μM of reverse
primer, 1 U Taq DNA polymerase (see Note 1), and
ddH2O and the DNA sample (usually 50 ng) (see Note 6).
Vortex and centrifuge the mixture briefly.
9. Set 7:
(a)
This MLST approach, based on a protocol first pre-
sented by Marco et al. [103], combines seven house-
keeping genes: aco, alat, enol, hgprt, pgm, pmm, and
spdsyn (Tables 4 and 5).
(b) Set up the PCR amplification reaction containing the
following reagents (final concentration): 1× PCR buffer
reverse primer, 1.25 U Taq DNA polymerase (see Note 1),
and ddH2O and the DNA sample (usually 10–20 ng)
(see Note 6). Vortex and centrifuge the mixture briefly.
3.3 Electrophoresis 1. Prepare a 1–1.2% agarose gel either with 1× TAE or 1× TBE
of PCR Products buffer. Also add the stain G as recommended by the manufac-
turer or use ethidium bromide for staining the gel.
2. For control electrophoresis of the PCR products mix 5 μl of
PCR sample with 1 μl loading dye (if not already incorporated in
the PCR mix) and load this mixture into the slots of the gel.
3. Always use at least one slot for a molecular weight marker to
define the size of your PCR product. The marker should have
at least one fragment close to the expected size of the PCR
product.
4. Run the electrophoresis at 5–10 V/cm in the same buffer as
contained in the gel.
3.4 Sequencing 1. PCR products for DNA sequencing should be a single fragment
of PCR Products free from primers, primer dimers and non-specific products, as
well as from Taq DNA polymerase and other reagents from
3.4.1 Preparation of PCR
the previous reaction mix and have a minimum concentration
Products for DNA
(see Subheading 3.4.2).
Sequencing
2. Purify the amplified fragments using kits, such as the QIAquick
PCR purification kit (QIAGEN) according to manufacturer’s
protocol, or standard ethanol precipitation protocols.
3. If extra products or intense primer dimer bands are present it
is necessary to excise the desired band from the gel after sepa-
ration through electrophoresis. Gel extraction protocols rec-
ommend the use of low melting point agarose at a low
concentration (ideally 0.8%). To reduce the amount of agarose
not containing DNA use large wells which can be made by
placing tape across several teeth to produce a sufficiently large
well when setting the agarose. Use a clean scalpel blade to cut
the band on a transilluminator (important: wear protective
UV glasses or mask) and transfer the band to a sterilized tube.
Purification can be done through standard gel extraction pro-
tocols or kits for DNA purification from gel (e.g., QIAquick
gel extraction kit or Wizard SV Gel and PCR Clean- Up
System—see Subheading 2.3.1).
4. To obtain sufficient PCR product it may be necessary to scale
up the PCR amplification reaction. Consider how many
sequencing reactions will be necessary to cover the entire PCR
product, from a minimum of two reactions, one per primer.
Ideally, all fragments should be sequenced in both directions
to correct sequencing errors and obtain sequences of the
region immediately in front of each primer, if necessary. As
such, and because good Sanger sequencing can produce at
least 600 up to 800 base reads, ensure two reactions per
600 bp of the PCR fragment. If the PCR product obtained is
not sufficiently concentrated, reduce the amount of elution
buffer after purification, even if it is necessary to dilute the
product at a later time. Purification of PCR products for target

concentration can be done through standard ethanol precipi-
tation protocols or kits for PCR product purification.
5. Using internal primers for sequencing fragments longer than
600 bp is always preferable to sequencing overlapping PCR
fragments with the same primers as for each PCR, as internal
primers tend to produce better quality sequences, and it saves
costs and time.
6. In some cases, it may be advisable or essential to clone frag-
ments prior to sequencing. It is, for example, the case of some
difficult or very short fragments, those for which sufficient
concentrations cannot be obtained, when the target is a poly-
morphic repeat region, when the target is heterozygous at
more than one position (for phase determination), with mixed
infections, or anonymous DNA fragments produced from
methods that use a single primer (such as RAPD or equiva-
lent). Cloning can be done with:
(a)
pCR2.1-TOPO vector TOP10 Kit (Invitrogen-Thermo
Fisher Scientific) (TOPO TA Cloning Kit, with pCR2.1-
TOPO, One Shot TOP10 Chemically Competent E. coli,
and PureLink Quick Plasmid Miniprep Kit) (if applicable).
(b) For PCR products with insufficient amounts of DNA for
direct sequencing: pGEM®-T Vector Systems (including
E. coli competent cells JM109), Wizard® Plus SV
Minipreps DNA purification system (Promega, Madison,
USA), universal primers T7 and SP6.
3.4.2 DNA Sequencing 1. ABI capillary sequencers require fragments generated using
Reactions BigDye™ Terminator v3.1 (Applied Biosystems™) chemistry.
Users should follow the manual guidelines, particularly regard-
ing the amount of template, which varies between 1 and 50 ng,
according to the size of the PCR product. The amount of PCR
product is best estimated through electrophoresis of 1 μl of the
purified PCR product and comparison with a molecular weight
marker with defined amounts of DNA per band.
2. Use internal primers for sequencing large fragments (>600 bp).
The primer sequences for the respective targets are listed in
Table 6 or the original listed references (e.g., for MLST),
some are indicated in the Figures of the targets (Fig. 1).
3. The products of the sequencing reaction should be purified
using one of the protocols described in the manual and left dry
at −20 °C until ready for analysis by the capillary sequencer.
4. Alternatively, it is possible to sequence DNA commercially,
either by sending PCR or cloned products or products from
sequencing reactions to a service provider.
3.5 Sequence 1. The chromatogram obtained from the sequencer is interpreted

Analysis automatically and, thus, may require visual inspection to
remove regions of poorer quality, such as the first positions
3.5.1 DNA Sequence
after the primer (as shown on the Fig. 2a for at least the first
Editing
15 positions), or at the end of the sequence. Automated
sequencers do not mark double peaks (Fig. 2b) in the result-
ing sequence, so visual inspection is required to identify het-
erozygous sequences and distinguish these from results with
background noise.
2. Heterozygous positions (Fig. 2b) can be distinguished from
background noise or poor sequence quality if:
(a) Peaks are of similar height, or the lower peak is at least
50% of the highest.
(b) The second peak is considerably higher than background
noise in the rest of the electropherogram.
(c) The double peak is present in sequencing results from both
directions.
3.5.2 Generating 1. Sequences for phylogenetic analysis should be as accurate as

a Consensus Sequence possible. As such, it is highly recommended that PCR frag-
ments, or cloned regions, are sequenced in both directions,
thus generating at least two sequences per fragment.
Furthermore, some genes or regions are longer than the
maximum range for Sanger sequencing (usually 600–800 bp)
and more than two sequences are generated by internal prim-
ers (see Subheading 3.4.1). In both cases, original sequences
must be assembled into a consensus sequence for the entire
region under study.
2. Different programs or algorithms can be used to generate
consensus sequences. However, alignment algorithms, such as
Fig. 2 Examples of sequencing results. (a) poor sequence quality at the beginning of the fragment (at least
the first 15 nucleotides). (b) double peaks in heterozygous sequences (positions 253, 254, 258–261).
Clustal, do not perform well and require manual input.

Assembly requires recognition of small regions of similarity as
well as generating reverse complementary sequences for opti-
mal alignment.
3. Once a consensus sequence is obtained, it should be inspected
for any differences between the original sequences. It may be
necessary to verify the original chromatograms to decide
between conflicting data, or to resequence the fragment.
4. The final consensus sequence should have the PCR primer
sequences removed.
5. Different alignment programs can be used to generate consen-
sus sequences (see Subheading 3.6.3)
3.6 Building 1. The dataset for phylogenetic inference should contain appro-
a Dataset priate data for the problem under investigation.
for Phylogenetic 2. If the objective is simply to study genetic diversity within a
Inference single population, then it is possible, although not advisable,
to use only the sequences generated in that study.
3. However, in most cases, it is important to compare the new
data with sequences obtained from previous studies. It is also
important to obtain a representation of the genetic diversity
within each species or group, as complete as possible, so that
phylogenies are as reliable and representative as possible.
3.6.1 Obtaining Two methods can be used to obtain homologous (share a common
Homologous DNA ancestor) sequences available on DNA sequence databases: search
Sequences by name, or search by sequence.
from Databanks
1. Search by species and target name
(a) Sites such as NCBI allow to search different databases
with DNA sequences, such as Nucleotide (https://www.
ncbi.nlm.nih.gov/nuccore/ for GenBank/EMBL/
DDBJ, which are synchronized), EST, Gene or Genome,
for example. Targets can be searched individually or in
datasets (PopSet).
(b) Searches should include the species or genus name and the
name of the desired region or gene.
(c) Care should be taken to search for all possible names asso-
ciated with that region or gene, for example including the
different names between parentheses with the expression
“OR,” (xxxx OR yyyy), or using wildcards, such as xxxx*
for variations of the word.
(d) In some cases, a large number of retrieved items belong to
undesired items, such as human sequences with parasite
homologies in the sequence description. In that case it is
possible to exclude them by adding the expression “NOT”
followed by a keyword (e.g., NOT human).
2. Search by sequence.
(a)
Use a sequence-based search engine, such as BLAST
(https://blast.ncbi.nlm.nih.gov/Blast.cgi), to look for
similar sequences to an initial sequence. This:
•• c an confirm that the amplified fragments correspond
to the desired sequences,
•• r ecovers any sequences that could be missed by name
searches and identifies the closest sequences.
(b) Obtaining sequences for a phylogeny using BLAST:
•• Introduce a sequence in FASTA format, or just the
sequence without description
•• hoose Database according to needs. “Nucleotide col-
C
lection” should include all available DNA sequences,
but it may be necessary to search different databases.
•• In Organism
–– Leave blank to recover all related sequences.
–– Type group or species name for a directed search.
•• In Program Selection, choose one of three options:
–– Megablast if highly similar sequences are expected.
–– D
iscontiguous Megablast if a higher degree of
dissimilarity or gaps is expected.
–– B
lastn for sequences for which no sequences were
recovered from the previous options.
•• I f more than 100 hits (the default option) are expected,
expand the Algorithm Parameters section and in
General Parameters, choose a higher number of Max
Target Sequences.
•• Run Blast.
•• On the results page:
–– Verify similarity of recovered sequences:
On
the Graphic Summary—highly similar
sequences should be shown in red, cover most
of the length of the query sequence.
n the Descriptions list, the Identity should have
O
a high value (90–100%), the E-value should be
very low (close to zero), and Query Cover
should be high (80–100%), depending on the
target sequence.
–– Obtain a file with the recovered sequences by:
Selecting All or specific sequences
hoose from Download, FASTA complete
C
sequences (entire original sequence), FASTA
aligned sequences (only region of homology

with query sequence—preferable) or GenBank
Complete Sequence (full sequence)
he resulting txt file can be opened or the
T
sequences copied into alignment programs that
recognize FASTA or GenBank formats.
3.6.2 Outgroup 1. To obtain Outgroup sequences, the process is similar to the

Sequences above (Subheading 3.6.1), but the search is for sequences out-
side the group of interest.
2. Search by name if the best outgroups are already known.
3. Search by sequence (BLAST) if it is not clear what the best
outgroup should be.
(a) In Organism.
•• ark the “Exclude” box and type group of species
M
name to recover all sequences that are most closely
related to your group of interest, but are outside of it.
These sequences can be used as outgroup in the phy-
logeny. More boxes can be added for inclusion or
exclusion, by pressing the + button on the right.
4. If available, select more than two species and more than two
sequences per species as outgroup to improve reliability of the
phylogeny.
5. Examples of outgroups in Leishmania:
(a) Species—for example if you are studying L. major, use
other species of the same subgenus, such as, in this case, L.
tropica, L. donovani at least, but also, if available, L. ger-
billi, L. turanica, and L. arabica, which are more closely
related.
(b) Sub-genus—for example L. (Leishmania), use species of
other subgenera of the genus Leishmania, such as differ-
ent species of L. (Viannia) at least, but also, if available, L.
(Sauroleishmania), Endotrypanum, and others.
(c) Genus Leishmania—use species of family
Trypanosomatidae, such as species of the genus
Trypanosoma, including T. cruzi and T. brucei at least, but
also, if available, Crithidia, Leptomonas, etc.
6. The NCBI Taxonomy database (https://www.ncbi.nlm.nih.
gov/taxonomy) or similar can be consulted for a list of known
species or variants within each group.
7. It should not be assumed that a given species or group is the
closest related, as phylogenetic relationships may be different
according to the marker used.
8. It is advisable to use a range of sequences of different origins,

preferably representing the scope of diversity within those
origins.
9. However, the outgroup normally includes fewer sequences
than the group of interest.
10. If no or few outgroup sequences are available, it is recom-
mended that at least one is obtained by sequencing known iso-
lates or strains, or that outgroup sequences are obtained from
more distantly related taxa, but this could affect results.
3.6.3 DNA Sequence 1. Prior to phylogenetic analysis, it must be ensured that homol-
Alignment ogous sites and regions are compared. Sequences with differ-
ing lengths, and of different origins, should thus be aligned to
ensure that like is compared to like. Multiple sequence align-
ment tools are required to prepare datasets for phylogenetic
analyses (Table 7).
2. Examples of alignment algorithms:
(a) ClustalW: smaller alignments [122].
(b) MUSCLE: large dataset alignment [123].
(c) MAFFT: nucleotide sequences with high variation [124].
(d) T-Coffee: for many taxa [125].
(e) WebPRANK: makes use of phylogenetic information to
decide placement of insertions and deletions (see
Subheading 3.6.4) [126].
3.6.4 Gaps 1. The gaps generated in the alignments done in the Subheading
3.6.3. may pose a problem if it is not clear where they should
be positioned.
2. The alignment method, such as Clustal W, may choose to
place gaps from identical sequences in different positions,
Table 7
Examples of commonly used programs or sites with alignment features
Name Address Freeware Algorithms

MEGA https://www.megasoftware.net/ Yes ClustalW, MUSCLE
Geneious https://www.geneious.com/ No Geneious Aligner, ClustalW, MUSCLE;
Plug-in: MAFFT, MAUVE, LastZ
BioEdit http://www.mbio.ncsu.edu/ Yes ClustalW
BioEdit/bioedit.html
DNAStar https://www.dnastar.com/ No MUSCLE, Mauve, MAFFT, Clustal
Omega, etc.
EBI tools https://www.ebi.ac.uk/Tools/ Clustal Omega, Kalign, MAFFT, MUSCLE,
msa/ MView, T-Coffee, WebPRANK
Fig. 3 Example of gap uncertainty on an alignment of DNA sequences, showing

alternative positions for two nucleotides (AC) on sequence number 1. The entire
region of uncertainty (blue box) should be removed from this alignment
which reflects uncertainty of the alignment. If this is the case,

it is best to remove the entire region of uncertainty from the
alignment (Fig. 3).
(a) Programs that can be used to optimize alignments reduc-
ing gaps and removing gaps, include MaxAlign 1.1 [127]
(http://www.cbs.dtu.dk/services/MaxAlign/).
3. Care should be taken with coding sequences to remove entire
codons, so as to not introduce false stop codons, as well as
regions that could generate different codons according to the
alignment.
3.6.5 Concatenate 1. Sequences from multiple loci can be analyzed separately or

Sequences from Multiple combined to generate longer sequences and analyzed together.
Loci (MLST) 2. To concatenate sequences, prepare files with aligned sequences
of the same samples and in the same order.
3. How the different files are merged to concatenate sequences,
may depend on the program.
(a) On BioEdit [128], choose “Append Alignment” under
the “File” menu.
(b) On SplitsTree [129], choose “Tools,” then “Concatenate
sequences,” under the “File” menu.
3.6.6 Input Data File 1. Users should check carefully which format for input data is
required by the chosen program and the format
specifications.
2. Most programs currently accept FASTA, but NEXUS is also

widely accepted. Some programs require or also accept their
own formats (e.g., MEGA, PHYLIP).
3. Attention should be paid to length of titles, accepted nonbase
characters, etc.
4. Details such as spaces, paragraph marks, and so on, can lead to
error messages.
5. Some programs indicate the cause of the error or allow for
inspection of the data file, but others (such as PHYLIP)
will not.
6. The input data file should also have as few sequences as
possible, as computational time increases with the number of
taxa. Some programs (such as BioEdit or SplitsTree) offer the
possibility to group identical sequences or profiles.
(a) On SplitsTree, it clearly states this option in the “File”
menu.
(b) In programs such as BioEdit it is less intuitive, and it
requires sorting by identical sequences followed by search
and selection of unique sequences, followed by concatena-
tion of titles and removal of duplicates.
3.7 Phylogenetic There are several methods available to produce trees for phyloge-
Tree Inference netic studies (Table 8). Methods can be grouped according to their
main characteristics and can be used for different purposes:
3.7.1 Choice of Method
for Phylogenetic Tree 1. Distance methods: the tree is produced from a matrix of genetic
Inference distances, calculated according to percentage of nucleotide dif-
ferences, often corrected by a mutation model (see Subheading
3.7.2). They are fast and produce a single tree
(a)
Neighbor-joining: this tree building method produces
unrooted trees. It is a robust method and recommended
as a first approach for phylogenetic analysis.
(b)
UPGMA: this method produces rooted trees, which
assume a constant rate of evolution (molecular clock). It
should not be used unless it has been demonstrated that a
molecular clock applies to the dataset (see Subheading
3.8), otherwise, it is highly susceptible to long branch
attraction1 effects and other distortions in relation to the
1
Long branch attraction is a phenomenon in phylogenetics that can alter tree
topology. It can occur when the mutation rate is higher along a lineage, or in
the presence of a single more distantly related branch. This longer branch tends
to be pushed toward the root, or toward shorter branches. It is a problem for
most methods, although more for some (Maximum Parsimony, UPGMA) than
for others (Maximum Likelihood, Neighbor-Joining), but it is still a problem
for those considered as the best methods, such as maximum likelihood, even for
long (>100,000 positions) sequences [118]. Reviewed by [119].
Table 8
Examples of commonly used programs or sites to produce phylogenetic trees. For a more
comprehensive list, see Subheading 5
Name Address Freeware Algorithms

MEGA https://www.megasoftware.net/ Yes Neighbor-joining, UPGMA, maximum
parsimony, maximum likelihood, etc.
PHYLIP http://evolution.gs.washington. Yes Neighbor-joining, UPGMA, maximum
edu/phylip.html parsimony, maximum likelihood, etc.
BEAST http://beast.community/index.html Yes Bayesian inference
MrBayes http://mrbayes.sourceforge.net/ Yes Bayesian inference
PAUP* http://evomics.org/resources/ No Maximum parsimony, but also distance
software/molecular-evolution- matrix, maximum likelihood
software/PAUP*/
SplitsTree4 http://www.splitstree.org/ Yes Neighbor-joining, UPGMA, maximum
parsimony, maximum likelihood,
networks (Split decomposition,
NeighborNet, Parsimony splits, etc.)
true phylogeny. However, this method is often incorpo-

rated to generate outputs of sequence comparisons, such
as BLAST results, or genotyping data.
2. Cladistics-based methods:
(a) Cladistics-based methods infer tree topologies and attempt
to identify groups that share common ancestors
(monophyletic).
(b) Maximum parsimony is the most common method. It
selects trees with the shortest paths (i.e., the minimum
number of mutations required to produce the tree from
the dataset). It can, thus, generate several trees of equal
length. It is a character-based method, and it does not ask
for a mutation model. As such, it is very sensitive to long
branch attraction and other distortions in relation to the
true phylogeny. Because it is character based, it can be
used to identify diagnostic characters for selected
branches. However, it only uses parsimony informative
sites (site with at least two states, each of which occurs in
at least one sequence).
(c) Are slow because all possible trees are examined, particu-
larly for data sets with a large number of sequences. It is
possible to use algorithms to select subsets of trees and
accelerate the process.
3. Probability-based methods.
(a) The tree that best fits the data, based on a given mutation
model, is chosen from all possible trees and given a prob-
ability score, which can be compared with the best fitting

tree given other mutation models. It considers topology
and branch length.
(b) These are slow methods, as they conduct intensive searches
of possible trees, particularly for datasets with a large num-
ber of sequences. It, thus, require high computational
power and time.
(c) They provide an intrinsic measure of tree reliability (unlike
distance methods) and take into account all sites in the
sequence (unlike distance and parsimony methods).
(d) It is possible to use tree selection algorithms to accelerate
the process, as for maximum parsimony. Care should be
taken because such algorithms can lead to the best tree
being missed.
(e)
The statistics and model parameters should be
understood.
(f) The most used methods are Maximum Likelihood and
Bayesian inference.
(g)
Maximum Likelihood calculates the probability (likeli-
hood) of each tree being produced from the data, accord-
ing to the chosen mutation model.
(h) Bayesian inference methods have been increasingly used,
particularly since the application of Markov Chain Monte
Carlo methods. They compare prior beliefs with the prob-
ability and calculate a posterior probability, which takes
into account uncertainty. It can incorporate complex
models of evolution, which is both an advantage and dis-
advantage, as it can be difficult to use and choice of param-
eters can affect results. An accessible recent review can be
found in Nascimento et al. [118].
3.7.2 Choice of Mutation 1. Some methods for phylogenetic inference require a mutation
Model for Distance-Based model (see Subheading 3.7.1), either to calculate distances or
and Model-Based Methods probabilities.
2. No underlying model: either by counting the number of dif-
ferences between sequences, or calculating p (percentage of
differences)
3. Mutation models may incorporate different aspects, such as:
(a) Substitution rate.
(b) Transition (A<->G, i.e., from purine to purine, or C<->T,
i.e., from pyrimidine to pyrimidine) and transversions
(from purine to pyrimidine or vice versa) rates and the
transition/transversion rate (it is usually close to 2 in most
biological systems, although it would be expected to be ½
if mutations were random).
(c) Base frequency.

(d) Different mutation rates between sites (e.g., second codon
positions, which are always nonsynonymous, tend to be
more conserved than third codon positions, which are
often synonymous).
(e) G+C content bias (the Leishmania genome is GC rich).
4. It is highly advisable that the best mutation models for a given
dataset are selected, applied and compared. Some phyloge-
netic programs, such as MEGA X [119] and the most recent
previous versions, offer this option.
5. Most parameters can be estimated from the data.
6. Different models should be compared when doing a phyloge-
netic analysis.
3.7.3 Programs 1. This is often a personal choice that may depend on operating
for Phylogenetics system (Windows, Macintosh, or other), knowledge of code
language, availability of funds, requirements for analysis, etc.
Most programs currently offer a Windows version, but some
require a Command Prompt for use.
2. In practice, most researchers use different packages for different
types of analyses (Table 8).
3. MEGA X [119] and previous versions, are often used, at least
for preliminary analysis of data, despite many earlier critics.
The latest versions have become more sophisticated and flexi-
ble regarding choice of models and parameters. It is very user
friendly, although it can sometimes be difficult to find and
interpret the methods from the Help menu. It is Menu based,
with easy to follow menus, and it accepts input data files in
different formats, including FASTA.
4. PHYLIP [132] is one of the earliest phylogenetic programs. It
requires a command prompt and processes are separated into
different packages, requiring different file names, which can
become burdensome and confusing. It can be used to gener-
ate distance files from nonsequence data, as well as handling
fragment data generated by methods such as RFLP, AFLP,
RAPD, and similar. Data files must be in PHYLIP format.
5. PAUP* [133] has often been the package of choice for maxi-
mum parsimony, but it requires purchase. Input files should
be in NEXUS format.
6. BEAST [134] requires an initial NEXUS format, which is used
to produce a specific XML file, and interaction is via a com-
mand prompt window.
7. MrBayes [135] also uses a command prompt window and
input NEXUS files in nonstandard format, which must be
checked in the Manual.
8. SplitsTree [129] is mostly used to generate phylogenetic net-

works (see Subheading 3.9), but it also produces trees using dis-
tance, parsimony and maximum likelihood methods. It accepts
different input file formats, including FASTA.
3.7.4 Testing Tree 1. As seen above (Subheading 3.7.1) some methods do not
Reliability—Bootstrap Test incorporate intrinsic measures of confidence in the tree
obtained. In any case, even in a robust tree, it should be esti-
mated how the data affect tree topology and estimate reliabil-
ity of individual branches.
2. The bootstrap test is the most widely used method to estimate
confidence in the tree, and in specific branches.
3. It may be calculated automatically in some programs (e.g.,
MEGA) or separately (e.g., PHYLIP).
4. It is based on resampling with replacement of the original
data, and it is nonparametric. It produces a tree for each of a
set of resampled datasets, gives the percentage of times each
group in the original tree is present in the new set of trees.
5. Number of resampled datasets: the minimum number should
be 100, but the highest possible number should be chosen
according to computational power and available time, ideally
between 1000 and 10,000.
6. Interpretation: it is similar to standard statistical confidence,
but it is more conservative. So, ideally, bootstrap support
should be above 95% to be considered a very reliable group.
In most cases, however, good support can be considered down
to 80%. Groups with lower than 75% support should not be
considered robust in any way.
3.8 Molecular Clock 1. The concept of a molecular clock allows to date events (nodes)
along a phylogenetic tree and to determine the earliest com-
mon ancestor (root).
2. It implies that the mutation rate is the same across all branches
of the tree, and, therefore, all tips of the tree should be at the
same distance from the root.
3.8.1 Testing Conformity 1. Algorithms for tree construction, such as UPGMA, imply a
of the Tree with a molecular clock, and should only be used if the data conforms
Molecular Clock to a molecular clock, or the tree topology could be distorted,
sometimes significantly.
2. Programs such as MEGAX [119] and previous versions allow to
test the overall topology of the tree (Maximum likelihood test)
or pairs of sequences in relation to an outgroup (Tajima’s
relative rate test [136]).
3. An overall test will provide an indication of whether the tree
conforms to a molecular clock, and can be used as a first
screening tool.
4. Relative rate tests, such as Tajima’s, can be used to detect

which sequences are outliers, that is, do not conform to a
molecular clock.
5. If only a few sequences are responsible for nonconformity, then
they can be removed from the analysis, if they are not essential.
6. Alternatively, more complex models of evolution, that take
into account different mutation rates in different lineages,
can be tested and applied to improve conformity with a
molecular clock.
3.8.2 Molecular Clock 1. Calibration of a molecular clock can be achieved in two main
Calibration ways: mutation rate or through known events.
2. Mutation rate.
(a) Mutation rates can be estimated from long-term cultures of
clones of Leishmania, or long-term passages in animal
models, by comparing sequences or markers in the original
clone with recovered cultures (direct mutation rate) or
comparing sequences in recovered cultures of different lin-
eages originating from the same clone (2× mutation rate).
(b) The time to branch nodes can then be extrapolated by
comparing the experimental mutation rate with the num-
ber of mutations along the branches leading to a node
(ancestor).
3. Known events.
(a)
Events, such as known introduction in a nonendemic
region, or physical separation within an endemic region,
or even association with new hosts, can be mapped to tree
nodes.
(b) The number of mutations to those nodes is divided by the
known time to give an overall mutation rate that can then
be applied to date all nodes in the tree.
(c) Examples of known events:
•• ithin kinetoplastids, separation between Africa and
W
South America can be used to date the separation
between Trypanosoma cruzi and Trypanosoma brucei
clades, which is useful for older events and phyloge-
nies at higher taxonomic levels.
•• more recent event is the introduction of L. infan-
A
tum in South America from circa 500 years ago, which
can be useful for calibration at species and population
level.
4. Care should be taken when applying the concept of a molecu-
lar clock, as mutation rates can vary with time in different lin-
eages due to different generation times, exposure to mutagens,
recombination rates, gene conversion rates, etc.
3.9 Phylogenetic 1. Most phylogenetic methods produce a single tree, or a num-

Networks ber of trees each showing only bifurcating evolution. However,
for Heterozygous or some sequences undergo recombination and some markers,
Recombinant Markers particularly nuclear or multicopy markers, may present hetero-
zygosity. The phylogenetic methods mentioned so far do not
deal well with such cases, resulting in conflicting trees when
using different models or low bootstrap values.
2. Phylogenetic networks allow visualization of such complex
relationships, by showing alternative paths of evolution.
3. Among the most used programs is SplitsTree [129], initially
developed to produce networks using Split Decomposition
[137]. SplitsTree currently includes NeighborNet (a net-
work version of Neighbor-Joining) and Parsimony Splits,
among others.
4. Programs that can produce Bayesian networks include
PhyloNet (https://bioinfocs.rice.edu/phylonet).
5. Programs for analysis of large-scale genome data include FastNet
(https://gitlab.msu.edu/liulab/FastNet.data.scripts).
6. Interpretation of phylogenetic networks is similar to that of
bifurcating trees, but with the presence of parallelograms
between some branches, that represent uncertainty of phylo-
genetic relationships, often caused by recombination between
those lineages.
4 Notes
1. Some authors are using high fidelity Taq DNA Polymerase

(especially for SNP analyses).
2. For clinical or biological material also add DMSO to the PCR
reaction to a final concentration of 2.5% (optional) (enhances
the amplification).
3. Genes evolve under different evolutionary constraints (e.g.,
SSU rDNA and gGAPDH). Most phylogenies of trypanoso-
matids are based on the SSU genes, which are multicopy genes
that evolve by concerted evolution, which includes mecha-
nisms such as gene conversion. Single copy protein coding
genes are under a different set of evolutionary constraints and
analysis of these genes is likely to complement analysis based
on SSU genes. Different gene regions may also suffer differen-
tial evolutionary constraints: functional vs nonfunctional sites,
hydrophobic vs hydrophilic regions, etc.
4. Most appropriate for studies approaching the intraspecies level
(e.g., populations or specific foci) is multilocus microsatellite
typing (MLMT). Microsatellite markers are mostly species or
species-complex specific and thus not applicable for phyloge-
netic studies.
5. Especially when working with clinical material or other bio-

logical samples prepare an inhibition control. Inhibition con-
trols are run along each clinical DNA sample to check for PCR
inhibition due to coextracted inhibitors. Inhibition controls
are prepared by adding purified L. turanica DNA (same
amount as in positive controls) AND clinical sample DNA to
the master mix. Comparisons of band intensities of positive
and inhibition control will indicate whether PCR is inhibited
or not.
6. When using many PCR samples always prepare the master mix
for one sample extra; that is, if you have ten samples, prepare
for 11 so that you have master mix in excess to meet pipetting
errors.
5 Further Resources
1. Phylogenetics—an Introduction: https://www.ebi.ac.uk/

training/online/course/introduction-phylogenetics/what-
phylogeny/aspects-phylogenies/confidence.
2. Phylogenetics resources: https://www.ncbi.nlm.nih.gov/
Class/NAWBIS/Modules/Phylogenetics/phylolast.html.
3. ExPASy: https://www.expasy.org/.
4. Phylogeny programs: http://evolution.genetics.washington.
edu/phylip/software.html.
5. Phylogenetic inference software tools: https://omictools.
com/phylogenetic-inference-category.
6. Phylogenetics program manuals (Table 8)
References
1. Dedet J-P, Pratlong F, Lanotte G, Ravel C old neglected tropical diseases. Springer,
(1999) The Parasite. Clin Dermatol 17: Cham, pp 15–30. https://doi.
261–268 org/10.1007/978-3-319-72386-0
2. Schönian G, Cupolillo E, Mauricio I (2013) 5. Lanotte G, Rioux JA, Lepart J, Maazoun R,
Molecular evolution and phylogeny of Pasteur N, Pratlong F (1984) Numerical
Leishmania. In: Ponte-Sucre A, Diaz E, cladistics of the phylogeny of the genus
Padrón-Nieves M (eds) Drug resistance in Leishmania Ross, 1903 (Kinetoplastida-
Leishmania parasites. Springer, Vienna, Trypanosomatidae). Use of enzyme charac-
pp 15–44. https://doi.org/10.1007/ teristics. C R Acad Sci III 299(19):
978-3-7091-1125-3_2 769–772
3. Akhoundi M, Kuhls K, Cannet A, Votýpka J, 6. Rioux JA, Lanotte G, Serres E, Pratlong F,
Marty P, Delaunay P, Sereno D (2016) A his- Bastien P, Perieres J (1990) Taxonomy of
torical overview of the classification, evolu- Leishmania. Use of isoenzymes. Suggestions
tion, and dispersion of Leishmania parasites for a new classification. Ann Parasitol Hum
and sandflies. PLoS Negl Trop Dis 10(3): Comp 65(3):111–125
e0004349 7. Thomaz-Soccol V, Lanotte G, Rioux JA,
4. Mauricio I (2018) Leishmania taxonomy. In: Pratlong F, Martini-Dumas A, Serres E
Bruschi F, Gradoni L (eds) The leishmaniases: (1993) Monophyletic origin of the genus
Leishmania Ross, 1903. Ann Parasitol Hum panosomatids: phylogeny versus taxonomy.
Comp 68(2):107–108 J Eukaryot Microbiol 45(3):293–297
8. Thomaz-Soccol V, Lanotte G, Rioux JA, 19. Stevens JR, Noyes HA, Dover GA, Gibson
Pratlong F, Martini-Dumas A, Serres E WC (1999) The ancient and divergent origins
(1993) Phylogenetic taxonomy of New World of the human pathogenic trypanosomes,
Leishmania. Ann Parasitol Hum Comp Trypanosoma brucei and T cruzi. Parasitology
68(2):104–106 118(Pt 1):107–116
9. Cupolillo E, Grimaldi G Jr, Momen H (1994) 20. Stevens JR, Noyes HA, Schofield CJ, Gibson
A general classification of New World W (2001) The molecular evolution of
Leishmania using numerical zymotaxonomy. Trypanosomatidae. Adv Parasitol 48:1–56
Am J Trop Med Hyg 50(3):296–311 21. Maslov DA, Podlipaev SA, Lukeš J (2001)
10. Schönian G, Kuhls K, Mauricio IL (2011) Phylogeny of the kinetoplastida: taxonomic
Molecular approaches for a better under- problems and insights into the evolution of
standing of the epidemiology and population parasitism. Mem Inst Oswaldo Cruz
genetics of Leishmania. Parasitology 138(4): 96(3):397–402
405–425 22. Merzlyak E, Yurchenko V, Kolesnikov AA,
11. Van der Auwera G, Dujardin JC (2015) Alexandrov K, Podlipaev SA, Maslov DA
Species typing in dermal leishmaniasis. Clin (2001) Diversity and phylogeny of insect try-
Microbiol Rev 28(2):265–294. https://doi. panosomatids based on small subunit rRNA
org/10.1128/cmr.00104-14 genes: polyphyly of Leptomonas and
12. Akhoundi M, Downing T, Votýpka J, Kuhls Blastocrithidia. J Eukaryot Microbiol
K, Lukeš J, Cannet A, Ravel C, Marty P, 48(2):161–169
Delaunay P, Kasbari M, Granouillac B, 23. Hamilton PB, Stevens JR, Gaunt MW, Gidley
Gradoni L, Sereno D (2017) Leishmania J, Gibson WC (2004) Trypanosomes are
infections: molecular targets and diagnosis. monophyletic: evidence from genes for glyc-
Mol Aspects Med 57:1–29 eraldehyde phosphate dehydrogenase and
13. Espinosa OA, Serrano MG, Camargo EP, small subunit ribosomal RNA. Int J Parasitol
Teixeira MM, Shaw JJ (2018) An appraisal of 34(12):1393–1404. https://doi.
the taxonomy and nomenclature of trypanoso- org/10.1016/j.ijpara.2004.08.011
matids presently classified as Leishmania and 24. Moreira D, Lopez-Garcia P, Vickerman K
Endotrypanum. Parasitology 145(4):430–442. (2004) An updated view of kinetoplastid phy-
https://doi.org/10.1017/s00311820 logeny using environmental sequences and a
16002092 closer outgroup: proposal for a new classifica-
14. Maslov DA, Lukeš J, Jirků M, Simpson L tion of the class Kinetoplastea. Int J Syst Evol
(1996) Phylogeny of trypanosomes as inferred Microbiol 54(Pt 5):1861–1875. https://doi.
from the small and large subunit rRNAs: org/10.1099/ijs.0.63081-0
implications for the evolution of parasitism in 25. Simpson AG, Stevens JR, Lukeš J (2006) The
the trypanosomatid protozoa. Mol Biochem evolution and diversity of kinetoplastid flagel-
Parasitol 75(2):197–205 lates. Trends Parasitol 22(4):168–174.
15. Noyes HA, Camps AP, Chance ML (1996) https://doi.org/10.1016/j.pt.2006.02.006
Leishmania herreri (Kinetoplastida; 26. Guan W, Cao DP, Sun K, Xu JN, Zhang JR,
Trypanosomatidae) is more closely related to Chen DL, Chen JP (2012) Phylogenic analy-
Endotrypanum (Kinetoplastida; sis of Chinese Leishmania isolates based on
Trypanosomatidae) than to Leishmania. Mol small subunit ribosomal RNA (SSU rRNA)
Biochem Parasitol 80(1):119–123 and 7 spliced leader RNA (7SL RNA). Acta
16. Noyes HA, Arana BA, Chance ML, Maingon Parasitol 57(2):101–113. https://doi.
R (1997) The Leishmania hertigi org/10.2478/s11686-012-0022-9
(Kinetoplastida; Trypanosomatidae) complex 27. Leelayoova S, Siripattanapipong S, Hitakarun
and the lizard Leishmania: their classification A, Kato H, Tan-ariya P, Siriyasatien P,
and evidence for a neotropical origin of the Osatakul S, Mungthin M (2013) Multilocus
Leishmania-Endotrypanum clade. J Eukaryot characterization and phylogenetic analysis of
Microbiol 44(5):511–517 Leishmania siamensis isolated from autoch-
17. Lukeš J, Jirků M, Dolezel D, Kral'ová I, Hollar thonous visceral leishmaniasis cases, southern
L, Maslov DA (1997) Analysis of ribosomal Thailand. BMC Microbiol 13:60. https://
RNA genes suggests that trypanosomes are doi.org/10.1186/1471-2180-13-60
monophyletic. J Mol Evol 44(5):521–527 28. Marcili A, Speranca MA, da Costa AP, Madeira
18. Hollar L, Lukeš J, Maslov DA (1998) Mde F, Soares HS, Sanches Cde O, Acosta Ida
Monophyly of endosymbiont containing try- C, Girotto A, Minervino AH, Horta MC, Shaw
JJ, Gennari SM (2014) Phylogenetic relation- Congress on Leishmaniasis, 13–17 May,

ships of Leishmania species based on trypanoso- Abstract P694, Porto de Galinhas,
matid barcode (SSU rDNA) and gGAPDH Pernambuco, Brazil
genes: Taxonomic revision of Leishmania (L.) 37. Croan D, Ellis J (1996) Phylogenetic rela-
infantum chagasi in South America. Infect tionships between Leishmania, Viannia and
Genet Evol 25:44–51. https://doi. Sauroleishmania inferred from comparison of
org/10.1016/j.meegid.2014.04.001 a variable domain within the RNA polymerase
29. Lukeš J, Skalicky T, Tyc J, Votýpka J, II largest subunit gene. Mol Biochem Parasitol
Yurchenko V (2014) Evolution of parasitism 79(1):97–102
in kinetoplastid flagellates. Mol Biochem 38. Dougall AM, Alexander B, Holt DC, Harris
Parasitol 195(2):115–122. https://doi. T, Sultan AH, Bates PA, Rose K, Walton SF
org/10.1016/j.molbiopara.2014.05.007 (2011) Evidence incriminating midges
30. Yurchenko VY, Lukeš J, Jirků M, Zeledon R, (Diptera: Ceratopogonidae) as potential vec-
Maslov DA (2006) Leptomonas costaricensis tors of Leishmania in Australia. Int J Parasitol
sp. n. (Kinetoplastea: Trypanosomatidae), a 41(5):571–579. https://doi.org/10.1016/j.
member of the novel phylogenetic group of ijpara.2010.12.008
insect trypanosomatids closely related to the 39. Pothirat T, Tantiworawit A, Chaiwarith R,
genus Leishmania. Parasitology 133(Pt Jariyapan N, Wannasan A, Siriyasatien P,
5):537–546. https://doi.org/10.1017/ Supparatpinyo K, Bates MD, Kwakye-Nuako
s0031182006000746 G, Bates PA (2014) First isolation of
31. Yurchenko V, Lukeš J, Xu X, Maslov DA Leishmania from Northern Thailand: case
(2006) An integrated morphological and report, identification as Leishmania marti-
molecular approach to a new species descrip- niquensis and phylogenetic position within
tion in the Trypanosomatidae: the case of the Leishmania enriettii complex. PLoS Negl
Leptomonas podlipaevi n. sp., a parasite of Boisea Trop Dis 8(12):e3339. https://doi.
rubrolineata (Hemiptera: Rhopalidae). org/10.1371/journal.pntd.0003339
J Eukaryot Microbiol 53(2):103–111. https:// 40. Kwakye-Nuako G, Mosore MT, Duplessis C,
doi.org/10.1111/j.1550-7408.2005.00078.x Bates MD, Puplampu N, Mensah-Attipoe I,
32. Svobodová M, Zídková L, Čepička I, Oborník Desewu K, Afegbe G, Asmah RH, Jamjoom
M, Lukeš J, Votýpka J (2007) Sergeia podli- MB, Ayeh-Kumi PF, Boakye DA, Bates PA
paevi gen. nov., sp. nov. (Trypanosomatidae, (2015) First isolation of a new species of
Kinetoplastida), a parasite of biting midges Leishmania responsible for human cutaneous
(Ceratopogonidae, Diptera). Int J Syst Evol leishmaniasis in Ghana and classification in
Microbiol 57(Pt 2):423–432. https://doi. the Leishmania enriettii complex. Int
org/10.1099/ijs.0.64557-0 J Parasitol 45(11):679–684. https://doi.
33. van Eys GJ, Schoone GJ, Kroon NC, Ebeling org/10.1016/j.ijpara.2015.05.001
SB (1992) Sequence analysis of small subunit 41. Waki K, Dutta S, Ray D, Kolli BK, Akman L,
ribosomal RNA genes and its use for detec- Kawazu S, Lin CP, Chang KP (2007)
tion and identification of Leishmania para- Transmembrane molecules for phylogenetic
sites. Mol Biochem Parasitol 51(1):133–142 analyses of pathogenic protists: Leishmania-
34. Noyes H, Pratlong F, Chance M, Ellis J, specific informative sites in hydrophilic loops
Lanotte G, Dedet JP (2002) A previously of trans- endoplasmic reticulum
unclassified trypanosomatid responsible for N-acetylglucosamine-1-phosphate transfer-
human cutaneous lesions in Martinique ase. Eukaryot Cell 6(2):198–210. https://
(French West Indies) is the most divergent doi.org/10.1128/ec.00282-06
member of the genus Leishmania ss. 42. Luyo-Acero GE, Uezato H, Oshiro M, Takei
Parasitology 124(Pt 1):17–24 K, Kariya K, Katakura K, Gomez-Landires E,
35. Croan DG, Morrison DA, Ellis JT (1997) Hashiguchi Y, Nonaka S (2004) Sequence
Evolution of the genus Leishmania revealed variation of the cytochrome b gene of various
by comparison of DNA and RNA polymerase human infecting members of the genus
gene sequences. Mol Biochem Parasitol Leishmania and their phylogeny. Parasitology
89(2):149–159 128(Pt 5):483–491
36. Kuhls K, Sinning D, Rauhut F, Köhler K, 43. Kato H, Uezato H, Gomez EA, Terayama Y,
Litzke LF, Schönian G (2013) Leishmania Calvopina M, Iwata H, Hashiguchi Y (2007)
siamensis as the cause of autochthonous cuta- Establishment of a mass screening method of
neous leishmaniasis of horses in Germany–a sandfly vectors for Leishmania infection by
new emerging zoonotic disease? Paper pre- molecular biological methods. Am J Trop
sented at the In: Abstracts book–5th World Med Hyg 77(2):324–329
44. Foulet F, Botterel F, Buffet P, Morizot G, 53. Van der Auwera G, Ravel C, Verweij JJ, Bart
Rivollet D, Deniau M, Pratlong F, Costa JM, A, Schönian G, Felger I (2014) Evaluation of
Bretagne S (2007) Detection and identifica- four single-locus markers for Leishmania spe-
tion of Leishmania species from clinical speci- cies discrimination by sequencing. J Clin
mens by using a real-time PCR assay and Microbiol 52(4):1098–1104. https://doi.
sequencing of the cytochrome B gene. J Clin org/10.1128/jcm.02936-13
Microbiol 45(7):2110–2115. https://doi. 54. Podlipaev SA, Sturm NR, Fiala I, Fernandes
org/10.1128/jcm.02555-06 O, Westenberger SJ, Dollet M, Campbell DA,
45. Asato Y, Oshiro M, Myint CK, Yamamoto Y, Lukeš J (2004) Diversity of insect trypanoso-
Kato H, Marco JD, Mimori T, Gomez EA, matids assessed from the spliced leader RNA
Hashiguchi Y, Uezato H (2009) Phylogenic and 5S rRNA genes and intergenic regions.
analysis of the genus Leishmania by cyto- J Eukaryot Microbiol 51(3):283–290
chrome b gene sequencing. Exp Parasitol 55. Marfurt J, Nasereddin A, Niederwieser I, Jaffe
121(4):352–361. https://doi.org/10.1016/ CL, Beck HP, Felger I (2003) Identification
j.exppara.2008.12.013 and differentiation of Leishmania species in
46. Yang BB, Chen DL, Chen JP, Liao L, Hu XS, clinical samples by PCR amplification of the
Xu JN (2013) Analysis of kinetoplast cyto- miniexon sequence and subsequent restriction
chrome b gene of 16 Leishmania isolates from fragment length polymorphism analysis. J Clin
different foci of China: different species of Microbiol 41(7):3147–3153
Leishmania in China and their phylogenetic 56. Mauricio IL, Stothard JR, Miles MA (2004)
inference. Parasit Vectors 6:32. https://doi. Leishmania donovani complex: genotyping
org/10.1186/1756-3305-6-32 with the ribosomal internal transcribed spacer
47. Lopes EG, Geraldo Junior CA, Marcili A, and the mini-exon. Parasitology 128(Pt
Silva RD, Keid LB, Oliveira TM, Soares RM 3):263–267
(2016) Performance of conventional PCRs 57. Votýpka J, Maslov DA, Yurchenko V, Jirků M,
based on primers directed to nuclear and Kment P, Lun ZR, Lukeš J (2010) Probing
mitochondrial genes for the detection and into the diversity of trypanosomatid flagel-
identification of Leishmania spp. Rev Inst lates parasitizing insect hosts in South-West
Med Trop Sao Paulo 58:41. https://doi. China reveals both endemism and global dis-
org/10.1590/s1678-9946201658041 persal. Mol Phylogenet Evol 54(1):243–253.
48. Leelayoova S, Siripattanapipong S, Manomat https://doi.org/10.1016/j.
J, Piyaraj P, Tan-Ariya P, Bualert L, Mungthin ympev.2009.10.014
M (2017) Leishmaniasis in Thailand: a review 58. Roelfsema JH, Nozari N, Herremans T,
of causative agents and situations. Am J Trop Kortbeek LM, Pinelli E (2011) Evaluation and
Med Hyg 96(3):534–542. https://doi. improvement of two PCR targets in molecular
org/10.4269/ajtmh.16-0604 typing of clinical samples of Leishmania
49. Ibrahim ME, Barker DC (2001) The origin patients. Exp Parasitol 127(1):36–41. https://
and evolution of the Leishmania donovani doi.org/10.1016/j.exppara.2010.06.024
complex as inferred from a mitochondrial 59. Fraga J, Montalvo AM, Van der Auwera G,
cytochrome oxidase II gene sequence. Infect Maes I, Dujardin JC, Requena JM (2013)
Genet Evol 1(1):61–68 Evolution and species discrimination according
50. Cao DP, Guo XG, Chen DL, Chen JP (2011) to the Leishmania heat-shock protein 20 gene.
Species delimitation and phylogenetic rela- Infect Genet Evol 18:229–237. https://doi.
tionships of Chinese Leishmania isolates org/10.1016/j.meegid.2013.05.020
reexamined using kinetoplast cytochrome 60. Garcia L, Kindt A, Bermudez H, Llanos-
oxidase II gene sequences. Parasitol Res Cuentas A, De Doncker S, Arevalo J, Wilber
109(1):163–173. https://doi.org/ Quispe Tintaya K, Dujardin JC (2004)
10.1007/s00436-010-2239-6 Culture-independent species typing of neo-
51. Zelazny AM, Fedorko DP, Li L, Neva FA, tropical Leishmania for clinical validation of
Fischer SH (2005) Evaluation of 7SL RNA a PCR-based assay targeting heat shock pro-
gene sequences for the identification of tein 70 genes. J Clin Microbiol
Leishmania spp. Am J Trop Med Hyg 42(5):2294–2297
72(4):415–420 61. Fraga J, Montalvo AM, De Doncker S,
52. Stevenson LG, Fedorko DP, Zelazny AM Dujardin JC, Van der Auwera G (2010)
(2010) An enhanced method for the identifica- Phylogeny of Leishmania species based on the
tion of Leishmania spp. using real-time poly- heat-shock protein 70 gene. Infect Genet
merase chain reaction and sequence analysis of Evol 10(2):238–245. https://doi.
the 7SL RNA gene region. Diagn Microbiol org/10.1016/j.meegid.2009.11.007
Infect Dis 66(4):432–435. https://doi. 62. da Silva LA, de Sousa Cdos S, da Graca GC,
org/10.1016/j.diagmicrobio.2009.11.005 Porrozzi R, Cupolillo E (2010) Sequence
analysis and PCR-RFLP profiling of the hsp70 The gp63 gene locus, a target for genetic char-
gene as a valuable tool for identifying acterization of Leishmania belonging to the
Leishmania species associated with human subgenus Viannia. Parasitology 117:1–113
leishmaniasis in Brazil. Infect Genet Evol 72. Garcia AL, Kindt A, Quispe-Tintaya KW,
10(1):77–83. https://doi.org/10.1016/j. Bermudez H, Llanos A, Arevalo J, Bañuls AL,
meegid.2009.11.001 De Doncker S, Le Ray D, Dujardin JC (2005)
63. Montalvo AM, Fraga J, Monzote L, Montano American tegumentary leishmanisis: antigene
I, De Doncker S, Dujardin JC, Van der Auwera polymorphism, taxonomy and clinical pleo-
G (2010) Heat-shock protein 70 PCR-RFLP: morphism. Inf Gen Evol 5:109–111
a universal simple tool for Leishmania species 73. Quispe-Tintaya KW, Ying X, Dedet JP, Rijal
discrimination in the New and Old World. S, De Bolle X, Dujardin JC (2004) Antigen
Parasitology 137(8):1159–1168. https://doi. genes for molecular epidemiology of leish-
org/10.1017/s0031182010000089 maniasis: polymorphism of cystein protease b
64. Odiwuor S, Veland N, Maes I, Arevalo J, and surface metalloprotease glycoprotein 63
Dujardin JC, Van der Auwera G (2012) in the Leishmania donovani complex. J Inf
Evolution of the Leishmania braziliensis spe- Dis 189:1035–1043
cies complex from amplified fragment length 74. Spanakos G, Patsoula E, Kremastinou T,
polymorphisms, and clinical implications. Saroglou G, Vakalis N (2002) Development
Infect Genet Evol 12(8):1994–2002. https:// of a PCR-based method for diagnosis of
doi.org/10.1016/j.meegid.2012.03.028 Leishmania in blood samples. Molecular and
65. Montalvo AM, Fraga J, Maes I, Dujardin JC, Cellular Probes 16: 415–420 https://doi.
Van der Auwera G (2012) Three new sensi- org/10.1006/mcpr.2002.0436
tive and specific heat-shock protein 70 PCRs 75. Fernandes O, Temeira MMG, Sturm NR,
for global Leishmania species identification. Sousa MA, Camargo EP, Degrave WM,
Eur J Clin Microbiol Infect Dis 31(7):1453– Campbell DA (1997) Miniexon gene
1461. https://doi.org/10.1007/ sequences define six groups within the genus
s10096-011-1463-z Crithidia. J Euk Microbiol 44(6):535–539
66. Van der Auwera G, Maes I, De Doncker S, 76. Fernandes O, Murthy VK, Kurath U, Degrave
Ravel C, Cnops L, Van Esbroeck M, Van WM, Campbell DA (1994) Mini-exon gene
Gompel A, Clerinx J, Dujardin JC (2013) variation in human pathogenic Leishmania
Heat-shock protein 70 gene sequencing for species. Mol Biochem Parasitol 66: 261–271
Leishmania species typing in European tropi- 77. Akman L, Aksu HSZ, Wang RQ, Ozensoy S,
cal infectious disease clinics. Euro Surveill Ozbel Y, Alkan Z, Ozcel MA, Culha G, Ozcan
18(30):20543 K, Uzun S, Memisoglu HR, Chang KP
67. Cupolillo E, Grimaldi Jr G, Momen H, (2000) Multi-site DNA polymorphism analy-
Beverly S (1995) Intergenic region typing ses of Leishmania isolates define their geno-
(IRT): A rapid molecular approach to the types predicting clinical epidemiology of
characterization and evolution of Leishmania. Leishmaniasis in a specific region. J Eukaryot
Mol Biochem Parasitol 73:145–155 Microbiol 47(6):545–554
68. Mauricio IL, Gaunt MW, Stothard JR, Miles 78. Gonzalez-Aseguinolaza G, Taladriz S,
MA (2007) Glycoprotein 63 (gp63) genes Marquet A, Larraga V (1999) Molecular
show gene conversion and reveal the evolu- cloning, cell localization and binding affinity
tion of Old World Leishmania. Int J Parasitol to DNA replication proteins of the p36/
37(5):565–576 LACK protective antigen from Leishmania
69. Guerbouj S, Victoir K, Guizani I, Seridi N, infantum. Eur J Biochem 259:909–916.
Nuwayri-Salti N, Belkaid M, Ben Ismail R, Le 79. Davila AM, Momen H (2000) Internal-
Ray D, Dujardin JC (2001) Gp63 gene poly- transcribed-spacer (ITS) sequences used to
morphism and population structure of explore phylogenetic relationships within
Leishmania donovani complex: influence of Leishmania. Ann Trop Med Parasitol
the host selection pressure? Parasitology 94(6):651–654
122:25–35 80. El Tai NO, El Fari M, Mauricio I, Miles MA,
70. Victoir K, De Doncker S, Cabrera L, Alvarez Oskam L, El Safi SH, Presber WH, Schönian
E, Arevalo J, Llanos-Cuentas A, Le Ray D, G (2001) Leishmania donovani: intraspecific
Dujardin JC (2003) Direct identification of polymorphisms of Sudanese isolates revealed
Leishmania species in biopsies from patients by PCR-based analyses and DNA sequencing.
with American tegumentary leishmaniasis. Exp Parasitol 97(1):35–44. https://doi.
Trans R Soc Trop Med Hyg 97:80–87 org/10.1006/expr.2001.4592
71. Victoir K, Bañuls AL, Arevalo J, Lllanos- 81. Berzunza-Cruz M, Cabrera N, Crippa-Rossi
Cuentas A, Hamers R, Noël S, de Doncker S, M, Sosa Cabrera T, Perez-Montfort R, Becker
Le Ray D, Tibayrenc M, Dujardin JC (1998) I (2002) Polymorphism analysis of the inter-
nal transcribed spacer and small subunit of 90. Schönian G, Nasereddin A, Dinse N,
ribosomal RNA genes of Leishmania mexi- Schweynoch C, Schallig HD, Presber W, Jaffe
cana. Parasitol Res 88(10):918–925. https:// CL (2003) PCR diagnosis and characteriza-
doi.org/10.1007/s00436-002-0672-x tion of Leishmania in local and imported clin-
82. Kuhls K, Mauricio IL, Pratlong F, Presber W, ical samples. Diagn Microbiol Infect Dis
Schönian G (2005) Analysis of ribosomal 47(1):349–358
DNA internal transcribed spacer sequences of 91. Da Silva FM, Noyes H, Campaner M,
the Leishmania donovani complex. Microbes Junqueira AC, Coura JR, Anez N, Shaw JJ,
Infect 7(11-12):1224–1234. https://doi. Stevens JR, Teixeira MM (2004) Phylogeny,
org/10.1016/j.micinf.2005.04.009 taxonomy and grouping of Trypanosoma
83. Spanakos G, Patsoula E, Kremastinou T, rangeli isolates from man, triatomines and syl-
Saroglou G, Vakalis N (2002) Development vatic mammals from widespread geographical
of a PCR-based method for diagnosis of origin based on SSU and ITS ribosomal
Leishmania in blood samples. Molecular and sequences. Parasitology 129(Pt 5):549–561
Cellular Probes 16: 415–420 https://doi. 92. El Tai NO, Osman OF, el Fari M, Presber W,
org/10.1006/mcpr.2002.0436 Schönian G (2000) Genetic heterogeneity of
84. Spanakos G, Piperaki ET, Menounos PG, ribosomal internal transcribed spacer in clini-
Tegos N, Flemetakis A, Vakalis NC (2008) cal samples of Leishmania donovani spotted
Detection and species identification of Old on filter paper as revealed by single-strand
World Leishmania in clinical samples using a conformation polymorphisms and sequenc-
PCR-based method. Trans R Soc Trop Med ing. Trans R Soc Trop Med Hyg 94(5):
Hyg 102(1):46–53. https://doi. 575–579
org/10.1016/j.trstmh.2007.05.019 93. Croan D, Ellis J (1997) Monophyletic origin
85. Parvizi P, Ready PD (2008) Nested PCRs and of the genus Sauroleishmania. Arch
sequencing of nuclear ITS-rDNA fragments Protistenkd 148:269–275
detect three Leishmania species of gerbils in 94. Hannaert V, Opperdoes FR, Michels PA
sandflies from Iranian foci of zoonotic cutane- (1998) Comparison and evolutionary analysis
ous leishmaniasis. Trop Med Int Health of the glycosomal glyceraldehyde-
3-
13(9):1159–1171. https://doi. phosphate dehydrogenase from different
org/10.1111/j.1365-3156.2008.02121.x Kinetoplastida. J Mol Evol 47(6):728–738
86. de Almeida ME, Steurer FJ, Koru O, Herwaldt 95. Looker D, Miller LA, Elwood HJ, Stickel S,
BL, Pieniazek NJ, da Silva AJ (2011) Sogin ML (1988) Primary structure of the
Identification of Leishmania spp. by molecular Leishmania donovani small subunit ribosomal
amplification and DNA sequencing analysis of RNA coding region. Nucleic Acids Res
a fragment of rRNA internal transcribed spacer 16(14b):7198
2. J Clin Microbiol 49(9):3143–3149. 96. Mauricio IL, Yeo M, Baghaei M, Doto D,
https://doi.org/10.1128/jcm.01177-11 Pratlong F, Zemanová E, Dedet JP, Lukeš J,
87. Uliana SR, Nelson K, Beverley SM, Camargo Miles MA (2006) Towards multilocus
EP, Floeter-Winter LM (1994) Discrimination sequence typing of the Leishmania donovani
amongst Leishmania by polymerase chain complex: resolving genotypes and haplotypes
reaction and hybridization with small subunit for five polymorphic metabolic enzymes
ribosomal DNA derived oligonucleotides. (ASAT, GPI, NH1, NH2, PGD). Int
J Eukaryot Microbiol 41(4):324–330 J Parasitol 36(7):757–769. https://doi.
88. Bualert L, Charungkiattikul W, Thongsuksai P, org/10.1016/j.ijpara.2006.03.006
Mungthin M, Siripattanapipong S, 97. Herrera G, Hernandez C, Ayala MS, Florez C,
Khositnithikul R, Naaglor T, Ravel C, El Teheran AA, Ramirez JD (2017) Evaluation of
Baidouri F, Leelayoova S (2012) a multilocus sequence typing (MLST) scheme
Autochthonous disseminated dermal and vis- for Leishmania (Viannia) braziliensis and
ceral leishmaniasis in an AIDS patient, south- Leishmania (Viannia) panamensis in
ern Thailand, caused by Leishmania siamensis. Colombia. Parasit Vectors 10(1):236. https://
Am J Trop Med Hyg 86(5):821–824. https:// doi.org/10.1186/s13071-017-2175-8
doi.org/10.4269/ajtmh.2012.11-0707 98. Tsukayama P, Lucas C, Bacon DJ (2009)
89. Meredith SE, Zijlstra EE, Schoone GJ, Kroon Typing of four genetic loci discriminates
CC, van Eys GJ, Schaeffer KU, el-Hassan among closely related species of New World
AM, Lawyer PG (1993) Development and Leishmania. Int J Parasitol 39(3):355–362.
application of the polymerase chain reaction https://doi.org/10.1016/j.
for the detection and identification of ijpara.2008.08.004
Leishmania parasites in clinical material. Arch 99. Zhang CY, Lu XJ, Du XQ, Jian J, Shu L, Ma
Inst Pasteur Tunis 70(3-4):419–431 Y (2013) Phylogenetic and evolutionary anal-
ysis of Chinese Leishmania isolates based on KW, Jirků M, Chocholová E, Haralambous C,

multilocus sequence typing. PLoS One Pratlong F, Oborník M, Horák A, Ayala FJ,
8(4):e63124. https://doi.org/10.1371/ Miles MA (2007) Evolutionary and geo-
journal.pone.0063124 graphical history of the Leishmania donovani
100. Boité MC, Mauricio IL, Miles MA, Cupolillo complex with a revision of current taxonomy.
E (2012) New insights on taxonomy, phylog- Proc Natl Acad Sci U S A 104(22):
eny and population genetics of Leishmania 9375–9380
(Viannia) parasites based on multilocus 108. Miles MA, Llewellyn MS, Lewis MD, Yeo M,
sequence analysis. PLoS Negl Trop Dis Baleela R, Fitzpatrick S, Gaunt MW,
6(11):e1888. https://doi.org/10.1371/ Mauricio IL (2009) The molecular epidemi-
journal.pntd.0001888 ology and phylogeography of Trypanosoma
101. Marlow MA, Boité MC, Ferreira GE, Steindel cruzi and parallel research on Leishmania:
M, Cupolillo E (2014) Multilocus sequence looking back and to the future. Parasitology
analysis for Leishmania braziliensis outbreak 136(12):1509–1528. https://doi.
investigation. PLoS Negl Trop Dis org/10.1017/s0031182009990977
8(2):e2695. https://doi.org/10.1371/jour- 109.
Downing T, Stark O, Vanaerschot M,
nal.pntd.0002695 Imamura H, Sanders M, Decuypere S, de
102. Zemanová E, Jirků M, Mauricio IL, Horák A, Doncker S, Maes I, Rijal S, Sundar S, Dujardin
Miles MA, Lukeš J (2007) The Leishmania JC, Berriman M, Schönian G (2012)
donovani complex: genotypes of five meta- Genome-wide SNP and microsatellite varia-
bolic enzymes (ICD, ME, MPI, G6PDH, and tion illuminate population-level epidemiology
FH), new targets for multilocus sequence typ- in the Leishmania donovani species complex.
ing. Int J Parasitol 37(2):149–160. https:// Infect Genet Evol 12(1):149–159. https://
doi.org/10.1016/j.ijpara.2006.08.008 doi.org/10.1016/j.meegid.2011.11.005
103. Marco JD, Barroso PA, Locatelli FM, Cajal 110. Imamura H, Downing T, Van den Broeck F,
SP, Hoyos CL, Nevot MC, Lauthier JJ, Sanders MJ, Rijal S, Sundar S, Mannaert A,
Tomasini N, Juarez M, Estevez JO, Korenaga Vanaerschot M, Berg M, De Muylder G,
M, Nasser JR, Hashiguchi Y, Ruybal P (2015) Dumetz F, Cuypers B, Maes I, Domagalska
Multilocus sequence typing approach for a M, Decuypere S, Rai K, Uranw S, Bhattarai
broader range of species of Leishmania genus: NR, Khanal B, Prajapati VK, Sharma S, Stark
describing parasite diversity in Argentina. O, Schönian G, De Koning HP, Settimo L,
Infect Genet Evol 30:308–317. https://doi. Vanhollebeke B, Roy S, Ostyn B, Boelaert M,
org/10.1016/j.meegid.2014.12.031 Maes L, Berriman M, Dujardin JC, Cotton JA
104. El Baidouri F, Diancourt L, Berry V, Chevenet (2016) Evolutionary genomics of epidemic
F, Pratlong F, Marty P, Ravel C (2013) visceral leishmaniasis in the Indian subconti-
Genetic structure and evolution of the nent. eLife 5. https://doi.org/10.7554/
Leishmania genus in Africa and Eurasia: what eLife.12613
does MLSA tell us. PLoS Negl Trop Dis 111. Harkins KM, Schwartz RS, Cartwright RA,
7(6):e2255. https://doi.org/10.1371/jour- Stone AC (2016) Phylogenomic reconstruc-
nal.pntd.0002255 tion supports supercontinent origins for
105. Chaara D, Ravel C, Bañuls A, Haouas N,
Leishmania. Infect Genet Evol 38:101–109.
Lami P, Talignani L, El Baidouri F, Jaouadi https://doi.org/10.1016/j.
K, Harrat Z, Dedet JP, Babba H, Pratlong F meegid.2015.11.030
(2015) Evolutionary history of Leishmania 112. Lukeš J, Butenko A, Hashimi H, Maslov DA,
killicki (synonymous Leishmania tropica) and Votýpka J, Yurchenko V (2018)
taxonomic implications. Parasit Vectors Trypanosomatids are much more than just
8:198. https://doi.org/10.1186/s13071- trypanosomes: clues from the expanded fam-
015-0821-6 ily tree. Trends Parasitol. https://doi.
106.
Shaw J, Pratlong F, Floeter-Winter L, org/10.1016/j.pt.2018.03.002
Ishikawa E, El Baidouri F, Ravel C, Dedet JP 113. Villinski JT, Klena JD, Abbassy M, Hoel DF,
(2015) Characterization of Leishmania Puplampu N, Mechta S, Boakye D, Raczniak
(Leishmania) waltoni n.sp. (Kinetoplastida: G (2008) Evidence for a new species of
Trypanosomatidae), the parasite responsible Leishmania associated with a focal disease out-
for diffuse cutaneous leishmaniasis in the break in Ghana. Diagn Microbiol Infect Dis
Dominican Republic. Am J Trop Med Hyg 60(3):323–327. https://doi.org/10.1016/j.
93(3):552–558. https://doi.org/10.4269/ diagmicrobio.2007.09.013
ajtmh.14-0774 114. Stevens JR, Gibson WC (1999) The evolu-
107. Lukeš J, Mauricio IL, Schönian G, Dujardin tion of pathogenic trypanosomes. Cad Saude
JC, Soteriadou K, Dedet JP, Kuhls K, Tintaya Publica 15(4):673–684
115. Kaufer A, Ellis J, Stark D, Barratt J (2017) 302(1):205–217. https://doi.org/10.1006/

The evolution of trypanosomatid taxonomy. jmbi.2000.4042
Parasit Vectors 10(1):287. https://doi. 126. Löytynoja A, Goldman N (2010) webPRANK:
org/10.1186/s13071-017-2204-7 a phylogeny-aware multiple sequence aligner
116. Rahbarian N, Mesgarian A, Mahmoudi Rad with interactive alignment browser. BMC
M, Hajaran H, Shahbazi F, Mesgarian Z, Bioinformatics 11(1):579. https://doi.
Taghipour N (2009) Identification of org/10.1186/1471-2105-11-579
Leishmania species isolated from human 127. Gouveia-Oliveira R, Sackett PW, Pedersen AG
cutaneous leishmaniasis using PCR method. (2007) MaxAlign: maximizing usable data in
J Res Health Sci 9(2):48–51 an alignment. BMC Bioinformatics 8(1):312.
117. Kostygov AY, Yurchenko V (2017) Revised https://doi.org/10.1186/1471-2105-8-312
classification of the subfamily Leishmaniinae 128. Hall TA (1999) {BioEdit: a user-friendly bio-
(Trypanosomatidae). Folia Parasitol 64. logical sequence alignment editor and analysis
https://doi.org/10.14411/fp.2017.020 program for Windows 95/98/NT}. In:
118. Nascimento FF, dos Reis M, Yang Z (2017) A Nucleic acids symposium series. pp. 95–98.
biologist’s guide to Bayesian phylogenetic anal- doi:citeulike-article-id:6807604
ysis. Nat Ecol Evol 1(10):1446–1454. https:// 129. Huson DH, Bryant D (2006) Application of
doi.org/10.1038/s41559-017-0280-x phylogenetic networks in evolutionary stud-
119. Kumar S, Stecher G, Li M, Knyaz C, Tamura ies. Mol Biol Evol 23(2):254–267. https://
K (2018) MEGA X: molecular evolutionary doi.org/10.1093/molbev/msj030
genetics analysis across computing platforms. 130. Kück P, Mayer C, Wägele J-W, Misof B

Mol Biol Evol 35(6):1547–1549. https:// (2012) Long branch effects distort maximum
doi.org/10.1093/molbev/msy096 likelihood phylogenies in simulations despite
120. Hamarsheh O, Presber W, Abdeen Z, Sawalha selection of the correct model. PLoS One
S, Al-Lahem A, Schönian G (2007) Genetic 7(5):e36593. https://doi.org/10.1371/
structure of Mediterranean populations of the journal.pone.0036593
sandfly Phlebotomus papatasi by mitochon- 131. Bergsten J (2005) A review of long-branch
drial cytochrome b haplotype analysis. Med attraction. Cladistics 21(2):163–163-193.
Vet Entomol 21(3):270–277. https://doi. https://doi.org/10.1111/j.1096-0031.
org/10.1111/j.1365-2915.2007.00695.x 2005.00059.x
121. Savani ES, Nunes VL, Galati EA, Castilho
132. Felsenstein J (2005) PHYLIP (Phylogeny

TM, Araujo FS, Ilha IM, Camargo MC, Inference Package) version 3.6. Distributed
D'Auria SR, Floeter-Winter LM (2005) by the author. Department of Genome
Occurrence of co-infection by Leishmania Sciences, University of Washington, Seattle
(Leishmania) chagasi and Trypanosoma 133. Swofford DL (1998) PAUP*. Phylogenetic
(Trypanozoon) evansi in a dog in the state of Analysis Using Parsimony (*and Other
Mato Grosso do Sul, Brazil. Mem Inst Methods). Version 4. Sinauer Associates,
Oswaldo Cruz 100(7):739–741. doi:/ Sunderland, Massachusetts
s0074-02762005000700011
134. Drummond AJ, Suchard MA, Xie D, Rambaut
122. Thompson JD, Higgins DG, Gibson TJ A (2012) Bayesian Phylogenetics with
(1994) CLUSTAL W: improving the sensitiv- BEAUti and the BEAST 1.7. Mol Biol Evol
ity of progressive multiple sequence alignment 29(8):1969–1973. https://doi.org/
through sequence weighting, position-specific 10.1093/molbev/mss075
gap penalties and weight matrix choice. Nucleic
Acids Res 22(22):4673–4680 135. Ronquist F, Teslenko M, van der Mark P,

Ayres DL, Darling A, Höhna S, Larget B, Liu
123.
Edgar RC (2004) MUSCLE: multiple L, Suchard MA, Huelsenbeck JP (2012)
sequence alignment with high accuracy and MrBayes 3.2: efficient bayesian phylogenetic
high throughput. Nucleic Acids Res inference and model choice across a large
32(5):1792–1797. https://doi.org/ model space. Syst Biol 61(3):539–542.
10.1093/nar/gkh340 https://doi.org/10.1093/sysbio/sys029
124. Katoh K, Misawa K, Kuma K-i, Miyata T
136. Tajima F (1993) Simple methods for testing
(2002) MAFFT: a novel method for rapid the molecular evolutionary clock hypothesis.
multiple sequence alignment based on fast Genetics 135(2):599–607
Fourier transform. Nucleic Acids Res
30(14):3059–3066 137. Bandelt H-J, Dress AWM (1992) Split decom-
position: a new and useful approach to phylo-
125. Notredame C, Higgins DG, Heringa J (2000) genetic analysis of distance data. Mol
T-coffee: a novel method for fast and accurate Phylogenet Evol 1(3):242–252. https://doi.
multiple sequence alignment. J Mol Biol org/10.1016/1055-7903(92)90021-8
Chapter 3
A Guide to Next Generation Sequence Analysis

of Leishmania Genomes
Hideo Imamura and Jean-Claude Dujardin
Abstract
Next generation sequencing (NGS) technology transformed Leishmania genome studies and became an
indispensable tool for Leishmania researchers. Recent Leishmania genomics analyses facilitated the discov-
ery of various genetic diversities including single nucleotide polymorphisms (SNPs), copy number varia-
tions (CNVs), somy variations, and structural variations in detail and provided valuable insights into the
complexity of the genome and gene regulation. Many aspects of Leishmania NGS analyses are similar to
those of related pathogens like trypanosomes. However, the analyses of Leishmania genomes face a unique
challenge because of the presence of frequent aneuploidy. This makes characterization and interpretation
of read depth and somy a key part of Leishmania NGS analyses because read depth affects the accuracy of
detection of all genetic variations. However, there are no general guidelines on how to explore and inter-
pret the impact of aneuploidy, and this has made it difficult for biologists and bioinformaticians, especially
for beginners, to perform their own analyses and interpret results across different analyses. In this guide we
discuss a wide range of topics essential for Leishmania NGS analyses, ranging from how to set up a com-
putational environment for genome analyses, to how to characterize genetic variations among Leishmania
samples, and we will particularly focus on chromosomal copy number variation and its impact on genome
analyses.
Key words Next generation sequencing, Bioinformatics, Somy variation, SNP calling, Leishmania
1 Introduction
Next generation sequencing (NGS) technologies enabled us to

study Leishmania genomes in greater detail in the past 10 years,
and NGS has become an indispensable tool in molecular and evo-
lutionary biology of the parasite [1–4]. Among the genetic varia-
tions of Leishmania such as SNPs, CNVs, aneuploidy, and structural
variations, frequent aneuploidy is one of the most striking features
and occurs frequently in cultured promastigotes [3, 5], while
disomy is more common in amastigotes [6, 7]. Aneuploidy poses
serious challenges for genetic manipulations [8], and it can compli-
cate the interpretation of phylogenetic analyses. Therefore, read
depth characterization in Leishmania sequencing is critical because
69
70 Hideo Imamura and Jean-Claude Dujardin
it affects all aspects of the NGS analyses [3–7, 9]. Many of the
common NGS guidelines and practices established for other
euploid and polyploid organisms are not particularly applicable to
genomes with frequent aneuploidy. First of all, normalization fac-
tors must be calculated separately for all individual chromosomes
to reflect aneuploidy. Second, aneuploidy is common in cloned and
noncloned cultured promastigotes regardless of their cloning sta-
tus, and the presence of different copy numbers of a given chromo-
some in cloned cells (somy mosaicism) is considered to be common
[10]. This somy mosaicism makes it difficult but critical to charac-
terize the somy values of all chromosomes. It is essential to care-
fully distinguish technical artifacts and real chromosome copy
number variations when somy mosaicism is also possible. In
Leishmania genome analyses, it is imperative to evaluate normal-
ized read depth with and without somy effects to properly attri-
bute the cause of depth changes to local copy number variations or
somy variations [3, 4, 11], and we will discuss this point in detail.
Frequent aneuploidy is one of the major differences between
Leishmania and Trypanosoma genome analyses [12, 13].
This guide mainly focuses on practical and specific computa-
tional aspects of Leishmania NGS sequencing analyses. However,
we must emphasize that proper planning and meticulous prepara-
tion are crucial, and before considering bioinformatics, we must
optimize many experimental details in genome sequencing thor-
oughly, including the experimental setup, number of samples,
number of replicates, type of DNA preparation kits, and read
length and insertion size [14, 15].
In this guide, we will concentrate on DNA genomics analyses
mainly and will also briefly discuss RNA sequencing. We will first
discuss how to set up computer environments and computational
tools for NGS analyses. Then we will discuss key sequencing pro-
cessing steps such as read mapping, reference genome evaluation,
depth characterization, and SNP and indel characterization, which
are described in a schematic diagram (Fig. 1). We describe the
details of depth analyses that are often ignored or misunderstood
since that is the key factor to understand Leishmania NGS results.
2 Before Performing Genome Sequencing
2.1 Set Up a Linux Most bioinformatic tools are developed for the Linux system.
Computer System Therefore, it is highly recommended to use either a Linux or
Linux-based system. We briefly discuss the different options below,
as well as some practical solutions for people working with a
Windows-based system.
Linux: People performing sequencing analysis regardless of
their previous backgrounds must get familiar with a Linux com-
puter system and key essential Linux commands for genome
sequence analyses. Many programs are designed for a Linux envi-
A Guide to Next Generation Sequence Analysis of Leishmania Genomes 71
2) Mapping reads to
the reference
1) Acquiring sequence reads
and a reference genome read mapping
samtools
• base quality check Picard
• masking reference SMALT
BWA alignment (sam/bam )
bowtie2
3) Evaluating mapping
4) Depth 4) SNPs/indels
evaluation identification
GATK
raw depth dr mpileup calling SNPs and indels
Freebayes
depth per chromosome dch filter SNPs
GATK
median depth of all evaluate impacts of

chromosomes dmch snpEff variants
• normalized depth dm=dr /dch
• haploid depth dH =2 dm • individual calling
• somy S=dch/ dmch • population calling
• full cell depth dF =S dH • read allele frequency
• length bias correlation • alternative allele frequency
Fig. 1 Schematic diagrams for different key sequencing steps: (1) acquiring sequence reads and a reference
genome, (2) mapping reads to the reference, (3) evaluating mapping, and (4) depth evaluation and SNPs/indels
identification. The program names are shown left to the process they work on, and some key processes and
characteristics are shown with bullet points
ronment including Mac OS, and these systems are most suitable
for sequencing analyses that generate a large amount of data.
Bio-linux: For beginners, it may be difficult to decide what
kind of programs to install, and there are specialized Linux pack-
ages designed for sequence analysis such as Bio-linux (http://envi-
ronmentalomics.org/bio-linux/). This package offers a simple
solution, but the programs in the package tend to become out-
dated quickly. Therefore, it is recommended to check their
sequencing tools and to install updated versions of these tools
individually.
Windows: In Windows, merely inspecting simple results can be
daunting, and many essential tools are not available for this envi-
ronment. Therefore, it is essential to have access to some form of
Linux computer environment. For Windows users, Linux can be
readily installed as an virtual operation system within Windows
(e.g., https://www.virtualbox.org), and recently Windows 10 has
started offering a Linux environment; thus, Windows users are
able to install many sequencing tools directly on its subsystem

without a third party software. Alternatively, we can also obtain
SSH client, a terminal interface program, for Windows to connect
to other Linux computers or to a larger supercomputing system,
and a program such as PuTTY (https://www.chiark.greenend.
org.uk/~sgtatham/putty/latest.html) is a popular simple option.
Once a Linux environment is set up, we can work through
some introductory books such as Practical Computing for
Biologists [16], which covers topics from basic Linux skills to prac-
tical programming skills for sequence analyses. We can find some of
many introductory lectures for bioinformatics online and start
learning simple but critical skills. For example, we can start learn-
ing basic computer skills by a freely available document such as
Unix & Perl Primer for Biologists (http://korflab.ucdavis.edu/
Unix_and_Perl/current.pdf), and we will be ready to handle our
sequence data.
2.2 Setting Once our computer is ready for sequence analyses, it is time to
Up Sequencing install various relevant programs, and we will list a limited number
Analysis Tools of essential general software packages that will help us to analyze
and appreciate the sequence results. There are also more alterna-
tive programs available, but we keep the list short because once we
get familiar with these tools, we will be able to obtain the addi-
tional programs we need. We will discuss some specific sequencing
tools in detail in the upcoming sections.
Software managing programs: Installing programs can be com-
plicated and time-consuming, but several specialized programs will
help to install recent sequencing tools. For example, a software man-
aging program called “Homebrew” can be installed both in Mac
(https://brew.sh) and Linux (http://linuxbrew.sh) and is a conve-
nient software managing tool to install the most recent sequencing
tools including samtools. When a software managing program can-
not update programs anymore, it is recommended to reinstall a new
Linux OS which makes bioinformatics tasks much easier.
Scripting languages and their scientific packages: Python and
Perl are popular versatile scripting languages, suitable for sequenc-
ing data including characters, numbers, and processing files.
Python has many numerical and scientific packages for sequencing
data processing. A Python package manager called anaconda
(https://www.anaconda.com) helps users to install most of Python
scientific packages including matplotlib (https://matplotlib.org),
numpy, scipy, and pandas (https://www.scipy.org) for computa-
tion and visualization with ease. Biopython (https://biopython.
org) also provides bioinformatics tools but its strength is leaning
toward structural biology. Perl is a flexible and versatile scripting
language to handle characters and complex text, and it is easy to
create our own statistical functions; however, it lacks extensive
statistical and visualization modules. The Comprehensive Perl

Archive Network (CPAN) offers various convenient modules

(https://www.cpan.org). Bioperl (https://bioperl.org) has many
useful file conversion tools.
R and gunplot: R (https://www.r-project.org) is a compre-
hensive statistical tool that offers many essential sequence tools and
bioconductor (https://www.bioconductor.org) is specialized for
genomic and sequence data analysis. Gunplot (http://www.gnu-
plot.info) is simple but versatile data visualization tool that is easy
to use and is particularly useful for initial quick data inspection for
sequence depth and allele frequency.
Sequence viewers: The Integrative Genomics Viewer (IGV) is a
powerful visualization tool for NGS data (http://software.
broadinstitute.org/software/igv/) and efficiently handles several
sequence alignment files called bam files. Artemis and Act (Artemis
Comparison Tool) are also genome browser and annotation tools
that allow for visualization of sequence features (https://www.
sanger.ac.uk/science/tools/artemis). Act is a unique convenient
tool to compare multiple samples and shows the blast similarity
between samples. Many other sequence viewers exist, but IGV and
artemis are good starters for visualizing large sequence data
efficiently.
Online NGS discussion forums: NGS technologies and bioin-
formatics tools are rapidly evolving, and well-maintained online
NGS discussion forums such as Biostars (https://www.biostars.
org) and Seqanswers (http://seqanswers.com) are popular forums
to find the most recent information and troubleshooting about
NGS analyses.
Online discussion forum and mailing list for a program: Many
commonly used NGS programs maintain their own online discus-
sion forum or mailing list, and these are good sources of up-to-
date information about the usage for these programs.
3 Sequence Analysis Steps
Leishmania sequencing analysis involves many interconnected

components, and here we classify them into four key parts for this
guide: mapping reads to a reference, evaluating a reference, char-
acterizing read depth, and identifying SNPs and indels. These key
parts are illustrated in Fig. 1, and we will refer to each component
as we walk through different sequence analysis steps.
3.1 Obtain Most of the Leishmania and Trypanosoma reference genomes can
a Reference Genome be obtained from TriTrypDB (http://tritrypdb.org/common/
and Obtain Sequence downloads/) [17]. However, other updated Leishmania refer-
Reads ence genomes are also hosted by Leishmania expression and
sequencing projects (http://leish-esp.cbm.uam.es), and an
updated Leishmania donovani LdBPK282 reference can be also
obtained from (ftp://ftp.sanger.ac.uk/pub/project/patho-

gens/Leishmania/donovani/LdBPKPAC2016beta/).
For real analyses or testing, we can start mapping the reads to a
reference if we already sequenced our own samples. Alternatively, we
can also find sequence reads using sample accession numbers
described in publications in public repositories such as EBI European
Nucleotide Archive (https://www.ebi.ac.uk/ena) or NCBI
Sequence Read Archive (https://www.ncbi.nlm.nih.gov/sra).
3.2 How to Evaluate To evaluate overall sequence quality, we need to measure various
Sequence Quality sequence features such as base quality and read depth quality. High
quality of bases, read depth, and a reference are equally critical for
the accurate sequence analyses. If the read depth fluctuation is too
high, if a reference is not assembled correctly or contains many
repetitive regions, it would affect the identification of all genetic
variations. Therefore, to thoroughly evaluate sequence quality, we
must cross-examine all aspects of the data shown in Fig. 1 as a
whole because when there are many technical artifacts, it is difficult
to identify the real genetic variations.
The quality of bases can be measured by a read base quality
control (QC) program at the beginning, but it can be more effi-
ciently measured after mapping the reads since low quality bases
would be trimmed off by an aligner or can be easily screened out
in a SNP calling process. Using alignment files, we can start evalu-
ating read depth and at the same time we can evaluate base quality,
and it is far more effective to evaluate sequence quality by inspect-
ing alignments in sequence viewers. Initial base quality control is
more essential for de novo assembly, but it is often counterproduc-
tive to assume that the initial read quality control and trimming
reads would guarantee high-quality genome sequencing results
without thoroughly examining other sequencing properties such
as the quality of read depth, mapping, and a reference. So, first, we
briefly describe how to check base quality and then describe how
to evaluate read depth and overall quality of sequence data.
Read quality check and base trimming: Read quality control
(QC) programs such as FastQC (http://www.bioinformatics.
babraham.ac.uk/projects/fastqc/) can be applied to measure vari-
ous basic read quality factors, such as base quality, overall GC con-
tent, GC content per position, duplicate level, length distribution,
and FastQC produces read quality information in an html file that
we can view in a browser (Fig. 1). Then reads can be trimmed
using a program such as trimmomatic [18] to remove bad-quality
bases [19]. If we obtain sequence reads from public short read
archive (SRA) databases, we are new to sequencing, we are testing
new methods, we are performing de novo assembly, or we are par-
ticularly interested in structural variation in detail, it is essential to
perform read quality control by a read quality evaluation program
because the quality of reads can vary significantly depending on
their DNA preparation, sequencing platform, and many other fac-

tors. If we obtain data from public data archives, the sequence
providers may not disclose a detailed information of read quality,
or it is often not easy to find such information in a public
database.
Sequence quality check after mapping: We may skip the initial
base QC and start mapping reads to a reference if we are not per-
forming de novo assembly and not analyzing repetitive regions in
detail. This will allow us to focus on detailed sequence data evalua-
tion as a whole and to screen out low quality reads and bases if nec-
essary. It is more effective to evaluate sequence quality after mapping
reads because read aligners and SNP callers perform base quality
control by themselves and can handle lower quality bases, and many
reads that produce false positive SNPs do not necessarily have lower
base quality. Many sequence providers currently already perform
their own quality control and provide an initial sequence read quality
report. But as for read depth quality, they would only provide an
expected average read depth which does not tell whether the read
depth quality is sufficient for detailed copy number variation analy-
ses. As for the handling of bases with low quality, an aligner such as
SMALT (www.sanger.ac.uk/resources/software/smalt/) can trim
off bad quality bases during its read mapping. After mapping reads,
we can examine SNPs, depth variations, and somy variations in detail
to critically test sequence quality and judge if the sequence variations
observed are real or just technical artifacts. Typical signs for unreli-
able sequence quality include higher SNP strand biases, uneven read
depth coverage, a large-scale depth fluctuation, uneven coverage
over genes and intergenic regions, and uneven chromosome copy
numbers. Higher SNP strand biases was more common in the past
but this has been improved recent years. However, irregular read
depth with higher fluctuation is still common, and it cannot be cor-
rected. This depth problem would make it hard to interpret accurate
copy number variation at gene level and to quantify read allele fre-
quency at heterozygous SNP sites, and the problem forces to lower
the resolution of base and depth analyses.
Impact of sequence library preparation on sequence analyses: In
practice, sequence library preparation comes earlier in a sequenc-
ing experiment, but we discuss it here as a potential detrimental
factor that impairs proper read depth and therefore hinders subse-
quent sequence analyses. These negative impacts cannot be
detected by the initial read quality controls but by some systematic
depth analysis. Detailed comparisons of library preparations must
be thoroughly tested [14, 15] before library selection. Now, we
will briefly address sequencing library preparation issues we have
observed. In general, the TruSeq DNA library preparation kit
without PCR amplification consistently produced higher quality
depth coverage than the Nextera XT DNA library and Nextera
DNA library preparation kit (Illumina Inc.) in our quality control
experiments where genomes of several strains were sequenced

using different protocols. Most commonly observed Nextera depth
deviations were lower or little depth in intergenic regions regard-
less of their repetitiveness. This was observed in our quality control
experiments and in Nextera reads downloaded from a previously
published L. infantum experiment. SNP calling would not be
severely affected by this for runs with their depth over 30×, but it
will reduce the resolution to detect small changes in read depth
allele frequency for samples with their depth less than 15×. For
CNV detection, TruSeq provides more reliable read depth cover-
age. The Nextera XT kit performs far better for samples with a
limited amount of DNA [13], but when there is a sufficient amount
of DNA available, it is wise to use methods that produce higher
quality results even though that might require some extra steps.
However, the TruSeq kit also can capture more kDNA than the
Nextera XT kit. We also found that DNA- and RNA-specific kits
work better than DNA and RNA dual-use kits even though dual
usage kits are more time effective for the experiments. Read depth
with high fluctuation would severely reduce the resolution to
detect copy number. Unfortunately, this excessive depth variability
is common in many studies; therefore, it is essential to test and
compare sequencing kits thoroughly.
3.3 Mapping Reads Read mapping algorithms: The first step of sequence analysis is to
map fasta read files with their base quality scores (FASTQ) to a
reference genome (Fig. 1) There are two main read mapping algo-
rithms, and we will briefly describe these two. One is based on hash
indexing and another is based on Burrows–Wheeler character
string transformation. For a hash-based alignment method, map-
ping FASTQ reads to a reference involves two steps: indexing a
reference and mapping reads to a refence. Indexing a reference
creates an indexed reference database which make a reference
genome readily accessible for quick search, instead of preforming
intensive base similarity search all over a reference database. Using
the indexed reference database, an aligner will identify optimal
matching positions in a reference by hash search and then perform
more rigorous search for best matches around these candidate
positions in the indexed reference. An alternative algorithm is
based on suffix/prefix digital trees (Burrows–Wheeler transforma-
tion) and can store genetic variations more efficiently [20–22].
The size of Leishmania reference genomes is around 32 million
bases, roughly 100 times smaller than a human genome reference,
making it possible to perform more thorough sensitive search for
alignment than the default parameters.
Read aligners SMALT, BWA, and bowtie2: For read mapping,
SMALT based on a hash algorithm, BWA [20] and bowtie2 [21],
based on Burrows–Wheeler transformation, are often used in
Leishmania sequencing studies. They are all effective aligners, and
we can select one after testing these.
SMALT has been used for various Leishmania sequencing

analyses [3, 6, 11, 23–25]. We can use SMALT v0.7.4 with the
exhaustive searching (−x) and a sequence match threshold of 80%
(−y 0.8) and a reference hash index of 11–13 bases and a sliding
steps of 2 or 3. For example, the index of 11 and the sliding step of
2 can perform more thorough hash base searching but this option
is slower than the index of 13 and the sliding step of 3. For shorter
reads like 50 or 76 bps, a hash index of 11 and a sliding step of 2
may be suitable but for long reads over 100 bps, a hash index of 13
and a sliding step of 3 are more efficient overall. The main benefit
of SMALT is that it can apply exhaustive Smith–Waterman after
initial hash word search for optimal mapping positions, that can
trim lower base quality bases, and that it can properly identify small
indels without splitting them into two locations. This feature per-
formed better than previous GATK realignment protocol which
created multiple indels for a single indel. Unfortunately, SAMLT
has not been updated often any more, but BWA or bowtie2 are
more frequently updated.
BWA-mem was used in [7, 19], and bowtie2 was also used in
many Leishmania studies [26, 27]. In many cases, their default
parameters are sufficient for Leishmania sequence analyses. bow-
tie2 automatically adjusts searching word length based on read
length and maps reads without trimming for its default parameters,
while both SAMLT and BWA-mem trim end bases, so bowtie2
might be beneficial for users who need to focus reads mapped in
full length. Many other aligners exist, but it is important to choose
properly maintained programs used by many users to get support
and suggestions. It is often advisable to avoid using the first version
of a new program since it would inevitably contain many bugs and
also avoid programs that are rarely used in sequence analyses of
Leishmania or other similar organisms.
3.4 Characterizing Two-loop depth estimation: To estimate a chromosome median

Depth: Aneuploidy depth dch, we first measure an average and standard deviation of a
raw read depth, and then for the second loop, read depth is mea-
3.4.1 Normalized
sured again at positions where the depth is within one standard
Chromosome Read Depth
deviation from a median value. This two-loop method can estimate
a proper median read-depth by removing outliers such as assembly
gaps, spurious high coverage regions, or real copy number variant
loci. Zero depth should be excluded to avoid large gaps in a chro-
mosome that would not skew depth. We defined a normalized
depth dm as a raw depth dr divided by the median depth of its chro-
mosome dch; that is, dm = dr/dch (Figs. 1 and 2a). A median value of
a normalized depth dm is used for characterizing depth variation
among different strains regardless of ploidy difference. Then hap-
loid depth can be defined as dH =2 × dm where 2 reflects that each
chromosome has two copies for disomic cells. The variation of
normalized depth dm can be approximated as SD(dm) = where SD
represents a standard deviation and the values of SD(dm) can be

used to measure the quality of depth of samples.
3.4.2 Somy We need to normalize the variation of DNA yields of sequence

runs for proper interstrain comparison, and for this we express a
median depth of all chromosome median depth dch of a strain as
dmch for interstrain depth normalization. Then somy can be written
as S = 2 × dch/dmch and full cell depth dF, which reflects ploidy dif-
ference, can be defined as dF=S × dm = 2 × dch/dmch × dm = 2 × dr/
dmch where × represents a multiplication. Note that the multiplica-
tion factor 2 was used because the most frequent base somy is
assumed to be disomic and if the base somy is trisomic, 2 must be
replaced by 3 in the formulas. Then, the range of monosomy,
disomy, trisomy, tetrasomy, and pentasomy can be defined to be
the full cell normalized chromosome depth or somy S of S < 1.5,
1.5 ≤S < 2.5, 2.5 ≤S < 3.5, 3.5 ≤ S < 4.5, and 4.5 ≤ S < 5.5, respec-
tively (Figs. 2b and 3a). Here it is possible to use an average of
average or median of all chromosome depths, but it is necessary to
use a median of average or median of all chromosome depths to
compute somy values that are closer to integers, otherwise somy
values of all chromosomes may become noninteger intermediate
values, which are not convenient for subsequent analyses. Somy
variation can be approximated as S × SD(dm) where SD represents
a standard deviation [3–5].
3.4.3 Copy Number To evaluate copy number variations at gene level, we define an
Variation average haploid depth per gene without its somy impact as d HG and
define full cell depth with its somy impact as d FG and their relation-
ship is given as d FG = S × d HG. To evaluate copy number variations,
in general, average values of haploid depth dH and full cell depth dF
in 1000 or 2000 bases windows can be used, and if the depth varia-
tion is high, then the window size must be increased. Sliding win-
dows of 200 bases were used to measure copy number variations in
Imamura 2016 [3]. This method resolved smaller scale CNVs but
it was difficult to identify CNV boundaries to find commonly
shared CNVs among the samples. Therefore, it is more practical to
use a wider window size so that the CNV shared by many strains
would have the same CNV boundaries. CNVs can become statisti-
cally significant in two ways: a statistically higher copy number and
a statistically longer CNV. The cutoff values of these statistical sig-
nificances must be defined for each sample set because these cutoffs
depend on the size of vertical depth fluctuation and the size of
horizontal depth fluctuation of each data set. The z-score can be
used to find optimal cutoffs.
We illustrated how to perform CNV analyses based on the
CNV analyses in a previous work [3]. For a CNV analysis, it is
essential to define a baseline haploid depth level using median or
average haploid depth for a number of strains. If wild type strains
A raw chromosome depth

80
70
60
50 average
40
median dmch
30
20
10
0
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36
chromosome
Median
B 4
3.5
3
2.5
somy
2
1.5
1
0.5
0
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36
chromosome
Somy
Fig. 2 Chromosome depth and somy: (a) Median chromosome depths are given in dark grey. The median
depth of all chromosome median depths dmch is suitable for somy normalization rather than the average
depth of all chromosome median depths. (b) These chromosome median depths can be converted to somy
values using dmch
and strains in vitro selected for drug resistance are compared, an

average haploid depth of wild type can be used as a baseline hap-
loid depth level [28, 29]. For CNV detection, we need to consider
CNV length along with depth because we can detect long hetero-
zygous deletions or duplications with a smaller depth deviation
better than we can detect them in similar CNVs in shorter variants.
Therefore, different depth thresholds can be used. For example, in
Imamura et al. [3], for CNVs of 2–5 kb, the threshold was five
times the standard deviation of the chromosomal depth; for CNVs
of 5–20 kb, the threshold was three times this value; for CNVs of
>20 kb, the threshold was 1.5 times this value (Fig. 3b).
3.4.4 Length Bias In somy values in some previous studies, we frequently observed
of Somy and Local Somy some somy bias associated with chromosome length for some
Normalization sequencing data. For example, we often observed the trend that
somy values of shorter chromosomes tend to be smaller in samples
sequenced by Illumina Genome Analyzer II [4, 5]. Similar skewed
somy values affected by chromosome length have been still
observed in Illumina HiSeq results [6]. However, it is clear that
these somy biases were technical artifacts because when these sam-
ples were sequenced again, none of these depth biases were
whole chromosomal duplication

A reads
somy variation depth
reference
reads
depth
reference
amplicon 15K
B
large scale deletion and duplication
duplication
reads deletion
depth
reference
linear episome up to 300K
reads
depth
reference
Fig. 3 Somy variation and local copy number variations: (a) Chromosome copy numbers are quite variable in
many chromosomes of Leishmania promastigotes. (b) Large-scale deletions and duplications are also com-
mon. Long and high copy number amplifications containing a few genes spanning about 15,000 bp and long
linear episomes spanning up to 300,000 bp have been observed in Leishmania donovani strains [3]
observed in high quality sequence runs. Unfortunately, however, it

is still common to interpret these somy trends as real biological
phenomena [5, 27], but it would be more appropriate to interpret
such length trends as technical artifacts. If they are real, it is critical
to confirm these results using different methods. Fortunately, it is
often possible to reduce this bias by applying a bias correction to
the somy estimation [6]. Instead of calculating a median depth
based on all chromosomes, we can calculate this value based on the
median values of neighboring chromosomes, whose lengths are
similar since chromosomes are numbered according to increasing
size. Thus, somy values can be calculated using a median depth
based on the median read depth of nearby 15 chromosomes: the
seven neighboring chromosomes on each side and the chromo-
some itself. When a chromosome does not have seven neighboring
chromosomes on one side, mirror-imaged values are used, so that
some depth values are used twice. This correction will not work
when trisomic and tetrasomic chromosomes are clustering together
around chromosomes of similar length, which would wrongly
suppress valid higher somy. Then it is necessary to perform local
normalization case by case, or else it may not be possible to fix this
bias when the bias is large and random.
3.4.5 Somy Estimation When the depth of samples is not sufficient or the variability of
for Sequences with Higher depth is too large, it is necessary to use other normalization fac-
Depth Variability tors, such as various percentile depths, or obtain depth from single
copy genes [30] or from nonrepetitive regions and the latter was
found to be more effective in a detailed population analysis of

Trypanosoma cruzi [31]. To characterize significant differences, it
is beneficial to use biological and statistical significance. Previously,
we used the following conditions: S-values should differ by more
than 0.5 and shift from one somy distribution range to another: for
instance, from 1.5–2.5 to 2.5–3.5. A t-test statistical value can be
calculated directly from binned depth [6] or from average depth,
standard deviation, and a number of data points [28].
3.4.6 Somy It is possible to estimate somy values from alternative read allele
and Alternative Read Allele frequency because when there are sufficient heterozygous SNPs,
Frequency read allele frequency distribution can reflect somy in most cases [5,
7]. However, read allele frequency can drastically change along a
chromosome without any somy or copy number variation [11, 13,
31, 32]; therefore, we must carefully interpret the relationship
between somy and read allele frequency.
3.4.7 Evaluating Somy When the depth of sequence is low and all the chromosomes have
Based on Binned similar read depth, we can still estimate somy from read allele fre-
Alternative Read Allele quency estimated from multiple SNP sites (e.g., 1000 SNP sites)
Frequency [13]. This method was applied to establish the evidences for viable
and stable triploid Trypanosoma congolense parasites during its life
cycle [13]. This method can be used to monitor somy variations
across different environment conditions when there are a sufficient
amount of heterozygous SNPs and sufficient DNA from the para-
sites from different stages because it requires the comparisons of
aggregated read allele frequency between different samples.
3.5 Characterizing Once alignment files (bam) are created, we can identify genetic
Base Variations variants such as single nucleotide polymorphisms and small
indels with these bam files. We describe three ways to identify
3.5.1 Individual
genetic variations. The first is an individual variant calling mode
and Population Variant
that identifies genetic variations per sample independently from
Calling Modes
any other samples, and is the simplest method [4, 11, 23, 32]. The
and Consensus Method
second is a population variant calling mode that identifies genetic
variations from multiple samples simultaneously [6, 12, 13, 28,
31]. The third is a consensus variant calling that obtains a consen-
sus of different variant calling methods, and this can be done in
individual [3, 24] or population mode or can be hybrid of both,
though these complicated cases will not be discussed here.
Individual variant calling: An individual variant calling
method is the one many people are familiar with and is commonly
used for analyzing various Leishmania samples. This method is
suitable to characterize a single sample or several unrelated samples
in detail. The advantages of this approach are its simplicity, and
SNP calling parameters can be adjusted to each sample. The main
disadvantage of this method is that it can miss a SNP whose read
allele frequency is less than 0.05 (e.g., a position with total depth
of 20, 19 reference allele bases, and 1 alternative allele base).
1
0.9
0.8
Read allele frequency

0.7
0.6
Sensitive
0.5
0.4 Resistant
0.3
0.2
0.1
0
0 3 6 12 35 49 61 74
Miltefosine (µM)
Fig. 4 Alternative allele frequency at a LdMT SNP site in a miltefosine induction

experiment: It is important to characterize transitional minor allele frequency to
monitor development of drug resistant parasite cells. Minor read allele frequency
0.0164 would have been totally ignored if an individual SNP calling was used.
The black line represents read allele frequency associated with miltefosine sen-
sitive cells and the gray line represents alternative (SNP) read allele frequency
associated with miltefosine-resistant cells. The x-axis represents miltefosine
concentrations
Therefore, it will ignore SNPs with a minor read allele frequency

unless SNP calling parameters are modified. This might be insig-
nificant in many analyses, but we will illustrate below that these
minor reads can play critical roles in many experiments (Fig. 4).
Population variant calling: A population variant calling
method is not commonly used for analyzing various Leishmania
samples. This method is suitable to characterize and compare many
samples effectively. In most cases, we perform sequence analysis to
compare multiple samples. Therefore, it is essential to characterize
genetic variations among all the samples to find out the presence or
absence of a given genetic variant across all samples at a given
position.
Comparison of individual and population calling methods: To
illustrate some advantage of a population calling over an individual
calling method, let us consider the case that, in an individual SNP
calling process, we have only a read depth of 2 for an alternative
base and a read depth of 48 for a reference base at a SNP position.
This SNP would be ignored because an alternative read allele needs
to have a higher frequency than 15% on a disomic chromosome.
However, in a population calling process such minor alternative
bases can be identified when other samples have a homozygous
SNP or clear heterozygous SNP where the alternative allele is higher
than 20–30%. Therefore, it is beneficial to apply a population SNP
calling method or a consensus SNP calling method [29]. Subtle,
consistent gradual read allele frequency changes were a key to find
a SNP critical to drug resistance in the MIL drug induction experi-
ment. An individual SNP calling could have been used in this case,
but then the method would have to have been performed multiple

times to characterize read allele frequency of all samples. This was
one of the main reasons we developed the consensus method
COCALL in order not to miss minor read allele SNPs among 206
strains [3] and among drug induction samples [29] since popula-
tion methods were still under development at that time.
SNP calling programs: Genome Analysis Toolkit (GATK) [33],
Freebayes (https://github.com/ekg/freebayes) [34], and sam-
tools mpileup [35] are popular genome variant callers and shown
in boldface in the next paragraphs (Fig. 1).
GATK comes with many versatile tools and extensive user
guides that beginners can follow and are well maintained; there-
fore, it is likely most valuable for many readers. It has many SNP
calling tools such as UnifiedGenotyper and Haplotypecaller [31].
UnifiedGenotyper has more mature population calling algorithm
while Haplotypecaller can handle a sample with many indels much
better than UnifiedGenotyper since Haplotypecaller performs local
de novo assembly for indels.
Freebayes is very sensitive but could be difficult to use since it
requires extensive post-SNP screening and deep understanding of
its parameters. It is often used by advanced users who can adjust
various parameters by themselves and users can take advantage of a
user guideline to perform postprocessing [3, 11]. If it is producing
some unexpected SNP calling results, we may need to examine its
parameters carefully. For example, a homozygous SNP can be
excluded by a single aberrant read whose mapping score is zero
because it excludes alignments from analysis if they have a mini-
mum mapping quality less than 1. Please see the parameter
--min-mapping-quality.
samtools mpileup is also popular and produces relatively fewer
false positives even though it may miss some heterozygous SNPs
with lower alternative allele frequency.
COCALL and consensus calling: In a previous analysis we used
a consensus SNP calling method, COCALL [3], which obtained a
consensus of five different SNP calling tools, samtools pileup, sam-
tools mpileup, Freebayes, GATK, and CORTEX [36], where each
tool was applied to each sample individually. We found that
COCALL outperformed all the 5 methods in an individual calling
mode and also a population calling mode of GATK, samtools
mpileup and Freebayes [3] and was particularly suitable for a set of
genetically homogenous samples like the core group of L. don-
ovani in the Indian subcontinent. However, in the last several
years, the situation has changed because the improvements in base
quality, longer read length, and genome analysis tools made SNP
callers more reliable, and the need to process larger sample num-
bers than before. Therefore, a complex consensus approach is slow
and difficult to implement and maintain, because such a method
requires extensive parameter adjustment and needs uniformity in
Characteristics of High quality SNPs

• Clean neighbouring bases (no gaps/repeats/base errors)
• Higher alternative read allele frequency
• Good mapping score (not in repeat region)
• High complexity region
2) a duplication 4) a duplication
close to a gap
1) a homopolymer 3) tandem repeats

AAAAAAA
reads AAAAAAA
AAAAAAA
reference AAATAAA
F FN FN F F
SNP F
5) a duplication
low complexity close to the end
of a chromosome
reference
unique unique tandem repeats unique
Fig. 5 Locations associated with many false positive SNPs in a reference genome: False positive SNPs were
often found in (1) low complexity regions such as homopolymers or short tandem repeat regions, (2) a dupli-
cated region where tandem repeats are truncated into a shorter unit in the reference, (3) tandem repeats
where mapping quality is zero and these SNPs may not be detected by SNP callers leading to false negative
SNPs, (4) duplications close to a gap, and (5) duplications close to the end and beginning of a chromosome.
The broad light green lines represent unique self-blast hits to themselves and the dark grey lines represent
repetitive matchings. In the figure, “SNP” indicates a real SNP. “F” indicates a false positive SNP and “FN”
indicates a false negative SNP. The left upper box highlights the characteristics of high-quality SNPs
sequence quality including read depth and base quality. A consen-

sus SNP calling is still used for evaluating a genome assembly. For
example, samtools pileup and samtools mpileup were used for the
assembly of L. naiff [24]. A consensus calling may not be suitable
for beginners who need a simple method they can follow and mod-
ify, but it would be informative to call SNPs using a few methods
to understand SNP callers and evaluate these tools to find their
strength and weakness.
3.5.2 Masking Our challenge here is to distinguish true SNPs from a flood of false
a Reference: Reference- SNPs mainly caused by a reference itself. The main characteristics of
Specific False Positives true SNPs are described in the box in Fig. 5, which include (1)
clean neighboring bases without gaps, repeats nor base errors, (2)
higher alternative read allele frequency, (3) high mapping score,
and (4) nonrepetitive high complexity regions. In contrast, we illus-
trated how a true SNP (SNP), false positive SNPs (F), and false
negative SNPs (FN) can appear in an alignment in Fig. 5. We
depicted the various features causing false SNPs in a hypothetical
reference genome including a homopolymer, a duplication, tandem
repeats, duplications close to a gap and the end of a chromosome.
Here a reference genome was self-blasted to itself, and one-to-one
unique similarity lines are shown in light green, and repetitive

multiple hits are shown in dark grey. Some regions of a genome
produce unexpectedly many false positive SNPs: lower complexity
region like homopolymer bases, misassembled repetitive regions,
bases adjacent to gaps or contig ends [3, 4], and the conserved
genome regions that are similar to contaminating host DNAs.
Characterizing a reference in detail is a fundamental step that is
often ignored by many analyses, and this is critical since true posi-
tive SNPs might be evenly distributed across a genome, but false
positive SNPs are not distributed equally. Hence, false SNPs caused
by technical biases should not be described as key biological
characteristics.
Lower complexity regions and mappability: Lower complexity
regions including homopolymers, simple repeats, or simple tan-
dem repeats can be identified by a repeat masking program tantan
[37] that can mask such regions to avoid false positives from
homologous regions. Alternatively, it is possible to characterize
proportions of a genome that can be properly mapped by reads,
using a mappability tool [38]. It is also possible to exactly calculate
k-mer uniqueness of a Leishmania reference for single and paired
reads using simple k-mer calculation [4].
Self blast matching: Higher complexity regions, which are not
homopolymers, simple repeats, or simple tandem repeats, can be
repetitive, and they can be identified by self-blasting itself using a
cutoff of 10e–20 [3]. This is an intuitive way to mask homologous
regions.
Gap and contig edges: Gaps are often located around a larger
repetitive region where the base cannot be corrected by computa-
tional base correction tool such as ICORN [4, 39]. Therefore, it is
better to exclude 100 bp adjacent to a gap and bases close to con-
tig edges for any genome analysis [24, 25].
The conserved genome regions that are similar to contaminating
host DNAs: When amastigote samples are sequenced, it is common
to have higher host DNA contaminations, and this can cause unex-
pected false positive SNPs in the Leishmania regions conserved to
host DNAs. These false positives can show up as high SNP score
heterozygous SNPs on truncated reads. These regions can be man-
ually masked out to avoid false positive SNPs.
Reference with many repetitive regions: Many Leishmania
genomes assembled using next generation sequencing technolo-
gies are relatively high quality and did not contain chromosomes
or contigs where reads cannot be mapped correctly [4, 24, 25].
Pacific Biosciences (PacBio) technology further improved
Leishmania references [6, 40]. On the other hand, for extremely
repetitive genomes, it is very difficult to estimate proper depth for
chromosome and characterize genetic variations particularly when
aneuploidy is common. For example, aneuploidy is not uncommon
in Trypanosoma cruzi, and this makes it difficult to estimate proper
read depth using a Trypanosoma cruzi reference [30].
3.5.3 Sample-Specific Read depth cutoffs: Duplicated and deleted regions can create false
Cutoffs positive SNPs for phylogenetic analysis; it is therefore common to
apply a read depth cutoff. For example, read depth cutoff-
normalized depth dm > 0.5 or dm < 2 can be used. Ideally, this
normalized depth must be defined for each chromosome in
Leishmania since somy values can vary significantly, but it is com-
mon to set a general common cutoff for all chromosomes for indi-
vidual samples or a total depth for all samples. More practically, raw
depth cutoffs can be used to simplify the computation.
SNP clusters: It is common to exclude or mark SNP clusters
where there are more than three SNPs within ten bases of each
other because these clusters are often associated with false positive
SNPs. The definition of SNP clusters, however, must be adjusted
for each data set, based on the amount of real SNP clusters.
Specifying somy: A various integer somy value can be assigned
for given chromosomes in GATK and Freebayes, which is quite
effective for polyploid plant genomes, whose ploidy is over penta-
somy. In Leishmania genomes, however, aneuploidy can often be
transient, and also intermediate somy values are quite common [3,
6]. Therefore, it is often difficult to specify proper somy values for
each chromosome in different strains without introducing unin-
tended biases. Therefore, it is normally sufficient to use a default
somy setting for SNP calling. For example, we have never observed
any SNP deficiency in chromosome 31, whose somy has been
always greater than 3 [3], nor in septasomic chromosomes we have
examined (data not shown).
3.5.4 Annotating A functional annotation program SnpEff [41] can be used to clas-
Functional Impact of SNPs sify all SNPs and indels based on their functional impact such as
and Indels frameshift, nonsynonymous, synonymous change and intergenic
mutation. SNPs and indels were compiled in a population genetic
variation vcf file. From this vcf file alternative allele and depth
information can be extracted for further analysis. Variants common
to all strains are often uninformative, and they can be excluded
from the analysis.
3.6 Screening SNPs Filtering SNPs and indels: Once SNPs and indels are identified, the
and Indels next step is to apply a variant filtering such as GATK Variant
Filtration, which evaluates many SNP quality conditions including
SNP quality per depth, SNP strand bias, root mean square of the
mapping quality and mapping quality test between reference and
alternative alleles. A caution here is that GATK is updated fre-
quently and their recommended parameters change occasionally;
therefore, it is essential to consult the GATK user guide to set
proper parameters.
SNP quality score: The next step is to test and select a SNP
score that match the sensitivity and specificity required for the
analysis. There is no universal SNP score that can be applied to any
samples since a SNP score itself depends on read depth, read base
quality, and other factors, but we will provide some values that
applied in our previous analyses.
In practice, SNP scores are given in the 6th column with the
tag QUAL in vcf files. They are expressed in terms of Phred scores
Q defined to be Q = −10 log10(P) where P is the estimated error
probability for that base-call [42]. In our data set for L. donovani,
other Leishmania and Trypanosoma species, we found that SNP
scores of 300 for GATK individual calling and 1500 for GATK
population calling are sufficient to remove most of false positive
SNPs. These values must be adjusted specifically to a given data set
because each data set can have different biases. In our previous
analyses, these values were selected after testing GATK using the
BPK282 sequence data from which the reference genome was cre-
ated. For example, in a sample set containing about 200 samples in
which dozens of samples are affected by base errors, a GATK SNP
score might be elevated to 4000 or higher in a population calling
to eliminate low-quality heterozygous false positive SNPs. In gen-
eral, a proper SNP cutoff should not change the number of SNPs
substantially when the cutoff is changed slightly such as 300–500 in
a population SNP calling of several dozen samples and 50–100 in
an individual SNP calling. If this happens, the SNP cutoff is too
low [3], and it is often safe to use the cutoff around which the
number of SNPs is stable, since the number of true positive SNPs
should not vary much depending on the cutoff. Alternatively, it is
better to remove samples producing excessive SNPs, if that is pos-
sible. During selection of a SNP cutoff, it is essential to inspect
SNPs visually in the Integrative Genomic Viewer, artemis, or sam-
tools tview to avoid false positives and mask regions that produce
excessive false positive SNPs.
3.7 Specific We have discussed the basics of sequence analyses and now we will
Sequencing Analyses further discuss more specific cases that improve sequencing analysis
methods and also explore topics that are important but less fre-
quently discussed.
3.7.1 Mapping Reference Mapping reference reads to the genome itself is a good practice to
Reads to Its Own become familiar with a reference genome and to know its potential
Reference Genome misassemblies. For example, the reference genome of L. major
to Understand Friedlin is considered the most accurate among Leishmania
the Reference genomes. However, the copy number variation analysis of various
and to Improve CNV of Leishmania genomes showed that many of the repetitive genes
Detection and SNP Calling were often concatenated, resulting in their higher copy numbers
Methods [5, 40]. Therefore, mapping reference reads to itself is excellent
way to calibrate and improve our own CNV detection and SNP
calling methods. Higher depth in a gene of a reference indicates
that some sections were truncated in the reference while lower
depth around a repetitive region indicated that the region was
overextended in the assembly process and this was observed in ref-
erences assembled by PacBio SMRT Sequencing [6, 31].
3.7.2 Optimizing SNP Optimizing SNP calling can be done by using simulated reads but
Calling Using Artificial it is more relevant to optimize the method by using alignments of
Mixtures of Two Samples an artificial mixtures of two samples, which have sufficient amount
of homozygous SNP differences. The main weakness of the simu-
lated reads is that these reads are too clean and too easy to train our
methods because real samples produce nearly intractable SNPs that
simulated reads cannot simply emulate. If we do not have two
clean samples to train our SNP calling method, it might be infor-
mative to optimize our SNP calling using the dataset which is
already published. For example, the data for in vitro selection of
miltefosine resistance in promastigotes of Leishmania donovani
from Nepal [29] may be used. These samples do not contain more
than 200 homozygous and heterozygous SNPs and BPK282 lines
are closely related to the reference BPK282 strain. Therefore, they
are an ideal data set to calibrate SNP calling. To refine SNP calling
parameters further, the alignment files of BPK282s and BPK275s,
which belong to a different genotype, can be mixed at certain pro-
portions using “samtools view -s” command. We are able to test
sensitivity and specificity of the method based on artificially mixed
simulated data set based on the real alignments because BPK275
lines have their own unique mainly homozygous SNPs. By using
these data sets, we will notice that some regions would produce
disproportionally many SNPs because of their repetitiveness or
some unknown factors and these regions must be masked for fur-
ther SNP analyses [3].
3.7.3 Genetic Variation Sequencing samples to identify genetic variations that can explain
Detection Among Samples specific phenotypes is common. One of the most common analyses
with Different Phenotypes is comparing between a drug-sensitive line and an induced drug-
Including Drug Induction resistant line. In this case, it is essential to identify any genetic
Experiments variations located in coding regions or even noncoding regions.
Further, we must not discard but explore base variations that over-
lap with local copy number variations since it is known that some
specific gene like L. donovani miltefosine transporter (LdMT) and
aquaglyceroporin 1 (AQP1) can contain partial or full deletions,
SNPs, or indels simultaneously in cells [3]. In drug induction
experiments, it is essential to the monitor allele frequency changes
at various intermediate stages to identify SNPs critical to drug resis-
tance. Here applying a population calling method among sensitive,
intermediate, and resistant lines will help to identify critical genetic
variations because it provides all allele frequency information at a
position where at least one high score SNP is present. For example,
in the previously mentioned miltefosine drug resistance induction
experiment [29], the critical SNP at LdMT was not detected at the
beginning of the induction experiment, but the SNP allele gradu-
ally increased and reached up to 100% in fully miltefosine-resistant
parasites (Fig. 4). To monitor this type of SNP allele transition, it
was more effective to use a population c alling method. If an indi-
vidual calling method is used, then all alternative allele frequencies

from all samples must be recalculated from all SNP sites. Therefore,
it is more efficient to use a population calling method from the
start. For example, we have used a COALL at that time for the SNP
detection and had to reevaluate allele frequencies of all SNP sites in
all the samples to achieve the same results as a population calling
method to capture rare allele SNPs.
3.7.4 Phylogenetic Comprehensible phylogenetic analyses require specialized skill and

Analysis methods and therefore we will not discuss the topic in details. We
will, however, describe simple practical guides applicable to basic
phylogenetic analyses. In general, SNPs selected for phylogenetic
analysis can be more rigorously filtered to capture the key phyloge-
netic relationship. Therefore, it is essential to perform extensive
screening of SNPs to retain high confidence SNPs and to mask out
the problematic regions from a reference to reduce false positive
SNPs. Special care must be taken to combine multiple SNP vcf files
to properly handle reference bases, alternative alleles and missing
information without unintentionally distorting the base informa-
tion. It is common to remove SNPs that appears in only one sample
or that appear in all samples. It is also common to remove linked
SNPs, and regions containing strong signatures of recombinations,
but identifying such SNPs and regions must be performed with care.
3.7.5 How to Handle For a large sequencing project, sequence data can come from vari-
Samples with Biased ous sources. Sequencing data quality may not be uniform and
False SNPs some samples may be of lower quality. Therefore, the data from
public archives must be treated with caution, and it is critical to
read the original paper in which the sequence data was generated
because the paper often describes the read quality issues and practi-
cal solutions in detail when the quality of some samples are lower
than that of other samples. For example, in our previous L. don-
ovani project [4], 18 samples had lower sequence quality and these
samples would have generated ten times more false positive SNPs
than the rest of the samples, but the problem was solved by apply-
ing additional SNP screening conditions to these samples. If we
obtained the data from a public database and observed abnormal
number of SNPs in a limited number of samples, then it is appro-
priate to remove these samples from the analyses rather than keep-
ing them, provided these samples are not essential.
3.7.6 Characterizing When a read can be mapped to multiple locations with the same
Depth and SNPs mapping score, aligners select one location randomly or alterna-
from Repetitive Regions tively ignore the multiple mapped read. Selecting a random posi-
tion is often more appropriate to characterize base variations and
copy number variations than keeping only uniquely mapped reads.
When only uniquely mapped reads are kept, the depth of repetitive
regions such as GP63 and HSP70 would be underestimated
because multiple mapped reads were ignored. This would conse-

quently lead to skewed CNV results [3, 5]. It is also easy to exclude
multiple mapped reads later based on the mapping scores of reads
by using samtools view with a mapping quality cutoff.
3.7.7 Lower Input DNA For various technical and biological reasons, the depth of samples
Samples can be lower than one or two reads per bases. It is, however, still
possible to estimate somy and perform genotyping from such
lower depth samples. For example, the read depth for Leishmania
donovani amastigotes from a hamster was lower than 0.8 and too
low to estimate somy based on a regular depth method as discussed
above. It was, however, possible to estimate their somy based on
the number of reads per 1000 bp [6]. Genotyping using regular
SNP calling methods is not possible for such low depth samples,
but if diagnostic SNP markers are known from other higher depth
samples, direct searching of base motifs that contain a diagnostic
SNP marker can be used for genotyping. For copy number varia-
tion, it is likely possible to identify amplicons with a high copy
number using depth based on a certain window. Smaller scale
CNVs can be detected by clustering many lower depth samples
together to increase resolution.
3.8 Transcriptomics We will briefly summarize the basics of upstream analysis of tran-
Analysis scriptomics sequencing and describe the read count normalization
specific to Leishmania and how to handle repetitive genes. RNA
sequencing analysis generally requires replicates per sample rang-
ing from 2 to 6. When it is not feasible to have replicates in some
experimental and clinical settings, it is common to group samples
together based on phenotypic differences to increase statistical
power. It is more difficult to choose an optimal RNA sequencing
library than DNA sequencing library because we must optimize
many factors such as number of replicates, read depth, read length,
inset size, and single or paired reads [43–45].
RNA read mapping and read counting: For RNA analysis,
STAR (Spliced Transcripts Alignment to a Reference) is likely a
convenient option in many cases [46]. It can perform elaborate
two-step mapping and read counting by itself. It can also handle
strand-specific RNA sequencing. Leishmania does not have introns
in general, so a splicing-aware mapping may not be needed; but it
is an attractive feature. As a cautionary note for STAR users, when
using a gff file from TritrypDB, a gff annotation file must be con-
verted to gtf annotation file even though STAR indicates that a gff
file is accepted. In general, STAR often produces an empty count-
ing when a gff from TritrypDB is used. Once we obtained read
count data, they can then be analyzed by DEseq2 which provides
normalized read count and fold changes and Benjamini–Hochberg-
adjusted p-values. It is common to use a fold change cutoff 2, and
a Benjamini–Hochberg adjusted p value <0.05 to define differen-
tially expressed genes.
Customized read count normalization: If readers are sufficiently

familiar and confident with their data sets, they can try their own
normalization reflecting Leishmania specific transcriptional differ-
ences in promastigotes and amastigotes. In Leishmania, promasti-
gotes tend to have higher expression level than amastigotes in
general, therefore DESeq2 [47] read count normalization may
slightly suppress promastigote expression levels [6]. In particular,
our group quantified the amount of transcripts by assessing read
depth as described in DNA somy estimation above. For each chro-
mosome, the average depth of transcripts was used to compute an
RNA-based relative somy value. In our previous analysis, we calcu-
lated RNA read depth as described in DNA sequencing and
obtained read depth for each gene. Then we converted these
depths into raw read counts, and calculated transcriptional somy.
This way, we found DESeq2 suppressed the amount of the total
normalized read count of a promastigote sample 4% compared to
the normalization based on RNA somy [6]. In this specific case,
the difference was only 4%, but we can envision to encounter a
more skewed expression level between promastigotes and amasti-
gotes. For example, when the promastigotes’ somy level is much
higher than the amastigotes’ somy level, regular DESeq2 normal-
ization may not be optimal and therefore some customized nor-
malization based on RNA somy might produce better results.
Transcription analysis over repetitive genes: In RNA sequencing
analyses, repetitive regions are often simply excluded from the
analyses because reads cannot be mapped uniquely to repetitive
regions. There are at least three ways to handle repetitive genes in
RNAseq data: ignoring multiple-hit reads, selecting one
representative homolog among these homologs, and describing
these genes separately.
First, if the main aim is to characterize transcription level in
general, it is common to ignore reads mapping to multiple loca-
tions. This method can still characterize expression of repetitive
genes as long as reads can be uniquely mapped. Second, repetitive
genes can be clustered using a program like cd-hit-est (http://
weizhongli-lab.org/cd-hit/). A specific similarity cutoff of 90% or
95% can be applied and a similarity cutoff 90% should be sufficient
to characterize general transcriptional behavior. However, for a
transcriptional analysis in the context of drug induction experi-
ments, small base differences, such as one frameshifting base differ-
ence, can have a significant impact on a gene. Therefore, a similarity
cutoff must be adjusted based on the aim of experiments. Third, as
we described in the last part of the previous section, we treat RNA
reads like DNA reads, and then we can characterize RNA depth
and SNPs. Then it is possible to evaluate RNA somy, RNA gene
depth, and RNA SNPs to observe translational biases, providing
additional information that the first two methods may not
provide.
4 Conclusion
We have discussed a broad range of topics that are often neglected

but critical to Leishmania NGS analyses and we have particularly
emphasized on how to handle read depth and somy. We have also
discussed important but often neglected topics such as masking a
reference, the differences between individual and population SNP
calling methods, and RNA depth normalization between promasti-
gote and amastigote samples. We hope this guide would help read-
ers to create their own sequence analysis tools and to understand
and evaluate the existing literature on Leishmania NGS better.
Acknowledgments
We thank Geraldine De Muylder, Bart Cuypers, and Malgorzata

Domagalska for their comments on the manuscript.
References
1. Leprohon P, Fernandez-Prada C, Gazanion É in Leishmania: current knowledge and future

et al (2015) Drug resistance analysis by next prospects. ACS Infect Dis 4(4):467–477
generation sequencing in Leishmania. Int 9. Mannaert A, Downing T, Imamura H,
J Parasitol Drugs Drug Resist 5(1):26–35 Dujardin JC (2012) Adaptive mechanisms in
2. Mardis ER (2017) DNA sequencing technolo- pathogens: universal aneuploidy in Leishmania.
gies: 2006–2016. Nat Protoc 12(2):213 Trends Parasitol 28(9):370–376
3. Imamura H, Downing T, Van den Broeck 10. Sterkers Y, Lachaud L, Bourgeois N et al
F et al (2016) Evolutionary genomics of (2012) Novel insights into genome plasticity in
epidemic visceral leishmaniasis in the Indian
Eukaryotes: mosaic aneuploidy in Leishmania.
subcontinent. Elife 5:e12613 Mol Microbiol 86(1):15–23
4. Downing T, Imamura H, Decuypere S et al 11. Iantorno SA, Durrant C, Khan A et al (2017)
(2011) Whole genome sequencing of mul- Gene expression in Leishmania is regu-
tiple Leishmania donovani clinical isolates pro- lated predominantly by gene dosage. MBio
vides insights into population structure and 8(5):e01393–e01317
mechanisms of drug resistance. Genome Res 12. Tihon E, Imamura H, Dujardin JC et al
21(12):2143–2156 (2017) Discovery and genomic analyses of
5. Rogers MB, Hilley JD, Dickens NJ et al (2011) hybridization between divergent lineages of
Chromosome and gene copy number variation Trypanosoma congolense, causative agent of
allow major structural change between spe- Animal African Trypanosomiasis. Mol Ecol
cies and strains of Leishmania. Genome Res 26(23):6524–6538
21(12):2129–2142 13. Tihon E, Imamura H, Dujardin JC, Van Den
6. Dumetz F, Imamura H, Sanders M et al Abbeele J (2017) Evidence for viable and sta-
(2017) Modulation of aneuploidy in ble triploid Trypanosoma congolense parasites.
Leishmania donovani during adaptation to Parasit Vectors 10(1):468
different in vitro and in vivo environments 14. Head SR, Komori HK, LaMere SA et al (2014)
and its impact on gene expression. MBio Library construction for next- generation
8(3):e00599–e00517 sequencing: overviews and challenges.
7. Barja PP, Pescher P, Bussotti G et al (2017) Biotechniques 56(2):61
Haplotype selection as an adaptive mechanism 15. Vincent AT, Derome N, Boyle B et al (2017)
in the protozoan pathogen Leishmania don- Next-generation sequencing (NGS) in the
ovani. Nat Ecol Evol 1(12):1961 microbiological world: how to make the
8. Jones NG, Catta-Preta CM, Lima AP, Mottram most of your money. J Microbiol Methods
JC (2018) Genetically validated drug targets 138:60–71
16. Haddock SHD, Dunn CW (2011) Practical 30. Reis-Cunha JL, Rodrigues-Luiz GF, Valdivia
computing for biologists. Sinauer, Sunderland HO et al (2015) Chromosomal copy number
17. Aslett M, Aurrecoechea C, Berriman M et al variation reveals differential levels of genomic
(2009) TriTrypDB: a functional genomic plasticity in distinct Trypanosoma cruzi strains.
resource for the Trypanosomatidae. Nucleic BMC Genomics 16(1):499
Acids Res 38(suppl_1):D457–D462 31. Schwabl P, Imamura H, Van den Broeck F et al
18. Bolger AM, Lohse M, Usadel B (2014) (2018) Parallel sexual and parasexual popula-
Trimmomatic: a flexible trimmer for tion genomic structure in Trypanosoma cruzi.
Illumina sequence data. Bioinformatics bioRxiv. https://doi.org/10.1101/338277
30(15):2114–2120 32. Rogers MB, Downing T, Smith BA et al
19. Cuypers B, Domagalska MA, Meysman P et al (2014) Genomic confirmation of hybridi-
(2017) Multiplexed spliced-leader sequencing: sation and recent inbreeding in a vector-
a high-throughput, selective method for RNA- isolated Leishmania population. PLoS Genet
seq in Trypanosomatids. Sci Rep 7(1):3725 10(1):e1004092
20. Li H, Durbin R (2009) Fast and accurate short 33. McKenna A, Hanna M, Banks E et al (2010)
read alignment with Burrows–Wheeler trans- The genome analysis toolkit: a MapReduce
form. Bioinformatics 25(14):1754–1760 framework for analyzing next- generation
21. Langmead B, Salzberg SL (2012) Fast gapped- DNA sequencing data. Genome Res
read alignment with Bowtie 2. Nat Methods 20(9):1297–1303
9(4):357 34. Marth GT, Korf I, Yandell MD et al (1999)
22. Li H, Homer N (2010) A survey of sequence A general approach to single-nucleotide poly-
alignment algorithms for next-generation morphism discovery. Nat Genet 23(4):452
sequencing. Brief Bioinform 11(5):473–483 35. Li H, Handsaker B, Wysoker A et al (2009)
23. Zackay A, Cotton JA, Sanders M et al (2018) The sequence alignment/map format and
Genome wide comparison of Ethiopian SAMtools. Bioinformatics 25(16):2078–2079
Leishmania donovani strains reveals differences 36. Iqbal Z, Caccamo M, Turner I et al (2012)
potentially related to parasite survival. PLoS De novo assembly and genotyping of variants
Genet 14(1):e1007133 using colored de Bruijn graphs. Nat Genet
24. Coughlan S, Mulhair P, Sanders M et al (2017) 44(2):226
The genome of Leishmania adleri from a mam- 37. Frith MC (2010) A new repeat-masking
malian host highlights chromosome fission in method enables specific detection of homolo-
Sauroleishmania. Sci Rep 7:43747 gous sequences. Nucleic Acids Res 39(4):e23
25. Coughlan S, Taylor AS, Feane E et al (2018) 38. Derrien T, Estelln J, Sola SM et al (2012) Fast
Leishmania naiffi and Leishmania guyanensis computation and applications of genome map-
reference genomes highlight genome structure pability. PLoS One 7(1):e30377
and gene evolution in the Viannia subgenus. R 39. Otto TD, Sanders M, Berriman M, Newbold
Soc Open Sci 5(4):172212 C (2010) Iterative correction of reference
26. Rastrojo A, García-Hernández R, Vargas P nucleotides (iCORN) using second genera-
et al (2018) Genomic and transcriptomic alter- tion sequencing technology. Bioinformatics
ations in Leishmania donovani lines experi- 26(14):1704–1707
mentally resistant to antileishmanial drugs. Int 40. Gonznformaticssecond S, Peirnformati R et al
J Parasitol Drugs Drug Resist 8(2):246–264 (2017) Resequencing of the Leishmania infan-
27. Valdivia HO, Reis-Cunha JL, Rodrigues- tum (strain JPCM5) genome and de novo
Luiz GF et al (2015) Comparative genomic assembly into 36 contigs. Sci Rep 7(1):18050
analysis of Leishmania (Viannia) peruviana 41. Cingolani P, Platts A, Wang LL et al (2012)
and Leishmania (Viannia) braziliensis. BMC program for annotating and predicting the
Genomics 16(1):715 effects of single nucleotide polymorphisms,
28. Dumetz F, Cuypers B, Imamura H et al (2018) SnpEff: SNPs in the genome of Drosophila
Molecular preadaptation to antimony resis- melanogaster strain w1118; iso-2; iso-3. Fly
tance in Leishmania donovani on the Indian 6(2):80–92
subcontinent. mSphere 3(2):e00548–e00517 42. Ewing B, Green P (1998) Base-calling of auto-
29. Shaw CD, Lonchamp J, Downing T et al mated sequencer traces using phred. II. Error
(2016) In vitro selection of miltefosine resis- probabilities. Genome Res 8(3):186–194
tance in promastigotes of Leishmania donovani 43. Schurch NJ, Schofield P, Gierliński M et al
from Nepal: genomic and metabolomic charac- (2016) How many biological replicates are
terization. Mol Microbiol 99(6):1134–1148 needed in an RNA-seq experiment and which
differential expression tool should you use? standing of the biology and host-pathogen
RNA 22(6):839–851 interactions. Infect Genet Evol 49:273–282
44. Fiebig M, Kelly S, Gluenz E (2015) 46. Dobin A, Davis CA, Schlesinger F et al (2013)
Comparative life cycle transcriptomics revises STAR: ultrafast universal RNA-seq aligner.
Leishmania mexicana genome annotation and Bioinformatics 29(1):15–21
links a chromosome duplication with parasitism 47. Love MI, Huber W, Anders S (2014)
of vertebrates. PLoS Pathog 11(10):e1005186 Moderated estimation of fold change and
45. Patino LH, Ramírez JD (2017) RNA-seq in dispersion for RNA-seq data with DESeq2.
kinetoplastids: A powerful tool for the under- Genome Biol 15(12):550
Chapter 4
Quantitative RNA Analysis Using RNA-Seq

Peter J. Myler, Jacqueline A. McDonald, Pedro J. Alcolea, and Aakash Sur
Abstract
High-throughput sequencing of cDNA copies of mRNA (RNA-seq) provides a digital readout of mRNA
levels over several orders of magnitude, as well as mapping the transcripts to the nucleotide level. Here we
describe two different RNA-seq approaches, including one that exploits the 39-nucleotide mini-exon or
spliced leader (SL) sequence found at the 5′ end of all Leishmania (and other trypanosomatid) mRNAs.
Key words RNA-seq, Transcriptome, mRNA, Differential gene expression
1 Introduction
In the first decade of the twenty-first century, publication of several

complete or draft genomes [1–5] and the use of microarray-based
transcriptomics enabled the first comprehensive investigation of
changes in mRNA levels between different life cycle stages of several
Leishmania species [6–16]. While not without controversy, these
studies generally concluded that, unlike most other organisms, only
a small percentage (<10%) of Leishmania genes showed significant
changes in mRNA levels in these different life cycle stages. However,
these initial analyses of gene expression suffered from technical
limitations (principally lack of sensitivity and inability to distinguish
between closely related genes), as well as prohibitively expensive ini-
tial costs (especially for a less well-studied organism such as
Leishmania). Fortunately, the rapid adoption of next-generation
sequencing (NGS) technologies provided a solution: high-through-
put sequencing of cDNA copies of mRNA (RNA-seq). This
approach not only allows for mapping of the transcripts to the
nucleotide level (precisely defining the boundaries of every mRNA)
but also provides a robust digital readout of mRNA levels over a
dynamic range of several orders of magnitude [17].
While there are many different NGS technologies available,
most RNA-seq applications currently use the Illumina platform,
since it provides the massively parallel throughput (tens to hundreds
95
96 Peter J. Myler et al.
of millions of reads per sample) necessary to obtain sufficient

coverage of lower abundance mRNAs. Similarly, there are several
approaches that can be used for cDNA library generation, depend-
ing on the specific question(s) being asked. However, since most
investigators are interested (at least initially) in determining the
steady state levels of mRNAs in the sample(s) of interest, it is usu-
ally desirable to use a method that avoids making cDNA from the
noncoding (ribosomal, transfer, small nuclear, and small nucleolar)
RNAs that make up the majority of cellular RNA. While this can be
readily achieved by purification of polyadenylated (polyA+) mRNA
using oligo(dT) magnetic beads, this approach has the disadvan-
tage of being subject to variable recovery (especially for small
samples). An alternative approach is removal of the rRNA by
hybridization with biotinylated probes, which has the advantage of
maintaining other ncRNAs in the sample. However, the rRNA
probes are commercially available only for common organisms
(e.g., human or mouse). There are also several approaches for
the reverse transcription step, which generates the cDNA that is
subsequently amplified and sequenced. Oligo(dT) priming has the
advantage of being selective for polyA+ mRNA, but the disadvan-
tage of under-representing the 5′ end of most mRNAs. Random
priming has the opposite bias (i.e., against the 3′ end of the
mRNA), as well as not being suitable with polyA+ selection. There
is also priming bias because of secondary structure at some regions
of the RNA. Hydrolysis of the mRNA into 200–300 nucleotide
fragments, followed by ligation of RNA adapters (which provide
the primer sequence for cDNA synthesis), is another common
method used, but it also suffers from some sequence bias.
Fortunately, the peculiarity of mRNA processing in trypanoso-
matids provides a unique opportunity to simplify the protocol for
many (but not all) applications of RNA-seq in Leishmania. In these
organisms, all (nuclear-encoded) mRNAs contain a common
sequence at their 5′ end: the 39-nucleotide mini-exon or spliced
leader (SL) sequence that is added post-transcriptionally by trans-
splicing [18]. This sequence provides a convenient primer for second
strand synthesis, ensuring that all cDNAs contain the 5′ end of
mRNA. This confers the advantage of being able to use random
priming of unpurified RNA for first strand synthesis without being
overwhelmed by ncRNA sequences. It also has the advantage of pre-
cisely defining the SL site(s) for each mRNA in a relatively quantita-
tive manner, without having to resort to the high coverage that
would be needed using conventional methods. This approach
(slRNAseq) was originally developed for Trypanosoma brucei, where
it was called “Spliced Leader trapping” [19], but has subsequently
used for Leishmania [20–23]. We have now used slRNAseq to pre-
pare more than 150 libraries from five different Leishmania species.
We have recently adapted a rapid and inexpensive protocol
[24] that allows parallel construction of strand-specific and slRNA
Quantitative RNA Analysis Using RNA-Seq 97
libraries, thereby combining the advantages of both approaches.

Briefly, first-strand cDNA is prepared by random priming of polyA+
RNA (eluted from oligo-dT beads) using a reverse transcriptase
that adds short tracts of untemplated C residues to the 3′-end of
the cDNA. Second-strand synthesis is then carried out using a
primer containing 3′-Gs to synthesize strand-specific cDNAs start-
ing at (semi-)random positions of all mRNAs and/or a primer con-
taining a conserved slRNA sequence to enrich for cDNAs
containing the 5′-end of trypanosomatid mRNAs. In both cases,
the double-stranded cDNAs are PCR amplified using primers that
add the Illumina P7 sequence to their 3′-ends and the P5 sequence
to their 5′ ends. The libraries are then sequenced using the stan-
dard Illumina Read1 sequencing primer (Rd1 SP) for the Stranded
library and a custom slRNA sequencing primer (SL-SP) for the
slRNA library, as well as the standard Indexing and Read2 sequenc-
ing primers for both libraries. Importantly, since the slRNAseq
libraries do not contain the RdSP1 sequence, both types of library
can be sequenced on the same chip by simply adding the SL-SP to
the samples before sequencing.
In conclusion, we have found that this approach provides a
rapid, quantitative, and cost-effective method determining changes
in mRNA levels in Leishmania parasites isolated from both axenic
culture and from infected macrophages. We hope that the methods
described herein will enable others to implement this approach for
their own purposes.
2 Materials
2.1 RNA Preparation 1. RNase-free water, pipette tips, and centrifuge tubes, RNaseZap
(Applied Biosystems #AM9780).
2. TRIzol Reagent (Invitrogen #15596-026).
3. Chloroform, isopropanol, and 75% ethanol (RNase-free).
4. High-speed refrigerated centrifuge and fixed-angle rotor.
5. Qubit Fluorimeter (Applied Biosystems).
6. Quant-iT RNA Assay kit (Applied Biosystems #Q33140).
7. Bioanalyzer 2100 and RNA 6000 Nano Kit (Agilent
#5067-1511).
2.2 Poly A+ mRNA 1. Dynabeads mRNA DIRECT Kit (Invitrogen #61011).

Purification 2. RNase-free water, pipette tips, and centrifuge tubes.
3. DynaMag™-2 Magnetic Particle Concentrator or similar
magnet (Invitrogen, 123.21D).
4. Heat block or water baths set to 70 °C and 80 °C.
2.3 First Strand 1. RNase-free water, pipette tips, and centrifuge tubes.
cDNA Synthesis 2. Random_Hexamer_P7 (GTGACTGGAGTTCAGACGTGT
GCTCTTCCGATCTNNNNNN)—HPLC-purified first strand
primer handled under RNase-free conditions.
3. SMARTscribe Reverse Transcriptase (Clontech, 639536),
including 5× Takara First Strand Buffer and 20 mM DTT.
4. Advantage® UltraPure PCR Deoxynucleotide Mix (10 mM
each dNTP, Clontech, 639125), combined in equimolar pro-
portions, 10 mM final concentration.
5. 96-well PCR machine, with 0.2-ml thin-wall strip tubes
(nuclease-free).
6. RNasin Ribonuclease Inhibitor, 40 U/μl (Promega, N2515).
2.4 Second Strand 1. Nuclease-free pipette tips and centrifuge tubes.

Synthesis 2. SMARTscribe Reverse Transcriptase (Clontech, 639536).
3. ST_2nd (ACACTCTTTCCCTACACGACGCTCTTCCGAT
CTNNNGG*G, where * indicates a locked nucleic acid)—
second strand primer for stranded RNAseq libraries, HPLC
purified.
4. SL_2nd (TCAGTTTCTGTA, see Note 1)—second strand
primer for slRNAseq libraries, HPLC-purified.
5. Thermal cycler.
6. Ampure XP beads (Beckman Coulter, A63880).
7. Nuclease-free low retention pipette tips (Rainin, 30389239).
8. DynaMag™-2 Magnetic Particle Concentrator or similar
magnet (Invitrogen, 123.21D).
9. Freshly prepared 80% ethanol.
10. TElow (10 mM Tris, 0.1 mM EDTA).

(nuclease-free).
2.5 PCR 1. Nuclease-free water, pipette tips, and centrifuge tubes.

Amplification and DNA 2. P7iX (CAAGCAGAAGACGGCATACGAGATNNNNNNG
Purification TGACTGGAGTT CAGACGTGTG, where NNNNNN is an
index sequence for multiplexing)—3′ PCR primer for both
stranded RNAseq and slRNAseq libraries, HPLC-purified.
3. ST_P5 (AATGATACGGCGACCACCGAGATCTACACTC
TTTCCCTACACGAC)—5′ PCR primer for stranded
RNAseq libraries, HPLC-purified.
4. SL_P5 (AATGATACGGCGACCACCGAGATCTCACTCT
TTCCCTACATCAGTTTCTGTAC)—5′ PCR primer for
slRNAseq libraries, HPLC-purified.

(nuclease-free).
6. Microfuge and 1.5-ml centrifuge tubes.
7. Phire Hot Start II PCR Master Mix (Thermo Scientific,
#F125S).
8. Ampure XP beads (Beckman Coulter, #A63880).
2.6 Quantification 1. Qubit dsDNA HS Assay Kit (Invitrogen #Q32854).

of Library 2. Qubit 2.0 Fluorimeter (Applied Biosystems).
3. Bioanalyzer 2100 and DNA 1000 Kit (Agilent #5067-1504).
4. KAPA Library Quantification Kit (Roche, KK4824) and qPCR
instrument (optional).
2.7 Illumina 1. SL_SEQ_LNA (CACTCT*TTCC*CTACA*TCAGT*TTCT

Sequencing *GTACT*TTA*TTG, where * indicates a locked nucleic
acid)—custom sequencing primer for slRNAseq libraries.
2.8 Data Analysis 1. FastQC v0.11.8: http://www.bioinformatics.babraham.ac.uk/

projects/fastqc/.
2. Bowtie2 v2.3.4.3: http://bowtie-bio.sourceforge.net/bowtie2/
index.shtml.
3. Samtools v1.9: http://www.htslib.org/.
4. Bioconductor v2.1: http://www.bioconductor.org/.
5. EdgeR v3.0.7: http://www.bioconductor.org/packages/
release/bioc/html/edgeR.html.
3 Methods
3.1 RNA Preparation 1. Pellet ~5 × 108 cells (see Note 2) at 3000 × g for 10 min at
4 °C in a 50-ml conical tube and discard supernatant.
2. Add 1 ml of TRIzol Reagent to each tube, pipet up and down
to disrupt the pellet, before letting sit at room temperature
for 5 min.
3. Add 200 μl chloroform and shake vigorously by hand for 15 s,
before letting the sample sit at room temperature for another
5 min.
4. Centrifuge for 15 min, at 12,000 × g, 4 °C and transfer 400 μl
of the aqueous phase to a new tube.
5. Add 500 μl of isopropanol and mix by inversion, before incu-
bating at room temperature for 10 min.
6. Centrifuge for 10 min, at 12,000 × g, 4 °C and discard
supernatant.
7. Wash pellet with 1 ml ice-cold 75% ethanol (prepared with

RNase-free water). Vortex briefly to disrupt the pellet.
8. Centrifuge at 7500 × g for 5 min at 4 °C and remove all
supernatant.
9. Let pellet air-dry at room temperature for 10 min (longer if
necessary).
10. Resuspend in 40 μl RNase-free water and determine concen-
tration using a Qubit Fluorometer.
11. The RNA should be checked for degradation and/or DNA
contamination by running on the Agilent Bioanalyzer 2100.
12. Store the RNA at −80 °C, avoiding freeze/thawing.
3.2 Poly A+ mRNA 1. Bring all reagents off the Invitrogen mRNA DIRECT Kit to
Purification room temperature and set heat block to 70 °C.
2. Add 22 μl oligo-dT beads to a 1.5-ml tube, place on magnet,
and remove supernatant.
3. Remove from magnet, add 22 μl Lysis/Binding buffer, and
pipet-mix.
4. Bring 1 μg RNA to 50 μl using RNase-free water and incubate
5. Add 50 μl binding buffer and pulse-centrifuge.
6. Add 20 μl oligo-dT beads, gently mix using a pipette, and
incubate for 5 min at room temperature. Meanwhile, incubate
RNase-free water (25 μl per sample) at 80 °C.
7. Briefly centrifuge samples (see Note 3) place on magnet, and
discard supernatant.
8. Add 100 μl Wash Buffer A, gently pipet, and pulse-centrifuge.
Place on magnet and discard supernatant.
9. Add 150 μl Wash Buffer B, gently pipet, and pulse-centrifuge.
Place on magnet and discard supernatant.
10. Resuspend beads in 25 μl 80 °C RNase-free water and incu-
bate at room temperature for 30 s.
11. Add 25 μl Lysis/Binding buffer and incubate at room tem-
perature for 5 min.
12. Repeat steps 7–9.
13. Add 15 μl 10 mM Tris and incubate at 80 °C for 2 min.
14. Place on magnet, and immediately transfer 14.5 μl sample to
another tube.
3.3 First Strand 1. Add 1 μl of 100 μM first strand primer (Random_Hexamer_
cDNA Synthesis P7) and 5 μl Takara First Strand Buffer to polyA+ mRNA and
incubate at 95 °C for 2 min.
2. Allow to cool to 4 °C and place on ice.

3. Add 2.5 μl 10 mM dNTPs, 1 μl 20 mM DTT, 0.5 μl RNase
inhibitor, and 1 μl SMARTscribe to first strand reaction while
cold.
4. Incubate at 42 °C for 120 min and 70 °C for 5 min.
3.4 Second Strand 1. Dilute second strand primers to 100 μM (ST_2nd) or 10 μM
Synthesis (SL_2nd) with RNase-free water.
2. For stranded RNAseq libraries, transfer 12.5 μl of the first
strand reaction to a new strip tube (labeled “ST”) and add
0.5 μl SMARTScribe Reverse Transcriptase and 1 μl of 100 μM
ST_2nd primer.
3. For slRNAseq libraries, transfer 12.5 μl of the first strand reac-
tion to a strip tube (labeled “SL”) and add 0.5 μl SMARTScribe
Reverse Transcriptase and 1 μl 10 μM SL_2nd primer.
4. Incubate samples at 42 °C for 120 min.
5. Transfer samples to 1.5-ml tubes and add a 1× volume (see
Note 4) of Ampure XP beads using RNase-free low-retention
pipette tips and pipet up and down until evenly suspended.
6. Allow DNA to bind to the beads at room temperature for
10 min.
7. Place on magnet. Once the supernatant is clear, carefully
remove and discard the supernatant, making sure not to dis-
lodge the beads.
8. Without disturbing the beads, add 200 μl freshly prepared
80% ethanol.
9. Incubate at RT for 30 s, then carefully remove and discard the
ethanol.
10. Repeat steps 8 and 9, for a total of two washes.
11. Remove residual ethanol from bottom and sides of tubes with
a P20 pipette tip and air-dry until beads are no longer shiny,
but before they have cracked (see Note 5).
12. Thoroughly resuspend the dried beads in 25 μl TElow using a
low-retention pipette tip.
13. Incubate at room temperature for 2 min and place samples
onto magnet.
14. Transfer supernatant to a fresh tube and repeat steps 5–11.
low-bind pipette tip.
16. Incubate at room temperature for 2 min and place samples on
magnet.
17. Transfer 25 μl of supernatant to a fresh strip tube (see Note 6).
3.5 PCR 1. For Stranded RNAseq libraries, prepare the PCR reaction mix
Amplification and DNA at room temperature by mixing:
Purification (a) 12.5 μl purified second strand cDNA above.
(b) 25 μl Phire Hotstart 2× Master Mix.
(c) 1 μl 20 μM ST_P5 primer.
(d) 1 μl 20 μM P7iX primer.
(e) 10.5 μl water.
2. PCR amplification is carried out by heating to 98 °C for 3 min;
followed by two cycles of 98 °C for 15 s, 58 °C for 15 s, 72 °C
for 1 min; 12–35 cycles (see Note 7) of 98 °C for 15 s, 72 °C
for 75 s; and, finally, 72 °C for 10 min, before cooling to 4 °C.
3. For slRNAseq libraries, prepare the PCR reaction at room
temperature by mixing:
(a) 12.5 μl purified second strand cDNA above.
(b) 25 μl Phire Hotstart 2× Master Mix.
(c) 1 μl 20 μM SL_P5 primer.
(d) 1 μl 20 μM P7iX primer.
(e) 10.5 μl water.
4. PCR amplification is carried out by heating to 98 °C for 3 min;
followed by two cycles of 98 °C for 15 s, 35 °C for 15 s, 72 °C
for 1 min; 12–35 cycles (see Note 7) of 98 °C for 15 s, 72 °C
for 75 s; and, finally, 72 °C for 10 min, before cooling to 4 °C.
5. Transfer samples to 1.5-ml tubes and add 0.8× volume (40 μl)
of Ampure XP beads using RNase-free low-retention pipette
tips and pipet up and down until incorporated.
6. Allow DNA to bind to the beads at room temperature for
10 min.
7. Place on magnet. Once the supernatant is clear, carefully
remove and discard, making sure not to dislodge the beads.
8. Without disturbing the beads, add 200 μl freshly prepared
80% ethanol.
9. Incubate at RT for 30 s and carefully remove and discard
ethanol.
10. Repeat steps 8 and 9, for a total of two washes.
11. Remove residual ethanol from the bottoms and sides of the
tubes with a P20 pipette tip and air-dry until beads are no
longer shiny, but before they have cracked.
low retention pipette tip.
magnet.
14. Transfer supernatant to a fresh tube and repeat steps 5–11.

low-bind pipette tip.
magnet.
17. Transfer 25 μl to a fresh strip tube (see Note 6).
3.6 Quantification 1. Measure DNA concentration using the Qubit Fluorometer

of Library High Sensitivity assay.
2. Verify the expected size range (100–500 bp) by running an
aliquot on a FlashGel or Agilent Bioanalyzer DNA 1000 chip
(see Note 8).
3. Optionally, the sample may be quantified using the KAPA
Library Quantification Kit.
4. Calculate the picomolar concentration (pM) of the sample
using the following formula:
Concentration ( ng / µl ) × 106
pM =
size × 0.66
3.7 Illumina 1. Provide 10 μl of each RNAseq library (and the concentration
Sequencing determined above) to a sequencing facility, along with an ali-
(See Note 9) quot of the custom sequencing primer (SL_SEQ) for slRNA-
seq samples (see Note 10).
2. The sequencing facility will usually provide fastq files for each
sample after deindexing.
3.8 Data Quality 1. Fastq files are uncompressed using appropriate tool (e.g., gun-
Check zip) and the average read quality calculated using FastQC tool
and Read-Filtering kit. Reads with a quality score of less than 20 are removed
from subsequent analysis.
2. The average quality for each cycle/base position is calculated
and plotted graphically using a customized R script. If there
are striking discrepancies in read qualities of adjacent bases,
the possible cause is investigated by consultation with the
sequencing facility.
3. The average GC content for each cycle/base is calculated and
compared to that of Leishmania (~60%). Because of method
of library preparation, we expect an over-abundance of Gs at
residues 4–6 of Read1 from Stranded RNAseq libraries, but
non-random distribution at other positions would indicate a
heavily skewed or contaminated library. The presence of Ns at
any position indicates a problem with read quality.
4. The thousand most-frequent reads are identified and aligned
to the reference genome (see below). The frequency and posi-
tion of these alignments are manually reviewed to determine if

there are a large number of reads from small number of genes
(e.g., rRNAs, tubulin), indicating bias in library preparation.
3.9 Alignment 1. A fasta file containing the reference genome sequence (usually
to Reference Genome obtained from TritrypDB) is indexed with “bowtie2-build”
command of the Bowtie2 suite.
2. Fastq files are aligned against the indexed reference genome
using Bowtie2 with following parameters: –very-sensitive-
local -trim5 6 (to trim the nontemplated sequence from the 5′
end of Stranded RNAseq libraries).
3. SAM output is converted into a binary format (BAM), sorted,
and indexed using default parameters in Samtools.
4. Using the SL-Seq software package (https://github.com/
CuypersBart/SL-Seq), the gene annotations of the organism are
expanded such that the 5′ UTR of a gene reaches the 3′ end of
the upstream gene. This change allows splice leader sequences to
map to the gene models during gene counting and produces a
new gene annotation file (GTF) to reflect these changes.
5. Using the featureCounts module from the subreads package
(http://bioinf.wehi.edu.au/featureCounts/), we utilize the
BAM alignment and the modifed splice leader GTF to produce
gene counts in a tab-delimited file to be used for differential
gene expression analysis.
3.10 Differential 1. Raw count data (not RPKM) are loaded into the Bioconductor
Expression Analysis edgeR package via the readDGE() function.
(See Note 12) 2. The DGEListobject$samples$lib.size <- colSums(DGEListo-
bject$counts) function is used to recalculate Library sizes
after filtering out genes with fewer than three counts in any
libraries.
3. Normalization factors are calculated using the calcNormFac-
tors() function (see Note 13).
4. A sample-wide common Biological Coefficient of Variation
(BCV) is calculated using the estimateGLMCommonDisp()
function (see Note 14).
5. The estimateGLMTagwiseDisp() function is used to calculate
gene-wise dispersion from common BCV (see Note 15).
6. The glmFit() function is used to fit the negative binomial GLM
for each gene and the glmLRT() used to perform a differential
expression test using likelihood ratio test (see Note 16).
7. The log2 ratio of median-normalized read counts (see Note 17)
between the libraries is calculated for each gene to determine
the fold-change in mRNA expression level between samples.
In case of time-series experiments, the starting sample (time-
zero) is usually used as a common reference.
4 Notes
1. The second strand primer used for slRNA libraries contains

nucleotides 22–33 (TCAGTTTCTGTA) from the 41-nt
Splice Leader (mini-exon) sequence present at the 5′ end of all
Leishmania mRNAs. Since this sequence is conserved in most
trypanosomatids, the primer could also be used in other
species.
2. The protocol is designed for use with cultured promastigotes,
but can also be used for axenic, macrophage- or lesion-derived
amastigotes. It is also suitable for preparation of total RNA
from infected macrophages or lesion material without isola-
tion of amastigotes. In the latter cases, the amount of RNA
used for cDNA synthesis may need to be increased, depend-
ing on the ratio of parasite to host mRNA, as determined in
step 11.
3. In this step, do not pellet the beads, but only remove buffer
from the tube walls.
4. Depending on what types of tubes and magnet you are using,
you may want to adjust the volume to make working with the
samples easier (25–50 μl is usually sufficient for 1.5-ml tubes).
5. If the beads crack, a longer incubation time with TElow in the
next step may be necessary.
6. Samples can be stored at −20 °C at this stage and the protocol
resumed at a later time.
7. In order to minimize the number of amplification cycles used,
it is advisable to perform the PCR twice. The first time, remove
a 10 μl aliquot from each sample after 10, 12, 14, 16, and
18 cycles and examine on a FlashGel to determine the mini-
mum number of cycles needed to obtain sufficient DNA
(~50–100 ng/20 μl). The second time, amplification is only
continued for this number of cycles before processing the
sample.
8. If peaks are observed in the 200-bp region, the library will
need to be repurified using an Ampure XP bead purification
before sequencing. Repeat the quantitation to ensure that
primer dimers have been removed before sequencing.
9. The RNAseq libraries can be sequenced on the high-
throughput Illumina platforms, including the NextSeq, HiSeq,
and NovaSeq series, as well as benchtop sequencers, such as
the MiSeq series (although the lower read output of the latter
make it suitable for only single libraries or quality control of
multiplexed libraries). We typically use a protocol for 50 cycles
of single end sequencing (SE50) with TruSEQ standard prim-
ers on a HiSeq 2500 or NextSeq 550 machine, but different
protocols may be used for other platforms.
10. If required, the sequencing facility will add the SL_SEQ primer
to the samples prior to loading onto the cBOT. We use a
locked nucleic acid (LNA) oligonucleotide to raise the melting
temperature of the SL_SEQ primer to match that of the
TruSEQ Read1 primer.
11. Since the 3′ UTRs for most genes are not yet defined, all SL
sites between the 3′ end of the CDS and the nearest boundary
of the next gene upstream are associated with each particular
gene. The major SL site is defined as that with the most reads
and minor SL sites are ranked in decreasing order of read
abundance.
12. The choice of approach used to identify differentially

expressed genes will be influenced heavily by the experimental
design. Here we describe the use of edgeR Bioconductor
package ([25]) for cases where there are two or more biologi-
cal replicates in a least one of the sample groups. edgeR can
analyze two or more sample groups (e.g., drug-treated and
untreated) for one (treatment effect) or multiple compound-
ing factors (batch effects, life cycle stage, etc.) at the same
time. While it is not possible to perform rigorous statistical
analyses on experiments that lack replicates, we use median-
normalization to correct for differences in library size to allow
descriptive analysis of single-replicate experiments. The raw
read counts for each gene is divided by the median read count
of all genes in each library and multiplied by 100. To minimize
artifacts due to low read counts, genes with raw read counts
below 10% of the median value are assigned a normalized read
count of 10.
13. calcNormFactors normalizes for RNA composition by finding a
set of scaling factors for the library sizes that minimize the log-
fold changes between the samples for most genes. The default
method for computing these scale factors uses a Trimmed
Mean of M-values (TMM) between each pair of samples ([25]).
The product of the original library size and the scaling factor is
called the “effective library size,” which replaces the original
library size in all downstream analyses.
14. A lower BCV indicates higher consistency within biological
replicates.
15. This estimates the unknown variation that exists between

genes within biological replicates.
16. The method used to calculate false discovery rate (FDR) can
be changed using p.adjust() function. The toptags() function
can be used to retrieve the results of edgeR analysis in a tabular
form (containing GeneID, log2-Fold Change, P-Values, and
FDR, among others) for use in subsequent analyses using
different software.
17. The raw read count for a gene is divided by the median read
count of all genes in each library and multiplied by 100. To
minimize artifacts due to low read counts, genes with raw read
counts below 10% of the median value are assigned a normal-
ized read count of 10.
References
1. Ivens AC, Peacock CS, Worthey EA, Murphy Chromosome and gene copy number variation
L, Aggarwal G, Berriman M, Sisk E, allow major structural change between species
Rajandream MA, Adlem E, Aert R, Anupama and strains of Leishmania. Genome Res
A, Apostolou Z, Attipoe P, Bason N, Bauser 21(12):2129–2142
C, Beck A, Beverley SM, Bianchettin G, 4. Downing T, Imamura H, Decuypere S, Clark
Borzym K, Bothe G, Bruschi CV, Collins M, TG, Coombs GH, Cotton JA, Hilley JD, de
Cadag E, Ciarloni L, Clayton C, Coulson RM, Doncker S, Maes I, Mottram JC, Quail MA,
Cronin A, Cruz AK, Davies RM, De Gaudenzi Rijal S, Sanders M, Schonian G, Stark O,
J, Dobson DE, Duesterhoeft A, Fazelina G, Sundar S, Vanaerschot M, Hertz-Fowler C,
Fosker N, Frasch AC, Fraser A, Fuchs M, Dujardin JC, Berriman M (2011) Whole
Gabel C, Goble A, Goffeau A, Harris D, genome sequencing of multiple Leishmania
Hertz-Fowler C, Hilbert H, Horn D, Huang donovani clinical isolates provides insights into
Y, Klages S, Knights A, Kube M, Larke N, population structure and mechanisms of drug
Litvin L, Lord A, Louie T, Marra M, Masuy D, resistance. Genome Res 21(12):2143–2156
Matthews K, Michaeli S, Mottram JC, Muller- 5. Raymond F, Boisvert S, Roy G, Ritt JF, Legare
Auer S, Munden H, Nelson S, Norbertczak H, D, Isnard A, Stanke M, Olivier M, Tremblay
Oliver K, O'Neil S, Pentony M, Pohl TM, MJ, Papadopoulou B, Ouellette M, Corbeil
Price C, Purnelle B, Quail MA, Rabbinowitsch J (2012) Genome sequencing of the lizard
E, Reinhardt R, Rieger M, Rinta J, Robben J, parasite Leishmania tarentolae reveals loss of
Robertson L, Ruiz JC, Rutter S, Saunders D, genes associated to the intracellular stage of
Schafer M, Schein J, Schwartz DC, Seeger K, human pathogenic species. Nucleic Acids Res
Seyler A, Sharp S, Shin H, Sivam D, Squares 40(3):1131–1147
R, Squares S, Tosato V, Vogt C, Volckaert G,
Wambutt R, Warren T, Wedler H, Woodward 6. Guimond C, Trudel N, Brochu C, Marquis N,
J, Zhou S, Zimmermann W, Smith DF, El F, Peytavi R, Briand G, Richard D, Messier
Blackwell JM, Stuart KD, Barrell B, Myler PJ N, Papadopoulou B, Corbeil J, Bergeron MG,
(2005) The genome of the kinetoplastid para- Legare D, Ouellette M (2003) Modulation of
site, Leishmania major. Science 309(5733): gene expression in Leishmania drug resistant
436–442 mutants as determined by targeted DNA micro-
arrays. Nucleic Acids Res 31(20):5886–5896
2. Peacock CS, Seeger K, Harris D, Murphy L,
Ruiz JC, Quail MA, Peters N, Adlem E, Tivey 7. Duncan R (2004) DNA microarray analysis of
A, Aslett M, Kerhornou A, Ivens A, Fraser A, protozoan parasite gene expression: outcomes
Rajandream MA, Carver T, Norbertczak H, correlate with mechanisms of regulation.
Chillingworth T, Hance Z, Jagels K, Moule S, Trends Parasitol 20(5):211–215
Ormond D, Rutter S, Squares R, Whitehead S, 8. Duncan RC, Salotra P, Goyal N, Akopyants
Rabbinowitsch E, Arrowsmith C, White B, NS, Beverley SM, Nakhasi HL (2004) The
Thurston S, Bringaud F, Baldauf SL, application of gene expression microarray tech-
Faulconbridge A, Jeffares D, Depledge DP, nology to kinetoplastid research. Curr Mol
Oyola SO, Hilley JD, Brito LO, Tosi LR, Med 4(6):611–621
Barrell B, Cruz AK, Mottram JC, Smith DF, 9. McNicoll F, Drummelsmith J, Muller M,
Berriman M (2007) Comparative genomic Madore E, Boilard N, Ouellette M,
analysis of three Leishmania species that cause Papadopoulou B (2006) A combined pro-
diverse human disease. Nat Genet 39(7): teomic and transcriptomic approach to the
839–847 study of stage differentiation in Leishmania
3. Rogers MB, Hilley JD, Dickens NJ, Wilkes J, infantum. Proteomics 6(12):3567–3581
Bates PA, Depledge DP, Harris D, Her Y, 10. Almeida R, Gilmartin BJ, McCann SH, Norrish
Herzyk P, Imamura H, Otto TD, Sanders M, A, Ivens AC, Lawson D, Levick MP, Smith DF,
Seeger K, Dujardin JC, Berriman M, Smith Dyall SD, Vetrie D, Freeman T, Coulson RM,
DF, Hertz-Fowler C, Mottram JC (2011) Sampaio I, Schneider H, Blackwell JM (2004)
Expression profiling of the Leishmania life 18. Clayton CE (2002) Life without transcrip-
cycle: cDNA arrays identify developmentally tional control? From fly to man and back again.
regulated genes present but not annotated in EMBO J 21(8):1881–1888
the genome. Mol Biochem Parasitol 136(1): 19. Nilsson D, Gunasekera K, Mani J, Osteras M,
87–100 Farinelli L, Baerlocher L, Roditi I, Ochsenreiter
11. Holzer TR, McMaster WR, Forney JD (2006) T (2010) Spliced leader trapping reveals wide-
Expression profiling by whole-genome inter- spread alternative splicing patterns in the highly
species microarray hybridization reveals differ- dynamic transcriptome of Trypanosoma brucei.
ential gene expression in procyclic PLoS Pathog 6(8):e1001037. https://doi.
promastigotes, lesion-derived amastigotes, and org/10.1371/journal.ppat.1001037
axenic amastigotes in Leishmania mexicana. 20. van Luenen HG, Farris C, Jan S, Genest PA,
Mol Biochem Parasitol 146(2):198–218 Tripathi P, Velds A, Kerkhoven RM, Nieuwland
12. Saxena A, Lahav T, Holland N, Aggarwal G, M, Haydock A, Ramasamy G, Vainio S,
Anupama A, Huang Y, Volpin H, Myler PJ, Heidebrecht T, Perrakis A, Pagie L, van
Zilberstein D (2007) Analysis of the Leishmania Steensel B, Myler PJ, Borst P (2012)
donovani transcriptome reveals an ordered pro- Glucosylated hydroxymethyluracil, DNA base
gression of transient and permanent changes in J, prevents transcriptional readthrough in
gene expression during differentiation. Mol Leishmania. Cell 150(5):909–921
Biochem Parasitol 152(1):53–65 21. Mittra B, Cortez M, Haydock A, Ramasamy G,
13. Leifso K, Cohen-Freue G, Dogra N, Murray A, Myler PJ, NW A (2013) Iron uptake controls
McMaster WR (2007) Genomic and proteomic the generation of Leishmania infective forms
expression analysis of Leishmania promastigote through regulation of ROS levels. J Exp Med
and amastigote life stages: The Leishmania 210(2):401–416
genome is constitutively expressed. Mol 22. Martin JL, Yates PA, Soysa R, Alfaro JF, Yang
Biochem Parasitol 152(1):35–46 F, Burnum-Johnson KE, Petyuk VA, Weitz
14. Cohen-Freue G, Holzer TR, Forney JD, KK, Camp DG 2nd, Smith RD, Wilmarth PA,
McMaster WR (2007) Global gene expression David LL, Ramasamy G, Myler PJ, Carter NS
in Leishmania. Int J Parasitol 37(10): (2014) Metabolic reprogramming during
1077–1086 purine stress in the protozoan pathogen
15. Rochette A, Raymond F, Ubeda JM, Smith M, Leishmania donovani. PLoS Pathog 10(2):
Messier N, Boisvert S, Rigault P, Corbeil J, e1003938
Ouellette M, Papadopoulou B (2008) 23. Goldman-Pinkovich A, Balno C, Strasser R,
Genome-wide gene expression profiling analy- Zeituni-Molad M, Bendelak K, Rentsch D,
sis of Leishmania major and Leishmania infan- Ephros M, Wiese M, Jardim A, Myler PJ,
tum developmental stages reveals substantial Zilberstein D (2016) An arginine deprivation
differences between the two species. BMC response pathway is induced in Leishmania
Genomics 9:255 during macrophage invasion. PLoS Pathog
16. Lahav T, Sivam D, Volpin H, Ronen M, 12(4):e1005494
Tsigankov P, Green A, Holland N, Kuzyk M, 24. Hunt AG (2015) A rapid, simple, and inexpen-
Borchers C, Zilberstein D, Myler PJ (2011) sive method for the preparation of strand-
Multiple levels of gene regulation mediate dif- specific RNA-Seq libraries. Methods Mol Biol
ferentiation of the intracellular pathogen 1255:195–207
Leishmania. FASEB J 25(2):515–525 25. Robinson MD, McCarthy DJ, Smyth GK (2010)
17. Wang Z, Gerstein M, Snyder M (2009) RNA- edgeR: a Bioconductor package for differential
Seq: a revolutionary tool for transcriptomics. expression analysis of digital gene expression
Nat Rev Genet 10(1):57–63 data. Bioinformatics 26(1):139–140
Chapter 5
Ribosome Profiling in Trypanosomatids

Amelie J. Kraus and Raúl O. Cosentino
Abstract
Ribosomes are the machinery responsible for reading mRNAs and translating them into proteins. The
ribosome profiling approach is based on high-throughput sequencing of ribosome-protected mRNAs.
RNAs not harboring ribosomes are removed by nuclease digestion leaving the so-called ribosome “foot-
prints.” The purified “footprint” RNA molecules are processed into DNA libraries and their individual
abundance is determined by deep sequencing. Ribosome profiling reveals the portion of transcripts which
are actually protein-coding and can be used for differential gene expression analysis addressing rates of
protein synthesis, and translational control and efficiency.
Key words Deep sequencing, Gene expression, mRNA levels, Translation efficiency, Protein abundance,
Translational control, Ribosome positions, CDSs
1 Introduction
In trypanosomatids, the expression of genes transcribed by RNA

polymerase II is not controlled at the level of transcription initia-
tion, relying only on posttranscriptional mechanisms to tune gene
expression [1]. Although mRNA levels are used widely as a mea-
sure of gene expression, they frequently correlate weakly with pro-
tein levels, since regulatory processes at the step of protein synthesis
determine which mRNAs are actually translated [2]. Therefore,
ribosome profiling analyses are essential for elucidating the role of
translational control in gene expression. Studies in Trypanosoma
brucei [3] and Trypanosoma cruzi [4] have already shown that
translational regulation plays a crucial role in gene expression and
that the translation efficiency of several mRNAs varies between dif-
ferent life-cycle stages. Furthermore, by mapping the exact ribo-
some protection sites, the actual translation start on transcripts
could be identified, revealing previously unannotated or wrongly
annotated coding sequences [3]. Here, we describe the ribosome
profiling strategy applied in Trypanosoma brucei by Vasquez et al.
[3]. The method is based on the protocol published by Ingolia et al.
109
110 Amelie J. Kraus and Raúl O. Cosentino
[5], and only a few steps were modified for the use in trypano-
somes (see Notes 1–3). The method should be readily applicable
for use in Leishmania spp.
2 Materials
All solutions should be kept nuclease-free and at 4 °C, unless

indicated differently.
2.1 General 1. Plate shaker.

Laboratory Equipment 2. NanoDrop 2000 (Thermo Fisher Scientific).
3. SW40 ultracentrifuge rotor (Beckman Coulter).
4. Gradient Station (Biocomp).
5. Optima™ L80 XP ultracentrifuge (Beckman Coulter).

6.
XCell SureLock™ Mini-Cell Electrophoresis System
(Invitrogen).
7. 14 mm × 95 mm SW40 ultracentrifuge tubes.
8. Continuous UV monitor (254 nm).
9. Nuclease-free water (Ambion).
10. 0.5 ml nonstick RNase-free tubes (low bind).
11. 1.5 ml nonstick RNase-free tubes (low bind).
12. 0.5 ml nonstick DNase-free tubes (low bind).
13. 1.5 ml nonstick DNase-free tubes (low bind).
14. 0.2 ml PCR tubes.
2.2 Cell Lysis 1. Wild-type bloodstream form (BF) cells of T. brucei Lister 427
(MITat 1.2 clone 221) cultivated at 37 °C in HMI-11 to a cell
density of 1.5 × 106 cells/ml or wild-type procyclic form (PF)
cells of T. brucei strain Lister 427 cultivated at 27 °C in SDM-
79 medium supplemented with 10% fetal bovine serum and
hemin (7.5 mg/l) to a cell density of 107 cells/ml.
2. Cycloheximide 100 mg/ml in DMSO.
3. Polysome lysis buffer [6]: 10 mM Tris–HCl pH 7.4, 300 mM
KCl, 10 mM MgCl2.
4. Cell lysis buffer (per 109 cells): 360 μl polysome lysis buffer,
40 μl of 10% noctylglycoside, and 10 μl TURBO DNaseI
(Ambion; 2 U/μl).
2.3 Preparation 1. RNaseI (Ambion).

of Footprint RNA 2. SUPERase•In RNase inhibitor (20 U/μl; Ambion).
3. 10% and 50% (w/v) sucrose solutions in polysome gradient
buffer (10 mM Tris–HCl pH 7.4, 300 mM KCl, and 10 mM
MgCl2, 100 μg/ml cycloheximide).
Ribosome Profiling in Trypanosomatids 111
4. Phenol–chloroform–isoamyl alcohol v/v/v 25:24:1.

5. 20% SDS.
6. 10 mM Tris–HCl pH 8.0 (Ambion).
2.4 Extraction 1. 10× TBE (Invitrogen).

from Polyacrylamide 2. SYBR Gold (Thermo Fisher Scientific).
Gels
3. Microfuge tube spin filters (VWR).
5. 2× denaturing loading buffer: 98% formamide, 10 mM EDTA,
and 300 μg/ml bromophenol blue.
6. 6× DNA gel loading dye (Thermo Fischer Scientific).
2.5 Preparation 1. 15% denaturing PAGE gels.

of RNA Footprint 2. 100 μM of synthetic RNA markers: upper marker [5′AUGUA
Libraries CACGGAGUCGAGCUCAACCCGCAACGCGA-
(Phos)-3′] and lower marker [5′AUGUACACGGAGUCGA
CCCAACGCGA-(Phos)-3′].
3. 0.3 M NaCl.
5. T4 polynucleotide kinase (New England Biolabs).
6. SUPERase•In RNase inhibitor (20 U/μl; Ambion).
8. Preadenylated and 3′-blocked linker 0.5 μg/μl (e.g., Universal
miRNA Cloning Linker; New England Biolabs).
9. T4 RNA ligase 2 truncated (New England Biolabs).
10. 50% PEG 8000.
11. 3 M sodium acetate pH 5.5 (Ambion).
12. GlycoBlue (Thermo Fisher Scientific).
13. 15% denaturing PAGE gel.
14. 1.5 μM reverse transcription primer: [5′-(Phos)-AGATCGGA
AGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTG
GTCGC-(SpC18)-CACTCA-(SpC18)-TTCAGACGTGTGC
TCTTCCGATCTATTGATGGTGCCTACAG-3′].
15. 10 mM dNTPs (Thermo Fisher Scientific).
16. SuperScript III Reverse Transcriptase (200 U/μl; Thermo

Fisher Scientific).
17. 1 N sodium hydroxide.
18. 8% denaturing PAGE gels.
19. DNA gel extraction buffer: 300 mM NaCl, 10 mM Tris–HCl
(pH 8.0), and 1 mM EDTA.
20. CircLigase II (Epicentre).
21. 2× KAPA HiFi HotStart Mix (Roche).

22. 10 μM primer: Forward library primer
[5′-AATGATACGGCGACCACCGAGATCTACAC-3′] and
indexed reverse library PCR primers (The reverse complement
sequence of the barcode index is indicated in underlined
italics.):
(a) 5′-CAAGCAGAAGACGGCATACGAGAT AGTCGT
GTGACTGGAGTTCAGACGTGTGCTCTTCCG-3′.
(b) 5′-CAAGCAGAAGACGGCATACGAGAT ACTGAT
(c) 5′-CAAGCAGAAGACGGCATACGAGAT ATGCTG
(d) 5′-CAAGCAGAAGACGGCATACGAGAT ACGTCG
(e) 5′-CAAGCAGAAGACGGCATACGAGAT AGCTGC
(f) 5′-CAAGCAGAAGACGGCATACGAGAT ATCGTA
23. 8% nondenaturing PAGE gels.
24. 10 bp DNA ladder (Invitrogen).
25. High sensitivity DNA chip (Agilent Technologies).
26. 2100 BioAnalyzer (Agilent Technologies).
27. NextSeq 500/550 Mid Output v2 kit (150 cycles) (Illumina).
28. Illumina NextSeq 500 (Illumina).
3 Methods
For analysis of ribosome profiling data, it is important to also

obtain the transcription profile. Therefore, total RNA is extracted
from the monosome fraction of the undigested sample according
to Ingolia et al. [7]; mRNAs are purified by poly(A) enrichment
and fragmented to 26–34 nt using an RNA Fragmentation
Reagent. Sequencing libraries from fragmented mRNA samples
are generated as described for footprint RNAs.
3.1 Cell Lysis 1. Add cycloheximide (Final concentration: 100 μg/ml) to dense

BF or PF cultures and incubate for 2 min at RT and under
gentle shaking. Harvest cells at 3000 × g and 4 °C for 5 min.
2. Remove supernatant without disturbing the cell pellet and
wash with 1 ml of polysome lysis buffer.
3. Transfer cell suspension to a 1.5 ml microcentrifuge tube and
pellet again at 10,000 × g, 4 °C for 30 s.
4. Lyse cells using 410 μl cell lysis buffer per 109 cells and incubate
for 30 min on ice.
5. Centrifuge lysate at 16,000 × g, 4 ° C for 10 min and transfer
supernatant to a new microcentrifuge tube.
6. Determine OD260 using a NanoDrop 2000. OD260 should be
≥80. Dilute cell lysate with cell lysis buffer to OD260 = 40.
7. Shock-freeze 200 μl aliquots (OD260 = 40) in liquid nitrogen
and store at −80 °C (samples can be stored for at least
6 months).
3.2 Preparation 1. Prechill rotor SW40 at 4 °C in an Optima™ L80 XP ultracen-

of Footprint RNA trifuge (Beckman Coulter); rotor buckets are chilled in a
refrigerator.
3.2.1 Nuclease Digestion
and Monosome Purification 2. Digest 200 μl aliquots of the lysate (OD260 = 40) with RNase
I (Ambion) at room temperature (1200 units) or on ice
(1600 units) for 1 h and stop reaction with 100 units of
SUPERase•In RNase inhibitor.
3. Prepare undigested control by adding 100 units of
SUPERase•In RNase inhibitor to a 200 μl aliquot of lysate
(OD260 = 40) not digested with RNase I.
4. Perform monosome purification directly after nuclease-
treatment by loading the samples onto sucrose gradients
immediately after stopping the digestions.
5. Place SW40 ultracentrifuge tubes inside a metallic support
provided with the Gradient Station (Biocomp) and fill up with
10% sucrose solution (6–7 ml) to the line marked in the metallic
tube.
6. Underlay the 10% sucrose solution with 50% sucrose solution
using a syringe without disturbing the 10% layer and fill the
tube leaving 4 mm empty at the top.
7. Gently insert rubber cap into the tube allowing the air to
escape.
8. Place tube in the tube holder of the gradient station and select
the gradient program “top 10%/bottom 45%” (rotation at
82 °C, speed 19, for 1:25 min) in the Generation option of the
Gradient Station and prepare the sucrose density gradients.
9. Put the tubes on ice.
10. Pipette the sample on top of the sucrose density gradients and
balance tube pairs for centrifugation using 10% sucrose
solution.
11. Place tubes into the prechilled SW40 rotor buckets and seal
the caps with a screwdriver.
12. Centrifuge samples at 100,000 × g, 4 °C for 2.5 h.
13. Remove gradients carefully from the rotor, put them at 4 °C,
and immediately carry out fractionation.
14. Fractionate sucrose gradients on the Gradient station (speed:
0.2 mm/s, distance/fraction: 80 mm).
15. Collect the 80S monosome peaks in 15 ml tubes. Note:
The 80S monosome peak should be larger for the digested
sample compared to the undigested sample.
16. If the collected volume is <700 μl, adjust volume with 10%
sucrose solution to 700 μl.
17. Freeze samples in liquid nitrogen and store at −80 °C.
3.2.2 RNA Purification All steps using organic solvents must be performed under a fume
from 80S Monosome hood, wearing protective gloves and facial shields/eye protection.
Fraction
1. Prewarm phenol–chloroform–isoamyl alcohol (PCI) to 65 °C
in water bath.
2. Adjust fractionated extracts to 65 °C and add 20% SDS to a
final concentration of 1%.
3. Add one sample volume PCI to each sample, vortex briefly,
and incubate the samples at 65 °C for 5 min in water bath
(vortex briefly every minute).
4. Incubate samples on ice for 5 min.
5. Centrifuge for 15 min at 4500 × g and 4 °C.
6. Carefully recover the upper, aqueous phase and transfer to
fresh 15 ml tubes.
7. If phase volume is ≤550 μl recover aqueous phase in a 1.5 ml
nonstick RNase-free tube.
8. Add one sample volume PCI to each sample, vortex briefly
and incubate the samples at RT for 5 min (vortex briefly every
minute).
9. Centrifuge for 15 min at 4500 × g and 4 °C for 15 ml tubes.
Alternatively, centrifuge 1.5 ml nonstick RNase-free tubes for
5 min at full speed and 4 °C.
10. Transfer aqueous phase to fresh 15 ml tube or 1.5 ml nonstick
RNase-free tube (if volume is ≤550 μl).
11. Add 1/10 (v/v) 3 M NaOAc (pH 5.5), 0.5 μl GlycoBlue, and
1.5 vol of isopropanol.
12. Precipitate RNA at −20 °C for at least 30 min (or

overnight).
13. Centrifuge the samples at 4500 × g and 4 °C for 60 min for
15 ml tubes or at full speed and 4 °C for 30 min for 1.5 ml
nonstick RNase-free tubes.
14. Discard supernatant.
15. Wash pellets with 800 μl 80% ethanol.

16. Centrifuge the samples at 4500 × g and 4 °C for 40 min for
15 ml tubes or at full speed and 4 °C for 20 min for 1.5 ml
nonstick RNase-free tubes.
17. Remove supernatant completely.
18. Air-dry pellets for 10 min.
19. Resuspend in 20 μl 10 mM Tris–HCl (pH 8) and transfer
samples to new 1.5 ml nonstick RNase-free tubes.
20. Measure concentration using the NanoDrop photometer.
21. Store RNAs at −80 °C.
3.3 General Protocol: In the following, the general extraction procedure of nucleic acids
Nucleic Acid from polyacrylamide gel is described. The specific requirements for
Extraction DNA or RNA are described where required.
from Polyacrylamide 1. Prerun polyacrylamide gels for 30 min in 1× TBE buffer at
Gels 180 V.
2. Load samples and run for 75 min at 180 V.
3. Prepare 0.5 ml non-stick nuclease-free tube: Poke a hole in the
bottom of the tube.
4. Stain gel with 1× SYBR Gold in 1× TBE for 3 min and visual-
ize gel under UV monitor.
5. Excise region of interest using a clean razor blade.
6. Transfer gel slice to the clean 0.5 ml non-stick nuclease-free
tube with a hole in the bottom.
7. Place 0.5 ml tube into a 1.5 ml tube and centrifuge at
16,000 × g and RT for 2 min, thereby straining the gel slice
through the hole and into the 1.5 ml tube.
8. Add elution buffer (see below) to the gel and elute overnight
on rotating wheel at 4 °C.
9. On the next day, transfer gel slurry to a microcentrifuge tube
spin filter and centrifuge at maximum speed and RT for 2 min.
10. Add 1.5 μl of GlycoBlue and 500 μl of isopropanol, vortex,
and place the tubes at −20 °C for at least 30 min (or
overnight).
11. Spin sample at 16,000 × g and 4 °C for 30 min, remove super-
natant, and add 1 ml of 80% ethanol. Mix thoroughly by
vortexing.
12. Spin sample at 16,000 × g and 4 °C for 20 min, and remove
supernatant.
13. Spin down briefly to collect residual ethanol at the bottom and
remove supernatant.
14. Air-dry pellet for 10 min at RT and resuspend it with the

appropriate volume of 10 mM Tris–HCl (pH 8).
15. Transfer to a clean nuclease-free tube and store sample at
−80 °C.
3.4 Preparation 1. Thaw footprint RNA of digested and undigested sample.

of RNA Footprint 2. Adjust samples to 40 μl with 10 mM Tris (pH 8) and add
Libraries 40 μl of 2× denaturing loading buffer to a final volume of
3.4.1 Size Selection 80 μl (digested and undigested).
of Ribosome Footprint 3. Prepare ladder by mixing 1 μl 10 bp DNA ladder (1 μg/μl),
RNAs 9 μl 10 mM Tris (pH 8) and 10 μl 2× denaturing loading
buffer.
4. Prepare control sample by mixing 2 μl of 10 μM upper and
lower RNA marker, 6 μl 10 mM Tris (pH 8) and 10 μl 2×
denaturing loading buffer.
5. Denature samples for 90 s at 80 °C and put on ice
immediately.
6. Prepare two 15% (wt/vol) denaturing-PAGE gels and prerun
them for 30 min.
7. Use individual gels for digested and undigested samples.
8. Load samples: split each footprint sample to eight wells and
load ladder and control RNA (10 μl per well).
9. Run gels for 75 min at 180 V, stain with SYBR Gold 1× for
3 min and visualize gels under UV.
10. Excise region between 34 nt and 26 nt in the footprint
samples and transfer gel slices to one 0.5 ml nonstick RNase-
free tube with a hole in the bottom. Do the same for the
control RNA.
11. Perform extraction as described above. Use 0.5 ml of 0.3 M
NaCl as elution buffer.
12. After precipitation, resuspend size-selected RNA in 10 μl of
10 mM Tris–HCl (pH 8).
13. Transfer the samples to new 1.5 ml nonstick RNase-free tubes
and store at −80 °C or proceed to the next step.
3.4.2 RNA 1. Add 33 μl of nuclease-free water to samples and denature for
Dephosphorylation 90 s at 90 °C. Let samples cool down to 37 °C and set up the
reactions according to Table 1.
2. Mix thoroughly and incubate reactions at 37 °C for 1 h.
3. Afterward, inactivate the enzyme at 70 °C for 10 min.
4. Precipitate RNAs by adding 39 μl of water, 1 μl of GlycoBlue,
and 10 μl of 3 M sodium acetate, mixing them together, and
then adding 150 μl isopropanol.
Table 1
Reaction mix for RNA dephosphorylation
Final
Component Amount (μl) concentration
RNA sample 43.0
T4 polynucleotide kinase buffer (10×) 5.0 1×
SUPERase•In RNase inhibitor (20 U/μl) 1.0 20 U
T4 polynucleotide kinase buffer (10 U/μl) 1.0 10 U
Table 2
Reaction mix for linker ligation to the RNA samples
Final
RNA and linker 10.0
T4 RNA ligase 2 truncated buffer (10×) 2.0 1×
PEG 8000 (50%, wt/vol) 6.0 15% (wt/vol)
T4 RNA ligase 2 truncated (200 U/μl) 1.0 200 U
5. Store reaction at −20 °C for at least 30 min (or overnight).

6. Pellet RNAs at 16,000 × g, 4 °C for 30 min, remove supernatant
carefully, and add 1 ml of 80% ethanol.
7. Wash RNAs at 16,000 × g and 4 °C for 20 min.
8. Air-dry pellets for 10 min and resuspend dephosphorylated
RNA in 8.5 μl of 10 mM Tris–HCl (pH 8.0).
9. Transfer samples to new 1.5 ml non-stick RNase-free tubes
and store RNAs at −80 °C or proceed to the next step.
3.4.3 Linker Ligation 1. Add 1.5 μl of preadenylated linker (0.5 μg/μl) to RNA samples
and denature for 90 s at 80 °C. Let samples cool down to
37 °C and set up the reactions according to Table 2.
2. Mix thoroughly and incubate reactions at RT for 2.5 h.
3. Precipitate RNAs by adding 338 μl of water, 1.5 μl of
GlycoBlue, and 40 μl of 3 M sodium acetate, mixing them
together, and then adding 500 μl isopropanol.
5. Pellet RNAs at 16,000 × g, 4 °C for 30 min, remove supernatant
carefully, and add 1.0 ml of 80% ethanol.
6. Wash RNAs at 16,000 × g and 4 °C for 20 min.

7. Air-dry pellets for 10 min and resuspend dephosphorylated
RNA in 5 μl of 10 mM Tris–HCl (pH 8.0).
8. Transfer samples to a new 1.5 ml non-stick RNase-free tube
and store at 80 °C or proceed to the next step.
9. Add 5 μl of 2× denaturing loading buffer to each sample, also
to the RNA marker control samples.
10. Prepare the 10 bp DNA ladder (1 μg/μl).
11. Denature samples for 90 s at 80 °C and put on ice immediately.
12. Prepare one 15% (wt/vol) denaturing-PAGE gel, prerun it
for 30 min, and load samples, ladder, and controls (10 μl per
well).
3 min, and visualize gels under UV.
14. Excise ligation products between 40 nt and 50 nt and transfer
each gel slice to a 0.5 ml non-stick RNase-free tube with a
hole in the bottom.
15. Perform extraction as described above. Use 0.5 ml of 0.3 M
NaCl as elution buffer.
16. After precipitation, resuspend size-selected RNA in 10 μl of
17. Transfer the samples to new 1.5 ml nonstick RNase-free tubes
and store at −80 °C or proceed to the next step.
3.4.4 Reverse 1. Add 2 μl of reverse transcription primer to ligated RNA sam-
Transcription ples, denature for 2 min at 80 °C in a thermal cycler and place
reactions immediately on ice.
2. Set up reactions according to the following pipetting scheme
in Table 3.
Table 3
Reaction mix for reverse transcription
Final
Ligated RNA and primer 12.0
First-strand buffer (5×) 4.0 1×
dNTPs (10 mM) 1.0 0.5 mM
DTT (0.1 M) 1.0 5 mM
SuperScript III (200 U/μl) 1.0 200 U
3. Mix thoroughly and incubate reactions in a thermal cycler at

48 °C for 30 min.
4. Hydrolyze RNA samples by adding 2.2 μl of 1 N and incubating
for 20 min at 98 °C.
5. For DNA precipitation, add 20 μl of 3 M sodium acetate
(pH 5.5), 2.0 μl of GlycoBlue, and 156 μl of water to each
reverse-transcription reaction, followed by 300 μl of
isopropanol.
7. Pellet DNAs at 16,000 × g, 4 °C for 30 min, remove superna-
tant carefully, and add 1 ml of 80% ethanol.
8. Wash DNAs at 16,000 × g and 4 °C for 20 min.
9. Air-dry pellets for 10 min and resuspend pellets in 5 μl of
10 mM Tris–HCl (pH 8.0).
10. Transfer samples to new 1.5 ml nonstick DNase-free tubes and
store DNAs at −20 °C or proceed to the next step.
3.4.5 Separation 1. Add 1.66 μl of 6× DNA loading dye and 3.34 μl of nuclease-
of Reverse-Transcription free water to each sample. Prepare 1 μl 10 bp DNA ladder
Products (1 μg/μl) and 2 μl of 1.25 μM reverse-transcription primer
from Unextended Primer similarly.
2. Prepare one 8% (wt/vol) denaturing-PAGE gel, prerun it for
30 min, and load samples, ladder, and controls (10 μl per well).
4. Excise reverse transcription products (>100 nt) and transfer
each gel slice to a 0.5 ml non-stick DNase-free tube with a
hole in the bottom.
5. Perform extraction as described above. Use 0.4 ml of DNA gel
extraction buffer as elution buffer.
6. After precipitation, resuspend size-selected DNA in 16 μl of
7. Transfer the samples to 0.2 ml PCR tubes and store at −20 °C
or proceed to the next step.
3.4.6 Circularization 1. Prepare circularization reactions according to the Table 4.

2. Incubate reactions for 16 h at 60 °C and inactivate them for
10 min at 80 °C in a thermal cycler. Circularized DNA may be
stored in the circularization reaction buffer indefinitely at
−20 °C.
3. Add 2 μl of GlycoBlue, 10 μl of 3 M sodium acetate (pH 5.5),
68 μl of water, and 150 μl of isopropanol to the samples and
store samples at −20 °C for at least 30 min (or overnight).
Table 4
Reaction mix for circularization of cDNA templates
Component Amount (μl) Final concentration

First-strand cDNA 16.0
CircLigase II buffer (10×) 2.0 1×
MnCl2 (50 mM) 1.0 2.5 mM
CircLigase II 1.0 100 U
Table 5
Reaction mix for amplification and barcode addition of the circularized
DNA templates
Component Amount (μl) Final concentration

PCR grade water 20.0
2× KAPA HiFi HotStart mix 25.0 1×
Forward library primer (10 μM) 1.5 0.3 μM
Reverse indexed primer (10 μM) 1.5 0.3 μM
Circularized DNA template 2.0
Total 50.0
4. Precipitate the circularized DNA as indicated above. Resuspend

the circularized products in 10 μl of 10 mM Tris–HCl
(pH 8.0). DNA may be stored at −20 °C.
5. Pellet circularized DNAs at 16,000 × g, 4 °C for 30 min,
remove supernatant carefully, and add 1 ml of 80% ethanol.
6. Wash DNA samples at 16,000 × g and 4 °C for 20 min.
7. Air-dry pellets for 10 min and resuspend them in 10 μl of
10 mM Tris–HCl (pH 8.0).
8. Transfer samples to new 1.5 ml nonstick DNase-free tubes and
store circularized DNAs at −20 °C or proceed to the next
step.
3.4.7 PCR Amplification 1. Set up PCR reactions according to Table 5.

and Barcode Addition 2. Use temperature cycler program in Table 6.
3. Cycle number depends on the amount of starting material and
the efficiency of each library preparation step.
4. Add 10 μl 6× DNA loading dye to each PCR reaction. Prepare
1 μl 10 bp DNA ladder (1 μg/μl) similarly.
Table 6
PCR cycling protocol for amplification and barcode addition of the
circularized DNA templates
Cycle number Denature Anneal Extend

1 95 °C—5 min
2–15 98 °C—20 s 65 °C—15 s 72 °C—15 s
5. Prepare two 8% (wt/vol) denaturing-PAGE gel, prerun it for

30 min, and load samples (split 60 μl to three wells) and ladder
(10 μl per well).
7. Excise DNA libraries between 160 nt and 180 nt (~145 nt:
Unextended RT primer) and transfer each gel slice to a 0.5 ml
nonstick DNase-free tube with a hole in the bottom.
8. Perform extraction as described above. Use 0.4 ml of DNA gel
extraction buffer as elution buffer.
9. After precipitation, resuspend size-selected DNA in 12 μl of
10. Transfer the samples to 0.2 ml PCR tubes and store at −20 °C
or proceed to the next step.
11. Analyze libraries using a High Sensitivity DNA chip on a 2100
Bioanalyzer. The expected size band in the footprint libraries
is between 163 and 175 nucleotides.
12. Sequence libraries on an Illumina NextSeq500 using a NextSeq
500/550 Mid Output v2 kit (150 cycles) according to the
manufacturer’s protocol.
4 Notes
1. Cycloheximide, which arrests translating ribosomes allowing

translation initiation site mapping, should be added to the cell
culture prior to lysis for only 2 min, since it has been shown
that it stabilizes RNA molecules in T. brucei [8].
2. No depletion of ribosomal RNA during library preparation.
3. To determine in advance the fraction containing the 80S
monosome peak in the sucrose gradient, we recommend to
prepare a test run beforehand and measure the absorbance of
the gradient at 254 nm using a continuous UV monitor. The
80S monosome peak should be larger for the digested sample
compared to the undigested sample.
Acknowledgments
We thank T. Nicolai Siegel and Juan José Vasquez for establishing

the ribosome profiling protocol in Trypanosoma brucei. This work
was funded by a European Research Council Starting Grant (3D_
Tryps 715466). R.O.C was supported by a Georg Forster
Fellowship (Humboldt Foundation).
References
1. Clayton CE (2002) Life without transcriptional 5. Ingolia NT et al (2012) The ribosome profiling
control? From fly to man and back again. strategy for monitoring translation in vivo by
EMBO J 21(8):1881–1888 deep sequencing of ribosome-protected mRNA
2. Ingolia NT et al (2009) Genome-wide analysis fragments. Nat Protoc 7(8):1534–1550
in vivo of translation with nucleotide resolution 6. Jensen BC et al (2005) Species specificity in
using ribosome profiling. Science 324(5924): ribosome biogenesis: a nonconserved phospho-
218–223 protein is required for formation of the large
3. Vasquez JJ et al (2014) Comparative ribosome ribosomal subunit in Trypanosoma brucei.
profiling reveals extensive translational com- Eukaryot Cell 4(1):30–35
plexity in different Trypanosoma brucei life 7. Ingolia NT (2010) Genome-wide translational
cycle stages. Nucleic Acids Res 42(6): profiling by ribosome footprinting. Methods
3623–3637 Enzymol 470:119–142
4. Smircich P et al (2015) Ribosome profiling 8. Webb H et al (2005) Developmentally regu-
reveals translation control as a key mechanism lated instability of the GPI-PLC mRNA is
generating differential gene expression in dependent on a short-lived protein factor.
Trypanosoma cruzi. BMC Genomics 16:443 Nucleic Acids Res 33(5):1503–1512
Chapter 6
Cosmid Library Construction and Functional Cloning

Joachim Clos and Dorothea Zander-Dinse
Abstract
Cosmid libraries can represent an entire genome in a library of circular DNA molecules, allowing for the
faithful amplification, cloning and isolation of large genomic DNA fragments. Moreover, using the so-
called shuttle cosmid vectors, genomic DNA may be propagated in bacteria and in eukaryotic cells, which
is a prerequisite for classic functional cloning and for the newly described Cos-Seq strategies.
Key words High-quality gDNA extraction, Cosmid library preparation, Cosmid library evaluation,
Functional cloning
1 Introduction
Trypanosomatid microorganisms are well-established genetic

model organisms used to investigate complex traits such as viabil-
ity, fitness, stress resistance including drug tolerance, infectivity,
and pathogenicity. Reverse genetic approaches, that is, gene
replacement followed by phenotype analysis, are in wide use and
have recently been augmented by techniques such as CRISPR/
cas-mediated gene editing [1, 2] and DiCRE recombination [3].
African trypanosomes and the Viannia subgenus of Leishmania
also accommodate RNA interference-based gene knockdown
approaches [4–6]. The ectopic expression of genes from circular
episomes, by contrast, is feasible in old-world Leishmania spp. [7],
the L. mexicana [8] and L. amazonensis [9] complexes of South
and Central America and in Trypanosoma cruzi [10]. This gave rise
to the application of complementation genetics in Leishmania spp.
whereby the cultured parasites are transfected with the DNA of a
genomic DNA library and selected for specific traits. A first prereq-
uisite was the development of shuttle cosmid vectors that could be
propagated both in E. coli bacteria and in trypanosomatid proto-
zoa. Shuttle cosmids cLHYG and cLNEO [11] and pcosTL [10]
accomplished that and facilitated the identification of genes
123
124 Joachim Clos and Dorothea Zander-Dinse
involved in the expression of virulence-mediating glycoconjugates

on the surface of Leishmania promastigotes [12–16].
The successful generation of cosmid libraries depends on the
quality of the genomic DNA, the generation of suitably sized
gDNA fragments, an efficient ligation, and a suitable commercial
bacteriophage packaging kit.
To prepare gDNA inserts of between 30,000 and 40,000 base
pairs (bp), the isolated genomic DNA must have a high quality,
that is, a minimal length of 200 kbp. This is due to the necessity to
perform a limited restriction enzyme digest of the DNA to gener-
ate fragments of the desired length that carry the required compat-
ible ends for the subsequent ligation. Shorter gDNA will likely give
rise to restriction fragments with one or two random ends.
Therefore, the use of commercial gDNA isolation kits is not feasi-
ble since they subject gDNA to shearing. Using a gentle phenol
extraction followed by ethanol precipitation and spooling mini-
mizes shearing of long DNA molecules [17].
For the preparation of inserts, gDNA is ideally digested with a
restriction enzyme that recognizes a short, four-base pair site with
at least 50% GC content (e.g., Sau3AI). This will provide a reason-
able distribution of restriction sites and a sufficiently random distri-
bution of cuts. Various concentrations of restriction enzyme
between 0.005 units μg−1 of DNA and 0.04 units μg−1 of DNA
must be tested empirically, and the products are analyzed by hori-
zontal agarose gel electrophoresis to determine the enzyme-to-
DNA ratio that yields fragments of the desired size (30,000 to
45,000 bp). The use of field inversion electrophoresis or pulse field
electrophoresis is recommended since conventional agarose elec-
trophoresis has a poor resolution at fragment sizes >10 kbp.
To prevent the formation of concatenated inserts from multi-
ple smaller restriction fragments, the inserts must be treated with
phosphatase before ligation.
2 Materials
2.1 Cell Culture 1. Medium 199, Hanks’ Salts (Sigma) supplemented with 20%
fetal calf serum (batch-tested, heat-inactivated), 100 μM ade-
nine, 10 μg/ml heme, 40 μM HEPES (pH 7.4), 1.2 μg/ml
6-biopterin, and 20 μg/ml gentamycin [18].
2. TE buffer: 10 mM Tris–HCl (pH 8.0), 1 mM EDTA [17].
3. Phosphate-buffered saline = PBS, pH 7.4.
2.2 Cell Lysis 1. Extraction buffer: 10 mM Tris–HCl pH 8.0; 100 mM EDTA,
and DNA Extraction pH 8.0; 0.5% SDS; 40 μg/ml RNase A.
2. 10 μg/μl RNaseA stock in distilled water.
3. 20 μg/μl Proteinase K stock.
Cosmid Library Construction and Functional Cloning 125
Fig. 1 Tip of a Pasteur pipette molten into a hook
4. Tris-saturated phenol (pH 8).

5. Chlorofom–isoamyl alcohol mix (24:1).
2.3 DNA 1. Ethanol, puriss (>96%).

Precipitation 2. Glass Pasteur pipette with end molten into a hook (Fig. 1).
and Spooling
3. TE buffer: 10 mM Tris–HCl (pH 8.0), 1 mM EDTA [17].
4. Agarose LE (SeaKem).
5. Field inversion gel electrophoresis: Tris–borate–EDTA buffer
(TBE) 10× concentrate: 1.5 M Tris; 100 mM NaCl; pH 7.2.
Dilute 1:20 in H2O before use.
(or)
6. Standard agarose gel electrophoresis: Tris–acetate–EDTA buf-
fer 50× concentrate [17]: 242 g Tris; 57.1 ml acetic acid;
100 ml of 0.5 M EDTA (pH 8). Dilute 1:50 in H2O before
use.
7. 0.2 μg/ml ethidium bromide solution.
2.4 Partial 1. 400 units/μl restriction endonuclease Sau3A1, New England

Restriction Enzyme Biolabs, and 10× NEBuffer 1.1.
Digest of gDNA 2. Agarose LE, SeaKem.
3. Tris–acetate–EDTA buffer 50× concentrate [17]: 242 g Tris;
57.1 ml acetic acid; 100 ml of 0.5 M EDTA (pH 8). Dilute
1:50 in H2O before use.
4. Formamide loading buffer: Mix 9 ml formamide with 1 ml TE
buffer (see Subheading 2.3, item 3). Add 50 mg each of bro-
mophenol blue (Sigma-Aldrich) and of xylene cyanol (Sigma-
Aldrich) and mix briefly.
6. Antarctic phosphatase (5 units/μl, New England Biolabs).
7. 100 mM stock solution of 1,10-phenanthroline (Sigma-
Aldrich) in H2O.
8. Phenol–chloroform–isoamyl alcohol mix (25:24:1; Tris-

buffered, pH 8.0).
9. Ethanol, 96%.
2.5 Preparation 1. Restriction endonuclease SmaI (New England Biolabs) with

of Cosmid Vector Arms CutSmart Buffer.
2. Restriction endonuclease BamHI HF (New England Biolabs)
with CutSmart Buffer.
3. Antarctic phosphatase, 5 units/μl, New England Biolabs.
4. Agarose LE, SeaKem.
6. Formamide loading buffer: Mix 9 ml formamide with 1 ml
TE buffer (see Subheading 2.3, item 3). Add 50 mg each of
bromophenol blue (Sigma-Aldrich) and of xylene cyanol
(Sigma-Aldrich) and mix briefly.
8. Gene Clean II kit, MPO Biomedicals.
9. Phenol–chloroform–isoamyl alcohol mix (25:24:1; Tris-buffered,
pH 8.0).
10. Ethanol, 96%.
2.6 Ligation 1. 50 mM adenosine triphosphate (ATP) solution.

2. T4 DNA Ligase, New England Biolabs, with 10× T4 Ligase
Reaction Buffer.
2.7 Packaging 1. Gigapack Gold III Packaging Kit, Agilent.

2. SM buffer: 100 mM NaCl; 20 mM MgSO4; 50 mM Tris–
HCl, pH 7.5; 0.01% gelatin.
3. Chloroform.
2.8 Infection 1. E. coli strain XL-1Blue (Agilent).

of Bacteria 2. Luria–Bertani agar plates (LB agar plates).
3. Luria–Bertani medium (LB medium).
4. 10 mM MgSO4 solution.
5. 5 mg/ml ampicillin solution.
2.9 Transfection 1. NucleoBond Xtra Max Kit (Macherey-Nagel, Düren, Germany).

of Leishmania with 2. Modified Medium 199: 1× Medium199 with Hanks’ salts
Cosmid Library DNA (Sigma), 20% (v/v) fetal calf serum, 0.035% (w/v) NaHCO3,
40 mM HEPES (pH 7.4), 10 μg/ml heme, 100 μM adenine,
1.2 μg/ml 6-biopterin, 2 mM glutamine.
3. Electroporation buffer: 21 mM HEPES (pH 7.5), 137 mM

NaCl, 5 mM KCl, 0.7 mM Na2HPO4, 6 mM glucose.
4. Freeze medium: 50% modified M199, 30% fetal calf serum,
20% DMSO (cell culture grade).
3 Methods
3.1 Cell Culture 1. Leishmania promastigotes are grown in axenic liquid medium
culture, monitoring cell density at daily intervals.
2. From a logarithmically growing culture, 4–5 × 109 cells are
collected and sedimented by centrifugation at 1200 × g, 4 °C
for 10 min.
3. The cell pellet is washed twice in 20 ml of 1× PBS and sedi-
mented by centrifugation at 1200 × g, 4 °C for 10 min.
4. After washing, promastigotes are suspended in TE buffer at
1 × 109 cells/ml.
3.2 Cell Lysis, DNA 1. To the cell suspension, add ten volumes of extraction buffer
Extraction and 40 μg/ml RNaseA; incubate at 37 °C for 1 h.
2. Add Proteinase K at 0.1 μg/μl; incubate at 50 °C for 3 h.
Steps 3–7. to be performed in a fume hood wearing solvent-
resistant gloves (nitrile gloves) and facial protection.
3. Transfer cell lysate to 100 ml separation funnel (Fig. 2) and
add one volume of Tris-saturated phenol (pH 8.0); mix gently.
Fix with clamp and leave in fume hood overnight.
Fig. 2 Phenol extraction using separation funnel

4. Using the stop cock, drain the lower, organic phase into a
waste container, but leave the interphase!
5. Repeat Subheadings 3 and 4 once.
6. To the aqueous phase, add 0.5 volumes each of Tris-saturated
phenol and of chloroform–isoamyl alcohol mix (24:1); mix
gently. Hold the stopper carefully. After mixing, place separa-
tion funnel in clamp, carefully open stopper once to release
fumes. Leave overnight.
7. Carefully transfer the aqueous phase to a 50 ml centrifuge
tube (any type of “50 ml Falcon tube”).
3.3 DNA 1. To the recovered aqueous phase, add 0.2 volumes of 7.5 M
Precipitation ammonium acetate solution and mix gently.
and Spooling 2. Overlay the aqueous phase with 1 volume of pure ethanol
(>96%). Using a glass hook (see Subheading 2.3, item 2,
Fig. 1), gently stir the border between aqueous and ethanol
phase, thereby spooling the high molecular weight DNA onto
the glass hook.
3. Break off the hook into a 2 ml reaction vial using a strong
forceps and add 500 μl of TE buffer, covering the glass. Place
on a roller mixer at very low speed for at least 24 h to dissolve
the high molecular weight DNA without shearing.
4. Determine the OD260 nm and OD280 nm of a 10 μl aliquot diluted
1:100 in TE buffer. The ratio OD260 nm/OD280 nm should be
1.8; higher ratios indicate RNA contamination. Calculate
gDNA concentration as OD260 nm × 100/21 (see Note 1).
5. Check the quality of the gDNA by electrophoresis of a 1 μg
aliquot by field inversion gel electrophoresis (FIGE, 1% aga-
rose in 0.5× TBE buffer, 7 V cm−1, 16 h, forward–reverse 2:1)
[19] or, if not available, by horizontal agarose gel electropho-
resis (0.8% agarose in 1× TAE buffer, 2 V cm−1, 12 h, buffer
circulation). Stain the gel for 15–30 min in 0.5 TBE buffer
with ethidium bromide, destain in buffer for 20 min. View gel
on UV (λ > 300 nm) transilluminator. The majority of the
gDNA should migrate as >200 bp fragments (FIGE) or be
stuck in the gel loading well (agarose gel electrophoresis).
3.4 Partial 1. In the first step, the best DNA–enzyme ratio must be deter-
Restriction Enzyme mined. We generally use the restriction endonuclease Sau3A1
Digest of gDNA for partial digests, generating fragments with 5′-GATC
overhangs that are compatible in ligation with the 5′-GATC
overhangs generated with the BamHI restriction endonucle-
ase (5′-G|GATCC-3′). A series of restriction digests with con-
stant substrate amount and increasing enzyme concentrations
is prepared. Firstly, the restriction endonuclease is diluted

(enzyme mix). Secondly, a master mix is prepared containing
gDNA (5 μg/sample) and reaction buffer. Following the
pipetting scheme for enzyme titration, water and gDNA
Master Mix are pipetted into the bottoms of eight 1.5 ml reac-
tion vials. The various amounts of Enzyme Mix are then pipet-
ted against the inside of the reaction vials, closing the vials
immediately after. Using a tabletop centrifuge, the eight reac-
tion vials are spun briefly to collect the complete reactions at
the bottoms of the vials, starting the digests. The vials are then
placed in a water bath set to 37 °C and incubated for 1 h.
Then, 2 μl each of 500 mM EDTA (pH 5.6) are added to the
samples which are then heated to 70 °C for 10 min to inacti-
vate the restriction enzyme.
2. While the digest is running, a 0.8% agarose gel with 1× Tris–
acetate–EDTA buffer is cast. Gel rigs with buffer circulation
are strongly recommended (see Note 2).
3. Mix 10 μl aliquots from each digest with 2 μl of formamide
loading buffer, and apply the samples to the agarose gel along-
side a DNA fragment size marker (e.g., λ phage DNA/HindIII).
Run the gel at moderate voltage (2 V/cm of electrode dis-
tance) overnight under buffer circulation. Use ethidium
bromide-resistant gloves, lab coat, and eye protection! Carefully
place the gel in 500 ml of ethidium bromide solution (0.2 μg/
ml) for 1 h. Drain the ethidium bromide solution and gently
wash the gel twice for 30 min with 500 ml of distilled water
(see Note 3). Place the gel on a 302 nm transilluminator and
take a photograph of the gel. Use different exposures to select
an enzyme concentration that reduces the undigested gDNA
(arrowhead) without producing too much fragments in the
<10 kbp range (Fig. 3).
4. Once the best enzyme–gDNA ratio is known, eight identical
digests are prepared using the selected amount of enzyme.
Since restriction endonuclease digests may be affected by
DNA and enzyme concentration, but also the reaction vol-
ume, all parameters are preserved in the preparative digest.
After incubation at 37 °C for 1 h, aliquots are taken again and
analyzed by agarose gel electrophoresis (see Subheading 3).
Samples are then pooled.
5. To the pooled Sau3AI digests (320 μl) add 36 μl of 10×
Phosphatase- buffer buffer and 8 μl Antarctic phosphatase
(1 units/μg DNA). Incubate at 37 °C 15–30 min. Add 1 μl of
1,10-phenanthroline solution and incubate at 65 °C for 5 min
to inactivate the phosphatase.
Fig. 3 Titration of the Sau3A1 restriction endonuclease against 5 μg of L. don-

ovani gDNA. Lane headings: units of Sau3A1 per reaction; left side: marker DNA
fragment sizes; arrow: position of undigested gDNA; asterisk: selected enzyme
concentration
Enzyme mix
Sau3AI 36 units
10× NEBuffer 1.1 3.6 μl
H2O add 36 μl
6. Add 1 volume of phenol–chloroform–isoamyl alcohol mix

(25:24:1), mix gently for 5 min, spin at 6000 × g for 2 min,
and remove the lower, organic phase, leaving the interphase.
gDNA master mix

gDNA (5 μg/sample) 45 μg
10× NEBuffer 1.1 36 μl
100× BSA 3.6 μl
H2O add 135 μl
7. Add 1 volume of chloroform–isoamyl alcohol mix (24:1), mix

gently for 5 min, spin at 6000 × g for 2 min and transfer the
aqueous phase to a fresh 1.5 ml reaction vial.
8. Add 0.1 volume of 7.5 M ammonium acetate and 2.5 volumes
of ethanol, mix gently and sediment by centrifugation at
14,500 × g and 25 °C for 30 min. Carefully remove the super-
natant and dispose. Add 40 μl of distilled water and dissolve

pellet overnight at 4 °C. Measure OD260 nm and calculate
gDNA concentration as OD260 nm × 100/21 (see Note 1).
Pipetting scheme for enzyme titration
Sample 1 2 3 4 5 6 7 8 9
H2O [μl] 24.8 24.6 24.4 24.2 24.0 23 μl 23.6 23.4 23.2
gDNA mix [μl] 15
Enzyme-mix (0.125 units/μl) 0.20 0.40 0.60 0.80 1.00 1.20 1.40 1.60 1.80
Enzyme units 0.025 0.050 0.075 0.100 0.125 0.150 0.175 0.200 0.225
3.5 Preparation 1. Mix 40 μg pcosTL circular DNA with 20 μl 10× CutSmart
of Cosmid Vector Arms buffer, 60 units of SmaI restriction endonuclease, and add
H2O to 200 µl. Incubate at 25 °C for 1 h. Add ten units of
SmaI and continue incubation at 25 °C for another hour
(see Note 4).
2. Add 22 μl 10× NEB Phosphatase-buffer and 20 units
Antarctic phosphatase to the reaction. Incubate at 37 °C for
15–30 min. Dephosphorylation will prevent ligation of the
blunt end SmaI ends. Add 1/100 volumes of
1,10-phenanthroline stock (100 mM) and heat to 65 °C for
5 min. Cool down to RT.
3. Add 200 μl of phenol–chloroform–isoamyl alcohol mix
(25:24:1) and mix for 5 min using a benchtop mixer.
Centrifuge for 2 min at 10,000 × g and carefully remove and
discard the lower phase. Add 200 μl of chloroform–isoamyl
alcohol mix (24:1), mix for 5 min using a benchtop mixer and
centrifuge for 2 min at 10,000 × g. Transfer the upper, aque-
ous phase to a fresh reaction vial.
4. Add 20 μl of 7.5 M ammonium acetate and 600 μl of 96%
ethanol. Mix thoroughly by turning the vial bottom over top
repeatedly. Immediately sediment the DNA by centrifugation
at 14,000 × g, 25 °C for 20 min (see Note 5). Remove the
supernatant carefully, spin briefly to collect remaining super-
natant and remove that, too. Add 100 μl of H2O and dissolve
pellet for 1 h at RT. Remove a 2 μl aliquot, mix with 2 μl of
formamide sample buffer, and store at RT for later analysis.
5. To the remaining 100 μl of SmaI-digested cosmid vector,
add 15 μl of 10× CutSmart buffer, 60 units of BamHI HF
restriction endonuclease and fill to 150 μl with H2O. Incubate
at 37 °C for 1 h. Add 20 units of BamHI HF and continue
incubation at 37 °C for another 1 h.
6. Cast a 1%, 1 cm deep agarose (LE agarose) gel with 1× Tris–
acetate–EDTA (TAE) buffer and insert a wide-toothed,
1.5 mm thick comb for preparative scale electrophoresis. Once

polymerized, remove the comb and fill the gel rig with 1×
TAE buffer.
7. To the BamHI reaction, add 50 μl of 90% formamide sample
buffer and mix. Distribute the digested DNA in sample buffer
into as few sample wells as possible. In a separate sample well,
load 1 μg of a marker (1 kb marker). Apply voltage (3 V cm−1
electrode distance) and run for 3 h. Use ethidium bromide-
resistant gloves, lab coat and eye protection! Stain the gel in
500 ml of ethidium bromide solution (0.2 μg/ml) for 10 min,
wash briefly with distilled water, and place the gel on a 360 nm
UV transilluminator plate (see Note 6). Using a disposable
scalpel and taking care to avoid damaging the gel tray, cut the
fluorescent bands at ~3.8 and ~4.8 kbp from the gel. Place the
gel pieces in 2 ml reaction vials.
8. Weigh the vials and determine the net weight of the gel pieces.
Add 1 μl of the 3 M NaI solution from the GeneClean kit per
mg of gel and incubate at 50 °C until the gel pieces are dis-
solved. Add 20 μl of freshly suspended glass beads to each vial
and incubate at RT for 5 min. Spin at RT for 1 min, 5000 × g.
Carefully remove the supernatant and add 500 μl 1× NEW
wash. Do not vortex! Incubate at RT for 10 min and spin
down (1 min, 5000 × g). Remove the NEW wash and replace
with 500 μl of fresh NEW wash. Again, incubate at RT for
10 min, spin the glass beads down (1 min, 5000 × g), and
remove the NEW wash. Spin briefly again to collect residual
NEW wash and remove that, too. Add 40 μl of H2O and sus-
pend the glass beads by gentle, up-and-down pipetting.
Incubate the suspension at 60 °C for 5 min and spin down the
glass beads (10,000 × g, 1 min, RT). Collect the supernatants
and pool them in a fresh reaction vial. Remove a 2 μl aliquot
and mix with 2 μl 90% formamide loading buffer.
9. Analyze the products of the SmaI and the BamHI digests by
agarose (1%) electrophoresis. Load 0.2 μg of a linearized plasmid
DNA as reference on the same gel. The bands from the vector
preparation should be of equal intensity as the plasmid control
and run at ~3.8 kbp and 4.8 kbp, respectively. In addition, deter-
mine the concentration of vector arms by UV spectrometry.
3.6 Ligation 1. For the ligation, plan on a vector–insert molecular ratio of

10:1. The vector, pcosTL, has a molecular mass of 8730 × 660
= 5.67 × 106. Thus, 1 μg represents 1.76 × 10−13 moles,
0.176 pmoles. Insert sizes vary from between 32 kbp and
40 kbp, that is, ~36 kbp on average or a molecular mass of
2.16 × 107. Thus, 1 μg represents 4.63 × 10−14 moles,
0.046 pmoles. Therefore, 1 μg of insert gDNA requires 4.63
× 10−14/1.76 × 10−13 × 10 = 2.63 μg of vector arms.
2. Prepare a diluted enzyme mix of 80 units/μl in 1× ligase

buffer.
3. Prepare three ligation reactions following the pipetting scheme
and incubate at 8 °C overnight.
4. Take 2 μl aliquots from each reaction, mix with 2 μl of 90%
formamide gel loading buffer and analyze on a 1% agarose/
TAE gel (Fig. 4c).
3.7 Packaging (See 1. Collect packaging extract aliquots from the −80 °C storage
Note 7) and thaw quickly between fingers. Once the contents start to
thaw, add 0.5 μg of DNA from a ligation reaction and stir
gently with the pipet tip. Collect the reaction at the bottom of
the tube with a short centrifuge spin. Incubate packaging reac-
tion at RT for 2 h.
2. Ad 500 μl of SM buffer to the reaction.
3. Ad 20 μl of chloroform and mix gently.
4. Briefly spin the tube at 10,000 × g to sediment debris.
5. Transfer the supernatant containing the newly assemble phage
particles to a fresh reaction vial. Prepare 1:10 and 1:50 dilu-
tions of the supernatant in SM buffer. Supernatant may be
stored for up to 1 month at 4 °C.
Vector − ligase Vector + ligase Vector + ligase + gDNA

ATP (50 mM) 2 2 2
10× ligase buffer 2 2 2
Vector arm DNA 2.63 μg 2.63 μg 2.63 μg
gDNA Ø Ø 1 μg
Ligase mix (80 units/μl) Ø 1 μl 1 μl
H2O Add 20 μl Add 20 μl Add 20 μl
3.8 Infection 1. Plate single colonies of Escherichia coli strain XL1-Blue on

of Bacteria antibiotic-free Luria–Bertani agar plates and place in an incu-
bator at 37 °C overnight. From a single colony, inoculate
100 ml of sterile, antibiotic-free Luria–Bertani (LB) medium
in a 250 ml Erlenmeyer flask and incubate overnight at
37 °C/120 rpm.
2. Inoculate 50 μl of the overnight culture into 100 ml of LB
medium supplemented with 10 mM MgSO4 and 0.2% (w/v)
maltose. Place in an incubator shaker at 37 °C/120 rpm and
monitor the OD600 nm at hourly intervals until OD600 nm = 0.5.
3. Sediment the bacteria at 500 × g for 10 min; gently resuspend
the bacteria in 50 ml of sterile 10 mM MgSO4, then dilute with
10 mM MgSO4 to OD600 nm = 0.5. The bacteria are now ready
for bacteriophage infection and should be used immediately.
Fig. 4 Preparation of cosmid arms and ligation. The vector pcosTL (a) is cut with SmaI and subsequently with
BamHI to yield the left and right cosmid arms (b) each with blunt ends due to SmaI digest and BamHI/Sau3A1-
compatible ends. (c) Analysis of ligation products by agarose gel electrophoresis. Cosmid arms without and with
ligase, but also cosmid arms ligated with gDNA inserts are shown. V Cosmid vector; VA Vector arm, M Marker
4. Mix 25 μl of the packaging reaction and the 1:10 and 1:50
dilutions, respectively, from Subheading 3.7, step 5. with
100 μl of the bacteria in a 1.5 ml reaction vial. Incubate at RT
for 30 min.
5. Add 200 μl LB medium to each sample and incubate at 37 °C
for 1 h, gently shaking the vial every 15 min. This step allows
expression of the ampicillin resistance.
6. Spin at 6000 × g for 1 min. Remove all but 100–150 μl of the
supernatant. Resuspend the cell pellet in the leftover
supernatant and distribute the suspension on an LB medium
agar plate containing 50 μg/ml ampicillin using a Drigalski
spatula and a spin table. Incubate at 37 °C overnight.
3.9 Quality Control 1. From the number of ampicillin-resistant clonal colonies on the
LB agar plates, the number of colony-forming units in each
infection can be calculated. To achieve a full coverage of the
genome with 99% certainty, >4200 individual cosmid-bearing
clones are required [20].
2. Genome coverage of a library can be tested by next generation
sequencing of the cosmid DNA from the library in E. coli.
Cosmid DNA is isolated from a bacterial culture using the
Nucleobond Xtra Maxi kit (Machery & Nagel). The DNA is
then processed by fragmentation and library building. Libraries
are then subjected to NGS, and the reads are aligned to the
relevant Leishmania genome using the Bowtie 2.0 algorithm.
Figure 5 shows such an alignment indicating a high degree of
genome coverage in a cosmid gDNA library. For further
instructions and information, contact your local sequencing
core facility or a commercial sequencing service provider. This
type of verification is a prerequisite for the Cos-Seq strategy of
functional cloning (see Chapter 7).
3.10 Final Now the remainder of the packaging reaction is used to infect the
Preparation bacteria.
of the Cosmid Library
1. Prepare bacteria for infection as described (see Subheading
3.8, steps 1–3).
2. Mix 2× 250 μl of packaging extract with 500 μl of the bacteria
in a 13 ml vented centrifuge tube and incubate at room tem-
perature for 30 min.
3. Add 2.5 ml of LB medium to each sample and incubate for 1 h
at 37 °C, shaking the tube gently once every 15 min.
4. Spin the tube for 5 min at 10,000 × g; remove the supernatant
but for 100–200 μl.
5. Suspend the pellet in leftover medium and plate it on LB/
Amp plates, using a Drigalski spatula. Incubate the plates
overnight at 37 °C.
Fig. 5 Next generation sequencing of cosmid library DNA and alignment of NGS reads to chromosomes 34, 35,
and 36, indicating a high degree of genome coverage in the library
6. Working in a sterile safety cabinet, count the colonies on each

plate. If there are too many colonies, count two opposing 1/8
sections and calculate the total. There should be at least 5000
colonies to reliably represent the Leishmania genome with
99% certainty.
7. Prepare 50 ml LB-Medium with ampicillin (50 μg ml−1);
prepare a sterile 50 ml centrifuge tube and place it on ice.
8. Using 1.5 ml of the LB/Amp medium and a cell scraper, care-

fully collect all bacterial colonies from the agar plates. Collect
bacteria in the 50 ml tube.
9. Repeat step 8 twice; pool the suspended bacteria in the pre-
pared 50 ml tube. Add LB medium to 10 ml.
10. Set aside 10 μl of the pooled bacteria for later titration.
11. Add 2 ml of glycerol (86%) to yield a final concentration of
14.3% and ampicillin to 50 μg ml−1. Mix well and prepare 1 ml
aliquots. Freeze for 2 h at −20 °C, then transfer to −80 °C
storage.
12. Using the aliquot set aside in step 10, prepare serial tenfold
dilutions in LB/Amp medium from 1:100 to 1:1,000,000.
Plate aliquots from each dilution on LB/Amp/agar plates,
incubate o/n at 37 °C and count the colonies. Calculate the
colony-forming units per ml.
3.11 Transfection Transfection of Leishmania spp. is done by electroporation, either

using generic electroporation techniques [21] or more specialized
nucleofection technology
1. Inoculate ≥100,000 colony-forming units of the library in
E. coli into 500 ml of LB medium and add ampicillin to 20 μg/
ml (see Note 8). Incubate at 37 °C under shaking (120 rpm)
until the culture reaches an OD600 nm of 0.5. Perform lysis and
cosmid DNA preparation using the NucleoBond® Xtra Maxi-
Kit according to the manufacturer’s manual. Concentration is
measured photometrically at 260/280 nm [17].
2. Grow a 100 ml culture of Leishmania promastigotes in com-
plemented Medium 199 to mid-logarithmic growth phase
(4–5 × 106 cells/ml). Sediment the cells gently by centrifuga-
tion (800 × g/4 °C/10 min) in sterile 50 ml conical bottom
tubes. Wash twice with cold PBS and once in ice-cold electro-
poration buffer. Adjust the promastigote suspension to
108 cells/ml.
3. Prepare 12 sterile electroporation cuvettes (4 mm gap) and
place them on ice. Add 50 μg of cosmid library DNA to each
of 10 cuvettes. Add 10 μg of cosmid pcosTL to N° 11 cuvette
and the equivalent volume of TE buffer to N° 12. Fill all
cuvettes with 400 μl each of the promastigote suspension and
keep the cuvettes on ice.
4. Treat each cuvette with three pulses of 1.5 kV, 200 Ω, 25 μF
and a time-constant of 0.9 to 1.5 (Bio-Rad Gene Pulser).
Return to the ice for 10 min for recovery. Transfer the popula-
tion from the cuvettes individually to 25 cm2 tissue culture
flasks, prefilled with 10 ml of modified M199 each. Incubate
o/n at 25 °C, then add G418 antibiotic to 50 μg/ml.
5. From two or three populations transfected with library DNA

take small aliquots and perform a limiting dilution analysis
under G418 antibiotic selection as described in Chapter 16
(Quantification of Leishmania Parasites in Murine Models of
Visceral Infection) to determine the number of transfected
clones per electroporation reaction. From this calculate the
total amount of transfected clones in the ten cosmid DNA
transfections. The total number should exceed 6000 to ensure
adequate coverage of the Leishmania genome.
6. Cultivation under G418 selection must be continued for 2–3
passages until the cultures show logarithmic growth. The
mock transfection population must be dead by then. The pop-
ulation transfected with the cosmid vector should also grow
under G418 selection and will serve as proper negative control
for selection screens.
7. Given that the transgenic populations grow well under anti-
biotic selection and the total number of clones exceeds 6000,
the ten populations transfected with cosmid library DNA can
be pooled, collected by sedimentation, resuspended at
1 × 108 cells/ml in freeze medium, and slowly frozen in ali-
quots to be stored over liquid nitrogen.
3.12 Selection 1. Thaw aliquots of the library DNA-transfected populations and

of the vector control population and inoculate into fresh mod-
ified M199 with 50 μg/ml G418. Incubate at 25 °C until late
logarithmic (<107 cells/ml) and dilute to 2 × 106 cells/ml in
fresh M199 with 50 μg/ml G418.
2. From mid-logarithmic growth, seed aliquots of ≥107 cells into
medium containing the selective compound at IC90.
Alternatively, the vector control and the cosmid library trans-
fected population may be exposed to physical challenges or
used for infection of model hosts or host cells. The range of
selective regimens is limited only by the imagination of the
experimentator. During the experimental selection the G418
antibiotic should be omitted to avoid cross-selection artifacts.
3. Once a population with the desired phenotype (resistance, viru-
lence, etc.) has been selected, the population as such or isolated
clones thereof can be subjected to full phenotypic evaluation.
4. From the selected population(s) or clones of recombinant
leishmaniae, the cosmid episomes can be harvested by the clas-
sic alkaline lysis, plasmid mini preparation protocol [22].
5. The resulting cosmid DNA may then be used to transform
library-grade competent E. coli DH5α cells (Life Technologies).
From colonies of transformed E. coli, the cosmid DNA can be
isolated either by alkaline lysis protocol or by using a plasmid
mini preparation kit. Between 24 and 48 cosmid preparations
can be subjected to a first analysis by restriction analysis (e.g.,
with an EcoRV and BamHI combination) to compare restriction
fragment patterns. From this, one can already determine

whether one or more individual cosmids were selected.
6. From each fragment pattern group, two prototypes are then
selected for partial sequence analysis using universal sequenc-
ing primers directed against the vector sequences flanking the
insertion site. The sequence information is then aligned to the
genome database and used to bracket the chromosome regions
represented by the cosmid inserts. Overlapping inserts can
dramatically reduce the number of candidate genes.
7. The individual coding sequences found in the cosmid inserts
can then be amplified and expressed ectopically to determine
the gene(s) responsible for the selected genetic trait.
4 Notes
1. It is important that the gDNA is completely dissolved to avoid

unreliable results in UV densitometry.
2. Do not add ethidium bromide to the gel or to the sample as it
will reduce the resolution of large DNA molecules. For running
buffers consult [17].
3. Dispose of ethidium bromide-containing wastes according to
your local guidelines and environmental protection laws!
4. SmaI restriction endonuclease requires an incubation at 25 °C,
unlike most other restriction endonucleases.
5. DNA precipitates rapidly at room temperature and does not
require sub-zero temperatures. Sedimentation, too, is best
performed at room temperature. Yields only depend on the
presence of suitable counterions (NH4+ or Na+) and on the
length of the sedimentation.
6. Never use short wavelength UV light (<300 nm) for prepara-
tive agarose gels as it will damage the DNA. Use 360 nm
transilluminator plates and use the UV light sparingly.
7. Do not use polyethylene glycol-containing ligase buffers as
they may interfere with the packaging.
8. Cosmids do not attain the same high copy numbers as plasmids;
therefore, a lower antibiotic pressure is required.
Acknowledgments
We thank former coworkers Cornelia Hoyer, Katja Mellenthin,

Andrea Nühs, Paloma Tejera Nevado, and Eugenia Bifeld for
developing the technologies, John Kelly for the gift of pcosTL
cosmid, and former and current members of the research group for
discussions and suggestions.
References
1. Sollelis L, Ghorbal M, MacPherson CR, 11. Ryan KA, Dasgupta S, Beverley SM (1993)
Martins RM, Kuk N, Crobu L, Bastien P, Shuttle cosmid vectors for the trypanosomatid
Scherf A, Lopez-Rubio JJ, Sterkers Y (2015) parasite Leishmania. Gene 131(1):145–150
First efficient CRISPR-Cas9-mediated genome 12. Ryan KA, Garraway LA, Descoteaux A, Turco
editing in Leishmania parasites. Cell Microbiol SJ, Beverley SM (1993) Isolation of virulence
17(10):1405–1412. https://doi. genes directing surface glycosyl-
org/10.1111/cmi.12456 phosphatidylinositol synthesis by functional
2. Zhang WW, Matlashewski G (2015) CRISPR- complementation of Leishmania. Proc Natl
Cas9-mediated genome editing in Leishmania Acad Sci U S A 90(18):8609–8613
donovani. MBio 6(4):e00861. https://doi. 13. Turco S, Descoteaux A, Ryan K, Garraway L,
org/10.1128/mBio.00861-15 Beverley S (1994) Isolation of virulence genes
3. Duncan SM, Myburgh E, Philipon C, Brown directing GPI synthesis by functional comple-
E, Meissner M, Brewer J, Mottram JC (2016) mentation of Leishmania. Braz J Med Biol Res
Conditional gene deletion with DiCre demon- 27(2):133–138
strates an essential role for CRK3 in Leishmania 14. Beverley SM, Turco SJ (1995) Identification
mexicana cell cycle regulation. Mol Microbiol of genes mediating lipophosphoglycan biosyn-
100(6):931–944. https://doi.org/10.1111/ thesis by functional complementation of
mmi.13375 Leishmania donovani mutants. Ann Trop Med
4. Ngo H, Tschudi C, Gull K, Ullu E (1998) Parasitol 89(Suppl 1):11–17
Double-stranded RNA induces mRNA degra- 15. Descoteaux A, Luo Y, Turco SJ, Beverley SM
dation in Trypanosoma brucei. Proc Natl Acad (1995) A specialized pathway affecting viru-
Sci U S A 95(25):14687–14692 lence glycoconjugates of Leishmania. Science
5. Ullu E, Tschudi C, Chakraborty T (2004) 269(5232):1869–1872
RNA interference in protozoan parasites. Cell 16. Descoteaux A, Avila HA, Zhang K, Turco SJ,
Microbiol 6(6):509–519 Beverley SM (2002) Leishmania LPG3 encodes
6. Lye LF, Owens K, Shi H, Murta SM, Vieira a GRP94 homolog required for phosphoglycan
AC, Turco SJ, Tschudi C, Ullu E, Beverley SM synthesis implicated in parasite virulence but
(2010) Retention and loss of RNA interference not viability. EMBO J 21(17):4458–4469
pathways in trypanosomatid protozoans. PLoS 17. Sambrook J, Russell DW (2001) Molecular
Pathog 6(10):e1001161. https://doi. cloning, 3rd edn. Cold Spring Harbor
org/10.1371/journal.ppat.1001161 Laboratory Press, Cold Spring Harbor, NY
7. LeBowitz JH, Coburn CM, McMahon-Pratt 18. Hübel A, Krobitsch S, Horauf A, Clos J (1997)
D, Beverley SM (1990) Development of a sta- Leishmania major Hsp100 is required chiefly in
ble Leishmania expression vector and applica- the mammalian stage of the parasite. Mol Cell
tion to the study of parasite surface antigen Biol 17(10):5987–5995
genes. Proc Natl Acad Sci U S A 87: 19. Reiling L, Chrobak M, Schmetz C, Clos
9736–9740 J (2010) Overexpression of a single Leishmania
8. Sanderson SJ, Pollock KG, Hilley JD, Meldal major gene is sufficient to enhance parasite
M, Hilaire PS, Juliano MA, Juliano L, Mottram infectivity in vivo and in vitro. Mol Microbiol
JC, Coombs GH (2000) Expression and char- 76(5):1175–1190
acterization of a recombinant cysteine protein- 20. Nuhs A, Schafer C, Zander D, Trube L, Tejera
ase of Leishmania mexicana. Biochem J 347(Pt Nevado P, Schmidt S, Arevalo J, Adaui V, Maes
2):383–388 L, Dujardin JC, Clos J (2014) A novel marker,
9. Chen DQ, Kolli BK, Yadava N, Lu HG, ARM58, confers antimony resistance to
Gilman-Sachs A, Peterson DA, Chang KP Leishmania spp. Int J Parasitol Drugs Drug
(2000) Episomal expression of specific sense Resist 4(1):37–47. https://doi.org/10.1016/j.
and antisense mRNAs in Leishmania amazo- ijpddr.2013.11.004
nensis: modulation of gp63 level in promasti- 21. Laban A, Wirth DF (1989) Transfection of
gotes and their infection of macrophages Leishmania enriettii and expression of chlor-
in vitro. Infect Immun 68(1):80–86 amphenicol acetyltransferase gene. Proc Natl

10. Kelly JM, Das P, Tomás AM (1994) An Acad Sci U S A 86:9119–9123
approach to functional complementation by 22. Clos J, Hübel A, Brandau S, Dresel A, Hörauf
introduction of large DNA fragments into A (1997) LeishmaniaHsp100. In: Gething M-J
Trypanosoma cruzi and Leishmania donovani (ed) Guidebook to molecular chaperones and
using a cosmid shuttle vector. Mol Biochem protein folding catalysts. Sambrook and Tooze,
Parasitol 65:51–62 Oxford, pp 259–261
Chapter 7
Cos-Seq: A High-Throughput Gain-of-Function Screen

for Drug Resistance Studies in Leishmania
Jade-Eva Potvin, Philippe Leprohon, Elodie Gazanion, Mansi Sharma,
Christopher Fernandez-Prada, and Marc Ouellette
Abstract
Leishmania is still a major cause of mortality and morbidity worldwide. Few efficient drugs are available,
and resistance threatens actual treatments. In order to improve knowledge about the mode of action of
current drugs and those in development, as well as to understand the mechanisms pertaining to their resis-
tance, we recently described a sensitive and high-throughput method termed Cos-Seq. Here we provide a
detailed protocol for every step of the procedure, from library construction to drug selection, cosmid
extraction, and next-generation sequencing of extracted cosmids. A section on the bioinformatics of Cos-
Seq is also included. Cos-Seq facilitates the identification of gain-of-function resistance mechanisms and
drug targets and is a useful tool in resistance and drug development studies.
Key words Leishmania, Next-generation sequencing, Cos-Seq, Drug resistance, Mode of action
1 Introduction
Drug resistance studies in Leishmania initially relied on the charac-

terization of drug-resistant clones using reverse genetics tools.
One such tool was cosmid-based functional cloning, a gain-of-
function screening approach relying on the transfection of parasites
with a genomic library cloned into cosmid episomes and selecting
for a particular phenotype. The first application of functional clon-
ing came from the study of lipophosphoglycan biosynthesis [1] but
it was later adapted to drug resistance studies [2–4]. While power-
ful, functional cloning is not easily amenable to high-throughput
screening as clones need to be characterized individually.
The advent of next-generation sequencing (NGS) now allows
to rapidly generate a large volume of genomics data and to per-
form high-throughput and genome-scale screening in eukaryotes.
NGS proved useful in finding drug targets and resistance mecha-
nisms [5, 6] and revealed copy number variations (CNV) and sin-
gle nucleotide polymorphism (SNP) in drug-resistant Leishmania
141
142 Jade-Eva Potvin et al.
parasites [7, 8] (reviewed in ref. 9). We recently described a sensitive

and high-throughput method, termed Cos-Seq, that couples cos-
mid-based functional cloning and NGS [10]. Genomic fragments
from Leishmania are cloned into a cLHYG [11] vector to build a
genomic cosmid library. The library is then transfected into wild
type Leishmania parasites, resulting in a large number of pooled
clones. While individual clones contain a small region (~35 kb) of
the genome, the diversity of the cosmid library and the size of the
population make it possible to probe the entire genome in a single
screen. The pool of clones is then exposed to incremental drug
pressure and parasites harboring a cosmid providing a selective
advantage in the presence of the drug will be selected and enriched
in the population at each passage. Cosmids from enriched clones
are extracted from the pool of surviving parasites at each drug
increment and sequenced by NGS, allowing to collect qualitative
and quantitative data about which cosmids, and hence which
genomic region, favored survival. These cosmids can finally be iso-
lated for downstream in-depth functional validation.
The protocol described herein covers every step of the Cos-
Seq procedure in the more tractable promastigote stage but
screens with intracellular parasites are also possible [12]. This pro-
tocol describes the generation of the cosmid libraries, the Cos-Seq
selection, the extraction of cosmids at each selection steps, and
NGS data analysis. The bioinformatics analysis aims at the identi-
fication of differences in gene abundance between Cos-Seq sam-
ples, focusing on genes whose abundance is increasing with drug
pressure. The pipeline takes as input the sequencing reads derived
from the Cos-Seq (in the form of FASTQ files) and outputs gene-
level read counts as flat text files. There are several methods avail-
able for estimating gene or transcript (in the case of RNAseq)
abundance from NGS data and these include (1) alignment-based
methods that rely on the alignment of sequencing reads to the
sequence of a reference genome or transcript assembly, and (2)
alignment-free methods which typically examine k-mer (i.e.,
sequences of length k) abundances in the sequencing reads and in
the reference genome or assembly. The current Cos-Seq pipeline
relies on the Trinity software [13] which provides direct support
for gene count estimation using third-party software as well as
scripts for data analysis and visualization in the R environment.
Trinity supports the alignment- based quantification methods
RSEM [14–16] and eXpress [16], as well as the alignment-free
methods salmon [15–17] and kallisto [15, 16, 18], the latter
being the one onto which our Cos-Seq analysis relies. Kallisto
is a program for quantifying the abundance of target sequences
using high-throughput sequencing reads. It is based on the con-
cept of a pseudo-alignment for rapidly determining the compat-
ibility between reads and target sequences, without the need for
alignment. Kallisto, as most other abundance estimation methods,
Gain of Function Cos-seq Screens in Leishmania 143
provides gene abundance e stimates as a normalized measure that

takes into account the length of the genes, the number of reads
mapped to the genes, and the total number of mapped reads in the
samples. These metrics are then compared between samples using
differential expression (or abundance) analysis tools, including the
R packages edgeR [19], DESeq2 [20], or limma/voom [21] that
are supported by Trinity. The current pipeline relies on edgeR for
the identification of genes whose abundance significantly increases
with drug pressure. Significantly enriched genes are then extracted
and clustered according to their patterns of abundance across sam-
ples. Finally, fold enrichment is normalized based on the abun-
dance profile of the appropriate genes in the untreated control
samples. This is to correct for possible biases coming from genes
providing a fitness gain to the parasite and whose enrichment is
unrelated to resistance.
2 Materials
1. Leishmania Culture Media (LCM) (see Note 1).

2. LCM-agar pate. For 500 mL (~30–32 petri dish): Prepare an
agar solution by mixing 200 mL of deionized H2O with 5 g of
agar and sterilize by autoclaving. Under a biological hood,
mix 200 mL of agar solution with 250 mL of 2× LCM, 50 mL
FBSi, 1 mL of hemin (2.5 mg/mL stock solution dissolved in
50 mM NaOH), 500 μL of biopterin (10 mM stock solution),
and appropriate concentrations of drug (hygromycin (HYG)
and the drug undergoing Cos-Seq). Distribute ~15 mL per
petri dish. Partially cover the plates with lids and let solidify for
15 min (see Note 2). Store at 4 °C.
3. TEG solution: 25 mM Tris–HCl pH 8, 10 mM EDTA, 50 mM
glucose. Store at 4 °C.
4. Lysis solution: 0.2 N NaOH, 1% SDS. Always use freshly pre-
pared lysis solution.
5. cLHYG cosmid.
6. Escherichia coli DH5α.
7. 25 cm3 and 75 cm3 culture flasks.
8. Antarctic phosphatase (or similar dephosphorylation enzyme).
9. Tris–borate–EDTA (TBE) buffer.
10. DNA staining dye (e.g., RedSafe).
11. Dialysis membrane.
12. SmaI, Sau3AI, BamHI, and EcoRI restriction enzymes.
13. QIAGEN Mega prep kit, or similar.
14. QIAGEN PCR purification kit, or similar.
15. Phenol–chloroform–isoamyl alcohol (PCIAA) (25:24:1 v/v).

16. 3 M sodium acetate pH 5.2.
17. EtOH.
18. Isopropanol.
19. Nuclease-free water.
20. Nextera DNA sample prep kit.
21. Nextera Indices kit.
22. Phage packaging kit (Gigapack III Gold packaging from

Agilent Technologies, or similar).
23. Hygromycin.
24. T cell nucleofector kit.
25. TE buffer.
26. Plasmid-safe ATP-dependent DNAse.
27. Low-melting point agarose.
28. β-Agarase.
3 Methods
3.1 Preparation Functional cloning in Leishmania has been developed for lipophos-
of Cosmid Library phoglycan biosynthetic genes and an alternative protocol for the
production of cosmid libraries is also available elsewhere [11].
3.1.1 Genomic DNA 1. Extract gDNA from Leishmania promastigotes using your
(gDNA) Extraction favorite kit or protocol and store at 4 °C. You should aim for a
and Optimization of Partial gDNA concentration ≥500 ng/μL (see Note 3).
Restriction Digest 2. Verify the size of gDNA by migrating 2–5 μg in 0.4% agarose
gel. The size of your gDNA should be ≥100 kb (see Note 4).
3. Perform restriction digests as indicated below to find the
reaction that will yield fragments with a mean size of ~35 kb
(see Note 5).
Optionally, changing incubation time may also be done to
test additional restriction digest conditions (Table 1).
4. Once optimization of gDNA partial digest is done, continue
with step 5 below (gDNA digestion), which should be
done simultaneously with cLHYG digestion if possible (see
Subheading 3.1.2).
5. gDNA digestion.
(a) Digest 50 μg of gDNA (5 tubes with 10 μg each) based on
the optimal digestion condition identified at step 3.
(b) Dephosphorylate DNA by adding 6 μL of 10× Antarctic
phosphatase buffer, 10 units of Antarctic phosphatase
Table 1
Optimization of genomic DNA partial restriction digest
Tube 1a Tube 2a Tube 3a Tube 4a

Buffer 10× (μL) 5 5 5 5
BSA 10× (μL) 5 5 5 5
gDNA (μg) 10 10 10 10
Sau3AI (U) 2 4.5 6 7
H2O Complete Complete Complete Complete
to 50 μL to 50 μL to 50 μL to 50 μL
Incubation time at 37 °C (min) 5 5 5 5
a
Tubes 1 to 4 represent different reactions that should be tested to identify optimal digestion conditions. It is suggested
to test all four reactions, as well as additional conditions if required
enzyme and adjust to 60 μL with H2O. Incubate at 37 °C

for 15 min before inactivating the enzyme by incubation
at 65 °C for 5 min (see Note 6).
6. gDNA size fractionation.
(a) Pour a 150 mL 0.4% (g/v) agarose gel (see Note 7),
arrange combs as illustrated in Fig. 1 (see Note 8) and let
solidify for 30 min. Put the gel into a clean electrophoresis
tank and add clean TBE buffer until covering the gel.
(b) In upper wells 1 and 5, load undigested gDNA.
(c) In upper wells 2, 6, and 9, load high range DNA ladder
(see Note 9).
(d) In upper wells 3 and 7, load 5 μL of the partial digestion
from step 5(b).
(e) In the upper well number 10 load the remaining volume
of the partial digestion from step 5(b).
(f) Run the gel at 1 V/cm for 16 h.
(g) Stop the power supply, gently take out the gel from the
electrophoresis tank and cut the gel at position equivalent
to line A in Fig. 1.
(h) Put the left-most part of the gel (i.e., gel part #1 in Fig. 1)
in a glass dish and cover with TBE buffer containing
nucleic acid staining solution (e.g., 5 μL RedSafe Nucleic
Acids Staining Solution per 100 mL TBE). Incubate at
room temperature with gentle shaking for 30 min.
(i) In the meantime, put back the gel in the electrophoresis
tank and resume electrophoresis for 30 min, but this time
at 4 V/cm.
Fig. 1 Agarose gel setup for purification of Sau3AI-partially digested gDNA
(j) Stop the power supply, gently take out the gel from the
electrophoresis tank and cut the gel at position equivalent
to line B in Fig. 1. Put this second gel slice (i.e., gel part
#2 in Fig. 1) in a second glass dish, cover with TBE buffer
containing DNA staining solution and incubate for 30 min.
Put back the remaining part of the gel (i.e., gel part #3 in
Fig. 1) in the electrophoresis tank (do not resume electro-
phoresis at this point).
(k) Visualize the two stained gel slices with a ruler under UV
light.
(l) From the distance on the ruler separating the bulks of
DNA in gel slice #1 versus gel slice #2, infer the electro-
phoresis time remaining at 4 V/cm before the ~25 kb
fragments from lane 10 are just short of falling into the
large well in the middle section of the gel.
(m) Resume electrophoresis at 4 V/cm for the amount of time
estimated at step l.
(n) Stop electrophoresis and remove a bit of TBE buffer from
the tank so that its level is just below the top edge of the
gel (see Note 10). Clean the big well located in the middle
section of lane 10 with clean TBE buffer twice. Remove
any remaining TBE buffer from the big well.
(o) Place a U-shaped dialysis membrane (hydrated in TBE)

into the big well located in the middle section of lane 10
as shown in grey in Fig. 1 (see Note 11).
(p) Fill up the big well with clean TBE buffer.
(q) Resume electrophoresis at 4 V/cm for 1 h. This will allow
gDNA from the appropriate size range to fall into the big
well and be trapped owing to the dialysis membrane.
(r) Reverse the flow of electrophoresis for 10 s at 4 V/cm
(by inverting the red and black power cords plugged into
the power supply). Recover the TBE buffer from the big
well in the middle section of lane 10 and put into a clean
1.5 mL tube (see Note 12). Rinse the dialysis membrane
using the well’s TBE to recover as much DNA as
possible.
7. gDNA precipitation and concentration,
(a) Add 0.4 volume of sodium acetate pH 5.2 to the tube
from step 6(r) and mix gently.
(b)
Add 2.5 volume of EtOH 100% and mix gently by
inversion.
(c) Incubate at −20 °C overnight.
(d)
Spin 30 min at 4 °C at maximum speed in a
microcentrifuge.
(e)
Discard supernatant, add 800 μL of freshly prepared
EtOH 70% and gently mix by inversion.
(f) Spin 5 min at maximum speed in a microcentrifuge and
remove supernatant by pipetting.
(g) Let dry the DNA on the bench with the cap of the tube
opened for 5 min (see Note 13).
(h)
Resuspend DNA in 10–15 μL nuclease-free water and
quantify. If possible, continue immediately with ligation
into cLHYG (see Subheading 3.1.3). If not, store DNA at
−20 °C.
3.1.2 cLHYG Digestion 1. Extract cLHYG cosmids from E. coli using the QIAGEN
Plasmid Mega kit following manufacturer’s recommendations,
or using a similar kit. cLHYG is sequentially digested with
SmaI and BamHI restriction enzymes as described below.
SmaI digestion liberates the cos sites at each extremities of
cLHYG, which are necessary for proper phage packaging and
thus for library transformation into E. coli. The BamHI restric-
tion site is compatible with Sau3AI and is therefore used to
clone genomic fragment into the SmaI-linearized cosmid (for
further information see map in ref. 11).
Table 2
SmaI digestion of cLHYG
cLHYG (3 μg) X μL

Buffer CutSmart 10× 5 μL
SmaI enzyme 20 U
H2O Complete to 50 μL
2. Digest a total of 30 μg of cLHYG to completion with the SmaI

restriction enzyme. This needs to be done using ten indepen-
dent restriction digests (3 μg of cLHYG per reaction), each
reaction being done in 1.5 mL tube and consisting of the
reagents described in Table 2.
3. Incubate the ten tubes at 37 °C for 16 h.
4. Migrate a 5 μL aliquot of the restriction digests (from each of
the ten tubes) on 0.8% agarose gel for ~1 h 30 min at 4 V/cm.
You should obtain a single DNA fragment of 12,205 bp upon
imaging of the gel.
5. Heat-inactivate the ten restriction digests at 65 °C for 15 min.
6. For each of the ten tubes, dephosphorylate digested cosmid
DNA by adding 6 μL of 10× Antarctic phosphatase buffer,
10 units of Antarctic phosphatase enzyme and complete to
60 μL with H2O (or use similar dephosphorylation enzyme).
Incubate at 37 °C for 15 min before inactivating the enzyme
by incubation at 65 °C for 5 min (see Note 6).
7. Pool the entire volume from the ten tubes into a single master
tube and complete to 500 μL with TE buffer, if necessary.
8.
Add 1 volume of phenol–chloroform–isoamyl alcohol
(25:24:1 v/v) to the 1.5 mL master tube from step 7 and mix
well.
9. Spin at 4 °C for 15 min at maximum speed in a
microcentrifuge.
10. Recover ~400 μL of the clear aqueous phase (i.e., the upper
phase) into a new 1.5 mL tube (see Note 14).
11. Add 0.1 volume of 3 M sodium acetate pH 5.2 and mix
gently.
12. Add 2 volumes of EtOH 100% and mix gently.
13. Incubate at −20 °C for 30 min (or overnight for maximum
DNA recovery).
14. Centrifuge at 4 °C for 30 min at maximum speed in a micro-
centrifuge and discard supernatant.
15. Wash the DNA pellet twice with 800 μL of EtOH 70%.
16. Remove as much as supernatant as possible by pipetting with-

out disturbing the DNA pellet and let dry for 2 to 5 min on
the bench with the cap of the tube opened (see Note 13).
17. Resuspend DNA in 30 μL of nuclease free water and quantify.
18. Digest 5 μg of SmaI-digested cLHYG from step 17 with the
BamHI restriction enzyme be setting up the reaction described
in Table 3.
19. Incubate at 37 °C for 16 h.
20. Migrate a 5 μL aliquot of the restriction digest on 0.8% agarose
gel for ~1 h 30 min at 4 V/cm. You should obtain two DNA
fragments (1927 bp and 10,278 bp) upon imaging of the gel.
21. Heat-inactivate the enzyme at 65 °C for 15 min.
22. Purify DNA using the QIAGEN PCR purification kit accord-
ing to the manufacturer’s protocol, or using a similar kit from
another vendor. If possible, continue immediately with liga-
tion (see Subheading 3.1.3). If not, store DNA at −20 °C.
3.1.3 Ligation 1. Ligate Sau3AI-digested gDNA (from Subheading 3.1.1)

into SmaI–BamHI-digested cLHYG (from Subheading 3.1.2)
as described in Table 4, and incubate at 37 °C overnight
(see Note 15).
Table 3
BamHI digestion of cLHYG
SmaI-digested cLHYG (5 μg) X μL

Buffer CutSmart 10× 5 μL
BamHI 20 U
H2O Complete to 50 μL
Table 4
Ligation of partially digested gDNA into cLHYG
Buffer (provided with the enzyme) 1 μL

ATP (provided with the enzyme) 1 μL
Fast link ligase enzyme 1 μL
cLHYG (SmaI–BamHI-digested) X μga
gDNA (Sau3AI-partially digested) X μga
Total volume 10 μL
Put as many cLHYG and gDNA as possible by using a gDNA–vector ratio of 4:1 and
a
without exceeding the total volume of 10 μL

3.1.4 Library Packaging 1. We use the Gigapack III Gold packaging kit from Agilent tech-
and Amplification nologies with E. coli DH5α. While other packaging kits exist,
these have not been benchmarked by us. Whichever packaging
kit, ~300,000 clones per phage infection need to be obtained
upon titration (see Note 16).
2. After infection, centrifuge E. coli cells for 1 min at maximum
speed and remove supernatant.
3. Resuspend the cell pellet into 500 μL of LB broth and spread
onto 10 LB agar plates (150 mm) supplemented with
100 μg/mL ampicillin. Also plate 5 μL onto a single 10 mm
LB agar plate supplemented with 100 μg/mL ampicillin.
This plate will be used at Subheading 3.1.5 for estimating
library diversity.
4. Incubate the plates at 37 °C for 16 h.
5. Recover colonies from the plates by adding 3 mL of LB media
to one of the 150 mm plate (plate 1) and scrape off cells.
6. Transfer as much volume of LB media from plate 1 to a second
150 mm plate (plate 2) and scrape off cells. Repeat until the
last 150 mm plate. Remove as much volume as possible from
the last plate and put into a 50 mL tube (see Note 17).
7. Wash plate 1 with an additional 1 mL of fresh LB media and
transfer as much volume as possible to plate 2. Repeat until the
last 150 mm plate. Remove as much volume from the last plate
and put into the same 50 mL tube as in step 6.
8. Aliquot the cosmid library into 2 mL cryogenic tubes (700 uL
of cosmid library per tube).
9. Add 300 μL of LB-glycerol (50:50 v/v) to the cryogenic tubes
(for a final glycerol concentration of 15%) and mix well by
inversion.
10. Store the cryogenic tubes at −80 °C.
3.1.5 Estimation 1. Pick 21 random E. coli colonies from the 10 mm plate from
of Library Diversity Subheading 3.1.4 and grow independently in 5 mL LB broth
supplemented with 100 μg/mL ampicillin for 16 h at 37 °C.
2. Extract cosmid DNA using your favorite plasmid DNA mini-
prep kit. Leave one of the 21 cosmid extractions at −20 °C for
later use at Subheading 3.1.6 for estimating Leishmania trans-
fection efficiency.
3. Digest each of the 20 remaining cosmid extracts with EcoRI in
a volume of 50 μL for 3 h.
4. Migrate the restriction digests (the entire volume of each
digestion) on a 150 mL agarose gel at 1 V/cm for 16 h. You
should obtain different migration profiles between samples
upon imaging of the gel. This ensures proper genomic inserts
diversity in the cosmid library (see Note 18).
3.1.6 Monitoring Cosmid 1. Determine the half maximal effective concentration (EC50) of
Transfection Efficiency HYG and of the drug undergoing Cos-Seq against your
in Leishmania (See Note Leishmania strain.
19) (a) Prepare six 25 cm3 culture flasks with 5 mL of LCM (see
Note 20).
(b) Add your drug of interest in incremental concentrations in
flasks 1 to 5. Do not add any drug to flask number 6 which
will be used as a control for maximal growth.
(c) Inoculate all flasks with 1 × 106 mid-log phase parasites.
(d) Incubate at 25 °C until the control flask reaches early sta-
tionary phase of growth (e.g., OD600 ~ 0.6).
(e) Monitor OD600 for all flask and plot against the drug con-
centration to extrapolate EC50.
2. Transfection of Leishmania.
(a) Quantify the cosmid DNA extracted and stored at −20 °C
at Subheading 3.1.5. You should have a DNA concentra-
tion ≥1 μg/μL. If not, concentrate by speed vacuum.
(b) Prepare 150 mm LCM agar plates supplemented with 30×
the HYG EC50 for your strain. Store at 4 °C.
(c) Warm two 25 cm3 culture flasks containing 10 mL of
LCM in an incubator at 25 °C.
(d) Remove T cell Nucleofector solution from 4 °C and bring
to room temperature on the bench.
(e) Count parasites from an exponential phase of growth cul-
ture of your Leishmania strain using a hemacytometer.
You will need 2 × 107 promastigote parasites per
transfection.
(f) Spin down the appropriate volume of Leishmania culture
at 3000 × g at room temperature for 10 min. The required
volume will vary according to the number of transfections
to be done and the parasite counts in your culture. You
need to plan for 2 × 107 parasites per transfection.
(g) Wash the cell pellet with 10 mL of 1× PBS and spin at
3000 × g at room temperature for 10 min.
(h) Resuspend the cell pellet in 1 mL 1× PBS and aliquot in
equal volume into the appropriate number of 1.5 mL tube
(1 tube per transfection, i.e., 2 × 107 parasites per tube).
(i) Spin the 1.5 mL tubes at 3000 × g at room temperature
for 5 min.
(j)
Completely remove the supernatant from each tube.
Importantly, steps 18–22 now need to be completed
within 15 min.
(k) Set up the Lonza 2d Nucleofector to the U-033 program,
or equivalent.
(l) Resuspend each cell pellet from step j with 100 μL T cell
Nucleofector solution brought to room temperature.
(m) Immediately add 5 μg (in ≤5 μL) of cosmid DNA to the
appropriate tube (plan for one negative control tube with-
out DNA) and transfer to nucleofection cuvettes, carefully
avoiding bubbles.
(n) Perform nucleofection (U-033 program).
(o)
Immediately transfer the content of the nucleofection
cuvettes to prewarmed LCM 25 cm3 culture flasks (one
transfection per flask). Use 500 μL from the flask to rinse
the cuvette in order to recover as much parasites as
possible.
(p) Incubate the culture flasks at 25 °C overnight.
(q) On day 2 add 15× the HYG EC50 concentration for your
strain (the HYG EC50 has been determined at step 1) to
each culture flask and incubate at 25 °C overnight.
(r) On day 3, spread different volumes (e.g., 100 μL of a
1/100 dilution, 100 μL and 300 μL) of transformed
Leishmania cultures from step q onto LCM agar plates
prepared at step a (bring the plates to room temperature
prior to plating the parasites). Using several plating vol-
umes will ensure that at least one plate per transfection will
have amenable colony counts for estimating transfection
efficiency.
3. Calculate transfection efficiency based on the number of trans-
fected cells, the volume of culture spread onto plates and the
number of colonies obtained per plate.
3.1.7 Transfection 1. Thaw one vial of cosmid library from Subheading 3.1.4 and
and Storage of the Whole inoculate into 50 mL of LB broth supplemented with 100 μg/
Cosmid Library mL ampicillin. Incubate with shaking overnight.
in Leishmania 2. Dilute the 50 mL overnight culture into 1000 mL of LB broth
supplemented with 100 μg/mL ampicillin and incubate under
shaking until the culture reaches late-log phase.
3. Extract cosmid DNA using the Promega Wizard Plus Megaprep
DNA Purification System (or equivalent kit) and quantify by
NanoDrop. You need a concentration ≥1 μg/mL to continue.
If required, concentrate the cosmid library by speed vacuum.
4. Calculate the number of transfections you will need according
to the transfection efficiency obtained at Subheading 3.1.6, the
average cosmid insert size and the size of the genome of your
Leishmania strain. You should aim for a ≥10× genome cover-
age. We usually need ~10 transfection reactions.
5. Perform nucleofection of the cosmid library as described at
Subheading 3.1.6.
6. Plate the entire volume of transfection onto 150 mm LCM

agar plates supplemented with 30× the HYG EC50 concentra-
tion for your strain. Wrap the plates in Parafilm and incubate at
25 °C until colonies are well grown (~10 days).
3.2 Leishmania 1. Determine the library coverage by estimating the total number
Cosmid Library of Leishmania colonies on plates (coverage = #colonies *
Recovery and Storage 35 kb/size of genome in kilobases). You should aim for ≥10×
genome coverage.
2. Recover colonies from the plates by adding 3 mL of LCM to
one plate (plate 1) and very gently scrape off cells.
3. Recover the media from plate 1 (containing the scraped para-
sites) and transfer onto a second plate. Repeat until the last
plate and transfer the recovered LCM volume into a 50 mL
tube (see Note 17).
4. Rinse plate 1 with an additional 1 mL of LCM, recover by
pipetting and transfer onto a second plate. Repeat until the last
plate and transfer the recovered LCM volume into the 50 mL
tube from step 3.
5. Aliquot the cosmid library into 2 mL cryogenic tubes (750 μL
of cosmid library per tube).
6. Add 250 μL of LCM–DMSO (80:20 v/v) to the cryogenic
tubes (for a final DMSO concentration of 5%) and mix well by
inversion.
7. Store at −80 °C for 10 days and then transfer to −150 °C for
long-term storage.
3.3 Cos-Seq 1. Thaw one vial of frozen Leishmania cosmid library and transfer
Selection into a 25 cm3 culture flask containing 5 mL of LCM supple-
mented with 30× the HYG EC50.
2. Incubate at 25 °C overnight (see Note 21).
3. Library expansion.
(a) Expand the Leishmania cosmid library by inoculating a
75 cm3 culture flask containing 44.5 mL of LCM and 30×
the HYG EC50 with the 5 mL culture from step 2.
(b) Incubate the 75 cm3 flasks at 25 °C (see Note 21) until
late-log phase of growth (OD600 0.7, ~3–4 days). This cul-
ture will be your P0 culture (P0 stands for Cos-Seq passage
0). Keep 5 mL of the P0 culture to initiate the first round
of Cos-Seq as described at step 4 below. While this volume
allows for Cos-Seq selection for two drugs in duplicate,
the current protocol describes a Cos-Seq experiment per-
formed with a single drug in duplicate. This protocol is
also for the promastigote stage of the parasite which in
general is easier and give a wider range of cosmids than
intracellular screens.
(c) Centrifuge 10 mL of P0 culture at 3000 × g in independent

tubes (do not discard the remaining 40 mL of P0 culture
which will be used at step 5).
(d) Discard supernatant and resuspend the cell pellet in 1.6 mL
of LCM.
(e) Split the 1.6 mL volume into two 2 mL cryogenic tubes
(800 μL per tube) and add 800 μL of LCM–DMSO
(90:10 v/v) so the final DMSO concentration is 5%. These
P0 frozen stocks are used as a backup if cosmid extraction
fails for some reason at step 5.
(f) Rapidly store the cryogenic tubes at −80 °C.
(g) Extract cosmid DNA from the remaining volume of P0
culture using the procedure described in step 5 below.
4. The Cos-Seq selection cycle (see Note 22).
(a) Transfer 1 mL of P0 culture into two 75 cm3 flasks con-
taining 49 mL of LCM, 30× the EC50 of HYG, and 1× the
EC50 of the drug undergoing Cos-Seq. These cultures will
be your P1_A and P1_B Cos-Seq replicates.
(b) Incubate cultures P1_A and P1_B at 25 °C until they
reach late-log phase (OD600 ~0.7).
(c) Transfer 1 mL of P1_A and P1_B cultures into two 75 cm3
flasks containing 49 mL of LCM, 30× the EC50 of HYG,
and 2× the EC50 of the drug undergoing Cos-Seq. These
cultures will be your P2_A and P2_B Cos-Seq replicates.
(d) Incubate cultures P2_A and P2_B at 25 °C until they
reach late log phase.
(e) In the meantime, freeze aliquots of the P1_A and P1_B
cultures as described at step 3.
(f) Extract cosmid DNA from the remaining volume of P1_A
and P1_B cultures using the procedure described at
step 5.
(g) Repeat steps b–f thrice by using drug concentrations
equivalent to 4× (cultures P3_A and P3_B), 8× (cultures
P4_A and P4_B), and then 16× (cultures P5_A and P5_B)
the EC50 of the drug undergoing Cos-Seq.
5. Cosmid extraction from Leishmania Cos-Seq samples (process
duplicates independently all along the procedure).
(a) Spin down parasites at 3000 × g for 5 min and discard
supernatant.
(b) Resuspend cells in 500 μL LCM and transfer in a 1.5 mL
tube.
(c) Spin down at 3000 × g for 5 min and discard as much
supernatant as possible by pipetting. Carefully avoid
disturbing the cell pellet.
(d) Add 200 μL ice-cold TEG solution, resuspend cells by

pipetting up and down and transfer to a clean 1.5 mL
microcentrifuge tube.
(e) Add 400 μL of lysis solution, mix by inversion, and incubate
at room temperature for 5 min.
(f) Add 200 μL of 3 M sodium acetate pH 4.8, mix by inversion
and incubate on ice for 10 min.
(g) Centrifuge for 10 min at 4 °C at 21,000 × g. Transfer the
clear supernatant into a new 1.5 mL microcentrifuge
tube.
6.
First phenol–chloroform–isoamyl alcohol extraction and
RNase treatment.
(a)
Add 1 volume of phenol–chloroform–isoamyl alcohol
(25:24:1 v/v) to the clear lysate of step 5 and mix vigor-
ously by inversion.
(b) Centrifuge at 21,000 × g for 10 min at 4 °C.
(c) Carefully recover the clear aqueous phase (i.e., the upper
phase) and transfer into a 15 mL tube (see Note 23).
(d) Add 2 volumes of 100% EtOH and mix by inversion.
(e) Incubate on ice for 15 min.
(f) Centrifuge at 21,000 × g for 10 min at 4 °C and discard
supernatant.
(g)
Quick spin the tube and remove any residual
supernatant.
(h) Invert the tube upside down (without the cap) on a paper
towel on the bench and let dry for 15–20 min.
(i) Resuspend the DNA pellet in 100 μL of TE buffer and
transfer to a new 1.5 mL microcentrifuge tube.
(j) Add Ribonuclease A (final concentration of 10 μg/mL),
and Ribonuclease T1 (final concentration of 25 units/mL)
and incubate for 1 h at 37 °C.
7. Second phenol–chloroform–isoamyl alcohol extraction (see
Note 24).
(a) Add TE buffer to your cosmid DNA sample from step 6
up to a volume of 500 μL.
(b) Repeat steps 6(a–d) and store at −20 °C overnight.
(c) Centrifuge at 21,000 × g for 20 min at 4 °C.
(d) Decant supernatant carefully (see Note 25).
(e)
Air-dry the pellet and resuspend in 42 μL of TE (see
Note 13).
(f) At this point cosmid DNA samples can be stored at −20 °C
to resume the procedure later.
8. Genomic DNA digestion by Plasmid-Safe ATP-Dependent

DNase and kDNA removal.
(a) Add 2 μL of 25 nM ATP, 10 units of Plasmid-Safe DNase
enzyme and 5 μL of 10× buffer (supplied with enzyme) to
each of the cosmid DNA samples from step 7.
(b) Incubate 30 min at 37 °C.
(c) Heat inactivate the enzyme at 70 °C for 30 min.
(d) Prepare a 1% Low Melting Point (LMP) agarose gel with
DNA staining dye.
(e) Load samples from step c in the gel (load each sample into
2 or 3 wells, leaving an empty well between distinct
samples to avoid cross-well contamination) and migrate at
4 V/cm for 1 h.
(f) For each sample, cut all bands ≥2 kb in a single gel slice
(see Note 26).
(g) Weight the gel slices in 1.5 mL microcentrifuge tubes
(preweight the empty tubes).
(h) Wash the gel slices twice with two volumes of 1× β-agarase
I buffer for 30 min to equilibrate the DNA-containing gel.
(i) Remove as much washing buffer as possible.
(j) Melt the agarose by incubation at 65 °C for 10 min, or
until the gel is completely dissolved. Mix by pipetting up
and down to ease agarose dissolution.
(k) Cool the melted agarose to 42 °C for 2 min.
(l) Add 0.5 μL β-agarase I enzyme and incubate at 42 °C for
1 h (0.5 μL of enzyme is suitable for digestion up to
200 μL gel volume, scale up accordingly).
(m) Inactivate the enzyme by incubation at 65 °C for 15 min.
(n) Cool the tubes to room temperature.
(o) Add 1/10 volume of 3 M sodium acetate pH 5.2.
(p) Chill on ice for 15 min.
(q)
Centrifuge at 21,000 × g for 15 min at room
temperature.
(r) Transfer the DNA containing supernatant to new 1.5 mL
microcentrifuge tubes.
(s) Add 2 volumes of isopropanol and 6 μL of glycogen. Mix
by inversion.
(t) Precipitate cosmid DNA on ice for 5 min (see Note 27).
(u) Centrifuge at 21,000 × g for 15 min at room temperature
and discard supernatant.
(v) Wash the pellet once with cold isopropanol.
(w) Air-dry the pellet for 5 min by opening the cap of the tube
(see Note 28).
(x) Resuspend the cosmid DNA pellet using 30 μL of nucle-
ase free H2O.
(y) Quantify cosmid DNA and measure the A260/280 ratio
(see Note 29).
3.4 DNA Sequencing 1. Construct NGS libraries from purified cosmids (Plasmid-Safe
DNase-treated and kDNA removed). The yield of purified cos-
mids usually requires the use of NGS library kits with low
DNA input. We usually generated our Cos-Seq NGS libraries
using the Nextera DNA sample prep kit according to the man-
ufacturer’s protocol and the AMPure XP beads for both puri-
fication steps. Other low DNA input NGS library kits exist
(NEBNext Ultra II DNA prep kit for Illumina, TruSeq DNA
Nano) but these have not been benchmarked by us. Include
appropriate Nextera indices (or appropriate indices) for sample
multiplexing (see Note 30).
2. Perform sequencing at your favorite NGS facility. Our sequenc-
ing is usually conducted using a paired-ends protocol on an
Illumina HiSeq 2500. The samples should be multiplexed to
get ~15 M reads per sample.
3.5 Bioinformatics 1. The described Cos-Seq bioinformatics pipeline needs to be

Analysis done on a 64-bit computer running Linux. It requires the
installation of the software Trinity, kallisto, and a number of R
packages. Trinity can be downloaded from GitHub at https://
github.com/trinityrnaseq/trinityrnaseq/releases. Note that a
version of gcc greater than 4.3 is required for installation. Also,
Trinity does not come prepackaged with any of the third-party
software for gene abundance estimation and differential expres-
sion and these needs to be separately installed (see below).
After downloading the Trinity software to a Linux server,
unpack the archive, go in the base installation directory and
then type:
#shell
make
You will then need to build the additional plugin compo-
nents that provide support for downstream analyses by
typing:
#shell
make plugins
Kallisto can be installed using the conda package and the
bioconda channel (see Note 31). Conda installation is out-
side the scope of this chapter but the best way is through the
Miniconda package. See detailed documentation at https://
conda.io/miniconda.html. After installing conda you will need

to add the bioconda channel as well as the other channels
bioconda depends on. It is important to add them in the
order indicated below so that the priority is set correctly:
#shell
conda config --add channels default
conda config --add channels conda-forge
conda config --add channels bioconda
Now that bioconda is enabled, any packages on the bio-
conda channel can be installed into the current conda environ-
ment. For installing the kallisto package:
#shell
conda install kallisto
Ensure that Trinity and kallisto are available within your
Unix PATH settings:
#SHELL
EXPORT TRINITY_HOME=/PATH/TO/TRINITY/IN STALLA-
TION/DIR
EXPORT PATH=/PATH/TO/KALLISTO/INSTALLATION/
DIR:$PATH
If you wish, you can include the above commands to your
~/.bashrc file so they will be available by default (optional).
The programs supported by Trinity for monitoring differ-
ences in gene abundance require the R software to be installed
in your system. Installation of R is outside the scope of this
chapter but if R is not available in your system you can get it
from https://www.r-project.org/. While the base R installa-
tion includes many useful functions, the current analysis
requires the installation of a few additional packages using the
commands:
#shell
R
source("http://bioconductor.org/biocLite.R")
biocLite('edgeR') (see Note 32)
biocLite('ctc')
biocLite('Biobase')
install.packages('gplots')
install.packages('ape')
biocLite('qvalue')
2. Input files.
In this example, we will see how to analyze a Cos-Seq experi-
ment conducted with five drug concentrations (e.g., 1×, 2×, 4×,
8×, and 16× EC50) in biological duplicates. You will need the
following input files for the analysis:
(a) Two FASTQ files for each sample, if NGS was performed in
paired-ends mode. The first FASTQ file contains the left
(i.e., R1) reads and the other contains the paired right
(i.e., R2) reads. If NGS was performed in single read mode,
then a single FASTQ file is needed (see Note 33).
(b) A reference file listing the sequence of the open reading

frames from your reference genome in the FASTA format
(see Note 34). For Leishmania, these can be retrieved from
TritrypDB using the wget command (example is for L.
infantum JPCM5):
#shell
wget http://tritrypdb.org/common/downloads/
Current_Release/LinfantumJPCM5/fasta/data/
TriTrypDB-36_LinfantumJPCM5_AnnotatedCDSs .fasta
For simplicity, rename the downloaded file to
“Reference.fasta” using the command:
#shell
mv TriTrypDB-36_LinfantumJPCM5_AnnotatedCDSs.
fasta Reference.fasta
(c) A tab-delimited two columns file named “Reference _com-
ponent_to_trans_map.tsv” listing the gene identifiers for
the reference genome (column 1) as well as their possible
variants (columns 2). This is irrelevant in the case of
Leishmania (there are no known gene variants derived from
splicing) so this mandatory file is basically a tab-delimited
file with two identical columns, a single gene ID per line.
For L. infantum JPCM5, this file should look like the
following:
LinJ.01.0010(tab)LinJ.01.0010
LinJ.01.0020(tab)LinJ.01.0020
LinJ.01.0030(tab)LinJ.01.0030
…
LinJ.36.7360(tab)LinJ.36.7360
(d) A tab-delimited text file named “conditions.tsv” indicating
biological replicate relationships for your samples. For a
Cos-Seq experiment with one baseline sample and a five
concentrations selection scheme (e.g., 1×, 2×, 4×, 8×, and
16× EC50), this file would look like the following:
conditionA(tab)sample_P0_A
conditionA(tab)sample_P0_B
conditionB(tab)sample_P1_A
conditionB(tab)sample_P1_B
conditionC(tab)sample_P2_A
conditionC(tab)sample_P2_B
conditionD(tab)sample_P3_A
conditionD(tab)sample_P3_B
conditionE(tab)sample_P4_A
conditionE(tab)sample_P4_B
conditionF(tab)sample_P5_A
conditionF(tab)sample_P5_B
(e) A tab-delimited text file named “comparisons.tsv” contain-
ing the pairwise sample comparisons to perform (edgeR
compares samples in pairs).
conditionA(tab)conditionB
conditionA(tab)conditionC
conditionA(tab)conditionD
conditionA(tab)conditionE
conditionA(tab)conditionF
conditionB(tab)conditionC
conditionB(tab)conditionD
conditionB(tab)conditionE
conditionB(tab)conditionF
conditionC(tab)conditionD
conditionC(tab)conditionE
conditionC(tab)conditionF
conditionD(tab)conditionE
conditionD(tab)conditionF
conditionE(tab)conditionF
3. Gene abundance quantification.
Before we can process any FASTQ files, we must first build
the reference index, so that it may subsequently be loaded into
memory. The Trinity toolkit comes with a script that bundles
the reference processing and gene abundance estimations
steps. The relative abundance of each gene is independently
calculated from NGS data derived from cosmid populations
isolated at each drug concentration. You should thus have one
script for each of your sample or replicate, and run them sepa-
rately. These scripts, which should be named ‘trinity_
kallisto_<sampleID>.sh’ (<sampleID> should hereafter be
replaced by the name of the appropriate sample), should look
like the following (see Note 35):
#shell
$TRINITY_HOME/util/align_and_estimate_abun dance.
pl \
--transcripts Reference.fasta \
--prep_reference \
--est_method kallisto \
--left <sampleID>_R1_paired.fastq \
--right <sampleID>_R2_paired.fastq \
--gene_trans_map Reference_component_to_trans_map.
tsv \
--seqType fq \
--thread_count 4 \
--output_dir <sampleID>_kallistoOut
Once finished, the relevant output files called ‘abundance.
tsv.genes’ are found in the ‘<sampleID>_kallistoOut’ folder for
each sample.
4. Build gene abundance matrices.
Using the gene-level abundance estimates generated at
step 3, construct the matrix of counts and the matrix of nor-
malized abundance values for all samples (i.e., from “sam-
ple_P0_A” to “sample_P5_B”) using the following script
(<drug> should hereafter be replaced by the appropriate
drug name):
#shell
$TRINITY_HOME/util/abundance_estimates_to_matrix.
pl \
--est_method kallisto \
--gene_trans_map Reference_component_to_trans_map.
tsv \
--out_prefix <drug>_kallisto_matrix \
sample_P0_A/abundance.tsv.genes \ sample_P0_B/abun-
dance.tsv.genes \sample_P1_A/abundance.tsv.genes \
sample_P1_B/abundance.tsv.genes \
dance.tsv.genes \
dance.tsv.genes \
dance.tsv.genes \
dance.tsv.genes
This will generate the following matrices of counts:

(a) <drug>_kallisto_matrix.gene.counts.matrix: the estimated
gene counts (raw counts)
(b) <drug>_kallisto_matrix.gene.TPM.not_cross_norm: a
matrix of TPM abundance values (not cross-sample
normalized)
(c) <drug>_kallisto_matrix.gene.TMM.EXPR.matrix: a matrix
of TMM-normalized abundance values.
5. Running comparative analyses between samples.
Genes whose abundance increased significantly during the
Cos-Seq selection are identified from the matrix of counts by
running the script below, which will perform pairwise com-
parisons among each of your sample types (see Note 36):
#shell
$TRINITY_HOME/Analysis/DifferentialExpression/run_
DE_analysis.pl \
--matrix <drug>_kallisto_matrix.gene.counts.matrix \
--method edgeR \
--samples conditions.tsv \
--contrasts comparisons.tsv \
--output edgeR_<drug>
6. Extracting and clustering significantly enriched genes based on
their abundance profile.
Go into the new <drug>_edgeR directory generated at
step 5 using the command:
#shell
cd <drug>_edgeR
Then, extract genes enriched by at least fourfold (i.e., log2
value of 2) in a highly significant fashion (false discovery
rate ≤ 0.001) during the Cos-Seq selection by running the
following script (see Note 37):
#shell
$TRINITY_HOME/Analysis/DifferentialExpression/
analyze_diff_expr.pl \
--order_columns_by_samples_file \
--samples conditions.tsv \
--matrix ../<drug>_kallisto_matrix.gene.TMM.EXPR.
matrix \
-P 0.001 \
-C 2
Finally, cluster significantly enriched genes based on their
enrichment profile using the script (see Note 38):
#shell
$TRINITY_HOME/Analysis/DifferentialExpression/de-
fine_clusters_by_cutting_tree.pl\
--no_column_reordering \
-R diffExpr.P0.001_C2.matrix.RData \
--Ptree 20
Genes have now been grouped into clusters based on how
they behaved during the Cos-Seq selection. The results are in
the new directory called “diffExpr.P0.001_C2.matrix.RData.
clusters_fixed_P_20” that contains the abundance matrix for
the gene clusters (data is log2-transformed, median centered).
The gene abundance pattern is also summarized in the pdf file
named “my_cluster_plots.pdf”. In this file, the individual pro-
files for the genes part of a given cluster are plotted in gray
and the mean abundance profile for the cluster is plotted in
blue. Genes part of the same cosmid are expected to behave
similarly and thus to be part of the same gene cluster. Also,
since the resistance phenotype conferred by a given cosmid is
expected to result from the overexpression of a single gene (or
at maximum only a few genes), it is important to realize that
not all genes from a given cluster will produce a phenotype
upon their individual overexpression. The gene clusters should
thus be carefully analyzed and ranked in terms of priority
based on their enrichment profile using the file “my_cluster_
plots.pdf” (see Note 39). The quantitative data for the priori-
tized gene clusters can be recovered from the appropriate
“subcluster_XX_log2_medianCentered_fpkm.matrix” files.
Use these files to compute (1) the gene-level mean abundance
for drug concentration replicates and (2) the gene-level fold-
enrichment compared to the P0 baseline sample (Fig. 2).
These computations can be done using Microsoft Excel or
similar spreadsheet software.
3.6 Validation 1. Cosmids that were highly enriched during Cos-Seq can be spe-
of Resistance cifically recovered by transforming E. coli with cosmid DNA
Conferred by Enriched derived from the passage at which the peak of selection
Cosmids occurred (e.g., transform DNA derived from passage 5 to
retrieve cosmids whose enrichment peaked at 16× EC50).
Fig. 2 Example of Cos-Seq output for gene loci implicated in drug resistance. Top panels: gene abundance and
differential enrichment profiles are generated from sequencing reads coverage. Genes sharing similar Cos-
Seq enrichment profiles are grouped into clusters. For each cluster, gray lines represent individual genes and
the blue line denotes the average gene profile. Gene abundance is expressed on the y-axis as log2-transformed
FPKM values centered to the median FPKM. Samples are ordered on the abscissa according to the selection
procedure, from nontreated (P0) samples to the fourth drug increment (P4). Middle panels: cosmids are identi-
fied from the list of enriched genes by looking for stretch of neighbor genes in the genome. Genes from the
same cosmid insert are expected to have similar enrichment profiles and usually belong to the same gene
cluster. Bottom panels: Fold enrichment for the genes part of enriched cosmids is normalized to the drug-free
control and expressed as fold increase at each increment in comparison to P0 baseline levels
2. Spread transformed bacteria onto LB-agar plates containing

ampicillin (100 mg/mL).
3. Pick random clones and expand individually in 5 mL of LB-
ampicillin (100 mg/mL).
4. Extract individual cosmid using plasmid DNA miniprep kit
from your favorite manufacturer.
5. Sanger sequence the edges of the cosmid’s insert using T7p
primer located immediately upstream of the multi cloning site
of cLHYG and a reverse primer (5′-GACCTCCTCGTC
TTCCTCCTG-3′) designed to prime sequencing on the other
side of the multiple cloning site.
6. Transform Leishmania parasites with the cosmids purified and
identified at step 5 and validate the resistance by performing a
growth inhibition assay with the drug responsible for their
enrichment during Cos-Seq. Compare the drug EC50 with
control parasites transfected with empty cLHYG.
4 Notes
1. We use SDM-79 [22] and M199 supplemented with 10%

(vol/vol) heat-inactivated FBS and 5 μg/mL hemin, but in
principle, any Leishmania culture media could be used.
2. Do not let dry for more than 30 min.
3. We use the DNazol reagent and protocol.
4. The gDNA size needs to be ≥100 kb to ensure fragments
≥25 kb are obtained upon partial restriction digest.
5. In our hands the best condition is usually the one from tube 2.
6. Incubation time is optimal for Antarctic phosphatase from
New England Biolabs. Optimization may be needed if using
other dephosphorylating enzymes.
7. At this point DNA must not be in contact with any DNA stain-
ing dye (e.g., EtBr, RedSafe). Do not add any to the gel.
8. To create the big well at the top of lane 10 in Fig. 1, use Scotch
tape to merge the 10th to 13th wells of a 14-well comb. To
create the big well located at the middle section of lane 10 in
Fig. 1, merge wells 10th to 13th of a second comb and add
scotch until a thickness of at least 5 mm. Remove the combs
gently once the gel is solidified as it will be fragile.
9. This ladder ranges approximately from 10 to 50 kb.
10. The gel should not be covered with TBE to avoid losing sam-
ple into TBE once reaching the big well in the middle section
of lane 10.
11. Curve the dialysis membrane so that it fits as tightly as possible
to the sides of the well to avoid losing samples.
12. Be careful not to aspirate gel pieces. This will contaminate
your DNA sample and hinder the next processing step.
13. Optionally, to ensure as much removal of EtOH as possible
without over drying the pellet, incubate the tube with its cap
opened for 15 min at 37 °C after solubilization of the DNA
with H2O.
14. This part must be done quickly as the separation of the organic
and aqueous phases fades with time.
15. Ligation with the Fast link ligase from Epicentre is performed
in small volume. Because phage packaging uses only 4 μL of
the ligation reaction, this allows to use almost half of the liga-
tion volume per packaging reaction.
16. The kit from Agilent suggests phage packaging for 2 h. We
usually incubate for 4 h at room temperature instead.
17. If the media becomes too thick, transfer it to a sterile 50 mL
tube and continue with a new 3 mL volume of LB broth.
18. The four bands at 494, 1732, 3032, and 6947 bp are derived
from the cLHYG vector itself. These bands should be present
in every successful digestion.
19. The efficiency of transfection may vary depending on the

strain. The number of clones obtained per transfection will
influence the number of transfections required to reach accept-
able genome coverage.
20. We usually test a minimum of five drug concentrations and a
no-drug control (six flasks total), but you can test more
concentrations.
21. Incubation can be done with gentle shaking.
22. For this section we recommend using two Cos-Seq replicates
for each drug concentration. We also recommend performing
both replicates at the same time.
23. Be careful not to touch the middle phase. Contamination with
phenol will ruin the process. It is advisable to recover a bit less
aqueous phase than collecting most of it at the risk of contami-
nating your sample with phenol.
24. Before proceeding to genomic DNA digestion, it is necessary
to remove RNase because it will decrease DNase efficiency.
25. At this point the DNA pellet may not be visible.
26. The kDNA is usually less than 2 kb.
27. No more than 5 min.
28. Be careful not to over dry as this will hamper proper solubili-
zation. To ensure as much removal of isopropanol as possible
without over drying the pellet, incubate the tube with its cap
opened for 15 min at 37 °C for 15 min after solubilization of
the DNA with H2O.
29. We usually quantify our DNAs using the Quantus system from
Promega, or equivalent.
30. Because the diversity of cosmids is inversely proportional to
drug pressure during Cos-Seq selection, it may be possible to
increase the number of samples per flowcell lane if only multi-
plexing highly selected samples (e.g., samples selected at 8× or
16× EC50).
31. An alternative way of installing kallisto is to clone it from
GitHub at https://github.com/pachterlab/kallisto
32. Differential abundance analysis can also be done using limma
or DESeq2. To install these packages, type:
#shell
biocLite('limma')
biocLite('DESeq2')
33. Our Cos-Seq sequencing is usually conducted in paired-ends
mode so we have left and right sequencing reads. If using single
reads sequencing mode, the “--left” and “--right” switches in

the “trinity_kallisto_<sampleID>.sh” scripts should be
replaced by the “--single” switch to provide the name of your
single FASTQ file.
34. It would also be possible to use a reference genome file listing
the sequence of entire chromosomes along with a gene anno-
tation file (gff file) for the analysis. Doing so would require
modifications to the current pipeline, however, as it relies on a
reference file listing only the gene sequences for simplicity
reasons.
35. You can change to other abundance estimation methods using
the “--est_method” switch in the script. Kallisto could be
changed to either RSEM, eXpress or salmon, which are the
other gene abundance quantification methods supported by
Trinity. Note that you should, however, first download and
install these additional software, a step not covered by the cur-
rent chapter. The number of CPUs for running the task can
also be changed, by using a different integer number for the
switch “--thread_count”.
36. You could also use the DESeq2 or limma/voom tools instead
of edgeR. This is specified by the “--method” switch at step 5.
Simply replace “edgeR” by “DESeq2” or “voom.”
37. The threshold for minimum fold-change and FDR can be
changed using the switches “-C” and “-P”, respectively.
Note that the intended fold-change threshold specified at
the “-C” switch should correspond to the log2-transformed
fold-change value.
38. You can increase or decrease the number of gene clusters by
changing the integer number specified by the switch
“‘--Ptree”.
39. The most highly enriched gene clusters are the most interest-
ing, especially if the abundance of their genes is steadily
increasing over the course of the Cos-Seq selection. Still, clus-
ters that are enriched up to the a given drug concentration
(e.g., 8× or 16× EC50) but at which point abundance suddenly
drops are also relevant as these may simply harbor genes whose
overexpression yields more subtle resistance phenotypes.
References
1. Ryan KA, Garraway LA, Descoteaux A et al for mutations in the high affinity folate trans-
(1993) Isolation of virulence genes directing porter and contributes to methotrexate resis-
surface glycosyl-phosphatidylinositol synthesis tance in the protozoan parasite Leishmania
by functional complementation of Leishmania. tarentolae. EMBO J 18(9):2342–2351.
Proc Natl Acad Sci U S A 90(18):8609–8613 https://doi.org/10.1093/emboj/18.9.2342
2. Kundig C, Haimeur A, Legare D et al (1999) 3. Coelho AC, Beverley SM, Cotrim PC (2003)
Increased transport of pteridines compensates Functional genetic identification of PRP1, an
ABC transporter superfamily member confer- Int J Parasitol Drugs Drug Resist 8(2):
ring pentamidine resistance in Leishmania 165–173. https://doi.org/10.1016/j.ijpddr.
major. Mol Biochem Parasitol 130(2):83–90 2018.03.004
4. Cotrim PC, Garrity LK, Beverley SM (1999) 13. Haas BJ, Papanicolaou A, Yassour M et al
Isolation of genes mediating resistance to (2013) De novo transcript sequence recon-
inhibitors of nucleoside and ergosterol metab- struction from RNA-seq using the Trinity plat-
olism in Leishmania by overexpression/selec- form for reference generation and analysis. Nat
tion. J Biol Chem 274(53):37723–37730 Protoc 8(8):1494–1512. https://doi.org/
5. Kotze AC, Hunt PW, Skuce P et al (2014) 10.1038/nprot.2013.084
Recent advances in candidate-gene and whole- 14. Li B, Dewey CN (2011) RSEM: accurate tran-
genome approaches to the discovery of anthel- script quantification from RNA-Seq data with
mintic resistance markers and the description of or without a reference genome. BMC
drug/receptor interactions. Int J Parasitol Bioinformatics 12:323. https://doi.org/
Drugs Drug Resist 4(3):164–184. https:// 10.1186/1471-2105-12-323
doi.org/10.1016/j.ijpddr.2014.07.007 15. Zhang C, Zhang B, Lin LL et al (2017)
6. Horn D, Duraisingh MT (2014) Antiparasitic Evaluation and comparison of computational
chemotherapy: from genomes to mechanisms. tools for RNA-seq isoform quantification.
Annu Rev Pharmacol Toxicol 54:71–94. BMC Genomics 18(1):583. https://doi.
https://doi.org/10.1146/annurev-pharmtox- org/10.1186/s12864-017-4002-1
011613-135915 16. Zakeri M, Srivastava A, Almodaresi F et al
7. Downing T, Imamura H, Decuypere S et al (2017) Improved data-driven likelihood fac-
(2011) Whole genome sequencing of multiple torizations for transcript abundance estimation.
Leishmania donovani clinical isolates provides Bioinformatics 33(14):i142–i151. https://
insights into population structure and mecha- doi.org/10.1093/bioinformatics/btx262
nisms of drug resistance. Genome Res 21(12): 17. Patro R, Duggal G, Love MI et al (2017)
2143–2156. https://doi.org/10.1101/gr. Salmon provides fast and bias-aware quantifi-
123430.111 cation of transcript expression. Nat Methods
8. Coelho AC, Boisvert S, Mukherjee A et al 14(4):417–419. https://doi.org/10.1038/
(2012) Multiple mutations in heterogeneous nmeth.4197
miltefosine-resistant Leishmania major popula- 18. Bray NL, Pimentel H, Melsted P et al (2016)
tion as determined by whole genome sequenc- Near-optimal probabilistic RNA-seq quantifi-
ing. PLoS Negl Trop Dis 6(2):e1512. https:// cation. Nat Biotechnol 34(5):525–527.
doi.org/10.1371/journal.pntd.0001512 https://doi.org/10.1038/nbt.3519
9. Leprohon P, Fernandez-Prada C, Gazanion E 19. Robinson MD, McCarthy DJ, Smyth GK
et al (2015) Drug resistance analysis by next gen- (2010) edgeR: a Bioconductor package for dif-
eration sequencing in Leishmania. Int J Parasitol ferential expression analysis of digital gene
Drugs Drug Resist 5(1):26–35. https://doi. expression data. Bioinformatics 26(1):139–
org/10.1016/j.ijpddr.2014.09.005 140. https://doi.org/10.1093/bioinformat-
10. Gazanion E, Fernandez-Prada C, Papadopoulou ics/btp616
B et al (2016) Cos-Seq for high-throughput 20. Love MI, Huber W, Anders S (2014) Moderated
identification of drug target and resistance estimation of fold change and dispersion for
mechanisms in the protozoan parasite RNA-seq data with DESeq2. Genome Biol
Leishmania. Proc Natl Acad Sci U S A 15(12):550. https://doi.org/10.1186/
113(21):E3012–E3021. https://doi.org/ s13059-014-0550-8
10.1073/pnas.1520693113 21. Law CW, Chen Y, Shi W et al (2014) voom:
11. Albert Descoteaux LAG, Ryan KA, Garrity LK, Precision weights unlock linear model analysis
Tuco SJ, Beverly SM (1994) Identification of tools for RNA-seq read counts. Genome Biol
Genes by Functional Complementation in 15(2):R29. https://doi.org/10.1186/
Protozoan Parasite Leihsmania. Methods Mol gb-2014-15-2-r29
Biol 3:23 22. White TC, Fase-Fowler F, van Luenen H et al
12. Fernandez-Prada C, Sharma M, Plourde M (1988) The H circles of Leishmania tarentolae
et al (2018) High-throughput Cos-Seq screen are a unique amplifiable system of oligomeric
with intracellular Leishmania infantum for the DNAs associated with drug resistance. J Biol
discovery of novel drug-resistance mechanisms. Chem 263(32):16977–16983
Chapter 8
Gene Replacement by Homologous Recombination

Henner Zirpel and Joachim Clos
Abstract
While homologous recombination-based gene replacement is about to be supplanted by more modern
approaches, it is still retaining usefulness for genes that prove to be poor targets for CRISPR/cas-based
approaches. Homologous recombination has proven to be relatively robust to minor sequence mismatches
between GOI-flanking sequences and the gene replacement constructs, and the faithfulness of recombina-
tion events is easily verified by whole-genome sequencing. Moreover, the availability of custom synthetic
gene production by numerous service providers should allow for a relatively quick generation of null
mutants without the need to introduce additional protein-coding genes beyond the selection markers.
Key words Leishmania, Homologous recombination, Gene replacement, Reverse genetics
1 Introduction
For over 25 years, homologous recombination-based gene replace-

ment [1, 2] had been the method of choice for reverse genetics
analysis in Leishmania spp., in spite of a number of drawbacks.
While new methodologies such as CRISPR/cas gene editing
(Chapter 9) and DiCre-based gene disruption (Chapter 10) have
been added to the reverse genetics toolbox for Leishmania [3–7],
they, like homologous recombination, may not work for all genes
of interest (GOI) targeted for reverse genetics. Moreover, creating
parent Leishmania strains for CRISPR/cas gene editing may also
involve the insertion of transgenes via homologous recombination,
for example, into the 18S rRNA gene repeats [6].
Homologous recombination-based gene replacement is usu-
ally limited to single-copy, double-allelic GOI that are not essential
or critical for the viability or growth of the promastigote stage.
Due to their slow proliferation, axenic amastigotes of those leish-
maniae able to undergo an axenic life cycle are not promising tar-
gets for homologous recombination and subsequent antibiotic
selection. Moreover, the gene loci of GOI with a low expression
may not yield sufficient expression of the antibiotic resistance
169
170 Henner Zirpel and Joachim Clos
markers needed for a successful selection, requiring the augmenta-

tion of gene replacement constructs with additional, empirically
proven flanking DNA sequences [8].
For homologous recombination to occur using the parasites’
inherent recombination activity [9], a selectable marker gene
should be flanked by >0.5 kbp of both 5′- and 3′-noncoding
sequences [10]. Even with the greater sequence divergence
between Leishmania species in the noncoding regions, gene
replacement constructs designed for one species may well work in
another species [11], providing a little flexibility in the choice of a
parent species or strain.
The classic pathway to assemble a gene replacement construct
is a three-step approach. The 5′- and 3′-noncoding regions of the
GOI are both amplified by PCR using primers that introduce sin-
gle restriction sites. The assembly pathway must be planned care-
fully to avoid interference with natural restriction sites in the GOI
noncoding regions. We found it most expedient to use a standard
system of plasmid vector and restriction sites for all GOI wherever
possible. Such a cassette system allows the recycling of vector DNA
and selection marker genes from verified gene replacement con-
structs and simplifies planning. As a vector backbone, we chose the
multicopy pUC19 plasmid [12] for its small size (<2.7 kbp) and
conveniently arranged multiple cloning site. This approach will be
described in detail.
Alternatively, the gene replacement constructs can be assem-
bled using simultaneous, multiple fusion (e.g., by using the
In-Fusion HD Cloning Plus system (Clontech)) [13], or be
ordered from a synthetic gene service provider. While stepwise
assembly usually takes 4 weeks of time, the In-Fusion system may
save 2 weeks in preparation. The use of a service provider, while
more costly, may save time depending on the delivery time, but
may greatly speed up a project where multiple GOI are targeted.
Once the recombination constructs have been prepared, they
are excised from the vector and purified. Transfection of Leishmania
spp. is usually performed by electroporation. Here, the choice of the
system depends on the local availability as all electroporation systems
perform satisfactorily. Care must be taken to optimize the electric
pulse treatment for the particular strain used as parent for the gene
replacement. As a rough guideline, 40–60% of the promastigotes
should survive the electric pulse treatment. Electroporation effi-
ciency can also be optimized by performing transfection with fluo-
rescent protein transgene constructs and determining the ratio of
fluorescent to nonfluorescent cells microscopically. The two alleles
of a gene may be targeted sequentially or simultaneously [14].
The former strategy should yield at least single-allele gene replace-
ment mutants in the case of an essential GOI. The latter strategy
shortens the time under selection and leaves less time for off-target
genetic adaptations of a null mutant.
Gene Replacement by Homologous Recombination 171
One day after electrotransfection, transfectants and mock

transfectants are subjected to single or double antibiotic selection.
The optimal antibiotic concentration for each parasite strain and
antibiotic batch must be determined empirically prior to transfec-
tion. Depending on the targeted species, growth in the transfected
populations should be detectable within 10–20 days, while the
mock transfectants should not show detectable growth.
Clones are then raised by dilution into 96-well cell culture
plates and subjected to genotyping by analytic PCR, RT-qPCR
and, if possible, Western blot analysis to verify the null mutant sta-
tus. In principle, the old stand-by techniques of Southern and
Northern blot may also be employed, but the PCR-based verifica-
tion is quicker, more sensitive, and ultimately more reliable.
Further analysis may include whole-genome sequencing fol-
lowed by SNP/INDEL analysis. This will not only establish the
gene replacement but also show additional genome changes
incurred during selection.
Lastly, in order to confirm a particular phenotype associated
with a gene replacement mutant, it is important to show that ecto-
pic expression of the GOI can restore the null mutants to a wild
type-like phenotype. This can be achieved either by reinserting the
GOI (1) in the original gene locus or (2) in a different gene locus,
or (3) by ectopic expression from a stably transfected plasmid or
cosmid episome. Of these strategies, we prefer and describe the
third.
2 Materials
2.1 In Silico Planning 1. TriTrypDB.

of the Gene 2. MacVector®, VectorNTI®, or similar software suite capable of
Replacement in silico “cloning.”
Constructs
2.2 Three-Step 1. Plasmid pUC19 [12].

Assembly of Gene 2. 10× CutSmart® buffer, New England Biolabs.
Replacement
3. EcoRI, KpnI, BamHI, NdeI, SwaI, New England Biolabs.
Constructs
4. Formamide loading buffer: 90% v/v formamide, 10% v/v TE
buffer (Subheading 2.3, item 3), 5 mg/ml bromophenol blue
(Sigma-Aldrich), and 5 mg/ml xylene cyanol (Sigma-Aldrich).
Mix and store at RT.
5. Agarose, low endoosmosis grade (LE) (e.g., SeaKem).
7. GeneClean® II Kit, MPO Biomedicals.

8.
Phenol–chloroform–isoamyl alcohol mix (25:24:1, Tris-
buffered at pH 8.0), Carl Roth.
9. 7.5 M ammonium acetate stock solution.
10. Ethanol 96%.
11. T4 DNA ligase, New England Biolabs, with 10× T4 ligase
reaction buffer.
12. Subcloning Efficiency E. coli DH5α, Bio-Rad.
13. Luria–Bertani medium.
14. 5 mg/ml ampicillin stock solution.
2.3 Ectopic See Subheading 2.2, plus:

Expression of GOI
1. Selectable expression vector plasmid (e.g., pCL2N) [16].
2. Restriction endonucleases as required, ligase (Subheading 2.2,
item 11), proofreading-capable PCR amplification system
(e.g., iProof Polymerase, Bio-Rad).
3. PCR amplification primers for the GOI coding region, match-
ing the planned restriction sites.
4. Plasmid DNA maxiprep capability, either by kit (multiple ven-
dors) or by alkaline lysis and CsCl gradient ultracentrifuga-
tion [15].
2.4 Electro- 1. PBS (0.137 M NaCl, 10 mM Na2HPO4, 2.7 mM KCl, 1.8 mM
transfection K2HPO4, pH = 7.4).
2. Electroporation buffer: 21 mM HEPES pH = 7.5, 137 mM
NaCl, 5 mM KCl, 0.7 mM Na2HPO4, and 6 mM glucose.
3. Electroporation cuvette 0.4 cm electrode gap (e.g., Biozym).
4. Bio-Rad Gene Pulser or similar system.
5. Medium 199+: 1× Medium199 with Hanks’ Salts (Sigma) sup-
plemented with 20% heat-inactivated, fetal calf serum (batch-
tested for optimal promastigote growth from low cell density),
100 μM adenine, 10 μg/ml heme, 40 μM HEPES pH 7.4,
1.2 μg/ml 6-biopterin, and 20 μg/ml gentamycin.
6. 100× PenStrep: 10,000 units/ml penicillin, 10 mg/ml strep-
tomycin, Sigma-Aldrich.
7. Selection antibiotics (G418, puromycin, bleocin, blasticidin,
hygromycin, or streptothricin).
8. Cryo storage medium: 1× M199, 50% v/v heat-inactivated
fetal calf serum, 20% v/v DMSO.
9. Cryo vials.
2.5 Generation Same as Subheading 2.4.

of Double Allele Gene
Replacement Mutants
2.6 Cloning 1. Medium 199+: 1× Medium199 with Hanks’ salts (Sigma) sup-
of Putative Null plemented with 20% heat-inactivated, fetal calf serum (batch-
Mutants tested for optimal promastigote growth from low cell density),
100 μM adenine, 10 μg/ml heme, 40 μM HEPES pH 7.4,
1.2 μg/ml 6-biopterin, and 20 μg/ml gentamycin.
2. 100× PenStrep: 10,000 units/ml penicillin, 10 mg/ml strep-
tomycin, Sigma-Aldrich).
3. Selection antibiotics (G418, puromycin, bleocin, blasticidin,
hygromycin, or streptothricin).
4. Sterile 96-well tissue culture plate (any vendor).
2.7 Verifying Null 1. Phosphate-buffered saline solution (PBS).

Mutants (Genotype) 2. ISOLATE II Genomic DNA Kit (BIOLINE).
3. GOI-5′-fwd primer (GOI-specific design).
4. GOI-3′-rev primer (GOI-specific design).
5. Selection marker (SM)-5′-fwd (SM-specific design).
6. SM-3′-rev (SM-specific design).
7. GOI-5′-NC-fwd (GOI-specific design).
8. GOI-3′-NC-rev (GOI-specific design).
9. SM-3′-fwd (SM-specific design).
10. SM-5′-rev (SM-specific design).
2.8 Verifying Null Next generation sequencing facility.

Mutants by Whole-
Genome Sequencing
(Optional)

Mutants and Add- 2. InviTrap® Spin Cell RNA Mini (Stratec).
Backs by RT-qPCR
3. Dithiothreitol (DTT aka Cleland’s Reagent).
4. QuantiTect® Reverse Transcription Kit (QIAGEN).
5. DyNAmo Flash SYBR Green qPCR Kit (ThermoFisher).
6. MacVector®, VectorNTI®, or similar software suite capable of
PCR primer design.
7. GOI forward primer (GOI-specific design).
8. GOI reverse primer (GOI-specific design).
9. Leishmania spp. actin-specific forward primer.
10. Leishmania spp. actin-specific reverse primer.
11. Rotor Gene 6000 or similar qPCR system.

Mutants and Add- 2. 2× protein gel loading buffer [17]: 100 mM Tris–HCl pH 6.8,
Backs by Western Blot 100 mM dithiothreitol, 4% sodium dodecyl sulfate, 0.01% bro-
mophenol blue, 20% glycerin
3. Sodium dodecyl sulfate–polyacrylamide gel [15].
4. Polyvinylidene difluoride (PVDF) membrane, PALL.
3 Methods
3.1 In Silico Planning 1. From the TriTryp database, download the current release of
of the Gene the relevant genome sequences (http://tritrypdb.org/com-
Replacement mon/downloads/Current_Release/).
Constructs 2. Identify the GOI with its flanking 5′- and 3′ noncoding
sequences. Locate the upstream and downstream neighboring
CDSs as well. Identify 1000 bp each of noncoding sequences
immediately upstream (5′) and downstream (3′) of the GOI. If
necessary, shorten the 5′- and 3′-flanks to avoid overlap with
upstream or downstream CDSs.
3. Design oligonucleotide primers for amplification of the selected
5′- and 3′-noncoding sequences. An 18–20 nt 3′ sequence match
is required, while a 5′ addition of between 10 and 20 nt adds the
required restriction sites to the PCR amplificates. Add four nucle-
otides 5′ of the restriction site to facilitate efficient cleavage.
4. Make certain that internal restriction sites in the 5′- or 3′-noncod-

ing DNA will not interfere with the planned ligation pathway! If
possible, use an in silico cloning software (e.g., MacVactor™ or
VectorNTI™) to assemble the constructs in silico first!
3.2 Three-Step See Note 1.

Assembly of Gene
1. To evade conflicts with internal restriction sites in one or two
Replacement
of the moieties to be joined, any sequence of assembly works.
Constructs Still, the standard sequence is 5′-NC, 3′-NC, then either of
two selection marker genes. In our hands and using L. donovani
strain 1SR, puromycin and bleomycin resistance markers work
best, but G418 and hygromycin have been used as well. In the
following, the standard approach is described.
2. Digest 10 μg of plasmid pUC19 [12] in a 50 μl Volume with
5 μl of 10× CutSmart buffer and 20 units each of the two
required restriction endonucleases (e.g., EcoRI and KpnI) for
1 h at 37 °C. After addition of another ten units each of the

restriction enzymes, incubate for another 1 h at 37 °C.
3. Add 15 μl of formamide sample buffer, apply to a 1% agarose/
TAE buffer gel, run at 3 V/cm for 90 min along with a DNA
size marker mix, and stain in ethidium bromide (5 μg/ml) for
10 min. Examine on a long-wave-length UV transilluminator
(λ > 300 nm). A single DNA band should be visible after the
digest (see Note 2). Using a disposable scalpel and taking care
to avoid damaging the gel tray, cut the fluorescent band from
the gel. Place the gel pieces in 2 ml reaction vials and weigh.
4. Add 2 μl of the 3 M NaI solution from the GeneClean II kit
per mg of gel and incubate at 50 °C until the gel piece is dis-
solved. Add 20 μl of freshly mixed glass bead suspension to the
vial and incubate at RT for 5 min. Spin at RT for 1 min,
5000 × g. Carefully remove the supernatant and add 500 μl of
1× NEW wash. Vortex briefly and spin down (1 min, 5000× g).
Remove the NEW wash and replace with 500 μl of fresh NEW
wash. Again, vortex, spin the glass beads down (1 min,
5000× g), and remove the NEW wash. Spin briefly again to
collect residual NEW wash and remove that, too. Add 50 μl of
H2O and suspend the glass beads by gentle, up-and-down
pipetting. Incubate the suspension at 60 °C for 5 min and spin
down the glass beads (10,000× g, 1 min, RT). Collect the
supernatant and transfer to a fresh reaction vial. Remove a 2 μl
aliquot, mix with 2 μl formamide loading buffer and analyze by
1% agarose gel electrophoresis in TAE buffer. Ascertain proper
size and quantity of the purified, linearized vector.
5. Using the 5′-EcoRI and 3′-KpnI primers and 100 ng of
Leishmania spp. genomic DNA, amplify the 5′-NC gDNA
(Fig. 1a–c). Purify the PCR product by preparative 1% aga-
rose/TAE buffer electrophoresis (Subheading 3.2, step 3) and
Gene Clean II glass bead adhesion (Subheading 3.2, step 4).
Elute DNA from the glass beads in 10–20 μl of H2O and digest
in a 50 μl Volume with 5 μl of 10× CutSmart buffer and ten
units each of the two required restriction endonucleases (e.g.,
EcoRI and KpnI) for 1 h at 37 °C. After addition of another
five units each of the restriction enzymes, incubate for another
1 h at 37 °C. Extract digested DNA with one volume of phe-
nol–chloroform–isoamyl alcohol mix (25:24:1), mix at
1200 rpm at RT, and centrifuge at 10,000 × g, RT, 2 min.
Carefully transfer the aqueous, upper phase to a fresh reaction
vial, add 0.1 volume of 7.5 M ammonium acetate and three
volumes of 96% ethanol, and mix by overturning. Sediment
the digested PCR products by centrifugation at 14,500 × g,
RT, 20 min and carefully remove the ethanol supernatant.
Dissolve the DNA pellet in 20 μl of H2O. Mix 2 μl of the dis-
solved, digested PCR product with 2 μl of formamide loading
Fig. 1 Schematic representation of the three-step assembly of gene replacement constructs. Single restric-
tions sites are shown, utilized restriction sites are shown in bold. GOI Gene of interest, CDS Coding sequence,
NC 5′ or 3′ noncoding DNA, relative to GOI
buffer and run on a 1% agarose/TAE buffer gel along with the

DNA size marker. Assess quantity and quality of the DNA
along with the digested vector DNA (Subheading 3.2, step 4).
6. Mix 100–200 ng of digested vector with a fivefold molar excess
of purified, digested PCR product in 10 μl, with 1 μl of 10× liga-
tion reaction buffer and five units of T4 DNA ligase. Also mix
a negative control without PCR product. Incubate at 8 °C
(refrigerator) overnight. Use 1 μl of each of the ligation reac-
tion and control to transform 50 μl of Subcloning Efficiency E.
coli DH5α bacteria, following the supplier’s recommendation,
and plate 0.2 volumes on LB-agar plates with 100 μg/ml ampi-
cillin. Incubate overnight at 37 °C. Compare colony numbers.
The colony number ratio for ligation reaction versus control
reaction should be >1. If the control ligation/transformation
yields too many colonies, start fresh at Subheading 3.2, step 2.
7. Identify and verify bacterial clones bearing the pUC19-5′-NC
plasmid (Fig. 1e) by plasmid minipreparation from single colo-
nies, followed by appropriate restriction fragment length anal-
ysis, followed by DNA sequence analysis. Of a verified colony,
prepare high-quality maxiprep plasmid DNA.
8. Continuing with the pUC19-5′-NC plasmid (Fig. 1e), digest
with the required restriction endonucleases (e.g., BamHI and
HindIII) as described in Subheading 3.2, step 2.
9. Using the primer pair designed for the 3′-NC DNA, perform
PCR amplification from gDNA as described in Subheading
3.2, step 5 (Fig. 1f, g), purify, and digest with the appropriate
enzymes (e.g., BamHI and HindIII).
10. Ligate the amplified and digested 3′-NC DNA into the digested
pUC19-5′-NC plasmid and process as described in Subheading
3.2, steps 6 and 7 to produce pUC19-5′ + 3′-NC (Fig. 1h).
11. Next, amplify the antibiotic resistance marker genes using
primers that engineer KpnI and BamHI sites at the 5′- and 3′
ends, respectively, or excise marker gene from a plasmid
(Fig. 1i) with KpnI and BamHI and ligate between the KpnI
and BamHI sites of the pUC19-5′+3′-NC plasmid to yield one
of the two gene replacement constructs (Fig. 1j). Produce
high-quality plasmids either by cesium chloride density gradi-
ent ultracentrifugation [15] or by using a plasmid maxiprep
kit. Verify the finished plasmids by sequencing.
12. Excise the recombination cassette from the plasmid backbone
(Fig. 1k). This can be done by a double digest, for example, with
Hind III and EcoRI, or when amplifying the 5′- and 3′-flanks,
another restriction site can be engineered close to the outer ends,

usually a SwaI site (ATTT|AAAT) which is extremely rare in the
G/C-rich Leishmania genomes and leaves blunt ends after
digest. Since recombination cassette and vector backbone can be
very close in size, separation by preparative agarose gel electro-
phoresis may not be feasible. Fortunately, a separation is not nec-
essary for the success of a homologous recombination and can be
dispensed with. In such a case, a simple phenol–chloroform
extraction (see above) followed by ethanol precipitation will suf-
fice. After purification and solubilization, determine the concen-
tration and set it to 0.2–0.5 μg/μl. Store at −20 °C.
3.3 Ectopic 1. In order to confirm a particular phenotype associated with a

Expression of GOI gene replacement mutant it is important to show that ectopic
expression of the GOI can restore the null mutants to a wild
type-like phenotype.
2. Digest 10 μg of plasmid pCL2N [16] in a 50 μl volume with
5 μl of 10× CutSmart buffer and 20 units each of the two
required restriction endonucleases (e.g., KpnI and BglII) for
1 h at 37 °C. After addition of another ten units each of the
restriction enzymes, incubate for another 1 h at 37 °C.
3. Add 15 μl of formamide sample buffer, apply to a 1% agarose/
TAE buffer gel, run at 3 V/cm for 90 min along with a DNA
size marker mix, and stain in ethidium bromide (5 μg/ml) for
10 min. Examine on a long-wavelength UV transilluminator
(λ > 300 nm). A single DNA band should be visible after the
digest (see Note 2). Using a disposable scalpel and taking care
to avoid damaging the gel tray, cut the fluorescent band from
the gel. Place the gel piece in 2 ml reaction vials and weigh.
4. For each mg of agarose gel, add 2 μl of the 3 M NaI solution
from the GeneClean II kit and incubate at 50 °C until the gel
piece is dissolved. Add 20 μl of freshly vortexed glass bead sus-
pension to the vial and incubate at RT for 5 min. Spin at RT
for 1 min, 10,000 × g. Carefully remove the supernatant and
add 500 μl of 1× NEW wash. Vortex briefly and spin down
(1 min, 10,000 × g). Remove the NEW wash and replace with
500 μl of fresh NEW wash. Again, mix by vortexing, spin the
glass beads down for 1 min at 10,000 × g, and remove the
NEW wash. Spin briefly again to collect residual NEW wash
and remove that, too. Add 50 μl of H2O and suspend the glass
beads by gentle, up-and-down pipetting. Incubate the suspen-
sion at 60 °C for 5 min and spin down the glass beads at
10,000 × g for 1 min. Carefully transfer the supernatant to a
fresh reaction vial. Remove a 5 μl aliquot, mix with 2 μl for-
mamide loading buffer and analyze by 1% agarose gel electro-
phoresis in TAE buffer. Check for proper size and quantity of
the purified, linearized vector.
5. Using the 5′-KpnI and 3′-BamHI primers and 100 ng of

Leishmania spp. genomic DNA, amplify the coding sequence
(Fig. 2a, b). Purify the PCR product by preparative 1% aga-
rose/TAE buffer electrophoresis (Subheading 3.3, step 3) and
Gene Clean II glass bead adhesion (Subheading 3.3, step 4).
Elute DNA from the glass beads in 10–20 μl of H2O and digest
in a 50 μl volume with 5 μl of 10× CutSmart buffer and ten
units each of the two required restriction endonucleases (e.g.,
BamHI and KpnI) for 1 h at 37 °C. After addition of another
five units each of the restriction enzymes, incubate for another
1 h at 37 °C. Extract digested DNA with one volume of phe-
nol–chloroform–isoamyl alcohol mix (25:24:1), mix at
1200 rpm at RT, and centrifuge at 10,000 × g, RT, 2 min.
Carefully transfer the aqueous, upper phase to a fresh reaction
vial, add 0.1 volume of 7.5 M ammonium acetate and three
volumes of 96% ethanol, and mix by overturning. Sediment
Fig. 2 Assembly of plasmid construct for ectopic expression of the GOI. (a) Amplification of GOI CDS by
proofreading-capable PCR system. (b) Digest of PCR product with restriction endonucleases; here: KpnI and
BamHI. (c) Digest of expression plasmid pCL2N with compatible restriction endonucleases; here: KpnI and
BglII. (d) Ligation of expression plasmid
the digested PCR products by centrifugation at 14,500 × g,

RT, for 20 min and carefully remove the ethanol supernatant.
Dissolve the DNA pellet in 20 μl of H2O. Mix 2 μl of the dis-
solved, digested PCR product with 2 μl of formamide loading
buffer and run on a 1% agarose/TAE buffer gel along with the
DNA size marker. Assess quantity and quality of the DNA
along with the digested vector DNA (Subheading 3.3, step 4).
6. Mix 100–200 ng of digested vector with a fivefold molar excess
of purified, digested PCR product in 10 μl, with 1 μl of
10× ligation reaction buffer and five units of T4 DNA ligase.
Also mix a negative control without PCR product. Incubate at
8 °C (refrigerator) overnight. Use 1 μl each of the ligation
reaction and control reaction to transform 50 μl of Subcloning
Efficiency E. coli DH5α bacteria, following the supplier’s rec-
ommendation, and plate 0.2 volumes on LB-agar plates with
100 μg/ml ampicillin. Incubate overnight at 37 °C. Compare
colony numbers. The colony number ratio for ligation reaction
versus control reaction should be >1. If the control ligation/
transformation yields too many colonies, start fresh at
Subheading 3.3, step 2.
7. Identify and verify bacterial clones bearing the pCL2N-GOI
plasmid (Fig. 2c) by plasmid minipreparation from single colo-
nies and appropriate restriction fragment length analysis, fol-
lowed by DNA sequence analysis. Of a verified colony, prepare
high-quality maxiprep plasmid DNA. Determine the concen-
tration and set it to 0.2–0.5 μg/μl. Store at −20 °C.
8. For electrotransfection (Subheading 3.4), 20 μg of the circular
plasmid are required. To avoid excessive overexpression of the
GOI, the pCL2N-GOI vector can be mixed at a 1:2 ratio with
the empty pCL2N vector.
3.4 Electro- Carry out all procedures under sterile conditions in a laboratory
transfection licensed for the handling of recombinant leishmaniae! Observe
guidelines and regulations for the handling of recombinant patho-
gens in your country! Always wear a lab coat, gloves and eye pro-
tection when handling cells or buffers. Clean all surfaces, bottles,
and plasticware with an antiseptic solution. Prewarm media and
buffers for cell cultivation, unless otherwise specified.
1. Grow Leishmania promastigotes in appropriate medium to
middle logarithmic phase (i.e., 8 × 106 cells/ml).
2. Sediment 4 × 107 cells at 1000 × g, 4 °C for 10 min.
3. Discard the supernatant and resuspend cells in 10 ml cold
(4 °C) PBS. Sediment at 1000 × g, 4 °C for 10 min.
4. Repeat step 3.
5. Discard the supernatant and resuspend cells in 10 ml ice-cold

electroporation buffer. Sediment at 1000 × g, 4 °C for 10 min.
6. Discard the supernatant and resuspend cells in 400 μl ice-cold
electroporation buffer.
7. Add 2 μg of the linearized construct or 50 μg of a circular
DNA construct to the precooled (ice) electroporation cuvette.
8. Add 400 μl of the cell suspension and mix by tipping against
the cuvette.
9. Pulse 3× at 1.5 kV, 200 Ω, 25 μF and a time-constant of 0.9 to
1.5 (Bio-Rad Gene Pulser).
10. Incubate on ice for 10 min.
11. Transfer the cell suspension into prewarmed (25 °C) 10 ml
M199+, supplemented with 100 μl PenStrep and incubate at
25 °C for 24 h, allowing homologous recombination to occur
(Fig. 3).
12. Add the required antibiotics at IC95 (see Note 3).
13. Incubate at 25 °C for 24 h.
14. Dilute cells 1:10 in M199+, supplemented with the required
antibiotics (IC95).
15. Antibiotic selection will take ~14 days or until the transfected
population shows motile promastigotes under microscopic
monitoring (40× magnification, phase contrast). The mock
transfection control must not contain viable, motile promasti-
gotes at this point.
16. Dilute cells 1:100 in M199+, supplemented with the required
antibiotics. Ascertain that the mock transfected population
does not resume growth. Repeat in vitro passage of the selected
population by 1:100 dilution and cultivation in M199+ with
both antibiotics to ~1 × 107 cell/ml.
17. Seed 2 × 30 ml cultures at 1 × 106 cells/ml in M199+ with
antibiotic and grow to 1 × 107 cells/ml; sediment by centrifu-
gation (1200 × g, 10 min, 4 °C) and resuspend at 2 × 108 cells/
ml in M199+ (w/o antibiotic). Mix with one volume of cryo
storage medium and distribute 1 ml aliquots in cryo vials.
Place inside a Styrofoam box and place the box in a −80 °C
freezer overnight. Quickly transfer the frozen samples to cryos-
torage in the gas phase over liquid N2.
3.5 Generation 1. Using the selected promastigotes from Subheading 3.4,

of Double Allele Gene step 16, repeat the process from Subheading 3.4, steps 1–16
Replacement Mutants using the second gene replacement construct. Apply selection
with both antibiotics at the predetermined IC95.
2. Seed 2 × 30 ml cultures at 1 × 106 cells/ml in M199+ with
antibiotic and grow to 1 × 107 cells/ml; sediment by centrifu-
Fig. 3 Schematic depiction of homologous recombination
gation (1200 × g, 10 min, 4 °C) and resuspend to 2 × 108 cells/

ml in M199+ (w/o antibiotic). Mix with one volume of cryo
storage medium and distribute 1 ml aliquots in cryo vials. Place
inside a Styrofoam box and place the box in a −80 °C freezer
o/n. Quickly transfer the frozen samples to cryostorage in the
gas phase over liquid N2.
3.6 Cloning Carry out all procedures under sterile conditions. Clean all sur-
of Putative Null faces, bottles, and plasticware with an antiseptic solution. Prewarm
Mutants media and buffers for cell cultivation, unless otherwise specified.
Always wear a lab coat and gloves when handling cells or buffers.
1. Sediment 1 × 107 cells obtained in Subheading 3.4, step 17 or
in Subheading 3.5, step 2 at 1200 × g, 4 °C for 10 min.
2. Discard the supernatant and resuspend cells in 1 ml M199+.
Determine cell density. Using serial dilution steps, produce a
50 cells/ml culture.
3. Add 2.5 ml of the cell suspension (Subheading 3.6, step 2) to

47 ml M199+ supplemented with 0.5 ml of 100× PenStrep and
the required antibiotic(s) (IC95) and split the diluted suspen-
sion into two 96-well tissue culture plates with 200 μl per well.
Seal the plates with parafoil and incubate for ~2 weeks at 25 °C.
4. Determine the percentage of wells containing viable parasites.
The percentage should be between 30% and 60%. Wells con-
taining very high or low number of parasites should be
discarded.
5. Select five wells from each plate and transfer the whole volume to
10 ml M199+ supplemented with required antibiotic(s) (IC95).
3.7 Verifying Null For gDNA isolation, use “ISOLATE II Genomic DNA Kit” or
Mutant Genotype similar.
1. Sediment 5 × 107 to 2 × 108 cells obtained in Subheading 3.4,
step 17 or in Subheading 3.5, step 2 at 1200 × g, 4 °C for
10 min. Discard the supernatant and resuspend cells in 10 ml
cold (4 °C) PBS.
2. Resuspend the pellet in 200 μl Lysis buffer GL. Add 200 μl
Lysis buffer G3 augmented with 25 μl proteinase K solution.
3. Continue gDNA isolation as described in the manufacturer’s
protocol.
4. To verify the successful gene replacement four PCRs are
needed (Fig. 4). In a first step the loss of the gene of interest
(GOI) is verified. Therefore, use two specific primers for your
GOI, one at the 5′-end (GOI-5′-fwd) and one at the 3′-end
(GOI-3′-rev) of the gene. The resulting PCR fragment should
be visible in the positive WT control, but missing in the null
mutant. (Please be aware that this PCR is not suitable for sin-
gle allele gene replacement mutants.)
5. The presence of the replacement construct is verified in a first
step by the presence of the resistance marker gene (RMG).
Therefore, use two specific primers binding to the 5′-end
(RMG-5′-fwd) and the 3′-end (RMG-3′-rev) of the resistance
maker gene. The resulting PCR fragment should be visible in
the null mutant, but missing in the WT control.
6. To verify the insertion at the correct gene position two PCRs
are needed. The first PCR will verify the correct 5′-position,
while the second will verify the correct 3′-position. The fwd
primer for the first PCR binds outside of the 5′-NC (GOI-5′-
NC-fwd), and the rev primer will bind at the 5′-end of the
RMG (RMG-5′-rev). The corresponding primer at the 3′-end
are the GOI-3′-NC-rev and the RMG-3′-fwd. Both PCRs
should show a fragment for the null mutant, while no frag-
ments should be visible for the WT control.
Fig. 4 Genotyping of putative null mutants. (a) Amplification of GOI CDS. (b) Control of resistance marker gene
integration in place of the GOI, using puroAC and bleoR as examples. Note that NC primers anneal beyond the
end points of the recombination constructs
3.8 Verifying Null The increasing availability and decreasing costs of next generation
Mutants by Whole- sequencing makes whole-genome sequencing of null mutants fea-
Genome Sequencing sible. This allows not only a high resolution verification of gene
(Optional) loss but may also detect gene duplications, changed ploidy of chro-
mosomes, and DNA sequence variants that may arise as compensa-
tion for the loss of the GOI. Using gDNA of a null mutant clone
and of its parental Leishmania strain to create a DNA fragment
library and the methodology involved in NGS is not the topic
of this chapter. However, Fig. 5 shows an example of a whole-
genome sequencing performed on wild type L. donovani and on
a replacement mutant for the 23 kD heat shock protein (HSP23)
gene [18]. The sequencing read coverage shows a gap for the
region encoding HSP23, confirming the gene replacement with
high resolution. Moreover, single nucleotide polymorphisms and
insertions/deletions specific for the null mutant can be detected
and give insight (not shown) into the genome rearrangements that
may ameliorate the phenotypic effects of the loss of gene function.
3.9 Verifying Null While working with viable parasites carry out all procedures under
Mutants and Add- sterile conditions. Clean all surfaces, bottles, and plasticware with an
Backs by RT-qPCR antiseptic solution. Prewarm media and buffers for cell cultivation,
unless otherwise specified. Always wear a lab coat and gloves when
Fig. 5 Illumina MiSeq reads of a genomic DNA library of L. donovani HSP23−/− [18]. The L. donovani gene IDs
are shown above the chromosome 34, with the red arrows representing the region containing the genes for the
58 kD antimony resistance marker, ARM58 [18], HSP23, and an emp24 family member protein. The HSP23 gene
was replaced by homologous recombination [18]. The positions of single nucleotide polymorphisms (SNPs) and
of insertions/deletions (INDELs) are shown above the sequencing read coverage graphs for wild type and
HSP23−/−. Note the absence of NGS reads in the HSP23 coding sequence for the null mutant [18, 19]
handling cells or buffers. If possible, use a dedicated laboratory bench

for RNA work. Clean all surfaces with a 1% SDS solution or with a
dedicated RNase remover (e.g., RNase AWAY (Sigma)).
1. Sediment 5 × 107 cells of the suspected null mutant, of the null
mutant expressing the GOI ectopically, and of the wild type at
1000 × g, 4 °C for 10 min. Prepare 2 biological samples of
each strain. Discard the supernatants and resuspend cells in
10 ml cold (4 °C) PBS. Sediment at 1000 × g, 4 °C for 10 min.
Repeat PBS wash once.
2. Resuspend the pellet in ~20 μl PBS and add 350 μl Lysis solu-
tion R augmented with DTT (InviTrap® Spin Cell RNA Mini
kit). Continue RNA isolation as described by the manufacturer’s
protocol.
3. Transcribe RNA into cDNA using the QuantiTect® Reverse
Transcription Kit or similar. Add 2 μl gDNA wipe out buffer
to 0.8 μg of RNA and add ddH2O to 14 μl. Incubate at 42 °C
for 4 min and cool down to 4 °C.
4. Add 5 μl of RT buffer with RT primer mix and 1 μl Reverse

Transcriptase. Incubate at 42 °C for 30 min, followed by
95 °C for 3 min. Cool down to 4 °C and store at −20 °C for
no longer than 48 h.
5. To verify null mutants and add-back mutants, use semiquanti-
tative real-time RT PCR [18]. Perform the qRT-PCR using
the DyNAmo Flash SYBR Green qPCR Kit. The gene of interest
(GOI) has to be standardized against actin.
GOI
SYBR Green MasterMix 10 μl
GOI forward primer (5 μM) 2 μl
GOI reverse primer (5 μM) 2 μl
ddH2O 5 μl
Actin
SYBR Green MasterMix 10 μl
L. donovani actin B2 primer (5 μM) 2 μl
L. donovani actin F1 primer (5 μM) 2 μl
ddH2O 5 μl
6. Design the GOI-specific primers to result in 80–120 bp prod-

ucts. Use both biological samples of the strains and two water
controls, and amplify each sample in triplicate according to the
following tables.
7. Run the RT-PCR using a Rotor Gene 6000 or similar.
Normalize the RT-qPCR against the median Ct values of the
wild type samples (CtWT = 1) and compare Ct values of null
mutant and add-back strain samples. The values for the null
mutant samples should be close to the water controls. The
gene add-back samples normally yield lower Ct values com-
pared to wild type, corresponding to GOI overexpression.
Significant amounts of GOI cDNA indicate an incomplete
gene replacement or the presence of additional gene copies.
3.10 Verifying Null If a protein of interest (POI)-specific antibody is available, the null
Mutants and Add- mutant may be tested for disappearance of the POI band in lieu of
Backs by Western Blot or in addition to RT-qPCR analysis of GOI-specific RNA.
1. Sediment 5 × 106 to 1 × 107 cells of null mutant, of null mutant
with gene add-back, and of wild type at 1000 × g, 4 °C for
10 min. Discard the supernatant and resuspend cells in 10 ml
cold (4 °C) PBS. Sediment at 1000 × g, 4 °C for 10 min. Repeat
PBS wash once.
2. Resuspend the pellet in 10 μl PBS and add 9 μl 2× Laemmli

buffer and 1 μl 500 mM DTT to the cell suspension.
3. Incubate at 95 °C for 10 min, collect all fluids by a brief
centrifuge spin, and store the sample at −20 °C until usage.
4. Prepare an SDS–polyacrylamide separation gel of appropriate
pore size (8–15% acrylamide–bisacrylamide, 29:1) with a 5%
stacking gel, load the samples, and run at 15 V/cm for 90 min
or until the buffer front is close to the bottom.
5. Transfer the protein form the SDS-page onto a polyvinylidene
difluoride (PVDF) membrane and develop the membrane with
the appropriate POI-specific antibody, secondary antibody,
and detection system.
6. Analyze the membrane by a specific antibody against your
protein. A band should be visible in your positive control (WT),
while no band should be visible in your null mutant. Gene
add-back usually results in an enhanced POI band.
4 Notes
1. All plasmid DNA is prepared either by CsCl density gradient

centrifugation [15] or using a plasmid maxiprep kit using the
appropriate amount of plasmid-bearing bacteria for high copy
number plasmids (use the culture volume specified in manufac-
turer’s manual).
2. After linearization of the vector, only a single band should be
visible after the agarose electrophoresis. The presence of
additional bands, even weak, is a sign for an incomplete
digest. Do not use an incompletely digested vector. Repeat
restriction digest until a single band at the expected size is
visible.
3. The correct antibiotic concentration must be determined
experimentally for each Leishmania strain. Aim for a 95%
growth-inhibiting concentration (IC95).
Acknowledgments
We are grateful to laboratory alumni Andreas Hübel, Sylvia

Krobitsch, Gabi Ommen, Katharina Bartsch, Eugenia Bifeld, and
Antje Hombach for their contributions to the refinement of the
homologous gene recombination strategy in the laboratory.
References
1. Cruz A, Beverley SM (1990) Gene replace- 12(5):e1001868. https://doi.org/10.1371/
ment in parasitic protozoa. Nature 348: journal.pbio.1001868
171–173 10. Papadopoulou B, Dumas C (1997) Parameters
2. Cruz A, Coburn CM, Beverley SM (1991) controlling the rate of gene targeting frequency
Double targeted gene replacement for creating in the protozoan parasite Leishmania. Nucleic
null mutants. Proc Natl Acad Sci U S A Acids Res 25(21):4278–4286
88:7170–7174 11. Krobitsch S, Clos J (2000) Cross-species
3. Sollelis L, Ghorbal M, MacPherson CR, homologous recombination in Leishmania
Martins RM, Kuk N, Crobu L, Bastien P, donovani reveals the sites of integration. Mol
Scherf A, Lopez-Rubio JJ, Sterkers Y (2015) Biochem Parasitol 107:123–128
First efficient CRISPR-Cas9-mediated genome 12. Yanisch-Perron C, Vieira J, Messing J (1985)
editing in Leishmania parasites. Cell Microbiol Improved M13 phage cloning vectors and host
17(10):1405–1412. https://doi. strains: nucleotide sequences of the M13mp18
org/10.1111/cmi.12456 and pUC19 vectors. Gene 33(1):103–119
4. Zhang WW, Matlashewski G (2015) CRISPR- 13. Bartsch K, Hombach-Barrigah A, Clos J (2017)
Cas9-mediated genome editing in Leishmania Hsp90 inhibitors radicicol and geldanamycin
donovani. MBio 6(4):e00861. https://doi. have opposing effects on Leishmania Aha1-
org/10.1128/mBio.00861-15 dependent proliferation. Cell Stress Chaperones
5. Duncan SM, Myburgh E, Philipon C, Brown 22:729–742. https://doi.org/10.1007/
E, Meissner M, Brewer J, Mottram JC (2016) s12192-017-0800-2
Conditional gene deletion with DiCre demon- 14. Ommen G, Lorenz S, Clos J (2009) One-step
strates an essential role for CRK3 in Leishmania generation of double-allele gene replacement
mexicana cell cycle regulation. Mol Microbiol mutants in Leishmania donovani. Int J Parasitol
100(6):931–944. https://doi.org/10.1111/ 39(5):541–546
mmi.13375 15. Sambrook J, Russell DW (2001) Molecular
6. Beneke T, Madden R, Makin L, Valli J, Sunter Cloning, 3rd edn. Cold Spring Harbor
J, Gluenz E (2017) A CRISPR Cas9 high- Laboratory Press, Cold Spring Harbor, NY
throughput genome editing toolkit for kineto- 16. Schäfer C, Tejera Nevado P, Zander D, Clos
plastids. R Soc Open Sci 4(5):170095. J (2014) ARM58 overexpression reduces intra-
https://doi.org/10.1098/rsos.170095 cellular antimony concentration in Leishmania
7. Martel D, Beneke T, Gluenz E, Spath GF, infantum. Antimicrob Agents Chemother
Rachidi N (2017) Characterisation of casein 58:1565–1574. https://doi.org/10.1128/
kinase 1.1 in Leishmania donovani using the AAC.01881-13
CRISPR Cas9 toolkit. Biomed Res Int 17. Laemmli UK (1970) Cleavage of structural pro-
2017:4635605. https://doi. teins during the assembly of the head of bacte-
org/10.1155/2017/4635605 riophage T4. Nature 227(5259):680–685
8. Bifeld E, Chrobak M, Zander D, Schleicher U, 18. Hombach A, Ommen G, MacDonald A, Clos
Schonian G, Clos J (2015) Geographical J (2014) A small heat shock protein is essential
sequence variation in the Leishmania major for thermotolerance and intracellular survival
virulence factor P46. Infect Genet Evol of Leishmania donovani. J Cell Sci 127(Pt
30:195–205. https://doi.org/10.1016/j. 21):4762–4773. https://doi.org/10.1242/
meegid.2014.12.029 jcs.157297
9. Ubeda JM, Raymond F, Mukherjee A, Plourde 19. Tejera Nevado P, Bifeld E, Hohn K, Clos
M, Gingras H, Roy G, Lapointe A, Leprohon J (2016) A Telomeric cluster of antimony resis-
P, Papadopoulou B, Corbeil J, Ouellette M tance genes on chromosome 34 of Leishmania
(2014) Genome-wide stochastic adaptive DNA infantum. Antimicrob Agents Chemother
amplification at direct and inverted DNA 60(9):5262–5275. https://doi.org/10.1128/
repeats in the parasite Leishmania. PLoS Biol AAC.00544-16
Chapter 9
LeishGEdit: A Method for Rapid Gene Knockout and Tagging

Using CRISPR-Cas9
Tom Beneke and Eva Gluenz
Abstract
Postgenomic analyses of Leishmania biology benefit from rapid and precise methods for gene manipulation.
Traditional methods of gene knockout or tagging by homologous recombination have limitations: they
tend to be slow and require successive transfection and selection rounds to knock out multiple alleles of a
gene. Clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9 systems overcome these
limitations. We describe here in detail a simple, rapid, and scalable method for CRISPR-Cas9-mediated
gene knockout and tagging in Leishmania. This method details how to use simple PCR to generate (1)
templates for single guide RNA (sgRNA) transcription in cells expressing Cas9 and T7 RNA polymerase
and (2) drug-selectable editing cassettes, using a modular set of plasmids as templates. pT plasmids allow
for amplification of drug resistance genes for knockouts and pPLOT plasmids provide a choice of different
tags to generate N- or C-terminally tagged proteins. We describe how to use an online platform
(LeishGEdit.net) for automated primer design and how to perform PCRs and transfections in small
batches or on 96-well plates for large-scale knockout or tagging screens. This method allows generation of
knockout mutants or tagged cell lines within 1 week.
Key words LeishGEdit, Leishmania, Kinetoplastids, CRISPR, Cas9, Gene editing, T7 RNA poly-
merase, Knockout, Tagging
1 Introduction
Targeted genetic manipulation is a powerful approach for the study

of Leishmania biology. Since the first report of gene replacement
in Leishmania [1], manipulation of the genome has relied on the
homologous recombination (HR) pathway to introduce DNA
constructs, which were traditionally produced by stepwise cloning
of DNA fragments in plasmids. This was necessary to produce the
required length of homology arms, which needed to be longer
than 300 nt for efficient integration as measured in L. mexicana
[2]. This approach has been highly successful in elucidating the
function of a small number of Leishmania genes in detail (see refer-
ences in [3]), but it is very time-consuming and knockout attempts
189
190 Tom Beneke and Eva Gluenz
have only been reported for 200 of a total of ca. 9000 Leishmania
genes [3].
Post-genomic analyses of parasite biology call for high-
throughput genetic tools to enable the study of larger cohorts of
genes. Clustered regularly interspaced short palindromic repeats
(CRISPR)/Cas9 systems are revolutionizing genome editing
across eukaryotes [4], including protozoan parasites [5, 6]. A vari-
ety of different approaches have been used in Leishmania spp. to
supply the required single guide RNA (sgRNA) and Cas9 nuclease:
Cas9 nuclease (typically derived from Streptococcus pyogenes) can be
expressed in the target cell [7–9] or alternatively the smaller Cas9
protein from Staphylococcus aureus can be delivered by transfection
of recombinant protein [10]. Precise cleavage of double-stranded
DNA is achieved upon formation of a ribonucleoprotein complex,
composed of Cas9 and a sequence-specific sgRNA. sgRNA mole-
cules can be synthesized [11] or transcribed from template DNA
[7, 9, 12], using a variety of promoters, including ribosomal RNA
promoters [8, 12, 13], U6 [12, 14, 15] or T7 [7, 9, 10]. Repair of
the resulting double strand break (DSB) occurs in kinetoplastids
by a mechanism called microhomology-mediated end joining
(MMEJ) [8] rather than nonhomologous end joining (NHEJ),
which is the dominant pathway in mammalian cells. MMEJ relies
on short stretches of sequence identity on either side of the
DSB. Providing repair templates with matching homology flanks
(which can be as short as 24 nt [7]) enables precise editing of a
gene locus.
We designed a streamlined protocol for gene editing in
Leishmania spp. and other kinetoplastids [7, 16, 17] which we
termed LeishGEdit. The key advantages of this robust system are
that it does not require any gene-specific cloning procedures or
in vitro transcription prior to transfections, making it rapid, scal-
able, and economical. Our system relies on a cell line that expresses
Cas9 nuclease and T7 RNA polymerase (RNAP) constitutively.
This allows for in vivo transcription of sgRNAs from transfected
short 124 nt PCR fragments made by using two overlapping single
oligonucleotides and incorporating a T7 promoter [18]. Donor
DNA constructs, containing 30 nt homology flanks identical to
the target locus and drug-selectable marker genes, can be amplified
from a plasmid template using long primers. A modular set of tem-
plate plasmids allows the reuse of the same primer pairs for genera-
tion of a variety of tagging or knockout (KO) constructs (Fig. 1a).
Applying drug-selection to transfected cells eliminates nonedited
cells from the population enabling the generation of Leishmania
null mutants in a single transfection in 1 week. To facilitate high-
throughput projects, an online platform www.leishgedit.net has
been generated to design the required primers for a variety of
different kinetoplastid species [7].
CRISPR-Cas9 Gene Editing Method 191
a pT plasmids
LmxM 5’UTR DrugR LmxM 3’UTR

1 5
KNOCKOUT
Genomic locus
sgRNA 5’UTR sgRNA 3’UTR

3 6
5’UTR ORF 3’UTR

1 2 4 5
TAGGING
1 4 2 5
DrugR Cf 5’UTR Tag* Cf intergenic DrugR
pPLOT plasmids
*mNeonGreen, eYFP, BirA*, mCherry, mStrawberry, Halo, 10-TY, nanoLuc, DD-domain, TEV-Strep
b Upstream forward primer: 5’[HFN30]gtataatgcagacctgctgc 3’ 1
Upstream reverse primer: 5’[HFN30]actacccgatcctgatccag 3’ 2
Downstream forward primer: 5’[HFN30]ggttctggtagtggttccgg 3’ 4
Downstream reverse primer: 5’[HFN30]ccaatttgagagacctgtgc 3’ 5
3
5’sgRNA primer: 5’gaaattaatacgactcactatagg[sgN20]gttttagagctagaaatagc 3’
3’sgRNA primer: 5’gaaattaatacgactcactatagg[sgN20]gttttagagctagaaatagc 3’ 6
Fig. 1 A modular plasmid system for streamlined gene editing. (a) Strategy for donor DNA amplification from
pT and pPLOT plasmids to repair a target locus after a double-strand break has been introduced by CRISPR-
Cas9. Numbers 1–6 denote oligos used for gene editing: Oligos 1, 2, 4, and 5 contain 30 nt homology flanks
specific to the target locus for integration of donor DNA fragments; 3 and 6 specify the sgRNA target sites,
directing Cas9 to cut immediately upstream (5′) or downstream (3′) of the target ORF. Knockout constructs
encoding a drug-selectable marker gene with endogenous UTRs from L. mexicana are amplified from pT
plasmids with primer pair 1 and 5 and integrated in the target locus after cutting with sgRNAs 3 and 6.
Tagging constructs encode a protein-tag for in-frame fusions to the target gene and a selectable marker.
Examples of available tags are listed. Tagging constructs are amplified from pPLOT plasmids with primer pair
1 and 2 to a tag protein at its N-terminus (cutting target locus at 5′ end with sgRNA 3) or primer pair 4 and
5 for C-terminal tagging (cutting target locus at 3′ end with sgRNA 6). (b) Primer sequences. Oligos 1, 2, 4,
and 5 contain a target-gene specific 30 nt homology flank ([HFN30]) followed by primer binding sites for pT
and pPLOT plasmids (underlined in red). Oligos 3 and 6 contain a T7 promoter (underlined in blue) followed
by 20 nt sgRNA target sequence ([sgN20]) and sequence complementary to the sgRNA backbone (underlined
in green) (reproduced from ref. 7 with permission)
Here we describe the standard protocol for gene editing using

the LeishGEdit system to insert a tag at the 5′ or 3′ end of a gene
or knock out both alleles of a gene in a single step. The protocol
offers a choice of performing the PCRs and transfections in indi-
vidual tubes or on 96-well plates.
2 Materials
PCR reagents and primers should be handled at room tempera-

ture, unless otherwise stated, and stored at −20 °C. Genomic
DNA can be stored at 4 °C or −20 °C. Transfection reagents are
stored at room temperature. Follow local rules for handling and
disposal of hazardous chemicals and for safe handling and contain-
ment of genetically modified Leishmania spp.
2.1 PCR 1. Primers (Fig. 1b):

Amplification (a)
Target-specific sgRNA primers containing the T7 pro-
of sgRNA Template moter, the 20 nt sgRNA target sequence and sequence
and Donor DNA complementary to the sgRNA scaffold can be designed
manually (see Subheading 3.1) or downloaded from www.
leishgedit.net and ordered from a suitable manufacturer.
(b) Donor DNA primer sequences containing target-specific
30 nt homology flanks and recognition sequence for the
pT and pPLOT template plasmids (Fig. 1a) [7] can be
designed manually or downloaded as above.
(c) G00 primer (sgRNA scaffold):
5′aaaagcaccgactcggtgccactttttcaagttgataacggactagccttattt-
taacttgctatttctagctctaaaac3′.
(d) Dilute primers to 100 μM in ultrapure water (see Note 1).
2. PCR reagents: Expand™ High Fidelity PCR System (Roche;
contains 10× reaction buffer supplemented with 15 mM
MgCl2, 10 mM deoxynucleotide (dNTP) mix, Expand High
Fidelity enzyme mix, and 25 mM MgCl2 solution), dimethyl
sulfoxide (DMSO).
3. Template plasmids for PCR amplification of donor DNA: pT
and pPLOT plasmids [7] diluted to 30 ng/μl in ultrapure
water.
4. Multichannel pipette.
5. Standard or 96-well PCR thermal cycler.
6. PCR tubes (we recommend using strips of eight 0.2 ml thin-
walled tubes) or 96-well PCR plates (half skirted,
polypropylene).
7. PCR sealing film.
2.2 Agarose Gel 1. 50× stock of Tris–acetate–EDTA (TAE) buffer: 2 M Tris ace-
Electrophoresis tate, 0.05 M EDTA. Dissolve 242 g Tris base in 500 ml dis-
tilled water (dH2O), add 57.1 ml glacial acetic acid, and 100 ml
of 500 mM EDTA (pH 8.0) solution. Bring up solution to 1 l
final volume using dH2O.
2. Agarose.
3. Ethidium bromide solution (10 mg/ml in water).

4. DNA ladder.
5. Equipment: Gel tank, casting tray, gel combs, power supply,
trans-illuminator.
2.3 Transfection 1. 1 M sucrose solution. Add 250 ml dH2O to a 500 ml glass
and Selection bottle and add 171 g sucrose while stirring. Fill up to 500 ml
and incubate at 100 rpm at 50 °C until completely dissolved.
2. 1 M HEPES. Add 250 ml dH2O to a 500 ml glass bottle and
add 10 solid NaOH pellets while stirring. When the pellets
have dissolved add 119 g HEPES, titrate to pH 7.4 while
mixing, using 1 M NaOH solution, and fill up to 500 ml with
dH2O.
3. 1 M Na2HPO.
4. 1 M NaH2PO4.
5. 1 M KCl.
6. 200 mM CaCl2.
7. 3× Tb-BSF buffer [19]: 200 mM Na2HPO4, 70 mM NaH2PO4,
15 mM KCl, 150 mM HEPES pH 7.4. For 500 ml buffer mix
stock solutions as follows: 100 ml of 1 M Na2HPO4, 35 ml of
1 M NaH2PO4, 7.5 ml of 1 M KCl and 75 ml of 1 M HEPES
pH 7.4. Add dH2O to bring to 500 ml.
8. 3× modified Tb-BSF buffer (based on observations made in
[20]): 22.3 mM Na2HPO4, 7.67 mM NaH2PO4, 45 mM KCl,
75 mM, HEPES pH 7.4. For 500 ml buffer mix stock solu-
tions as follows: 11.2 ml of 1 M Na2HPO4, 3.8 ml of 1 M
NaH2PO4, 22.5 ml of 1 M KCl, 37.5 ml of 1 M HEPES
pH 7.4, and 225 ml of 1 M sucrose. Add dH2O to bring to
500 ml.
9. 1.5 mM CaCl2. Make 500 ml by adding 3.75 ml of 200 mM
CaCl2 to 496.25 ml dH2O.
10. Transfection mix for knockouts: 25 μl 1.5 mM CaCl2, 83 μl 3×
Tb-BSF, 42 μl ddH2O, 100 μl pooled PCR products (sgRNA
template and donor DNA). Just before transfection, make a
transfection buffer master mix for the required number of
transfections.
11. Transfection mix for tagging: 25 μl 1.5 mM CaCl2, 83 μl 3×
Tb-BSF, 92 μl ddH2O, 50 μl pooled PCR products (sgRNA
template and donor DNA). Just before transfection, make a
transfection buffer master mix for the required number of
transfections.
12. M199 medium. Dissolve 9.5 g M199 powder in 500 ml
ddH2O and add 2.2 g NaHCO3. Add 100 ml fetal bovine
serum (FBS) (10% v/v final concentration), 40 ml of 1 M
HEPES pH 7.4 (prepared as described in item 2 in S

ubheading
2.3) and 2 ml of 2.5 mg/ml hemin solution (dissolved in
dH2O). Fill up with ddH2O to 1 l and sterilize by passage
through a 0.22 μm filter. Batches of FBS should be tested
before use.
13. MM199 medium [2]. Dissolve 9.5 g M199 powder in 500 ml
ddH2O and add 2.2 g NaHCO3. Add 200 ml FBS (20% v/v
final concentration), 40 ml of 1 M HEPES pH 7.3 (prepared
as described in item 2 in Subheading 2.3), 1 ml of 2.5 mg/ml
hemin solution (dissolved in dH2O), 4 ml of 0.3 mg/ml biop-
terin (dissolved in DMSO) and 20 ml of 5 mM adenine hemi-
sulfate (dissolved in ddH2O). Fill up with ddH2O to 1 l and
sterilize by passage through a 0.22 μm filter.
14. 20 mg/ml puromycin dihydrochloride, sterilized.
15. 10 mg/ml Blasticidin S hydrochloride, sterilized.
16. 45 mg/ml G-418 disulfate, sterilized.
17. 100 mg/ml nourseothricin sulfate, sterilized.
18. 10 mg/ml phleomycin, sterilized.
19. 100 mg/ml hygromycin B Gold (see Note 2), sterilized.
20. Amaxa Nucleofector 2b (Lonza).
21. 2 mm gap Electroporator Cuvettes (MBP) or 2 mm gap BTX
Electroporation Cuvettes Plus (see Note 3)
22. BTX ECM 830 Electroporation System with HT-200 plate
handler and 96-well disposable electroporation plates, 4 mm
gap, 250 μl (BTX).
2.4 Genomic DNA 1. Lysis buffer (200 mM NaCl, 0.5% SDS, 5 mM EDTA,
Extraction 100 μg/ml Proteinase K, 10 mM Tris–HCl, pH 8.0): Make
and Diagnostic PCR 50 ml by mixing 1 ml of 0.5 M Tris–HCl pH 8.0, 0.5 ml of
for Knockout 0.5 M EDTA pH 8.0, 1.25 ml of 20% SDS solution, 10 ml of
Validation 1 M NaCl, and 0.5 ml of 10 mg/ml proteinase K solution.
Add dH2O to bring to 50 ml. Aliquot and store at −20 °C.
Defrost in 37 °C water bath before use.
2. Primers: Design primers as described in Subheading 3.7
and prepare 100 μM stock in ddH2O.
3. PCR reagents: Expand™ High Fidelity PCR System (Roche;
contains 10× reaction buffer supplemented with 15 mM MgCl2,
10 mM deoxynucleotide (dNTP) mix, Expand High Fidelity
enzyme mix and 25 mM MgCl2 solution).
4. Standard or 96-well PCR thermal cycler.
5. PCR tubes (we recommend using strips of eight 0.2 ml thin-
walled tubes).
3 Methods
An overview of the workflow is shown in Fig. 2. The protocols

detailed below using PCR tubes and individual transfection
cuvettes are designed for generating a small number of cell lines at
a time; protocols using 96-well plates are designed for higher
throughput gene editing projects.
a Primer design b
PCR1 PCR2
sgRNA donor
template DNA(s)
DNA(s)
5 minutes 3 hours
d DNA isolation or c Transfection

microscopy
Drug
Selection
4-10 days +
L. mex Cas9
Knockout Tagging T7 RNAP cells
2 hours 2 hours
e Knockout verification f Phenotyping

PCR1 PCR2 PCR3
ORF ORF Ctrl

Mutant Parental Mutant
DNA DNA DNA
2 hours
Fig. 2 Gene editing workflow using the LeishGEdit toolkit. Each step is indicated in
a single frame with approximate times for each step indicated below each box in
green. Time required for ordering of oligos is not indicated as it will vary; the selec-
tion time depends on the type of experiment and may vary too. (a) Primer design
can be automated with the LeishGEdit.net primer design tool. (b) Primers are used
to generate sgRNAs and donor DNAs. (c) PCR products from (b) can be mixed
without further purification with a Cas9 and T7 RNAP expressing cell line followed
by electroporation. (d) Cells are subjected to drug selection to obtain populations of
edited cells. Genomic DNA is extracted from knockout candidates and tagged cell
lines are assessed by microscopy. (e) Knockout candidates are screened using
diagnostic PCRs to test genomic DNA for (1) ORF presence in mutant DNA, (2) ORF
presence in parental DNA, and (3) control gene presence in mutant DNA. Finally, the
phenotype of validated cell lines can be studied in detail for example by measuring
growth rate, motility, analyzing cell shape, or testing infectivity (f)
3.1 Primer Design 1. Manual design of sgRNA primers: the sequence consists of (1)
a T7 promoter sequence, (2) 20 nt sgRNA target site ([sgN20])
(see Note 4), which must be next to a protospacer adjacent
motif (PAM) “NGG” at the target locus, and (3) sequence
complementary to the sgRNA backbone (G00 primer)
(Fig. 1b). For designing the [sgN20] manually, use the
EuPaGDT CRISPR gRNA Design Tool [21] (http://grna.
ctegd.uga.edu/).
2. Manual design of donor DNA primers: the sequence consists
of 30 nt homology flanks ([HFN30] at either end of the donor
DNA (corresponding to target locus sequence next to the
sgRNA target) and sequences binding to the pT or pPLOT
template plasmids (Fig. 1b).
3. Steps 1 and 2 can be automated for genomes available on
www.leishgedit.net. To get sequences, go to the website and
navigate to the primer design tab.
4. Enter the target gene GeneID (from TritrypDB.org) in the
primer design box and choose “pT and pPLOT plasmids” for
gene editing in Leishmania. Choose your desired gene editing
strategy (tagging, knockout, or both).
5. Press the button “Design primers.”
6. A new tab in your browser will appear showing the primer
sequences. You should first validate your search result by check-
ing the sgRNA target count for each primer, which represents
the number of total matches for the sgRNA target sequence
(including a PAM site) within your chosen reference genome.
For most genes the sgRNA target sequence is unique, that is, a
sgRNA target count of 1. If the sgRNA target count is >1 this
means the same sequence is found elsewhere in the genome; this
could result in a lower efficiency of editing the gene of interest
and there may be a higher chance of off-target modifications.
7. Once validated, primers can be exported as .csv file. All primer
sequences are written in a 5′ to 3′ orientation and are ready for
ordering from a suitable manufacturer without further
modifications.
3.2 PCR Gene tagging requires preparation of only one PCR to produce one
Amplification sgRNA template. For tagging a protein at the N-terminus, design
of sgRNA Templates the sgRNA to direct a DSB at the 5′ end of the target gene (Fig. 3a),
for a C-terminal tag, place the DSB at the 3′ end (Fig. 3b). A gene
knockout requires preparation of two PCRs for each target gene
(one sgRNA directing a DSB upstream of the target CDS and
one downstream, (Fig. 4). The following protocol is suitable for
individual PCR tubes (strips of eight tubes are convenient) or
96-well PCR plates.
a
CGGGGACACGTATCCGCGCTACACAGTGGCCCTCTTCCCTCCTCTCCCGTCCGCCAAACAAAGCATGTCGAATCGGGTTATTCTGCAAACCTTCGACGAGTACCAG
GCCCCTGTGCATAGGCGCGATGTGTCACCGGGAGAAGGGAGGAGAGGGCAGGCGGTTTGTTTCGTACAGCTTAGCCCAATAAGACGTTTGGAAGCTGCTCATGGTC
PAM DSB Met Ser Asn Arg Val Ile Leu Gln Thr Phe Asp Glu Tyr Gln
HFN30 of upstream forward primer sgN20 of 5’sgRNA primer PF16 ORF LmxM.20.1400
HFN30 of upstream reverse primer
b
GAGAAGATCGAGAACTACCACGTGCAGCAGCACTAGCGGGGGAGGAGGCGTCGCGGATGCTCAGCGGGCCTTTCGGCACAGTCACGCCCATGCACGCTGCTCGTCG
CTCTTCTAGCTCTTGATGGTGCACGTCGTCGTGATCGCCCCCTCCTCCGCAGCGCCTACGAGTCGCCCGGAAAGCCGTGTCAGTGCGGGTACGTGCGACGAGCAGC
Glu Lys Ile Glu Asn Tyr His Val Gln Gln His* DSB PAM
PF16 ORF LmxM.20.1400 sgN20 of 3’sgRNA primer HFN30 of downstream reverse primer
HFN30 of downstream forward primer
Fig. 3 Insertion of protein tag into endogenous locus. Strategy for generating cell line expressing protein
tagged at the N-terminus (a), or C-terminus (b). Left panels, Locus map of PF16 (LmxM.20.1400) showing
position of homology flanks (HFN30) used for integration of donor DNA, 20 nt sgRNA target sequence (sgN20),
the PAM site (highlighted in red) and the site of the double-strand break (DSB, red line). The stop codon of PF16
ORF is indicated with asterisk. Right panels, Micrographs showing the result of tagging PF16 with eYFP at the
N-terminus (a) or at the C-terminus (b). Cells were imaged live and images are a composite of phase contrast
and fluorescence channels. Both PF16 fusion proteins localize to the flagellum (eYFP fluorescence shown in
green). DNA is stained with Hoechst (red). Scale bar, 5 μm. Sequence maps were generated with SnapGene
(www.snapgene.com)
a TATCCGCGCTACACAGTGGCCCTCTTCCCTCCTCTCCCGTCCGCCAAACAAAGCATGTCGAATCGGGTTATTCTGC
..
ATAGGCGCGATGTGTCACCGGGAGAAGGGAGGAGAGGGCAGGCGGTTTGTTTCGTACAGCTTAGCCCAATAAGACG
PAM DSB Met Ser Asn Arg Val Ile Leu
HFN30 of upstream forward primer sgN20 of 5’sgRNA primer PF16 ORF LmxM.20.1400
.. C A C T A G C G G G G G A G G A G G C G T C G C G G A T G C T C A G C G G G C C T T T C G G C A C A G T C A C G C C C A T G C A C G C T G C T C G T C G
GTGATCGCCCCCTCCTCCGCAGCGCCTACGAGTCGCCCGGAAAGCCGTGTCAGTGCGGGTACGTGCGACGAGCAGC
His * DSB PAM
sgN20 of 3’sgRNA primer HFN30 of downstream reverse primer
K P K P
b c
600
400 5’UTR PF16 3’UTR 800 5’UTR Ctrl 3’UTR
200
ORF 600
400
200
Fig. 4 Knocking out ORF by replacement with donor DNA cassette. (a) Locus map of PF16 (LmxM.20.1400)
showing upstream and downstream region. The dotted line denotes PF16 ORF internal sequence not shown in
figure. Yellow arrows indicate the position of the homology flanks (HFN30), sgRNA target sequence (sgN20),
PAM site (red) and DSB site (red line) for targeting the 5′ end of the donor DNA to a site immediately upstream
of the PF16 ORF. Grey arrows indicate the position of the same elements, targeting the 3′ end of the donor DNA
to a site immediately downstream from the PF16 ORF (stop codon indicated with asterisk). Insertion of the
donor DNA will result in loss of the PF16 ORF. (b and c) Strategy and results of diagnostic PCRs for knockout
verification. PCR products were run on agarose gels, the numbers indicate band sizes for DNA ladder. The PF16
ORF is detected in the parental DNA (P) but missing from the knockout (K). (c) Control PCR amplifying a control
gene from the parental and the PF16 knockout DNA. The cartoons show the gene loci with small arrows indi-
cating primer binding sites. Sequence maps were generated with SnapGene (www.snapgene.com)
1. Dilute 100 μM sgRNA primer stock to 4 μM by placing 4 μl of

100 μM primer stock and 96 μl ddH2O into a PCR tube or
well of a 96-well plate.
2. Mix your 4 μM primer dilutions well and pipet 10 μl of this
dilution into new PCR tubes or 96-well plate. Briefly spin
down to collect contents at the bottom. Freeze at −80 °C for
30 min (ideally in a cold rack) (see Note 5).
3. During the freezing process, calculate the required number of
reactions and prepare a PCR master mix. For each reaction add
0.4 μl of 100 μM G00 primer, 0.4 μl of 10 mM dNTP mix,
2 μl of 10x reaction buffer supplemented with 15 mM MgCl2
and 7 μl of ddH2O. Add 0.2 μl High-fidelity polymerase last
(see Note 6).
4. Start the following program on a PCR thermocycler:
(a) Step 1: First denaturation 98 °C 30 s.
(b) Step 2: Denaturation 98 °C 10 s.
(c) Step 3: Annealing 60 °C 30 s.
(d) Step 4: Elongation 72 °C 15 s.
(e) Step 5: 35× back to steps b–d.
(f) Step 6: 72 °C 10 min.
(g) Step 7: keep reaction at 4 °C (until removal from the PCR
machine).
5. As soon as 98 °C is reached, pause the program and remove
your primer dilutions from the freezer (see Note 5).
6. Add PCR master mix to primer dilutions: When processing a
small number of samples (less than 24) add 10 μl of the PCR
master mix to each primer dilution (total reaction volume
20 μl). For a larger number of samples pipet the entire master
mix into a reagent reservoir and add 10 μl of the PCR master
mix from the reservoir to each primer dilution by using a mul-
tichannel pipette. Use a new tip every time and work quickly
before reactions reach room temperature.
7. Briefly centrifuge tubes or plate and place in hot PCR block.
Resume the PCR program.
3.3 PCR Gene tagging requires preparation of one PCR product encoding
Amplification of Donor the tag and drug resistance marker. A gene knockout requires
DNA preparation of two PCR products (one for each drug resistance
marker). Alternatively, knockouts can be generated using only one
drug resistance marker followed by cloning out cell lines after
transfection (see Note 7). Transfection efficiencies may depend on
the chosen drug resistance markers (see Note 8). The following
protocol is suitable for PCR tubes or 96-well plates.
1. Dilute 100 μM stocks of donor PCR primers to 10 μM by

adding 5 μl of 100 μM forward primer stock, 5 μl of corre-
sponding 100 μM reverse primer stock and 40 μl ddH2O to
PCR tube or well of a 96-well plate.
dilution into new PCR tubes or 96-well plate. Briefly centri-
fuge tubes to collect liquid at the bottom. Freeze tubes at
−80 °C for 30 min (ideally in a cold rack).
reactions and prepare the PCR master mix accordingly. For
each reaction add 0.5 μl of 30 ng/μl plasmid template, 0.8 μl
of 10 mM dNTP mix, 1.2 μl of 100% (v/v) DMSO, 3 μl of
25 mM MgCl2 solution, 4 μl of 10× reaction buffer supple-
mented with 15 mM MgCl2 and 22.1 μl of ddH2O. Add 0.4 μl
High-fidelity polymerase last (see Note 6).
4. Start the following program on a PCR thermocycler:
(a) Step 1: First denaturation 94 °C 5 min.
(d) Step 4: Elongation 72 °C 2 min and 15 s.
(f) Step 6: 72 °C 7 min.
machine).
5. As soon as 94 °C is reached, pause the program and remove
primer dilutions from the freezer (see Note 5).
7. Briefly centrifuge tubes or plate and place in hot PCR block.
3.4 Agarose Gel 1. Make a 1% (w/v) agarose gel by dissolving 1 g agarose in
Electrophoresis 100 ml 1× TAE buffer. Bring to the boil until agarose is dis-
solved then cool to ca. 50 °C and add 1 μl ethidium bromide
solution. Pour gel into tray, insert comb and leave to set at
room temperature (see Note 9).
2. Remove comb and load 2 μl of each reaction into the wells of
the gel without loading dye and before submerging the gel in
the buffer tank. Loading is easiest using a multichannel pipette.
Carefully and slowly place your gel into the gel tank containing
1× TAE buffer, then load DNA ladder.
3. Run the agarose gel for 20 min at 120 V and verify product
yield by using a UV transilluminator.
3.5 Transfection Prepare an exponentially growing culture of a Leishmania promas-

of Leishmania tigote cell line expressing Cas9 and T7 RNAP (e.g., L. mexicana
Promastigotes Cas9 T7 [7]). This parental cell line should be cultured with selec-
tion drugs for Cas9 and T7 RNAP construct over several passages
until the day of transfection. For each transfection you will need
1 × 107 cells.
3.5.1 Pooling of PCR 1. For each new cell line to be generated, pool sgRNA PCR
Reactions reaction(s) together with the corresponding donor PCR
reaction(s) to combine all PCR reactions for the same target
gene in a single tube or well of a plate. If applicable use a mul-
tichannel pipette. For a knockout you will end up with approx-
imately 100 μl total PCR reaction (2 × 40 μl donor DNA PCR
plus 2 × 20 μl sgRNA DNA template PCR minus amount
loaded for gel electrophoresis minus evaporation and sample
loss during handling); for a tagging transfection the yield is
approximately 50 μl total PCR reaction (40 μl donor DNA
PCR plus 20 μl sgRNA DNA template PCR minus amount
loaded for gel electrophoresis minus evaporation and sample
loss during handling).
2. Close PCR tubes, or if pooled on 96-well plates, seal plates
with adhesive foil. Heat-sterilize pooled PCR products at
94 °C for 5 min. Proceed to transfection protocol.
3.5.2 Single Cuvette 1. Prewarm medium: Fill the required number of 25 cm2 flasks
Transfection with 3–5 ml M199 medium or fill the required number of
wells of a 24-well plate with 1 ml M199 and warm up in 28 °C
incubator. If 24-well plates are used, it is recommended to
incubate them in an incubator with a humid 5% CO2 atmo-
sphere (see Note 10).
2. Collect the required number of cells (1 × 107 cells per transfec-
tion) by centrifugation at 800 × g for 10 min.
3. During the centrifugation step, prepare appropriate amount of
transfection buffer master mix (as described in Subheading 2.3)
for the required number of transfections and volume needed
for the washing step below (see step 5).
For 50 knockout transfections, mix 1.25 ml 1.5 mM CaCl2,
4.15 ml 3× Tb-BSF, and 2.1 ml ddH2O (7.5 ml total).
For 50 tagging transfections, mix 1.25 ml 1.5 mM CaCl2,
4.15 ml 3× Tb-BSF, and 4.6 ml ddH2O (10 ml total).
4. Sterilize transfection mix by passaging though a 0.22 μm filter.
5. Following centrifugation of cells, discard supernatant and

resuspend cells in 1 ml transfection buffer. Do not exceed
9 × 107 cells per ml. If the cell number is >9 × 107 cells scale up
the buffer volume.
6. Transfer cell suspension to 1.5 ml Eppendorf tube and centri-
fuge at 800 × g for 5 min. If volume exceeds 1 ml, aliquot into
multiple Eppendorf tubes.
7. Resuspend cells in desired final volume of transfection buffer as
follows:
(a) For knockouts add 150 μl transfection buffer per 1 × 107
cells.
(b) For tagging add 200 μl transfection buffer per 1 × 107
cells.
8. Mix the cell suspension with the PCR products in electropora-
tion cuvettes as follows:
(a) For knockouts: 150 μl cells in transfection buffer (from
step 7a above) + 100 μl heat-sterilized pooled PCR reac-
tions (from Subheading 3.5.1).
(b) For tagging: 200 μl cells in transfection buffer (from step
7b above) + 50 μl heat-sterilized pooled PCR reactions
(from Subheading 3.5.1).
9. Leave the cells in the cuvettes for the shortest possible time.
When doing a big batch of transfections, do no more than five
cuvettes at a time and keep the remaining cell suspension in the
Eppendorf tube until use.
10. Place cuvette in Amaxa Nucleofector 2b and apply one pulse
with program X-001 (see Note 11).
11. Quickly and carefully transfer cells from the cuvette into pre-
warmed M199: dilute either into 1 ml medium in a well of a
24-well plate or into 3–5 ml in a 25 cm2 flask. Rinse cuvette once
with medium to flush out any remaining cells (see Note 10).
12. Leave cells to incubate at 28 °C for 8–16 h, then add the
required selection drugs for the repair cassettes (see Subheading
3.6) and incubate until drug-resistant populations emerge.
3.5.3 96-Well Plate 1. Prewarm M199 medium to 28 °C (see Note 10).
Transfection 2. Collect 52 × 107 cells expressing Cas9 and T7 RNAP
(1 × 107 cells per reaction) by centrifugation at 800 × g for
15 min (see Note 12).
3. While waiting for the centrifugation step to complete, label
two 24-well plates and fill each well with 1 ml of M199
medium.
4. Prepare transfection buffer as follows:
(a) For knockouts: 2000 μl CaCl2, 6500 μl modified 3×

Tb-BSF, 1500 μl ddH2O.
(b) For tagging: 2000 μl CaCl2, 6500 μl modified 3× Tb-BSF,
6500 μl ddH2O.
5. Sterilize transfection buffer by passaging though a 0.22 μm
filter.
6. Following centrifugation of cells, remove supernatant and
resuspend cells in 3 ml transfection buffer.
7. Centrifuge again as above.
8. During the second spin, program the BTX ECM 830
Electroporation System with the following settings: 1500 V,
24 pulses, 2 counted pulses, 500 ms interval, unipolar, 100 μs.
9.
Pipet pooled and heat-sterilized PCR products (from
Subheading 3.5.1) into wells of 96-well transfection plate.
10. After the second spin remove supernatant and resuspend cells
in transfection buffer:
(a) For knockouts, in 5200 μl transfection buffer.
(b) For tagging, in 7800 μl transfection buffer.
11. Transfer cell suspension from step 10 into a sterile reservoir
and pipet 100 μl (for knockouts) or 150 μl (for tagging) of
cell suspension to each well containing the pooled PCR
products.
12. Do not pipet up or down; rather, just add the cell suspension
to the wells with the pipette tip touching the wall on the bot-
tom corner.
13. Quickly seal the plate with foil (do not press foil too tightly).
14. Transfer plate to BTX unit and apply electroporation pulses
using the settings defined above (see step 8).
15. After electroporation, remove the foil and transfer cells to
24-well plates (from step 3 above). Rinse wells with medium
to flush out any remaining cells.
16. Place plates in 28 °C, 5% CO2 incubator and leave for 8–16 h,
then add the required selection drugs for the repair cassettes
(see Subheading 3.6) and incubate until drug-resistant popula-
tions emerge.
3.6 Selection 1. For selection on 24-well plates, add 1 ml M199 with double
the concentration of the desired drug. For selection in flasks,
add an equal volume of M199 with double the concentration
of the desired drug (or add the required volume of drug stock
solution directly to each flask). For selection of L. mexicana or
L. major transfectants, we use the following concentrations:
32 μg/ml hygromycin B, 20 μg/ml puromycin dihydrochlo-
ride, 5 μg/ml blasticidin S hydrochloride, 40 μg/ml G-418
disulfate, 50 μg/ml nourseothricin sulfate OR 25 μg/ml

phleomycin (see Note 13). If desired, cells can be cloned at this
point (see Note 14). Do not add selection drugs for Cas9 and
T7 RNAP constructs anymore.
2. Place plates in 28 °C, 5% CO2 incubator.
3. Depending on the type of genetic modification, drug-resistant
populations will have emerged and be ready for splitting
between 4 and 10 days after transfection. Exact timings will
depend on the growth rate of the chosen species and strain.
Putative knockout populations should be passaged twice (first
time dilute 1:10, second time dilute 1:100) before testing for
loss of the open reading frame (ORF). Tagged cell lines should
be passaged at least once (dilute 1:20) before imaging.
3.7 Validation To verify loss of the target ORF in drug-resistant transfectants,

of Transfected Cell perform a diagnostic PCR, amplifying a short PCR product (100–
Lines 300 bp) within the ORF of the target gene, using primers that are
unique to the target gene. As a positive control for detection of the
target ORF, run the same diagnostic PCR on genomic DNA from
the parental cell line. A further technical control PCR is required,
amplifying a different gene from the genomic DNA of the putative
knockout cell line to demonstrate presence of DNA (e.g., amplify
a short fragment from the phosphomannomutase (LmxM.36.1960)
ORF) (see Note 15).
3.7.1 DNA Isolation Genomic DNA can be isolated quickly and cost-effectively from a
large number of samples using a simplified DNA isolation proce-
dure described in [22]:
1. Collect cells from 400 to 800 μl of exponentially growing
Leishmania by centrifugation at 800 × g for 5 min in a 1.5 ml
Eppendorf tube. Extract DNA from each of the mutant cell
lines to be tested and from the parental cell line.
2. Remove supernatant and resuspend cells in 100 μl prewarmed
lysis buffer.
3. Incubate samples for 30 min at 65 °C.
4. After incubation add 250 μl 100% (v/v) EtOH and spin at
17,000 × g for 20 min at 4 °C.
5. Discard supernatant (see Note 16).
6. Add 50 μl of ddH2O.
7. Allow genomic DNA to dissolve overnight at 4 °C.
8. Vortex genomic DNA after overnight incubation for 5 s and
spin Eppendorf tubes briefly to collect liquid from lid and walls.
9. Determine the DNA concentration of your samples and calcu-
late the necessary dilution to reach a concentration of about
30 ng/μl (see Note 17).
10. Dilute DNA into new PCR tubes (see Note 16).
11. Repeat steps 1–8 from above to isolate genomic DNA from
the parental cell line separately (scale up number of collected
cells if DNA is required for a large number of PCRs). Dilute
DNA to 60 ng/μl.
3.7.2 Knockout 1. Prepare 100 μM stocks of ORF PCR primers then dilute cor-
Verification: Test Mutant responding forward and reverse primers to 10 μM by adding
DNA for Loss of ORF 5 μl of 100 μM forward primer stock, 5 μl of 100 μM reverse
primer stock and 40 μl ddH2O to a PCR tube.
dilution into a new PCR tube.
3. Add 2 μl of diluted genomic DNA (as prepared in step 10 in
Subheading 3.7.1) from the corresponding cell line. Centrifuge
tubes to collect liquid at the bottom. Freeze tubes at −80 °C
for 30 min (ideally in a cold rack).
each reaction add 0.4 μl of 10 mM dNTP mix, 2 μl of 10×
reaction buffer supplemented with 15 mM MgCl2 and
11.4 μl of ddH2O. Add 0.2 μl high-fidelity polymerase last
(see Note 6).
5. Start the following program on a PCR thermocycler
(a) Step 1: First denaturation 94 °C 5 min,.
(d) Step 4: Elongation 72 °C 30 s.
(f) Step 6: 72 °C 7 min.
machine).
6. As soon as it reaches 94 °C, pause the program and remove
your primer dilutions from −80 °C (see Note 5).
8. Briefly centrifuge tubes and place in hot PCR block. Resume
the PCR program.
3.7.3 Knockout 1. Use the 10 μM primer dilutions prepared for ORF detection in
Verification: ORF Detection mutant DNA and pipet 4 μl of this dilution into new PCR
in Parental Cell Line tubes. Centrifuge tubes to collect liquid at the bottom. Freeze
tubes at −80 °C for 30 min (ideally in a cold rack).
each reaction add 1.0 μl of 60 ng/μl parental genomic DNA,
0.4 μl of 10 mM dNTP mix, 2 μl of 10× reaction buffer supple-
mented with 15 mM MgCl2 and 12.4 μl of ddH2O. Add 0.2 μl
high-fidelity polymerase at last (see Note 6).
3. Start the PCR thermocycler as described in step 5 in
Subheading 3.7.2. As soon as it reaches 94 °C, pause the
program and remove your primer dilutions from −80 °C
(see Note 5).
5. Briefly centrifuge tubes and place on hot PCR block. Resume
the PCR program.
3.7.4 Knockout 1. Pipet 2 μl of diluted mutant genomic DNA (as prepared in
Verification: Control Gene step 10 in Subheading 3.7.1) into new PCR tubes. Centrifuge
PCR tubes to collect liquid at the bottom. Freeze tubes at −80 °C
for 30 min (ideally in a cold rack).
each reaction add 0.4 μl of each 100 μM housekeeping gene
forward and reverse primer, 0.4 μl of 10 mM dNTP mix, 2 μl
of 10× reaction buffer supplemented with 15 mM MgCl2
and 14.6 μl of ddH2O. Add 0.2 μl High-fidelity polymerase
last (see Note 6).
3. Start the PCR thermocycler as described in step 5 in Subheading
3.7.2. As soon as it reaches 94 °C, pause the program and
remove your primer dilutions from −80 °C (see Note 5).
mix from the reservoir to each primer dilution by using a
multichannel pipette. Use a new tip every time and work

quickly before reactions reach room temperature.
5. Briefly spin tubes or plate down and place on hot PCR block.
3.7.5 Knockout Assess all PCR products by running 4 μl of each PCR reaction on
Verification: Agarose Gel a 2% agarose gel (Subheading 3.4).
Electrophoresis
4 Notes
1. Avoid too many freeze and thaw cycles of primers. Especially

for the frequently used G00 primer, we recommend storing
the stock in smaller aliquots, which should not be thawed
more than about four times.
2. We found that there are quite large batch-to-batch differences
with hygromycin B from various suppliers. Therefore, we rec-
ommend using hygromycin B Gold from InvivoGen.
3. We have not found any notable differences between 2 mm gap
electroporation cuvettes from various suppliers.
4. LeishGEdit sgRNA target sequences were designed with the
EuPaGDT CRISPR gRNA Design Tool [21] (http://grna.
ctegd.uga.edu/) and represent the highest scoring 20 nt
sgRNA sequence identified within 105 bp upstream or down-
stream of the target gene open reading frame.
5. Freezing of primers or template DNA at −80 °C before addi-
tion of other PCR reagents enables a physical separation of
polymerase, oligos, and template DNA. This reduces nonspe-
cific primer annealing and avoids oligo degradation, which can
be introduced by unspecific exonuclease activity at low tem-
peratures (this is similar to a PCR hot-start, in which the poly-
merase is added once the PCR reaction is heated up to 94 °C).
This is particularly important when handling a larger number
of samples (e.g., 96-well plates). When taking out frozen PCR
tubes for addition of PCR master mix, wipe ice off tubes or
plate foils with facial tissue before opening. Otherwise lids and
foils are liable to crack.
6. Always include at least one spare reaction in your PCR master
mix to avoid running out of mix due to inaccuracies in pipet-
ting. When using reservoirs for pipetting PCR master mix
include multiple spare reactions, about 100–200 μl spare
volume.
7. The advantage of using two drug resistance markers is that
typically all cells in a nonclonal population of drug-resistant
cells will be knockouts (given the gene is nonessential for
promastigote viability in culture). When only a single drug

resistance marker is used, typically about half of the cells in a
population are full knockouts while the others have retained
an allele of the target gene.
8. For single allele mutations (e.g., in tagging experiments), our
preferred selection drug is puromycin. For knockouts in popu-
lations our preferred selection drug combination (using pT
plasmid knockout cassettes) is blasticidin and puromycin, fol-
lowed by a combination of puromycin and neomycin. Try to
avoid generation of knockout populations using the combina-
tion blasticidin and neomycin. For generation of knockouts
using only one selection drug (1 pT knockout cassette), we
recommend using neomycin.
9. Diluting PCR amplicons in DNA gel loading buffer can be
very time-consuming for a large number of samples. To load
amplicons without loading dye, it is best to pipet reactions
into a dry gel. To get sharp bands and good resolution, pre-
pare 1× TAE buffer fresh from 50× stock and make the gels
relatively thin (ideally 0.3 to 0.5 cm).
10. We routinely recover cells after transfections in M199 medium
either in flasks in an incubator without CO2 or on 24-well
plates in an incubator with a humid 5% CO2 atmosphere.
However, for some slow growth phenotypes, we have found
that culturing in MM199 (see Subheading 2.3; [2]) and incu-
bation in a humid 5% CO2 atmosphere appears to increase
transfection success rates. Plates allow efficient handling of
transfectants (especially for more than 10 transfections), while
flasks are ideal for a smaller samples sizes.
11. For single cuvette electroporation we have also successfully
used the BTX ECM 830 Electroporation System using
1600 V, 3 pulses, 500 ms interval, unipolar, 100 μs. Please
note that the total reaction volume for a BTX single cuvette
electroporation needs to be 500 μl. Please scale up the trans-
fection mix appropriately. Other electroporation systems that
have been used for transfection of Leishmania are also likely
to work.
12. To avoid cross-contamination between wells, we only fill a
maximum of 48 wells on a 96-well plate. We use either col-
umns 1 to 12 in rows A, C, E, and G or in rows B, D, F and
H, leaving always one entire row empty between wells con-
taining cells for a transfection.
13. The optimal selection drug concentration may vary between
different Leishmania spp. and strains; therefore, it is important
to establish suitable drug concentrations before starting an
experiment.
14. For generation of clonal cell lines after transfection, we recom-

mend diluting cells and plating on 96-well plates immediately
after the addition of drugs.
(a) Selection with one drug: To select using puromycin or blasti-
cidin resistance markers, make a 1:50 and 1:500 dilution
(10 ml each) of the culture containing ~1 × 107 electropor-
ated cells. Dispense into sterile reagent reservoirs and use a
multichannel pipette to aliquot dilutions on half of a 96-well
plate (200 μl per well). For neomycin resistance markers,
dilute cells 1:10 and 1:100 (10 ml each). For phleomycin
resistance markers, plate cells undiluted. Always keep the
remaining undiluted cell cultures from each transfection to
select transfectants in the original flask.
(b) Selection with two drugs: To select using puromycin and blas-
ticidin resistance markers, aliquot undiluted culture contain-
ing ~1 × 107 electroporated cells on half of a 96-well plate
and a 1:10 dilution on the other half. For a combination of
puromycin and neomycin plate cells undiluted. We do not
recommend using any other drug combinations.
15. The diagnostic PCRs described in Subheading 3.7 are suited
to high-throughput screening. Further PCR tests can be per-
formed using primers in the 5′UTR and/or the ORF to vali-
date correct integration of drug resistance genes or successful
deletion of the target gene. Depending on the nature of the
modification, other tests may be required such as Southern
blotting or DNA sequencing. This may be of particular rele-
vance for validation of larger deletions such as gene arrays.
16. It is extremely important to avoid cross-contamination at any
stage during isolation and handling of genomic DNA for
knockout validation. Try to minimize cross-contamination by
not leaving multiple tubes open at any given time and do not
evaporate remaining ethanol from tubes at the end of DNA
precipitation.
17. This DNA isolation protocol works very reliably. It will typi-
cally yield about 10–20 μg total DNA per cell line (depending
on cell density when harvested), which means that samples are
typically diluted about 1:8 for the knockout verification
PCR. The dilution increases also the likelihood of PCR suc-
cess, since PCR inhibitors will be reduced.
Funding Statement
EG is a Royal Society University Research Fellow; TB was sup-

ported by a Medical Research Council PhD studentship
(15/16_MSD_836338).
References
1. Cruz A, Beverley SM (1990) Gene replace- (2018) High-throughput Cos-Seq screen with
ment in parasitic protozoa. Nature intracellular Leishmania infantum for the dis-
348(6297):171–173. https://doi. covery of novel drug-resistance mechanisms.
org/10.1038/348171a0 Int J Parasitol Drugs Drug Resist 8(2):165–
2. Dean S, Sunter J, Wheeler RJ, Hodkinson I, 173. https://doi.org/10.1016/j.
Gluenz E, Gull K (2015) A toolkit enabling effi- ijpddr.2018.03.004
cient, scalable and reproducible gene tagging in 12. Zhang WW, Lypaczewski P, Matlashewski G
trypanosomatids. Open Biol 5(1):140197. (2017) Optimized CRISPR-Cas9 genome
https://doi.org/10.1098/rsob.140197 editing for Leishmania and its use to target a
3. Jones NG, Catta-Preta CMC, Lima A, Mottram multigene family, induce chromosomal translo-
JC (2018) Genetically validated drug targets in cation, and study DNA break repair mecha-
Leishmania: current knowledge and future pros- nisms. mSphere 2(1):e00340-16. https://doi.
pects. ACS Infect Dis 4(4):467–477. https:// org/10.1128/mSphere.00340-16
doi.org/10.1021/acsinfecdis.7b00244 13. Lander N, Li ZH, Niyogi S, Docampo R
4. Komor AC, Badran AH, Liu DR (2017) (2015) CRISPR/Cas9-induced disruption of
CRISPR-based Technologies for the Paraflagellar rod protein 1 and 2 genes in
Manipulation of eukaryotic genomes. Cell Trypanosoma cruzi reveals their role in Flagellar
169(3):559. https://doi.org/10.1016/j. attachment. MBio 6(4):e01012. https://doi.
cell.2017.04.005 org/10.1128/mBio.01012-15
5. Duncan SM, Jones NG, Mottram JC (2017) 14. Ishemgulova A, Hlavacova J, Majerova K,
Recent advances in Leishmania reverse genet- Butenko A, Lukes J, Votypka J, Volf P, Yurchenko
ics: manipulating a manipulative parasite. Mol V (2018) CRISPR/Cas9 in Leishmania mexi-
Biochem Parasitol 216:30–38. https://doi. cana: a case study of LmxBTN1. PLoS One
org/10.1016/j.molbiopara.2017.06.005 13(2):e0192723. https://doi.org/10.1371/
6. Lander N, Chiurillo MA, Storey M, Vercesi journal.pone.0192723
AE, Docampo R (2016) CRISPR/Cas9-
15. Sollelis L, Ghorbal M, MacPherson CR,
mediated endogenous C-terminal tagging of Martins RM, Kuk N, Crobu L, Bastien P,
Trypanosoma cruzi genes reveals the Scherf A, Lopez-Rubio JJ, Sterkers Y (2015)
Acidocalcisome localization of the inositol First efficient CRISPR-Cas9-mediated
1,4,5-Trisphosphate receptor. J Biol Chem genome editing in Leishmania parasites. Cell
291(49):25505–25515. https://doi. Microbiol 17(10):1405–1412. https://doi.
org/10.1074/jbc.M116.749655 org/10.1111/cmi.12456
7. Beneke T, Madden R, Makin L, Valli J, Sunter 16. Costa FC, Francisco AF, Jayawardhana S,

J, Gluenz E (2017) A CRISPR Cas9 high- Calderano SG, Lewis MD, Olmo F, Beneke
throughput genome editing toolkit for kineto- T, Gluenz E, Sunter J, Dean S, Kelly JM,
plastids. R Soc Open Sci 4(5):170095. https:// Taylor MC (2018) Expanding the toolbox
doi.org/10.1098/rsos.170095 for Trypanosoma cruzi: a parasite line incor-
8. Zhang WW, Matlashewski G (2015) CRISPR- porating a bioluminescence-fluorescence
Cas9-mediated genome editing in Leishmania dual reporter and streamlined CRISPR/Cas9
donovani. MBio 6(4):e00861. https://doi. functionality for rapid in vivo localisation and
org/10.1128/mBio.00861-15 phenotyping. PLoS Negl Trop Dis
12(4):e0006388. https://doi.org/10.
9. Peng D, Kurup SP, Yao PY, Minning TA, 1371/journal.pntd.0006388
Tarleton RL (2015) CRISPR-Cas9-mediated
single-gene and gene family disruption in 17. Martel D, Beneke T, Gluenz E, Spath GF,
Trypanosoma cruzi. MBio 6(1):e02097-02014. Rachidi N (2017) Characterisation of casein
https://doi.org/10.1128/mBio.02097-14 kinase 1.1 in Leishmania donovani using the
CRISPR Cas9 toolkit. Biomed Res Int
10. Soares Medeiros LC, South L, Peng D, 2017:4635605. https://doi.org/10.1155/
Bustamante JM, Wang W, Bunkofske M, 2017/4635605
Perumal N, Sanchez-Valdez F, Tarleton RL
(2017) Rapid, selection-free, high-efficiency 18. Bassett A, Liu JL (2014) CRISPR/Cas9 medi-
genome editing in protozoan parasites using ated genome engineering in Drosophila.
CRISPR-Cas9 Ribonucleoproteins. MBio 8(6). Methods 69(2):128–136. https://doi.
https://doi.org/10.1128/mBio.01788-17 org/10.1016/j.ymeth.2014.02.019
11. Fernandez-Prada C, Sharma M, Plourde M, 19. Schumann Burkard G, Jutzi P, Roditi I (2011)
Bresson E, Roy G, Leprohon P, Ouellette M Genome-wide RNAi screens in bloodstream
form trypanosomes identify drug transporters. for eukaryotic pathogens. Microb Genom
Mol Biochem Parasitol 175(1):91–94. https:// 1(4):e000033. https://doi.org/10.1099/
doi.org/10.1016/j.molbiopara.2010.09.002 mgen.0.000033
20. Dyer P, Dean S, Sunter J (2016) High- 22.
Rotureau B, Gego A, Carme B (2005)
throughput gene tagging in Trypanosoma Trypanosomatid protozoa: a simplified DNA
brucei. J Vis Exp (114). https://doi.org/ isolation procedure. Exp Parasitol 111(3):
10.3791/54342 207–209. https://doi.org/10.1016/j.
21. Peng D, Tarleton R (2015) EuPaGDT: a web exppara.2005.07.003
tool tailored to design CRISPR guide RNAs
Chapter 10
DiCre-Based Inducible Disruption of Leishmania Genes

Samuel M. Duncan, Elmarie Myburgh, Eliza V. Alves-Ferreira,
Abstract
Conditional gene deletion using dimerizable Cre recombinase (DiCre) is so far the best developed system
for the phenotypic analysis of essential genes in Leishmania species. Here, we describe a protocol for the
generation of a conditional gene deletion mutant and the subsequent inducible deletion of a target gene.
Leishmania parasites are genetically modified to express two inactive Cre subunits (DiCre) and a single
LoxP-flanked version of a target gene in a context where both endogenous copies of the gene have been
deleted. Treatment with rapamycin dimerizes the DiCre subunits, resulting in activation of the enzyme,
recombination between the LoxP sites, and excision of the LoxP-flanked target gene. Subsequent pheno-
typing allows for the analysis of essential gene function.
Key words DiCre, Cre recombinase, Conditional gene deletion, Essential genes, LoxP sites,
Rapamycin, Leishmania
1 Introduction
It is well established that attempts to target essential genes in

Leishmania using targeted homologous recombination and selec-
tion with two antibiotic markers result in chromosomal rearrange-
ments, changes in ploidy, and formation of extrachromosomal
elements [1–4]. The plasticity of the Leishmania genome allows
the parasites to retain an extra copy of an essential gene even in the
presence of strong selective pressure [5]. Currently, the most
robust approach to circumvent this limitation is the application of
dimerized Cre (DiCre) for conditional gene deletion [6]. By this
method, Cre recombinase is expressed as two inactive subunits
(Cre59 and Cre60), each fused to FK506-binding protein
(FKBP12) and FKBP12-rapamycin associated protein (FRB),
respectively [7]. Treatment of cells with the ligand rapamycin
reconstitutes Cre recombinase activity to induce excision of DNA
flanked by LoxP sites (locus of crossover of bacteriophage P1).
Duncan et al. [8] first applied DiCre in Leishmania spp. to generate
211
212 Samuel M. Duncan et al.
conditional null mutants by LoxP flanking of the essential Cdc2-

related kinase 3 (CRK3) gene.
DiCre conditional gene deletion in Leishmania requires integra-
tion of transgenic expression cassettes containing distinct drug resis-
tance genes. In this protocol we detail two strategies (Fig. 1a) for
conditional null mutant generation: (1) the first allele of a targeted
gene of interest (GOI) is replaced with a LoxP-flanked (floxed) ver-
sion of the gene (untagged or containing an N or C-terminal 6xHA/
GFP tag) linked to a puromycin resistance marker (PURR), and the
second allele of the GOI is replaced by the DiCre cassette linked to
Fig. 1 Schematic of conditional gene deletion in Leishmania. (a) Two strategies

for the generation of conditional null mutants. Gene of interest (GOI). Puromycin
resistance marker (PURR), blasticidin resistance marker (BSDR), hygromycin
resistance marker (HYGR), nourseothricin resistance marker (SATR). (b) Addition
of rapamycin facilitates the dimerization of the Cre subunits and excision of a
LoxP-flanked gene of interest (GOI). LoxP sites are indicated by arrows
DiCre Inducible Gene Disruption 213
a blasticidin resistance marker and (2) the DiCre cassette linked to a

blasticidin resistance marker is integrated into the ribosomal RNA
locus (SSU rRNA gene) to generate a cell line that constitutively
expresses the dimerizable Cre subunits (Rib-DiCre). Subsequently,
the first allele of the GOI is replaced with a floxed version of the
gene (untagged or containing an N or C-terminal 6xHA/GFP tag)
linked to a puromycin resistance marker and the second allele with a
third antibiotic resistance marker (HYGR or SATR). The antibiotic
resistance markers allow for selection of clones expressing the
DiCre machinery and a single floxed gene of interest. Additionally,
membrane-bound mCherry (HASPB-mcherry) expression from
the LoxP cassette facilitates fluorescence microscopy of the cell
line. The DiCre/LoxP/antibioticR gene knockout constructs are
generated by Gateway® mediated recombination using standard
Gateway plasmids, the DiCre system donor plasmids and amplified
GOI flanks. The pRIB-DiCre construct is available for generation
of the DiCre expressing cell lines.
For both strategies excision of the GOI is induced by treat-
ment with the ligand rapamycin, which causes the excision of the
LoxP-flanked GOI with subsequent loss of the encoded protein
(Fig. 1b).
2 Materials
2.1 Generation 1. PCR components: nuclease-free water, Leishmania genomic

of Plasmids DNA, primers (see Table 1), high-fidelity DNA polymerase
(e.g., Q5® or Phusion® DNA polymerase), dNTPs, PCR
tubes, thermal cycler.
2. QIAquick gel extraction kit (QIAGEN).
Table 1
Primers for Gateway cloning of 5′ and 3′ gene flanks and sequencing of pDONR vectors
Primer Extra sites Primer sequence

Gateway cloning primers
5′ flank forward attB4, PacI GGGGACAACTTTGTATAGAAAAGTTGccTTAATTAA-gene-
specific sequence
5′ flank reverse attB1r GGGGACTGCTTTTTTGTACAAACTTGC-gene-specific sequence
3′ flank forward attB2r GGGGACAGCTTTCTTGTACAAAGTGGCC-gene-specific sequence
3′ flank reverse attB3, PmeI GGGGACAACTTTGTATAATAAAGTTGCGTTTAAAC-gene-
specific sequence
Colony PCR and sequencing primers
M13F gateway – GTAAAACGACGGCCAG
M13R gateway – CAGGAAACAGCTATGAC
Fig. 2 Generation of pDONR LoxP with GOI. (a) pGL2314 and pGL2315 have C-terminal 6xHA or GFP fusion tags
downstream of their multiple cloning sites (MCS). PCR amplification of the target gene with 5′ NdeI and 3′ SpeI
is recommended for insertion. However, if these sites are not unique, there are EcoRI, KpnI, and ClaI sites avail-
able. PCR amplification without a stop codon allows fusion with 6xHA or GFP. (b) pGL2316 has an N-terminal
GFP fusion tag upstream of the multiple cloning site, therefore the GOI should be amplified with a stop codon at
the 3′ end. The gene may be digested and ligated in via KpnI, ClaI, SpeI, and XbaI sites; it may be preferable to
ligate the GOI in via KpnI and XbaI sites to remove the 6xHA tag; however, if a stop codon is added to the end of
the gene coding sequence, this HA tag will not be translated into a fusion protein (see Note 7). LoxP sites are
indicated by arrows
3. NanoDrop™ or other system for quantifying DNA.

4. MultiSite Gateway® Three-Fragment Vector Construction Kit
(Invitrogen).
5. Competent cells (e.g., DH5α™).
6. pGL2314, pGL2315, and pGL2316 plasmids (see Fig. 2 and
Note 1).
7. Cloning kit for subcloning (e.g., pGEM®-T Easy or PCR-
Script Amp kit).
8. Restriction endonucleases (PacI, PmeI; see multiple cloning
sites in Fig. 2).
2.2 Generation 1. Final knockout (KO), floxed GOI (GOIflox), and DiCre (e.g.,
of Conditional Deletion pGL2399) plasmids (generated in Subheading 3.1).
Leishmania spp. 2. Restriction endonucleases (selected for plasmid linearization in
Mutants Subheading 3.1.1 (e.g., PacI and PmeI)).
3. Wild-type Leishmania promastigotes (in mid-log stage of
growth).
4. Amaxa Human T-Cell Nucleofector™ kit.
5. Amaxa 2D Nucleofector™.
6. Leishmania culture medium (e.g., HOMEM, M199) supple-

mented with heat-inactivated fetal calf serum (see Note 2).
7. Blasticidin, puromycin, and selected antibiotic for second allele
replacement (hygromycin or nourseothricin).
8. PCR components (see Subheading 2.1, item 1).
2.3 Induction 1. Rapamycin (see Note 3).

of Conditional Gene 2. DMSO.
Deletion
3 Methods
3.1 Generation 1. Design primers to amplify the 5′ and 3′ flanking sequences of

of Plasmids the GOI. The flanks should be between 500 and 1000 bp in
length (see Note 4). Each primer should contain the appropri-
3.1.1 Plasmid
ate attB sites to enable recombination into a pDONR vector
Generation: pDONR Vector
catalyzed by BP Clonase, a unique restriction site such as PacI
with Homologous Flanks
and PmeI to enable linearization of the final expression con-
of GOI
struct by restriction digest and gene-specific sequence (18–
21 bp) to allow primer binding to Leishmania template DNA
during amplification (see Table 1).
2. Perform PCR using a high-fidelity DNA polymerase such as
Phusion® or Q5® according to the chosen enzyme specifications.
3. Resolve and visualize the amplicons by agarose gel electropho-
resis to ensure they are of expected size.
4. Purify the PCR products using a gel extraction kit and quantify
the DNA concentration.
5. BP reaction: Insert the purified 5′ and 3′ DNA into pDONR
vectors by BP mediated recombination. Set up the BP reac-
tions as shown in Table 2 below. It is recommended to use 50
femtomoles (fmol) of each purified amplicon, which can be
calculated using the formula:
Nanogram ( ng ) of DNA required = ( x fmol ) (N ) ( 0.00066 ) ,

Table 2
BP recombination reaction
Components Sample Negative control

attB PCR product (50 fmole) 1 μL 1 μL
pDONR™ Vector (P41-Pr/P2r-P3) 1 μL 1 μL
(150 ng·μL−1)
TE buffer, pH 8.0 6 μL 8 μL
BP Clonase enzyme 2 μL –
where x = number fmoles required and N = size of DNA

insert in bp.
Calculate the appropriate volume required for each DNA frag-
ment and carry out BP reactions using the P41-Pr as pDONR
for the 5′ flank and P2r-P3 as the pDONR for the 3′ flank
(both supplied with kit). Include a negative control sample
where BP Clonase is omitted (see Note 5).
6. Thaw the BP Clonase (stored at −80 °C) on ice for 2 min,
and vortex the enzyme briefly (2 s) before adding to the
reactions.
7. Mix reactions by vortexing briefly twice (2 s each). Incubate the
reactions at room temperature (25 °C) for 1 h (see Note 6).
8. Add 1 μL of Proteinase K mix to each reaction and incubate at
37 °C for 10 min to degrade the BP Clonase.
9. Store samples at −20 °C or begin transforming competent
DH5α cells.
10. Thaw competent cells on ice and add 1 μL of each BP reaction
to 50 μL cell solution, gently mix and incubate on ice for
10–30 min.
11. Heat-shock cells at 42 °C for 45 s, recover on ice for 2 min,
then add 250 μL of room-temperature S.O.C. medium and
incubate at 37 °C for 1 h with shaking (~200 rpm).
12. Spread 20 μL and 100 μL from the cultures onto LB agar
plates containing 50 μg mL−1 kanamycin and incubate at 37 °C
overnight.
13. If false positives are high use colony PCR to identify colonies
containing the recombined flank. If background is low prepare
plasmid DNA for sequencing and later transfections. M13F
and M13R gateway primers can be used for colony PCR and
sequencing of vectors (see Table 1).
14. Sequence the plasmids containing the homologous flanks to
ensure no errors in the insert DNA sequences.
3.1.2 Plasmid 1. Design GOI specific primers containing the appropriate restric-
Generation: pDONR LoxP tion sites that are compatible with the multiple cloning sites
with GOI for N-(pGL2316) or C-(pGL2314/5) terminal tagging, or
containing upstream and downstream stop codons if no protein
tag is desired (see Note 7). The available pDONR LoxP vectors
and available restriction sites are shown in Fig. 2.
2. Perform PCR amplification of the GOI from genomic DNA
using a high-fidelity DNA polymerase such as Phusion® or
Q5® according to the chosen enzyme specifications.
3. Subclone the amplicon into an appropriate cloning vector (e.g.,
pGEM®-T or PCRScript) to enable sequencing and restriction
enzyme digestion from a plasmid. This enables the gene to be
resolved by agarose gel electrophoresis for visualization of

double enzyme digest and gel extraction of the product.
4. Perform double restriction enzyme digestion of the GOI and
pDONR vector using your selected restriction enzymes and
purify the digested products using the gel extraction kit.
5. Set up a ligation reaction with the purified insert and backbone
at appropriate molar ratios.
6. Transform chemically competent cells with the ligation reac-
tions and select clones using 50 μg·mL−1 kanamycin infused
agar plates.
7. Screen for colonies transformed with the pDONR LoxP con-
struct containing the GOI by colony PCR or by restriction
enzyme digestion of purified plasmid DNA.
8. Sequence plasmids from at least two positive colonies to iden-
tify a clone where the gene has been amplified and inserted
without any base pair changes.
3.1.3 Plasmid 1. Determine the DNA concentration of each pDONR plasmid

Generation: Final Knockout containing 5′ flank, 3′ flank, and GOIflox, DiCre cassette, or
(KO), Floxed GOI (GOIflox), DrugR cassette. Table 3 shows the available and generated
and DiCre Plasmids donor vectors for this reaction.
Table 3
Vectors used for the generation of conditional deletion Leishmania mutants
Description pGL No.a Plasmid R Expression product DrugR Generation

Donors for LR reaction
pDONR P41-Pr (+5′ – KANr 5′ flanking region – Generated in
flank) Subheading 3.1.1
pDONR P2-P3r (+3′ – KANr 3′ flanking region – Generated in
flank) Subheading 3.1.1
DrugR pDONR221 2206 KANr Nourseothricin SAT Available
DrugR pDONR221 2207 KANr Hygromycin HYG Available
DrugR pDONR221 2208 KANr Blasticidin BSD Available
DrugR pDONR221 2209 KANr Puromycin PUR Available
DiCre pDONR221 2313 KANr DiCre—Endogenous BSD Available
locus
GOIflox pDONR221 2314 KANr c-6xHA LoxP PUR Generated in
Subheading 3.1.2
GOIflox pDONR221 2315 KANr c-GFP LoxP PUR Generated in
Subheading 3.1.2
GOIflox pDONR221 2316 KANr n-GFP LoxP PUR Generated in
Subheading 3.1.2
DiCre in ribosomal locus
pRIB-DiCre 2399 AMPr DiCre—Ribosomal locus BSD Available
All plasmid sequences are available on the Mottram group website (see Note 1).
a
Table 4
LR recombination reaction
Components Sample Negative Control

10 fmole pDONR P41-Pr (+5′ flank) 1 μL –
10 fmole pDONR P2-P3r (+3′ flank) 1 μL –
10 fmole pDONR expression construct 1 μL –
20 fmole pDEST™ R4-R3 Vector II 0.4 μL 0.4 μL
TE buffer, pH 8.0 4.6 μL 6.6 μL
LR Clonase enzyme 2 μL 2 μL
2. Calculate the mass of DNA required for 10 fmole using the

formula from Subheading 3.1.1, step 5 and dilute your
plasmids in TE buffer to 10 fmoles·μL−1 to avoid pipetting
volumes less than 1 μL.
3. Set up the LR reaction(s) and negative control as shown in
Table 4.
4. Incubate the reaction overnight at room temperature (see
Note 8).
5. Add 1 μL of Proteinase K mix to each sample and incubate at
37 °C for 10 min to degrade the LR Clonase.
6. Store samples at −20 °C or use immediately by transforming
chemically competent DH5α cells: thaw cells on ice and add
1 μL of each BP reaction to 50 μL cell solution; gently mix and
incubate on ice for 10–30 min.
7. Heat-shock cells at 42 °C for 45 s, recover on ice for 2 min,
then add 250 μL room-temperature S.O.C. Medium and
incubate at 37 °C for 1 h with shaking (~200 rpm).
8. Spread 50 μL and 100 μL from the cultures onto LB agar
plates infused with 100 μg mL−1 ampicillin and incubate at
37 °C overnight.
9. Screen colonies by colony PCR and/or restriction enzyme
digestion.
10. Sequence plasmids prior to transfection.
3.2 Generation For the first approach (expression of DiCre from the endogenous
of Conditional Deletion locus) two rounds of transfection are performed using the method
Leishmania Mutants below. For the second approach (expression of DiCre from the
ribosomal locus) it is necessary to generate the DiCre-expressing
line first using the procedure below followed by another two
rounds of transfection for replacement of each allele of the GOI.
3.2.1 Plasmid 1. Set up a double restriction digest of the desired construct with
Preparation appropriate enzymes to linearize the transfection cassette (see
for Transfection Subheading 3.1.1). For example use PacI and PmeI if these
were added to the 5′ and 3′ flanks. For pG2399 (pRIB-DiCre)
digestion use PacI and PmeI.
2. Resolve the restriction digestion products by 0.7% agarose gel
electrophoresis to separate the transfection cassette from the
plasmid backbone. The pGL2399 digest should produce two
fragments of 5460 bp and 2557 bp, respectively. Other frag-
ment sizes will depend on the size of GOI or the resistance
marker chosen.
3. Visualize the DNA and extract the appropriate transfection
fragment using a gel extraction kit.
4. Elute the DNA in a large volume to maximize yield and con-
centrate to ~20 μL by ethanol precipitation.
5. Quantify the purity and concentration of DNA prior to trans-
fection: for integration into the ribosomal RNA locus use 5 μg
DNA, and for gene replacement it is recommended to use
10 μg of purified DNA per transfection.
3.2.2 Transfection 1. Culture procyclic promastigotes until mid-log phase of growth

and Clonal Selection (~5 × 106 cells mL−1) in Leishmania culture medium supple-
mented with 10% heat-inactivated fetal calf serum at 25 °C
(see Note 2).
2. Harvest 5 × 107 cells per transfection by centrifugation at
1200 × g for 10 min.
3. Resuspend parasites to 5 × 108 cells mL−1 in ice-cold Amaxa
Human T-Cell Nucleofector solution.
4. Transfer 100 μL (5 × 107 cells) to each cuvette containing 5 or
10 μg of linear, purified DNA (see Note 9).
5. Mix the cells and DNA by gently flicking the cuvette and
immediately electroporate using program X-001 in an AMAXA
2D system.
6. Immediately transfer the transfected cells into 10 mL pre-
warmed Leishmania culture medium containing 20% FCS, split
into two flasks containing 5 mL each and incubate overnight to
allow recovery (see Note 10).
7. Resuspend cells in the desired volume of culture medium
containing 20% FCS and dose with the appropriate antibiotic
(see Note 11).
8. Perform selection of clones by diluting recovered cells and
plating in 96-well plates. The following dilution method
allows for clone recovery for a range of transfection efficiencies
(see Note 12).
(a) Add 4 mL from each flask of cells to 20 mL culture media
(1/6 dilution)—plate out 200 μL per well in a 96-well
plate.
(b) Add 2 mL from the above dilution to 22 mL media
(1/72 dilution)—plate out in a 96-well plate.
(c) Add 2 mL from above dilution to 22 mL media (1/864
dilution)—plate out in a 96-well plate.
9. Seal the plates with Parafilm or cling film to reduce
evaporation.
10. Incubate plates for 3–4 weeks at 25 °C to obtain antibiotic-
resistant clones.
11. Expand clonal populations in flasks and extract gDNA from
5 × 106 to 1 × 107 cells to check for integration of constructs
(see Subheading 3.2.3 and Note 13).
3.2.3 Construct 1. Design appropriate primers to confirm integration of the KO,

Integration Checks GOIflox, or DiCre cassettes (see Note 14). Use a primer that
binds outside the homologous flanks with a primer that binds
in the integration cassette (see Table 5 for sequences of integra-
tion cassette primers).
2. Perform Taq polymerase PCR amplification from drug-resistant
and wild-type gDNA using these primer pairs.
3. Resolve PCR products by agarose gel electrophoresis and
visualize the DNA. Amplicons of expected size that are absent
Table 5
Primers used for construct integration checks
Integration
Primer plasmid Binding site Orientation Primer sequence
OL13 KO-HYGR Start of HYGR Reverse GGTGAGTTCAGGCTTTTTCA
OL14 KO-HYG R
End of HYG R
Forward CGTCCGAGGGCAAAGGAATA
OL17 KO-SATR Start of SATR Reverse CAGGGATCACCGAAATCTTCA
OL18 KO-SATR End of SATR Forward CGGGAGCACAGGATGACGCCT
OL5118 GOI -PUR flox R
PolyA downstream Reverse CTGCCTCAAACTTGCTTTTC
of second LoxP site
OL16 GOIflox-PURR End of PURR Forward ACCCGCAAGCCCGGTGCCTGA
OL2380 DiCre-BSD in R
5′ of rRNA locus Forward CATTCCGTGCGAAAGCCGG
rRNA locus integration site
OL4101 DiCre-BSDR End of BSDR Forward CTGGTTATGTGTGGGAGG
OL4102 DiCre-BSDR Start of FKBP12 Reverse GATGGTTTCCACCTGCAC
(fused to Cre59)
in the wild-type control indicate the integration of the cassette

at the target gene locus. Integration can be confirmed by
Southern blotting.
Once an integrated clone has been identified, this line can be
used for further gene replacement to generate a GOI
null:GOIflox heterozygote (see Note 15).
3.3 Induction Once it has been confirmed that a cell line is deficient of the endog-
of Conditional Gene enous GOI and contains integrated GOIflox and DiCre cassettes,
Deletion the process of dissecting the phenotype upon conditional deletion
can begin.
1. Seed log-phase procyclic promastigotes at a low density
(5 × 104 to 5 × 105 cells/mL) in culture medium, mix the cul-
ture, and separate into two flasks with equal volumes.
2. Inoculate 300 nM of rapamycin into the induced flasks and an
equal volume of DMSO into the noninduced control.
Alternatively, rapamycin and DMSO can also be added daily at
100 nM for the duration of the experiment. Gently mix the cul-
tures to ensure even distribution of the ligand (see Note 16).
3. Count cells every 24 h to generate growth curves. Dilute cells
and add fresh rapamycin or DMSO if needed.
4. Extract genomic DNA to perform PCR and Southern blotting
analysis of gene excision to validate loss of the floxed gene
(see Note 17).
5. Carry out Western blotting using a primary native antibody, or
an anti-HA/GFP Ab if the GOI has been cloned into a
pDONR conferring a protein tag (see Note 18).
6. Apply the appropriate biochemical analysis to determine the
effect of gene loss on the cells.
4 Notes
1. All plasmid sequences are available on the Mottram group

website (http://www.mottramlab.org).
2. Culture conditions and media (including percentage of FCS)
may vary depending on the Leishmania species used. Well-
adapted lab strains are usually maintained in growth medium
with 10% FCS, while recovery and cloning of cells after trans-
fection is done in medium with 20% FCS.
3. Rapamycin stock solution is prepared at 1 mM in DMSO;
100 μM working solution is prepared by dilution of the stock
solution with DMSO; both stock and working solutions
should be aliquoted and stored at −20 °C to minimize
freeze-thawing.
4. Integration of constructs through homologous recombina-

tion requires at least 500 bp of flanking region (FR) surround-
ing the GOI.
5. The negative control is useful to determine the background
recombination that occurs in the absence of the DNA inserts.
It indicates the number of false positives that might be
expected. The number of colonies between BP Clonase ±
reactions can be compared to determine the recombination
efficiency.
6. One hour is sufficient for recombination to occur, but the
reaction can be left up to 18 h. However, longer incubations
increase the rate of “background” recombination, whereby
the toxic genes are excised in the absence of BP Clonase. This
means the flank is not incorporated, but bacterial growth is
possible thereby allowing growth of false-positive colonies
where the flank is absent.
7. SpeI and XbaI sites are compatible, so ligations following
digestion with these restriction enzymes may be difficult. Also,
ClaI and XbaI restriction enzymes only digest plasmids ampli-
fied in bacterial strains which are deficient in methyltransferase
activity (DAM-), so an additional transformation reaction will
be required to facilitate digestion.
8. Generally, the LR reaction results in less false positives than
the BP reaction and can be performed overnight to ensure
correct recombination.
9. It is advisable to include a water control to compare the rate
and efficacy of drug killing in the absence of DNA.
10. Do not apply drug selection at this stage; let the cells recover
overnight.
11. The concentration of antibiotics will vary depending on the
Leishmania species and strains that are used. Check recent lit-
erature or the Mottram group website (http://www.mot-
tramlab.org) for guidance.
12. The dilution series used for cloning of overnight recovered
cells is based on the expected transfection efficiency. For exam-
ple for an AMAXA transfection of a pRIB construct (e.g.,
pGL2399) the expected transfection efficiency is 1 antibiotic-
resistant cell per μg DNA for every 2 × 105 cells used = 1/2 × 105
per μg DNA = 5 × 10−6 transfectants/μg DNA. Therefore
transfecting 5 × 107 Leishmania with 10 μg DNA should yield:
5 × 107 cells × 5 × 10−6 transfectants/μg DNA × 10 = 2500
clones in total.
If transfected cells are recovered overnight in 10 mL there
are 2500 clones in 10 mL.
For a pRIB transfection three dilution plates would yield

the following clones:
Dilution 1 (1/6) = 1000 clones (in 4 mL)/24 mL = 41.7
clones per mL.
Per 96-well plate (200 μL/well) = 41.7 clones per
mL × 19.2 mL = 800 clones.
Dilution 2 (1/72) = 41.7 clones/12 = 3.5 clones per
mL × 19.2 mL = 66.7 clones.
Dilution 3 (1/864) = 3.5 clones/12 = 0.29 clones per
mL × 19.2 mL = 5.6 clones.
Integration into the ribosomal locus using the pRIB construct
is efficient due to the high number of integration sites.
Clones are expected to be recovered from the last dilution
(1/864) plate. Other integrations such as first and particu-
larly second allele integration have far lower efficiency and
clones may only be recovered in the second or first dilution
plate.
13. Genomic DNA can be extracted using a DNA extraction kit
(e.g., Qiagen DNeasy Blood and Tissue kit).
14. Design the primers that will result in amplicons that are <2 kb
to facilitate PCR amplification.
15. The first round of gene replacement should be performed
with the GOIflox vector and second round deletion with the
DiCre or knockout cassette.
16. Excision of the gene is efficient within 48–72 h of induction
with rapamycin; however, depending on the stability and
expression rate of the target protein, it may take longer for a
cell growth phenotype to be detected. Diluting cells with fresh
addition of rapamycin or DMSO may be needed if the pheno-
type is slower to develop.
17. PCR analysis of floxed gene excision by the resulting decrease
in amplicon size is a useful method to ascertain gene excision,
while comparison between induced and noninduced gDNA
should indicate no background excision. Southern blotting
can be used to confirm and quantify gene excision.
18. If the gene is essential and results in a rapid growth defect it
may be difficult to obtain sufficient cells for protein extraction.
In this case a higher starting cell concentration and volume are
advisable.
Acknowledgments
This work was supported by the Medical Research Council (MR/

K019384) and the Wellcome Trust (104976, 104111).
References
1. Cruz AK, Titus R, Beverley SM (1993) 5. Duncan SM, Jones NG, Mottram JC (2017)
Plasticity in chromosome number and testing Recent advances in Leishmania reverse genetics:
of essential genes in Leishmania by targeting. manipulating a manipulative parasite. Mol
Proc Natl Acad Sci U S A 90(4):1599–1603 Biochem Parasitol 216:30–38. https://doi.
2. Mottram JC, McCready BP, Brown KG, Grant org/10.1016/j.molbiopara.2017.06.005
KM (1996) Gene disruptions indicate an essen- 6. Jones NG, Catta-Preta CMC, Lima A, Mottram
tial function for the LmmCRK1 cdc2-related JC (2018) Genetically validated drug targets in
kinase of Leishmania mexicana. Mol Microbiol Leishmania: current knowledge and future pros-
22(3):573–583. https://doi.org/10.1046/ pects. ACS Infect Dis 4(4):467–477. https://
j.1365-2958.1996.00136.x doi.org/10.1021/acsinfecdis.7b00244
3. Hassan P, Fergusson D, Grant KM, Mottram 7. Jullien N, Sampieri F, Enjalbert A, Herman JP
JC (2001) The CRK3 protein kinase is essen- (2003) Regulation of Cre recombinase by
tial for cell cycle progression of Leishmania ligand-induced complementation of inactive
mexicana. Mol Biochem Parasitol 113(2): fragments. Nucleic Acids Res 31(21):e131
189–198 8. Duncan SM, Myburgh E, Philipon C, Brown E,
4. Agron PG, Reed SL, Engel JN (2005) An Meissner M, Brewer J, Mottram JC (2016)
essential, putative MEK kinase of Leishmania Conditional gene deletion with DiCre demon-
major. Mol Biochem Parasitol 142(1):121–125. strates an essential role for CRK3 in Leishmania
https://doi.org/10.1016/j.molbiopara.2005. mexicana cell cycle regulation. Mol Microbiol
03.007 100(6):931–944. https://doi.org/10.1111/
mmi.13375
Chapter 11
DiCre-Based Inducible Gene Expression

Jeziel D. Damasceno, Luiz R. O. Tosi, Renato E. R. S. Santos,
Abstract
Induction of gene expression is a valuable approach for functional studies since it allows for the assessment
of phenotypes without the need for clonal selection. Inducible expression can find a wide range of appli-
cations, from the study of essential genes to the characterization of overexpression of genes of interest.
Here, we describe a detailed protocol for the use of the DiCre-based inducible gene expression system in
Leishmania parasites. This is a tightly regulated induction system that allows for time- and dose-controlled
expression of gene products, as rapidly as within 12 h.
Key words Dimerizable cre recombinase, DiCre, Inducible gene expression, Conditional genome
engineering, Leishmania, Trypanosomatids
1 Introduction
Among the genetic manipulation toolkit for Leishmania, the DiCre

recombinase-based inducible system for controlled gene expres-
sion stands out as a robust and versatile strategy to investigate the
parasite’s gene expression and function [1]. The DiCre-based
inducible expression system’s major advantages include the possi-
bility to compare endogenous proteins with mutated counterparts,
as well as to design time-and dosage-dependent expression kinetics
for gene products of interest. The system is versatile as it allows for
the induction of expression of genes of interest (GOI) from both
chromosomal and episomal contexts, with no detectable leaky
activity. Also, it uses fewer selectable markers in comparison to
other Leishmania inducible systems, making it relatively simple to
establish.
The first step in the establishment of a DiCre-based inducible
system is the generation of a cell line expressing two portions of
the Cre recombinase protein from the 18S rRNA locus. In this cell
line, hereafter referred to as DiCre-expressing cell line, the trun-
cated N-terminal portion of Cre is fused with FKBP12, while its
225
226 Jeziel D. Damasceno et al.
truncated C-terminal portion is fused with FRB, rendering two

separated domains with no recombinase activity (Fig. 1a). Upon
addition of the ligand rapamycin, which simultaneously binds to
FKBP12 and FRB, a dimer (DiCre) is formed and the Cre recom-
binase activity is reconstituted [2]. The DiCre-expressing cell line
can be tailored to bear a cassette containing a GOI, in an inverted
configuration, flanked by cis-oriented loxP sites (floxed) also in the
A) C)
a b DiCre/GFPFloxed
Kb
0.7- a+c
5’SSU FKBP12-Cre FRB-Cre59 BLA 3’SSU
2.0- d+e
B) 1.5- Control
66 77 Rapamycin - +
lox lox
5’SSU SL-AS GOI-6xHA PAC 3’SSU D)
a e c d DiCre/GFPFloxed
KDa
43- GFP
P 72
lox lox 43- Control
5’SSU SL-AS GOI-6xHA PAC 3’SSU
- 12h 24h 48h
a c e d Rapamycin
+
Fig. 1 The DiCre-based induction system for Leishmania. (a) Schematic representation (not to scale) of the
cassette encoding FKBP12-Cre59 and FRB-Cre60, the truncated forms of Cre recombinase (DiCre) after inte-
gration into the 18S ribosomal RNA locus in the DiCre-expressing cell line; this cassette contains the blastici-
din resistance marker (BLA) and is also flanked by regions homologous to the 18S ribosomal RNA locus (5′SSU
and 3′SSU); the cassette is obtained by digesting the pGL2339 plasmid with PacI and PmeI restriction enzymes.
(b) Schematic representation (not to scale) of the cassette containing the GOIFloxed construct after integration
into the 18S ribosomal RNA locus of the DiCre-expressing cell line (a) to generate the DiCre/GOIFloxed cell line;
to obtain this cassette the GOI must be cloned into the pGL6000 vector, which contains a sequence encoding
for a peptide with six copies of hemagglutinin (6xHA) in an inverted orientation, flanked by lox66 and lox77
sites and followed by the puromycin resistance marker (PAC); the cassette also contains a splice leader accep-
tor site (SL-AS) upstream to the inverted 6xHA coding sequence; DNA fragments encoding for GOI can be
cloned in an inverted orientation allowing for the generation of a floxed version of GOI containing a C-terminal
fusion with 6xHA tag; the linear DNA fragment containing the GOIFloxed construct is generated by digesting the
pGL6000-GOIFloxed vector with PacI and PmeI restriction enzymes and then transfected into the DiCre-expressing
cell line; upon rapamycin addition, the lox66 and lox77 sites mediate the flipping of GOI-6xHA allowing for its
expression. In (a) and (b), black arrows indicate approximate annealing position of primers that can be used
for PCR analysis; a anneals at 5′SSU (5′-CATTCCGTGCGAAAGCCGG-3′); b anneals at the 5′ end of FKBP12-
Cre59 (5′-GATGGTTTCCACCTGCAC-3′); c is specific for the GOI and anneals at the 5′ end of GOI; d anneals at
the 5′ end of PUR (5′-CCGTGGGCTTGTACTCGGTCA-3′); e is specific for the GOI and anneals at the 3′ end of
GOI. (c) PCR of genomic DNA from a DiCre/GOIFloxed cell line (where GOI is GFP) cultivated in the absence (−) or
presence (+) of Rapamycin for 48 h; primers pairs a + c and d + e (annealing positions shown in b) were used
for the analysis; Control indicates a PCR product using primers for the dihydrofolate reductase thymidylate
synthase coding sequence, which was as used as loading control. (d) Western blotting analysis of whole cell
extracts from DiCre/GFPFlox cells treated with rapamycin for the indicated period of times; Control is an unspe-
cific band recognized by anti-EF1α antibody and was used as the loading control
DiCre-Based Inducible Gene Expression 227
18S rRNA locus, hereafter referred to as DiCre/GOIFloxed cell line.

Thus, the second step in the establishment of a DiCre-based induc-
tion system requires cloning of GOI sequence into the pGL6000
vector and subsequent transfection of GOIFloxed DNA fragment
into the DiCre-expressing cell line (Fig. 1b).
Controlled expression stems from the fact that when the GOI
is in an inverted configuration its transcription does not produce a
functional mRNA. Upon rapamycin-mediated dimerization, DiCre
catalyzes the inversion (or “flipping”) of the locus flanked by cis
loxP elements allowing for the expression of GOI (Fig. 1b,c,d).
In this system, mutated loxP sites (lox66 and lox77) are used in
order to prevent continual reinversion of the target sequence [3].
Upon flipping, lox66 and lox77 will generate a wild-type loxP site
and a double mutant lox72 site for which the DiCre enzyme has a
drastically decreased affinity. Hence, flipping of the locus is favored,
thus guaranteeing continual and robust gene expression after
rapamycin-mediated DiCre activation.
2 Materials
2.1 Generation 1. Wild-type Leishmania cells in mid-log phase (see Note 1).
of DiCre-Expressing 2. Supplemented M199 medium [4].
Cell Line
3. pGL2339 vector (Fig. 1a; [5]).
4. Restriction endonuclease PacI.
5. Restriction endonuclease PmeI.
6. QIAquick gel extraction kit (QIAGEN) (see Note 2).
7. Cytomix electroporation buffer (120 mM KCl2, 0.15 mM
CaCl2, 10 mM K2HPO4, 25 mM HEPES, 2 mM EDTA, and
5 mM MgCl2; pH 7.6) [6] (see Note 3).
8. 4 mm gap electroporation cuvettes.
9. Electroporator.
10. 96-well flat bottom plates.
11. Blasticidin.
12. DNeasy Blood and Tissue genomic DNA extraction Kit
(QIAGEN).
13. Primers a and b (Fig. 1a).
2.2 Generation 1. DiCre-expressing cell line in mid-log phase.

of DiCre/GOIFloxed Cell 2. Supplemented M199 medium.
Line
3. Specific primers to perform PCR amplification of GOI.
4. Phusion® High Fidelity DNA polymerase.
5. pGL6000 vector (Fig. 1b).
6. Calf-intestinal alkaline phosphatase.

7. T4 ligase.
8. Ca2+-competent E. coli cells.
9. Restriction endonuclease PacI.
10. Restriction endonuclease PmeI.
11. QIAquick gel extraction kit (QIAGEN).
12. Cytomix electroporation buffer (see Subheading 2.1, item 7).
13. 4 mm gap electroporation cuvettes.
14. Electroporator.
15. 96-well flat bottom plates.
16. Blasticidin.
17. Puromycin.
18. DNeasy Blood and Tissue genomic DNA extraction Kit
(QIAGEN).
19. Primers a and e (Fig. 1b).
2.3 Induction 1. DiCre/GOIFloxed cell line in mid-log phase.

of Expression of GOI 2. Rapamycin (see Note 4).
3. DMSO.
4. Supplemented M199 medium.
5. Puromycin.
6. Blasticidin.
2.4 Confirm 1. DNeasy Blood and Tissue genomic DNA extraction Kit
Induction of Gene (QIAGEN).
of Interest 2. Primers a, d, c, and e (Fig. 1b).
3. 1× PBS (137 mM NaCl; 2.7 mM KCl; 10 mM Na2HPO4;
1.8 mM KH2PO4).
4. Laemmli buffer (63 mM Tris–HCl pH 6.8; 10% glycerol; 2%
SDS; 0.0025% Bromophenol Blue; 5% v/v
2-mercaptoethanol).
5. Anti-hemagglutinin antibody.
6. ECL HRP-linked anti-mouse secondary antibody (Amersham).
7. PVDF membrane.
8. ECL Prime Western Blotting Detection Reagent (Amersham)
(see Note 5).
3 Methods
3.1 Generation 1. Set up the restriction digest of pGL2339 plasmid (Fig. 1a)

of DiCre-Expressing with PacI and PmeI enzymes (see Note 6).
Cell Line 2. Run the reaction product on a 0.7% agarose gel to visualize the
3.1.1 Plasmid
DNA fragments. Two fragments of 5460 bp and 2557 bp are
Preparation
expected.
for Transfection 3. Purify the 5460 bp fragment containing the DiCre SSU-flanked
cassette using the Gel Extraction Kit (see Note 7).
4. Run an aliquot of purified DNA on a 0.7% agarose gel to check
for purity and integrity.
5. Determine the concentration of the purified DNA.
3.1.2 Transfection 1. On the day before the transfection, dilute mid-log wild type
and Clone Selection cells to ~1 × 106 cells/ml.
2. Allow cells to grow for approximately 18 h (~2 to 3 rounds
of cell cycle) until a 5 to 7 × 106 cells/ml density is reached
(see Note 8).
3. Harvest cells by centrifugation at 2000 × g for 5 min at 25 °C.
4. Resuspend cells in half of the original cell culture volume using
the cytomix electroporation buffer and harvest them again by
centrifugation at 2000 × g for 5 min at 25 °C.
5. Resuspend cell pellet in cytomix electroporation buffer to a
final density of 2 × 108 cells/ml.
6. Transfer 0.8 ml of the cell suspension to a 4 mm gap cuvette
containing 5 μg of purified DNA (see Subheading 3.1.1).
7. Electroporate cells twice at 25 μF, 1500 V (3.75 kV/cm), with
a 30 s pause between pulses (see Note 9).
8. Immediately transfer the cells to 10 ml of M199 medium
supplemented with 20% fetal bovine serum and incubate
overnight.
9. Clone parasites by limiting dilution in the presence of 10 μg/ml
blasticidin in 96 well plates (see Note 10).
10. After 2–4 weeks of selection, genomic DNA from resistant
clones can be extracted using DNeasy Blood and Tissue
genomic DNA extraction Kit (see Note 11).
11. Confirm pGL2339 integration by PCR using primers pair
a + b. A fragment of ~500 bp should be observed (see Notes
12 and 13).
3.2 Generation After establishment of the DiCre-expressing cell line, it can be used
of the DiCre/GOIFloxed as background cell line to generate a cell line for inducible expres-
Cell Line for Inducible sion of GOIs.
Expression of GOI
3.2.1 Cloning GOI 1. Design the appropriated pair of primers to perform a PCR of
into pGL6000 vector the GOI coding sequence from genomic DNA. Include appro-
to Generate the pGL6000- priate restriction sites in the primers to allow restriction digest
GOIFloxed Construct of PCR products and cloning into pGL6000 vector (Fig. 1b)
(see Note 14).
2. Perform PCR using Phusion® High Fidelity DNA polymerase
and run PCR products on an agarose gel.
3. Purify the amplified fragment using the Gel Extraction Kit.
4. Digest the purified PCR product with the appropriated restric-
tion enzymes to allow cloning into pGL6000 vector.
5. Digest pGL6000 vector with the same set of restriction
enzymes used to digest the PCR product in step 4.
6. Confirm digest of pGL6000 by running an aliquot on an aga-
rose gel. A single DNA fragment of 8079 bp should be
observed.
7. Treat the linearized pGL6000 with calf intestinal alkaline
phosphatase, run it on an agarose gel and purify the fragment
using the Gel Extraction Kit.
8. Set up the ligation reaction using the purified pGL6000 and
GOI digestion products.
9. Transform ligation reaction products into Ca2+-competent
E. coli cells.
10. Screen for the clones bearing the plasmid containing GOIFloxed
(pGL6000-GOIFloxed) (see Note 15).
3.2.2 Plasmid 1. Set up the restriction digest of pGL6000-GOIFloxed construct

Preparation using PacI and PmeI restriction enzymes (see Notes 6,
for Transfection 16 and 17).
2. Run the products of the restriction digest on a 0.7% agarose
gel to visualize the DNA fragments. Two fragments are
expected for this reaction. One of them has 2653 bp and the
other one has 5426 bp plus the size of GOI. Use the Gel
Extraction Kit to purify the fragment containing the cassette
encoding the GOIFloxed construct flanked by SSU (see Notes 3
and 7).
3. Visualize an aliquot of purified DNA on a 0.7% agarose gel to
check for purity and integrity.
4. Determine the concentration of the purified DNA.
3.2.3 Transfection 1. One day before transfection, dilute mid-log phase DiCre-
and Clone Selection expressing cells to ~1 × 106 cells/ml.
2. Allow cells to grow for approximately 18 h (around 2–3
rounds of cell cycle) to reach ~5 to 7 × 106 cells/ml density
(see Note 8).
3. Harvest cells by centrifugation at 2000 × g for 5 min at 25 °C.
4. Resuspend cells in half of the original cell culture volume with
cytomix electroporation buffer and harvest them again by
centrifugation at 2000 × g for 5 min at 25 °C.
5. Resuspend cell pellet in cytomix buffer to give a final concen-
tration of 2 × 108 cells/ml.
6. Transfer 0.8 ml of the suspension to a 4 mm gap electropora-
tion cuvette containing 5 μg of purified DNA (see Subheading
3.1.2).
7. Electroporate cells twice at 25 μF, 1500 V (3.75 kV/cm), with
30 s pause between each (see Note 9).
8. Immediately transfer parasites to 10 ml M199 medium supple-
mented with 20% fetal bovine serum and incubate overnight.
9. Clone parasites by limiting dilution in 96-well plates. Selection
must be performed in the presence of both blasticidin and
puromycin at a concentration of 10 μg/ml each (see Note 10).
10. After 2–4 weeks of selection, genomic DNA from resistant
clones can be extracted using DNeasy Blood and Tissue
genomic DNA extraction Kit (see Note 11).
11. Confirm correct integration of the GOIFloxed construct by PCR
using primers pairs a + e and/or c + d (Fig. 1b). Also, confirm
that the DiCre-bearing construct is present in the selected
clones, using primers pair a + b (see Note 12).
3.2.4 Induction Once clones have been selected and proper integration of DiCre
of Expression and GOIFloxed cassettes have been confirmed, DiCre/GOIFloxed cell
line can be used for inducible expression of the GOI.
1. In the day before induction, dilute mid-log phase DiCre/
GOIFloxed cells to ~1 × 106 cells/ml.
2. Allow cells to grow for approximately 18 h (~2 to 3 rounds of
cell cycle) to a ~5 to 7 × 106 cells/ml density (see Note 18).
3. Seed cells at 0.5 to 1 × 105 cells/ml density (see Notes 19
and 20).
4. Add rapamycin to a 100 nM final concentration (see Note 21).
5. Collect cells every 24 h (see Notes 22 and 23).
6. Extract genomic DNA from cells collected at each time point
using DNeasy Blood and Tissue genomic DNA extraction Kit
(see Note 11).
7. Use this genomic DNA as template in PCR analyses with

primer pairs a + c and d + e (Fig. 1b), to confirm flipping of the
GOI (see Note 24).
8. Prepare whole cell extracts by harvesting cells, washing them
in 1× PBS, and resuspending them in Laemmli buffer (see
Note 25).
9. Resolve total cell extract in SDS-PAGE (see Note 26).
10. Transfer resolved proteins to PVDF membrane (see Note 27).
11. Perform western blot using the anti-hemagglutinin as primary
antibody and ECL HRP-linked anti-mouse secondary anti-
body (see Note 28).
12. Visualize bands with ECL Prime Western Blotting Detection
Reagent (see Notes 29 and 30).
4 Notes
1. The published DiCre-mediated inducible system [1] was

established using the Leishmania major wild-type cell line
LT252 (MHOM/IR/1983/IR).
2. In order to obtain the adequate amount of DNA for transfec-
tion, usually a large amount of starting material—from at least
ten PCR reactions—has to be resolved in an agarose gel in
order to be further purified. Alternatively, the linear DNA
fragment can be generated by PCR using pGL2339 plasmid as
template.
3. Due to the repetitive nature of rRNA locus, in which is the
target for integration in this system, transfection efficiency is
satisfactory when performed with cytomix in the Gene Pulser
Xcell™ Electroporation System (Bio-Rad, see Note 9). If a
higher transfection efficiency is needed, use Human T Cell
Nucleofector® Kit (Lonza) and perform transfection in Amaxa
electroporator set in the U-33 program.
4. Rapamycin stock solution is prepared at 1 mM in DMSO;
100 μM working solution is prepared by dilution of the stock
solution with DMSO; both stock and working solutions
should be aliquoted and stored at −20 °C.
5. Compared to other commercially available detection reagents,
ECL Prime has a significant increased sensitivity. This is espe-
cially useful when analysing early induction time points since
it allows for the detection of low levels of the induced
protein.
6. PacI and PmeI from New England Biolabs can be used simul-
taneously in a double digestion reaction with CutSmart®
buffer.
7. Elute DNA with high volumes—at least 300 μl—to maximize

DNA recovery. DNA can be concentrated by ethanol precipi-
tation and resuspended in a smaller volume (20 μl).
8. Optimal transfection efficiency is dependent on the replicative
state of the cells. Cells must be at mid-log phase, in a cell den-
sity that should not be over 7 × 106 cells/ml at the moment of
transfection.
9. These parameters have been used with Gene Pulser XCell™
Electroporation System (Bio-Rad). Optimization may be
required if a different electroporation system is employed.
10. Cells can also be cloned in semi solid M199 plates. While this
method guarantees the selection of clonal cell lines, the num-
ber of clones recovered is greatly reduced when compared to
the serial dilution method.
11. As little as 105 cells can yield enough DNA for PCR analysis.
Thus, there is no need to expand clones in large volumes for
an initial screening. DNA can also be extracted directly from a
small aliquot from the wells containing cells that survived
selection on the 96-well plate.
12. Alternatively, integration can be checked by Southern blot-
ting. In this case, genomic DNA can also be extracted using
DNeasy Blood and Tissue genomic DNA extraction Kit.
Usually, 10 ml of stationary phase cultures yields sufficient
DNA for at least two Southern blotting experiments.
13. There are commercially available antibodies against FKBP12
(Thermo Scientific, product number PA1-026A) and FRB
(Enzo Life Sciences, product number ALX-215-065-1).
These antibodies can be used to assess DiCre levels in western
blotting analysis. Such screening can be useful to select clones
with the desired levels of DiCre.
14. There are four different restrictions sites in the multiple clon-
ing site of pGL6000. They can be used in different combina-
tions to allow both directed ligation reaction and C-terminal
fusion with 6xHA sequence. Alternatively, the GOI can be
cloned not in frame with 6xHA in order to be expressed as an
untagged protein.
15. Sequencing of the construct pGL6000GOIFloxed is necessary to
confirm proper configuration of the construct, especially to
confirm that the GOI coding sequence is in frame with 6xHA.
16. Depending on the intended application, pGL6000GOIFloxed
can be transfected as a circular plasmid, without the need for
digestion with restriction enzymes. In this way, the construct
is maintained as an extrachromosomal circular molecule. pGL-
6000GFPFloxed can be maintained stably as episomes and can
achieve robust induction of GOI expression.
17. In this case, linear DNA fragment can also be generated by

PCR using pGL6000GOIFloxed as template.
18. DiCre activity is dependent on the replicative state of cells and
seems to be optimal in mid-log phase cells. Hence, make sure
that the density of cell culture used to set up induction is not
higher than 7 × 106 cells/ml at the moment they will be seeded
to start the induction with rapamycin.
19. If a noninduced control is needed, seed cells in a sufficient
large volume of medium that can be split into two flasks: one
for the rapamycin induction and the other without the drug.
20. If a negative control for the rapamycin treatment is needed,
the DiCre-expressing cell line can be used for that. In this
case, DiCre-expressing cell line should be grown in parallel
with the DiCre/GOIFloxed cell line, in the presence of rapamycin.
This could be used to rule out possible off-target effects of
rapamycin in the phenotype observed upon induction.
21. Rapamycin concentration as low as 2 nM is sufficient to induce
robust expression of GOI. Empiric determination of rapamy-
cin concentration might be required, as the size of GOIFloxed
construct and DiCre expression levels can influence flipping
efficiency.
22. Make sure that enough cells are collected to be processed
for both genomic DNA extraction and total cell lysate
preparation.
23. Maximum levels of induction are reached between 48 and
72 h after induction, but empirical determination of optimal
induction levels might be required for each GOI.
24. Although PCR analysis is sufficient to demonstrate flipping
activity, Southern blotting can be used for quantitative analysis
as it allows the simultaneous detection of nonflipped and
flipped molecules. Alternatively, qPCR can also be used for
quantitative analysis.
25. Resuspend cells at a concentration of ~1 to 2 × 105 cell/μl.
Make sure to shear DNA completely by pipetting solution up
and down until no viscosity is perceived. Samples can be stored
at −80 °C until all time points are collected to be resolved in
the same SDS-PAGE.
26. Usually, loading the equivalent of 106 cells per well is sufficient
to detect induced protein after 24 h of incubation with
rapamycin. If necessary, up to 107 cells equivalent can be
loaded on each well.
27. PVDF membrane is mechanically more resistant and has

improved protein retention capacity compared to nitrocellu-
lose membrane. This is useful, for instance, to detect low levels
of protein at early induction time points.
28. If antibody against the protein encoded by GOI is available, it

should be used to check if induction is leading to
overexpression.
29. Compared to other commercially available detection reagents,
ECL Prime Western Blotting Detection Reagent has signifi-
cantly increased sensitivity, also allowing for detection of low
levels of protein, which can be of interest if protein is expressed
in low levels after induction.
30. Alternatively, induction can be examined by immunofluores-
cence, which allows for determination of the percentage of
induced cells in the population; also, it allows for cellular local-
ization study of the induced protein.
References
1. Santos RERS, Silva GLA, Santos EV et al Leishmania major delineates a 30- kilobase
(2017) A DiCre recombinase-based system for region sufficient for extrachromosomal replica-
inducible expression in Leishmania major. Mol tion and expression. Mol Cell Biol 10:1084–
Biochem Parasitol 216:45–48. https://doi. 1094. https://doi.org/10.1128/
org/10.1016/j.molbiopara.2017.06.006 MCB.10.3.1084
2. Jullien N, Sampieri F, Enjalbert A, Herman J-P 5. Duncan SM, Myburgh E, Philipon C et al
(2003) Regulation of Cre recombinase by (2016) Conditional gene deletion with DiCre
ligand-induced complementation of inactive demonstrates an essential role for CRK3 in L.
fragments. Nucleic Acids Res 31:e131. https:// eishmania mexicana cell cycle regulation. Mol
doi.org/10.1093/NAR/GNG131 Microbiol 100:931–944. https://doi.org/
3. Albert H, Dale EC, Lee E, Ow DW (1995) 10.1111/mmi.13375
Site-specific integration of DNA into wild-type 6. Robinson KA, Beverley SM (2003)
and mutant lox sites placed in the plant genome. Improvements in transfection efficiency and
Plant J 7:649–659. https://doi.org/ tests of RNA interference (RNAi) approaches in
10.1046/j.1365-313X.1995.704649.x the protozoan parasite Leishmania. Mol
4. Kapler GM, Coburn CM, Beverley SM (1990) Biochem Parasitol 128:217–228. https://doi.
Stable transfection of the human parasite org/10.1016/S0166-6851(03)00079-3
Chapter 12
Generation of Bone Marrow-Derived Macrophages

for In Vitro Infection Experiments
Eugenia Bifeld
Abstract
Murine bone marrow-derived macrophages (BMMs) can be differentiated within 10 days from ex vivo
bone marrow progenitor cells by supplementing the cell growth medium with colony stimulating factor-1
(CSF-1). Mature macrophages express specific myeloid markers which can be labeled and detected by flow
cytometry (FACS).
BMMs are a valuable tool to investigate the interactions between the Leishmania parasites and their
host cell as well as to screen anti-Leishmania components. Options for the readout of in vitro infection
experiments are diverse and may range from simple counting of intracellular parasites to the determination
of metabolic changes of the intracellular parasite or the infected cell, thus providing the investigator with
valuable results.
Key words Bone marrow-derived macrophages, Colony stimulating factor-1, Flow cytometry
1 Introduction
Macrophages are highly heterogenous professional phagocytes

with microbicidal functions which are distributed all over the body.
They engulf invading pathogens, process them, and prime the
immune system during an infection. In return, they rapidly change
their functions in response to inflammatory signals. Leishmania
spp., however, evolved sophisticated mechanisms to silence the
microbicidal functions of a macrophage by manipulating its signal
transduction in order to survive in this host defense cell.
Murine bone marrow-derived macrophages (BMMs) are a
valuable tool to investigate not only this manipulation mechanism
of Leishmania spp. but also the phenotype of genetically manipu-
lated parasites. Infections are further essential for the screening of
anti-leishmania compounds and the analysis of cytokine profiles
from infected macrophages.
237
238 Eugenia Bifeld
The proliferation and differentiation of macrophages from

individual bone marrow progenitor cells is promoted by the hema-
topoietic growth factor, colony-stimulating factor-1 (CSF-1), also
known as the macrophage colony-stimulating factor (M-CSF) [1,
2], and takes 10 days [3]. The ex vivo proliferation of BMMs
depends on the CSF-1 concentration [4]. CSF-1 acts exclusively
on mononuclear phagocytes. It is produced by mesenchymal cells,
including fibroblasts and the endothelium [5]. Different cell lines
are available for the production of CSF-1, with the murine fibro-
blast L929 cell line (NCTC clone 929, ATCC® CCL-1™) being
the best established source for the macrophage CSF and the granu-
locyte CSF (G-CSF) [6]. In 1985, Sklar and colleagues generated
another cell line for the secretion of CSF-1 only, by transfecting
murine macrophage progenitor cells from bone marrow with the
human c-myc oncogene homolog, R-myc. The resulting LADMAC
cells (ATCC® CRL-2420™) have monocyte-like morphology,
secrete high amounts of CSF-1 and are suitable for cultivation in a
Pannell–Milstein roller bottle apparatus [7–10].
BMMs express different markers during their development,
which can be utilized for the monitoring of BMM maturation.
Mature macrophages in general express the integrin Mac-1
(CD11b/CD18), the transmembrane glycoprotein F4/80, and
the integrin CD86. Bone marrow-derived macrophages, further-
more, show a high expression of CD80 [3, 11].
Although the ex vivo differentiated macrophages lack the
whole immune system environment of an organism, their pheno-
types differ, for example, in cytokine production and microbicidal
effector functions depending on the parental mouse genetic back-
ground [3, 12, 13]. The best-studied mouse infection models for
Leishmania spp. are inbred mice of the genotypes BALB/c and
C57BL/6 and the parasite Leishmania major. While the C57BL/6
mice can control the L. major infection, the BALB/c mice develop
progressive lesions and a systemic disease. Both mice are used as
models for the human disease outcomes: either a self-healing or a
nonhealing form—which in humans is associated with infections
by L. infantum and L. donovani—respectively. The mouse infec-
tion outcome correlates with the characteristic cytokine-driven bal-
ance of the TH1/TH2 response [14]. BMMs from BALB/c mice
produce more IL-10 and IL-6, but less TNF-α and IL-12 than
BMMs isolated from C57BL/6 mice [12], something to be con-
sidered by investigators prior to bone marrow preparation.
2 Materials
Prepare all solutions using sterile filtered (0.22 μm), distilled water.
Store all solutions at 2–8 °C, unless indicated otherwise. Sterilize
all material prior to use with an alcoholic disinfection solution and
use a safety cabinet for all cell manipulations.
Generation of Bone Marrow-Derived Macrophages for In Vitro Infection Experiments 239
2.1 Bone Marrow- 1. Donor mice: female BALB/c or C57BL/6, typically 6–8
Derived Macrophages weeks old.
2. Harvesting medium: Phosphate-buffered saline (PBS) without
calcium and magnesium. Add 0.2 g KCl, 0.24 g KH2PO4, 8 g
NaCl, and 1.41 g Na2HPO4 to 800 mL water, adjust the pH
to 7.4 using a 10 mM HCl solution, fill up to 1000 mL, filtrate
through 0.2 μm bottle top filter into a sterilized glass bottle.
3. BMM growth and differentiation medium: DMEM/F-12,
supplemented with GlutaMAX (see Note 1) (Thermo Fisher
Scientific, Germany), 10% heat-inactivated fetal calf serum
(FCS) (see Note 2), 5% horse serum, 100 units penicillin,
0.1 mg mL−1 streptomycin, and 5–20% of CSF-1 condi-
tioned medium, and filtered through a 0.2 μm filter system.
(see Note 3)
4. Trypsin–EDTA (Sigma-Aldrich, Germany).
5. Trypan Blue for cell viability testing was prepared according to
a protocol by G.A. Perry, Creighton University: For the Trypan
Blue stock solution dissolve 0.2 g Trypan Blue (Sigma-Aldrich,
Germany) in 99.8 mL water, filtrate through 0.2 μm filter, add
0.2% sodium azide (Sigma-Aldrich, Germany). Prepare a
0.7 M NaCl solution in water, mix 0.5 mL of the 0.7 M saline
solution with 2 mL of the Trypan Blue stock solution to prepare
the working solution.
6. 20-mL syringes (Injekt®, B. Braun Medical AG, Sempach,
Switzerland) and 27-G needles (Sterican®, B. Braun Medical
AG).
7. Scalpels and preparation cutlery set.
8. Hemacytometer, 1 mm2 surface × 0.1 mm depth (Hecht
Assistant, Germany).
9. Suitable culture dish for adherent cells (e.g., cell culture flasks
(150/300 cm2 growth surface) with ventilated caps).
10. Cell culture plates suitable for adherent cells from 6 to 24
wells.
2.2 LADMAC Cells 1. LADMAC cells, American Type Culture Collection (ATCC®
CRL-2420™).
2. Complete growth medium for cultivation: Minimum Essential
Medium Eagle (MEME, Sigma-Aldrich, Germany) supple-
mented with 10% heat-inactivated FCS, 1× GlutaMAX
(ThermoFisher Scientific, Germany), 100 U penicillin, 0.1 mg
mL−1 streptomycin, and filtered through a 0.2 μm filter
system.
3. Growth medium for cultivation in roller bottles: RPMI-1640
(Sigma-Aldrich, Germany) supplemented with 10% heat-
inactivated FCS, 1× GlutaMAX (ThermoFisher Scientific,
240 Eugenia Bifeld
Germany), 100 U penicillin, 0.1 mg mL−1 streptomycin, and

filtered through a 0.2 μm filter system.
4. PBS without calcium and magnesium (for recipe see
Subheading 2.1).
5. Trypan Blue for cell viability (for recipe see Subheading 2.1).
6. Hemocytometer.
7. Suitable culture dish for suspension cells with ventilated cap.
8. Roller Bottles (Greiner, Germany) (see Note 4).
9. A roller bottle rotating machine with adjustable speed (e.g.,
CELLROLL (Pfeiffer, Germany)).
2.3 FACS Analysis 1. FACS buffer: PBS supplemented with 10% of heat-inactivated
FCS, and filtered through a 0.2 μm filter system.
2. Antibodies (Biolegend, Germany): Purified nonlabeled anti-
mouse CD16/32 antibody (clone 93) (see Note 5), PE labeled
anti-mouse F4/80 (clone BM8), PerCP-labeled anti-mouse/
human CD11b (clone M1/70), PerCP/Cy5.5-labeled anti-
mouse/human CD86 (clone GL-1), and FITC-labeled anti-
mouse CD11c (clone N418).
3. Zombie UV Fixable Viability Kit (Biolegend, Germany): dis-
solve the delivered powder in 100 μL DMSO and prepare ali-
quots at 2 μL, protect from light, store at −20 °C.
4. Falcon® 5 mL round bottom polystyrene tubes.
5. Flow cytometer (e.g., the LSR II Flow Cytometer from BD
Bioscience (Germany)).
3 Methods
Carry out all procedures in a sterile environment! Clean all sur-

faces, bottles, and plasticware with an antiseptic solution from the
outside. Prewarm media and buffers for cell cultivation, unless oth-
erwise specified.
3.1 Cultivation 1. Precool centrifuge to 4 °C, chill the complete growth medium
of LADMAC Cells (for recipe see Subheading 2.2) on ice, and chill a 15 mL tube
After Freezing on ice.
2. Cells from the ATCC are delivered in cryogenic tubes as fro-
zen cultures. Thaw cells immediately after arrival in a water
bath until the culture is unthawed to approximately 80%.
Transfer the cells into the 15 mL tube on ice.
3. Add 4 mL of the complete growth medium dropwise to the
cells while gently shaking the tube.
4. Immediately spin the cells down at 400 × g and 4 °C for 10 min.
Fig. 1 Monitoring of LADMAC cell growth. Cells were counted using a hemocy-
tometer on day 3, 5, and 7 after the start of cultivation
5. Fill a 25 cm2 ventilated cell culture flask (see Note 6) with

10 mL of the prechilled complete growth medium and keep at
room temperature.
6. Decant the supernatant after centrifugation and resuspend the
cell pellet in 2 mL of complete growth medium; transfer the
cell suspension into the prepared flask.
7. Incubate the culture horizontally in an incubator set to 37 °C
and 5% CO2. Ascertain a high humidity in the incubator.
8. Monitor cell proliferation by using the hemacytometer. Mix
100 μL of the cell suspension with 100 μL of the Trypan Blue
working solution (for recipe see Subheading 2.2), apply 20 μL
on a hemacytometer and count the nonstained cells at the
microscope (Fig. 1).
9. Cultures can be maintained at a cell density between 1 × 105
and 1 × 106 viable cells/mL, according to ATCC guidelines.
Add fresh medium every 2–3 days (depending on the cell den-
sity) or replace the medium.
3.2 Generation 1. Scale up the LADMAC cell culture 1–2 weeks prior to the
of the CSF-1 transfer into roller bottles.
Conditioned Medium 2. Cool down a 50 mL centrifuge tube to 4 °C, fill roller bottles
with 280 mL of growth medium for cultivation (for recipe see
Subheading 2.2), and place the bottle in a suitable incubator at
37 °C and 5% CO2 in air atmosphere.
3. Count the cell density in the culture using the hemacytometer.
Take 1.8 × 108 cells/mL for 300 mL of growth medium
(6 × 105/mL) per roller bottle (for recipe see Subheading 2.2).
4. Fill required amount of the cell culture into 50 mL tubes and
centrifuge at 400 × g and 4 °C for 10 min.
242 Eugenia Bifeld
5. Decant the supernatant and resuspend the cell pellet in 20 mL

of growth medium for cultivation in roller bottles; transfer the
cell suspension into the prewarmed roller bottle.
6. Place the roller bottle on a rotator (4 rpm).
7. Grow the cells to confluence.
8. After 5–7 days collect the CSF-1-containing, conditioned
medium by transferring the cell culture into centrifuge tubes,
pelleting the cells at 1000 × g and 4 °C and harvesting the
supernatant from the cell pellet.
9. Filter the supernatant through a 0.2 μm filter, prepare 50 mL
aliquots and store at −20 °C.
3.3 Generation 1. Euthanize mice according to the relevant ethical and legal
of Bone Marrow- regulations.
Derived 2. Sterilize abdomen and hind legs with an antiseptic solution.
Macrophages (BMMs)
3. Sterilize the preparation cutlery set.
4. Make an incision along the hind legs and flip the skin outward
to expose the legs.
5. Remove the muscle tissue and the feet using scissors or a
scalpel.
6. Remove the head of the femur from the acetabulum by press-
ing the scalpel between both. Disjoin femur from tibia.
7. Clean the bones by placing them in 70% 2-propanol for 5 min
and air-dry the bones afterward.
8. Prepare two 75 cm2 cell culture flasks with ventilated caps (see
Note 7) and fill them with 20 mL CSF-1-containing complete
growth medium for macrophages each. Place the flasks hori-
zontally in a incubator set to 37 °C and 5% CO2.
9. Perform the next four steps on ice.
10. Cut the ends of femur and tibia and flush the bone marrow
with complete growth medium for macrophages (for recipe see
Subheading 2.1) into a 50 mL tube using a 20-mL syringe and
a 27-G needle.
11. Incubate for 5 min on ice.
12. Transfer supernatant into a fresh 50 mL tube without disturb-
ing the sediments.
13. Centrifuge at 400 × g and 4 °C for 10 min.
14. Decant the supernatant, resuspend the cell pellet in 10 mL of
prewarmed, CSF-1-containing complete growth medium for
macrophages, and transfer 5 mL aliquots into the prepared cell
culture flasks.
15. Incubate at 37 °C and 5% CO2 with high humidity.
16. After 2 days, add 12 mL of CSF-1-containing complete growth

medium for macrophages to the cell culture.
17. After 5 days replace 20 mL of the culture volume with fresh
CSF-1-containing complete growth medium for macrophages.
18. After 8 days of cultivation, remove the complete medium, rinse
the cell layer with PBS (for recipe see Subheading 2.1), and add
fresh, CSF-1-containing complete growth medium for macro-
phages to the cells (see Note 8).
19. After 10 days, harvest the BMMS.
20. Remove the medium from the culture flasks, rinse the BMM
monolayer (Fig. 2) twice with prewarmed PBS.
21. Add 10 mL of trypsin–EDTA to the BMMs and incubate at
37 °C for 10 min.
22. Inhibit the trypsin by adding two volumes of complete growth
medium for macrophages to the BMMs. Attached cells may be
suspended by tapping the sides of the flask until cells detach.
Alternatively, use a cell scraper to detach cells.
23. Collect the BMM suspension in 50 mL tubes, centrifuge at
400 × g and 4 °C for 10 min.
24. Discard the supernatant, resuspend the cell pellet in 2–5 mL
(depending on the cell yield) CSF-1-containing complete
growth medium for macrophages.
25. Count BMMs using the hemocytometer as described in
Subheading 3.1, step 8.
26. Transfer the desired amount of BMMs into an appropriate
multiwell plate (depending on the experimental design).
27. Incubate the cells for 48 h at 37 °C and 5% CO2 with high
humidity.
28. After 48 h the BMMs are ready for infection.
Fig. 2 10-day-old bone marrow-derived macrophages in a culture flask. Bright

field microscopy 40×, size bar 100 μm
244 Eugenia Bifeld
3.4 Testing The proliferation and differentiation of macrophages derived from

of the CSF-1- bone marrow precursors depends on the concentration of CSF-1 in
Conditioned Medium the growth medium. The production and secretion of CSF-1 by
cells varies. Therefore, it is necessary to determine the required
amount of CSF-1-conditioned medium in the macrophage growth
medium for ideal proliferation and differentiation conditions.
1. Prepare complete growth medium for macrophages, with varying
amounts of CSF-1-conditioned medium. Add CSF- 1-
conditioned medium to 5%, 10%, 15%, and 20%.
2. Isolate bone marrow from two mice following the instructions
in Subheading 3.3.
3. Prepare one 75 cm2 cell culture flask with a ventilated cap for
each concentration of the CSF-1 conditioned medium, fill
with 25 mL of the designated complete growth medium for
macrophages, label the flasks accurately, and incubate at 37 °C
and 5% atmospheric CO2.
4. Use PBS supplemented with 10% heat-inactivated FCS to flush
the bone marrow from the bones (Subheading 3.3, step 10).
5. Follow the steps 11–13 in Subheading 3.3.
6. Resuspend the cell pellet in 4 mL PBS supplemented with 10%
heat-inactivated FCS.
7. Add 1 mL of the cell suspension into each flask.
8. Repeat the steps 15–20 described in Subheading 3.3.
9. Perform further procedures on ice.
10. Add 15 mL of ice-cold PBS supplemented with 10% heat-
inactivated FCS to the culture flasks, place horizontally on ice,
and incubate for 10–20 min (see Note 9).
11. Gently scrape the BMMs using a cell scraper and tap the sides
of the culture flask to detach cells.
12. Transfer the cell suspension to a 50 mL tube.
14. Decant supernatant and resuspend the cell pellet in 1–2 mL
PBS supplemented with 10% heat-inactivated FCS.
15. Count the cells as described in Subheading 3.1, step 8.
3.5 FACS Analysis Perform all procedures on ice unless otherwise specified.
1. Transfer 1 × 106 cells from each culture from Subheading 3.4
into Falcon® 5 mL round-bottom polystyrene tubes prefilled
with 1 mL FACS buffer (for recipe see Subheading 2.3).
2. For the negative control transfer another 1 × 106 cells from the
BMM culture grown in complete medium into a Falcon® 5 mL
round-bottom polystyrene tube prefilled with 1 mL FACS

buffer.
4. Decant the supernatant, resuspend the cell pellet (see Note 10)
in 300 μL PBS, add 0.3 μL Zombie UV, and vortex.
5. Incubate for 15 min at room temperature in the dark.
6. Add 1 mL PBS to rinse off excess dye.
7. Centrifuge at 400 × g and 4 °C for 5 min. Decant and resus-
pend cells in residual fluid (approximately 50 μL).
8. Add 0.5 μg of anti-mouse CD16/32 antibody to the cells.
10. Repeat steps 6 and 7.
11. Prepare one antibody master mix for all samples according to
Table 1 (see Note 11).
12. Add 50 μL of the antibody pool to the suspended cells. Add 50
μL of PBS to the negative control.
14. Add 1 mL PBS to rinse off non-bound antibodies.
15. Centrifuge at 400 × g and 4 °C for 5 min and decant
supernatant.
17. Resuspend cell pellet after the second centrifugation in 150 μL
PBS. The sample is ready for flow analysis (see Note 12).
18. To fix the cells, prepare a solution of 1% paraformaldehyde
(PFA) in PBS.
19. Add 200 μL of 1% PFA to the cell pellet in step 17 (Subheading
3.5) instead of PBS.
20. Store the samples in the dark in a refrigerator until flow analysis.
21. Mature BMMs are highly positive for F4/80, CD11b, and
CD86.
Table 1
Pipetting scheme for antibody pool
Antibody μL for 1× μL for 5×

F4/80-PE 0.5 2.5
CD11b-PerCP 1 5
CD11c-FITC (see Note 13) 0.5 2.5
CD86-PerCP-Cy5.5 1 5
PBS 47 235
246 Eugenia Bifeld
4 Notes
1. GlutaMAX is a l-alanyl-l-glutamine dipeptide, which is more

stable than l-glutamine, and thus can be added directly to
the cell growth medium and supports the cell growth during
the cultivation process.
2. It is not in particular necessarily to degrade complement pro-
teins in the FCS by heating up the serum for 30 min to
56 °C. But keep in mind that complement proteins may inter-
fere with macrophage effector mechanisms or immune
response during an infection experiment.
3. For the choice of the basic medium for cell growth, the buffer
conditions of the medium should be taken into account as
some media require 9% CO2 in the air atmosphere whereas the
atmospheric CO2 is for most incubators regulated to 5%.
4. Roller bottles allow for a scale-up culture of cells from a
growth surface of 175 to 850 cm2.
5. Murine macrophages express the receptors Fc-γRII (CD32)
and Fc-γRIII (CD16) on their surface which bind nonspecifi-
cally immunoglobulins. This Fc receptors must be blocked
prior to the surface marker labeling by IgGs for the FACS
analysis. The “Fc Block step” is not required for cells which do
not contain Fc receptors on their surface.
6. Cell contact promote cell proliferation. Take care that your
cells are not highly diluted, especially if cells are stressed, for
example, due to the DMSO in the freezing medium.
7. Always chose the cell culture dishes regarding the surface
texture and the growth area in dependence to the cell type and
the expected amount of cells. This information are provided
by the manufacturer.
8. Avoid pipetting of solutions directly on a cell monolayer. Set
your pipette on a counterpart flask wall and release gently the
liquid.
9. Avoid using Trypsin for BMM harvest prior to analysis with
a flow cytometer as trypsin will remove surface markers on
the cells.
10. The cell pellet of 1 × 106 cells is hardly seen.
11. Spin down the antibody solutions prior to usage. Prepare the
antibody pool with minimal light exposure. The best concen-
tration for antibodies has always to be evaluated by titration
experiments upon acquirement of the antibodies.
12. If you are not able to analyze your cells within 4 h after
staining, fix the cells and keep in the refrigerator for at least
3–7 days (depending on the dye used).
13. Add the FITC labeled anti-mouse CD11c (clone N418)

antibody if you want to distinguish between BMMs and den-
dritic cells (DCs).
Acknowledgments
Thanks to Andrea MacDonald and Christine Brinker for help with

handling the cell cultures, and to Dr. Hannah Bernin and Dr. Julie
Sellau for advice regarding the FACS analysis.
References
1. Stanley ER, Guilbert LJ (1981) Methods for lating factor 1. J Cell Physiol 125(3):403–412.
the purification, assay, characterization and tar- https://doi.org/10.1002/jcp.1041250307
get cell binding of a colony stimulating factor 9. Sieff CA, Niemeyer CM, Mentzer SJ, Faller
(CSF-1). J Immunol Methods 42(3):253–284 DV (1988) Interleukin-1, tumor necrosis fac-
2. Clark SC, Kamen R (1987) The human hema- tor, and the production of colony-stimulating
topoietic colony-stimulating factors. Science factors by cultured mesenchymal cells. Blood
236(4806):1229–1237 72(4):1316–1323
3. Eske K, Breitbach K, Kohler J, Wongprompitak 10. Olivas E, Chen BB, Walker WS (1995) Use of
P, Steinmetz I (2009) Generation of murine the Pannell-Milstein roller bottle apparatus to
bone marrow derived macrophages in a stan- produce high concentrations of the CSF-1, the
dardised serum-free cell culture system. mouse macrophage growth factor. J Immunol
J Immunol Methods 342(1–2):13–19. https:// Methods 182(1):73–79
doi.org/10.1016/j.jim.2008.11.011 11. Leenen PJ, de Bruijn MF, Voerman JS,
4. Hume DA, Gordon S (1982) Regulation of Campbell PA, van Ewijk W (1994) Markers of
bone-marrow macrophage proliferation. Adv mouse macrophage development detected by
Exp Med Biol 155:261–266 monoclonal antibodies. J Immunol Methods
5. Sherr CJ, Rettenmier CW, Roussel MF (1988) 174(1–2):5–19
Macrophage colony-stimulating factor, CSF-1, 12. Tabel H, Kaushik RS, Uzonna J (1999)
and its proto-oncogene-encoded receptor. Experimental African trypanosomiasis: differ-
Cold Spring Harb Symp Quant Biol 53(Pt 1): ences in cytokine and nitric oxide production by
521–530 macrophages from resistant and susceptible
6. Englen MD, Valdez YE, Lehnert NM, Lehnert mice. Pathobiology 67(5–6):273–276. https://
BE (1995) Granulocyte/macrophage colony- doi.org/10.1159/000028078
stimulating factor is expressed and secreted in 13. Kaushik RS, Uzonna JE, Zhang Y, Gordon JR,
cultures of murine L929 cells. J Immunol Tabel H (2000) Innate resistance to experi-
Methods 184(2):281–283 mental African trypanosomiasis: differences in
7. Tushinski RJ, Oliver IT, Guilbert LJ, Tynan cytokine (TNF-alpha, IL-6, IL-10 and IL-12)
PW, Warner JR, Stanley ER (1982) Survival of production by bone marrow-derived macro-
mononuclear phagocytes depends on a lineage- phages from resistant and susceptible mice.
specific growth factor that the differentiated Cytokine 12(7):1024–1034. https://doi.
cells selectively destroy. Cell 28(1):71–81 org/10.1006/cyto.2000.0685
8. Sklar MD, Tereba A, Chen BD, Walker WS 14. Sacks D, Noben-Trauth N (2002) The immu-
(1985) Transformation of mouse bone marrow nology of susceptibility and resistance to
cells by transfection with a human oncogene Leishmania major in mice. Nat Rev Immunol
related to c-myc is associated with the endoge- 2(11):845–858. https://doi.org/10.1038/
nous production of macrophage colony stimu- nri933
Chapter 13
Quantification of Intracellular Leishmania spp. Using

Real-Time Quantitative PCR (qPCR)
Eugenia Bifeld
Abstract
While infecting humans and other mammals, Leishmania spp. are obligate intracellular parasites. Therefore,
for the purpose of therapeutic intervention and the study of infectivity, the relevant form of Leishmania
spp. is the intracellular amastigote. Therefore, monitoring intracellular parasite load is an essential require-
ment in many fields of Leishmania research. Real-time quantitative PCR is a highly accurate technique for
the detection and quantification of parasite burden in in vitro or in vivo infection experiments. The quan-
tification of DNA for standard curves shows linearity over a 5 to 6-log concentration range indicating the
high sensitivity of the method. Moreover, qPCR allows for the simultaneous quantification of host and
parasite DNA in the same reaction, thereby allowing for an assessment of relative parasite load for basic
research, but also for low- to medium-throughput compound screening. The method also allows to
analyze late stages of in vitro infections where host cells and parasites have detached from surfaces and
escape microscopy-based assays.
Key words Leishmania, Real-time PCR, Parasite burden, Leishmania actin
1 Introduction
Real-time quantitative PCR (qPCR) is a technique for the amplifi-

cation of a distinct DNA sequence with subsequent detection and
relative quantification of the target sequence. It is used to monitor
gene deletions, gene duplications [1], gene overexpression or bio-
markers [2, 3]; for the quantification of distinct DNAs (e.g., patho-
gen DNA) in tissue or body fluids [4–6], as well as for the analysis
of gene expression. Detecting and quantifying messenger RNA
(mRNA) requires the additional step of reverse transcription
(RT-PCR) into complementary DNA (cDNA) prior to target
sequence amplification. Reverse transcription of RNA to cDNA
thereby allows for the accurate quantification of mRNAs, microR-
NAs (miRNA), and other RNA species by qPCR [7]. The tech-
nique is highly sensitive capturing even low abundance RNAs,
249
250 Eugenia Bifeld
accurate, robust against observer bias and rapid, with results

derived from a small number to hundreds of samples [8].
The simplest method to quantify newly synthesized PCR prod-
ucts in real time is the use of the SYBR® Green I fluorescence dye,
which intercalates into the double-stranded DNA and emits fluo-
rescence proportional to the increase of PCR products in the reac-
tion [9]. By contrast, the TaqMan® chemistry technique exploits
the 5′-3′ exonuclease activity of Taq DNA polymerase to degrade
a nonextendable, target-specific oligonucleotide, the DNA probe,
during the extension reaction. The TaqMan® probe is labeled with
a 5′-fluorochrome and a 3′-quencher. Fluorescence of the fluoro-
chrome is quenched by fluorescence-resonance energy transfer
(FRET) to the quencher and emitted only upon hydrolysis of the
probe by the Taq polymerase in the course of primer extension.
Importantly, the TaqMan® chemistry also allows for the detection
of multiple target sequences in the same reaction tube. This multi-
plex qPCR allows for normalization of a quantification against one
or more standards, thereby increasing the accuracy of the target
sequence quantification, and facilitating higher sample throughput
per run. Moreover, the inclusion of the probe adds to the specific-
ity of the detection.
Both fluorescence-based technologies allow for either an abso-
lute or a relative quantification of the target sequence. An absolute
quantification requires an internal or external calibration curve per-
formed with reliable standard material (e.g., a dilution series using
recombinant DNA templates). A relative quantification is based on
the relation of the target sequence (e.g., gene of interest, GOI)
amplification to the amplification of a reference gene. The latter
method is sufficient for most purposes. For cDNA amplification,
the reference gene is usually an endogenous housekeeping gene as
these genes are essential for the cell’s survival and mostly expressed
at constant levels. Commonly used reference genes are the glyceral-
dehyde-3-phosphate dehydrogenase (GAPDH), tubulins, ß-actin,
or ribosomal RNAs genes.
PCR techniques allow for the detection of very low quantities
of nucleic acids in a sample by exponential amplification of both
DNA strands with each cycle n to N = 2n – 2 molecules. A 2n – 2 gain
of the initial material is given if the reaction efficiency (E) is 100%.
Reduction of the efficiency by only 5% already results in a strong
decrease of the quantified PCR product. An equal amplification
efficiency for all targets is therefore important for accurate quanti-
fication. This requires careful selection of primers and an optimiza-
tion of the reaction conditions. The PCR efficiency is calculated
from a given slope resulting from a plot of input DNA quantity
versus the corresponding cycle threshold (Ct) values according to
the equation: E = 10[−1/slope] − 1 (Fig. 1) (for more detail see [6]).
The amplification efficiency should further be the basis for the
Quantification of Intracellular Leishmania spp. Using Real-Time Quantitative PCR (qPCR) 251
Fig. 1 A hypothetical plot of Ct vs Log10 of target sequence for calculation of PCR

efficiency. A five- or tenfold serial dilution of a control sequence is used as a
target in the qPCR reaction. Resulting Ct-values are plotted versus the Log10
concentration of the input control sequence. The slope of the fitted linear trend
line is used for the calculation of PCR efficiency. In this example the PCR effi-
ciency is at 90%. A 100% efficiency would result from an ideal slope of −3.32
evaluation of relative expression ratio in qPCR as was proposed by

Pfaffl (2001) and is expressed in the Eq. 1 [10].
The relative expression ratio (R) of the target gene (t) is then
calculated as deviation of the Ct-values for the target gene in an
unknown sample from the Ct-values of the target gene in a control
on the basis of its amplification efficiency (Et) versus the relative
expression of the reference gene (r):
(Et ) ( )
∆Ct t control　 sample
Ratio = (1)
(Er ) (
∆Ct control　 sample )
r

The qPCR technique has become indispensable for work with
Leishmania spp. and is used for a variety of tests. Besides the use
for gene expression analysis or the monitoring of gene deletions,
the intracellular parasite load may also be evaluated via qPCR anal-
ysis. Since Leishmania spp. are obligate intracellular parasites,
in vivo or in vitro infection experiments are common for the study
of these parasites. For the evaluation of parasite load by qPCR,
genomic DNA (gDNA) is preferable as it is not dependent on fluc-
tuation of mRNA abundance and more stable than RNA, but still
rapidly degraded after parasite death [11].
While the qPCR applications used for Leishmania spp. molec-
ular diagnosis generally require high sensitivity, the evaluation of
in vitro infection experiments requires an accurate quantification of
the parasite load relative to host cells or tissue. High sensitivity can
be achieved by targeting a high copy number gene (e.g., the
kinetoplast minicircle DNA of Leishmania spp.) [12–14], which is
overrepresented in the parasites. A high copy number target can
also be the choice for the evaluation of in vivo infection experi-
ments by a duplex qPCR with TaqMan® chemistry since the excess
252 Eugenia Bifeld
of host DNA from an organ preparation may divert reaction

supplies from the amplification of the parasite target gene, requiring
higher copy number of parasite target genes. Conversely, the num-
ber of copies of amplified genes may vary between species, strains,
and even life cycle stages [15].
For an accurate evaluation of parasite loads from in vitro
infections, perform qPCR against invariant single copy genes
(e.g., the ß-actin genes are suitable targets) [6]. Primers and
probes for the reference gene (host cell ß-actin) and the gene of
interest (Leishmania ß-actin) facilitate the comparable amplifica-
tion efficiencies needed for analysis of relative infection rates and
intracellular persistence of Leishmania.
2 Materials
2.1 In Vitro Infection 1. Mature BMMs (see Chapter 12) or THP-1 cells [6].
of Bone Marrow- 2. BMM growth and differentiation medium: DMEM/F-12,
Derived Macrophages supplemented with GlutaMAX (see Note 1) (Thermo Fisher
(BMMs) Scientific, Germany), 10% heat-inactivated fetal calf serum
(FCS) (see Note 2), 5% horse serum, 100 units penicillin,
0.1 mg/mL streptomycin, and 5–20% of CSF-1 conditioned
medium, and filtered through 0.2 μm filter system.
3. Leishmania growth medium: Medium 199 (M199) powder
(Sigma-Aldrich, Germany) is dissolved in deionized water to
obtain a 1× solution and supplemented with 20% heat-
inactivated FCS, 40 mM HEPES (Biomol, Germany), 10 mg/
mL hemin, 1 mM adenine, 5 μM 6-biopterin, 2 mM gluta-
mine, 100 units penicillin, and 0.1 mg/mL streptomycin, the
pH is adjusted to 7.4 using a 10 mM HCl solution, medium is
filtered through a 0.2 μm bottle top filter into sterilized glass
bottles. Medium can be stored at 4 °C.
4. Trypsin–EDTA (Sigma-Aldrich, Germany).
5. Trypan-blue for cell viability was prepared according to the
protocol from G.A. Perry, Creighton University: Briefly, for
the Trypan Blue stock solution dissolve 0.2 g Trypan Blue
(Sigma-Aldrich, Germany) in 99.8 mL water, filter with 0.2 μm
filter, add 0.2% sodium azide (Sigma-Aldrich, Germany).
Prepare a 0.7 M saline solution in water, mix 0.5 mL of the
0.7 M saline solution with 2 mL of the Trypan Blue stock
solution to gain the working solution.
6. Hemacytometer, 1 mm2 surface × 0.1 mm depth (Hecht
Assistant, Germany).
7. CASY® Cell Counter System (Roche Innovatis AG) or an
equivalent system to determine cell density.
2.2 Real-Time Prepare all material using deionized, nucleic acid-free water.
qPCR Assay Store all solutions frozen at −20 °C, unless indicated otherwise.
1. TE-buffer: Prepare a solution of 10 mM Tris and 1 mM EDTA
with deionized water, adjust the pH to 8.0 using a 1 M HCl
solution. Sterilize the buffer by filtering the solution through a
0.2 μm filter. Store at room temperature.
2. Oligonucleotides: Dissolve the lyophilized oligonucleotides in
TE buffer for a 100 μM stock solution.
3. 0.5% SDS solution: Dissolve 2.5 mg of SDS powder in 500 mL
deionized water.
4. Appropriate real-time PCR instrument.
5. Appropriate optical reaction plates or reaction tubes for the
particular instrument.
Name Sequence 5′ > 3′ Product [nt]

OW-LeishAcF GAACCGTGAGAAGATGAC 75
OW-LeishAcR ACAGCCTGAATACCAATG
OW-LeishAcProbe FAM-ATTCAATGTGCCGTCGCTGT-BHQ-1
LbrAcF GGAGGTGCTGTTCAAGCC
LbrAcR CAATGTCGCACTTGTTGATGG
LbrProbe Fam-AGGCGCCCGGCTTCCCAGAGA-BHQ-1
MouseBetaAcF CTGGAGAAGAGCTATGAG 102
MouseBetaAcProbe Cy5-CATCACTATTGGCAACGAGCGG-BHQ-3
MoBetaACR2 CTTACCCAAGAAGGAAGGCTG
HuAcB-F2 CCCATCTACGAGGGGTATG 99
HuAcB-R2 GCGCTCGGTGAGGATCTTC
HuAcB-Probe2 Cy5-CCTGGCTGGCCGGGACCTGAC-BHQ-3
FAM 5(6)-Carboxyfluorescein, Cy®5 Cyanine 5, BHQ® 1 or 3 Black Hole Quencher® 1 or 3
6. Primers (Sigma-Aldrich) used in our laboratory:

OW-Leish = Old World Leishmaniae (L. major, L. tropica,
L. donovani, L. infantum); Ac = actin; Hu = Human; Lbr =
L. braziliensis; F = forward; R = reverse.
3 Methods
3.1 In Vitro Infection 1. Follow the protocol in Chap. 0, Subheading 3.3 to generate
of BMMs mature BMMs for in vitro infection experiments. Briefly:
(a) Remove the medium from the mature BMM mono layer,
rinse 2 times with prewarmed PBS.
(b) Add 10 mL of trypsin–EDTA to the BMMs and incubate
254 Eugenia Bifeld
(c) Inhibit the trypsin by adding two volumes of complete

growth medium for macrophages to the BMMs. Attached
cells may be subcultured by tapping the sides of the flask
until cells detach. Alternatively, use a cell scraper to
detach cells.
(d) Collect the BMM suspension in 50 mL tubes, centrifuge
at 400 × g and 4 °C for 10 min.
(e) Meanwhile fill 2 mL BMM growth medium into the wells
of a 12-well cell culture plate for adherent cells (see Notes 1
and 2). Place the plate into an incubator at 37 °C in 5%
CO2 in air atmosphere.
(f) Remove 50 mL tubes from the centrifuge, discard the
supernatant, resuspend the cell pellet in 2–5 mL (depend-
ing on the cell yield) complete growth medium for
macrophages.
(g) Count BMMs using the hemocytometer as described in
Chapter 12, Subheading 3.1, step 8.
(h) Transfer 2 × 105 of BMMs per well. Shake the plate gently
to distribute the cells evenly.
(i) Incubate the cells for 48 h at 37 °C in a 5% CO2 atmo-
sphere with high humidity.
2. Prepare Leishmania spp. culture for the infection. Count the
parasites using the CASY® cell counter system or an equivalent
cytometry system.
3. Transfer 5 × 105 promastigotes/mL (see Note 3) into a 25 cm2
cell culture flask prefilled with 10 mL M199. The cells will be
in their stationary growth phase after 2–3 days.
4. Use parasites in their stationary phase for the infection of
BMMs (see Note 4).
5. For the desired multiplicity of infection (MOI), calculate the
number of parasites needed.
6. Transfer the calculated amount of parasites into a 50 mL reac-
tion tube, centrifuge at 800 × g for 10 min at 4 °C.
7. Remove the supernatant and resuspend the parasite pellet in
500 μL BMM growth medium times the number of wells (e.g.,
5 mL BMM growth medium for a 12-well plate).
8. Remove the BMM growth medium from the wells, rinse the
cell monolayers twice with prewarmed PBS. Remove PBS
completely and add 500 μL of promastigote suspension to the
BMMs (see Note 5).
9. Incubate at 37 °C with 5% CO2 for 4 h.
10. Remove the medium supernatant with the free promastigotes
and gently wash the BMMs three times with prewarmed PBS
to remove extracellular parasites.
11. Add 2 mL BMM growth medium per well to the cells.
12. Incubate the cells for 48–72 h at 37 °C, 5% CO2, and high
humidity.
or:
13. If antileishmanial compounds should be tested, remove the
BMM growth medium from the wells 24 h post infection.
Supplement BMM growth medium with the desired concen-
tration of the compound and add. Incubate the cells for
another 48 h at 37 °C in 5% CO2 with high humidity.
14. Remove the medium from the infected BMMs, rinse the cell
monolayer twice with prewarmed PBS, and proceed with the
extraction of gDNA.
Alternatively, include adherent and detached cells, including
parasites from ruptured host cells, into the analysis [6]. This
prevents underestimation of parasite loads in nontreated
infections:
15. Collect adherent cells and suspended cells in the medium
supernatant by using cell scrapers. Spin down all cells (1200 × g,
4 °C, 20 min), wash twice in PBS, and proceed with the extrac-
tion of gDNA from the cell pellet.
3.2 Extraction 1. The extraction of gDNA may be performed with any commer-
of Genomic DNA cial gDNA preparation kit. Avoid PCR-interfering substances
such as phenol in the preparation. Ideally, utilize kits based on
magnetic beads or silica membranes, which are available from
different companies (e.g., the silica-based kit ISOLATE II
from Bioline) for the isolation of nucleic acids.
2. When using the ISOLATE II kit (Bioline, Germany), follow
the manufacturer’s instruction. It allows for the direct applica-
tion of cell lysis buffer to attached cells or to cell pellets, avoid-
ing the loss of material during the cell recovery process. Lysed
cells are transferred to columns containing silica membranes,
which selectively bind the nucleic acids (e.g., gDNA), separat-
ing them from contaminants during the washing steps. The
bound gDNA is then eluted into a microcentrifuge tube and
ready to use for the qPCR assay. Genomic DNA should be
stored at 4 °C if used frequently or at −20 °C for long-term
storage.
3.3 Design 1. Design primers of 18–20 nt length using either an online

of Oligonucleotides resource (e.g., https://www.genscript.com/tools/real-time-
pcr-tagman-primer-design-tool) or an on-site software solu-
tion (e.g., MacVector™) (Fig. 2).
2. Chose gene regions with comparable G/C content for ampli-
fication to assure an equal melting temperature of the primer
pairs and the resulting PCR products.
256 Eugenia Bifeld
Fig. 2 Example of a primer/probe design for the L. infantum actin gene, using the primer design module of the
MacVector™ software suite. (a) Parameter settings for PCR primers. (b) Parameter settings for the probe.
Note that Tm (°C) for the probe is set higher than for the primers. (c) Graphic display of the product lengths and
the positions on the gene of suggested primer/probe combinations
3. Consider that the melting temperature of the probe should be

about 10 °C higher compared with the primers to assure its
alignment to the DNA during primer annealing and
extension.
4. The primer extension should result in a PCR product of com-
parable length for both the gene of interest and the reference
gene (e.g., 80–130 bp).
5. Test primer and probe sequences by BLAST analysis for pos-

sible off-target annealing elsewhere in the genomes.
6. Choose fluorochromes with clearly separated emission spectra
for the different probes (e.g., FAM™ and Cy®5) [6].
7. Each fluorochrome needs a matching quencher counterpart
with a corresponding excitation wavelength (e.g., BHQ®-1 for
FAM™ or BHQ®-3 for Cy®5). This information is usually pro-
vided by the manufacturer of the dual-labeled probes.
3.4 Real-Time qPCR, Prepare all materials using deionized, nucleic acids-free water.
Test for Best Primer Keep the qPCR reagents and primers separate from any nucleic
Combination acids-containing material at all times. If possible, use a clean bench
for assay assembly; clean with a 0.5% SDS-solution prior to assem-
bling the qPCR assay. Use fresh disposable gloves and a dedicated,
clean lab coat. Avoid contaminations with nucleic acids by follow-
ing a strict pipetting direction from negative to positive material.
1. To test the ideal primer conditions prepare primer working
solutions in water with concentrations of 50 nM, 200 nM, 300
nM, and 900 nM (see Note 6) for the reverse (rev) and for-
ward (fwd) primers, respectively. Sixteen primer combinations
should be tested (Table 1).
2. Prepare qPCR assays to test the ideal combinations for parasite-
specific and host cell-specific primer pairs first.
3. Use purified host or Leishmania spp. gDNA of a high and a
low concentration (e.g., 500 ng/μL and 0.5 ng/μL) as tem-
plate for the qPCR assay.
4. Thaw all reagents and samples before preparing the qPCR assay.
Mix all reagents and samples by gentle vortexing and a subse-
quent spin down directly before adding to the master mix.
5. Prepare the master mix for three technical replicates of each
primer combination, and both template concentrations as well
as a water control according to Table 2 (see Note 7).
Table 1
Pipetting scheme for the 16 different combinations using the 4 designated
concentrations for the reverse (rev) and the forward (fwd) primer
respectively
Rev/Fwd 50 nM 200 nM 300 nM 900 nM

50 nM 1 5 9 13
200 nM 2 6 10 14
300 nM 3 7 11 15
900 nM 4 8 12 16
258 Eugenia Bifeld
Table 2
Reaction setup for a single qPCR assay
Number of reactions 1 [μL] 7 [μL]

Master Mixa 10 70
Primer fwd 1 7
Primer rev 1 7
Probe b
1 7
MgCl2c 1.2 8.4
Template 2d —e
Water 3.8 26.6
Final 20 126
a
Provided by the kit manufacturer (contains the Taq polymerase and the deoxynucleo-
side triphosphates, dNTPs)
b
Use a concentration of 200 nM for initial tests
c
Optional addition of 1.5 mM (see Note 8)
d
Template volume must not exceed 10% of the final reaction volume
e
Template is never added to the master mix but at last, directly into the well or reaction
vial prefilled with the master mix
6. Pipet 18 μL of the master mix into each required well or reac-
tion tube.
7. Pipet 2 μL of water into the well or reaction tube designated
for the no-template control. Close the reaction tube to avoid
contamination with the template.
8. Add 2 μL of template (see Note 9) into the required wells or
reaction tubes. Close the reaction tubes or seal the multiwell
plate.
9. Run the qPCR assay on an appropriate real-time qPCR instru-
ment (e.g., Rotor-Gene™ 3000 (Corbett Research) with
settings according to the manufacturer’s instructions) (see
Note 10).
10. Set the temperature profile for a one-step real-time qPCR
according to Table 3:
11. Evaluate the best primer concentrations by comparing the cor-
responding amplification kinetics.
12. Prepare probe working solutions (see Note 12) in water with
the concentrations 50 nM, 100 nM, and 200 nM.
13. Use the best primer pair combination to determine the ideal
probe concentration following the same procedure as for the
primers.
14. After the evaluation of the best primer/probe concentrations
for both the host- and the Leishmania spp.-specific reactions,
Table 3
Temperature profile for the qPCR assay
Step Temperature Time Cycle repeats

Denaturation 95 °C 10 min 1
10 s 35
Annealing/elongation 66 °C >>> 58 °Ca 40 s
HOLD 40 °C 30 s 1
a
The annealing/elongation temperature is decreased in 0.5 °C steps for 16 subsequent
cycles (see Note 11)
Table 4
Reaction setup for a duplex qPCR assay, with a Leishmania-specific
oligonucleotide set (L) and a mouse-specific oligonucleotide set (M)
Number of reactions 1 [μL] 7 [μL]

Master mix 10 70
Primer fwd -L 1 7
Primer rev -L 1 7
Probe -L 1 7
Primer fwd -M 1 7
Primer rev -M 1 7
Probe -M 1 7
MgCl2 1.2 8.4
Template 2 —
Water 0.8 5.6
Final 20 126
prepare a duplex qPCR assay to test both oligonucleotide sets

in a multiplex setup (see Note 13).
15. Prepare high and a low template concentrations by mixing
both the host and Leishmania spp. gDNAs equally.
16. Prepare a master mix for three replicates for each template con-
centration and a nontemplate control according to Table 4.
17. Use the temperature profile according to Table 3.
18. Both oligonucleotide sets should perform comparably in a
duplex qPCR assay and in the single qPCR assay.
19. If the duplex qPCR assay is not working as expected, try to
change the concentration of the primer set specific for the
poorly amplified target sequence first. Other parameters for
260 Eugenia Bifeld
PCR optimization are the probe concentration (see Note 14),

the concentration of MgCl2, the annealing/elongation tem-
perature and time (see Note 15).
3.5 Amplification 1. Use oligonucleotide setup evaluated by following the instruc-

Efficiency tions in Subheading 3.4.
2. Prepare a five- or tenfold dilution series of the host gDNA and
the Leishmania spp. gDNA. At least 5 to 6 data points are
required for a proper standard curve, thus 6 dilutions are
needed.
3. For the duplex qPCR assay, mix each dilution with equal
amounts of both gDNAs.
4. Prepare single qPCR assays for the host-specific and the
Leishmania spp.-specific templates and a duplex qPCR assay
for the mixed template according to Table 5.
5. Each dilution sample is tested in triplicate in the qPCR assay.
Two water controls for each master mix should be included
into the qPCR assay.
6. Calculation for 6 samples: 6 samples × 3 technical replicates =
18 reactions in the qPCR assay plus 2 reactions for the nega-
tive control requires a master mix for 20 samples.
7. Pipet 18 μL of the master mix into each well or reaction tube.
Table 5
Reaction setup for 6 samples in a single qPCR assay either with a
Leishmania-specific oligonucleotide set (L) or a host-(mouse-)specific
oligonucleotide set (M) and a duplex qPCR assay with oligonucleotide
sets specific for both organisms
Number of reactions 1 [μL] 20 [μL] 20 [μL] 20 [μL]

Master mix 10 200 200 200
Primer fwd -L 1 20 — 20
Primer rev -L 1 20 — 20
Probe -L 1 20 — 20
Primer fwd -M 1 — 20 20
Primer rev -M 1 — 20 20
Probe -M 1 — 20 20
MgCl2 1.2 24 24 24
Template 2 — — —
Water 0.8 76 76 16
Final 20 360 360 360
8. Pipet 2 μL of water into the well or reaction tube designated

for the control. Close the reaction tube to avoid contamina-
tion with template.
9. Add 2 μL of each template dilution to the wells or reaction
tubes. Close the reaction tubes or seal the multiwell plate.
10. Run the qPCR assay on an appropriate real-time qPCR instru-
ment (e.g., Rotor-Gene™ 3000 (Corbett Research) with settings
according to the manufacturer’s instructions).
11. Set the temperature profile for a one-step real-time qPCR
according to Table 3.
12. Evaluate the amplification efficiency as described in [6].
13. Use the calculated efficiency according to Eq. 1 to determine
the relative parasite load in unknown samples. Alternatively,
use the standard curve for relative quantification of parasite
gDNA to host gDNA in unknown samples.
The conditions for the real-time qPCR assay must be estab-
lished specifically for each Leishmania species or host organism
(e.g., mouse or human cell lines, primary cultures).
The method also works for quantification of parasites in host
tissue after infection of susceptible laboratory hosts [6].
4 Notes
1. Consider that the corner wells often do not provide an even

cell monolayer; do not transfer cells into these wells but fill
with PBS.
2. Before detaching the mature BMMs, calculate how many wells
and plates you will need for the experiment. For statistical
accuracy, at least three biological samples should be run for
each data point. A negative and a positive control should be
added as well, also in triplicate.
3. Leishmania spp. and strains differ in their in vitro growth.
Therefore, the initial concentration should be adjusted to the
growth behavior of the parasite species/strain.
4. Leishmania spp. enter metacyclogenesis in their insect host
before the transmission to the mammalian host. This infective
form is mimicked in vitro by parasites in the stationary growth
phase.
5. The medium volume over the BMM mono layer should be
small to facilitate an efficient infection through high parasite
density. Alternatively, the plate can be centrifuged at 400 × g
for 10 min to force the parasites to the host cells attached to
the well bottom.
262 Eugenia Bifeld
6. Volumes of working solution aliquots should not exceed the

needs for one experiment to avoid repeated freeze and thaw
cycles and contaminations.
7. The composition of the qPCR assay depends on the chemistry
and on the manufacturer. We used the SensiFAST Probe No-
ROX Kit (Bioline, Germany), among others.
8. MgCl2 facilitates the hybridization of oligonucleotides to the
template but can also decrease the sequence specificity. Master
Mixes provided commercially usually contain a sufficient con-
centration of MgCl2. It should be still considered a parameter
for PCR optimization.
9. If using purified gDNA as a template it is advisable to use
more than 1 μL for the qPCR assay because of the long mol-
ecules and the resulting viscosity.
10. Consider that some real-time qPCR instruments requires the
reference dye ROX™.
11. The touchdown style PCR avoids the amplification of nonspe-
cific sequences. The PCR starts with a high annealing tem-
perature, which assures a highly specific binding of the primers
to their target sequence. These initial fragments will be expo-
nentially amplified in the subsequent amplification cycles while
the efficiency of the reaction will increase toward the end by
the decrease of the annealing temperature, which will preserve
the polymerase.
12. Protect the probes from bleaching in the light by using tinted
1.5 mL microcentrifuge tubes to prepare the working
solutions.
13. An exemplary setup for a duplex qPCR is as follows: final con-
centration of each primer is 200 nM, final concentration of
each probe is 100 nM, final concentration of the additional
MgCl2 is 1.5 nM, temperature profile conforms to Table 3.
14. Of note, a high concentration of the probe in a sample with a
low template amount will not increase sensitivity but reduce
specificity because an excess of nonbound probe may result in
unspecific fluorescence signals.
15. Make sure to give the Taq polymerase sufficient time to elon-
gate the target sequence. The elongation speed [bps/s] of the
Taq polymerase is usually provided by the manufacturer.
Acknowledgments
Thanks to Heidrun Von Thien for the advice and help with the
establishment of the real-time qPCR assay.
References
1. Weksberg R, Hughes S, Moldovan L, Bassett for gene expression analysis. Biotechniques
A, Chow E, Squire J (2005) A method for 44(5):619–626. https://doi.org/10.2144/
accurate detection of genomic micro-deletions 000112776
using real-time quantitative PCR. BMC 9. Morrison TB, Weis JJ, Wittwer CT (1998)
Genomics 6:180 Quantification of low-copy transcripts by con-
2. Day E, Dear PH, McCaughan F (2013) Digital tinuous SYBR Green I monitoring during
PCR strategies in the development and analysis amplification. Biotechniques 24(6):954–958,
of molecular biomarkers for personalized medi- 960, 962
cine. Methods 59(1):101–107. https://doi. 10. Pfaffl MW (2001) A new mathematical model
org/10.1016/j.ymeth.2012.08.001 for relative quantification in real-time
3. Nassirpour R, Mathur S, Gosink MM, Li Y, RT-PCR. Nucleic Acids Res 29(9):e45
Shoieb AM, Wood J, O’Neil SP, Homer BL, 11. Prina E, Roux E, Mattei D, Milon G (2007)
Whiteley LO (2014) Identification of tubular Leishmania DNA is rapidly degraded following
injury microRNA biomarkers in urine: com- parasite death: an analysis by microscopy and
parison of next-generation sequencing and real-time PCR. Microbes Infect 9(11):
qPCR-based profiling platforms. BMC 1307–1315
Genomics 15:485. https://doi.org/10.1186/ 12. Lachaud L, Marchergui-Hammami S,
1471-2164-15-485 Chabbert E, Dereure J, Dedet JP, Bastien P
4. Kearns AM, Guiver M, James V, King J (2001) (2002) Comparison of six PCR methods using
Development and evaluation of a real-time peripheral blood for detection of canine visceral
quantitative PCR for the detection of human leishmaniasis. J Clin Microbiol 40(1):210–215
cytomegalovirus. J Virol Methods 95(1–2): 13. Mary C, Faraut F, Lascombe L, Dumon H
121–131 (2004) Quantification of Leishmania infantum
5. Nicolas L, Prina E, Lang T, Milon G (2002) DNA by a real-time PCR assay with high sensi-
Real-time PCR for detection and quantitation tivity. J Clin Microbiol 42(11):5249–5255
of leishmania in mouse tissues. J Clin Microbiol 14. Weirather JL, Jeronimo SM, Gautam S, Sundar
40(5):1666–1669 S, Kang M, Kurtz MA, Haque R, Schriefer A,
6. Bifeld E, Tejera Nevado P, Bartsch J, Eick J, Talhari S, Carvalho EM, Donelson JE, Wilson
Clos J (2016) A versatile qPCR assay to quan- ME (2011) Serial quantitative PCR assay for
tify trypanosomatidic infections of host cells detection, species discrimination, and quantifi-
and tissues. Med Microbiol Immunol cation of Leishmania spp. in human samples.
205(5):449–458. https://doi.org/10.1007/ J Clin Microbiol 49(11):3892–3904. https://
s00430-016-0460-3 doi.org/10.1128/JCM.r00764-11
7. Chen C, Ridzon DA, Broomer AJ, Zhou Z, 15. Jara M, Berg M, Caljon G, de Muylder G,
Lee DH, Nguyen JT, Barbisin M, Xu NL, Cuypers B, Castillo D, Maes I, Orozco MDC,
Mahuvakar VR, Andersen MR, Lao KQ, Livak Vanaerschot M, Dujardin JC, Arevalo J (2017)
KJ, Guegler KJ (2005) Real-time quantifica- Macromolecular biosynthetic parameters and
tion of microRNAs by stem-loop metabolic profile in different life stages of
RT-PCR. Nucleic Acids Res 33(20):e179. Leishmania braziliensis: amastigotes as a func-
https://doi.org/10.1093/nar/gni178 tionally less active stage. PLoS One 12(7):
8. VanGuilder HD, Vrana KE, Freeman WM e0180532. https://doi.org/10.1371/journal.
(2008) Twenty-five years of quantitative PCR pone.0180532
Chapter 14
In Vitro Infections of Macrophage-Like Cell Lines

with Leishmania infantum for Drug Screening
Nuno Santarém, Joana Tavares, and Anabela Cordeiro-da-Silva
Abstract
The study of in vitro infections is essential to evaluate distinct aspects of Leishmania biology and also
invaluable for more meaningful in vitro screening of promising chemical entities. Macrophage-like cells
lines from different origins are amenable to Leishmania infection. Cell lines due to their stability and stan-
dardization potential are highly valued for their capacity to support reproducible infections and consistent
data. In fact, these cells have been a mainstay of leishmaniasis research for more than 40 years. In this
context, the human monocytic THP-1 cell line is commonly used as it can be differentiated with phorbol-
12myristate-13-acetate (PMA) into macrophages that are susceptible to Leishmania infection. In this sec-
tion, we will describe generalities concerning the use of cell lines for in vitro Leishmania infection using
THP-1 derived macrophages and Leishmania infantum axenic amastigotes expressing luciferase associated
to preclinical drug screening as example.
Key words Leishmania, Macrophage-like cell lines, Drug screening, Axenic amastigotes
1 Introduction
Leishmaniasis is a disease that was discovered more than 100 years

ago. Still no vaccines for human use are available, and pentavalent
antimony, in use since the 1930s to treat this disease, is still a first
line treatment [1]. Therefore, there is the need to unravel the
secrets of the parasite biology and etiology of disease enabling
novel avenues to fight leishmaniasis. Considering the complex life
cycle of the parasite, the simplest and most generally accessible
tools to study it involve the use of promastigotes/axenic amasti-
gotes and in vitro infection models using specific host cells.
Although there is a drive to implement ever more complex models,
like 3D culture systems [2], the studies involving simple in vitro
infections are still essential to evaluate in a controlled manner dis-
tinct aspects of Leishmania biology and basic cellular responses.
Moreover, these in vitro infections are invaluable for more
meaningful preclinical evaluation of promising chemical entities
265
266 Nuno Santarém et al.
a ssociated with drug development [3]. In fact, these approaches

enable the detection of compounds active against the parasite’s
intracellular stage, reducing the high rate of false positive hits asso-
ciated with screening promastigotes and axenic amastigotes [4, 5].
Macrophages from different origin are amenable to successful
Leishmania infection in vitro. These cells can be primary from
murine origin, like peritoneal [6] or bone marrow-derived macro-
phages [7], or from human origin like peripheral blood monocyte-
derived macrophages [8]. An alternative to primary cells is the use
of immortalized monocyte or macrophage-like cell lines as the
human THP-1 [9, 10] and U937 [8, 11] or the murine J774.1
[12–14] and RAW264.7 [15–17] and also the canine DH82 cells
[8, 18, 19]. These immortalized cell lines are a well-defined con-
trolled source of biological material that are more amenable to
standardization increasing inter-laboratory reproducibility when
compared to primary cells. In fact, they have been used in leish-
maniasis research for more than 40 years [14]. In this context,
differentiated, nondividing human THP-1-derived macrophages
are highly interesting host cells for parasite infections. This cell line
was established from human monocytes recovered from a 1-year-
old male with acute monocytic leukemia exhibiting lymphoblast
morphology [9]. THP-1 upon phorbol 12-myristate 13-acetate
(PMA) stimulation acquire phenotypic and functional characteris-
tics resembling those of primary human macrophages [20]. In fact,
THP-1 are the most widely used cell line for in vitro studies inves-
tigating primary human macrophage function [20]. These cells,
upon PMA differentiation are susceptible hosts for infection with
several species of Leishmania [10]. Moreover, THP-1 are also con-
sidered reference cells for toxicity determinations becoming par-
ticularly interesting for direct selectivity index determination in
preclinical drug screening [21]. In this section we will describe the
use of THP-1 cells as hosts for Leishmania infection using lucifer-
ase expressing parasites as a reporter for infection in the context of
preclinical drug screening.
2 Materials
2.1 General 1. Sterile phosphate-buffered saline (PBS): Dissolve in 800 mL

Reagents of deionized H2O: 8 g NaCl, 0.2 g KCl, 1.44 g Na2HPO4,
0.24 g KH2PO4. Adjust the pH to 7.4. Add H2O to
1 L. Autoclave to sterilize. Store at room temperature (RT).
2. Phorbol 12-myristate 13-acetate (Sigma) at 1 mg/mL store at
−20 °C.
3. Penicillin/Streptomycin (Invitrogen) stored at −20 °C.
4. 2-mercaptoethanol (Sigma) stored at RT.
Leishmania in vitro Drug Screening 267
5. G418 (Sigma) at 100 mg/mL stored at −20 °C.

6. FBS (Heat inactivated) stored at −20 °C.
7. Steady-Glo® Luciferase System Assay Kit (Promega).
8. DMSO (Sigma) stored at RT.
9. l-Glutamine (Invitrogen) stored at −20 °C.
10. HEPES 1 M (Sigma) stored at 4 °C.
11. Glutaraldehyde (Sigma) solution at 0.25% in PBS, stored at RT.
12. RPMI without l-glutamine (Invitrogen), stored at 4 °C.
13. Trypan blue (Sigma) diluted at 0.4% in PBS, stored at RT.
2.2 Parasites Parasites

and Cell Lines 1. Luciferase-expressing Leishmania infantum (MHOM/
MA/67/ITMAP-263) axenic amastigotes (see Note 1).
Cells
2. Human leukemia cell line, THP-1 (ATCC® TIB202™).
2.3 Culture Media 1. Culture media for THP-1: RPMI-1640 medium supple-
mented with 10% FBS, 0.05 mM 2-mercaptoethanol, and 1%
penicillin/streptomycin.
2. Culture media for axenic amastigotes: M199 supplemented
with Hank’s balanced salts, 0.5% soya trypto-casein, 5 mM
glutamine, 4 mM NaHCO3, 23 μM hemin, 25 mM Hepes
(final pH, 6.5), and 20% FBS.
2.4 Equipment 1. Light microscope capable of at least 400× magnification.

2. Humidified tissue culture incubator set at a temperature of
37 °C and atmospheric conditions of 5% CO2.
3. Synergy 2 Plate Reader (BioTek).
4. Neubauer cell counter chamber.
5. Graphpad Prism software.
2.5 Consumables 1. Flat bottom 96-well cell culture plates.

2. White bottom 96-well plate.
3 Methods
3.1 Cell and Parasite For more details on THP-1 cell culture, such as storage, thawing,
Culture and maintenance of cells, see the ATCC recommendations [22].
Although THP-1 is a biosafety level 1 cell type all the manipulations
3.1.1 Culture
are performed on a class II biosecurity cabinet due to the need for
and Maintenance
parasite infections. All media used are prewarmed to 37 °C.
of THP-1 Cells
1. Defrost frozen stock THP-1 cells (frozen as 5 × 106 THP-1

cells in complete THP-1 culture media supplemented with 5%
(V/V) DMSO) in 10 mL of THP-1 culture media using a
15 mL conical tube.
2. Centrifuge at 125 × g for 10 min at RT and remove the
supernatant.
3. Suspend the cells by adding 10 mL of THP-1 culture media
and seed into a 75-cm2 tissue culture flask adjusting the final
volume to 20 mL.
4. Incubate the flask for 48 h in a humidified tissue culture incu-
bator set at a temperature of 37 °C and 5% CO2.
5. With a disposable Pasteur pipette remove two samples from
the flask into empty 1.5 mL reaction vials. Dilute each of the
samples 1:2 in trypan blue 0.4% and count the cells in a
Neubauer chamber (viability should be more than 90%) using
an optical microscope.
6. After establishing the average cell number, initiate a new
culture (20 mL) using as starting inoculum 1 × 105 cells/mL
(see Note 2).
7. Incubate the flask for 3 days in humidified tissue culture incuba-
tor set at a temperature of 37 °C and 5% CO2 and subculture it
every 3 days repeating steps 5 and 6 (see Notes 3 and 4).
3.1.2 Culture All the manipulations are performed on a class II biosecurity cabi-
and Maintenance net. All media used should be prewarmed to 37 °C. The time that
of Leishmania infantum the axenic amastigotes remain outside the incubator should be
Axenic Amastigotes minimized.
Expressing Luciferase
1. Defrost (see Note 5) a stock vial of luciferase-expressing
Leishmania infantum axenic amastigotes (frozen as 1 × 107
axenic amastigotes are in complete axenic amastigotes culture
media supplemented with 10% (V/V) DMSO) in 10 mL of
prewarmed (37 °C) axenic amastigote culture media using a
15 mL conical tube (see Note 6).
2. Centrifuge at 1800 × g for 10 min at RT and remove the
supernatant.
3. Suspend the parasites in 5 mL of amastigote culture media
supplemented with 60 μg/mL of G418 and seed it into a
25 cm2 tissue culture flask.
4. Incubate the flask on its side for 3 days in a humidified tissue
culture incubator at 37 °C and atmospheric conditions of 5%
CO 2.
5. Observe the parasites in the inverted microscope to confirm
that they are indeed round/oval shaped and dwelling near the
bottom. With a disposable Pasteur pipette remove two samples
from the flask into empty 1.5 mL reaction vials. Dilute the
sample 1:20 in 0.4% glutaraldehyde and count the cells in a

Neubauer chamber using an optical microscope (see Note 7).
6. After establishing the average cell number, seed a new culture
using as starting inoculum 1 × 106 cells/mL in 5 mL of amas-
tigote culture media supplemented with 60 μg/mL G418.
7. Incubate the flask for 5 days in a humidified tissue culture
incubator at 37 °C and 5% CO2 and subculture it each 5 days
repeating steps 5 and 6 (see Notes 8 and 9).
3.2 In Vitro Before starting, place the THP-1 media and also the PBS in a
Screening of Drugs 37 °C water bath for at least 30 min.
Against Intracellular
1. With a disposable Pasteur pipette remove two samples from
Leishmania infantum
the flask into empty 1.5 mL reaction vials. Dilute each of the
3.2.1 Differentiation samples 1:2 in trypan blue 0.4% and count the cells in a
of THP-1 into Macrophages Neubauer chamber (viability should be more than 90%) using
an optical microscope.
2. After establishing the average cell number, transfer 1 × 107
cells (for each 96-well plate planned for the assay) to a 50 mL
conical tube and centrifuge cells in a table top centrifuge at
125 × g for 10 min RT.
3. Discard supernatant and suspend the cells in 5 mL of THP-1
medium for each plate planed. Count the THP-1 cells in try-
pan blue (dilution 1:1 cells–trypan blue) using a Neubauer
chamber as described in step 1. Cell number should be
between 1.5 and 2 × 106/mL.
4. After establishing the cell number, add THP-1 media to dilute
the cells to 1 × 106/mL.
5. Supplement the cell suspension with PMA at a final concentra-
tion of 20 ng/mL (see Note 10).
6. Using a multichannel pipette, fill the border wells of the
96-well plate with 200 μL of PBS, and then transfer 100 μL of
the cell suspension (1 × 105 cells/well) to each well of the
96-well plate (see Note 11).
7. Incubate the plate for 18 h in a humidified tissue culture incu-
bator set at a temperature of 37 °C and atmospheric condi-
tions of 5% CO 2.
8. Place the THP-1 media in a 37 °C water bath for at least
30 min.
9. Observe the cells in inverted light microscope to confirm that
they are adherent (with a 70–80% confluence). Using a multi-
channel pipette to remove the media from each well contain-
ing cells, wash once with 100 μL of complete media, and then
add 100 μL of fresh culture media.
10. Incubate the plate overnight in a humidified tissue culture
incubator at 37 °C and atmospheric conditions of 5% CO2.
3.3 Infection Before starting: place the THP-1 media in a 37 °C water bath for
of THP-1 Cells at least 30 min. Confirm that parasites and cell morphology is in
and Treatment accordance to what is described for the parasites and cells.
with Drugs to Test 1. With a disposable Pasteur pipette remove two samples from a
3.3.1 Infection 5-day old axenic amastigotes culture into empty 1.5 mL reac-
and Treatment tion vials. Dilute the samples 1:40 in 0.4% glutaraldehyde and
count the cells in a Neubauer chamber.
2. Transfer 1 × 108 amastigotes for each plate planned into a
15 mL conical tube. Centrifuge parasites at 1800 × g for
10 min at RT.
3. Wash the parasites, discard the supernatant and suspend the
parasites in 10 mL of THP-1 media for each plate planed.
Centrifuge parasites at 1800 × g for 10 min at room
temperature.
4. Discard supernatant and suspend the parasites in 5 mL of
THP-1 media for each plate planed. Take 10 μL of parasite
suspension and dilute it 1:20 in glutaraldehyde 0.25% and
count the parasites in a Neubauer chamber using a bench top
optical microscope, at this stage parasite concentration should
be between 1.5 and 2 × 107/mL.
5. After establishing the parasite concentration, add THP-1
media sufficient to dilute the parasites to 1 × 107/mL.
6. Using a multichannel pipette remove all media from wells
containing cells and immediately add either 100 μL of THP-1
media in wells labeled NI or parasite suspension to all other
wells (Table 1). This leads to a 1:10 ratio of infection (cells–
parasites) (see Note 12).
bator at 37 °C and 5% CO2.
8. At this stage the compounds to add to the plate should be
prepared, for the proposed assay from the stock solutions
using warm media (see Note 13).
9. After 4 h, remove the media containing noninternalized para-
sites using a multichannel pipette and wash carefully with
100 μL of complete THP-1 media (pipette up and down for at
least six times) (see Note 14).
10. Remove the media and repeat the wash with another 100 μL
of complete THP-1.
11. Repeat step 10 twice more.
12. After three washes add 50 μL of THP-1 media and confirm
that no free parasites are detectable using an inverted
microscope.
13. At this stage the plate is ready to receive 50 μL of the com-
pounds to be tested (T1 through T6), the reference drug, the
Table 1
Generic schematic example of a 96-well plate layout for a drug screening assay
1 2 3 4 5 6 7 8 9 10 11 12
EC EC
Ref Ref Ref
B NT T1 T1 T1 T1
C1 C1 C1
100 100
Ref Ref Ref

C NI NT T2 T2 T2 T2 NT
C2 C2 C2
Ref Ref Ref

D NI NT T3 T3 T3 T3 NT
C3 C3 C3
Ref Ref Ref

E NI NT T4 T4 T4 T4 NT
C4 C4 C4
Ref Ref Ref

F NI NT T5 T5 T5 T5 NT
C5 C5 C5
EC EC
Ref Ref Ref
G NT T6 T6 T6 T6
100 C6 C6 C6 100
Gray PBS filled wells, EC100 positive controls, treated with >EC100 of reference drugs, NI noninfected, NT
negative controls, nontreated, T1–6 treatments, Ref reference drugs for control dose response curve
positive controls (EC100) according to the schematic depicted

in Table 1.
bator set at a temperature of 37 °C and atmospheric condi-
tions of 5% CO2.
3.3.2 Determine 1. Before starting, place lysis buffer, luciferin substrate and PBS
Compound Activity in a 37 °C water bath for at least 30 min before use.
Through Luciferase Assay 2. Using a multichannel pipette, remove media from wells con-
taining cells and add 100 μL of PBS to each well. Then add
25 μL of Glo Lysis buffer, mixing with the pipette (aspirate
fluid up and down three times) to ensure homogeneity.
3. Incubate the plates for 10 min in an agitator at 100 rpm.
4. Using a multichannel pipette, add 30 μL of luciferase substrate
to each well ensuring homogeneity (aspirate fluid up and
down three times). Cover plate in tin foil to protect from light.
5. Incubate the plates for 15 min in an agitator at 100 rpm.
6. Using a multichannel pipette transfer 140 μL from each well
to a white bottom 96-well plate.
7. Read luminescence in a Synergy 2 BioTek reader with 250
sensitivity (see Note 15).
3.3.3 Activity 1. Raw viability data consists of values of relative luminescence

Determination unit (R.L.U.) obtained from the oxidation of luciferin by
luciferase (see Note 16).
2. Mean of positive control values (reference drug EC100
treated) are determined (Mean Pos).
3. Mean of negative control values (NT) are determined (Mean
Neg).
4. % Antiparasitic activity calculated according to the following
formula:
% Antiparasitic activity = ( mean neg − test value ) / ( mean neg − mean pos )  ×100
5. % Antiparasitic activity is estimated at the compound concen-

tration used in the assay.
6. For dose response determination nonlinear regression is per-
formed using the Graphpad prism software (see Note 17).
4 Notes
1. The choice of parasite species and strain influences the out-

come of infection. Therefore, it must be taken in consider-
ation that there is no simplified formula for success, there is no
one approach to fit all questions. Extreme care must be taken

when selecting the in vitro infection model that is adequate for
the scientific question at hand. Even in preclinical drug devel-
opment the choice of host cell can modulate significantly the
activity of various drugs [23]. In the adjoining example,
THP-1 cells infected with axenic amastigotes are intended to
be used for drug screening. Although these axenic amastigotes
are not considered bona fide amastigotes they are susceptible
to the known antileishmanial drugs and are highly infective
enabling more sustainable and reproducible infections that the
promastigotes [24]. These axenic amastigotes are also highly
infective in in vivo infection models, originating productive
infections (we are able to recover parasites) in a BALB/c
mouse infection model. The use of genetically altered parasites
is also a conscientious option as luciferase is an excellent
reporting system, the episomal expression enables high levels
of expression enabling more sensitive assays with more than
70-fold difference between negative and positive controls.
2. Although cell lines are known for being more stable and stan-
dardizable than primary cells it is important to take in consid-
eration the importance of subculture as simple things as cell
density can influence the response of a cell line [25]. Therefore,
when working with cell lines it is important to keep not only a
precise schedule of subculture but also define specific days for
cell use in assays.
3. All experiments with THP-1 in our laboratory are performed
using cells with less than 20 passages. The number of passages
reflects the number of times that the cells were subcultured
being transferred to a new flask. There are compelling evi-
dences that the apparent functional immortality of cell lines
through unrestricted subpassage affects their characteristics
altering their genetic background, morphology, and capacity
to respond to environmental stimuli [26, 27]. There is no
golden number for the passage number range of a specific cell
line in which an experiment can be performed with consistent
and reproducible results. Therefore, we recommend that you
invest in knowing your cells performing growth curves to
access routine and easily accessible aspects like growth and
associated doubling times. Moreover, normal cellular mor-
phology, expression of characteristic cell markers should be
registered being always on the look-out for changes in growth
patterns or surface marker expression. For THP-1 cells 20 to
30 passages seem to be the most common thresholds in the
available literature, as stated above we use this cell line only for
20 passages.
4. The THP-1 cells used in our laboratory have a duplication
time of around 24–26 h, so with 3 days of culture we expect
to have between 8 × 105 and 1 × 106/mL. The ATCC does

not recommend that the cells grow beyond 1 × 106/mL. It is
possible to have growth variation due to the batch of serum
used, so adapt the inoculum and time of culture to your cul-
ture conditions to uphold the ATCC recommendations.
5. Defrosting should be done rapidly either using a 37 °C bath or
by warming the vial in a gloved hand. If using a bath be sure
to rinse thoroughly the vial with 70% ethanol prior to open-
ing, it is very easy to contaminate axenic amastigotes as the
culture media used does not have antibiotic.
6. Parasites are recovered from a 1-week-old cellular suspension
(0.25 mg/mL) of spleen from infected BALB/c. Then a sin-
gle high density subpassage (5 × 106/mL) is performed. After
4 days these promastigotes are transformed in axenic amasti-
gotes using the conditions described by Sereno et al. [24].
The resulting amastigotes are then frozen as 1 × 107/mL
axenic amastigotes in complete axenic amastigotes culture
media supplemented with 10% (V/V) DMSO and stored at
−80 °C being used as a source of virulent parasites for the
experiments.
7. When observing in the inverted microscope the axenic amasti-
gotes from a 5-day culture it is normal that the parasites
become attached to the bottom of the tissue culture flask and
also forming clumps (parasite aggregates) so whenever these
parasites are counted the flask should be vigorously tapped
against the hand. Normally this is sufficient to detach the para-
sites (you immediately notice that the culture becomes signifi-
cantly more turbid).
8. For the used parental Leishmania strain, Leishmania infantum
(MHOM/MA/67/ITMAP-263) it is well established the
timing of promastigotes loss of overtime virulence [28].
Therefore, promastigote cultures should only be used for less
than 10 passages after recovery from infected animals.
Although no evidenced of loss of virulence exist for the axenic
amastigotes, the same 10 passage criteria was maintained. As a
general rule, for other species/strains of Leishmania the para-
sites should be used as early as possible after recovery from
infected animals as this phenomena of loss of virulence associ-
ated to promastigote sub cultivation is well established [29].
9. In the conditions the axenic amastigotes grow to densities of
7–8 × 107/mL. We had growth variability (less 20%) depen-
dent on the FBS batch that was used in the laboratory.
10. In the literature a broad range of PMA concentrations is
described for THP-1 differentiation (2–500 ng/mL).
Nonetheless it must be taken in consideration that time of
exposure and concentration of PMA has functional and
henotypic implications in THP-1 cells, although the cells are

p
indistinguishable by light microscopy [20].
11. We add PBS to the border wells because these are prone to
evaporation during the assay. This precludes their use for the
assay as the solute concentration would vary rendering them
incomparable to the center wells.
12. The infection ratio must be established case by case and
depending of the objective. For drug screening we do not
want to overwhelm the macrophages killing them and having
as consequence free parasites in the end of the assay. The
infected cells should remain infected but functional.
13. Prepare stock solutions of the drugs/test compounds in
DMSO at a general concentration of 10 mM. We do not use
in our screening system DMSO concentrations higher than
0.5%, ideally we use it at 0.1%. If 0.1% DMSO is used we do
not add DMSO controls for all other concentrations we add
DMSO controls using the target DMSO concentration. Each
compound is tested in quadruplicate. The reference drug dose
response curve is done using a twofold serial dilution. We use
miltefosine as a reference drug, using as EC100 40 μM and
performing dose response curves starting at 20 μM. All the
solutions are prepared at a twofold concentration and then
100 μL is pipetted in a 96-well plate that is the exact replica of
the infected plate. Any serial dilution is also done in this plate,
compounds will be then transferred (50 μL) to the corre-
sponding wells of the assay plate.
14. Although the cells are healthy and attached to the bottom we
recommend that the washing is done inclining the plate and
then discarding the liquid against the upper wall avoiding
pipetting directly against the cells.
15. Save both the .xpt file from Gene 5 and also an excel file for
subsequent analysis. This is important a the xpt file is the raw
data (not editable) while the excel file (editable) should only
be used for data analysis.
16. It is important to keep a consistent registry of the expected
values for the assays. The positive controls should be less than
1000 R.L.U. not significantly different from noninfected cells.
The 90% confidence interval for the positive controls is
between 70,000 and 82,000 R.L.U. Any deviation from these
values means that the assay was not “normal” by our labora-
tory standards. This type of analysis can only be done if a
deliberate registry of the controls exists. This is invaluable for
any biological assay.
17. The dose response curve for miltefosine is always performed.
This functions as a quality control of the assay. The average
EC50 of miltefosine in our system is 2.02 μM with a 90%
c onfidence interval of 1.66–2.37 μM. If the calculated EC50

is outside this interval the results should be repeated. Once
again this type of analysis can only be done if a deliberate
registry of the controls exists.
Acknowledgments
This work was supported by funds from the Fundação para a

Ciência e Tecnologia (FCT)/Ministério da Educação e Ciência
(MEC) cofunded by the European Regional Development Fund
(FEDER) under the Partnership agreement PT2020, through the
Research Unit No.4293. This work also received funds from
project POCI-01-0145-FEDER-031013 financed by Portugal
2020, under the Programa Operacional Competitividade e Inter
nacionalização (COMPETE 2020) and Norte-01-0145-
FEDER-000012—Structured program on bioengineered therapies
for infectious diseases and tissue regeneration, supported by Norte
Portugal Regional Operational Programme (NORTE 2020),
under the PORTUGAL 2020 Partnership Agreement, through
the FEDER. J.T. is an Investigator FCT funded by National funds
through FCT and cofunded through European Social Fund within
the Human Potential Operating Programme.
References
1. WHO (2017) Leishmaniasis. http://www. axenic assay with high predictivity of leishmani-
who.int/leishmaniasis/en/. Accessed 30 Nov cidal intracellular activity. PLoS Negl Trop Dis
2017. 9(9):e0004094. https://doi.org/10.1371/
2. Edmondson R, Broglie JJ, Adcock AF, Yang L journal.pntd.0004094
(2014) Three-dimensional cell culture systems 6. Shafi S, Afrin F, Islamuddin M, Chouhan G,
and their applications in drug discovery and Ali I, Naaz F, Sharma K, Zaman MS
cell-based biosensors. Assay Drug Dev Technol (2016) Beta-nitrostyrenes as potential
12(4):207–218. https://doi.org/10.1089/ anti-leishmanial agents. Front Microbiol

adt.2014.573 7:1379. https://doi.org/10.3389/fmicb.
3. Zulfiqar B, Shelper TB, Avery VM (2017) 2016.01379
Leishmaniasis drug discovery: recent progress 7. Santarem N, Cunha J, Silvestre R, Silva C,
and challenges in assay development. Drug Moreira D, Ouellette M, Cordeiro-da-Silva A
Discov Today 22(10):1516–1531. https:// (2014) The impact of distinct culture media in
doi.org/10.1016/j.drudis.2017.06.004 Leishmania infantum biology and infectivity.
4. De Muylder G, Ang KK, Chen S, Arkin MR, Parasitology 141(2):192–205. https://doi.
Engel JC, McKerrow JH (2011) A screen org/10.1017/S0031182013001388
against Leishmania intracellular amastigotes: 8. Maia C, Rolao N, Nunes M, Goncalves L,
comparison to a promastigote screen and iden- Campino L (2007) Infectivity of five different
tification of a host cell-specific hit. PLoS Negl types of macrophages by Leishmania infantum.
Trop Dis 5(7):e1253. https://doi. Acta Trop 103(2):150–155. https://doi.
org/10.1371/journal.pntd.0001253 org/10.1016/j.actatropica.2007.06.001
5. Nuhs A, De Rycker M, Manthri S, Comer E, 9. Tsuchiya S, Yamabe M, Yamaguchi Y,
Scherer CA, Schreiber SL, Ioset JR, Gray DW Kobayashi Y, Konno T, Tada K (1980)
(2015) Development and validation of a novel Establishment and characterization of a human
Leishmania donovani screening cascade for acute monocytic leukemia cell line (THP-1).
high-throughput screening using a novel Int J Cancer 26(2):171–176
10. Ogunkolade BW, Colomb-Valet I, Monjour L,

p ro-
inflammatory stimulus. J Immunol
Rhodes-Feuillette A, Abita JP, Frommel D Methods 430:64–70. https://doi.org/
(1990) Interactions between the human 10.1016/j.jim.2016.01.012
monocytic leukaemia THP-1 cell line and Old 21. Borsari C, Santarem N, Torrado J, Olias AI,
and New World species of Leishmania. Acta Corral MJ, Baptista C, Gul S, Wolf M, Kuzikov
Trop 47(3):171–176 M, Ellinger B, Witt G, Gribbon P, Reinshagen
11. Sundstrom C, Nilsson K (1976) Establishment J, Linciano P, Tait A, Costantino L, Freitas-
and characterization of a human histiocytic Junior LH, Moraes CB, Bruno Dos Santos P,
lymphoma cell line (U-937). Int J Cancer Alcantara LM, Franco CH, Bertolacini CD,
17(5):565–577 Fontana V, Tejera Nevado P, Clos J, Alunda
12. Gupta S, Yardley V, Vishwakarma P, Shivahare JM, Cordeiro-da-Silva A, Ferrari S, Costi MP
R, Sharma B, Launay D, Martin D, Puri SK (2017) Methoxylated 2′-hydroxychalcones as
(2015) Nitroimidazo-oxazole compound antiparasitic hit compounds. Eur J Med Chem
DNDI-VL-2098: an orally effective preclinical 126:1129–1135. https://doi.org/10.1016/j.
drug candidate for the treatment of visceral ejmech.2016.12.017
leishmaniasis. J Antimicrob Chemother 22. ATCC THP1(ATCC TIB-202). https://www.
70(2):518–527. https://doi.org/10.1093/ lgcstandards-atcc.org/products/all/TIB-202.
jac/dku422 aspx. Accessed 4 Jan 2018.
13. Ralph P, Moore MA, Nilsson K (1976) 23. Seifert K, Escobar P, Croft SL (2010) In vitro
Lysozyme synthesis by established human and activity of anti-leishmanial drugs against
murine histiocytic lymphoma cell lines. J Exp Leishmania donovani is host cell dependent.
Med 143(6):1528–1533 J Antimicrob Chemother 65(3):508–511.
14. Pratt DM, David JR (1982) Monoclonal anti- https://doi.org/10.1093/jac/dkp500
bodies recognizing determinants specific for 24. Sereno D, Lemesre JL (1997) Axenically cul-
the promastigote state of Leishmania mexi- tured amastigote forms as an in vitro model for
cana. Mol Biochem Parasitol 6(5):317–327 investigation of antileishmanial agents. Anti
15. Kolodziej H, Kiderlen AF (2005) Antilei microb Agents Chemother 41(5):972–976
shmanial activity and immune modulatory 25. Aldo PB, Craveiro V, Guller S, Mor G (2013)
effects of tannins and related compounds on Effect of culture conditions on the phenotype
Leishmania parasitised RAW 264.7 cells. of THP-1 monocyte cell line. Am J Reprod
Phytochemistry 66(17):2056–2071. https:// Immunol 70(1):80–86. https://doi.org/
doi.org/10.1016/j.phytochem.2005.01.011 10.1111/aji.12129
16. Raschke WC, Baird S, Ralph P, Nakoinz I 26. Wenger SL, Senft JR, Sargent LM, Bamezai R,
(1978) Functional macrophage cell lines trans- Bairwa N, Grant SG (2004) Comparison of
formed by Abelson leukemia virus. Cell established cell lines at different passages by
15(1):261–267 karyotype and comparative genomic hybridiza-
17. Nandan D, Lo R, Reiner NE (1999) Activation tion. Biosci Rep 24(6):631–639. https://doi.
of phosphotyrosine phosphatase activity atten- org/10.1007/s10540-005-2797-5
uates mitogen-activated protein kinase signal- 27. Briske-Anderson MJ, Finley JW, Newman SM
ing and inhibits c-FOS and nitric oxide synthase (1997) The influence of culture time and pas-
expression in macrophages infected with sage number on the morphological and physi-
Leishmania donovani. Infect Immun 67(8): ological development of Caco-2 cells. Proc Soc
4055–4063 Exp Biol Med 214(3):248–257
18. Wellman ML, Krakowka S, Jacobs RM, Kociba 28. Moreira D, Santarem N, Loureiro I, Tavares J,
GJ (1988) A macrophage-monocyte cell line Silva AM, Amorim AM, Ouaissi A, Cordeiro-
from a dog with malignant histiocytosis. In da-Silva A, Silvestre R (2012) Impact of con-
Vitro Cell Dev Biol 24(3):223–229 tinuous axenic cultivation in Leishmania
19. Looker DL, Martinez S, Horton JM, Marr JJ infantum virulence. PLoS Negl Trop Dis
(1986) Growth of Leishmania donovani amas- 6(1):e1469. https://doi.org/10.1371/jour-
tigotes in the continuous human macrophage nal.pntd.0001469
cell line U937: studies of drug efficacy and 29. Ali KS, Rees RC, Terrell-Nield C, Ali SA
metabolism. J Infect Dis 154(2):323–327 (2013) Virulence loss and amastigote transfor-
20. Lund ME, To J, O'Brien BA, Donnelly S mation failure determine host cell responses to
(2016) The choice of phorbol 12-myristate Leishmania mexicana. Parasite Immunol
13-acetate differentiation protocol influences 35(12):441–456. https://doi.org/10.1111/
the response of THP-1 macrophages to a pim.12056
Chapter 15
Quantification of Parasite Loads by Automated

Microscopic Image Analysis
Carolina Borsoi Moraes and Laura Maria Alcântara
Abstract
High content analysis enables automated, robust, and unbiased evaluation of in vitro Leishmania
infection. Here, we describe a protocol based on the infection of THP-1 macrophages with Leishmania
promastigotes and the quantification of parasite load by high content analysis. The technique is capable
of detecting and quantifying intracellular amastigotes, providing a multiparametric readout of the total
number of cells, ratio of infected cells, total number of parasites, and number of parasites per infected
cells. The technique can be used to quantitate infection of any Leishmania species in virtually all types of
permissive host cells and can be applied to quantification of drug activity and studies of the Leishmania
intracellular life cycle stage.
Key words High content screening, High content analysis, Phenotypic assays, Intracellular amasti-
gotes, Automated image analysis, Leishmania intracellular parasites, In vitro infection, Leishmania-
infected THP-1 macrophages
1 Introduction
Quantification of parasite loads using in vitro models of Leishmania

infection of macrophages (primary cells or cell lines) is performed
as a routine assay to study several aspects of the infection, such as
parasite–host cell interaction, characterization of invasion and
infection, biochemical pathways, and immunological response
[1–3]. Additionally, those assays play a crucial role in the early
stages of drug discovery, for evaluation of compound activity
against the parasite, as a diagnostic tool and for evaluation of treat-
ment outcome [4].
With the advent of high content screening, automated analysis
has become the method of choice to quantitate Leishmania in vitro
infection, replacing more laborious traditional methods of manual
evaluation of infection on Giemsa-stained glass slides. In fact, auto-
mated analysis of high content screening assays has greatly enhanced
early drug discovery activities for leishmaniasis and has become the
279
280 Carolina Borsoi Moraes and Laura Maria Alcântara
gold standard for the screening of compound libraries in search of

antileishmanials [5, 6].
Two parameters may be used to directly quantify parasite load
in vitro: (a) the ratio of infected cells or infection ratio, determined
as the number of infected cells in relation to the number of total
cells, and (b) the infection index, calculated as the total number of
parasites in relation to the total number of cells counted [7]. In
both approaches, parasite load has been measured by microscopic
examination, usually using light microscopy [8, 9]. However, man-
ual counting techniques are time-consuming, are nonadaptable for
large-scale screening, and can be less precise, as errors may occur
due to inaccurate counts or bias [10, 11]. As an alternative, the
automated image-based high content approach can overcome
most of the manual counting limitations by autonomous detecting
and quantifying intracellular amastigotes in a robust, unbiased, and
sensitive fashion [5, 12–14].
Here, we describe an adaptable high content assay protocol to
assess Leishmania intracellular amastigotes in THP-1 cell line, in
order to determine both infection ratio and the number of para-
sites/infected cells parameters. We also describe the analysis work-
flow from two distinct high content systems (Fig. 1).
2 Materials
The assay described is based on the infection of PMA-differentiated

THP-1 cells with Leishmania promastigotes in 384-well micro-
plates and the subsequent evaluation of infection by high content
analysis (see Note 1).
2.1 Host Cells 1. THP-1: a human monocytic cell line derived from the periph-
and Parasites eral blood of a 1-year-old human male, isolated in 1980 [15].
These cells grow as monocytes in suspension and can be
differentiated to adherent macrophages upon exposure to

phorbol myristate acetate.
2. A Leishmania strain that can produce metacyclic promasti-
gotes infective to human macrophages. The present protocol
has been validated with L. donovani (MHOM/IN/80/DD8),
L. infantum (MHOM/BR/2002/LPC-RPV), L. amazonen-
sis (MHOM/BR/1977/LTB0016), and L. braziliensis
(MHOM/BR/75/M2903).
2.2 Reagents 1. 384-well polystyrene microplates for cell culture (F-bottom,

and Consumables μCLEAR®, black, Greiner Bio-One—cat. no. 781091—or
equivalent).
2. Adenine.
3. Biotin.
Quantitative Analysis of Intracellular Infection by Automated Image Analysis 281
Fig. 1 High content analysis workflow for Leishmania intracellular amastigote detection and quantification.
Central workflow shows sequential analysis steps, while side-boxes provide details from specific prepro-
grammed algorithms from distinct high content analysis software: PerkinElmer Harmony (left) and General
Electric Investigator (right)
4. Draq5.
5. Fetal bovine serum (FBS).
6. Hepes.
7. Medium 199.
8. Paraformaldehyde (PFA).
9. Phorbol myristate acetate (PMA).
10. Phosphate buffered saline (PBS), pH 7.4.
11.
10,000 U/mL penicillin–10,000 μg/mL streptomycin
solution.
12. RPMI 1640 media, containing 2 mM l-glutamine, 25 mM
HEPES, 2000 mg/L glucose, and 5 mg/L phenol red.
13. Sodium bicarbonate.
2.3 Equipment High content screening system—this protocol has been validated
with Operetta (PerkinElmer) and IN Cell Analyzer 2200 (GE
Healthcare) but can be adapted to virtually any high content
screening platform available.
3 Methods
3.1 Cell Culture 1. Culture THP-1 cells in RPMI 1640 medium supplemented
with 20% FBS, 100 μg/mL penicillin, and 100 U/mL strep-
tomycin at 37 °C in a humidified atmosphere containing 5%
CO2. Cells should be subcultured at 2 × 105/mL every 3 days
and cellular density should not exceed 1 × 106/mL.
2. Culture Leishmania spp. as promastigotes at 1 × 106/mL in
medium 199 supplemented with 0.1 mM adenine, 40 mM
hepes and 0.0001% biotin, 10% FBS (or 20% for L. brazilien-
sis), 100 U/mL penicillin, and 100 μg/mL streptomycin, at
26 °C under agitation of 30 rpm. Cultures should be passaged
every 3 days, while in exponential growth phase (see Note 2).
3.2 Infection 1. Subculture Leishmania promastigotes from 4 to 6 days prior

to infection at 1 × 106/mL in medium 199 (see Note 3).
2. Subculture THP-1 cells 3 days prior to the infection at
2 × 105/mL in supplemented RPMI 1640 medium.
3. Two days before the infection, count THP-1 cells and resus-
pend culture at 2.7 × 105/mL in supplemented RPMI 1640
media, containing 50 ng/mL PMA (see Note 4).
4. Add 25 μL/well of THP-1 cell suspension into 384-well poly-
styrene microplates (7000 cells/well) and incubate at
37 °C/5% CO2 for 48 h.
5. At 48 h after THP-1 plating, count Leishmania promastigote

density and resuspend culture in supplemented RPMI 1640
media at 8 × 107/mL (see Note 5).
6. Add 25 μL of parasite culture (2.1 × 105/well) into 384-well
plates containing host cells and place the plates at 37 °C (34 °C
for cutaneous species) and 5% CO2, in a humidified incubator
(see Note 6). It is recommended to use noninfected control
wells in order to normalize the amastigote quantification to
noise signal (false positives).
3.3 Washing 1. After incubation period, add 25 μL of 12% PFA (in PBS, pH
and Fixing 7.4 v/v) solution into the plates of culture. PFA final concen-
tration should be 4%.
2. Incubate the plates for 15 min at room temperature.
3. Wash plates three times with 1× PBS.
4. Stain the plates with 10 μL of 5 μM Draq5 (in PBS) (see Note 7).
5. Incubate the plates for 20 min at room temperature and in the
absence of light. No washing is required.
3.4 Image 1. Insert the microplate into the high content screening equip-
Acquisition ment following the supplier’s instructions.
2. Choose the plate specification (format, model, and brand).
3. Select the 20× objective.
4. Select the far-red emission filters (Excitation/Emission (nm):
630/650).
5. Define empirically the exposure time by taking pictures and
checking the signal histogram. As the lamp power declines
with lamp usage, it is necessary to adjust exposure time often.
In the histogram, the intensity values should be distributed in
the entire intensity range, without saturating image pixels.
6. Select the proper image focus. When the autofocus is not
available in the device options, perform multiple stacks imag-
ing, adjusting the focus based on the intracellular parasite
(see Note 8).
7. Select wells for image acquisition.
8. Select the number of images per well. For 384-well plates, the
number of four images/well is often sufficient for an appropri-
ate analysis (see Note 9).
9. Start plate reading following the device specifications.
3.5 Images Analysis The following steps can be performed in different high content
analysis software, adapting the conditions to each program’s speci-
ficities (Figs. 1 and 2).
Fig. 2 Images of high content analysis workflow for Leishmania infection. THP-1 cells were infected with
Leishmania promastigotes and incubated for 96 h. Host cells and parasites were fixed with 4% PFA and
stained with Draq5. In this case, images were acquired by Operetta high content system. Figures from left to
right: raw image obtained by high content microscope, detection of host cell nuclei, segmentation of host cell
cytoplasm, detection of intracellular amastigotes, and identification of infected cells (green color) and nonin-
fected cells (red color)
1. Import acquired images data to analysis software, according to

device specifications.
2. Choose a control well containing infected cells to determine
image analysis protocol.
3. Define an analysis protocol containing the steps of image pro-
cessing: Detection of host cell nuclei → Segmentation of host
cell cytoplasm → Detection of intracellular parasites →
Determination of infected cell population → Definition of
output data.
4. Set a protocol (script) to detect and segment host cell nuclei.
For this, it is recommended to use, for example, the method
“find nuclei,” in Operetta, or the feature “nuclei,” in IN Cell
Analyzer. Details are shown in Fig. 1.
5. Fine-tune nuclei detection by applying the segmentation
methods and visualizing the defined object. The nuclei seg-
mentation is based especially on nuclei area (size) and minimal
contrast/intensity threshold to separate nuclei (foreground)
from background (see Note 10).
6. Define a method to delimit the host cell cytoplasm, based on
predetected nuclei, individualizing each cell and delineating
the cytoplasm region. For this, it is recommended to use, for
example, the method “find cytoplasm,” in Operetta, or the

feature “cells,” in IN Cell Analyzer (Fig. 1).
7. Fine-tune cytoplasm delimitation by applying the segmenta-
tion methods and visualizing the defined object. The cytoplasm
segmentation is based especially on cytoplasm areas and mini-
mal contrast/intensity threshold (sensitivity) (see Note 10).
8. If available, apply the exclusion of cells that are on the borders
and not entirely framed within the image, to ensure that all
host cell regions are fully accounted for intracellular parasites.
Some high content analysis software provide ready- to-
use
algorithms that automatically recognize and exclude border
cells not fully contained within the image.
9. Set a method for the detection and quantification of intracel-
lular parasites within the host cell cytoplasm regions. As there
is not a specific method for detection and quantification of
intracellular parasites, it is recommended to use, for example,
the method “find spots,” in Operetta, or the feature “organ-
elles,” in IN Cell Analyzer, to identify intracellular parasites
(see Note 11 and Fig. 1).
10. Apply a fine adjustment of the parasite detection method to
properly identify and delimitate intracellular parasites and have
them distinguished from other intracellular structures.
Parameters that can be adjusted for accurate parasite detection
are parasite size (define a minimal or maximal radius), spot
intensity (define the sensitivity range), the minimal distance
between two spots to have them considered two independent
objects, and the region of spot detection (it is essential to
define that spots should be all within the cytoplasm, as there
can be extracellular parasites).
11. Test if your analysis method is sufficiently accurate and robust
by checking for false positives (nonparasite intracellular struc-
tures that are recognized as parasites by the software) in con-
trol wells containing noninfected cells and false negatives in
control wells containing infected cells (see Note 12).
12. Apply classifier filters to identify and quantify the number of
infected cells (i.e., count cells which present at least one spot
in the cytoplasm). For this, it is recommended to use, for
example, the method “selection population – filter by proper-
ties,” in Operetta, or “Filters,” in IN Cell Analyzer. Details on
Fig. 1.
13. Determine the output parameters to be extracted from the
image analysis: total host cell number, total intracellular amas-
tigote number, total number of infected cells, average number
of amastigotes per infected cell, and infection ratio. For this,
use, for example, the function “Multiparameters readout,” in
Operetta, or “Summary,” in IN Cell Analyzer, and select the
readout data (Fig. 1).
3.6 Data Analysis 1. Determine the average infection ratio in infected cell control
wells (see Note 13).
2. Determine the average infection ratio in noninfected cell con-
trol wells (see Note 13).
3. The average infection ratio in noninfected cells is the back-
ground and can be subtracted from the infection ratio of
infected cells (both from control and test wells).
4 Notes
1. The protocol described here is based on Leishmania – infected,

differentiated THP-1 in 384-well plate format; however, it can
be adapted for other host cells (including primary macro-
phages) and other plate models/formats (for example, 24 and
96-well plates).
2. Both THP-1 cells and Leishmania parasite cultures should not
exceed the maximum density suggest in topic 3.1, because
increased cellular densities usually result in decreased
infection.
3. Depending on Leishmania species/strains, the growth period
before the infection can vary; therefore, it is recommended to
establish the most appropriate incubation time, in order to
obtain higher rates of metacyclic promastigotes and thus
higher infection.
4. Stocks of 500 μg/mL PMA should be prepared in small ali-
quots (5–10 μL), in order to avoid repeated thawing-freezing
cycles. After preparation, PMA stock solution can be stored
protected from light at −20 °C for 1 year or until the expira-
tion date.
5. It is recommended to empirically determine the parasite–host
cell ratio for infection, depending on the objective of the
experiment and for each Leishmania species, because infectiv-
ity varies regarding distinct Leishmania species (and strains
within species).
6. During THP-1 cell and parasite plating, maintain cultures
under low speed and constant stirring to ensure homogeneity
in cell suspension and, consequently, homogenous and
consistent number of cells and parasites among different wells
and plates.
7. The nucleic acid staining, Draq5, enables proper detection of
parasites and macrophage nuclei as well as the host cell cyto-
plasm. As a consequence, plates can be read using a single
channel for fluorescence, which results in reducing time of
both image acquisition and analysis, and demanding less image

storage capability, thus representing an advantage when large-
scale screening is considered. The plate can be imaged up to
2 weeks after staining.
8. Leishmania-infected THP-1 cells typically present different
focal planes for proper imaging of parasites and cell nuclei.
Whenever possible, it is recommended to prioritize the para-
site spots focus (even if the host cell nuclei are slightly out of
focus), as image analysis is still capable of detecting the host
cell nuclei.
9. Before initiating an analysis, it is important to determine the
minimal number of images to be acquired that represents the
whole well. In assays performed in 384-well microplates, the
number of four images/well is often sufficient to have a proper
number of cells for statistical analysis (approximately 1000
host cells per well image). This correlation is only maintained
if cell and parasite distribution is homogenous throughout
wells and plates.
10. As macrophage cells (including differentiated THP-1 cells) are
highly polymorphic and often multinucleated, it is necessary
to extensively optimize both nuclei detection and cytoplasm
segmentation, in order to prevent (a) the multinucleated cells
to be considered more than one individual cell and (b) the loss
of cytoplasm area.
11. Adapted algorithms, which were originally developed for
mammalian cell organelles/ultrastructure detection, can be
used to find and delimit individual parasites in the cytoplasm.
Depending on the image resolution available, parasite nuclear
and kinetoplast DNA (nDNA and kDNA, respectively) can be
spatially distinguished (as two separate peak signal spots, even
when imaged under 20× objective), which might lead to dou-
ble counting, resulting in inaccurate parasite counting.
Therefore, a fine adjustment should be performed in order to
merge the detected parasite nDNA and kDNA.
12. In order to decrease the false-positive ratio (caused by cellular
debris and other nonspecifically stained spots), noninfected
controls were also used to establish the optimal analysis condi-
tion for amastigotes detection.
13. The infection ratio could vary depending on the Leishmania
species; however, typical values obtained are above 50% of
infection ratio for this protocol. On the other hand, nonin-
fected controls usually present values lower than 10% of infec-
tion ratio.
Acknowledgments
We would like to thank Lucio Freitas-Junior for technical discus-

sions. This work was supported by the European Union’s Seventh
Framework Programme under grant agreement no. 603240 (New
Medicines for Trypanosomatidic Infections—NMTrypI), and the
Drugs for Neglected Diseases Initiative. For this project, DNDi
received financial support from the following donors: Department
for International Development (DFID), UK; Directorate-General
for International Cooperation (DGIS), The Netherlands; and
Swiss Agency for Development and Cooperation (SDC),
Switzerland. The donors had no role in study design, data collec-
tion and analysis, decision to publish, or preparation of the
manuscript.
References
1. Mosser DM, Edelson PJ (1985) The mouse Leishmania (Viannia) braziliensis. Am J Trop
macrophage receptor for C3bi (CR3) is a major Med Hyg 96:656–659
mechanism in the phagocytosis of Leishmania 9. Seifert K, Escobar P, Croft SL (2010) In vitro
promastigotes. J Immunol 135:2785–2789 activity of anti-leishmanial drugs against
2. Mosser DM, Edelson PJ (1987) The third Leishmania donovani is host cell dependent.
component of complement (C3) is responsible J Antimicrob Chemother 65:508–511
for the intracellular survival of Leishmania 10. Zulfiqar B, Shelper TB, Avery VM (2017)
major. Nature 327:329–331 Leishmaniasis drug discovery: recent progress
3. Sampaio WM et al (2007) In vitro binding and and challenges in assay development. Drug
survival assays of Leishmania parasites to Discov Today 22:1516–1531
peripherical blood monocytes and monocyte- 11. Field MC et al (2017) Anti-trypanosomatid
derived macrophages isolated from dogs natu- drug discovery: an ongoing challenge and a
rally and experimentally infected with Leishmania continuing need. Nat Rev Microbiol 15:
(Leishmania) chagasi. BMC Vet Res 3:11. 217–231
https://doi.org/10.1186/1746-6148-3-11 12. Nühs A et al (2015) Development and valida-
4. Sundar S, Rai M (2002) Laboratory diagnosis tion of a novel Leishmania donovani screening
of visceral leishmaniasis. Clin Diagn Lab cascade for high-throughput screening using a
Immunol 9:951–958 novel axenic assay with high predictivity of
5. Siqueira-Neto JL et al (2012) An image-based leishmanicidal intracellular activity. PLoS Negl
high content screening assay for compounds Trop Dis 9:e0004094. https://doi.org/
targeting intracellular Leishmania donovani 10.1371/journal.pntd.0004094
amastigotes in human macrophages. PLoS 13. De Muylder G et al (2011) A screen against
Negl Trop Dis 6:e1671. https://doi. Leishmania intracellular amastigotes: compari-
org/10.1371/journal.pntd.0001671 son to a promastigote screen and identification
6. De Rycker M et al (2013) Comparison of a of a host cell-specific hit. PLoS Negl Trop Dis
high-throughput high content intracellular 5:e1253. https://doi.org/10.1371/journal.
Leishmania donovani assay with an axenic pntd.0001253
amastigote assay. Antimicrob Agents 14. Dagley MJ, Saunders EC, Simpson KJ,
Chemother 57:2913–2922 McConville MJ (2015) High content assay for
7. Maes L et al (2016) In vitro ‘time-to-kill’ assay measuring intracellular growth of Leishmania
to assess the cidal activity dynamics of current in human macrophages. Assay Drug Dev
reference drugs against Leishmania donovani Technol 13:389–401
and Leishmania infantum. J Antimicrob 15. Tsuchiya S et al (1980) Establishment and
Chemother 72:428–430. https://doi.org/ characterization of a human acute monocytic
10.1093/jac/dkw409 leukemia cell line (THP-1). Int J Cancer
8. Espada CR et al (2017) Susceptibility to 26:171–176
miltefosine in Brazilian clinical isolates of

Chapter 16
Quantification of Leishmania Parasites in Murine Models

of Visceral Infection
Joana Tavares, Nuno Santarém, and Anabela Cordeiro-da-Silva
Abstract
Visceral leishmaniasis (VL) is mainly caused by Leishmania donovani (India and East Africa), and
Leishmania infantum (Mediterranean Basin and South America) infections. Although murine models of
visceral infection lack the clinicopathological aspects of VL in humans, they have been proven useful at
advancing our knowledge in the Leishmania field. Indeed, these models have been used not only to better
understand the pathophysiology of the infection but also in drug and vaccine development. This chapter
focuses on the protocols used to experimentally infect mice and to quantify parasite burdens in mice
infected with L. infantum using limiting dilution methodology of target organs and whole-mouse in vivo
imaging.
Key words Leishmania infantum, Visceral infection, Limiting dilution, Whole-mouse in vivo
imaging
1 Introduction
Visceral leishmaniasis (VL) is fatal if left untreated. The main signs

and symptoms include fever, weight loss, hepatomegaly/spleno-
megaly, and anemia [1, 2]. VL is mainly associated with Leishmania
donovani (India and East Africa), and Leishmania infantum
(Mediterranean Basin and South America) infections as the para-
sites disseminate and infect internal organs, particularly the liver,
spleen, and bone marrow [3]. While for L. infantum dogs are the
most important reservoir, for L. donovani the transmission is
mostly anthroponotic [4]. Only a few experimentally infected ani-
mal models exhibit similar clinicopathological aspects of VL in
humans, and these include hamsters and dogs [5–7]. However,
the restrictions associated with these animal models including eth-
ics, costs, and prolonged time of infection until symptoms appear
support the importance of murine models. Several aspects must be
taken into account when studying Leishmania infections in mice.
289
290 Joana Tavares et al.
Indeed, the mouse genetic background, parasite genotype,

inoculation route/infection site, parasite dose, and vector saliva
affect the infection outcome [8, 9]. Although experimental sand
fly-mediated Leishmania infections are possible, only few labora-
tories have the adequate facilities to perform them. Therefore, the
bulk of published experimental infections with L. infantum (and
also with L. donovani) still involve injecting intraperitoneally or
intravenously high numbers of stationary phase cultured promas-
tigotes in the susceptible BALB/c mice [10, 11]. Despite using
the parasite stage inoculated by the sand fly vector, this procedure
bypasses the skin where few parasites are deposited with other
components of parasite and vector origin [12–15]. However,
demonstration of a consistent model of visceral infection follow-
ing cutaneous needle inoculation of promastigotes has not been
accomplished [16]. Still, the above murine models of VL play an
important role when studying transgenic parasites’ infectivity [17,
18], in drug t reatment efficacy [19, 20], in analysis of the immune
response [21–23], and when investigating protective anti-parasite
vaccination strategies [24–26].
In L. infantum infected mice, parasite burden in the liver,
spleen, and bone marrow is commonly assessed by culture microti-
tration of homogenized organs [27]. In this assay, parasite loads
are determined from the highest dilution at which Leishmania
promastigotes could be grown after 2 weeks incubation at 27 °C.
Alternatively, parasite loads in target organs can be assessed by
quantitative PCR of kDNA [28–30]. Despite being sensitive, these
techniques are labor-intensive and time-consuming and do not
allow for longitudinal studies as organ collection implies euthana-
sia of infected animals. Therefore, high numbers of animals are
needed for meaningful longitudinal studies. In vivo imaging tech-
niques, namely those using whole-mouse bioluminescence imag-
ing to detect luciferase-expressing parasites have been developed to
overcome such limitations [31–34]. We have recently validated the
use of a minimally invasive bioluminescence murine model for pre-
liminary in vivo screening of promising chemical entities against
visceral infection by L. infantum. Indeed, we have demonstrated
that luciferase-expressing axenic amastigotes, unlike promasti-
gotes, are highly infectious to BALB/c mice generating a robust
bioluminescence signal that can be used to screen/adjust treat-
ment efficacy [34]. This chapter focuses on the methods used to
infect BALB/c mice with L. infantum parasites and to determine
parasite burdens either by the classical parasitological limiting dilu-
tion assay or by live imaging.
Leishmania Infection in Mice 291
2 Materials
2.1 Parasites 1. L. infantum cloned line (MHOM/MA/67/ITMAP-263)

(see Note 1).
2. The reporter parasite line L. infantum (MHOM/MA/67/
ITMAP-263) expressing firefly luciferase under the control of
the tubulin intergenic region [35].
2.2 Laboratory 1. In our laboratory 6-week-old BALB/c mice are used. The
Animals mice are obtained from Charles River (France). All experi-
ments involving rodents must conform to national and institu-
tional regulations and will follow the Principle of the 3Rs.
Final approval of the experiments is dependent on licensing by
the relevant authorities.
2.3 Reagents 1. Culture media: (a) complete RPMI: RPMI 1640 medium
supplemented with 10% heat-inactivated Fetal Bovine Serum—
2.3.1 Quantification
FBS, 2 mM l-glutamine, 100 U/ml penicillin, 100 μg/ml
of Parasite Burden
streptomycin, and 20 mM HEPES buffer; (b) Schneider cul-
by Limiting Dilution
ture medium: Schneider’s Insect Medium supplemented with
10% heat inactivated FBS, 200 U/ml penicillin, 200 μg/ml
streptomycin, 5 mM HEPES buffer, 2.5 mg/ml phenol red.
2. Sterile PBS.
3. 0.25% glutaraldehyde in PBS.
4. Trypan blue solution, 0.4%.
2.3.2 Quantification 1. Medium for L. infantum axenic amastigotes growth (MAA/20)

of Parasite Burden consists of modified medium 199 with Hanks’ salts, supple-
by Whole-Mouse In Vivo mented with 20% heat-inactivated FBS, 0.5% soybean trypto-
Imaging casein, 5 mM l-glutamine, 4 mM NaHCO3, 0.023 mM bovine
hemin, and 25 mM HEPES at a final pH of 6.5.
2. Sterile PBS.
3. 0.25% glutaraldehyde in PBS.
4. d-Luciferin potassium salt. Dissolve 1 g d-luciferin in 25 ml
sterile PBS to give a stock solution of 40 mg/ml and store at
−20 °C in the dark. Thaw the stock solution and inject 2.4 mg
(60 μl) for a mouse of 25 g.
5. Neomycin. Stock solution at 100 mg/ml in sterile PBS and
store at −20 °C.
2.4 Equipment 1. Biohazard class II safety cabinet.

2.4.1 Quantification 2. Incubator 27 °C.
of Parasite Burden 3. Hemacytometer (i.e., Neubauer chamber).
by Limiting Dilution
4. Insulin syringes: 0.5 ml with integrated needle and 1-ml

syringes.
5. Sterile scissors, scalpel, and forceps (used for collection of
organs).
6. Sterile glass tissue homogenizers (to prepare liver homogenate).
7. Sterile cell strainer, 100 μm (to prepare spleen cell
suspension).
8. Sterile glass tissue grinder.
2.4.2 Quantification 1. Incubator 37 °C, 5% CO2 with a humidified atmosphere for

of Parasite Burden axenic amastigotes.
by Whole-Mouse In Vivo 2. Mouse restrainer.
Imaging
3. IR heat lamp.
4. Small animal cordless clipper.
5. In vivo imaging system (i.e., IVIS Lumina LT from Perkin
Elmer is the system available at our institute).
6. Isoflurane anesthesia system (i.e., XGI-8 gas connected to
Lumina LT from PerkinElmer) for anesthesia of mice prior to
and during in vivo imaging. Mice are anesthetized in the
“induction chamber” which is prefilled with anesthetic vapor
(isoflurane–oxygen) via the vaporizer unit. In the imaging sys-
tem animals are kept anesthetized by holding their muzzles
close to a mask connected to the main vaporizer unit.
2.5 Software 1. Imaging data are analyzed with the software provided with the
in vivo imaging system (i.e., LIVING IMAGE 4.4 for the
IVIS Lumina LT from PerkinElmer).
2. Microsoft Excel is used to calculate parasite burdens by the
limiting dilution method.
3. GraphPad Prism software (Graph-Pad software, Inc., USA) or
comparable software is used for statistical analysis.
3 Methods
3.1 Quantification 1. Seed promastigotes at 1 × 106/ml in complete RPMI (see

of Parasite Burden Subheading 2.3.1) and culture for 5 days at 27 °C (see Note 2).
by Limiting Dilution 2. Collect cultures and centrifuge at 1800 × g for 10 min at 4 °C.
3.1.1 In Vitro Culture 3. Remove the supernatant and resuspend the parasite pellet in
of L. infantum 20 ml of PBS to wash out culture medium components.
Promastigotes 4. Centrifuge at 1800 × g for 10 min at 4 °C.
6. Discard supernatant and resuspend the parasites in PBS

(see Note 3).
7. Count the total number of promastigotes by preparing two
independent dilutions (1:40) in 0.25% glutaraldehyde solu-
tion. Load 10 μl into a hemocytometer and count parasites.
8. Dilute promastigote suspension with PBS to a final concentra-
tion of 1 × 108 promastigotes per 200 μl for injection into
mice.
3.1.2 Infection of Mice 1. Inside a biohazard class II safety cabinet inject promastigotes
with Leishmania into mice by performing an intraperitoneal injection. For that,
Promastigotes open the cage and restrain the animals by gently removing it
from the cage and apply the restraining technique. Slightly
move the animal head down so that the abdominal viscera
move toward the thorax and inject into the lower right quad-
rant of the abdomen toward the head at 30–40° angle to
horizontal.
3.1.3 Quantification 1. Anesthetize mice using the isoflurane anesthesia system and
of Parasite Burden euthanize the animal by cervical dislocation.
in Organs (Workflow Is 2. Inside a biohazard class II safety cabinet place the mouse in
Shown in Fig. 1) dorsal decubitus (laying on the back) and wet the abdomen
with 70% ethanol (see Note 4).
3. Lift the skin in the mid-abdomen and make an approximately
2-cm long horizontal skin incision with a scissor. Liver and
spleen should be visible under the muscle layer. Make a hori-
zontal incision in the muscle layer and remove the spleen and
the liver. Place the organs on previously weighed petri dishes
placed on ice.
4. To collect the bone marrow, remove fur and skin from the legs
by lifting skin at the base of each leg with tweezers and cutting
away skin across thigh and down to ankle. Peel skin down the
leg and over the foot and firmly tug until it is removed.
Remove remaining muscles from femur and tibia so that bone
is completely exposed. The entire leg will be removed. Place
intact bones in 70% ethanol and then in PBS (see Note 5).
5. Discard mouse and all excess tissues according to institutional
policy.
6. Weigh the liver- and spleen-containing petri dishes and calcu-
late organ weights.
7. To prepare a single cell suspension of the spleen, place a sterile
cell strainer in the petri dish, add 4 ml of complete RPMI cul-
ture medium and pass the tissue through the wire mesh with
the sterile plunger head of a 1-ml syringe. Disaggregate cells
by gently pipetting up and down several times using a 3 ml
Pasteur pipette. Transfer all the cell suspension into a 15 ml-

conical tube. Place the tubes on ice.
8. Process the liver using a sterile glass tissue grinder and 5 ml of
complete RPMI culture media. Transfer the suspension into a
15 ml conical tube and place tubes on ice. Wash tissue grinders
with extra 5 ml of media and add it to the cell suspension.
9. Collect bone marrow cells by flushing the shaft with 2 ml
complete RPMI medium using a 2 ml syringe and a 26 G
needle. Disaggregate cells by gently pipetting up and down
several times using a 1 ml Pasteur pipette. Transfer the cell
suspension into a 15 ml-conical tube. Place the tubes on ice.
Take an aliquot and dilute (1:1) with 0.4% trypan blue solu-
tion. Count live nucleated cells in a hemocytometer.
10. To determine the parasite burden in the spleen, liver, and bone
marrow, subject the respective organ homogenates (1 mg for
spleen; 4 mg for liver; and 106 cells for the bone marrow) in
quadruplicate to twofold serial dilutions in 96-well microtitra-
tion plates. Dilutions are performed with Schneider’s media
(see Subheading 2.3.1) and with the wells’ final volume com-
pleted to 200 μl (see Note 6).
11. Seal the plates with Parafilm and incubate at 27 °C for 2 weeks
(see Note 7).
12. Inspect the wells microscopically for the presence of promasti-
gotes. High-density growth should be achieved in all positive
wells so that scoring is very easy as the color of the medium
changes to yellow (see representative plates in Fig. 1).
13. The final titer is the last dilution for which the well contained
at least one parasite. The number of parasites per gram of
organ (parasite burden) is calculated as follows: [(geometric
mean of reciprocal titer from each quadruplicate cell culture/
weight of homogenized organ) × reciprocal fraction of the
homogenized organ inoculated into the first well]. For bone
marrow the number of parasites is calculated per 106 cells and
is as follow: [(geometric mean of reciprocal titer from each
quadruplicate cell culture/weight of homogenized
organ) × reciprocal fraction of the homogenized organ inocu-
lated into the first well]. For graphical representation log
transformation is applied to the parasite load to reduce right
skewness.
3.2 Quantification This protocol requires the use of L. infantum axenic amastigotes
of Parasite Burden expressing firefly luciferase [35] and it was validated to be used in
Using Whole-Mouse a primary screening of promising drugs against visceral infection
In Vivo Imaging [34]. To that end mice are enrolled in the experimental treatment
2 weeks after infection. It is advisable that imaging be performed
before treatment initiation and groups harmonized based on parasite
burdens. Animals are usually treated for up to 10 consecutive days.
L. infantum
infected
mice
Liver Spleen Bone Marrow

1 2 3 4 5 6 7 8 9 10 11 12 1 2 3 4 5 6 7 8 9 10 11 12 1 2 3 4 5 6 7 8 9 10 11 12
1 A 1 A 1 A
Target 2 B 2 B 2 B
4 C 4 C 4 C
oragans 8 D 1 2 3 4 5 6 7 8 9 10 11 12 8 8 D
Serial dilutions
D 1 2 3 4 5 6 7 8 9 10 11 12 1 2 3 4 5 6 7 8 9 10 11 12
A A A
16 E 16 E 16 E
colletion, 32 F
B
C
32 F
B
C
32 F
B
C
64 G 64 G 64 G
processing 128 H
D
E
A
1 2 3 4 5 6 7 8 9 10 11 12
128 H
D
E
A
1 2 3 4 5 6 7 8 9 10 11 12
128 H
D
E
A
1 2 3 4 5 6 7 8 9 10 11 12
and serial
B B B
F F F
C C C
G G G
dilutions H
D
E
H
D
E
H
D
... F
... F
... F
4194304 G
4194304 G
4194304 G
8389608 H
8388608 H
8388608 H
Incubation Incubator 27ºC, 2 weeks
Analysis
Fig. 1 Workflow scheme for quantitative analysis of Leishmania infantum parasite loads in BALB/c mice using
the limiting dilution assay. Liver, spleen, and bone marrow of infected mice are collected, and tissue homog-
enates are prepared and twofold serial-diluted in microtitration plates. The plates are then incubated for
2 weeks at 27 °C. The wells are macroscopically (plates in the left) and then microscopically inspected for the
presence of promastigotes (representative photograph images on the right taken from wells (depicted with
dashed lines) showing high (green dashed line) and medium (red dashed line) density promastigote growth or
negative (blue dashed line)
Imaging (see Subheading 3.2.3) can be performed every 2 days to

evaluate treatment efficacy. Mice whose treatment was successful
at reducing parasite burdens below bioluminescent background
levels should then be analyzed by the limiting dilution technique
3.2.1 In Vitro Culture 1. Seed axenic amastigotes expressing luciferase at 1 × 106/ml in

of Luciferase-Expressing the respective complete medium (see Subheading 2.3.2)
L. infantum Axenic containing 60 μg/ml of neomycin (and culture for 5 days at
Amastigotes 37 °C and 5% CO2 (see Note 8).
2. Collect cultures and centrifuge at 1800 × g for 10 min at 4 °C.
3. Remove the supernatant and resuspend the parasite pellet in

20 ml of PBS to wash out culture medium components.
4. Centrifuge at 1800 × g for 10 min at 4 °C.
6. Centrifuge at 1800 × g for 10 min at 4 °C. Discard the super-
natant and resuspend parasites in PBS (see Note 9).
7. Count the total number of axenic amastigotes by preparing two
independent dilutions (1:40) in 0.25% glutaraldehyde solution.
Load 10 μl into a hemocytometer and count parasites.
8. Dilute amastigote suspensions with PBS to a final concentra-
tion of 1 × 108 axenic amastigotes per 100 μl for injection into
mice.
3.2.2 Infection of Mice 1. Place the mice under an IR heat lamp for 5–10 min before
with Amastigotes injection of the parasites. The tail veins swell at high
temperature.
2. Inject the parasite suspension in the mouse tail vein.
3.2.3 Quantification 1. Prepare the in vivo imaging system for imaging the mice
of Parasite Burden (see Note 10).
2. For imaging visceral infection, anesthetize infected mice using
the isoflurane anesthesia system (see Note 11).
3. Prior to image acquisition remove the ventral fur with an
appropriate clipper. This must be done carefully as hematoma
might affect the imaging.
4. Inject 60 μl of d-luciferin substrate solution subcutaneously
into the neck of the anesthetized mice (see Note 12).
5. Transfer the mice to the 37 °C heated stage of the imaging
chamber and maintain anesthesia with 2.5% isoflurane. After a
5-min incubation allowing the distribution of the substrate in
the body, a 5-min signal acquisition controlled by the Living
Image software is initiated. After exposure is complete, the
overlay of the photographic and luminescent picture is dis-
played (see Fig. 2 for a representative image).
6. Animals are returned to their cages to recover from
anesthesia.
3.2.4 Image Analysis The quantitative assessment of the bioluminescent signal in the
regions encompassing target organs such as the liver and spleen can
be performed with the Living Image software as it enables the
quantification of the signal emanating from the specific areas of
interest (“region of interest,” ROI) [35, 36].
1. Select the image to analyze.
2. Define and adjust the regions of interest (ROI) encompassing
most of the ventral view of the animal body, liver, and spleen.
Multiple ROI of different sizes and shapes can be created.
L. infantum
infected mice
D-luciferin injection
5 min
Imaging
5 min
Days
15 20 26 40
post-infection
nº treatments 0 4 10 10
Untreated
10000
Analysis
8000
6000
Treatment A
4000
Radiance
Treatment B
(p/sec/cm 2/sr)
Fig. 2 Workflow scheme for quantitative analysis of parasite loads in BALB/c mice infected with firefly
luciferase-expressing axenic amastigotes using whole-body in vivo imaging. Infected mice are injected with
d-luciferin subcutaneously in the neck and anesthetized with isoflurane for imaging with the IVIS Lumina
LT. The images show representative mice enrolled in a longitudinal study where animals remained either
untreated or treated (treatment A or B) during 10 consecutive days starting at day 15 postinfection. Animals
were imaged at the indicated time points
Apply the defined ROIs to all animals, as the ROIs can be

copied and pasted to multiple images.
3. The bioluminescent signal is automatically calculated in aver-
age radiance (photons/second/cm2/steradian) for every ROI.
The average radiance background signal of the respective
ROIs is subtracted from the respective average radiance mea-
sured on infected animals.
4 Notes
1. L. infantum parasites are considered to have moderate poten-

tial hazard to personnel, thus, Biosafety Level 2 practices and
facilities should be used when working with the parasites. The
greatest risk of acquiring the infection in the laboratory has
been associated with parasite inoculation in mice (Sacks and
Melby [16]). Never recap needles.
2. Leishmania promastigotes’ progressive loss of virulence follow-
ing in vitro culture can be reverted by passage through a mam-
malian host. Therefore, maintain a cloned line of virulent L.
infantum promastigotes by weekly subpassages at 27 °C in
complete RPMI medium. Use promastigotes between 4 and 10
passages in all the experiments. In our laboratory, the density of
promastigote culture grown for 5 days is of 2–4 × 107/ml;
therefore, 5–10 ml of culture will be needed for each mouse.
3. The volume of PBS will depend on the culture volume.
Consider 0.1 ml for each 5–10 ml of culture.
4. It is important to maintain sterility throughout this procedure.
The entire procedure should be performed in a laminar flow
hood and generous amounts of 70% ethanol should be used to
sterilize surgical equipment periodically as well as the exterior
of the mouse itself.
5. Be very careful not to cut bone, as this will compromise the
sterility of the bone marrow.
6. The number of serial dilutions needed to dilute the parasites to
extinction is directly correlated with the organs’ parasite load.
This will vary according to the organ, duration of infection,
number of parasites and stage used to infect the mice. Usually
a total of 24 twofold serial dilutions (three microtitration plates
containing three mice homogenates tested in quadruplicated)
are sufficient to determine parasite extinction.
7. It is very important to seal the microtitration plate all around
with parafilm to avoid evaporation of the culture medium
while the plate is incubated for 2 weeks at 27 °C.
8. In our laboratory the density of axenic amastigote culture
grown for 5 days is of 5–8 × 107/ml; therefore, 3–5 ml of cul-
ture will be needed for each mouse.
9. The volume of PBS will depend on the culture volume.

Consider 0.1 ml for each 3–5 ml of culture.
10. Follow the manufacturer’s instructions to use the imaging sys-
tem. Ensure that the automatic background measurements
have been performed with the settings that will be used for
imaging the mice and that the observation field is set to pro-
vide an imaging area that is wide enough to encompass the
entire sample. Usually, three animals are analyzed at a time.
Do not forget to place the black bars, provided with the equip-
ment, between the mice.
11. A group of noninfected mice should be imaged to quantify the
bioluminescent background signal.
12. Subcutaneous injection of d-luciferin gives reproducible imag-
ing results. However, intravenous injection of the substrate
might improve imaging sensitivity in organs that can eliminate
d-luciferin more rapidly or are less accessible to the substrate.
Acknowledgments
We apologize to many researchers in this field whose work we have

not been able to cite directly owing to space limitation. This work
was supported by funds from the Fundação para a Ciência e
Tecnologia (FCT)/Ministério da Educação e Ciência (MEC)
cofunded by the European Regional Development Fund (FEDER)
under the Partnership agreement PT2020, through the Research
Unit No.4293. This work also received funds from project Norte-
01-
0145-FEDER-000012—Structured program on bioengi-
neered therapies for infectious diseases and tissue regeneration,
supported by Norte Portugal Regional Operational Programme
(NORTE 2020), under the PORTUGAL 2020 Partnership
Agreement, through the FEDER and the project POCI-01-0145-
FEDER-031013 financed by Portugal 2020, under the Programa
Operacional Competitividade e Internacionalização (COMPETE
2020). J.T. is an Investigator FCT funded by National funds
through FCT and cofunded through European Social Fund within
the Human Potential Operating Programme.
References
1. WHO. Leishmaniasis (2017) [cited 2017 4. Chappuis F et al (2007) Visceral leishmania-

2017-11-30]; Available from: http://www. sis: what are the needs for diagnosis, treat-
who.int/leishmaniasis/en/ ment and control? Nat Rev Microbiol
2. Alvar J et al (2012) Leishmaniasis worldwide 5:873–882
and global estimates of its incidence. PLoS 5. Fernández-Cotrina J et al (2013) Experimental
One 7:e35671 model for reproduction of canine visceral leish-
3. Murray HW et al (2005) Advances in leish- maniosis by Leishmania infantum. Vet Parasitol
maniasis. Lancet 366:1561–1577 192:118–128
6. Melby PC et al (2001) The hamster as a model 20. Tavares J et al (2012) Anti-leishmanial activity
of human visceral Leishmaniasis: progressive of the bisnaphthalimidopropyl derivatives.
disease and impaired generation of nitric oxide Parasitol Int 61:360–363
in the face of a prominent Th1-like cytokine 21. Pérez-Cabezas B et al (2016) Interleukin-27
response. J Immunol 166:1912–1920 early impacts Leishmania infantum infection in
7. Aslan H et al (2013) A new model of progres- mice and correlates with active visceral disease
sive visceral leishmaniasis in hamsters by natu- in humans. Front Immunol 7:478
ral transmission via bites of vector sand flies. 22. Nascimento MS et al (2016) NOD2-RIP2-
J Infect Dis 207:1328–1338 mediated signaling helps shape adaptive immu-
8. Loeuillet C et al (2016) Study of Leishmania nity in visceral leishmaniasis. J Infect Dis
pathogenesis in mice: experimental consider- 214:1647–1657
ations. Parasit Vectors 9:144 23. Arcanjo AF et al (2017) Toll-like receptor 2 is
9. Scott P, Novais FO (2016) Cutaneous leish- required for inflammatory process develop-
maniasis: immune responses in protection and ment during Leishmania infantum infection.
pathogenesis. Nat Rev Immunol 16:581–592 Front Microbiol 8:978
10. Leclercq V et al (1996) The outcome of the 24. Silvestre R et al (2007) SIR2-deficient
parasitic process initiated by Leishmania infan- Leishmania infantum induces a defined IFN-
tum in laboratory mice: a tissue-dependent gamma/IL-10 pattern that correlates with
pattern controlled by the Lsh and MHC loci. protection. J Immunol 179:3161–3170
J Immunol 157:4537–4545 25. Agallou M et al (2017) Identification of
11. Kaye PM, Beattie L (2016) Lessons from other BALB/c immune markers correlated with a
diseases: granulomatous inflammation in leish- partial protection to Leishmania infantum
maniasis. Semin Immunopathol 38:249–260 after vaccination with a rationally designed
12. Atayde VD (2015) Exosome secretion by the multi-epitope cysteine protease A peptide-
parasitic protozoan Leishmania within the sand based Nanovaccine. PLoS Negl Trop Dis
fly midgut. Cell Rep 13:957–967 11:e0005311
13. Gomes R, Oliveira F (2012) The immune 26. Banerjee A et al (2018) Live attenuated
response to sand fly salivary proteins and its Leishmania donovani centrin gene-deleted par-
influence on Leishmania immunity. Front asites induce IL-23-dependent IL-17-
Immunol 3:110 protective immune response against visceral
14. Rogers ME (2012) The role of Leishmania leishmaniasis in a murine model. J Immunol
proteophosphoglycans in sand fly transmission 200:163–176
and infection of the mammalian host. Front 27. Buffet PA et al (1995) Culture microtitration:
Microbiol 3:223 a sensitive method for quantifying Leishmania
15. Dey R et al (2018) Gut microbes egested dur- infantum in tissues of infected mice. Anti
ing bites of infected sand flies augment severity microb Agents Chemother 39:2167–2168
of leishmaniasis via inflammasome-derived 28. Nicolas L et al (2002) Real-time PCR for
IL-1β. Cell Host Microbe 23:134–143 detection and quantitation of Leishmania in
16. Sacks DL, Melby PC (2015) Animal models mouse tissues. J Clin Microbiol 40:
for the analysis of immune responses to leish- 1666–1669
maniasis. Curr Protoc Immunol 29. Cunha J et al (2013) Characterization of the
108:19.2.1–19.2.24 biology and infectivity of Leishmania infantum
17. Faria J et al (2016) Leishmania infantum viscerotropic and dermotropic strains isolated
asparagine synthetase a is dispensable for para- from HIV+ and HIV- patients in the murine
sites survival and infectivity. PLoS Negl Trop model of visceral leishmaniasis. Parasit Vectors
Dis 10:e0004365 6:122
18. Faria J et al (2016) Disclosing the essentiality 30. Moreira D et al (2015) Leishmania infantum
of ribose-5-phosphate isomerase B in modulates host macrophage mitochondrial
Trypanosomatids. Sci Rep 6:26937 metabolism by hijacking the SIRT1-AMPK
axis. PLoS Pathog 11:e1004684
19. Costa Lima SA et al (2012) Characterization
and evaluation of BNIPDaoct-loaded PLGA 31. Michel G et al (2011) Luciferase-expressing
nanoparticles for visceral leishmaniasis: in vitro Leishmania infantum allows the monitoring of
and in vivo studies. Nanomedicine (Lond) amastigote population size, in vivo, ex vivo and
7:1839–1849 in vitro. PLoS Negl Trop Dis 5:e1323
32. Reimao JQ et al (2015) Generation of screening against Leishmania infantum: a reli-
luciferase-expressing Leishmania infantum able method to evaluate efficacy and optimize
chagasi and assessment of miltefosine efficacy treatment regimens. bioRxiv. https://doi.
in infected hamsters through bioimaging. org/10.1101/326355
PLoS Negl Trop Dis 9:e0003556 35. Sereno D et al (2001) DNA transformation of
33. Melo GD et al (2017) New insights into exper- Leishmania infantum axenic amastigotes and
imental visceral leishmaniasis: real-time in vivo their use in drug screening. Antimicrob Agents
imaging of Leishmania donovani virulence. Chemother 45:1168–1173
PLoS Negl Trop Dis 11:e0005924 36. Tavares J et al (2017) In vivo imaging of patho-
34. Costa DM et al (2018) Whole-mouse in vivo gen homing to the host tissues. Methods
bioluminescence imaging applied to drug 127:37–44
Chapter 17
Syrian Hamster as an Advanced Experimental Model

for Visceral Leishmaniasis
María Dolores Jiménez-Antón, Montserrat Grau,
Ana Isabel Olías-Molero, and José Mª Alunda
Abstract
Animal models are needed along the development and evaluation of potential chemotherapeutic agents
against leishmaniasis. Infections of Syrian hamsters with Leishmania species causing visceral leishmaniasis
(VL) closely mimic the disease in the natural hosts, including target organs, lesions, and clinical course.
Therefore, despite some shortcomings (e.g., genetic background, price, and scarcity of reagents), it is
probably the best laboratory rodent model of VL. However, handling of hamsters can be technically chal-
lenging because of their particular anatomy. Here, we describe in detail four different routes to establish
an experimental VL in the hamster model using Leishmania promastigotes and amastigotes. Each route
requires various manipulations and has different benefits and drawbacks. Choice of the most suitable route
should be made by the researcher in accordance with the specific plan and purpose of the study.
Key words Leishmania, Visceral leishmaniasis, Hamster, Experimental infection, Intraperitoneal,

Intracardiac, Retro-orbital, Intradermic, Promastigotes, Amastigotes
1 Introduction
Visceral leishmaniasis (VL) is a severe parasitic disease caused by

Leishmania species, mainly L. donovani and L. infantum. No
human vaccine has been developed yet, and control of human
infection relies on chemotherapy. Several drugs are available [1]
although they have important limitations such as poor efficacy,
high price of the most effective and safer presentations, low com-
pliance, and increasing numbers of resistant isolates to first choice
drugs [2, 3]. Research and development of vaccines, new chemical
entities (NCE), repurposed drugs, or combinations require reli-
able and predictive animal models. Some surrogate models of VL
have been established, and these include rodent models (mice and
hamster), dogs for secondary trials, and nonhuman primates for
tertiary tests. Mice have been extensively used along the drug
pipeline development and to explore host–parasite interactions.
303
304 María Dolores Jiménez-Antón et al.
The wide use of this model relates to the availability of reagents,

affordable cost, homogeneous genetic background, and easy hous-
ing and handling. However, visceral Leishmania infections are
restricted to some mouse lines (e.g., BALB/c) and are self-limiting
[4]. By contrast, infections in the Syrian hamster (Mesocricetus
auratus) are long lasting due to the inability of its immune system
to control the dissemination of the parasite, thus leading to bio-
pathological alterations and lesions comparable to those found in
the natural hosts. Despite the inconveniences of this animal model
(e.g., relative lack of reagents, anatomical characteristics, and hous-
ing requirements), hamster offers the possibility of an advanced
rodent model mimicking some of the characteristics of the natural
infection [4–6].
Hamsters are susceptible to visceral Leishmania infection initi-
ated with both promastigotes, particularly purified metacyclics
obtained in culture media [7–10], and intracellular amastigotes
from biopsies or necropsies of naturally or experimentally infected
hosts.
Several inoculation routes have been described for the estab-
lishment of experimental visceral leishmaniasis in hamsters.
Immune response, success, progression, and severity of infection
will depend on both the Leishmania strain and the inoculation
route [11–14]. Parasite cells must be properly manipulated to
guarantee maximal cell viability and infectivity. Therefore, infec-
tion routes must be chosen considering not only the aim of the
experiment but also their particular advantages and limitations.
Some inoculation procedures are not highly demanding in terms
of technical difficulty. However, other infection techniques require
adequate training under supervision of skilled personnel and an
advanced knowledge of anatomical and physiological characteris-
tics of hamsters. We offer a step-by-step guide of four inoculation
techniques, intraperitoneal, dermal, intracardiac, and retro-orbital,
to achieve hamster infections with viscerotropic Leishmania spp.
2 Materials
2.1 Promastigote 1. Culture medium: Prepare medium RPMI-1640 following the

Inoculum manufacturer’s indications. Thaw frozen reagents in a water
bath at 37 °C prior to use. Add 20% (v/v) heat-inactivated
fetal bovine serum (56 °C, 45 min), 1% penicillin–streptomy-
cin (199 μg/mL), and 1% l-glutamine (200 mM) and mix.
Store supplemented complete culture medium at 2–8 °C
(see Note 1).
2. Promastigotes cultures: Use an established Leishmania cul-
ture, preferably in mid-log phase, count in Neubauer hemocy-
Hamster Model for Visceral Leishmaniasis 305
tometer, take the appropriate volume to get a final concentration

in the new culture of 2 × 106 promastigotes/mL and incubate
at 27 °C for at least 10 days (see Note 2).
3. Ficoll solutions: Prepare separately Ficoll 30% by dissolving
30 g Ficoll powder in a final volume of 100 mL PBS w/o Mg2+
and Ca2+, and Ficoll 10% with 10 g Ficoll in a final volume of
100 mL Medium 199. Dissolution can be facilitated by mag-
netic stirring at room temperature (RT). When properly dis-
solved, filter the solutions through a 3 mL syringe with 0.22 μm
filter attached. Store solutions at 2–8 °C (see Note 3).
2.2 Amastigote 1. SDS 0.05%-PBS solution: Add 0.250 mL of SDS to

Inoculum 499.750 mL of PBS w/o Mg and Ca. If SDS is solid consider
a density of 1 then dissolve 0.250 g of SDS in 500 mL of
PBS. Filter through a 3 mL syringe attached to a 0.22 μM fil-
tration device. Prepare fresh and store at 2–8 °C.
3 Methods
3.1 Preparation 1. Collect cell cultures in sterile 50 mL Falcon tubes and centri-
of Promastigote fuge at 1000 × g for 10 min at RT. Discard supernatant from
Inoculum each tube, resuspend and pool the pellets obtained in the left-
over medium (ca. 5 mL/pellet) and centrifuge as above.
Repeat until all promastigotes are in a single tube.
2. To a 30 mL transparent conical-bottom tube, add carefully
Ficoll 30% (10 mL), Ficoll 10% (10 mL), and promastigote
culture suspension (10 mL). It is important to follow this
order (see Note 4).
3. Centrifuge at 365 × g for 10 min at RT without brake. Due to
their distinct shape and sedimentary properties [7, 15], meta-
cyclic promastigotes accumulate on top of the 10% Ficoll phase.
4. Discard most of the upper phase with a pipette. Collect the
interphase between cell suspension and 10% Ficoll containing
the metacyclic promastigote fraction. To assure maximum col-
lection of infective forms, small amounts from the adjacent
10% Ficoll layer (ca. 10%) can be included, since interphases
may contain cell forms too. Discard the tube with remaining
Ficoll 10% and Ficoll 30% phases.
5. Move the cell suspension to a clean tube and wash twice in
RPMI-1640 or HBSS by centrifugation at 1000 × g for 10 min
at RT to remove the Ficoll.
6. Wash the final pellet with sterile PBS by resuspending the pel-
let in 50 mL of PBS, centrifuge at 1000 × g for 10 min at RT,
Table 1
Specific material recommendations and notes for inoculation parameters for intraperitoneal (IP),
intracardiac (IC), retro-orbital (RO), and intradermic (ID) inoculation routes
Specific material and recommendations
IP IC RO ID
Inoculum size (cells/animal) 107–108 107–108 107–108 105–107
Syringe 1 mL or insulin syringe
Needle gauge 25 G 27–29 G 29–30 G 29–30 G
Inoculation volume < 2 mL ≤ 0.2 mL ≤ 0.2 mL ≤ 0.05 mL
discard supernatant and resuspend in fresh buffer. Repeat

twice.
7. Discard the supernatant and resuspend the pellet in 5 mL of
sterile saline solution (NaCl 0.9%) for perfusion.
8. Disperse Leishmania rosettes by repeated (10–15×) passage
through a 23 G syringe needle.
9. Count with Neubauer-improved chamber under light micro-
scope. Two counts is the minimum recommendation for an
accurate estimation.
10. Adjust the concentration to the desired dose and volume
(Table 1) in saline (NaCl 0.9%) for perfusion.
11. Keep inoculum at RT until infection is performed (see Note
5).
3.2 Preparation 1. Spleen extract: Aseptically extract the whole spleen from a
of Amastigote euthanized natural or experimental host with an established
Inoculum Leishmania infection. Process always within 24 h after organ
extraction.
2. Cut the spleen into manipulable parts (Ø 3–4 cm) and homog-
enize in PBS (w/o Mg and Ca) +1% penicillin-streptomycin
(100 μg/mL) (PBS-pen-strep). For larger pieces use a glass
Tenbroeck tissue grinder or electric tissue homogenizer. Add
PBS-pen-strep to cover up the tissue sample (ca. 5 mL). For
small pieces (e.g., from mouse and hamster) it is possible to
pass them through a cell strainer set on a 6-well plate filled
with 5 mL PBS-pen-strep solution. Maintain organ pieces on
ice during processing (see Note 6).
3. Gather all suspensions obtained and centrifuge at 50 × g for
10 min at 4 °C and discard pellet to remove cell debris.
Centrifuge supernatant again at 1000 × g for 10 min at
4 °C. Discard supernatant.
4. To disrupt tissue cells and release amastigotes, resuspend the

pellet obtained from the last centrifugation in 10 mL 0.05%
SDS-PBS solution and keep for 30 s at RT. Afterward, dilute
the solution by filling the tube completely (50 mL) with PBS-
pen-strep to stop the lysis treatment.
5. Centrifuge at 3000 × g for 30 min at 4 °C to recover amasti-
gotes as a pellet. Discard supernatant.
6. Add 10 mL PBS-pen-strep and resuspend pellet by gently
turning the tube over manually (do not use vortex).
7. Centrifuge at 3000 × g for 30 min at 4 °C. Discard supernatant
and resuspend amastigotes in fresh PBS.
8. Estimate cell concentration of the final suspension by counting
in a Neubauer-improved chamber under a light microscope.
Add 2% Trypan-blue vital stain to confirm cell viability. Two
counts is the minimum recommendation.
9. Adjust the concentration to the desired dose and volume
(Table 1) in saline solution (NaCl 0.9%) for perfusion.
10. Keep inoculum at RT until infection is performed (see Note
5).
3.3 Intraperitoneal 1. Intraperitoneal injection does not require anesthesia of the

Infection (IP) animal.
2. Place the animal beyond the hand on a plain surface. Generally,
use your nondominant hand for restraining the animal and
your dominant one to inject. Grab the hamster by its back skin
from the scruff with the forefinger and thumb and keep a grip
to the rear between the other fingers and the hand palm.
Animal must be firmly but gently held for a safe injection.
3. Place the animal face up to expose the ventral side and lightly
bend backward to reduce likelihood of puncturing viscera such
as intestines or cecum.
4. Clean the area with 70% ethanol and a clean gauze.
5. Homogenize the cell suspension with the syringe by gentle
suction-release several times and fill the syringe up to 2 mL
maximum. Eliminate air bubbles prior to injection.
6. Insert the needle, bevel up, at ca. 60° angle in the left or right
chordal half of the abdomen directed along the line of the high
limb. Avoid the ventral midline to reduce likelihood of bladder
or cecum puncture. Insert by 5 mm of depth maximum
(Fig. 1).
7. Softly draw the syringe plunge back to ascertain that blood,
urine or other internal visceral content are not aspirated. If
they appear, withdraw the needle, discard and replace it and
reposition the animal before a second try.
Fig. 1 Intraperitoneal inoculation of Leishmania in hamster
8. If syringe stays clean, proceed to inject the material slowly.

9. Retract the needle linearly.
3.4 Intracardiac 1. Anesthetize the animal with inhalatory isoflurane by induction

Infection (IC) at 4% in medical air/oxygen [17] using an anesthetic vaporizer
connected to a transparent induction chamber. Hold on ca.
10 min until the induction cage is properly filled and then
place the animal inside and wait until the subject loses con-
sciousness. For an adult hamster (150–180 g) this can take ca.
2–3 min (see Note 7).
2. Lay the animal on its back with its snout set into the anesthetic
mask. Isoflurane concentration must be readjusted to 2–3% in
medical air/oxygen for anesthesia maintenance [17].
3. Restrain the upper limbs of the animal manually or with surgi-
cal tape to the surface for a wider access to the thorax.
4. Clean the chest with 70% ethanol and a clean gauze.
5. Homogenize the cell suspension with the syringe needle by
gentle suction-release several times. Subheading 3.1, step 8
can be previously repeated if it seems convenient or after pro-
longed time elapsed since Leishmania inoculum was prepared.
Afterward, fill the syringe up to 0.2 mL maximum. Absolutely
ensure that there are no air bubbles in either the syringe or the
needle prior to inoculation; air bubles may cause embolism.
6. Advance the needle to the left of the xiphisternal junction at a
30° angle downward pointing to the apex beat of the heart and
directed to the hamster’s left ear. Access can also be done
through the fourth or fifth intercostal junction (Fig. 2).
Fig. 2 Intracardiac inoculation of Leishmania in hamster
7. Right after piercing the skin, slightly draw back the syringe
plunge to get negative pressure inside and enable to perceive
the cardiac approach.
8. At the moment that blood comes up in the needle hub or the
syringe, slowly inject half of the content. Without changing
the needle position, draw back the plunge again and, if right
position it is still confirmed, inject the remaining material.
9. Carefully withdraw the needle linearly.
10. Monitor animal health status after injection, including rhythm
and effort of breathing as well as proper recovery.
3.5 Retro-Orbital 1. Anesthetize the animal following the procedure in Subheading

Infection (RO) 3.4.
2. Lay the animal in left or right lateral decubitus position and
place its snout into the anesthetic mask. Isoflurane anesthetic
2–3% in medical air/oxygen must be established for anesthesia
maintenance (see Note 8).
3. Apply 1–2 drops of specific ophthalmic anesthetic (e.g., tetra-
caine chlorhydrate 1 mg/mL + oxybuprocaine chlorhydrate
4 mg/mL) on the animal’s eye and wait for 5 min for the eye
drop to make effect.
4. Homogenize the suspension as indicated in point 3.4.5.
Subheading 3.1, step 8 can be previously repeated if it seems
convenient or after prolonged time elapsed since Leishmania
inoculum was prepared. Fill a 1 mL syringe needle with the
promastigote solution up to 0.2 mL maximum. Make sure that
there are not air bubbles in the syringe or needle prior to
inoculation.
5. Carefully protrude hamster’s eye by placing the index and
thumb fingers on the periorbital area (above and under the
Fig. 3 Retro-orbital inoculation of Leishmania in hamster
eyeball, respectively) and applying downward pressure in order

to facilitate access to ocular venous sinus.
6. Place the top of the needle, bevel down, right into the medial
canthus of the eye meeting a 45–50° angle (Fig. 3). Cautiously
introduce the needle underneath the edge of the eye pointing
the venous sinus until feeling a slight resistance of the orbital
bone (see Note 9).
7. Slowly inject the cell suspension into the retro-orbital vessel
sinus.
8. Carefully retract the needle linearly and then release the skin
(see Note 10).
3.6 Intradermic 1. Anesthetize the animal following the procedure in Subheading

Infection (ID) 3.4.
2. Restrain the upper limbs of the animal manually or with surgi-
cal tape for a safer access to the hind limbs.
3. Swap the foot-pad with 70% ethanol. Injection should be done
always in the same-side foot-pad to leave the other as control
(see Note 11).
4. Homogenize the cell suspension and fill the syringe up to
0.1 mL maximum. If possible, limit volume injected to
0.05 mL to avoid tissue trauma. The highly specific local site of
injection avoids material loss or dispersion.
5. Insert the needle 30° bevel up holding nearly parallel to the
plane of the skin, on the top of one rear hind foot or on the ear
pinnae (Fig. 4).
Fig. 4 Intradermic inoculation of Leishmania in foot-pad of hamster
6. Do not aspirate. Directly inject the syringe content slowly.

7. Retract the needle. If correctly done, a small round skin swell-
ing appears at the puncture site.
3.7 Monitoring Syrian hamsters are highly receptive to visceralizing Leishmania

the Infection species but contrary to what is found in sensible mice strains, the
clinical course tends to be chronic. Outcome of the infection in
hamsters inoculated with visceralizing Leishmania species depends
mainly on the inoculation route, virulence of the parasite strain,
parasitic stage (amastigotes versus promastigotes), and size of the
inoculum. Thus, monitoring of inoculated animals is essential irre-
spective of the purpose of the research. Follow-up should include
daily observation after inoculation to detect behavioral changes
and food and water intake. Several signs and lesions, particularly
cutaneous, should be expected such as localized alopecic areas and
exfoliative dermatitis in different parts of the body (e.g., periorbi-
tary, nose, and abdomen), dry and brittle hair, weight loss, and, on
ocassion, liver and spleen enlargement (hepatosplenomegaly).
Moreover peripheral specific antibody anti-Leishmania response
correlates to the dissemination of the parasite in target organs. To
determine the parasite load in main target organs (spleen, liver,
bone marrow) a number of methods could be used. These include
the estimation of Parasite burden by Leishman–Donovan units
(LDU) following the counting of Leishmania amastigotes stained
in organs‘smears; Limiting Dilution Assay (LDA) using organ
homogenates; in vivo imaging; back transformation of amastigotes
in host’s tissues to promastigotes; or qPCR, among others. For this
purpose, comparable methods described in Chapter 16 can be used
or adapted.
4 Notes
1. If a commercial serum bottle is frozen, it must be thawed in

advance at 4 °C prior to the inactivation. This might take
refrigerator storage overnight. Serum actually requires only
30 min of heat inactivation but 15 extra min assure that the
total volume reaches the specified temperature for the dura-
tion required. Turn the serum bottle regularly while it is in the
water bath to homogenize temperature of the whole liquid
more easily. Bottle can swell lightly due to heat. Prior to use,
2–3 mL of the complete medium should be placed at 37 °C in
a heater for 72 h minimum to check absence of bacterial or
fungal contamination.
2. It is essential that Leishmania promastigotes have been recently
isolated from an infected animal. Cultures in a passage below
fifth are appropriate for in vivo infection. Higher culture pas-
sages contribute to a strong decrease in the proportion of
metacyclic infective promastigotes [16]. After 10 days, cul-
tures become cloudy and yellowish due to the acidification
resulting from the cell growth, and promastigote rosettes can
be recognized by sight as a light dust in the cultures.
3. It takes several hours for Ficoll solutions to get properly dis-
solved, so they must be prepared in advance before the sched-
uled infection day.
4. Ficoll solutions will acquire a viscose appearance. To avoid
unwanted mixing, add all solutions carefully by placing the
pipette on the upper edge of the tube, gradually expelling and
letting the fluids to run slowly along the tube. If solutions
become mixed, discard and repeat the procedure.
5. It is recommended to divide the final total inoculum in several
recipients (e.g., Eppendorf tubes) to avoid excessive handling
of one single inoculum that may lead to contamination.
6. When using an electric tissue homogenizer, follow manufac-
tory recommendations to establish the suitable parameters of
speed and time to assure tissue disruption but without damage
of intracellular parasites. In case of doubt, use a manual
homogenizer.
7. Other anesthetics could be employed always following recom-
mendations for laboratory animal species [17]. It is important
to wait until the induction cage is properly prepared before
introducing the animal. Otherwise, the anesthetic does not
reach the concentration required and the procedure will be
longer and more stressful for the animal. Since animal loses
consciousness, wait for ca. 30 s to assure a deep enough anes-

thetic effect. Too short induction time will lead to sudden
awakening of the animal short after taking it out of the induc-
tion chamber and/or during the procedure. These techniques
must be performed only by qualified personnel following the
FELASA guidelines.
8. Hamster position will depend on the side of inoculation pre-
ferred according to the operator’s handedness. To the right-
handed operator it will be more convenient to lay the animal
in left lateral position, thus exposing the right eye for inocula-
tion. On the contrary, to the left-handed operator it will be
more suitable to access the left eye by placing the animal in
right lateral position.
9. Syringe must be held in a way that it allows to easily press the
plunger smoothly and linearly without having to relocate
the fingers or hand position. It is recommended to grasp
the syringe by using middle and thumb fingers and keeping
the forefinger free to press the plunger. Since neither skin
nor other tough tissue need to be pierced to get the venous
sinus, puncture should proceed smoothly. No resistance of
the eye or any other tissue during the needle insert or the
material injection should be felt at any time.
10. Eye damage is not expected since puncture must never be
done in the ocular globe or the caruncle. An immediate but
temporary eye protrusion might be observed. Minor bleeding
is rare, although can appear after withdrawing the needle.
Light compression with a sterile gauze and returning the skin
to its normal position must immediately resolve the situation.
Liquid or blood should never come out from the nose.
11. Although infection can be also done in the snout, we recom-
mend to use the foot-pad for animal welfare; adverse effects
derived from the infection can be highly uncomfortable for
the animal if the snout is affected.
General considerations
Leishmania is considered a moderate biological hazard for person-
nel, and all work performed with infective stages of this parasite
must always be done under laboratory and personal biosafety
BSL-2 and ABSL-2 practices [18].
All animal procedures must be approved by animal experimenta-
tion and ethical committees of the institution; personnel must
be officially qualified for animal handling. We suggest to include
veterinary advice.
Acknowledgments
This work has been partially funded by the European Union’s

Seventh Framework Programme for research, technological devel-
opment, and demonstration under grant agreement no. 603240
(NMTrypI—New Medicines for Trypanosomatidic Infections).
http://www.nmtrypi.eu/. Collaboration with Evidence-Based
Advisors (P + 3A) is acknowledged.
References
1. Nagle AS, Khare S, Kumar AB, Supek F, 11. Moreira N, Vitoriano-Souza J, Roatt BM,
Buchynskyy A, Mathison C, Chennamaneni Vieira PM, Ker HG, de Oliveira Cardoso JM,
NK, Pendem N, Buckner FS, Gelb MH, Giunchetti RC, Carneiro CM, de Lana M, Reis
Molteni V (2014) Recent developments in AB (2012) Parasite burden in hamsters infected
drug discovery for Leishmaniasis and human with two different strains of Leishmania
African Trypanosomiasis. Chem Rev (Leishmania) infantum: “Leishman Donovan
114(22):11305–11347 units” versus real-time PCR. PLoS One
2. World Health Organization (2010) Control of 7(10):e47907
Leishmaniases. Technol Rep Ser 949:1–186 12. Wyllie S, Fairlamb AH (2006) Refinement
3. Corral-Caridad MJ, Alunda JM (2013) of techniques for the propagation of Leishma
Chemotherapy of leishmaniasis: a veterinary nia donovani in hamsters. Acta Trop 97:
perspective. In: Jäger T, Koch O, Flohé L (eds) 364–369
Trypanosomatid diseases. Molecular routes to 13. Moreira ND, Vitoriano-Souza J, Roatt BM,
drug discovery. Wiley-VCH, Weinheim, Vieira PM, Coura-Vital W, Cardoso JM,
pp 17–36 Rezende MT, Ker HG, Giunchetti RC,
4. Nishi GS (2011) Visceral leishmaniasis: experi- Carneiro CM, Reis AB (2016) Clinical, hema-
mental models for drug discovery. Indian tological and biochemical alterations in ham-
J Med Res 133(1):27–39 ster (Mesocricetus auratus) experimentally
5. Hommel M, Jaffe CL, Travi B, Milon G (1995) infected with Leishmania infantum through
Experimental models for leishmaniasis and for different routes of inoculation. Parasit Vectors
testing anti-leishmanial vaccines. Ann Trop 31(9):181
Med Parasitol 89(Suppl 1):55–73 14. Kaur S, Kaur T, Garg N, Mukherjee S, Raina P,
6. Melby PC, Chandrasekar B, Zhao W, Coe JE Athokpam V (2008) Effect of dose and route
(2001) The hamster as a model of human vis- of inoculation on the generation of CD4+
ceral Leishmaniasis: progressive disease and Th1/Th2 type of immune response in murine
impaired generation of nitric oxide in the face visceral leishmaniasis. Parasitol Res 103:1413
of a prominent Th1-like cytokine response. 15. Spath GF, Beverley SM (2001) A
J Immunol 166:1912–1920 lipophosphoglycan- independent method for
7. Sacks DL, Perkins PV (1984) Identification of isolation of infective Leishmania metacyclic
an infective stage of Leishmania promastigotes. promastigotes by density gradient centrifuga-
Science 223(4643):1417–1419 tion. Exp Parasitol 99:97–103
8. Bates PA (1993) Complete developmental 16. Lei SM, Romine NM, Beetham JK (2010)
cycle of Leishmania mexicana in axenic culture. Population changes in Leishmania chagasi pro-
Parasitology 108:1–9 mastigote developmental stages due to serial
passage. J Parasitol 96(6):1134–1138
9. Gonzaga M, Laranjeira MF, Andrade R,
Marino R, Floeter-Winter LM (2011) 17. Flecknell P, Lofgren J, Dyson M, Marini R,
Correlation of meta 1 expression with culture Swindle M (2015) Preanesthesia, Anesthesia,
stage, cell morphology and infectivity in analgesia and euthanasia. In: Fox JG (ed)
Leishmania (Leishmania) amazonensis promas- Laboratory animal medicine. Academic Press-
tigotes. Mem Inst Oswaldo Cruz Elsevier, London, pp 1135–1200
106(2):190–193 18. U.S. Department of Health and Human
10. Silva AM, Cordeiro-da-Silva A, Coombs GH Services (2009) Section VIII-C: parasitic
(2011) Metabolic variation during develop- agents. In: Biosafety in microbiological and
ment in culture of Leishmania donovani pro- biomedical laboratories. HHS Publication No.
mastigotes. PLoS Negl Trop Dis 5(12):e1451 (CDC) 21–1112: 182–194
Chapter 18
Experimental Cutaneous Leishmaniasis: Mouse Models

for Resolution of Inflammation Versus Chronicity
of Disease
Christian Bogdan, Andrea Debus, Heidi Sebald, Baplu Rai,
Johanna Schäfer, Stephanie Obermeyer, and Ulrike Schleicher
Abstract
Experimental cutaneous leishmaniasis of mice is a valuable model to study the immune response to the
protozoan pathogen Leishmania and to define mechanisms of parasite control and resolution of inflamma-
tion as well as of parasite evasion and chronicity of disease. In addition, over many years Leishmania-
infected mice have been successfully used to analyze the function of newly discovered immune cell types,
transcription factors, cytokines, and effector mechanisms in vivo. In this chapter we present detailed pro-
tocols for the culture, propagation, and inoculation of Leishmania promastigotes, the monitoring of the
course of cutaneous infection, the determination of the tissue parasite burden and for the phenotyping of
the ensuing immune response. The focus lies on the L. major mouse model, but an overview on other
established models of murine cutaneous leishmaniasis is also provided.
Key words Leishmania major, Mouse models, Cutaneous leishmaniasis
1 Introduction
Leishmania are protozoan parasites, which exist in two morpho-

logically distinct developmental forms: (a) the flagellated, so-called
promastigote form that is primarily found in the invertebrate vec-
tor (i.e., sand flies) and (b) the amastigote form that lacks a flagel-
lum (except for a rudimentary part visible only by electron
microscopy) and represents the intracellular parasite stage seen
within phagocytic cells of mammalian hosts [1, 2]. Leishmania
parasites are the causative agents of various forms of leishmaniasis,
ranging from self-healing cutaneous leishmaniasis (CL; called ori-
ental sore in the Near and Middle East) to nonhealing diffuse cuta-
neous leishmaniasis (DCL), mucocutaneous leishmaniasis (MCL),
and lethal visceral leishmaniasis (VL; also termed kala azar) [3, 4].
Leishmaniasis belongs to the ten most important parasitic
315
316 Christian Bogdan et al.
infections and is categorized by the WHO as a neglected tropical

disease [5].
Soon after the discovery of Leishmania parasites at the end of
the nineteenth and the beginning of the twentieth century in ori-
ental sores of human patients and in the spleens of patients with
kala azar (reviewed in [6]) it was demonstrated that mice are sus-
ceptible to infection by Leishmania parasites [7]. More systematic
analyses of experimental murine leishmaniasis began in the 1960s
and 1970s which then led to the discovery that the severity and
outcome of experimental cutaneous leishmaniasis elicited by
Leishmania (L.) major (formerly termed L. tropica major) or other
Leishmania species varies in different inbred strains of mice, indi-
cating that the host immune response is decisive for disease devel-
opment [8–15]. Besides L. major various other species of
Leishmania that either belong to the subgenus Leishmania (L.L.)
or the subgenus Viannia (L.V.), have been utilized to establish
mouse models of cutaneous leishmaniasis, some of which reflect
characteristic features of the diverse forms of human cutaneous
leishmaniasis (Table 1). Subsequent studies revealed that not only
the genetic background of the mice but also (a) the parasite dose
[11, 16–21], (b) the parasite growth phase (logarithmic vs. sta-
tionary phase), stage (procyclic vs. metacyclic) [22–24], and viabil-
ity [25], (c) the parasite isolate/strain [26–31] and clone [32, 33],
(d) the site of infection (e.g., footpad, tail base, dorsal skin/rump,
ear dermis) [34–38], (e) the route of infection (subcutaneously
[s.c.], intradermally [i.d.], intravenously [i.v.]) [39–41], (f) the sex
of the mice [42–45], (g) the age of the mice [46–48], and (h) the
environmental temperature [49] influence the course of cutaneous
leishmaniasis in inbred mice (Table 1).
Over the past almost 50 years all these models were instrumen-
tal to define the role of different types of immune cells, cytokines
and effector mechanisms for the control of Leishmania parasites
and the resolution of cutaneous leishmaniasis as well as for parasite
persistence or chronic progressive disease [50, 51]. In fact, many
pathways that account for a protective (e.g., type 1 T helper 1
[Th1], interleukin [IL]-12, signal-transducer-and-activator-of-
transcription [STAT] 4, interferon [IFN]-γ, interferon-regulatory-
factor [IRF]-1, tumor necrosis factor [TNF], inducible or type 2
NO synthase [NOS2]) or nonprotective immune response to
intracellular infectious pathogens (e.g., Th2, regulatory T cells,
IL-4, IL-10, STAT6, arginase 1) were first described in the L.
major mouse model of cutaneous leishmaniasis [2, 50–55].
In the following we will provide detailed experimental instruc-
tions for setting up and analyzing the L. major mouse model of
cutaneous leishmaniasis, using the subcutaneous infection route.
Table 1
Mouse models of cutaneous leishmaniasis
Leishmania Dose and

subgenus and route of Related form of Key
species Parasite strain infection Mouse strain Course of infection human leishmaniasis references
L. L. majora MHOM/IL/80/ high, s.c.c; C57BL/6, CBA, C3H/ Self-healing, nonulcerative skin Acute, self-healing CL [58, 86,
Friedlin, low, HeN lesion 87]
MHOM/IL/81/FEBNI, i.d.d
LV39
MHOM/SN/74/SD low, i.d.d C57BL/6 Nonhealing skin lesion Chronic nonhealing [28, 29]
(Seidman) CL
MHOM/IL/80/ high, s.c.c; BALB/c Progressive ulcerative skin lesion Viscerotropic CL; [26, 58,
Friedlin, low, i.d.d (± metastases) disseminated CL; 86, 87]
MHOM/IL/81/FEBNI, → visceralization → death VL
MRHO/SU/59/P
(LV39)
MHOM/IL/80/ low, s.c.e BALB/c Nonprogressive skin lesion [11, 15,
Friedlin, 18, 87]
MHOM/IL/81/FEBNI
Various clinical isolates of high, s.c.f BALB/c Variable (small nonprogressive [88]
L. major from patients or large, nonhealing lesions)
with CL
MHOM/IL/81/FEBNI, high, s.c.c BALB/c IL-4 k.o. Stable, nonprogressive skin [26, 89]
WHOM/ lesion
IR/-/173(IR173)
MRHO/SU/59/P high, s.c.c BALB/c IL-4 k.o. Progressive, ulcerative skin [26, 90]
(LV39) lesion
MHOM/IL/80/Friedlin high, s.c.c BALB/c × C57BL/6 F1 Self-healing, nonulcerative skin Acute, self-healing CL [34]
(footpad) lesion
Mouse Cutaneous Leishmaniasis
high, s.c.g BALB/c × C57BL/6 F1 Nonhealing, progressive skin Chronic nonhealing [34]

(rump) lesions CL
(continued)
317
Table 1
318
(continued)
Leishmania Dose and

subgenus and route of Related form of Key
species Parasite strain infection Mouse strain Course of infection human leishmaniasis references
L. L. tropicab MHOM/AF/88/KK27 high, s.c.c BALB/c, C57BL/6 Nonulcerative, nonprogressing, Acute, prolonged, [91, 92]
or low, long-lasting skin lesions ultimately self-
i.d.d healing CL
Christian Bogdan et al.
High, s.c.g Swiss albino Nonhealing skin lesion → skin Chronic, nonhealing [93]
(rump) metastases, visceralization CL with
disseminated
lesions; viscerotropic
CL, VL
L. L. mexicana MNYC/BZ/62/M379, low, i.d.d BALB/c Nonhealing, progressive skin Chronic nonhealing [19, 38,
MHOM/BZ/82/BEL21 lesion (± metastases) CL with 94, 95]
disseminated lesions
(DCL)
low, i.d.d C57BL/6, CBA/Ca Healing or nonhealing (slowly Acute, self-healing [19, 38,
progressing) skin lesion CL; chronic 94–97]
nonhealing CL
L. L. IFLA/BR/67/PH8 low, i.d.d BALB/c, C57BL/6, Nonhealing, progressive skin Chronic nonhealing [20, 98,
amazonensis MHOM/BR/00/ or high, C57BL/10 lesion CL 99]
LTB0016 s.c.
MPRO/BR/1972/
M1841
L. Viannia MAN/BR/79/LTB-111 high, s.c.c C57BL/6, BALB/c Small, nonulcerative, self- Acute, self-healing CL [100–104]
braziliensis MHOM/BR/75/ or healing skin lesion
M2903 low, i.d.d
MHOM/BR/01/BA788
MHOM/
BR/94/H-3227
L. Viannia WHI/BR/78/M5313 high, s.c.c C57BL/6 Nonulcerative, self-healing Acute, self-healing CL [105, 106]
guyanensis MHOM/BR/75/ lesion (more severe if parasites (± distant skin
M4147 carry Leishmaniavirus LRV1) metastases)
a
Formerly termed L. tropica major
b
Formerly termed L. tropica minor
c
High dose: mice were subcutaneously (s.c.) inoculated into the footpad; parasite dose ranged from 1–5 × 105 and 1–3 × 106 to 1–2 × 107 (in most cases stationary-phase pro-
mastigotes were used, sometimes purified metacyclic parasites)
d
Low dose: mice were intradermally (i.d.) inoculated into ear skin; parasite numbers ranged from 10 to 1000 (in most cases, 1000 metacyclic promastigotes were injected)
e
Low dose: mice were s.c. inoculated into the footpad using stationary-phase parasites; parasite numbers ranged from 100 to 104
f
High dose: mice were s.c. infected into the footpad with 2 × 106 L. major amastigotes
g
High dose: mice were s.c. infected in the dorsal skin of the rump with 1 × 105 metacyclic L. major promastigotes
Mouse Cutaneous Leishmaniasis
319
2 Materials
2.1 General Remarks 1. All solutions, buffers, and media used for cell cultures will be
prepared with ultrapure, deionized water (minimum resistance
>18 MΩ, total organic content <5 ppm; derived from a
Millipore Merck water purification system [e.g., Milli-Q-
Biocel]), are autoclaved or subjected to sterile filtration (pore
size 0.2 mm) and need to be tested for their endotoxin (i.e.,
lipopolysaccharide [LPS]) content using a colorimetric Limulus
amebocyte lysate-assay (QCL-1000, Lonza Inc., Verviers,
Belgium; cat. no. 50-647 U). Alternatively, they are purchased
as sterile ready-to-use cell culture-tested products certified to
be endotoxin-free.
2. All instruments used for preparing these solutions, buffers and
media (e.g., glass cylinders, bottles, magnetic stirring bars,
spatulas) need to be endotoxin-free (achieved by baking for
2 h at 200 °C). The final LPS concentration of all buffers and
media in contact with Leishmania parasites or immune cells
should not exceed 10 pg/mL (<0.1 endotoxin unit/mL).
2.2 In Vitro Culture 1. L. major MHOM/IL/81/FEBNI promastigotes (derived

of L. major from lesional amastigotes [see Subheadings 2.3 and 3.3])
The L. major FEBNI strain, which is routinely used by our
2.2.1 Passaging,
laboratory, was originally published as L. tropica (major) and
Counting, and Freezing
was isolated from the cutaneous lesion of an Israeli patient by
of L. major
F. Ebert at the Bernhard-Nocht-Institut (BNI) für
Tropenmedizin in Hamburg, Germany, in 1981 [56–58]. The
strain has been studied for more than 30 years in Erlangen and
subsequently also in other research laboratories in and outside
Germany [25, 48, 59–66]. Throughout the years, its virulence
has been maintained by regular infection of and reisolation
from BALB/c mice after not more than six in vitro passages.
The strain has never been cloned.
2. Other commonly used L. major strains:
(a) L. major Friedlin (MHOM/IL/80/Friedlin [67]).
(b) L. major LV39 (MRHO/SU/59/P [26]).
(c) L. major IR173 (WHOM/IR/−/173 [26]).
3. NNN-rabbit blood agar slants in 96-well flat-bottomed plates
4. Complete modified Schneider’s drosophila medium (see
Subheading 2.2.3).
5. Complete RMPI1640 medium: RPMI1640 culture medium
(ThermoFisher Scientific, Gibco cat. no. 21875; contains
2 mM l-glutamine, 2 g/L NaHCO3, 2 g/L d-glucose, 5 mg/L
phenol red) supplemented with 10 mM HEPES (pH 7.2),
Mouse Cutaneous Leishmaniasis 321
50 μM 2-mercaptoethanol (Gibco cat. no. 31350010),

100 U/mL penicillin G, 100 mg/mL streptomycin, and 10%
(v/v) heat-inactivated (30 min, 56 °C) fetal calf serum (FCS).
6. Ca2+- and Mg2+-free Dulbecco’s Phosphate-buffered saline (PBS):
Prepare from commercially available powder and ultrapure
endotoxin-free water (minimum resistance >18 MΩ, total
organic content <5 ppm) or buy as ready-to-use buffer (e.g.,
ThermoFisher Scientific, Life Technologies, Karlsruhe,
Germany).
7. 96-well flat-bottomed tissue culture plates with lids (e.g.,
NUNCLON™).
8. Tissue culture flasks (e.g., 25 cm2 with angled neck and filter
cap, Nunclon™, cat. no. 136196).
9. Multichannel pipette (50–200 μL).
10. Polystyrene petri dish (diameter 85 mm).
11. 15 or 50 mL polypropylene conical centrifuge tubes.
12. Refrigerated cell centrifuge.

13. Trypan blue stock solution (0.4%, e.g., ThermoFisher
Scientific, cat. no. 15250061) and working solution (0.05% in
PBS).
14. PBS with 1% paraformaldehyde.

15. Modified Neubauer counting chamber with a depth of
0.02 mm and a large square area of 1 mm2.
16. Sterile, endotoxin-free dimethylsulfoxide (DMSO; e.g., Sigma-
Aldrich D-2650).
2.2.2 Biphasic Novy– The basic version of this medium used for growing Leishmania
Nicolle–McNeal (NNN) parasites was originally published by Charles Nicolle in 1908
Rabbit Blood Agar Slants [68, 69].
in 96 Well Plates
2.2.2.1 Components (for 1. 200 mL Brain Heart Infusion agar (consisting of 7.4 g Bacto™
300 mL Agar) Brain Heart Infusion [Becton Dickinson cat. no. 237500] and
3 g Bacto™ agar [Becton Dickinson cat. no. 214040] ad
200 mL ultrapure endotoxin-free water; boiled while stirring
until completely dissolved; pH adjusted to 7.4 ± 0.2 with 1 M
NaOH; autoclaved for 15 min. at 121 °C) (see Note 1).
2. 50 mL 0.9% sodium chloride solution (autoclaved or sterile
filtered).
3. 50 mL defibrinated rabbit blood (controlled for sterility).
4. 0.3 mL penicillin G (60 mg/mL; sterile filtered).
5. 0.3 mL streptomycin (100 mg/mL; sterile filtered).
2.2.2.2 Preparation 1. Place bottle with autoclaved BHI agar on magnetic stirrer and
adjust temperature to approximately 50 °C.
2. Add the ingredients listed above while stirring. Keep the com-
plete NNN-agar in a 42 °C water bath.
3. Pour the agar in portions into a preheated glass petri dish
(42 °C; diameter ca. 15 cm) with stirring bar, which has been
placed on a heated magnetic stirrer in a laminar airflow
cabinet.
4. Using an 8-channel pipette transfer 50 μL/well of the NNN-
agar in sterile 96-well flat-bottomed tissue culture plates with
lids that are placed on an oblique (45°) metal stand.
5. Once the agar has solidified, the plates are taken from the
stand, tightly wrapped in plastic bags (to avoid dehydration
and shrinkage of the agar slants) and stored at 4 °C with the
lids facing the bottom. The plates can be stored for
≤3 months.
6. An aliquot of the NNN-agar is subjected to sterility control
(cultures for aerobic and anaerobic bacteria as well as fungi).
2.2.3 Monophasic The use of Schneider’s drosophila or insect medium for the growth
Complete Modified of Leishmania was first described in 1981 [70]. Subsequently, the
Schneider’s Drosophila medium was modified and enriched by the addition of human
Medium (cmSDM) urine and an amino acid cocktail [71, 72].
2.2.3.1 Components 1. Basic Schneider’s drosophila medium (bSDM; e.g., Genaxxon

no. C4193.0500 [with l-glutamine and NaHCO3]).
2. Endotoxin-free, ultrapure, deionized water (minimum resis-
tance >18 MΩ, total organic content <5 ppm).
3. 1 M NaOH solution.
4. 1 M HCl.
5. 0.80 g CaCl2 × 2H2O (e.g., Sigma-Aldrich 3306) in 50 mL
ultrapure water.
6. Amino acid–antibiotic–pyruvate (AAP) solution (25× concen-
trate) (see Table 2).
7. 1 M HEPES solution (pH 7.0–7.6, e.g., Sigma-Aldrich
H0887).
8. Fetal calf serum (heat-inactivated, 30 min. 56 °C).
9. Normal human midstream urine. Add 1/100 volume of
100 × penicillin G/streptomycin solution, sterile filter
(0.22 μm) and store in 5 mL aliquots at −20 °C (do not store
at 4 °C!).
Table 2
Composition of the 25 × AAP-solution
mL or g Final concentration of
Component Concentration of stock added 25 × solution
100 × penicillin G/ 10,000 U/mL (= 6 mg/L) 50 mL 2500 U/mL (= 1.5 mg/mL)
streptomycin solution (e.g., PenG, 10 mg/mL PenG, 2.5 mg/mL
Sigma-Aldrich P4333) streptomycin streptomycin
100 × sodium pyruvate solution 100 mM 50 mL 25 mM
(e.g., Sigma-Aldrich 3662)
100 × l-glutamine solution 200 mM 50 mL 50 mM
(e.g., Biochrom GmbH,
K0282)
DMEM-medium w/o phenol 50 mL
red (e.g., Sigma-Aldrich no.
D5921)
L-asparagine (free base; e.g., 0.18 g 0.9 g/L (= 6.8 mM)
Calbiochem no. 1860)
L-arginine HCl (e.g., Sigma- 0.58 g 2.9 g/L (= 13.76 mM)
Aldrich no. A5131)
Total volume 200 mLa
a
Stir at room temperature for ca. 1 h until a clear solution is obtained. Sterile filter (0.22 μm), prepare 10 mL aliquots
and store at −20° or − 70 °C (do not store at 4 °C!)
2.2.3.2 Preparation 1. Add powdered Schneider’s drosophila medium to ca. 800 mL

of Basic Schneider’s ultrapure water.
Drosophila Medium 2. Stir until grossly dissolved (NB: complete dissolution will not
(bSDM) be achieved at this stage; do not heat!).
3. Add 50 mL 1 M NaOH solution. Stir for 10 min. (medium
will appear cloudy).
4. Add 35 mL 1 M HCl. Medium will become clear and reach a
pH of ca.6.9.
5. Add 0.8 g CaCl2 × 2H2O in 50 mL ultrapure water while
stirring vigorously.
6. Adjust pH to 6.9 with 1 M NaOH or 1 M HCl.
7. Fill up to 1000 mL with ultrapure water.
8. Sterile filtration using 0.22 μm filter cup. Prepare 50, 100, or
500 mL aliquots as needed. Store at 4 °C under light protec-
tion (bottles wrapped with aluminum foil).
2.2.3.3 Preparation See Table 3.

of Complete Modified
Schneider’s Drosophila
Medium (cmSDM)
Table 3
Composition of the complete modified Schneider’s drosophila medium
(cmSDM)a
Starting Desired final Volume needed

Component concentration concentration for 500 mL cmSDM
bSDM n.a. n.a. 415 mL
FCS 100% 10% 50 mL
AAP-solution 25 × 1× 20 mL
HEPES 1 M 10 mM 5 mL
Human urine 100% 2% (v/v) 10 mL
Store the cmSDM under light protection at 4 °C
a
2.3 Isolation 1. Wild-type or Rag1- or Rag2-deficient BALB/c mouse that

of Lesional L. major was infected into one hind footpad with 3 × 106 L. major
Amastigotes promastigotes approximately 3 weeks earlier and developed a
nonulcerated skin swelling.
2. Sterilized tweezers and pairs of scissors for the preparation of
mouse footpads.
3. 70% ethanol.
4. Sterile conical polypropylene centrifuge tubes (15 mL).
5. PBS without FCS.
6. Metal sieve (mesh size 180 μm, diameter 80 mm; autoclaved
or sterilized in boiling water; custom-made by VWR
International).
8. 50 mL polypropylene conical centrifuge tubes.
9. Plunger of a 20 mL syringe.
10. 27 G injection needle.
11. NNN-rabbit blood agar slants in 96-well flat-bottomed plates
12. Complete RMPI1640 medium (containing 10% FCS) (see
Subheading 2.2.1, item 5).
2.4 In Vivo Infection 1. Stationary-phase culture of L. major promastigotes.

2. Inbred strains of mice (e.g., BALB/cAnNCrl, C57BL/6N, or
C57BL/6J) obtained from commercial breeders and kept
under specific pathogen-free conditions (see Note 2). In most
studies mice used for infection experiments were (6-)8(-10)
weeks old. Sex [42–45] and age [46–48] of the mice have an
influence on the course of infection.
3. Mouse injection chamber (used for restraining the mice during
the foot injection procedure; e.g., ZOONLAB GmbH
Castrop-Rauxel, Germany, cat. no. IK-M).
4. Tuberculin syringe (1 mL).
5. Disposable hypodermic injection needles (27 G).
6. Sterile microcentrifuge (2 mL) or centrifuge tubes (5 mL).
2.5 Clinical Course 1. Metric caliper Oditest® (mechanical external measuring gauge;
of Infection scale interval 0.01 mm; measuring force ≤1.75 N) (Kroeplin,
D-36381 Schlüchtern/Germany; cat. no. S5010 or D110T).
2. Scales (range 0–100 g; accuracy 0.01 mg).
2.6 Tissue 1. Scales (range 0–100 g; accuracy 0.01 mg).

Parasite Burden 2. Sterilized tweezers and pairs of scissors for the preparation of
mouse tissues (e.g., footpad, draining popliteal lymph nodes
[pLNs], spleen).
3. Sterile polypropylene microcentrifuge (2 mL) or centrifuge
tubes (5 mL).
4. PBS without or with 1% FCS.
5. Metal sieves (mesh size 180 μm, diameter 80 mm; sterilized in
boiling water [5 min] or autoclaved; custom-made by VWR
International).
6. Cell strainer (mesh size 100 μm; sterile; Falcon™, BD
Biosciences).
8. 15 mL and 50 mL polypropylene conical centrifuge tubes.
9. Plungers of 2 mL and 20 mL syringes.
10. Regular Neubauer counting chamber (depth 0.1 mm).
11. Trypan blue working solution (0.05% in PBS).
12. Erythrocyte lysis buffer (0.17 M NH4Cl and 20 mM HEPES
[pH 7.4] in ultrapure water), prewarmed to 37 °C.
13. 5 mL polystyrene round bottom centrifuge tubes.

14. Repeating pipette (Multipipette™ Eppendorf M4) with
2.5 mL combitips.
15. 96-well flat-bottomed tissue culture plates.

16. Complete modified Schneider’s drosophila medium (see
Subheading 2.2.3 and Table 3).
17. ELISA reader (96 well plate photometer).
18. Inverted microscope for plate microscopy.
19. Free software Lcalc™ version 1.1 for limiting dilution analysis
(STEMCELL Technologies GmbH, Cologne, Germany; com-
pany offers no updates or technical support; https://www.
stemcell.com/products/product-types/
instruments/l-calc-software.html).
2.7 Immunopheno- 1. Sterilized tweezers and pairs of scissors for the preparation of
typing mouse tissues (e.g., skin lesion, draining pLN, spleen).
2.7.1 mRNA Analyses 2. TRIzol® (Thermo Fisher Scientific) or TRIzol® equivalent
(e.g., TriFast, VWR International).
2.7.1.1 Preparation
3. Chloroform.
of Total RNA from Infected
Organs 4. Isopropanol.
5. 75% (v/v) ethanol prepared with ultrapure sterile water.
6. Ultrapure sterile water (DNAse-, RNAse-, and endotoxin-free;
Biochrom, cat. no. L0020).
7. 2 mL sterile polypropylene tubes.
8. Bench centrifuge.
9. Stainless steel beads (diameter 3 mm; Max Lamb GmbH &
CoKG, Würzburg, Germany; https://www.lamb.de).
10. Tissue homogenizer (e.g., Tissue Lyser Qiagen).
2.7.1.2 cDNA Synthesis 1. High capacity cDNA Reverse Transcription Kit (Thermo
Fisher Scientific; cat. no. 4368813).
2. Ultrapure sterile water (Biochrom, cat. no. L0020).
3. 0.2 mL sterile polypropylene tubes.
4. PCR machine.
2.7.1.3 Quantitative 1. TaqMan™ gene expression assay containing gene-specific

Real-Time PCR primer plus probe (Thermo Fisher Scientific).
2. 2× TaqMan™ Universal Mastermix II, no UNG (contains no
uracil-n-glycosylase; Thermo Fisher Scientific, cat. no.
4440048).
3. 96- or 384-well PCR plate with sealing foil.
4. Real-time PCR machine.
2.7.2 Flow Cytometry 1. Sterilized tweezers and pairs of scissors for the preparation of
and Intracellular Cytokine mouse tissues (e.g., skin lesion, pLN, spleen).
Staining of Immune Cells 2. RPMI1640 cell culture medium without any supplements.
2.7.2.1 Preparation 3. Collagenase P (Roche).
of Single Cell Suspensions 4. DNAse I (Roche).
5. Percoll (GE Healthcare, Cat No 17-0891-01).
6. Hanks’ balanced salt solution (HBSS; Sigma-Aldrich).
7. PBS (10× concentrate and 1× working buffer).

8. Thermomixer (Eppendorf).
9. Cell Centrifuge.
2.7.2.2 Staining 1. Fluorochrome-labeled or biotin-labeled antibodies specific for

of Cell-Specific Surface surface molecules of immune cells (e.g., Biolegend, BD
Molecules Biosciences, Miltenyi, Thermo Fisher Scientific).
2.
Fluorochrome-labeled streptavidin (e.g., Biolegend, BD
Biosciences, Miltenyi, Thermo Fisher Scientific).
3. Fluorochrome-labeled cell viability dye (e.g., fixable viability
dye [FVD], Thermo Fisher Scientific).
4. Unlabeled rat anti-mouse CD16/32 antibodies (so-called “Fc
block”) (e.g., Biolegend).
5. FACS staining buffer: PBS with 1% FCS and 2 mM EDTA.
6. 5 mL polystyrene or polypropylene tubes (NB: immune cells
show lower adherence to the latter).
7. Cell centrifuge.
8. Nylon mesh (100 μm; e.g., Franz Eckert GmbH, Waldkirch,
Germany, cat. no. PA-100/32).
9. Multilaser flow cytometer (e.g., Canto II, Fortessa [BD
Biosciences]) and flow cytometry software (e.g., FlowJo®).
2.7.2.3 Intracellular 1. Complete RPMI medium with supplements and 10% FCS (see
Cytokine Staining Subheading 2.2.1, item 5).
2. Brefeldin A (Sigma-Aldrich).
3. Phorbol myristate acetate (PMA, Sigma-Aldrich).
4. Ionomycin (Sigma-Aldrich).
5. Fluorochrome-labeled cytokine- or effector molecule-specific
antibodies (e.g., Biolegend, BD Biosciences, Miltenyi, Thermo
Fisher Scientific).
6. Cytofix/Cytoperm™ solution (BD Biosciences, cat. no.
51-2090KZ).
7. Saponin buffer: PBS/2% FCS/0.5% saponin (Sigma-Aldrich).
8. FACS staining buffer: PBS with 1% FCS and 2 mM EDTA.
9. 5 mL polystyrene or polypropylene tubes.
10. Sterile 96-well round-bottom tissue culture plates.
2.7.3 Restimulation of T 1. Sterilized tweezers and pairs of scissors for the preparation of
Lymphocytes pLNs and spleen.
2. Complete RPMI medium with supplements and 10% FCS (see
Subheading 2.2.1, item 5).
3. Freeze-thaw (ft) lysate of L. major promastigotes (prepared

from for example 10 mL of a 1 × 109 L. major promastigotes/
mL suspension in PBS that was aliquoted into 2 mL microcen-
trifuge tubes and subjected to five cycles of freezing (−80 °C)
and thawing [on ice]; stored at −80 °C).
4. Purified anti-CD3ε antibody (clone 145-2C11, e.g., BioXCell).
5. Concanavalin A (ConA, Sigma).
6. PBS.
7. 96-well round- and flat-bottomed tissue culture plates.
8.
Cytokine ELISA or bead-based immunoassay (e.g.,
LEGENDplex™, Biolegend).
3 Methods
3.1 General Remarks 1. When handling L. major parasites or infected organs, prepar-
ing amastigotes, or infecting mice, always wear lab coat, gloves
3.1.1 Important Remarks
and goggles.
on Lab Safety
2. When handling chloroform or phenol-containing TRIzol®,
always work in a fume hood and wear lab coat, gloves, and
goggles to protect yourself from toxic fumes and/or skin and
eye burns.
3.1.2 Important Remarks 1. All cell culture procedures need to be performed in a laminar
on General Lab Practice airflow cabinet using sterile aseptic techniques.
2. All cultures of L. major parasites (i.e., maintenance of promas-
tigotes, generation of promastigotes from infected tissues or
purified amastigotes) are routinely kept at (26-)28 °C with 5%
CO2 and 95% humidified air.
3. All cultures of mouse immune cells are routinely kept at 37 °C
with 5% CO2 and 95% humidified air.
4. When preparing total RNA from tissues or cells, always wear
gloves to avoid contamination with skin-derived RNases. All
plasticware, reagents, buffers and solutions need to be molecu-
lar biology grade, RNase- and DNase-free and reserved for
RNA work only. Glassware, spatulas, tweezers, and scissors are
baked at 200 °C for at least 2 h.
3.2 In Vitro Culture 1. Harvest stationary-phase L. major promastigotes (see Note

of L. major 3), densely grown in 96-well flat-bottomed plates with (a)
NNN-blood agar slants and 100 μL/well complete RPMI1640
3.2.1 Harvesting of L.
with 10% FCS or with (b) 100 μL/well cmSDM, with an
major Promastigotes
8-channel multipipette. To obtain optimal parasite yields,
pipet up and down several times without touching the agar
slant (see Note 4).
2. Transfer the parasite suspension first into a polystyrene petri dish

and from there into a 50 mL polypropylene centrifuge tube.
3. Fill up with PBS (with or w/o 1% FCS).
4. Centrifuge at 3400 × g for 10 min. at 4 °C (see Note 5).
5. Carefully and completely remove the supernatant.
6. (a) For in vitro or in vivo infection experiments: perform two
additional steps of washing (resuspend the parasite pellet in
30 mL PBS and centrifuge as above) before final resuspension
in PBS (for in vivo infection) or in the desired cell culture
medium (e.g., for in vitro macrophage infections or T cell
stimulation assays) at the density needed (see step 7).
(b) For passaging: resuspend in complete RPMI1640 with 10%
FCS or in cmSDM and adjust the parasite density as needed (see
step 7).
7. Determination of parasite numbers:
(a) Mix 10 μL of the parasite suspension with 90 μL trypan blue
working solution (see Subheading 2.2.1, item 13) and
count the parasites in one large square (1 mm2) of a modi-
fied Neubauer chamber (depth 0.02 mm; see Note 6).
(b) Calculate the parasite concentration and total number:
L .major / mL = parasites / large square ´ dilution factor ( here : 10 ) ´ 50
0 ´ 1000
8. Adjust the parasite density as desired.
3.2.2 Freezing of Parasites should be frozen at a minimum density of 1 × 107 pro-

L. major Promastigotes mastigotes/mL (e.g., in 90% FCS plus 10% DMSO) and stored in
liquid nitrogen.
3.2.3 In Vitro Passaging 1. For in vivo infection experiments and long-term maintenance:
of L. major Promastigotes (a) The parasites are kept in 96-well flat-bottomed plates with
NNN-rabbit blood agar slants and 100 μL/well RPMI1640
with 10% FCS.
(b) Cultures are split 1: 200 (or higher) on a weekly basis.
(c) After a maximum of six consecutive in vitro passages, a
new stock of L. major promastigotes is obtained from
lesional amastigotes (see Subheading 3.3) or a new aliquot
of a previously frozen large stock of an early NNN-blood
agar passage of L. major promastigotes is thawed to ascer-
tain the infectivity of the promastigotes.
2. For short-term expansion (e.g., for in vitro infection experi-
ments, biochemical or molecular biological experiments):
A small aliquot of stationary-phase L. major promastigotes
from a NNN-blood agar culture is transferred into a 96-well
flat-bottomed plate or a 25 cm2 tissue culture flask with cmSDM
and allowed to grow for 5–6 days until the stationary growth-
phase is reached.
3.3 Preparation of 1. L. major-infected BALB/c wild-type or Rag1- or Rag2-

L. major Amastigotes deficient mouse with a nonulcerated skin lesion of the foot is
euthanized according to approved animal protocols.
2. Carefully disinfect the entire mouse corpse with 70% ethanol.
3. Aseptically remove the infected foot below the ankle and cut
off the toes.
4. Transfer into 15 mL polypropylene tube with 10 mL sterile PBS.
5. Pour the PBS with the mouse foot onto the metal sieve that
was placed into a sterile polystyrene petri dish.
6. Using sterile tweezers and a pair of scissors carefully cut the
foot into small pieces.
7. Mince the pieces of tissue with the plunger and pass them
through the sieve.
8. Rinse the metal sieve with additional 10 mL of PBS.
9. Draw the suspension into a 20 mL syringe.
10. Press the suspension two (to four) times through a 27 G needle
in a 50 mL polypropylene tube. Cave: Make sure that the needle
is tightly fixed on the syringe.
11. Place the tube for exactly 5 min. on ice, which allows sedimen-
tation of larger debris of tissue.
12. Harvest supernatant and centrifuge at 120 × g and 4 °C for
5 min to remove tissue debris (NB: released amastigotes will
not quantitatively sediment).
13. Harvest supernatant, pass again through 27 G needle, and
centrifuge at 120 × g and 4 °C for 5 min.
14. Harvest supernatant and centrifuge at 3200 × g and 4 °C for
15 min.
15. Resuspend the pellet of amastigotes in sterile PBS and deter-
mine the number of parasites and their purity in a modified
Neubauer chamber (see Subheading 3.2.1, step 7).
16. Keep the amastigote preparation on ice until use. L. major
amastigotes can be used for in vitro macrophage infections
(for examples see ref. [73, 74]) or for setting up a new L. major
promastigote culture (see Subheading 3.2.3, step 1 (c)).
3.4 In Vivo Infection 1. Prepare a suspension of L. major promastigotes (derived from a

of Mice stationary-phase NNN-blood agar culture [see Subheading 3.2.1,
step 6]) in sterile PBS. Depending on the number of parasites to
be inoculated in a volume of 50 μL, the parasite concentration
will vary between 400/mL (equals 20 parasites/50 μL) and
6 × 107 (equals 3 × 106 parasites/50 μL).
2. Put mouse into restrainer which allows free access to the lower
leg and foot.
3. Subcutaneously (s.c.) inject 50 μL of the parasite suspension

into the footpad or the back of the foot using a 27 G needle
and a tuberculin syringe (see Notes 7 and 8).
4. For certain experiments (e.g., transcriptome analyses at day 1
or 2 of infection [see Subheading 3.7.1]), control mice need to
be injected with PBS alone [75].
3.5 Clinical Course The clinical course of L. major infection is followed by (a) measur-
of Infection ing the thickness of the infected foot and of the contralateral unin-
fected foot (once or twice weekly) and by (b) determining the
body weight of the mice (weekly).
1. Perform the measurements at day 0 (immediately prior to
infection) and then at day 3, 7, 10, 14, 17, 21, 24, 28 etc. after
L. major infection.
2. Put mouse into restrainer which allows free access to the lower
leg and foot.
3. Measure the maximal thickness of the foot lesion using a
mechanical metric caliper (see Note 9) and determine the body
weight of the mice (see Note 10).
4. Calculate for each day the relative increase of the foot thickness
(see Note 11):
% thickness increase = ({infected foot [ mm ] - uninfected foot [ mm ]}
¸ uninfected foot [ mm ]) ´ 100
3.6 Tissue 1. L. major-infected mice with nonulcerated foot lesion are euth-
Parasite Burden anized according to approved animal protocols.
3.6.1 Removal of Organs 2. Carefully disinfect the entire mouse corpse with 70% ethanol.
and Preparation of Tissue
Homogenates
3.6.1.1 Skin Lesion 1. Aseptically remove the infected foot below the ankle, cut off
the toes and weigh the foot.
2. Transfer into 15 mL polypropylene tube with 10 mL sterile
PBS and put on ice.
3. Pour the PBS with the mouse foot onto a sterilized metal sieve
that was placed into a sterile polystyrene petri dish.
4. Using sterile tweezers and a pair of scissors carefully cut the
foot into small pieces.
5. Mince the pieces of tissue with the plunger of a 10 mL syringe
and pass them through the sieve. Rinse with additional 10 mL
sterile PBS.
6. Harvest the cell suspension from the petri dish and transfer in
a 50 mL polypropylene tube.
7. Centrifuge at 3400 × g and 4 °C for 10 min (see Note 12).

8. Resuspend the cell pellet in 3 mL cmSDM (see Subheading
2.2.3.3).
3.6.1.2 Draining Popliteal 1. Remove the skin from the lower extremities of the L. major-
Lymph Node (pLN) infected mouse, bluntly prepare the fossa poplitea and remove
the draining pLN.
2. Transfer the pLN into a sterile microcentrifuge tube filled with
1 mL PBS and predetermined tare weight.
3. Weigh the tube with the pLN and thereby determine the
weight of the pLN.
4. Empty the microcentrifuge tube with the pLN on a 100 μm
cell strainer placed on top of a 50 mL polypropylene tube.
5. Using the plunger of a 2 mL syringe pass the pLN through a
100 μm cell strainer and flush the cell strainer with 15 mL PBS.
6. Centrifuge the cell suspension at 3400 × g and 4 °C for 10 min
(see Note 12).
7. Resuspend the cell pellet in 3 mL PBS and determine the cell
number per mL with a regular Neubauer counting chamber
(depth 0.1 mm) (see Note 13).
8. Prepare 3 mL of a pLN suspension in cmSDM with a cell
concentration of 1 × 106/mL (or lower depending on the
time-point of infection and the size of the pLN). The remain-
der of the original pLN cell suspension in PBS can be used for
immunophenotyping (see Subheading 3.7).
3.6.1.3 Spleen 1. Remove the skin from the abdomen of the sacrificed L. major-
infected mouse.
2. Cut the peritoneum on the left-lateral side and resect the entire
spleen.
3. Transfer the spleen into a sterile microcentrifuge tube filled
with 1 mL PBS and predetermined tare weight.
4. Weigh the tube with the spleen and thereby determine the
weight of the spleen (see Note 14).
5. Empty the microcentrifuge tube with the spleen on a 100 μm
cell strainer placed on top of a 50 mL polypropylene tube.
6. Using the plunger of a 2 mL syringe pass the spleen through a
100 μm cell strainer and flush the cell strainer with 15 mL PBS.
(see Note 12).
8. Resuspend the cell pellet in 5 mL erythrocyte lysis puffer
(37 °C) and leave at room temperature for exactly 5 min.
9. Stop the lysis by adding at least 30 mL PBS.
(see Note 12).
11. Determine the cell number per mL with a regular Neubauer
counting chamber (see Note 13).
12. Prepare 3 mL of a spleen suspension in cmSDM with a cell
concentration of 1 × 107/mL (or lower depending on the
time-point of infection and the size of the spleen). The remain-
der of the original spleen cell suspension in PBS can be used
for immunophenotyping (see Subheading 3.7).
3.6.2 Limiting Dilution The parasite load in the tissues (skin, pLN, spleen) will be deter-
(LD) Analysis mined by classical LD analysis adapting previously published
protocols and statistical methods [76, 77]. The procedure entails
16 or 24 serial 1:2, 1:3, or 1:5 dilutions with at least 12 replicates
per dilution step in cmSDM, depending on the mouse strain, the
organ and the time-point of infection (Table 4).
1. Prepare serial 1:2, 1:3, or 1:5 dilutions of the original tissue
suspension (3 mL) in cmSDM using 5 mL polystyrene tubes
(see Note 15).
2. Using a repeating pipette, seed 12 wells of a 96 well flat-bot-
tomed plate with 100 μL of each dilution. Start with the highest
dilution first, which makes changing of pipette tips dispensable.
Carefully avoid spill-overs into neighboring wells.
3. Incubate the plates at 28 °C/5%CO2/95% humidified air for
10–14 days.
4. Read the plates in a 96 well-plate photometer (ELISA reader)
at 450 nm. Wells with dense parasite growth, but also with
high host cell numbers, will have a “positive” OD value.
5. Microscopically scrutinize all wells for the presence of L. major
promastigotes, which were read as “positive” (due to high host
Table 4
Parameters for LD analysis of different organs and mouse strains after L. major infection
L. major-infected C57BL/6 mouse L. major-infected BALB/c mouse

Parameter (self-healing) (nonhealing)
Skin Skin
lesion pLN Spleen lesion pLN Spleen
Starting concentration of n.a.a 1 × 106/mL 1 × 107/mL n.a. 1 × 106/mL 1 × 107/mL
cell suspension
Dilution factor 1:3 1:3 1:2 1:5 1:5 1:3
No. of dilution steps 16–24 16–24 16 24 24 24
n.a not applicable
a
cell numbers) or “negative” (due to low or absent parasites) in

the 96 well-plate photometer.
6. Determine the number of parasite-positive and parasite-negative
wells for each dilution step.
7. Perform statistical analysis with the L-Calc™ software, which
analyses data by applying the Poisson distribution and the χ2
test. Calculate parasite loads (± 95% confidence intervals [CI])
per gram tissue or per 1 × 105 cells. Statistical significance
between parasite loads is assumed when 95% CI do not
overlap.
3.7 Immunopheno- 1. This method allows to quantify mRNA expression levels of

typing of L. major- cytokines, effector molecules and transcription factors that are
Infected Mice critically involved in the protective or nonprotective immune
response in CL (see introduction).
3.7.1 mRNA Analyses
2. It is recommended to evaluate the mRNA expression profile at
several time-points during the course of infection, covering the
early (day 1 post infection [p.i.]), acute (day 15, 25, 35, 50
p.i.), and persistent/latent phase of infection (>day 100 p.i.).
3. Organs of noninfected mice should always be included to allow
for the calculation of infection-induced expression level
changes relative to naïve mice.
4. Organs of PBS-injected control mice need to be included when
analyzing early time-points (day 1, 2 or 3) of infection in order
to detect changes of gene expression due to the injection pro-
cess itself. At later time-points of infection, age-matched naïve
mice without PBS-injection are sufficient controls.
5. When mRNA is prepared from total organs, infection-induced
alterations in the expression of certain molecules may be missed
if only a minor cell population accounts for the expression of
the respective gene (e.g., IL-12 production by dendritic cells).
In this case it is recommended to purify the cell population for
example by flow cytometry-based or magnetic cell sorting
prior to mRNA expression analysis.
3.7.1.1 Preparation 1. Mice are euthanized according to the animal protocol and
of Total RNA from Infected thoroughly disinfected with 70% ethanol. Please note general
Organs lab practice and safety remarks (see Subheading 3.1).
2. Prepare the organs of interest (cut lesional skin without ten-
dons and bones into small pieces; at least one complete pLN;
one eighth to one half of the spleen) with tweezers and pairs of
scissors.
3. Place the tissue immediately into sterile 2 mL tubes filled with
1 mL of TRIzol® (or equivalent reagent). Alternatively, if RNA
extraction is postponed, put the tissue samples into empty tubes,
immediately freeze in liquid nitrogen and store at −80 °C.
4. Add one (lymph node, spleen) or two (skin) stainless steel

beads and homogenize the tissue in the tissue lyser for 5 min,
either at maximum speed (30 movements/s) or according to
the manufacturer’s organ-specific recommendations.
5. Mix the lysate with 200 μL chloroform and vigorously shake it
for 30 s to achieve proper extraction. Incubate for 5 min on
ice.
6. Centrifuge at 12,500 × g and 4 °C for 15 min.
7. Transfer the upper aqueous phase into a fresh tube, mix with
500 μL isopropanol by inverting the tube six times and leave at
room temperature for 10 min.
8. Centrifuge at 12,500 × g and 4 °C for 10 min.
9. Wash RNA pellet with 1 mL 75% (v/v) ethanol and centrifuge
again at 7500 × g and 4 °C for 5 min.
10. Air-dry the RNA pellet and dissolve it in 50–100 μL RNase-
free water for 10 min at 55 °C.
11. If qPCR will be performed with non-intron spanning primers,
digest contaminating genomic DNA by treating the samples
with RNAse-free DNase I (60 min at 37 °C) (see Notes 16
and 17).
12. Determine the concentration of RNA (e.g., using a UV spec-
trometer). An absorbance (A) of 1 at 260 nm equals 40 μg/
mL RNA. The ratio A260nm/280nm should be >1.8 indicating that
your RNA preparation is not significantly contaminated with
proteins which have their absorption maximum at 280 nm.
3.7.1.2 cDNA Synthesis 1. Depending on the RNA yield reverse transcribe 1–10 μg of
total RNA into cDNA following the instructions of the High
Capacity cDNA reverse transcription kit (see Note 18).
2. Total RNA solution (1–10 μg) is mixed at a 1:1 ratio with the
RT (reverse transcription)-PCR master mix containing the
reverse transcriptase enzyme, nucleotides, and random primers
in 2 × RT-PCR buffer.
3. RT-PCR is performed with the following cycle conditions:
10 min at 25 °C, 120 min at 37 °C.
3.7.1.3 Quantitative 1. We routinely use a TaqMan probe-based amplification and

Real-Time PCR detection system (see Note 19).
2. For qPCR 50–100 ng cDNA is used as template in each reac-
tion and analyzed in duplicates or triplicates.
3. The gene of interest is amplified using gene expression assays
that include optimized target gene-specific primers and a probe
labeled by the 6-FAM (6-carboxyfluorescein) reporter dye and
a nonfluorescent quencher.
4. The gene-specific assay is mixed in a 1:1 ratio with 2× TaqMan®

Universal Mastermix II, no UNG, containing the DNA poly-
merase, nucleotides and the reference dye ROX (see Note 20).
5. Depending on the real-time PCR machine used the total
volume per PCR reaction is 20 μL (96-well plate) or 10 μL
(384-well plate).
6. Perform the PCR reaction with the following cycle conditions:
2 min at 50 °C, 10 min at 95 °C, plus 40 cycles of 15 s at 95 °C
and 60 s at 60 °C.
7. PCR results are given as C t (threshold cycle) values (see
Note 21).
8. For relative quantification, the mRNA expression level of the
target gene is normalized to the expression level of the house
keeping gene using the following formula based on the 2−ΔCt
method: 2−(Ct target − Ct endogenous control).
9. If desired, mRNA expression may be calibrated to one sample
(e.g., day 0, naïve mice) and results can be presented as fold
induction.
3.7.2 Flow-Cytometric 1. Prepare skin lesion tissue without bones and toes, draining
Characterization pLN and/or (a piece of the) spleen and transfer the tissue
of Immune Cells sample(s) into sterile microcentrifuge tube(s) kept on ice.
3.7.2.1 Preparation 2. For generation of single cell suspensions from draining pLN or
of Single Cell Suspensions spleens: proceed as detailed in Subheading 3.6.1.2 (steps 1–5)
and Subheading 3.6.1.3 (steps 1–6).
3. For generation of single cell suspensions from skin lesions (see
Note 22):
(a) Cut the tissue in small pieces and suspend them in 1 mL
RPMI1640 containing 200 μg/mL collagenase P and
100 μg/mL DNAse I.
(b) Place the tube containing the tissue fragments in a 37 °C
shaker for 45 min.
(c) Transfer the digested tissue to a 100 μm cell strainer placed
on top of a 50 mL polypropylene tube.
(d)
Using the plunger of a 2 mL syringe pass the tissue
through the cell strainer and flush the cell strainer with
10 mL PBS.
4. Centrifuge the skin, pLN or spleen cell suspension at 350 × g
and 4 °C for 10 min.
5. Draining pLN: determine the cell number with a regular
Neubauer counting chamber (see Note 13).
6. Spleen: Perform red blood cell lysis (see Subheading 3.6.1.3,
steps 8–10, but centrifuge with 350 × g and 4 °C for 10 min.)
prior to cell counting.
7. Skin lesion:
(a) Resuspend cell pellet in 2.5 mL 40% Percoll (50 mL prep-
aration: 20 mL Percoll stock solution, 2.2 mL 10× PBS,
27.8 mL HBSS) and carefully transfer it onto a 1.5 mL
60% Percoll (50 mL preparation: 30 mL Percoll, 3.3 mL
10× PBS, 16.7 mL HBSS) in 5 mL polystyrene tubes to
remove cell debris from the suspension.
(b)
Centrifuge with slow acceleration and without brake
(930 × g, 20 min, room temperature!).
(c) Carefully remove the gradient from the centrifuge.
(d) Gently take off the debris on top of the 40% layer with a
pipette and discard it.
(e) Transfer the cell layer at the interphase of 40% and 60% to
a new 50 mL tube filled with 20 mL 1× PBS.
(f) Centrifuge the cells (350 × g, 10 min, 4 °C) and determine
the cell number.
3.7.2.2 Staining 1. Design a detailed staining protocol and make yourself familiar
of Cell-Specific Surface with the basic principles of flow cytometry using available
Molecules reviews [78] (see Note 23).
2. Use 1–2 × 106 cells in 100 μL PBS in a 5 mL tube per
staining.
3. Add fixable viability dye (FVD) at a final dilution of 1:1000.
4. Mix cells by gentle vortexing.
5. Incubate for 20 min in the dark at 4 °C. In case you use other
cell viability dyes optimal concentration has to be determined
before.
6. Wash cells with cold FACS staining buffer and centrifuge at
350 × g and 4 °C for 6 min.
7. Pour off supernatant which usually leaves a residual volume of
approximately 100 μL sufficient to resuspend the cell pellet.
8. Add 2 μL of rat anti-mouse CD16/32 antibodies (Fc Block,
concentration 0.5 mg/mL) (see Note 24).
9. Incubate at room temperature for 5 min.
10. Add your mix of fluorochrome-labeled antibodies (see Note 25).
11. Mix cells by gentle vortexing and incubate for 20 min in the
dark at 4 °C.
12. Wash cells as mentioned above.
13. If your antibody mix contains a biotin-labeled antibody, proceed
with a second staining using fluorochrome-labeled streptavidin.
14. Wash cells as mentioned above.
15. Pass the stained cells through a nylon mesh (100 μm) to avoid
clogging during acquisition at the flow cytometer.
16. Acquire at least 10,000 to 50,000 cells of your sample on a

flow cytometer (see Note 26).
17. Analyze your data using FlowJo® software or any other compa-
rable software.
18. Exclude cell debris in the forward scatter (FSC-A)/sideward
scatter (SSC-A) plot by gating out dots with very low FSC
intensity. Gate on single cells in the FSC-A/FSC-H plot.
Exclude dead cells stained by the viability dye.
19. Analyze your cell-type specific stainings, using histograms, dot
plots, or volcano plots for data presentation.
3.7.2.3 Intracellular To analyze whether L. major infection induces expression of cyto-

Cytokine Staining kines (e.g., IFN-γ, IL-4, IL-10) or other effector molecules (e.g.,
NOS2, arginase 1) in certain immune cell populations, surface
staining of immune cell markers can be combined with the intra-
cellular staining of the target molecules.
1. Culture cells in complete RPMI1640 medium (see Subheading
2.2.1, item 5) in 96-well round-bottom plates (maximal cell
number per well 1 × 106, total volume per well 200 μL) for 4 h
in a 37 °C cell incubator in the presence of 10 μg/mL brefeldin
A (blocks secretion of proteins to allow for the intracellular
accumulation of the target molecules) (see Note 27).
2. Perform surface staining of cells as described in Subheading
3.7.2.2, steps 1 to 12 or 1 to 14.
3. For fixation and simultaneous permeabilization of cells add
200 μL Cytofix/Cytoperm™ solution per tube. Wear gloves as
Cytofix/Cytoperm™ contains toxic formaldehyde.
4. Mix cells immediately by gentle vortexing and incubate them
in the dark at 4 °C for 20 min.
5. Wash cells twice with saponin buffer.
6. Add cytokine- or effector molecule-specific antibody at the
appropriate concentration (dilution) determined in pilot
experiments.
7. Mix cells by gentle vortexing and incubate them in the dark at
4 °C for 20 min.
8. Wash cells in FACS staining buffer.
9. Acquire your samples on a flow cytometer.
3.7.3 Restimulation of T 1. Prepare pLN and spleen single cell suspensions as described in
Lymphocytes Subheading 3.7.2.1.
2. Seed pLN and spleen cells in round bottom 96-well plates in
complete RPMI medium (total volume per well 250 μL, cell
number per well 1–2.5–5 × 105).
3. Stimulate the T cells within the culture (a) by the T cell recep-
tor-crosslinking lectin ConA (2.5 μg/mL) and (b) in a
Leishmania antigen-specific manner by adding ft. L. major
lysate in a parasite–cell ratio of 5:1 (important: briefly vortex
the ft. lysate just before use to ascertain homogenous suspension
of the lysed parasites). Instead of using ConA the T cells can
also be stimulated with plate-bound anti-CD3ε (see Note 28).
Set up the cultures in triplicates for all conditions.
4. Incubate the cells for 72 h at 37 °C, 95% humidified air and 5%
CO2.
5. Collect the cell culture supernatant after 24 to 72 h.
6. Test the cell culture supernatant for the content of T cell
derived cytokines such as IFN-γ (Th1), TNF (Th1), IL-4
(Th2) and/or IL-10 (Th2, regulatory T cells) with the help of
commercially available ELISAs or a bead-based immunoassay
that simultaneously detects several cytokines.
4 Notes
1. For measurement of pH a small aliquot of the agar is trans-

ferred into a sterile plastic tube in order to avoid endotoxin
contamination of the agar by the pH meter electrode.
2. When gene-deficient mouse strains are studied, wild-type lit-
termates need to be used as controls. The mouse genetic back-
ground has a strong influence on the course of Leishmania
infections. Many transgenic mouse lines have been generated
on 129Sv background and were then crossed back to for exam-
ple C57BL/6 or BALB/c background. As resistance-mediat-
ing genes can co-segregate with the deleted gene locus, the use
of regular C57BL/6 or BALB/c wild-type mice as controls
would be inappropriate.
3. During the initial logarithmic (exponential) growth phase L.
major promastigotes are slender and highly motile and rapidly
divide in rich media (e.g., NNN-agar, cmSDM). Cell division
of L. major starts at the flagellum (anterior pole), continues
with the division of the kinetoplasts and the nucleus (mitosis)
and ends with the cytokinesis (separation of the cytoplasm)
proceeding toward the posterior pole. During logarithmic
growth parasites can adhere to each other as “rosettes,” with
the flagella of the parasites facing the center of the cluster [79];
“doublets” with two parasites being connected to each other
at their posterior pole before cytokinesis is completed can also
be observed [80, 81]. During the stationary growth phase the
parasites are densely packed, become increasingly less motile
and the cell bodies ultimately acquire a more stumpy form.
Procyclic, logarithmically growing L. major promastigotes

are less infectious than stationary-phase promastigotes [22, 23].
L. major promastigotes can be enriched for highly infectious
metacyclic stages by agglutination of procyclic stages with
peanut agglutinin (PNA) [22]. PNA-mediated enrichment
for metacyclics works well with L. major Friedlin strain [22],
but much less so with L. major FEBNI strain (less than 1%
metacyclics in stationary-phase L. major FEBNI promasti-
gotes [C. Bogdan, unpublished observations]). In our labora-
tory and according to the experience of others [23] the
clinical course of intradermal ear infections or s.c. footpad
infections was not much different between stationary-phase
and metacyclic L. major promastigotes.
4. From a densely grown 96-well NNN-agar plate a total parasite
yield of ca. 4–6 × 108 promastigotes can be expected.
5. Parasite pellets ideally appear greyish or ivory. Contamination
with red blood cells from the NNN-agar slants can be easily
recognized and might result from either touching the agar
during the harvesting process or from using NNN-agar plates
stored for too long. The latter can also cause red blood cell
lysis. Please note that red blood cell, hemoglobin or heme con-
tamination of parasite preparations can have an inhibitory
impact on macrophage functions [82, 83].
6. (a) If the number of parasites per large square exceeds 150,
further dilution is recommended to ascertain accurate count-
ing. (b) If the parasites are too motile (i.e., enter and leave the
group squares within the large square), use PBS with 1% para-
formaldehyde rather than the 0.05% trypan blue working solu-
tion for counting.
7. When injecting groups of inbred mice, the parasite preparation
needs to be repeatedly resuspended and mixed to remain
homogenous. Injection should be performed steadily and
always at the exact same anatomic site. Make sure that the
injected volume does not leak out of the tissue. Always wear
gloves and goggles and avoid needle stick injuries by proper
disposal of the syringes with the needles into special sharps
container.
8. A valid alternative site for infection is the ear dermis [84].
Other previously used sites of infection are the tail-base as well
as the dorsal skin of the rump. Each location has its advantages
and disadvantages (Table 5).
9. When measuring the skin lesions it is important to always
determine the maximum thickness of a given lesion. Within
one experiment all measurements should be carried out by one
and the same person.
Table 5
Possible sites of infection in mouse cutaneous leishmaniasis
Infection site Advantages Disadvantages

Back of the foot • Easy to perform • s.c. rather than intradermal infection
or footpad • Wide range of parasite numbers can be • Mice need to be sacrificed when
used for infection lesions ulcerate
• Anesthesia of mice not necessary
• Determination of lesion size as thickness
is highly reproducible and can be done
by one experimentator
Ear skin • Strictly intradermal infection (as there is • Anesthesia of mice necessary
no subcutis in the mouse ear), • Determination of lesion size is more
resembling the natural sand fly infection complex and requires measurement
mode of thickness, width and length with
the help of two experimentators
Tail-base • Easy to perform • Quantitative lesion size
• Anesthesia of mice not necessary measurements not possible
• Loss of tail possible; therefore not
recommended
Dorsal skin of • Easy to perform • Quantitative lesion size
the rump • Anesthesia of mice not necessary measurements not possible
• Will lead to nonhealing ulcers even
in genetically resistant mouse strains
[34]; therefore not recommended
10. In addition to the daily inspection of the mice, which is neces-

sary to recognize possible physical burden or stress of the mice,
the weekly measurement of the body weight is important to
record potential systemic effects of the skin infection (e.g.,
weight loss during the development of visceral leishmaniasis in
the case of L. major-infected BALB/c mice).
11. In case of bilateral infections or secondary infections (after
healing of a unilateral primary infection) the lesion size devel-
opment has to be calculated by relating the thickness of the
infected foot to the thickness prior to infection.
12. 3400 × g is used to ascertain complete sedimentation of
Leishmania parasites.
13. Cell count needs to include both viable (trypan blue-negative)
and dead cells (trypan blue-positive), because viable parasites
can also reside in cells that have died during the preparation of
the cell suspension.
14. If the spleen is also used for other purposes (e.g., RNA prepa-
ration and transcriptome analysis, [immuno]histology), divide
the spleen into parts and determine the weight of the part used
for LD analysis.
15. Important: (a) Change pipette tips after each dilution step to
prevent carry-over of parasites from lower to higher dilution
steps. (b) The minimum final volume per dilution should be
1.5 mL (sufficient for seeding 12 replicates with 100 μL each).
16. We recommend the DNAfree® DNA removal kit from Thermo
Fisher Scientific (cat. no. AM1906), because after the digest
DNAse is not inhibited by adding EDTA, which might inter-
fere with the subsequent qPCR reaction.
17. Complete digestion of genomic DNA can be verified by the
absence of mouse β-actin DNA amplification in a conventional
PCR reaction using 1 μL of the digested RNA sample as tem-
plate (95 °C for 5 min, 35 cycles of 95 °C 30 s, 58 °C 30 s and
72 °C 30 s; sense primer: 5′-CACCCGCCACCAGTTC
GCCA-3′; antisense primer: 5′-CAGGTCCCGGCCAG
CCAGGT-3′).
18. We recommend this kit, because cDNA synthesis is done with
random hexamer primers that cover the entire length of the
mRNA transcripts rather than the 3′-end of mRNA transcripts
as it is the case with oligo-dT primers often used in cDNA
synthesis. Another advantage is that the cDNA yield can be
scaled up to 10 μg per reaction.
19. The quantification of a target gene within the cDNA prepara-
tion is based on its amplification in a PCR reaction with gene-
specific primers that is monitored “in real time” by generation
of a fluorescent signal during each PCR cycle. The higher the
starting copy number of the gene of interest is, the sooner a
significant increase of the fluorescence signal will become
detectable. The fluorescence signal may be released by two dif-
ferent strategies, the SYBR® Green or the TaqMan™-based
chemistry. The SYBR® Green I dye binds to each new copy of
double-stranded DNA as soon it is formed during the gene-
specific PCR, resulting in a gain of fluorescence intensity pro-
portional to the amount of PCR product generated. In
contrast, in TaqMan™ technology a gene-specific probe
labelled with a reporter dye at the 5′ end, whose fluorescence
is extinguished by the nearby quencher dye fixed to the 3′ end
of the probe, anneals downstream from one of the primer sites.
During PCR reaction the reporter dye is cleaved by the 5′
nuclease activity of the Taq polymerase enzyme and the
reporter fluorescence becomes detectable as the quencher is
now separated from the reporter and is therefore no longer
able to inhibit its signal. During each PCR cycle additional
reporter dye molecules will be cleaved and enhance the fluo-
rescence intensity proportional to the amplified gene product.
Due to the higher specificity we prefer to use the TaqMan™
based qPCR system.
20. For relative quantification, a house keeping gene has to be

included in the analysis as endogenous control besides the tar-
get genes of interests. We routinely use Hprt1 (hypoxanthine-
phosphoribosyl-transferase 1), which is not regulated during
L. major infection in mice.
21. The Ct value represents the cycle number at which the fluores-
cence generated by the amplicon crosses the background fluo-
rescence level. The lower the Ct value, the higher is the
expression level of the gene of interest.
22. Use this protocol for tissue digestion also when planning to
analyze minor cell populations (e.g., macrophages, dendritic
cells, lymphatic endothelial cells) or fibroblast reticular cells in
other types of tissue, because these cell types are embedded in
extracellular matrix and connective tissue and are therefore not
quantitatively recovered by just using the cell strainer.
23. Flow cytometry allows the multiparametric analysis of cell sur-
face or intracellular antigens of cells. The number of surface
markers that can be stained simultaneously by specific antibod-
ies depends on the specifications of the flow cytometer (number
of lasers). Usually, surface antigens with weak expression are
stained by dyes with bright emission (e.g., PE [phycoerythrin],
APC [allophycocyanin] or BV421 [Brilliant Violet 421]),
whereas antigens strongly expressed can also be sufficiently
detected with dyes of lower brightness (e.g., FITC [fluorescein
isothiocyanate], APCeFluor 780). It is strongly recommended
to avoid staining of the very same cell with dyes that show a
strong overlay in their emission spectra and require massive
compensation. Multicolor staining panels including ≥6–8
dyes should be tested in advance and adjusted accordingly. To
control for specific staining, isotype or FMO (fluorescence-
minus-one) controls are required [85]. In order to adjust
proper instrument settings (PMT voltage) and compensation
of different fluorescence dyes with overlays in their emission
spectra, both unstained controls and cells or beads stained
with a single dye are necessary.
24. This serves to saturate Fcγ receptors expressed on the surface
of cells, thereby avoiding nonspecific binding of the fluoro-
chrome-labeled antibodies via their Fc parts.
25. The optimal concentration (dilution) of the antibodies for
proper staining has to be determined in pilot experiments.
In case you stain several samples with the same combination of
antibodies, it is strongly recommended to prepare a common
antibody mix to treat all samples in the same manner.
26. In case you are interested in small cell populations (e.g., mac-
rophages, dendritic cells, NK cells, innate lymphoid cells), try
to acquire a high number of cells (≥ 0.5–1 × 106) to get statis-

tically reliable results.
27. A 4 to 6 h in vitro culture period with brefeldin A is usually
sufficient for detecting cytokines in T cells that had become
activated by the in vivo infection with Leishmania; incubation
with brefeldin A is not required if intracellular effector mole-
cules such as NOS2 or arginase 1 are stained. As a positive
control for the intracellular cytokine staining, cells should be
additionally stimulated for maximal cytokine release. In the
case of analysis of T cell-derived cytokines, 50 ng/mL PMA
and 750 ng/mL ionomycin for 4 h are useful as strong
stimulants.
28. Rat anti-CD3 ε antibodies are attached to the bottom of
96-well flat-bottomed plates. To this end, add 50 μL PBS con-
taining 5 μg/mL anti-CD3ε per well and incubate for 2 h at
37 °C. Wash the plate with PBS twice and add 1–2.5–5 × 105
lymph node or spleen cells in 250 μL complete RPMI medium.
Acknowledgments
The preparation of the manuscript and some of the studies reviewed

were supported by the Deutsche Forschungsgemeinschaft
(SFB1181, project C4; GK1660, project A5; SPP1937, Bo996/5-
1), the Interdisciplinary Center for Clinical Research (IZKF) of the
Universitätsklinikum Erlangen (project A61 and A63), and the
Bundesministerium für Bildung und Forschung (BMBF; Infect-
Era “EpiCross”).
References
1. Rittig MC, Bogdan C (2000) Leishmania- resources/Leishmaniasis_worldwide_epide-
host cell interaction: complexities and alterna- miological_and_drug_access_update.pdf.
tive views. Parasitol Today 16:292–297 Accessed May 30 2012
2. Kaye P, Scott P (2011) Leishmaniasis: com- 6. Steverding D (2017) The history of leishman-
plexity at the host-pathogen interface. Nat iasis. Parasit Vectors 10(1):82. https://doi.
Rev Microbiol 9(8):604–615 org/10.1186/s13071-017-2028-5
3. Bogdan C (2012) Leishmaniasis in rheumatol- 7. Bayon H (1912) Demonstration of specimens
ogy, hematology, and oncology: epidemiologi- relating to the transmission of artificial cul-
cal, immunological, and clinical aspects and tures of Leishmania infantum to mice and
caveats. Ann Rheum Dis 71(suppl 2):i60–i66 rats. Brit Med J 2(2705):1197–1199
4. Banuls AL, Bastien P, Pomares C, Arevalo J, 8. Philippe E, Chadli A (1961) Experimental
Fisa R, Hide M (2011) Clinical pleiomor- leishmaniasis in the mouse (Leishmania don-
phism in human leishmaniases, with special ovani and Leishmania tropica). Arch Inst
mention of asymptomatic infection. Clin Pasteur Tunis 38:241–254
Microbiol Infect 17(10):1451–1461 9. Kellina OI (1973) Differences of susceptibil-
5. Leishmaniasis: worldwide epidemiological ity of inbred mice of different strains to
and drug access update (2012) WHO. Leishmania tropica major. Med Parazitol
h t t p : / / w w w. w h o . i n t / l e i s h m a n i a s i s / Parazit Bolezni 42:279
10. Handman E, Ceredig R, Mitchell GF (1979) 22. da Silva R, Sacks DL (1987) Metacyclogenesis
Murine cutaneous leishmaniasis: disease pat- is a major determinant of Leishmania promas-
terns in intact and nude mice of various geno- tigote virulence and attenuation. Infect
types and examination of some differences Immun 55(11):2802–2806
between normal and infected macrophages. 23. Lang T, Courret N, Colle JH, Milon G,
Aust J Exp Biol Med Sci 57:9–29 Antoine JC (2003) The levels and patterns of
11. Howard JG, Hale C, Chan-Liew WL (1980) cytokines produced by CD4 T lymphocytes of
Immunological regulation of experimental BALB/c mice infected with Leishmania
cutaneous leishmaniasis. I. Immunogenetic major by inoculation into the ear dermis
aspects of susceptibility to Leishmania tropica depend on the infectiousness and size of the
in mice. Parasite Immunol 2:303–314 inoculum. Infect Immun 71(5):2674–2683
12. DeTolla LJ, Scott PA, Farrell JP (1981) Single 24. Felizardo TC, Toma LS, Borges NB, Lima
gene control of resistance to cutaneous leish- GM, Abrahamsohn IA (2007) Leishmania
maniasis in mice. Immunogenetics (Leishmania) amazonensis infection and dis-
14(1–2):29–39 semination in mice inoculated with station-
13. Preston PM, Carter RL, Leuchars E, Davies ary-phase or with purified metacyclic
AJS, Dumonde DC (1972) Experimental promastigotes. Parasitology 134(Pt
cutaneous leishmaniasis. III. Effects of thy- 12):1699–1707
mectomy on the course of infection of CBA 25. van Zandbergen G, Bollinger A, Wenzel A,
mice with Leishmania tropica. Clin Exp Kamhawi S, Voll R, Klinger M, Muller A,
Immunol 10:337–344 Holscher C, Herrmann M, Sacks D, Solbach
14. Leclerc C, Modabber F, Deriaud E, Cheddid W, Laskay T (2006) Leishmania disease devel-
L (1981) Systemic infection of Leishmania opment depends on the presence of apoptotic
tropica (major) in various strains of mice. promastigotes in the virulent inoculum. Proc
Trans R Soc Trop Med Hyg 75:851–854 Natl Acad Sci U S A 103(37):13837–13842
15. Nasseri M, Modabber FZ (1979) Generalized 26. Noben-Trauth N, Paul WE, Sacks DL (1999)
infection and lack of delayed hypersensitivity IL-4- and IL-4 receptor-deficient BALB/c
in BALB/c mice infected with Leishmania mice reveal differences in susceptibility to
tropica major. Infect Immun 26(2):611–614 Leishmania major parasite substrains.
16. Preston PM, Dumonde DC (1976) J Immunol 162:6132–6140
Experimental cutaneous leishmaniasis 27. Ritter U, Mattner J, Soares Rocha J, Bogdan
V. Protective immunity in subclinical and self- C, Körner H (2004) The control of
healing infection in the mouse. Clin Exp Leishmania (Leishmania) major by TNF
Immunol 23:126–138 in vivo is dependent on the parasite strain.
17. Preston PM (1973) Immunology in cutane- Microbes Infect 6:559–565
ous leishmaniasis. Proc Roy Soc Med 28. Anderson CF, Mendez S, Sacks DL (2005)
66(8):776–777 Nonhealing infection despite Th1 polariza-
18. Bretscher PA, Wei G, Menon JN, Bielefeldt- tion produced by a strain of Leishmania major
Ohmann H (1992) Establishment of stable, in C57BL/6 mice. J Immunol
cell-mediated immunity that makes "suscep- 174:2934–2941
tible" mice resistant to Leishmania major. 29. Lee SH, Charmoy M, Romano A, Paun A,
Science 257:539–542 Chaves MM, Cope FO, Ralph DA, Sacks DL
19. Pérez H, Arredondo B, Gonzalez M (1978) (2018) Mannose receptor high, M2 dermal
Comparative study of American cutaneous macrophages mediate nonhealing Leishmania
leishmaniasis and diffuse cutaneous leishman- major infection in a Th1 immune environ-
iasis in two strains of inbred mice. Infect ment. J Exp Med 215(1):357–375
Immun 22:301–307 30. Indiani de Oliveira C, Teixeira MJ, Teixeira
20. Courret N, Lang T, Milon G, Antoine JC CR, Ramos de Jesus J, Bomura Rosato A,
(2003) Intradermal inoculations of low doses Santa da Silva J, Brodskyn C, Barral-Netto M,
of Leishmania major and Leishmania amazo- Barral A (2004) Leishmania braziliensis iso-
nensis metacyclic promastigotes induce differ- lates differing at the genome level display dis-
ent immunoparasitic processes and status of tinctive features in BALB/c mice. Microbes
protection in BALB/c mice. Int J Parasitol Infect 6(11):977–984
33(12):1373–1383 31. Teixeira MJ, Fernandes JD, Teixeira CR,
21. Lira R, Doherty M, Modi G, Sacks DL (2000) Andrade BB, Pompeu ML, da Silva JS,
Evolution of lesion formation, parasitic load, Brodskyn CI, Barral-Netto M, Barral A
immune response, and reservoir potential in (2005) Distinct Leishmania braziliensis iso-
C57BL/6 mice following high- and low-dose lates induce different paces of chemokine
challenge with Leishmania major. Infect expression patterns. Infect Immun
Immun 68:5176–5182 73:1191–1195
32. Sulahian A, Garin YJ, Pratlong F, Dedet JP, Leishmania major systemic infections. Infect
Derouin F (1997) Experimental pathogenic- Immun 56(12):3316–3319
ity of viscerotropic and dermotropic isolates 44. Satoskar A, Alexander J (1995) Sex-
of Leishmania infantum from immunocom- determined susceptibility and differential
promised and immunocompetent patients in IFN-γ and TNF-α mRNA expression in
a murine model. FEMS Immunol Med DBA/2 mice infected with Leishmania mexi-
Microbiol 17(3):131–138 cana. Immunology 84:1–4
33. Garin YJ, Sulahian A, Pratlong F, Meneceur 45. Bryson KJ, Millington OR, Mokgethi T,
P, Gangneux JP, Prina E, Dedet JP, Derouin F McGachy HA, Brombacher F, Alexander
(2001) Virulence of Leishmania infantum is J (2011) BALB/c mice deficient in CD4 T
expressed as a clonal and dominant pheno- cell IL-4Ralpha expression control
type in experimental infections. Infect Immun Leishmania mexicana Load although female
69(12):7365–7373 but not male mice develop a healer pheno-
34. Nabors GS, Nolan T, Croop W, Li J, Farrell type. PLoS Negl Trop Dis 5(1):e930.
JP (1995) The influence of the site of parasite https://doi.org/10.1371/journal.
inoculation on the development of Th1 and pntd.0000930
Th2 type immune responses in (BALB/c x 46. Cillari E, Milano S, Dieli M, Arcoleo F,
C57BL/6) F1 mice infected with Leishmania Perego R, Leoni F, Gromo G, Severn A, Liew
major. Parasite Immunol 17:569–579 FY (1992) Thymopentin reduces the suscep-
35. Kirkpatrick CE, Nolan TJ, Farrell JP (1987) tibility of aged mice to cutaneous leishmania-
Rate of Leishmania-induced skin-lesion devel- sis by modulating CD4 T-cell subsets.
opment in rodents depends on the site of Immunol 76:362–366
inoculation. Parasitology 94(Pt 3):451–465 47. Lages CS, Suffia I, Velilla PA, Huang B,
36. Baldwin TM, Elso C, Curtis J, Buckingham Warshaw G, Hildeman DA, Belkaid Y,
L, Handman E (2003) The site of Leishmania Chougnet C (2008) Functional regulatory T
major infection determines disease severity cells accumulate in aged hosts and promote
and immune responses. Infect Immun chronic infectious disease reactivation.
71(12):6830–6834 J Immunol 181(3):1835–1848
37. Felizardo TC, Gaspar-Elsas MI, Lima GM, 48. Kropf P, Herath S, Weber V, Modolell M,
Abrahamsohn IA (2012) Lack of signaling by Muller I (2003) Factors influencing Leishmania
IL-4 or by IL-4/IL-13 has more attenuating major infection in IL-4-deficient BALB/c
effects on Leishmania amazonensis dorsal mice. Parasite Immunol 25(8–9):439–447
skin--than on footpad-infected mice. Exp 49. Quinonez-Diaz L, Mancilla-Ramirez J, Avila-
Parasitol 130(1):48–57 Garcia M, Ortiz-Avalos J, Berron A, Gonzalez
38. Rosas LE, Keiser T, Barbi J, Satoskar AA, S, Paredes Y, Galindo-Sevilla N (2012) Effect
Septer A, Kaczmarek J, Lezama-Davila CM, of ambient temperature on the clinical mani-
Satoskar AR (2005) Genetic background festations of experimental diffuse cutaneous
influences immune responses and disease out- leishmaniasis in a rodent model. Vector Borne
come of cutaneous L. mexicana infection in Zoonot Dis 12(10):851–860
mice. Int Immunol 17(10):1347–1357 50. Sacks DL, Noben-Trauth N (2002) The
39. Mitchell GF, CJ M, Handman E (1981) immunology of susceptibility and resistance
Resistance to cutaneous leishmaniasis in to Leishmania major in mice. Nat Rev
genetically susceptible BALB/c mice. Aust Immunol 2:845–858
J Exp Biol Med Sci 59:555–565 51. Bogdan C (2008) Mechanisms and conse-
40. Scott PA, Farrell JP (1982) Experimental quences of persistence of intracellular patho-
cutaneous leishmaniasis: disseminated leish- gens: leishmaniasis as an example. Cell
maniasis in genetically susceptible and resis- Microbiol 10:1221–1234
tant mice. Am J Trop Med Hyg 52. Bogdan C, Gessner A, Röllinghoff M (1993)
31(2):230–238 Cytokines in Leishmaniasis: a complex net-
41. Melby PC, Yang Y-Z, Cheng J, Zhao W work of stimulatory and inhibitory interac-
(1998) Regional differences in the cellular tions. Immunobiology 189:356–396
immune response to experimental cutaneous 53. Bogdan C, Röllinghoff M (1998) The
or visceral leishmaniasis with Leishmania don- immune response to Leishmania: mechanisms
ovani. Infect Immun 66:18–27 of parasite control and evasion. Int J Parasitol
42. Alexander J (1988) Sex differences and cross- 28:121–134
immunity in DBA/2 mice infected with L. 54. Schleicher U, Paduch K, Debus A, Obermeyer
mexicana and L. major. Parasitology 96(Pt S, Konig T, Kling JC, Ribechini E, Dudziak
2):297–302 D, Mougiakakos D, Murray PJ, Ostuni R,
43. Mock BA, Nacy CA (1988) Hormonal mod- Korner H, Bogdan C (2016) TNF-mediated
ulation of sex differences in resistance to restriction of arginase 1 expression in myeloid
cells triggers type 2 no synthase activity at the 65. Paul C, Wolff S, Zapf T, Raifer H, Feyerabend
site of infection. Cell Rep 15(5):1062–1075 TB, Bollig N, Camara B, Trier C, Schleicher
55. McMahon-Pratt D, Alexander J (2004) Does U, Rodewald HR, Lohoff M (2016) Mast
the Leishmania major paradigm of pathogen- cells have no impact on cutaneous leishmani-
esis and protection hold for New World cuta- asis severity and related Th2 differentiation in
neous leishmaniases or the visceral disease? resistant and susceptible mice. Eur J Immunol
Immunol Rev 201:206–224 46(1):114–121
56. Stenger S, Thüring H, Röllinghoff M, 66. Amer EI, Eissa MM, Mossallam SF (2016)
Manning P, Bogdan C (1995) L-N6-(1- Oral azithromycin versus its combination
iminoethyl)lysine potently inhibits inducible with miltefosine for the treatment of experi-
nitric oxide synthase and is superior to mental Old World cutaneous leishmaniasis.
NG-monomethyl-arginine in vitro and J Parasit Dis 40(2):475–484
in vivo. Eur J Pharmacol 294:703–712 67. Ivens AC, Lewis SM, Bagherzadeh A, Zhang
57. Solbach W, Forberg K, Kammerer E, Bogdan L, Chan HM, Smith DF (1998) A physical
C, Röllinghoff M (1986) Suppressive effect map of the Leishmania major Friedlin
of cyclosporin A on the development of genome. Genome Res 8(2):135–145
Leishmania tropica-induced lesions in geneti- 68. Nicolle C (1908) Nouvelles acquisitions sur le
cally susceptible BALB/c mice. J Immunol kala-azar: culture; inoculation au chien; etiol-
137:702–707 ogie. Compte rendu hebdomadaire des
58. Solbach W, Forberg K, Röllinghoff M (1986) Sciences de I’dcademie des Sciences, Paris
Effect of T-lymphocyte suppression on the 146:498–499
parasite burden in Leishmania major-infected, 69. Nicolle C (1908) Culture du parasite du bou-
genetically susceptible BALB/c mice. Infect ton d’orient. Compte rendu hebdomadaire
Immun 54:909–912 des Sciences de l’Academie des Sciences, Paris
59. Unsoeld H, Mueller K, Schleicher U, Bogdan 146:842–843
C, Zwirner J, Voehringer D, Pircher H 70. Hockmeyer WT, Kager PA, Rees PH,
(2007) Abrogation of CCL21 chemokine Hendricks LD (1981) The culture of
function by transgenic over-expression Leishmania donovani in schneider’s insect
impairs T cell immunity to local infections. medium: its value in the diagnosis and man-
Int Immunol 19(11):1281–1289 agement of patients with visceral leishmania-
60. Brewig N, Kissenpfennig A, Malissen B, Veit sis. Trans R Soc Trop Med Hyg
A, Bickert T, Fleischer B, Mostbock S, Ritter 75(6):861–863
U (2009) Priming of CD8+ and CD4+ T cells 71. Howard MK, Pharoah MM, Ashall F, Miles
in experimental leishmaniasis is initiated by MA (1991) Human urine stimulates growth
different dendritic cell subtypes. J Immunol of Leishmania in vitro. Trans R Soc Trop Med
182(2):774–783 Hyg 85:477–479
61. Fromm PD, Kling J, Mack M, Sedgwick JD, 72. Lima HC, Bleyenberg JA, Titus RG (1997) A
Korner H (2012) Loss of TNF signaling facil- simple method for quantifying Leishmania in
itates the development of a novel Ly-6C(low) tissues of infected animals. Parasitol Today
macrophage population permissive for 13:80–82
Leishmania major infection. J Immunol 73. Prajeeth CK, Haeberlein S, Sebald H,
188(12):6258–6266 Schleicher U, Bogdan C (2011) Leishmania-
62. Gonzalez-Leal IJ, Roger B, Schwarz A, infected macrophages are targets of NK cell-
Schirmeister T, Reinheckel T, Lutz MB, Moll derived cytokines, but not of NK cell
H (2014) Cathepsin B in antigen-presenting cytotoxicity. Infect Immun 79:2699–2708
cells controls mediators of the Th1 immune 74. Blos M, Schleicher U, Rocha FJ, Meissner U,
response during Leishmania major infection. Röllinghoff M, Bogdan C (2003) Organ-
PLoS Negl Trop Dis 8(9):e3194. https:// specific and stage-dependent control of
doi.org/10.1371/journal.pntd.0003194 Leishmania major infection by inducible
63. Matsushita M, Freigang S, Schneider C, nitric oxide synthase and phagocyte NADPH
Conrad M, Bornkamm GW, Kopf M (2015) oxidase. Eur J Immunol 33:1224–1234
T cell lipid peroxidation induces ferroptosis 75. Schleicher U, Liese J, Justies N, Mischke T,
and prevents immunity to infection. J Exp Haeberlein S, Sebald H, Kalinke U, Weiss S,
Med 212(4):555–568 Bogdan C (2018) Type I interferon signaling
64. Schatz V, Strussmann Y, Mahnke A, Schley G, is required for CpG-oligodesoxynucleotide-
Waldner M, Ritter U, Wild J, Willam C, Dehne induced control of Leishmania major, but not
N, Brune B, McNiff JM, Colegio OR, Bogdan for spontaneous cure of subcutaneous pri-
C, Jantsch J (2016) Myeloid cell-derived HIF- mary or secondary L. major infection. Front
1alpha promotes control of Leishmania major. Immunol 9:79. https://doi.org/10.3389/
J Immunol 197(10):4034–4041 fimmu.2018.00079
76. Taswell C (1981) Limiting dilution assays for Schmitt S, Schober K, Schuler T, Schulz AR,
the determination of immunocompetent cell Schumacher T, Scotta C, Shankey TV, Shemer
frequencies. I. Data analysis. J Immunol A, Simon AK, Spidlen J, Stall AM, Stark R,
126(4):1614–1619 Stehle C, Stein M, Steinmetz T, Stockinger
77. Titus RG, Marchand M, Boon T, Louis JA H, Takahama Y, Tarnok A, Tian Z, Toldi G,
(1985) A limiting dilution assay for quantify- Tornack J, Traggiai E, Trotter J, Ulrich H,
ing Leishmania major in tissues of infected van der Braber M, van Lier RAW, Veldhoen
mice. Parasite Immunol 7:545–555 M, Vento-Asturias S, Vieira P, Voehringer D,
78. Cossarizza A, Chang HD, Radbruch A, Akdis Volk HD, von Volkmann K, Waisman A,
M, Andra I, Annunziato F, Bacher P, Barnaba Walker R, Ward MD, Warnatz K, Warth S,
V, Battistini L, Bauer WM, Baumgart S, Watson JV, Watzl C, Wegener L, Wiedemann
Becher B, Beisker W, Berek C, Blanco A, A, Wienands J, Willimsky G, Wing J, Wurst P,
Borsellino G, Boulais PE, Brinkman RR, Yu L, Yue A, Zhang Q, Zhao Y, Ziegler S,
Buscher M, Busch DH, Bushnell TP, Cao X, Zimmermann J (2017) Guidelines for the use
Cavani A, Chattopadhyay PK, Cheng Q, of flow cytometry and cell sorting in immu-
Chow S, Clerici M, Cooke A, Cosma A, nological studies. Eur J Immunol 47(10):
Cosmi L, Cumano A, Dang VD, Davies D, 1584–1797
De Biasi S, Del Zotto G, Della Bella S, 79. Dwyer DM, Langreth SG, Dwyer NK (1974)
Dellabona P, Deniz G, Dessing M, Diefenbach Evidence for a polysaccharide surface coat in
A, Di Santo J, Dieli F, Dolf A, Donnenberg the developmental stages of Leishmania
VS, Dorner T, Ehrhardt GRA, Endl E, Engel donovani: a fine structure-cytochemical study.
P, Engelhardt B, Esser C, Everts B, Dreher A, Z Parasitenkd 43(4):227–249
Falk CS, Fehniger TA, Filby A, Fillatreau S, 80. Ambit A, Woods KL, Cull B, Coombs GH,
Follo M, Forster I, Foster J, Foulds GA, Mottram JC (2011) Morphological events
Frenette PS, Galbraith D, Garbi N, Garcia- during the cell cycle of Leishmania major.
Godoy MD, Geginat J, Ghoreschi K, Gibellini Eukaryot Cell 10(11):1429–1438. https://
L, Goettlinger C, Goodyear CS, Gori A, doi.org/10.1128/EC.05118-11
Grogan J, Gross M, Grutzkau A, Grummitt 81. Wheeler RJ, Gluenz E, Gull K (2011) The
D, Hahn J, Hammer Q, Hauser AE, Haviland cell cycle of Leishmania: morphogenetic
DL, Hedley D, Herrera G, Herrmann M, events and their implications for parasite biol-
Hiepe F, Holland T, Hombrink P, Houston ogy. Mol Microbiol 79(3):647–662
JP, Hoyer BF, Huang B, Hunter CA, Iannone 82. Hand WL (1984) Inhibition of cell-free oxi-
A, Jack HM, Javega B, Jonjic S, Juelke K, dative bactericidal activity by erythrocytes and
Jung S, Kaiser T, Kalina T, Keller B, Khan S, hemoglobin. Infect Immun 44:465–468
Kienhofer D, Kroneis T, Kunkel D, Kurts C, 83. Martins R, Maier J, Gorki AD, Huber KV,
Kvistborg P, Lannigan J, Lantz O, Larbi A, Sharif O, Starkl P, Saluzzo S, Quattrone F,
LeibundGut-Landmann S, Leipold MD, Gawish R, Lakovits K, Aichinger MC, Radic-
Levings MK, Litwin V, Liu Y, Lohoff M, Sarikas B, Lardeau CH, Hladik A, Korosec A,
Lombardi G, Lopez L, Lovett-Racke A, Brown M, Vaahtomeri K, Duggan M,
Lubberts E, Ludewig B, Lugli E, Maecker Kerjaschki D, Esterbauer H, Colinge J,
HT, Martrus G, Matarese G, Maueroder C, Eisenbarth SC, Decker T, Bennett KL,
McGrath M, McInnes I, Mei HE, Melchers F, Kubicek S, Sixt M, Superti-Furga G, Knapp S
Melzer S, Mielenz D, Mills K, Mirrer D, (2016) Heme drives hemolysis-induced sus-
Mjosberg J, Moore J, Moran B, Moretta A, ceptibility to infection via disruption of
Moretta L, Mosmann TR, Muller S, Muller phagocyte functions. Nat Immunol 17(12):
W, Munz C, Multhoff G, Munoz LE, Murphy 1361–1372
KM, Nakayama T, Nasi M, Neudorfl C, 84. Fischer MR, John D, Kautz-Neu K,
Nolan J, Nourshargh S, O'Connor JE, Schermann AI, Schwonberg K, von Stebut E
Ouyang W, Oxenius A, Palankar R, Panse I, (2013) Animal model for cutaneous leish-
Peterson P, Peth C, Petriz J, Philips D, Pickl maniasis. Methods Mol Biol 961:389–402
W, Piconese S, Pinti M, Pockley AG, Podolska 85. Hulspas R, O'Gorman MR, Wood BL,
MJ, Pucillo C, Quataert SA, Radstake T, Gratama JW, Sutherland DR (2009)
Rajwa B, Rebhahn JA, Recktenwald D, Considerations for the control of background
Remmerswaal EBM, Rezvani K, Rico LG, fluorescence in clinical flow cytometry.
Robinson JP, Romagnani C, Rubartelli A, Cytometry B Clin Cytom 76(6):355–364
Ruckert B, Ruland J, Sakaguchi S, Sala-de- 86. Solbach W, Lohoff M, Streck H, Rohwer P,
Oyanguren F, Samstag Y, Sanderson S, Röllinghoff M (1987) Kinetics of cell-medi-
Sawitzki B, Scheffold A, Schiemann M, ated immunity developing during the course
Schildberg F, Schimisky E, Schmid SA, of Leishmania major infection in ‘healer’ and
‘non-healer’ mice: progressive impairment of ous leishmaniasis by sand flies is enhanced by

response to and generation of interleukin-2. regurgitation of fPPG. Nature 430(6998):
Immunol 62:485–492 463–467
87. Stenger S, Donhauser N, Thüring H, 98. Afonso LC, Scott P (1993) Immune responses
Röllinghoff M, Bogdan C (1996) Reactivation associated with susceptibility of C57BL/10
of latent leishmaniasis by inhibition of induc- mice to Leishmania amazonensis. Infect
ible nitric oxide synthase. J Exp Med 183: Immun 61(7):2952–2959
1501–1514 99. Cortes DF, Carneiro MB, Santos LM, Souza
88. Kebaier C, Louzir H, Chenik M, Salah AB, TC, Maioli TU, Duz AL, Ramos-Jorge ML,
Dellagi K (2001) Heterogeneity of wild Afonso LC, Carneiro C, Vieira LQ (2010)
Leishmania major isolates in experimental Low and high-dose intradermal infection
murine pathogenicity and specific immune with Leishmania major and Leishmania ama-
response. Infect Immun 69:4906–4915 zonensis in C57BL/6 mice. Mem Inst
89. Kopf M, Brombacher F, Köhler G, Kienzle G, Oswaldo Cruz 105(6):736–745
Widmann K-H, Lefrang K, Humborg C, 100. DeKrey GK, Lima HC, Titus RG (1998)

Ledermann B, Solbach W (1996) IL-4 Analysis of the immune responses of mice to
deficient BALB/c mice resist infection with infection with Leishmania braziliensis. Infect
Leishmania major. J Exp Med 184: Immun 66:827–829
1127–1136 101. Lima GH, DeKrey GK, Titus RG (1999)

90. Noben-Trauth N, Kropf P, Müller I (1996) Resolution of an infection with Leishmania
Susceptibility to Leishmania major infection braziliensis confers complete protection to a
in interleukin-4-deficient mice. Science subsequent challenge with Leishmania major
271:987–990 in BALB/c mice. Mem Inst Oswaldo Cruz
91. Lira R, Mendez S, Carrera L, Jaffe C, Neva F, 94:71–76
Sacks D (1998) Leishmania tropica: the iden- 102.
Maioli TU, Takane E, Arantes RME,
tification and purification of metacyclic pro- Fietto JLR, Afonso LCC (2004) Immune
mastigotes and use in establishing mouse and response induced by New World Leishmania
hamster models of cutaneous and visceral dis- species in C57BL/6 mice. Parasitol Res
ease. Exp Parasitol 89(3):331–342 94:207–212
92. Anderson CF, Lira R, Kamhawi S, Belkaid Y, 103. Soares Rocha FJ, Schleicher U, Mattner J,
Wynn TA, Sacks D (2008) IL-10 and TGF- Alber G, Bogdan C (2007) Cytokines, sig-
beta control the establishment of persistent naling pathways, and effector molecules
and transmissible infections produced by required for the control of Leishmania
Leishmania tropica in C57BL/6 mice. (Viannia) braziliensis in mice. Infect Immun
J Immunol 180(6):4090–4097 75:3823–3832
93. Youssef MY, Eissa MM, el-Naga IF, el-Gow- 104. de Moura TR, Novais FO, Oliveira F,

hary SH (1996) Dissemination of leishmania Clarencio J, Noronha A, Barral A, Brodskyn
to organs of mice experimentally infected C, de Oliveira CI (2005) Toward a novel
with Leishmania tropica. J Egypt Soc Parasit experimental model of infection to study
26(3):719–731 American cutaneous leishmaniasis caused by
94. Pérez H, Labrador F, Torrealba J (1979) Leishmania braziliensis. Infect Immun
Variations in the response of five strains of 73:5827–5834
mice to Leishmania mexicana. Int J Parasitol 105. Ives A, Ronet C, Prevel F, Ruzzante G,

9:27–32 Fuertes-Marraco S, Schutz F, Zangger H,
95. Aguilar Torrentera F, Lambot MA, Laman Revaz-Breton M, Lye LF, Hickerson SM,
JD, Van Meurs M, Kiss R, Noel JC, Carlier Y Beverley SM, Acha-Orbea H, Launois P, Fasel
(2002) Parasitic load and histopathology of N, Masina S (2011) Leishmania RNA virus
cutaneous lesions, lymph node, spleen, and controls the severity of mucocutaneous leish-
liver from BALB/c and C57BL/6 mice maniasis. Science 331(6018):775–778
infected with Leishmania mexicana. Am 106. Hartley MA, Bourreau E, Rossi M, Castiglioni
J Trop Med Hyg 66(3):273–279 P, Eren RO, Prevel F, Couppie P, Hickerson
96. Buxbaum LU, Uzonna JE, Goldschmidt SM, Launois P, Beverley SM, Ronet C, Fasel
MH, Scott P (2002) Control of New World N (2016) Leishmaniavirus-dependent meta-
cutaneous leishmaniasis is IL-12-independent, static leishmaniasis is prevented by blocking
but STAT4 dependent. Eur J Immunol IL-17A. PLoS Pathog 12(9):e1005852.
32:3206–3215 https://doi.org/10.1371/journal.
97. Rogers ME, Ilg T, Nikolaev AV, Ferguson ppat.1005852
MA, Bates PA (2004) Transmission of cutane-
Chapter 19
Establishment, Maintenance of Phlebotomus spp.

in the Laboratory, and Infection with Leishmania spp.
Ifhem Chelbi and Elyes Zhioua
Abstract
Sand fly colonies are of major importance for experimental studies on biology, behavior, vector compe-
tence, relationship with Leishmania parasites, and vector control. This chapter is intended to provide
methods and techniques used to initiate, establish, and maintain sand fly colonies. Details on collecting
sand flies for colonization, colony initiation, maintenance, and experimental infection of Phlebotomus spp.
with Leishmania spp. are reported.
Key words Phlebotomus, Colonization, Leishmania infection
1 Introduction
Safyanova [1] stated that “colonization of sand flies is necessary for

the experimental study of their biology, behavior and mutual rela-
tion with diseases agents, and for the testing of new methods of
vector control.” In 1977, the WHO Scientific Working Group on
leishmaniasis emphasized that “colonies are valuable in work on
vector potential, life cycles of Leishmania and transmission by bite.
They are indispensable in genetic studies and in controlled obser-
vations on the physiology and behavior of sand flies, all of which
are neglected subjects of high priority. Colonies are of particular
value for screening insecticides.” Despite the importance of suc-
cessful colonies of sand flies in physiology, genetics, behavioral,
vector competence, and control studies, establishment and mainte-
nance of sand fly colonies is extremely difficult to accomplish [2].
It is of major importance to point out that initiation of laboratory
colonies of sand flies is more difficult than the maintenance of
already-established colonies [3]. Among 800 known sand fly spe-
cies, 21 species have been successfully colonized in 35 laboratories
located in 18 countries worldwide [4]. Up until recently, research
on vaccine against leishmaniasis focused only on the parasite; now,
a growing interest in sand fly saliva proteins as potential vaccine
351
352 Ifhem Chelbi and Elyes Zhioua
candidates against leishmaniasis [5] has led to the development

and refinement of rearing techniques in order to successfully estab-
lish and maintain colonies of sand fly vectors of leishmaniasis and
sand-fly transmitted diseases [6–11]. In this chapter, methods of
colonization and experimental infection of sand flies are described.
2 Materials Needed for Sand Fly Colonization
Anesthetic.
Autoclave.
Brushes.
CDC light traps.
CO2.
Cotton.
Distilled water.
Entomological needles.
Electric mill.
Filter paper.
Glass vials for single oviposition.
Guinea pigs.
Incubator.
Larvae food.
Microscope.
Mouth and electric aspirator.
Nylon holding cages for adults with 1000-mesh netting.
Oviposition pots.
Plaster of Paris.
Plastic bag.
Plastic petri dishes.
Rabbit feces.
Rabbit food.
Sand.
Soft tweezers.
Stainless steel frames.
Stainless steel tray.
Stereomicroscope.
Sugar solutions (30%).
Washing bottles.
Colonization and Experimental Infection of Sand Flies 353
3 Initiation of Laboratory Colony of a Sand Fly Species
In endemic foci of leishmaniasis, several sand fly species may be

present including the main vector species of interest to be reared.
Before initiating a colony of a sand fly species, a good knowledge
of the ecology of the vector is required. In general, the phenology
of sand flies is bimodal with a small peak early in summer and a
larger one in September–October. Because a new laboratory col-
ony of a sand fly species is difficult to be initiated, a continuous
access to wild sand flies is necessary during the season of activity.
1. Collection of sand flies should start at the beginning of sand fly
activity and not during the major peak (Fig. 1) by using CDC
light traps (Fig. 2). Sand fly collection sites are usually far from
the laboratory, and therefore collected sand flies should be placed
in a plastic bag with cotton soaked with distilled water to main-
tain a high degree of relative humidity during the transport.
2. Transfer each blood-fed female into a vial containing a small,
wet strip of filter paper which serves as a platform for egg-
laying (Fig. 3).
3. Expose collected wild-caught unfed females to anesthetized
BALB/c mice (Fig. 4) for 2 h. Keep the engorged females in
the same cage for 3 days to allow full digestion followed by an
individual transfer in a vial as described above. Finally transfer
the unengorged ones individually to a vial as described above.
4. During the preoviposition period, moisten the filter paper with
distilled water using a syringe on a daily basis (Fig. 5).
Fig. 1 Phenology of sand fly vector of zoonotic visceral leishmaniasis in North Africa
Fig. 2 CDC light trap
Fig. 3 Blood-fed female into an oviposition vial

Fig. 4 Feeding of sand fly females on anesthetized BALB/c mice
Fig. 5 Moistening the paper strip of the oviposition vial

Fig. 6 Adding cotton soaked with sugar solution on the top of oviposition vials
5. Place all vials in a sealed plastic box over several sheets of paper
towels soaked with distilled water and place a piece of cotton
soaked with 30% sugar solution on the top of the vial (Fig. 6).
6. Place the plastic box in an incubator at 29–30 °C with a pho-
toperiod of 17:7 L.D.
7. Check vials on a daily basis for eggs and soak the filter paper
with distilled water when needed.
8. After oviposition, remove the dead females for species identifi-
cation by using the keys of Croset et al. [12].
9. Adjust the filter paper for humidity with distilled water. Due to
the fragility of eggs, replace the mesh with parafilm to provide
a high level of relative humidity in the vial. Keep the vial in the
incubator for 24 h.
10. Extract the filter paper with eggs from the vial by using a soft
tweezers (Fig. 7).
11. Because they are very fragile, remove the eggs gently with a
fine brush (Fig. 8) and deposit them at the center of the sur-
face of a plaster pot (Fig. 9).
3.1 Preparation Larval food is made of a mixture of 50% rabbit feces and 50% pel-
of Food and Feeding lets of rabbit food.
Larvae
1. Grind rabbit feces and pellets in an electric mill and mix the
powder with distilled water in a plastic box.
2. Apply a thin layer of the mix on the surface of the stainless steel
tray (Fig. 10). All trays are placed in a plastic bag and incubated
at 30 °C for 2 days to undergo an aerobic fermentation.
Fig. 7 Extraction of strips after egg-laying
Fig. 8 Transferring eggs from the paper strip with fine brush to the plaster box
3. Remove trays from plastic bag and return them on the support
upside down for another 15 days at 30 °C and high humidity
to complete the fermentation (Fig. 11).
4. Allow all trays to dry and grind the food with an electric mill.
The final product must be autoclaved. Distribute the food in
small jars (Fig. 12) and store them at +4 °C.
Fig. 9 Eggs deposited at the center of the plaster box
Fig. 10 Starting fermentation of larval food
5. Feed larvae three times per week by sprinkling food over them
(Fig. 13).
6. Maintain the humidity of the plaster pot by adding distilled
water.
7. In the case of fungal growth, remove hyphae with a needle or
add some autoclaved sand (Fig. 14).
8. Follow the whole life cycle until emergence of adults.
3.2 Preparation 1. Use plastic pots (500 ml Nalgene Ref.: 2117-0500).

of Plaster Pots 2. Remove the bottom of the plaster pots using a jigsaw.
Fig. 11 Completed fermentation of larval food
Fig. 12 Larval food distributed into storage jars and stored at +4 °C
3. Add a thin layer of plaster of Paris on the wall of the pot.

4. Fill pots with a layer of 1 cm at the bottom with plaster of Paris
and allow drying (Fig. 15).
5. Pots are reusable after removing the plaster, cleaning with tap
water, and drying.
Fig. 13 Sprinkling of larval food on the edge of the plaster with eggs placed in the
center
Fig. 14 Checking plaster pot for fungal growths and removing hyphae with
needle
Fig. 15 Preparation of plaster pots

Fig. 16 Holding cage with sand flies inside the plastic bag
3.3 Establishing Upon emergence of adult sand flies in individual rearing pots,
a Colony of Sand Fly transfer the sand fly species intenden for colonization from plaster
Species pot to holding cage.
1. Introduce the plaster pot into the holding cage and gently
open the cover to allow adult sand flies to be released into the
holding cage.
2. Place a petri dish containing cotton soaked with 30% sugar
solution at the bottom of the holding cage.
3. Wrap the holding cage in a plastic bag containing cotton
soaked with distilled water at one corner of the bag to maintain
a stable relative humidity (Fig. 16).
3.4 Maintenance 1. Remove sugar meal from the holding cage 24 h prior to blood
of Sand Fly Colonies feeding.
2. Use 5-day-old sand flies because younger ones are not ready to
feed and older ones usually have a lower rate of survival.
3. Anesthetize a BALB/c mouse with ketamine (150 mg/kg)
and place it for 2 h in an environment with 27 °C in the hold-
ing cage for sand flies (Fig. 4).
4. Cover the cage with dark cloth.
5. Keep the blood-fed females with males for 3 days to allow full
digestion, defecation, and mating (Fig. 17) before transferring
them to a plaster pot.
6. Maintain humidity of the pot with distilled water (Fig. 18).
7. Place a 2-cm layer of autoclaved sand in the bottom of a plastic
box and adjust for humidity the sand with distilled water
(Fig. 19).
8. Transfer gravid females from the holding cage to the plaster
pot using a mouth aspirator (Fig. 20) and place cotton soaked
with 30 % sugar solution on the mesh (Fig. 21).
Fig. 17 Blood-fed sand flies in the holding cage
Fig. 18 Preparation of oviposition pots
Fig. 19 Preparation of plastic box with sand substrate

Fig. 20 Transferring blood-fed females to oviposition pots
Fig. 21 Oviposition pot in the plastic box
9. Eggs hatch within 5–7 days.

10. Remove surviving females with a mouth aspirator.
11. Remove dead females with needle.
12. With a fine brush, take the eggs to the center of the pots and
sprinkle a thin layer of larval food around the eggs (Fig. 22).
Fig. 22 Sprinkling of larval food on the edge of the plaster pot containing first
instar larvae
Fig. 23 Plaster pot with larvae of a sand fly species
13. Check pots three times per week for fungal infection and add a
thin layer of larval food (Fig. 23).
14. Allow sand flies to complete their life cycle.
3.5 Experimental 1. Euthanize 2–3-day-old chicken.

Infection of Sand Flies 2. Pull the feathers gently.
with Leishmania spp.
3. Detach the skin from the chicken.
4. Cut the whole skin into large pieces to cover the feeder.
5. Store each piece of skin soaked with PBS in aluminum foil at
−20 °C.
6. Unfreeze the skin at room temperature for 1 h before use.
7. Autoclave the feeder before use.
8. Stretch the membrane with the inner part face up.
Fig. 24 Feeding device connected to the bath
9. Place the feeder above the inner part of the membrane and fix
it with parafilm.
10. Connect the feeder to the thermo-circulating water bath and
switch it on (Fig. 24).
11. Add 1 ml of 107 metacyclic promastigotes of Leishmania major
into the inner tube of the feeder.
12. Attach the cage containing 5–7-day-old 100–150 female and
100 male Phlebotomus papatasi to the feeder with rubber plas-
tic (Fig. 24).
13. Cover the feeding system with dark cloth.
14. Allow sand flies to feed for 2–3 h (Fig. 25).
15. Detach the cage from the feeding system after a good feeding
success (70% of females should be blood fed).
16. Remove the unfed females and use them for the next experi-
mental infection.
17. Maintain blood-fed females in the cage in the presence of males
at 26–27 °C with a photoperiod of 17:7 L:D with sugar and
wrapped in a plastic bag with cotton soaked with distilled water
in a secure P2 insectary to allow the parasite to complete its life
cycle in the sand fly vector.
Fig. 25 Sand flies feeding on the chicken membrane
3.6 Examine Sand Between fifth and seventh day post infectious blood meal, sand
Flies for Leishmania flies can be examined for the presence of Leishmania spp.
Infection
1. By using a mouth aspirator, take 5 to 10 females and anaesthe-
tize them with CO2.
2. Place anesthetized females in a sterile petri dish with PBS and
a few drops of liquid soap.
3. Shake soaked sand flies gently to remove wax.
4. Place two drops of sterile PBS on a sterile slide and remove
wings and legs by using an entomological needle.
5. Place the rest of the body (head, thorax, and abdomen) in the
second drop.
6. Hold the sand fly at the thorax level gently with an entomo-
logical needle, and with a second entomological needle pull
gently at the last three segments of the abdomen to remove the
midgut in the drop of PBS (Fig. 26).
7. Remove the abdomen.
8. Cover the midgut in the drop of PBS with a coverslip.
9. Examine the gut for the presence of promastigotes under the
microscope (Fig. 27).
Fig. 26 Dissection of sand fly gut
Fig. 27 Sand fly gut infected with Leishmania spp
References
1. Safyanova VM (1964) Laboratory cultivation flies (Diptera: Psychodidae). Parasite 24:42.
of sandflies (Diptera: Phlebotominae). Bull https://doi.org/10.1051/parasite/2017041
WHO 31:573–576 5. Valenzuela J, Belkaid Y, Garfiela MK, Mendez
2. Endris RG, Perkins PV, Young DG, Johnson S, Kamhawi S, Rowton E, Sacks D, Ribeiro
RD (1982) Techniques for laboratory rearing JMC (2001) Toward a defined anti-Leishmania
of sand flies (Diptera: Psychodidae). Mosquito vaccine targeting vector antigens: characteriza-
News 42:400–407 tion of a protective salivary protein. J Exp Med
3. Killick-kendrick R, Leaney AJ, Ready PD 194:331–342
(1977) The establishment, maintenance and 6. Anonymous (1977) Report of the first meet-
productivity of a laboratory colony of ing, Scientific Working Group on leishmaniasis.
Lutzomyia longipalpis (Diptera: Psychodidae). World Health Organization Special Program
J Med Entomol 13:429–440 for Research and Training in Tropical Diseases,
4. Lawyer P, Killick-Kendrick M, Rowland T, Geneva, p 31
Rawton E, Volf P (2017) Laboratory coloniza- 7. Chelbi I, Zhioua E (2007) Biology of
tion and mass rearing of phlebotomine sand Phlebotomus papatasi Scopoli (Diptera:
Psychodidae) in the laboratory. J Med Entomol Phlebotomus papatasi (Diptera: Psychodidae) in

44:597–600 the laboratory. J Med Entomol 20:568–569
8. Lawyer PG, Rowton ED, Perkins PV, Johnson 11. Ward RD (1977) The colonization of
RN, Young DG (1991) Recent advances in Lutzomyia flaviscutellata (Diptera:
laboratory mass rearing of phlebotomine sand Psychodidae), a vector of Leishmania mexicana
flies. Parassitologia 33(Suppl. 1):361–364 amazonensis in Brazil. J Med Entomol 14:
9. Maroli M, Fiorentino S, Guandalini E (1987) 469–476
Biology of a laboratory colony of Phlebotomus 12. Croset H, Rioux JA, Master M, Bayar N (1978)
perniciosus (Diptera: Psychodidae). J Med Les phlébotomes de la Tunisie (Diptera,
Entomol 24:547–551 Phlebotominae). Mise au point systématique,
10. Modi GB, Tesh RB (1983) A simple technique chorologique et éthologique. Ann Parasitol
for mass rearing Lutzomyia longipalpis and Hum Comp 53:711–749
Index
A F
Amastigotes�� v, 1, 69, 105, 169, 265, 280, 290, 304, 315 Flow cytometry�� 326–327, 334, 336–338, 343
Automated image analysis��279–287
Axenic amastigotes�� v, 2, 4–6, 8, 169, 265–270, 273, 274, G
290–292, 294–298 Gene editing��123, 169, 190, 191, 195, 196
Gene expression��95, 109, 225–235, 249, 251,
B
326, 334, 335
Bioinformatics��30–33, 70, 72, 73, 142, 157 Genetic markers��10
Bone marrow-derived macrophages (BMMs)�� 237–247,
252–255, 261, 266 H
Hamsters��7, 90, 289, 303–313
C
High content analysis�� 279–281, 283–285
Cas9��189–208 High-content screening�� 279, 282, 283
CDSs��174
Clustered regularly interspaced short palindromic repeats I
(CRISPR)��123, 169, 189–208 Inducible gene expression��225–235
Colonization�� 351, 352 Intracardiac (IC)�� 304, 306–309
Colony-stimulating factor-1 (CSF-1)�� 238, 239, Intracellular amastigotes�� 280, 281, 284, 285, 304
241–244, 252 Intradermic (ID)��159, 306, 310, 311
Conditional gene deletion��211, 212, 215, 221 Intraperitoneal (IP)�� 290, 293, 304, 306–308
Conditional genome engineering��225 In vitro infections��237–246, 251–255,
Cos-Seq�� 135, 141–166 265–276, 279, 329
Cre recombinase�� 211, 225, 226
Cutaneous leishmaniasis (CL)��315–344 K
D Kinetoplastids��23, 27, 59, 190
Knockouts (KO)��189–208, 213, 214, 217, 218, 223
Deep sequencing��v
Development�� 1, 4, 14, 83, 123, 238, 266, 273, L
303, 316, 341, 352
LeishGEdit��189–208
Differential gene expression��104
Leishmania��v, 1–28, 33, 34, 38–41, 43, 51,
Differentiation��1–8, 13, 23, 238, 239, 244,
57, 59, 69–92, 95–97, 103, 105, 110, 123, 124, 127,
252, 266, 269, 274
135–138, 141–166, 169, 170, 173, 175, 178–180, 184,
Dimerizable cre recombinase (DiCre)��123, 169, 211–223,
187, 189, 190, 192, 196, 200–203, 207, 211–223,
225–235
225–227, 232, 237, 238, 249–262, 279–284, 286, 287,
DNA sequence analysis�� 48, 177, 180
289–299, 303, 304, 306, 308–312, 315–317, 320–322,
Drug resistance�� 79, 82, 88, 141–166, 198, 206, 208, 212
339, 341, 344, 351–367
Drug screening��266, 271, 273, 275
Leishmania-infected THP-1 macrophages��287
E Leishmania infections�� 266, 279, 284, 289,
304, 306, 339, 366
Essential genes��211 Leishmania intracellular parasites��280
Experimental infections��290, 352, 364, 365 Leishmania major�� 232, 238, 365
https://doi.org/10.1007/978-1-4939-9210-2, © Springer Science+Business Media, LLC, part of Springer Nature 2019
369
370 ILndex
eishmania: Methods and Protocols
Limiting-dilution (LD)��138, 229, 290–292, 311, 312, 315, 319, 320, 324, 328–330, 333, 339, 340,
295, 311, 326, 333–334, 341 365, 366
LoxP sites�� 211, 212, 214, 226, 227
R
M
Rapamycin�� 211–213, 215, 221, 223, 226, 228, 231, 234
Macrophage-like cell lines��265–276 Retro-orbitary (RO)��304, 306, 309–310
Mouse models��315–344 Ribosome profiling��109–121
mRNA levels�� 95, 97, 109 RNA-seq��95
mRNAs��95–97, 100, 104, 105, 109, 112,
227, 249, 251, 326, 334–336, 342 S
Multi locus approaches��19–21 Signaling��1
Single locus approaches��11–12, 15–18, 23–28
N
SNP calling��74, 76, 81–84, 86–88, 90, 92
Next generation sequencing (NGS)�� 69–92, 135,
136, 141, 173, 184 T
Tagging�� 189–208, 216
P
Taxonomic levels�� 13, 33, 59
Phagolysosomes��1 Transcriptome�� 331, 341
Phenotypic assays��279 Translational control��109
Phlebotomus��351–366 Translational efficiency��109
Phylogenetic inference methods�� 10, 14, 18, 23, T7 RNA polymerase�� 190, 195, 200, 201, 203
28–29, 34, 49–54, 56 Trypanosomatids��11, 23, 39–41, 60, 96, 97,
Phylogenetic inference software��61 105, 109–121, 123
Phylogenetics��9–60, 69, 86, 89
Ploidy variation��77 V
Promastigotes�� 1–7, 28, 69, 88, 91, 92, 105, Visceral leishmaniasis (VL)�� 289, 303–313, 315, 341, 353
124, 127, 137, 142, 144, 151, 153, 169, 170, 172, 173,
180, 181, 200–202, 207, 214, 219, 221, 254, 266, 273, W
274, 280, 282, 284, 286, 290, 292–295, 298, 304–306,
Whole-mouse in vivo imaging��291, 292, 294–298

10.1007@978 1 4939 9210 2 PDF

Загружено:

Сведения о документе

Оригинальное название

Авторское право

Доступные форматы

Поделиться этим документом

Поделиться или встроить документ

Параметры публикации

Этот документ был вам полезен?

Это неприемлемый материал?

Авторское право:

Доступные форматы

10.1007@978 1 4939 9210 2 PDF

Загружено:

Авторское право:

Доступные форматы

Methods in

Molecular Biology 1971

Joachim Clos Editor

For further volumes:

Methods and Protocols

ISSN 1064-3745 ISSN 1940-6029 (electronic)

Library of Congress Control Number: 2019935497

© Springer Science+Business Media, LLC, part of Springer Nature 2019

Hamburg, Germany Joachim Clos

1 Host-Free Systems for Differentiation of Axenic Leishmania ������������������������������� 1

14 In Vitro Infections of Macrophage-Like Cell Lines

Laura Maria Alcântara • Department of Microbiology, Institute of Biomedical Sciences,

Elodie Gazanion • Université de Montpellier, IRD, CNRS, MIVEGEC, Montpellier,

Baplu Rai • Mikrobiologisches Institut–Klinische Mikrobiologie, Immunologie und

Host-Free Systems for Differentiation of Axenic

Key words Development, Phagolysosome, Differentiation, Signaling, Promastigote, Amastigote

During their life, Leishmania parasites reside and proliferate in two

the host body [4]. Growing promastigotes at pH 5 at 26 °C

2.3 Serum 1. When purchasing a new batch of serum we recommend that

6. Continue incubation in the CO2 incubator for additional

Time in differentiation (hours) Description Picture

Phase 2: 5–9 Movement secession

Phase 3: 10–23 Morphogenesis

Phase 4: 24–120 Amastigote maturation

parasites undergo morphogenesis, they get rounded and sub-

Fig. 2 Axenic amastigotes aggregate during differentiation in culture. Phase

2. We observed that the serum contains a heat sensitive factor that

3.4 Quality Control 1. Differentiating axenic amastigotes back to promastigotes:

2. 2,3-trans-enoyl CoA isomerase: We propose this protein as a

1. Over the years we learned that short passage animal derived

2. Counting axenic amastigotes in culture might be difficult

The history of the classification as well as the phylogeny and molec-

technique for classification for a long time, despite several

some limitations in the subgenus L. (Viannia) and alignments of

Marker Product Complete or Reference Position in reference

Marker Product Complete or Reference Position in reference

Marker Product Complete or Reference Position in reference

Gene and Internal

Gene and Internal

MLST sets used in phylogenetic studies of the genus Leishmania

validated [53, 83, 90]. Other authors have developed alternative

study the subgenus L. (Mundinia) [13, 117]. RPOIILS has also

Phylogenetic methods have evolved over time, becoming more

2.1 PCR— 1. DNA extracted from cultured promastigotes or from clinical

(100 mM Tris–HCl pH 8.3, 500 mM KCl, 15 mM MgCl2).

7. Molecular size marker depending on the size of the studied

2.3 Sequencing 1. QIAquick PCR-product purification kit (QIAGEN, Hilden,

3. Bioinformatic programs (for more details see the respective

3. Define the appropriate sample set: including a representative

In most phylogenetic studies PCR-G or PCR-F are used

ITS rDNA 1. This PCR, based on a validated protocol first presented by el

ITS1+5.8S+ITS2: LITSR/LITSV (Size 950–1130 bp)

2. Set up the PCR amplification reaction containing the follow-

RPOIILS 1. This PCR based on a protocol first presented by Croan and

polymerase (5 U/μl), and 15.8 μl ddH2O (see Note 6). Vortex

CYTB 1. This PCR based on a validated protocol first presented by

Complete cytb gene: COIIIF/MURF4R (Amplicon size 1338 bp,

2. LCBF1 and LCBR2 are identical to Lcyt-S and Lcyt-R in Kato

It was validated with a representative set of strains including

7SL RNA 1. The 7 SL RNA PCR is based on a protocol first described by

POLA 1. This PCR is based on a protocol first presented by Noyes et al.

4. Add 2 μl of template DNA (10 ng/μl solutions if DNA

SSU With respect to phylogenetic studies of Leishmania there is no

Hamburg, Germany Joachim Clos

1 Host-Free Systems for Differentiation of Axenic Leishmania �� 1

(e) Run the following thermocycler program: initial denatur-

3.2.2 MLST/MLSA 1. Set 1

(c) Base frequency.