Академический Документы
Профессиональный Документы
Культура Документы
Edited by
W. Scott Champney
Department of Biochemistry and Molecular Biology,
East Tennessee State University,
Johnson, Tennessee
© 2008 Humana Press Inc.
999 Riverview Drive, Suite 208
Totowa, New Jersey 07512
www.humanapress.com
No part of this book may be reproduced, stored in a retrieval system, or transmitted in any form or by any means,
electronic, mechanical, photocopying, microfilming, recording, or otherwise without written permission from the Publisher.
Methods in Molecular MedicineTM is a trademark of The Humana Press Inc.
All papers, comments, opinions, conclusions, or recommendations are those of the author(s), and do not necessarily reflect
the views of the publisher.
Cover illustration: The cover shows the chemical structures of a number of antibiotics currently used against some of the
targets described in this book.
v
vi Preface
Protein biosynthesis has been a major target for many different antimicrobial
agents. Methods to target the aminoacyl tRNA synthetases are presented in
Chapter 5. Chapters 6 and 7 present methods to examine inhibitors of bacterial
ribosome biogenesis, a newly described target for antibiotics. Chapters 8
and 9 describe specific assays for inhibitors of ribosomal functions in trans-
lation including initiation (Chapter 8) and peptidyltransferase (Chapter 9). An
additional promising new target is peptide deformylase; assays for inhibitors
of its function are given in Chapter 10.
The bacterial cell wall and membrane remain attractive targets for antibiotics.
Chapter 11 discusses assays for penicillin-binding proteins of the cell wall,
and Chapter 12 presents methods to assay inhibitors of lipopolysaccharide
biosynthesis, an exciting new target. Membrane structure and function are the
topics of Chapters 13 and 14, including measures of cationic antimicrobial
peptide function (Chapter 13) and assays for changes in permeability using
flow cytometry (Chapter 14). Chapter 15 describes several assays for detecting
inhibitors of the ubiquitous efflux pumps in bacterial membranes.
Two novel targets are described in Chapters 16 and 17. Inhibition of fatty
acid synthesis (Chapter 16) is a promising new target, as are compounds
that affect the important two-component signal transduction pathways in cells
(Chapter 17).
The remaining chapters describe assays for measuring target modification
by ribosomal methyltransferases (Chapter 18), a discussion of inhibitors of
-lactamase activity (Chapter 19), and assays for aminoglycoside-modifying
enzymes (Chapter 20).
The chapters in the book describe in detail specific methods that can be
used to identify and assay these targets. As additional new compounds are
identified and new targets in different microorganisms are found, these methods
will aid in testing the antibacterial potential of these products. It is anticipated
that this book will be primarily useful to laboratory investigators in academic,
pharmaceutical, and medical institutions.
W. Scott Champney
Contents
Preface . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . v
Contributors. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ix
vii
viii Contents
ix
x Contributors
Summary
The complete genome sequences of about 300 bacteria (mostly pathogenic) have been deter-
mined, and many more such projects are currently in progress. The detection of bacterial genes
that are non-homologous to human genes and are essential for the survival of the pathogen
represent a promising means of identifying novel drug targets. We present a subtractive genomics
approach for the identification of putative drug targets in microbial genomes and demonstrate
its execution using Pseudomonas aeruginosa as an example. The resultant analyses are in good
agreement with the results of systematic gene deletion experiments. This strategy enables rapid
potential drug target identification, thereby greatly facilitating the search for new antibiotics. It
should be recognized that there are limitations to this computational approach for drug target
identification. Distant gene relationships may be missed since the alignment scores are likely
to have low statistical significance. In conclusion, the results of such a strategy underscore
the utility of large genomic databases for in silico systematic drug target identification in the
post-genomic era.
Key Words: bacterial pathogens; comparative microbial genomics; essential genes; drug
targets; antibiotics.
1. Introduction
“Antibiotic” consists of the root words “anti,” meaning “opposed to” or
“preventing,” and “biotic,” which is derived from the Greek word for life. In
nature, various microbes and fungi secrete these compounds to gain an advantage
in their microenvironment, and antibiotics are commonly isolated from such
organisms. Between 1940 and 1960, the search for antibacterial agents relied
1
2 K. R. Sakharkar et al.
among previously characterized proteins that are specific and essential for a
particular pathogen. Genes that are conserved in different genomes often turn
out to be essential (8–11). A gene is considered to be essential if the cell
cannot tolerate its inactivation by mutation, and its status is confirmed using
conditional lethal mutants.
Genomics can be applied to evaluate the suitability of potential targets
using two criteria, i.e., “essentiality” and “selectivity” (4). The target must
be essential for the growth, replication, viability, or survival of the microor-
ganism, i.e., encoded by genes critical for pathogenic life stages. In order to
address cytotoxicity issues, the microbial target for therapy should not have
any well-conserved homolog in the host. This can help to avoid expensive dead
ends when a lead target is identified and investigated in great detail only to
discover at a later stage that all its inhibitors are invariably toxic to the host.
Concurrently, the recent availability of the human genome sequence represents
a major advance in drug discovery (12,13). Since this approach merely short-
lists the putative microbial targets, the subsequent step would be to validate
the prioritized targets, e.g., by constructing knockouts or by using chemical
validation to verify their essentiality.
Mutagenesis data are available for selected pathogenic microbial genomes
and can be used to ascertain the essentiality of putative targets. Recently,
Zhang et al. (14) compiled a list of all the currently available, experimen-
tally determined essential genes into the Database of Essential Genes (DEG),
2. Materials
1. Microbial genome data and human genome data in relevant databases.
2. Computing power to perform comparative genome analyses (e.g., networked high-
end machine with large storage capacity).
3. Basic bioinformatics programs such as CD-HIT and BLASTP installed in the host
machine.
3. Methods
1. Download the protein sequences for Homo sapiens and the bacterium of interest
from the National Center for Biotechnology Information Website ftp://ftp.ncbi.nlm.
nih.gov/genomes/ (15).
2. Download the Database of Essential Genes (DEG) from http://tubic.tju.edu.cn/
deg/ (15).
3. Download the CD-HIT program (16) from http://bioinformatics.ljcrf.edu/cd-hi.
4. Purge the bacterial genome file at 60% using CD-HIT to exclude paralogs from
bacterium for further analyses.
5. Subject the resultant file to BLASTP against the H. sapiens genome to identify
pathogen genes without homologs in humans (an expectation or E-value cutoff of
10−3 or lower is advisable). This will help to identify bacterial genes without human
homologs and ensure that the target is selective for the genome of interest.
6. The non-homologous entries are then subjected to BLASTP against the DEG
database for the identification of homologs to essential genes at a cutoff score
of 10−10 .
7. The genes with hits are then classified into different groups based on gene names
and metabolic pathways. Information on metabolic pathways can be obtained from
the KEGG database available at http://www.genome.jp/kegg/.
Using the completely sequenced Pseudomonas aeruginosa genome as an
example, the results demonstrate the unprecedented potential of the available
6 K. R. Sakharkar et al.
Table 1
Results of the Computational Analyses of Pseudomonas
aeruginosa Proteins
Description Proteins
4. Notes
It must be noted that this approach may not identify all the targets.
Nonetheless, since gene disruption data are not available for all the genes in all
the pathogens, this approach makes it possible to hazard a “first-order guess”
for the probability that any untested gene is essential and may be a probable
drug target.
References
1.
1 Miesel, L., Greene, J., and Black, T. A. (2003) Genetic strategies for antibacterial
drug discovery. Nat. Rev. Genet. 4, 442–456.
2.
2 Huynen, M. A., Diaz-Lazcoz, Y., and Bork, P. (1997) Differential genome display.
Trends Genet. 13, 389–390.
3.
3 Huynen, M., Dandekar, T., and Bork, P. (1998) Differential genome analysis
applied to the species-specific features of Helicobacter pylori. FEBS Lett. 426, 1–5.
8 K. R. Sakharkar et al.
4.
4 Sakharkar, K. R., Sakharkar, M. K., and Chow, V. T. (2004) A novel genomics
approach for the identification of drug targets in pathogens, with special reference
to Pseudomonas aeruginosa. In Silico Biol. 4, 355–360.
5.
5 Bruccoleri, R. E., Dougherty, T. J., and Davison, D. B. (1998) Concordance
analysis of microbial genomes. Nucleic Acids Res. 26, 4482–4486.
6.
6 Sakharkar K. R., Sakharkar M. K., and Chow, V. T. (2006) Gene fusion
in Helicobacter pylori: Making the ends meet. Antonie van Leeuwenhoek 89,
169–180.
7.
7 Galperin, M. Y., and Koonin, E. V. (1999) Searching for drug targets in microbial
genomes. Curr. Opin. Biotechnol. 10, 571–578.
8.
8 Itaya, M. (1995) An estimation of minimal genome size required for life. FEBS
Lett. 362, 257–260.
9.
9 Tatusov, R. L., Koonin, E. V., and Lipman, D. J. (1997) A genomic perspective
on protein families. Science 278, 631–637.
10.
10 Koonin, E. V., Tatusov, R. L., and Galperin, M. Y. (1998) Beyond complete
genomes: From sequence to structure and function. Curr. Opin. Struct. Biol. 8,
355–363.
11. Kobayashi, K., Ehrlich, S. D., Albertini, A., Amati, G., Andersen, K. K.,
11
Arnaud, M., et al. (2003) Essential Bacillus subtilis genes. Proc. Natl. Acad. Sci.
USA 100, 4678–4683.
12.
12 Lander, E. S., Linton, L. M., Birren, B., Nusbaum, C., Zody, M. C., Baldwin, J.,
et al. (2001) Initial sequencing and analysis of the human genome. Nature 409,
860–921.
13.
13 Venter, J. C., Adams, M. D., Myers, E. W., Li, P. W., Mural, R. J., Sutton, G. G.,
et al. (2001) The sequence of the human genome. Science 291, 1304–1351.
14.
14 Zhang, R., Ou, H. Y., and Zhang, C. T. (2004) DEG: A database of essential
genes. Nucleic Acids Res. 32, D271–D272.
15. Wheeler, D. L., Church, D. M., Edgar, R., Federhen, S., Helmberg, W.,
15
Madden, T. L., et al. (2004) Database resources of the National Center for Biotech-
nology Information: Update. Nucleic Acids Res. 32, D35–D40.
16.
16 Li, W., Jaroszewski, L., and Godzik, A. (2001) Clustering of highly homol-
ogous sequences to reduce the size of large protein databases. Bioinformatics 17,
282–283.
17.
17 Stover, C. K., Pham, X. Q., Erwin, A. L., Mizoguchi, S. D., Warrener, P.,
Hickey, M. J., et al. (2000) Complete genome sequence of Pseudomonas aerug-
inosa PA01, an opportunistic pathogen. Nature 406, 959–964.
18.
18 Payne, D. J., Warren, P. V., Holmes, D. J., Ji, Y., and Lonsdale, J. T. (2001)
Bacterial fatty-acid biosynthesis: A genomics-driven target for antibacterial drug
discovery. Drug Discov. Today 6, 537–544.
19.
19 Heath, R. J., White, S. W., and Rock, C. O. (2002) Inhibitors of fatty acid synthesis
as antimicrobial chemotherapeutics. Appl. Microbiol. Biotech. 58, 695–703.
Biocomputational Strategies for Microbial Drug Target Identification 9
20.
20 Fraser, C. M., Gocayne, J. D., White, O., Adams, M. D., Clayton, R. A.,
Fleischmann, R. D., et al. (1995) The minimal gene complement of Mycoplasma
genitalium. Science 270, 397–403.
21.
21 Lewis, K. (1999) Multidrug resistance: Versatile drug sensors of bacterial cells.
Curr. Biol. 9, R403–R407.
22.
22 Clayton, R. A., White, O., Ketchum, K. A., and Venter, J. C. (1997) The first
genome from the third domain of life. Nature 387, 459–462.
23.
23 Smith, R. S., Wolfgang, M. C., and Lory, S. (2004). An adenylate cyclase-
controlled signaling network regulates Pseudomonas aeruginosa virulence in a
mouse model of acute pneumonia. Infect. Immun. 72, 1677–1684.
2
Summary
DNA gyrase and DNA topoisomerase (topo) IV are the bacterial targets of coumarin and
quinolone antimicrobial agents. Widespread resistance to clinically important antibiotics such
as beta-lactams and macrolides has stimulated the development of novel gyrase and topo IV
inhibitors especially against Streptococcus pneumoniae and other Gram-positive pathogens. Here,
we describe how gyrase and topo IV activities are measured and how inhibitors of these enzymes
may be assayed, focusing as a paradigm on DNA supercoiling by S. pneumoniae gyrase, DNA
decatenation by S. pneumoniae topo IV, and DNA cleavage by both enzymes. These approaches
provide mechanistic insight on inhibitor action and allow identification of dual gyrase/topo IV
targeting agents that can minimize the emergence of bacterial resistance.
Key Words: DNA gyrase; DNA topoisomerase IV; DNA supercoiling; DNA decatenation;
cleavage complex; ciprofloxacin; agarose gel electrophoresis; Streptococcus pneumoniae.
1. Introduction
DNA gyrase and topo IV are important antimicrobial drug targets (1).
Gyrase catalyzes the ATP-dependent supercoiling of DNA (2). The enzyme
is present in all eubacteria but not in mammals and is unique among topoiso-
merases in promoting the negative supercoiling of DNA. Gyrase is essential
for bacterial viability with functions in DNA replication, transcription, and
recombination and in the regulation of chromosome supercoiling (1). First
discovered in Escherichia coli, and best characterized from this source, gyrase
has also been obtained in native or recombinant form from a variety of bacterial
11
12 L. M. Fisher and X.-S. Pan
species (3–5). Gyrase is a tetramer comprising two GyrA and two GyrB subunits
encoded by gyrA and gyrB genes, respectively. Its mechanism of DNA super-
coiling proceeds via the passage of one DNA segment (the “transported” or T
segment) through a transient double-stranded break in a second DNA helical
region (the “gate” or G segment) involving a covalent enzyme-DNA complex
called the “cleavage complex” (6–8). Strand passage is achieved through the
concerted opening and closure of protein–protein and protein–DNA gates. It is
believed that the T and G segments lie within a 120–150-bp region of DNA
wrapped on the enzyme such that the T segment is presented in the correct orien-
tation to generate negative supercoiling on strand passage (6–8). Gyrase shares
homology and mechanistic similarity with topo IV (9), a ParC2 ParE2 tetramer
that also acts via a double-stranded DNA break to facilitate ATP-dependent
chromosome decatenation and relaxation. Both enzymes change DNA linking
number in steps of two and are categorized as type II topoisomerases (6–8).
In addition to its biological and mechanistic interest, gyrase is the target
for coumarins, quinolones, and other novel classes of antimicrobials (10–13).
Coumarins, e.g., novobiocin, as well as the cyclothialidines and aminoben-
zimidazoles, inhibit DNA supercoiling by acting as competitive inhibitors
of the GyrB ATPase (10,11,13). By contrast, quinolones and their fluoro-
quinolone analogues such as ciprofloxacin inhibit gyrase activity by stabilizing
the cleavage complex involving the GyrA subunits (1,12). The traditional view
of gyrase as the primary quinolone target holds for Gram-negative bacteria such
as E. coli but not for Gram-positive species such as S. pneumoniae, wherein
the target can be gyrase or topo IV, or both, depending on the drug structure
(14,15); see also (13). Ongoing development of novel agents (13) and the recent
clinical introduction of new quinolones such as levofloxacin, moxifloxacin,
gatifloxacin, and gemifloxacin directed specifically against Gram-positive
pathogens (16) have identified the need to understand how inhibitors interfere
with gyrase and topo IV.
The assay for gyrase activity involves monitoring ATP-dependent super-
coiling of a relaxed circular plasmid DNA (3,4). The reaction products are
separated and displayed by agarose gel electrophoresis. Supercoiled DNA is
more compact than relaxed DNA and therefore migrates more rapidly through
the gel. Though almost any plasmid DNA could be employed as substrate, it is
now customary to use the small (4.3-kb) plasmid pBR322, thereby maximizing
the electrophoretic separation of relaxed and supercoiled DNA. Topo IV activity
is assayed by following its ATP-dependent decatenation of kinetoplast DNA
(kDNA) again using agarose gel electrophoresis. These are the assays of choice
in investigating the effects of catalytic inhibitors such as coumarins. By contrast,
Inhibition of DNA Gyrase and Topo IV 13
a DNA cleavage assay is used for quinolones and other topoisomerase II poisons
that act by stabilizing the topoisomerase cleavage complex on DNA resulting
in double-stranded DNA breaks. Given the recent recognition that either gyrase
or topo IV may be the potential target (14,15), it is now usual to test inhibitor
effects on both enzymes. The following sections describe the gyrase super-
coiling assay, the topoisomerase IV decatenation assay, and a DNA cleavage
assay applicable to both gyrase and topo IV.
2. Materials
2.1. DNA Supercoiling Assay
1. 3X Gyrase assay solution: 105 mM Tris-HCl, pH 7.5, 18 mM MgCl2 , 5.4 mM
spermidine, 72 mM KCl, 15 mM DTT, 1.08 mg/mL BSA, 19.5% glycerol (w/v),
and (optional) 90 μg/mL E. coli tRNA (Calbiochem).
2. Gyrase dilution buffer: 50 mM Tris-HCl, pH 7.5, 0.2 M KCl, 5 mM DTT, 1 mM
EDTA, 3 mg/mL BSA, 50% glycerol. (3X assay solution and dilution buffer can
be made up and stored in aliquots at –20 °C).
3. 50-mM ATP solution: 27.5 mg ATP (disodium salt) dissolved in 1 mL 100 mM
NaOH (see Note 1).
4. Relaxed pBR322 DNA (see Note 2).
5. 5X dye mix: 5% SDS, 25 % glycerol, 0.25 mg/ml bromophenol blue.
6. Agarose gel: 1% agarose in TBE (90 mM Tris base, 90 mM boric acid, 2.5 mM
EDTA).
7. 10 mg/mL ethidium bromide (EtBr) (see Note 3).
8. Gyrase preparation or the individual purified GyrA and GyrB subunits.
9. Prospective gyrase inhibitor and known control inhibitor.
10. Gel documentation system, e.g., Alpha Innotech digital camera and associated
software. Such instrumentation allows quantification of DNA bands and conse-
quently has largely superseded image capture on Polaroid film using a Land
camera and uv transilluminator.
3. Methods
3.1. DNA Supercoiling Assay
This section describes how to measure and titrate the ATP-dependent DNA
supercoiling activity of gyrase prior to testing the effect of inhibitors on
the enzyme reaction. The assay uses relaxed pBR322 DNA as substrate and
in principle may employ gyrase activity present in bacterial extracts, native
enzyme purified from bacteria, or individual GyrA and GyrB proteins obtained
from bacterial extracts by affinity chromatography on novobiocin-Sepharose
(17). Crude extracts from bacteria should be avoided as they contain large
amounts of nucleases that lead to nicking of plasmid DNA and thereby abrogate
the assay. It is better to purify the enzyme by ammonium sulfate and Polymin
P fractionation, plus column chromatography, including tRNA when assaying
to suppress any nuclease activity. Highly purified DNA gyrases from E. coli
and Micrococcus luteus are available from John Innes Enterprises and from
Gibco BRL. Increasingly, recombinant His-tagged GyrA and GyrB proteins are
being prepared for a variety of bacterial species using E. coli strains bearing
the appropriate gyrA or gyrB genes cloned in inducible vectors such as pET
(3–5). Although construction of expression plasmids is time-consuming, it
has the advantage that the tagged GyrA and GyrB proteins can be recovered
in high purity (>95% homogeneity) from E. coli extracts in a single step
by nickel chelate chromatography (4,5). Neither subunit alone is active, but
gyrase activity can be reconstituted by mixing GyrA and GyrB. Each subunit
is assayed in the presence of an excess of the complementing protein so
that the specific activity of each subunit can be measured individually. This
approach, based on Ref. 4, is described using S. pneumoniae GyrA and GyrB
proteins.
Inhibition of DNA Gyrase and Topo IV 15
1 2 3 4 5 6 7 8 9 10 11 12 13
N
R
1 2 3 4 5 6 7 8
N
R
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15
kDNA
monomer
1 2 3 4 5 6 7 8
kDNA
monomer
DNA, and following proteinase K digestion (to remove GyrA or ParC subunit
linked to DNA), the DNA products are examined by agarose gel electrophoresis.
Trapping of the cleavage complex is revealed by the generation of linear
pBR322 DNA. It should be noted that detection of DNA cleavage requires
the use of stoichiometric amounts of DNA substrate and gyrase or topo IV,
i.e., typically 50–100 times more enzyme than employed in assays of catalytic
function. The following protocol has been developed for S. pneumoniae gyrase
and topo IV but is widely applicable to the enzymes from other bacteria.
1. DNA cleavage assays for gyrase are performed in the absence and presence of
inhibitor in 35 mM Tris-HCl, pH 7.5, 24 mM KCl, 6 mM MgCl2 , 1.8 mM
spermidine, 0.36 mg/mL bovine serum albumin (BSA), supercoiled pBR322, and
DNA gyrase (final volume 20 μL). Except for the higher enzyme levels, these condi-
tions are similar to those used in the gyrase supercoiling assay (see Sections 2.1 and
3.1), except ATP is omitted (see Note 9). Cleavage of supercoiled pBR322 by topo
IV is also observed under these gyrase conditions (allowing direct comparison) but
is more efficient using a buffer containing 40 mM Tris-HCl, pH 7.5, 6 mM MgCl2 ,
10 mM NaCl, 10 mM DTT, 50 μg/mL BSA, and 200 mM potassium glutamate,
i.e., similar to the decatenation assay conditions.
2. Make a reaction mix on ice containing 6.7 μL 3X gyrase cleavage buffer or 5 μL of
4X topo IV cleavage buffer, supercoiled pBR322 DNA (0.4 μg), and sterile water
to 16 μL. A multiple of these quantities can be made up depending on the number
of assays to be run. The mix is distributed into 1.5-mL Eppendorf tubes on ice
containing various concentrations of the inhibitor (in 2 μL) to be assayed. Reaction
is initiated by adding 0.45 μg GyrA (or ParC) and 1.7 μg GyrB (or ParE) (in 2 μL)
that had been mixed and pre-incubated on ice for 10 min. After mixing, the tubes
are incubated in a circulating water bath at 25 °C for 1 h.
3. Induce DNA cleavage by adding 3 μL of 2% (w/v) SDS to each tube taken directly
from the water bath and vortex. Add 3 μL of 1 mg/mL proteinase K (see Note 10),
vortex, and incubate for 30 min at 37 °C.
4. Reactions are stopped by adding 7 μL of 5X dye mix, and the DNA products
are separated by electrophoresis in 1% agarose. The gel is stained with EtBr and
photographed as described in earlier sections.
5. Figure 5 shows a representative DNA cleavage experiment for gyrase and topo
IV. DNA cleavage can be quantified in terms of the CC25 , the drug concentration
that converts 25% of the input DNA to the linear form (see Notes 11 and 12).
The ciprofloxacin CC25 values for gyrase and topo IV are 80 μM and 5–10 μM,
respectively (see Note 13). Quinolone CC25 values (and indeed the IC50 values) are
elevated at least 8- to 16-fold for S. pneumoniae gyrase and topo IV complexes
reconstituted with GyrA and ParC subunits bearing quinolone resistance mutations
of Ser79Phe and Ser81Phe, respectively (18).
20 L. M. Fisher and X.-S. Pan
A B
12 3 4 5 6 7 8 1 2 3 4 5 6 7 8
N
L
S
Fig. 5. DNA cleavage induced by S. pneumoniae gyrase (A) and topo IV (B) in the
presence of ciprofloxacin. Supercoiled pBR322 was incubated (A) with gyrase (0.45 μg
GyrA and 1.7 μg GyrB) and ciprofloxacin at 0, 20, 40, 80, 160, and 320 μM (lanes 3–8,
respectively) or (B) topo IV (0.45 μg ParC and 1.7 μg ParE) and ciprofloxacin at 0, 2.5,
5, 10, 20, and 40 μM (lanes 3–8, respectively). DNA cleavage was induced with SDS,
and after proteinase K digestion, DNA products were displayed by 1% agarose gel
electrophoresis. Lane 1, supercoiled pBR322 control; lane 2, linear pBR322 control.
N, L, and S denote nicked, linear, and supercoiled pBR322, respectively.
4. Notes
1. ATP solutions should be stored as aliquots at –20 °C and discarded after use.
2. Relaxed pBR322 may be purchased from John Innes Enterprises. Alternatively,
it can be readily prepared by relaxation of supercoiled pBR322 (New England
Biolabs) using either human topoisomerase I (from Topogen) or the calf thymus
topo I from New England Biolabs according to the protocol detailed in Ref 19.
3. A note of caution: EtBr is a mutagen. Gloves should be worn when handling EtBr
solutions, and both should be disposed of using proper procedures.
4. Do not add more than 2 μL of gyrase diluent to the assay: It contains a high
concentration of salt and can inhibit the reaction.
5. For optimal separation of relaxed and supercoiled DNA, gels should be run slowly
overnight. EtBr should not be included in the agarose gel as it intercalates into
DNA, changing the mobility of relaxed DNA to that of supercoiled DNA.
6. Relaxed DNA prepared by treatment of supercoiled DNA with a eukaryotic topoi-
somerase I is made up of a Gaussian distribution of topoisomers bearing differing
linking numbers, which are resolved in the gel as a discrete ladder of bands (see
Fig. 1, lane 1). Preparations of supercoiled DNA normally contain a small amount
of nicked DNA. Any nuclease contamination in the gyrase preparation converts
the relaxed DNA ladder to nicked DNA that migrates as a single band and cannot
be supercoiled by gyrase.
7. Ciprofloxacin is a quinolone inhibitor of gyrase/topo IV. It exerts its inhibitory
action by interfering with DNA resealing in the cleavage complex.
8. Topo IV has both decatenation and DNA relaxation activities. Therefore, the
released minicircles migrate as relaxed DNA species.
Inhibition of DNA Gyrase and Topo IV 21
Acknowledgments
X.-S. Pan and this work were supported by Project Grant BBD01882X1 from
the Biotechnology and Biological Sciences Council of the United Kingdom.
References
1.
1 Drlica, K., and Zhao, X. (1997) DNA gyrase, topoisomerase IV, and the 4-
quinolones. Microbiol. Mol. Biol. Rev. 61, 377–392.
2.
2 Gellert, M., Mizuuchi, K., O’Dea, M. H., and Nash, H. A. (1976) DNA gyrase:An
enzyme that introduces superhelical turns into DNA. Proc. Natl. Acad. Sci.USA
73, 3872–3876.
3.
3 Mizuuchi, K., Mizuuchi, M., O’Dea, M. H., and Gellert, M. (1984) Cloning and
simplified purification of Escherichia coli DNA gyrase A and B proteins. J. Biol.
Chem. 259, 9199–9201.
4.
4 Pan, X.-S., and Fisher, L. M. (1999) Streptococcus pneumoniae DNA gyrase
and topoisomerase IV: Overexpression, purification, and differential inhibition by
fluoroquinolones. Antimicrob. Agents Chemother. 43, 1129–1136.
22 L. M. Fisher and X.-S. Pan
5.
5 Aubry, A., Veziris, N., Cambau, E., Truffot-Pernot, C., Jarlier, V., and Fisher, L. M.
(2006) Novel gyrase mutations in quinolone-resistant and -hypersusceptible clinical
isolates of Mycobacterium tuberculosis: Functional analysis of mutant enzymes.
Antimicrob. Agents Chemother. 50, 104–112.
6.
6 Mizuuchi, M., Fisher, L. M., O’Dea, M. H., and Gellert, M. (1980) DNA gyrase
action involves the introduction of transient double strand breaks into DNA. Proc.
Natl. Acad. Sci. USA. 77, 1847–1851.
7.
7 Corbett, K. D., and Berger, J. M. (2004) Structure, molecular mechanisms, and
evolutionary relationships in DNA topoisomerases. Ann. Rev. Biophys. Biomol.
Struct. 33, 95–118.
8.
8 Corbett, K. D., Schoeffler A. J., Thomsen, N. D., and Berger, J. M. (2005) The
structural basis for substrate specificity in DNA topoisomerase IV. J. Mol. Biol.
351, 545–561.
9.
9 Kato, J., Nishimura, Y., Imamura, R., Niki, H., Higara, S., and Suzuki, S. (1990)
New topoisomerase essential for chromosome segregation in E. coli. Cell 63,
393–404.
10.
10 Maxwell, A., and Lawson, D. M. (2003) The ATP binding site of type II topoiso-
merases as a target of antibacterial drugs. Curr. Top. Med. Chem. 3, 283– 303.
11.
11 Oram, M., Dosanjh, B., Gormley, N. A., Smith, C. V., Fisher, L. M., Maxwell,
A., and Duncan, K. (1996) The mode of action of GR122222X, a novel inhibitor
of DNA gyrase. Antimicrob. Agents Chemother. 40, 473–476.
12.
12 Drlica, K., and Malik, M. (2003) Fluoroquinolones: Action and resistance. Curr.
Top. Med. Chem. 3, 249–282.
13.
13 Grossman, T. H., Bartels, D. J., Mullin, S., Gross, C. H., Parsons, J. D., Liao, Y.,
Grillot, A.L., Stamos, D., Olson, E. R., Charifson, P. S., and Mani, N. (2007) Dual
targeting of GyrB and ParE by a novel aminobenzimidazole class of antibacterial
compounds. Antimicrob. Agents Chemother. 51, 657–666.
14.
14 Pan, X.-S., and Fisher, L. M. (1997) Targeting of DNA gyrase in Streptococcus
pneumoniae by sparfloxacin: Selective targeting of gyrase or topoisomerase IV by
quinolones. Antimicrob. Agents Chemother. 41, 471–474.
15.
15 Pan, X.-S., and Fisher, L. M. (1998) DNA gyrase and topoisomerase IV are dual
targets of clinafloxacin action in Streptococcus pneumoniae. Antimicrob. Agents
Chemother. 42, 2810–2816.
16.
16 Zhanel, G. G., Fontaine, S., Adam, H., Schurek, K., Mayer, M., Noreddin, A. M.,
Gin, A. S., Rubinstein, E., and Hoban, D. J. (2006) A review of new fluoro-
quinolones: Focus on their use in respiratory tract infections. Treatment Respir.
Med. 5, 437–465.
17.
17 Staudenbauer, W. L., and Orr, E. (1982) DNA gyrase: Affinity chromatog-
raphy on novobiocin-Sepharose and catalytic properties. Nucleic Acids Res. 9,
3589–3603.
18.
18 Pan, X.-S., Yague, G., and Fisher, L. M. (2001) Quinolone resistance mutations
in Streptococcus pneumoniae GyrA and ParC proteins: Mechanistic insights into
Inhibition of DNA Gyrase and Topo IV 23
Summary
The need for new drugs to treat infections caused by antibiotic-resistant bacterial strains
has prompted many studies to identify novel targets in pathogenic bacteria. Among the three
DNA polymerases expressed by bacteria, one of these, designated pol III, is responsible for
DNA replication and growth of bacteria and, therefore, warrants consideration as a drug target.
However, the pol III enzymes of Gram-positive and Gram-negative species are quite different,
and the Gram-positive enzyme pol IIIC has been more extensively studied as a drug target than
the Gram-negative enzyme pol IIIE.
DNA polymerases are unique enzymes with respect to the five substrates (four dNTPs, one
of which is radiolabeled, and primer:template DNA) that they typically utilize. Variations of the
assay, e.g., by leaving out one dNTP but allowing measurable incorporation of the remaining
substrates, or use of homopolymer primer:templates, may be used to simplify the assay or to
obtain mechanistic information about inhibitors. Use of gel analysis of primer extension assays
can also be applied to study alternate substrates of DNA polymerases. Methods to isolate pol IIIC
from Gram-positive bacterial cells and to clone and express the polC gene are described in this
chapter. In addition, the assay conditions commonly used to identify and study the mechanism
of inhibitors of pol IIIC are emphasized.
Key Words: DNA polymerase; pol IIIC; pol IIIE; isolation; cloning; DNA polymerase
assay.
1. Introduction
Bacteria contain three distinct DNA polymerases, designated pol I, pol II,
and pol III (1). Pol III has been found to be responsible for DNA replication
and growth of bacteria and is, therefore, the most relevant enzyme as a drug
25
26 M. M. Butler and G. E. Wright
2. Materials
2.1. Preparation of B. subtilis Pol IIIC
2.1.1. Isolation of Native B. subtilis Pol IIIC
1. B. subtilis NB841, obtained from Dr. Neal Brown.
2. 20 mM Tris-acetate, pH 8.2, 10 mM magnesium acetate, 0.5 mM EDTA.
3. 15 mM potassium phosphate, pH 7.4, 300 mM ammonium sulfate.
4. 10 mM potassium phosphate, pH 7.4, 200 mM ammonium sulfate.
5. 10 mM potassium phosphate, pH 6.5.
6. Hydroxylapatite (Clarkson Chemical Co.).
7. DEAE cellulose DE 52 (Whatman).
8. Sephadex G25, G200 (Pharmacia).
9. Agarose (Bio-Rad).
A Method to Assay Inhibitors of DNA Polymerase IIIC Activity 27
3. Methods
3.1. Preparation of B. subtilis Pol IIIC
3.1.1. Isolation of Native B. subtilis Pol IIIC
Purification of native pol III from B. subtilis has been described, starting
with a strain that is deficient in pol I (9,10).
1. All buffers contain 20% (v/v) glycerol and 5 mM -mercaptoethanol, and purifi-
cation procedures are done at 0–4 °C. Protein concentration is estimated by the
A Method to Assay Inhibitors of DNA Polymerase IIIC Activity 29
method of Lowry et al. (11). Five g of packed B. subtilis NB841 are suspended in
10 mL of a buffer consisting of 20 mM Tris-acetate, pH 8.2, 10 mM magnesium
acetate, and 0.5 mM EDTA, and ruptured in a French pressure cell. The lysate
is freed of debris by centrifugation at 17,000X g for 30 min, and the super-
natant is further centrifuged for 3 h in a Spinco 50.1 rotor at 42,000 rpm
(200,000X g).
2. The high-speed supernatant (10 mL; 20 mg of protein per mL) is diluted with 20
mL of 16 mM potassium phosphate buffer, pH 7, containing 300 mM ammonium
sulfate, and passed at a rate of 0.5 mL/min through a 13 × 1.65-cm column of
DEAE-cellulose equilibrated with 10 mM potassium phosphate buffer (pH 7.4)
containing 200 mM ammonium sulfate. The first 15 mL of eluant is discarded; the
subsequent 45 mL, containing 85% of input protein, is mixed with 22 g of ground
ammonium sulfate and stirred for 90 min. The precipitated protein is harvested
by centrifugation, dissolved in 6 mL of 10 mM potassium phosphate, pH 6.5, and
freed of ammonium sulfate by passage through Sephadex G-25 in the same buffer
(Fraction IV).
3. All of the solutions contain 20% glycerol, 10 mM magnesium acetate, 25 mM
-mercaptoethanol, 0.5% Triton X-100, and potassium phosphate, pH 6.5 (referred
to as phosphate) at a specified concentration. Fraction IV is diluted to 2 mg per mL
in 10 mM phosphate and applied to a 100 mL column (2 × 32 cm) of denatured
DNA-cellulose equilibrated with the same buffer. The column is eluted with a
linear gradient (0.1 to 0.4 M; volume 1000 mL; 3.3 mL per min) of phosphate.
The polymerase activity, which emerges as a single peak between 0.22 and 0.29 M
phosphate, is pooled in a volume of 190 mL, diluted 4-fold with 10 mM phosphate,
and applied to a 5 mL column (1.1 × 5 cm) of DEAE-cellulose washed with 10
mM phosphate. The enzyme, which is retained on the column, is eluted with 0.5 M
phosphate in a volume of 6.5 mL (Fraction V).
4. Fraction V is diluted 7-fold with 10 mM phosphate and applied to a 25 mL
column (1.5 × 15 cm) of hydroxylapatite equilibrated with 10 mM phosphate, and
eluted with a linear gradient (0.05 to 0.3 M; volume, 600 mL; 2 mL per min) of
phosphate. Enzyme activity, which emerges as a single peak between 0.15 and 0.19
M phosphate, is pooled in a volume of 96 mL and diluted 3-fold with 10 mM
phosphate. The pool is applied to a l mL column (0.56 × 4 cm) of DEAE-cellulose
washed with 10 mM phosphate, and the enzyme is eluted in a volume of 0.8 mL
of 0.5 M phosphate (Fraction VI).
5. Fraction VI is applied to a column (1.1 × 54 cm) of Sephadex G-200 equili-
brated with 0.5 M phosphate and eluted at a rate of 0.9 mL per hour. The
enzyme emerges as a symmetrical peak approximately 5 mL after the void volume
(15 mL, blue dextran 2000); 80% of the activity is pooled in a volume of 5
mL, diluted 7-fold with 10 mM phosphate, and concentrated into 0.25 mL of
0.5 M phosphate with a 0.25 mL column (0.56 × 1 cm) of DEAE-cellulose
(Fraction VII).
30 M. M. Butler and G. E. Wright
45000
40000
35000
30000 0.075 ug/mL
Counts
a sterile flask. Add 400 mL sterile 50 mM Tris-HCl, pH 7.5 (to yield a 2 mg/mL
solution), and shake at 125 rpm for 48 h at 4 °C.
2. Perform a pilot run of DNAse digestion to determine the proper DNAse concen-
tration and digestion time. Set up four glass tubes containing 2 mg/mL DNA, 5 mM
MgCl2 , and DNAse at the following concentrations: 0.6, 0.3, 0.15, and 0.075 μg/mL.
Incubate the tubes at 37 °C, remove 200 μL aliquots at 2.5, 5, 10, and 15 min,
and inactivate DNAse by heating to 65 °C for 10 min and cooling samples on ice.
3. Add 5 μL of each DNA sample to 15 μL DNA-free assay mix (see Section 2.2.1)
and 5 μL pol IIIC at a 1:200 dilution in a 96-well assay plate and incubate for 10
min at 30 °C. Process samples as described in Section 3.3.
4. Plot the results as counts vs. time for each DNAse concentration (e.g., see Fig. 1) and
select the optimal DNAse concentration and digestion time. Scale up the reaction by
placing 200 mL of the DNA solution into each of two 2 L flasks (see Note 5) and adding
MgCl2 to a final concentration of 5 mM and DNAse to the concentration chosen in
the pilot study (see Note 6). Incubate in a 37°C water bath with occasional swirling
for the amount of time chosen in the pilot study, inactivate the DNAse by heating
the flask in a 65°C water bath with constant swirling, and place flasks on ice to cool.
5. Aliquot the activated DNA into 15 mL tubes and store at –20 °C for up to 10 years.
4. Notes
1. The cloning and expression of B. subtilis polC can be performed using a number
of different kits/protocols that are now available from companies such as Novagen
(i.e., pET vectors).
2. Lysis of E. coli cells can also be achieved by sonication, although use of the French
press is preferable. For example, we have used a Virsonic 475 Ultrasonic Cell
Disrupter (Virtis Company) with a ½-in. probe, setting 5 (of a maximum of 10),
using 3 × 10 s pulses to lyse cells. Always immerse the tube containing cells in a
beaker of ice, and avoid foaming of the suspension to prevent protein denaturation.
3. A Mono-Q anion exchange column with an FPLC system (Pharmacia) has been used
as the second column purification step in published versions of the pol III purifi-
cation, but we have found the MacroPrep column to give an equivalent purification
without requiring the purchase of an FPLC system.
4. Pol III is stably stored at -80 °C for many years but is susceptible to loss of activity
upon multiple freeze/thaw cycles. The best way to store this enzyme is, after the
34 M. M. Butler and G. E. Wright
initial storage in a large volume, e.g., 1 mL, upon thawing a tube for the first time,
aliquot that volume into smaller units, e.g., 50 μL, for more frequent use.
5. Perform DNAse treatment using a large flask and volume:liquid ratio to obtain the
fastest possible heat inactivation. If the DNAse treatment lasts too long, activity
begins to decrease rapidly.
6. An example of a typical DNAse treatment pilot run is illustrated in Fig. 1. The
scale-up conditions that were chosen in this particular experiment were to treat with
0.15 μg/mL of DNAse for 10 min.
7. The standard 4-dNTP assay should be used to analyze inhibitors of an unknown
mechanism. However, to identify inhibitors that compete with any of the dNTPs, a
truncated assay should be used. This assay type requires the omission of one dNTP
at a time, the use of activated DNA, and the inclusion of the [3 H]-labeled dNTP
that is not the dNTP that has been omitted. This so-called truncated assay has been
used to assay the anilinouracils, pol IIIC inhibitors whose activities compete with
dGTP (7).
8. Further characterization of inhibitors with a competitive mechanism of action
(MOA) may be performed using synthetic primer:templates, such as in the assay
described in Section 3.3.2. Detailed analysis of the MOA of pol IIIC inhibitors,
i.e., the 6-(phenylhydrazino)uracils, has been accomplished using synthetic DNAs
(9,21).
References
1.
1 Kornberg, A., and Baker, T. (1992) DNA Replication, 2nd ed. W.H. Freeman and
Co., New York.
2.
2 Wright, G. E., and Brown, N. C. (1999) DNA polymerase III: A new target for
antibiotic development. Curr. Opin. Anti-Infective Investig. Drugs 1, 45–48.
3.
3 Tarantino, P. M., Zhi, C. G., Wright, E., and Brown, N. C. (1999) Inhibitors of DNA
polymerase III as novel antimicrobial agents against Gram-positive eubacteria.
Antimicrob. Agents Chemother. 43, 1982–1987.
4.
4 Ali, A., Aster, S. D., Graham, D. W., Patel, G. F., Taylor, G. E., Tolman, R. L.,
Painter, R. E., Silver, L. L., Young, K., Ellsworth, K., Geissler, W., and Harris,
G. S. (2001) Design and synthesis of novel antibacterial agents with inhibitory
activity against DNA polymerase III. Bioorg. Med. Chem. Lett. 11, 2185–2188.
5.
5 Yang, F., Dicker, I. B., Kurilla, M. G., and Pompliano, D. L. (2002) PolC-type
polymerase III of Streptococcus pyogenes and its use in screening for chemical
inhibitors. Anal. Biochem. 304, 110–116.
6.
6 Dervyn, E., Suski, C., Daniel, R., Bruand, C., Chapuis, J., Errington, J., Janniere, L.,
and Ehrlich, S. D. (2001) Two essential DNA polymerases at the bacterial repli-
cation fork. Science 294, 1716–1719.
7.
7 Wright, G. E., and Brown, N.C. (1976) Inhibition of Bacillus subtilis DNA
polymerase III by arylhydrazinopyrimidines. Novel properties of 2-thiouracil
derivatives. Biochim. Biophys. Acta 432, 37–48.
A Method to Assay Inhibitors of DNA Polymerase IIIC Activity 35
8.
8 Alberts, B. M., Amodio, F. J., Jenkins, M., Gutmann, E. D., and
Ferris, F. L. (1968) Studies with DNA-cellulose chromatography. I. DNA-binding
proteins from Escherichia coli. Cold Spring Harb. Symp. Quant. Biol. 33,
289–305.
9.
9 Clements, J. E., D’Ambrosio, J., and Brown, N. C. (1975) Inhibition of Bacillus
subtilis deoxyribonucleic acid polymerase III by phenylhydrazinopyrimidines.
Demonstration of a drug-induced deoxyribonucleic acid-enzyme complex. J. Biol.
Chem. 250, 522–526.
10.
10 Mackenzie, J. M., Neville, M. M., Wright, G. E., and Brown, N. C. (1973) Hydrox-
yphenylazopyrimidines: Characterization of the active forms and their inhibitory
action on a DNA polymerase from Bacillus subtilis. Proc. Natl. Acad. Sci. USA
70, 512–516.
11.
11 Lowry, O. H., Rosebrough, N. J., Farr, A. L., and Randall, R. J. (1951) Protein
measurement with the Folin phenol reagent. J. Biol. Chem. 193, 265–275.
12.
12 Ghosh, S., and Lowenstein, J. M. (1996) A multifunctional vector system for
heterologous expression of proteins in Escherichia coli. Expression of native and
hexahistidyl fusion proteins, rapid purification of the fusion proteins, and removal
of fusion peptide by Kex2 protease. Gene 176, 249–255.
13.
13 Barnes, M. H., Leo, C. J., and Brown, N. C. (1998) DNA polymerase III of Gram-
positive eubacteria is a zinc metalloprotein conserving an essential finger-like
domain. Biochem. 37, 15254–15260.
14.
14 Barnes, M. H., and Brown., N. C. (1995) Purification of DNA polymerase III of
Gram-positive bacteria. Methods Enzymol. 262, 35–42.
15.
15 Hammond, R. A., and Brown, N. C. (1992) Overproduction and purification of
Bacillus subtilis DNA polymerase III. Protein Expr. Purif. 3, 65–70.
16.
16 Foster, K. A., Barnes, M. H., Stephenson, R. O., Butler, M. M., Skow, D. J.,
LaMarr, W. A., and Brown, N. C. (2003) DNA polymerase III of Enterococcus
faecalis: Expression and characterization of recombinant enzymes encoded by the
polC and dnaE genes. Protein Expr. Purif. 27, 90–97.
17.
17 Butler, M. M., Dudycz, L. W., Khan, N. N., Wright, G. E., and Brown, N. C.
(1990) Development of novel inhibitor probes of DNA polymerase III based on
dGTP analogs of the HPUra type: Base, nucleoside and nucleotide derivatives of
N2-(3,4-dichlorobenzyl)guanine. Nucleic Acids Res. 18, 7381–7387.
18.
18 Khan, N. N., Wright, G. E., and Brown, N. C. (1991) The molecular mechanism
of inhibition of alpha-type DNA polymerases by N2-(butylphenyl)dGTP and 2-
(butylanilino)dATP: Variation in susceptibility to polymerization. Nucleic Acids
Res. 19, 1627–1632.
19. Townsend, A. J., and Cheng, Y. C. (1987) Sequence-specific effects of ara-5-aza-
19
CTP and ara-CTP on DNA synthesis by purified human DNA polymerases in
vitro: Visualization of chain elongation on a defined template. Mol. Pharmacol.
32, 330–339.
36 M. M. Butler and G. E. Wright
20.
20 Wright, G. E., and Dudycz, L. W. (1984) Synthesis and characterization of N2-(p-
n-butylphenyl)-2’-deoxyguanosine and its 5’-triphosphate and their inhibition of
HeLa DNA polymerase alpha. J. Med. Chem. 27, 175–181.
21.
21 Gass, K. B., Low, R. L., and Cozzarelli, N. R. (1973) Inhibition of a DNA
polymerase from Bacillus subtilis by hydroxyphenylazopyrimidines. Proc. Natl.
Acad. Sci. USA 70, 103–107.
4
Summary
RNA polymerase is essential to the viability of bacteria in all phases of growth and devel-
opment and is a proven chemotherapeutic target as the cellular target of the rifamycin class of
antibiotics. However, despite the characterization of multiple different classes of natural products
that selectively target bacterial RNA polymerase, and the identification of a limited number
of synthetic compound inhibitors, only agents of the rifamycin class have been developed and
approved for human clinical use as antibiotics. Herein we describe a scintillation proximity assay
(SPA) for identifying and characterizing inhibitors of bacterial RNA polymerases and that is
applicable to de novo drug discovery programs through application of automated high-throughput
screening methods. In addition, we describe gel electrophoresis-based methods that are appli-
cable to the detailed characterization of inhibitors of transcriptional initiation or elongation by
bacterial RNA polymerases.
Key Words: RNA polymerase; transcription; rifampin; Sigma factor; inhibitor; antibiotic;
high-throughput screen.
1. Introduction
Bacteria possess a single RNA polymerase (RNAP) enzyme that is respon-
sible for the synthesis of all structural RNA (tRNA and rRNA) and messenger
RNA (mRNA) species. RNAP is a complex macromolecular machine
comprised of a multi-subunit catalytic “core” enzyme (2 ) of ∼400 kDa
that combines with an additional subunit, Sigma (), to form a “holoenzyme”
capable of site-specific transcriptional initiation at cognate promoter elements
(1). RNAP is essential for the propagation and maintenance of bacteria
37
38 A. S. Lynch and Q. Du
2. Materials
2.1. Bacterial Strains and Growth Media
1. S. aureus CB0842 is a derivative of strain RN4220 that bears an rpoC::His8
allele linked to a tetracycline-resistant determinant and was engineered by standard
methods (A. S. Lynch, unpublished).
2. E. coli CU0311 is a derivative of BL21 (DE3)/pLysS (Novagen, EMD Biosciences)
bearing a plasmid (pET24- A ) that expresses the S. aureus A (PlaC, RpoD) protein
in an isopropyl -D-1-thiogalactopyranoside (IPTG) inducible fashion (A. S. Lynch,
unpublished).
3. Cation-adjusted Mueller Hinton (MH II) broth and agar medium.
4. Terrific Broth (TB) medium.
5. Luria Bertani (LB) medium.
RNA Polymerase assays 39
(kDa) MW EC PA SA SP MW
203 203
120 120
90 90
52 52
20 20
4 4
3. Methods
The identification and characterization of RNAP inhibitors require access to
highly purified enzyme preparations that exhibit high-specific activity in vitro.
Despite the availability of E. coli RNAP from a number of commercial sources,
RNA Polymerase assays 41
-35 -10 +1
PT7A1 GAGTATTGACTTAAAGTCTAACCTATAGGATACTTACAGCCATA
Psea TATTATAGACAAGTATAAAAAAGGTATAGTAATATATGTATATA
PTAC18 CGCTATTGACATTATAGTGGTACCGCTTATATAATCTCAATTAT
methods that are readily adaptable for the preparation of similar recombinant
enzymes from other bacteria.
A number of biochemical HTS assay methods have been reported that
are broadly applicable to the identification of novel inhibitors of RNAP
enzymes including both (1) non-homogenous methods involving RNA product
capture (17,18) and (2) homogenous methods that utilize either the scintil-
lation proximity assay (SPA) (19,20) or fluorescence-based molecular beacon
(21,22) technologies for RNA product detection. Herein we describe in detail
the use of a 96-well SPA-based HTS assay employing either commercially
supplied E. coli 70 or purified S. aureus A RNAP holoenzymes that can be
run manually or in an automated fashion. This assay is readily adaptable for
implementation in 384- or 1536-well automated formats.
A variety of assays have been reported that are applicable to the detailed
characterization of different mechanistic classes of inhibitors of bacterial RNAP
enzymes (23). Herein we describe methods for the characterization of inhibitors
of transcriptional initiation or elongation and that are based on direct quantifi-
cation of either a single (or multiple) radiolabeled RNA product(s) following
resolution by gel electrophoresis. The transcription template employed in the
assays described in detail bears the bacteriophage T7A1 promoter, which is
efficiently utilized by bacterial RNAP holoenzymes of both Gram-negative and
Gram-positive origin; however, alternate transcription templates can be readily
substituted that are applicable to studies of specific RNAP enzymes. Hence,
while the methods described are focused on characterization of inhibitors of
either E. coli 70 or S. aureus A RNAP holoenzymes, they are readily adaptable
for similar studies of RNAP enzymes from other bacterial sources. Finally,
DNA templates that incorporate a “G-less” cassette element (24) allow for
detailed kinetic studies of RNAP inhibitors through analysis of the yield of
synthesis of a unique RNA product formed by a single round of transcription.
4. The bacterial cells are then harvested by centrifugation at 5000 RPM (4000X g)
for 20 min in a Sorvall H6000A rotor. This step and all subsequent steps are
carried out at 4 ºC or on ice unless stated otherwise.
5. Cell pellets are resuspended, washed in Lysis buffer, and consolidated into a
single pellet by centrifugation at 12,000 RPM (12,000X g) for 20 min in a Sorvall
SLA-1500 rotor. The cell pellet is then either immediately processed as described
below or flash frozen in liquid nitrogen and stored at –80 ºC.
6. If previously frozen, the cell pellet (typically ∼50 g) is gradually thawed and
suspended in 170 mL of Lysis buffer. Four complete protease inhibitor tablets
(EDTA free) and 20 mg of lysostaphin (as a dry powder) are then added, and the
bacterial cell suspension is incubated at 37 ºC for 1 h, with occasional mixing,
and then placed on ice.
7. The viscosity of the bacterial cell solution is then reduced by sonication: 5–10
cycles for 30 s on the maximum power setting with a Branson Digital Sonifier (or
equivalent) with intermittent cooling on ice. Cell lysis is then completed by 4–6
cycles of treatment with a microfluidizer (Microfuidics Corp.) at 80–100 pounds
per square inch (psi) of pressure at 4 ºC.
8. Insoluble cell debris is then removed by centrifugation at 12,000 RPM (12,000X
g) for 20 min in a Sorvall SLA-1500 rotor.
9. RNAP enzyme is purified by IMAC using two 5 mL HiTrap HP columns (in
series) that are charged with CoCl2 and equilibrated in lysis buffer. The supernatant
from Step 8 is loaded onto the HiTrap HP columns using an ÄKTA FPLC system
(Amersham, or equivalent) and washed with 20 column volumes of Buffer A, and
the protein is then eluted with a 20 column volume linear 0–100 mM imidazole
gradient that is produced by mixing Buffer A and Buffer B.
10. Peak column fractions are identified by SDS-PAGE analysis, pooled, and dialyzed
against RNAP storage buffer containing 0.2 mM PMSF.
11. Following dialysis, the concentration of the purified protein preparation is deter-
mined and aliquots flash frozen in liquid N2 and stored at –80 ºC. The final protein
yield is typically 20 mg; see Fig. 1 for SDS-PAGE analysis of a representative
preparation.
holoenzyme form that exhibits high specific activity in vitro. See Note 5 for details
of methods used to estimate the relative stoichiometry of RNAP subunits.
2. If reconstitution of an alternate S. aureus RNAP holoenzyme form is desired, the
recombinant RNAP enzyme must be further purified by repeated passage through
a phosphocellulose column to yield a core RNAP enzyme preparation devoid of
contaminating Sigma factors (see Note 6).
3. Prior to use in mechanistic studies of RNAP inhibitors, reconstituted S. aureus
RNAP holoenzymes should be characterized to ensure that they exhibit site-specific
initiation of transcription from DNA templates bearing a cognate S. aureus promoter
element (see Section 3.5).
120
S. aureus σA Rif-S
100
E. coli σ70 RpoC::His6
% Remaining
80
Activity
60
40
20
0
0.1 1 10 100 1000
Rifampin Concentration
(Log nM)
120
80 S. aureus σA Rif-S
Activity
0
0.1 1 10 100 1000
Rifampin Concentration
(Log nM)
Fig. 3. Analysis of data from the SPA and gel format assays. Figure 3a shows
titrations of rifampin in the SPA format assay obtained for reconstituted forms of
the RpoC::oligo-histidine tagged variants of the S. aureus A and E. coli 70 RNA
polymerase holoenzymes. Analysis of the data using Prism version 3.03 (GraphPad
Software Inc.) yielded apparent 50% inhibition concentration (IC50 ) values of 6 and
9 nM for the S. aureus and E. coli enzymes, respectively. Figure 3b shows titrations of
rifampin in the gel format assay obtained for the indicated RNA polymerase holoen-
zymes using the pGL2B-T7A1-Gless template in reactions conducted in the absence
of GTP. Analysis of the data using Prism yielded apparent IC50 values of 5.5, 9.9, and
10.5 nM for the E. coli 70 (RpoC::His6 ), E. coli 70 (Epicentre), and S. aureus A
(rifampin-sensitive, RpoC::His8 ) enzymes, respectively. Also shown is a titration of
rifampin against a rifampin-resistant variant of the S. aureus A RpoC::His8 enzyme that
RNA Polymerase assays 47
4. Notes
1. Unless otherwise stated, all solutions and buffers should be prepared using high-
quality de-ionized water that is free (<5 ppm) of organic contaminants. Where
indicated, commercially supplied “RNAse-free” water (Ambion Inc.) is employed.
2. Yttrium silicate (Ysi) RNA binding SPA beads are supplied at 100 mg/mL in
water and are stable at 2–8 °C for at least 6 months if protected from light. Once
opened, the beads should be aliquotted and similarly stored at 2–8 °C and then
used within 2–4 weeks.
Fig. 3. (Continued) bears a Ser464Pro mutation in the canonical rifampin-resistance-
determining region of the RpoB subunit. As expected, and in contrast to the wild-
type rifampin-sensitive enzyme, rifampin has little or no effect on the S. aureus
RpoBSer464Pro , RpoC::His8 enzyme in the concentration range tested.
48 A. S. Lynch and Q. Du
tract yields an RNA product of any significant length, it can be readily separated
by electrophoresis from other short aborted transcripts and quantified. Further,
analysis of the yield of synthesis of the unique (G-less) RNA product formed
by a single round of transcription allows for detailed kinetic studies of RNAP
inhibitors.
Acknowledgments
The authors wish to thank both present and past colleagues at Tularik
Inc. and Cumbre Pharmaceuticals Inc. who have contributed to programs
focused on the identification and characterization of inhibitors of bacterial RNA
polymerases; in particular, Kelly LaMarco, Pengguang Wu, Mohan Sivaraja,
Gary H. Dallmann, Daniel Roche, and Len Duncan.
References
1.
1 Mooney, R. A., Darst, S. A., and Landick, R. (2005) Sigma and RNA polymerase:
An on-again, off-again relationship? Mol. Cell 20, 335–345.
2.
2 Adelman, K., Yuzenkova, J., La Porta, A., Zenkin, N., Lee, J., Lis, J. T.,
Borukhov, S., Wang, M. D., and Severinov, K. (2004) Molecular mechanism of
transcription inhibition by peptide antibiotic Microcin J25. Mol. Cell 14, 753–762.
3.
3 Mukhopadhyay, J., Sineva, E., Knight, J., Levy, R. M., and Ebright, R. H. (2004)
Antibacterial peptide microcin J25 inhibits transcription by binding within and
obstructing the RNA polymerase secondary channel. Mol. Cell 14, 739–751.
4.
4 Campbell, E. A., Korzheva, N., Mustaev, A., Murakami, K., Nair, S., Goldfarb, A.,
and Darst, S. A. (2001) Structural mechanism for rifampicin inhibition of bacterial
RNA polymerase. Cell Microbiol, 104, 901–912.
5.
5 Doundoulakis, T., Xiang, A. X., Lira, R., Agrios, K. A., Webber, S. E., Sisson, W.,
Aust, R. M., Shah, A. M., Showalter, R. E., Appleman, J. R., and Simonsen, K. B.
(2004) Myxopyronin B analogs as inhibitors of RNA polymerase, synthesis and
biological evaluation. Bioorg. Med. Chem. Lett. 14, 5667–5672.
6.
6 Babcock, M. J., Buttner, M. J., Keler, C. H., Clarke, B. R., Morris, R. A.,
Lewis, C. G., and Brawner, M. E. (1997) Characterization of the rpoC gene of
Streptomyces coelicolor A3(2) and its use to develop a simple and rapid method
for the purification of RNA polymerase. Gene 196, 31–42.
7.
7 Tuske, S., Sarafianos, S. G., Wang, X., Hudson, B., Sineva, E., Mukhopadhyay, J.,
Birktoft, J. J., Leroy, O., Ismail, S., Clark, A. D. J., Dharia, C., Napoli, A.,
Laptenko, O., Lee, J., Borukhov, S., Ebright, R. H., and Arnold, E. (2005)
Inhibition of bacterial RNA polymerase by streptolydigin: Stabilization of a
straight-bridge-helix active-center conformation. Cell 122, 541–552.
8.
8 Campbell, E. A., Pavlova, O., Zenkin, N., Leon, F., Irschik, H., Jansen, R.,
Severinov, K., and Darst, S. A. (2005) Structural, functional, and genetic analysis
of sorangicin inhibition of bacterial RNA polymerase. EMBO J. 24, 674–682.
50 A. S. Lynch and Q. Du
9.
9 Sarubbi, E., Monti, F., Corti, E., Miele, A., and Selva, V. (2004) Mode of action
of the microbial metabolite GE23077, a novel potent and selective inhibitor of
bacterial RNA polymerase. Eur. J. Biochem. 271, 3146–3154.
10.
10 Andre, E., Bastide, L., Michaux-Charachon, S., Gouby, A., Villain-Guillot, P.,
Latouche, J., Bouchet, A., Gualtieri, M., and Leonetti, J. P. (2006) Novel synthetic
molecules targeting the bacterial RNA polymerase assembly. J. Antimicrob.
Chemother. 57, 245–251.
11. Arhin, F., Belanger, O., Ciblat, S., Dehbi, M., Delorme, D., Dietrich, E., Dixit, D.,
11
Lafontaine, Y., Lehoux, D., Liu, J., McKay, G. A., Moeck, G., Reddy, R., Rose, Y.,
Srikumar, R., Tanaka, K. S., Williams, D. M., Gros, P., Pelletier, J. , Parr, T. R. J.,
and Far, A. R. (2006) A new class of small molecule RNA polymerase inhibitors
with activity against Rifampicin-resistant Staphylococcus aureus. Bioorg. Med.
Chem. 14, 5812–5832.
12.
12 Artsimovitch, I., Chu, C., Lynch, A. S., and Landick, R. (2003) A new class
of bacterial RNA polymerase inhibitor affects nucleotide addition. Science 302,
650–654.
13.
13 Darst, S. A. (2004) New inhibitors targeting bacterial RNA polymerase. Trends
Biochem. Sci. 29, 159–160.
14.
14 Lee, M. S., and Morrison, D. A. (1999) Identification of a new regulator in
Streptococcus pneumoniae linking quorum sensing to competence for genetic
transformation. J. Bacteriol. 181, 5004–5016.
15.
15 Qi, Y., and Hulett, F. M. (1998) PhoP-P and RNA polymerase sigmaA holoenzyme
are sufficient for transcription of Pho regulon promoters in Bacillus subtilis:
PhoP-P activator sites within the coding region stimulate transcription in vitro.
Mol. Microbiol. 28, 1187–1197.
16.
16 Gualtieri, M., Villain-Guillot, P., Latouche, J., Leonetti, J. P., and Bastide, L.
(2006) Mutation in the Bacillus subtilis RNA polymerase beta’ subunit confers
resistance to lipiarmycin. Antimicrob. Agents Chemother. 50, 401–402.
17.
17 Garcia-Martinez, L. F., Bilter, G. K., Wu, J., O’Neill, J., Barbosa, M. S., and
Kovelman, R. (2002) In vitro high-throughput screening assay for modulators of
transcription. Anal. Biochem. 301, 103–110.
18.
18 Wu, P., Daniel-Issakani, S., LaMarco, K., and Strulovici, B. (1997) An automated
high throughput filtration assay: Application to polymerase inhibitor identification.
Anal. Biochem. 245, 226–230.
19.
19 Liu, J., Feldman, P. A., Lippy, J. S., Bobkova, E., Kurilla, M. G., and Chung, T. D.
(2001) A scintillation proximity assay for RNA detection. Anal. Biochem. 289,
239–245.
20.
20 Zheng, W., Carroll, S. S., Inglese, J., Graves, R., Howells, L., and Strulovici,
B. (2001) Miniaturization of a hepatitis C virus RNA polymerase assay using a
-102 degrees C cooled CCD camera-based imaging system. Anal. Biochem. 290,
214–220.
RNA Polymerase assays 51
21.
21 Liu, J., Feldman, P., and Chung, T. D. (2002) Real-time monitoring in vitro
transcription using molecular beacons. Anal. Biochem. 300, 40–45.
22.
22 Marras, S. A., Gold, B., Kramer, F. R., Smith, I., and Tyagi, S. (2004) Real-time
measurement of in vitro transcription. Nucleic Acids Res. 32, e72.
23.
23 Adhya, S. (1996) RNA polymerase and associated factors: Parts A and B; Methods
in Enzymology 273 & 274, Academic Press, San Diego.
24.
24 Sawadogo, M., and Roeder, R. G. (1985) Factors involved in specific transcription
by human RNA polymerase II: Analysis by a rapid and quantitative in vitro assay.
Proc. Natl. Acad. Sci. USA 82, 4394–4398.
25.
25 Maeda, H., Fujita, N., and Ishihama, A. (2000) Competition among seven
Escherichia coli subunits: Relative binding affinities to the core RNA polymerase
Nucleic Acids Res. 28, 3497–3503.
5
Summary
Aminoacyl-tRNA synthetases (aa-RS) attracted interest as potential targets for new antibac-
terial compounds. Most organisms express 20 aa-RSs: one for each amino acid. Aa-RSs are
essential proteins in all living organisms. When one aa-RS is inhibited, the corresponding tRNA is
not charged and is therefore unavailable for translation. This leads to protein synthesis inhibition,
which in turn causes cell growth arrest. Consequently, each compound that inhibits any of the
aa-RS could be a potential antibacterial agent. Only one aa-RS inhibitor, the Ile-RS inhibitor
mupirocin, is currently marketed as an antibacterial agent. We focused on phenylalanyl (Phe)-
tRNA synthetase (Phe-RS), but the described methods are not restricted to Phe-RS and might be
adapted to other aa-RS.
1. Introduction
Protein fractions containing aa-RSs can be isolated from different bacteria,
and inhibition of aa-RS by chemical compounds can be measured in
biochemical experiments. In one of our research programs, compounds were
tested and optimized for inhibition of Phe-RS derived from different Gram-
negative pathogens (Escherichia coli and Haemophilus influenzae) as well
as from Gram-positive pathogens (Staphylococcus aureus and Streptococcus
pneumoniae) (1).
For inhibitors of bacterial aa-RS, which are competitive for the amino acid
binding to their target, difficulties in demonstrating in vitro efficacy on bacteria
53
54 D. Beyer et al.
2. Materials
2.1. Bacterial Strains
S. aureus 133 (deposited with the number DSM11832 at the Deutsche
Sammlung von Mikroorganismen und Zellkulturen, Braunschweig, Germany),
S. pneumoniae G9A, S. pneumoniae 1707/4, H. influenzae Spain 7, and
Moraxella catarrhalis 489 are clinical isolates (purified and identified according
to standard procedures) from infected clinical patients.
Methods to Assay Inhibitors of tRNA Synthetase Activity 55
2.2. Chemicals
1. Mupirocin was kindly provided by Glaxo-Smith-Kline. All other antibiotics and
chemicals used were obtained from Sigma-Aldrich (best quality available) unless
otherwise indicated (see Note 1).
2.3.2. Chemicals
1. Radiolabeled amino acids, e.g., [14 C] Phe or [14 C] Ile (GE Healthcare, England,
product code CFB70 or CFB68, respectively).
2. ATP, solubilized with water to 100 mM.
3. CTP, solubilized with water to 5 mM.
4. tRNAEcoli (Sigma; ribonucleic acid, transfer from E. coli), solubilized with water
to 0.02 A260 /mg.
was prepared with the following ingredients: 6.3 g K2 HPO4 , 0.28 g KH2 PO4 , 1.2 g
sodium acetate, 2.05 g NaCl, 0.22 g MgCl2 , 2.3 mg CaCl2 , 0.014 mg MnSO4 , 1.9 g
glucose, 0.23 g sucrose, 0.25 g pyruvate, 0.09 g alanine, 0.1 g of arginine, 0.05 g of
asparagine, 0.19 g of aspartic acid, 0.04 g of cysteine, 0.57 g of glutamic acid, 0.03
g of glutamine, 0.05 g of glycine, 0.08 g of histidine, 0.2 g of isoleucine, 0.25 g of
leucine, 0.23 g of lysine, 0.08 g of methionine, 0.3 g of proline, 0.15 g of serine,
0.12 g of threonine, 0.04 g of tryptophan, 0.02 g of tyrosine, 0.19 g of valine, 19
mg of adenosine, 19 mg of uridine, 5 mg of choline, 0.02 mg of biotin, 0.6 mg of
nicotinic acid, 0.7 mg of pyridoxine HCl, 2.5 mg of calcium pantothenate, 0.7 mg
of thiamine HCl, and 0.3 mg of riboflavin.
3. For S. pneumoniae, the C-DEN medium was supplemented with 10 g of choline/L
and 20 mg of yeast extract (Becton-Dickinson)/L; for H. influenzae, the medium
was supplemented with 10 g IsoVitale × (Becton-Dickinson)/L and 10 g of hemin
(Oxoid)/L.
4. A simpler minimal medium with the following components (per liter) was used
to cultivate S. aureus and E. coli: 3.3 g Na2 HPO4 , 1 g KH2 PO4 , 1 g NaCl, 0.5 g
NH4 Cl, 0.34 g MgSO4 , 10 g glucose, 1.2 mg nicotinic acid, 0.03 mg of thiamine,
0.003 mg of biotin. All amino acids with the exception of phenylalanine were added
to the minimal medium, resulting in a concentration of 25 μg/mL each.
5. Full-medium (medium with complex ingredients without Phe restriction). Luria
broth medium supplemented with 0.2% (wt/vol) glucose was used for S100 protein
isolation to support optimal bacterial growth.
3. Methods
3.1. Enzymatic aa-tRNA Activity and Enzyme-Inhibition Tests
Protein fraction (S-100), containing soluble proteins including aa-RS, was
isolated according to Nierhaus and Dohme (3). The protocol was initially
optimized for E. coli and subsequently adapted to isolate S-100 fractions from
different bacteria (1).
1. Bacteria were grown in 2 L of appropriate liquid medium (see Note 7) at 37 °C.
Cultures were grown up to an optical density at 578 nm of approximately 0.5 (see
Note 8), cooled to 0 °C in a water/ice bath, and maintained at low temperature for
the whole protein-isolation procedure.
2. Cells were harvested by centrifugation (5,000× g, 7 min, 4 °C), washed three times in
50 mL ice-cold T10 M6 N30 SH4 buffer, and centrifuged again (8,000× g, 10 min, 4 °C).
3. The cell pellet was weighted (wet weight) and resuspended in 1 mL T10 M6 N30 SH4
PF05 buffer per gram of cells.
4. Cells were disrupted by four subsequent French Press Cell passages at 14,000 lb/in.2
(see Note 9).
5. The cell lysate was precipitated by centrifugation (8,000× g, 10 min, 4 °C). The
pellet was discarded and the supernatant was subjected to another centrifugation
(9,000× g, 30 min, 4 °C) followed by a final centrifugation for 18 h at 3,000× g.
6. The supernatant was decanted and dialyzed three times for 1 h against 1 L of
T10 M6 N30 SH4 PF05 at 4 ° C. S-100 enzyme fractions were shock-frozen in liquid
nitrogen in aliquots of 250–500 μL and stored at -80 °C (see Note 10).
3.2. Phe-RS Inhibition Studies
1. Phe-tRNA aminoacylation reaction was performed as follows: 5 μL test compound
(see Note 11), 5 μL [14 C] Phe (approximately 0.05 μCi), up to 10 μL S-100 enzyme
fraction (see Note 12), 15 μL H900 M100 G50 buffer, 5 μL ATP (100 mM), 5 μL CTP,
and 0.1 U of tRNAEcoli (see Note 13) were added in a total volume of 75 μL per aliquot.
2. The reaction was incubated for 20 min at room temperature.
3. The reaction product ([14 C] animoacyl-tRNA) was separated from the [14 C] amino
acid by precipitation with 200 μL of ethanol followed by 30 min of incubation at
4 °C and subsequent filtration through a GF/C 96-well plate.
4. Filter-bound radioactivity was detected with a scintillation counter.
5. IC50 values (concentration at which half of the enzyme activity is inhibited by the
compound) were calculated (see Note 14).
2. MICs were determined by broth microdilution in the media with the appropriate
additives as indicated above for the different bacterial strains with an inoculum of
105 CFU/mL.
3. After incubation for 18 h at 37 °C, MICs were read as the lowest concentrations of
compounds that prevented visible bacterial growth. Streptococci and Haemophilus
strains were incubated in the presence of 10% CO2 (using a jar GasPak 150®
Systems and CampyPak® Hydrogen + CO2 gas generator envelopes of Beckton-
Dickinson); all other strains were incubated in ambient air.
5. Apply the intended antibiotic treatment to the infected animals 30 min after infection
(see Note 16).
6. Sacrifice the animals 3 h after infection by placing them into a tank that is flooded
with CO2 .
7. For determination of the viable bacterial load, remove the organs of interest asepti-
cally and homogenize them in a POTTER S homogenizer (B. Braun, Melsungen,
Germany) in 1 mL sterile 0.9% NaCl. Spread the diluted samples on Columbia
blood agar plates and count the colony-forming units after overnight incubation.
For each sample a dilution series is recommended that covers the concentration
range from 109 to 102 .
4. Notes
1. Antibiotics were weighed on an analytical scale dissolved in the appropriate
amount of solvent and filtered through a sterile filter (0.22 μm pore size; Millipore).
2. Not only was the phenylalanine concentration of the fodder reduced. but the
tyrosine concentration was reduced also. Omitting tyrosine was not required for
the experiment but was recommended by the producer (Ssniff, Soest, Germany),
because during their production process both amino acids were usually added to
the fodder preparation as a mixture. Omitting both phenylalanine and tyrosine
facilitated the production process and reduced production costs.
3. While establishing the animal model, we monitored the content of all amino acids
in the mouse plasma on the 5th, 10th, and 15th day after onset of the diet (see
Fig. 1). The phenylalanine concentration had already dropped from 70 μM to
15 μM on the 5th day and was maintained at that level until the 15th day. Animals
were also weighted daily, and their behavior and motility were investigated over
the whole period. No discrepancies were observed between the group on Phe-
reduced diet and the group on normal diet. As a result, the Phe/Tyr-reduced fodder
was fed for five days prior to starting the bacterial infection.
4. When bacteria are applied in 5% mucin, the lethal infective dose for this strain is
two orders of magnitude lower than when the culture is applied in NaCl alone. This
allows the use of a lower infective dose, which makes the model more responsive
to antibiotic therapy and, thus, more sensitive.
5. The bacterial concentration of 106 colony-forming units per mL corresponds to
the lethal infective dose for this bacterial strain, when applied in 5% mucin to
this mouse strain at this age. Without antibiotic treatment, the animals die within
18 h from a systemic infection. If another bacterial strain is used, a different
mouse strain, or mice at a different age, the lethal dose has to be determined in a
preceding experiment.
6. The solvent that is used for application of the test substance should be selected with
care. It should be ensured that the compound is completely dissolved, especially
when intravenous application is intended, and that the solvent is compatible with
60 D. Beyer et al.
1000
800
600
µM
400
200
0
GLY
ALA
LEU
ILE
VAL
SER
THR
ASP
GLU
ASN
GLN
HIS
ARG
ORN
LYS
PHE
TYR
TRP
MET
day 0 day 5 day 10 day 15
14. To determine IC50 values, at least five different test compound concentrations
should be tested in one experiment. In any case, control experiments (similar
experiment without S-100) should be included in the assay, and the corresponding
background radioactivity should be subtracted. Sensitivity of the test system might
be established in experiments with the Ile-RS inhibitor mupirocin; in our experi-
ments, IC50 values of 0.001–0.004 μM were observed for mupirocin.
15. The groups should contain the minimal number of animals required to obtain
statistically significant results. A group size of 5 is sufficient if the antibacterial
treatment leads to at least a 2 log reduction and if the variations between the
individuals within each group are moderate.
16. Use an application route that is appropriate for your compound and the experi-
mental question under investigation. For per os application, sufficient oral bioavail-
ability is required and good solubility of the compound is a prerequisite for
intravenous injection. 0.2 mL is a suitable volume for intraperitoneal and oral
application and 0.1 mL for intravenous and subcutaneous injection.
Acknowledgments
We thank Rainer Endermann (Bayer Healthcare AG) for performing the
animal experiment and Werner Schroeder (Bayer Healthcare AG) for determi-
nation of the amino acid concentration in mouse plasma.
References
1.
1 Beyer, D., Kroll, H. P., Endermann, R., Schiffer, G., Siegel, S., Bauser, M.,
Pohlmann, J., Brands, M., Ziegelbauer, K., Haebich, D., Eymann, C., and
Brotz-Oesterhelt, H. (2004) New class of bacterial phenylalanyl-tRNA synthetase
inhibitors with high potency and broad-spectrum activity. Antimicrob. Agents
Chemother. 48, 525–532.
2.
2 Lacks, S., and Hotchkiss, R. D. (1960). A study of the genetic material determining
an enzyme activity in Pneumococcus. Biochim. Biophys. Acta 39, 508–518.
3.
3 Nierhaus, K. H., and Dohme, F. (1979). Total reconstitution of 50S subunits from
Escherichia coli ribosomes. Methods in Enzymology LIX, 443–449.
4.
4 Liu, H. (2000). Measurement of blood plasma amino acids in ultrafiltrates by high-
performance liquid chromatography with automatic precolumn O-phthaldialdehyde
derivatization. Methods Mol. Biol. 159, 123–140.
6
W. Scott Champney
Summary
The inhibition of bacterial ribosomal subunit formation is a novel target for translational
inhibitors. Inhibition of subunit biogenesis has been shown to be equivalent to the inhibition of
protein biosynthesis for many antibiotics. This chapter describes three methods for examining
the inhibition of subunit formation in growing bacterial cells. The first method permits the
determination of the IC50 value for inhibition of assembly and protein synthesis. The second is
a pulse and chase labeling procedure to measure the kinetics of subunit formation. The third
procedure allows an examination of ribosome reformation after antibiotic removal as a part of
the post-antibiotic effect. Together these procedures give a description of the relative inhibitory
effects of an antibiotic on translation and subunit formation.
1. Introduction
The bacterial ribosome is an important target for antimicrobial agents. A large
number of natural products and their derivatives are known that bind to this
essential structure and prevent some aspect of its function (1). A variety of small
inhibitors target the 30S subunit and affect its role in the initiation of translation.
Another collection of compounds interact with the larger 50S subunit and inhibit
its functions in protein synthesis. A recent comprehensive review of these
inhibitors is included in the book by Bryskier (2). In addition to effects on the
functional activities of ribosomes in translation, many of the known ribosomal
63
64 W. S. Champney
2. Materials
1. 3 H-uridine (39.5 Ci/mmol) was from Perkin-Elmer, and Tran-35 S-Label methionine
(1175 Ci/mmol) was from MP Biomedicals.
2. 5X A salts: 52.5 g K2 HPO4 , 22.5 g KH2 PO4 , 5 g (NH4 )2 SO4 , and 2.5 g Na citrate
2H2 O in 1 L of H2 O (28). It is diluted to 1X and sterilized before use.
3. SAS buffer: 10 mM Tris-HCl, pH 8.0, 0.1 mM MgCl2 , 50 mM NH4 Cl, which are
filtered and autoclaved for 10 min.
4. Gradient solutions are made by adding 5 g or 20 g of sucrose to SAS buffer and
brought to 100 mL to give 5% and 20% sucrose solutions.
5. Tryptic soy broth (TSB) and square TSB agar plates containing 1.5% agar.
6. DNase I, 1 mg/ml (Sigma).
7. Bovine serum albumin (BSA), 1 mg/ml (Sigma).
8. 10% trichloroacetic acid (TCA).
9. Uridine, 1 mg/ml.
10. Phenylmethanesulfonyl fluoride (PMSF), 0.1 M in isopropanol, made fresh.
Ribosome Assembly Assays 65
3. Methods
3.1. Four-Part Assay Procedure
The advantage of this methodology is that four measures of the effect of
an antibiotic on cell processes can be determined simultaneously in a single
bacterial culture. The inhibition of the growth rate is followed directly by
using side-arm flasks to look at cell density. The viability measurements are
made by simple serial dilution and plating of six samples on the same agar
plate. Protein synthesis rates are measured by 35 S amino acid incorporation
into acid-precipitable material from the culture. Ribosomal subunit amounts are
measured by sucrose gradient centrifugation of 3 H-uridine-labeled cell lysates
in a buffer designed to allow separation of the 30S and 50S particles. The
relative amounts of radioactivity in each region of the gradient indicate the
effect of the antibiotic on subunit formation. The procedure is designed to use
six cultures at once, a control, and five antibiotic-containing samples over a
range of drug concentrations. An analysis of the data permits the calculation
and comparison of an IC50 value for each process (29).
15000
A B
100
10000
75
50
5000
25
0 0
0 5 10 15 0 0.1 0.2 0.3 0.4 0.5 0.6
C D
100 100
% Control growth rate
75 75
50 50
25 25
0 0
0 0.1 0.2 0.3 0.4 0.5 0.6 0 0.1 0.2 0.3 0.4 0.5 0.6
pellet in 3.0 mL SAS buffer. Centrifuge again for 5 min at 6000 rpm. Discard the
supernatant and store the cell pellet at –70 °C.
9. Resuspend the pellets in 0.2 mL SAS buffer. Add 20 μg lysostaphin (= 20 μL of 1
mg/mL stock) and 15 μL of 0.1 M PMSF in isopropanol. Incubate the samples at
room temperature until lysate becomes viscous and debris is apparent. Freeze and
thaw the samples 3 times at –70 °C, then add 5 μL DNAse I (1 mg/mL). Incubate
at room temperature for 5 min. Pellet cell debris by centrifuging 10 min at 6000
rpm at 4 °C. (See Note 5.)
10. Prepare SAS buffer with 5% and 20% sucrose. Make SW40 gradients with 6
mL 5% sucrose and 6 mL 20% sucrose in SAS buffer. Hold the gradients in
refrigerator until the lysate is prepared.
11. Load the supernatant onto the gradients using a sterile Pasteur pipette. Centrifuge
for 5 hours at 39,000 rpm (200,000X g) at 4 °C. Fractionate each gradient through
an ISCO Model UA-5 density gradient fractionator using 40% sucrose with 0.005%
bromophenol blue as a density lift. The full-scale setting is usually 1.0 with a
chart speed of 60 cm/h. Collect fractions of 6 drops each (36 fractions) into 4 mL
plastic scintillation vials. Add 3 mL Scintisafe gel solution, mix well, and count
for 3 H and 35 S radioactivity (dual label setting). (See Notes 6 and 7.)
1. Two 12 mL cultures of cells in TSB, one control and one with the antibiotic at the
IC50 concentration are grown to a Klett of 40 at 27 °C (see Note 8).
2. The cells are pulse labeled with 3 H-uridine (1 μCi/mL) for 90 s and are then chased
with uridine at 25 μg/mL.
3. At intervals, 2 mL samples are removed, collected by centrifugation, washed and
stored frozen before lysis for sucrose gradient centrifugation as described above.
4. Notes
1. Instead of an overnight culture, growth can be initiated from freezer stocks of cells
kept at –70 °C in 12% glycerol.
2. Tryptic soy broth is the best overall growth media to use because of its ability
to support the growth of most bacterial species and its relatively low amino acid
and nucleoside content. Other richer media have more of these metabolites and
will significantly reduce the incorporation of 3 H-uridine and 35 S-methionine. For
the growth of Haemophilus, TSB was supplemented with NAD and hemin at
10 μg/mL. The growth of Streptococci was improved by the addition of bovine
lipoprotein to 0.7%.
3. Side-arm flasks are convenient for following the growth of Staphylococcus,
Haemophilus, and E. coli strains using a Klett-Summerson colorimeter with a red
filter. Streptococci were grown without shaking in a 37 °C incubator in 13X 100
mm screw cap tubes containing 9 mL of TSB. These tubes can also be read in the
Klett colorimeter after mixing the settled cells.
4. It is convenient and efficient to use the method of Jett et al. (34) for plating
cells. One square TSB plate will hold six diluted samples, and two plates allow
duplicates to be made. Accurate colony counts can be made by this method. Serial
dilution of the cells in A salts permits samples to be stored overnight at 4 °C
without growth. Replating of these dilutions can then be performed if desired.
5. Lysis was always accomplished with enzymes and a threefold freeze thaw
procedure. Lysostaphin was used with S. aureus, and lysozyme at 50 μg/mL was
used for the other organisms. With small volumes of radioactive samples, this was
the safest and gentlest method to use. Lysis can be facilitated with the addition of
Triton-X 100 to 0.1% if desired. PMSF is important to prevent protease activity in
the Staph. lysis procedure.
6. Centrifugation can also be performed at 18,000 rpm (45,000X g) for 18 h overnight.
A Beckman SW 41 rotor can also be employed. Fractionation through the ISCO
monitor is not critical, but it allows a printed record of the quality and quantity of
the material in the gradient to be kept. It is important to use a scintillation counter
Ribosome Assembly Assays 69
set for dual label samples so that the 3 H activity from uridine in RNA and the 35 S
activity from protein labels can be distinguished.
7. In the four-part assay, data analysis is performed to measure the IC50 value over
the range of antibiotic concentrations used. For the growth rates, cell counts, and
protein synthesis, this is simply a comparison of the inhibited value relative to
the control set as 100%. Figures 1B–D illustrate typical results obtained with the
oxazolidinone antibiotic linezolid. For the sucrose gradient samples, the areas of
200000 100000
A 50S B
150000 75000
H-Uridine (cpm)
H-Uridine (cpm)
30S
100000 50000
3
50000 25000
0 0
0 10 20 30 40 0 10 20 30 40
Fraction number Fraction number
40 60
C D
50
% Total Gradient CPM
30
40
20 30
20
10
10
0 0
0 0.1 0.2 0.3 0.4 0.5 0.6 0 0.1 0.2 0.3 0.4 0.5 0.6
Linezolid (µg/ml) Linezolid (µg/ml)
Fig. 2. Sucrose gradient profiles of cells labeled with 3 H-uridine with and without
linezolid. (A) Gradient profile of cells grown and labeled without linezolid. (B) Gradient
profile of cells grown and labeled with linezolid at 0.5 μg/ml. (C) Concentration depen-
dence of linezolid effects on 50S amounts ( O ) and 30S amounts ( ). (D) Relative
percentage of total gradient cpm in 50S subunit region ( O ) and the top gradient
fractions (1-10) ( s ) as a function of linezolid concentration. Results are the mean
of duplicate experiments. The arrow indicates the IC50 value. From (19) with kind
permission of Springer Science and Business Media.
70 W. S. Champney
the top, the 30S and 50S regions, are summed and expressed as a percentage
of the total cpm in the gradient. The total radioactivity in the gradient will be
diminished with increasing antibiotic inhibition of growth, representing a good
way to normalize the data. Figures 2A–D are illustrations.
8. The cultures for the pulse-chase analysis are grown at 27 °C in order to slow down
the rate of subunit assembly, which is proportional to the growth rate (35). Typical
results are shown in Fig. 3A–D.
30000 5000
A B
25000
50S 4000
H -uridine (cpm)
H -uridine (cpm)
20000
3000
30S
15000
2000
10000
3
5000 1000
0 0
0 10 20 30 40 0 10 20 30 40
Fraction number Fraction number
30 30
C D
% Total gradient cpm
20 20
10 10
0 0
0 10 20 30 0 10 20 30
Time (min) Time (min)
Fig. 3. Pulse and chase labeling kinetics of 30S and 50S subunit formation in cells
grown with and without linezolid. (A) Gradient profile of cells grown and labeled
without linezolid after 5 min ( O ) and 30 min ( ) of a chase. (B) Gradient profile
of cells grown and labeled with linezolid at 0.5 μg/ml after 5 min ( O ) and 30 min
( ) of a chase. (C) Relative rates of 50S ( O ) and 30S ( ) subunit synthesis in
cells growing without linezolid. (D) Relative rates of 50S ( O ) and 30S ( ) subunit
synthesis in cells growing with linezolid at 0.5 μg/ml.
Ribosome Assembly Assays 71
Acknowledgments
I appreciate the technical assistance of Mindy Miller and Craig Tober for
their help in developing these methods.
References
1.
1 Vazquez, D. (1979) Inhibitors of Protein Biosynthesis. Springer-Verlag, Berlin.
2.
2 Bryskier, A. (2005) Antimicrobial Agents. Antibacterials and Antifungals.
American Society for Microbiology, Washington, DC.
3.
3 Champney, W. S. (2003) Bacterial ribosomal subunit assembly is an antibiotic
target. Curr. Top. Medicinal Chem. 3, 929–947.
4.
4 Champney, W. S., Chittum, H., and Tober, C. L. (2003) A 50S ribosomal subunit
precursor particle is a substrate for the ermC methyltransferase in Staphylococcus
aureus cells. Curr. Microbiol. 46, 453–460.
5.
5 Usary, J., and Champney, W. S. (2001) Erythromycin inhibition of 50S ribosomal
subunit formation in Escherichia coli cells. Molec. Microbiol. 40, 951–962.
6.
6 Silvers, J. A., and Champney, W. S. (2005) Turnover and degradation of 23S
ribosomal RNA in azithromycin-inhibited ribonuclease mutants of Escherichia
coli. Arch. Microbiol. 187, 66–77.
7. Champney, W. S., and Burdine, R. (1996) 50S Ribosomal subunit synthesis and
7
translation are equivalent targets for erythromycin inhibition in Staphylococcus
aureus. Antimicrob. Agents Chemother. 40, 1301–1303.
8.
8 Champney, W. S., and Burdine, R. (1995) Macrolide antibiotics inhibit 50S
ribosomal subunit assembly in Bacillus subtilis and Staphylococcus aureus.
Antimicrob. Agents Chemother. 39, 2141–2144.
9.
9 Champney, W. S., Tober, C. L., and Burdine, R. (1998) A comparison of the
inhibition of translation and 50S ribosomal subunit formation in Staphylococcus
aureus cells by nine different macrolide antibiotics. Curr. Microbiol. 37, 412–417.
10.
10 Champney, W. S., and Burdine, R. (1998) Azithromycin and clarithromycin
inhibition of 50S ribosomal subunit formation in Staphylococcus aureus cells.
Curr. Microbiol. 36, 119–123.
11.
11 Champney, W. S., and Burdine, R. (1998) Macrolide antibiotic inhibition of trans-
lation and 50S ribosomal subunit assembly in methicillin-resistant Staphylococcus
aureus cells. Microbial Drug Resistance 4, 169–174.
12. Champney, W. S., and Tober, C. L. (1998) Inhibition of translation and 50S
12
ribosomal subunit formation in Staphylococcus aureus cells by eleven different
ketolide antibiotics. Curr. Microbiol. 37, 418–425.
13.
13 Champney, W. S., and Tober, C. L. (1998) A molecular investigation of the post-
antibiotic effect of clarithromycin and erythromycin on Staphylococcus aureus
cells. Antimicrob. Agents Chemother. 43, 1324–1328.
72 W. S. Champney
14.
14 Champney, W. S. (1999) Macrolide antibiotic inhibition of 50S ribosomal subunit
formation in bacterial cells. Recent Res. Devel. Antimicrob. Agents Chemother. 3,
39–58.
15.
15 Champney, W. S., and Tober, C. L. (1999) Superiority of 11,12 carbonate
macrolide antibiotics as inhibitors of translation and 50S subunit formation in
Staphylococcus aureus cells. Curr. Microbiol. 38, 342–348.
16.
16 Champney, W. S., and Tober, C. L. (2000) Specific inhibition of 50S ribosomal
subunit formation in Staphylococcus aureus cells by 16-membered macrolide,
lincosamide and streptogramin B antibiotics. Curr. Microbiol. 41, 126–135.
17.
17 Champney, W. S., and Tober, C. L. (2000) Evernimicin (SCH27899) inhibits both
translation and 50S ribosomal subunit formation in Staphylococcus aureus cells.
Antimicrob. Agents Chemother. 44, 1413–1417.
18.
18 Champney, W. S., Pelt, J., and Tober, C. L. (2001) TAN-1057A: A translational
inhibitor of 50S ribosomal subunit activity and formation. Curr. Microbiol. 43,
340–345.
19.
19 Champney, W. S., and Miller, M. (2002) Linezolid is a specific inhibitor of 50S
ribosomal subunit formation in Staphylococcus aureus cells. Curr. Microbiol. 44,
350–356.
20.
20 Mabe, S., and Champney, W. S. (2005) A comparison of a new oral
streptogramin XRP2868 with quniupristin-dalfopristin against antibiotic-resistant
Haemophilus influenzae, Staphylococcus aureus, and Streptococcus pmeumoniae.
Curr. Microbiol. 51, 363–366.
21.
21 Champney, W. S., and Pelt, J. (2002) The ketolide antibiotic ABT773 is an
inhibitor of protein synthesis and 50S ribosomal subunit formation in Streptococcus
pneumoniae cells. Curr. Microbiol. 45, 155–160.
22.
22 Champney, W. S., and Pelt, J. (2002) Telithromycin inhibition of protein synthesis
and 50S ribosomal subunit formation in Streptococcus pneumoniae cells. Curr.
Microbiol. 45, 328–333.
23.
23 Champney, W. S., Mentens, N., and Zurawick, K. (2004) An examination
of the differential sensitivity to ketolide antibiotics in ermB strains of
Streptococcus pneumoniae and Streptococcus pyogenes. Curr. Microbiol. 49,
239–247.
24.
24 Chittum, H. S., and Champney, W. S. (1995) Erythromycin inhibits the assembly
of the large ribosomal subunit in growing Escherichia coli cells. Curr. Microbiol.
30, 273–279.
25.
25 Mehta, R., and Champney, W. S. (2002) 30S ribosomal subunit assembly is a
target for inhibition by aminoglycosides in Escherichia coli. Antimicrob. Agents
Chemother. 46, 1546–1549.
26.
26 Champney, W. S., and Miller, M. (2002) Inhibition of 50S ribosomal subunit
assembly in Haemophilus influenzae cells by azithromycin and erythromycin.
Curr. Microbiol. 44, 418–424.
Ribosome Assembly Assays 73
27.
27 Champney, W. S., and Tober, C. L. (2003) Preferential inhibition of protein
synthesis by ketolide antibiotics in Haemophilus influenzae cells. Curr. Microbiol.
46, 103–108.
28.
28 Miller, J. H. (1972) Experiments in Molecular Genetics. Cold Spring Harbor
Laboratory, Cold Spring Harbor, NY.
29.
29 Champney, W. S. (2001) Bacterial ribosomal subunit synthesis: A novel antibiotic
target. Curr. Drug Targets—Infectious Disorders 1, 19–36.
30.
30 Schlessinger, D. (1974) in Ribosomes (M. Nomura, A. Tissieres, and P. Lengyel,
eds.), Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, pp. 393–416.
31.
31 Mabe, S., Eller, J., and Champney, W. S. (2004) Structure-activity relationships
for three macrolide antibiotics in Haemophilus influenzae. Curr. Microbiol. 49,
248–254.
32.
32 Mehta, R., and Champney, W. S. (2003) Neomycin and paromomycin inhibit
30S ribosomal subunit assembly in Staphylococcus aureus. Curr. Microbiol. 43,
237–243.
33.
33 MacKenzie, F. M., and Gould, I. M. (1993) The post-antibiotic effect. J.
Antimicrob. Chemother. 32, 519–537.
34.
34 Jett, B. D., Hatter, K. L., Huycke, M., and Gilmore, M. S. (1997) Simplified agar
plate method for quantifying viable bacteria. BioTechniques 23, 648–650.
35.
35 Michaels, G. A. (1972) Ribosome maturation of Escherichia coli growing at
different growth rates. J. Bacteriol. 107, 385–387.
7
Summary
In Escherichia coli, the molecular chaperone HSP70 (DnaK) is necessary for 30S and 50S
ribosomal subunit assembly at temperatures above 37 °C. Inhibitors of DnaK should therefore
hinder ribosome biogenesis, in addition to all of the other DnaK-dependent cellular functions.
An easily testable phenotype of DnaK is described here based on -complementation of -
galactosidase. This protein fragment complementation requires a functional DnaK in vivo,
offering a suitable method for screening for DnaK inhibitors. Subsequently, it will be of great
importance to check whether inhibitors of bacterial DnaK selected in this way have an effect
(inhibitory or stimulatory) on the activities of eukaryotic HSP70 and HSC70 chaperones, because
of the universal conservation in all biota of these chaperones in both their structural and functional
properties. This question is important due to their implication in many pathways in immunology,
cancer biology, and neurodegenerative disorders.
Key Words: E.coli; chaperone; DnaK; HSP70; ribosome; ribosomal subunit assembly;
biogenesis; -complementation; -galactosidase.
1. Introduction
Extra-ribosomal factors are likely to be involved in the biogenesis of
bacterial ribosomal subunits (1,2). The E. coli chaperones DnaK/DnaJ/GrpE
(3,4) and GroEL/GroES (5) are candidates for such a function, because authentic
precursors (21S, 32S, and 45S particles) to ribosomal subunits (30S and 50S)
accumulate in an E. coli thermosensitive dnaK756-ts mutant at 44 °C (6). A
defective DnaK system (dnaK null mutant) does not affect ribosome assembly
at 30 °C, but seriously disturbs assembly at temperatures above 37 °C (5).
75
76 A. A. Refaii and J.-H. Alix
2. Materials
2.1. E. coli Strains and Growth Media
1. Ribosome assembly defects are generally exacerbated in E. coli strains devoid of
stringent control (relaxed phenotype), and therefore any dnaK+ , relA strain such
as AL26 (relA251: :kanR ) (4) or MC4100(relA1) (5) is suitable for studying the
pattern of labeled ribosomal particles by sedimentation analysis.
2. Strains harboring either a mutant dnaK allele (AL19 = AL26dnaK756-ts) (3) or
a dnaK null allele (BB1553 = MC4100dnaK52: :cmR , sidB1 (5)) (see Note 1)
can be used as control strains exhibiting typical ribosome assembly defects when
Chaperones and Ribosome Biogenesis 77
3. Methods
3.1. Analysis of the Ribosome Assembly Pattern
1. To label ribosomes synthesized by the strain under study (wild-type or mutant dnaK,
with a resident plasmid or not), liquid cultures (50 mL to 200 mL) are inoculated
with 0.01 volume of an overnight preculture grown in the same medium at 30 °C.
2. Incubation at 30 °C in a shaking water bath is continued for 3 to 5 h, and the
A600 /mL of the culture is measured each hour.
3. For labeling at 30°C, [3 H]-uridine is added to the culture at an A600 /mL between
0.3 and 0.6, and incubation is continued for 1 h.
4. For labeling at a non-permissive temperature, the culture is transferred to a second
water bath set up at the required temperature, and shaken for 1.5 h (see Note 6)
before adding the labeled uridine as above. Incubation is then continued for 1 h.
5. 1 mL of bacterial samples are withdrawn and acid-insoluble radioactivity is
measured, to estimate the amount of tritated uridine incorporated into RNA.
Labeling at 43 °C generally results in 105 to 106 [3 H] c.p.m. incorporated in the
culture, about 2–3-fold less than that obtained at 30 °C.
6. Aliquots of the culture and of the overnight culture are also streaked on plates to
verify the expected phenotypes of the strain under study, like antibiotic resistance
or thermosensitivity.
7. Bacteria are collected by centrifugation, washed with TMNSH buffer, and the
bacterial pellets (usually 50 to 200 mg) are kept frozen at –20 °C in 15 mL Corex
tubes.
8. Bacterial crude extracts are prepared by grinding bacteria in the Corex tubes
with a glass rod in the presence of twice their weight of alumina. They are
resuspended in 1 to 2 mL of TMNSH buffer, then centrifuged at 10,000 rpm
(12,000X g) for 20 min in a Sorvall centrifuge at 3 °C to pellet the alumina,
unbroken cells, and cell debris. The supernatants are immediately layered on sucrose
gradients.
Chaperones and Ribosome Biogenesis 79
Fig. 1. Sedimentation profiles of ribosomes and their subunits prepared from strains
AL26 (dnaK+ ) (A and B) , and AL19 (dnaK756-ts) (C and D) labeled with [3 H]-uridine
at 43°C. Ionic conditions in sucrose gradients promote either association of ribosomal
subunits (A and C) or their dissociation (B and D). Sedimentation is from right to left.
A260 /mL, open circles. [3 H] c.p.m, closed circles. (Taken from (4), with kind permission
of Springer Science and Business Media.)
80 A. A. Refaii and J.-H. Alix
4. Notes
1. The sidB1 mutation is an extragenic suppressor present in the strain BB1553, in
addition to the disrupted dnaK gene. It prevents the excessive synthesis of heat-
shock proteins that occurs in the absence of DnaK, the negative regulator of the
heat-shock response in prokaryotes. It is a mutant allele of rpoH, which encodes
the heat-shock-specific transcription factor 32 . The point mutation (Thr252Met) in
sidB1 affects the activity rather than the cellular concentration of 32 and suppresses
the major cellular defects of the dnaK52 mutant by reducing the elevated level of
expression of heat-shock proteins (9).
2. Strains AL19 and BB1553 (dnaK) are thermosensitive for growth on LB plates
at 44 °C and 38 °C, respectively, whereas dnaK+ strains AL26 and MC4100 grow
on LB plates at 44 °C. BB1553 (cmR ) grows on LB plates containing 25 μ g/mL
chloramphenicol at 30 °C.
3. Strain JM83 (lacZM15, dnaK52::cmR ) is chloramphenicol-resistant,
temperature-sensitive (at 40 °C), and cold-sensitive (at 20 °C), as expected. When
transformed to kanamycin resistance with plasmid pWSK129, it is unable to sustain
-complementation after streaking on LB plates containing IPTG, X-Gal, and
kanamycin, since all the isolated colonies are white after 48 h at 30 °C. However, the
high-cell-density portion of the streak is pale blue (see Fig. 5A of (8)), and therefore
it is important to examine the lac phenotype at the level of isolated colonies and
not at high cell density.
4. Strain TR20 (dnaK756-ts) grows normally in LB medium at 37 °C and also at 40 °C,
although a slight inhibition of growth is observed at 40 °C. -complementation is
abolished at these temperatures but is normal at 30 °C, the permissive temperature.
5. In the case of a pulse-chase experiment, labeling is performed for 30 s (with [5-3 H]
uridine Amersham (TRK178) isotopically undiluted), followed by a chase with 0.5
mM unlabeled uridine.
6. It is assumed that the mutant DnaK756 protein present in strain AL19 is thermosen-
sitive and inactive only when synthesized at 43 °C, but that the portion synthesized
84 A. A. Refaii and J.-H. Alix
References
1.
1 Alix, J. H. (1993) Extrinsic factors in ribosome assembly. In The Translational
Apparatus: Structure, Function, Regulation, Evolution (K. H. Nierhaus et al., eds.),
Plenum, New York, pp.173–184.
2.
2 Culver, G. M. (2003) Assembly of the 30S ribosomal subunit. Biopolymers 68,
234–249.
3.
3 Alix, J. H., and Guérin, M. F. (1993) Mutant DnaK chaperones cause ribosome
assembly defects in E. coli. Proc. Natl. Acad. Sci. USA 90, 9725–9729.
4.
4 Sbaï, M., and Alix, J. H. (1998) DnaK-dependent ribosome biogenesis in E. coli:
Competition for dominance between the alleles dnaK756 and dnaK+ . Mol. Gen.
Genet . 260, 199–206.
5.
5 El Hage, A., Sbaï, M., and Alix, J. H. (2001) The chaperonin GroEL and other
heat-shock proteins, besides DnaK, participate in ribosome biogenesis in E. coli.
Mol. Gen. Genet. 264, 796–808.
6.
6 El Hage, A., and Alix, J. H. (2004) Authentic precursors to ribosomal subunits
accumulate in E. coli in the absence of functional DnaK chaperone. Mol. Microbiol.
51, 189–201.
7.
7 Alix, J. H. (2004) The work of chaperones. In Protein Synthesis and Ribosome
Structure (K. H. Nierhaus.and D. N. Wilson, eds.), Wiley-VCH Verlag, New York,
pp. 529–562.
8.
8 Lopes Ferreira, N., and Alix, J. H. (2002) The DnaK chaperone is necessary for
-complementation of -galactosidase in E. coli. J. Bacteriol. 184, 7047–7054.
9.
9 Bukau, B., and Walker, G. C. (1990) Mutations altering heat shock specific subunit
of RNA polymerase suppress major cellular defects of E. coli mutants lacking the
DnaK chaperone. EMBO J. 9, 4027–4036.
10.
10 Miller, J. H. (1972) Experiments in Molecular Genetics. Cold Spring Harbor
Laboratory Press, New York.
11.
11 Neidhardt, F. C., Bloch, P. L., and Smith, D. F. (1974) Culture medium for
enterobacteria. J. Bacteriol. 119, 736–747.
Chaperones and Ribosome Biogenesis 85
12.
12 Yanisch-Perron, C., Vieira, J., and Messing, J. (1985) Improved M13 phage
cloning vectors and host strains: Nucleotide sequences of the M13mp18 and pUC19
vectors. Gene 33, 103–119.
13.
13 Wang, R. F., and Kushner, S. R. (1991) Construction of versatile low-copy-number
vectors for cloning, sequencing and gene expression in E. coli. Gene 100, 195–199.
14.
14 Rida, S., Caillet, J., and Alix, J. H. (1996) Amplification of a novel gene, sanA,
abolishes a vancomycin-sensitive defect in E. coli. J. Bacteriol. 178, 94–102.
15.
15 Shapiro, S., and Baneyx, F. (2002) Stress-based identification and classification
of antibacterial agents: Second-generation E. coli reporter strains and optimization
of detection. Antimicrob. Agents Chemother. 46, 2490–2497.
16.
16 Abbas-Terki, T. and Picard, D. (1999) -Complementation of -galactosidase: An
in vivo model substrate for the molecular chaperone heat-shock protein 90 in yeast.
Eur. J. Biochem. 266, 517–523.
8
Summary
While bacterial protein synthesis is the target of about half of the known antibiotics, the great
structural-functional complexity of the translational machinery still offers remarkable oppor-
tunities for identifying novel and specific inhibitors of unexploited targets. We designed a
knowledge-based in vitro translation assay to identify inhibitors selectively targeting the bacterial
or the yeast translational apparatus, preferentially blocking the early steps of protein synthesis.
Using a natural-like, “universal” model mRNA and cell-free extracts prepared from Eschericha
coli, Saccharomyces cerevisiae, and HeLa cells, we were able to translate, with comparable
yields in the three systems, the immunogenic peptide encoded by this “universal” mRNA. The
immuno-enzymatic quantification of the translated peptide in the presence of a potential inhibitor
can identify a selective bacterial or fungal inhibitor inactive in the human system. When applied
to the high-throughput screening (HTS) of a library of approximately 25,000 natural products,
this assay led to the identification of two novel and specific inhibitors of bacterial translation.
1. Introduction
The translational apparatus of both bacteria and lower eukaryotes, such as
pathogenic protozoa and fungi, is an ideal target for the identification of new
anti-infective drugs. In fact, protein synthesis is a vital, multi-target process
involving the largest and most complex ribozyme found in nature (i.e., the
ribosome) in addition to over 100 RNA and protein molecules. The mechanism
of protein synthesis is essentially the same in all kingdoms of life and relies
87
88 L. Brandi et al.
2. Materials
2.1. General Materials
1. Mortar (20 cm diameter).
2. Polystyrene roller bottles (Corning 850 cm2 ).
3. Dialysis tubing (Spectrum Laboratories, Inc.) with 3,500 Da molecular weight
cut-off.
90 L. Brandi et al.
2.3. Buffers
1. Binding buffer: 20mM Tris-HCl, pH 7.5, 500 mM NaCl, 1mM EDTA, pH 8.0.
Sterilized by autoclaving.
2. Wash buffer: 20 mM Tris-HCl, pH 7.5, 100 mM NaCl, 1mM EDTA, pH 8.0.
Sterilized by autoclaving.
3. Elution buffer: 20 mM Tris-HCl, pH 7.5, 1mM EDTA, pH 8.0. Sterilized by
autoclaving.
4. Buffer A: 10mM Tris-HCl, pH 7.7, 10mM Mg acetate, 60mM NH4 Cl, 10%
glycerol. Sterilized by autoclaving. Just before use, make 0.2 mM benzamidine,
0.2 mM PMSF, and 1 mM DTT.
5. Bacterial grinding/extraction buffer: Buffer A containing 0.5 g/L bentonite.
Sterilized by autoclaving.
6. Breaking buffer: 30 mM Hepes-KOH, pH 7.4, 100 mM K acetate, 2 mM Mg
acetate, 20% glycerol. Sterilized by autoclaving. Add mannitol, 85 g/L, and just
before use, make 2 mM DTT and 0.5 mM PMSF.
Translation Test for Antibiotic Detection 93
1. DEPC-treated water.
2. Ribonucleotide triphosphates, ATP, GTP, UTP, CTP, Na salts (Roche).
3. BSA RNase-free, 20 mg/mL (Roche), and RNasin Ribonuclease Inhibitor, 40 U/mL
(Promega).
4. 1 M Tris-HCl, pH 8.0, 1 M MgCl2 , 1 M spermidine trihydrochloride, and 1 M
DTT.
5. T7 RNA polymerase (BioLabs).
3. Methods
3.1. In vitro Transcription of Model mRNA
The quality of the mRNA is a key element in determining the quality of
the results obtained in the translation tests. Thus, special care should be taken
in the preparation and purification of the mRNA. The main characteristics
of the universal mRNA 27IF2Cp(A) are described in Section 1.1.The DNA
template used for the in vitro transcription is present as an insert in a plasmid
(pTZ18UmRNA). For the transcription reaction it is possible to use either a
DNA template prepared by PCR amplification of the relevant coding sequence
or the HindIII-linearized plasmid. The mRNA produced by transcription can be
purified (see Note 6) either by column chromatography on oligo (dT) cellulose
(Section 3.1.2.1) or by LiCl precipitation (Section 3.1.2.2). Disposable sterile
plastic ware as well as glassware oven-sterilized for 4 h at 180 °C after rinsing
with DEPC-treated water is used in the preparative transcription of the mRNA.
3.1.1. Transcription Reaction
1. The reaction mix (typically 12 mL) consists of 0.02 μM DNA template, 40 mM
Tris-HCl, pH 8.1, 20 mM MgCl2 , 10 mM spermidine, 5 mM DTT, 0.1 mg/mL
BSA, 0.05 U/μL RNase inhibitor, 0.004 U/μL PPase, 3.75 mM each ribonucleotide
triphosphates, and 1.2–1.7 U/μL T7 RNA polymerase.
2. The reaction mix is incubated for 2–3 h at 37 °C (see Note 7).
Translation Test for Antibiotic Detection 97
0.5 mM ATP, 0.1 mM GTP, 30 mM CP, 20 μg/mL CPK, 200 U/mL RNase inhibitor,
amino acid mixture containing 200 μM each of all amino acids (minus pheny-
lalanine), 9 μM [14 C] phenylalanine, and 36 μM non-radioactive phenylalanine.
2. Optimized aliquots of the S30 yeast extract (generally 0.5–1 A260 /tube is the best
concentration) and of universal mRNA (generally, 0.056 μM) are added to the
reaction mixture (following the same procedure described for bacterial translation
reported in Note 17).
3. The reaction mixture is incubated for 90–120 min at 25 °C, then 20 μL aliquots
from each sample are spotted on 3 MM filters and processed as described for the
bacterial system (see Section 3.5.2).
3.5.6. In vitro Yeast Non-radioactive Translation
The reaction mixture is prepared and incubated as described in Section 3.5.5
except for the omission of radioactive phenylalanine and the inclusion of 45
μM non-radioactive phenylalanine. The immunodetection and quantification of
the translated peptide are performed as described for the bacterial system (see
Section 3.5.3).
3.5.7. In vitro Human Translation
1. Translation is performed in 15–25 μL reaction mixtures containing 16 mM Hepes-
KOH, pH 7.6, 75 mM Ka acetate, 2.5 mM Mg acetate, 2mM DTT, 0.8 mM ATP,
0.1 mM GTP, 20 mM CP, 0.1μg/μL CPK, 0.1 μg/μL bovine liver tRNA, amino
acid mixture containing 200 μM each of all amino acids including phenylalanine,
and 0.1 mM spermidine.
2. Optimized aliquots of the HeLa cell extract (generally, 6–9 μL/15 μL is the best
concentration) and of universal mRNA (generally, 0.3 μM) are added to the
reaction mixture (following the same procedure described for bacterial translation
reported in Note 17).
3. The translation reaction is incubated for 60 min at 30 °C, and 10–25 μL are used
for the immunological quantification of the peptide produced, which is carried out
as described for the bacterial system (see Section 3.5.3).
4. Notes
1. Using the commercially available chemical capping system, our mRNA can be
capped and used to drive a CAP-dependent translation.
2. The unwashed glass beads were washed in 33% HCl (overnight), then washed
with plenty of water, and sterilized in an oven at 180 °C for 8 h.
3. DEPC-treated water is obtained by diluting 1:1000 the DEPC (Caution: toxic).
After stirring overnight, the solution is autoclaved at 120 °C for 20 min 2–3 times
in order to be sure that all the DEPC is completely removed. Since RNases can be
permanently denatured by multiple cycles of autoclaving, another way to sterilize
water (especially large volumes) is to autoclave it 3–4 times.
Translation Test for Antibiotic Detection 103
17. Keep all components of the translation reaction on ice. Prepare a premix consisting
of water, ions, energy system, amino acids, and tRNA in an ice-cold tube.
Distribute the S30 into the single Eppendorf tubes, and then add the premix and
finally the mRNA. The mRNA can be frozen and thawed many times, but use
sterile materials and make a fresh dilution for each experiment in order to add an
easy-to-pipette aliquot to the rest of the reagents to start the reaction. Transfer the
Eppendorf tubes from ice to a 37 °C incubator. Do not freeze leftover S30 more
than once.
18. To calculate the yield of product in pmoles, one must determine the specific
activity (cpm/pmole) of the Phe in the reaction mixture. This is done by directly
spotting 2 μL of the reaction mix onto a prewashed 3MM filter, determining the
cpm on the filter, and correlating the cpm with the known amount of Phe present
in the 2 μL. From this specific activity (cpm/pmol Phe) and knowing the number
of Phe present in the product peptide, one can calculate the pmoles of peptides
synthesized in vitro.
19. When calculating the final concentrations of these ions (Mg++ = 3.8 mM and
K+ = 160 mM) in the in vitro translation reaction mixture, one must keep in mind
that the S30 contains Mg++ and K+ .
Acknowledgments
The authors would like to thank Prof. Fabrizio Loreni for the kind gift of
the HeLa S3 cell line.
References
1.
1 Bottger, E. C., Springer, B., Prammananan, T., Kidan, Y., and Sander, P. (2001)
Structural basis for selectivity and toxicity of ribosomal antibiotics. EMBO Rep.
2, 318–323.
2.
2 Ban, N., Nissen, P., Hansen, J., Moore, P. B., and Steitz, T. A. (2000) The
complete atomic structure of the large ribosomal subunit at 2.4 A resolution.
Science 289, 905–920.
3.
3 Harms, J., Schluenzen, F., Zarivach, R., Bashan, A., Gat, S., Agmon, I., Bartels,
H., Franceschi, F., and Yonath, A. (2001) High resolution structure of the large
ribosomal subunit from a mesophilic eubacterium. Cell 107, 679–688.
4.
4 Nissen, P., Hansen, J., Ban, N., Moore, P. B., and Steitz, T. A. (2000) The
structural basis of ribosome activity in peptide bond synthesis. Science 289,
920–930.
5.
5 Schluenzen, F., Tocilj, A., Zarivach, R., Harms, J., Gluehmann, M., Janell,
D., Bashan, A., Bartels, H., Agmon, I., Franceschi, F., and Yonath, A. (2000)
Structure of functionally activated small ribosomal subunit at 3.3 Angstroms
resolution. Cell 102, 615–623.
Translation Test for Antibiotic Detection 105
6.
6 Schuwirth, B. S., Borovinskaya, M. A., Hau, C. W., Zhang, W., Vila-Sanjurjo,
A., Holton, J. M., and Cate, J. H. (2005) Structures of the bacterial ribosome at
3.5 A resolution. Science 310, 827–834.
7.
7 Wimberly, B. T., Brodersen, D. E., Clemons, W. M. Jr., Morgan-Warren, R. J.,
Carter, A. P., Vonrhein, C., Hartsch, T., and Ramakrishnan, V. (2000) Structure
of the 30S ribosomal subunit. Nature 407, 327–339.
8.
8 Yusupov, M. M., Yusupova, G. Z., Baucom, A., Lieberman, K., Earnest, T.
N., Cate, J H, and Noller,H F. (2001) Crystal structure of the ribosome at 5.5
A resolution. Science 292, 883–896.
9.
9 Poehlsgaard, J., and Douthwaite, S. (2005) The bacterial ribosome as a target for
antibiotics. Nat. Rev. Microbiol. 3, 870–881.
10.
10 Bottger, E. C. (2006) The ribosome as a drug target. Trends Biotechnol. 24,
145–147.
11.
11 Harms, J. M., Bartels, H., Schlunzen, F., and Yonath, A. (2003) Antibiotics acting
on the translational machinery. J. Cell Sci. 116, 1391–1393.
12.
12 Tenson, T., and Mankin, A. (2006) Antibiotics and the ribosome. Mol. Microbiol.
59,1664–1677.
13.
13 Brandi, L., Lazzarini, A., Cavaletti, L., Abbondi, M., Corti, E., Ciciliato, I.,
Gastaldo, L., Marazzi, A., Feroggio, M., Fabbretti, A., Maio, A., Colombo, L.,
Donadio, S., Marinelli, F., Losi, F., Gualerzi, C. O., and Selva, E. (2006) Novel
tetrapeptide inhibitors of bacterial protein synthesis produced by a Streptomyces
sp. Biochemistry 45, 3692–3702.
14.
14 Brandi, L., Fabbretti, A., La Teana, A., Abbondi, M., Losi, D., Donadio, S.,
et al. (2006) Specific, efficient, and selective inhibition of prokaryotic translation
initiation by a novel peptide antibiatic. Proc Natl Acad Sci USA 103, 39–44.
15.
15 Brandi, L., Fabbretti, A., Di Stefano, M., Lazzarini, A., Abbondi, M., and
Gualerzi, C. O. (2006) Characterization of GE82832, a peptide inhibitor
of translocation interacting with bacterial 30S ribosomal subunits. RNA 12,
1262–1270.
16.
16 McCarthy, J. E., and Gualerzi, C. (1990) Translational control of prokaryotic
gene expression. Trends Genet. 6, 78–85.
17.
17 Cigan, A. M., and Donahue, T. F. (1987) Sequence and structural features
associated with translational initiator regions in yeast—A review. Gene 59, 1–18.
18.
18 Iizuka, N., Najita, L., Franzusoff, A., and Sarnow, P. (1994) Cap-dependent
and cap-independent translation by internal initiation of mRNAs in cell extracts
prepared from Saccharomyces cerevisiae. Mol. Cell Biol. 14, 7322–7330.
19.
19 Calogero, R. A., Pon, C. L., Canonaco, M. A., and Gualerzi, C. O. (1988)
Selection of the mRNA translation initiation region by Escherichia coli
ribosomes. Proc. Natl. Acad. Sci. USA 85, 6427–6431.
20.
20 Carroll, R., and Lucas-Lenard, J. (1993) Preparation of a cell-free trans-
lation system with minimal loss of initiation factor eIF-2/eIF-2B activity. Anal.
Biochem. 212, 17–23.
9
Summary
The formation of peptide bonds is the central chemical reaction during protein synthesis
and is catalyzed by the peptidyl transferase center residing in the large ribosomal subunit. This
active site is composed of universally conserved rRNA nucleosides. The peptidyl transferase
center is by far the most frequently used target site of natural antibiotics in the cell. Here we
describe a novel, simple, and convenient method to assess peptide bond formation which we
named SPARK. The basic principle of SPARK is the use of two reaction substrates that closely
resemble the natural tRNA substrates (one is biotinylated and the other carries a tritium label)
that become covalently connected during transpeptidation. Formation of this peptide bond then
allows capture and direct quantification of the radiolabled product, now joined to the biotin
group, using the scintillation proximity assay technology. Binding of the tritiated radioligand to
streptavidin-coated beads causes the excitation of the bead-embedded scintillant, thus resulting in
the detection of radioactivity. Since no product purification step is required, SPARK is amenable
to simple automation, which makes it useful in high-throughput screens of natural or synthetic
compound libraries in the search for novel antibiotics.
1. Introduction
All the proteins in the cell are synthesized by ribosomes, which use the
genetic information brought in the form of mRNA to polymerize amino
acids into functional polypeptides. The ribosome is an evolutionary preferred
antibiotic target: More than half of the known natural antibiotics inhibit growth
of bacteria by interfering with the functions of the translation apparatus.
107
108 A. S. Mankin and N. Polacek
Fig. 1. The principle of SPARK. a. The reaction of peptide bond formation (peptidyl
transfer reaction) catalyzed by the ribosome in the process of protein synthesis. In the
result of the reaction, the peptidyl residue (light gray circles) is transferred from the
P-site bound tRNA to the aminoacyl moiety (dark gray circle) of the A-site bound
aminoacyl-tRNA. b. SPARK-Pmn. The tritium-labeled formyl methionine (filled circle)
is transferred from the P-site bound formyl-[3 H]Met-tRNAfMet to the aminoacyl residue
(open circle) of biot CC-Pmn (biotin moiety is shown as a star). The reaction product
SPARK: A New Peptidyl Transferase Activity Assay 109
The ribosome consists of two subunits, large and small. Each of the subunits
is built of ribosomal RNA (rRNA) and ribosomal proteins, with rRNA being the
main structural and functional component of the ribosome. The key chemical
reaction catalyzed by the ribosome is the formation of new peptide bonds that
link amino acid residues into polypeptides. In the course of the reaction, the
growing polypeptide is transferred from the peptidyl-tRNA bound in the P-site
of the ribosome to the aminoacyl-tRNA bound in the ribosomal A-site. This
results in the elongation of the polypeptide by one amino acid (Fig. 1). In
chemical terms, the reaction involves a nucleophilic attack of the -amino group
of aminoacyl-tRNA on the carbonyl carbon atom of the ester bond that links
the peptidyl moiety to the 3’-hydroxyl of the 3’ terminal adenine residue of
peptidyl-tRNA. The reaction takes place in the active site of the catalytic center
of the large ribosomal subunit, which is called the peptidyl transferase center
(PTC). A great variety of natural antibiotics and their semisynthetic deriva-
tives bind at the PTC and interfere with peptide bond formation by obstructing
correct binding of the PTC substrates, peptidyl-tRNA and aminoacyl-tRNA,
or by affecting the orientation of critical nucleotides in the peptidyl trans-
ferase active site (1). Clinically important antibiotics such as lincosamides,
streptogramins A, oxazolidinones, and others act upon the PTC. Therefore, a
significant effort is dedicated to search for newer drugs that would inhibit trans-
lation by targeting the PTC, which arguably represents the best evolutionarily
and clinically validated antibiotic target.
The Scintillation Proximity Assay for Ribosome Kinetics (SPARK) is an
assay developed in collaboration with researchers at Pharmacia and Upjohn
(presently Pfizer) (2). SPARK provides a simple and efficient way to test
multiple compounds for their ability to inhibit peptide bond formation in a high-
throughput format. The reaction utilizes beads that carry embedded scintillant
(SPA beads, GE-Healthcare Bio-Sciences) and are coated with streptavidin.
SPA beads can detect the radioactivity of a tritium-labeled substrate bound on
the surface of the beads. One of the substrates used in SPARK assay carries
Fig. 1. (Continued) is captured by streptavidin-coated SPA beads, and the proximity
of the tritium source to the bead leads to activation of the bead-embedded scintillant.
c. SPARK-2T. The N-biotin-conjugated phenylalanine residue is transferred from the
P-site bound biotin-Phe-tRNAPhe to [3 H]Phe-tRNAPhe of the A-site bound aminoacyl-
tRNA. The reaction product is captured by streptavidin-coated SPA beads, and the
proximity of the tritium source to the bead leads to activation of the bead-embedded
scintillant.
110 A. S. Mankin and N. Polacek
a biotin tag, while the other is 3 H-labeled. The peptidyl transfer reaction (the
reaction of peptide bond formation) leads to a covalent linkage between the two
substrates and thus generates a biotinylated and tritium-labeled product that
can be monitored directly in the reaction mixture without further purification
(Fig. 1b–c). Depending on the experimenter’s needs, the reaction can utilize
various tRNA analogs. The activity of a complete (70S) ribosome or of an
isolated large (50S) ribosomal subunit can be assayed.
2. Materials
2.1. Ribosomes and S100 Supernatant
1. E. coli ribosomes and ribosomal subunits were prepared from the strain MRE600
or CAN20-12E, essentially as described in (3). A 25 g cell pellet is resuspended in
45 ml buffer A, 20 mM Tris-HCl, pH 7.5, 100 mM NH4 Cl, 10 mM MgCl2 , 0.5 mM
EDTA, 6 mM -mercaptoethanol, and lysed by passing the cells twice through a
French Press at 18,000 psi. The cell lysate is centrifuged for 15 min at 30,000X g
in an SS-34 rotor and the resulting supernatant incubated with 20 units RQ1 DNase
(Promega) for 5 min on ice. After another 15 min centrifugation at 30,000X g, the
cell lysate is layered on top of a 12 mL 1.1 M sucrose cushion prepared in buffer
B: 20 mM Tris-HCl, pH 7.5, 500 mM NH4 Cl, 10 mM MgCl2 , 0.5 mM EDTA
employing 32.4 mL Beckman Optiseal polyallomer tubes. Subsequent to a 17 h
ultracentrifugation at 100,000X g, the crude post-ribosomal supernatant (S100) is
removed and the ribosome pellet-washed with 5 mL buffer C: 50 mM Tris-HCl,
pH 7.6, 100 mM NH4 Cl, 10 mM MgCl2 , 6 mM -mercaptoethanol, and finally
resuspended in 300 μL buffer C. The concentration of the 70S ribosome prepa-
ration is determined by spectrophotometry (1A260 = 24 pmol 70S). The ribosome
concentration is adjusted to 24 μM, and the solution is aliquotted, snap-frozen, and
stored at –80°C.
2. In our experience, SPARK can be used with ribosomes from other Gram-positive
and Gram-negative species (Staphylococcus aureus, Thermus aquaticus, and others
(2,4)) without any modifications of the SPARK protocol.
3. The E. coli post-ribosomal supernatant (S100) containing aminoacyl-tRNA
synthetases is used for tRNA aminoacylation (5). The crude S100 supernatant from
Step 1 is dialyzed three times against 100 volumes of buffer D: 20 mM Hepes-
KOH, pH 7.6, 6 mM MgOAc2 30 mM NH4 Cl, 4 mM 2-mercaptoethanol for 30
min each at 4°C using a membrane with a molecular-weight cut-off of 3.5 kD. The
endogenous tRNAs are removed by batch treatment with DEAE-cellulose (Sigma-
Aldrich, St. Louis, MO) (this step also eliminates a substantial amount of cellular
RNases). 5 g of cellulose are resuspended in buffer E: 20 mM Hepes-KOH, pH
7.6, 10 mM MgOAc2 500 mM KCl prewarmed to 90°C, and incubated at 90°C
for 30 min. The supernatant is decanted, and the procedure repeated twice at 90°C
and three times with buffer F: 20 mM Hepes-KOH, pH 7.6, 10 mM MgOAc2
SPARK: A New Peptidyl Transferase Activity Assay 111
150 mM KCl at room temperature. The supernatant is removed, and the cellulose
matrix is left for at least 2 h at 4°C and subsequently combined with ∼50 mL S100
extract and incubated for 2 h at 0°C under occasional swirling. After centrifugation
(10,000X g at 4°C for 30 min in an SS-34 rotor), the supernatant is removed, and
the resin is resuspended in 15 mL of buffer F and incubated for 2 h on ice. The
resin is pelleted by centrifugation (10,000X g, 4°C, 30 min in an SS-34 rotor), and
the supernatant (fraction II) is saved. The elution step is repeated two more times
using 15 mL buffer F200: 20 mM Hepes-KOH, pH 7.6, 10 mM MgOAc2 200 mM
KCl (fraction III), and finally 15 ml buffer E (fraction IV). The resulting fractions
II, III, and IV are individually dialyzed four times against 2 L of buffer D for 45
min at 4°C and centrifuged for 30 min at 30,000X g at 4°C. Typically, fractions
II and III show the highest activities in tRNA aminoacylation reactions. The active
S100 fractions are stored in aliquots at –80°C.
3. Methods
SPARK can be used for studying catalysis of peptide bond formation (see
Note 4) or in screenings (low- or high-throughput) of natural or synthetic
compound libraries for new inhibitors of protein synthesis. It has been optimized
to be used with a full-size peptidyl-tRNA analog as a donor substrate and a
minimal A-site substrate analog, Biot CC-Pmn, as acceptor (SPARK-Pmn) or
with full-length peptidyl- and aminoacyl tRNAs (SPARK-2T).
4. Notes
1. The SPARK stop mix should always be prepared freshly.
2. The SPA beads should be stored at 4°C and should not be frozen.
3. After the SPARK reaction performed in 1.5 mL Eppendorf tubes has been stopped,
the reaction mixture does not need to be pipetted into a scintillation vial; the
Eppendorf tube can be directly placed into the scintillation vial instead.
4. The kinetics of the peptidyl transferase reaction as measured by SPARK is slower
than that catalyzed by the ribosome in the living cell. This can be due to the
presence of biotin on one of the reaction substrates. However, all the tested well-
characterized inhibitors of peptide bond formation readily inhibit the reaction
monitored by SPARK (2,8).
5. Before adding leucovorin to the reaction, the pH of the leucovorin solution has to
be increased by adding 2 μL of 5 M KOH to a 120 μL aliquot in order to allow
complete dissolving.
6. It is important to adjust the final pH of the charging reaction to 7.5 by using 1 M
KOH before the S100 addition.
7. In SPARK reactions containing antibiotics, the drug is added after binding of the
donor (P-site) tRNA substrate prior to addition of the acceptor (A-site) substrate.
8. In SPARK-Pmn, the reaction with biot CC-Pmn as an acceptor substrate, a plateau
in product formation is reached after 30 min of incubation.
9. SPA beads register ∼35% of the radioactivity of the reaction products compared to
conventional liquid scintillation counting. The radioactivity of unreacted substrates
is essentially not registered, and background radioactivity values (obtained by
omitting ribosomes or the biotinylated substrate) are approximately 2 orders of
magnitude lower than the measured radioactivity of the reaction products produced
in the uninhibited reaction.
SPARK: A New Peptidyl Transferase Activity Assay 115
10. Biotin-Phe-tRNAPhe elutes in two distinct peaks from the HPLC C4 column.
While both fractions were shown to be biotinylated, only the slower-eluting tRNA
fraction is active in SPARK-2T.
11. HPLC purification of [3 H]Phe-tRNAPhe can be substituted with purification by
BD-cellulose column chromatography as described in (9).
12. Under these conditions, the reaction proceeds to completion and the entire
Phe-[3 H]Phe-tRNAPhe is converted into the dipeptidyl-tRNA product biotin-Phe-
[3 H]Phe-tRNAPhe .
13. SPARK-2T can also be used with isolated large ribosomal subunits instead of 70S
ribosomes. In this version of SPARK-2T, 14 pmol 50S subunits are incubated
with 11 pmol biotin-Phe-tRNAPhe in 28 μL of SPARK-Pmn reaction buffer for 10
min at 37°C. The reaction tube is then transferred on ice. 2 μL of H2 O containing
12 pmol [3 H]Phe-tRNAPhe are added, and the reaction is initiated by the addition
of 15 μL of cold methanol. The reaction is incubated on ice for 4 h and stopped
by the addition of 90 μL of SPARK stop mix (containing SPA beads).
Acknowledgments
The authors would like to thank Dean Shinabarger and Steven Swaney
(Pharmacia and Upjohn, currently Pfizer) for a fruitful collaboration leading to
the development of SPARK. Steven Swaney is additionally thanked for advice
on preparing the manuscript. This work was supported by NIH Grant GM
59028 to A.S.M. and by the Austrian Science Foundation (FWF) Grant P18709
to N.P.
References
1.
1 Polacek, N., and Mankin, A. S. (2005) The ribosomal peptidyl transferase center:
Structure, function, evolution, inhibition. Crit. Rev. Biochem. Mol. 40, 285–311.
2.
2 Polacek, N., Swaney, S., Shinabarger, S. D., and Mankin, A. S. (2002) SPARK—A
novel method to monitor ribosomal peptidyl transferase activity. Biochemistry 41,
11602–11610.
3.
3 Moazed, D., and Noller, H. F. (1989) Interaction of tRNA with 23S rRNA in the
ribosomal A, P, and E sites. Cell 57, 585–597.
4.
4 Polacek, N., Gaynor, M., Yassin, A., and Mankin, A. S. (2001) Ribosomal peptidyl
transferase can withstand mutations at the putative catalytic nucleotide. Nature 411,
498–501.
5.
5 Triana-Alonso, F. J., Spahn, C. M., Burkhardt, N., Rohrdanz, B., and Nierhaus, K. H.
(2000) Experimental prerequisites for determination of tRNA binding to ribosomes
from Escherichia coli. Methods Enzymol. 317, 261–276.
6.
6 Blaha, G., Stelzl, U., Spahn, C. M., Agrawal, R. K., Frank, J., and Nierhaus, K. H.
(2000) Preparation of functional ribosomal complexes and effect of buffer conditions
116 A. S. Mankin and N. Polacek
Summary
The emergence of bacterial pathogens resistant to current antibiotics has caused an urgent
demand for new treatments. Peptide deformylase (PDF) has become an exciting target for
designing novel antibiotics. To facilitate the screening of PDF inhibitors, three robust, coupled
assays have been developed. The first method couples the PDF reaction with that of formate
dehydrogenase. Formate dehydrogenase oxidizes formate into CO2 with a concomitant reduction
of NAD+ to NADH, which can be monitored spectrophotometrically. The second method
involves Aeromonas aminopeptidase (AAP) as the coupling enzyme and an artificial substrate,
f-Met-Leu-p-nitroanilide. The sequential action of PDF and AAP releases p-nitroanilide as a
highly chromogenic product. In the third method, f-Met-Lys-7-amino-4-methylcoumarin is used
as the substrate. Deformylation by PDF gives an excellent substrate for dipeptidyl peptidase I,
which releases the dipeptide Met-Lys and fluorogenic 7-amino-4-methylcoumarin. The combi-
nation of these assay methods should meet the needs of most laboratories.
1. Introduction
Peptide deformylase (PDF) has emerged as an exciting target for designing
novel antibacterial drugs to combat the ever-increasing antibiotic-resistant
pathogens (1–4). Bacterial protein biosynthesis starts with N-formylmethionine,
and, as a result, all newly synthesized polypeptides carry an N-terminal formyl
117
118 K. T. Nguyen and D. Pei
group (5). PDF catalyzes the hydrolytic removal of the N-formyl moiety from
the vast majority of these polypeptides. Subsequently, many of these polypep-
tides undergo further processing by methionine aminopeptidase to produce
mature proteins (6). The essentiality of PDF has been demonstrated both
by genetic studies (7–9) and by growth inhibition by PDF inhibitors (1–4).
PDF is present in all eubacteria and has a highly conserved active site,
which contains a tetrahedrally coordinated and catalytically essential divalent
metal ion (Fe2+ in most bacteria) (10,11). Although PDF is also present in
human mitochondrion, its physiological function in the mitochondrion remains
controversial, and specific PDF inhibitors have shown little toxicity to human
cells (12). These properties have made PDF an attractive antibacterial drug
target.
Many potent PDF inhibitors have been reported in recent years, and one of
the inhibitors has already advanced into phase I clinical trials for the treatment
of upper respiratory tract infections. To facilitate mechanistic study of this
enzyme and screening of PDF inhibitors, several robust assays have been
developed for PDF. One method monitors the release of formate by formate
dehydrogenase (FDH) as the coupling enzyme (Fig. 1a) (13,14). Oxidation
of formate into CO2 is coupled with the reduction of NAD+ into NADH,
which can be monitored at 340 nm. The second assay method employs N-
formylmethionyl-leucyl-p-nitroanilide (f-ML-pNA) as the substrate, and the
PDF reaction is coupled with Aeromonas aminopeptidase (AAP). Deformy-
lation by PDF releases ML-p-nitroanilide, which is sequentially hydrolyzed
by AAP to release methionine, leucine, and the chromophore p-nitroaniline
(Fig. 1b) (15). The third method employs N-formylmethionyl-lysyl-7-amino-
4-methylcoumarin (f-MK-AMC) as the substrate (16). The PDF reaction
produces MK-AMC as its product, which is an excellent substrate for dipep-
tidyl peptidase I (DPPI). DPPI hydrolysis generates 7-amino-4-methylcoumarin
as the chomophore/fluorophore (Fig. 1c). Although each assay method has its
strengths and weaknesses, a combination of the three methods should meet
most of the assay needs.
As mentioned above, native PDFs from most bacteria contain a Fe2+ ion in
the active site, which makes them extremely unstable under aerobic conditions
(17). A common practice has been to replace the Fe2+ ion with a more stable
metal ion such as Co2+ , Ni2+ , or Zn2+ . Both Ni(II)- and Co(II)-substituted PDF
variants retain essentially full catalytic activity and are highly stable (11,18,19).
They are frequently used in mechanistic studies and PDF inhibitor screening.
The Zn(II)-substituted enzyme is very stable but has greatly reduced activity
(>100-fold).
Peptide Deformylase 119
b
S S
O O NO2 NO2
H H O
PDF
N N
H N N H2N N
H O H O H
HCO2H
S
AAP
OH + H N OH + H2N NO2
H2N 2
O O
c
S S
O O H O
H PDF
N N
H N N O O H2N N O O
H O H O H
HCO2H
NH2 NH2
S
DPPI
H O
N +
H2N OH
O H2N O O
NH2
Fig. 1. Reactions involved in PDF coupled assays. (a) With FDH as coupling
enzyme; (b) with AAP as coupling enzyme; and (c) with DPPI as coupling enzyme.
120 K. T. Nguyen and D. Pei
2. Materials
2.1. Bacterial Strains and Expression Vectors
1. Escherichia coli strain DH5 cells [F− , 80dlac(lacZ)M15 (lacZYA-argF),
U169, endA1, recA1, hsdS17 (rK − m K + ), deoR, thi-1, supE44, gyrA96, relA1] for
subcloning and construction of expression vectors.
2. E. coli strain BL21 (DE3) cells [F− ,OmpThsdS B (rB − m B − ), gal, dcm, met (DE3)].
This is used for protein overexpression (see Note 1).
3. Plasmid pET22b(+) (Novagen, Madison, WI) as cloning and expression vector to
add a histidine tag to the C-terminus of PDF. Clone PDF gene by polymerase
chain reaction (PCR) and ligate it into NdeI and XhoI sites of pET22b to construct
pET22b-PDF.
13. Ni-NTA His-bind buffer (buffer E): 50 mM sodium phosphate, pH 8.0, 300 mM
NaCl, 10 mM imidazole. Store at 4 °C.
14. Ni-NTA elution buffer (buffer F): 50 mM sodium phosphate, 300 mM NaCl; 125
mM imidazole. Store at 4 °C.
15. Enzyme assay buffers. 10X FDH assay buffer (buffer G): 500 mM sodium
phosphate, pH 7.0; 10X AAP assay buffer (buffer H): 500 mM HEPES, pH 7.0,
1.5 M NaCl; 10X DPPI assay buffer (buffer I): 500 mM HEPES, pH 7.0, 1.5 mM
NaCl, 50 mM DTT. Store at room temperature.
16. Anion exchange buffers. Low-salt buffer (buffer J): 20 mM 2-[N-
morpholino]ethanesulfonic acid (MES), pH 6.0, 10 mM NaCl. High-salt buffer:
20 mM MES, pH 6.0, 1.0 M NaCl. Store at 4 °C.
17. Enzyme dilution buffer (buffer K): 50 mM HEPES, pH 7.0, 100 μg/mL bovine
serum albumin.
18. MonoQ HR 5/5 FPLC anion exchange column (Pharmacia).
3. f-MK-AMC is not yet commercially available but can be easily prepared in a chemical
or biochemical laboratory (16). A stock solution is prepared in DMSO and stored
at -20 ºC. The concentration is determined by diluting the stock solution 10–100-
fold in 1 mL containing 50 mM HEPES, pH 7.0, 150 mM NaCl, and 5–10 μg of
Co-EcPDF. The reaction mixture is incubated at room temperature and covered with
aluminum foil for 3 h to allow the complete removal of the N-formyl moiety. Next,
5 mM DTT (final concentration) and 1 U of DPPI are added and incubated at room
temperature for 1 h to allow the complete release of the chromogenic 7-amino-4-
methylcoumarin (AMC). The absorbance at 360 nm is measured, and the concentration
of f-MK-AMC is calculated (AMC molar absorptivity e360 nm = 17,000 M−1 cm−1 ).
3. Methods
Since each PDF assay method has its advantages and disadvantages, we
make the following recommendations. For routine kinetic assays of wild-type
and mutant PDF in the absence of PDF inhibitors, the AAP-coupled assay is
the best choice. f-ML-pNA is an excellent substrate of PDF, and the released
p-nitroaniline has a large extinction coefficient, making this method highly
sensitive. Also, the released ML-pNA is rapidly hydrolyzed by AAP, so the
assay reaction can be conveniently performed in a continuous fashion. AAP is
a very stable enzyme and easy to purify to near homogeneity. The disadvantage
of this method is that AAP is also a metallopeptidase and therefore often
strongly inhibited by PDF inhibitors, which are usually metal chelators. Both
FDH and DPPI assays may be employed to screen PDF inhibitors. The FDH
assay has the advantage that PDF inhibitors seldom affect the FDH reaction.
However, FDH is a rather inefficient enzyme, and the coupled assay is typically
performed in an end-point (discontinuous) fashion. If kinetic characterization
of a PDF inhibitor is desired or if the PDF inhibitor is exceptionally potent (low
KI -value), the DPPI assay is the method of choice. This method is extremely
sensitive because f-MK-AMC is a very efficient substrate of PDF, MK-AMC
Peptide Deformylase 123
purified by this method is typically free of major impurities and may be used
directly in PDF activity assays.
9. Dialyze the protein against 2 L of dialysis buffer at 4 ºC (two buffer changes) to
remove imidazole from the sample. If necessary, the dialyzed protein solution can
be concentrated by ultrafiltration using aYM-3 membrane filter. Glycerol is added
to the protein to a final concentration of 33%, and the resulting mixture is quickly
frozen in liquid N2 and stored at -80 ºC. Protein concentration is determined by the
Bradford method using bovine serum albumin as standard.
3.1.2.2. Ni(II)-PDF-HT
1. The cell pellet from 3 L of culture is resuspended in 100 mL of lysis buffer plus
5 mM NiCl2 .
2. Cell lysis is carried out similarly as described above.
3. The crude lysate (supernatant) is loaded onto an Ni-NTA column (20 mL of resin).
Wash the column with 3 × 50 mL of buffer E.
4. Elute the bound Ni(II)-PDF-HT as described above with buffer F.
5. Pool the PDF fractions (∼50 mL) and precipitate the protein by the addition of
ammonium sulfate to 80% saturation. Dissolve the precipitate in 10 mL of buffer J
and load it onto a FPLC MonoQ HR 5/5 column (AKTA, Pharmacia) that has been
equilibrated in buffer J. Elute the bound PDF by a linear gradient of 10 mM–1 M
NaCl in buffer J.
6. Collect fractions containing significant PDF activity and analyze their purity on a
15% SDS-PAGE gel.
7. Pool the pure PDF fractions and dialyze the protein against buffer D plus 50 μM
NiCl2 at 4 ºC (2 buffer changes). The resulting protein is concentrated and stored
as described above.
3.1.2.3. Fe(II)-PDFH6
1. All buffers must be degassed by first applying a vacuum and then sparging with a
dry inert gas (He or Ar) for 30 min.
2. Add a freshly prepared TCEP solution to the lysis buffer to give a final concentration
of 1 mM. Buffers for all subsequent purification steps must contain 0.5 mM TCEP,
and purification steps are carried out as fast as possible.
3. Cell lysis and purification on Talon column are carried out as described above.
4. The PDF fractions from the Talon column are concentrated by ammonium sulfate
precipitation (80% saturation).
5. Dissolve the protein pellet in 5 mL of degassed 20 mM HEPES, pH 7.0, 150 mM
NaCl, 1 mM TCEP. The sample is frozen and stored at –80 ºC.
be calculated. This is done by comparing the amount of pNA formed and the
initial concentration of f-ML-pNA. It is imperative that the percentage does not
exceed 20%.
1. The following procedure is based on detection in the absorbance mode (see Note 9).
Assay reactions are carried out in quartz microcuvettes.
2. Prior to use, DPPI is treated with 5 mM DTT for 30 min on ice in 50 mM HEPES,
pH 7.0, 10 mM NaCl.
3. Prepare fresh 10X DPPI assay buffer each day by adding 50 mM DTT to the buffer.
4. Prepare inhibitor stock solutions (1 mM) in DMSO since many PDF inhibitors have
limited solubility in aqueous solution. Working stock solutions of 10–100 μM are
prepared from this original stock by diluting in DMSO.
5. A typical assay reaction has a 200-μL total volume. To a microcuvette, add 20 μL
of the 10X DPPI assay buffer, 1–5 μL of working inhibitor stock solution (0–200
nM final concentration), 0.1 U of DPPI, 100 μM f-MK-AMC, and ddH2 O to bring
the reaction volume to 195 μL. Place the cuvette in the spectrophotometer and
monitor the reaction for 30 s at 360 nm. The slope of the curve gives the amount
of background hydrolysis of substrate by DPPI.
6. The PDF reaction is then initiated by the addition of 5 μL of PDF (4.0 nM final
concentration). The reaction is monitored continuously for another 60–120 s. The
128 K. T. Nguyen and D. Pei
initial rate is calculated from the early region of the progress curve (0–30 s after
the addition of PDF) and corrected by subtracting the background rate from above.
7. The inhibition constant (KI ) is calculated according to the equation
V = Vmax ×
S/ KM 1 +
I/KI +
S
4. Notes
1. Expression of eukaryotic PDF in E. coli may suffer from low yields due to codon
usage bias. This problem can be alleviated by the use of the E. coli BL21 (DE3)
Rosetta strain (Novagen). This particular strain carries rare tRNA synthetases, which
recognize rare codons that are normally found in E. coli but frequently encountered
in G+C-rich DNA.
2. Fe(II)-PDF is very unstable when stored as a solution, even when every effort is
made to remove reactive oxygen species. However, it is stable for at least 1 year
when stored frozen at –80 °C. We recommend that it be stored in small aliquots
at –80 °C and that a fresh aliquot be thawed on ice and used at least once a day.
Co(II)-, Ni(II)-, and Zn(II)-EcPDF are more stable and can be stored at 4 °C for
weeks without significant loss of activity.
3. f-ML-pNA has a maximal solubility of ∼200 μM in aqueous solution. Prepare
the solution at neutral pH. Acidic pH facilitates hydrolysis of the N-formyl group,
whereas basic pH promotes hydrolysis of the pNA group.
4. Formate dehydrogenase is sensitive to chloride ions. Samples come as lyophilized
powder. One unit will oxidize 1.0 μmole of formate to CO2 per min in the presence
of
-NAD at pH 7.6 at 37 °C. It is less problematic when the assay is monitored at
365 nm. Co(II)-PDF has strong absorption near 340 nm.
5. AAP is a zinc-containing enzyme. Samples come in lyophilized powder. Often, AAP
obtained from Sigma contains background endopeptidase activity. The Prescott and
Wilkes method employing the gelatin digestion assay can measure the endopeptidase
activity (21). The residual enzyme activity can often be removed by heating the
stock enzyme solution at 65 °C for 2 h. One unit will hydrolyze 1.0 μmole of
L-leucine-p-nitroanilide to L-leucine and p-nitroaniline per min at pH 8.0 at 25 °C.
Working stock samples can be stored at 4 °C for up to 2 weeks. Avoid freeze-
thaw cycles. Since this assay is the method of choice in our lab for routine PDF
characterization, we found it to be economical to purify AAP from Aeromonas
proteolytica by the Prescott and Wilkes method (21).
6. Dipeptidyl peptidase I from bovine spleen is a cysteine protease and must be
reactivated with 5 mM dithiothreitol (DTT) for 30 min on ice in 50 mM HEPES,
pH 7.0, 10 mM NaCl before use. Samples come in lyophilized powder. The enzyme
is very unstable and must be stored frozen. One unit will produce 1 μmole of
Peptide Deformylase 129
Acknowledgments
This work was supported by NIH Grant AI40575.
References
1.
1 Giglione, C., Pierre, M., and Meinnel, T. (2000) Peptide deformylase as a target
for new generation, broad spectrum antimicrobial agents. Mol. Microbiol. 36,
1197–1205.
2.
2 Pei, D. (2001) Peptide deformylase: A target for novel antibiotics? Emerging Ther.
Targets 5, 23–40.
3.
3 Yuan, Z, Trias, J., and White, R. J. (2001) Deformylase as a novel antibacterial
target. Drug Discovery Today 6, 954–961.
4.
4 Clements, J. M., Beckett, R. P., Brown, A., Catlin, G., Lobell, M., Palan, S.,
Thomas, W., Whittaker, M., Wood, S., Salama, S., Baker, P. J., Rodgers, H. F.,
Barynin, V., Rice, D. W., and Hunter, M. G. (2001) Antibiotic activity and charac-
terization of BB-3497, a novel peptide deformylase inhibitor. Antimicrob. Agents
Chemother. 45, 563–570.
5.
5 Meinnel, T., Mechulam, Y., and Blanquet, S. (1993) Methionine as translation start
signal: A review of the enzymes of the pathway in Escherichia coli. Biochimie
75, 1061–1075.
6.
6 Ben-Bassart, A., Baur, K., Chang, S. Y., Myambo, K., Boosman, A., and Chang, S.
(1987) Processing of the initiation methionine from proteins: Properties of the
Escherichia coli methionine aminopeptidase and its gene structure. J. Bacteriol.
169, 751–757.
7.
7 Mazel, D., Pochet, S., and Marliere, P. (1994) Genetic characterization of
polypeptide deformylase, a distinctive enzyme of eubacterial translation. EMBO J.
13, 914–923.
130 K. T. Nguyen and D. Pei
8.
8 Meinnel, T., and Blanquet, S. (1994) Characterization of the Thermus thermophilus
locus encoding peptide deformylase and methionyl-tRNA(fMet) formyltransferase.
J. Bacteriol. 176, 7387–7390.
9.
9 Margolis, P. S., Hackbarth, C. J., Young, D. C., Wang, W., Chen, D., Yuan, Z.,
White, R., Trias, J. (2001) Peptide deformylase in S. aureus: Resistance to
inhibition is mediated by mutations in the formyltransferase gene. Antimicrob.
Agents Chemother. 44, 825–1831.
10.
10 Rajagopalan, P. T. R., Yu, X. C., and Pei, D. (1997) Peptide deformylase: A new
type of mononuclear iron protein. J. Am. Chem. Soc. 119, 12418–12419.
11.
11 Groche, D., Becker, A., Schlichting, I., Kabsch, W., Schultz, S., and
Wagner, A. F. V. (1998) Isolation and crystallization of functionally competent
Escherichia coli peptide deformylase forms containing either iron or nickel in the
active site. Biochem. Biophys. Res. Comm. 246, 342–346.
12.
12 Nguyen, K. T., Hu, X., Colton, C., Chakratarti, R., Zhu, M. X., and Pei, D. (2003)
Characterization of a human peptide deformylase: Implications for antibacterial
drug design. Biochemistry 42, 9952–9958.
13.
13 Lazennec, C., and Meinnel, T. (1997) Formate dehydrogenase-coupled spectropho-
tometric assay of peptide deformylase. Anal. Biochem. 244, 180–182.
14.
14 Rajagopalan, P. T. R., Datta, A., and Pei, D. (1997) Purification, characterization,
and inhibition of peptide deformylase from Escherichia coli. Biochemistry 36,
13910–13918.
15.
15 Wei, Y., and Pei, D. (1997) Continuous spectrophotometric assay of peptide
deformylase. Anal. Biochem. 250, 29–34.
16.
16 Nguyen, K. T., Hu, X., and Pei, D. (2004) Slow-binding inhibition of peptide
deformylase by cyclic peptidomimetics as revealed by a new spectrophotometric
assay. Bioorg. Chem. 32, 178–191.
17.
17 Rajagopalan, P. T. R., and Pei, D. (1998) Oxygen mediated inactivation of peptide
deformylase. J. Biol. Chem. 273, 22305–22310.
18.
18 Rajagopalan, P. T. R., Grimme, S., and Pei, D. (2000) Characterization of
Cobalt(II)-substituted peptide deformylase: Function of the metal ion and the
catalytic residue Glu-133. Biochemistry 39, 779–790.
19.
19 Hu, X., Nguyen, K. T., Jiang, V. C., Lofland, D., Moser, H. E., and Pei, D. (2004)
Macrocyclic inhibitors for peptide deformylase: A structure-activity relationship
study of the ring size. J. Med. Chem. 47, 4941–4949.
20.
20 Prescott, J. M., and Wilkes, S. H. (1976) Aeromonas aminopeptidase. Methods
Enzylmol. 45, 530–543.
11
Summary
Key enzymes that assemble the bacterial cell wall are also the target of the -lactam class
of antibiotics. The covalent binding of labeled penicillin to these proteins has been used in
numerous studies in drug discovery, antibiotic mechanisms of action and resistance, and cell
wall physiology. Methods to label and measure penicillin binding proteins in two prototypical
organisms, a Gram-negative (Escherichia coli) and Gram-positive (Staphylococcus aureus), are
described. The methods discussed include identifying penicillin-binding proteins in both intact
cells (in vivo measurements) and isolated cell membranes.
1. Introduction
The penicillin-binding proteins (PBPs) are a set of enzymes catalyzing
terminal reactions of bacterial peptidoglycan biosynthesis (1–3). The ability
to use radioactive or fluorescent labeled penicillin to identify this subset of
bacterial proteins is the genesis of the terminology. In fact, these proteins, which
are situated on the outer surface of the bacterial cytoplasmic membrane, possess
key cell wall assembly enzymatic activities, which include transglycosylation
and transpeptidation, along with endopeptidase and carboxypeptidase functions.
The transpeptidation and carboxypeptidase functions are inhibited when these
proteins are acylated by a -lactam antibiotic, with the -lactam ring opening
and forming a covalent bond with an active-site serine residue found in a highly
conserved binding pocket present in PBPs (4). Much of our initial knowledge
about the roles of individual PBPs came from work done primarily in the
131
132 M. J. Pucci and T. J. Dougherty
2. Materials
2.1. Cell Culture, Lysis, and Membrane Preparation
1. Tryptone broth and Brain-Heart-Infusion broth (Difco, Detroit, MI). Lennox L broth
or LB (Gibco BRL, Gaithersburg, MD) (see Note 1).
2. Agitation on a gyratory shaking incubator from New Brunswick Scientific Co. For
E. coli and staphylococci, vigorous shaking at ∼250 rpm is used (see Note 2).
3. Bacterial growth is monitored using a Spectronic 20 spectrophotometer or equivalent
at 600 nm.
4. Sonication buffer: 0.05 M Tris-HCl, pH 7.5, containing 1 mM MgCl2 , 1 mM
2-mercaptoethanol, and 5 μg/ml DNase.
5. Proteins are assayed by either the bicinchoninic acid assay (BCA; Pierce) or Lowry
assay (12).
A Method to Assay Penicillin-Binding Proteins 133
3. Methods
PBPs are usually assayed by an indirect method using labeled -lactam
antibiotics, most often radiolabeled penicillin. This material must be custom-
synthesized, as it is generally not available commercially. The [3 H] version of
labeled penicillin is made as an ethylpiperidinium salt, which is soluble in both
acetone and water. The material is stored in acetone as small volume aliquots
(40–60 μL, based on specific activity) in 1.5 mL micro fuge tubes at –80°C and
is stable for up to 2 years. Just prior to use, the acetone is removed with a gentle
stream of nitrogen, and the dried residue in the tube is resuspended with an
appropriate volume of phosphate buffer. Alternatively, a fluorescent penicillin
derivative (Bocillin), which is currently available commercially, may be used.
The labeling of the PBPs can either be in vivo using whole cells or by using
isolated membrane proteins. Labeled PBPs then can be separated on SDS-PAGE
gels where band migration distances (and thus apparent molecular weights)
and relative amounts of labeled antibiotic can be analyzed. The utilization of
isolated membrane proteins is the more common method often resulting in gels
with better appearances than those from in vivo labeling experiments. However,
accurate quantitation in regard to the amount of input cells is very difficult using
134 M. J. Pucci and T. J. Dougherty
3. The cells are then sonicated with cooling in an ice bath until 95% or greater breakage
occurs. This may require several cycles with cooling in between.
4. Unbroken cells and cellular debris are removed by a low-speed centrifugation at
3,000X g. Retain the sonicated supernatants.
5. Supernatent fluids from the low-speed centrifugation are centrifuged to pellet
membranes by ultracentrifugation at 100,000X g for 30 min at 4°C. Membranes are
resuspended in sodium phosphate buffer, pH 7.0, and washed once at 100,000X g
at 4°C for 30 min. Pellets are resuspended in 500 μL of phosphate buffer and stored
at –70°C if not used immediately.
6. Small samples (5 μL) of the pellet resuspension are taken for protein concentration
determinations by the bicinchoninic acid assay or Lowry assay, and 100 μg of
protein were used per gel lane.
frozen at –70°C. Membranes can also be aliquotted and frozen after protein concen-
tration is estimated.
8. Protein concentration determinations are obtained by the bicinchoninic acid assay
or Lowry assay, and 100 μg of protein are used per gel lane.
and the film (see Note 8). The film is developed and fixed to reveal the positions of
the radiolabeled bands (see Note 9). Examples of results for E. coli and S. aureus
are shown in Figs. 1 and 2.
2. Penicillin binding can be quantified by scanning PBP fluorographs using a scanning
laser densitometer or an image analyzer device to generate areas under the peaks
corresponding to the various PBPs in each gel lane. The areas are plotted, and
best-fit sigmoidal curves are determined by using curve-fitting software such as
Prism or SigmaPlot. Kinetics of binding and IC50 values can be determined for
PBPs and -lactam antibiotics. An example is shown in Fig. 3.
1 a b c d e f g
2a
2
3
Fig. 3. E. coli PBP binding curve for a cephalosporin antibiotic. Areas were deter-
mined by scanning laser densitometry of individual lanes on fluorographs. Areas under
the peaks are plotted versus the log of the concentrations (μg/mL) of the competing
antibiotic. Best-fit sigmoidal curves were plotted using GraphPad Prism software.
4. Notes
1. Suggested bacterial culture media are listed. Other media may also be appropriate,
but adjustments may be necessary to adjust for varied cell numbers.
2. Agitation of cultures was done in New Brunswick shaking incubators. It is important
to maintain vigorous aeration of E. coli and staphylococcal cultures to ensure optimal
140 M. J. Pucci and T. J. Dougherty
Acknowledgments
We would like to thank Alexander Tomasz and Roberta Fontana for their
assistance in helping us become proficient in the methodologies described in
this work. We also thank Regine Hakenbeck and Brigitte Berger-Bachi for
helpful discussions over the years.
References
1.
1 Macheboeuf, P., Contreras, C., Job, V., Dideberg, O., and Dessen, A. (2006)
Penicillin binding proteins: Key players in bacterial cell cycle and drug resistance
processes. FEMS Microbiol. Rev. 30, 673–691.
2.
2 Spratt, B. G. (1975) Distinct penicillin-binding proteins involved in the division,
elongation, and shape of Escherichia coli K-12. Proc. Natl. Acad. Sci. USA 72,
2999–3003.
3.
3 Koch, A. L. (2000) Penicillin-binding proteins, beta-lactams, and lactamases:
Offenses, attacks, and defensive countermeasures. Crit. Rev. Microbiol. 26,
205–220.
4.
4 Goffin, C., and Ghuysen, J.-M. (1998) Multimodular penicillin-binding proteins:
An enigmatic family of orthologs and paralogs. Microbiol. Mol. Biol. Rev. 62,
1079–1093.
5.
5 Young, K. D. (2001) Approaching the physiological functions of penicillin-binding
proteins in Escherichia coli. Biochemie 83, 99–102.
6.
6 McPherson, D. C., and Popham, D. L. (2003) Peptidoglycan synthesis in the
absence of class A penicillin-binding proteins in Bacillus subtilis. J. Bacteriol.
185, 1423–1431.
A Method to Assay Penicillin-Binding Proteins 141
7.
7 Stewart, G. C. (2005) Taking shape: Control of bacterial cell wall biosynthesis.
Mol. Microbiol. 57, 1177–1181.
8.
8 Spratt, B. G. (1977) Properties of the penicillin-binding proteins of Escherichia
coli K-12. Eur. J. Biochem. 72, 341–352.
9.
9 Dougherty, T. J., Kennedy K., Kessler, R. E., and Pucci, M. J. (1996) Direct
quantitation of the number of individual penicillin-binding proteins per cell in
Escherichia coli. J. Bacteriol. 178, 6110–6115.
10.
10 Pucci, M. J., and Dougherty, T. J. (2002) Direct quantitation of the number
of individual penicillin-binding proteins per cell in Staphylococcus aureus.
J. Bacteriol. 184, 588–591.
11.
11 Tipper, D. J., and Strominger, J. L. (1965) Mechanism of action of penicillins:
A proposal based on their structural similarity to acyl-D-alanyl-D-alanine. Proc.
Natl. Acad. Sci. USA 54, 1133–1141.
12.
12 Lowry, O. H., Rosebrough, N. J., Farr, A. L., and Randall, R. J. (1951) Protein
measurement with the Folin phenol reagent. J. Biol. Chem. 193, 265–275.
13.
13 Zhao, G., Meier, T. I., Kahl, S. D., Gee, K. R., and Blaszczak, L. C. (1999)
Bocillin FL, a sensitive and commercially available reagent for detection of
penicillin-binding proteins. Antimicrob. Agents Chemother. 43, 1124–1128.
14.
14 Kaczmarek, F. S., Gootz, T. D., Dib-Hajj, F., Shang, W., Hallowell, S., and
Cronan, M. (2004) Genetic and molecular characterization of -lactamase-negative
ampicillin-resistant Haemophilus influenzae with unusually high resistance to
ampicillin. Antimicrob. Agents Chemother. 48, 1630–1639.
15.
15 Laskey, R. A., and Mills, A. D. (1975) Quantitative film detection of 3H and 14C
in polyacrylamide gels by fluorography. Eur. J. Biochem. 56, 335–341.
12
Summary
Treatment of Gram-negative bacterial infections is complicated by innate and acquired
drug resistance resulting in a limited number of effective antibiotics. Several Gram-negative
bacteria, for which current therapies are ineffective, have recently been identified as potential
bioterror agents. These findings highlight the need for new antibiotics, specifically antibiotics
that act on new drug targets to circumvent drug resistance. Potential targets in Gram-negative
bacteria include enzymes involved in the biosynthesis of lipopolysaccharides (LPS) that form
outer membranes of these organisms. UDP-3-O-(R-3-hydroxymyristoyl)-N-acetylglucosamine
deacetylase (LpxC) catalyzes the committed step in the biosynthesis of the lipid A portion of
LPS. Therefore, inhibitors of this enzyme have the potential to serve as antibiotics, and efforts
toward the development of LpxC inhibitors are currently underway. Here we describe methods
for assaying LpxC inhibitors, including methods for measuring deacetylase activity and binding
affinity for LpxC, which will be useful for the development of LpxC inhibitors.
1. Introduction
Lipopolysaccharides (LPS) are negatively charged molecules that form the
outer membranes of Gram-negative bacteria and act as barriers to prevent
entry of small molecules, thereby contributing to the viability and innate resis-
tance of these organisms (1,2). Structurally, LPS consists of three regions:
O-antigen, core, and lipid A. The O-antigen and core portions of LPS are
variable oligosaccharides, while lipid A is a glucosamine phospholipid that
143
144 M. Hernick and C. A. Fierke
2. Materials
2.1. Preparation of [14 C]-UDP-3-O-(R,S-hydroxymyristoyl)
-N-acetyl-glucosamine
1. 1 M bis-tris, pH 6 (Research Organics Inc., Cleveland, OH).
2. 50 mM bis-tris, pH 6, 1 M NaCl.
3. 10 mM bis-tris, pH 6.
4. 0.2 M NaCl (see Note 1).
5. Filter (0.2 μm) aqueous solutions and store at room temperature.
6. Freshly prepared solutions: 0.4 M HEPES, pH 8 (Fisher Scientific), 10 mg/mL
bovine serum albumin fatty acid-free (BSA; Sigma, St. Louis, MO), and 100 mM
methyl methanethiosulfonate (MMTS; Sigma, St. Louis, MO).
7. [14 C]-UDP-N-acetyl-glucosamine (NEN Life Science Products, Boston, MA)
stored at –20 °C.
8. Disposable 10 mL and 60 mL luer-lok syringes (Fisher Scientific).
9. Costar 3620 1.7 mL microcentrifuge tubes (Corning Incorporated, Corning, NY)
(see Note 2).
A Method to Assay Inhibitors of Lipopolysaccharide Synthesis 145
10. Poly prep columns, 0.8 × 4 cm (Bio-Rad, Hercules, CA) filled with 2 mL DEAE-
sepharose fast flow resin (GE Healthcare BioSciences, Piscataway, NJ). Prior to
initiating reactions: Wash column with 18 mL H2 O (to remove ethanol), equilibrate
column with 16 mL 1 M bis-tris, pH 6, followed by 8 mL 50 mM bis-tris, pH 6, 1
M NaCl, and finally 8 mL 10 mM bis-tris, pH 6. Use a 60 mL disposable syringe
fitted with column adapter to apply pressure (air) to speed the flow of solutions
through the column.
11. C18 sep-pak (Waters, Milford, MA) washed with 10 mL methanol followed
by 20 mL H2 O. Attach equilibrated sep-pak onto bottom of DEAE-sepharose
column.
12. R S-3-hydroxy-myristate-ACP (2-3 mM) and LpxA (11–39 mg/mL) stored
at –80 °C (see Note 3).
5. Inhibitor.
6. [14 C]-UDP-3-O-(R-hydroxymyristoyl)-N-acetyl-glucosamine (see Notes 4, 5, 8).
7. Costar 3620 1.7 mL microcentrifuge tubes, Costar 4826 (0.1–10 μL) tips, and Costar
4863 (1–200 μL) tips (Corning Incorporated, Corning, NY). ART 200 and 1000
tips (Molecular BioProducts, San Diego, CA) (see Note 2).
3. Methods
3.1. Preparation of [14 C]-UDP-3-O-(R-hydroxymyristoyl)
-N-acetyl-glucosamine
1. Mix together 100 μL 0.4 M HEPES, pH 8, 100 μL 10 mg/mL BSA, 540 μL H2 O,
200 μL [14 C]-UDP-N-acetyl-glucosamine, 10 μL 100 mM MMTS, and 30 μL 2–3
mM R,S-3-hydroxymyristate-ACP in 1.7 mL microfuge tube. Spin in microfuge for
10 s (see Note 9).
2. Initiate reaction with the addition of 20 μL 11–39 mg/mL LpxA to assay mixture.
Vortex. Spin in microfuge for 10 s. Incubate in heat block at 30 °C for 30 min.
3. Transfer 1 μL of assay mixture into a scintillation vial (for counting). Load
remaining assay mixture onto pre-equilibrated DEAE column.
4. Wash column with 18 mL 0.2 M NaCl to load radioactivity onto sep-pak. Remove
sep-pak from DEAE-sepharose column. Discard DEAE column in radioactive waste.
5. Wash sep-pak with 30 mL H2 O using a disposable luer-lok syringe to remove
unreacted [14 C]-UDP-N-acetylglucosamine. Collect waste in a 50 mL conical tube,
and dispose of in radioactive waste (if necessary).
6. Elute [14 C]-UDP-3-O-(R,S-hydroxymyristoyl)-N-acetyl-glucosamine into 50 mL
conical tube with 15 mL methanol using a disposable luer-lok syringe.
7. Concentrate methanol solution to dryness using a speed vac (see Note 9).
8. Resuspend [14 C]-UDP-3-O-(R-hydroxymyristoyl)-N-acetyl-glucosamine in 100 μL
10 mM bis-tris pH 6, and transfer into 1.7 mL microfuge tube. Transfer 1
μL of product into scintillation vial (for counting). Store [14 C]-UDP-3-O-(R-
hydroxymyristoyl)-N-acetyl-glucosamine at –20 °C.
9. Add scintillation fluid to vials and count using scintillation counter. Determine
reaction yield from the ratio of purified product (cpm)/total assay mixture (cpm).
Yields for purified [14 C]-UDP-3-O-(R-hydroxymyristoyl)-N-acetyl-glucosamine
using this procedure are typically >90%. Concentrations of stored product can
be determined using the specific activity of purchased [14 C]-UDP-N-acetyl-gluco-
samine.
Fig. 1. Example of initial linear product formation for turnover of [14 C]-UDP-3-O-
(R,S-hydroxymyristoyl)-N-acetyl-glucosamine catalyzed by EcLpxC (20 mM bis-tris
propane, 10 mM TCEP, pH 7.5, 30 °C).
IC50
v= (1)
I + IC50
V S
v= max (2)
KM 1 + KI + S
I
EL
EL Ltotal Endpt
= + EL L (3)
Ltotal 1 + EKD total Background
total
EL
EL Ltotal
= Pr oduct + EL L Initial (4)
Ltotal KD
1 + LpxC 1 + Inhibitor
K Inhibitor
D
150 M. Hernick and C. A. Fierke
4. Notes
1. All water used in the described methods is milliQ purified water.
2. LpxC is catalytically active with one bound Zn(II) (E•Zn); however, LpxC can
bind a second Zn(II) to form an inactive E•Zn2 complex (6,17). Therefore, low-
metal-content tubes and tips are used throughout the methods to minimize Zn(II)
contamination and formation of E•Zn2 during assays and storage. Aerosol-resistant
tips are used for pipetting radioactive materials.
3. Procedures for preparation of R,S-3-hydroxy-myristoyl-ACP and LpxA are
provided in references (24,25).
4. Inhibitor stocks should be prepared at 10X the desired final concentration. Water-
soluble LpxC inhibitors should be dissolved in 1X buffer. DMSO (≤ 10 % v/v
final) can be included for inhibitors with low water solubility.
5. To minimize formation of E•Zn2 , all metal ions should be removed from purified
LpxC by treatment with 20 mM dipicolinate as previously described (6). The
catalytic Zn(II) is added back by incubation of apo-LpxC with Zn(II) (6). The
concentration of LpxC required will depend on the type of assay, as well as the
inhibitor potency. For assays that measure deacetylase activity, low concentrations
of LpxC are typically required (i.e., 1–10 nM), while much higher concentrations
of LpxC are required for assays that measure binding affinity (i.e., 1–200 μM).
A Method to Assay Inhibitors of Lipopolysaccharide Synthesis 151
6. The amount of 1.25 M NaOH required will depend on the volume of the reaction
being quenched. For a typical assay, 20 μL of reaction is quenched with 8 μL 1.25
M NaOH prior to neutralization with 94 μL 80:20 i-PrOH/1.5 M acetic acid.
7. To wash microcons, fill sample reservoirs with 500 μL each of 0.1 M NaOH.
Spin at 14,000X g for 12 min. Discard filtrate. Repeat for a total of three washes.
Fill sample reservoirs with 500 μL 25 mM bis-tris propane, 1.5 mM TCEP, pH
7.5. Spin at 14,000X g for 12 min. Discard filtrate. Fill sample reservoirs with
500 μL 20 mM bis-tris propane, 1.5 mM TCEP, pH 7.5. Microcons can be stored
in buffer at 4 °C for several days prior to use. Immediately before use, spin at
14,000X g for 12 min. Place the sample reservoirs upside down over collection
tubes. Spin at 3000X g for 3 min. Discard filtrate. Insert sample reservoirs into
collection tube. Microcons are now ready for loading samples.
8. The KD -values of radiolabeled, or fluorescent, inhibitors for LpxC are deter-
mined using a direct binding assay, while the KD -values of unlabeled inhibitors
are determined using a competition-based assay between the unlabeled inhibitor
and [14 C]-UDP-3-O-(R,S-hydroxymyristoyl)-glucosamine. In these experiments,
the concentration of either LpxC or inhibitor is varied, and the concentration of
the other reagent held constant (below the KD -value). Since LpxC overexpresses
at high levels and is unstable at low concentrations, the concentration of LpxC
is typically varied in these experiments (typical range 1–200 μM). Both direct
and competition-based assays require EL/Ltotal measurements at 6 to 10 different
concentrations of LpxC to obtain a KD -value for a specific ligand.
9. The 3-acyl group on UDP-3-O-(R-hydroxymyristoyl)-N-acetyl-glucosamine can
undergo isomerization to afford a molecule that is not a substrate for LpxC (24).
To avoid isomerization of the acyl group, it is important to carry out the synthesis
as quickly as possible, and the reaction should be kept cool. Therefore, the DEAE-
sepharose columns and sep-paks should be equilibrated prior to initiating the
LpxA reaction, a syringe should be used to speed the rate of flow through the
column, and the speed vac concentration step should be carried out at room
temperature. If materials needed for the biochemical preparation are not readily
available, radiolabeled UDP-3-O-(R-hydroxymyristoyl)-N-acetyl-glucosamine can
also be prepared synthetically (26).
10. The length of film exposure will depend on the amount of radioactivity loaded
onto the TLC plates, but in general ≥16 h is long enough to visualize substrate
and/or product. Substrate migrates ∼1 cm below product on the PEI-cellulose
TLC plate (Rf -values of ∼0.5 and ∼0.6, respectively), under these conditions.
In experiments where product formation is low (steady-state conditions, <20%
reaction), the product band on film is only visible after long exposure times
(several days). In this case, TLC plates can be cut just above the substrate band
and each piece loaded into scintillation vials.
11. LpxC is generally unstable at concentrations <1 μM, and therefore BSA (1 mg/mL)
is included in assay buffers to stabilize the LpxC at low concentrations (6).
152 M. Hernick and C. A. Fierke
Acknowledments
This work was supported by the National Institutes of Health (GM40602 to
C.A.F.) and the Cystic Fibrosis Foundation (HERNIC05F0 to M.H.).
References
1.
1 Raetz, C. R. H., and Whitfield, C. (2002) Lipopolysaccharide endotoxins. Ann.
Rev. Biochem. 71, 635–700.
2.
2 Wyckoff, T. J. O., Raetz, C. R. H., and Jackman, J. E. (1998) Antibacterial and
anti-inflammatory agents that target endotoxin. Trends Microbiol. 6, 154–159.
3.
3 Darveau, R. P. (1998) Lipid A diversity and the innate host response to bacterial
infection. Curr. Opin. Microbiol. 1, 36–42.
4.
4 Onishi, H. R., Pelak, B. A., Gerckens, L. S., Silver, L. L., Kahan, F. M.,
Chen, M. H., Patchett, A. A., Galloway, S. M., Hyland, S. A., Anderson, M. S.,
and Raetz, C. R. H. (1996) Antibacterial agents that inhibit lipid A biosynthesis.
Science 274, 980–982.
5.
5 Young, K., Silver, L. L., Bramhill, D., Cameron, P., Eveland, S. S.,
Raetz, C. R. H., Hyland, S. A., and Anderson, M. S. (1995) The envA
permeability cell division gene of Escherichia coli encodes the second enzyme
of lipid A biosynthesis—UDP-3-O-(R-3-hydroxymyristoyl)-N-acetylglucosamine
deacetylase. J. Biol. Chem. 270, 30384–30391.
6.
6 Jackman, J. E., Raetz, C. R. H., and Fierke, C. A. (1999) UDP-3-O-(R-3-
hydroxymyristoyl)-N-acetylglucosamine deacetylase of Escherichia coli is a zinc
metalloenzyme. Biochemistry 38, 1902–1911.
7.
7 Clements, J. M., Coignard, F., Johnson, I., Chandler, S., Palan, S., Waller, A.,
Wijkmans, J., and Hunter, M. G. (2002) Antibacterial activities and characterization
of novel inhibitors of LpxC. Antimicrob. Agents Chemother. 46, 1793–1799.
8.
8 Kline, T., Andersen, N. H., Harwood, E. A., Bowman, J., Malanda, A., Endsley, S.,
Erwin, A. L., Doyle, M., Fong, S., Harris, A. L., Mendelsohn, B., Mdluli, K.,
Raetz, C. R. H., Stover, C. K., Witte, P. R., Yabannavar, A., and Zhu, S. G. (2002)
Potent, novel in vitro inhibitors of the Pseudomonas aeruginosa deacetylase LpxC.
J. Med. Chem. 45, 3112–3129.
9.
9 Li, X. C., Uchiyama, T., Raetz, C. R. H., and Hindsgaul, O. (2003) Synthesis of
a carbohydrate-derived hydroxamic acid inhibitor of the bacterial enzyme (LpxC)
involved in lipid A biosynthesis. Org. Lett. 5, 539–541.
10.
10 Pirrung, M. C., Tumey, L. N., McClerren, A. L., and Raetz, C. R. H.
(2003) High-throughput catch-and-release synthesis of oxazoline hydroxamates.
A Method to Assay Inhibitors of Lipopolysaccharide Synthesis 153
Summary
Widespread resistance to antibiotics in current clinical use is increasing at an alarming rate.
Novel approaches in antimicrobial therapy will be required in the near future to maintain control
of infectious diseases. An enormous array of small cationic peptides exists in nature as part of
the innate defense systems of organisms ranging from bacteria to humans. For most naturally
occurring linear peptides, such as magainins and cecropins, a common feature is their capacity
to form an amphipathic -helix (with polar and nonpolar groups on opposite faces of the helix),
a structural feature believed to be important in their antimicrobial function as membrane-lytic
agents. A massive effort over the past two decades has resulted in a better understanding of the
molecular mechanism of antimicrobial peptides and the production of more potent analogues.
To date, however, few of these peptides have been shown to have clinical efficacy, especially
for systemic use, in large part due to insufficient selectivity between target and host cells.
Recently, we developed a new strategy in the design of antimicrobial peptides. These linear
cationic peptides, which form amphipathic -sheets rather than -helices, demonstrated superior
selectivity in binding to the lipids contained in bacterial vs. mammalian plasma membranes. Here
we describe methods to evaluate the structure and function of cationic antimicrobial peptides.
Key Words: antimicrobial peptides; circular dichroism (CD); large unilamellar vesicles
(LUV); membrane leakage; tryptophan fluorescence; acrylamide quenching.
1. Introduction
The structure, function, and interactions that occur between cationic antimi-
crobial peptides and various cell membranes and lipid model systems can
be evaluated using the experimental approaches described in this chapter.
155
156 M. Pate and J. Blazyk
2. Materials
2.1. Peptide Source and Preparation of Stock Solutions
1. Peptides are generally synthesized using Fmoc chemistry. The crude peptides are
purified by reverse-phase HPLC, and their purity is assessed by reverse-phase
HPLC, capillary electrophoresis, and electrospray mass spectrometry. The pure
peptides are lyophilized and stored at –20 °C. Many companies offer custom peptide
synthesis services.
2. To prepare stock peptide solutions, each lyophilized frozen sample is warmed to
room temperature; the desired amount is dissolved in purified water (dH2 O) to a
concentration of 3–4 mg/mL and then stored at –20 °C. These stock solutions are
thawed, vortexed, and diluted to obtain the peptide working solutions of the desired
concentration for each assay before usage (see Note 1).
room temperature in a ventilated cabinet away from organic solvents and should
be treated as hazardous.
b. 2.5% (w/v) ammonium molybdate solution. Add ammonium molybdate (VI)
tetrahydrate ((NH4 )6 Mo7 O24 ·4H2 O, Fisher Scientific, Pittsburgh, PA) to dH2 O.
Store in an amber bottle at 4 °C for up to 1 month.
c. 10% (w/v) L-ascorbic acid solution. Add L-ascorbic acid (Fisher Scientific,
Pittsburgh, PA) to dH2 O. Store in an amber bottle at 4 °C for up to 1 month.
d. 0.65 mM phosphorus standard solution (Sigma-Aldrich, St. Louis, MO). Store
at 4 °C.
e. 30% hydrogen peroxide (H2 O2 ) solution, phosphorus-free (Fisher Scientific,
Pittsburgh, PA); store at 4 °C. H2 O2 is an oxidizer and irritant. Care should be
taken during handling.
3. Methods
3.1. Preparation and Quantitation of Peptide Stock Solutions
1. The concentration of tryptophan-containing peptides is determined by measuring
the absorbance at 280 nm in a 1-cm-pathlength quartz cuvette (see Note 5). The
absorbance value can be converted to concentration using Beer’s law since the
molar absorptivity (or molar extinction coefficient) of tryptophan is 5500 M−1 cm−1
at 280 nm. The concentration of other peptides containing tryptophan, tyrosine,
and/or cysteine can also be determined by measuring the absorbance at 280 nm (see
Note 6).
2. For peptides lacking these residues or of unknown composition, a wide variety of
protein assays, such as bicinchoninic acid (BCA)-based protein assay or modified
Lowry protein assay, are available commercially (see Note 7).
3. The peptide concentration may also be determined by weight. Since peptides can be
quite hygroscopic; however, this method may be less accurate than those mentioned
above.
162 M. Pate and J. Blazyk
4. The extruder is then assembled according to the manufacturer’s instructions with the
appropriately sized polycarbonate membrane (see Sections 3.3.2, 3.3.3, and 3.3.4
for specific assay requirements) (see Note 10).
5. The lipid mixture is drawn into the syringe and pushed through the extruder for 10
cycles (over and back counts as one cycle). The final extrusion should fill the syringe
opposite to the syringe the sample was initially drawn up in, to minimize potential
contamination with larger particles that could not pass through the polycarbonate
membrane filter.
6. The extruded LUV are placed in a sealed tube and stored at room temperature.
7. An aliquot is removed for use in the phosphorus assay (detailed in Section 3.2) to
determine LUV concentration (see Sections 3.3.2, 3.3.3, and 3.3.4).
8. The extruder is disassembled and carefully washed with phosphorus-free detergent
and a 2:1 chloroform/methanol solution (see Note 11).
is carefully poured into the column to form the resin bed. It is necessary to ensure
that no air bubbles are trapped within the resin (see Note 15).
4. After the resin has settled to the appropriate column volume, the column is
equilibrated with 5 column volumes of degassed HEPES buffer (see Note 16).
5. 200 μL of a 5 mg/mL blue dextran solution are eluted through the column with
degassed HEPES buffer to ensure that the resin is evenly distributed and to
determine the void volume. The column is then washed and equilibrated.
6. 4 μmoles of lipid stock solution are dried down and hydrated in 300 μL calcein
HEPES buffer.
7. 100-nm-diameter LUV are prepared using the 0.1 μm-pore polycarbonate filter.
8. The extruded sample is centrifuged very briefly in a microcentrifuge tube (to
collect all the sample in the bottom of the tube) and then applied to the gel
filtration column in order to separate the calcein-loaded LUV from calcein in the
surrounding buffer, using degassed calcein-free HEPES buffer as the eluent (see
Note 17).
9. Calcein-loaded LUV are easily visible (deep-orange in color) and elute through the
column first (before the free calcein, which is yellow-green in color; see Note 18).
The calcein-loaded LUV fraction is collected, and the column is then washed to
remove the remaining free calcein and equilibrated with HEPES buffer for reuse.
10. A 100 μL aliquot of calcein-loaded LUV is added to a test tube and dried down
in the 100 °C oven in duplicate for quantification using the phosphorus assay, as
detailed in Section 3.2.
11. Calcein-loaded LUV are stored in a capped vial at 4 °C for up to a week or until
leakage is visible (see Note 19).
8. Peptide interactions with LUV can be estimated by plotting the relative intensity at
330 nm as a function of the lipid-to-peptide ratio [2, 13] .
4. Notes
1. All solutions are prepared in distilled/de-ionized water (dH2 O) unless otherwise
noted.
2. For the total phosphorus assay procedure, see the Technical section of the
Avanti Polar Lipids, Inc. Web site: http://www.avantilipids.com/Technical
Structure-Function of Cationic Antimicrobial Peptides 169
DeterminationOfTotalPhosphorus.asp?t=Total%20Determination%20Of%20Total
%20Phosphorus.
3. Buffers must be stored at room temperature following degassing.
4. Calcein will not dissolve easily at this concentration until the pH is adjusted to
7.4. Add 0.5 g calcein to 1 or 2 mL of HEPES buffer and add several mL of 1
M NaOH to reach pH 7.4. Adjust the volume to 10 mL using the HEPES buffer,
and store in a vial at 4 °C.
5. The peptides are generally diluted by 1:20 or 1:50 in dH2 O for absorbance
measurements. The dilution factor depends on both the peptide concentration of
the solution and the relative content of amino acid residues that absorb at 280 nm.
6. According to Beer’s law, A = ecl, where A is absorbance (no units), ? is the
wavelength-dependent molar absorptivity or molar extinction coefficient (with
units of M−1 cm−1 ), c is the concentration of the absorbing compound (expressed
in molarity), and l is the path length of the cuvette (in cm). A detailed
explanation of how to use the absorbance at 280 nm to measure the concen-
tration of peptides and proteins is provided on the Pierce Biotechnology, Inc.
Web site at: http://www.piercenet.com/files/TR0006dh5-Extinction-coefficients.
pdf#search=%22peptide%20absorbance%20extinction%22.
7. A description of a variety of protein assays that can be used to measure the concen-
tration of peptides and proteins is provided on the Pierce Biotechnology, Inc.
Web site at: http://www.piercenet.com/Proteomics/browse.cfm?fldID=BE219700-
9B95-43A1-A3DA-83800F1A0392.
8. We typically use 5 μL of a 10 mg/mL lipid stock solution.
9. Since the temperature must be maintained above 200 °C at all times, all test tubes
are preheated in the heating block for 5 min. The H2 SO4 is then added directly to
the tubes in the heating block.
10. We have used the following extruders to prepare LUV in our laboratory: the
Liposofast-Basic extruder (Avestin, Inc., Ottawa, Canada) and the Avanti Mini-
Extruder (Avanti Polar Lipids, Inc., Alabaster, AL). The Liposofast-Basic extruder
is assembled as follows. There is a central metal body with two nuts that screw
onto each end. Loosely screw a nut onto one end of the central metal body. Place
the rubber O-rings into the grooves of each of two Teflon inserts. One Teflon
insert is then placed in the metal assembly so that the O-ring faces toward the
center and the metal portion extends through the hole in the nut. A membrane
support filter is placed inside the O-ring. The appropriate pore-size polycarbonate
membrane is then placed over the O-ring and membrane support filter. It may be
necessary to remove static electricity at this point with a static gun in order to
seat the membrane properly. Another membrane support filter is placed on top of
the polycarbonate membrane, followed by the other Teflon insert with its O-ring
facing the polycarbonate membrane. Finally, the second nut is loosely screwed
onto the assembly, and then the two nuts are simultaneously tightened. Instructions
for the use of the Avanti Mini-Extruder are provided by the manufacturer.
170 M. Pate and J. Blazyk
11. After the extruder is completely disassembled, all pieces are soaked in a
phosphorus-free detergent bath for a few minutes and carefully rinsed with tap
water followed by a dH2 O rinse. It is important to clean the Teflon inserts
with a soap solution using a syringe and then thoroughly rinse with dH2 O.
It is also important to thoroughly clean the extruder components using a 2:1
chloroform/methanol solution to remove all traces of lipid. This is followed by an
aqueous rinsing, a phosphorus-free detergent soak, and a final rinsing in dH2 O.
The pieces are then allowed to air-dry.
12. It should be noted that although LUV for CD experiments are prepared in
phosphate buffer, the additional phosphorus contributed by the buffer is negli-
gible and does not introduce appreciable error during when measuring the LUV
concentration.
13. We find it useful to make 50% more than necessary to ensure that there is enough
available should any problems arise during column preparation.
14. Stirring introduces air bubbles into the resin and must therefore be avoided. It is
necessary to maintain the volume of the slurry by adding water during this time.
15. Adding the slurry continuously as the resin settles results in a more uniform
column bed. If necessary, the stopcock can be opened to speed the settling process.
16. It is imperative that the level of the buffer is always maintained above the top of
the resin in the column. Therefore, the buffer delivery must be closely monitored.
Cracks or air bubbles present within the resin bed indicate that the column is
defective and must be repoured. The column is washed and equilibrated by elution
with five column volumes of degassed HEPES buffer.
17. A volume of 300 μL of lipid suspension is extruded, and while some is lost during
the extrusion process due to the void volume in the apparatus, at least 200 μL of
extrusion product is recovered for application to the column.
18. Mounting a piece of white paper behind the column makes it easier to visualize the
calcein-loaded LUV entering the glass wool. A well-packed column will result in
2–3 in. of separation between the calcein-loaded LUV and the free calcein when
the LUV elute from the column.
19. Calcein-loaded LUV should be used within a week of preparation. POPC, in
particular, should be monitored for signs of leaky vesicles prior to a week. Best
results can be expected when the calcein-loaded LUV are freshly prepared.
20. Antimicrobial susceptibility testing against E. coli ML-35 is performed using a
modification of the National Committee for Clinical Laboratory Standards microdi-
lution broth assay. Mueller-Hinton broth is used for diluting the bacterial inoculum.
The inoculum is prepared from mid-log phase cultures at an approximate concen-
tration of 106 CFU/mL. Microtiter plate wells receive aliquots of 0.1 mL each of
the inoculum and peptide dilution. The final concentration of the peptide solution
ranges from 0.5 to 64 μg/mL in 2-fold dilutions. The microtiter plates are incubated
overnight at 37 °C. Minimum inhibitory concentration (MIC) is defined as the
lowest concentration that completely inhibits growth of the organism.
Structure-Function of Cationic Antimicrobial Peptides 171
21. We measure the absorbance at 600 nm, using fresh Mueller-Hinton broth as the
blank, and calculate the bacterial concentration using a calibration curve that
correlates number of bacteria with absorbance. The bacteria are then either diluted
or allowed to incubate longer to achieve the desired bacterial concentration. Based
on our growth curve, this takes approximately 3 h.
22. Since the peptide undergoes a 1:5 dilution in the cuvette, the peptide concentrations
in the assay are 4 × MIC, 2 × MIC, 1 × MIC, 0.5 × MIC, 0.25 × MIC, and 0.125
× MIC.
23. The leakage values can be normalized to the peptide inducing the greatest leakage
if necessary.
24. The sample absorbances are averaged for each peptide concentration at 5 and 15
min, and the slope is calculated. The slope of the blank is subtracted from the
slope of the 100% control and peptide sample slopes. All of the values are then
divided by the 100% control slope to determine the percentage of ONPG leakage
for each peptide at each concentration tested. None of our peptides has shown any
direct effect upon -galactosidase activity. In all cases, our reaction rates have
been linear over the 15-min time course.
25. The stock peptide solution is diluted to 50 μM in 500 μL of dH2 O for the 2:1
lipid-to-peptide ratio. For the 4:1, 8:1, and 16:1 ratios, 100 μL, 50 μL, and 25 μL
of the 50 μM peptide solution are added to 100 μL, 150 μL, and 175 μL of dH2 O,
respectively. A 3.13 μM peptide solution is made by combining 30 μL of the 50
μM peptide solution with 450 μL of dH2 O for the 32:1 ratio. For the 64:1, 128:1,
and 256:1 ratios, 100 μL, 50 μL, and 25 μL of the 3.13 μM peptide solution are
added to 100 μL, 150 μL, and 175 μL of dH2 O, respectively.
26. A customized trough, machined from a Teflon block, was designed to allow a
multichannel pipette to simultaneously add 20 μL aliquots to an 8-well section
of the 96-well plate. With four rows, the trough will hold all of the dilutions
necessary to measure the entire range of lipid-to-peptide ratios for one peptide.
The first column of circular wells in the trough is filled with dH2 O for the negative
control. The second column of wells in the trough is filled with 0.1% Triton X-100
for the positive control. Each of the long rectangular wells, designed to accept
three pipette tips, is filled with 200 μL of the desired peptide dilution (see Note
25). Care must be taken to prevent air bubble formation during pipettings. After
the four rows in the trough have been assayed, the trough is cleaned with soap,
thoroughly rinsed with dH2 O, and allowed to dry. The diagram of the Teflon
trough is shown below.
OO
OO
OO
OO
172 M. Pate and J. Blazyk
27. These volumes and concentrations could be changed if necessary but will most
likely remain consistent throughout the experiments. We have set up an Excel
spreadsheet to calculate the appropriate volumes of lipid, peptide, and buffer that
are required for each ratio based on the lipid and peptide stock concentrations to
automate these calculations.
28. All cuvettes that routinely come into contact with LUV should be periodically
cleaned with Chromerge to remove any peptide and lipid residue. This procedure
should be carried out in the hood and done so carefully wearing chemical-resistant
gloves. The cuvettes should be filled with Chromerge solution and allowed to sit
for 2–3 min. The Chromerge should then be discarded into a beaker containing
sodium bicarbonate to neutralize the H2 SO4 , and the cuvettes should be rinsed
well with dH2 O.
29. As increasing amounts of acrylamide are added, the fluorescence emission intensity
of tryptophan decreases due to collisional quenching. If the peptide binds to LUV,
so that the tryptophan residues are less accessible to the solvent, the degree of
quenching is reduced in proportion to binding.
30. Varying concentrations of acrylamide used to zero the fluorescence spectropho-
tometer are prepared as follows:
0 mM = 600 μL of HEPES buffer,
20 mM = 40 μL of 0.3 M acrylamide and 560 μL of HEPES buffer,
40 mM = 80 μL of 0.3 M acrylamide and 520 μL of HEPES buffer,
60 mM = 120 μL of 0.3 M acrylamide and 480 μL of HEPES buffer,
80 mM = 160 μL of 0.3 M acrylamide and 440 μL of HEPES buffer,
100 mM = 200 μL of 0.3 M acrylamide and 400 μL of HEPES buffer,
120 mM = 240 μL of 0.3 M acrylamide and 360 μL of HEPES buffer,
140 mM = 280 μL of 0.3 M acrylamide and 320 μL of HEPES buffer,
160 mM = 320 μL of 0.3 M acrylamide and 280 μL of HEPES buffer,
180 mM = 360 μL of 0.3 M acrylamide and 240 μL of HEPES buffer, and
200 mM = 400 μL of 0.3 M acrylamide and 200 μL of HEPES buffer.
The 10μM peptide volume is added to each for the control experiments and the
HEPES buffer is decreased by that volume.
Acknowledgments
The authors would like to thank Dr. Renato Gennaro for providing the
E. coli ML-35 bacterial strain and Dr. Alexey Ladokhin for helpful discus-
sions concerning the fluorescence experiments. This work was supported by
NIH Grants AI-047165 and C06-RR-14575 by the Ohio University College of
Osteopathic Medicine.
Structure-Function of Cationic Antimicrobial Peptides 173
References
1.
1 Blazyk, J., Wiegand, R., Klein, J., Hammer, J., Epand, R. M., Epand, R. F,
Maloy, W. L., and Kari, U. P. (2001) A novel linear amphipathic beta-sheet
cationic antimicrobial peptide with enhanced selectivity for bacterial lipids. J. Biol.
Chem. 276, 27899–27906.
2.
2 Jin, Y., Mozsolits, H., Hammer, J., Zmuda, E., Zhu, F., Zhang, Y., Aguilar, M. I.,
and Blazyk, J. (2003) Influence of tryptophan on lipid binding of linear amphipathic
cationic antimicrobial peptides. Biochemistry 42, 9395–9405.
3.
3 Jin, Y., Hammer, J., Pate, M., Zhang, Y., Zhu, F., Zmuda, E., and Blazyk, J. (2005)
Antimicrobial activities and structures of two linear cationic peptide families with
various amphipathic beta-sheet and alpha-helical potentials. Antimicrob. Agents
Chemother. 49, 4957–4964.
4.
4 Skerlavaj, B., Romeo, D., and Gennaro, R. (1990) Rapid membrane permeabi-
lization and inhibition of vital functions of Gram-negative bacteria by bactenecins.
Infect. Immun. 58, 3724–3730.
5.
5 Lakowicz, J. R. (1999) Protein fluorescence. In Principles of Fluorescence
Spectroscopy, 2nd ed. Kluwer Academic/Plenum Publishers, New York, pp.
445–486.
6.
6 Breukink, E., Van Kraaij, C., Van Dalen, A., Demel, R. A., Siezen, R. J.,
De Kruijff, B., and Kuipers, O. P. (1998) The orientation of nisin in membranes.
Biochemistry 37, 8153–8162.
7.
7 Schibli, D. J., Hwang, P. M., and Vogel, H. J. (1999) Structure of the antimicrobial
peptide tritrpticin bound to micelles: A distinct membrane-bound peptide fold.
Biochemistry 38, 16749–16755.
8.
8 Ladokhin, A. S. (1999) Analysis of protein and peptide penetration into membranes
by depth-dependent fluorescence quenching: Theoretical considerations. Biophys.
J. 76, 946–955.
9.
9 Epand, R. F., Epand, R. M., Monaco, V., Stoia, S., Formaggio, F., Crisma, M.,
and Toniolo, C. (1999) The antimicrobial peptide trichogin and its interaction with
phospholipid membranes. Eur. J. Biochem. 266, 1021–1028.
10.
10 Hong, J., Oren, Z., and Shai, Y. (1999) Structure and organization of hemolytic and
nonhemolytic diastereomers of antimicrobial peptides in membranes. Biochemistry
38, 16963–16973.
11.
11 Campbell, I. D., and Dwek, R. A. (1984) Optical activity. In Biological
Spectroscopy. The Benjamin/Cummings Publishing Company, Inc., Menlo Park,
CA, pp. 255–277.
12.
12 Chen, P. S., Toribara, T. Y., and Warner, H. (1956) Microdetermination of
phosphorus. Anal. Chem. 28, 1756–1758.
13.
13 Ladokhin, A. S., Jayasinghe, S., and White, S. H. (2000) How to measure and
analyze tryptophan fluorescence in membranes properly, and why bother? Anal.
Biochem. 285, 235–245.
14
Howard M. Shapiro
Summary
This chapter describes reliable flow cytometric methods for assessment of two important
physiologic characteristics of bacteria, membrane potential and membrane permeability, which
can provide indications of the effects of antimicrobial agents on microorganisms.
Key Words: bacteria; cyanine dyes; flow cytometry; membrane permeability; membrane
potential.
1. Introduction
Although Leeuwenhoek’s microscopes introduced science to the microbial
world at the single-cell level in the 17th century, most analyses of microbial
growth and metabolism done in modern laboratories are still accomplished
using bulk measurements of large numbers of cells, limiting the degree to
which microbial behavior can be understood, especially with regard to detecting
heterogeneity within populations. The technology of cytometry (1–5) now
makes it possible to carry out detailed studies of the physiology of microor-
ganisms. Perturbations resulting from the action of physical and chemical agents
can be examined at the single-cell level, using much smaller inocula and smaller
amounts of reagents. This permits results to be obtained in a shorter period
of time and could thus potentially play a useful role in antimicrobial drug
development.
175
176 H. M. Shapiro
Propidium bears a double positive charge because its ring nitrogen side chain
is an iso-propyl group with a quaternary ammonium substituent. Like a number
of other dyes that also bear quaternary ammonium groups and more than one
positive charge [e.g., TO-PRO-1, TO-PRO-3, and Sytox Green, all from Invit-
rogen/Molecular Probes (Eugene, OR)], propidium is generally believed to be
membrane-impermeant; i.e., excluded by prokaryotic and eukaryotic cells with
intact cytoplasmic membranes. Cells that take up propidium and other multiply
charged dyes are usually considered to be nonviable, although transient perme-
ability to these dyes can be induced by certain chemical and physical treat-
ments, e.g., electroporation, with subsequent recovery of membrane integrity
and viability. Thus, staining (or, more properly, the lack thereof) with propidium
is the basis of a so-called dye exclusion test of viability. Acid dyes, such as
trypan blue and eosin, are also membrane-impermeant and are used in dye
exclusion tests.
A variation on the dye exclusion test employs a nonfluorescent, membrane-
permeant substrate for an intracellular enzyme, which crosses intact or damaged
cell membranes and which is then enzymatically cleaved to form a fluorescent,
impermeant (or slowly permeant) product. The product is retained in cells
with intact membranes and quickly lost from putatively nonviable cells with
damaged membranes. One commonly used substrate is diacetylfluorescein,
also called fluorescein diacetate (FDA), which yields the slowly permeant
fluorescein. Nonfluorescent esters of some other fluorescein derivatives are
better for dye exclusion tests because their products are less permeant (10).
Another substrate is 5-cyano-2,3-ditolyl tetrazolium chloride (CTC) (2). This is
reduced by intracellular dehydrogenases to a fluorescent formazan and provides
an indication of respiratory activity as well as of membrane integrity.
Bacteria normally maintain an electrical potential gradient (membrane
potential, ) of over 100 mV across the cytoplasmic membrane, with the
interior side negative. Charged dyes that are sufficiently lipophilic to pass
readily through the lipid bilayer portion of the membrane partition across the
membrane in response to the potential gradient. Positively charged lipophilic
dyes, such as cyanines, are concentrated inside cells that maintain , while
negatively charged lipophilic dyes, such as oxonols, are excluded. Thus, if two
cells of the same volume, one with a transmembrane potential gradient and one
without, were equilibrated with a cyanine dye, the cell with the gradient would
contain more dye than the one without. If the cells were equilibrated with an
oxonol dye, the cell without the gradient would contain more dye. However,
cells with different volumes may contain different amounts of dye, irrespective
of their s, because it is the concentration of dye, rather than the amount
Flow Cytometry of Bacterial Membrane Potential and Permeability 179
of dye, in the cell that reflects . The flow cytometer measures the amount,
not the concentration.
When the cyanine dye 3,3 -diethyloxacarbocyanine iodide (DiOC2 (3))
(typically excited at 488 nm) is added to cells at much higher concentrations
than are normally used for flow cytometric estimation of , it is possible
to detect red (∼610 nm) fluorescence in addition to the green (∼525 nm)
fluorescence normally emitted by this dye (11). The red fluorescence is likely
due to the formation of dye aggregates. At high dye concentrations, the green
fluorescence is dependent on cell size but independent of , whereas the red
fluorescence is both size- and potential-dependent. The ratio of red and green
fluorescence, which is largely independent of size, provides a more accurate
and precise measurement of bacterial than can be obtained from simple
fluorescence measurements.
In addition, the protocol described here uses the far-red (>695 nm) fluores-
cence of TO-PRO-3, excited by a red He-Ne (633 nm) or diode (635-640 nm)
laser, to demonstrate membrane permeability. Dividing the TO-PRO-3 fluores-
cence signal by the green DiOC2(3) fluorescence signal produces a normalized
indicator of permeability that provides better discrimination between cells with
impermeable and permeable membranes than can be obtained from TO-PRO-3
fluorescence alone (12).
2. Materials
Note: All aqueous solutions should be made with de-ionized distilled water
(dH2 O) and filtered through a filter with a pore size no larger than 0.22 μm.
Dye solutions should be stored in the dark.
3. Methods
3.1. Measurement of and Permeability Using DiOC2 (3)
and TO-PRO-3 (See Note 1)
3.1.1. Sample Preparation (see Note 2)
1. Dilute samples in MHBc to a target concentration of 106 –107 cells/mL.
2. Add dyes: 30 μM DiOC2 (3) and 100 nM TO-PRO-3.
3. Keep the samples at room temperature (∼25 ºC) for 5 min before running on the
flow cytometer.
many cells have lost completely, and most have lost to some extent
(lower and upper left quadrants); over 58% of the total have become permeable
(upper left quadrant). By 4 h, some regrowth has occurred; about 17% of the
events measured show normal and no permeability. The situation is quite
different at a sub-MIC amoxicillin concentration (bottom panel). At 2, 3, and
even 4 h, a substantial fraction of events (as high as 28%) are in the upper
right quadrant, indicating a greater than zero with permeability to TO-
PRO-3. By 4 h, most cells (over 79%) have regained normal and lost
permeability. Bacterial counts over this time period rule out the accumulation
of a high- , impermeable population by expansion of the small population
of such cells present after 2 h. Although some intermediate- , permeable
events may represent aggregates of high- , impermeable viable cells and
permeable, low- dead cells, many of these events appear to be accounted for
by TO-PRO-3 uptake into viable cells. This, parenthetically, suggests a novel
approach to antimicrobial therapy (1,3,13,14). Recent work by others (15,16)
also suggests that propidium, which, like TO-PRO-3, is widely regarded as a
“nonviability” indicator, may be taken up by metabolically and reproductively
viable cells.
184 H. M. Shapiro
4. Notes
1. DiOC2 (3)/TO-PRO-3 staining. This method has been used in instruments with 488
nm and red illuminating beams separated in space; it is not known whether it
will work in instruments with collinear 488 nm and red beams. Both DiOC2 (3)
and TO-PRO-3 adhere to the tubing used in most flow cytometers, and the high
concentration of cyanine dye used in this protocol may necessitate replacement of
some tubing if repeated cleaning with dilute chlorine bleach, ethanol, or detergents
still leaves dye in the system. Some bacterial types (e.g., S. aureus) may be grown
in culture following exposure to 30 μM DiOC2 (3). The ratiometric measurement
can be done without the permeability measurement, using DiOC2 (3) without TO-
PRO-3, in an instrument with a single 488-nm illuminating beam. In this instance,
measurement of DiOC2 (3) red fluorescence through a 660–680-nm bandpass or
long-pass filter can give satisfactory results.
2. Dye concentrations and incubation times given are for Staphylococcus aureus and
other Gram-positive species, e.g., Enterococcus and Streptococcus. Both of the latter
typically show low membrane potentials. The concentration of DiOC2 (3) and the
dye incubation time may need to be adjusted for other species. For Mycobacterium
smegmatis, 20 μM of dye and a 20–25 min incubation time appear optimal, and
supplemented Middlebrook 7H9 broth is used as the medium. The method has also
been used with some Gram-negative species, e.g., E. coli, with 5–10 mM of EDTA
added to staining solutions, and delineates cells with various apparent values of
as well as discriminating those that do and do not take up TO-PRO-3. However,
Gram-negative bacteria appear to be damaged by the calibration buffers used with
Gram-positive organisms, and it has not been possible to derive calibration curves
for the former. A buffer containing 100 mM of Tris-HCl, pH 8.0, 50 mM of NaCl,
5mM of KCl, and 10 mM of EDTA can be used for work with a number of
Gram-negative organisms, including Enterobacter cloacae, Klebsiella pneumoniae,
Proteus mirabilis, and Pseudomonas aeruginosa.
Acknowledgments
The author thanks Dave Novo, Nancy Perlmutter, and Jared Silverman, who
have played vital roles in the development and application of the methods
described here.
Flow Cytometry of Bacterial Membrane Potential and Permeability 185
References
1.
1 Shapiro, H. M. (2003) Practical Flow Cytometry, 4th ed. Wiley-Liss, Hoboken, NJ
(available online at http://probes.invitrogen.com/products/flowcytometry/practi-
calflowcytometry.html).
2.
2 Davey, H. M., and Kell, D. B. (1996) Flow cytometry and cell sorting of heteroge-
neous microbial populations—The importance of single-cell analyses. Microbiol.
Rev. 60, 641–696.
3.
3 Shapiro, H. M. (2000) Microbial analysis at the single-cell level: Tasks and
techniques. J. Microbiol. Meth. 42, 3–16. (Note: The full text of this paper
may be downloaded without charge from http://www1.elsevier.com/homepage/
sah/mimet/speciss/1368.pdf.)
4.
4 Brehm-Stecher, B., and Johnson, E. A. (2004) Single-cell microbiology: Tools,
technologies, and applications. Microbiol. Mol. Biol. Rev. 68, 538–559.
5.
5 Nebe-von-Caron, G., Stephens, P. J., Hewitt, C. J., Powell, J. R., and
Badley, R. A. (2000) Analysis of bacterial function by multi-colour fluores-
cence flow cytometry and single cell sorting. J. Microbiol. Meth. 42, 97–114.
(Note: The full text of this paper may be downloaded without charge from
http://www1.elsevier.com/homepage/sah/mimet/speciss/1378.pdf.)
6.
6 Nikaido, H. (2003) Mechanisms of bacterial outer membrane permeability
revisited. Microbiol. Mol. Biol. Rev. 67, 593–656.
7.
7 Leive, L., and Kollin, V. (1967) Controlling EDTA treatment to produce permeable
Escherichia coli with normal metabolic processes. Biochem. Biophys. Res. Comm.
28, 229–236.
8.
8 Vaara, M. (1992) Agents that increase the permeability of the outer membrane.
Microbiol. Rev. 56, 395–411.
9.
9 Walberg, M., Gaustad, P., and Steen, H. B. (1999) Uptake kinetics of nucleic acid
targeting dyes in S. aureus, E. faecalis and B. cereus: A flow cytometric study. J.
Microbiol. Meth. 35, 167–176.
10.
10 Haugland, R. P. (ed.) (2005) The Handbook: A Guide to Fluorescent Probes
and Labeling Technologies, 10th ed. Invitrogen/Molecular Probes, Eugene, OR
(updated Web edition online at http://probes.invitrogen.com/handbook).
11.
11 Novo, D., Perlmutter, N. G., Hunt, R. H., and Shapiro, H. M. (1999) Accurate
flow cytometric membrane potential measurement in bacteria using diethyloxacar-
bocyanine and a ratiometric technique. Cytometry 35, 55–63.
12.
12 Novo, D. J., Perlmutter, N. G., Hunt, R. H., and Shapiro, H. M. (2000) Multi-
parameter flow cytometric analysis of antibiotic effects on membrane potential,
membrane permeability, and bacterial counts of Staphylococcus aureus and Micro-
coccus luteus. Antimicrob. Agents Chemother. 44, 827–834.
13.
13 Shapiro, H. M. (2001) Multiparameter flow cytometry of bacteria: Implications
for diagnostics and therapeutics. Cytometry 43, 223–226.
14.
14 Shapiro, H. M. (2003) Method for overcoming bacterial antibiotic resistance.
U. S. Patent No. 6,562,785, issued May 13, 2003.
186 H. M. Shapiro
15.
15 Gelle, M. P., Jacquelin, L. F., and Choisy, C. (2003) [Compared viability of
planctonic bacteria and bacteria in biofilms by flowcytometry] [Article in French]
Ann. Pharm. Fr. 61, 243–252.
16.
16 Spiers, A. J., and Rainey, P. B. (2005) The Pseudomonas fluorescens SBW25
wrinkly spreader biofilm requires attachment factor, cellulose fibre and LPS inter-
actions to maintain strength and integrity. Microbiology 151, 2829–2839.
17.
17 Silverman, J. A., Perlmutter, N. G., and Shapiro, H. M. (2003) Correlation of
daptomycin bactericidal activity and membrane depolarization in Staphylococcus
aureus. Antimicrob. Agents Chemother. 47, 2538–2544.
18.
18 Andries, K., Verhasselt, P., Guillemont, J., Gohlmann, H. W., Neefs, J. M.,
Winkler, H., Van Gestel, J., Timmerman, P., Zhu, M., Lee, E., Williams, P., de
Chaffoy, D., Huitric, E., Hoffner, S., Cambau, E., Truffot-Pernot, C., Lounis, N.,
and Jarlier, V. (2005) A diarylquinoline drug active on the ATP synthase of
Mycobacterium tuberculosis. Science 307, 223–227.
15
Summary
Infections caused by multidrug-resistant Gram-negative pathogens play a major role in the
morbidity and mortality of hospitalized patients. The rise of resistance to current antibiotic
therapies has made the discovery of new agents urgent. One of the major antibiotic resistance
mechanisms utilized by more than 15 species of Gram-negative bacterial cells is the Resistance
Nodulation Division (RND) efflux pump, which eliminates several classes of antibiotics such as
penicillins and cephalosporins, macrolides, aminoglycosides, fluoroquinolones, and tetracyclines.
Here we describe a multistep process to identify compounds that inhibit the RND-type efflux
pumps. This involves measuring the inhibition of accumulation of ethidium bromide in E. coli or
Haemophilus influenzae cells and confirming that the inhibition is specific for the efflux pumps
by using genetic constructs and biochemical methods to measure nonspecific inhibition due to,
e.g., intrinsic antibacterial activity or membrane disruption. In whole bacterial cells, synergism,
antagonism, or indifference of the combination of an antibiotic with the putative inhibitor is
determined, and this is then confirmed by quantitating viable bacterial cells in liquid culture
over 24 h.
Key Words: bacterial efflux pump inhibitor; antibiotic resistance; Haemophilus influenzae;
E. coli; Pseudomonas aeruginosa; Resistance Nodulation Division (RND) efflux pump.
1. Introduction
Haemophilus influenzae is a prominent Gram-negative pathogen of the upper
respiratory tract. This organism and several pathogenic Gram-negative Enter-
obacteriaceae and Pseudomonas aeruginosa share a common mechanism of
187
188 B. Kamicker et al.
to accumulate in the cell via the proton motive force (i.e., both the membrane
potential and the pH gradient). Any potential EPI that also disrupts the proton
motive force is not working through efflux pump mechanisms and is excluded
as a potential EPI. Finally, kill kinetic studies over 24 h give a dynamic picture
of the effect of the EPI on the bacterial killing of strains containing efflux
pumps in the presence of antibiotic alone, and in combination with the EPI. This
test is the final in vitro step in the search for a successful efflux pump inhibitor.
2. Materials
2.1. Bacterial Culture
1. LB agar containing 100 μg/mL of ampicillin (Molecular Toxicology, Boone, NC).
2. LB agar (Molecular Toxicology, Boone NC).
3. Chocolate agar (Hardy Diagnostics, Santa Maria, CA).
4. HTM (Haemophilus test medium) agar (Oxoid LTD, Basingstoke, UK).
5. Tryptic Soy Agar containing 5% sheep blood (Hardy Diagnostics, Santa Maria, CA).
6. 20 μg/mL of kanamycin (U.S. Pharmacopeia, Rockville, MD).
7. E. coli strains EC1763, EC1764, EC1639, and EC1763 were used in these studies
(see Note 1).
8. H. influenzae utilizes acrAB as its major efflux pump to confer antibiotic resistance.
H. influenzae strain 54A1116 is the parent strain, and the corresponding efflux
pump knockout was designated 54A1115. 54A1116 was grown on chocolate agar
plates, and 54A1115 was grown on HTM agar containing 20 μg/mL of kanamycin.
9. E. coli JL467 (B500:pBR/lacY) was especially constructed for the protonophore
assay. It was grown on LB agar or LB broth containing 100 μg/mL of ampicillin.
9. Falcon 96-well white opaque tissue culture plates, flat bottom with lid (BD,
Franklin Lakes, NJ).
10. Dimethyl sulfoxide (DMSO).
11. Potential efflux pump inhibitors (Pfizer, New York, NY).
3. Methods
3.1. Bacterial Strains
1. H. influenzae strains were streaked for single colonies from frozen culture onto
chocolate agar plates, HTM agar plates containing 20 μg/mL of kanamycin, or a
loop full of frozen culture was added to supplemented BHI broth and incubated
at 37°, 5% CO2 overnight. E. coli strains were streaked for single colonies from
frozen culture onto either Tryptic soy agar with 5% sheep blood, LB agar, LB agar
containing 100 μg/mL of ampicillin, or a loopful of frozen culture was added to
LB broth containing 100 μg/mL of ampicillin, and incubated at 35°, ambient air,
overnight.
2. Except for JL467, single colonies from agar plates were passed onto fresh agar
plates and incubated a second night before testing.
Fig. 1. Example of results from the ethidium bromide accumulation assay using
E. coli strain K1764, two control compounds (CCCP and DMSO), and an active
compound A at 50 μM.
standard deviation or more above the negative control, DMSO (Fig. 1). CCCP
is used as a positive control. To ensure that the ethidium bromide accumulation
is dependent on pump inhibition alone, the ethidium bromide accumulation
assay Part II is employed. Strains EC1763 and 54A1115, which contain no
pumps, will accumulate levels of ethidium bromide that are the same as the
negative control, DMSO, in the presence or absence of a true pump inhibitor.
Any decrease in ethidium bromide accumulation in such strains in the presence
of a test compound will be a signal that the test compound is working by a
pump-independent mechanism. Compounds are tested on three separate days,
with fresh inoculum each day, and a test compound must be active for at least
two of the three days tested.
Part I
3.2.1. Preparation of cultures
1. From a frozen culture, inoculate 10 mL of supplemented BHI with a 10 μL loop
of 54A1116 and incubate overnight at 37°, 5% CO2 , with shaking. Also, streak a
chocolate agar plate to check for sterility after overnight incubation. From a frozen
Bacterial Efflux Pump Inhibitors 193
1. As described above, strains were grown from frozen stocks on the appropriate agar
plates, for 2 nights before use, with passage of each strain onto a fresh agar plate
after one night.
2. Using the appropriate media for the organism, each 96-well plate was filled with
190 μL of media in wells A1–H1. The remaining wells were filled with 95 μL of
media.
3. Antibiotic at a concentration that was 20X the final concentration needed in the
first well was dissolved in DMSO. The final concentration of antibiotic should be
1 to 2 dilutions above the actual MIC for that compound with that organism.
4. Ten μL of the 20X azithromycin were added to wells A1 and E1. Ten μL of the
20X linezolid were added to wells B1 and F1. Ten μL of DMSO were added to
wells C1, D1, G1, and H1.
5. 1:2 serial dilutions of 100 μL from column 1 to column 11 were performed by a
Biomek 2000, removing the last 100 μL from the plate. Column 12 received only
95 μL of media and served as the growth control wells. Plates now contained 95
μL of antibiotic at 1X the final concentration in two-fold serial dilutions.
6. The density of a bacterial culture was adjusted to an OD625 of 0.1, as read on
a spectrophotometer, and then diluted 1:10. A multichannel pipette was used to
196 B. Kamicker et al.
inoculate the plates with 5 μL of this diluted culture for a final organism concen-
tration of approximately 5 × 105 CFU/mL. One organism inoculated rows A–D,
while a second organism inoculated rows E–H.
7. Added to the inoculum was the test EPI at a concentration of 10 mM. 38 μL of
EPI at 10 mM were added to 340 μL of 1:10 diluted inoculum, and then 5 μL of
inoculum were added to the 95 μL in the plate, for a 200-fold dilution of EPI. The
final concentration of EPI in the well was 50 μM.
8. The plates were incubated at 35°C, ambient air, for 18 ± 2 h.
9. MICs of antibiotic in the presence of 50 μM of EPI were read by eye. Any compound
that had an eight-fold or larger decrease in the MIC of the antibiotic in the presence
of inhibitor compared to the MIC of the antibiotic alone, in at least one of the three
strains tested, was further tested by FIC testing.
3. A11 through H11 and A12 through H12 were filled with 50 μL of media. These
wells will determine the MIC of the inhibitor and the antibiotic alone, on the same
plate as the compounds in combination.
4. Test compounds were dissolved at 40 mg/mL in DMSO.
5. Compound stocks were further diluted in the appropriate media to 4X and 8X the
final maximum concentration in the plate.
6. 50 μL of the EPI, at 4X the final concentration, were added to well A11, and 50
μL of the antibiotic, at 4X the final concentration, were added to well A12.
7. Wells A11 and A12 were serially diluted 1:2 through wells H11 and H12 by a
Denley Wellpro (Progroup Inc, St. Louis, MO), with the remaining 50 μL removed
from the plate.
8. 25 μL of the EPI at 8X the starting concentration was added to wells A1 through
H1. The drug was serially diluted 1:2 through column 8, with the remaining 25
μL removed from the plate.
9. The antibiotic was made at 4X the starting concentration in 10 mL of media.
10. Seven 1:2 serial dilutions in 5 mL were made.
11. Using an 8-channel pipette, 25 μL of the highest concentration of antibiotic were
added to wells A1–A8.
12. The next-highest concentration was added to wells B1–B8, etc. The final volume
of drug was 50 μL in each well, at a concentration of 2X the final concentration
(Table 1).
13. To inoculate a plate, several colonies of each strain were added to a 5-mL flat-
bottom saline tube and mixed for 5 s, to an OD of 0.5 measured in a Crystalspec
nephelometer. This gave a cell density of approximately 1 × 108 CFU/mL.
14. Each inoculum was diluted 1:100 in HTM or CAMHB.
15. 50 μL of diluted inoculum were added to each well, for a final organism density
of 5 × 105 CFU/mL, in a final volume of 100 μL, and a drug concentration of 1X
the final concentration.
16. The 96-well plates were incubated at 35°, ambient air, for 22 h and read by eye.
17. FIC indexes were determined by the following formula: (MIC of antibiotic in
combination/MIC of antibiotic alone) + (MIC of EPI in combination/MIC of
EPI alone).
18. An alternative method of making checkerboard plates is described in Section 3.8.
a known proton motive force inhibitor, and cycloserine, which has no effect
on membranes, are included in the assay to validate the assay conditions. LB
broth serves as a positive control, allowing full uptake of the radiolabel. Any
EPI tested at 3X the MIC that had less than 50% 14 C-lactose accumulation after
30 min, compared to LB broth alone, was eliminated.
1. A 10 μL loop JL467 frozen stock was grown in LB broth containing 100 μg/mL of
ampicillin at 37°C, in ambient air, overnight. Overnight culture was diluted 1:100
in LB broth containing 100 μg/mL of ampicillin. This culture was grown for 3 h,
until the OD600 read on a spectrophotometer equaled 1.0.
2. One 96-well flat-bottom plate can test 15 compounds at three concentrations,
1X, 2X, and 3X the MIC of that compound, in duplicate. Also included on the
plate is CCCP, at 5 μg/mL final concentration, cycloserine, at 50 μg/mL final
concentration, and two wells that contain the positive control, LB broth.
3. In Eppendorf tubes, 100 μL of each compound at 12X the final concentration
were prepared in LB broth. Also, prepared were 100 μL of CCCP in LB broth at
60 μg/mL and 100 μL of cycloserine in LB broth at 600 μg/mL.
4. Compound was added to 96-well flat-bottom plates in duplicate by adding 25 μL
of the highest concentration of compound 1 to wells A1 and B1, the second-highest
concentration in wells A2 and B2, and the lowest concentration of compound in
wells A3 and B3. The remaining wells were filled similarly with compounds 2
through 15. 25 μL CCCP were added to wells G10 and H10, 25 μL of cycloserine
were added to wells G11 and H11, and 25 μL of LB broth were added to wells
G12 and H12.
5. 25 μL of 14 C-lactose in LB broth were added to all wells.
6. Following the 3-h incubation of cells, to an OD600 = 1.0, 200μL cells were added
to each well.
7. The plate was incubated at 37°C for 30 min.
8. The reaction was stopped by transferring the entire volume of each well to a
GF/B filter plate and filtering the contents by a Filtermate harvester (PerkinElmer,
Boston, MA). The plate was washed 3 times with 200 μL of cold stop solution.
9. The plate was air-dried overnight.
10. The bottom of plate was covered, and 25 μL of liquid scintillation cocktail were
added to each well. The top of the plate was covered, and the plate was counted
for 14 C in 1-min intervals in a Wallac Trilux liquid scintillation counter (EG&G
Wallac, Gaithersburg, MD).
11. Use the counts from the wells containing only LB broth as 100% uptake, and
normalize all other counts to percent uptake compared to LB broth. As an active
protonophore, CCCP will have less than 50% uptake. Cycloserine will have
>80% uptake. At a concentration that is 3X the MIC, a potential EPI that is not
protonophore-like will have more than 60% uptake of 14 C-lactose.
200 B. Kamicker et al.
CFU/mL. Plates were allowed to sit for 10 min on the bench before incubating at
37°C, ambient air, overnight. Colonies at each dilution were counted and plotted
on a log scale versus incubation time for each antibiotic/inhibitor combination.
EPI/Antibiotic 1 2 3 4 5 6 7 8 9 10 11 12
4. Notes
1. Because E. coli has multiple antibacterial efflux pumps, two strains, EC1763 and
EC1764, derived from parent strain EC1639, were constructed by Keith Poole
(Queens University, Kingston, Ontario) to examine the effect of inhibiting only
the acrAB pump. E. coli strain EC1763 had four chromosomally encoded efflux
pumps knocked out as well as waaP (quad strain—acrAB, acrEF, emrE,
emrD—with a waaP deletion). waaP is a kinase in the outer membrane of E. coli
that is responsible for adding the LPS component to the outer membrane. Deletion
of this kinase increases the outer membrane permeability of this strain, allowing
potential efflux pump inhibitor compounds to more readily reach the efflux pumps.
EC1763 was transformed with a plasmid vector encoding ampicillin resistance and
the structural genes for acrAB and the new strain containing only acrAB was
designated EC1764. EC1764 was grown on LB agar containing 100 μg/mL of
ampicillin. The other related E. coli strains, EC1639 and EC1763, were grown on
LB agar or Tryptic soy agar without added antibiotic.
2. Previous tests found the largest data variation occurred from inocula made on
separate days. Therefore, replicates were run over three days instead of three plates
on one day or three wells in one plate on a single day.
Acknowledgments
We acknowledge the work of numerous former colleagues at Pharmacia who
started this research program: D. E. Decker, M. P. Sheets, S. E. Buxser, M. R.
Barbachyn, R. Gadwood, G. Zurenko, J. Bourdage, G. F. Hess, J. K. Gibson,
A. G. Morgan, J. E. Mott, et al. We also thank Keith Poole and colleagues at
Queens University in Kingston, Ontario, for E. coli strain constructs.
References
1.
1 Li, X.-Z., and Nikaido, H. (2004) Efflux-mediated drug resistance in bacteria.
Drugs 64, 159–204.
2.
2 Yu, E. W., McDermott, G., Zgurskaya, H., Nikaido, H., and Koshland, D. E. Jr.
(2003) Structural basis of multiple drug-binding capacity of the AcrB multidrug
efflux pump. Science 300, 976–980.
3.
3 Yu, E. W., Aires, J. R., and Nikaido, H. (2003) AcrB multidrug efflux pump
of Escherichia coli: Composite substrate-binding cavity of exceptional flexibility
generates its extremely wide substrate specificity. J. Bacteriol. 185, 5657–5664.
4.
4 Yu, E. W., Aires, J. R., McDermott, G., and Nikaido, H. (2005) A periplasmic
drug-binding site of the AcrB multidrug efflux pump: A crystallographic and
site-directed mutagenesis study. J. Bacteriol. 187, 6804–6815.
5.
5 Murakami, S., Nakashima, R., Yamashita, E., and Yamaguchi, A. (2002) Crystal
structure of bacterial multidrug efflux transporter AcrB. Nature 419, 587–593.
204 B. Kamicker et al.
6.
6 Murakami, S., Nakashima, R., Yamashita, E., Matsumoto, T., and Yamaguchi, A.
(2006) Crystal structures of a multidrug transporter reveal a functionally rotating
mechanism. Nature 443, 173–179.
7.
7 Higgins, M. K., Bokma, E., Koronakis, E., Hughes, C., and Koronakis, V. (2004)
Structure of the periplasmic component of a bacterial drug efflux pump. Proc.
Natl. Acad. Sci. USA 101, 9994–9999.
8.
8 Anonymous (2003) National nosocomial infections surveillance (NNIS) system
report, data summary from January 1992 through June 2003, issued August 2003.
Amer. J. Infect. Control 31, 481–498.
9.
9 Baker, C. N., Banerjee, S. N., and Tenover, F. C. (1994) Evaluation of alamar
colorimetric MIC method for antimicrobial susceptibility testing of Gram-negative
bacteria. J. Clin. Microbiol. 32, 1261–1267.
10.
10 Clinical and Laboratory Standards Institute. (2006) Methods for Dilution Antimi-
crobial Susceptibility Tests for Bacteria That Grow Aerobically; Approved
Standard – Seventh Edition. CLSI Document M7-A7.
11.
11 Amsterdam, D. (1996) Susceptibility testing of antimicrobials in liquid media. In
Antibiotics in Laboratory Medicine, 4th ed. (V. Lorian, ed.). The Williams and
Wilkins Co., Baltimore, MD, pp. 52–111.
12.
12 Eliopoulos, G. M., and Moellering, R. C. Jr. (1996) Antimicrobial combination.
In Antibiotics in Laboratory Medicine, 4th ed. (V. Lorian, ed.). The Williams and
Wilkins Co., Baltimore, MD, pp. 330–396.
16
Summary
Fatty acid biosynthesis is one of the relatively newer targets in antibacterial drug discovery.
The presence of distinct fatty acid synthases (FAS) in mammals and bacteria and the fact that most
bacterial FAS enzymes are essential for viability make this a very attractive antimicrobial drug
target. The enzyme -ketoacyl ACP synthase (KASIII or FabH) is the key enzyme that initiates
fatty acid biosynthesis in a type II dissociated FAS. This enzyme catalyzes the condensation
of acyl CoA and malonyl ACP (acyl carrier protein) to form a -ketoacyl ACP product, which
is further processed to form mature fatty acids that are involved in various essential cellular
processes and structures like phospholipid biosynthesis, cell wall formation, etc. Herein we
describe a new assay for the Mycobacterium tuberculosis FabH (mtFabH) enzyme involved in a
key initiation step in the synthesis of mycolic acids, which are an integral component of the cell
wall. The assay eliminates the need for the cumbersome washing steps or specialty scintillation
proximity assay beads and the preparation of acyl carrier proteins required in other assay
formats. This discontinuous assay involves the reduction of radiolabled long-chain -ketoacyl
CoA product to its dihydroxy derivative, which partitions into a nonpolar phase for quantitation,
while the reduced radiolabeled substrate derivative remains in the aqueous phase.
Key Words: FAS; fatty acid biosynthesis; lipid metabolism; mtFabH; -ketoacyl ACP
synthase; KASIII; fatty acid condensing enzymes.
1. Introduction
Bacterial fatty acid biosynthesis is an essential cellular process and has
recently gained interest as a relatively unexplored drug target. In mammals, this
205
206 S. Sachdeva and K. A. Reynolds
A slower reaction rate for mtFabH is observed when malonyl CoA is used in
place of a MACP substrate (8) (see Table 1). Dodecanoyl CoA is the preferred
substrate for assays using either malonyl CoA or ecMACP (generated from the
Escherichia coli ACP). With this acyl CoA substrate, the reaction rate is about
four-fold slower with malonyl CoA than with ecMACP or mtMACP (generated
from the M. tuberculosis ACP). Catalysis of longer-chain acyl CoA substrates
by the mtFabH is markedly reduced using either ecMACP or malonyl CoA, but
not mtMACP. One advantage of this modified assay is that all the substrates
are commercially available. There is no need to obtain a purified ACP, or to
convert it to either the corresponding MACP or biotinylated MACP, leading to
significant savings in both time and cost. The direct utilization of radioactive
malonyl CoA in the assay also maximizes the use of this substrate for the
assay, avoiding the inevitable losses associated with conversion to malonyl
ACP. The assay also uses lower concentrations of malonyl CoA (12.5 μM
vs. the 50 μM typically used in other formats (7,8), decreasing the amount of
material and potentially increasing the range of the assay to include both poor
mtFabH Assay: Principles and Method 209
Table 1
Specific Activity of mtFabH with Malonyl
CoA (in Place of MACP) Using a Range of
Different Acyl CoA Substrates
and good competitive inhibitors. A final advantage of this new assay format is
an excellent 60:1 signal-to-noise ratio (compared with 10:1 in the scintillation
proximity assay (6)).
2. Materials
1. Lauroyl CoA or other long-chain acyl CoA (Sigma)—Make a stock solution of
100 mM or 10 mM in aqueous hydrochloric acid, pH 3.5, then dilute to 100 μM
working concentration and aliquot into appropriate working volumes (see Note 1).
Store at –80 °C.
2. Radioactive [2-14 C] Malonyl CoA (1.8 mM; specific activity, 55 mCi/mmol,
American Radiolabeled Chemicals, Inc.). Dilute approximately 7.2 times in aqueous
hydrochloric acid solution (pH 3.5) and aliquot the resulting 250 μM solution into
appropriate working volumes (see Note 2). Store at –80 °C.
3. mtFabH expression in E coli and purification has been described previously (6).
4. Sodium phosphate buffer: 100 mM sodium phosphate, pH 7.0, in double-distilled
(DD) water or enzyme grade water.
5. Tetrahydrofuran (THF)—reagent grade.
6. Reducing reagent: 5 mg of NaBH4 to 1 mL of a 70% 100 mM K2 HPO4 , 100mM
KCl, 30% THF solution. This solution is prepared fresh and kept on ice until used
(10) (see Note 3).
7. Screw-cap microcentrifuge tubes.
8. Scintillation cocktail—EcoScint A (National Diagnostics).
9. Scintillation vials—Wheaton Science; high-density polyethylene (HDPE).
210 S. Sachdeva and K. A. Reynolds
3. Methods
The reaction is carried out in 20 μL (total volume). This low volume
using a minimum of the commercial radioactive malonyl CoA sample with an
unchanged specific activity balances a high signal-to-noise ratio with a low
cost. Larger-volume assays would require either additional radioactive malonyl
CoA (increased cost) or the addition of unlabeled malonyl CoA (decreasing
the specific activity and signal-to-noise ratio). The concentrations of various
components in a typical assay are shown in Table 2. These volumes permit
determination of an IC50 value for mtFabH inhibitor but can be modified to
perform the other enzyme studies by replacement with an additional 2 μL of
buffer.
1. Thaw the desired number of lauroyl CoA, malonyl CoA, and mtFabH aliquots and
keep at 4 °C.
2. In a screw-cap microcentrifuge tube, add 2.5 μL of 100 μM lauroyl CoA solution
(final concentration, 12.5 μM lauroyl CoA), 1 μL of the 250 μM [2-14 C] malonyl
CoA solution (approx. 31,000 counts; final concentration, 12.5 μM), and 2 μL
of 10X inhibitor concentration (for inhibitor IC50 studies). Add 0.1 M of sodium
phosphate buffer, pH 7.0, to make up the volume to 18 μL.
3. Initiate the reaction by addition of 2 μL of mtFabH (0.2–0.4 μg) solution in 0.1 M
of sodium phosphate buffer, pH 7.0. Cap the microcentrifuge tube and keep at 37
°C for a designated time (typically, 30–90 min). Under these assay conditions, a
linear reaction rate was observed over a 2-h assay period (Fig. 3).
4. Add 0.5 mL of the reducing solution to the assay mixture, cap the vials, and shake
vigorously. Incubate the mixture at 37 °C for 15 min (see Note 4).
5. Add 500 μL of toluene to the mixture, mix the solution vigorously, and allow to
separate at room temperature (see Note 5).
6. Remove 320 μL of the upper phase (toluene), and combine with approximately 3
mL of scintillation cocktail.
Table 2
List of Various Components of a Typical mtFabH Assay
10000
8000
Counts
6000
14C
4000
2000
0
0 20 40 60 80 100 120
Time in minutes
Fig. 3. Linearity of mtFabH activity with time. Enzyme is incubated with substrates
at 37 °C for the specified time, and product formation is quantitated as described above.
4. Notes
1. As acyl CoA substrates are unstable at neutral and higher pH, the solutions are
made in acidic pH (aqueous hydrochloric solutions at pH 3.5) and stored in aliquots
at –80 °C in working volumes (avoiding the need to repeatedly thaw and refreeze
the solutions and the associated increased degradation).
2. Malonyl CoA from this source comes in 1800-μM solution. It is diluted to a final
concentration of 250 μM and stored at –80 °C at pH 3.5. The manufacturer’s
technical data sheet states that under these conditions the rate of decomposition
is approximately 2% over the first six months. A very important factor in this
particular assay is the purity of the commercially available radioactive malonyl CoA.
Radioactive malonyl CoA is prepared by the reaction of monothiophenylmalonate
[malonyl-2-14 C] and coenzyme A, and the [2-14 C] malonyl CoA product is purified
by column chromatography. The radioactive reactant is relatively nonpolar and, if
present in the [2-14 C] malonyl CoA sample, can lead to a high background during
the assay and a substantially reduced signal-to-noise ratio.
212 S. Sachdeva and K. A. Reynolds
3. Divalent cations like Mg2+ and Mn2+ catalyze the decomposition of sodium borohy-
dride (NaBH4 ), preventing effective reduction of the 3-ketoacyl CoA product. Thus,
the use of distilled water free of divalent ions is used in both the assay and the
preparation of the reducing reagent solution (10).
4. Sodium borohydride produces significant effervescence when mixed with aqueous
solutions. There is thus a potential for loss of the radioactive material from the vial at
this point. A screw-cap microcentrifuge tube should be used and tightened carefully
before shaking the sample. Reduction of long-chain acyl CoA is quantitative within
10 min. If inconsistent results are obtained, the reduction reaction can be carried
out for a longer time. The THF in the reducing solution decreases the time required
to quantitatively reduce the acyl thioesters (from 2 h to 10 min) (10). The buffer
can be stored at room temperature, and NaBH4 should be added just before use.
This reduction solution can be used for up to 2 h if kept on ice but potentially can
lead to a loss of consistency with the assay results.
5. The volume of toluene solution increases to about 640 μL due to partitioning of
THF into toluene.
6. Solvents used to deliver inhibitors have a predictable inhibitory effect on the activity
on mtFabH. The effect of various concentrations of dimethylsulfoxide (DMSO) and
methanol is shown in Fig. 4. This figure demonstrates that the concentrations of
solvent should ideally be at or below 1% in the final assay volume. The order of
substrate and inhibitor components can be changed to perform the assays with or
without the enzyme-inhibitor preincubation. While this assay uses malonyl CoA
(with the associated advantages discussed above), it can also be used with MACP.
120
DMSO
100 MeOH
% mtFabH Activity
80
60
40
20
0
0.01 0.1 1 10
% Solvent
References
1.
1 Heath, R. J., White, S. W., and Rock, C. O. (2001) Lipid biosynthesis as a target
for antibacterial agents. Prog. Lipid Res. 40, 467–497.
2.
2 Rock, C. O., and Jackowski S. (2002) Forty years of bacterial fatty acid synthesis.
Biochem. Biophys. Res. Comm. 292(5), 1155–1166.
3.
3 Heath, R. J., White, S. W., and Rock, C. O. (2002) Inhibitors of fatty acid synthesis
as antimicrobial chemotherapeutics. Appl. Microbiol. Biotechnol. 58, 695–703.
4.
4 Nie, Z., Perretta, C., Lu, J., Su, Y., Margosiak, S., Gajiwala, K. S., Cortez, J.,
Nikulin, V., Yager, K. M., Appelt, K., and Chu, S. (2005) Structure-based design,
synthesis, and study of potent inhibitors of -ketoacyl-acyl carrier protein synthase
III as potential antimicrobial agents. J. Med. Chem. 48, 1596–1609.
5.
5 Tsay, J. T., Oh, W., Larson, T. J., Jackowski, S., and Rock, C. O. (1992) Isolation
and characterization of the -ketoacyl-acyl carrier protein synthase III gene (fabH)
from Escherichia coli K-12. J. Biol. Chem. 267, 6807–6814.
6.
6 Scarsdale, J. N., Kazanina, G., He, X., Reynolds, K. A., and Wright, H. T. (2001)
Crystal structure of the Mycobacterium tuberculosis -ketoacyl-acyl carrier protein
synthase III. J. Biol. Chem. 276, 20516–20522.
7.
7 Choi, K. H., Kremer, L., Besra, G. S., and Rock, C. O. (2000) Identification and
substrate specificity of -ketoacyl (acyl carrier protein) synthase III (mtFabH)
from Mycobacterium tuberculosis. J. Biol. Chem. 275, 28201–28207.
8.
8 Brown, A. K., Sridharan, S., Kremer, L., Lindenberg, S., Dover, L. G.,
Sacchettini, J. C., and Besra, G. S. (2005) Probing the mechanism of the
Mycobacterium tuberculosis -ketoacyl-Acyl carrier protein synthase III mtFabH;
factors influencing catalysis and substrate specificity. J. Biol. Chem. 280(37),
32539–32547.
9.
9 Garwin, J. L., Klages, A. L., and Cronan, J. E. Jr. (1980) Structural, enzymatic, and
genetic studies of -ketoacyl-acyl carrier protein synthases I and II of Escherichia
coli. J. Biol. Chem. 255(24), 11949–11956.
10.
10 Barron, E. J., and Mooney, L. A. (1968) Determination of acyl-thiolesters by
gas-liquid chromatography of their sodium borohydride reduction products. Anal.
Chem. 40(11), 1742–1744.
17
Summary
Bacterial signal transduction systems can be used as drug targets. The signal transduction
targets fall into two groups—sensor kinases and response regulators. Previously reported studies
describe hits that were thought to inactivate sensor kinases but on closer examination were
found to act elsewhere instead; a possible reason for this is that full-length sensor kinases are
integral membrane proteins whose activity might reflect interaction with the cell membrane or
with membrane components. We describe a model system that instead is based on the interaction
between a test compound and a response regulator in a homogeneous phase reaction. In this
system, response regulator-DNA complex formation and its inhibition by a test compound are
measured by fluorescence polarization. The model system should be readily adaptable to drug
discovery based on other bacterial two-component s transduction systems.
1. Introduction
Two-component signal transduction (TCST) systems mediate adaptive
changes in bacteria. The key participants are a sensor kinase and a response
regulator. The response regulator protein is phosphorylated by its cognate
activated sensor kinase and acts as transcription factor by binding to the promoter
region of the gene(s) whose function it regulates. For reviews, see the studies
by Hoch and Silhavy (1), Stock et al. (2), and West and Stock (3). Genetic
215
216 M. G. Erickson et al.
studies have shown that several TCST systems are essential for virulence or
infectivity, suggesting that TCST systems may be suitable targets for screening
compounds with anti-infective activity. Examples include (1) Streptococcus
pneumoniae CiaRH (4) and RR489 (5), which control cephalosporin resis-
tance and lung infectivity, respectively; (2) Mycobacterium tuberculosis MtrA,
which is needed for infectivity (6); (3) Listeria monocytogenes CesRK, which
regulates tolerance to ß-lactam antibiotics (7); and (4) Enterococcus faecium
VanRS, which specifies inducible vancomycin resistance (8).
Bacterial antibiotic resistance has become a problem that severely limits the
clinical effectiveness of many of our commonly used antibiotics. One conse-
quence has been the need for new antibiotics, which, in turn, has led to the search
for new drug targets. One example of a group of potential drug targets is the
TCST systems of bacteria. These systems generally consist of a sensor kinase
and its cognate response regulator in which the kinase is associated with the
cell membrane and serves as a specific environmental sensor and, in response to
environmental changes, auto-phosphorylates and transfers its phosphoryl group
to its cognate response regulator. The phosphorylated response regulator, thus
activated, binds to a cognate promoter(s) enhancing transcription of a particular
gene, or group of genes. Several studies (9–14) have reported the discovery of
lead compounds that inhibit kinase activity of TC His kinases. A reevaluation
of these findings later noted some of the compounds as acting at other (unspec-
ified) targets (15). In retrospect, the enzymatic activity of His kinases in vivo
might be affected by (1) perturbing the cell membrane or, alternatively, (2) the
activity of kinase-response regulator pairs might also include cross-talk effects
(see Note 1). Assay development based on the interaction between a response
regulator and its cognate DNA binding site avoids both mitigating circumstances.
We describe a fluorescence polarization assay based on the VanRS TCST
system that regulates vancomycin resistance in Enterococcus faecium. Assay
development utilizing this system has provided a model system that quantifies
the binding between DNA promoter segments and their cognate response
regulator protein. Using the VanRS TCST system, we demonstrate inhibition of
response regulator protein-promoter segment binding with a known inhibitor.
Observed binding constants were comparable to those reported in surface
plasmon resonance measurements and gel shift measurements (16).
2. Materials
2.1. Promoter DNA Fragment
1. 5 -Fluorescein-tagged double-stranded 18-mer oligonucleotide promoter segment
H2 based on the vanH promoter studies of Holman et al. (8) was used (see Fig. 1).
Two-Component Signal Transduction Assays 217
Fig. 1. The vanRS and vanH promoters (R1 and H1 + H2, respectively). Expression
of vanH is upregulated by binding of VanR∼P to H1 + H2. VanR also binds to its
own promoter R1 regulating its own transcription. The promoter segment used in these
studies was based on H2. Coordinates are numbered with respect to both the vanR and
vanH transcription start sites as reported by Holman et al. (8).
The two individual strands, H2 Forward and H2 Reverse, were chemically synthe-
sized, with H2 Forward arbitrarily selected to carry the 5 -fluorescein:
where Z = fluorescein.
2. The two single-stranded samples were dissolved in de-ionized water at a concen-
tration of 8 μM and stored at –20 °C. Prior to use, they were annealed by mixing
equal volumes of the forward and reverse strands and heated in a thermal cycler at
80 °C for 10 min, followed by slow cooling to room temperature.
2.3. Compound A
1. The inhibitory action of compound A (2-(2,3,4-trifluorphenyl)-2,3-
dihydroisothiazole-3-one) (Maybridge Chemical Co., KM-04537) on signal
transduction was originally reported by Roychoudhury et al. (18) as part of a
search for inhibitors of alginate biosynthesis, a virulence factor in Pseudomonas
aeruginosa (see Note 3).
2. Compound A was dissolved at a concentration of 1 mM in water and stored
at –20 °C.
218 M. G. Erickson et al.
3. Methods
3.1. FP Measurements
1. Binding reactions were run in black 384-well black microtiter plates (Corning).
2. All fluorescence polarization experiments were performed using a Model #1420
fluorometer (Wallac, Turku, Finland) with a measurement time of 1 s per well.
Fluorescein was excited at 485 nM, and its emission was measured at 515
nM. Measurements were made at ambient temperature, approximately 25 °C. The
microtiter plate was allowed to equilibrate for 30 min at room temperature prior to
recording fluorescence polarization measurements.
3. The solutions needed to measure GST-VanR-DNA complex formation were
prepared as follows:
a. Gel shift buffer (GSB) was prepared as in Section 2.2.
b. A dilution series GST-VanR in GSB, 20-μL scale, was prepared by seven
successive 3.16-fold dilutions beginning with the highest concentration, 6 μM
(see Fig. 2).
c. Fluoroscein-labeled H2 DNA was dissolved at 130 nM in GSB.
d. 20, 10, and 6 μM stock solution of CpdA in GSB (see Note 4).
4. Using the solution described in Section 3.1.3, the binding reaction contained, in a
volume of 40 μL:
a. GSB sufficient to adjust the total volume to 40 μL.
b. GST-VanR, 20 μL of each dilution in the test series.
c. H2 DNA, 4 μL (see Note 5).
d. Test compound, 4 μL. The highest concentration of CpdA used was 5 μM. Other
compounds should be tested at higher concentrations (see Note 6).
5. The G factor was obtained by collecting parallel and perpendicular components of
fluorescence from a 40-μL sample containing 8 nM of fluorescein in water with
water as the blank. A blank reaction containing 40 μL of 1.0 μM GST-VanR in 1X
GSB was used to obtain a correction factor to subtract from the raw-intensity data.
4. Notes
1. Thus far, TCST sensor kinases have been tested as possible drug targets, but
studies reported to date have failed to produce anti-infective leads (9–14). TCST
kinases may be less suitable targets than their cognate response regulators due to
phosphorylation by a promiscuous kinase from another system or to nonspecific
phosphorylation from small phosphoryl group donors in the cytosolic fraction. This
suggests that pharmacological intervention aimed at response regulators would be
more difficult to circumvent.
2. GSB was used in the gel mobility retardation experiments as described by Ulijasz
et al. (17) at –80 °C.
3. Compound A was shown previously to inhibit phosphoryl transfer from VanS∼P
to VanR by its action on VanR (19). The resultant accumulation of VanS∼P was
reversed by supplementing the reaction mixture with additional VanR, but additional
VanS had no effect.
4. Compound A inhibits the binding of VanR and VanR∼P to its DNA promoter
site. This has been demonstrated by both surface plasmon resonance studies and
agarose gel electrophoresis mobility retardation, suggesting a wider scope of action
involving the VanR protein DNA binding domain as well (17). The regulatory
regions of vanRS and vanHAX contain response-regulator-binding sequences desig-
nated R1, H1, and H2, as shown in Fig. 1.
5. The promoter DNA functionally serves as a surrogate ligand. The effect is allosteric,
unlike other assays that are crafted on the basis of a competitive interaction at the
enzyme active site.
6. As shown in Fig. 2, compound A inhibits the binding of PvanH2 to GST-VanR.
The Kd for the control reaction was 30 nM. This result is comparable to promoter-
response regulator interaction values reported by Mattison and Kenney (20) for the
OmpR bacterial TCST. It is also comparable to the value of 40 nM reported for
the binding of VanR∼P to the vanHAX promoter by gel shift measurement (8), and
to the value of approximately 150 nM reported for the binding of GST VanR∼P
220 M. G. Erickson et al.
to each of the three promoter segments in the previously reported SPR study (16).
Compound A at 1.5, 2.5, and 5.0 μM increased the apparent Kd to 35 nM, 150 nM,
and 500 nM. This compares with the four- to five-fold increase reported for the
apparent Kd for the GST-VanR∼ P promoter segment interactions reported (16).
7. Z’ is a number calculated according to the formula
where SD1 and SD2 are the standard deviations in the experimental and control
values, and μ1 and μ2 are the means of the experimental and control values (21).
A Z value between 0.5 and 1 is considered “an excellent assay.” Assuming a
difference of 150 mP units between the two signals, Fig. 2, we can calculate that
for Z = 0.8, SD1 + SD2 would have to be less than 10.
Acknowledgments
We thank F. M. Hoffmann for access to a fluorometer, supported by the
University of Wisconsin Clinical Cancer Center.
References
1.
1 Hoch, J. A., and Silhavy, T.J. (eds.) (1995) Two-Component Signal Transduction.
ASM Press, Washington, DC.
2.
2 Stock, A. M., Robinson, V. L., and Goudreau, P. N. (2000) Two-component signal
transduction. Ann. Rev. Biochem. 69, 183–215.
3.
3 West, A. H., and Stock, A. M. (2001) Histidine kinases and response regulator
proteins in two component signaling systems. Trends Biochem. Sci. 26, 369–376.
4.
4 Giammarinaro, P., Sicard, M., and Gasc, A. M. (1999) Genetic and physiological
studies of the CiaH-CiaR two-component signal-transducing system involved in
cefotaxime resistance and competence of Streptococcus pneumoniae. Microbiology
145, 1859–1869.
5.
5 Throup, J. P., Koretke, K. K., Bryant, A. P., Ingraham, K. A., Chalker, A. F.,
Ge, Y., Marra, A., Wallis, N. G., Brown, J. R., Holmes, D. J., Rosenberg, M., and
Burnham, M. K. (2000) A genomic analysis of two-component signal transduction
in Streptococcus pneumoniae. Mol. Microbiol. 35, 566–576.
6.
6 Zahrt, T. C., and Deretic, V. (2001) Mycobacterium tuberculosis signal trans-
duction system required for persistent infections. Proc. Natl. Acad. Sci. USA 98,
12706–12711.
7.
7 Kallipolitis, B. H., Ingmer, H., Gahan, C. G., Hill, C., and Sogaard-Andersen, L.
(2003) CesRK, a two-component signal transduction system in Listeria monocy-
togenes, responds to the presence of cell wall-acting antibiotics and affects beta-
lactam resistance. Antimicrob. Agents Chemother. 47, 3421–3429.
Two-Component Signal Transduction Assays 221
8.
8 Holman, T. R., Wu, Z., Wanner, B. L., and Walsh, C. T. (1994) Identification of the
DNA-binding site for the phosphorylated VanR protein required for vancomycin
resistance in Enterococcus faecium. Biochemistry 33, 4625–4631.
9.
9 Barrett, J. F., Goldschmidt, R. M., Lawrence, L. E., Foleno, B., Chen, R.,
Demers, J. P., Johnson, S., Kanojia, R., Fernandez, J., Bernstein, J., Licata, L.,
Donetz, A., Huang, S., Hlasta, D. J., Macielag, M. J., Ohemeng, K., Frechette, R.,
Frosco, M. B., Klaubert, D. H., Whiteley, J. M., Wang, L., and Hoch, J. A. (1998)
Antibacterial agents that inhibit two-component signal transduction systems. Proc.
Natl. Acad. Sci. USA 95, 5317–5322.
10.
10 Barrett, J. F., and Hoch, J. A. (1998) Two-component signal transduction as a
target for microbial anti-infective therapy. Antimicrob. Agents Chemother. 42,
1529–1536.
11.
11 Stephenson, K., and Hoch, J. A. (2002) Two-component and phosphorelay signal
transduction systems as therapeutic targets. Curr. Opin. Pharmacol. 2, 507–512.
12.
12 Kanojia, R. M., Murray, W., Bernstein, J., Fernandez, J., Foleno, B. D., Krause, H.,
Lawrence, L., Webb, G., and Barrett, J. F. (1999) 6-oxa isosteres of anacardic
acids as potent inhibitors of bacterial histidine protein kinase (HPK)-mediated
two-component regulatory systems. Bioorg. Med. Chem. Lett. 9, 2947–2952.
13.
13 Macielag, M. J., Demers, J. P., Fraga-Spano, S. A., Hlasta, D. J., Johnson, S. G.,
Kanojia, R. M., Russell, R. K., Sui, Z., Weidner-Wells, M. A., Werblood, H.,
Foleno, B. D., Goldschmidt, R. M., Loeloff, M. J., Webb, G. C., and Barrett, J. F.
(1998) Substituted salicylanilides as inhibitors of two-component regulatory
systems in bacteria. J. Med. Chem. 41, 2939–2945.
14.
14 Weidner-Wells, M. A., Ohemeng, K. A., Nguyen, V. N., Fraga-Spano, S.,
Macielag, M. J., Werblood, H. M., Foleno, B. D., Webb, G. C., Barrett, J. F., and
Hlasta, D. J. (2001) Amidino benzimidazole inhibitors of bacterial two-component
systems. Bioorg. Med. Chem. Lett. 11, 1545–1548.
15. Hilliard, J. J., Goldschmidt, R. M., Licata, L., Baum, E. Z., and Bush, K. (1999)
15
Multiple mechanisms of action for inhibitors of histidine protein kinases from
bacterial two-component systems. Antimicrob. Agents Chemother. 43, 1693–1699.
16.
16 Smith, E. A., Erickson, M. G., Ulijasz, A. T., Weisblum, B., and Corn, R. M. (2003)
Surface plasmon resonance imaging of transcription factor proteins: Interactions
of bacterial response regulators with DNA Arrays on gold films. Langmuir 19,
1486–1492.
17.
17 Ulijasz, A. T., Kay, B. K., and Weisblum, B. (2000) Peptide analogues of the
VanS catalytic center inhibit VanR binding to its cognate promoter. Biochemistry
39, 11417–11424.
18. Roychoudhury, S., Zielinski, N. A., Ninfa, A. J., Allen, N. E., Jungheim, L. N.,
18
Nicas, T. I., and Chakrabarty, A. M. (1993) Inhibitors of two-component signal
transduction systems: Inhibition of alginate gene activation in Pseudomonas aerug-
inosa. Proc. Natl. Acad. Sci. USA 90, 965–969.
222 M. G. Erickson et al.
19.
19 Ulijasz, A. T., and Weisblum, B. (1999) Dissecting the VanRS signal transduction
pathway with specific inhibitors. J. Bacteriol. 181, 627–631.
20.
20 Mattison, K., and Kenney, L. J. (2002) Phosphorylation alters the interaction of
the response regulator OmpR with its sensor kinase EnvZ. J. Biol. Chem. 277,
11143–11148.
21.
21 Zhang, J. H., Chung, T. D., and Oldenburg, K. R. (1999) A simple statistical
parameter for use in evaluation and validation of high throughput screening assays.
J. Biomol. Screen. 4, 67–73.
22.
22 Erickson, M. G., Ulijasz, A. T., and Weisblum, B. (2005) Bacterial 2-component
signal transduction systems: A fluorescence polarization screen for response
regulator-protein binding. J. Biomol. Screen. 10, 270–274.
18
Summary
Resistance to antibiotics that target the bacterial ribosome is often conferred by methylation at
specific nucleotides in the rRNA. The nucleotides that become methylated are invariably key sites
of antibiotic interaction. The addition of methyl groups to each of these nucleotides is catalyzed
by a specific methyltransferase enzyme. The Erm methyltransferases are a clinically prevalent
group of enzymes that confer resistance to the therapeutically important macrolide, lincosamide,
and streptogramin B (MLSB ) antibiotics. The target for Erm methyltransferases is at nucleotide
A2058 in 23S rRNA, and methylation occurs before the rRNA has been assembled into 50S
ribosomal particles. Erm methyltransferases occur in a phylogenetically wide range of bacteria
and differ in whether they add one or two methyl groups to the A2058 target. The dimethylated
rRNA confers a more extensive MLSB resistance phenotype. We describe here a method using
matrix-assisted laser desorption/ionization (MALDI) mass spectrometry to determine the location
and number of methyl groups added at any site in the rRNA. The method is particularly suited to
studying in vitro methylation of RNA transcripts by resistance methyltransferases such as Erm.
Key Words: rRNA methylation; ribosomal antibiotic resistance; RNA mass spectrometry.
1. Introduction
Many clinically important antibiotics inhibit the growth of bacteria by
blocking protein synthesis on the ribosomes (1–3). These antibiotics bind to
regions of the ribosome that are concerned with essential steps in protein
synthesis such as peptide bond formation, GTP hydrolysis, and mRNA
decoding. The main contact sites for the antibiotics are on the rRNA, rather
than on the ribosomal protein components (4), which is consistent with the
223
224 S. Douthwaite et al.
view that the rRNA carries out the primary functions of the ribosome, including
formation of the peptide bond (5,6). Not surprisingly therefore, changes in
the ribosome structure that confer antibiotic resistance are mainly to be found
in the rRNA and consist of nucleotide methylations or base substitutions (4).
There are indeed cases of ribosomal protein (r-protein) mutations that confer
resistance to ribosome-targeting antibiotics. However, these mutations tend to
confer resistance in an indirect manner by influencing the conformation of
adjacent rRNA structures that make contact with the antibiotic (7,8).
In pathogenic bacteria with multiple rRNA (rrn) operons, resistance to
ribosome-targeting drugs is most commonly conferred through modification
of the rRNA by specific methyltransferase enzymes (9,10). All the rRNA
resistance methyltransferases studied to date use S-adenosyl-L-methionine
(AdoMet) as the methyl group donor and contain conserved motifs involved in
AdoMet binding (11) and have distinct similarity to Rossmann-fold structures
found in proteins that bind other adenosine-based cofactors such as ATP and
NAD (12). In other parts of their structures, the rRNA methyltransferases are
largely heterogeneous, and these differences presumably enable the enzymes
to distinguish their specific target nucleotides.
Target nucleotides in 16S rRNA tend to be methylated after assembly of the
30S subunit. The methyltransferases Grm and KamA function in this manner
by methylating the assembled 30S subunit at nucleotides G1405 and A1408,
respectively, and thereby confer resistance to aminoglycoside antibiotics (13,14)
(Escherichia coli rRNA nucleotide numbering is used throughout). These target
nucleotides are displayed at the decoding region on the subunit interface sites
on the mature 30S subunit (15,16). For methylation to occur, the nucleotides
are not only required to be accessible on the surface of the small subunit, but
also need to be presented in higher-order structures that are absent in the free
16S rRNA. In contrast, the free 23S rRNA is generally the preferred substrate
for methylation prior to its complete assembly with r-proteins to form 50S
subunits. Examples include nucleotide G748, the target for the tylosin resis-
tance methyltransferase RlmAII (TlrB) (17); nucleotide A1067, the target for
the thiostrepton resistance methyltransferase Tsr (18,19); nucleotide A2058, the
target for the MLSB (macrolide, lincosamide, and streptogramin B antibiotic)
resistance methyltransferase Erm (20,21); and nucleotides G2470, U2479, and
G2535 that are respectively targeted by the orthosomycin resistance methyl-
transferases EmtA (22), AviRb, and AviRa (23). In addition to methylating the
free 23S rRNA substrate, these methyltransferases also specifically recognize
their targets within short RNA transcripts, making them ideal for the type of
in vitro studies described here.
MALDI-MS Analysis of RNA Methylation 225
2. Materials
1. Lauria Bertani (LB) broth (32) was used as the rich medium for bacterial cultures.
Single-distilled water was used for media, as well as for gels and running buffers;
double-distilled water was used for all other buffers and solutions.
2. TMN: 50 mM Tris-HCl, pH 7.8, 10 mM MgCl2 , 100 mM NH4 Cl.
3. Buffer A: 20 mM Tris-HCl, pH 7.5, 10 mM MgCl2 , 1 M NH4 Cl, 10% glycerol,
6 mM -mercaptoethanol. Buffer B: 20 mM Tris-HCl, pH 7.5, 10 mM MgCl2 ,
226 S. Douthwaite et al.
Fig. 1. In vitro RNA transcripts representing the peptidyl transferase loop of 23S
rRNA. The structures are based on the E. coli 23S rRNA sequence, although the
majority of nucleotide positions are highly conserved and thus identical in most bacteria
(43). Helices 73, 74, 89, and 90 have been shortened in the in vitro transcripts, and
the missing sequences have been replaced with stable tetraloops (except for helix 89).
The 3´- and 5´-ends of the structures are positioned in helix 89; this ensures that helix
73 will be stably formed and maintain the structure at the target nucleotide A2058. In
structure B, helices 73 and 89 have been shortened further, and the tetraloop capping
helix 74 has been altered to give a unique RNase T1 fragment containing the A2058
target (AAAG). Testing with Erm(E) and Erm(N) shows that RNA structures such as
these, which contain the complete peptidyl transferase loop and most of helix 73, are
methylated as efficiently as intact 23S rRNA.
3. Methods
3.1. Preparation of Erm(E) Methyltransferase
1. Add 0.5 mL of an overnight culture of E. coli cells harboring a plasmid such as
pJEK47 encoding erm(E) (see Notes 1 and 2) to 200 mL of LB broth, containing
100 μg/mL of ampicillin, in a 1 L flask. Shake at 100 rpm in incubator at 37 °C,
and measure the optical density (A450 ) every 30 min. Draw a semi-log curve to
follow the cell growth. Place the cells on ice when they reach an A450 of 0.4. All
the buffers, tubes, and centrifuge rotors should be between 0 °C and 4 °C for the
rest of this section.
2. Harvest the cells by centrifugation at 10,000X g for 10 min in a Beckman JA14 rotor,
or equivalent. Carefully pour off the supernatant. Wash the cells by resuspending
in 200 mL of cold TMN buffer and repeating the centrifugation step. Pour off the
supernatant, and resuspend the cells in 20 mL of TMN buffer. Transfer the cell
suspension to suitably sized polyethylene tubes (JA20 tubes) on ice.
3. The cell walls are lyzed by sonication, keeping the tube on ice. Wear gloves and
ear protection; rinse the sonicator probe with ethanol, and dry before and after
use. Sonicate with four bursts at approximately 150 W for 30 s (with a 30-s pause
between each burst, or longer if the probe begins to heat up).
4. The cell debris is removed by centrifuging at 30,000X g for 10 min. Transfer
the supernatant, containing ribosomes and the Erm(E) methyltransferase, to fresh,
cold JA20 tubes. Centrifuge again, to remove any remains of cell walls and cell
membranes, and transfer the supernatant to cold Ti50 ultracentrifuge tubes. Fill and
balance tubes with cold TMN buffer, and centrifuge at 100,000X g for 3 h at 4
°C in an ultracentrifuge. This, and the following, ultracentrifugation step can be
carried out at 20,000X g overnight if the timing is more convenient (see Note 3).
228 S. Douthwaite et al.
5. Pour off the supernatant. Keep the tubes on ice while redissolving the ribosome
pellets by gentle pipetting in 2.5 mL of buffer A. Allow to stand on ice between 2
and 5 h to wash off the methyltransferase.
6. Centrifuge at 100,000X g for 3 h at 4 °C in Ti50 ultracentrifuge tubes. The ribosomes
will pellet leaving the methyltransferase in the supernatant. Collect the supernatant
and transfer to a dialysis tube. Seal the tube, excluding air. Dialyze against 200 mL
of buffer B in a cold room (4 °C) with stirring; change the buffer every hour (four
times in all).
7. Transfer the dialyzed supernatant to Eppendorf tubes. Pellet the methyltransferase
by spinning at full speed in an Eppendorf centrifuge (15, 0000 to 20, 000 rpm) for
20 min at 4 °C. Remove the supernatant, keep 15 μL for SDS gel analysis, and
discard the rest. Gently redissolve each pellet in 50 μL of buffer C (see Note 3).
Take out a total of 15 μL for SDS gel analysis for size (see Note 2) and purity (see
Note 4). The rest of the methyltransferase can be stored at –20 °C.
at 4 °C. Remove supernatant and wash the pellet with 100 μL of 70% ethanol.
Remove supernatant, dry the pellet, and redissolve in 50 μL of H2 O (see Note
5). The transcript can be checked by running 1 μL on a 10% polyacrylamide gel
alongside RNA markers to give a rough estimation of the transcript concentration
and size. Stain the gel with toluidine blue after the gel run.
positive ions (see Note 15). Spectra can be smoothed and calibrated using the Data
Explorer software supplied with the mass spectrometer (see Note 16).
5. The exact nucleotide position of a modification can be located by tandem mass
spectrometry (23). This can be carried out on a MicroMass MALDI Q-TOF Ultima
mass spectrometer in positive ion mode (see Note 17). Generally, the window for
parent ion selection is set at 2 m/z units, and the collision energy varies between
40 and 100 eV, depending on the mass of the parent ion. When required, spectra
can be smoothed and calibrated using the MassLynx software supplied by the
manufacturer.
4. Notes
1. The entire erm(E) gene from Saccharopolyspora erythraea, the producer of the
macrolide antibiotic erythromycin, has been cloned into R1-derivative plasmids
such as pJEK47 (21) and pJEK48 (33). These plasmids are suitable for expression
of large amounts of active Erm(E) in E. coli.
2. With its overall length of 385 amino acids, Erm(E) is significantly longer than most
other members of the Erm family. Alignments with other Erm methyltransferases
(24,27) show that they are generally 10 to 35 amino acids shorter at their N-termini
and approximately 90 amino acids shorter at their C-termini. In one recombinant
version of Erm(E), expressed from plasmid pSDdiv (26), we removed the C-
terminal 89 amino acids and added a histidine-tag without any apparent loss of
methylation activity (see Note 4).
3. The Erm(E) methyltransferase associates with ribosomes under low- to moderate-
salt conditions (here, up to 100 mM NH4 Cl) and is released by washing with a
high-salt buffer (buffer A with 1 M NH4 Cl) (20,21). The solubility of Erm(E) is
reduced in the absence of monovalent ions (buffer B), but the enzyme becomes
readily soluble again on increasing the salt concentration (buffer C).
4. Fairly high Erm(E) purity (about 80%) is achieved by this procedure. A higher
purity (>95%) can be obtained on Ni-NTA resin (Qiagen) after a histidine-tag has
been added to the C-terminal of Erm(E). The activity of Erm(E) and other orthologs
we have tried, such as Erm(N), remain unaffected by a C-terminal histidine-tag.
However, we observed a reduction in Erm(E) activity with N-terminal tags (34).
5. It is important not to excessively dry nucleic acid pellets, as they can be difficult
to redissolve. DNA and RNA pellets are best dried by removing all visible traces
of 70% ethanol using a micropipette and then leaving the tubes with the lids open
on the bench at ambient temperature for 30 min to allow any remain traces of
ethanol to evaporate.
6. Slightly higher yields of in vitro transcripts can be obtained by extending the
incubation up to a maximum of 16 h (overnight). Longer times yield diminishing
returns, probably due to RNA breakdown.
7. As discussed in the Introduction, members of the Erm family are either mono- or
dimethyltransferases, and addition of two methyl groups to the A2058 target by
MALDI-MS Analysis of RNA Methylation 231
the latter type confers the more severe resistance phenotype. All Erm methyltrans-
ferases have but a single AdoMet binding site, and thus dimethylation proceeds in
a two-step manner (35) requiring recharging of the enzyme with a new cofactor
molecule. Under both in vivo and in vitro conditions, Erm(E) is an extremely
effective dimethyltransferase adding the second methyl group very rapidly, and it
is rare that we find a trace of the monomethylated RNA intermediate. Other Erm
dimethyltransferases we have studied, including the streptococcal Erm(B) (36) and
the mycobacterial Erm(38) (37), are distinctly less efficient at adding the second
methyl group to A2058. The effects of Erm dimethyltransferase inhibitors might
first become evident as an accumulation of monomethylated product. In Fig. 2, we
have used a recombinant version of the monomethyltransferases Erm(N) (histidine-
tagged at the C-terminus; see Note 4) to demonstrate MALDI-MS detection of the
monomethylated product.
8. Potential methyltransferase inhibitors can be added in buffer C, while maintaining
the total volume reaction at 30 μL of buffer C. It will be necessary to stop
reactions at a series of time points if IC50 values of potential inhibitors are to be
estimated.
9. A rapid and accurate estimate of A2058 dimethylation can be obtained by primer
extension with reverse transcriptase (21). Primer extension requires appreciably
less RNA than MALDI mass spectrometry (about 10% the amount) but has the
disadvantage that it cannot detect monomethylation at the N6 of A2058.
10. Masses of the RNase digestion fragments can be calculated using the Mongo
Oligo Mass Calculator (http://www-medlib.med.utah.edu/masspec/mongo.htm).
Digestion products smaller than trinucleotides are unsuited for MALDI time-of-
flight mass spectrometry, because the lower m/z range is crowded with numerous
signals including those from the matrix and buffers (31).
11. The RNase T1 digestion products will predominantly harbor 2´-3´ cyclic
phosphates under the conditions described here. Increasing the digestion time or
enzyme concentration will result in a greater proportion of digestion products with
a 3´-phosphate (31); these are heavier by 18.01 Da (monoisotopic mass).
12. Commercial cartridges ready-packed with reverse-phase chromatography material
are available from various suppliers including Waters (ZipTip cartridges) and
Proxeon (StageTip cartridges).
13. Size fractionation of digestion fragments can be obtained by stepwise elution with
increasing concentrations of acetonitrile (38); all the fragments (Figure 2B and
2C) will be eluted by 25% acetonitrile.
14. Other matrices that yield higher sensitivity and/or resolution have been reported
for oligonucleotide analysis by MALDI mass spectrometry (39,40). However, we
prefer the 3-HPA matrix for this type of application, because it discriminates less
between digestion fragments, i.e., nearly all fragments are detected regardless of
their nucleotide composition or sequence.
232 S. Douthwaite et al.
15. The resolution of the delayed extraction, reflector time-of-flight mass analyzer
is required to resolve the approximately 1 Da mass difference between U- and
C-nucleotides. The instrument may also be operated in negative ion mode with
(a)
Fig. 2. (continued)
MALDI-MS Analysis of RNA Methylation 233
Fig. 2. (a) MALDI mass spectrum of fragments derived from RNase A digestion
of structure A (Fig. 1). The fragment containing the A2058 target nucleotide
(GGAAAGAC) runs at m/z 2675.40 (monoisotopic mass; see expanded region in box,
and Note 18). Detection of a single methyl group is illustrated by the new signal 14
Da larger that appears in samples treated with the monomethyltransferase Erm(N);
the methylation reaction with Erm(N) was stopped before it had run to completion.
(b) Theoretical monoisotopic masses of the singly protonated RNase A fragments match
the empirical masses to within 0.1 Da (see Note 10). All digestion fragments have
5´-OH and 3´-phosphate unless otherwise noted. The 94-101 fragment (italics) corre-
sponds to the 23S rRNA nucleotides 2056 to 2063 and harbors the Erm target at A2058.
(c) Theoretical monoisotopic masses of the singly protonated RNase T1 fragments
derived from structure B (Fig. 1). The AAAG fragment at 83-86 (italics) corresponds
to 23S rRNA nucleotides 2058 to 2061. This fragment is unique in structure B (but not
in structure A) and gives a better resolved and more intense MS peak than the larger
RNase A fragment containing nucleotide A2058.
c- and y-type; for the nomenclature of nucleic acid fragment ions, see McLuckey
et al. (42).
18. The natural isotopic distribution of 12 C and 13 C (approximately 99:1) leads to
multiple signals at 1 Da increments, and this is visible upon closer inspection
of the MS peaks. The multiplicity is more pronounced for larger oligonucleotide
fragments due to the binomial distribution of the carbon isotopes.
Acknowledgments
We thank Birte Vester and Lykke Haastrup Hansen for discussions. Support
from the Danish Research Agency (FNU Grants #21-04-0505 and #21-04-
0520), the Nucleic Acid Center of the Danish Grundforskningsfond, and CDC
funds are gratefully acknowledged.
References
1.
1 Gale, E. F., Cundliffe, E., Reynolds, P. E., Richmond, M. H., and Waring, M. J.
(1981) The Molecular Basis of Antibiotic Action. John Wiley and Sons, London.
2.
2 Vázquez, D. (1979) Inhibitors of Protein Biosynthesis. Springer-Verlag, Berlin.
3.
3 Poehlsgaard, J., and Douthwaite, S. (2005) The bacterial ribosome as a target for
antibiotics. Nat. Rev. Microbiol. 3, 870–881.
4.
4 Cundliffe, E. (1990) Recognition sites for antibiotics within rRNA. In The
Ribosome: Structure, Function and Evolution (W. E. Hill, A. Dahlberg, R. A.
Garrett, P. B. Moore, D. Schlessinger, and J. R.Warner, eds.). American Society
for Microbiology, Washington DC, pp. 479–490,
5.
5 Green, R., and Noller, H. F. (1997) Ribosomes and translation. Ann. Rev. Biochem.
66, 679–716.
6.
6 Nissen, P., Hansen, J., Ban, N., Moore, P. B., and Steitz, T. A. (2000) The structural
basis of ribosome activity in peptide bond synthesis. Science 289, 920–930.
7.
7 Gregory, S. T., and Dahlberg, A. E. (1999) Erythromycin resistance mutations in
ribosomal proteins L22 and L4 perturb the higher order structure of 23S ribosomal
RNA. J. Mol. Biol. 289, 827–834.
8.
8 Gabashvili, I. S., Gregory, S. T., Valle, M., Grassucci, R., Worbs, M., Wahl, M. C.,
Dahlberg, A. E., and Frank, J. (2001) The polypeptide tunnel system in the
ribosome and its gating in erythromycin resistance mutants of L4 and L22. Mol.
Cell 8, 181–188.
9.
9 Vester, B., and Douthwaite, S. (2001) Macrolide resistance conferred by base
substitutions in 23S rRNA. Antimicrob. Agents Chemother. 45, 1–12.
10.
10 Douthwaite, S., Fourmy, D., and Yoshizawa, S. (2005) Nucleotide methylations in
rRNA that confer resistance to ribosome-targeting antibiotics. In Fine-Tuning of
RNA Functions by Modification and Editing (H. Grosjean, ed.), Vol. 12. Springer,
New York, pp. 287–309.
MALDI-MS Analysis of RNA Methylation 235
11.
11 Kagan, R. M., and Clarke, S. (1994) Widespread occurrence of three motifs in
diverse S-adenosylmethionine-dependent methyltransferases suggests a common
structure for these enzymes. Arch. Biochem. Biophys. 310, 417–427.
12.
12 Schubert, H. L., Blumenthal, R. M., and Cheng, X. (2003) Many paths to methyl-
transfer: A chronicle of convergence. Trends Biochem. Sci. 28, 329–335.
13.
13 Skeggs, P. A., Thompson, J., and Cundliffe, E. (1985) Methylation of 16S
ribosomal RNA and resistance to aminoglycoside antibiotics in clones of Strepto-
myces lividans carrying DNA from Streptomyces tenjimariensis. Mol. Gen. Genet.
200, 415–421.
14.
14 Thompson, J., Skeggs, P. A., and Cundliffe, E. (1985) Methylation of 16S
ribosomal RNA and resistance to the aminoglycoside antibiotics gentamicin and
kanamycin determined by DNA from the gentamicin-producer, Micromonospora
purpurea. Mol. Gen. Genet. 201, 168–173.
15.
15 Wimberly, B. T., Brodersen, D. E., Clemons, W. M. J., Morgan-Warren, R. J.,
Carter, A. P., Vonrhein, C., Hartsch, T., and Ramakrishnan, V. (2000) Structure
of the 30S ribosomal subunit. Nature 407, 327–339.
16.
16 Schlünzen, F., Tocilj, A., Zarivach, R., Harms, J., Gluehmann, M., Janell, D.,
Bashan, A., Bartels, H., Agmon, I., Franceschi, F., and Yonath, A. (2000) Structure
of functionally activated small ribosomal subunit at 3.3 Angstroms resolution. Cell
102, 615–623.
17.
17 Liu, M., Kirpekar, F., van Wezel, G. P., and Douthwaite, S. (2000) The tylosin
resistance gene tlrB of Streptomyces fradiae encodes a methyltransferase that
targets G748 in 23S rRNA. Mol. Microbiol. 37, 811–820.
18.
18 Thompson, J., Schmidt, F., and Cundliffe, E. (1982) Site of action of a
ribosomal RNA methylase conferring resistance to thiostrepton. J. Biol. Chem. 257,
7915–7917.
19.
19 Bechthold, A., and Floss, H. G. (1994) Overexpression of the thiostrepton-
resistance gene from Streptomyces azureus in Escherichia coli and characterization
of recognition sites of the 23S rRNA A1067 2’-methyltransferase in the guanosine
triphosphatase center of 23S ribosomal RNA. Eur. J. Biochem. 224, 431–437.
20.
20 Skinner, R., Cundliffe, E., and Schmidt, F. J. (1983) Site of action of a ribosomal
RNA methylase responsible for resistance to erythromycin and other antibiotics.
J. Biol. Chem. 258, 12702–12706.
21.
21 Vester, B., and Douthwaite, S. (1994) Domain V of 23S rRNA contains all the
structural elements necessary for recognition by the ErmE methyltransferase. J.
Bacteriol. 176, 6999–7004.
22.
22 Mann, P. A., Xiong, L., Mankin, A. S., Chau, A. S., Mendrick, C. A.,
Najarian, D. J., Cramer, C. A., Loebenberg, D., Coates, E., Murgolo, N. J.,
Aarestrup, F. M., Goering, R. V., Black, T. A., Hare, R. S., and McNicholas, P. M.
(2001) EmtA, a rRNA methyltransferase conferring high-level evernimicin resis-
tance. Mol. Microbiol. 41, 1349–1356.
236 S. Douthwaite et al.
23.
23 Treede, I., Jakobsen, L., Kirpekar, F., Vester, B., Weitnauer, G. A. B., and
Douthwaite, S. (2003) The avilamycin resistance determinants AviRa and AviRb
methylate 23S rRNA at the guanosine 2535 base and the uridine 2479 ribose. Mol.
Microbiol. 49, 309–318.
24.
24 Weisblum, B. (1995) Erythromycin resistance by ribosome modification.
Antimicrob. Agents Chemother. 39, 577–585.
25.
25 Zalacain, M., and Cundliffe, E. (1990) Methylation of 23S ribosomal RNA due to
carB, an antibiotic-resistance determinant from the carbomycin producer, Strepto-
myces thermotolerans. Eur. J. Biochem. 189, 67–72.
26.
26 Liu, M., and Douthwaite, S. (2002) Activity of the ketolide antibiotic telithromycin
is refractory to Erm monomethylation of bacterial rRNA. Antimicrob. Agents
Chemother. 46, 1629–1633.
27.
27 Roberts, M. C., Sutcliffe, J., Courvalin, P., Jensen, L. B., Rood, J., and Seppälä,
H. (1999) Nomenclature for macrolide and macrolide-lincomycin-streptogramin B
resistance determinants. Antimicrob. Agents Chemother. 43, 2823–2830.
28.
28 Champney, W. S., Chittum, H. S., and Tober, C. L. (2003) A 50S ribosomal subunit
precursor particle is a substrate for the ErmC methyltransferase in Staphylococcus
aureus cells. Curr. Microbiol. 46, 453–460.
29.
29 Vester, B., Nielsen, A. K., Hansen, L. H., and Douthwaite, S. (1998) ErmE
methyltransferase recognition elements in RNA substrates. J. Mol. Biol. 282,
255–264.
30.
30 Kovalic, D., Giannattasio, R. B., Jin, H. J., and Weisblum, B. (1994) 23S rRNA
domain V, a fragment that can be specifically methylated in vitro by the ErmSF
(TlrA) methyltransferase. J. Bacteriol. 176, 6992–6998.
31.
31 Kirpekar, F., Douthwaite, S., and Roepstorff, P. (2000) Mapping posttranscrip-
tional modifications in 5S ribosomal RNA by MALDI mass spectrometry. RNA 6,
296–306.
32. Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular Cloning:
32
A Laboratory Manual. Cold Spring Harbor Press, Cold Spring Harbor,
New York.
33.
33 Vester, B., Hansen, L. H., and Douthwaite, S. (1995) The conformation of 23S
rRNA nucleotide A2058 determines its recognition by the ErmE methyltransferase.
RNA 1, 501–509.
34.
34 Vilsen, I. D., Vester, B., and Douthwaite, S. (1999) ErmE methyltransferase rocog-
nizes features of the primary and secondary structure in a motif within domain V
of 23S rRNA. J. Mol. Biol. 286, 365–374.
35.
35 Denoya, C., and Dubnau, D. (1989) Mono- and dimethylating activities and kinetic
studies of the ermC 23 S rRNA methyltransferase. J. Biol. Chem. 264, 2615–2624.
36.
36 Douthwaite, S., Jalava, J., and Jakobsen, L. (2005) Ketolide resistance in Strepto-
coccus pyogenes correlates with the degree of rRNA dimethylation by Erm. Mol.
Microbiol. 58, 613–622.
MALDI-MS Analysis of RNA Methylation 237
37.
37 Madsen, C. T., Jakobsen, L., and Douthwaite, S. (2005) Mycobacterium smegmatis
Erm(38) is a reluctant dimethyltransferase. Antimicrob. Agents Chemother. 49,
3803–3809.
38.
38 Mengel-Jorgensen, J., Jensen, S. S., Rasmussen, A., Poehlsgaard, J., Iversen, J. J.,
and Kirpekar, F. (2006) Modifications in Thermus thermophilus 23S ribosomal
RNA are centered in regions of RNA-RNA contact. J. Biol. Chem. 281, 22108–
22117.
39.
39 Asara, J. M., and Allison, J. (1999) Enhanced detection of oligonucleotides in UV
MALDI MS using the tetraamine spermine as a matrix additive. Anal. Chem. 71,
2866–2870.
40.
40 Zhu, Y. F., Chung, C. N., Taranenko, N. I., Allman, S. L., Martin, S. A.,
Haff, L., and Chen, C. H. (1996) The study of 2,3,4-trihydroxyacetophenone and
2,4,6-trihydroxyacetophenone as matrices for DNA detection in matrix-assisted
laser desorption/ionization time-of-flight mass spectrometry. Rapid Comm. Mass
Spectrom. 10, 383–388.
41.
41 Kirpekar, F., and Krogh, T. N. (2001) RNA fragmentation studied in a matrix-
assisted laser desorption/ionisation tandem quadrupole/orthogonal time-of-flight
mass spectrometer. Rapid Comm. Mass Spectrom. 15, 8–14.
42.
42 McLuckey, S. A., Van Berkel, G. J., and Glish, G. L. (1992) Tandem mass
spectrometry of small multiply charged oligonucleotides. J. Amer. Soc. Mass
Spectrom. 3, 60–70.
43.
43 Cannone, J. J., Subramanian, S., Schnare, M. N., Collett, J. R., D’Souza, L. M.,
Du, Y., Feng, B., Lin, N., Madabusi, L. V., Müller, K. M., Pande, N., Shang, Z.,
Yu, N., and Gutell, R. R. (2002) The Comparative RNA Web (CRW) Site: An
online database of comparative sequence and structure information for ribosomal,
intron, and other RNAs. BMC Bioinformatics 3, 2.
19
Summary
The ability, either innate or acquired, to produce -lactamases, enzymes capable of
hydrolyzing the endocyclic peptide bond in -lactam antibiotics, would appear to be a primary
contributor to the ever-increasing incidences of resistance to this class of antibiotics. To date,
four distinct classes, A, B, C, and D, of -lactamases have been identified. Of these, enzymes in
classes A, C, and D utilize a serine residue as a nucleophile in their catalytic mechanism while
class B members are Zn2+ -dependent for their function. Efforts have been and still continue to
be made toward the development of potent inhibitors of these enzymes as a means to ensure the
efficacy of -lactam antibiotics in clinical medicine. This chapter concerns procedures for the
evaluation of the catalytic activity of -lactamases as a means to screen compounds for their
inhibitory potency.
1. Introduction
-Lactam antibiotics constitute a major class of chemotherapeutic agents
currently employed in the treatment of diseases of bacterial origin. This
family of antibiotics comprises penicillins and cephalosporins, derived from
6-aminopenicillanic acid (6APA) and 7-aminocephalosporanic acid, respec-
tively, as well as oxacephems, carbapenems, and monobactams. Structures of
some of these -lactam antibiotics are shown in Fig. 1.
Innate features of oral bioavailability, low toxicity, and high efficacy have
contributed to the widespread use of these antibiotics in clinical medicine.
239
240 T. Viswanatha et al.
O O
N N
H H H H H H
N N Cl N
S Me S Me S Me
O O O
N Me N Me N Me
O O O
CO2 CO2 CO2
Penicllin G Oxacillin Cloxacillin
(Penam) (Penam) (Penam)
H O
OH OH
H HN H
Me NH2 Me NMe2
+
S S NH2
N N +
O O
CO2 CO2
Imipenem Meropenem
(Carbapenem) (Carbapenem)
S H OMe H H OMe H
N N
S HO O
Me
O O
N O NH2 N S N
O O N
CO2 O CO2 N N
Cefoxitin Moxalactam
(Cephamycin) (7-α-methoxy oxacephem)
N OMe CO2
H2N N H H3C
H CH3
N
S S
O O
N N
N H2N N
O O
CO2 Me Aztreonam
Cefepime S CH3
HN (Monobactam)
(Cephalosporin)
N
O SO3
H H O2 H O2
O OH S S N
N N
N N N
O O O
CO2H CO2H CO2H
O
O
R NH
R NH H2O O S
S
β-lactamase + H
N O HN
O
CO2 CO2
penicillin (antibiotic) penicilloic acid (devoid of antibiotic activity)
O
O H
N S H2 O R NH
R O S
N X β-lactamase + H
O O HN X
CO2
CO2
as an acid by virtue of the newly formed carboxylic acid function (see Fig. 3).
This aspect has provided the basis for such assay techniques as (a) alkali-metric
titration with the aid of a pH-stat (25), (b) acidimetric analysis involving the
use of an indicator such as phenol red or bromocresol purple (26), and (c)
manometric assay procedure (27); (2) its ability to function as a reducing agent
and thus forming the basis for iodometric analytical procedures (28,29); and (3)
the absence of antibiotic activity, the basis for the development of biological
assay techniques (30,31). The protocols and the related details of these proce-
dures have been documented (32). The relative merits of some of these methods
have been assessed (33).
The direct methods, on the other hand, exploit the difference between the
substrate and its product with regard to their UV-visible spectra. The -
lactamase catalyzed reaction is usually monitored by following the change
in absorbance at the wavelength where the difference in the molar absorp-
tivity, M , is maximal or near the maximum value. This approach, which
was initially employed to monitor the -lactamase catalyzed hydrolysis of
cephalosporins (34), has been extended to studies with penicillins as substrates
(35,36). The introduction of chromogenic -lactam substrates such as nitro-
cefin (37), CENTA (38), mCPP (39), PADAC (40), and FAP (6--furylacry-
loylamidopenicillanic acid) (41) has allowed for spectrophotometric assays to
be performed in the visible spectral region, a feature that allows for circum-
S H H
H H H
N N
S Me S
NO2
O O
N N
Me O
O
CO2 CO2
Nitrocefin NO2
Penicllin G
S S NH
H H H H H H O O
N N
S S
O O O
N N N S
O O
CO2 N CO2
PADAC N CENTA NO2 CO2
CO2
Depsipeptide Substrate
N
H3C CH3
venting the problems arising from the high absorbance of most of the substrates
in the UV spectral region. The structures of these substrates are shown
in Fig. 4.
2. Materials
2.1. Buffers
1. 100 mM of acetate, pH 4.5–5.5.
2. 50 mM of phosphate, pH 6.0–7.5.
3. 50 mM of HEPES (N-(2-hydroxyethyl)piperazine-N´-2-ethane sulfonic acid), pH
6.0–7.5.
4. AMT buffer system (42): 50 mM of acetic acid, 50 mM of MES (2-(N-morpholino)-
ethane sulfonic acid), and 100 mM of Tris (tris(hydroxymethyl)aminomethane), pH
4.5–9.0 (see Note 1).
2.2. Substrates
The chromophoric -lactams, nitrocefin (37) and CENTA (38), are the
substrates of choice by virtue of their attractive features that allow for a rapid
and reliable spectrophotometric assay procedure for monitoring the activity of
-lactamases. The particulars regarding the use of nitrocefin, the most widely
used substrate, are provided below:
1. Nitrocefin: A stock solution (2 mM) is prepared by dissolving 10.3 mg of nitrocefin
in 0.5 mL of DMSO (dimethyl sulfoxide) and subsequently adding 25 mM HEPES
buffer, pH 7.3, or other desired buffer to a final volume of 10 mL. This nitrocefin
stock solution (DMSO 5% v/v) is stable for several weeks when stored at 4 °C.
2. CENTA: A stock solution (1 mM) is prepared by dissolving 5.4 mg in 10 mL of 25
mM HEPES, pH 7.3, or other desired buffer. This CENTA stock solution is stable
for several days when stored at 4 °C.
3. Benzyl penicillin (Pen G): In instances when Pen G is used as a substrate, a
stock solution (10 mM) of this substrate is prepared by dissolving 37 mg of
benzyl penicillin (potassium salt) in 10 mL of the desired buffer (see Note 2).
Despite the drawback of requiring the use of low-wavelength measurements, assays
employing Pen G do have the advantage of low cost and still find significant use in
this area.
2.3. Enzyme
-lactamase (stock) solutions (0.4–1.0 μM) can be stored at –20 °C without
adverse effect on the catalytic activity of the protein (see Note 3). However,
they are prone to inactivation when subjected to repeated freezing and thawing.
Assays for -Lactamase Activity and Inhibition 245
Table 1
Published Procedures for the Isolation and Purification of Some
Representative -Lactamases
A BcI, 44
TEM-1 45
B IMP-1 43
BcII 44
CcrA 46
VIM-2 47
L1 48
C P99 49
D Oxa 10 50
BcI, Bacillus cereus 569H (type I); TEM, class A -lactamases named after the
patient (Temoneira) providing the first sample; in the early literature also termed
RTEM or R-TEM to emphasize its R plasmid origin; IMP-1, plasmid-encoded
class B -lactamases active on imipenem. Pseudomonas aeruginosa 101/477 (most
common in Japan); BcII, Bacillus cereus 569H (type II); CcrA, Bacteriodes fragilis
TAL636 (Cefoxitin and carbapenem resistant); VIM 1, Verona integron-encoded
metallo--lactamase. Pseudomonas aeruginosa VR-143/97 (most common in Taiwan,
Verona; L1, Labile enzyme from Stenotrophomonas (Pseudomonas, Xanthomonas)
maltophilia; P99, chromosomal -lactamase from Enterobacter cloacae P99; Oxa 10,
class D -lactamases active on oxacillin (Acinetobacter species).
between 20 and 60 s. The total absorbance change is less than 1.0 OD in order to
ensure compliance with Beer’s law.
11. Grafit 4.0 for IC50 determination.
3. Methods
As noted in Section 1, -lactamases, identified to date, fall into four distinct
categories, classes A, B, C, and D. The requirement(s) for the optimal expression
of catalytic function, as is to be expected, may depend on the class of -lactamase
under investigation. Information concerning such specific requirement(s) is
provided in the sections pertaining to the assay procedures for the different
types of -lactamases. Given below are the details of items that are common
to all the procedures regardless of the class or type of enzymes under study.
M -values are used: –2,500 M−1 cm−1 and +6,400 M−1 cm−1 at 346 nm and
405 nm, respectively (see Note 5).
The reaction was initiated by the addition of an aliquot (50 μL) of nitrocefin stock.
The final concentrations of the substrate, enzyme, and BSA, in a reaction mixture
of 1 mL, were 100 μM, 4 nM, and 1 μg/mL, respectively (see Note 6). The progress
of the reaction was monitored by recording the increase in the absorbance at 482
nm. Estimates of the steady-state kinetic parameters (KM and kcat ) for the hydrolysis
of the substrate are achieved by fitting the initial velocity data to the Michaelis–
Menten equation with the aid of Grafit 4.0 (Erithacus Software Ltd, Stains, UK).
A M -value of 15,900 M−1 cm−1 at 482 nm for nitrocefin hydrolysis (54) is used
for the determination of the kcat -value.
E Zn + C E Zn C E + Zn C or E∗ Zn C
Fig. 6. Common metal chelators. (a) Structures of DPA (dipicolinic acid); (b) OP (o-
phenanthroline); (c) PAR (4-(2-pyridylazo)resorcinol); (d) EDTA (ethylenediaminete-
traacetic acid); (e) TPEN (N,N,N ,N -tetrakis(2-pyridylmethyl)ethylenediamine); (f) and
Zincon. (Reprinted from (60) with permission from Elsevier.)
Table 2
Ingredients in Control and Test
482 nm. The average of the two determinations (from the reactions in the corre-
sponding wells in the columns 2 and 3 of the microtiter plate) is used to determine
percent activity relative to the rate in control 2 (see Note 7). IC50 values can be
determined by fitting each inhibition data set to the IC50 -2 parameter equation of
Grafit 4.0 (Erithacus Software Ltd., Staines, UK) by nonlinear regression analysis.
Hydrophilic
group O
HN
S
N S
O
Hydrophobic,
CO2 potential
gelation agent
β−lactamase
Hydrophilic
group O
HN HS
S
Hydrophobic,
Activated
N +
gelation agent
O
O
CO2
Self assembly
H2O
Hydrogel formation
4. Notes
1. This buffer system provides a constant ionic strength of ∼0.1 over the pH range
of 4.5–9.0 and is useful in pH optimum determinations. It is pertinent to note the
following limitation(s) of the medium. MES can exert inhibitory action on class B
-lactamases, as in the CcrA (63), although no adverse effect was observed in the
case of IMP-1 (54). And Tris, the third component of the buffer system, being a
good nucleophile at high pH, may interfere in the assay procedures of class A, C,
and D -lactamases, which operate via an acylenzyme intermediate in their catalytic
mechanism (64).
2. Pen G solutions at pH ≥ 6.0 are prone to undergo hydrolysis even when stored at
4 °C. The hydrolysis of Pen G is accompanied by a M -value of -1100 M−1 cm−1 at
232 nm. The deviation from this value in the assay is a reflection of the breakdown
of the substrate during storage. Substrate preparations standing for more than 1 h
at 4 °C should be replaced by freshly prepared stock solutions.
3. In the case of metallo--lactamases, stock solutions of the enzyme are prepared in
buffer medium (other than phosphate) containing 100 μM of ZnCl2 and 100 μg/mL
of BSA to minimize the denaturation of the protein.
4. The pH of the buffer increases upon standing due to loss of the bicarbonate. Buffer
is to be replaced by a fresh preparation after 4–6 h.
5. In the case of CENTA as substrate, the reaction can be monitored either at 346
nm or at 405 nm. The increase in the absorbance at 405 nm accompanying the
hydrolysis of CENTA is due to the formation of 2-nitrothiobenzoate (NTB− ) anion,
an outcome of the propensity of the primary product of the reaction to undergo the
relevant elimination event. The M -values of 6,400 M−1 cm−1 (38) and ≈8,000
M−1 cm−1 (65) reported in the studies with CENTA as substrate are considerably
lower than the M -values reported (66,67).
6. BSA at the concentration present in the enzyme stock protects the enzyme from
denaturation. At the concentration present in the reaction mixture, it does not
interfere with the catalytic function of -lactamase but, by its protective action,
ensures the reaction’s progress is linear with time.
7. Some DMSO preparations have been found to exert strong inhibitory action even
when present at a concentration as low as 1% (v/v) in the reaction mixture. DMSO
256 T. Viswanatha et al.
preparations should be checked for this feature, and only those without such adverse
effects should be chosen for use in the studies and kept under argon at 4 °C. In these
studies, a DMSO preparation with no such adverse effect (the difference between
the activity in control 1 and that in control 2 does not exceed 10%) is used.
References
1 Knowles, J. R. (1985) Penicillin resistance—The chemistry of -lactamase
1.
inhibition. Acc. Chem. Res. 18, 97–104.
2.
2 Livermore, D. M., and Wooford, N. (2006) The -lactamase threat in Enterobac-
teriacae, Pseudomonas and Acinetobacter. Trends Microbiol. 9, 413–420.
3.
3 Payne, D. J., Du, W., and Bateson, J. H. (2000) -Lactamase epidemiology and
the utility of established and novel -lactamase inhibitors. Expert Opin. Invest.
Drugs 9, 247–261.
4.
4 Fisher, J. F., Meroueh, S. O., and Mobashery, S. (2005) Bacterial resistance to -
lactam antibiotics: Compelling opportunism, compelling opportunity. Chem. Rev.
105, 395–424.
5.
5 Walsh, C. (2000) Molecular mechanisms that confer antibacterial drug resistance.
Nature 406, 775–781.
6.
6 Martinez, J. L., and Baquero, F. (2000) Mutation frequencies and antibiotic resis-
tance. Antimicrob. Agents Chemother. 44, 1771–1777.
7.
7 Helfand, M. S., and Bonomo, R. A. (2003) -lactamases: A survey of protein
diversity. Curr. Drug Targets-Infect. Disord. 3, 9–23.
8.
8 Matagne, A., Dubos, A., Galleni, M., and Frère, J. M. (1999) The -lactamase
cycle: A tale of selective pressure and bacterial ingenuity. Nat. Prod. Rep. 16,
1–19.
9.
9 Page, M. I., and Laws, A. P. (1998) The mechanism of catalysis and the inhibition
of -lactamases. Chem. Comm. 16, 1609–1617.
10.
10 Rasmussen, B. A., and Bush, K. (1997) Carbapenem-hydrolyzing -lactamases.
Antimicrob. Agents Chemother. 41, 223–232.
11.
11 Sykes, R. B., Bonner, D. P., Bush, K., and Georgopapadakou, N. H. (1982)
Aztreonam (SQ.26,776) a synthetic monobactam specifically active against Gram-
negative bacteria, Antimicrob. Agents Chemother. 21, 85–92.
12.
12 Fisher, J., Charnas, R., and Knowles, J. R. (1978) Kinetic studies on the inacti-
vation of Escherichia coli RTEM -lactamase by clavulanic acid. Biochemistry 17,
2180–2184.
13.
13 English, A. R., Retsema, J. A., Girard, A. E., Lynch, J. E., and Barth, W. E. (1978)
CP-45,899, a -lactamase inhibitor that extends the antibacterial spectrum of -
lactams: Initial bacteriological characterization. Antimicrob. Agents Chemother.
14, 414–419.
14.
14 Micetich, R. G., Maiti, S. N., Spevak, P., Hall, T. W., Yamabe, S., Ishida, N.,
Tanaka, M., Yamazaki, T., Nakai, A., and Ogawa, K. (1987) Synthesis and
Assays for -Lactamase Activity and Inhibition 257
28.
28 Grove, D. C., and Randall, W. A. (1955) Assay methods of antibiotics. A laboratory
manual Medical Encyclopedia, New York, p. 16.
29.
29 Perret, C. J. (1954) Iodometric assay of penicillinase. Nature, 174, 1012–1013.
30.
30 Masuda, G. (1976) Studies on bactericidal activities of -lactam antibiotics on
agar plates: The correlation with the antibacterial activities determined by the
conventional methods. J. Antibiot. 29, 1237–1240.
31.
31 McGhie, D., Clarke, P. D., Johnson, T., and Hutchison, J. G. P. (1977) Detection
of -lactamase activity of Haemophilus influenzae. J. Clin. Path. 30, 585–587.
32. Sykes, R. B., and Mathew, M. (1979) Detection and immunology of -lactamases.
32
In -Lactamases (J. M. T. Hamilton-Smith and J. T. Smith, eds.). Academic Press
Ltd., London, pp. 17–49.
33.
33 Lucas, T. J. (1979) An evaluation of 12 methods for the demonstration of penicil-
linase. J. Clin. Pathol. 32, 1061–1065.
34.
34 O’Callaghan, C. H., Muggleton, P. W., and Ross, G. W. (1968) Effects of
-lactamase from gram-negative organisms on cephalosporins and penicillins.
Antimicrob. Agents Chemother. 8, 57–63.
35.
35 Samuni, A. (1975) A direct spectrophotometric assay and determination of
Michaelis constants for the -lactamase reaction. Anal. Biochem. 63, 17–26.
36.
36 Waley, S. G. (1974) A spectrophotometric assay of -lactamase action on
penicillins. Biochem. J. 139, 789–790.
37. O’Callaghan, C. H., Morris, A., Kirby, S., and Shingler, A. H. (1972) Novel method
37
for detection of -lactamases by using a chromogenic cephalosporin substrate.
Antimicrob. Agents Chemother. 1, 283–288.
38.
38 Bebrone, C., Moali, C. Mahy, F., Rival, S., Docquier, J. D., Rossolini, G. M.,
Fastrez, J., Pratt, R. F., Frère, J. M., and Galleni, M. (2001) CENTA as a
chromogenic substrate for studying -lactamases. Antimicrob. Agents Chemother.
45, 1868–1871.
39.
39 Perumal, S. K., and Pratt, R. F. (2006) Synthesis and evaluation of ketophosph
(on)ates as -lactamase inhibitors. J. Org. Chem. 71, 4778–4785.
40.
40 Jones, R. N., Wilson, H. W., and Novick, W. J. Jr. (1982) In vitro evaluation
of pyridine-2-azo-p-dimethylaniline cephalosporin, a new diagnostic chromogenic
reagent, and comparison with nitrocefin, cephacetrile, and other -lactam
compounds. J. Clin. Microbiol. 15, 677–683.
41.
41 Durkin, J. P., Dmitrienko, G. I., and Viswanatha, T. (1977) N-(2-Furyl) acryloyl
penicillin: A novel compound for the spectrophotometric assay of -lactamase I.
J. Antibiot. 30, 883–885.
42.
42 Ellis, K. J., and Morrison, J. F. (1982) Buffers of constant ionic strength for
studying pH dependent processes. Methods Enzymol. 87, 405–426.
43.
43 Laraki, N., Franceschini,N., Rossolini,G. M., Santucci,P., Meunier, C., de
Pauw, E., Amicosante,G., Frère, J. M., and Galleni, M. (1999) Biochemical charac-
terization of the Pseudomonas aeruginosa 101/1477 metallo-ß-lactamase IMP-1
produced by Escherichia coli. Antimicrob. Agents Chemother. 43(4), 902–906.
Assays for -Lactamase Activity and Inhibition 259
44.
44 Kuwabara, S. (1970) Purification and properties of two extracellular -lactamases
from Bacillus cereus 569/H. Biochem. J. 118, 457–465.
45.
45 Mathonet, P., Deherve, J., Soumillion, P., and Fastrez, J. (2006) Active TEM-1
mutants with random peptides inserted in three contiguous surface loops. Protein
Sci. 15, 2323–2334.
46.
46 Toney, J. H., Wu, J. K., Overbye, K. M., Thompson, C. M., and Pompliano, D. L.
(1997) High-yield expression, purification, and characterization of active, soluble
Bacteroides fragilis metallo-beta-lactamase, CcrA. Protein Expr. Purification 9(3),
355–362.
47.
47 Poirel, L., Naas,T., Nicolas,D., Collet,L., Bellais,S., Cavallo,J.-D., and
Nordmann, P. (2000) Characterization of VIM-2, a carbapenem-hydrolyzing
metallo-beta-lactamase and its plasmid- and integron-borne gene from a
Pseudomonas aeruginosa clinical isolate in France. Antimicrob. Agents Chemother.
44(4), 891–897.
48.
48 Crowder, M. W., Walsh, T. R., Banovic, L., Pettit, M., and Spencer, J.
(1998) Overexpression, purification, and characterization of the cloned metallo--
lactamase L1 from Stenotrophomonas maltophilia. Antimicrob. Agents Chemother.
42(4), 921–926.
49.
49 Goward, C. R., Stevens, G. B., Hammond, P. M., and Scawen, M. D. (1988) Large-
scale purification of the chromosomal ß-lactamase from Enterobacter cloacae P99.
J. Chromat. 457, 317–324.
50.
50 Maveyraud, L., Golemi-Kotra, D., Ishiwata, A., Meroueh, O., Mobashery, S., and
Samama, J.-P. (2002) High-resolution X-ray structure of an acyl-enzyme species
for the class D OXA-10 -lactamase. J. Amer. Chem. Soc. 124(11), 2461–2465.
51.
51 Bush, K., and Sykes, R. B. (1986) Methodology for the study of -lactamases.
Antimicrob. Agents Chemother. 30, 6–10.
52.
52 Dixon, M. (1953) The determination of enzyme inhibitor constants. Biochem. J.
55, 170–171.
53.
53 Cornish-Bowden, A. (1974) A simple graphical method for determining the
inhibition constants of mixed, uncompetitive and non-competitive inhibitors.
Biochem. J. 137, 143–144.
54.
54 Siemann, S., Clarke, A. J., Viswanatha, T., and Dmitrienko, G. I. (2003) Thiols
as classical and slow-binding inhibitors of IMP-1 and other binuclear metallo--
lactamases. Biochemistry, 42, 1673–1683.
55.
55 Doucet, N., DeWals, P. Y., and Pelletier, J. N. (2004) Site saturation mutagenesis
of Tyr 105 reveals its importance in substrate stabilization and discrimination in
TEM-1 -lactamase. J. Biol. Chem. 279, 46295–46303.
56.
56 Abeles, R. H., and Maycock, A. L. (1976) Suicide enzyme inactivators. Acc. Chem.
Res. 9, 313–319.
57.
57 Auld, D. S. (1988) Use of chelating agents to inhibit enzymes. Methods Enzymol.
158, 110–114.
58.
58 Kitz, R., and Wilson, I. B. (1962) Esters of methanesufonic acid as irreversible
inhibitors of acetylcholinesterase. J. Biol. Chem. 237, 3245–3249.
260 T. Viswanatha et al.
59.
59 Silverman, R. B. (2000) The organic chemistry of enzyme catalyzed reactions.
Appendix 1 Academic Press, New York, pp. 584–587.
60.
60 Siemann, S., Brewer, D., Clarke, A. J., Dmitrienko, G. I., Lajoie, G., and
Viswanatha, T. (2002) IMP-1 metallo--lactamase: Effect of chelators and
assessment of metal requirement by electrospray mass spectrometry. Biochim.
Biophys. Acta 1571, 190–200.
61.
61 Payne, D. J., Coleman, K., and Cramp, R. (1991) The automated in-vitro
assessment of -lactamase inhibitors. J. Antimicrob. Chemother. 28, 775–776.
62.
62 Yang, Z., Ho, P.-L., Liang, G., Chow, K. H., Wang, W., Cao, Y., Guo, Z., and
Xu, B. (2006) Using -lactamase to trigger supramolecular hydrogelation. J. Amer.
Chem. Soc. ASAP Article; DOI: 10.1021/ja0675604.
63.
63 Fitzgerald, F. M. D., Wu, J. K., and Toney, J. H. Unanticipated inhibition of
metallo- -lactamase from Bacterioides fragilis by 4-morpholinoethane sulfonic
acid (MES): A crystallographic study at 1.85 À resolution. Biochemistry 37,
6791–6800.
64.
64 Oliver, R. W. A., and Viswanatha, T. (1968) Reaction of tris(hydroxymethyl)-
aminomethane with cinnamoylimidazole and cinnamoyltrypsin. Biochem. Biophys.
Acta 156, 422–425.
65.
65 Jones, R. N., Wilson, H. W., Novick, W. J. Jr., Barry, A. L., and Thornsberry, C.
(1982) In vitro evaluation of CENTA, a new -lactamase-susceptible chromogenic
cephalosporin reagent. J. Clin. Microbiol. 15, 954–958.
66.
66 Ellman, G. L. (1959) Tissue sulfhydryl groups. Arch. Biochem. Biophys. 82, 70–77.
67 Riddles, P. W., Blakely, R. L., and Zerner, B. (1979) Ellman’s reagent: 5,5 -
67.
dithiobis-92-nitrobenzoic acid: a reexamination. Anal. Biochem. 94, 75–81.
20
Summary
Aminoglycoside antibiotics are highly potent, wide-spectrum bactericidals (1,2). Bacterial
resistance to aminoglycosides, however, is a major problem in the clinical use of aminoglycosides.
Enzymatic modification of aminoglycosides is the most frequent resistance mode among several
resistance mechanisms employed by resistant pathogens (1,3). Three families of aminoglycoside
modifying enzymes, O-phosphotransferases, N-acetyltransferases, and N-nucleotidyltransferases,
are known to have more than 50 enzymes (1,3,4). In this chapter, determination of enzymatic
activity of a single enzyme from each family in the presence and absence of an inhibitor is
described.
1. Introduction
Aminoglycosides are hydrophilic molecules carrying several hydroxyl and
amino functional groups. Most of the aminoglycosides have one or more amino
sugars that are attached to a 2-deoxystreptamine (2-DOS) ring. Aminogly-
cosides that contain 2-DOS are generally further separated into two groups
as the neomycin group (4,5-disubstituted 2-DOS) and the kanamycin group
(4,6-disubstituted 2-DOS) based on the substitution pattern of the 2-DOS
(Fig. 1). Aminoglycoside-modifying enzymes (AGMEs) are promiscuous in
261
262 E. H. Serpersu et al.
measurements with each class of AGMEs using an example enzyme from each
family, an acetyltransferase, a nucleotidyltransferase, and a phosphotransferase.
2. Materials
2.1. Acetyltransferase Activity
1. Spectrophotometer.
2. 0.5 M Tris-HCl buffer, pH 7.5. Store at 4 °C.
3. 0.25 M EDTA. Store at 4 °C.
4. 100 mM AldrithiolTM -4 (4,4’-dipyridyl disulfide). Store at –80 °C.
5. 50 mM acetyl coenzyme A. Store at –80 °C.
6. 5 mM kanamycin A. Store at –20 °C or –80 °C.
7. AAC sample.
3. Methods
3.1. Acetyltransferase Activity
1. Turn on the spectrophotometer, and set the wavelength to 324 nm and the run
time to several minutes.
2. Prepare the assay mix by adding 856 μL distilled water (resistivity 17.5 M-cm
or better), 100 μL 0.5 M TrisHCl, and 4 μL 0.25 M EDTA into a quartz cuvette.
3. Equilibrate the mix to the temperature at which the assay will be conducted.
4. Add 2 μL 50 mM acetyl coenzyme A, 8 μL 100 mM 4,4’-dipyridyl disulfide, and
10 μL 100 μM (∼3 mg/mL) AAC sample and mix (see Notes 1 and 2).
5. Blank the spectrophotometer using the mixture prepared in Step 4.
6. Start the run and determine the background rate ( absorbance units/min) for
pyridine-4-thiolate formation.
7. Add 20 μL 5 mM kanamycin A, quickly mix, and continue the run.
8. After the run is complete, calculate the rate of increase ( absorbance units/min)
in pyridine-4-thiolate absorption using a linear part of the plot. Subtract the
background rate from this value to find the enzymatically catalyzed reaction rate
(see Notes 3 and 4).
9. Using the rate calculated in Step 8 and the molar extinction coefficient of pyridine-
4-thiolate (19,800 M−1 cm−1 at 324 nm), calculate the enzyme activity in units
(one unit is defined as μmoles of substrate utilized per min).
10. Calculate the specific enzyme activity (μmoles/min/mg or units/mg) by dividing
the activity determined in Step 9 by the amount (mg) of AAC in the assay cuvette.
AAC activity is ∼5 units/mg (17) (see Notes 5 and 6).
266 E. H. Serpersu et al.
6. Start the run. Observe a flat baseline for the initial 10 to 20 s, add 10 μL of 100
μM APH, quickly mix, and continue the run.
7. After the run is complete, calculate the rate of decrease ( absorbance units per
minute) in NADH absorption using a linear stretch of the plot (see Note 16).
8. Using the rate calculated in Step 7 and the molar extinction coefficient of NADH
(6.22 × 103 M−1 cm−1 at 340 nm), calculate the enzyme activity in units (a unit is
defined as one μmole/min) (see Note 17).
9. Calculate the specific enzyme activity (units/mg) by dividing the activity determined
in Step 8 by the amount (mg) of APH in the assay cuvette (see Notes 18–20).
4. Notes
1. Keep 4,4’-dipyridyl disulfide, acetyl coenzyme A, kanamycin A stocks, and AAC
sample on ice.
2. If multiple assays are to be conducted, one can prepare a stock solution of the
assay mix by multiplying the amounts given at Step 2 of the Methods section with
the number of assays. This solution can be stored on ice for several hours. Use
962 μL from the prepared stock for each assay.
3. In order to ensure that no other assay component except AAC is the limiting factor
in the assay, double the amount of AAC added in another run and confirm the
doubling of the rate.
4. Mercaptoethanol (BME) can be used as a positive control to test the assay mix.
Add 5 μL of 5 mM BME into the cuvette. An immediate increase in absorbance
should be observed.
5. When present, inhibitors should be added in Step 4 before the baseline determi-
nation.
6. Inhibitors with low water solubility can be added from stocks dissolved in DMSO,
ethylene glycol, or hexylene glycol. A matching concentration of solvent needs
to be present in assays performed without the inhibitor. Generally, AGMEs are
tolerant to the presence of these solvents in the assay medium up to several
percentage points.
7. The assay can be scaled up to 1.0 mL if more time points are required.
8. Initial tests to determine the limits of linearity of the assay vs. enzyme concen-
tration (Fig. 2) and linearity of activity vs. time (Fig. 3) are strongly recommended.
9. If desired, commercial preparations of inorganic pyrophosphate can be used in
place of tobramycin to construct a standard curve to determine absorbance vs.
inorganic phosphate for a particular spectrophotometer. This method also can
confirm the activity of the inorganic pyrophosphatase is not a limiting factor in
the assay.
10. If multiple assays are to be conducted, prepare an assay mix stock that can be
stored at 4 °C for a couple of hours by multiplying the amounts given at Step 2
of the Methods section with the number of assays.
268 E. H. Serpersu et al.
Fig. 2. A typical experiment showing the linearity of the assay as a function of ANT
concentration. Incubation time was 5 min.
11. ANT is an unstable enzyme. It should be kept on ice at all times and should be
used within 48 h of preparation. ANT should not be frozen.
12. Substrate inhibition is observed with ANT (22,27). This phenomenon must be
considered when designing detailed kinetic analysis using this enzyme.
13. Keep stock solutions of kanamycin A, ATP, PEP, NADH, PK/LDH, and APH on
ice.
14. If multiple assays are to be conducted, one can prepare an assay mix stock that
can be stored at 4 °C for a couple of hours by multiplying the amounts given at
Step 2 of the Methods section with the number of assays. Use 970 μL from the
prepared stock for each assay.
15. NADH stocks will undergo oxidation and take a yellowish color within a couple
of weeks. The degree of oxidation can be estimated from the absorbance reading
when 15 μL of NADH are added into the assay mix (100% NADH should give
an absorbance reading of 0.95). Thus, small stocks of NADH should be prepared
to be consumed in a short period of time. Also, repeated freeze/thaw cycles of
NADH solutions are not recommended.
16. In order to ensure that no other assay component except APH is the limiting
factor for the measured rate, add another 10 μL of APH after a linear decrease in
absorbance is observed. The rate should double after the second addition.
17. ADP can be used as a positive control to check the assay mix components in case
no activity is observed. Add 10 μL of 10 mM ADP to observe approximately a
0.6-unit decrease in absorbance.
18. In these types of assays, coupling enzyme(s) should not create a bottleneck for
observed activity. To guarantee this, activity units per unit volume for coupling
enzymes should be at least 10-fold higher than the one for the enzyme studied.
19. Substrate inhibition is observed with APH at high concentrations, which must be
considered in detailed kinetic experiments.
20. APH activity is not affected by DMSO, ethylene glycol, or hexylene glycol up
to several percent presence of these solvents, which can be used in assays of
inhibitors with low solubility in water (16,20).
References
1.
1 Umezawa, H. (1974) Biochemical mechanism of resistance to aminoglycosidic
antibiotics. Adv. Carbohydrate Chem. Biochem. 30, 183–225.
2.
2 Davies, J. E. (1991) In Antibiotics in Laboratory Medicine (V. Lorian, ed.).
Williams and Wilkins, Baltimore, MD, pp. 691–713.
3.
3 Davies, J. E. (1994) Inactivation of antibiotics and the dissemination of resistance
genes. Science 264, 375–382.
4. Shaw, K. J., Rather, P. N., Hare, R. S., and Miller, G. H. (1993) Molecular-
4
genetics of aminoglycoside resistance genes and familial relationships of the
aminoglycoside- modifying enzymes. Microbiol. Rev. 57, 138–163.
5.
5 Allen, N. E., Alborn, W. E., Hobbs, J. N., and Kirst, H. A. (1982) 7-
Hydroxytropolone—An inhibitor of aminoglycoside-2”-O-adenylyltransferase.
Antimicrob. Agents Chemother. 22, 824–831.
270 E. H. Serpersu et al.
6.
6 Williams, J. W., and Northrop, D. B. (1979) Synthesis of a tight-binding, multi-
substrate analog inhibitor of gentamycin acetyltransferase I. J. Antibiot. 32,
1147–1154.
7.
7 Yu, L. P., Oost, T. K., Schkeryantz, J. M., Yang, J. G., Janowick, D., and
Fesik, S. W. (2003) Discovery of aminoglycoside mimetics by NMR-based
screening of Escherichia coli A-site RNA. J. Amer. Chem. Soc. 125, 4444–4450.
8.
8 Agnelli, T., Sucheck, S. J., Marby, K. A., Rabuka, D., Yao, S. L., Sears, P. S.,
Liang, F. S., and Wong, C. H. (2004) Dimeric aminoglycosides as antibiotics.
Angew. Chem. Intl. Ed. 43, 1562–1566.
9.
9 Sucheck, S. J., Greenberg, W. A., Tolbert, T. J., and Wong, C.-H. (2000) Design of
small molecules that recognize RNA: Development of aminoglycosides as potential
antitumor agents that target oncogenic RNA sequences. Angew. Chem. Intl. Ed.
39, 1080–1084.
10.
10 Asensio, J. L., Hidalgo, A., Bastida, A., Torrado, M., Corzana, F., Chiara, J.
L., Garcia-Junceda, E., Canada, J., and Jimenez-Barbero, J. (2005) A simple
structural-based approach to prevent aminoglycoside inactivation by bacterial
defense proteins. Conformational restriction provides effective protection against
neomycin-B nucleotidylation by ANT4. J. Amer. Chem. Soc. 127, 8278–8279.
11.
11 Griffey, R. H., Hofstadler, S. A., and Swayze, E. E. (2003) Preparation of
heterocyclic 2-deoxystreptamine aminoglycoside analogues and characterization of
their interaction with RNAs by use of electrospray ionization mass spectrometry.
Carbohydrate-Based Drug Discovery 2, 483–499.
12.
12 Haddad, J., Kotra, L. P., Llano-Sotelo, B., Kim, C., Azucena, E. F., Liu, M. Z.,
Vakulenko, S. B., Chow, C. S., and Mobashery, S. (2002) Design of novel
antibiotics that bind to the ribosomal acyltransfer site. J. Amer. Chem. Soc. 124,
3229–3237.
13. Fridman, M., Belakhov, V., Yaron, S., and Baasov, T. (2003) A new class of
13
branched aminoglycosides: Pseudo-pentasaccharide derivatives of neomycin B.
Org. Lett. 5, 3575–3578.
14.
14 Boehr, D. D., Draker, K. A., Koteva, K., Bains, M., Hancock, R. E., and
Wright, G. D. (2003) Broad-spectrum peptide inhibitors of aminoglycoside
antibotic resistance enzymes. Chem. Biol. 10, 189–196.
15.
15 He, Y., Yang, J., Wu, B., Robinson, D., Sprankle, K., Kung, P.-P., Lowery, K.,
Mohan, V., Hofstadler, S., Swayze, E. E., and Griffey, R. (2004) Synthesis and
evaluation of novel bacterial rRNA-binding benzimidazoles by mass spectrometry.
Bioorg. Med. Chem. Lett. 14, 695–699.
16.
16 Welch, K. T., Virga, K. G., Brown, C. L., Wright, E., Lee R. E., and Serpersu, E. H.
(2005) Inhibitors of aminoglycoside-modifying enzymes based on the 1,3-diamine
motif of the 2-deoxystreptamine ring. Bioorg. Med. Chem. 13, 6252–6263.
17.
17 Owston, M. A., and Serpersu, E. H. (2002) Cloning, overexpression, and
purification of aminoglycoside antibiotic 3-acetyltransferase-IIIb: Conformational
studies with bound substrates. Biochemistry 41, 10764–10770.
Studies of Enzymes That Cause Resistance to Aminoglycosides 271
18.
18 Williams, J. W., and Northrop, D. B. (1978) Kinetic mechanisms of gentamycin
acetyltransferase-I—Antibiotic-dependent shift from rapid to nonrapid equilibrium
random mechanisms. J. Biol. Chem. 253, 5902–5907.
19.
19 Grassetti, D. R., and Murray, J. F. (1967) Determination of sulfhydryl groups with
2,2’- or 4,4’-dithiodipyridine. Arch. Biochem. Biophys. 119, 41–49.
20.
20 Serpersu, E., and Dan, J. (2004) Effects of solvents on the activity and substrate
preference of the aminoglycoside-3-acetyltransferase-IIIb. Biophys. J. 86, 93a–93a.
21.
21 Wright, E., and Serpersu, E. H. (2004) Isolation of aminoglycoside
nucleotidyltransferase(2”)-Ia from inclusion bodies as active, monomeric enzyme.
Protein Expr. Purif. 35, 373–380.
22.
22 Wright, E., and Serpersu, E. H. (2005) Enzyme-substrate interactions with
an antibiotic resistance enzyme: Aminoglycoside nucleotidyltransferase(2”)-
Ia characterized by kinetic and thermodynamic methods. Biochemistry 44,
11581–11591.
23.
23 Shimizu, K., Kumada, T., and Hsieh, W. C. (1985) Comparison of aminoglycoside
resistance patterns in Japan, Formosa, and Korea, Chile, and the United States.
Antimicrob. Agents Chemother. 27, 282–288.
24.
24 Gates, C. A., and Northrop, D. B. (1988) Substrate specificities and structure
activity relationships for the nucleotidylation of antibiotics catalyzed by amino-
glycoside nucleotidyltransferase-2”-I. Biochemistry 27, 3820–3825.
25.
25 Ekman, D. R., DiGiammarino, E. L., Wright, E., Witter, E. D., and Serpersu, E. H.
(2001) Cloning, overexpression, and purification of aminoglycoside antibiotic
nucleotidyltransferase (2 ‘)-Ia: Conformational studies with bound substrates.
Biochemistry 40, 7017–7024.
26.
26 Ames, B. N. (1965) Assay for inorganic phosphate. Meth. Enzymol. 7, 115–118.
27.
27 Gates, C. A., and Northrop, D. B. (1988) Alternative substrate and inhibition-
kinetics of aminoglycoside nucleotidyltransferase-2”-I in support of a Theorell-
Chance kinetic mechanism. Biochemistry 27, 3826–3833.
28.
28 McKay, G., A., Thompson, P. R., and Wright, G. D. (1994) Broad spectrum
aminoglycoside phosphotransferase type III from Enterococcus: Overexpression,
purification and substrate specificity. Biochemistry 33, 6936–6944.
29.
29 Ozen, C., Malek, J. M., and Serpersu, E. H. (2006) Dissection of aminoglycoside-
enzyme interactions: A calorimetric and NMR study of noemycin B binding to the
aminoglycoside phosphotransferase(3’)-IIIa. J. Amer. Chem. Soc. (in press).
30.
30 Özen, C., and Serpersu, E. H. (2004) Thermodynamics of aminoglycoside binding
to aminoglycoside-3’-phosphotransferase IIIb studied by isothermal titration
calorimetry. Biochemistry 43, 14667–14675.
Index
A Chaperone proteins, 75
Agarose gel electrophoresis, 13, 15, 17, 19 Circular dichroism assay, 168
Aminoglycosides, 263–264
Aminoglycoside modifying enzyme assays, D
aminoglycoside acetyltransferase assay, 265 Database of Essential Genes (DEG), 5
aminoglycoside nucleotidyltransferase assay, 266 Decatenation assay for topo IV, 15
aminoglycoside phosphotransferase assay, DNA cleavage assay, 17–19
266–267 DNA gyrase, 11–12
Antibiotic mechanisms of inhibition, 2 DNA polymerase III, 26
Antibiotic target identification, 3 DNA polmyerase III assay, 28, 32
DNA polymerase III, isolation 27–30
B DNA supercoling assay, 13–15
Bacillus subtilis, 26 DNA topoisomerase IV, 11–12
Bacterial colony counting, 58, 66 DnaK, 76, 80
Bacterial efflux pump inhibitors (EPI), 187–188 Drug target features, 4
Bacterial cell extracts, 28, 42, 57, 67, 78, 98, 110,
123, 227, 246 E
Bacterial growth media, Erythromycin resistance methyltransferase (Erm)
broth growth media, 30, 38, 56, 64, 68, 120, enzyme isolation, 227–228
189, 225 Escherichia coli, 5,12, 38, 68, 76, 98, 120, 134,
minimal media, 55–56, 64, 77, 93, 120 189, 191, 217, 245
Bacterial membrane preparations, 134, 136 Essential genes, 4, 7
Beta-galactosidase assay, 80 Ethidium bomide, 20, 177, 188
Beta-keto acyl carrier protein synthase III Ethidium bromide accumulation assay,
(FabH), 207 191–193
Beta-lactamase, 241–244
Beta-lactamase assays, 244–245, 250–251, F
252–256 Fatty acid biosynthesis, 205–206
Beta-lactamase isolation, 246 Flow cytometry, 176–177
BLASTP, 5 Fluorescence polarization assay, 218–219
Bocillin, 139 Fluorescent dyes, 179
Broth growth media, 30, 38, 56, 64, 68, 120, Fluorography, 137
189, 225 Four-part assay for ribosomal subunit
formation, 65
C Fractional inhibitory concentration method (FIC),
Calcein leakage assay, 165 196–197, 201
Calf thymus DNA activation, 30
Cationic antimicrobial peptides, 155–156 H
Cell-free translation assays, 88 Haemophilus influenzae, 2, 54, 68,
bacterial translation, 100 189, 191
human cell translation, 102 HeLa cell culture, 93
yeast cell translation, 101 High throughput screening assay, 45
273
274 Index
His-tagged proteins, 14, 30, 41, 124 PDF enzyme preparation, 123–125
Human cell extracts, 100 Plasmid DNA, 12
Post-antibiotic effect, 67
I Primer extension assay, 28, 33
IC50 , 61, 65 Protonophore assay, 197–199
Pseudomonas aeruginosa, 6, 188
K Pulse and chase labeling, 67
Kinetoplast DNA, 12
Q
L Quinolones, 12
Large unilamellar vesicle (LUV) assays, 162–163
Lipid quantitation assay, 162 R
Lipopolysaccharides (LPS), 143–144 Ribosomes, 63, 76, 87, 109, 223
Liquid scintillation counting, 32, 67, 77, 79, 147, Ribosomal subunit, 64
149, 199, 211 RNA methyltransferases, 224–225
LpxC deacetylase assay, 147 RNA polymerase, 37–38
RNA polymerase assay, 39, 40
M RNA polymerase purification, 42–43
MALDI mass spectrophometry, 229 RNA transcription, 96, 228
Membrane permeability and potential
measurements, 180–181
Membrane preparation, 135, 136 S
Messenger RNA (mRNA), 88 S100 supernatant preparation, 57,110
Miicroorganisms, Scintillation proximity assay, 39, 109
Bacillus subtilis , 26 SDS polyacrylamide gel electrophoresis (PAGE),
Escherichia coli, 5,12, 38, 68, 76, 98, 120, 134, 40, 47, 133, 137
189, 191, 217, 245 Sigma factor purification, 43–44
Haemophilus influenzae, 2, 54, 68, 189, 191 SPARK assay, 112–114
Pseudomonas aeruginosa, 6, 188 SPARK assay principle, 108
Staphylococcus aureus, 38, 54, 66, 68, 135 Staphylococcus aureus, 38, 54, 66, 68, 135
Streptococcus pneumoniae, 19, 54, 68 Streptococcus pneumoniae, 19, 54, 68
Minimal inhibitory concentration (MIC), 57, 170, Sucrose density gradient centrifugation, 67, 77
194–196 Synthetic templates, 27, 32
Minimal media, 55–56, 64, 77, 93, 120
Mouse infection, 58 T
Messenger RNA (mRNA) transcription, 96–97 Thin-layer chromatography (TLC), 147
mtFabH assay, 210–211 Time kill kinetics assays, 58, 200
Transfer RNA synthetases, 53–54
O Transfer RNA synthetase assay, 57
ONPG leakage assays, 164 Tryptophan fluorescence assays, 166–167
Two-component signal transduction (TCST),
P 215–216
Penicillin binding proteins (PBP), 131–132
PBP labeling, 134, 136
U
PBP assays, 137–139
Ultrafiltration binding assay, 149
Peptide deformylase (PDF), 117–118
Uridine labeling of RNA, 65, 77
PDF enzyme assays,
PDF coupling enzymes, 122
AAP coupled, 125–127 Y
DPPI coupled, 127–128 Yeast extract preparation, 99
FDH coupled, 124–125 Yeast growth media, 93