Biotechnology Techniques, Vol 12, No 7, July 1998, pp.

507–510

Gene transfer in silkworm Bombyx mori

via electroporation
Y. Shamila and S. Mathavan
Department of Genetics, School of Biological Sciences, Madurai Kamaraj University, Madurai – 625 021, India
email: mathavan@pronet.xlweb.com ; Fax :191-452-531056

Electroporation conditions have been standardized for the mass mobilization of foreign DNA into silkworm eggs. The
hatchability of egg varied depending upon the electroporatic conditions. The maximum hatchability of 68% was at the
electroporatic condition of 200V/cm and 25mF with two pulses. Electroporation has resulted in successful transfer of
foreign DNA into silkworm eggs and it has been confirmed by slot blot , Southern blot and PCR analysis.

Introduction 10 mM MgCl2, 0.1 mM DTT) with DNase I (1 unit/ ml)

Microinjection for the transfer of foreign DNA into fertil-
ized eggs is often tedious, technically demanding and time
consuming. Electroporation is a rapid and simple method
allowing the mobilization of DNA into large number of
eggs within a short time. This method has been followed
for gene transfer in plant and animal cells (Okada et al.,
1986; Andreason and Evans , 1988). Electroporation of fish
sperm and eggs have resulted in high frequency of trans-
genic production (Xie et al., 1993; Tsai and Tseng, 1994).
Electroporation has also been attempted in eggs of few
insects such as Drosophila (Kamdar et al., 1992), corn
earworm moth Helicoverpa zea and house fly Musca domestica
(Leopold et al., 1996). This communication describes the
optimum conditions for successful transfer of foreign DNA
into the eggs of silkworm following electroporation tech-
nique.
Materials and Methods
Bombyx mori (Pure Mysore) eggs were collected 8–10 h
after egg laying (pre-blastoderm stage eggs). Electropora-
tion was carried out in Gene Pulser II (Bio-Rad, USA).
About 50 eggs were placed in the cuvette (0.2 cm elec-
trode gap) containing 500 ml buffer (5 mM KCl, 0.1 mM
Na2HPO4, pH 7.8) with 250 mg pBmA-CAT vector DNA
of 6.7 kb (gift from Dr. S. Mahalingam, USA). Various
combinations (voltage 50 to 1500 V/cm, capacitance 25 to
1000 mF with 2 pulses) of operational conditions were
tested for electroporation. Electroporation was done with
only buffer under identical conditions in control eggs.
After electroporation, eggs were removed from the cuvette
and incubated for hatching (Krishnaswami, 1978).
To check the possible attachment of the DNA on the
chorion, the electroporated eggs were treated with DNase
I ; eggs (10–20) were transferred to 1.5 ml Eppendorf
tubes containing standard buffer (50 mM Tris/HCl, pH 8,
and incubated at 37°C for 15 min to eliminate the plasmid
DNA that might be adhering to the egg surface. The
enzyme was then inactivated by five successive washes with
TE buffer (10mM Tris/HCl, pH 7.4, 1mM EDTA). Geno-
mic DNA was extracted from electroporated eggs (DNase
treated and untreated eggs) during embryonic develop-
mental stages as well as from the larvae that hatched from
electroporated eggs (Jowett, 1986).
For slot blot analysis, genomic DNA (5 mg) extracted from
the experimental samples were transferred on to a nylon
membrane using slot blot apparatus. This was then placed
on Whatman 1 filter paper, pre-wetted with 0.4 M NaOH,
for 30 min to denature the DNA. For Southern blot
analysis, genomic DNA from the experimental samples
(20 mg DNA digested with HindIII or uncut DNA) were
electrophoresed on 0.9% agarose gel. The fractionated
DNA samples were transferred on to a nylon membranes
by the capillary transfer method. The DNA in the gels
were depurinated (0.2M HCl for 10 min), denatured (0.5
M NaOH, 1.5 M NaCl for 10 min) and neutralized (0.5 M
Tris/HCl, pH 8.0, 1.5 M NaCl for 15 min) prior to
transfer. The DNA were fixed to the membranes by
exposing it to UV light for 3 min.
Standard protocols were followed for pre-hybridization and
hybridization of the membranes prepared by slot and
Southern blots. The entire pBmA-CAT plasmid was not
used as probe because it contained the Bm1 sequence
(repetitive sequence in B.mori genome). The plasmid Blue-
script SK1 was used for the probe which formed the
backbone of pBmA-CAT. The probe DNA was labeled in
vitro with [a32P] dCTP following random priming method
(Boehringer – Mannhem, Germany). All the other genetic
techniques were followed as described by Sambrook et al.
(1988).

© 1998 Chapman & Hall Biotechnology Techniques ⋅ Vol 12 ⋅ No 7 ⋅ 1998 507

Y. Shamila and S. Mathavan

Polymerase Chain Reaction (PCR) was performed to check

the persistence of electroporated DNA in the experimental
samples. Primers have been designed to amplify a part of
CAT coding sequence present in the electroporated DNA.
The following primers were used: (I) Forward primer: 5’
CCGGAATTCCGTATGGCAA 3’(position 851bp);
Reverse primer: 5’ AATTACAACAGTACTGCGAT 3’
(position 1281bp). For PCR the final reaction volume was
50 ml; the reaction mix contained the following: 0.1 mm
each of forward and reverse primers, 1 X PCR buffer (10
mM Tris/ HCl, pH 9.0, 1.5 mM KCl, 2mM MgCl2, 0.1%
Triton X-100), 300 ng genomic DNA as template,
Figure 1. Slot blot analysis of genomic DNA extracted
0.05 mM of all the four dNTPs and 0.5 units Taq DNA from the eggs electroporated (950 V/cm, 50 mF, with 2
polymerase. PCR conditions were: denaturation 95°C 1 pulses) with pBmA-CAT : Slots A1, A2 : positive control
min, primer annealing 55°C 1 min and primer extension (4 mg, 0.25mg); Slots A3 - A5 : 1, 2 & 6 day old eggs;
72°C 1.5 min. A minimum of 35 cycles were performed in Slots A6 & B11: freshly emerged larvae; Slot B10: neg-
Perkin Elmer Thermal Cycler (model 2400). After the ative control (eggs electroporated without DNA) and
Slots B12-15: 1, 2, 6, 8 day old eggs (DNase treated).
reaction, 10 ml sample was mixed with bromophenol dye
and analyzed in 2% agarose gel.
chorion. Further, the DNA extracted from freshly emerged
Expression of transgene was studied by CAT assay as
larvae (eclosed from electroporated eggs) also showed pos-
described by Gorman et al. (1982). The electroporated,
itive response (Fig. 1). Similar results were obtained in the
DNase treated eggs were homogenized in 0.25M Tris/HCl
DNA extracted from the eggs subjected to other electro-
buffer (pH 7.8). After incubation at 68°C for 10 min,
poratic conditions also (data shown in PCR analysis).
50 ml of supernatant was mixed with 20 ml 4mM acetyl
coenzyme A, 8ml C14 chloramphenicol (Amersham, 60mci/
mmol, 25mci/ml), 72ml 250 mM Tris/HCl buffer (pH 7.5) Southern hybridization of genomic DNA from eggs (with-
and incubated at 37°C for 4 h. The reaction mixture was out DNase treatment) showed persistence of the electro-
then subjected to thin layer chromatographic analysis porated plasmid DNA in different conformational forms
following the standard protocols for CAT assay. (Fig. 2A, lanes 3, 4, 5, 6). On digesting the DNA (20 mg/
lane) with HindIII, two bands (4.6 Kb & 2.1 Kb) and few
Results partially digested bands were observed (Fig. 2B lanes
Survival of eggs varied depending upon the electroporatic 2,3,4,7). However, the DNA extracted from DNase treated
conditions. The eggs subjected to electroporation at eggs showed faint response in Southern analysis [irrespec-
200 V/cm and 25 mF showed maximum hatchability tive of DNA digested (Fig. 2C, lanes 2,3) or undigested
(68%). The combination of low voltage and high capaci- (Fig.2A, lanes 7,8,9)]. These observations clearly indicate
tance (100–300 V/cm, 800 to 1000 mF) resulted in total that low amount of DNA has been internalized into the
mortality of the eggs. Similarly, combination of high eggs by electroporation and considerable amount is
voltage and low capacitance (.1000 V/cm with 25 mF) retained in the chorion.
also resulted in non-viability of the eggs. The electropora-
tion condition of 950 V/cm and 50 mF with 2 pulses
PCR was performed using the genomic DNA extracted
resulted in 8% survival.
from the experimental and control samples. PCR product
of expected size (430 bp; Fig. 3) was obtained indicating
DNA extracted from the electroporated eggs (950 V/cm
the persistence of electroporated DNA in the eggs and
and 50 mF) before and after DNase treatments were sub-
freshly emerged larvae. PCR product was obtained from
jected to slot blot and Southern blot analyses. The positive
the DNA extracted both from DNase treated and untrea-
signals obtained in slot blot analysis indicate that the
ted eggs.
DNA has been internalized into the egg or attached to the
chorion. The signals were very faint in DNase treated eggs
compared with the signals from non treated eggs. Con- CAT assay of electroporated eggs (DNase treated and
sidering the low intensity of signal observed, the amount untreated) and larval samples showed expression of the
of DNA internalized into the egg appears to be very low, injected sequences. In the CAT assay the conversion of
while significant amount of DNA has been attached to the 1-acetylated chloramphenicol form was visible promi-

508 Biotechnology Techniques ⋅ Vol 12 ⋅ No 7 ⋅ 1998


Figure 2. Southern hybridization of the genomic DNA
extracted from electroporated eggs. (DNase treated and
untreated). [A] Lane 1 : l/HindIII; Lane 2 : negative
control; Lanes 3 – 6 : 1, 2, 6 & 8 day old eggs before
DNase treatment (undigested); Lanes 7–9 : 1, 2 & 6 day
old eggs after DNase treatment (undigested); Lane 10 :
positive control : pBmA-CAT (undigested). [B] Lane 1 : l/
HindIII; Lanes 2–4 : 1, 6 & 8 day old eggs (HindIII
digested); Lanes 5–6 : Negative control; Lane 7 : freshly
emerged larvae (HindIII digested). [C]: Lane 1 : l/HindIII;
Lanes 2–3 : 2 & 8 day old eggs (HindIII digested; DNase
treated).
nently while a faint response was noticed in 3-acetylated
form (data not shown).
Discussion
Microinjeciton (single and double prick) and sperm medi-
ated gene transfer techniques have been standardized for
the transfer of foreign DNA into silkworm eggs (Tamura et
al., 1990, Shamila and Mathavan, 1996, 1998). However,
Gene transfer in silkworm Bombyx mori via electroporation
Figure 3. PCR amplification of CAT sequences using the
DNA extracted from electroporated eggs and larvae.
Lane 1 : l/HindIII (arrow A indicates 560bp marker); Lane
2 : negative control; Lane 3 : freshly emerged larvae (200
V/cm; 25 mF); Lanes 4 – 6 : 5, 8 day old eggs and freshly
emerged larvae (900 V/cm ; 25 mF); Lanes 7–9 : 5 , 8 day
old eggs and freshly emerged larvae (800 V/cm; 25 mF);
Lanes 10–12 : 1, 6 day old eggs and freshly emerged
larvae (950 V/cm; 50 mF); Lanes 13–15 : 1, 2 and 6 day
old eggs from DNase treated batch (950 V/cm; 50 mF);
Lanes 16–17 : negative control and Lane 18 : pBmA-CAT
(positive control)
for mass mobilization of DNA into insect eggs, electro-
poration has also been attempted in eggs of Drosophila
(Kamdar et al., 1992), house fly and corn earworm (Leopold
et al., 1996).
Application of electric pulses to cells and tissues are known
to cause structural rearrangements in the cell membrane,
resulting in the formation of temporary pores. The electric
field is playing the dual role of causing pore formation in
the cell surface and providing a local driving force to
transport DNA through the pores (Weaver, 1995). Apart
from membrane permeation, several other factors also
control the mobilization of exogenous DNA into the cell/
egg. Electroporation buffer, nature of biological materials,
DNA concentration, pulse conditions and cell surface
property are critical parameters that determine the effi-
ciency of gene transfer (Andreason and Evans, 1988).
It has been reported that the cells are irreversibly damaged
due to the loss of membrane integrity when the magnitude
or the duration of the pulse applied exceeded a critical level
(Orlowski and Mir, 1993). The high mortality of eggs
observed in the present study during high voltage/
capacitance might be due to the damage caused to the
developing embryos.
Hatchability was about 75% in the Drosophila eggs electro-
porated at 250 V/cm, 960mF (Kamdar et al., 1992). The
Biotechnology Techniques ⋅ Vol 12 ⋅ No 7 ⋅ 1998 509
Y. Shamila and S. Mathavan
electroporation of B.mori eggs under identical electro-
poratic conditions resulted in total mortality of the eggs.
The electroporation of H.zea at 100V/cm and 600 mF has
resulted in 30% hatchability (Leopold et al., 1996). How-
ever electroporation of B.mori eggs at 100V/cm and 500mF
has resulted in 2% hatchability. Though the B.mori and
H.zea belong to the same order, lepidoptera, silkworm eggs
appear to be more sensitive than H.zea. Electroporation of
dechorionated eggs of dipterans, M. domestica (200 V/cm &
600 mF) and Drosophila (70V/cm and 960mF) resulted in
50% and 10% hatchability, respectively (Leopold et al.,
1996; Kamdar et al., 1992). Analysis of the available data
revealed that the sensitivity of insect eggs to electropora-
tion is species specific. Each species has different optimum
electroporatic conditions for maximum survival of the
eggs.
Slot blot, Southern blot and PCR analysis of the DNA
extracted from DNase treated eggs confirmed that even
though major portion of DNA was attached to the surface
of the chorion, some amount of DNA penetrated through
the chorion and got internalized in the electroporated eggs.
The transferred DNA persisted as episomal forms and their
feeble expression was confirmed by CAT assay. No endoge-
nous CAT activity has been observed in silkworm (see also
Shamila and Mathavan, 1998; Tamura et al., 1990). These
results confirm that electroporation can be followed for
gene transfer into the silkworm eggs.
Acknowledgements
The second author is thankful to World Bank and Central
Silk Board, Bangalore for financial support through a
research grant (No. CSB : 46/107/ 90 - 91 - TS). The first
510 Biotechnology Techniques ⋅ Vol 12 ⋅ No 7 ⋅ 1998
author is thankful to CSIR, New Delhi for the financial
support.
References
Andreason, GL and Evans, GL (1988). Biotechniques 6:
650–660.
Gorman, CM, Moffat, LF and Howard, BH (1982). Mol. Cell.
Biol. 2: 1044–1051.
Jowett, T (1986). Preparation of Nucleic acid In: Drosophila, A
Practical Approach, DB Roberts ed. pp. 275–286 Oxford : IRL
Press.
Kamdar, P, Von Allmen, G, and Finnerty, V (1992). Nucl. Acids
Res. 20: 3526–3526.
Krishnaswami, S (1978). New Technology of Silkworm Rearing,
Mysore (India):CSRTI.
Leopold, RA, Hughes, KJ and DeVault, JD (1996). Genet. Anal.
Biomol. Eng. 12: 197–200.
Okada, K, Nagata, T and Takebe, I (1986). Plant Cell Physiol., 27:
619–629.
Orlowski, S and Mir, LM (1993). Biochim. Biophys. Acta. 1154:
51–63.
Sambrook, J, Fritsch, EF and Maniatis, T (1989). Molecular
Cloning: A Laboratory Manual, New York: Cold Spring
Harbor Laboratory.
Shamila, Y and Mathavan, S (1996). Indian J. Seric. 35: 80–82.
Shamila, Y and Mathavan S (1998). Arch. Insect Biochem. Physiol.
37: 168–177.
Tamura, T, Kanda, T, Takiya, S, Okano, K and Maekawa, H
(1990). Jpn. J. Genet. 65: 401–410.
Tsai, HJ and Tseng FS (1994). Fish. Sci. 60: 787–788.
Weaver, JC (1995). Electroporation: Theory concepts and mecha-
nisms. Electroporation protocols for microorganisms In: Meth-
ods in Molecular Biology J.A. Nickoloff ed. Vol. 47 pp 1–26,
New Jersey: Totowa Humana Press Inc.
Xie, Y, Liu, D, Zou, J, Li, G and Zhu, Z (1993). Aquaculture
111: 207–213.
Received as revised:- 14 May 1998
Accepted:- 19 May 1998