Journal of Ethnopharmacology 99 (2005) 165–178

Review

Antioxidant approach to disease management and the

role of ‘Rasayana’ herbs of Ayurveda
R. Govindarajan, M. Vijayakumar, P. Pushpangadan ∗
Pharmacognosy and Ethnopharmacology Division, National Botanical Research Institute, Lucknow 226001, India

Received 4 November 2004; received in revised form 22 February 2005; accepted 22 February 2005
Available online 26 April 2005

Abstract

The disease preventive and health promotive approach of ‘Ayurveda’, which takes into consideration the whole body, mind and spirit while
dealing with the maintenance of health, promotion of health and treating ailments is holistic and finds increasing acceptability in many regions
of the world. Ancient Ayurvedic physicians had developed certain dietary and therapeutic measures to arrest/delay ageing and rejuvenating
whole functional dynamics of the body system. This revitalization and rejuvenation is known as the ‘Rasayan chikitsa’ (rejuvenation therapy).
Traditionally, Rasayana drugs are used against a plethora of seemingly diverse disorders with no pathophysiological connections according
to modern medicine. Though, this group of plants generally possesses strong antioxidant activity, only a few have been investigated in detail.
Over about 100 disorders like rheumatoid arthritis, hemorrhagic shock, CVS disorders, cystic fibrosis, metabolic disorders, neurodegenerative
diseases, gastrointestinal ulcerogenesis and AIDS have been reported as reactive oxygen species mediated. In this review, the role of free
radicals in these diseases has been briefly reviewed. ‘Rasayana’ plants with potent antioxidant activity have been reviewed for their traditional
uses, and mechanism of antioxidant action. Fifteen such plants have been dealt with in detail and some more plants with less work have also
been reviewed briefly.
© 2005 Elsevier Ireland Ltd. All rights reserved.

Keywords: Rasayana; Antioxidant; Ayurveda; Panchkarma

Contents

1. Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 166
2. ‘Rasayana’ concept of ‘Ayurveda’ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 166
3. Free radicals and their role in diseases . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 167
3.1. Aging biology . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 167
3.2. Atherosclerosis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 168
3.3. Autoimmune diseases . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 168
3.4. Cancer . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 168
3.5. Diabetes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 168
3.6. Inflammation . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 168
3.7. Parkinson’s disease. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 169
3.8. Rhuematoid arthritis. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 169
4. Antioxidant defense . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 169

Abbreviations: CAT, catalase; DPPH, 1,1-diphenyl-2-picrylhydrazyl; GSH, glutathione; GSH-px, glutathione peroxidase; GSH-R, glutathione reductase;
GST, glutathione S-transferase; LDL, low density lipoproteins; LPO, lipid peroxidation; MDA, malondialdehyde; RNS, reactive nitrogen species; ROI, reactive
oxygen intermediates; ROS, reactive oxygen species; SOD, superoxide dismutase; TBARS, thiobarbituric acid reactive substances
∗ Corresponding author. Tel.: +91 522 2205848; fax: +91 522 2205836.

E-mail address: pushpangadan@satyam.net.in (P. Pushpangadan).

0378-8741/$ – see front matter © 2005 Elsevier Ireland Ltd. All rights reserved.
doi:10.1016/j.jep.2005.02.035
166 R. Govindarajan et al. / Journal of Ethnopharmacology 99 (2005) 165–178

5. Rasayana as antioxidants. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 169

5.1. Acorus calamus . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 170
5.2. Aloe vera . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 170
5.3. Andrographis paniculata. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 170
5.4. Asparagus racemosus . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 170
5.5. Azadirachta indica . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 171
5.6. Bacopa monnieri. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 171
5.7. Desmodium gangeticum . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 171
5.8. Phyllanthus emblica . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 171
5.9. Glycyrrhiza glabra . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 172
5.10. Picrorhiza kurroa . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 172
5.11. Psoralea corylifolia . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 172
5.12. Semecarpus anacardium . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 172
5.13. Terminalia chebula. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 173
5.14. Tinospora cordifolia . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 173
5.15. Withania somnifera . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 173
5.16. Miscellaneous plants . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 174
6. Conclusion . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 174
References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 175

1. Introduction body. Hence any medicine that improves the quality of ‘Rasa’
(‘Rasayana’) should strengthen or promote the health of all
The health promotive, disease preventive and rejuvena- tissues of the body. ‘Rasayana’ drugs act inside the human
tion approach available in the Indian systems of medicine body by modulating the neuro-endocrino-immune systems
like ‘Ayurveda’ is gaining greater attention and popularity and have been found to be a rich source of antioxidants
in many regions of the world. A majority of the present day (Brahma and Debnath, 2003). These Rasayana plants are
diseases are reported to be due to the shift in the balance of said to possess the following properties: they prevent ageing,
the pro-oxidant and the antioxidant homeostatic phenomenon re-establish youth, strengthen life, brain power and prevent
in the body. Pro-oxidant conditions dominate either due to diseases (Sharma, 1983; Ghanekar, 1981), all of which
the increased generation of the free radicals caused by ex- imply that they increase the resistance of the body against
cessive oxidative stress of the present day life, or due to any onslaught.
the poor scavenging/quenching in the body caused by deple- ‘Rasayana chikitsa’ is a specialized section of Ayurveda,
tion of the dietary antioxidants (Schulz et al., 2000; Dringen, which mainly deals with the preservation and promotion
2000). The disease preventive and health promotive approach of health by revitalizing the metabolism and enhancing
of Ayurveda, which takes into consideration the whole body, immunity. ‘Rasayana’ therapy is done for a particular
mind and spirit while dealing with the maintenance of health, period of time with strict regimen on diet and conduct.
promotion of health and treating ailments, is an holistic ap- ‘Rasayana’ drugs are very rich in powerful antioxidants
proach and finds increasing acceptability in many regions of and are good hepatoprotective and immunomodulating
the world. The ancient Ayurvedic physicians understood the agents. ‘Rasayana’ is not a drug therapy, but is a specialized
delicate cellular mechanisms of the body and the deterio- procedure practiced in the form of rejuvenation recipes,
ration of the functional efficiency of the body tissues. These dietary regimen and special health promoting right conduct
ancient Ayurvedic masters had thus developed certain dietary and behavior, i.e. ‘Achara Rasayana’. Shushruta (an ancient
and therapeutic measures to arrest/delay ageing and rejuve- Ayurvedic surgeon) while defining ‘Rasayana’ therapy
nating whole functional dynamics of the body organs. This says that it arrests ageing (‘Vayasthapam’), increase life
revitalisation and rejuvenation is known as the ‘Rasayan chik- span (‘Ayushkaram’), intelligence (‘Medha’) and strength
itsa’ (rejuvenation therapy). (‘Bala’) and thereby enable one to prevent disease (Sharma,
1983). ‘Rasayana’ enhances the functions of the whole body
system. ‘Rasayana’ treatment for rejuvenation is done after
2. ‘Rasayana’ concept of ‘Ayurveda’ the system is thoroughly cleansed by ‘Panchakarma’ therapy
(Joshi, 1998). ‘Panchakarma’ is essentially a pretreatment
Ayurvedic pharmacology classifies medicinal plants into equipping the body tissues for ‘Rasayana’ therapy. Shushruta
different groups according to their actions. One of these is observed that a person, whose system is not been previously
the ‘Rasayana’ group. The word ‘Rasayana’ literally means cleansed by proper purification remedies, cannot expect
the path that ‘Rasa’ takes (‘Rasa’: plasma; Ayana: path). good results with ‘Rasayana’ treatment. ‘Panchakarma’ is
It is believed, in Ayurveda that the qualities of the ‘Rasa- a method of purifying the body system by five methods
dhatu’ influence the health of other dhatus (tissues) of the called ‘Vamana’ (emesis), ‘Virechana’ (purgation), ‘Vasti’
 R. Govindarajan et al. / Journal of Ethnopharmacology 99 (2005) 165–178
(enema), including ‘Asthapana’ (medicated enema), ‘Nasya’
(nasal medication) and ‘Rakta moksha’ (blood letting)
(Trikamji, 1994). According to the ‘Caraka Samhita’, one
of the ancient treatises of ‘Ayurveda’, if a disease is not sub-
jected to ‘Panchakarma’, the rejuvenation therapy may not
be effective. ‘Panchakarma’ is advised for treating broad cat-
egory of conditions like arthritis, rheumatism, neurological,
muscular skeletal disorders and also degenerative conditions
like infertility, menstrual problems, obesity, respiratory
disorders, gastrointestinal disorders, etc. ‘Panchakarma’
may be administered with curative and corrective drugs
along with having powerful antioxidant activity (Devaraj,
1980).
There has been a plenty of research on the plants used as
Rasyana drugs in order to reason them in the modern context.
Puri (1970a,b, 1971, 1972) gave an account of the herbs used
in various ‘Rasayana’ preparations while Udupa (1973) stud-
ied the effects of ‘Rasayana’ drugs on psychosomatic stress.
‘Rasayana’ drugs have been proven to treat epilepsy (Singh
and Murhty, 1989), convulsive disorders (Diwedi and Singh,
1992) and to reduce anxiety, apprehension and keep the mind
calm and cool (Puri, 2003). Plenty of study has been under-
taken to provide scientific evidence to the ‘Rasayana’ drugs
as immunomodulators and adaptogens. Wagner (1994) after a
detailed study concluded that ‘Rasayana’ preparations, which
act both as herbal immunostimulant and adaptogens, regulate
the immunological and endocrine systems with relatively low
doses, without damaging the autoregulative functions of the
organisms. ‘Rasayana’ drugs haven been reported to treat
generalized weakness (Jayaram et al., 1993) and afford pro-
tection from cyclophosphamide-induced luekopenia (Kumar
et al., 1994).
3. Free radicals and their role in diseases
Free radicals are natural by-products of our own
metabolism. These are electrically charged molecules that
attack our cells, tearing through cellular membranes to
react and create havoc with the nucleic acids, proteins, and
enzymes present in the body. These attacks by free radicals,
collectively known as oxidative stress, are capable of causing
cells to lose their structure, function and can eventually
destroy them. They are continuously produced by our body’s
use of oxygen such as in respiration and some cell-mediated
immune functions. They are also generated through envi-
ronmental pollutants, cigarette smoke, automobile exhaust,
radiation, air-pollution, pesticides, etc. (Li and Trush, 1994).
Normally there is a balance between the amount of free
radicals generated in the body and the antioxidant defense
systems that scavenge/quench these free radicals preventing
them from causing deleterious effects in the body (Nose,
2000). The antioxidant defense systems in the body can only
protect the body when the amount of the free radicals is
within the normal physiological level. But when this balance
is shifted towards more of free radicals, increasing their
167
burden in the body either due to environmental condition
or produced within the body, it leads to oxidative stress,
which may result in tissue injury and subsequent diseases
(Finkel and Holbrook, 2000). Since free radicals play such
an important role in the disease scenario of an individual,
a thorough understanding of the various physiologically
significant free radicals is of paramount importance before
the search of the radical scavengers or the antioxidant
principles to treat the physiological disorders caused
by them.
Free radicals may be designated as molecular sharks that
damage molecules in cell membranes, mitochondria (the
cell’s energy plants), DNA (the cell’s intelligence) and are
very unstable, tend to rob electrons from the molecules in the
immediate surrounding in order to replace their own losses.
Reactive oxygen species (ROS) is a collective term, which
includes not only the oxygen radicals (O2 •− , and • OH) but
also some non-radical derivatives of oxygen. These include
hydrogen peroxide (H2 O2 ), hypochlorous acid (HOCl) and
ozone (O3 ) (Bandhopadhyay et al., 1999).
Over about 100 disorders like rheumatoid arthritis, hem-
orrhagic shock, cardiovascular disorders, cystic fibrosis,
metabolic disorders, neurodegenerative diseases, gastroin-
testinal ulcerogenesis and AIDS have been reported as ROS
mediated. Some specific examples of ROS mediated diseases
include Alzheimers disease, Parkinson’s disease, Atheroscle-
rosis, Cancer, Down’s syndrome and ischemic reperfusion
injury in different tissues including heart, liver, brain, kidney
and gastro intestinal tract. The role played by ROS in stress-
induced gastric ulcer and inflammatory bowel diseases have
been well established, as well as their involvement in the pro-
cess of ageing. The role of radicals in various diseases is dealt
in detail.
3.1. Aging biology
In the biological process of aging, the following
cause–effect relationships are demonstrated: formation
of intra and intermolecular cross-linkings, as in the case
of muscle cells aging. Modifications of immunological
reactions, usually resulting in decrease of their activities.
Telomere shortening with decrease or interruption of cell
proliferation, which can mean an unbalance between cells
lost and reposition rates, culmination with organ and system
failure and death of the organism. Cell damages provoked by
free radicals are common during aging; once in this life step
cells produce less concentrations of antioxidant enzymes like
superoxide dismutase (SOD), catalase (CAT), etc. Gene ac-
tivation with inevitable aging-related physiological changes
(Harman, 1998; Ferrari, 2001). In healthy human cente-
narians, although both plasmatic and red blood cell-SOD
were decreased (in concentration with the increasing levels
since <60 years until 99 years), the remarkable increase of
plasmatic Vitamins A and E contribute the first indication
that these vitamins are favorable to longevity (Mecocci et al.,
2000).
168 R. Govindarajan et al. / Journal of Ethnopharmacology 99 (2005) 165–178
3.2. Atherosclerosis
It is a disease of arteries characterized by a local thicken-
ing of the vessel wall that develops in the inner coat (Tunica
intima). It is now believed and accepted that ROS/RNS play
an important role in initiation and development of atheroscle-
rosis. There are a number of roles believed to be played by the
oxidants in atherogenesis: firstly, activation of macrophages
or their monocyte precursors (Mitchinson and Ball, 1987).
Secondly, normal macrophages possess some low density
lipoprotein (LDL) receptors. LDL bound to these receptors is
taken up with enhanced efficiency, so that cholesterol rapidly
accumulates with in the macrophage and may convert it to
a foam cell (Mitchinson and Ball, 1987). Thirdly, any lipid
peroxides present in LDL could conceivably contribute to the
initial endothelial cell damage that is thought to start off the
whole process. Fourth, it has been suggested that products
formed in peroxidized LDL such as lysophosphotidylcholine
(Mitchinson and Ball, 1987) might act as a chemotactic fac-
tors for blood monocytes, encouraging their recruitment into
an atherosclerotic lesion. Fifth, low concentration of perox-
ides might accelerate cycloxygenase and lipoxygenase catal-
ysed reactions in endotheliym and in any platelets present
leading to enhanced formation of eicosanoids (Yokoda et al.,
1988).
3.3. Autoimmune diseases
It seems likely that ROS, RNS and released enzymes such
as proteases play some role in tissue damage in the autoim-
mune diseases. Hence therapy against them might prove ben-
eficial. Example, urinary excretion of F2 isoprostanes is ele-
vated in scleroderma patients suggesting increased lipid per-
oxidation (LPO). Also the levels of nitrate plus nitrite tend to
be higher in the patients suffering from autoimmune diseases,
indicating more NO• generation (Halliwell and Gutteridge,
1999).
3.4. Cancer
Most tumors form discrete masses but in the leukemias,
the tumor cells are spread through the bone marrow or lym-
phoid tissues and circulate in the blood. DNA damage plays
a very important role in carcinogenesis and any agent, which
is capable of chemically modifying DNA could be carcino-
genic. ROS/RNS fall into this category. Hydroxyl radical at-
tack upon DNA generates a whole series of modified purine
and pyrimidine bases many of which are known to be muta-
genic. Attack of • OH upon deoxyribose also yields a multi-
plicity of products. It is well known that increased production
of ROS can cause DNA damage in cells (Cerutti, 1994). Ox-
idative damage to lipids and to proteins could also lead to
mutagenic effects. One of effects of several tumor promot-
ers including oxidative stress is to decrease the gap func-
tional communication, and finally ROS may also be involved
in metastatin. Thus, the multiple effects of ROS/RNS sug-
gest that they could contribute to all stages of carcinogenesis,
however an excess of ROS/RNS can inhibit the cell prolif-
eration. Hence the net effect will depend upon the amount
of ROS/RNS generated and the extent of antioxidant defense
existing (Marnett, 1987).
3.5. Diabetes
It has been postulated that the etiology of the compli-
cations of diabetes involves oxidative stress perhaps as a
result of hypoglycemia (Hunt et al., 1990). Glucose itself
and hyperglycemia-related increased protein glycosylation
are important sources of free radicals (Wolff and Dean, 1987).
Elevated glucose causes slow but significant non-enzymatic
glycosylation of proteins in diabetes (Brownlee et al., 1984).
Glucose auto-oxidise in the presence of transition metal ions
generating oxygen free radicals, which make the membrane
vulnerable to oxidative damage. As the diabetogenic action
can be prevented by the SOD, CAT, and other hydroxyl rad-
ical scavengers such as ethanol, dimethyl urea, there is evi-
dence to suggest that the incidence of diabetes involves su-
peroxide anion and hydroxyl radicals. In addition to these
enzymes, glutathione reductase (GSH-R) and glutathione-S-
transferanse (GST) provide GSH and help to nutralize toxic
electrophiles, respectively. There are clear cut evidence to
show the role of free radicals in diabetes and studies indi-
cate that tissue injury in diabetes may be due to free radicals
(Grankvist et al., 1981). The significance of oxidative stress
in the disease pathology is uncertain but is frequently pro-
posed to be related to the hyperglycaemia. Other possible
sources include elevated plasma lipids leading to increased
lipid oxidation and decreased levels of antioxidant defense
systems (Baynes and Thorpe, 1999).
3.6. Inflammation
An inflammatory response implicates macrophages and
neutrophils, which secrete a number of mediators (eicosi-
noids, oxidants, cytokine and lytic enzymes) responsible for
initiation, progression and persistence of acute or chronic
state of inflammation (Lefkowitz et al., 1999). NO along
with superoxide (O2 •− ) and the products of their interaction
initiates a wide range of toxic oxidative reactions causing
tissue injury (Hogg, 1998). Likewise, the neutrophils
too produce oxidants and release granular constituents
comprising of lytic enzymes performing important role in
inflammatory injury (Yoshikawa and Naito, 2000). Reactive
oxygen intermediates (ROI) are believed to be mediators
of inflammation and responsible for the pathogenesis of
tissue destruction in rheumatoid arthritis (Valentao et al.,
2002). The role of ROS/RNS in inflammation is clearly
demonstrated by the anti-inflammatroy effects of the an-
tioxidants. Niric oxide synthase inhibitors are also effective
as anti-inflammatory agents in carrageenan-induced rat
paw odema method as SOD. These may be due to the
removal of O2 •− by SOD, so preventing O2 •− dependent
 R. Govindarajan et al. / Journal of Ethnopharmacology 99 (2005) 165–178
formation of a factor chemotactic for nutrophils (Miller et al.,
1992).
3.7. Parkinson’s disease
There have been several reports on the role of ROS/RNS
in neurodegenertive diseases. Parkinson’s disease usually ap-
pears in the middle to old age often as a rhythmic tremor in a
foot or hand especially when the limb is at rest. Comparison
of the brains of Parkinson’s disease with that of the neurologi-
cally normal brains shows several parameters consistent with
increased oxidative stress and defective mitochondrial func-
tion. Damaged mitochondria may generate more ROS than
usual and ROS/RNS (including O2 •− , • OH, ONOO− ) can in-
activate complex I. Hence it is possible that oxidative stress
and mitochindrial defects form a vicious cycle (Halliwell and
Gutteridge, 1999).
3.8. Rhuematoid arthritis
ROI produced by activated phagocytes in the in-
flamed joints have been implicated along with prostanoids,
leukotrienes and proteases, as mediators of inflammation and
the pathogenesis of tissue destruction (Krane et al., 1990).
Many drugs commonly used in the day to day treatment of
rheumatoid arthritis are believed to mediate their therapeu-
tic actions by multiple mechanisms, one of them being sug-
gested is a reduction of oxidant damage at sites of inflamma-
tion by drugs either acting as ROI scavengers or inhibitors of
ROI production by phagocytes (Aruoma, 1993). In humans,
there are intrinsic enzymatic and non-enzymatic antioxidants
detoxifying mechanisms that help to maintain a low ROI con-
centration in the body (Seiss, 1991). Enzymatic mechanisms
include SOD, which dismutates superoxide radicals, CAT
and GSH-px that reduce H2 O2 to water and molecular oxy-
gen (Halliwell and Gutteridge, 1999).
4. Antioxidant defense
It is evident through the reactions of oxygen, that it is toxic;
still only the aerobes survive its presence, primarily because
they have evolved an inbuilt antioxidant defense. Antioxidant
defenses comprise:
• Agents that catalytically remove free radicals and other re-
active species like SOD, CAT, peroxidase and thio specific
antioxidants.
• Proteins that minimize the availability of peroxidase such
as iron ions, copper ions and haem.
• Proteins that protect biomolecules against oxidative dam-
age example heat shock proteins.
• Low molecular mass agents that scavenge ROS and RNS,
example GSH, ascorbic acid, tocopherol.
The antioxidants may be defined as “any substance, when
present at low concentrations compared with that of an ox-
169
idizable substrate, that significantly delays or prevents oxi-
dations of that substrate”. The term oxidizable substrate in-
cludes every type of molecule found in vivo. Antioxidant
defense include the antioxidant enzymes like SOD, CAT,
GSH-px, etc, low molecular agents and dietary antioxidants
(Halliwell and Gutteridge, 1999).
5. Rasayana as antioxidants
The concept of developing drugs from plants used in in-
digenous medical system is much older, while in some cases
direct links between a local and biomedical use exists, in
other cases the relationship is much more complex (Heinrich
and Gibbons, 2001). Traditionally, ‘Rasayana’ drugs are
used against a plethora of seemingly diverse disorders with
no pathophysiological connections according to modern
medicine. Looking at these diverse applications adaptogenic
agents from this group of ‘Rasayanas’ were identified by
Rege et al. (1999). It has been reported that the ‘Rasayanas’
are rejuvenators, nutritional supplements and possess strong
antioxidant activity. They also have antagonistic actions on
the oxidative stressors which giving rise to the formation of
different free radicals. Therefore, the therapeutic indication
of these drugs can include the diseases relating to all the
above systems. Their antistress/adaptogenic actions have
made them therapeutically far more important (Brahma
and Debnath, 2003). The strong antioxidant activity of
any ‘Rasayana’ was found to be 1000 times more potent
than ascorbic acid, ␣-tocopherol, and probucol (Sharma
et al., 1992). For example, oral administration of ‘Brahma
rasayana’ (50 mg/animal for 10 and 30 days) significantly
increased the liver antioxidant enzymes such as SOD, CAT
along with tissue and serum levels of GSH. Thus, indicating
that ‘Brahma rasayana’ could ameliorate the oxidative dam-
age produced in the body by radiation (Rekha et al., 2001).
‘Rasayana’ preparations also increased stem cell prolifera-
tion and also prevented free radical-induced injury produced
by radiation (Puri, 2003). Hanna et al. (1994) also reported
the prevention of oxidant stress by ‘Student Rasayana’.
Since free radicals are implicated in a number of physio-
logical disorders as described above and with the ‘Rasayana’
drugs of Ayurveda used in the treatment of diverse physiolog-
ical disorders, there is a strong case to believe that ‘Rasayana’
drugs exert their therapeutic actions by their ability to scav-
enge free radicals or by their antioxidant potential. There has
been a review on some plants of Indian traditional medicine
with antioxidant activity (Scartezzini and Speroni, 2000) and
a review of immunemodulators from ‘Ayurveda’ especially of
the ‘Rasayana’ drugs (Agarwal and Singh, 1999). But there is
not a single review of the ‘Rasayana’ drugs of the ‘Ayurveda’,
as antioxidants. Some important plants like Allium sativum,
Centella asiatica, Ocimum sanctum, Vitis vinifera and Zin-
giber officinale have been extensively reviewed in the recent
past. Important ‘Rasayana’ drugs are reviewed in detail for
their antioxidant activity here.
170 R. Govindarajan et al. / Journal of Ethnopharmacology 99 (2005) 165–178
5.1. Acorus calamus
Acorus calamus Linn. (family: Acoraceae, Ayurvedic
name: ‘Vacha’) is a semi-aquatic, perennial, aromatic herb
with creeping rhizomes. Since antiquity, calamus rhizome has
been used for medicinal baths, in incense and tea. It used tra-
ditionally for flatulent colic and chronic dyspepsia (Parotta,
2001). In ‘Ayurveda’, the rhizome is used as an aromatic,
stimulant, bitter, tonic, carminative, anti-spasmodic, emetic,
expectorant, emmenagogue, aphrodisiac, laxative, and di-
uretic (Kapoor, 2001). It has also been ethnobotanically used
in asthma, bronchitis, body ache, cold, cough and inflamma-
tion (Jain, 1991). The ethyl acetate extract of Acorus cala-
mus was found to be potent antioxidant by inhibition of 1,1-
diphenyl-2-picrylhydrazyl (DPPH) free radical (Acuna et al.,
2002). Antioxidant activity (in vitro) by DPPH scavenging at
three different concentrations (0.2, 0.1 and 0.01 g/ml) showed
a maximum activity of 86.43% at 0.2 g/ml (Govindarajan et
al., 2003a).
5.2. Aloe vera
Aloe vera Linn. (family: Aloaceae, Ayurvedic name:
‘Kumari’) is commonly known as aloe. In ‘Ayurveda’, dried
juice of Aloe vera is cathartic and given in constipation.
The expressed juice of Aloe vera in the form of an ointment
in vaseline has been found to hasten healing of wounds of
thermal burns and radiation injury. It has been found that
aloe compound is very useful in cases of functional sterility
and disturbed menstrual function. It is a favorite remedy for
intestinal worms in children. The Ayurvedic drug known as
‘Kumari asava’ is useful in general debility, cough, asthma,
piles, epilepsy and colic (Kapoor, 2001). 8-C-␤-d-[2-O-(E)-
Coumaroyl]glucopyranosyl-2-[2-hydroxy]-propyl-7-metho-
xy-5-methylchromone, a potent antioxidative compound
has been isolated from a methanolic extract of Aloe (Lee
et al., 2000). Aloesin derivatives isorabaichromone together
with feruloylaloesin and p-coumaroylaloesin from Aloe vera
showed potent DPPH radical and superoxide anion scaveng-
ing activities. Electron spin resonance (ESR) using the spin
trapping method suggested that the potent superoxide anion
scavenging activity of isorabaichromone may have been due
to its caffeoyl group (Yagi et al., 2002). Polysaccharides and
flavonoids fractions along with aloe extracts showed sig-
nificant antioxidant activity (Hu et al., 2003). Experimental
investigations performed after 3, 7 and 10 days exposure to
radiation showed that Aloe vera treatment has significantly
minimized the radiation-induced increase in the amount of
malondialdehyde (MDA) in liver, lungs, and kidney tissues
of irradiated rats. Significant amelioration in SOD and CAT
activities was observed (Saada et al., 2003). The combination
of extracts of Withania somnifera and Aloe vera was more
effective in reducing oxidative damage in brain regions
than the supplementation of single plant extract (Parihar et
al., 2004).
5.3. Andrographis paniculata
Andrographis paniculata (Burm. f.) Wall ex. Nees (fam-
ily: Acanthaceae, Ayurvedic name: ‘Kalmegh’), which has
widespread distribution in India, was found to be a substi-
tute for Swertia chirayta and it became popular as green
chirayta. In ‘Ayurveda’, the leaf juice is a household rem-
edy for flatulence, loss of appetite, bowel complaints of chil-
dren, diarrhea, dysentery, dyspepsia, and general debility; it
is preferably given with the addition of aromatics. Decoction
or infusion of the leaves gives good results in sluggish liver,
neuralgia, in general debility, in convalescence after fevers,
and in advanced stages of dysentery (Kapoor, 2001). Andro-
graphis paniculata significantly decreased kidney TBARS
level (P < 0.005) in normal rats along with increase in the
activity of SOD and CAT, but had no significant effect on
GSH-px activity in diabetic rats showing that it possesses an
antihyperglycaemic property, and may also reduce oxidative
stress in diabetic rats (Zhang and Tan, 2000). Administra-
tion of Andrographis paniculata showed protective effect in
the activity of SOD, CAT, GSH-px, GSH-R as well the level
of GSH with decreased activity of lipid peroxidase proving
it has antioxidant and hepatoprotective activity (Trivedi and
Rawal, 2001). ‘Kalmegh’ treated group showed a significant
decrease in activity of LDL and MDA formation and CAT,
GSH-px and GSH-R showed significant increases only at the
higher dose in the liver (Singh et al., 2001).
5.4. Asparagus racemosus
Asparagus racemosus Willd. (family: Asparagaceae,
Ayurvedic name: ‘Shatavari’), is a tall climber under-shrub
found all over India. Almost all parts of this plant are used
by the Indian traditional system of medicine (‘Ayurveda’ and
‘Unani’) for the treatment of various ailments in human be-
ings. In particular, the roots are used in dysentery, diarrhoea,
tuberculosis, leprosy, skin diseases, epilepsy, inflammations,
and as an expectorant (Jain, 1991; Nadkarni, 1976). The aque-
ous extracts of both fresh and dried roots were found to have
amylase and lipase activities (Kapoor, 2001). The antioxi-
dant effect of an active fraction consisting of polysaccha-
rides (termed as P3) fraction was more pronounced against
LPO, as assessed by TBARS formation, while that of the
crude extract was more effective in inhibiting protein oxi-
dation. Both the crude extract and P3 fraction also partly
protects against radiation-induced loss of protein thiols and
inactivation of SOD. The inhibitory effects of these active
principles, at the concentration of 10 ␮g/ml, are compara-
ble to that of the established antioxidants GSH and ascorbic
acid (Kamat et al., 2000). The Asparagus racemosus extract
supplemented mice displayed an improvement in GSH-px
activity and GSH content and reduction in membranal LPO
(Parihar and Hemnani, 2003). Antioxidant compound race-
mofuran was isolated from Asparagus racemosus, which re-
vealed activity against DPPH with IC50 value of 130 ␮M
(Wiboonpun et al., 2004). Asparagus racemosus (100 and
 R. Govindarajan et al. / Journal of Ethnopharmacology 99 (2005) 165–178
250 mg/kg body weight) for 3 weeks significantly reversed
antioxidant enzymes like SOD and CAT in liver and kidney in
diabetic rats. It possesses moderate antidiabetic activity, but
it exhibits potent antioxidant potential in diabetic conditions
(Govindarajan et al., 2004).
5.5. Azadirachta indica
Azadirachta indica A. Juss. (family: Meliaceae, Ayurvedic
name: ‘Nimba’) is commonly known as neem. It is very
useful in blood disorders, eye diseases, intermittent fever,
as well as persistent low fever. Oil is very useful in leprosy,
skin diseases, ulcers, and wounds. The bark contains a
resinous bitter principle and is usually prescribed in the
form of a tincture or an infusion. It is also regarded as
beneficial in malarial fever (Kapoor, 2001). The antioxidant
property of Azadirachta indica has been reported (Rao et al.,
1998). Neem leaf extracts (100, 200 and 400 mg/kg) showed
its chemoprotective effects on potent gastric carcinogen
N-methyl-N -nitro-N-nitrosoguanidine (MNNG)-induced
oxidative stress by decreasing LPO and enhancing the an-
tioxidant enzymes like SOD, CAT, GSH-px and GST in male
rats (Subapriya et al., 2003). Ethanolic neem leaf extract
exerts protective effects against MNNG-induced genotox-
icity and oxidative stress by augmenting host antioxidant
defence mechanisms (Subapriya et al., 2004). Azadirachta
indica extract demonstrated anticancer activity by increasing
the distribution of antioxidant elements and GST activity
to protect cells in preneoplastic nodules in cancer treated
groups (Hanachi et al., 2004). Modulatory effects of garlic
and neem leaf on hepatic and blood oxidant–antioxidant
status may play a key role in preventing cancer development
at extrahepatic sites (Arivazhagan et al., 2004).
5.6. Bacopa monnieri
Bacopa monnieri (Linn.) Penn. (family: Scrophulariaceae,
Ayurvedic name: Brahmi). Leaves and stalks are very use-
ful in the stoppage of urine, which is accompanied by ob-
stinate costiveness. A poultice made of the boiled plant is
placed on the chest in acute bronchitis and other coughs of
children. Leaves also give satisfactory results in cases of as-
thenia, nervous breakdown, and other low adynamic con-
ditions. It is also given in combination with ‘Ghrita’ (ani-
mal fat), a well-known Ayurvedic medicine (brahmi ghrita)
in cases of hysteria and epilepsy. It is also useful in insan-
ity, neurasthenia, aphonia and hoarseness (Kapoor, 2001).
Bacopa monnieri, is clinically used for memory enhanc-
ing, epilepsy, insomnia and as mild sedative. It protected
the autooxidation and FeSO4 -induced oxidation of GSH
on lower doses 100 ␮g/ml and below, but on higher con-
centrations it enhanced the rate of oxidation (Tripathi et
al., 1996). Extract of Bacopa monnieri was assessed on rat
brain frontal cortical, striatal and hippocampal SOD, CAT
and GSH-px activities, following administration for 7, 14
or 21 days which induced a dose-related increase in SOD,
171
CAT and GSH-px activities (Bhattacharya et al., 2000a). It
showed a dose-dependent free radical scavenging capacity
and a protective effect on DNA cleavage and was confirmed
by a significant protective effect on H2 O2 -induced cytoxic-
ity and DNA damage in human non-immortalized fibroblasts
(Russo et al., 2003). Treatment with Bacopa monnieri extract
significantly increased the antioxidant enzymes such as CAT,
SOD, GSH-px and the levels of GSH, inhibited lipid perox-
idation and reduced the tumor markers (Rohini et al., 2004).
5.7. Desmodium gangeticum
Desmodium gangeticum (L.) DC. (family: Fabaceae,
Ayurvedic name: ‘Shalparni’) is a small shrub of tropical re-
gion which has been used in Indian system of medicine as a
bitter tonic, febrifuge, digestive, anticatarrhal, antiemetic, in
inflammatory conditions of chest and various other inflam-
matory conditions (Chopra et al., 1956). Though the roots
of the plant are one of the ingredients of popular Ayurvedic
drug – Dashmoola, a potent rejuvenating formulation used in
‘Ayurveda’, the aerial parts of this plant are mostly used as
a substitute in Dashmoola. Desmodium gangeticum extract
has potent antioxidant activity, achieved by scavenging abil-
ities observed against DPPH, nitric oxide, ferryl-bipyridyl
and hypochlorous acid and LPO activity (Govindarajan et
al., 2003b).
5.8. Phyllanthus emblica
Phyllanthus emblica L. (family: Euphorbiaceae, Ayurve-
dic name: ‘Amalaki’) is considered best among ‘Rasayana’
so called ‘Acharasayana’ (Puri, 2003). In ‘Ayurveda’, fresh
fruit is used in inflammation of the lungs and of the eyes as
a collyrium. The seeds are used in the treatment of asthma,
bronchitis, and biloiousness. The dried fruit is useful in hem-
orrhage, diarrhea, and dysentery. In combination with iron
it is used as a remedy for anemia, jaundice, and dyspepsia.
Acute bacillary dysentery may be cured by drinking a syrup
of amla with lemon juice. ‘Chyvanaprash’, a popular prepara-
tion containing Emblica officinalis, is very useful in anemia,
asthma, inflammations of the lungs and eye diseases (Kapoor,
2001). The active tannoids of Emblica officinalis consisting
of emblicanin A (37%), emblicanin B (33%), punigluconin
(12%) and pedunculagin (14%), administered in the doses of
5 and 10 mg/kg, i.p., and deprenyl (2 mg/kg, i.p.), induced an
increase in both frontal cortical and striatal SOD, CAT and
GSH-px activity, with concomitant decrease in LPO in brain
areas when administered once daily for 7 days (Bhattacharya
et al., 1999). Fresh juice of Emblica fruits (50 and 100 mg/kg
body weight) given orally twice daily for 14 days increased
the activities of cardiac SOD, CAT and GSH-px, with a con-
comitant decrease of LPO in Ischemia-reperfusion-induced
rats (Bhattacharya et al., 2002). Emblica officinalis inhibited
LPO induced with Fe(2+)/ascorbate along with inhibition of
hydoxyl and superoxide radical (Sabu and Kuttan, 2002). A
standardized extract of Emblica officinalis was found to have
172 R. Govindarajan et al. / Journal of Ethnopharmacology 99 (2005) 165–178
a long-lasting and broad-spectrum antioxidant activity, thus
showing that Emblica is suitable for use in anti-aging, sun-
screen and general purpose skin care products (Chaudhuri,
2002). Administration of Emblica tannoids (10 and 20 mg,
po) for 21 days, concomitant with the stress procedure, in-
duced a dose-related alteration in the stress effects. Thus,
antistress ‘Rasayana’ activity of Emblica officinalis may be,
at least partly due to its tendency to normalize stress-induced
perturbations in oxidative free radical scavenging activity
(Bhattacharya et al., 2000b). The presence of ‘Amlaki’ re-
sulted in an enhanced cell survival, decreased free radical
production and higher antioxidant levels (Sairam et al., 2003).
Emblica officinalis causes myocardial adaptation and protects
against oxidative stress in ischemic-reperfusion injury in rats
(Rajak et al., 2004).
5.9. Glycyrrhiza glabra
Glycyrrhiza glabra Linn. (family: Fabaceae, Ayurvedic
name: ‘Yashtimadhu’) is commonly known as licorice. In
Ayurveda, root in infusion, decoction, or extract is used
as a demulcent in inflammatory or irritable conditions of
the bronchial tubes, bowels, and catarrh of the genitouri-
nary passage, such as cough, hoarseness, sore throat, asthma
and dysuria (Kapoor, 2001). Seven constituents, with an-
tioxidant capacity were isolated from Glycyrrhiza glabra
which include isoflavans hispaglabridin A, hispaglabridin
B, glabridin, and 4 -O-methylglabridin, the two chalcones,
isoprenylchalcone derivative and isoliquiritigenin, and the
isoflavone, formononetin (Vaya et al., 1997). The effect of
the consumption of glabridin, an isoflavan isolated from
Glycyrrhiza glabra root, on the susceptibility of low den-
sity lipoprotein to oxidation was moderate in atherosclerotic
apolipoprotein E deficient mice (Belinky et al., 1998). Rab-
bits were treated (orally) with a preparation of Glycyrrhiza
glabra for 30 days and in parallel were exposed to vibration
stress (30 days). The licorice preparation reduced CAT activ-
ity in the peripheral blood and increased animal resistance to
vibration stress (Oganesyan, 2002). Five new prenylated di-
hydrostilbenes, ␣,␣ -dihydro-3,5,4 -trihydroxy-4,5 -diisop-
entenylstilbene, ␣,␣ -dihydro-3,5,3 ,4 -tetrahydroxy-4,5 -di-
isopentenylstilbene, ␣,␣ -dihydro-3,5,4 -trihydroxy-5 -isop-
entenylstilbene, ␣,␣ -dihydro-3,5,3 -trihydroxy-4 -methoxy-
5 -isopentenylstilbene, and ␣,␣ -dihydro-3,5,3 ,4 -tetrahyd-
roxy-5 -isopentenyl stilbene with antioxidant activity were
isolated (Biondi et al., 2003).
5.10. Picrorhiza kurroa
Picrorhiza kurroa Royle ex Benth (family: Scrophulari-
aceae, Ayurvedic name: ‘Kutki’), is found in the Himalayan
region growing at an altitude of 3000–5000 m. It is a well-
known herb in Ayurvedic system of medicine and has tradi-
tionally been used to treat disorders of the liver and upper res-
piratory tract, reduce fever and treat dyspepsia, chronic disor-
ders and scorpion sting (Jain, 1991). In bilious fever, a com-
pound decoction of its root, liquorice, raisins, and neem bark
is very curative; in dyspepsia with severe pains, the powder of
‘kutki’, Acorus calamus, chebulic myrobalan, and plumbago
root in equal parts is given in doses of 28 ml with cow’s urine.
In clinical studies on patients of infective hepatitis with jaun-
dice, Picrorhiza kurroa was reported to have led to a rapid fall
in serum bilirubin levels toward normal range and quicker
clinical recovery with no untoward effects. Picrorhiza kurroa
led to beneficial results in the management of bronchial
asthma. The drug is also reported to produce marked re-
duction in serum cholesterol and coagulation time (Kapoor,
2001). Picroliv, the active principle of Picrorhiza kurrooa,
and its main components which are a mixture of the iridoid
glycosides, picroside-I and kutkoside possess the properties
of antioxidants which appear to be mediated through activity
like that of SOD, metal ion chelation and xanthine oxidase
inhibition (Chander et al., 1992). The extract (1 mg/ml)
showed marked protection (up to 66.68%) against peroxi-
dation of liver phospholipids besides, reduced GSH showed
very encouraging activity. The extract also exhibited signif-
icant free radical scavenging activity (Govindarajan et al.,
2003c).
5.11. Psoralea corylifolia
Psoralea corylifolia Linn. (family: Leguminoceae,
Ayurvedic name: ‘Vakuchi’). In Ayurveda, seed powder
is used in leprosy and leukoderma internally; and is also
applied in the form of paste or ointment externally. As a
laxative it is particularly used in bilious disorders (Kapoor,
2001). A meroterpene and four flavonoids bakuchiol,
bavachinin, bavachin, isobavachin and isobavachalcone
were isolated from the seeds of Psoralea corylifolia as
antioxidative components. They showed broad antioxidative
activities in rat liver microsomes and mitochondria. They
inhibited NADPH-, ascorbate-, t-BuOH- and CCl4 -induced
LPO in microsomes. They also prevented NADH-dependent
and ascorbate-induced mitochondrial LPO (Haraguchi et
al., 2002). Psoralea corylifolia showed higher activity in
phospholipid peroxidation inhibition (Tang et al., 2004).
Bakuchiol, corylifolin, corylin and psoralidin isolated from
Psoralea corylifolia had strong antioxidant activities, and
especially psoralidin had stronger antioxidant property than
butylated hydroxy toluene (Jiangninga et al., 2005).
5.12. Semecarpus anacardium
Semecarpus anacardium Linn. f. (family: Anacardiaceae,
Ayurvedic name: Bhalatak) is commonly known as marking
nut. In ‘Ayurveda’, the juice of the shell of the nut is a power-
ful escharotic; it is given in small doses with some bland oil
or butter in leprous and scrofulous affections, syphilis, skin
diseases, epilepsy, nervous debility, neuralgia, asthma, dys-
pepsia, and piles. The bruised nut is used as an abortifacient
by placing it in the mouth of the uterus; also given as ver-
mifuge. Equal parts of marking nut and chebulic myrobalams
 R. Govindarajan et al. / Journal of Ethnopharmacology 99 (2005) 165–178
and sesamum seeds are made into a confection (‘Kshir pak’)
and administered in doses of 3–4 gm. It is used with advan-
tage in simple chromic enlargement of the spleen without
any hepatic complication or fever. It is used in many neurotic,
cardiac troubles; the rate of the heartbeat is usually increased
under its influence. It is also useful in cases of pneumonia
(Kapoor, 2001). Administration of Semecarpus anacardium
nut extract 150 mg/kg body weight for 14 days on adjuvant
arthritis brings back the altered antioxidant defense com-
ponents evidenced by the increased level of non-enzymatic
antioxidants (GSH, Vitamin E, Vitamin C) and enzymatic
antioxidants (CAT and GSH-px except SOD) to near normal
levels (Vijayalakshmi et al., 1997). Semecarpus anacardium
nut extract administration induces the in vivo antioxidant
defense system in aflatoxin B1 mediated hepatocellular car-
cinoma with marked increase in antioxidant levels and a dra-
matic elevation in cytochrome P450 content (Premalatha and
Sachdanandam, 1999). Alcoholic extract of pericarp showed
significant protection against FeSO4 -induced lipid peroxida-
tion, as compared with whole native nut and seeds. Mecha-
nism of action may be through metal chelation or activation
of endogenous antioxidant enzymes (Tripathi and Singh,
2001).
5.13. Terminalia chebula
Terminalia chebula Retz. (family: Combretaceae,
Ayurvedic name: ‘Haritaki’). In ‘Ayurveda’, myrobalans are
used in fevers, cough, asthma, urinary diseases, piles and
worms. It is also useful in chronic diarrhea and dysentery,
flatulence, vomiting, colic and enlarged spleen and liver.
Chebulic myrobalans are extensively used in combination
with belleric and embolic myrobalans under the name
of ‘Triphala’ and also as adjuncts to other medicines in
numerous diseases (Kapoor, 2001). As a ‘Rasayana’, 3 g
of ‘Haritaki’ is used in the morning in empty stomach for
body strengthening and anti-aging (Puri, 2003). Terminalia
chebula (fruits, brown) were stronger antioxidants than
alpha-tocopherol, while Terminalia chebula (fruit coat) and
Terminalia chebula (fruits, black) were weaker antioxidant
extracts than alpha-tocopherol and butylated hydroxy toluene
in inhibition of LPO in vitro (Saleem et al., 2001). Emblica
officinalis inhibited LPO induced with Fe(2+)/ascorbate
along with inhibition of hydoxyl radical, and superoxide
scavenging (Sabu and Kuttan, 2002). Terminalia chebula
showed maximum inhibition in the TBARS formation,
restore antioxidant enzyme SOD from the radiation-induced
damage (Naik et al., 2003). Terminalia chebula exhibited
antioxidant activity at different magnitudes of potency for
anti-LPO, anti-superoxide radical formation and free radical
scavenging activities (Cheng et al., 2003).
5.14. Tinospora cordifolia
Tinospora cordifolia (Willd.) Miers. (family: Menisper-
maceae, Ayurvedic name: ‘Guduchi’). In ‘Ayurveda’, the
173
starch obtained from the roots and stems of the plant is useful
in diarrhea and dysentery, it is also a nutrient. The fresh plant
is more efficacious than the dried plant. Its watery extract,
known as Indian quinine, is very effective in fevers due to cold
or indigestion; the plant is commonly used in rheumatism,
urinary diseases, dyspepsia, general debility, syphilis, skin
diseases, bronchitis, spermatorrhea, and impotence (Kapoor,
2001). As ‘Rasayana’, juice is given with honey or raw sugar
(Puri, 2003). Extract of Tinospora cordifolia has been shown
to inhibit the LPO and superoxide and hydroxyl radicals in
vitro (Mathew and Kuttan, 1997). Oral administration of an
aqueous Tinospora cordifolia root extract (2.5 and 5.0 g/kg)
for 6 weeks resulted in a decrease in the levels of plasma
TBARS, ceruloplasmin and ␣-tocopherol in alloxan diabetic
rats. The root extract also causes an increase in the levels
of GSH and vitamin C in alloxan diabetes rats (Prince and
Menon, 1999). Oral administration of 2.5 g and 5.0 g/kg body
weight of the aqueous extract of the roots for 6 weeks re-
sulted in a significant reduction in TBARS and an increase in
reduced GSH, CAT and SOD in alloxan diabetic rats (Prince
and Menon, 2001, Prince et al., 2004). The arabinogalactan
polysaccharide isolated from Tinospora cordifolia showed
good protection against iron-mediated LPO of rat brain ho-
mogenate as revealed by the TBARS and lipid hydroperoxide
assays and high reactivity towards DPPH, superoxide radi-
cals and the most damaging of radicals, the hydroxyl rad-
ical (Subramanian et al., 2002). Aqueous extract inhibited
the formation of ferryl–bipiridyl complex by chelating Fe2+
ions in a dose dependent manner. It also inhibited ferrous
sulphate mediated LPO in a dose-dependent manner (Goel
et al., 2002). Tinospora cordifolia was effective in elevating
the GSH levels, expression of the gamma-glutamylcysteine
ligase and Cu–Zn SOD genes and also exhibited strong free
radical scavenging properties against ROS and RNS as stud-
ied by electron paramagnetic resonance spectroscopy (Rawal
et al., 2004).
5.15. Withania somnifera
Withania somnifera Dunal (family: Solanaceae,
Ayurvedic name: ‘Ashwagandha’) has been in use for
more than 2500 years. The roots of the plant are categorised
as ‘Rasayanas’, a group of plant-derived drugs that are
reputed to promote health and longevity by augmenting
defense against disease, arresting the aging process, revi-
talising the body in debilitated conditions, increasing the
capability of the individual to resist adverse environmental
factors and creating a sense of mental well-being (Weiner
and Weiner, 1994). In ‘Ayurveda’, it is used as nerve tonic,
aphrodosiac, sedative, antirhuematism, for the treatment of
constipation. It relieves inflammation, pain, backache and
it stimulates sexual impulses and increases sperm count.
It is considered as a ‘Rasayana’ for strength, vigor and
rejuvenation. Powders of Withania (100 g) and Tinospora
(50 g) and Tinospora starch (10 g) are mixed and half a
spoon of this powder is taken with half teaspoons of ghee
174 R. Govindarajan et al. / Journal of Ethnopharmacology 99 (2005) 165–178
and two teaspoons of honey (Puri, 2003). Root is used as
an application in obstinate ulcers and rheumatic swelling. It
infuses fresh energy and vigor in a system worn out owing
to any constitutional disease like syphilis, and in rheumatic
fever. Powdered root is very useful with equal parts of ghee
and honey for impotence or seminal debility. As nutrient and
health restorative to the pregnant and old people, a decoction
of the root is recommended (Kapoor, 2001). Thirty days
treatment Withania somnifera root produced a significant
decrease in LPO, and an increase in both SOD and CAT thus
indicating that Ashwagandha root powder possesses free
radical scavenging activity (Panda and Kar, 1997). Active
glycowithanolides, sitoindosides VII-X and withaferin A of
Withania somnifera (10 and 20 mg/kg, i.p.), administered
once daily for 21 days, induced a dose-related increase
in SOD, CAT and GSH-px activity in frontal cortex and
striatum, which was statistically significant on days 14 and
21 (Bhattacharya et al., 1997). Administration of Withania
somnifera in the doses of 0.7 and 1.4 g/kg body weight per
day along with equivalent doses of lead acetate for 20 days
significantly decreased LPO and increased the activities of
antioxidant enzymes, viz., SOD and CAT, thus retaining
normal peroxidative status of the tissues (Chaurasia et al.,
2000). Withania somnifera glycowithanolides, administered
orally 1 h prior to the stress procedure for 21 days, in the
doses of 10, 20 and 50 mg/kg, induced a dose-related reversal
of the stress effects. Withania somnifera glycowithanolides
tended to normalise the augmented SOD and LPO activities
and enhanced the activities of CAT and GSH-px indicating
that, at least part of chronic stress-induced pathology may
be due to oxidative stress, lending support to the clinical
use of the plant as an antistress adaptogen (Bhattacharya et
al., 2001). Treatment with Withania somnifera successfully
attenuated GSH-px activity and inhibited LPO in a dose
dependent manner. Withania somnifera inhibited both the
LPO and protein oxidative modification induced by copper
(Gupta et al., 2003). The combination of extracts of Withania
somnifera and Aloe vera was more effective in reducing
oxidative damage in brain regions than the supplementation
of single plant extract (Parihar et al., 2004). Given the
increasing recognition that chronic stress, particularly when
the individual is unable to cope with the stressor, may
underlie the increasing incidence of stress-related physical
and mental disorders, there is need for an effective antistress
adaptogen. The answer probably lies in the ‘Ayurvedic’
‘Rasayana’, the most promising of which is Withania
somnifera (Weiner and Weiner, 1994).
5.16. Miscellaneous plants
Curculigo orchioides Gaertn. had high antioxidant ac-
tivity in 2,2 -azinobis[3-ethylbenzothiazoline-6-sulfonate]
(ABTS) assay (Tang et al., 2004). Hygrophila auriculata
(Schum.) Hiene. extract showed good radical scavenging
activity against DPPH with moderate scavenging activity
against Nitric oxide, hydroxyl radical, ferryl bipyridyl com-
plex and LPO (Vijayakumar et al., 2005). Alcoholic extract of
the seeds of Mucuna pruriens (Linn.) DC. has an antilipid per-
oxidation property, which is mediated through the removal of
superoxides and hydroxyl radicals (Tripathi and Upadhyay,
2002). The antioxidant components of Piper species, viz.,
Piper cubeba, green pepper, Piper brachystachyum, Piper
longum and Piper nigrum constitute a very efficient system
in scavenging a wide variety of reactive oxygen species. An-
tioxidant potential of Piper species was further confirmed by
their ability to curtail in vitro LPO by around 30–50% with
concomitant increase in GSH content (Karthikeyan and Rani,
2003). In ferric reducing/antioxidant power (FRAP)/DPPH
assays, boiled ethanolic extracts of Plumbago zeylanica L.
were the most effective, while in the ABTS assay boiled
aqueous extracts were the most efficient. These extracts also
significantly inhibited LPO induced by cumene hydroper-
oxide, ascorbate-Fe(2+) and peroxynitrite. Thus, Extracts
of Plumbago zeylanica and its active ingredient plumbagin
have significant antioxidant abilities that may possibly ex-
plain some of the reported therapeutic effects (Tilak et al.,
2004). ABTS assay showed that the ethanolic extract of Sida
cordifolia L. was found to be most potent along with rela-
tive antioxidant capacity for the water infusions and potent
inhibition of LPO. Evolvulus alsinoides and Cynodon dacty-
lon were also found to be moderately active (Auddy et al.,
2003).
6. Conclusion
Ayurvedic concept of ‘Rasayana’ seems not only to em-
body the principal aspects of new hypothesis centered on a
immuno-endocrine psycho neuro axis but also to go beyond
it by encompassing the entire human system with its diverse
and complicated immunoendocrine pathway (Handa, 1993).
It was well known to Ayurvedic physicians that the delicate
cellular machinery of the body suffers from trauma, result-
ing in wear and tear on different body structures and the
deterioration of the functional capacity. For this, procedures
of revitalization and rejuvenation (Rasayana therapy) were
adopted to increase the power of resistance to disease, these
procedures retarded advancement of aging also.
The data in the review of the plants for their antioxidant
activity so far prove that ‘Rasayana’ plants could exert a more
global and nonspecific antioxidant effect. However, it is also
evident that each plant is unique in its action and may be ex-
erting specific protective effects on specific organ/enzymes
more than others. There is also tremendous amount of reports
of the plants as antioxidants under various disease conditions
like diabetes, cancer, atherosclerosis and arthritis, proving
that the mechanism involved may be in curing these dis-
eases may be of antioxidants. From the review, it is evident
that most of the ‘Rasayana’ plants possess potent antioxi-
dant activity. But still there is lacuna in the existing knowl-
edge. Firstly, some ‘Rasayana’ group of plants like Alpinia
galanga, Argyreia speciosa, Boerhaavia diffusa, Convolvu-
 R. Govindarajan et al. / Journal of Ethnopharmacology 99 (2005) 165–178
lus pluricaulis, Myristica fragrans, Tribulus terrestris, Ferula
foetida, etc. which are used extensively in ‘Ayurveda’ have
not been tested for their antioxidant potential. Most of the
reports claim to validate the traditional claim of the plant as a
‘Rasayana’, but the proper mechanism of the action of these
plants is not clear.
Secondly, there are a number of preparations or formu-
lations, which are sold in the name of ‘Rasayana’, whose
activity, or the use has not been established. The ethnophar-
macological claims of these preparations need to be validated
to make them more acceptable. Also the method and mode
of the treatment mentioned in the Ayurvedic texts needs to
be understood before undertaking any biological screening.
Thirdly, clinical efficacy of these preparations though re-
ported by the continuous use by traditional practices has not
been scientifically validated. The personalized medicine is
still followed by Ayurveda, making it difficult for the global
acceptance, as the exact mechanism or indications for their
uses are not clear.
Thus, a more focused research and understanding is re-
quired to validate the ‘Rasayana’ drugs as antioxidants. There
are challenges ahead for researchers in ‘Ayurveda’ for vali-
dating the claims of the Ayurvedic treatment in the light of
the modern scientific knowledge and understanding, thereby
make the system globally acceptable. This requires a highly
integrated approach that combines the best of the traditional
wisdom and modern scientific knowledge and expertise.
Several studies are going on throughout the world to iden-
tify antioxidant compounds that are pharmacologically po-
tent with low profile of side effects. Ayurveda, the oldest
medical system in the world, provides lots of lead to find
active and therapeutically useful compounds from plants.
‘Rasayana’ formulations in Indian traditional medicine may
have antioxidant activity arising from individual plants, and
may act synergistically to prevent aging and related degenera-
tive diseases. Further studies to isolate active principles from
these plants and their pharmacological validation in terms of
modern medicine will be of great medicinal importance in
future.
References
Acuna, U.M., Atha, D.E., Ma, J., Nee, M.H., Kennelly, E.J., 2002. An-
tioxidant capacities of ten edible North American plants. Phytotherapy
Research 16, 63–65.
Agarwal, S.S., Singh, V.K., 1999. Immunomodulators: a review of studies
on Indian medicinal plants and synthetic peptides. Proceedings of
Indian Science Academy 65B, 179–204.
Arivazhagan, S., Velmurugan, B., Bhuvaneswari, V., Nagini, S., 2004.
Effects of aqueous extracts of garlic (Allium sativum) and neem
(Azadirachta indica) leaf on hepatic and blood oxidant–antioxidant
status during experimental gastric carcinogenesis. Journal of Medical
Food 7, 334–339.
Aruoma, O.I., 1993. Use of DNA damage as a measure of pro-oxidant
actions of antioxidant food additives and nutrient components. In:
Halliwell, B., Aruoma, O.I. (Eds.), DNA and Free Radicals. Ellis
Horwood, London, pp. 315–327.
175
Auddy, B., Ferreira, M., Blasina, F., Lafon, L., Arredondo, F., Dajas, F.,
Tripathi, P.C., Seal, T., Mukherjee, B., 2003. Screening of antioxidant
activity of three Indian medicinal plants, traditionally used for the
management of neurodegenerative diseases. Journal of Ethnopharma-
cology 84, 131–138.
Bandhopadhyay, U., Das, D., Banerjee, R.K., 1999. Reactive oxygen
species: oxidative damage and pathogenesis. Current Science 77,
658–666.
Baynes, J.W., Thorpe, S.R., 1999. Role of oxidative stress in diabetic
complications: a new perspective on an old paradigm. Diabetes 48,
1–9.
Belinky, P.A., Aviram, M., Fuhrman, B., Rosenblat, M., Vaya, J., 1998.
The antioxidative effects of the isoflavan glabridin on endogenous
constituents of LDL during its oxidation. Atherosclerosis 137, 49–61.
Bhattacharya, A., Chatterjee, A., Ghosal, S., Bhattacharya, S.K., 1999.
Antioxidant activity of active tannoid principles of Emblica officinalis
(amla). Indian Journal of Experimental Biology 37, 676–680.
Bhattacharya, A., Ghosal, S., Bhattacharya, S.K., 2000b. Antioxidant ac-
tivity of tannoid principles of Emblica officinalis (amla) in chronic
stress induced changes in rat brain. Indian Journal of Experimental
Biology 38, 877–880.
Bhattacharya, A., Ghosal, S., Bhattacharya, S.K., 2001. Antioxidant effect
of Withania somnifera glycowithanolides in chronic footshock stress-
induced perturbations of oxidative free radical scavenging enzymes
and lipid peroxidation in rat frontal cortex and striatum. Journal of
Ethnopharmacology 74, 1–6.
Bhattacharya, S.K., Bhattacharya, A., Kumar, A., Ghosal, S., 2000a. An-
tioxidant activity of Bacopa monniera in rat frontal cortex, striatum
and hippocampus. Phytotherapy Research 14, 174–179.
Bhattacharya, S.K., Bhattacharya, A., Sairam, K., Ghosal, S., 2002. Effect
of bioactive tannoid principles of Emblica officinalis on ischemia-
reperfusion-induced oxidative stress in rat heart. Phytomedicine 9,
171–174.
Bhattacharya, S.K., Satyan, K.S., Ghosal, S., 1997. Antioxidant activ-
ity of glycowithanolides from Withania somnifera. Indian Journal of
Experimental Biology 35, 236–239.
Biondi, D.M., Rocco, C., Ruberto, G., 2003. New dihydrostilbene deriva-
tives from the leaves of Glycyrrhiza glabra and evaluation of their
antioxidant activity. Journal of Natural Products 66, 477–480.
Brahma, S.K., Debnath, P.K., 2003. Therapeutic importance of Rasayana
drugs with special reference to their multi-dimensional actions.
Aryavaidyan 16, 160–163.
Brownlee, M., Vlassara, H., Cerami, A., 1984. Non-enzymic glycosylation
and the pathogenesis of diabetic complications. Annals of Internal
Medicine 101, 527–530.
Cerutti, P.A., 1994. Oxy-radicals and cancer. Lancet 344, 862.
Chander, R., Kapoor, N.K., Dhawan, B.N., 1992. Picroliv, picroside-I
and kutkoside from Picrorhiza kurroa are scavengers of superoxide
anions. Biochemical Pharmacology 44, 180–183.
Chaudhuri, R.K., 2002. Emblica cascading antioxidant: a novel natural
skin care ingredient. Skin Pharmacology and Applied Skin Physiology
15, 374–380.
Chaurasia, S.S., Panda, S., Kar, A., 2000. Withania somnifera root extract
in the regulation of lead-induced oxidative damage in male mouse.
Pharmacological Research 41, 663–666.
Cheng, H.Y., Lin, T.C., Yu, K.H., Yang, C.M., Lin, C.C., 2003. Antiox-
idant and free radical scavenging activities of Terminalia chebula.
Biological and Pharmaceutical Bulletin 26, 1331–1335.
Chopra, R.N., Nayar, S.L., Chopra, I.C., 1956. Glossary of Indian Medic-
inal Plants. CSIR Publication, New Delhi, India, p. 84.
Devaraj, T.L., 1980. The Panckarma Treatment of Ayurveda. India Book
Centre, Delhi, India.
Diwedi, K.K., Singh, R.H., 1992. A clinical study of Medhya ‘Rasayana’
therapy in the management of convulsive disorders. Journal of Re-
search in Ayurvedha and Sidha 13, 97–106.
Dringen, R., 2000. Glutathione metabolism and oxidative stress in neu-
rodegenration. European Journal of Biochemistry 267, 49–103.
176 R. Govindarajan et al. / Journal of Ethnopharmacology 99 (2005) 165–178
Ferrari, C.K.B., 2001. Oxidative stress pathophysiology: searching for
an effective antioxidant protection. International Medical Journal 8,
175–184.
Finkel, T., Holbrook, N.J., 2000. Oxidants, oxidative stress and biology
of ageing. Nature 408, 239–247.
Ghanekar, B.G., 1981. Sutrasthana. In: Sushrut Samhita. Motilal Banarasi-
das, Varanasi, p. 3.
Goel, H.C., Prem Kumar, I., Rana, S.V., 2002. Free radical scaveng-
ing and metal chelation by Tinospora cordifolia, a possible role in
radioprotection. Indian Journal of Experimental Biology 40, 727–
734.
Govindarajan, R., Agnihotri, A.K., Khatoon, S., Rawat, A.K.S., Mehro-
tra, S., 2003a. Pharmacognostical evaluation of an antioxidant
plant—Acorus calamus. Natural Product Sciences 9, 264–269.
Govindarajan, R., Rastogi, S., Vijayakumar, M., Rawat, A.K.S., Shir-
waikar, A., Mehrotra, S., Pushpangadan, P., 2003b. Studies on the
antioxidant activities of Desmodium gangeticum. Biological and Phar-
maceutical Bulletin 26, 1424–1427.
Govindarajan, R., Vijayakumar, M., Rawat, A.K.S., Mehrotra, S., 2003c.
Free radical scavenging potential of Picrorhiza kurroa Royle ex Benth.
Indian Journal of Experimental Biology 41, 875–879.
Govindarajan, R., Vijayakumar, M., Rao, Ch.V., Kumar, V., Rawat,
A.K.S., Pushpangadan, P., 2004. Action of Asparagus racemosus
against streptozotocin-induced oxidative stress. Natural Product Sci-
ences 10, 177–181.
Grankvist, K., Marklfund, S., Taljedal, I.B., 1981. Superoxide dismutase
is prophylactic against alloxan diabetes. Nature 294, 158–161.
Gupta, S.K., Dua, A., Vohra, B.P., 2003. Withania somnifera (Ashwa-
gandha) attenuates antioxidant defense in aged spinal cord and inhibits
copper induced lipid peroxidation and protein oxidative modifications.
Drug Metabolism and Drug Interaction 19, 211–222.
Halliwell, B., Gutteridge, J.M.C., 1999. Antioxidant defenses. In: Free
Radicals in Biology and Medicine, third ed. Oxford University Press,
New York, p. 175.
Hanachi, P., Fauziah, O., Peng, L.T., Wei, L.C., Nam, L.L., Tian, T.S.,
2004. The effect of Azadirachta indica on distribution of antioxidant
elements and glutathione S-transferase activity in the liver of rats
during hepatocarcinogenesis. Asia Pacific Journal of Clinical Nutrition
13, S170.
Handa, S.S., 1993. ‘Rasayana’ drugs. Part I. Pharma Times 25, 9–15.
Hanna, A.N., Kauffman, E.M., Newman, H.A., Sharma, H.M., 1994. Pre-
vention of oxidant stress by Student Rasayana (SR). Advanced Ex-
perimental Medical Biology 366, 444–445.
Haraguchi, H., Inoue, J., Tamura, Y., Mizutani, K., 2002. Antioxidative
components of Psoralea corylifolia (Leguminosae). Phytotherapy Re-
search 16, 539–544.
Harman, D., 1998. Aging: phenomenon and theories. American New York
Academy of Sciences 854, 1–7.
Heinrich, M., Gibbons, S., 2001. Ethnopharmacology in drug discovery:
an analysis of its role and potential contributions. Journal of Pharmacy
and Pharmacology 53, 425–432.
Hogg, N., 1998. Free radicals in disease. Seminar in Reproductive En-
docrinology 16, 241–248.
Hu, Y., Xu, J., Hu, Q., 2003. Evaluation of antioxidant potential of Aloe
vera (Aloe barbadensis Miller) extracts. Journal of Agricultural Food
Chemistry 51, 7788–7791.
Hunt, J.V., Smith, C.C.T., Wolff, S.P., 1990. Auto-oxidative glycosyla-
tion and possible involvement of peroxides and free radicals in LDL
modification by glucose. Diabetes 39, 1420–1424.
Jain, S.K., 1991. Dictionary of Indian Folk Medicine and Ethnobotany.
Deep Publications, New Delhi.
Jayaram, S., Walwaikar, P.P., Rajadhyaksha, S.S., 1993. Evaluation of
efficacy of a preparation containing a combination of Indian medicinal
plants in patients of generalized weakness. Indian Drugs 30, 498–500.
Jiangninga, G., Xinchu, W., Houb, W., Qinghuab, L., Kaishuna, B., 2005.
Antioxidants from a Chinese medicinal herb—Psoralea corylifolia L.
Food Chemistry 91, 287–292.
Joshi, S., 1998. Ayurveda and ‘Panchkarma’. Motilal Banarasidas Pub-
lishers, Delhi, India.
Kamat, J.P., Boloor, K.K., Devasagayam, T.P., Venkatachalam, S.R.,
2000. Antioxidant properties of Asparagus racemosus against dam-
age induced by gamma-radiation in rat liver mitochondria. Journal of
Ethnopharmacology 71, 425–435.
Kapoor, L.D., 2001. Hand book of Ayurvedic Medicinal plants. CRC
Press, Washington, DC, pp. 18–19.
Karthikeyan, J., Rani, P., 2003. Enzymatic and non-enzymatic antioxidants
in selected Piper species. Indian Journal of Experimental Biology 41,
135–140.
Krane, S.M., Conca, W., Stephenson, M.I., Amento, E.P., Goldring, M.B.,
1990. Mechanisms of matrix degradation in rheumatoid arthritis. An-
nals of the New York Academy of Sciences 580, 340–354.
Kumar, P., Kuttan, R.V., Kuttan, G.G., 1994. Chemoprotective action of
‘Rasayana’ against cyclophosphamide toxicity. Tumori 80, 306–308.
Lee, K.Y., Weintraub, S.T., Yu, B.P., 2000. Isolation and identification of
a phenolic antioxidant from Aloe barbadensis. Free Radical Biology
and Medicine 28, 261–265.
Lefkowitz, D.L., Gelderman, M.P., Fuhrmann, S.R., Graham, S., Starnes,
J.D., Lefkowitz, S.S., Bollen, A., Moguilevsky, N., 1999. Neu-
trophilic lysozyme-macrophage interactions perpetuate chronic inflam-
mation associated with experimental arthritis. Clinical Immunology
91, 145–155.
Li, Y., Trush, M.A., 1994. Reactive oxygen dependent DNA damage
resulting from the oxidation of phenolic compounds by a copper redox
cycle. Cancer Research 54, 1895s–1898s.
Marnett, L.J., 1987. Peroxyl free radicals: potential mediators of tumor
initiation and promotion. Carcinogenesis 8, 1365.
Mathew, S., Kuttan, G., 1997. Antioxidant activity of Tinospora cordifolia
and its usefulness in the amelioration of cyclophosphamide induced
toxicity. Journal of Experimental and Clinical Cancer Research 16,
407–411.
Mecocci, P., Polidori, M.C., Troiano, L., Cherubini, A., Cecchetti, R.,
Pini, G., 2000. Plasma antioxidants and longevity: a study on health
centenarians. Free Radical Biology and Medicine 28, 1243–1248.
Miller, M.J., Sadowska, K.H., Chotinaruemol, S., Kakkis, J.L., Clark,
D.A., 1992. Amelioration of chronic ileitis by nitric oxide synthase
inhibition. Journal of Pharmacology and Experimental Therapeutics
264, 11–16.
Mitchinson, M.J., Ball, R.Y., 1987. Macrophages and atherogenesis.
Lancet 2, 146–148.
Nadkarni, A.K., 1976. Nadkarni’s Indian Materia Medica, vol. 1. Popular
Prakashan, Bombay, p. 153.
Naik, G.H., Priyadarsini, K.I., Satav, J.G., Banavalikar, M.M., Sohoni,
D.P., Biyani, M.K., Mohan, H., 2003. Comparative antioxidant ac-
tivity of individual herbal components used in Ayurvedic medicine.
Phytochemistry 63, 97–104.
Nose, K., 2000. Role of reactive oxygen species in regulation of physio-
logical functions. Biological and Pharmaceutical Bulletin 23, 897–903.
Oganesyan, K.R., 2002. Antioxidant effect of licorice root on blood cata-
lase activity in vibration stress. Bulletin of Experimental Biology and
Medicine 134, 135–136.
Panda, S., Kar, A., 1997. Evidence for free radical scavenging activity of
Ashwagandha root powder in mice. Indian Journal of Physiology and
Pharmacology 41, 424–426.
Parihar, M.S., Chaudhary, M., Shetty, R., Hemnani, T., 2004. Suscep-
tibility of hippocampus and cerebral cortex to oxidative damage in
streptozotocin treated mice: prevention by extracts of Withania som-
nifera and Aloe vera. Jouranl of Clinical Neuroscience 11, 397–402.
Parihar, M.S., Hemnani, T., 2003. Experimental excitotoxicity provokes
oxidative damage in mice brain and attenuation by extract of Aspara-
gus racemosus. Journal of Neural Transmission 111, 1–12.
Parotta, J.A., 2001. Healing Plants of Peninsular India. CABI Publishing,
Oxon, UK, pp. 106–107.
Premalatha, B., Sachdanandam, P., 1999. Semecarpus anacardium L. nut
extract administration induces the in vivo antioxidant defence sys-
 R. Govindarajan et al. / Journal of Ethnopharmacology 99 (2005) 165–178
tem in aflatoxin B1 mediated hepatocellular carcinoma. Journal of
Ethnopharmacology 66, 131–139.
Prince, P.S., Kamalakkannan, N., Menon, V.P., 2004. Restoration of an-
tioxidants by ethanolic Tinospora cordifolia in alloxan-induced dia-
betic Wistar rats. Acta Poloniae Pharmaceutica 61, 283–287.
Prince, P.S., Menon, V.P., 1999. Antioxidant activity of Tinospora cordi-
folia roots in experimental diabetes. Journal of Ethnopharmacology
65, 277–281.
Prince, P.S., Menon, V.P., 2001. Antioxidant action of Tinospora cordi-
folia root extract in alloxan diabetic rats. Phytotherapy Research 15,
213–218.
Puri, H.S., 1970a. Indian medicinal plants use in elixirs and tonics. Quar-
terly Journal of Crude Drug Research 10, 1555–1566.
Puri, H.S., 1970b. Chavanprasha – an ancient Indian preparation for res-
piratory diseases. Indian Drugs 7, 15–16.
Puri, H.S., 1971. Vegetable aphrodisiacs of India. Quarterly Journal of
Crude Drug Research 11, 1742–1748.
Puri, H.S., 1972. Aphrodisiacs in India. Indian Drugs 9, 11–14.
Puri, H.S., 2003. ‘Rasayana’—Ayurvedic herbs for longevity and rejuve-
nation. Taylor and Francis, London.
Rajak, S., Banerjee, S.K., Sood, S., Dinda, A.K., Gupta, Y.K., Gupta,
S.K., Maulik, S.K., 2004. Emblica officinalis causes myocardial adap-
tation and protects against oxidative stress in ischemic-reperfusion
injury in rats. Phytotherapy Research 18, 54–60.
Rao, A.D., Devi, K.N., Thyagaraju, K., 1998. Isolation of antioxidant
principle from Azadirachta seed kernels: determination of its role on
plant lipoxygenases. Journal of Enzyme Inhibition 4, 85–96.
Rawal, A.K., Muddeshwar, M.G., Biswas, S.K., 2004. Rubia cordifolia
Fagonia cretica linn and Tinospora cordifolia exert neuroprotection by
modulating the antioxidant system in rat hippocampal slices subjected
to oxygen glucose deprivation. BMC Complementary and Alternative
Medicine 4, 11.
Rege, N.N., Thatte, U.M., Dahanukar, S.A., 1999. Adaptogenic proper-
ties of six Rasayana herbs used in Ayurvedic medicine. Phytotherapy
Research 13, 275–291.
Rekha, P.S., Kuttan, G., Kuttan, R., 2001. Effect of brahma rasayana
on antioxidant system after radiation. Indian Journal of Experimental
Biology 39, 1173–1175.
Rohini, G., Sabitha, K.E., Devi, C.S., 2004. Bacopa monniera Linn. ex-
tract modulates antioxidant and marker enzyme status in fibrosarcoma
bearing rats. Indian Journal of Experimental Biology 42, 776–780.
Russo, A., Izzo, A.A., Borrelli, F., Renis, M., Vanella, A., 2003. Free
radical scavenging capacity and protective effect of Bacopa monniera
L. on DNA damage. Phytotherapy Research 17, 870–875.
Saada, H.N., Ussama, Z.S., Mahdy, A.M., 2003. Effectiveness of Aloe
vera on the antioxidant status of different tissues in irradiated rats.
Pharmazie 58, 929–931.
Sabu, M.C., Kuttan, R., 2002. Anti-diabetic activity of medicinal plants
and its relationship with their antioxidant property. Journal of
Ethnopharmacology 81, 155–160.
Sairam, M., Neetu, D., Deepti, P., Vandana, M., Ilavazhagan, G., Kumar,
D., Selvamurthy, W., 2003. Cytoprotective activity of Amla (Emblica
officinalis) against chromium (VI) induced oxidative injury in murine
macrophages. Phytotherapy Research 17, 430–433.
Saleem, A., Ahotupa, M., Pihlaja, K., 2001. Total phenolics concentration
and antioxidant potential of extracts of medicinal plants of Pakistan.
Zeitschrift für Naturforschung C 56, 973–978.
Scartezzini, P., Speroni, E., 2000. Review on some plants of Indian tra-
ditional medicine with antioxidant activity. Journal of Ethnopharma-
cology 71, 23–43.
Schulz, J.B., Lindnau, J., Seyfriend, J., Dichgans, J., 2000. Glutathione
oxidative stress and neuro-degeneration. European Journal of Bio-
chemistry 267, 4904–4911.
Seiss, H., 1991. Oxidative stress: from basic research to clinical applica-
tions. American Journal of Medicine 91, 375–385.
Sharma, H.M., Hanna, A.N., Kauffman, E.M., Newman, H.A.I., 1992. In-
hibition of human low-density lipoprotein oxidation in vitro by Ma-
177
harishi Ayurveda herbal mixtures. Pharmacology Biochemistry and
Behavior 43, 1175–1182.
Sharma, P., 1983. Chikithsasthana. In: Charaka Samhita. Chaukhamba
Orientalia, Varanasi.
Singh, R.H., Murhty, A.R.V., 1989. Medhya ‘Rasayana’ therapy in the
management of Apsmara viz-a-viz epilepsies. Journal of Research and
Education in Indian Medicine 8, 13–16.
Singh, R.P., Banerjee, S., Rao, A.R., 2001. Modulatory influence of An-
drographis paniculata on mouse hepatic and extrahepatic carcinogen
metabolizing enzymes and antioxidant status. Phytotherapy Research
15, 382–390.
Subapriya, R., Kumaraguruparan, R., Abraham, S.K., Nagini, S., 2004.
Protective effects of ethanolic neem leaf extract on N-methyl-N -nitro-
N-nitrosoguanidine-induced genotoxicity and oxidative stress in mice.
Drug Chemistry and Toxicology 27, 15–26.
Subapriya, R., Kumaraguruparan, R., Chandramohan, K.V., Nagini,
S., 2003. Chemoprotective effects of ethanolic extract of neem
leaf against MNNG-induced oxidative stress. Pharmazie 58, 512–
517.
Subramanian, M., Chintalwar, G.J., Chattopadhyay, S., 2002. Antioxi-
dant properties of a Tinospora cordifolia polysaccharide against iron-
mediated lipid damage and gamma-ray induced protein damage. Re-
dox Reports 7, 137–143.
Tang, S.Y., Whiteman, M., Peng, Z.F., Jenner, A., Yong, E.L., Halliwell,
B., 2004. Characterization of antioxidant and antiglycation properties
and isolation of active ingredients from traditional chinese medicines.
Free Radical Biology and Medicine 36, 1575–1587.
Tilak, J.C., Adhikari, S., Devasagayam, T.P., 2004. Antioxidant proper-
ties of Plumbago zeylanica, an Indian medicinal plant and its active
ingredient, plumbagin. Redox Reports 9, 219–227.
Trikamji, Y. (Ed.), 1994. Shushruta Samhita. Chaukhambha Surbharathi
Prakasan, Varanasi, India.
Tripathi, Y.B., Chaurasia, S., Tripathi, E., Upadhyay, A., Dubey, G.P.,
1996. Bacopa monniera Linn. as an antioxidant: mechanism of action.
Indian Journal of Experimental Biology 34, 523–526.
Tripathi, Y.B., Singh, A.V., 2001. Effect of Semecarpus anacardium nuts
on lipid peroxidation. Indian Journal of Experimental Biology 39,
798–801.
Tripathi, Y.B., Upadhyay, A.K., 2002. Effect of the alcohol extract of
the seeds of Mucuna pruriens on free radicals and oxidative stress in
albino rats. Phytotherapy Research 16, 534–538.
Trivedi, N.P., Rawal, U.M., 2001. Hepatoprotective and antioxidant prop-
erty of Andrographis paniculata (Nees) in BHC induced liver damage
in mice. Indian Journal of Experimental Biology 39, 41–46.
Udupa, K.N., 1973. Psychosomatic stress in ‘Rasayana’. Journal of Re-
search in Indian Medicine 8, 1–2.
Valentao, P., Fernndes, E., Canvalho, E., Andrade, P.B., Seabra, R.M.,
Bastos, M.L., 2002. Antioxidant activity of Hypericum androsaenium
infusion scavenging effect on superoxide radical, hydroxyl radical
and hypochlorous acid. Biological and Pharmaceutical Bulletin 25,
1324–1327.
Vaya, J., Belinky, P.A., Aviram, M., 1997. Antioxidant constituents from
licorice roots: isolation, structure elucidation and antioxidative capac-
ity toward LDL oxidation. Free Radical Biology and Medicinedkjdot
23, 302–313.
Vijayakumar, M., Govindarajan, R., Shirwaikar, A., Kumar, V., Rawat,
A.K.S., Mehrotra, S., Pushpangadan, P., 2005. Free radical scavenging
and lipid peroxidation inhibition potential of Hygrophila auriculata.
Natural Product Sciences. 11, 61–66.
Vijayalakshmi, T., Muthulakshmi, V., Sachdanandam, P., 1997. Salubrious
effect of Semecarpus anacardium against lipid peroxidative changes in
adjuvant arthritis studied in rats. Molecular and Cellular Biochemistry
175, 65–69.
Wagner, H., 1994. Therapy and Prevention with Immunomodulatory and
Adaptogenic Plant Drugs. Update – Ayurveda, Bombay, pp. 24–26.
Weiner, M.A., Weiner, J., 1994. Ashwagandha (Indian ginseng). In: Herbs
that heal. Quantum Books, Mill Vallery, pp. 70–72.
178 R. Govindarajan et al. / Journal of Ethnopharmacology 99 (2005) 165–178
Wiboonpun, N., Phuwapraisirisan, P., Tip-pyang, S., 2004. Identification
of antioxidant compound from Asparagus racemosus. Phytotherapy
Research 18, 771–773.
Wolff, S.P., Dean, R.T., 1987. Glucose auto-oxidation and protein modi-
fication: the potential role of autooxidative glycosylation in diabetes.
Biochemical Journal 245, 243–246.
Yagi, A., Kabash, A., Okamura, N., Haraguchi, H., Moustafa, S.M.,
Khalifa, T.I., 2002. Antioxidant, free radical scavenging and anti-
inflammatory effects of aloesin derivatives in Aloe vera. Planta Medica
68, 957–960.
Yokoda, M., Kitta, T., Kikawa, Y., Ogorochi, T., Narumiya, S., Kawai,
C., 1988. Stimulated arachidonate metabolism during foam cell
transformation of mouse peritoneal macrophages with oxidized
low density lipoprotein. Journal of Clinical Investigation 81, 720–
729.
Yoshikawa, T., Naito, Y., 2000. The role of neutrophils and inflammation
in gastric mucosal injury. Free Radical Research 33, 785–794.
Zhang, X.F., Tan, B.K., 2000. Antihyperglycaemic and antioxidant prop-
erties of Andrographis paniculata in normal and diabetic rats. Clinical
and Experimental Pharmacology and Physiology 27, 358–363.
 Journal of Ethnopharmacology 99 (2005) 179–184

Protective effect of Khamira Abresham Uood Mastagiwala against free

radical induced damage in focal cerebral ischemia
Seema Yousuf, Sofiyan Salim 1 , Muzamil Ahmad 1 ,
Abdullah Shafique Ahmed 1 , Mubeen Ahmed Ansari, Fakhrul Islam ∗
Neurotoxicology Laboratory, Department of Medical Elementology and Toxicology, Jamia Hamdard (Hamdard University),
Hamdard Nagar, New Delhi 110062, India

Received 23 October 2004; received in revised form 5 December 2004; accepted 10 December 2004
Available online 7 April 2005

Abstract

The effect of Khamira Abresham Uood Mastagiwala (KAUM) (a preparation of Indian System of Unani Medicine) on the activity of
antioxidant enzymes, glutathione reductase (GR), glutathione S-transferase (GST), glutathione peroxidase (GPx), catalase (CAT) and the
content of glutathione (GSH) and thiobarbituric acid reactive substances (TBARS) was studied in the middle cerebral artery occluded (MCAO)
rats after 15 days pretreatment (200 mg/kg body weight (b.wt.), orally) of Khamira Abresham Uood Mastagiwala. The rats were trained and
assessed for neurobehavioral activity using Cook’s climbing pole. The middle cerebral artery of adult male Wistar rats was occluded for 2 h
and reperfused for 22 h. The activity of GPx, GST, GR, catalase and content of GSH was decreased significantly in MCAO group as compared
with sham. The rats of MCAO + KAUM group have shown a significant protection in the activity of above-mentioned antioxidant enzymes
and content of glutathione when compared with MCAO group. The significantly elevated level of TBARS in MCAO group was depleted
significantly by the pretreatment of animals with KAUM in MCAO group. The neurobehavioral assessment has also strengthened the above
biochemical data thereby indicating that the therapeutic intervention of KAUM, which is a potent cardiac and melancholic tonic, can be used
to prevent or reduce the deterioration caused by free radicals thereby preventing subsequent pathological and biochemical changes which
occur during cerebral ischemia.
© 2005 Elsevier Ireland Ltd. All rights reserved.

Keywords: Cerebral ischemia; Khamira Abresham Uood Mastagiwala; Free radicals; Antioxidant enzymes; Cook’s climbing pole

1. Introduction ischemic damage. Also, Shah and Vohora (2002) reported

Traditional herbs have potentials for preventing patho-
logical outcome of neurodegenerative diseases (Ichikawa
and Tetsuya, 2002). Several studies reported the effect of
traditional herbs on free radicals induced damage in cerebral
ischemia. Likewise, Salim et al. (2003) have shown the
protective effect of Nardostachys jatamansi on cerebral
∗ Corresponding author. Tel.: +91 11 2605 9688x5567;
fax: +91 11 2605 9663; mobile: 9818684535.
E-mail addresses: drislamf@yahoo.co.in, fislam@jamiahamdard.ac.in
(F. Islam).
1 Present address: Department of Anesthesia, Critical Care Medicine,
Johns Hopkins University School of Medicine, 600 North Wolfe Street,
Blalock 1404-A, Baltimore, MD 21287, USA.
the protective effect of Swarna Bhasma and Unani Kushta
Tila Kalan on cerebral ischemia induced oxidative damage.
One of the myriad of events following cerebral ischemia is
oxidative stress which poses a threat to the brain environment
(Chan, 2001). Reactive oxygen species (ROS) have been im-
plicated in the pathophysiology of many neurological disor-
ders and brain dysfunctions (Chan, 2001). Cellular functions
are critically altered with increased production of free radi-
cals after brain injury, which are generated through different
cellular pathways (Lewen et al., 2000). Increased vulnerabil-
ity of brain to oxidative damage leads to the impairment of
brain antioxidant systems after ischemia/reperfusion, which
are responsible for failure of cerebral energy metabolism
(Pulsinelli et al., 1982). Abrupt loss of neurological functions

0378-8741/$ – see front matter © 2005 Elsevier Ireland Ltd. All rights reserved.
doi:10.1016/j.jep.2004.12.035
180 S. Yousuf et al. / Journal of Ethnopharmacology 99 (2005) 179–184

like memory dysfunction is also reported during cerebral
ischemia (Hirakawa et al., 1994). Although, many synthetic
drugs have been reported to possess therapeutic effects
against cerebral ischemia (Chan, 2001; Montoliu et al.,
2002) but its complete treatment is yet obscure.
Khamira Abresham Uood Mastigiwala (KAUM), a com-
pound formulation used in the Indian System of Unani
Medicine since ages, is extensively used in the treatment of
arrhythmia, palpitation and cardiac debility, effectively stim-
ulates the functioning of all the basic organs of the body
(Kabeer, 1951). The efficacy of KAUM on oxidative stress
related parameters have not been scientifically explored. The
properties of this Unani drug have created our interest to study
its possible neuroprotective implications in the stroke.
2. Material and methods
2.1. Drugs and chemicals
Glutathione (GSH) (oxidized and reduced), nicotinamide
adenine dinucleotide phosphate reduced form (NADPH), 1-
chloro-2,4-dinitrobenzene (CDNB), 5-5 -dithiobis-2-nitro-
benzoic acid (DTNB) and thiobarbituric acid (TBA) were
purchased from Sigma–Aldrich Foreign Holding Chemical
Company, India. Other chemicals were of analytical reagent
grade. Khamira Abresham Uood Mastagiwala was procured
from M/s Hamdard (Waqf) Laboratories, Gaziabad, U.P.,
India.
2.2. The recipe of the Unani formulation “Khameera
Abreesham Uood Mastagiwala”
added. Then mastagi, musk, uood, marwareed, amber (each
8 g), badranjaboya 84 g and sugar 1.2 kg were added to the
water and boiled till the content was reduced to 1/4 that
gives concentrated thick syrup. Thereafter, yaqoot, marjan
and yashab (each 4 g) were crushed and made a paste in rose
water and mixed thoroughly in the above-mentioned thick
cold syrup (Table 1).
2.3. Animals
Male Wistar rats weighing 300–350 g were obtained from
the Central Animal House, Jamia Hamdard, New Delhi. They
were housed in polypropylene cages in air conditioned room
and allowed free access to pelletted diet and water ad libitum.
The animals were used in accordance with the procedure ap-
proved by the Animal Ethics Committee of Jamia Hamdard.
2.4. Experimental protocol
Animals were divided into four groups each having eight
animals for a period of 15 days. The first group served as
sham and saline was given orally, second was middle cerebral
artery occluded (MCAO), i.e., ischemia was induced for 2 h
followed by reperfusion for 22 h, third was pretreated for 15
days with KAUM (200 mg/kg, orally) followed by MCAO for
2 h and reperfusion for 22 h, i.e., MCAO + KAUM group, and
fourth was pretreated for 15 days with drug alone, i.e., KAUM
(200 mg/kg, orally). After the completion of the reperfusion
period, the animals were assessed for neurobehavioral activ-
ity and then sacrificed. The brains were taken out to dissect
hippocampus for biochemical estimations.
2.5. Induction of ischemia

A red hot gold piece and a red hot iron rod were immersed The right middle cerebral artery occlusion was pro-
in 4 l of water for 1 min. Thereafter, Abresham (408 g) was duced using an intraluminal filament model as described by

Table 1
Constituents of Khameera Abresham Uood Mastagiwala (KAUM)
S. no. Name Family name Origin Content g/10 g Clinical importance
1 Abresham Bombycidae (Bombyx Animal 0.15 Strengthens/vitalizes/relaxes/stimulates heart muscles,
(Silk Cocoon) Mori Linn) nervine tonic, memory enhancer, bronchodilator,
vasodilator (Sifiuddin, 1999)
2 Uood (Eagle-wood) Liliaceae Plant 0.01 Stimulant, cholagogue, deobstructant, nervine tonic,
carminative (Sifiuddin, 1999).
3 Badranjiboya Labiatae (Lamiaceae) Plant 1.14 Strengthens heart, exhilarant, melancholic disorders,
(Mountain Balm) nervine tonic (Sifiuddin, 1999).
4 Amber (Ambergris) Araucariaceae Plant 0.02 Exhilarant, stimulant, antiseptic, nervous debility,
delirium, epilepsy (Sifiuddin, 1999).
5 Mastagi (Mastich) Pistaciaceae Plant 0.01 Stimulant, catarrh, astringent (Sifiuddin, 1999).
6 Marjan (Coral) Acroporidea Animal 0.03 Nervine tonic, vertigo, headache, giddiness, asthma,
scrofulous afflictions, T.B. (Sifiuddin, 1999).
7 Kehruba (Vateria) Dipterocarpaceae Plant 0.03 Antibacterial, carminative (Rafiquddin, 1995)
8 Marwareed (Pearl) Pteriacea Mineral 0.05 Stimulant, nutritive, tones heart & brain muscles,
epilepsy, asthma (Deshaprabhu, 1982; Sifiuddin, 1999).
9 Yaqoot (Ruby) Corundum variety Mineral 0.03 Cardiac tonic, tranquilizer, epilepsy, anticoagulant,
melancholic disorders (Sifiuddin, 1999).
10 Yashab (Jade) Silicates Mineral 0.03 Cardio protective (Deshaprabhu, 1982).
Words italicized are in Urdu/Persian and the parentheses include names in English.
 S. Yousuf et al. / Journal of Ethnopharmacology 99 (2005) 179–184
Salim et al. (2003). In brief, the rats were anesthetized with
chloral hydrate (400 mg/kg, i.p.), a 4-0 nylon monofilament,
was inserted into the external carotid artery and advanced into
the internal carotid artery. Two hours after the induction of
ischemia, the filament was slowly withdrawn and the animals
were then returned to their cages. In sham-operated rats, the
external carotid artery was surgically prepared for insertion
of the filament but the filament was not inserted.
2.6. Behavioral study
The behavioral test in each group was performed before
and after occlusion and reperfusion. The experiment was per-
formed between 9.00 a.m. and 4.00 p.m. at standard labora-
tory conditions. All tests were performed and analyzed by
subject blind to the experiment.
2.6.1. Conditioned avoidance response (CAR)
This experiment was done in Cook’s climbing pole appara-
tus (Cook and Wieldley, 1957). The conditioned stimulus was
buzzer for 10 s and unconditioned stimulus was foot shock
delivered through the grid of floor applied for 10 s. After
training, the animals kept in Cook’s climbing pole chamber
jumped on the pole on hearing the buzzer to avoid electric
shock and failure results in foot shock. All the animals which
showed 100% CAR were again tested for their performance
after surgery and reperfusion of 22 h.
2.7. Tissue preparation
After producing MCAO and assessment of CAR, the ani-
mals were sacrificed immediately and their brains were taken
out to dissect hippocampus. Post mitochondrial supernatant
(PMS) obtained from 10% homogenate of tissue was used
for the estimation of various parameters related to oxidative
stress.
2.8. Biochemical estimations
2.8.1. Glutathione peroxidase
Glutathione peroxidase (GPx) (EC 1.11.1.9) activity was
measured at 37 ◦ C by coupled assay system as described by
Wheeler et al. (1990). The change in absorbance was recorded
at 340 nm and the enzyme activity was calculated as nmol
NADPH oxidized min−1 mg−1 protein using molar extinc-
tion coefficient of 6.22 × 103 M−1 cm−1 .
2.8.2. Glutathione S-transferase
Glutathione S-transferase (GST) (EC 2.5.1.18) activity
was measured by the method of Habig et al. (1974). The
change in absorbance was recorded at 340 nm and the enzyme
activity was calculated as nmol CDNB conjugate formed
min−1 mg−1 protein using a molar extinction coefficient of
9.6 × 103 M−1 cm−1 .
181
2.8.3. Catalase
The activity of catalase (CAT) (EC 1.11.1.6) was measured
by the method of Claiborne (1985). Change in absorbance
was recorded at 240 nm and enzyme activity was calculated
in terms of nmol H2 O2 consumed by using a molar extinction
coefficient of 43.6 M−1 cm−1 .
2.8.4. Glutathione reductase
Glutathione reductase (GR) (EC 1.6.4.2) activity was
measured according to the method of Carlberg and
Mannerviek (1975). The enzyme activity was quantitated
at 25 ◦ C by measuring the disappearance of NADPH at
340 nm. The activity was calculated as nmol NADPH oxi-
dized min−1 mg−1 protein using molar extinction coefficient
of 6.22 × 103 M−1 cm−1 .
2.8.5. Estimation of reduced glutathione
The reduced glutathione was determined by the method
of Jollow et al. (1974). The yellow color developed was
read immediately at 412 nm in spectrophotometer (␭-20,
Perkin-Elmer). The GSH content was calculated as ␮g of
GSH/g of fresh tissue by using molar extinction coefficient
of 13.6 × 103 M−1 cm−1 .
2.8.6. Estimation of TBARS
The assay for thiobarbituric acid reactive substance
(TBARS) was done according to the method of Islam
et al. (2002). The absorbance of the color was read at
535 nm and TBARS was calculated as nmoles of TBARS
formed per h/g tissue using a molar extinction coefficient of
1.56 × 105 M−1 cm−1 .
2.8.7. Protein estimation
It was determined by the method of Lowry et al. (1951).
2.8.8. Statistical analyses
Results are expressed as mean ± S.E. of eight animals.
Differences between the means of experimental and control
groups were analysed statistically using Student’s t-test.
3. Results
3.1. Effect of MCAO on the activity of GPx, GR, GST,
CAT and protection by KAUM
Table 2 shows the effect of MCAO and protection by
KAUM on the activity of GPx, GR, GST and CAT. The activ-
ity of GPx, GR, GST and CAT were significantly decreased
in MCAO group (p < 0.001) as compared to sham and atten-
uated significantly (p < 0.001) in MCAO + KAUM group as
compared to MCAO group.
182 S. Yousuf et al. / Journal of Ethnopharmacology 99 (2005) 179–184

Table 2
Effect of cerebral ischemia on the activities of glutathione peroxidase, glutathione reductase, glutathione S-transferase and catalase and protection with Khamira
Abresham Uood Matagiwala (KAUM)
Enzymes Treatment

Sham MCAO MCAO + KAUM KAUM only

GPx (nmol NADPH oxidized 16.30 ± 0.25 9.84 ± 0.15* (39.63% ↓) 13.86 ± 0.10## (40.85% ↑) 16.00 ± 0.42(1.84% ↓)
min−1 mg−1 protein)
GR (nmol NADPH oxidized 38.01 ± 0.29 28.93 ± 0.26* (23.88% ↓) 31.31 ± 0.55# (8.22% ↑) 37.60 ± 0.56(1.07% ↓)
min−1 mg−1 protein)
GST (nmol CDNB conjugate 17.85 ± 0.21 10.07 ± 0.10* (43.58% ↓) 14.42 ± 0.16## (43.19% ↑) 18.11 ± 0.14(1.45% ↑)
formed min−1 mg−1 protein)
Catalase (nmol H2 O2 consumed) 6.55 ± 0.45 3.61 ± 0.43* (44.88% ↓) 4.82 ± 0.28# (33.51% ↑) 6.17 ± 0.25(5.80% ↓)
Values are expressed as mean ± S.E. Significance was determined by Student’s t-test.
Values in parentheses show the percentage increase or decrease with respect to their control.
∗ p < 0.001 sham vs. MCAO.
# p < 0.01, ## p < 0.001 MCAO vs. MCAO + KAUM.

3.2. Effect of MCAO on GSH and TBARS content and its

protection by KAUM

Fig. 1 shows the effect of MCAO on GSH (
) and TBARS

(), and their protection with KAUM. The formation of
TBARS was elevated significantly (p < 0.001) in MCAO
group when compared with sham and its level was signifi-
cantly depleted (p < 0.001) in MCAO + KAUM group when
compared with MCAO group. The level of GSH was de-
pleted significantly (p < 0.001) in MCAO group as compared
to sham and its level was increased significantly (p < 0.001)
in MCAO + KAUM group as compared to MCAO group.

3.3. Effect of MCAO on CAR and its protection by

KAUM
Fig. 2 shows the effect of MCAO on CAR and its im-
provement with KAUM. The loss of CAR in Sham, MCAO,
MCAO + KAUM and KAUM group was 33.33, 66.67, 50
and 16.67%, respectively. The loss of CAR was decreased by
Fig. 2. Effect of KAUM (200 mg/kg) on conditioned avoidance response
(CAR). The results are expressed in % avoidances. Values in parentheses
include percent change in loss of CAR in sham vs. MCAO; MCAO vs.
MCAO + KAUM and sham vs. KAUM groups.
33.34% when MCAO group was compared with sham group
whereas the loss of CAR was increased in MCAO + KAUM
group when compared with MCAO by 16.67% and it was
16.33% when sham was compared with KAUM group.

4. Discussion

Traditional formulations have been shown to have medic-

Fig. 1. Effect of KAUM (200 mg/kg) on the content of (
) GSH and ()
TBARS in the hippocampus. Values are expressed as mean ± S.E. Signif-
icance was determined by Student’s t- test. * p < 0.001 sham vs. MCAO;
# p < 0.001 MCAO vs. MCAO + KAUM. Units for GSH are ␮g GSH/g tissue
and for LPO nmoles of TBARS/h/g tissue.
inal and therapeutic value (Shah and Vohora, 2002; Salim
et al., 2003), but little experimental evidence is available
to substantiate the neuroprotective action. In order to use
traditional Unani formulation to treat stroke more reliably
and more widely, we investigated the neuroprotective ac-
tion of KAUM. Our results demonstrated a significant restor-
ing effect on antioxidant enzymes, a subsequent decrease in
TBARS and improvement in behavioral activities in groups
pretreated with KAUM when compared with their respective
controls. About 50 years back, Kabeer (1951) had reported
the significance of this drug on various ailments of heart,
 S. Yousuf et al. / Journal of Ethnopharmacology 99 (2005) 179–184
brain, melancholia and various other disorders. Since then
therapeutic effect of this Unani formulation has been used in
the treatment of various related disorders (Sifiuddin, 1999).
But there is no report of this drug on the prevention of stroke.
To the best of our knowledge, this study provides the first
scientific data on the efficacy of this drug on focal cerebral
ischemia.
KAUM inhibited the content of TBARS and increased
level of GSH (Fig. 1) when given to the ischemic groups.
Since GSH content reflects the cellular physiological re-
sponse, the effect of KAUM on these two biochemical indices
suggest that KAUM not only functions as a simple antioxidant
to inhibit lipid peroxidation but also as a modulator of cellular
antioxidant potential by the restoration of GSH, which is an
oxy-radical scavenger. KAUM’s constituent Abresham con-
tains the protein sericin, which is reported to resist oxidation
(Zhang, 2002) and also suppresses lipid peroxidation (Kato
et al., 1998) providing the proof of lipid peroxide inhibitory
nature of KAUM.
Intracellular antioxidant enzymes determine the cellular
sensitivity to oxidative damage. The decreased activity of
glutathione dependent enzymes, GPx, GR and GST in the
MCAO group resulted from the imbalance between ROS pro-
duction and the endogenous scavenging system. Ultimately,
the imbalance may form a vicious circle which results in the
collapse of the endogenous system. The pretreated KAUM
group has shown a significant increase which might be due to
the restoration of the imbalance in the production and scav-
enging of free radicals. Our results are in agreement with
Xuejiang et al. (1999), Shah and Vohora (2002) and Salim
et al. (2003) who have shown that the treatment of rats with
herbal formulations/or plants extract resulted the increased
activity of these enzymes because of the ROS scavenging
activity of these traditional drugs which might lead to the
restoration of the depleted enzymes. The protection offered
by KAUM could also be due to the vasodilating/strengthening
activity of KAUM which might lead to increased supply of
blood to the infracted area thus supplying both energy and
oxygen to the damaged tissue.
Passive avoidance response in MCAO had latency shorter
than that of sham animals, indicating an impairment of learn-
ing ability. The results of KAUM pretreated animals have
shown an improved response, indicating that KAUM’s ac-
tion can interfere with functional effects of brain ischemic
injury on learning ability. Our data has shown that KAUM
may be used as a therapy for the oxidative stress related dis-
orders, although further studies are required to identify the
specific agent of KAUM participating in each biochemical
step for the brain damage protection.
5. Conclusion
Oxidative damage represents one of the important arms in
cerebral ischemic damage and the ability of KAUM to ame-
liorate the enzymes activity and level of glutathione, which
183
were considerably depleted after ischemia/reperfusion and
depletion of TBARS suggests that the drug may be used as a
possible neuroprotective agent.
Acknowledgments
Authors are thankful to the Central Council for Research
in Unani Medicine, Ministry of Health and Family Welfare,
Government of India, New Delhi, for financial assistance and
Dr. Asim Ali Khan, Lecturer, Department of Surgery, Faculty
of Unani Medicine, Jamia Hamdard, New Delhi, for help and
cooperation.
References
Carlberg, I., Mannerviek, B., 1975. Glutathione reductase levels in rat
brain. Journal of Biological Chemistry 250, 5475–5480.
Chan, P.H., 2001. Reactive oxygen radicals in signaling and damage in
the ischemic brain. Journal of Cerebral Blood Flow and Metabolism
21, 2–14.
Claiborne, A., 1985. Catalase activity. In: Greenwald, R.A. (Ed.), Hand
Book of Methods for Oxygen Radical Research. CRC Press, Boca
Raton, pp. 283–284.
Cook, L., Wieldley, E., 1957. Behavioral effects of some neurophar-
macological agents. Annals of New York Academy of Sciences 66,
740–752.
Deshaprabhu, S.B., 1982. The Wealth of India, vol. VII–X. Publications
and Information Directorate, Council of Scientific and Industrial Re-
search (CSIR), New Delhi, pp. 202–440.
Habig, W.H., Pabst, M., Jakoby, W.B., 1974. Glutathione S-Transferase:
the first enzymatic step in mercapturic acid formation. Journal of
Biological Chemistry 249, 7130–7139.
Hirakawa, M., Tamura, A., Anathema, H., Nakayama, H., Sano, K., 1994.
Disturbance of retention of memory after focal cerebral ischemia in
rats. Stroke 25, 2471–2475.
Ichikawa, H., Tetsuya, K., 2002. In vitro antioxidant potentials of tradi-
tional chinese medicine, shengmai san and their relation to in vivo
protective effect on cerebral oxidative damage in rats. Biological and
Pharmaceutical Bulletin 25, 898–903.
Islam, F., Zia, S., Sayeed, I., Zafar, K.S., Ahmad, A.S., 2002. Selenium
induced alteration on lipids, lipid peroxidation, and thiol group in
circadian rhythm centers of rat. Biological Trace Element Research
90, 1–12.
Jollow, D.J., Mitchell, J.R., Zampaghone, N., Gillete, J.R., 1974. Bro-
mobenzene induced liver necrosis: protective role of glutathione and
evidence for 3, 4-bromobenzene oxide as the hepatotoxic intermediate.
Pharmacology 11, 161–169.
Kabeer, U., 1951. Bayaaz-e-Kabeer, Part II, 15th ed. Daftarul Miyah,
Billimaran, New Delhi, pp. 66–68.
Kato, N., Sato, S., Yamanaka, A., Yamada, H., Fuwa, N., Nomura, M.,
1998. Silk protein, sericin, inhibits lipid peroxidation and tyrosinase
activity. Bioscience Biotechnology and Biochemistry 62, 145–147.
Lewen, A., Matz, P., Chan, P.H., 2000. Free radical pathways in CNS
injury. Journal of Neurotrauma 17, 871–890.
Lowry, O.H., Rosenbrough, N.J., Farr, A.L., Randall, R.J., 1951. Protein
measurement with folin phenol reagent. Journal of Biological Chem-
istry 193, 265–275.
Montoliu, C., Humet, M., Canales, J.J., Burda, J., Planells-Cases, R.,
Sanchez-Baeza, F., Carbonell, T., Perez-Paya, E., Messeguer, A.,
Ferrer-Montiel, A., Felipo, V., 2002. Prevention of in vivo excitotoxi-
city by a family of trialkylglycines, a novel class of neuroprotectants.
184 S. Yousuf et al. / Journal of Ethnopharmacology 99 (2005) 179–184
Journal of Pharmacology and Experimental Therapeutics 301, 29–36.
Pulsinelli, W.A., Brierley, J.B., Plum, F., 1982. Temporal profile of neu-
ronal damage in a model of transient cerebral forebrain ischemia.
Annals of Neurology 11, 491–498.
Rafiquddin, H., 1995. Kunzul Adviya. Aligarh Muslim University Publi-
cation Division, Aligarh, pp. 568–570.
Salim, S., Ahmad, M., Zafar, K.S., Ahmad, A.S., Islam, F., 2003. Protec-
tive effect of Nardostachys Jatamansi in rat cerebral ischemia. Phar-
macology Biochemistry Behavior 74, 481–486.
Shah, Z.A., Vohora, S.B., 2002. Antioxidant/restorative effects of calcined
gold preparations used in Indian systems of medicine against global
and focal models of ischaemia. Pharmacology and Toxicology 90,
254.
Sifiuddin, H., 1999. Unani Adviya Mafarruda, VIII ed. Tariki Urdu Bu-
reau, R.K. Puram, New Delhi, pp. 65–294.
Wheeler, R., Jhaine, A.S., Elsayeed, M.N., Omaye, T.S., Korte, J.W.D.,
1990. Automated assays for superoxide dismutase, catalase, glu-
tathione peroxidase and glutathione reductase activity. Analytical Bio-
chemistry 184, 193–199.
Xuejiang, W., Magara, T., Konishi, T., 1999. Prevention and re-
pair of cerebral ischemia-reperfusion injury by Chinese herbal
medicine, shengmai san, in rats. Free Radical Research 31, 449–
455.
Zhang, Y.Q., 2002. Applications of natural silk protein sericin in bioma-
terials. Biotechnological Advances 20, 91–100.
 Journal of Ethnopharmacology 99 (2005) 185–192

Immunosuppressive properties of an ethyl acetate fraction from

Euphorbia royleana
Sarang Bani∗ , Anpurna Kaul, Beenish Khan, Sheikh Fayaz Ahmad, K.A. Suri, N.K. Satti,
Musarat Amina, G.N. Qazi
Division of Pharmacology, Regional Research Laboratory, Canal Road, Jammu Tawi 180001, India

Received 12 January 2004; received in revised form 20 December 2004; accepted 20 December 2004

Abstract

The objective of the study was to investigate the activity of the ethyl acetate (EA) fraction of Euphorbia royleana latex on cellular and
humoral-mediated immune responses and phagocytic function of the cells of the reticuloendothelial system in mice. Oral administration
of EA at doses of 50, 100 and 200 mg/kg p.o. in mice with sheep red blood cells (SRBC) as an antigen-inhibited both the delayed-type
hypersensitivity reaction and the production of circulating antibody titre. Reduction of CD4+ T cell counts in the peripheral whole blood and
the neutrophil counts in pleural exudates of the animals treated with EA was observed by flowcytometric analysis. Process of phagocytosis
was also inhibited in in vivo and in vitro experimental test models. The oral LD50 in both rats and mice was more than 2.5 g/kg body weight.
© 2005 Published by Elsevier Ireland Ltd.

Keywords: Euphorbia royleana; Cellular; Humoral; Flowcytometry; Co-receptors

1. Introduction
Euphorbia royleana Boiss (Family: Euphorbiaceae) is a
shrub commonly found on the dry slopes of Himalayan range
at an altitude between 3000 and 5000 ft. Its latex is used as
a remedy for joint pains in traditional system of medicine
and is also filled in hollow cavities of decayed teeth to check
infection (Kaushik, 1988).
We have shown ethyl acetate fraction (EA) from the latex
of Euphorbia royleana to have significant anti-inflammatory
and anti-arthritic activity in experimental animals (Bani et
al., 1996). On the basis of these properties, it was anticipated
that EA fraction should have a bearing on the immune system
of the test animals, as inflammation in general and arthritis
in particular are closely related to the immune status of a
living being. The immune system is involved in the etiology
as well as pathophysiologic mechanisms of these diseases.
Modulation of the immune responses to alleviate the diseases
∗ Corresponding author.
E-mail address: sarangbani@rediffmail.com (S. Bani).
has been of interest for many years. Thus, a detailed study of
EA was taken up to establish its immunomodulatory activity.
2. Methodology
2.1. Chemicals
Fluoroisothiocyanate (FITC)-labeled CD4 anti-mouse
monoclonal antibody, phycoerytherin (PE)-labeled CD8 anti-
mouse monoclonal antibody, FACS lysing solution (BD
Biosciences); phosphate buffer saline, cyclosporin (Sigma–
Aldrich, India); gumacacia (Hi Media).
2.2. Plant material
Euphorbia royleana was collected from the Nandini area
of Jammu (Jammu and Kashmir State, India) and authenti-
cated by T.N. Srivastava, taxonomist at Janki Ammal Herbar-
ium of the Institute (Regional Research Laboratory, Jammu,
India), where voucher specimen has been deposited.

0378-8741/$ – see front matter © 2005 Published by Elsevier Ireland Ltd.

doi:10.1016/j.jep.2004.12.017
186 S. Bani et al. / Journal of Ethnopharmacology 99 (2005) 185–192
2.3. Preparation of plant fraction
The latex was collected and kept in a refrigerator
overnight. It was extracted with 85% ethanol at room temper-
ature while stirring. The 85% ethanol extract thus obtained
was then triturated with ethyl acetate at room temperature
and filtered to obtain the ethyl acetate fraction. A flow sheet
of systematic fractionation procedure is presented below:
The ethyl acetate fraction was found to contain four major
spots by Co-T.L.C (mobile phase; petrol ether:EtOAc::4:1)
in comparison to pure cycloyleanol (Rf, 0.45), lupeol (0.35),
friedelan-3-␣-ol (Rf, 0.29) and isotaraxerol (Rf, 0.27) present
in the extract.
Further fractionation of EA fraction did not give any frac-
tion, which biologically showed more activity than EA; there-
fore, further work was carried out on EA fraction only.
2.4. Animals
Male Balb/c mice weighing 20–24 g, 10–12-week-old,
were employed in groups of six for the study. All the an-
imals were maintained in plastic cages at 22 ± 2◦ C with
12-h light/12-h dark cycle and free access to pellet food
(Lipton India Ltd.) and water. According to ethical regula-
tions on animal research, all animals used in experimental
work received humane care. Drugs were prepared as a ho-
mogenized suspension in gum acacia (1%, w/v) and were
administered orally daily once a day for the duration of
experiment.
2.5. Antigen
Fresh sheep red blood cells (SRBC) were collected asepti-
cally from the jugular vein of sheep and stored in cold sterile
Alsever’s solution, were washed three times with pyrogen-
free sterile saline (NaCl, 0.9% (w/v)) and adjusted to the
concentration of 5 × 109 cells/mL for immunization and chal-
lenge at the required time schedule.
2.6. Effect on general behaviour and maximum dose
tolerance in mice
Graded doses of the test drug were administered orally to
group of 8 rats and 10 mice by the method of Singh et al.
(1978). The animals were observed for first 2 h continuously
and then at half-hourly interval for next 6 h for changes in re-
activity, gait, motor activity, ptosis, respiration rate, writhing,
etc. A high dose toxicity effect resulting into mortality was
recorded over 1-week period and the acute oral LD50 was
calculated.
2.7. Delayed-type hypersensitivity response (DTH)
The method of Doherty (1981) was followed. Test ma-
terial was administered 2 h after SRBC injection and once
daily on consecutive days. Six days later, the thickness of the
left hind food was measured with a spheromicrometer (pitch,
0.01 mm) and was considered as a control. The mice were
then challenged by injecting the same amount of SRBC in-
 S. Bani et al. / Journal of Ethnopharmacology 99 (2005) 185–192 187

tradermally into the left hind footpad. The foot thickness was
measured again after 24 h.

2.8. Humoral antibody response

Mice were immunized by injecting 20 ␮L of 5 × 109

SRBC/mL intraperitoneally (i.p.) on day 0, and the blood
samples were collected on day +7 (before challenge) for pri-
mary antibody titre and on day +14 (7 days after challenge) for
secondary antibody titre. Haemagglutination antibody titres
were determined following the microtitration technique de-
scribed by Nelson and Mildenhall (1967). BSA-saline alone
served as a control.

2.9. Skin allograft rejection

The modified method of Billingham and Medawar (1951)
was followed to study the skin allograft rejection time in
mice. Graded doses of test material were administered to
the animals for 7 days and graft rejection time (GRT) was
recorded by daily observation of epithelial skin layer survival.
Control group was given vehicle only, and another group
received cyclosporine as standard at 5 mg/kg body weight
daily for 7 days.
2.10. Lymphocyte immunophenotyping
Immunophenotyping focuses on lymphocyte populations
involved in acquired immunity. Specific molecules present on
the cell surface defines characteristics of lymphocytes such
as state of activation or functional capabilities. Immuniza-
tion of Balb/c mice was carried out by injecting 20 ␮L of
5 × 109 SRBC/mL i.p. Drug administration was carried out
for 5 days. Same amount of SRBC was then injected into
the mice for the challenge on day 6 and blood was collected
after 24 h of challenge in heparinised tubes from retro-orbital
plexus for estimation of CD4+ and CD8+ T cells. Later, the
blood was again collected on day 14 to see the secondary
response and determine the effect of EA on the T cell subsets
CD4 and CD8.
Murine monoclonal antibodies conjugated to a fluo-
rochrome and directed against co-receptors CD4 and CD8
Fig. 1. Effect of EA on homologous graft rejection in mice.
were used in a multiparametric flowcytometric assay to quan-
tify the lymphocyte subsets associated with the cell-mediated
immune response.
FITC-labeled anti-mouse CD4 (L3T4) monoclonal anti-
body that reacts with the CD4 differentiation antigen ex-
pressed on MHC class II-restricted T cells that includes most
helper cells and PE-labeled CD8 monoclonal antibody that
reacts with CD8 differentiation antigen present on MHC
class-I-restricted T cells were used to determine the percent-
age of CD4+ and CD8+ T cells in control and treated group
of animals.
These antibodies were added directly to 100 ␮L of whole
blood, which was then lysed using whole blood lysing reagent
(BD Biosciences). Following the final centrifugation, sam-
ples were resuspended in phosphate buffer saline (pH, 7.4)
and analyzed directly on the flowcytometer (LSR, BD Bio-
sciences) using Cell Quest Pro Software (BD Biosciences).
To CD4+ and CD8+ T cells in the whole blood of the chal-
lenged animals, a fluorescence trigger was set on the FITC
(FLI) parameter to analyse CD4+ and PE (FL2) param-
eter to collect CD8+ events. Fluorescence compensation,
data analysis, and data presentation was performed using
Cell Quest Pro software. Data transformation for compen-

Table 1
Effect of EA on SRBC-induced delayed-type hypersensitivity (DTH) response (CM1) and humoral response in mice
Treatment dose (mg/kg p.o.) Cell-mediated immune response Humoral immune response

Paw swelling (mm) in mice day 7 Habt [log 2] 7th day Sabt [log 2] 14th day

Mean ± S.E. % Change Mean ± S.E % Change Mean ± S.E. % Change

Control SRBC 0.81 ± 0.04 – 6.50 ± 0.22 – 6.66 ± 0.22 –
+EA [25] 0.68 ± 0.16 16.04 ↓ 5.66 ± 0.21 12.92 ↓ 6.00 ± 0.22 09.90 ↓
+EA [50] 0.63 ± 0.02 a 22.22 ↓ 5.16 ± 0.16a 20.61 ↓ 5.83 ± 0.16 12.46 ↓
+EA [100] 0.48 ± 0.03 b 40.74 ↓ 4.66 ± 0.20b 28.30 ↓ 5.50 ± 0.22a 17.41 ↓
+EA [200] 0.45 ± 0.02 b 44.44 ↓ 5.00 ± 0.25a 23.07 ↓ 5.66 ± 0.21a 15.01 ↓
+Cyclosporin [5] 0.35 ± 0.02 c 56.79 ↓ 4.00 ± 0.25b 38.46 ↓ 4.00 ± 0.25 b 39.93 ↓
n = 6; (a) P < 0.05; (b) P < 0.01; (c) P < 0.001; Habt, humoral antibody titre; Sabt, secondary antibody titre; (↓) reduction.
188 S. Bani et al. / Journal of Ethnopharmacology 99 (2005) 185–192
Fig. 2. Flowcytometric analysis of T cell surface antigen CD4 (FITC-conjugated monoclonal antibody) and CDS (PE-conjugated monoclonal antibody), day
7.
sated data was done using default values provided by the
software.
2.11. Macrophage phagocytic response
2.11.1. In vitro
The method of Lehrer (1981) was followed. The percent-
age and average number of Candida albicans cells (heat-
killed) ingested by peritoneal murine macrophages was cal-
culated.
2.11.2. In vivo
The phagocytic clearance of the endothelial system was
assayed in groups of six mice each by injecting i.v. 160 mg/kg
of 1.6% suspension of gelatin stabilized carbon particles (Atal
et al., 1986). Blood samples were collected before and at
intervals varying between 2 and 90 min after carbon injec-
tion. An aliquot (10 ␮L) of blood samples were lysed with
2 mL of 0.1% acetic acid and the transparency determined
spectrophotometrically at 675 nm (Uvikon 810, spectropho-
tometer, Kontron Ltd., Switzerland) (Hudson and Hay, 1980).
EA was administered orally for 7 days, and 30 min prior to
the carbon injection. The rate of carbon clearance termed as
phagocytic index was calculated.
2.12. Flowcytometric analysis of neutrophil migration
in vivo
Flowcytometry as a tool for evaluation of neutrophils is
particularly useful because of their larger size than mono-
cytes and lymphocytes when analysed on the forward scatter
(FSc). The percentage of these can be analysed by selec-
tively ‘gating’ the neutrophils without physical separation of
the cells. Pleurisy in rats was induced by injecting 0.5 mL
of carageenan (1%, w/v in distilled water) into the pleural
cavity of the rats by the method of Meacock and Kitchen
(1979). The test drug was administered orally 1 h before and
6 h after the carrageenan injection. After 24 h of carageenan
injection, the pleural exudates were collected in phosphate
buffer saline, and neutrophil count was carried out.
2.13. Statistical analysis
The results were expressed as mean ± S.E.M. and are pre-
sented as fold increase/decrease values compared with the
untreated control. Statistical significance was determined by
Student’s t-test, comparing the experimental group to the con-
trol group.
 S. Bani et al. / Journal of Ethnopharmacology 99 (2005) 185–192 189

Fig. 3. Flowcytometrlc analysis of T cell surface antigen CD4 (FITC-conjugated monoclonal antibody) and CD8 (PE-conjugated monoclonal antibody), day
14.

3. Results
Table 2
3.1. Effect on general behaviour and maximum dose Effect of EA on phagocytic function of murine peritoneal macrophages
tolerance in mice Treatmenta (dose ␮g/mL)
Mice and rats treated with EA at a maximum oral dose Control
of 2500 mg/kg did not show any difference in gross general EA [25]
EA [50]
behaviour compared with the control group of animals that
EA [100]
were administered only the vehicle. No mortality was ob- EA [200]
served over an observation period of 7 days. EA [400]
EA [800]
Cyclosporin [10] (standard)
3.2. Delayed-type hypersensitivity response
Treatmentb (dose mg/kg)
EA when administered orally at 50–200 mg/kg doses
showed a decrease of 16.04–44.44% in DTH response in Control
mice. Cyclosporin at 5 mg/kg p.o. produced 56.79% decrease EA [25]
EA [50]
(Table 1).
EA [100]
EA [200]
3.3. Humoral antibody response EA [400]
EA [800]
Cyclosporin [5] (standard)
EA (50–200 mg/kg p.o.) produced a dose-related de-
Figures in parentheses represent percentage change; (a) P < 0.01 decrease;
crease in the primary antibody synthesis. Maximum ef- (b) P < 0.001 decrease.
fect was observed at 100 mg/kg (28.30% decrease) after a Number of observations for each dose = 6.
b Number of animals in each group = 6.
which the suppressive effect waned and was 23.07% at
% Phagocytosis (in vitro study)
Mean ± S.E.
25.33 ± 1.26
25.16 ± 1.33 (0.67%) ↓
22.00 ± 0.90 (13.14%) ↓
20.80 ± 0.75 (17.88%) ↓
17.50 ± 0.72 a (30.91%) ↓
15.50 ± 0.56 a (38.80%) ↓
14.26 ± 0.40 b (43.70%) ↓
11.80 ± 1.08 b (53.41%) ↓
Phagocytic index (in vivo
study) Mean ± S.E.
1.26 ± 0.12
1.26 ± 0.14
1.20 ± 0.12 (4.76%)↓
1.00 ± 0.14 (20.63%)↓
0.92 ± 0.12 a (26.98%) ↓
0.90 ± 0.08 a (28.57%) ↓
0.88 ± 0.12 b (30.15%) ↓
0.72 ± 0.10 b (42.85%) ↓
190 S. Bani et al. / Journal of Ethnopharmacology 99 (2005) 185–192

200 mg/kg oral dose. Cyclosporin used as a standard drug
showed 38.46% decrease in antibody synthesis at the dose of
5 mg/kg oral dose (Table 1). EA also effectively decreased
the secondary antibody production but its suppressive ef-
fect was more significant on primary antibody synthesis
(Table 1).
3.4. Skin allograft rejection
Oral administration of EA at 50, 100 and 200 mg/kg de-
layed the skin allograft rejection time in mice (days) by 15.5,
22.0 and 24.0%, respectively. Cyclosporin at 5 mg/kg in-
creased the rejection time by 34.5% (Fig. 1).
3.5. Lymphocyte immunophenotyping
EA showed effect of 10.91% of CD4+ and 6.90% of CD8+
T cells and 12.17% of CD4+ and 6.39% of CD8+ T cells at
100 and 200 mg/kg p.o. dose, respectively. The control values
were 15.23% of CD4+ and 7.63% of CD8+ T cells. This shows
a significant decrease in CD4+ and CD8+ T cell count (Fig. 2).
Cyclosporin, a standard T cell inhibitor at 5 mg/kg oral dose
inhibited both CD4+ and CD8+ T cells showed 7.74% of
CD4+ and 3.79% of CD8+ T cells.
The same set of experiment was repeated on day 14 and
the observation made for the secondary response. EA at
100 mg/kg dose showed 9.16% of CD4+ and 6.03% of CD8+

Fig. 4. Effect of EA on neutrophU count in carrageenan-induced pleurisy (in vivo) in rats.

 S. Bani et al. / Journal of Ethnopharmacology 99 (2005) 185–192
T cells and at 200 mg/kg showed 8.53% of CD4+ and 4.22%
of CD8+ T cells. This shows EA to have sustained suppressive
effect even after its administration was discontinued after 5
days. At 200 mg/kg p.o. dose EA had significant inhibitory
effect on both CD4+ and CD8+ T cells. The control values
stood at 10.15% of CD4+ and 6.00% of CD8+ T cells. Cy-
closporin, however, showed 7.84% of CD4+ and 3.94% of
CD8+ T cells (Fig. 3).
3.6. Phagocytic response
3.6.1. In vitro
EA was tested at the doses of 25, 50, 100, 200, 400 and
800 ␮g/mL. The significant percent decrease was observed at
the dose 200, 400 and 800, where the effect was 30.91, 38.80
and 43.70%, respectively. Cyclosporin at 10 ␮g/mL showed
53.41% decrease in phagocytosis of heat killed Candida al-
bicans by the murine macrophages (Table 2).
3.6.2. In vivo
Oral administration of EA for 7 days decreased the
clearance rate of carbon particles from circulation in mice
(Table 2). The decrease in phagocytic index was 4.76–28.57%
at dose range of 50–800 mg/kg. The effect was statistically
highly significant at higher doses.
3.7. Flowcytometric analysis of neutrophil migration in
vivo
Oral administration of EA fraction at the doses of
100–200 mg/kg inhibited the polymorphonuclear leucocytes
in a dose-dependent manner (Fig. 4). Maximum effect was
observed at 200 mg/kg.
4. Discussion and conclusion
A dose as high as 2500 mg/kg p.o. in both mice and rats
caused neither any observable negative symptom nor death
in these animals over 1-week period of study.
In immune-related studies, EA produced a dose-
dependent decrease in DTH reaction in mice (Table 1) show-
ing suppression on ‘T’ lymphocytes and accessory cell types
required for the expression of the reaction (Dean et al., 1979;
Luster et al., 1982a,b). Supporting hypothesis of T lympho-
cytes inhibition is the increase in the homologous skin graft
rejection time in mice treated with EA (Fig. 1). The basic
mechanism involved in increase in graft rejection time is the
suppression of T lymphocytism, and this is supported by sig-
nificant inhibitory effect of EA on CD4+ and CD8+ T cells.
After transplantation, MHC peptide complexes of the foreign
organ are recognized by CD4+ and CD8+ T cells of the re-
cipient as non-self antigens. These T cells differentiate into
effector T cells and stimulate an immune response. After T
cells differentiate and migrate to the site, macrophages and
other inflammatory agents are mediated to the site. Cytotoxic
191
T cells (CD8+ ) lyse the endothelial cells on the graft, CD4+
Th1 activate macrophages and CD4+ Th2 aid in antibody pro-
duction. T cells expressing CD4 are increased when there is
a general expansion due to active immunological activity of
the T cell and inhibition of this observation shows immuno-
suppressive activity.
Macrophages and polymorphonuclear leucocytes (neu-
trophils) survey the body for foreign antigens, which they
destroy by making toxic molecules such as the reactive oxy-
gen intermediate molecules. Continued production of these
toxic molecules by overactive macrophages and neutrophils
not only destroys the foreign antigens but also the tissues
surrounding them. The inhibition of humoral response by
EA (Table 1) also indicates the reduced responsiveness of
macrophages and subsets of T and B lymphocytes, involved
in antibody synthesis (Benacerraf, 1978). This is evident by
the decrease in clearance of carbon particles from the reticu-
loendothelial system and also reduction in the rate of phago-
cytosis in vitro by murine macrophages, thereby, suggesting
the reduction in the functioning of macrophages after treat-
ment with EA (Table 2). CD4+ T cell inhibition by EA may be
one of the factors responsible for the decrease in the function-
ing of the macrophages as the activation of primary cells of
phagocytosis is one major effector function of CD4+ T cells.
The reduction in percentage neutrophil count in the animals
treated with EA further proves this (Fig. 4).
Since EA not only suppresses cell-mediated immunity but
also humoral immune responses, it appears very promising in
the treatment of autoimmune diseases. The findings demon-
strate it to have a potent immunosuppressive potential, which
is suggestive of its possible therapeutic usefulness. Its ap-
parent safety over long-term administration is encouraging
enough to warrant further studies to explore its possible role
in modern clinical practice.
References
Atal, C.K., Sharma, M.L., Kaul, A., Khajuria, A., 1986. Immunomodu-
lating agents of plant origin. Part 1: preliminary screening. Journal of
Ethnopharmacology 18, 133–141.
Bani., S., Chand, D., Suri, K.A., Suri, O.P., Sharma, O.P., 1996. Anti-
inflammatory effects of an ethyl acetate extract of Euphorbia royleana.
Phytotherapy Research 10, 285–291.
Benacerraf, B., 1978. A hypothesis to relate the specific of T lymphocytes
and the activity of I region-specific Ir genes in macrophages and B
lymphocytes. Journal of Immunology 120, 1809–1812.
Billingham, R.E., Medawar, P.B., 1951. The technique of free skin graft-
ing in mammals. Journal of Experimental Biology 28, 385–402.
Dean, J.H., Padarath Singh, M.L., Jerrels, T.R., 1979. Application of
immunocompetence assays for defining immunosuppression. Annals
of the New York Academy of Sciences 320, 579–590.
Doherty, N.S., 1981. Selective effect of immunosuppressive agents against
the delayed hypersensitivity response and humoral response to sheep
red blood cells in mice. Agents and Actions 11, 237–242.
Hudson, L., Hay, F.C., 1980. Practical Immunology, second ed. Blackwell,
London, pp. 73–92.
Kaushik, P. (1988). Indigenous Medicinal Plants. Today and Tommorrow,
New Delhi, p. 160.
192 S. Bani et al. / Journal of Ethnopharmacology 99 (2005) 185–192
Lehrer, R.I., 1981. Ingestion and destruction of Candida albicans. In:
Adams, D.O., Edelson, P.J., Koren, H. (Eds.), Methods for Studying
Mono-Nuclear Phagocytes. Academic Press, New York, pp. 693–708.
Luster, M.L., Dean, J.H., Moore, J.A., 1982a. Evaluation of immune
functions in toxicology. In: Wallace Hayes, A. (Ed.), Principles and
Methods of Toxicology. Raven Press, New York, pp. 561–586.
Luster, M.L., Dean, J.H., Boorman, G.A., 1982b. Cell mediated immunity
and its application in toxicology. Environmental Health Perspectives
43, 31–36.
Meacock, S.C.R., Kitchen, B.A., 1979. Effects of the non-steroidal anti-
inflammatory drug benoxaprofen on leucocyte migration. Journal of
Pharmacy and Pharmacology 31, 366–370.
Nelson, D.S., Mildenhall, P., 1967. Studies on cytophilic antibodies.
The production by mice of macrophage cytophilic antibodies to
sheep erythrocytes: relationship to the production of other anti-
bodies and development of delayed-type hypersensitivity. Australian
Journal of Experimental Biology and Medical Sciences 45, 113–
130.
Singh, G.B., Srimal, R.C., Nityanand, S., Dhawan, B.N., 1978. Pharma-
cological studies on 3-(-p-fluorebenzoyl-propyl)-2,3,4,5,6-hexahydro-
1-(H)-pyrazino-(1,2-a)-quinoline hydrochloride (compound 69/183).
Drug Research 28, 1403–1406.
 Journal of Ethnopharmacology 99 (2005) 193–197

Antimicrobial properties of Phrygilanthus acutifolius

A. Daud, A. Gallo, A. Sánchez Riera ∗
Departamento de Biologı́a del Desarrollo, Instituto Superior de Investigaciones Biológicas (INSIBIO) y Universidad Nacional de
Tucumán (UNT), Chacabuco 461, 4000-San Miguel de Tucumán, Tucumán, Argentina

Received 1 November 2003; received in revised form 23 December 2004; accepted 19 January 2005
Available online 25 April 2005

Abstract

Ethanol extract of flowers of Phrygilanthus acutifolius (Ruiz & Pav.) Eichler (Loranthaceae) inhibited the growth of both Gram (+)
bacteria (Staphylococcus aureus, Staphylococcus saprophyticus and Enterococcus faecalis) and Gram (−) bacteria (Serratia marcescens,
Acinetobacter sp. and Pseudomonas aeruginosa). This extract was bactericidal against Staphylococcus aureus and bacteriostatic against
Pseudomonas aeruginosa. Morphological evidence suggests that the extract causes the swelling of the bacterial body of Staphylococcus
aureus, the disintegration of the cell surface and the cell death. Bactericidal activity was optimal at pH 7.5 and was not affected by different
ionic strengths. The presence of Mg2+ in the culture medium of Phrygilanthus acutifolius diminished the sensitivity of Pseudomonas aeruginosa
strain against the extract. Test results would tend to corroborate the folk belief that the flowers of this plant are efficacious against respiratory
infections and would justify its further investigation.
© 2005 Elsevier Ireland Ltd. All rights reserved.

Keywords: Phrygilanthus acutifolius; Loranthaceae; Antimicrobial activity; Argentine medicinal plants

1. Introduction and their preparation from their father/grandfather. Accord-

Traditional medicine in developing countries uses a wide
variety of natural products in the treatment of common in-
fections (Low et al., 2002; Rojas et al., 2001). Argentine
indigenous culture has a long-standing tradition of healing
with medicinal plants, especially in the prevention or cure
of gastrointestinal, respiratory and skin diseases (Martinez
Crovetto, 1965, 1981).
In Tucumán, Argentina, Phrygilanthus acutifolius (Ruiz
& Pav.) Eichler (Loranthaceae) (Abbiatti, 1943), a hemipar-
asite, is found in the mountains surrounding the Calchaquı́
Valleys; it takes its vulgar name, “corpus”, from the festivity
of Corpus Christie, when it is in full bloom. Amaicha del Valle
(Tucumán) was visited in order to carry out and ethnomedical
investigation on the medicinal uses of this species. The people
we interviewed were traditional healers and families belong-
ing to the village. They had learned about medicinal plants
∗ Corresponding author. Fax: +54 381 4248025.
E-mail address: sariera@unt.edu.ar (A.S. Riera).
ing to this survey, it was found that the extracts from flowers
was use to treat respiratory diseases and infections. How-
ever, there are no references on the uses of this species in the
literature.
Therefore, the aim of the present work is to evaluate the
antimicrobial potential of aqueous and ethanol extracts of
Phrygilanthus acutifolius flowers on several Gram (+) and
Gram (−) microorganisms of medical importance.
2. Materials and methods
2.1. Plant materials
The plant materials used in this study consisted of the
flowers of Phrygilanthus acutifolius (Ruiz & Pav.) Eichler
(Corpus) collected during the flowering season (May–June)
in Amaicha del Valle, in the province of Tucumán, Argentina.
The voucher herbarium specimen (no. 511125) was identi-
fied by using morphological, anatomical and histochemical

0378-8741/$ – see front matter © 2005 Elsevier Ireland Ltd. All rights reserved.
doi:10.1016/j.jep.2005.01.043
194 A. Daud et al. / Journal of Ethnopharmacology 99 (2005) 193–197
techniques, in comparison with an identified specimen at the
Herbarium “Miguel Lillo” of San Miguel de Tucumán, Tu-
cumán, Argentina.
2.2. Preparation of plant extracts
Ethanol and aqueous extracts were made from the flow-
ers of the plant under study. The dried materials were milled
into particles of about 5–10 mm in diameter. For the ethanol
extracts, 20 g samples of flowers were soaked for 5 days
in 100 ml of 70% ethanol. For the aqueous extracts, sam-
ples were soaked for 2 days in 100 ml of water. All extracts
were filtered through no. 1 Whatman paper and evaporated
to dryness in an air current. The dry-crude extracts were ir-
radiated with ultraviolet light for 24 h for sterilization; steril-
ity was confirmed by plating each sample suspension on
Müller–Hinton (MH) agar. All extracts were dry-stored in
sterile eppendorf at 4 ◦ C until used for the screening of an-
timicrobial activity. At that time, the extracts were recon-
stituted to a concentration of 200 mg/ml in 70% ethanol or
sterile water.
2.3. Bacterial strains
Strains of Pseudomonas aeruginosa, Acinetobacter sp.
(resistant to piperacilline, ceftazidime, cefepime and gen-
tamicine), Klebsiella pneumoniae (resistant to cephalothin,
ampicillin, ciprofloxacine, gentamicine, amikacine; cepho-
taxime, ampicillin-sulbactam and ampicillin-clavulanic
acid), Enterococcus faecalis, Staphylococcus aureus (resis-
tant to oxacilline), Staphylococcus saprophyticus (penicillin-
resistant), Serratia marcescens, Escherichia coli, all of them
human pathogenic strains and Escherichia coli K12 strain
4100 were used. These bacterial strains were clinical isolates
from the Bacteriological Section of the Instituto de Micro-
biologı́a “Dr. L. Verna”, Facultad de Bioquı́mica, Quı́mica y
Farmacia, Universidad Nacional de Tucumán.
Bacterial strains were maintained on MH agar. For inocu-
lum preparations, bacteria were sub-cultured in brain–heart-
infusion (BHI) at 37 ◦ C for 8 h and adjusted to a suspension
of 1 × 106 to 2 × 106 CFU/ml. The optical density (OD) at
550 nm of each culture was measured with a Spectronic 601
spectrophotometer.
2.4. Assay for inhibition of bacterial growth
The antimicrobial activity of the extract from the flowers
was determined by the “hole-plate diffusion method” (Bennet
et al., 1996). The tested bacterial suspension was homoge-
neously seeded onto petri dishes containing 15 ml of the MH
agar medium. Holes were aseptically bored into the agar with
a hollow punch and 25 ␮l aliquots of the extract were placed
into wells with a sterile pipette. The plate was kept for 1 h at
room temperature for the diffusion of the extract into the agar.
Subsequently, the plate was incubated at 37 ◦ C for 18 h. Chlo-
ramphenicol was used as positive control and 70% ethanol
was used as negative control. The microorganism control con-
sisted of a seeded petri dish with no plant material, solvent
(70% ethanol) or chloramphenicol. Results were recorded as
the mean of triplicate experiments.
Bacterial growth inhibition was determined as the diam-
eter of the inhibition zones around the holes. The inhibition
diameter was the average of four measurements per hole.
2.5. Determination of Minimum Inhibitory
Concentration (MIC), Minimal Bactericidal
Concentration (MBC) and Minimal Bacteriostatic
Concentration (MBS)
The MICs were determined by the agar dilution method.
Two-fold serial dilutions of the extract (100 mg/ml in 70%
ethanol) were prepared in MH agar from 10 to 0.1 mg/ml. Sol-
vent, antibiotic and microorganism controls were also ana-
lyzed. Bacterial inoculum (2 ␮l) (OD550 = 1) was seeded onto
the agar. The plates were incubated at 37 ◦ C for 18 h. The MIC
was considered the lowest concentration of the sample that
prevents visible growth. MBC and MBS were determined by
sub-culturing the negative samples. MBC were defined as
the lowest concentration that yielded negative sub-cultures
and MBS as the lowest concentration that produced positive
growth.
2.6. Effect of different ionic strengths, pHs and cation
(Mg2+ ) on the antibacterial activity
In order to determine the effect of different pHs on the
antibacterial activity of the ethanol extract, bacterial cells
(1 × 106 CFU/ml) were incubated with 50 ␮l of ethanol ex-
tract for 1 h at 37 ◦ C in the presence of 75 ␮l of 10 mM sodium
citrate buffer (pH 5.0) or 10 mM of sodium phosphate (pHs
7.5 and 8.0), both supplemented with 100 mM of NaCl.
In order to find out the effect of ionic strength, similar
assays were performed, using 10 mM sodium phosphate (pH
7.5) containing different concentrations of NaCl (25, 50, 100
and 150 mM).
The effect of Mg2+ on the antibacterial activity was also
assayed. Bacterial cells were incubated in 10 mM sodium
phosphate (pH 7.5) with 100 mM NaCl in the presence or
absence of MgCl2 (0.5 mM).
Controls lacking ethanol extract were set-up. At the end of
incubation, samples were serially diluted with sterile saline
solution, plated in duplicate on MH agar and incubated for
18 h to allow colony count.
2.7. Effect of temperature on the antibacterial activity
In order to determine the effect of temperature, 75 ␮l of
dry-crude extract were placed in eppendorf and kept in a
water bath for 20 min at 100 ◦ C. After heating, the samples
were reconstituted, and subsequently tested for antibacterial
activity as describe above.
 A. Daud et al. / Journal of Ethnopharmacology 99 (2005) 193–197
2.8. Morphology
Antibacterial action was determined by electron mi-
croscopy in accordance with the technique of Shigeharu
(2000). Gram (+) bacteria (Staphylococcus aureus) at a con-
centration of 1 × 106 CFU/ml were incubated for 18 h at
37 ◦ C in 20 mM Tris–HCl buffer, pH 7.4, containing 0.15 M
NaCl, 1 mM CaCl2 and 1 mM MnCl2 , in the presence of
ethanol extract (100 mg). Chloramphenicol (positive control)
and 70% ethanol (negative control) were incubated for the
same period. After incubation, bacteria were washed twice
with 0.85% NaCl solution and incubated for 1 h in saline solu-
tion containing a macromolecular tracer, horseradish perox-
idase (HRP) 2 mg/ml (Sigma). The samples were fixed with
2.7% glutaraldehyde-sodium phosphate buffer (pH 7.4) con-
taining 0.01 M of CaCl2 or 0.22 mM sucrose. Then, they were
post fixed in 1% Osmium tetroxide solution. Ultra-thin sec-
tions were contrasted with uranyl acetate and lead citrate. The
materials were then included in resin spun. The screens were
observed and photographed with a Zeiss 902 transmission
electron microscope (TEM).
3. Results and discussion
The preliminary biological screening of the extracts
showed that the aqueous extract had no antimicrobial activity
while the ethanol extract showed activity. The results of the
antimicrobial activity test, as shown in Fig. 1, revealed that
the growth of the Gram (+) bacterial strains (Staphylococ-
cus aureus, Staphylococcus saprophyticus and Enterococcus
faecalis) was affected by the extract by forming clear inhi-
bition zones between 8 and 12 mm in diameter. The great-
est inhibition zones were found against clinical isolates of
Fig. 1. Antimicrobial activity of the extracts of flowers of Phrygilanthus acutifolius. Zone of inhibition measured in mm by agar diffusion assay for ethanol
extract of Phrygilanthus acutifolius on nine human patogen microorganisms. Data are reported as the mean ± S.D. from three different experiments. All
experiments were performed by seeding 25 ␮l of ethanol extract. The inhibition diameter was the average of four measurements per hole. Chloramphenicol
was used as a standard antibiotic at a concentration of 30 ␮g/ml and the inhibition diameter was 20.0 ± 2.0.
195
Table 1
Minimal Inhibitory Concentration, Minimal Bacteriostatic Concentration
and Minimal Bactericidal Concentration of Phrygilanthus acutifolius
extracta
Bacteria Ethanol extract
MICb M Bacteriostatic M Bactericidal
(mg/ml) Cc (mg/ml) Cd (mg/ml)
Staphylococcus aureus 0.625 – 0.625
Pseudomonas aeruginosa 2.5 2.5 5.0
Cloramphenicol – – –
a Agar dilution method, mean value N = 3.
b MIC: Minimal Inhibitory Concentration.
c M Bacteriostatic C: Minimal Bacteriostatic Concentration.
d M Bactericidal C: Minimal Bactericidal Concentration.
Staphylococcus aureus, an oxacillin-resistant strain. These
bacteria were sensitive to chloramphenicol (30 ␮g) between
20 and 24 mm in diameter. The Minimum Inhibitory Concen-
tration of the extract, 0.625 mg/ml (Table 1), was identical
to the Minimum Bactericidal Concentration. The Staphylo-
coccus aureus strain was chosen on the basis of its clinical
importance in cases of infection. It acquires its resistance due
to the presence of penicillin-binding protein (PBP) of high-
molecular weight and has a very low-affinity for lactamic
antibiotics (Hardman et al., 1996) (Table 2).
Electron microscopy techniques revealed that the extract
also had an effect on the morphology of the strain under study.
The untreated culture remained unaltered, while swelling of
the bacterial body and disintegration of the cell surface was
found in an 18 h extract-treated culture. This may be due to
injury of the cell wall and alterations in the cytoplasmic mem-
brane permeability, resulting in the loss of cytosol and finally
in cell death. Significant morphological changes were ob-
served in the cells-treated with 100 ␮g/ml of chlorampheni-
col as compared with the intact cells (Fig. 2).
196 A. Daud et al. / Journal of Ethnopharmacology 99 (2005) 193–197
Table 2
Effect of ionic strength and divalent cations
+Ethanol Extract
Staphylococcus aureus Pseudomonas aeruginosa
NaCl concentrations (mM)
25 0 0
50 0 0
100 0 0
150 0 0
Divalent cations
+Mg2+ 4±1 195 ± 5
−Mg2+ 0 0
UNC: uncountable number of colonies. Mean value N = 3.
The extract evidenced different inhibitory properties
against Gram (−) bacteria (Fig. 1). Thus, Klebsiella pneumo-
niae, Escherichia coli wild strain and Escherichia coli K12
4100 were not affected, while Serratia marcescens, Acineto-
bacter sp. and Pseudomonas aeruginosa showed a moderate
zone of growth inhibition, indicating that they might be sus-
ceptible. MIC studies revealed that about 2.5 mg/ml of extract
was required for growth inhibition in Pseudomonas aerug-
inosa. The MBC for this species was always found to be
two-fold higher than MIC values, thus the extract exhibited
bacteriostatic activity at a lower concentration and bacterici-
dal activity at a higher concentration. The greater resistance
of Gram (−) bacteria to plant extracts has been documented
previously (Palombo and Semple, 2001). This resistance is
probably due to the differences in cell wall structure between
Gram (+) and Gram (−) bacteria; the Gram (−) outer mem-
brane acting as a barrier to many substances, including an-
tibiotics (Tortora et al., 2001).
All bacterial organisms tested were sensitive to chlo-
ramphenicol, which was used as a control antibiotic and
which exerted a higher inhibitory effect on bacterial growth
14–22 mm in diameter than the ethanol extract (Fig. 1). The
low-bioactivity of the crude extract would result either from
dilutions of its active constituents or from the antagonism
in the bioactivity among extract constituents (Ibrahim et al.,
1997).
We measured antibacterial activity under different experi-
mental conditions of pH, ionic strength and divalents cations
(Mg2+ ). The assays were affected at pHs 5, 7.5 and 8 and at
Fig. 2. TEM of ethanol extract-treated Staphylococcus aureus (magnification: ×28,800). (A) 70% Ethanol, (B) treated and (C) chloramphenicol.
−Ethanol Extract
Staphylococcus aureus Pseudomonas aeruginosa
UNC UNC
UNC UNC
UNC UNC
UNC UNC
UNC UNC
UNC UNC
increasingly higher NaCl concentrations ranging from 25 to
150 mM. Activity was not affected either by different pH or
by different ionic strength (Table 2).
The presence of Mg2+ in the culture medium of Phry-
gilanthus acutifolius diminished the sensitivity of the Pseu-
domonas aeruginosa strain against the extract, an increase in
the MIC values being observed (data not shown). This effect
is probably explained by the fact that divalent cations stabilize
the outer membrane of Gram (−) bacteria. Ca2+ and/or Mg2+
are necessary for salt bridging between LPS and phospho-
lipids within the bilayer matrix (Lugtemberg and Alphem,
1983).
Our results suggest the presence in the crude extract of
active constituents that interact with target molecules; this
interaction would involve electrostatic-binding to negatively
charge surface molecules.
The results of the present investigation indicate the exis-
tence of compounds with antimicrobial activity in the ethanol
extract of the flowers of Phrygilanthus acutifolius. Although
no previous reports concerning the antibacterial activity of
the plant species studied could be found in the literature, our
results would support the efficacy of its traditional use in
the treatment of respiratory infections known by interviews
with healer and rural people of Amaicha del Valle (Tucumán,
Argentina). Approximately, 60% of those who were pooled
responded about the use of the flower for respiratory diseases
(data not shown).
Further phytochemical studies are required to establish the
types of compounds responsible for the bioactivity of this
 A. Daud et al. / Journal of Ethnopharmacology 99 (2005) 193–197
medicinal plant and to determine the value of the ethnob-
otanical approach (Cox and Balick, 1994) for the screening
of plants as potential sources of bioactive substances.
Acknowledgements
This research was supported by CIUNT grants to A.
Sánchez Riera. We are grateful to the Microbiology Course
of the Universidad Nacional de Tucumán for providing the
strains. We wish to thank Mrs. Virginia Méndez for her proof-
reading.
References
Abbiatti, D., 1943. Sinopsis de las Lorantaceas argentinas. Revista Ar-
gentina de Agronomı́a 10, 1–25.
Bennet, J.V., Brodie, J.L., Benner, J.L., Kirby, W.M.M., 1996. Simplified
accurate method for antibiotic assays of clinical specimens. Appl.
Microbiol. 14, 170–177.
Cox, P.A., Balick, M.J., 1994. The ethnobotanical approach to drug dis-
covery. Sci. Am. 270, 60–65.
Hardman, J.G., Limbird, L.E., Goodman Gilman, A., 1996. Las Bases
Farmacológicas de la Terapéutica, vol. 45, Novena edición, McGraw-
Hill Interamericana, Tomo II, Cap., p. 1145.
197
Ibrahim, M.B., Owonubi, M.O., Onaolapo, J.A., 1997. Antimicrobial ef-
fects of extracts of leaf, stem and root bark of Anogiessus leicar-
pus on Staphylococcus aureus NCTC 8198, Escherichia coli NCTC
10418 and Proteus vulgaris NCTC 4636. J. Pharma. Res. Dev. 2, 20–
26.
Low, C.A.M., Regnier, T.J.C., Korsten, L., 2002. Medicinal bul-
bous plants of South Africa and their traditional relevance in
the control of infectious diseases. J. Ethnopharmacol. 82, 147–
154.
Lugtemberg, B., van Alphem, L., 1983. Molecular architecture and func-
tioning of the outer membrane of Escherichia coli and other Gram
negative bacteria. Biochim. Biophys. Acta 737, 51–115.
Martinez Crovetto, R., 1965. Estudios etnobotanicos II. Nombres de plan-
tas y su utilidad según los indios tobas del este de Chaco. Bonplandia
4, 270–333.
Martinez Crovetto, R., 1981. Las Plantas Utilizadas en Medicina Popular
en el Noroeste de Corrientes, República Argentina, Fundación M.
Lillo, Tucumán, Argentina.
Palombo, E.A., Semple, S.J., 2001. Antibacterial activity of tradi-
tional Australian medicinal plants. J. Ethnopharmacol. 77, 151–
157.
Rojas, G., Lévaro, J., Tortoriello, J., Navarro, V., 2001. Antimicrobial
evaluation of certain plants used in Mexican traditional medicine for
the treatment of respiratory disease. J. Ethnopharmacol. 74, 97–101.
Shigeharu, K., 2000. Enzymes responsible for the bactericidal effect in
extracts of vitelline and fertilization envelopes of rainbow trouts eggs.
Zygotes 8, 257–265.
Tortora, G.J., Funke, B.R., Case, C.L., 2001. Microbiology: An Introduc-
tion. Benjamı́n Cummings, San Francisco, p. 88.
 Journal of Ethnopharmacology 99 (2005) 199–202

Antidiabetic plants used by Sikkim and

Darjeeling Himalayan tribes, India
D.R. Chhetri a,∗ , P. Parajuli b , G.C. Subba c
a Post Graduate Department of Botany, Darjeeling Government College, Darjeeling 734101, India
b Department of Neurosurgery, Wayne State University and Karmanos Cancer Institute, Detroit, MI 48201, USA
c Government Diosgenin Factory, Gairibas, Darjeeling 734502, West Bengal, India

Received 7 June 2004; received in revised form 13 December 2004; accepted 25 January 2005
Available online 11 April 2005

Abstract

Sikkim and Darjeeling Himalayan region is characterized by a rich floral diversity and an equally rich ethnomedicinal tradition. Herbal
medicine is the dominant system of medicine practiced by the local tribes of this region for the treatment of diabetes. During the course of the
present studies it was found that 37 species of plants belonging to 28 families are used as antidiabetic agents in the folk medicinal practices
in the region and 81% of these plants are hitherto unreported as hypoglycemic agents. This finding may lead to serious research towards
developing new and efficient drugs for diabetes.
© 2005 Elsevier Ireland Ltd. All rights reserved.

Keywords: Diabetes; Antidiabetic plants; Hypoglycemic agents; Traditional medicine

1. Introduction medical system (Kameswararao et al., 2003). To treat dia-

Sikkim and Darjeeling Himalaya is situated between
87◦ 59 and 88◦ 53 East longitude and, 26◦ 31 and 28◦ 10
North latitude in India (Fig. 1). This region is rich in floral
diversity, many endemic elements and a number of species,
which have become rare, threatened or endangered. (Pandey,
1991; Bhujel, 1996). The major ethnic groups of the region
are the Nepalese, Lepchas and Bhutias (Tibetans). The tribes
of this Himalayan region also have rich ethnomedicinal tradi-
tions for which a few literatures are available (Biswas, 1956;
Bennet, 1983; Yonzone et al., 1984; Srivastava et al., 1987;
Venu et al., 1990; Pandey, 1991; Rai and Sharma, 1994; Rai
et al., 1998; Rai and Bhujel, 1999, 2002; Das and Mandal,
2003).
Diabetes affects about 5% of the global population
(Chakraborty and Rajagopalan, 2002) and management of
diabetes without any side effects is still a challenge to the
∗ Corresponding author. Present address: P.O. Box No. 79, Darjeeling-
HPO, Darjeeling 714101, India. Tel.: +91 354 2259054.
E-mail address: munal@sancharnet.in (D.R. Chhetri).
betes, the tribal people in these parts of the Himalayas are
found to use herbal treatments either alone or in combination
with other forms of treatments. Herbal drugs are prescribed
widely because of their effectiveness, less side effects and
relatively low cost (Venkatesh et al., 2003). Therefore, in-
vestigation on such agents from traditional medicinal plants
has become more important (Suba et al., 2004). Here, we re-
port 37 species of plants used as antidiabetic agents by the
traditional healers of Sikkim and Darjeeling Himalayas.
2. Methodology
Regular field trips to different areas of Darjeeling and
Sikkim hills were conducted between September 2001 and
April 2003 to collect the ethnomedicinal information and
herbarium specimens. The tribal people including local heal-
ers, Jhankris, Bijuwas and Fedangwas (Nepalese traditional
healers), Bongthings and Mon-Bongthings (Lepcha medicine
men and women, respectively) Lamas (Bhutia priest) and vil-
lage elders were interviewed. The help of the socio-cultural

0378-8741/$ – see front matter © 2005 Elsevier Ireland Ltd. All rights reserved.
doi:10.1016/j.jep.2005.01.058
200 D.R. Chhetri et al. / Journal of Ethnopharmacology 99 (2005) 199–202

Table 1
Antidiabetic medicinal plants from Sikkim and Darjeeling Himalayas
Botanical name family, voucher specimen no. Habit Local name: N-Nepali; Method of use and administration
L-Lepcha; T-Tibetan
1 2 3 4
Abroma augustaa (L.) L.f., Sterculiaceae, Shrub Ulatkamal (N) Stem bark and leaf decoction (10–20 ml)
GCS 373 taken one time each alternate day in empty
stomach for 4–6 week.
Abutilum indicumb (L.) Sw., Malvaceae, Shrub Ghantiphool (N) Decoction of stem bark (25–50 ml) given
DRC 178 two times daily (after principal meals) for
3–4 weeks.
Aconitum palmatumb D. Don., Herb Seto bikhumma (N); Nyini Root decoction (10–15 ml) taken with a cup
Ranunculaceae, DRC 166 (L); Bhongnanukpo (T) of milk one time daily (after lunch) for 7–10
days.
Aloe barbadensisc Mill, Liliaceae, DRC 161 Herb Ghew kumari (N); Kumari Fresh leaf pulp (40–50 g) taken once a day in
(T) empty stomach for 10–12 weeks.
Asparagus racemosusa Willd., Liliaceae, Climbing shrub Kurilo (N); Neusiri (T) Decoction of tender shoots (25 ml) taken
DRC 102 once a day for 6–8 weeks.
Berberis aristataa DC., Berberidaceae, DRC Shrub Sano Chutro (N); Sutangkung Root bark extract (5–10 ml) taken twice daily
111 (L); Skyerba (T) (after breakfast and dinner) for 1–2 weeks
Boenninghausenia albiflorad (Hook. f.) Herb Chirbirpatay (N) The whole plant is crushed without water
Reich ex Meissn., Rutaceae, DRC 180 and the juice (5–10 ml) taken one to two
times daily for 3–4 weeks.
Calamus rotanga (L.), Arecaceae, GCS 338 Climbing shrub Bet (N) Raw fruit (1–2) taken as masticatory two
times daily (after breakfast and lunch) for
6–8 weeks.
Campylandra aurantiacad Baker, Liliaceae, Herb Nakima (N) Flowers are made into curry and taken with
DRC 179 staple food two times per week for 4–6
weeks
Cannabis sativab (L.), Cannabaceae, GCS Under shrub Bhang (N) Leaf extract (5–10 ml) taken two times daily
329 for 3–4 weeks.
Catharanthus roseuse (L.) G. Don., Herb Sada bahar (N) Raw leaf (1–2) chewed daily for 2 weeks.
Apocynaceae, DRC 161
Cinnamomum tamalad (Buch.-Ham.) Nees Tree Sinkauli (N); Napsor (L); Decoction of stem bark taken three times
and Eberm., Lauraceae, GCS 378 Mensing (T) daily for 3–4 weeks
Cissampelos pareiraa (L.), var.hirsuta Climber Batulpatay (N) Root bark extract (5–10 ml) tken one to two
(Buch.-Ham ex DC) Forman, Menisper- times daily for 2–3 weeks
maceae, PPR 219
Coccinea grandisa (L.) Voigt., Climber Tilkor (N) Fresh root extract (5–10 ml.) taken two times
Cucurbitaceae, PPR 286 daily (before principal meals) for 3–4 weeks
Costus speciosusb (Koening) Sm., Herb Betlouri (N); Ruyang (L) Decoction of rhizome (10–20 ml) taken two
Costaceae, PPR 249 to three times daily for 2–4 weeks
Ficus racemosaf (L.), Moraceae, DRC 127 Tree Dumri (N) Fruit juice (20–25 ml) taken two times daily
(before meals) for 4–8 weeks
Girardiana heterophyllab Decne., Shrub Bhangre sisnu (N) Root decoction (25–50 ml) taken two times
Urticaceae, PPR 228 daily for 4–8 weeks
Gynocardia odorataa R. Br., Flacourtiaceae, Tree Gantay (N); Tukkung (L) Fruit juice (10–15 ml) taken one time daily
DRC 150 for 2 weeks
Ipomoea batatusg (L.) Lamk., Herb Sagarkhanda (N) The juice of the aerial part of the plant
Convolvulaceae, PPR 238 (25–30 ml) taken two times daily for 3–4
weeks
Litsea cubebag Pers., Lauraceae, GCS 344 Tree Siltimmur (N) One raw fruit chewed as masticatory two
times daily for 4–6 weeks
Momordica chrantiaa (L.), Cucurbitaceae, Climber Karela (N) Fruit extract (25 ml) taken two times daily
GCS 368 for 12–14 weeks
Nardostachys jatamansia DC., Valerianaceae, Herb Jatamansi (N), Spanpos (T) Decoction of rootstock (30–50 ml) taken
DRC 154 once daily for 2–3 weeks
Oroxylum indicumc (L.) Vent., Tree Totola (N), Phagorip (L), Stem bark decoction (15–20 ml) or juice
Bignoniaceae, DRC 134 Sonaka (T) (5–10 ml) taken two to three times daily
Paederia foetidaa (L.), Rubiaceae, DRC 138 Climber Birilahara (N), Takpoedrik Leaf infusion (50–60 ml) taken one time in
(L) the morning for 2–3 weeks
Panax pseudoginsengd Wall., Araliaceae, Herb Panch patay (N) Dried rhizome powder (0.5–1 g) taken one
DRC 123 time daily with warm milk
Picrorhiza kurrooad Royle ex Benth., Herb Kutki (N), Putse sel (T) Dry rhizome powder (0.5 g) taken with two
Scrophulariaceae, DRC 189 tablespoon of curd and a pinch of pepper
power one time daily for 1–2 weeks
 D.R. Chhetri et al. / Journal of Ethnopharmacology 99 (2005) 199–202
Table 1 (Continued )
Botanical name family, voucher specimen no. Habit
1 2
Potentilla fulgensc Wall., Rosaceae, DRC Herb
171
Quercus lanatad Sm., Fagaceae, PPR 248 Tree
Saraca asocae (Roxb.) De Wilde, Tree
Caesalpiniaceae, GCS 334
Stephania glabrab (Roxb.) Miers, Climber
Menispermaceae, PPR 212
Swertia angustifoliad Buch.-Ham.ex D. Herb
Don., Gentianaceae, DRC 121
Swertia chirayitab (Roxb. ex Flem.) Karst., Herb
Gentianaceae, DRC 187
Swertia pedicellatab Banerji, Gentianaceae, Herb
DRC 151
Syzygium cuminiie (L.) Skeels, Myrtaceae, Tree
PPR 209
Trigonella foenum-graecuma (L.), Fabaceae, Herb
PPR 243
Urtica dioicaa (L.), Urticaceae, DRC 163 Herb
Zingiber officinalea Rosc., Zingiberaceae, Herb
DRC 162
a Kirtikar and Basu (1998).
b Das and Mandal (2003).
c Kumar (2002).
d Polunin and Stainton (1984).
e Jain (1994).
f Chatterjee and Pakrashi (1991).
g Gurung (2002).
organizations of each group was taken for approaching and
building up of rapport with the traditional healers of each
community. Preliminary identification of collected plant ma-
terials, their local names and information regarding their
mode of use were recorded with the help of these traditional
medicine practitioners and village elders. Information ob-
tained and cross checked with at least seven different infor-
mants only has been incorporated here. Subsequently, the
collected plants were identified at the Panchavati Greentech
Research Society, Darjeeling, and the voucher herbarium
specimens were deposited in the herbarium of the Medici-
nal Plants Division, Panchavati Greentech Research Society,
Darjeeling, India.
In the enumeration, data on the plants used as hypo-
glycemic agents are presented which consist of the botanical
name, family, voucher specimen number, habit, local name in
Nepali (N), Lepcha (L) and Tibetan (T) (wherever available)
followed by the method of use and administration (Table 1).
References used for identification have been mentioned as su-
perscript letters against the name of each plant. The present
study reports the use of medicinal plants in the form of infu-
sion or decoction (by soaking in hot water or boiling), extract
201
Local name: N-Nepali; Method of use and administration
L-Lepcha; T-Tibetan
3 4
Banmula (N) Decoction of root (20–25 ml) taken two
times daily for 4–8 weeks
Banj (N) Decoction of stem bark (20–25 ml) taken one
or two times daily for 2–3 weeks
Asok (N) Infusion of the dry flower (50–100 ml) taken
two times daily (before principal meals) for
4–5 weeks
Tamarkay (N), Kanthey (L) Root decoction (20–25 ml) taken with milk
two to three times daily for 1–2 weeks
Patlay Chireto (N) Infusion of whole plant (40–50 ml) taken
two times daily (before principal meals for
3–4 weeks
Chireto (N), Rungkyon (L), Infusion of the whole plant (50–60 ml) taken
Tagota (T) one time daily in empty stomach for 2 weeks
Chireto (N) Decoction of shoot (20–25 ml) taken two
times daily (before meals) for 4–6 weeks
Kyamuna (N), Dzambu (T) Decoction of stem bark (25–30 ml) taken
three times daily for 2–3 weeks
Methi (N) Sprouted seeds mixed with chilly, salt and
garlic and ground into a paste. 5–10 g of the
paste taken with two principal meals daily
Sisnu (N), Sarong (L) Decoction of young leaves and shoots
(50–100 ml) taken as curry one or two times
daily with meals for 4–8 weeks
Adua (N), Heng (L), Beasga Decoction of rhizome (25–50 ml) taken as
(T) herbal tea with a pinch of salt two to three
times daily for 8–12 weeks
or juice (by crushing the fresh plant parts with or without wa-
ter) and paste or powder (by grinding the fresh or dried plant
parts).
3. Results and discussion
In the present study, it was found that a total of 37 species
of plant belonging to 28 different families are utilized as an-
tidiabetic agents by the tribal people Sikkim and Darjeeling
Himalayan region. Of these, 30 species of plants (81%) have
not been reported as hypoglycemic agents in the Dictionary
of Indian Folk Medicine and Ethnobotany (Jain, 1991). This
emboldens us to conclude that herbal medicine is still the
dominant medicine for diabetes in this area.
The efficacy of these ethnomedicinal plants needs to be
subjected to pharmacological validation. Some antidiabetic
plants may exert their action by stimulating the function
or number of ␤-cells and thus increasing insulin release
(Persaud et al., 1999). In some other plants, the effect is due
to decreased blood glucose synthesis due to the decrease of
the activity of enzymes like glucose-6-phosphatase, fructose
202 D.R. Chhetri et al. / Journal of Ethnopharmacology 99 (2005) 199–202
Fig. 1. Map of Sikkim and Darjeeling Himalayas showing the study area.
1,6-bisphosphatase, etc. In still other plants, the activity is
due to slow absorption of carbohydrate and inhibition of glu-
cose transport (Madar, 1984). However, these products may
interact with the conventional diabetes medicines (Shane-
McWhorter, 2001). Therefore, a cautious approach should
be adopted before administering these drugs. Of course, this
primary information is important in view that it may lead to
serious pharmacological research and can provide great value
in selecting plant material for drug discovery (Lewis et al.,
2004).
Acknowledgements
The authors are thankful to the authorities of the Depart-
ment of Forests, Government of Sikkim, Sikkim, India; Pan-
chavati Greentech Research Society, Darjeeling, India; All
India Lepcha Association and other tribal organizations for
various helps provided during the present study. The anony-
mous reviewers of the paper are thankfully acknowledged for
their constructive suggestions.
References
Bennet, S.S.R., 1983. Ethnobotanical studies in Sikkim. Indian Forester
109, 577–581.
Bhujel, R.B., 1996. Studies on the dicotyledonus flora of Darjeeling dis-
trict. Ph. D. Thesis. North Bengal University, Darjeeling, India.
Biswas, K., 1956. Common Medicinal Plants of Darjeeling and Sikkim
Himalaya. Bengal Government Press, West Bengal, Calcutta.
Chakraborty, R., Rajagopalan, R., 2002. Diabetes and insulin resistance
associated disorders: disease and the therapy. Current Science 83,
1533–1538.
Chatterjee, A., Pakrashi, S.C., 1991. The Treatise on Indian Medicinal
Plants, vol. I. Publication and Information Directorate, CSIR, New
Delhi.
Das, A.P., Mandal, S., 2003. Some Medicinal Plants of Darjeeling Hills,
WWF-India. West Bengal State Office, Kolkata.
Gurung, B., 2002. The medicinal plants of Sikkim Himalaya. Maples,
Chakung.
Jain, S.K., 1991. Dictionary of Indian Folk Medicine and Ethnobotany.
Deep Publications, New Delhi.
Jain, S.K., 1994. Medicinal Plants. National Book Trust, India, New
Delhi.
Kameswararao, B., Kesavulu, M.M., Apparao, C., 2003. Evaluation of
antidiabetic effect of Momordica cymbalaria fruit in alloxan-diabetic
rats. Fitoterapia 74, 7–13.
Kirtikar, K.R., Basu, B.D., 1998. Indian Medicinal Plants, vol. I–IV.
Bishen Singh Mahendra Pal Singh, Dehradun.
Kumar, S., 2002. The Medicinal Plants of North-East India. Scientific
Publishers (India), Jodhpur.
Lewis, W.H., Vaisberg, A., Lamas, G., Sarasara, C., Elvin-Lewis, M.,
2004. Advantage of ethnomedically based research for searching new
pharmaceuticals. Ethnobotany 16, 10–15.
Madar, Z., 1984. Fenugreek (Trigonella foenum-graecum) as a means of
reducing postprandial glucose levels in diabetic rats. Nutrition Report
International 29, 1267–1273.
Pandey, V.N., 1991. Medico-Ethno-Botanical Explorations in Sikkim Hi-
malayas. Central Council for Research in Ayurveda and Siddha, Gov-
ernment of India, New Delhi.
Persaud, S.J., Al-Majed, H., Raman, A., Jones, P.M., 1999. Gymnema
sylvestre stimulates insulin release in vitro by increased membrane
permeability. Journal of Endocrinology 163, 207–212.
Polunin, O., Stainton, A., 1984. Flowers of the Himalaya. Oxford Uni-
versity Press, New Delhi.
Rai, P.C., Sarkar, A., Bhujel, R.B., Das, A.P., 1998. Ethnomedicinal stud-
ies in some fringe areas of Sikkim and Darjeeling Himalaya. Journal
of Hill Research 11, 12–21.
Rai, L.K., Sharma, E., 1994. Medicinal Plants of Sikkim
Himalayas—Status Uses and Potential. Bishen Singh Mahen-
dra Pal Singh, Dehradun.
Rai, S.K., Bhujel, R.B., 1999. Notes on some less known ethnomedici-
nal plants from Darjeeling Himalayas. Journal of Hill Research 12,
160–163.
Rai, S.K., Bhujel, R.B., 2002. Ethnic uses of some monocotyledonous
plants in the Darjeeling Himalayan region. In: Das, A.P. (Ed.), Per-
spectives of Plant Biodiversity. Bishen Singh Mahendra Pal Singh,
Dehradun, pp. 635–644.
Shane-McWhorter, L., 2001. Biological complimentary therapies: a focus
on botanical products in diabetes. Diabetes Spectrum 14, 199–208.
Srivastava, T.N., Kapaki, B.K., Atal, C.K., 1987. Ethnomedico-botanical
investigations in Sikkim. Journal of Economic and Taxonomic Botany
11, 413–421.
Suba, V., Murugesan, T., Rao, R.B., Ghosh, L., Pal, M., Mandal, S.C.,
Saha, B.P., 2004. Antidiabetic potential of Barleria lupulina extract
in rats. Fitoterapia 75, 1–4.
Venkatesh, S., Reddy, G.D., Reddy, B.M., Ramesh, M., Appa Rao, A.V.N.,
2003. Antihyperglycemic activity of Caralluma attenuata. Fitoterapia
74, 274–279.
Venu, P., Kumar, V., Bhasin, M.K., 1990. Human activity and its impacts
on vegetation: a case study in Sikkim Himalayas. Journal of Human
Ecology 1, 27–38.
Yonzone, G.S., Yonzone, D.K.N., Tamang, K.K., 1984. Medicinal plants
of Darjeeling district. Journal of Economic and Taxonomic Botany 5,
605–616.
 Journal of Ethnopharmacology 99 (2005) 203–209

Preliminary pharmacological studies on Piper chaba stem bark

Md. Taufiq-Ur-Rahman a,∗ , Jamil Ahmad Shilpi b ,
Muniruddin Ahmed c , Chowdhury Faiz Hossain d
a
School of Biological Sciences, University of Manchester, Oxford Road, M13 9PL Manchester, UK
b Pharmacy Discipline, Life Science School, Khulna University, Khulna 9208, Bangladesh
c Department of Pharmacology and Clinical Pharmacy, University of Dhaka, Dhaka 1000, Bangladesh
d Department of Pharmacognosy and National Center for Natural Products Research, School of Pharmacy, University of Mississippi, MS, USA

Received 24 May 2004; received in revised form 9 December 2004; accepted 28 January 2005
Available online 11 April 2005

Abstract

Piper chaba Hunter (Piperaceae) is a common pepper in the southern part of Bangladesh. Various parts of this plant have been extensively
used in different traditional formulations including ayurveda. In order to rationalize the ethnomedical uses of this plant in a number of ailments,
the methanol extract of the stem bark was subjected to preliminary evaluation for analgesic, anti-inflammatory, diuretic, anti-diarrhoeal, effect
on gastrointestinal motility and CNS depressant activity in mice and rat at 125, 250 and 500 mg/kg body weight doses. The extract at given
doses significantly and dose dependently reduced the frequency of acetic acid induced writhing in mice, prolonged the tail flicking latency
in mice, reduced Carrageenan-induced paw edema volume in rat, delayed the onset as well as reduced the frequency of castor oil induced
diarrhoeal episodes in mice, decreased gastrointestinal motility as assessed by the charcoal motility test in mice and prolonged pentobarbitone
induced sleeping time in mice. However at the same doses, the extract exhibited moderate diuretic activity only at the highest dose.
© 2005 Elsevier Ireland Ltd. All rights reserved.

Keywords: Analgesic activity; Anti-inflammatory activity; Diuretic activity; Anti-diarrhoeal activity; CNS depressant activity; Charcoal motility test

1. Introduction post-delivery pain in mothers and also useful in rheumatic

The plant Piper chaba Hunter (Piperaceae) is a climbing,
glabrous shrub available in various parts of India and Malay
Islands (Kirtikar and Basu, 1980). In Bangladesh, it grows
in plenty in Khulna division and more specifically in the
Satkhira–Bagerhatt area. Like other plants of Piper genus,
the plant enjoys vast folklore uses, as traditional medicine.
The root is alexiteric; useful in asthma, bronchitis, con-
sumption. The fruit is pungent; thermogenic, anthelmintic,
expectorant, carminative; improves appetite and taste and
also useful in asthma, bronchitis, fever, inflammation, piles,
pain in the abdomen and at the anus. The fruit has stimulant
and carminative properties, and is used in haemorrhoidal
affections (Kirtikar and Basu, 1980). Stem is used to alley
∗ Corresponding author. Present address: Department of Pharmacology,
University of Cambridge, CB2 1PD, UK.
E-mail address: mtrahmanbd@yahoo.com (Md. Taufiq-Ur-Rahman).
pains and diarrhoea (Yusuf et al., 1994).
Previous phytochemical investigation of the stem bark
of the plant revealed the presence of lignan (Bhandari
et al., 1998) and alkaloids such as piperamine 2,4-decadienoic
acid piperidide, kusunokinin and pellitorine (Connolly et al.,
1995). Root has been reported to contain some alkamides
such as piperine, sylvatine, piplartine and piperlonguminine
and ␤-sitosterol (Patra and Ghosh, 1974). A novel piperine
dimer called chabamide has also been indentified in the stem
bark (Rukachaisirikul et al., 2002). Besides ␤-caryophyllene,
caryophyllene oxide and few monoterpene hydrocarbons,
a moderate content of sesquiterpenes and high amount of
aliphatic hydrocarbons have been found in the fruit oil of the
plant (Tewtrakul et al., 2000). A survey of literature reveals
that there has been dearth of information on pharmacological
studies with Piper chaba Hunter. One previous investigation,
which is rather pharmacokinetic than pharmacological, re-
vealed that the crude extract of the plant increased the oral

0378-8741/$ – see front matter © 2005 Elsevier Ireland Ltd. All rights reserved.
doi:10.1016/j.jep.2005.01.055
204 Md. Taufiq-Ur-Rahman et al. / Journal of Ethnopharmacology 99 (2005) 203–209
bioavailability of sulfadiazine and tetracycline hydrochloride
(Atal et al., 1980). In another study, the crude extract was
found to possess antibacterial activity (Sarker et al., 1991).
Recently, the 80% aqueous acetone extract from the fruit of
Piper chaba as well as some isolated alkamides were found
to be protective against ethanol and indornethacin induced
gastric lesions in rats (Morikawa et al., 2004).
2. Materials and methods
2.1. Plant material and extract preparation
The stem bark of Piper chaba Hunter was collected
from Satkhira, Khulna division of Bangladesh, in June
2002 and was taxonomically identified by Professor Hasan,
Department of Botany, University of Dhaka, where a voucher
specimen has been deposited. After collection, the barks
were cut into pieces, shade-dried and finally ground to coarse
powder. The powdered plant material (1.5 kg) was extracted
with distilled methanol at room temperature for 3 days.
The filtrate was concentrated in vaccuo (50 ◦ C) yielding the
crude methanol extract (20.4 g). The crude extract obtained
as such was kept in refrigerator at 4 ◦ C and was diluted with
normal saline prior to any pharmacological screening.
2.2. Animals
Swiss Albino mice (n = 6 per group) of either sex, weigh-
ing 26–28 g, obtained from the Animal Resource Division,
International Center for Diarrhoeal Diseases and Research,
Bangladesh (ICDDR, B), were used for the experiments ex-
cluding the diuretic and anti-inflammatory activity screening.
For the later tests, male Wister rats (n = 6 per group) weighing
200–250 g obtained from the same source were used. The ani-
mals were kept in standard environmental condition, had free
access to standard food (ICDDR, B formulated) and water ad
libitum and fasted 18 h prior to their use.
2.3. Evaluation of analgesic study
2.3.1. Acetic acid induced writhing test
The method of Koster et al. (1959) was used. Crude
extract (125, 250 and 500 mg/kg) was orally administered
to mice (n = 6) 1 h before i.p. injection of 0.6% (v/v) acetic
acid, at a dose of 10 ml/kg, while normal saline was used
as control treatment. The positive control group received
100 mg/kg of acetylsalicylic acid. Writhings that occurred
between 5 and 15 min after acetic acid were counted.
2.3.2. Tail flicking test
The method of D’Amour and Smith (1941) as modified
by Connor et al. (2000) was adopted for this test. An
analgesiometer (Medicraft Co., India) was used to record
tail flick latencies. Each mouse was encased in small plastic
chamber with the distal part of the tail placed over a heated
nichrome wire and the time taken to withdraw the tail was
recorded 40 min after the administration of test material
(125, 250 and 500 mg/kg). A maximum cut-off time of 10 s
was observed to minimize undue tissue damage as a result
of over exposure of the tail to heat. The control and positive
control group received normal saline and morphine HC1
solution (2 mg/kg, s.c.), respectively.
2.4. Carrageenan-induced rat paw edema test
The method of Winter et al. (1962) was followed for the
test. Administration of 0.1 ml of 1% freshly prepared sus-
pension of carrageenan (Sigma, USA) into the sub-planter
region of the right hind paws of each rat of four groups (each
consisting of six animals) led to the formation of edema in
situ due to localized inflammation. Thirty minutes prior to the
administration of carrageenan solution, the test groups, the
standard group and the control group received orally the ex-
tract (125, 250 and 500 mg/kg), phenylbutazone (100 mg/kg,
Sigma, USA) and normal saline, respectively. Paw volumes
were measured up to a fixed mark by mercury displacement as
viewed by travelling microscope at 1–4 and 24 h after the ad-
ministration of the standard drug and test extracts. The aver-
age percent increase in paw volume with time was calculated
and compared against the control group. Percent inhibition
was calculated using the formula:
Vc − Vt
inhibition (%) = × 100
Vc
where Vc and Vt represent average paw volume of control
and treated animals, respectively.
2.5. Evaluation of diuretic activity
The method of Lipschitz et al. (1943) as modified by Kau
et al. (1984) was adopted for this test. The animals, fasted
and deprived of water for 18 h prior to the experiment, were
divided in five groups of six rats each. The first group of ani-
mals, serving as control, received normal saline (10 ml/kg,
p.o.); the second group received furosemide (1 mg/kg, p.o.) as
a standard: the third, fourth and fifth groups received the test
extract at doses of 125, 250 and 500 mg/kg, respectively. Im-
mediately after dosing, the animals were separately placed in
metabolic cages with provision for urine collection in gradua-
ted measuring cylinders. Cumulative urine out-puts were col-
lected for 5 h while animals were deprived of food and water.
2.6. Evaluation of anti-diarrhoeal activity
Castor oil induced diarrhoea as described by Shoba and
Thomas (2001) was adopted. Mice were divided into con-
trol, positive control and test groups (n = 6). Each mouse was
placed in an individual cage, the floor of which was lined
with blotting paper. Diarrhoea was induced by administering
0.3 ml of castor oil orally to mice. The control group received
only normal saline; the positive control group received lop-
 Md. Taufiq-Ur-Rahman et al. / Journal of Ethnopharmacology 99 (2005) 203–209 205

eramide HCI (5 mg/kg, p.o.; Sigma, USA); the test groups
received the extract (at 125, 250 and 500 mg/kg, p.o.) 40 min
prior to castor oil charge. The time elapsed between the ad-
ministration of castor oil and the excretion of the first diar-
rhoeic stool (wet faeces that left a halo on the filter paper) and
the total number of faecal output by the animals and the total
numbers of wet faeces over a time period of 4 h were counted.
2.7. Evaluation of effect on gastrointestinal motility
The experiment was done in accordance with Biswas et al.
(2002). The animals were divided into control, positive con-
trol and test groups consisting of six mice in each group. Each
animal was given orally 1 ml of charcoal meal (3% deacti-
vated charcoal in normal saline). The test groups received the
extracts at 125, 250 and 500 mg/kg body weight doses (one
dose of extract per group) immediately after the charcoal meal
administration. The positive control group received atropine
sulfate (0.1 mg/kg, i.p.) as standard drug, while the control
group received normal saline (5 ml/kg, p.o.). After 30 min, the
animals were sacrificed and the movement of charcoal from
pylorus to caecum was measured. The charcoal movement
was expressed in terms of percentage.
2.8. Evaluation of effect on pentobarbitone induced
sleeping time of mice
of saline served as the control. Diazepam (1 mg/kg, i.p.; Bex-
imco Pharma, Bangladesh) was used as standard drug. Thirty
minutes after treatments, all animals received sodium phe-
nobarbitone (25 mg/kg, i.p.; Rhone Poulenc, UK). The time
between the loss and recovery of the righting reflex was
recorded as the sleeping time.
2.9. Statistical analysis
All data were expressed as mean ± S.E.M. and analyzed
by Student’s t-test.
3. Results and discussions
3.1. Analgesic activity
The crude Piper chaba bark extract given orally at 125, 250
and 500 mg/kg body weight doses, significantly (P < 0.001)
and dose dependently, inhibited the frequency of acetic acid
induced abdominal constrictions in mice (Table 1). At the
same dose level, the extract also showed significant (P < 0.05,
P < 0.02) and dose dependent prolongation of the tail flicking
time of mice (Table 2).
3.2. Carrageenan-induced rat paw edema

The method adopted by Ramirez et al. (1998) was fol- As can be seen from Table 3, the extract at given doses
lowed. Mice (n = 6) in test groups received test extract (125, caused a sustained and significant (P < 0.001) reduction of
250 and 500 mg/kg, p.o.) while an equal volume (10 ml/kg) carrageenan-induced paw edema volume of treated rats in

Table 1
Effect of methanol extract of Piper chaba stem bark on acetic acid induced writhing in mice
Treatment Dose (mg/kg, p.o.)a Writhings (n)b Inhibition (%)
Control (vehicle, 10 ml/kg, p.o.) – 68.40 ± 1.44 –
Piper chaba extract 125 37.80 ± 1.83**** 44.74
250 31.89 ± 2.20**** 53.37
500 26.12 ± 2.68**** 61.80
ASA 100 19.44 ± 1.41**** 72.47
a Administered 1 h before 0.6% acetic acid (0.1 ml/10g , i.p.).
b Counted for 10 min, starting 5 min after acetic acid injection; values are mean ± S.E.M.; n = 6.
∗∗∗∗P < 0.001 vs. control; Student’s t-test.

Table 2
Effect of methanol extract of Piper chaba stem bark on tail flick reflex of micea
Treatment Dose (mg/kg) Tail-flicking latency (s)b Elongation of tail-flicking latency (%)
Control (vehicle, 10 ml/kg) – 5.1 ± 0.6 –
Morphine 2, s.c. 8.8 ± 0.8*** 72.6
Piper chaba extract 125, p.o. 6.9 ± 0.5* 35.3
250, p.o. 7.4 ± 0.8* 45.1
500, p.o. 8.2 ± 0.8** 60.8
a 40 min after treatment, mice were injected s.c. with morphine (2 mg/kg. s.c.); 5 min after morphine administration, the tail flicking latency was counted for

each group setting analgesiometer current at 0.4 A.

b Values are mean ± S.E.M (n = 6).
∗ P < 0.05 vs. control; Student’s t-test.
∗∗ P < 0.02 vs. control; Student’s t-test.
∗∗∗ P < 0.01 vs. control; Student’s t-test.
206 Md. Taufiq-Ur-Rahman et al. / Journal of Ethnopharmacology 99 (2005) 203–209

Table 3
Effect of methanol extract of Piper chaba on Carrageenan-induced paw edema in ratsa
Treatment Dose Increase in paw volume (ml × 1000) ± S.E.M. (inhibition (%))
(mg/kg p.o.)
1h 2h 3h 4h 24 h
Control (saline) – 58.6 ± 1.5 70.9 ± 2.0 76.7 ± 2.2 89.0 ± 1.7 47.1 ± 1.5
Piper chaba extract 125 51.1 ± 1.3*** (12.8) 56.2 ± (20.7) 60.2 ±
1.5**** (21.5) 71.3 ±
1.3**** (20.1) 42.1 ± 1.3 (10.6)
2.6****
250 47.2 ± 1.3**** (19.4) 54.2 ± 1.6**** (23.5) 53.2 ± 1.5**** (30.6) 64.8 ± 1.8**** (27.3) 41.2 ± 1.3*** (12.5)
500 45.8 ± 2.1**** (21.8) 45.2 ± 2.8*** (36.3) 49.6 ± 1.6**** (35.3) 56.9 ± 2.3**** (36.1) 40.8 ± l.l** (13.4)
Phenylbutazone 100 43.9 ± 1.5**** (25.1) 46.7 ± 1.7**** (34.1) 47.9 ± 1.8**** (37.5) 54.4 ± 2.2**** (39.0) 38.2 ± 1.3** (18.9)
a Values are mean ± S.E.M (n = 6).
∗∗ P < 0.02 vs. control; Student’s t-test.
∗∗∗ P < 0.01.
∗∗∗∗P < 0.001 vs. control; Student’s t-test.

Table 4
Effect of methanol extract of Piper chaba stem bark on urinary output in ratsa
Treatment Dose (mg/kg, p.o.) Total urine output (ml)b Increase (%)
Control (saline, 10 ml/kg, p.o.) – 4.8 ± 0.4 –
Piper chaba extract 125 3.6 ± 1.8 –
250 5.4 ± 0.4 12.5
500 6.9 ± 0.8* 43.7
Furosemide 10 8.1 ± 0.6*** 68.7
a Values are mean ± S.E.M. (n = 6).
b Collected for 5 h after treatment.
∗ P < 0.05 vs. control; Student’s t-test.
∗∗∗ P < 0.001 vs. control; Student’s t-test.

Table 5
Effect of the methanol extract of Piper chaba stem bark on castor oil induced diarrhoea in micea
Treatment Dose (mg/kg body Onset time of Total number of Total number of
weight, p.o.) diarrhoea (min) faecal output in 4 h wet faeces in 4 h
Control (normal saline) 5b 104.6 ± 3.3 13.2 ± 1.1 10.1 ± 1.4
Loperamide 5 244.8 ± 1.5**** 2.8 ± 0.8**** 1.6 ± 0.8****
Piper chaba extract 125 138.8 ± 2.6**** 10.8 ± 0.8 8.9 ± 1.8
250 158.8 ± 2.1**** 10.2 ± 0.8* 6.3 ± 0.8*
500 198.8 ± 2.4**** 8.3 ± 1.1*** 5.4 ± 1.2*
a Values are mean ± S.E.M. (n = 6).
b In ml/kg.
∗ P < 0.05 vs. control; Student’s t-test.
∗∗∗ P < 0.01 vs. control; Student’s t-test.
∗∗∗∗P < 0.001 vs. control; Student’s t-test.

dose dependent manner. At the second hour of study, the

extract at 500 mg/kg body weight dose, showed the maximum
(36.3%) inhibition of edema, which was even higher than that
with phenylbutazone (100 mg/kg). Table 6
Effect of methanol extract of Piper chaba bark on gastrointestinal motility
of micea
3.3. Test for diuretic activity
Treatment Dose (mg/kg, p.o.) Distance traversed by
charcoal meal (%)
As shown in Table 4, the extract showed significant
(P < 0.05) increase in total urinary output of rats only at Control (normal saline) 5b , p.o. 86.4 ± 1.2
Atropine sulfate 0.1, i.p. 44.8 ± 1.4****
500 mg/kg body weight dose where as the standard diuretic
furosemide exhibited 68.7% increase (P < 0.00l). Piper chaba extract 125 80.1 ± 2.2*
250 72.5 ± 1.8****
500 54.2 ± 1.4****
3.4. Castor oil induced diarrhoea a Values are mean ± S.E.M. (n = 6).
b In ml/kg.
In the castor oil induced diarrhoea model, the crude ex- ∗ P < 0.05 vs. control; Student’s t-test.

tract showed about 52 and 90% prolongation of the time for ∗∗∗∗P < 0.001 vs. control; Student’s t-test.
 Md. Taufiq-Ur-Rahman et al. / Journal of Ethnopharmacology 99 (2005) 203–209
Table 7
Effect of the methanol extract of Piper chaba bark on phentobarbital-induced sleeping time of micea
Treatment Dose (mg/kg body weight
Control (normal saline) 10b p.o.
Diazepam 1, i.p.
Piper chaba extracts 125, p.o.
250, p.o.
500, p.o.
a Values are mean ± S.E.M. (n = 6).
b In ml/kg.
∗ P < 0.05 vs. control; Student’s t-test.
∗∗∗∗P < 0.001 vs. control; Student’s t-test.
induction of diarrhoea against the control group at 250 and
500 mg/kg body weight doses, respectively. At the same dose
level, the extract also reduced the frequency of defaecation
by almost 23 and 37%, respectively (Table 5). Although the
extract at 125 mg/kg body weight dose delayed the on-set
time of diarrhoea by 32.7% (P < 0.001), it failed to exhibit
any significant reduction in diarrhoeal episodes.
3.5. Gastrointestinal motility test
The results of the charcoal motility test (Table 6), the ex-
tract at 250 and 500 mg/kg body weight doses, significantly
and dose dependency decreased the propulsion of charcoal
meal through the gastrointestinal tract by about 16 and 37%
with respect to the control group whereas the maximum inhi-
bition (around 48%) of gastrointestinal motility was observed
with atropine sulphate. But anti-motility effect of the extract
at 125 mg/kg was not prominent compared to the standard.
3.6. Pentobarbitone induced sleeping time
The extract significantly (P < 0.001) prolonged the du-
ration of pentobarbitone induced sleeping time in mice at
500 mg/kg body weight dose only whereas it reduced the on-
set time significantly (P < 0.05) at both 250 and 500 mg/kg
body weight dose (Table 7).
4. Discussions
The crude methanol extract of Piper chaba stem bark (at
125, 250 and 500 mg/kg body weight dose, p.o.) showed
significant and dose dependent analgesic activity in both
acetic acid induced writhing and tail flick test in mice
(Tables 1 and 2) which is indicative of its ability to act in
both peripheral and central pathways of pain. Intraperito-
nial administration of acetic acid causes algesia by liber-
ating noxious endogenous substances including serotonin,
histamine, prostaglandin, bradykinin and substance P that
sensitize pain nerve endings (Collier et al., 1968; Raj, 1996).
Of the prostanoids, mainly prostacyclin (PGI2 ) has been held
responsible for the causation of pain following acetic acid
administration (Murata et al., 1997). It has been suggested
207
Onset of sleep (min) Duration of sleep (min)
5.78 ± 0.88 19.48 ± 1.90
2.92 ± 0.44* 39.44 ± 1.80****
4.46 ± 1.40 21.88 ± 2.10
3.38 ± 0.48* 28.56 ± 1.01
3.25 ± 0.56* 34.19 ± 1.30****
that acetic acid stimulates the vanilloid receptor (VR1) and
bradykinin B2 receptor in the pathway comprising sensory
afferent C-fibers (Ikeda et al., 2001). Therefore, the observed
activity of the methanol extract might stem from its ability
to interfere with the synthesis and/or release of those en-
dogenous substances or desensitization of the nerve fibers
involved in the pain transmission pathway. Such ability may
be due to presence of some active constituents, especially
the alkamides many of which have been reported to inhibit
prostaglandin synthesis (Stöhr et al., 2001). Again, the ob-
served central anti-nociceptive activity of the extract is sug-
gestive of its ability to mimic the opiod like drugs in some
way.
The traditional use of Piper chaba in rheumatic pain as
well as the observed activity of the methanol extract of Piper
chaba stem bark against acetic acid induced writhing which
is an inflammatory model of pain (Vinegar et al., 1979) pro-
vided a basis for its screening for possible anti-inflammatory
activity by the Carrageenan-induced rat paw edema model.
Result of this experiment (Table 3) showed that the mean paw
volume after carrageenan administration in animals treated
with test samples (except 500 mg/kg) increased up to the third
hour of study, and then got a declining trend. The change in
paw volume at different hours of study with test compounds
was compared to control for the evaluation of percent inhi-
bition of paw edema. The extract exhibited most prominent
anti-inflammatory activity at 500 mg/kg body weight dose
with comparable efficacy with phenylbutazone.
Carrageenan-induced paw edema has been reported to
have more than one phase and the initial phase has been at-
tributed to the release of histamine and serotonin (5-HT), the
maintenance of edema during the plateau phase is caused by
kinin-like substances and the second accelerating phase of
swelling are due to prostaglandin like substances (DiRosa
et al., 1971; DiRosa, 1972). As the crude methanol extract
exhibited significant and sustained inhibition of paw edema
from l to 4 h, the possible mechanism of the observed anti-
inflammatory activity might be its ability to inhibit the release
of histamine, serotonin or kinin like substances or biosynthe-
sis of prostaglandins which is consistent with the observation
of analgesic activity.
One of the most important features of inflammation is
edema which is caused by the action of some inflamma-
208 Md. Taufiq-Ur-Rahman et al. / Journal of Ethnopharmacology 99 (2005) 203–209
tory autacoids like kinins, prostaglandins, leukotrienes,
etc. resulting in vasodilation, enhancement of capillary
permeability and plasma exudation. Therefore, substances
having anti-inflammatory activity can be good candidates for
being diuretic. Since the crude bark extract of Piper chaba
had shown good anti-inflammatory activity as screened by
Carrageenan-induced rat paw edema test, screening for possi-
ble diuretic activity was logical. However, the extract showed
significant (P < 0.05) and substantial (43.7% increase in urine
output) only at the highest dose (500 mg/kg, p.o.) (Table 4).
The reported traditional use of Piper chaba in diarrhoea
justified its screening for anti-diarrhoeal activity using castor
oil induced diarrhoea in mice model. As shown in Table 5,
the extract at given doses (125, 250 and 500 mg/kg, p.o.)
significantly and dose dependently, retarded the onset time of
diarrhoea but reduced the frequency of diarrhoeal episodes
significantly only at 250 and 500 mg/kg doses. Again, the
results of charcoal motility test as shown in Table 6 indicate
that the extract reduced the propulsive movement of small
intestine significantly (P < 0.001) and substantially only at
500 mg/kg dose.
The castor oil model incorporates both secretory and
motility diarrhoea (Yegnanarayan and Shrotri, 1982). The
liberation of ricinoleic acid from castor oil results in irrita-
tion and inflammation of the intestinal mucosa, leading to the
release of prostaglandins, which stimulates motility and se-
cretion (Pierce et al., 1971). Ricinoleic acid is also reported to
reduce active Na+ and K+ absorption with decreased Na+ , K+
ATPase activity in the small intestine and colon (Gaginella
and Phillips, 1975). As with other laxatives, castor oil changes
the intestinal permeability and the histology (Mascolo et al.,
1993). The observed anti-diarrhoeal as well as anti-peristaltic
activity of Piper chaba stem bark extract may be attributed
to possible inhibition of prostaglandin biosynthesis or to any
anticholinergie effect like atropine, respectively.
The rationale behind the test was to assess whether the
extract possesses any depressant action on the central ner-
vous system, which might contribute to the observed anal-
gesic activity. The results (Table 7) show that the extract
significantly (P < 0.05) reduced the onset time of sleep at
250 and 500 mg/kg doses whereas substantial and significant
(P < 0.001) potentiation of duration of sleep was observed
only at 500 mg/dose. The observed CNS depressant activity
might at least partially account for the acetic acid induced
writhing inhibition by the extract.
5. Conclusions
The findings of the preliminary pharmacological screen-
ing with the methanol extract of Piper chaba stem bark
validates its ethnomedical use in various ailments including
different types of pain and diarrhoea. The observed activities
of the extract may be attributed to various active ingredients,
mainly of the alkamides, many of which are common in the
piperaceae family. Further, pharmacological investigations
(such as testing with different models of analgesic, anti-
inflammatory activity and analysis of electrolyte profile of
urine, etc.) and bioactivity guided phytochemical studies are
required to find out the actual active constituents.
Acknowledgements
The authors are grateful to the Ministry of Science and
Technology, Government of Bangladesh, for providing the
necessary financial support to carry out the work. M.T. Rah-
man was sponsored by the Commonwealth Commission,
UK. The authors gratefully acknowledge the help of Dr.
S.C. Bachar and J.K. Kundu, assistant professors, Faculty
of Pharmacy, University of Dhaka, in carrying out the anti-
inflammatory screening.
References
Atal, C.K., Manavalan, R., Nighojkar, R., Sarcen, A.N., Gupta, O.P.,
1980. Studies on Piper chaba as a bioavailable agent. Indian Drugs
17, 266–268.
Bhandari, S.P.S., Babu, U.V., Garg, H.S., 1998. A lignan from Piper
chaba stem. Photochemistry 47, 1435–1436.
Biswas, S., Murugesan, T., Sinha, S., Maiti, K., Gayen, J.R., Pal, M.,
Saha, B.P., 2002. Antidiarrhoeal activity of Strychnos potatorum seed
extract in rats. Fitoterapia 73, 43–47.
Collier, H.O., Dinneen, L.C., Johnson, C.A., Schneider, C., 1968. The
abdominal constriction response and its suppression by analgesic drags
in the mouse. British Journal of Pharmacology 32, 295–310.
Connolly, J.D., Deans, R., Haque, M.E., 1995. Constituents of Piper
chaba. Fitoterapia 66, 188.
Connor, J., Makonnen, E., Rostom, A., 2000. Comparison of analgesic
effects of khat (Catha edulis Forsk) extract, d-amphetamine and
ibuprofen in mice. Journal of Pharmacy and Pharmacology 52, 107–
110.
D’Amour, F.E., Smith, D.L., 1941. A method for determining loss of pain
sensation. Journal of Pharmacology and Experimental Therapeutics
72, 74–79.
DiRosa, M., 1972. Biological properties of carrageenan. Journal of Phar-
macy and Pharmacology 24, 89–102.
DiRosa, M., Giroud, J.P., Willoughby, D.A., 1971. Studies of the acute
inflammatory response induced in rats in different sites by carrageenan
and turpentine. Journal of Pathology 104, 15–29.
Gaginella, T.S., Phillips, S.F., 1975. Ricinoleic acid: current view of an
ancient oil. Digestive Diseases 20, 1171–1177.
Ikeda, Y., Ueno, A., Naraba, H., Oh-ishi, S., 2001. Involvement of vanil-
loid receptor VRl and prostanoids in the acid-induced writhing re-
sponses of mice. Life Sciences 69, 2911–2919.
Kau, S.T., Keddi, J.R., Andrews, D., 1984. A method for screening di-
uretic agents. Journal of Pharmacology and Experimental Therapeutics
11, 67–75.
Kirtikar, K.R., Basu, B.D., 1980. Indian Medicinal Plants, vol. 1, second
ed., B. Singh, M.P. Singh, India.
Koster, R., Anderson, M., DeBeer, E.J., 1959. Acetic acid analgesic
screening. Federation Proceedings 18, 418–420.
Lipschitz, W.L., Hadidian, Z., Kerpesar, A., 1943. Bioassay of diuret-
ics. Journal of Pharmacology and Experimental Therapeutics 79, 97–
110.
Mascolo, N., Izzo, A.A., Barbato, F., Capasso, F., 1993. Inhibitors of
nitric oxide synthetase prevent castor oil induced diarrhoea in the rat.
British Journal of Pharmacology 108, 861–864.
 Md. Taufiq-Ur-Rahman et al. / Journal of Ethnopharmacology 99 (2005) 203–209
Morikawa, T., Matsuda, H., Yamaguchi, I., Pongpiriyadacha, Y.,
Yoshikawa, M., 2004. New amides and gastroprotective con-
stituents from the fruit of Piper chaba. Planta Medica 70, 152–
159.
Murata, T., Ushikubi, F., Matsuoka, T., Hirata, M., Yamasaki, A., Sugi-
moto, Y., Ichikawa, A., Aze, Y., Tanaka, T., Yoshida, N., Ueno, A.,
Oh-Ishi, S., Narumiya, Shu., 1997. Altered pain perception and in-
flammatory response in mice lacking prostacyclin receptor. Nature
388, 678–682.
Patra, A., Ghosh, A., 1974. Amides of Piper chaba. Phytochemistry 13,
2889–2890.
Pierce, N.F., Carpenter, C.C.J., Elliot, H.I., Greenough, W.B., 1971. Ef-
fects of prostaglandins, theophylline and cholera exotoxin upon trans-
mucosal water and electrolyte movement in canine jejunum. Gastroen-
terology 60, 22–32.
Raj, P.P., 1996. Pain mechanisms. In: Pain Medicine: A Comprehen-
sive Review, first ed. Mosby-Year Book, Inc., St. Louis, USA,
pp. 12–24.
Ramirez, N.N., Ruiz, J.D.Q., Arellano, B.R., Madrigal, M.T.V.,
Michel, G.P., 1998. Anticonvulsant effects of Magnolia grandi-
fora L. in the rats. Journal of Ethnopharmacology 61, 143–
152.
Rukachaisirikul, T., Prabpai, S., Champung, P., Suksamrarn, A., 2002.
Chabamide, a novel piperine dimer from stems of Piper chaba. Planta
Medica 68, 853–855.
209
Sarker, S.D., Moniruzzaman, M., Khan, S.I., Chowdhury, A.K.A., 1991.
Antibacterial activity of Piper chaba. Bangladesh Journal of Botany
20, 679–681.
Shoba, F.G., Thomas, M., 2001. Study of antidiarrhoeal activity of four
medicinal plants in castor oil induced diarrhoea. Journal of Ethnophar-
macology 76, 73–76.
Stöhr, J.R., Xiao, P., Bauer, R., 2001. Constituents of Chinese Piper
species and their inhibitory activity on prostaglandin and leukotriene
biosynthesis in vitro. Journal of Ethnopharmacology 75, 133–139.
Tewtrakul, S., Hase, K., Kadota, S., Namba, T., Komatsu, K., Tanaka, K.,
2000. Fruit oil composition of Piper chaba Hunt., P. longum L. and
P. nigrum L. Journal of Essential Oil Research 12, 603–608.
Vinegar, R., Truax, J.F., Selph, J.L., Johnston, P.R., 1979. Antagonism
of pain and hyperalgesia. Anti-inflammatory drugs. In: Vane, J.R.,
Ferreira, S.H. (Eds.), Handbook of Experimental Pharmacology, 50/II.
Springer-Verlag, Berlin, pp. 208–222.
Winter, C.A., Risley, E.A., Nuss, G.W., 1962. Carrageenan-induced edema
in hind paws of the rats as an assay for anti-inflammatory drugs.
Proceedings of the Society for Experimental Biology and Medicinal
3, 544–547.
Yegnanarayan, R., Shrotri, D.S., 1982. Comparison of antidiarrhoeal ac-
tivity of some drugs in experimental diarrhoea. Indian Journal of Phar-
macology 14, 293–299.
Yusuf, M., Chowdhury, J.U., Wahab, M.A., Begum, J., 1994. Medicinal
Plants of Bangladesh. BCSIR, Dhaka, Bangladesh, p. 193.
 Journal of Ethnopharmacology 99 (2005) 211–214

Ethnoveterinary medicine in the search for antimicrobial agents:

Antifungal activity of some species of Pterocaulon (Asteraceae)
Ana Cristina Stein a , Maximiliano Sortino b , César Avancini c,1 ,
Susana Zacchino b , Gilsane von Poser a,∗
a Programa de Pós Graduação em Ciências Farmacêuticas, Universidade Federal do Rio Grande
do Sul-Av. Ipiranga 2752, 90610-000 Porto Alegre, RS, Brazil
b Facultad de Ciencias Bioquı́micas y Farmacéuticas, Universidad Nacional de Rosario, Suipacha 531, 2000 Rosario, Argentina
c Faculdade de Veterinária, Depto. de Medicina Veterinária Preventiva, Universidade Federal do Rio Grande do Sul-Av.

Bento Gonçalves 9090, 90540-000 Porto Alegre, RS, Brazil

Received 28 May 2004; received in revised form 5 January 2005; accepted 7 February 2005
Available online 18 April 2005

Abstract

Based on informal interview, ethnoveterinary information about plants used in the treatment of skin diseases were obtained. Plants from the
genus Pterocaulon (Asteraceae) known as “quitoco” are used to treat problems popularly diagnosed as “mycoses”, which can have both fungic
and bacterial etiology. In order to validate this traditional practice, the crude methanolic extracts and fractions from the aerial parts of three
species of Pterocaulon (Pterocaulon alopecuroides (Lam.) D.C., Pterocaulon balansae Chodat. and Pterocaulon polystachyum D.C.) grown
in southern Brazil were analyzed for the in vitro antifungal activity against a panel of standardized and clinical opportunistic pathogenic yeasts
and filamentous fungi including dermatophytes by the agar dilution method. The crude methanolic extract of Pterocaulon alopecuroides was
the most active followed by the extract of Pterocaulon polystachyum. Pterocaulon balansae crude methanolic extract was the less active but
its lipophilic fractions showed remarkable activity mainly against the dermatophytes.
© 2005 Published by Elsevier Ireland Ltd.

Keywords: Pterocaulon species; Asteraceae; Ethnoveterinary; Antifungal activity; Broth dilution assay

1. Introduction With few exceptions, veterinary and human mycology

Dermal and mucosal human fungal infections have in-
creased at an alarming rate in the last 30 years, mainly due to
the growing population of immunocompromised individuals
such as cancer patients receiving chemotherapy and patients
submitted to organ transplantation, being treated with im-
munosuppressive drugs. HIV-positive patients strongly con-
tribute to this problem since they have developed resistence
to treatment with fluconazole, the most currently used anti-
fungal (Groll et al., 1996; Denning et al., 1997; Portillo et al.,
2001; Schmourlo et al., 2005).
∗
Corresponding author. Tel.: +55 51 3165258; fax: +55 51 3305610.
E-mail address: gilsane@farmacia.ufrgs.br (G. von Poser).
1 Tel.: 55 51 33166123.
deals with the same fungal pathogens (Acha and Szyfres,
2003) and, therefore, the traditional or popular experience
regarding the treatment of animal mycoses (ethnoveterinary
treatments) is considered nowadays a valuable knowledge
for the discovery of new antifungal drugs for human beings
(McCorkle, 1986; Mathias-Mundy and McCorkle, 1995).
Both human and animal mycoses are not always success-
fully treated, since the available antifungal drugs are ineffec-
tive, produce many adverse effects, show recurrence, or lead
to the development of resistance. There is a general consen-
sus that new antifungal agents which overpass these disad-
vantages are strongly needed (Selitrennikoff, 2001).
Although most antibiotics in clinical use have been ob-
tained from microorganisms, a renewed interest in plant an-
timicrobials in the last 20 years has been emerged. Only a very

0378-8741/$ – see front matter © 2005 Published by Elsevier Ireland Ltd.

doi:10.1016/j.jep.2005.02.011
212 A.C. Stein et al. / Journal of Ethnopharmacology 99 (2005) 211–214
small fraction of the known plant species of the whole world
has been evaluated for the presence of antifungal compounds.
Considering that there is a rapid rate of plant species extinc-
tion, many efforts are necessary to collect and to screen plants
in order to avoid the lost of an important source of potential
leads for the development of novel and environmentally safe
antifungal agents.
Since the ethnoveterinary research previously carried out
by Avancini (2002) indicated that “quitoco” (Pterocaulon
species) was useful to treat skin diseases popularly diag-
nosed as mycoses in animals (although frequently they can
be caused by both fungus and bacteria), we decided to
test three Pterocaulon species native to southern Brazil:
Pterocaulon alopecuroides, Pterocaulon balansae and Pte-
rocaulon polystachyum (Asteraceae) in order to evaluate
their antifungal properties. The genus Pterocaulon encloses
various species used in traditional medicine in different
parts of the world and antibiotic (flavonoid and sesquiter-
pene) (Macleod and Rasmussen, 1999), antiviral (flavonoid)
(Semple et al., 1998, 1999) and cytotoxic (dichloromethane
extract) (Mongelli et al., 2000) activities have been reported
for them.
2. Material and methods
2.1. Plant material
Aerial parts of Pterocaulon alopecuroides (Lam.)
D.C., Pterocaulon balansae Chodat. and Pterocaulon
polystachyum D.C. were collected in Guaiba, in March, 2003.
The plants were identified by Nelson Matzembacker (Pro-
grama de Pós-graduação em Botânica, Universidade Federal
do Rio Grande do Sul, Brazil). Voucher specimens (59571,
59572 and 59567, respectively) were deposited in the herbar-
ium of the Federal University of Rio Grande do Sul (ICN).
2.2. Preparation of plant extracts
Dried and powdered plant material (aerial parts) was
submitted to two distinct extraction processes. The to-
tal methanolic crude extracts (TMCE) of Pterocaulon
alopecuroides, Pterocaulon balansae and Pterocaulon
polystachyum (100 g) were prepared in a drug:solvent ra-
tio = 1:10 (w/v) by maceration (3 × 24 h), yielding 12, 14
and 13 g, respectively. Fractions were obtained extracting
successively the plant material (ca. 50 g) with n-hexane,
dichloromethane and methanol over 12 h in a Soxhlet appa-
ratus. The extracts were evaporated to dryness under reduced
pressure at 45 ◦ C affording 3.5–4.5% HEX, 3.5–4.0% DCM
and 4.5–6.0% MET, respectively.
2.3. Microorganisms and media
For the antifungal evaluation, strains from the Ameri-
can Type Culture Collection (ATCC), Rockville, MD, USA
and CEREMIC (C), Centro de Referencia Micológica, Fac-
ultad de Ciencias Bioquı́micas y Farmacéuticas, Suipacha
531, 2000 Rosario, Argentina were used: Candida al-
bicans ATCC10231, Candida tropicalis C131, Saccha-
romyces cerevisiae ATCC9763, Cryptococcus neoformans
ATCC32264, Aspergillus flavus ATCC9170, Aspergillus fu-
migatus ATTC26934, Aspergillus niger ATCC9029, Tri-
chophyton rubrum C110, Trichophyton mentagrophytes
ATCC 9972 and Microsporum gypseum C115. Yeasts were
grown on Sabouraud-chloramphenicol agar slants, for 48 h at
30 ◦ C.
2.4. Antifungal susceptibility testing
The minimal inhibitory concentration (MIC) of each ex-
tract was determined by using broth microdilution techniques
as described by the National Committee for Clinical Labora-
tory Standards for yeasts (M27-A2) (NCCLS, 2002a) as well
as for filamentous fungi (M 38 A) (NCCLS, 2002b) in mi-
crotiters of 96 wells. MICs values were determined in RPMI
1640 (Sigma, St. Louis, MO, USA) buffered to a pH 7.0 with
MOPS. The starting inocula were approximately 1 × 103 to
5 × 103 CFU/ml. Microtiters trays were incubated at 35 ◦ C
for yeasts and hialophyphomycetes and at 28–30 ◦ C for der-
matophyte strains in a moist, dark chamber and MICs were
recorded at 48 h for yeasts and a time according to the control
fungus growth, for the other fungi. The susceptibility of the
standard drugs ketoconazol, terbinafine and amphotericin B
were defined as the lowest concentration of drug which re-
sulted in the total inhibition of fungal growth.
For the assay, extracts stock solutions were two-fold
diluted with RPMI from 800 to 0.98 ␮g/ml (final vol-
ume = 100 ␮l) and a final DMSO concentration ≤1%. A vol-
ume of 100 ␮l of inoculum suspension was added to each
well with the exception of the sterility control where sterile
water was added to the well instead. The MIC was defined as
the minimum inhibitory concentration of the extract which
resulted in total inhibition of the fungal growth.
To carry out the antifungal evaluation with broth microdi-
lution assays, concentrations of extracts up to 1000 ␮g/ml
were incorporated into the growth media following the guide-
lines of NCCLS. Extracts with MICs ≤ 800 ␮g/ml were con-
sidered active.
3. Results and discussion
The antifungal activity of the crude extracts and frac-
tions obtained with the aerial parts of three Pterocaulon
species was evaluated in vitro against Candida tropicalis,
Saccharomyces cerevisiae, Aspergillus flavus, Aspergillus fu-
migatus, Aspergillus niger, Trichophyton mentagrophytes,
Microsporum gypseum, Candida albicans, Trichophyton
rubrum and Cryptococcus neoformans. Results showed
(Table 1) that all fungi tested were inhibited by the differ-
ent extracts (MIC values between 12.5 and 800 ␮g/ml) being
 A.C. Stein et al. / Journal of Ethnopharmacology 99 (2005) 211–214 213

Table 1
In vitro evaluation of the antifungal activity of different extracts of Pterocaulon species using the broth microdilution methods M27A2 and M38A recommended
by NCCLS (MIC values are given in ␮g/ml)
Plant Type of Extract C.a C.t S.c Cr.n A.fl A.n A.fu M.g T.r T.m
Pterocaulon TMCE 100 100 50 25 400 400 400 50 50 50
alopecuroides
HEX 200 100 200 100 >800 >800 >800 50 25 25
DCM 200 200 100 100 >800 >800 >800 50 25 25
MET 400 400 400 250 400 400 400 200 200 100
Pterocaulon TMCE >800 >800 >800 400 >800 >800 >800 200 200 200
interruptum
HEX 100 50 50 50 400 200 400 25 12.5 12.5
DCM 200 200 100 100 400 400 400 100 50 50
MET >800 >800 500 250 >800 >800 >800 200 200 100
Pterocaulon TMCE 200 200 100 100 >800 >800 >800 50 50 50
polystachyum
HEX 200 100 200 100 200 200 100 50 50 25
DCM >800 >800 500 100 >800 >800 >800 200 100 100
MET >800 >800 >800 >800 >800 >800 >800 250 250 250
Amphotericin B 1 0.5 0.5 0.25 0.5 0.5 0.5 0.125 0.075 0.075
Ketoconazole 0.5 0.125 0.5 0.25 0.125 0.5 0.25 0.05 0.025 0.025
Terbinafine 0.04 0.01 0.04
TMCE, total methanol crude extract; HEX, hexane extract; DCM, dichloromethane extract; MET, methanolic extract; C.a, Candida albicans ATCC 10231; C.t,
Candida tropicalis C 131; S.c, Saccharomyces cerevisiae ATCC 9763; Cr.n, Cryptococcus neoformans ATCC 32264; A.fl, Aspergillus flavus ATCC 9170; A.n,
Aspergillus niger ATCC 9029; A.fu, Aspergillus fumigatus ATCC 26934; M.g, Microsporum gypseum C 115; T.r, Trichophyton rubrum C113; T.m, Trichophyton
mentagrophytes ATCC 9972.

Trichophyton mentagrophytes and Trichophyton rubrum the
most susceptible species. Interesting enough, 11/12 extracts
inhibit Candida spp. with MICs between ≤800 ␮g/ml, 8/12
with MICs ≤ 400 ␮g/ml, and 6/12 with MICs ≤ 200 ␮g/ml.
These are relevant results since Candida albicans is the lead-
ing primary agent causing superficial and often fatal dissem-
inated infections in immunocompromised patients and Can-
dida tropicalis is one of the non-albicans Candida strains cur-
rently emerging in fungal infections (Powderly et al., 1999)
existing at present a renewal interest in these organism’s new
inhibitors, because drug resistance is quickly becoming a ma-
jor problem in the immunocompromised population (White
et al., 1998).
Regarding the crude methanolic extracts, it is interest-
ing to note that Pterocaulon alopecuroides crude extract
showed the best activity against Cryptococcus neoformans
(MIC = 25 ␮g/ml) which is the cause of the most com-
mon life-threatening meningitis in HIV-positive patients
(Michaels et al., 1999). This fungus, which is sensitive to
some of the currently available antifungals in clinical use,
sometimes acquire resistance during the course of therapy,
thus being new agents strongly needed (Powderly et al.,
1990).
Among Pterocaulon fractions, the HEX extract of Pte-
rocaulon balansae showed a broad spectrum of action in-
hibiting all the fungi tested including Candida species dis-
playing the strongest antifungal activity against Trichophyton
species with MIC = 12.5 ␮g/ml. Trichophyton rubrum and
Trichophyton mentagrophytes are the main cause of athlete’s
foot and onichomycoses in human beings, being the first
one, the most prevalent superficial infection in the developed
world (Evans, 1997) and the second one, an infection that
affect 2–13% of the population worldwide and up to 30% of
groups at high risk such as elderly and people with diabetes
(Levy, 1997; Gupta et al., 1998).
The strongest antifungal activity was found in the n-
hexane and chloroformic extracts, suggesting that coumarins
are the active substances. This class of natural products with
recognized antimicrobial activity are the main constituents
of the lipophilic extracts of the Pterocaulon species investi-
gated until now (Vera et al., 2001). In fact, coumarins are fre-
quently found in the lipophilic fractions of plants belonging
to several families and have demonstrated antibacterial activ-
ities against microorganisms such as Staphylococcus aureus,
Bacillus cereus, Bacillus subtilis and Nocardia gardenen.
Their presence could justify the popular use of some Ptero-
caulon species as a wound-healing agent and in the treatment
of some infectious diseases (Avancini, 2002).
In conclusion, Pterocaulon extracts possess a broad spec-
trum of activity against a panel of opportunistic pathogenic
fungi responsible for the most common fungal systemic, der-
mal and mucosal infections that are usually very difficult to
eradicate. These promissory extracts open the possibility of
finding new clinically effective antifungal compounds and
give positive data regarding their use in fungal infections in
animals and human beings.
Acknowledgements
This work was supported by FAPERGS, CNPq (Brazil)
and Agencia de Promociones Cientı́ficas y Tecnológicas de
214 A.C. Stein et al. / Journal of Ethnopharmacology 99 (2005) 211–214
la Argentina (grants to SAZ PICTR # 00260); and it is part
of the collaborative research within the “Bioactive Natural
Products and their Applications” nucleus from the Associa-
tion of Universities of the Montevideo Group (AUGM). Col-
laboration from the Iberoamerican Program of Science and
Technology for the Development (CYTED) (Project X.7) is
gratefully acknowledged. SAZ is gratefully acknowledged to
the OEA (Project: Profit of the Regional Flora).
References
Acha, P.N., Szyfres, S.B., 2003. Zoonoses and communicable diseases
common to man and animals. In: Bacterioses and Mycoses, vol. I,
third ed. Pan American Health Organization Scientific Publication,
Washington, 401 pp.
Avancini, C.A.M., 2002. Saneamento aplicado em saúde e produção ani-
mal: etnografia, triagem da atividade antibacteriana de plantas nativas
do sul do Brasil Tese de doutorado, Programa de Pós-graduação em
Agronomia. Universidade Federal do Rio Grande do Sul, Porto Ale-
gre, Brasil.
Denning, D.W., Evans, E.G.V., Kibbler, C.C., Richardson, M.D., Roberts,
M.M., Rogers, T.R., Warnock, D.W., Warren, R.E., 1997. Guide-
lines for the investigation of invasive fungal infections in haemato-
logical malignancy and solid organ transplantation. European Jour-
nal of Clinical Microbiology and Infectious Diseases 16, 424–
436.
Evans, E.G., 1997. Tinea pedis: clinical experience and efficacy of short
treatment. Dermatology 1, 3–6.
Groll, A.H., Shah, P.M., Mentzel, C., Schneider, M., Just-Neubling, G.,
Huebner, K., 1996. Trends in the postmortem epidemiology of inva-
sive fungal infections at a university hospital. Journal of Infection 3,
23–32.
Gupta, A.K., Konnikov, N., Mac Donald, P., Rich, P., Rodger, N.V.V.,
Edmonds, M.W., 1998. Prevalence and epidemiology of toenail ony-
chomycosis in diabetic subjects: a multicenter survey. British Journal
of Dermatology 139, 665–671.
Levy, L.A., 1997. Epidemiology of onychomycosis in special risk pop-
ulations. Journal of the American Podiatric Medical Association 87,
546–550.
Macleod, J.K., Rasmussen, H.B., 1999. A hydroxy-␤-caryophyllene from
Pterocaulon serrulatum. Phytochemistry 50, 105–108.
Mathias-Mundy, E., McCorkle, C., 1995. Ethnoveterinary medicine and
development: a review of the literature. In: Warren, D.M., Surrerwer,
L., Broshenka, D. (Eds.), The Cultural Dimension of Indigenous
Knowledge Systems. Intermediate Technology Publications, London,
pp. 488–498.
McCorkle, C., 1986. An introduction to ethnoveterinary research and de-
velopment. Journal of Ethnobiology 6, 129–149.
Michaels, S.H., Clark, R., Kissinger, P., 1999. Incidence and spectrum
of AIDs defining illnesses among persons treated with antiretroviral
drugs. Clinical Infectious Diseases 29, 468–469.
Mongelli, E., Pampuro, S., Coussio, J., Salomon, H., Ciccia, G., 2000.
Cytotoxic and DNA interaction activities of extracts from medicinal
plants used in Argentina. Journal of Ethnopharmacology 71, 145–151.
National Committee for Clinical Laboratory Standards (NCCLS), 2002a.
Reference Method for Broth Dilution Antifungal Susceptibility Testing
of Yeasts, Approved Standard, vol. 22, second ed. NCCLS, Wayne,
PA, pp. 1–29.
National Committee for Clinical Laboratory Standards (NCCLS), 2002b.
Reference Method for Broth Dilution Antifungal Susceptibility Test-
ing of Filamentous Fungi, Approved Standard, vol. 22, second ed.
NCCLS, Wayne, PA, pp. 1–27.
Portillo, A., Vila, R., Freixa, B., Adzet, T., Cañigueral, S., 2001. Antifun-
gal activity of Paraguayan plants used in traditional medicine. Journal
of Ethnopharmacology 76, 93–98.
Powderly, W.G., Keath, E.J., Sokol-Anderson, M., 1990. Amphotericin B-
resistant Cryptococcus neoformans in a patient with AIDS. Infectious
Diseases in Clinical Practice 1, 314–316.
Powderly, W.G., Mayer, K.H., Perfect, J.R., 1999. Diagnosis and treat-
ment of oropharingeal candidiasis in patients infected with HIV: a
critical reassessment. AIDS Research and Human Retroviruses 15,
1405–1412.
Selitrennikoff, C.P., 2001. Antifungal Proteins. Applied and Environmen-
tal Microbiology 67, 2883–2894.
Semple, S.J., Nobbs, S.F., Pyke, S.M., Reynolds, G.D., Flower, R.L.P.,
1999. Antiviral flavonoid from Pterocaulon sphacelatum, an Aus-
tralian aboriginal medicine. Journal of Ethnopharmacology 68,
283–288.
Semple, S.J., Reynolds, G.D., O’Leary, M.C., Flower, R.L.P., 1998.
Screening of Australian medicinal plants for antiviral activity. Journal
of Ethnopharmacology 60, 163–172.
Schmourlo, G., Mendonça-Filho, R.R., Alviano, C.S., Costa, S., 2005.
Screening of antifungal agents using ethanol precipitation and bioau-
tography of medicinal and foods plants. Journal of Ethnopharmacol-
ogy 96, 563–568.
Vera, N., Bardón, A., Catalan, C.A.N., Gedris, T.E., Herz, W., 2001.
New coumarins from Pterocaulon polystachyum. Planta Medica 67,
674–677.
White, T.C., Marr, K.A., Bowden, R.A., 1998. Clinical, cellular, and
molecular factors that contribute to antifungal drug resistance. Clinical
Microbiology Reviews 11, 382–402.
 Journal of Ethnopharmacology 99 (2005) 215–220

Anti-inflammatory and analgesic properties of water–ethanolic extract

from Pothomorphe umbellata (Piperaceae) aerial parts
Fabio F. Perazzo a,b,c , Gustavo H.B. Souza a , Walter Lopes a , Luis G.V. Cardoso b ,
Jose C.T. Carvalho b , N.P. Dhammika Nanayakkara c , Jairo K. Bastos a,∗
a Faculdade de Ciências Farmacêuticas de Ribeirão Preto, Universidade de São Paulo, Av. do Café s/n, Ribeirão Preto 14040-903, SP, Brazil
b Laboratório de Fitofármacos, Universidade de Alfenas, Rod. MG 179, km 0, CP 23, Alfenas CEP 37130-000, MG, Brazil
c National Center for Natural Products Research, School of Pharmacy, The University of Mississippi, MS 38677, USA

Received 1 July 2004; received in revised form 14 January 2005; accepted 8 February 2005
Available online 12 April 2005

Abstract

Anti-inflammatory and analgesic activities as well as the median lethal dose (LD50 ) of water–ethanolic extract (PHE) of the aerial parts
of Pothomorphe umbellata were evaluated in animal models. The ED50 (oral) for the inhibition of carrageenan-induced rat paw edema
assay was determined to be 550 mg/kg, while the LD50 was higher than 2.0 g/kg. At a dose of 550 mg/kg, PHE inhibited the inflammatory
process by 48.7% (P < 0.05) on the third hour of the assay (edema peak) when compared to the untreated control. Indomethacin, the positive
control used in this test, inhibited the edema by 58.6% at a dose of 10 mg/kg, when compared to the untreated control (P < 0.05). All three
fractions – hexane, methylene chloride and ethyl acetate – obtained by partition of PHE with respective solvents also showed inhibition of
the edema induced by carrageenan over a period of 4 h but the methylene chloride fraction showed the best activity. The activity shown
by the methylene chloride fraction at 200 mg/kg was comparable to that exhibited by indomethacin at a dose of 10 mg/kg. The number of
writhings induced by a 0.6% acetic acid solution intraperitoneal injection was decreased by 22% (P < 0.05) in the group treated orally with
Pothomorphe umbellata crude extract. PHE also inhibited the granulomatous tissue formation in rats by 6.2% (P < 0.05). In the same assay,
topically applied dexamethasone decreased the granuloma formation by 14.2%. The above results suggest that Pothomorphe umbellata crude
extract has analgesic and anti-inflammatory properties supporting its folkloric use for the treatment of these conditions.
© 2005 Elsevier Ireland Ltd. All rights reserved.

Keywords: Pothomorphe umbellata; Piperaceae; Anti-inflammatory; Analgesic; Ethanolic extract

1. Introduction and small conical flowers no more than 10 cm long (Stasi et

Pothomorphe umbellata (L.) Miq. (Piperaceae) [syn.
Heckeria umbellata (L.) Kunth., Piper umbellata L., Piper
hilarianum Stend.] – known in Brazil as “caapeba”, “caapeba
do norte”, or “pariparoba” – has been used as an analgesic,
diuretic and anti-spasmodic agent, and also has been used
for the treatment of a variety of ailments including inflam-
matory disorders, malaria, asthma and gastro-intestinal dis-
eases. This is a common annual plant and found growing up
to 1.5 m high. It has large round leaves, with thin branches
∗ Corresponding author. Tel.: +55 16 602 4181; fax: +55 16 633 1941.
E-mail address: jkbastos@fcfrp.usp.br (J.K. Bastos).
al., 1989; Almeida, 1993; Hammer and Johns, 1993).
An evaluation of Pothomorphe umbellata leaves extract
against malaria in mice has shown a significant reduction
of parasitemia in a dose dependant manner (Amorim et al.,
1988). In a subsequent study, however, results were incon-
clusive (Ferreira-da-Cruz et al., 2000).
A extract of Pothomorphe umbellata leaves has shown
an analgesic and sedative effect in a rat model. Pothomor-
phe peltata, a related species also widely used in folkloric
medicine in Brazil, has been found to possess an analgesic
effect (Pupo, 1988) and a potent anti-inflammatory property
against carragennan-induced edema in rats (Desmarchelier
et al., 2000). An investigation on the mutagenic effects of

0378-8741/$ – see front matter © 2005 Elsevier Ireland Ltd. All rights reserved.
doi:10.1016/j.jep.2005.02.023
216 F.F. Perazzo et al. / Journal of Ethnopharmacology 99 (2005) 215–220
Pothomorphe umbellata and Pothomorphe peltata revealed
that both of these plants are devoid of mutagenic activity
(Felzenswalb et al., 1987).
Chemical studies of Pothomorphe umbellata have led
to the isolation of several natural compounds, including
4-nerolidylcatechol (Kijjoa et al., 1980) and N-benzoyl-
mescaline (Isobe et al., 2002). The former has been found
to have strong anti-oxidant activity (Ropke et al., 2003) and
could confer protection against photodamage in the skin, and
the latter was shown to have significant activity against He-
licobacter pylori-induced gastric ulcers (Isobe et al., 2002).
As a part of our investigation of Brazilian medicinal
plants with potential anti-inflammatory activity, we eval-
uated extracts of Pothomorphe umbellata leaves for anti-
inflammatory and analgesic properties in animal models.
2. Material and methods
2.1. Plant material
Leaves of Pothomorphe umbellata L. were collected in
March 2003, in the campus of the University of São Paulo,
Ribeirão Preto, SP, Brazil. A voucher specimen is deposited at
the Botanic Department Herbarium (Universidade Estadual
de Campinas - Unicamp) under registration number UEC
127123.
2.2. Preparation of extract and fractions
Leaves (500 g) of Pothomorphe umbellata were air dried
at 40 ◦ C, powdered and extracted by maceration with
water–ethanolic solution (4.0 l, 70.0%) during 2 days. The
macerate was filtered, and the extraction procedure repeated
twice. The concentration of the combined extracts under
reduced pressure furnished 112 g (yield 22.47%) of crude
water–ethanolic extract (PHE). The crude dried extract was
suspended in 3% Tween 80, 0.9% saline solution just before
the administration to animals.
The water–ethanolic extract was fractionated by parti-
tion between MeOH:H2 O 9:1 and hexanes, methylene chlo-
ride and ethyl acetate, sequentially. The dried hexane (Hex),
methylene chloride (DCM) and ethyl acetate (EtOAc) ex-
tracts yielded 9.78 g (1.95%), 7.45 g (1.49%) and 12.40 g
(2.48%), respectively.
2.3. Animals
Male rats (Rattus norvegicus, albinus, Wistar) and male
mice (Mus musculus, albinus, Swiss), specific pathogen free,
weighing 150–200 and 20–25 g, respectively, were acquired
from the Central Biotery of Universidade de São Paulo. The
animals were kept in polyethylene boxes (n = 5), in a cli-
matic environment (23 ± 2 ◦ C), with air humidity control, in
12 h/shifts with dark/light control, with food and water ad
libitum, for at least 7 days before the experiments. The an-
imals were provided only water ad libitum during the 12 h
before experimentation. This study was conducted according
to internationally accepted principles of laboratory animal
use.
2.4. Drugs and chemicals
Acetic acid (Reagen Co.), kappa carrageenan type III
(Iota-Fluka-Biochemica Co.), indomethacin (MSD Co.) and
dexamethasone (MSD Co.)
2.5. Determination of the median lethal dose (LD50 )
PHE was orally administered as a single dose to groups
of mice (n = 8) at different concentrations (500, 750, 1000,
1250, 1500 and 2000 mg/kg). These animals were observed
for a 72-h period. The number of animal deaths was expressed
as a percentile, and the LD50 was determined by probit a test
using the death percentage versus the dose’s log (Thompson
and Weil, 1952).
2.6. Anti-inflammatory activity
2.6.1. Rat paw oedema induced by carrageenan
The inflammatory agent (carrageenan 1000 ␮g/paw) was
injected into the right hind paw planter surface of groups of
rats (n = 8). Sterile saline solution (0.9%, 0.1 ml) was injected
into the left paw as the control reference for the tested paw.
The foot volumes of the animals were determined by ples-
timographic method described by Ferreira (1979). The foot
volume measurements were taken before the injections and
then at hourly intervals for 4 h after the injection of the in-
flammatory stimulus. This method was used to evaluate the
effectiveness of PHE and its fractions in the inhibition of the
inflammatory process by comparison with the control and
the standard drug indomethacin. The results were obtained
by measuring the volume difference between the right and the
left paws in comparison to both the negative control group,
treated with saline solution, and the positive control, treated
with indomethacin.
2.6.2. Determination of ED50 and comparison of PHE
and its fraction with indomethacin
Groups of rats (n = 8) were treated orally with Pothomor-
phe umbellata crude extract (PHE) (100, 200, 300, 400, 500,
600, 700, 800, 900 and 1000 mg/kg) 30 min before the injec-
tion of the stimulus (carrageenan 1000 ␮g/paw) into the right
hind paw plantar surface. The inhibition of inflammation was
calculated by measuring the volume difference between the
right and left paws in comparison with the control group.
ED50 was determined from the curve drawn for the percent-
age of edema inhibition as a function of the dose (Carvalho
et al., 1999).
The same procedure was used to compare Pothomor-
phe umbellata crude extract (PHE) to the indomethacin
 F.F. Perazzo et al. / Journal of Ethnopharmacology 99 (2005) 215–220 217

and untreated control. The ED50 of PHE (550 mg/kg), in-

domethacin (10 mg/kg, p.o.) and 0.9% saline solution (0.5 ml,
p.o.) were administered orally 30 min before the injection of
carrageenan and inhibition of inflammation was determined.
Similarly, the Hex, DCM and EtOAc extracts (200 mg/kg,
p.o.), obtained by a solvent partition of PHE, were compared
with indomethacin (10 mg/kg, p.o.) and 0.9% saline solution
(0.5 ml, p.o.).

2.7. Writhing test

The writhing test was carried out as described by Koster
et al. (1959). Groups of mice (n = 8) were treated with
Pothomorphe umbellata crude extract (550 mg/kg, p.o.), in-
domethacin (10 mg/kg, p.o.) and 0.9% saline solution (0.5 ml,
p.o.). The muscular contraction was induced by an intraperi-
toneal injection of 0.6% acetic acid solution (0.25 ml/animal)
30 min after the treatment. The number of muscular contrac-
tions was counted starting 5 min after injection for a period
of 20 min. Data represent the average of the total writhes
observed.
2.8. Granulomatous tissue induction
This assay was described by Meier et al. (1950), Swingle
and Shideman (1972) and Niemegeers (1975). Three groups
of rats (n = 8) were used. Pellets weighing approximately
40 mg each were made with 5 mm of dental cotton tampons.
The pellets were sterilized and impregnated with 0.4 ml ampi-
cillin water solution at the moment of implantation. Animals
were anaesthetized, and the pellets were subcutaneously in-
troduced through an abdominal skin incision. Each group
was treated daily, for six consecutives days, with 0.5 ml, p.o.
of Pothomorphe umbellata crude extract (550 mg/kg daily),
dexamethasone (2 mg/kg, topically) or distilled water (0.5 ml,
p.o.). On the seventh day, the animals were sacrificed, the pel-
lets dissected out and granulomas dried at 60 ◦ C overnight to
determine the dried weight. The difference between the ini-
tial and final weights was considered as the weight of the
granulomatous tissues produced.
Fig. 1. Determination of the effectiveness dose 50. Each point represents
the average of eight animals, expressed as inhibition percentile.
ner (correlation coefficient r = 0.9809 and linear regres-
sion y = −9E−05x2 + 0.13x + 5.91). ED50 was determined
as 555.0 mg/kg (Fig. 1). In the acute toxicity assay, no
deaths were observed during the 72-h period at the doses
tested. At these doses, the animals showed no stereotypi-
cal symptoms associated with toxicity, such as convulsion,
ataxy, diarrhoea or increased diuresis. The median lethal dose
(LD50 ) was determined to be higher than highest dose tested,
2.0 g/kg.
3.2. Carrageenan-induced rat paw edema
There was a significant reduction (P < 0.05) in carra-
geenan-induced rat paw edema at 550 mg/kg dose of PHE and
at 10 mg/kg of indomethacin, over a period of 4 h (Fig. 2).
The obtained fractions from the crude ethanol extract also
inhibited significantly (P < 0.05) the treated groups during a
4-h period.
The treatment with PHE inhibited the formation of the
edema by 48.7% in the third hour of experimentation (peak
of edema formation). This result is quite similar to the one
observed for the group treated with indomethacin, which in-
hibited edema formation by 58.6%. Both results are statis-

2.9. Statistical analysis

The statistical analyses were done using Analysis of

Variance (ANOVA) followed by the Tukey–Kramer multi-
ple comparison test (Sokal and Rohlf, 1995). Results with
P < 0.05 were considered to be significant. Data are expressed
as mean ± S.D.

3. Results

3.1. Effectiveness and lethal median dose (ED50 and

LD50 )
The treatment with PHE produced a reduction of the
edema induced by carrageenan in a dose-dependent man-
Fig. 2. Effect of p.o. administration of PHE (550 mg/kg) and indomethacin
(10 mg/kg) on the paw edema induced by an intraplantar carrageenan in-
jection (1000 ␮g/paw) over a 4-h period in different groups f rats (n = 8).
Data are expressed as mean ± S.D. * P < 0.05, ANOVA followed by the
Tukey–Kramer multiple comparison test.
218 F.F. Perazzo et al. / Journal of Ethnopharmacology 99 (2005) 215–220
Fig. 3. Effect of p.o. administration of PHE fractions (200 mg/kg of Hex,
DCM and EtOAc fractions) and indomethacin (10 mg/kg) on the paw edema
induced by an intraplantar carrageenan injection (1000 ␮g/paw) in different
groups of rats (n = 8). Data are expressed as mean ± S.D. * P < 0.05, ANOVA
followed by the Tukey–Kramer multiple comparison test.
tically significant compared to the control, but not between
them. In the second and fourth hours of experimentation,
the treatment with PHE decreased the edema formation by
55.3% and 46.6%, respectively. The group treated with in-
domethacin showed the best activity, decreasing the edema
formation by 61.6% and 60.2%, respectively, after the same
period following the treatment. Both treatments were sig-
nificantly different from the control group, but not between
them.
In adittion, the three organic fractions obtained from PHE
(Hex, DCM and EtOAc) also produced an inhibitory ef-
fect at 200 mg/kg dose on the carrageenan-induced edema
in the third hour. The methylene chloride fraction inhibited
the inflammatory process by 44% when compared to the
control (P < 0.01). This was comparable to the effect ob-
served for indomethacin at 10 mg/kg, which inhibited the
edema by 49%. The Hex fraction inhibited the inflamma-
tion by 25% (P < 0.05) and the ethyl acetate fraction in-
hibited it by 27% (P < 0.05) compared to the control group
(Fig. 3).
3.3. Writhing test
PHE (32.14 ± 5.36 writhes) as well as indomethacin
(29.28 ± 4.38 writhes) (P < 0.05) were effective in inhibiting
the writhings in mice when compared to the control group
(41.14 ± 5.42 writhes). The treated groups did not show a
significant difference between them. These results are shown
in Fig. 4.
3.4. Granuloumatous tissue induction
Daily administration of PHE (550 mg/kg, p.o) inhibited
the formation of granulomatous tissue by 6.2%, in compar-
ison to the control group (P < 0.05). Moreover, the topically
applied dexamethasone reduced its formation by 8.5% in
comparison to PHE (P < 0.01) and by 14.2% when compared
to the control group (P < 0.001). These results are expressed
in Table 1.
Fig. 4. Effect of p.o. administration of PHE (550 mg/kg) and indomethacin
(10 mg/kg) in writhing induced in groups of mice (n = 8) by an intraperitoneal
injection of 0.6% acetic acid. Data are expressed as mean ± S.D. * P < 0.05,
** P < 0.01, ANOVA followed by the Tukey–Kramer multiple comparison
test.
Table 1
Effect of Pothomorphe umbellata crude hydroethanolic extract on cotton
pellet-induced granuloma pouch in rats
Treatment Mean weight of
granuloma (mg)
Control 352.85 ± 12.54
Pothomorphe umbellata extract (550 mg/kg) 306.80 ± 10.75*
Topic applied dexamethasone (0.2 mg/kg) 280.16 ± 13.70**
Data represent the mean ± S.D. (n = 6). * P < 0.05, ** P < 0.001, significant
as compared to the control. Data are expressed as mean ± S.D. (n = 8).
* P < 0.05, ** P < 0.01, ANOVA followed by the Tukey–Kramer multiple com-
parison test.
4. Discussion
Different preparations made from Pothomorphe umbellata
are commonly used in ethnobotanical practices for the treat-
ment of inflammation in the Amazon region in Brazil (Stasi et
al., 1989). In this study, we evaluated the safety and efficacy of
a water–ethanol extract of leaves of this species. ED50 of PHE
was established as 550 mg/kg by a carrageenan-induced paw
edema assay. Using acute toxicity assay, the median lethal
dose, LD50 , was determined to be higher than 2.0 g/kg. In
this assay, neither deaths nor symptoms associated with toxi-
city, such as convulsion, ataxy, diarrhoea or increased diure-
sis occurred during the 72-h observation period. These results
indicate the effectiveness and relative safety of PHE for the
treatment of conditions associated with inflammation.
Carrageenan-induced edema has been commonly used
as an experimental animal model for acute inflammation
and is believed to be biphasic. The early phase (1–2 h)
of the carrageenan model is mainly mediated by his-
tamine, serotonin and increased synthesis of prostaglandins
in the damaged tissues surroundings. The late phase is sus-
tained by prostaglandin release and mediated by bradykinin,
leukotrienes, polymorphonuclear cells and prostaglandins
produced by tissue macrophages (Brito and Antonio, 1998).
The inhibitory activity shown by the extract of Pothomor-
phe umbellata leaves (550 mg/kg) over a period of 4 h in
carrageenan-induced paw inflammation was quite similar to
 F.F. Perazzo et al. / Journal of Ethnopharmacology 99 (2005) 215–220
that exhibited by the group treated with indomethacin. These
results indicate that it acts in later phases, probably involv-
ing arachidonic acid metabolites, which produce an edema
dependent on neutrophils mobilization (Just et al., 1998).
The intraperitoneal administration of agents that irritate
serous membranes provokes a stereotypical behavior in mice
and rats which is characterized by abdominal contractions,
movements of the body as a whole, twisting of dorsoabdom-
inal muscles, and a reduction in motor activity and coordina-
tion (Bars et al., 2001). The quantification of prostaglandins
by radioimmunoassay in the peritoneal exudates of rats ob-
tained after the intraperitoneal injection of acetic acid demon-
strated high levels of prostaglandins PGE2␣ and PGF2␣ dur-
ing 30 min after stimulus (Deraedt et al., 1980). It should be
taken into consideration that the mechanism involved in the
genesis of the carrageenan-induced edema can cause the re-
lease of prostaglandins and kinins, among other substances
(Garcia-Leme et al., 1973). The writhing test has shown re-
sults similar to that obtained in the edematogenic assay using
carrageenan.
The granuloumatous tissue induction is a widely used
method for the assessment of anti-inflammatory substances
(Swingle and Shideman, 1972). For that, the topically ap-
plied dexamethasone treatment was the most effective, due
to phospholipase A2 inactivation (Flores et al., 1993).
The solvent partition of PHE by using three organic sol-
vents yielded three fractions and all of them showed an
inhibitory effect on the carragennan-induced edema assay.
Moreover, the methylene chloride fraction showed the best
activity, indicating that active compounds are concentrated
in this fraction. The methylene chloride fraction inhibited the
inflammatory process by 44% at 200 mg/kg when compared
to the control group. This effect was comparable to that ob-
served for the group treated with indomethacin (10 mg/kg).
Regarding the active compounds previously described in this
species, Kijjoa et al. (1980) described the presence of sitos-
terol and 4-nerolidylcatechol in the leaves of this plant as
major compounds. Navarro et al. (2001) described the anti-
inflammatory and immunomodulating effects obtained from
the acetone extract from Sideritis foetens, which contains
about 60% of the sterol mixture (campesterol, stigmasterol
and ␤-sitosterol). Nevertheless, it is well known that inflam-
mation sites present a high concentration of free radicals, and
anti-oxidant compounds can be helpful to avoid this process.
The other major compound present in the leaves of Pothomor-
phe umbellata, 4-nerolidylcatechol, has been proven to have a
high anti-oxidant potential, inhibiting Fe(II)-dependent DNA
damage and scavenging peroxyl radicals (Desmarchelier et
al., 1997) and to confer protection against photodamage in
the skin (Ropke et al., 2003). Also, Cuzzocrea et al. (2001)
have shown that anti-oxidant therapy is a new pharmacolog-
ical approach to inflammatory diseases.
Based on the results obtained in this study, we can suggest
that the extracts of Pothomorphe umbellata leaves possess an
anti-inflammatory property supporting its folkloric use in the
treatment of inflammatory disorders.
219
Acknowledgements
We are grateful to Fundacao Coordenacao de Aperfeicoa-
mento de Pessoal de Nivel Superior (Capes – CBE/PDEE
00012/2003, Processo BEX 2824/03-5) for the “Sandwich
Program” scholarship. We are also thankful to Dr. Warren
Hill Kelly (Olemiss Writing Center) for the English revision
of this manuscript and Carlos Henrique Cenzi for technical
support.
References
Almeida, E.R., 1993. Plantas Medicinais Brasileiras. Real Produções
Gráficas, pp. 120–121.
Amorim, C.Z., Flores, C.A., Gomes, B.E., Marques, A.D., Cordeiro, R.S.,
1988. Screening for anti-malarial activity in the genus Pothomorphe.
Journal of Ethnopharmacology (Lausanne) 4, 101–106.
Bars, D., Gozariu, M., Cadden, S.W., 2001. Animal models of nocicep-
tion. Pharmacological Reviews 53, 597–652.
Brito, A.R.M.S., Antonio, M.A., 1998. Oral anti-inflammatory and anti-
ulcerogenic activities of a hydroalcoholic extract and partitioned frac-
tions of Turnera ulmifolia (Turneraceae). Journal of Ethnopharmacol-
ogy 61, 215–228.
Carvalho, J.C.T., Sertie, J.A.A., Barbosa, M.V.J., Patrı́cio, K.C.M., Ca-
puto, L.R.G., Sarti, S.J., Ferreira, L.P., Bastos, J.K., 1999. Anti-
inflammatory activity of the crude extract from the fruits of Pterodon
emarginatus Vog. Journal of Ethnopharmacology 64, 127–133.
Cuzzocrea, S., Riley, D.P., Caputi, A.P., Salvemini, D., 2001. Antioxidant
therapy: a new pharmacological approach in shock, inflammation, and
ischemia/reperfusion injury. Pharmacological Reviews 53, 135–159.
Deraedt, R., Jouquey, S., Delevallee, F., Flauhaut, M., 1980. Release of
prostaglandins E and F in an algogenic reaction and its inhibition.
European Journal of Pharmacology 61, 17–24.
Desmarchelier, C., Mongelli, E., Coussio, J., Ciccia, G., 1997. Inhibition
of lipid peroxidation and iron (II)-dependent DNA damage by extracts
of Pothomorphe peltata (L.) Miq. Brazilian Journal of Medical and
Biological Research 30, 85–91.
Desmarchelier, C., Slowing, K., Ciccia, G., 2000. Anti-inflammatory ac-
tivity of Pothomorphe peltata leaf methanol extract. Fitoterapia 71,
556–558.
Felzenswalb, I., Valsa, J.O., Araujo, A.C., Alcantara-Gomes, R., 1987.
Absence of mutagenicity of Pothomorphe umbellata and Pothomorphe
peltata in the Samonella/mammalian microsome mutagenicity assay.
Brazilian Journal of Medical and Biological Research (Ribeirão Preto)
20, 403–405.
Ferreira, S.H., 1979. A new method for measuring variations of rats paw
volumes. Journal of Pharmacy and Pharmacology 31, 648.
Ferreira-da-Cruz, M., Adami, Y.L., da Espinola-Mendes, E., Figueiredo,
M.R., Daniel-Ribeiro, C.T., 2000. The intraperitoneal Plasmodium
berghei-Pasteur infection of Swiss mice is not a system that is able to
detect the antiplasmodial activity in the Pothomorphe plant extracts
that are used as antimalarials in Brazilian endemic areas. Experimental
Parasitology 94, 243–247.
Flores, C.A., Zappellini, A., Prado-Franceschi, J., 1993. Lipoxygenase-
derived mediators may be involved in in vivo neutrophil migration
induced by Bothrops erythromelas and Bothrops alternatus venoms.
Toxicon 31, 1551–1559.
Garcia-Leme, J., Nakamura, L., Leite, M.P., Rocha e Silva, M., 1973.
Pharmacological analysis of the acute inflammation process induced
in rat’s paw by local injection of carrageenan and heating. British
Journal of Pharmacology 64, 91–98.
Hammer, M.L.A., Johns, E.A., 1993. Tapping an Amazonian plethora:
four medicinal plants of Marajo Island, Para (Brazil). Journal of
Ethnopharmacology 40, 53–75.
220 F.F. Perazzo et al. / Journal of Ethnopharmacology 99 (2005) 215–220
Isobe, T., Ohsaki, A., Nagata, K., 2002. Antibacterial constituents against
Helicobacter pylori of Brazilian medicinal plant, pariparoba. Yaku-
gaku Zasshi 122, 291–294.
Just, M.J., Recio, M.C., Giner, R.M., Cullar, M.J., Manez, S., Bilia, A.R.,
1998. Anti-inflammatory activity of unusual Lupane saponins from
Bupleurum fruticescens. Planta Medica 64, 404–407.
Kijjoa, A., Giesbrecht, A.M., Akisue, M.K., Gottlieb, O.R., Gottlieb, H.E.,
1980. 4-nerolidycatechol from Pothomorphe umbellata. Planta Medica
39, 85–87.
Koster, R., Anderson, M., DeBeer, E.J., 1959. Acetic acid analgesic
screening. Federation Proceedings 18, 418–420.
Meier, R., Schuler, W., Desaullles, P., 1950. Zur Frage des Mechanismus
der Hemmung des Bindegewebswachstums durch Cortisone. Experi-
entia (Basel) 6, 469–471.
Navarro, A., De Las Heras, B., Villar, A., 2001. Anti-inflammatory and
immunomodulating properties of sterol fraction from Sideritis foetens
Clem. Biological Pharmaceutical Bulletin 24, 470–473.
Niemegeers, C.J.E., 1975. The activity of suprofen on nystatin-induced
paw oedema in rats. Arzneimittel-Forschung 23, 1516–1519.
Pupo, A.S., 1988. Estudo do efeito analgésico de plantas medicinais da
famı́lia Piperaceae. Monografia, UNESP, Botucatu.
Ropke, C.D., Meirelles, R.R., da Silva, V.V., Sawada, T.C.H., Barros,
S.B.M., 2003. Pothomorphe umbellata extract prevents ␣-tocopherol
depletion after UV-irradiation. Photochemistry and Photobiology 78,
436–439.
Sokal, R.R., Rohlf, F.J., 1995. Biometry: The Principles and Practice of
Statistics in Biologial Research, 2nd ed. (Freeman) Campbell, R.C.,
pp. 175–205; 404–486.
Stasi, L.C., Santos, E.M.C., Moreira dos Santos, C., Hiruma, C.A.,
1989. Plantas medicinais na Amazônia. UNESP, São Paulo, pp. 39–
40.
Swingle, K.F., Shideman, F.E., 1972. Phases of the inflammatory response
to subcutaneous implantation of a cotton pellet and their modification
by certain anti-inflammatory agents. The Journal of Pharmacology and
Experimental Therapeutics, 226–234.
Thompson, W.R., Weil, C.S., 1952. On the construction of tables for
moving average interpolations. Biometrics 8, 51–54.
 Journal of Ethnopharmacology 99 (2005) 221–227

Model of inhibition of Thermus aquaticus polymerase and Moloney

murine leukemia virus reverse transcriptase by tea polyphenols
(+)-catechin and (–)-epigallocatechin-3-gallate
Ales Tichopad a , Jürgen Polster b , Ladislav Pecen c , Michael W. Pfaffl a,∗
a Physiology Weihenstephan, Zentralinstitut für Ernährung-und Lebensmittel-forschung, Technische Universität München, D-85350 Freising, Germany
b Department für ‘Biowissenschaftliche Grundlagen’, Lehrstuhl für Biologische Chemie, FG Physikalische Chemie, Technische Universität München,
Wissenschaftszentrum Weihenstephan, D-85350 Freising, Germany
c First Medical Faculty of the Charles University, CZ-80200 Prague, The Czech Republic

Received 18 March 2004; received in revised form 18 January 2005; accepted 11 February 2005
Available online 9 April 2005

Abstract

Non-nutritional polyphenolic compounds such as (+)-catechin and (−)-epigallocatechin-3-gallate (EGCG) are known as anticancer chemo-
preventive agents and have been utilised for medical purposes in form of tea drinking. Documented anticancer properties of these compounds
result from their antioxidant effects. However, also direct alteration of an enzyme performance has been reported and deserves more attention.
In this paper, a direct effect of catechin and EGCG on the performance of reverse transcription (RT) and/or polymerase chain reaction (PCR)
was studied. Both tea polyphenolic compounds were added into real-time RT-PCR reactions and the fluorescence data obtained were fitted
with a mathematical model. Several parameters of PCR performance were compared, obtained from the mathematical model for reactions
with and without addition of (+)-catechin and EGCG. Addition of EGCG to enzyme reaction seems to inhibit the RT reaction (p < 0.05) and
to slow down the DNA polymerase reaction (p < 0.001). Similarly, (+)-catechin inhibited the DNA amplification (p < 0.01) but had no effect
on the RT reaction. The effects could be observed in physiological flavanol concentrations ranging from 10−5 to 10−8 M.
© 2005 Elsevier Ireland Ltd. All rights reserved.

Keywords: Reverse transcriptase; DNA polymerase; Catechin; EGCG; Real-time RT-PCR; Cancer

1. Introduction sides the use as a beverage, the medicinal properties of the

There are about 6000 polyphenols in nature. Their bio-
chemical and ethno-pharmacological role is understood only
poorly. The diverse interaction between flavanoids and cell
proteins or enzymes protect the cells against a quick degra-
dation. High flavan-3-ols (catechins) concentrations in leaves
and needles prevent them during autumn from fermentation
activities caused by microorganisms (Feucht et al., 2004).
Polyphenolic compounds such as catechins are supposed to
be non-cytotoxic plant constituents for humans present in
high concentrations in tea, but also in many other foods, such
as apples, grapes, vine and their processed beverages. Be-
∗ Corresponding author. Tel.: +49 8161 713511; fax: +49 8161 714204.
E-mail address: pfaffl@wzw.tum.de (M.W. Pfaffl).
green, black and Oolong tea were well known and utilised
by many peoples in Asia. The long-term tea drinking habit
of Asians is believed to be responsible for lowering cancer
incidence. Recently, these compounds are under intensive sci-
entific focus for their assumed anticancer preventive and cu-
rative properties (Middleton et al., 2000; Lambert and Yang,
2003). However, evidence obtained from clinical trials and
population studies, that would support such theories is con-
flicting. This is often a result of confounding factor correlated
with tea drinking, such as smoking (Higdon and Frei, 2003).
As chemopreventive agents, these compounds are assumed
to be able to halt or reverse the development and progression
of tumour cells (Hayakawa et al., 2001; Morre et al., 2003).
It has been shown that EGCG can induce and also inhibit ex-
pression of genes associated with the cancer progression and

0378-8741/$ – see front matter © 2005 Elsevier Ireland Ltd. All rights reserved.
doi:10.1016/j.jep.2005.02.021
222 A. Tichopad et al. / Journal of Ethnopharmacology 99 (2005) 221–227
apoptosis (Okabe et al., 2001; Ahn et al., 2003; Gupta et al.,
2003). Telomere shortening caused by this compound is dis-
cussed as well in literature (Seimiya et al., 2002) together with
a possible interaction between histones and catechins (Polster
et al., 2003). There is an abundant in vitro and less abundant
in vivo evidence of a direct as well as indirect antioxidant
effect of the tea polyphenols and their derivatives (Wiseman
et al., 1997; Henning et al., 2003; Cabrera et al., 2003). A
direct effect such as the scavenging of reactive oxygen and
nitrogen species is well studied. Inhibition of enzymes by
tea polyphenols whose activity possibly increases oxidative
stress in organism such as cytochromes (CYP), CYP P450
(Muto et al., 2001) and CYP 1A1 (Schwarz and Roots, 2003)
is an example of the indirect antioxidant effect.
The risk of oncogene changes in cells is linked to poly-
merase enzymes, therefore, a possible interaction between
polymerases, their activities and catechin compounds de-
serves interest. Such an action was described earlier (Tao,
1992), but this issue deserves surely more focus with an up-
dated methodology and a greater public attention.
In addition, anti-viral effects of tea polyphenolic com-
pounds are also discussed in recent literature (Fassina et al.,
2002; Yamaguchi et al., 2002; Chang et al., 2003). Blocking
of reverse transcriptase or just its partial inhibition may be at
least a particular explanation of anti-retroviral curative prop-
erties of these compounds (Fassina et al., 2002). Preparations
containing tea extracts have been already successfully tested
as effective anti-herpesvirus simplex drug (Kaul et al., 1985;
Namba et al., 1998).
Presumably, the mutation probability in metazoan organ-
isms can be approximated by the polymerase chain reaction
(PCR) with its exponential strengthening of the polymerase
activity. However, using the updated RT-PCR systems, the
analogy between the archeobacterial thermo-resistant DNA
polymerase and the DNA polymerase in living metazoans is
low. PCR performed on complementary DNA (cDNA) sub-
strate, obtained by reverse transcription from the total RNA
or mRNA, is a routinely used tool in expression analysis in
a lot of laboratories today. Either for amplification of sub-
strate aimed for later analysis, or as a direct precise analyt-
ical tool, PCR offers fast, easy and cheap way to quantify
and classify selected sequences of nucleic acids. In the real-
time PCR, not only final data on the quantity, but also data
on the whole PCR kinetic performance is available (Wittwer
et al., 1997). This additional information reports about the
reaction system itself. Mathematical approximation of this
data by suitable model yields characteristic parameters of
reaction kinetics. These parameters can be then compared
between samples with experimental manipulation and con-
trol samples (Tichopad et al., 2002, 2003). Thus, an attempt
was started to simulate the reaction kinetics of the DNA poly-
merase (Wittwer et al., 1997) by real-time PCR on the Light-
Cycler instrument (Roche Diagnostics, Basel, Switzerland).
Additionally, the efficiency of the reverse transcriptase (RT)
could be estimated. In this way, the influence of (+)-catechin
and EGCG could be assessed on the Thermus aquaticus (Taq)
DNA polymerase and on the Moloney Murine Leukemia Virus
(MMLV) reverse transcriptase.
2. Materials and methods
2.1. Tea polyphenols preparation
(+)-Catechin and (−)-epigallocatechin-3-gallate (EGCG)
were purchased from Sigma–Aldrich (Munich, Germany).
Working dilution series in water of each compound to final
concentrations 10−5 , 10−6 , 10−7 , and 10−8 M were prepared.
Blood concentrations of 10−6 to 10−7 M represent physiolog-
ical concentrations occurring in human blood (Middleton et
al., 2000; Higdon and Frei, 2003).
2.2. RT and PCR reaction preparation
Samples of bovine liver tissue were stored immediately af-
ter its sampling in liquid nitrogen and then in −80 ◦ C. Total
RNA extraction was performed using the commercial prepa-
ration TriPure (Roche Diagnostics) utilising the single step
extraction procedure according to Chomczynski (1993). The
following two approaches of RT-PCR were adopted differing
in their separation of the reverse transcription (RT) reaction
from the polymerase chain reaction.
2.2.1. One-step real-time RT-PCR approach
In this approach, the studied flavanol compounds were
added into reaction before starting the reverse transcription,
and could thus influence it. The RT as well as the PCR
were run together on the LightCycler platform (Roche Di-
agnostics) using the QuantiTect SYBR Green RT-PCR Kit
(Qiagen, Hilden, Germany). Prior to the PCR, the RT step
was attached reverse transcribing 5 ng total RNA into cDNA.
The reaction was set according to the standard protocol rec-
ommended by manufacturer (Qiagen). The master-mix was
prepared as follows: 5 ␮l QuantiTect SYBR Green RT-PCR
Master Mix, 0.5 ␮l forward primer (1 ␮M), 0.5 ␮l reverse
primer (1 ␮M) and 0.1 ␮l QuantiTect RT Mix. 6.1 ␮l of
master-mix was filled in glass capillaries and a 2.9 ␮l wa-
ter containing 5 ng total RNA was added as RT-PCR tem-
plate. Finally, always 1 ␮l water containing varying concen-
tration of one of the two studied compounds was added
into each capillary so that the final concentrations 10−5 ,
10−6 , 10−7 , and 10−8 M were achieved. Primers were de-
signed and purchased from MWG Biotech (Ebersberg, Ger-
many) to amplify 359 bp long cDNA fragment of bovine
tumour necrosis factor alpha (TNF␣), according to the lit-
erature (Wittmann et al., 2002). Capillaries with samples
were closed, centrifuged and placed into a cycling rotor.
A five-step experimental run protocol was used consist-
ing of (1) RT step (20 min at 50 ◦ C), (2) denaturation step
(15 min at 95 ◦ C); (3) amplification and quantification step
repeated 45 times (15 s at 94 ◦ C; 10 s at 60 ◦ C; 20 s at
72 ◦ C; 5 s at 80 ◦ C with a single fluorescence measure-
 A. Tichopad et al. / Journal of Ethnopharmacology 99 (2005) 221–227
ment); (4) melting curve step (60–99 ◦ C) with a heating
rate of 0.1 ◦ C/s and a continuous measurement (Ririe et al.,
1997); (5) fast cooling step down to 40 ◦ C.
Each concentration of one of the two studied flavanol com-
pound was run in triplicate. In total four flavanol concentra-
tions, three replicates, two compounds either (+)-catechin
or EGCG (each n = 12) plus eight control capillaries with
reaction mix but without any flavanol were run in a single
real-time RT-PCR run so that no random inter-run effect was
introduced into the experiment.
2.2.2. Two-step RT real-time-PCR approach
In this approach, the mRNA was reverse transcribed with
the MMLV reverse transcriptase into cDNA separately on an-
other platform (TGradient, Biometra, Göttingen, Germany).
The studied flavanols were added after the RT reaction. The
two-step RT real-time PCR was employed additionally to
study the effect of flavanol exclusively on the polymerase re-
action without a possible effect on the RT. If the RT itself is
affected, the performance of the following polymerase reac-
tion would also be altered since the cDNA concentration at
the start of the PCR differs between samples.
Within this approach the same, above-mentioned, 359 bp
TNF␣ (Wittmann et al., 2002) was amplified using the
LightCycler–FastStart DNA Master SYBR Green I (Roche
Diagnostics). It is a ready-to-reaction mix for PCR that con-
tains Taq DNA polymerase and DNA double-strand specific
SYBR Green I dye for detection (Morrison et al., 1998). The
polyphenols were added into PCR reaction diluted in varying
concentration in 1 ␮l water. The concentrations of both com-
pounds present in the PCR were the same like in the one-step
approach. Triplicate design with eight additional control re-
actions was adopted as well as in the one-step approach. All
32 samples were performed within one run.
2.3. Statistical analysis
Using SigmaPlot software (SPSS Inc., Illinois, USA) the
four parametric sigmoid model (Tichopad et al., 2002), ac-
cording to Eq. (1), was used to fit the fluorescence raw data
observations (Fig. 1) generated by LightCycler software ver-
sion 3.5 (Roche Diagnostics).
a
f (x) = y0 + (1)
1 + e−(x−x0 /b)
In total, 64 reaction kinetics curves were obtained by fit-
ting the fluorescence raw data of each single sample with the
model. In the four-parametric sigmoid model, x is the cycle
number, f(x) the computed function of the fluorescence in de-
pendence of cycle number x, y0 the background fluorescence,
a the difference between maximal fluorescence reached at
plateau phase and background fluorescence (i.e. the plateau
height), e the natural logarithm base, x0 the co-ordinate of
the first derivative maximum of the model or inflexion point
of the curve, and b describes the slope at x0 in the log–linear
phase.
223
Fig. 1. Real-time fluorescence history of two-step RT-PCR with flavanol
treatment. (-
-) Control group; (-䊉-) 10−6 M (+)-Catechin treatment; (-䊉-)
dotted baseline is no template water control. Inlay: four-parametric sigmoid
model (described by Eq. (1)), x is the cycle number, f(x) the computed
function of the fluorescence at cycle x, y0 the background fluorescence, a
the difference between maximal fluorescence reached at plateau phase and
background fluorescence (i.e. the plateau height), e the natural logarithm
base, x0 the co-ordinate of the first derivative maximum of the model or
inflexion point of the curve, CP is the co-ordinate of the second derivative
maximum of the model, calculated by the LightCycler software 3.5 (Roche
Diagnostics) and b describes the slope at x0 in the log–linear phase.
The following general scheme can be given:
a—high a detects high real-time PCR product obtained after
all cycles;
b—low b detects high polymerase reaction efficiency
(Tichopad et al., 2003);
x0 —high x0 detects delay in the detectable phase of the
reaction, comparable to CP;
y0 —high y0 detects high RT product obtained.
Further parameter analysed was the crossing point (CP),
which is also named Ct value. The parameter CP is not a
part of the four-parametric sigmoid model but can be ob-
tained by differentiation of the corresponding Eq. (1). It is a
central term of the real-time PCR quantification (Wittwer et
al., 1997; Rasmussen, 2001). In brief, CP gives the number
of PCR cycles at which the fluorescence generated by PCR
product reaches a defined fluorescence level. In this sense, it
is a direct measure for the initial concentration of nucleic acid
in the sample. This threshold level can be set by user subjec-
tively or it is based on an exact computing algorithm. The
CP applied within this paper was obtained direct from Light-
Cycler software version 3.5 (Roche Diagnostics) based on a
special computation method (Wittwer et al., 2001), where CP
is placed into the positive maximum of the second derivative
of the curve (Fig. 1), computed on smoothed PCR fluores-
cence data. Thus, CP denotes the second derivative maximum
and x0 is the first derivative maximum, of the described math-
ematical model. CP gives information similar to x0 , and is less
influenced by reaction inhibitors and inhomogenities, like the
PCR efficiency (parameter b; Tichopad et al., 2003).
224 A. Tichopad et al. / Journal of Ethnopharmacology 99 (2005) 221–227

In the two-step RT-PCR reaction the y0 parameter becomes

irrelevant for the analysis since it reflects only the pipetting
error and the background noise of the measuring optic system
of the LightCycler. In the one-step approach, parameters a,
b, x0 and CP were analysed together with the y0 parameter.
Here, the higher y0 the higher the cDNA synthesis efficiency
of the previous RT reaction was. This parameter becomes an
interesting hint to assume RT efficiency, provided, the one-
step approach was employed.
All further statistics was done using the SAS 8.02 soft-
ware. Effect of the flavanols was inspected for all model pa-
rameters. Comparison of samples with one of the two fla-
vanols versus control group was carried out. The one-way
ANOVA test was employed, testing, whether there are dif-
ferences between the samples containing a special flavanol
(each n = 12) and the control group (n = 8). The differences
between dilution steps of flavanol added into samples were
disregarded in the model. The ANOVA model was reduced to
the present/absent character. The applied measurement taken
as the dilution steps of factor 10 was too great and the assump-
tion of dilution response would thus weaken the test’s differ-
entiation between groups with present and absent flavanol.
Since the statistical design was heavily unbalanced, the pro-
cedure generalised linear model (GLM) was employed. Data
was plotted and visually inspected (not all figures shown).
A table of p-values for parameters of the sigmoidal model
was established (Table 1). Statistical probability of obtaining
results with p < 0.05 was considered significant. Where sig-
nificant statistics was obtained a short comment was given
(Table 1).
3. Results
Modified extraction procedure of the total RNA from
bovine samples according to Chomczynski (1993) could pro-
duce highly pure RNA extract with high integrity as inspected
by electrophoresis and melting curve inspection (Ririe et al.,
1997). The RT as well as the PCR reaction showed a good
performance and gave a typical shaped sigmoidal curve with a
Fig. 2. Effect of EGCG on RT reaction parameter y0 presented in log trans-
formation on PCR reaction parameter b. The first box represents eight reac-
tions with no EGCG added. Following boxes of n = 3 represent reactions with
various concentration of EGCG added. The length of the box represents the
interquartile range (the distance between the 25th and the 75th percentiles),
the solid line interior represents the mean and the thin line in the box interior
represents the median.
steep exponential phase and sudden plateau termination of the
reaction, resulting in a high plateau phase (compare Fig. 1).
Inspection of the melting curve of the amplification product
showed no side products generated during the reaction (e.g.
primer-dimers).
The four-parametric sigmoid model could tightly fit the
fluorescence data (r2 > 0.999, n = 64) and thus produced re-
liable model parameters for the further estimation. These
parameters were subsequently compared between the con-
trol group and the positive samples, employing the one-
way ANOVA test (Table 1). Before employing the one-way
ANOVA test the data was checked for the Gaussian distribu-
tion and equal variance between groups. Where this condition
was fulfilled computation of the one-way ANOVA test was
performed directly on the data. Often, no linear trend in the
model parameters corresponded to the dilution series (Fig. 2)
or the error distribution within the dilution groups was heavily

Table 1
The significance of the alteration of parameters by EGCG and (+)-catechin in one-step and two-step real-time RT-PCR approach
a b x0 y0 CP
(A) One-step approach
Catechin p-value 0.8052 0.1858 0.9416 0.4086 0.5315
The addition of agent causes – – – – –
EGCG p-value 0.1051 0.5921 0.6113 0.0294 0.5171
The addition of agent causes – – – Lower RT product –

a b x0 CP
(B) Two-step approach
Catechin p-value 0.0815 0.0015 <0.0001 0.8843
The addition of agent causes – Decrease of PCR efficiency Delay of PCR –
EGCG p-value 0.0919 0.777 <0.0001 <0.0001
The addition of agent causes – – Delay of PCR Delay of PCR
a, b, x0 , y0 are the parameters of the four-parametric sigmoid model and CP is the fundamental parameter of the real-time PCR quantification. Significantly
altered parameters are indicated. Beneath the respective significant p-value a comment on the impact of the finding on the reaction is given.
 A. Tichopad et al. / Journal of Ethnopharmacology 99 (2005) 221–227
Fig. 3. Effect of (+)-catechin on PCR reaction parameter b (direct reaction
efficiency presented in log transformation).
unequal (Fig. 3). For this reason, no linear regression analy-
sis or adjustment to the dilution-covariate (ANCOVA model)
was performed. Figs. 2 and 3 were chosen to demonstrate the
difference between the control group and groups with vari-
ous concentrations of the two compounds. They also show the
error distribution and the pattern of the concentration effect.
The effect of EGCG on the RT reaction was statistically
significant (p = 0.029) and caused a lower RT product yielded
(Table 1). The decrease of the y0 value due to EGCG addition
was approximately 0.2 fluorescence units. No response to
the concentration gradient, in the form of a linear trend, was
present on the data plot.
Other parameters reflecting an effect on the subsequent
polymerase reaction remained unaffected. This is logical, as
there was no longer the same cDNA concentration in samples
at the beginning of the polymerase reaction. This interfered
with the real effects of flavanols during the following PCR
cycling. Therefore the two-step approach had to be employed
to get rid of any interference with the prior RT.
In the two-step approach, both compounds caused very
significant (p < 0.0001) delay of reaction as reflected by later
reaching of the x0 or the CP (p < 0.0001). (+)-Catechin caused
+0.22 shift in the x0 , that is, the reactions containing (+)-
catechin reached their first derivative maximum, in average,
0.22 cycles later. Adding EGCG into reaction caused a shift of
0.17 for x0 and 0.27 for CP. (+)-Catechin caused additionally
a direct efficiency decrease of the reaction as reported by the
b parameter change of 0.04 (p = 0.0015). This decrease of
efficiency was strongly linearly concentration dependent, but
the error distribution between different concentration groups
was heavily unequal (Fig. 3).
4. Discussion
We studied the inhibition of the Thermus aquaticus (Taq)
polymerase and Moloney Murine Leukemia Virus (MMLV)
225
reverse transcriptase performance in addition of two tea fla-
vanol compounds (+)-catechin and EGCG using real-time
PCR with reverse transcribed mRNA (Wittwer et al., 1997;
Ririe et al., 1997; Rasmussen, 2001). This experimental
model with both enzymes was just a rough approximation
of biological conditions in a real cell. We compared several
reaction trajectories obtained with or without the addition of
these two flavanol compounds.
Monitoring the reaction kinetics of real-time PCR or/and
real-time RT-PCR (Wittwer et al., 1997) is a possible way to
study the performance of a DNA polymerase and also reverse
transcriptase under various conditions. If a suitable mathe-
matical model is applied to fit the reaction history a quanti-
tative analysis of the reaction kinetics is possible (Tichopad
et al., 2002).
The one-step real-time RT-PCR approach applied here fa-
cilitated the look at effect of added agents on the performance
of the RT reaction and the reverse transcriptase enzyme in
particular. An effect of EGCG on the one-step RT-PCR was
significantly present as decrease of final cDNA product after
RT reaction. This showed that EGCG inhibits processes such
as retroviral reproduction directly on the reverse transcrip-
tion level. This is in accordance with reported anti-retroviral
properties of EGCG and other flavanol compounds in cell
and tissue cultures (Tao, 1992; Fassina et al., 2002).
As the in vitro experiments herein were very restrictive,
with relatively few reactants in comparison to complex con-
ditions in the living cell nucleus, we can assume direct effect
on the reverse transcriptase MMLV enzyme itself.
Employing the two-step RT-PCR approach, one can see an
effect of both compounds on the polymerase reaction. With
(+)-catechin, the direct efficiency and the reaction delay was
altered in a sense of PCR inhibition. Also with EGCG the
delay of the reaction is present and reported by change of pa-
rameters x0 and CP. Different model parameters are altered by
adding either of the two flavanols. This could be explained
only partially. Each of the two compounds has possibly a
different saturation plateau in its inhibition of the reaction.
This effect may cause the kinetic curve of the PCR to have
a slightly different history and therefore the model param-
eters to shift. In all significant results obtained, there were
no alterations of the investigated parameters towards better
performance of the polymerase reaction. This is a strong indi-
cation that EGCG as well as (+)-catechin inhibits or just slows
down the efficiency rate of PCR. Since the reaction system is
relatively simple, containing just few reaction components,
we assume a direct effect on the Taq polymerase itself.
The range of dilution of flavanols added to the reaction
was biologically relevant as to be able to inhibit the PCR
polymerase and RT reaction. Even low concentrations, down
to from 10−5 to 10−8 M, exhibit significant inhibitory effect
on the investigated enzymes, compared to untreated controls.
Unfortunately, no quantitative conclusion can be drawn from
the used flavanols concentrations.
The real-time PCR approach employed to study the per-
formance of a polymerase reaction is not the most common
226 A. Tichopad et al. / Journal of Ethnopharmacology 99 (2005) 221–227
but surely a very sensitive one. Unfortunately, the real-time
PCR cannot be used quantitatively in this study, because
the fluorescence data is directly analysed. There is always
a great deal of background noise of fluorescence that is hard
to quantify. Because of this background noise it is impossible
to quantitatively express the difference between the treated
and the control samples. However, the model can detect very
sensitively each increase or decrease shift in the reaction
system.
The PCR can only roughly simulate the biological condi-
tions in the eukaryotic cell. The fact that the Taq polymerase
is of archeobacterial and not of eukaryotic origin must be
taken into account. On the other hand, the PCR model of
DNA replication in vivo can restrict the reaction to only few
compounds present, facilitating thus more robust interpreta-
tion. Surely, more tightly focused study must be performed
to disclose whether flavanol compounds can decrease the risk
of mutation during DNA replication by slowing the rate of
enzyme reaction.
Further we can assume, that the applied PCR reaction with
45 cycles is a model for cell proliferation with 45 mitoses,
where DNA is also doubled. Herein, a significant influence
on polymerase activity is given. If we speculate how many
cell cycles (with an average epithelium cell life span of a
few days) are occurring in the gut epithelium during a hu-
man life of 75 years, we may estimate the significance of the
inhibitory effect of flavanols in the gut. Gastrointestinal cell
proliferation rate will be slowed down and therefore, the risk
of gut cancer may be markedly reduced.
To conclude, employing modern and sensitive diagnostic
method, we present sensitive evidence in this paper, that the
tea flavanols (+)-catechin and EGCG can inhibit and slow
down the DNA polymerase reaction and reverse transcrip-
tion. This is of concern as far as anticancer properties of this
compounds are discussed.
Acknowledgement
The authors thank Prof. W. Feucht from the Lehrstuhl
für Obstbau of the Technical University of Munich for his
initiating this paper and plenty of inspiring ideas.
References
Ahn, W.S., Huh, S.W., Bae, S.M., Lee, I.P., Lee, J.M., Namkoong, S.E.,
Kim, C.K., Sin, J.I., 2003. A major constituent of green tea, EGCG,
inhibits the growth of a human cervical cancer cell line, CaSki cells,
through apoptosis, G(1) arrest, and regulation of gene expression.
DNA Cell Biology 22, 217–224.
Cabrera, C., Gimenez, R., Lopez, M.C., 2003. Determination of tea com-
ponents with antioxidant activity. Journal of Agriculture and Food
Chemistry 51, 4427–4435.
Chang, L.K., Wei, T.T., Chiu, Y.F., Tung, C.P., Chuang, J.Y., Hung, S.K.,
Li, C., Liu, S.T., 2003. Inhibition of Epstein-Barr virus lytic cycle
by (-)-epigallocatechin gallate. Biochemical and Biophysical Research
Communications 301, 1062–1068.
Chomczynski, P.A., 1993. Reagent for single-step simultaneous isolation
of RNA. BioTechniques 15, 532–536.
Fassina, G., Buffa, A., Benelli, R., Varnier, O.E., Noonan, D.M., Albini,
A., 2002. Polyphenolic antioxidant (-)-epigallocatechin-3-gallate from
green tea as a candidate anti-HIV agent. AIDS 16, 939–941.
Feucht, W., Treutter, D., Polster, J., 2004. Flavanol binding of nuclei from
tree species. Plant Cell Reproduction 22, 430–436.
Gupta, S., Hussain, T., Mukhtar, H., 2003. Molecular pathway for (-)-
epigallocatechin-3-gallate-induced cell cycle arrest and apoptosis of
human prostate carcinoma cells. Archives of Biochemistry and Bio-
physics 410, 177–185.
Hayakawa, S., Saeki, K., Sazuka, Y., Shoji, Y., Ohta, T., Kaji, K., You,
M., Isemura, M., 2001. Apoptosis induction by epicatechin gallate
involves its binding to FAS. Biochemical and Biophysical Research
Communications 24, 1102–1106.
Henning, S.M., Fajardo-Lira, C., Lee, H.W., Youssefian, A.A., Go, V.L.,
Heber, D., 2003. Catechin content of 18 teas and a green tea ex-
tract supplement correlates with the antioxidant capacity. Nutrition
and Cancer 45, 226–235.
Higdon, J.V., Frei, B., 2003. Tea catechins and polyphenols: health ef-
fects metabolism and antioxidant functions. Critical Reviews in Food
Science and Nutrition 43, 89–143.
Kaul, T.N., Middleton Jr., E., Ogra, P.L., 1985. Antiviral effect of
flavonoids on human viruses. Journal of Medical Virology 15, 71–79.
Lambert, J.D., Yang, C.S., 2003. Cancer chemopreventive activity
and bioavailability of tea and tea polyphenols. Mutation Research
523–524, 201–208.
Middleton Jr., E., Kandaswami, C., Theoharides, T.C., 2000. The effects
of plant flavonoids on mammalian cells: implications for inflamma-
tion, heart disease, and cancer. Pharmacology Reviews 52, 673–751.
Morre, D.J., Morre, D.M., Sun, H., Cooper, R., Chang, J., Janle, E.M.,
2003. Tea catechin synergies in Inhibition of cancer cell proliferation
and of a cancer specific cell surface oxidase (ECTO-NOX). Pharma-
cology and Toxicology 92, 234–241.
Morrison, T.B., Weis, J.J., Wittwer, C.T., 1998. Quantification of low-copy
transcripts by continuous SYBR Green I monitoring during amplifi-
cation. BioTechniques 24, 954–958.
Muto, S., Fujita, K., Yamazaki, Y., Kamataki, T., 2001. Inhibition by green
tea catechins of metabolic activation of procarcinogens by human
cytochrome P450. Mutation Research 479, 197–206.
Namba, T., Kurokawa, M., Kadota, S., Shiraki, K., 1998. Development
of antiviral therapeutic agents from traditional medicines. Yakugaku
Zasshi 118, 383–400.
Okabe, S., Fujimoto, N., Sueoka, N., Suganuma, M., Fujiki, H., 2001.
Modulation of gene expression by (−)-epigallocatechin gallate in PC-
9 cells using a cDNA expression array. Biological and Pharmaceutical
Bulletin 24, 883–886.
Polster, J., Dithmar, H., Feucht, W., 2003. Are histones the targets
for flavan-3-ols (catechins) in nuclei. Biological Chemistry 384,
997–1006.
Rasmussen, R., 2001. Quantification on the LightCycler instrument. In:
Meuer, S., Wittwer, C., Nakagawara, K. (Eds.), Rapid Cycle Real-
Time PCR: Methods and Applications. Springer, Heidelberg, pp.
21–34.
Ririe, K.M., Rasmussen, R.T., Wittwer, C.T., 1997. Product differentia-
tion by analysis of DNA melting curves during the polymerase chain
reaction. Analytical Biochemistry 245, 154–160.
Schwarz, D., Roots, I., 2003. In vitro assessment of inhibition by natural
polyphenols of metabolic activation of procarcinogenes by humans
CYP1A1. Biochemical and Biophysical Research Communications
303, 902–907.
Seimiya, H., Oh-hara, T., Suzuki, T., Naasani, I., Shimazaki, T., Tsuchiya,
K., Tsuruo, T., 1991. Telomere shortening and growth inhibition of
human cancer cells by novel synthetic telomerase inhibitors MST-312,
MST-295 and MST. Molecular Cancer Therapy 1, 657–665.
Tao, P., 1992. The inhibitory effects of catechin derivatives on the activi-
ties of human immunodeficiency virus reverse transcriptase and DNA
 A. Tichopad et al. / Journal of Ethnopharmacology 99 (2005) 221–227
polymerases. Zhongguo Yi Xue Ke Xue Yuan Xue Bao 14, 334–338.
Tichopad, A., Dilger, M., Schwarz, G., Pfaffl, M.W., 2003. Standardized
determination of real-time PCR efficiency from a single reaction set-
up. Nucleic Acids Research 31, 122.
Tichopad, A., Dzidic, A., Pfaffl, M.W., 2002. Improving quantitative real-
time RT-PCR reproducibility by boosting primer-linked amplification
efficiency. Biotechnology Letters 24, 2053–2056.
Wiseman, S.A., Balentine, D.A., Frei, B., 1997. Antioxidants in tea. Crit-
ical Reviews in Food Science and Nutrition 37, 705–718.
Wittmann, S.L., Pfaffl, M.W., Meyer, H.H.D., Bruckmaier, R.M., 2002.
5-Lipoxygenase, cyclo-oxygenase-2 and tumor necrosis factor alpha
227
(TNF-alpha) gene expression in somatic milk cells. Milk Science In-
ternational 57, 63–66.
Wittwer, C.T., Gutekunst, M., Lohmann, S., 2001. Method for quantifi-
cation of an analyte. US Patent No. 6,303,305 B1.
Wittwer, C.T., Ririe, K.M., Andrew, R.V., David, D.A., Gundry, R.A.,
Balis, U.J., 1997. The LightCycler: a microvolume multisample fluo-
rimeter with rapid temperature control. BioTechniques 22, 176–181.
Yamaguchi, K., Honda, M., Ikigai, H., Hara, Y., Shimamura, T., 2002.
Inhibitory effects of (-)-epigallocatechin gallate on the life cycle of
human immunodeficiency virus type 1 (HIV-1). Antiviral Research
53, 19–34.
 Journal of Ethnopharmacology 99 (2005) 229–237

Use of Pavo cristatus feather extract for the better management of

snakebites: Neutralization of inflammatory reactions
Satish K. Murari a , Felix J. Frey b , Brigitte M. Frey b , There V. Gowda a ,
Bannikuppe S. Vishwanath a,∗
a Department of Studies in Biochemistry, University of Mysore, Manasagangothri, Mysore 570006, Karnataka, India
b Division of Nephrology and Hypertension, Inselspital CH-3010, Berne, Switzerland

Received 19 August 2004; received in revised form 3 February 2005; accepted 12 February 2005
Available online 11 April 2005

Abstract

In Indian traditional medicine, peacock feather in the form of ash (Bhasma) or water extract are used against snakebite and to treat various
problems associated with lungs. This study was aimed to evaluate the water extract of peacock feather (PCF) against the local tissue damage
caused due to snakebite. PCF water extract showed inhibition towards phospholipase A2 enzyme activity from snake venom (Naja naja and
Vipera russelii), inflammatory fluids (synovial, pleural, ascites) and normal serum in a dose-dependent manner. Hyaluronidase and proteases
are other major enzymes in snake venoms responsible for local tissue damage. PCF water extract inhibited hyaluronidase and proteolytic
enzyme activities from Vipera russelii, Naja naja and Trimeresurus malabaricus venom. The active principle is a hydrophilic molecule easily
extractable in water or polar solvents. PCF water extract gave positive results for the presence of protein and secondary metabolites like
carotenoids and steroids. Analysis of metal ions revealed that iron is the major ion (>20-fold). Other metal ions detected in smaller amount
are copper, chromium, zinc and nickel. The least amount of ion detected is gold. Co-injection of PCF water extract with snake venom and
inflammatory PLA2 enzymes neutralize the edema inducing activity of all the PLA2 enzymes studied. Since it inhibits hyaluronidase and
proteases enzyme activity from snake venom PCF water extract is a powerful neutralizing agent, which has therapeutic application against
venom toxicity.
© 2005 Elsevier Ireland Ltd. All rights reserved.

Keywords: Pavo cristatus; Phospholipase A2 ; Hyaluronidases; Proteases; Anti-inflammatory activity; Synovial fluid; Metal ions; Snake venom

1. Introduction of pro-inflammatory lipid mediators such as prostaglandins,

Snake’s envenomation involves subcutaneous or intra-
muscular injection of venom into the prey/human victims.
The pathology of envenomation includes both local and sys-
temic effects (Warrell, 1996). Local effects include severe
inflammatory reactions, hemorrhage and local tissue necro-
sis. The venom toxins responsible for these local effects are
phospholipase A2 (PLA2 ), protease and hyaluronidase en-
zymes (Chippaux et al., 1991). PLA2 enzyme plays a key
role in many inflammatory reactions by releasing free arachi-
donic acid, which is the rate-limiting step for the production
∗ Corresponding author. Tel.: +91 821 2515525x52; fax: +91 821 2421263.
E-mail address: skmuom 77@yahoo.co.in (B.S. Vishwanath).
leukotrienes, lipoxins and platelet activating factor (Glaser et
al., 1993). Injection of purified PLA2 enzyme from synovial
fluid and from snake venom into animal joints confirmed the
development of an acute inflammatory response with edema,
swelling of synovial cells and hyperplasia (Vishwanath et
al., 1988; Bomalaski and Clark, 1993). Venom proteases are
responsible for tissue necrosis and hemorrhagic activity at
the site of envenomation. These proteases interfere in the
blood coagulation mechanism and act either anti- or proco-
agulants and are responsible for tissue damage (Weinstein et
al., 1991; Jagadeesha et al., 2002). Hyaluronidase enzymes
precede with the diffusion of target-specific toxins into sys-
temic circulation. Agents, which promote this process, are
referred to as ‘Spreading factors’. The spreading action of

0378-8741/$ – see front matter © 2005 Elsevier Ireland Ltd. All rights reserved.
doi:10.1016/j.jep.2005.02.027
230 S.K. Murari et al. / Journal of Ethnopharmacology 99 (2005) 229–237

hyaluronidase enzyme in snake venoms is through selective
degradation of hyaluronan in the extracellular matrix in hu-
man skin and muscle tissue sections (Escalante et al., 2000;
Anai et al., 2002; Girish et al., 2004a, 2004b).
The lethal systemic effects of venoms are due to the spe-
cific toxins like neurotoxins (presynaptic and postsynaptic),
cardiotoxins, nephrotoxins, toxins affecting the blood clot-
ting mechanism (procoagulants, anticoagulation and platelet
aggregation), and myotoxins, which are highly specific and
induce toxicity at the target organs (Barrett, 1986; Paul,
1993; Kini, 1997; Rosenberg, 1997; Estevao-Costa et al.,
2000). The activities of these specific toxins are facilitated
by hyaluronidase enzyme, which is presumed to be the crit-
ical event in spreading of toxins from the site of injection
to systemic circulation. Vasodilatation due to inflammatory
reactions induced by PLA2 enzyme and softening of tissue
and necrosis at the site of envenomation by protease enzymes
indirectly helps the easy spreading of the lethal toxins in the
systemic circulation. Inhibition of these enzyme activities
will result in the minimal tissue destruction and decreases
the spreading of the specific toxins into the systemic regions.
Incorporation of these enzyme inhibitors as a cocktail would
complement and enhance the efficiency of anti-venom ther-
apy.
The general treatment for snakebite is the use of mono-
valent or polyvalent antiserum. These antiserums suffer
from certain inherent drawbacks and do not provide pro-
tection against local tissue damage (Homma and Tu, 1970).
Treatment of snake venom toxicity is greatly enhanced
with a compound, which could overcome the deficiency
of antiserum. A great deal of search has been focused on
traditional medicines. Botanical cure is very well practised
in Indian and Chinese medicine. Several plants recorded
as antidote against venoms in popular use have antidotal
properties due to great number of active compounds they
contain (Duke, 1985; Bernard et al., 2001). Crude extracts
from the root of Aristolochia radix, Gymnema sylvestra,
Sarasparilla hemidesmus indicus and Mimosa puidca
exhibited anti-venom properties (Tsai et al., 1980; Kini and
Gowda, 1982a, 1982b; Alam et al., 1994; Girish et al., 2004a,
2004b). Later the active components aristolochic acid from
Aristolochia radix and Aristolochia indica, and gymnemic
acid from Gymnema sylvestra plants were isolated and
characterized for their anti-venom properties (Vishwanath
et al., 1987; Kini and Gowda, 1982a, 1982b). From the
plant extract of Eclipta prostrata, wedelolactone, sitosterol
and stigmasterol neutralize the myotoxicity, hemorrhagic
and coagulant properties of crotalid venoms (Mors et al.,
1989; Melo et al., 1994). In Indian traditional ayurvedic
medicine apart from plants, animal products are also used.
In Indian folk medicine aqueous extract of peacock feather
is administered orally against snakebite. However detailed
scientific study in these reports are lacking.
The aim of the present study is to examine the effect of var-
ious extracts of peacock feather on the potent venom enzymes
like PLA2 , proteases and hyaluronidase. The inhibitors of
these enzymes can be of greater use in the management of
snakebite victims along with anti-venom therapy.
2. Materials and methods
2.1. Feather collection
Pavo cristatus feather were purchased from ayurvedic
shops in local market, Mysore, India.
2.2. Preparation of extract
Entire Pavo cristatus feather (PCF) without shaft were cut
into fine pieces. Feather pieces, 50 mg were taken in 2.0 ml of
water and different buffer solutions of various molarity and
pH to extract hydrophilic/water-soluble compounds. To ex-
tract hydrophobic/organic compounds, 50 mg feather pieces
were extracted with organic solvents of different polarity. The
samples were vortex-mixed vigorously for 10 min. Similar
extraction was carried out for individually separated coloured
regions of PCF as described in Fig. 1. The extracted sample
was centrifuged at 20,000 × g and the clear supernatant was
used for further in vitro analysis. For in vivo PLA2 induced
hind paw edema, 200 mg of feather was extracted separately
in 2.0 ml of water. The extracted sample was lyophilized and
was re-dissolved in same volume of saline.
2.3. Chemicals
Escherichia coli cells and hyaluronic acid were purchased
from Sigma-Aldrich Company. [14 C] Oleic acid was ob-
tained from Perkin Elmer Life Sciences Inc., USA, fatty
acid free BSA was obtained form PAA Laboratories GmbH,
Austria. Scintillation cocktail were obtained from Packard
Biosciences B.V. The Netherlands. Vipera russelii and Naja
naja snake venoms were purchased from Haffkine Institute,
Mumbai, India. Human pleural fluid (HPF), synovial fluid
(SF) and serum from normal person (NS) were obtained from
Mysore Medical College Hospital, Mysore. Human samples
Fig. 1. Pavo cristatus feather with different coloured regions marked from
1 to 6.
 S.K. Murari et al. / Journal of Ethnopharmacology 99 (2005) 229–237
were collected from patient volunteers according to the guide-
lines mentioned by the institutional ethics committee for
biomedical research and individual signed the informed pa-
tient consent form. Trimeresurus malabaricus snake venom
and Ehrlich ascites fluid (EAF) was obtained from Prof. B.K.
Sharath, Department of Biosciences and Prof. B.P. Salimath,
Department of Biotechnology, University of Mysore, India.
All other reagents and chemicals used were of analytical
grade and all solvents were redistilled before use.
2.4. Animals
Male Swiss Wistar mice weighing 20–22 g obtained form
the Central Animal House Facility, Department of Studies in
Zoology, University of Mysore, Mysore, India. The animal
care and handling were conducted in compliance with the
national regulations for animal research. The animal experi-
ments were carried out after reviewing, the protocols by the
Animal Ethical Committee of the University of Mysore.
2.5. Partial purification of PLA2 from inflammatory
fluids and serum
PLA2 was partially purified from serum and other inflam-
matory fluids according to the previously published method
(Vishwanath et al., 1996). Normal serum and other inflam-
matory fluids were centrifuged at 3000 × g for 10 min. Cen-
trifuged fluids, 5.0 ml was extracted with equal volumes of
0.36N sulphuric acid and kept overnight at 4 ◦ C. The sul-
phuric acid was removed by dialysis (membrane with molec-
ular weight cutoff of 6000–8000 Da) against 10 mM sodium
acetate buffer pH 4.5 at room temperature with minimum
three changes. The dialyzed samples were incubated for 5 min
in boiling water, resulted in the formation of a white precip-
itate. Precipitated sample was centrifuged at 20,000 × g for
30 min. The supernatant was used as a source for PLA2 .
2.6. Estimation of protein
Protein content in PCF extract was measured by the
method (Lowry et al., 1951), using bovine serum albumin
as standard.
2.7. Determination of carbohydrate content by total
sugar estimation
Carbohydrate content in PCF extract was determined by
the phenol–sulphuric acid method (Dubois et al., 1956). Glu-
cose was taken as the standard.
2.8. Estimation of phenolic compounds
Phenolic compounds in PCF extracts were determined by
the colorimetric method described (Swain and Hillis, 1959).
Phenol was used as reference standard.
231
2.9. Determination of secondary metabolites
Secondary metabolites in the PCF water extract were de-
termined qualitatively as described (Vishnoi, 1985). Sec-
ondary metabolites tested are carotenoids, steroids, alkaloids,
flavonoids and triterpenes.
2.10. Estimation of metal ions
Metal ions of PCF water extract were estimated quantita-
tively by using GBC Avanta PM Atomic Absorption Spec-
trophotometer.
2.11. Assay of phospholipase A2 activity
PLA2 activity was assayed with [14 C] oleate-labeled au-
toclaved Escherichia coli cells as substrate according to
the published method (Rothut et al., 1983; Vishwanath et
al., 1993). The reaction mixture, 350 ␮l contained 100 mM
Tris–HCl, pH 8.0; 5.0 mM Ca2+ and 3.15 × 109 autoclaved
Escherichia coli cells (corresponding to 10,000 CPM and
60 nmol of lipid phosphorous). The amount of enzyme pro-
tein concentration was chosen such that 10–15% hydrolysis
of substrate was obtained when incubated at 37 ◦ C for 60 min.
The reaction components were mixed in the following order:
buffer, Ca2+ , water and enzyme source (snake venom, par-
tially purified PLA2 from serum and inflammatory fluids).
The reaction was started by adding labeled Escherichia coli
cells. The reaction was terminated by adding 100 ␮l of 2.0 M
HCl and 100 ␮l of fatty acid free BSA (100 mg/ml). The tubes
were vortex-mixed and centrifuged at 20,000 × g for 5 min.
An aliquot (140 ␮l) of the supernatant containing released
[14 C] oleic acid was mixed with scintillation cocktail and
counted in a Hewlett Packard Liquid Scintillation Analyzer
TRI-CARB 2100 TR.
2.12. Hyaluronidase assay
Hyaluronidase activity was assayed by estimating the
amount of N-acetyl glucosamine (NAGA) released accord-
ing to the method (Reissig et al., 1955). The reaction mixture
300 ␮l contained 200 ␮g of hyaluronan, 0.2 M sodium ac-
etate buffer pH 5.0 containing 0.15 M NaCl and increasing
amounts of PCF water extract pre-incubated for 5 min with
200 ␮g of venom samples were incubated at 37 ◦ C for 90 min.
Activity in the absence of extract was considered 100%.
The change in absorbance was monitored at 585 nm. Ac-
tivity was expressed as millimoles of N-acetyl glucosamine
released/90 min at 37 ◦ C.
2.13. Proteolytic activity
Proteolytic activity was determined according to the
method (Satake et al., 1963) using 2% casein in 0.02 M
Tris–HCl buffer pH 8.5, as substrate for venom and trypsin
and 2% casein in 0.02 M citrate buffer pH 6.0 as substrate
232 S.K. Murari et al. / Journal of Ethnopharmacology 99 (2005) 229–237
for papain. Venom sample (200 ␮g each), trypsin (5 ␮g)
and papain (5 ␮g) were incubated separately with 1 ml of
buffer substrate for 45 min at 37 ◦ C. The unhydrolyzed ca-
sein was precipitated by the addition of 1.5 ml of 0.44 M
trichloroacetic acid. The hydrolyzed casein in the super-
natant (1 ml) was determined using Folinciocalteu’s reagent.
The activity in the absence of extract was considered 100%.
One unit of activity is defined as the amount of enzyme
required to cause an increase in absorbance of 0.01 at
660 nm/min.
2.14. Phospholipase A2 induced hind paw mouse edema
Mouse paw edema was carried out according the method
(Yamakawa et al., 1976). To induce edema six different
PLA2 ’s were used. The PLA2 enzymes were injected s.c.
into the right hind mice paw in 50 ␮l saline (1 ␮g of PLA2
from Naja naja; 1.5 ␮g of PLA2 from Vipera russelii; 1 ␮g
of PLA2 from HPF; 200 ng of PLA2 from HSF; 0.9 ␮g of
PLA2 from EAF; 25 ␮g of PLA2 from serum of normal per-
son) with and without PCF water extract. In all the cases the
left paw received the same volume of saline, which served
as control. After 45 min, mice were sacrificed by cervical
dislocation and both legs were removed at ankle joints and
weighed individually. The increase in weight due to edema
was calculated as the edema ratio, which equals the weight
of edematous leg × 100/weight of the normal leg. Minimum
edema dose is defined as the microgram of protein causing
an edema ratio of 120%. Edema ratio is calculated as defined
above.
2.15. Statistical analysis
All the experiments were repeated for five independent
observations. Data are presented as mean ± S.D. Statisti-
cal significance of the data was determined by Student’s
t-test.
3. Results
3.1. PCF extractions
To extract both polar and non-polar compounds separately
from Pavo cristatus feather, it was subjected to extraction
with different solutions. For polar compounds feather was
extracted with water and different buffers of varying pH, hav-
ing different molarity. For non-polar compounds feather was
extracted with organic solvents of different polarity. Both the
extracted samples appeared light yellowish in colour indi-
cating the extraction of some coloured pigments from the
feather. Since the feather is brightly coloured in specific
regions, different distinct coloured regions marked as 1–6
as shown in Fig. 1 were extracted with acetone and wa-
ter. Various PCF extracted samples were checked for PLA2
inhibition.
3.2. Inhibition of Vipera russelii PLA2 activity by PCF
extract
Inhibitions of Vipera russelii PLA2 enzyme activity by
PCF extracted in water and various buffers are shown in
Fig. 2. Maximum inhibition of >40% was observed with wa-
ter extract. Tris–HCl buffer 0.2 M at different pH value exhib-
ited PLA2 inhibition. However, the inhibition was 13–45%.
Buffers with extreme pH values like pH 2.0 of 0.2 M HCl/KCl
and pH 9.0 of 1.0 M Tris base exhibits >40% inhibition. Phos-
phate buffer and citrate buffer (0.1 M) at different pH values
did not show any PLA2 inhibition. Citrate and phosphate
buffers failed to extract any PLA2 inhibitor compounds from
peacock feather or the extracted material is unstable in these
salt solutions.
Following aqueous extractions, PCF were extracted in
different polar, non-polar and mixture of organic solvents.
The inhibitions of Vipera russelii snake venom PLA2 from
these PCF extracts of organic solvents are shown in Fig. 3.
Doles mixture, methanol and acetone extracts exhibited
>70% inhibition. The extracts of chloroform, heptane and
hexane showed least inhibition of 1.2, 10 and 21%, respec-
tively. These data suggest that the inhibitory compounds are
hydrophilic in nature and easily extractable in aqueous or
polar solvents and not in non-polar solvents. Good PLA2
inhibition was observed with water and acetone extract of
PCF. Using these solvent systems, the different brightly
coloured regions as marked in Fig. 1 was separately extracted
and tested for Vipera russelii venom PLA2 inhibition. Only
Fig. 2. Inhibition of Vipera russelii venom PLA2 enzyme activity by peacock
feather extracted with different buffers: (1) water; (2) 0.2 M HCl/KCl pH 2;
(3) 0.2 M Tris–HCl pH 7.2; (4) 0.2 M Tris–HCl pH 8; (5) 0.2 M Tris–glycine
pH 8.1; (6) 2 M glycine–NaOH pH 10.1; (7) 0.1 M Tris pH 7.4; (8) 1 M Tris
pH 9.
 S.K. Murari et al. / Journal of Ethnopharmacology 99 (2005) 229–237
Fig. 3. Inhibition of Vipera russelii venom PLA2 enzyme activity
by PCF extracted with different organic solvents: (1) doles mixture
[isopropanol:petroleum ether:1N H2 SO4 = 40:10:1]; (2) chloroform; (3)
methanol; (4) alcohol; (5) hexane; (6) acetone; (7) heptane; (8) chlo-
form:methanol [2:1]; (9) methanol:acetic acid [99:1].
the coloured region 5 showed 40 and 50% inhibition with the
extraction of acetone and water, respectively. Other regions
did not show any PLA2 inhibition. Further characterization
of feather inhibitor from region 5 was carried out in
water-extracted samples.
3.3. Biochemical characterization of PCF water extract
In PCF water extract, carbohydrate and phenolic com-
pounds were absent and the major macromolecule detected
was protein. In the extracted sample the protein concentration
was 400 ␮g/ml. PCF water extract was tested for several sec-
ondary metabolites. The extract showed positive results for
the presence of carotenoids and steroids and other metabo-
lites like alkaloids, flavonoids and triterpenes were absent.
3.4. Detection of metal ions in the PCF water extract
Since the feather colour has metallic texture, the water-
extracted sample was subjected to detection of various metal
ions. Six metal ions are detected in the PCF extract and
their concentration are given in Table 1. The major metal ion
present is iron, which is more than 20 times higher than the
next major ion, which is copper. The least detected amount
of ion is gold.
3.5. In vitro inhibition of PLA2 activity
The PLA2 inhibitory effect of PCF water extract was
checked with different PLA2 enzymes from Vipera russelii,
233
Table 1
Qualitative analysis of PCEF aqueous extract for the metal ions
Metal ions mg/l
Iron 10.6
Copper 0.44
Chromium 0.367
Zinc 0.22
Nickel 0.15
Gold 0.002
Naja naja and Trimeresurus malabaricus snake venoms, in-
flammatory fluids like pleural fluid and Ehrlich ascites fluid
and acid extracted serum samples (Fig. 4). The water extract
of PCF inhibited all PLA2 enzymes in a dose-dependent man-
ner. The least inhibited PLA2 enzyme was that of Naja naja
snake venom (55% inhibition at 100 ␮l of PCF water extract).
All other snake venom, inflammatory fluids and serum PLA2
enzymes are inhibited >80% at 100 ␮l of PCF water extract.
These data clearly suggest that the water extract contained
a PLA2 inhibitor that is more sensitive in inhibiting inflam-
matory and serum PLA2 enzyme than snake venom PLA2
enzyme.
Since the feather extract gave positive results for the pres-
ence of macromolecules like proteins and small molecules
like steroids, carotenoids and several metal ions the nature of
inhibitory compounds was checked using several parameters.
The feather extract was subjected to extensive dialysis, am-
monium sulphate precipitation, acid hydrolysis and boiling.
The inhibitory compound loses its activity on heating and
on acid hydrolysis. Since the activity retained after dialysis
indicated that the inhibitory molecule is a macromolecule
or an aggregation product of micromolecules. On 100%
Fig. 4. Inhibition of different snake venom PLA2 and inflammatory PLA2
by PCF water extract: (
) Vipera russelii; () Naja naja; () Trimeresurus
malabaricus; (×) synovial fluid; () asites fluid; () normal serum. Values
are mean ± S.D. of five independent determinations.
234 S.K. Murari et al. / Journal of Ethnopharmacology 99 (2005) 229–237

ammonium sulphate precipitation the inhibitory activity of

the extract was retained in the supernatant and not in the
precipitate fraction. This data ensures that the inhibitory
molecule is not protein in nature. The role of metal ions and
other small molecules has to be established clearly.

3.6. In vitro inhibition of hyaluronidase activity

The other key enzyme involved in local tissue damage and

inflammation is hyaluronidase enzyme. The PCF water ex-
tract was checked for its inhibitory effect on hyaluronidase
enzyme. Fig. 5 shows the effect of PCF water extract on
Naja naja and Vipera russelii venom hyaluronidase enzyme
activity. PCF water extract inhibits the hyaluronidase enzyme
activity of both the venom in a dose-dependent manner. Com-
pared to Naja naja venom, Vipera russelii venom exhibited
highest hyaluronidase activity. Hyaluronidase enzyme activ-
ity was completely inhibited by PCF water extract at above
125 ␮l concentration. The inhibition is more for Naja naja
hyaluronidase enzyme, than Vipera russelii hyaluronidase ac- Fig. 5. Inhibition of Naja naja and Vipera russelii hyaluronidase by PCF
water extract. Values are mean ± S.D. of five independent determinations:
tivity.
() Naja naja; (
) Vipera russelii.

3.7. In vitro inhibition of proteolytic enzyme activity

Snake venom proteases are involved in hemorrhage and
tissue necrosis. The PCF water extract on proteolytic activity
of Naja naja, Vipera russelii and Trimeresurus malabaricus
venom was studied (Fig. 6A). Trimeresurus malabaricus
venom showed very high (>10-fold) proteolytic activity
compared to Naja naja and Vipera russelii venom. PCF
water extract inhibited proteolytic enzyme activity of all
the venom in a dose-dependent manner. With all the above
venom the inhibition was more than 55%.
Snake venoms are rich in serine protease and metallopro-
teases (Faiz et al., 1996). Proteases from plant latex known
to induce hemorrhage in mice are rich in cysteine protease
(Barrett, 1986). The effect of PCF water extract on trypsin
(serine protease) and on papain (cysteine protease) was stud-
ied (Fig. 6B). PCF water extract inhibits both proteases in a
dose-dependent manner. The inhibition with serine proteases
is one-fold higher compared to cysteine protease, indicating
that the PCF water extract more specifically inhibits serine
protease.

Fig. 6. (A) Inhibition of different snake venom protease by PCF water extract. Values are mean ± S.D. of five independent determinations: (
) Trimeresurus
malabaricus; () Naja naja; () Vipera russelii. (B) Inhibition of trypsin and papain by PCF water extract. Values are mean ± S.D. of five independent
determinations: (
) papain; () trypsin.
 S.K. Murari et al. / Journal of Ethnopharmacology 99 (2005) 229–237
Fig. 7. Effect of PCF water extract on PLA2 induced paw edema. Different
volumes of PCF water extract was mixed with different PLA2 enzyme in a
mixture of 50 ␮l saline and injected into the mouse footpad. Values of edema
ratio are expressed as mean ± S.D. (n = 6), P values < 0.01 were considered
significant when compared to the control by Student’s t-test: () Naja naja;
() Vipera russelii; () synovial fluid; (×) ascites fluid; () pleural fluid;
(䊉) normal serum.
3.8. Neutralization of PLA2 induced hind paw mice
edema
It is very well established that injection of PLA2 into the
mouse footpad induces edema. All these PLA2 tested from
serum, inflammatory fluids and snake venom induce edema
when injected into the mouse footpad. Snake venom PLA2
(Naja naja and Vipera russelii) induces maximum edema of
180%. On the other hand serum induces inflammation up to
140%. The PCF water extract on administration with these
PLA2 enzymes neutralizes the edema inducing activity. The
neutralization by PCF water extract is dose-dependent and
neutralized completely the edema activity of all the enzymes
studied (Fig. 7).
4. Discussion
In snakes production and release of venom is an evolution-
ary adaptation primarily to immobilize the prey and secondar-
ily to defense and to support digestion. To bring about these
effects each species have unique venom composition with
different amounts of hydrolytic enzymes and specific sys-
temic toxins (Chippaux et al., 1991; Sasa, 1999). Because of
this complex mixture venom toxicity is a multiple poisoning
due to the combined action of hydrolytic enzymes and spe-
cific toxins and become a medical emergency (Ohsaka, 1979).
The common hydrolytic enzymes found in most venom are
proteolytic enzymes, phospholipases and hyaluronidases and
235
are responsible for local tissue damage (Shashidharamurthy
et al., 2002; Jagadeesha et al., 2002). The lethality of sys-
temic toxins depends upon the amount and also on the rate
at which these toxins diffuse into the systemic circulation for
transport to their sites of action (Girish et al., 2004a, 2004b).
An early neutralization of local tissue damage is a prerequi-
site in the better management of snakebite. In this direction
several inhibitors were checked for these hydrolytic enzymes.
Indian peafowl feathers are used against snakebite
(Samudralwar and Garg, 1996) and are valued in ayurvedic
medicine as Mayur chandrika bhasma (ML No ND/AYU/4;
Vaidhya, 1946; Lakshmipatishastri, 1973) and used as anti-
emetic, anti-spasmodic, relieves hiccough, asthma, vomiting
and various other problems associated with lungs (Bhandari,
1925; Yadav, 1980). The extraordinary variety and brilliance
of feather colour is due to its pigments. The feathers of
a hooded Pitohui bird, Pitohui dichrous contained a toxic
steroidal alkaloid homobatrachotoxin that function as a de-
fensive chemical (Dumbacher et al., 1992). This purified
toxin caused numbness, burning and sneezing on contact with
human buccal and nasal tissue and highly toxic when injected
into mice. These observations suggest that the bird feathers
contain many more chemical substances that have different
function apart from giving plumage patterns.
In this study it has been found out that peacock feather
contained several bioactive components, which are poten-
tially active against snake venom enzymes involved in local
tissue damage. Though alkaloid was detected in the feathers
of a hooded Pitohui bird, peacock feather did not show the
presence of any alkaloids. On the other hand it showed pos-
itive results for secondary metabolites such as carotenoids
and steroids. The characterization of these carotenoids and
steroids in this peacock feather for their inhibitory activity
has to be established. Apart from secondary metabolites sev-
eral metal ions like iron, copper, nickel, zinc and gold are
detected in the PCF extract. Similar observations were made
in the ash sample of peacock feather (Samudralwar and Garg,
1996). Since the dialyzed sample of PCF extract retained the
inhibitory activity against PLA2 enzyme these ions have no
role in inhibiting the enzyme activity.
The PCF extract apart from snake venom PLA2 also
inhibits PLA2 from inflammatory fluids like pleural fluid,
Ehrlich ascites fluid and acid extracted serum samples. This
extract preferentially inhibits the inflammatory PLA2 as
compared to snake venom PLA2 . The current data clearly in-
dicates the therapeutic importance of this molecule as an anti-
inflammatory compound. Many powerful anti-inflammatory
drugs like salicylates, indomethacin, and drugs, which
suppresses allergic reaction like disodium cromoglycate
inhibits the hyaluronidase enzyme activity (Guerra, 1946;
Szary et al., 1975; Yingprasertchai et al., 2003). In ethno-
pharmacology several traditional compounds used against
snakebite and to promote wound healing were subsequently
demonstrated to possess anti-hyaluronidase activity. These
include flavonoids, tannins, curcumins, cinnamic acid and
glycyrrhizin from licorice (Kuppusamy and Das, 1991;
236 S.K. Murari et al. / Journal of Ethnopharmacology 99 (2005) 229–237
Fluruya et al., 1997). In folk medicine the same plant extract
are also used as anti-inflammatory drugs suggesting that
many anti-inflammatory drugs inhibits both PLA2 enzyme
and hyaluronidase activity. Similarly the PCF water extract
inhibits both inflammatory PLA2 activity and hyaluronidase
enzyme activity indicating its usefulness in regulating the lo-
cal tissue damage. Another beneficial factor with PCF water
extract is its preferential inhibition of serine proteases over
cysteine proteases, which are the major proteases of all snake
venoms responsible for local tissue necrosis. Co-injection
of PCF water extract with all the six PLA2 enzymes studied
completely neutralizes the edema inducing activity in a dose-
dependent manner. The concomitant inhibition of in vitro
PLA2 activity and in vivo edema inducing activity suggests
that PCF water extract has a powerful anti-inflammatory
compound, which has greater therapeutic application. Since
this PCF water extract also inhibits hyaluronidase enzyme
and proteolytic enzyme, its usefulness in treating snakebite
victims becomes more relevant. It has been pointed out that
even if no complete neutralization of the venom occurred
the time of death was often increased. In areas where
no antiserum treatment is available or even possible these
antidotes could play an important role by effectively bridging
the time until qualified support is available.
5. Conclusion
The results from this preliminary study are first of a kind
reported from Pavo cristatus feather, which has neutralizing
compounds against snake venom enzymes responsible for lo-
cal tissue necrosis. Present studies create ways in developing
new anti-snake venom preparations, which are useful in the
management of snakebite.
Acknowledgements
We wish to extend our gratitude to Department of Sci-
ence and Technology, Government of India (Grant No.
SP/SO/B21/2000) for supporting this research and grateful
to the faculties at Government Ayurvedic Hospital, Mysore.
SKM thank Council of Scientific and Industrial Research,
Government of India for Senior Research Fellowship.
References
Alam, M.I., Auddy, B., Gomes, A., 1994. Isolation, purification and partial
characterization of viper venom inhibiting factor from the root extract
of the Indian medicinal plant sarsaparilla (Hemidesmus indicus R Br.).
Toxicon 32, 1551–1557.
Anai, K., Sugiki, M., Yoshida, E., Maruyama, M., 2002. Neutralization of
a snake venom haemorrhagic metalloproteinase prevents coagulopa-
thy after subcutaneous injection of Bothrops jararaca venom in rats.
Toxicon 40, 63–68.
Barrett, A.J., 1986. The cystatins: a diverse superfamily of cysteine pep-
tidase inhibitors. Biomedica Biochimica Acta 45, 1363–1374.
Bernard, P., Scior, T., Didier, B., Hibert, B., Hibert, M., Berthon, J.Y.,
2001. Ethnopharmacology and bioinformatic combination for leads
discovery: application to phospholipase A2 inhibitors. Phytochemistry
58, 865–874.
Bhandari, C.R., 1925. Vanoshadhi Chandrodaya. The Time Table Press,
Banaras, India, p. 1666.
Bomalaski, J.S., Clark, M.A., 1993. Phospholipase A2 and arthritis.
Arthritis and Rheumatism 36, 190–198.
Chippaux, J.P., Williams, White, J., 1991. Snake venom variability: meth-
ods of study results and interpretations. Toxicon 29, 1279–1303.
Dubois, M., Gillies, K.A., Hamilton, J.K., Rebers, P.A., Smith, F., 1956.
Colorimetric method for determination of sugars and related sub-
stances. Analytical Chemistry 28, 350–356.
Duke, J.A., 1985. Hand Book of Medicinal Herbs. CRC Press, Boca
Raton, USA, p. 120.
Dumbacher, J.P., Beehler, B.M., Spande, T.F., Garraffo, H.M., Daly, J.W.,
1992. Homobatrachotoxin in the genus Pitohui: chemical defense in
birds? Science 258, 799–801.
Escalante, T., Franceschi, A., Rucavado, A., Gutierrez, J.M., 2000. Ef-
fectiveness of Batimastat: a synthetic inhibitor of matrix metallo-
proteinases, in neutralizing local tissue damage induced by BaP1:
a hemorrahagic metalloproteinase from the venom of the snake Both-
rops asper. Biochemical Pharmacology 60, 269–274.
Estevao-Costa, M.I., Diniz, C.R., Magalhaes, A., Markland, F.S., Sanchez,
E.F., 2000. Action of metalloproteinases mytalysin I and II on several
components of the hemostatic and fibrinolytic systems. Thrombosis
Research 99, 363–376.
Faiz, M.A., Falkous, G., Harris, J.B., Mantle, D., 1996. Comparison of
protease and related enzyme activities in snake venoms. Comparative
Biochemistry and Physiology, Part B: Biochemistry and Molecular
Biology 1138, 199–204.
Fluruya, T., Yamagata, S., Shimoyama, Y., Fujihara, M., Morishima, N.,
Ohtsuki, K., 1997. Biochemical characterization of glycyrrhizin as an
effective inhibitor for hyaluronidases from bovine testis. Biological
and Pharmaceutical Bulletin 20, 973–977.
Girish, K.S., Mohanakumari, H.P., Nagaraju, S., Vishwanath, B.S., Kem-
paraju, K., 2004a. Hyaluronidase and protease activity from Indian
snake venoms: neutralization by Mimosa pudica root extract. Fitoter-
apia 75, 378–380.
Girish, K.S., Shashidharamurthy, R., Nagaraju, S., Gowda, T.V., Kem-
paraju, K., 2004b. Isolation and characterization of hyaluronidase a
“Spreading factor” from Indian cobra (Naja naja) venom. Biochimie
86, 193–202.
Glaser, K.B., Mobilio, D., Chang, J.Y., Senko, N., 1993. Phospholipases
A2 enzymes: regulation and inhibition. Trends in Pharmacological
Sciences 14, 92–98.
Guerra, F., 1946. Hyaluronidase inhibition by sodium salicylate in
rheumatic fever. Science 103, 686–687.
Homma, M., Tu, A.T., 1970. Antivenin for the treatment of local tissue
damage due to envenomation by southeast Asian snakes. The Amer-
ican Journal of Tropical Medicine and Hygiene 19, 880–884.
Jagadeesha, D.K., Shashidharamurthy, R., Girish, K.S., Kemparaju, K.,
2002. A non-toxic anticoagulant metalloprotease: purification and
characterization from Indian cobra (Naja naja naja) venom. Toxicon
40, 667–675.
Kini, R.M., 1997. Venom Phospholipase A2 Enzymes: Structure, Function
and Mechanism. Wiley, New York, p. 134.
Kini, R.M., Gowda, T.V., 1982a. Studies on snake venom enzymes. Part I.
Purification of ATPase, a toxic component of Naja naja venom and its
inhibition by potassium gymnemate. Indian Journal of Biochemistry
and Biophysics 19, 152–157.
Kini, R.M., Gowda, T.V., 1982b. Studies on snake venom enzymes. Part
II. Partial characterization of ATPase from Russell’s viper (Vipera rus-
selli) venom and their interaction with potassium gymnemate. Indian
Journal of Biochemistry and Biophysics 19, 342–347.
 S.K. Murari et al. / Journal of Ethnopharmacology 99 (2005) 229–237
Kuppusamy, U.R., Das, N.P., 1991. Inhibitory effects of flavonoids on
several venom hyaluronidases. Experientia 47, 1196–2000.
Lakshmipatishastri, S.V., 1973. Yogarattanakara. In: Brama-
hashankarashastri, B.S. (Ed.), Vidhyotani Hindi Commentary
Charadi Chikitsa. Choukambha Samskrita Series Office, Varanasi,
India, pp. 453–457.
Lowry, O.H., Rosebrough, N.J., Farr, A.L., Randall, R.J., 1951. Protein
measurement with the Folin Phenol reagent. The Journal of Biological
Chemistry 193, 265–275.
Melo, P.A., Nascimento, M.C., Mors, W.B., Suarez-Kurtz, G., 1994. Inhi-
bition of the myotoxic and hemorrhagic activities of crotalid venoms
by Eclipta prostrata (Asteraceae) extracts and constituents. Toxicon
32, 595–603.
ML No ND/AYU/4 (AYU.MED), SHREE Baidyanath Ayurved Bhavan
Ltd., Great Nag Road, Nagpur, India.
Mors, W.B., Nascimento, M.C., Parente, J.P., Silva, M.H., Melo, P.A.,
Juarez-Kurtz, G., 1989. Neutralization of lethal and Myotorattlesnake
venom by extracts and constituents of the plant Eclipta prostrata
(Asteraceae). Toxicon 27, 1003–1009.
Ohsaka, A., 1979. Hemorrhagic, necrotizing and edema forming effects
of snake venoms. In: Lee, C.Y. (Ed.), Snake Venoms. Handbook for
Experimental Pharmacology. Springer-Verlag, Berlin, pp. 52–77.
Paul, V.K., 1993. Animal and insect bites. In: Singh, M. (Ed.), Medical
Emergencies in Children, 2nd ed. Sagar Publications, New Delhi,
India, pp. 20–80.
Reissig, J.L., Stominger, J.L., Leloir, L.F., 1955. A modified colorimetric
method for the estimation of N-acetylamino sugars. The Journal of
Biological Chemistry 217, 959–969.
Rosenberg, P., 1997. Pitfalls to avoid in the study of correlations between
enzymatic activity and pharmacological properties of phospholipase
A2 enzyme. In: Kini, R.M. (Ed.), Venom Phospholipase A2 Enzymes:
Structure, Function and Mechanism. Wiley, UK, pp. 155–184.
Rothut, B., Russo-Marie, F., Wood, J., Di Rosa, M., Flower, R.J., 1983.
Further characterization of the glucocorticoid induced antiphosphli-
pase protein ‘Renocortin’. Biochemical and Biophysical Research
Communications 117, 878–884.
Samudralwar, D.L., Garg, A.N., 1996. Minor and trace elemental de-
termination in the Indian herbal and other medicinal preparations.
Biological Trace Element Research 54, 113–121.
Sasa, M., 1999. Diet and snake venom evolution: can local selection alone
explain intraspecific venom variation? Toxicon 37, 249–252.
Satake, M., Murata, Y., Suzuki, T., 1963. Studies on snake venom XIII.
Chromatographic separation and properties of three proteinases from
Agkistrodon halys blomhoffii venom. Journal of Biochemistry (Tokyo)
53, 438–447.
Shashidharamurthy, R., Jagadeesha, D.K., Girish, K.S., Kemparaju, K.,
2002. Variations in biochemical and pharmacological properties of
Indian cobra (Naja naja naja) venom due to geographical distribution.
Molecular and Cellular Biochemistry 229, 93–101.
Swain, T., Hillis, W.E., 1959. The phenolic constituents of Prunus do-
mestica. I. The quantitative analysis of phenolic constituents. Journal
of the Science of Food and Agriculture 10, 63–67.
237
Szary, A., Kowalczyk-Bronisz, S.H., Gieldanowski, J., 1975. In-
domethacin as inhibitor of hyaluronidase. Archivum Immunologiae
et Therapiae Experimentalis (Warsz) 23, 131–134.
Tsai, L.H., Yang, L.L., Chang, C., 1980. Inactivation of Formosan snake
venoms in vivo by aristolochic acid, the chemical component of
Aristolochia radix. Journal of the Formosan Medical Association 74,
352–358.
Vaidhya, Y.T.A., 1946. Vamanaadhikara. Sri Baidyanath Ay. Bhavan,
Kolkata, India, p.51.
Vishnoi, N.K., 1985. Advanced Practical Organic Chemistry. Vikas Pub-
lishing, India, p. 36.
Vishwanath, B.S., Kini, R.M., Gowda, T.V., 1987. Characterization
of three edema inducing phospholipase A2 enzymes from Habu
(Trimeresurus flavoviridis) venom and their interaction with the al-
kaloid aristolochic acid. Toxicon 25, 501–515.
Vishwanath, B.S., Fawzy, A.A., Franson, R.C., 1988. Edema induc-
ing activity of phospholipase A2 purified from human synovial
fluid and inhibition by aristolochic acid. Inflammation 12, 549–
561.
Vishwanath, B.S., Frey, F.J., Bradbury, M.J., Dallman, M.F., Frey,
B.M., 1993. Glucocorticoid deficiency increases phospholipase A2
activity in rats. The Journal of Clinical Investigation 92, 1974–
1980.
Vishwanath, B.S., Fux, C.A., Uehlinger, D.E., Frey, B.M., Franson, R.C.,
Frey, F.J., 1996. Haemodialysis activates phospholipase A2 enzyme.
Nephrology Dialysis Transplantation 11, 109–116.
Warrell, D.A., 1996. Venoms, toxins and poisons of animals and
plants. In: Wealtherall, D.J., Ledingham, J.G.G., Warrell, D.S. (Eds.),
Textbook of Medicine. Oxford University Press, Oxford, pp. 130–
148.
Weinstein, S.A., Schmidt, J.J., Bernheimer, A.W., Smith, L.A., 1991.
Characterization and amino acid sequences of two lethal peptides iso-
lated from venom of Wagler’s pit viper, Trimeresurus wagleri. Toxicon
29, 227–236.
Yadav, A.V., 1980. Dravyaguana Part I and II. Baidyanath Publications,
Calcutta, India, p. 794.
Yamakawa, M., Nozaki, M., Hokama, Z., 1976. Fractionation of
sakishima–habu (Trimeresurus elegans) venom and lethal hemorrhagic
and edema forming activity of the fractions. In: Ohsaka, A., Hayashi,
K., Sawai, Y. (Eds.), Animal, Plant and Microbial Toxins, vol. 1.
Plenum Press, New York, p. 97.
Yingprasertchai, S., Bunyasrisawt, S., Ratanabanangkoon, K., 2003.
Hyaluronidase inhibitors (sodium cromoglycate and sodium auro-
thiomalate) reduce the local tissue damage and prolong the survival
time of mice injected with Naja kaouthia and Calloselasma rhodos-
toma venoms. Toxicon 42, 635–646.
Further reading
Markland, F.S., 1997. Snake venoms. Drugs 54, 1–10.
 Journal of Ethnopharmacology 99 (2005) 239–244

Punica granatum flower extract, a potent ␣-glucosidase inhibitor,

improves postprandial hyperglycemia in Zucker diabetic fatty rats
Yuhao Li a,∗ , Suping Wen b , Bhavani Prasad Kota a , Gang Peng a , George Qian Li a ,
Johji Yamahara c , Basil D. Roufogalis a
a Herbal Medicines Research and Education Centre, Faculty of Pharmacy, A15, The University of Sydney, Sydney, NSW 2006, Australia
b Department of Health Sciences, University of Technology, Sydney, Australia
c Pharmafood Institute, Kyoto, Japan

Received 2 November 2004; received in revised form 12 January 2005; accepted 12 February 2005
Available online 9 April 2005

Abstract

Postprandial hyperglycemia plays an important role in the development of type 2 diabetes and has been proposed as an independent risk
factor for cardiovascular diseases. The flowering part of Punica granatum Linn. (Punicaceae) (PGF) has been recommended in Unani literature
as a remedy for diabetes. We investigated the effect and action mechanism of a methanolic extract from PGF on hyperglycemia in vivo and
in vitro. Oral administration of PGF extract markedly lowered plasma glucose levels in non-fasted Zucker diabetic fatty rats (a genetic model
of obesity and type 2 diabetes), whereas it had little effect in the fasted animals, suggesting it affected postprandial hyperglycemia in type 2
diabetes. In support of this conclusion the extract was found to markedly inhibit the increase of plasma glucose levels after sucrose loading,
but not after glucose loading in mice, and it had no effect on glucose levels in normal mice. In vitro, PGF extract demonstrated a potent
inhibitory effect on ␣-glucosidase activity (IC50 : 1.8 ␮g/ml). The inhibition is dependent on the concentration of enzyme and substrate, as
well as on the length of pretreatment with the enzyme. These findings strongly suggest that PGF extract improves postprandial hyperglycemia
in type 2 diabetes and obesity, at least in part, by inhibiting intestinal ␣-glucosidase activity.
© 2005 Elsevier Ireland Ltd. All rights reserved.

Keywords: Punica granatum; Postprandial hyperglycemia; ␣-Glucosidase; Diabetes; Zucker diabetic fatty rats

1. Introduction tributing factors to the development of atherosclerosis, even

At the present time it is estimated that 150 million people
worldwide have diabetes and that this will increase to 220
million by 2010 and 300 million by 2025. Globally, the per-
centage of type 2 diabetes (non insulin-dependent diabetes
mellitus) is greater than 90% (Zimmet et al., 2001). Patients
with diabetes have an increased risk of cardiovascular disease
(CVD). Recently, much attention has been paid to evidence
that abnormalities of the postprandial state are important con-
Abbreviations: FPG, fasting plasma glucose; PG, Punica granatum;
PGF, Punica granatum flowers; ZL, Zucker lean; ZDF, Zucker diabetic fatty;
CVD, cardiovascular disease
∗ Corresponding author. Tel.: +61 2 9351 8585; fax: +61 2 9351 8638.
E-mail address: yuhao@pharm.usyd.edu.au (Y. Li).
in diabetes mellitus (Ceriello, 2000). Postprandial hyper-
glycemia plays an important role in the development of type
2 diabetes mellitus and complications associated with the
disease, such as micro- and macro-vascular diseases (Baron,
1998), and has been proposed as an independent risk factor
for CVD (Ceriello, 1998). Therefore, control of postprandial
hyperglycemia is suggested to be important in the treatment
of diabetes and prevention of cardiovascular complications.
Punica granatum Linn. (PG), commonly known as
pomegranate, is a small tree, belonging to the Punicaceae
family. Pomegranate is grown mainly in Iran, India and
the USA, but also in most Near and Far East countries.
Pomegranate juice and wine have become increasingly pop-
ular because of the attribution to the plant of important bio-
logical actions (Schubert et al., 1999), including antioxidant

0378-8741/$ – see front matter © 2005 Elsevier Ireland Ltd. All rights reserved.
doi:10.1016/j.jep.2005.02.030
240 Y. Li et al. / Journal of Ethnopharmacology 99 (2005) 239–244
activity and cardiovascular protection (Aviram et al., 2002).
In Ayurvedic medicine almost all parts of PG are used for
the treatment of numerous disorders. Only PG flowering part
(PGF), however, has been recommended in Unani literature
as a remedy for diabetes (Jurjani, 1878; Majoosi, 1889). It
has been reported that the aqueous-ethanolic extract of the
flowers led to a blood glucose lowering effect in rats (Jafri
et al., 2000). However, the action mechanism of the PGF
remains unknown. Furthermore, PGF has not been investi-
gated in type 2 diabetic animals. Zucker diabetic fatty (ZDF)
rats have been frequently used as a genetic model for obesity
and type 2 diabetes (Kasiske et al., 1992; Alemzadeh and
Tushaus, 2004; Tikellis et al., 2004). In the present study, we
have investigated the effects of methanolic extract from PGF
on hyperglycemia and also clarified its mechanism of action
through studies in ZDF rats and enzyme inhibition in vitro.
2. Materials and methods
2.1. Animals
All experimental procedures were carried out in accor-
dance with the Guiding Principles for the Care and Use of
Laboratory Animals approved by the Animal Ethics Com-
mittee of the University of Sydney, Australia. Male ZDF
and Zucker lean (ZL) rats, aged 13–14 weeks were obtained
from Monash University Animal Services, Vic., Australia.
Male ddY mice were purchased from Kiwa Laboratory An-
imals (Wakayama, Japan). Animals were housed in an air-
conditioned room at 23 ± 1 ◦ C with a 12 h light/dark cycle
and were provided with standard food and water ad libitum.
Animals were allowed free access to diet and water for 1
week before starting the experiments.
2.2. Drugs and reagents
␣-Glucosidase (EC 3.2.1.20) was purchased from
Sigma–Aldrich Chemical Co. (St. Louis, MO, USA).
Acarbose (Glucobay, Bayer, Leverkusen, Germany) was
purchased from a pharmacy in Japan. A kit for glucose
determination was purchased from Wako Pure Chemical
Industry (Osaka, Japan).
2.3. Preparation of extract
PGF was collected in June, 2002 in Maharashtra, India,
and identified. A voucher specimen was deposited at the
herbarium of the Herbal Medicines Research and Education
Centre, Faculty of Pharmacy, the University of Sydney, Aus-
tralia. Air-dried and ground PGF (1 kg) were extracted at
room temperature three times with 5 vol of methanol (w/v).
The solvent was evaporated under reduced pressure below
50 ◦ C to give a methanolic extract (yield: 40%). The hot wa-
ter extract of Salacia oblonga root was prepared as previously
described (Li et al., 2004).
2.4. Bioassay
2.4.1. Effects on plasma glucose level in ZDF rats
Test sample (suspended in 5% acacia) and vehicle were
orally given by a gavage once daily for 2 weeks. Animals
were weighed once every 3–4 days for regulating the volume
of the test sample. Plasma glucose levels were determined by
the glucose oxidase method before (week 0) and 1 h after last
administration of test sample and vehicle (week 2) under non-
fasted and fasted (20 h) conditions. Blood was taken from the
orbital sinus under halothane anesthesia.
2.4.2. Effects on plasma glucose level in sucrose- and
glucose-loaded mice
Test samples and vehicle were given orally to mice fasted
for 20 h. Sixty minutes later, sucrose (1 g/kg in distilled wa-
ter), glucose (0.5 g/kg in distilled water) or water was admin-
istered orally. Plasma glucose levels were determined 30 min
after administration of sucrose, glucose or water (see figure
legends for details).
2.4.3. Effect on ␣-glucosidase activity in vitro
Experiment was carried out by the method previously de-
scribed (Li et al., 2004). Briefly, 200 ␮l of ␣-glucosidase solu-
tion (0.6 U/ml) was pre-incubated with 200 ␮l of test sample
(dissolved in DMSO, DMSO final concentration: 2%) or ve-
hicle for 5 min. The reaction was started by adding 200 ␮l
of 37 mM sucrose and terminated after 30 min incubation at
37 ◦ C by heating at 90–100 ◦ C. The formation of glucose was
determined. Inhibition rates were calculated as a percent of
blank controls, and the IC50 value was defined as the concen-
tration required to inhibit 50% of the ␣-glucosidase activity
under the assay conditions specified.
To better understand the effect of PGF, several experi-
ments were undertaken at different concentrations of enzyme
(␣-glucosidase: 0.3, 0.6, 1.5, 3 and 6 U/ml) and substrate (su-
crose: 7.5, 15, 30, 60 and 120 mM), and at different pretreat-
ment times (0, 5, 30, 60 and 120 min).
2.5. Statistics
All results are expressed as mean ± S.E.M. Data were an-
alyzed by one-factor ANOVA. If a statistically significant
effect was found, the Newman–Keuls test was performed to
isolate the difference between the groups. Values of P < 0.05
were considered statistically significant.
3. Results
3.1. PGF extract markedly lowers plasma glucose level
in non-fasted ZDF rats, but has little effect in fasted ZDF
rats
As shown in Fig. 1a and b, ZDF rats showed a significantly
higher glucose level than ZL rats under the fasted condition,
 Y. Li et al. / Journal of Ethnopharmacology 99 (2005) 239–244
Fig. 1. Effect of Punica granatum flower (PGF) extract on plasma glucose
levels. PGF has little effect in fasted Zucker diabetic fatty (ZDF) rats after 2
weeks of treatment (a), whereas it lowers plasma glucose levels in non-fasted
ZDF rats in the same time period (b). PGF extract (500 mg/kg, suspended
in 5% acacia) or vehicle was administered by oral gavage once daily for
2 weeks. Plasma glucose levels were determined by the glucose oxidase
method before (week 0) and 1 h after the last administration of test sample
and vehicle (week 2) under non-fasted (normal access to food and water) and
fasted (for 20 h) conditions. All values are mean ± S.E.M. (n = 5). * P < 0.05.
ZL, Zucker lean rats.
and the level was much higher in non-fasted than in the
fasted condition. PGF extract reduced plasma glucose levels
by 43.1% under non-fasted conditions, whereas it showed
little effect under fasted conditions.
3.2. PGF extract inhibits increase of glucose level in
sucrose-, but not glucose-loaded mice
Plasma glucose levels of mice were increased after oral
loading of sucrose (Fig. 2a) or glucose (Fig. 2b). PGF
extract dose-dependently (250–1000 mg/kg, p.o.) inhibited
the increase in sucrose-loaded mice (plasma glucose lev-
els were reduced by 13.9%, 19.7%, and 20.6%, respec-
tively), whereas it showed little effect in glucose-loaded
mice. Acarbose (300 mg/kg, p.o.) also showed similar ef-
fects (10.6% reduction of plasma glucose level in sucrose-
loaded mice). Additionally, PGF extract (500 mg/kg) did not
affect plasma glucose levels in fasted mice (the first left bar,
Fig. 2b).
3.3. PGF extract inhibits ␣-glucosidase activity in vitro
We have recently reported that Salacia oblonga root, an
Ayurvedic antidiabetic medicine, inhibits postprandial hyper-
glycemia in ZDF rats, in which inhibition of ␣-glucosidase
activity plays an important role. In the present study, Salacia
oblonga root extract, used as a positive control, effectively
inhibited ␣-glucosidase activity (IC50 : 4.3 ␮g/ml, Fig. 3b).
Interestingly, PGF extract showed a more potent effect on
␣-glucosidase activity (IC50 : 1.8 ␮g/ml, Fig. 3a). Increas-
241
Fig. 2. PGF extract inhibits the increase of plasma glucose levels after su-
crose loading in mice. PGF extract (250–1000 mg/kg, p.o.) dose-dependently
inhibits the increase of plasma glucose levels after sucrose loading (a). PGF
extract (0–500 mg/kg) has no effect after glucose loading (the second and
third bars from the right) or in fasted normal mice (the first bar from the
left (b). Acarbose (300 mg/kg) also inhibited plasma glucose accumulation
after sucrose feeding (a), but not after glucose loading (b). Test samples and
vehicle were given by a gavage to mice fasted for 20 h; 60 min later, sucrose
(1 g/kg), glucose (0.5 g/kg) or vehicle were administered orally. Plasma glu-
cose levels were determined 30 min after administration of sucrose, glucose
or vehicle. All values are mean ± S.E.M. (n = 8–10). * P < 0.05.
ing ␣-glucosidase concentration shifted the dose–response
curve for PGF to higher concentrations (Fig. 4a). Increas-
ing ␣-glucosidase concentration (from 0.3 to 6 U/ml) in-
creased the IC50 of PGF extract substantially (from 0.8 to
23.5 ␮g/ml, Fig. 4b). Increasing the sucrose concentration
Fig. 3. PGF extract concentration-dependently inhibits ␣-glucosidase ac-
tivity in vitro. (a) An amount of 200 ␮l ␣-glucosidase (0.6 U/ml) was pre-
incubated with 200 ␮l of PGF extract or vehicle for 5 min. The reaction was
started by adding 200 ␮l of 37 mM sucrose (the final volume: 600 ␮l) and
terminated by heating at 90–100 ◦ C after 30 min incubation at 37 ◦ C. The
formation of glucose was determined. Inhibition rates were calculated as
percentages relative to blank controls, and IC50 values were calculated from
the dose-inhibition curves. (b) The water extract from Salacia oblonga root
was used as a positive control. Each experiment was done for three times in
duplicate.
242 Y. Li et al. / Journal of Ethnopharmacology 99 (2005) 239–244
Fig. 4. The inhibitory effect of PGF extract on ␣-glucosidase activity is
inversely dependent on the enzyme concentration. An amount of 200 ␮l
␣-glucosidase (0.3, 0.6, 1.5, 3 and 6 U/ml) was pre-incubated with 200 ␮l
of test sample or vehicle for 5 min. The reaction was started by adding
200 ␮l of 37 mM sucrose (the final volume: 600 ␮l) and terminated by heat-
ing at 90–100 ◦ C after 30 min incubation at 37 ◦ C. The formation of glucose
was determined. (a) Inhibition rates were calculated as percentages of blank
controls. The inhibitions of PGF extract were attenuated by increase in en-
zyme concentrations. (b) IC50 values (the concentration to inhibit 50% of
␣-glucosidase activity under the assay conditions) increased with progressive
increases in enzyme concentrations. Each experiment was done in duplicate.
(7.5–120 mM) also affected the position of the dose–response
curve (Fig. 5a), the IC50 of PGF extract increasing from 1.4 to
2.6 ␮g/ml (Fig. 5b). Increasing the time of pretreatment with
PGF (from 0 to 120 min) progressively enhanced the effect
of PGF extract (Fig. 6a), with a consequent reduction in IC50
from 2.2 to 1.2 ␮g/ml (Fig. 6b).
Fig. 5. The inhibitory effect of PGF extract on ␣-glucosidase activity is at-
tenuated by an increase in substrate concentration. An amount of 200 ␮l
␣-glucosidase was pre-incubated with 200 ␮l of PGF extract or vehicle for
5 min. The reaction was started by adding 200 ␮l of sucrose (7.5, 15, 30,
60 and 120 mM) (the final volume: 600 ␮l) and terminated by heating at
90–100 ◦ C after 30 min incubation at 37 ◦ C. The formation of glucose was
determined. (a) Inhibition was calculated as percentage of blank controls.
The inhibition by PGF extracts were attenuated by increases in sucrose (sub-
strate) concentrations. (b) IC50 values (as in Fig. 4) increased with increasing
sucrose concentrations. Each experiment was done in duplicate.
Fig. 6. Increase in pretreatment time enhances the inhibitory effect of PGF
extract. An amount of 200 ␮l ␣-glucosidase (0.6 U/ml) was pre-incubated
with 200 ␮l of PGF extract or vehicle for 0, 5, 30, 60 or 120 min. The reaction
was started by adding 200 ␮l of sucrose (37 mM) (the final volume: 600 ␮l)
and terminated by heating at 90–100 ◦ C after 30 min incubation at 37 ◦ C.
The formation of glucose was determined. (a) Inhibition was calculated as
percentage of blank controls. The inhibition by PGF extract was enhanced
by increasing pretreatment times. (b) IC50 value (as in Fig. 4) decreased with
increasing pretreatment times. Each experiment was done in duplicate.
4. Discussion
The treatment goal for patients with type 2 diabetes mel-
litus is generally agreed to be to maintain near-normal levels
of glycemic control, both in the fasting and postprandial
states (Ratner, 2001). Postprandial hyperglycemia is the
earliest metabolic abnormality to occur in type 2 diabetes
mellitus (Lebovitz, 1998). Postprandial blood glucose levels
may be elevated in the presence of normal levels of fasting
plasma glucose (FPG), constituting an early stage in type
2 diabetes, which some have called “postprandial diabetes”
(Baron, 1998). This state not only initiates the development
of early microvascular and macrovascular complications,
but also can contribute to a more rapid progression to
symptomatic diabetes by causing glucose toxicity in muscle
and pancreatic beta cells. Early identification of postprandial
hyperglycemia and its effective control, therefore, offer the
potential for early intervention and prevention of diabetic
complications (Ratner, 2001).
Although diet and exercise are the first steps toward
achieving treatment goals, 90% of patients with type 2 dia-
betes cannot maintain long-term glycemic control with diet
and exercise alone (Ratner, 2001). Thus, antihyperglycemic
drugs are necessary for the treatment of type 2 diabetes.
However, most of the currently available antidiabetes
therapies reduce FPG but have little impact on postprandial
glycemic excursions; therefore, they do not normalize post-
prandial hyperglycemia (Ratner, 2001). A number of newer
antidiabetes therapies—the meglitinides, ␣-glucosidase
inhibitors, and insulin lispro and aspart (Mooradian and
Thurman, 1999; Raskin et al., 2000)—target postprandial
blood glucose spikes, and these agents should be considered
increasingly in the long-term management of patients with
 Y. Li et al. / Journal of Ethnopharmacology 99 (2005) 239–244
type 2 diabetes. Use of these agents may lead to achievement
of overall target glycemic levels in a greater proportion of
patients, thus helping to prevent the excessive morbidity and
mortality associated with the disease (Ratner, 2001). In the
present study, oral administration of PGF extract lowered
plasma glucose levels in non-fasted, but not fasted, ZDF rats.
Furthermore, this treatment inhibited the increase of plasma
glucose levels after sucrose loading in mice. The results
suggest that PGF extract may have therapeutical potential in
postprandial hyperglycemia.
␣-Glucosidase is one of a number of glucosidases located
in the brush-border surface membrane of intestinal cells, and
is a key enzyme of carbohydrate digestion (Caspary, 1978).
␣-Glucosidase inhibitors block the actions of ␣-glucosidase
enzymes in the small intestine, which is rate-limiting in
the conversion of oligosaccharides and disaccharides to
monosaccharides, necessary for gastrointestinal absorption.
Postprandial glucose peaks may be attenuated by delayed
glucose absorption. The main benefits attributable to
␣-glucosidase inhibitors are reductions in both postprandial
glycemic levels and in the total range of postprandial
glucose levels (Lebovitz, 1997). The clinical efficacy of
␣-glucosidase inhibitors is well established. With acarbose,
the most extensively studied and widely used agent of this
class, patients with type 2 diabetes had a mean decrease in
postprandial plasma glucose of approximately 50 mg/dl, and
a mean decrease in HbA1c of 0.86% (Lebovitz, 1997). In
a long-term randomized study, acarbose improved glycemic
control without weight gain in 50% of patients with type
2 diabetes who could not achieve control by diet alone or
by diet combined with metformin, sulfonylureas or insulin
(Chiasson et al., 1994). However, it is well documented that
synthetic ␣-glucosidase inhibitors have undesirable side
effects, such as flatulence, diarrhea and abdominal cramping.
In addition, some of them may increase the incidence of
renal tumors and serious hepatic injury and acute hepatitis
(Carrascosa et al., 1997; Kihara et al., 1997; Diaz-Gutierrez
et al., 1998; Charpentier et al., 2000).
Many herbal medicines have been used in the prevention
and treatment of diabetes. They have in general not been
associated with marked toxic or other side effects. As for
most natural medicines, however, their action mechanisms
need to be clarified. Although some herbal medicines have
been reported to inhibit ␣-glucosidase activity, most of the
experiments have been limited to in vitro studies or to normal
or chemical-induced diabetic animal models only (Kim et
al., 1999, 2004; Muraoka et al., 2001; Ye et al., 2002; Pan et
al., 2003; Yoshikawa et al., 2003). In the present study, PGF
extract markedly reduced plasma glucose levels in non-fasted
ZDF rats, but affected neither the levels in fasted ZDF rats,
nor interfered with plasma glucose levels in normal mice.
The results suggest that PGF extract interferes with transit,
digestion or absorption of sugars in the small intestine, rather
than by other mechanisms, such as promotion of secretion
of insulin. The combined findings of inhibition of increase
of plasma glucose levels after sucrose loading, and failure to
243
lower blood glucose levels in glucose-loaded mice, suggest
that PGF extract inhibits carbohydrate digestion rather than
the transit and absorption of glucose and other sugars in the
digestive tract. Therefore, we speculated that PGF extract
had an inhibitory effect on ␣-glucosidase activity. The results
obtained in vitro demonstrated that PGF is indeed an effective
␣-glucosidase inhibitor.
Enzyme availability directly decides the rate of an en-
zymatically catalyzed reaction. The catalytic activity of an
enzyme is affected by the substrate concentration. To fur-
ther understand the effect of PGF extract, we investigated the
influence of the concentration of enzyme and substrate, as
well as pretreatment time, on the potency of ␣-glucosidase
inhibition by PGF extract. The results demonstrated that
the inhibitory potency of PGF extract is inversely depen-
dent on the concentration of ␣-glucosidase. An increase
in substrate concentration also attenuates to some extent
the effect of the PGF extract. ␣-Glucosidase inhibition by
PGF extract was increased progressively by preincubation
of the inhibitor with the enzyme. Because the time required
to reach binding equilibrium varies with the enzyme con-
centration in a bimolecular reaction mechanism, the inhibi-
tion seems to reflect a slow-binding mode. The IC50 curves
from the experiments with different substrate concentra-
tions and pretreatment time indicates that the dose of PGF
will be regulated by the amount of food intake, and when
used therapeutically PGF extract should be taken before
meals.
Glycosidases are not only essential to carbohydrate diges-
tion, but also vital for the processing of glycoproteins and
glycolipids. Glycosidases are also involved in a variety of
metabolic disorders and other diseases such as viral attach-
ment (Gruters et al., 1987) and cancer formation (Dennis
et al., 1987). Because of their importance, glycosidase in-
hibitors can be important tools for studying the mechanisms
of action on glycosidases and are also prospective therapeutic
agents for some degenerative diseases (Winchester and Fleet,
1992). Some ␣-glucosidase inhibitors such as nojirimycin,
N-butyldeoxynojirimycin, and castanospermine are potent
inhibitors of human immunodeficiency virus (HIV) replica-
tion and HIV-mediated syncytium formation in vitro (Walker
et al., 1987; Fischer et al., 1996a,b). There is much evi-
dence suggesting that the extracts of fruit from pomegranate
have anti-microbial (Anesini and Perez, 1993), anti-parasitic
(Ponce-Macotela et al., 1994), anti-viral (Zhang et al., 1995)
and anti-cancer (Kim et al., 2002) properties. However, the
action mechanisms of these remain unclear. Our current find-
ings provide a possible rationale for the purported actions of
pomegranate and suggest further research directions on the
action mechanisms of pomegranate and the investigation of
its new therapeutic potentials.
In conclusion, the present studies indicate that PGF extract
improves postprandial hyperglycemia in type 2 diabetes, at
least in part, by inhibiting ␣-glucosidase activity. Our findings
provide insight into the effects and action mechanism of PGF,
an ancient medicine for diabetes.
244 Y. Li et al. / Journal of Ethnopharmacology 99 (2005) 239–244
References
Alemzadeh, R., Tushaus, K.M., 2004. Modulation of adipoinsular axis in
prediabetic ZDF rats by diazoxide. Endocrinology 145, 5476–5484.
Anesini, C., Perez, C., 1993. Screening of plants used in Argentine folk
medicine for antimicrobial activity. Journal of Ethnopharmacology 39,
119–128.
Aviram, M., Dornfeld, L., Kaplan, M., Coleman, R., Gaitini, D., Nitecki,
S., Hofman, A., Rosenblat, M., Volkova, N., Presser, D., Attias, J.,
Hayek, T., Fuhrman, B., 2002. Pomegranate juice flavonoids inhibit
low-density lipoprotein oxidation and cardiovascular diseases: studies
in atherosclerotic mice and in humans. Drugs under Experimental and
Clinical Research 28, 49–62.
Baron, A.D., 1998. Postprandial hyperglycemia and ␣-glucosidase in-
hibitors. Diabetes Research and Clinical Practice 40, S51–S55.
Carrascosa, M., Pascual, F., Arest, S., 1997. Acarbose-induced acute se-
vere hepatotoxicity. Lancet 349, 698–699.
Caspary, W.F., 1978. Sucrose malabsorption in man after ingestion of
alpha-glucosidehydrolase inhibitor. Lancet 1, 1231–1233.
Ceriello, A., 1998. The emerging role of post-prandial hypergly-
caemic spikes in the pathogenesis of diabetic complications. Diabetic
Medicine 15, 188–193.
Ceriello, A., 2000. The post-prandial state and cardiovascular disease:
relevance to diabetes mellitus. Diabetes-Metabolism Research and Re-
views 16, 125–132.
Charpentier, G., Riveline, J.P., Varroud-Vial, M., 2000. Management of
drugs affecting blood glucose in diabetic patients with renal failure.
Diabetes and Metabolism 26, 73–85.
Chiasson, J.L., Josse, R.G., Hunt, J.A., Palmason, C., Rodger, N.W., Ross,
S.A., Ryan, E.A., Tan, M.H., Wolever, T.M., 1994. The efficacy of
acarbose in the treatment of patients with non-insulin-dependent di-
abetes mellitus. A multicenter controlled clinical trial. Annals of In-
ternal Medicine 15, 928–935.
Dennis, J.W., Laferte, S., Waghorne, C., Breitman, M.L., Kerbel, R.S.,
1987. Beta 1–6 branching of Asn-linked oligosaccharides is directly
associated with metastasis. Science 236, 582–585.
Diaz-Gutierrez, F.L., Ladero, J.M., Diaz-Rubio, M., 1998. Acarbose-
induced acute hepatitis. American Journal of Gastroenterology 93,
481.
Fischer, P.B., Karlsson, G.B., Butters, T.D., Dwek, R.A., Platt, F.M.,
1996a. N-butyldeoxynojirimycin-mediated inhibition of human im-
munodeficiency virus entry correlates with changes in antibody recog-
nition of the V1/V2 region of gp120. Journal of Virology 70,
7143–7152.
Fischer, P.B., Karlsson, G.B., Dwek, R.A., Platt, F.M., 1996b. N-
butyldeoxynojirimycin-mediated inhibition of human immunodefi-
ciency virus entry correlates with impaired gp120 shedding and gp41
exposure. Journal of Virology 70, 7153–7160.
Gruters, R.A., Neefjes, J.J., Tersmette, M., De Goede, R.E.Y., Tulp, A.,
Huisman, H.G., Miedema, F., Ploegh, H.L., 1987. Interference with
HIV-induced syncytium formation and viral infectivity by inhibitors
of trimming glucosidase. Nature 330, 74–77.
Jafri, M.A., Aslam, M., Javed, K., Singh, S., 2000. Effect of Punica
granatum Linn. (flowers) on blood glucose level in normal and
alloxan-induced diabetic rats. Journal of Ethnopharmacology 70,
309–314.
Jurjani, M.I., 1878. Zakheera-Khwarzam-Shahi. Munshi Nawal Kishore,
Lucknow (Urdu translation), pp. 540.
Kasiske, B.L., O’Donnell, M.P., Keane, W.F., 1992. The Zucker rat model
of obesity, insulin resistance, hyperlipidemia, and renal injury. Hyper-
tension 19, 110–115.
Kihara, Y., Ogami, Y., Tabaru, A., Unoki, H., Otsuki, M., 1997. Safe
and effective treatment of diabetes mellitus associated with chronic
liver diseases with an alpha-glucosidase inhibitor, acarbose. Journal
of Gastroenterology 32, 777–782.
Kim, H.S., Kim, Y.H., Hong, Y.S., Paek, N.S., Lee, H.S., Kim, T.H., Kim,
K.W., Lee, J.J., 1999. Alpha-glucosidase inhibitors from Commelina
communis. Planta Medica 65, 437–439.
Kim, N.D., Mehta, R., Yu, W., Neeman, I., Livney, T., Amichay, A.,
Poirier, D., Nicholls, P., Kirby, A., Jiang, W., Mansel, R., Ramachan-
dran, C., Rabi, T., Kaplan, B., Lansky, E., 2002. Chemopreventive and
adjuvant therapeutic potential of pomegranate (Punica granatum) for
human breast cancer. Breast Cancer Research Treatment 71, 203–217.
Kim, Y.M., Wang, M.H., Rhee, H.I., 2004. A novel alpha-glucosidase
inhibitor from pine bark. Carbohydrate Research 339, 715–717.
Lebovitz, H.E., 1997. Alpha-glucosidase inhibitors. Endocrinology and
Metabolism Clinics of North America 26, 539–551.
Lebovitz, H.E., 1998. Postprandial hyperglycaemic state: importance and
consequences. Diabetes Research and Clinical Practice 40, S27–S28.
Li, Y., Peng, G., Li, Q., Wen, S., Huang, T.H., Roufogalis, B.D., Yama-
hara, J., 2004. Salacia oblonga improves cardiac fibrosis and inhibits
postprandial hyperglycemia in obese Zucker rats. Life Sciences 75,
1735–1746.
Majoosi, A.I.A., 1889. Kamilussanah. Munshi Nawal Kishore, Lucknow
(Urdu translation by Kantoori), pp. 145.
Mooradian, A.D., Thurman, J.E., 1999. Drug therapy of postprandial hy-
perglycemia. Drugs 57, 19–29.
Muraoka, O., Ying, S., Yoshikai, K., Matsuura, Y., Yamada, E., Mine-
matsu, T., Tanabe, G., Matsuda, H., Yoshikawa, M., 2001. Synthe-
sis of a nitrogen analogue of salacinol and its alpha-glucosidase in-
hibitory activity. Chemical and Pharmaceutical Bulletin (Tokyo) 49,
1503–1505.
Pan, G.Y., Huang, Z.J., Wang, G.J., Fawcett, J.P., Liu, X.D., Zhao, X.C.,
Sun, J.G., Xie, Y.Y., 2003. The antihyperglycaemic activity of berber-
ine arises from a decrease of glucose absorption. Planta Medica 69,
632–636.
Ponce-Macotela, M., Navarro-Alegria, I., Martinez-Gordillo, M.N.,
Alvarez-Chacon, R., 1994. In vitro effect against Giardia of 14 plant
extracts. Revista De Investigacion Clinica 46, 343–347.
Raskin, P., Riis, A., Guthrie, R.A., Jovanovic, L., Leiter, L., 2000. Use
of insulin aspart, a fast-acting insulin analog, as the mealtime insulin
in the management of patients with type 1 diabetes. Diabetes Care
23, 583–588.
Ratner, R.E., 2001. Controlling postprandial hyperglycemia. American
Journal of Cardiology 88, 26H–31H.
Schubert, S.Y., Lansky, E.P., Neeman, I., 1999. Antioxidant and
eicosanoid enzyme inhibition properties of pomegranate seed oil and
fermented juice flavonoids. Journal of Ethnopharmacology 66, 11–17.
Tikellis, C., Wookey, P.J., Candido, R., Andrikopoulos, S., Thomas, M.C.,
Cooper, M.E., 2004. Improved islet morphology after blockade of the
renin-angiotensin system in the ZDF rat. Diabetes 53, 989–997.
Walker, B.D., Kowalski, M., Goh, W.C., Kozarsky, K., Krieger, M., Rosen,
C., Rohrschneider, L., Haseltine, W.A., Sodroski, J., 1987. Proceed-
ings of the National Academy of Sciences of the United States of
America 84, 8120–8124.
Winchester, B., Fleet, G.W., 1992. Amino-sugar glycosidase inhibitors:
versatile tools for glycobiologists. Glycobiology 2, 199–210.
Ye, F., Shen, Z., Xie, M., 2002. Alpha-glucosidase inhibition from a
Chinese medical herb (Ramulus mori) in normal and diabetic rats and
mice. Phytomedicine 9, 161–166.
Yoshikawa, M., Pongpiriyadacha, Y., Kishi, A., Kageura, T., Wang,
T., Morikawa, T., Matsuda, H., 2003. Biological activities of Sala-
cia chinensis originating in Thailand: the quality evaluation guided
by alpha-glucosidase inhibitory activity. Yakugaku Zasshi 123, 871–
880.
Zhang, J., Zhan, B., Yao, X., Gao, Y., Shong, J., 1995. Antiviral activity
of tannin from the pericarp of Punica granatum L against Herpes
virus in vitro. Chung Kuo Chung Yao Tsa Chih 20, 556–558.
Zimmet, P., Alberti, K., Shaw, J., 2001. Global and societal implications
of the diabetes epidemic. Nature 414, 782–787.
 Journal of Ethnopharmacology 99 (2005) 245–252

Effect of bee venom on aromatase expression and activity in

leukaemic FLG 29.1 and primary osteoblastic cells
Kap-Sung Kim a , U-Shik Choi a , Seung-Duk Lee a , Kyung-Ho Kim a , Kang-Hyun Chung b ,
Young-Chae Chang c , Kwan-Kyu Park c , Young-Choon Lee d , Cheorl-Ho Kim a,∗
a Department of Acupuncture, Biochemistry and Molecular Biology, College of Oriental Medicine, Dongguk University and
National Research Laboratory for Glycobiology, Kyungju, Kyungbuk 780-714, Korea
b Department of Food Science and Technology, Seoul National University of Technology, Seoul 139-743, Korea
c Department of Pathology, College of Medicine, Daegu Catholic University, Daegu, Korea
d Faculty of Biotechnology, Dong-A University, Pusan 604-714, Korea

Received 5 July 2004; received in revised form 3 February 2005; accepted 17 February 2005
Available online 11 April 2005

Abstract

The effect of bee venom aqua-acupunture (BVA) (api-toxin), a traditional immunosuppressive Korean aqua-acupuncture, on the bone
function in human osteoblastic cells was studied. To provide insights into the effect of BVA on aromatase activity in bone-derived cells, we
examined the human leukaemic cell line FLG 29.1, which is induced to differentiate toward the osteoclastic phenotype by TPA and TGF-␤1,
and the primary first-passage osteoblastic cells (hOB). Southern blot of RT-PCR products with a 32 P-labeled cDNA probe for the human
aromatase demonstrated that FLG 29.1 and hOB cells express aromatase mRNA. Gene expression and enzyme activity were stimulated in a
time-dependent fashion by 5.0 ␮l/ml BV and by either 1–50 nM TPA or 0.01–0.5 ng/ml TGF-␤1, with maximal responses after 2–3 h exposure.
After 24 h incubation of the cells in the absence of these stimuli the aromatase mRNA and the protein were barely detectable. These findings
demonstrate that cells of the osteoclastic lineage synthesize aromatase in vitro by the local cytokine of TGF-␤1 and BVA. These can offer an
explanation for the lack of development of osteoarthritis in BVA-treated patients.
© 2005 Elsevier Ireland Ltd. All rights reserved.

Keywords: Rheumatoid arthritis; Bee venom aqua-acupunture (BVA); Aromatase; Gene expression; Activity; Human leukaemic cell FLG 29.1; Primary
osteoblastic cells

1. Introduction into the patients inhibit cytokine production from both T

Bee venom aqua-acupunture (BVA) (api-toxin) has been
widely used in the treatment of some immune-related dis-
ease, especially rheumatoid arthritis (RA) and satisfactory
results are obtained (Kwon et al., 2001, 2002). However, lit-
tle is known about the mode of action of this medication
on RA. Previously, BVA inhibited production of IL-1␤ and
TNF-␣ from macrophages in response to in vivo stimula-
tion with bacterial lipopolysaccharides when the extract was
administered into mice once a day for 7 days (Shin, 2002;
Kwon et al., 2001), suggesting that the BVA administered
∗ Corresponding author. Tel.: +82 54 770 2663; fax: +82 54 770 2281.
E-mail address: chkimbio@dongguk.ac.kr (C.-H. Kim).
cells and macrophages and potent effects on RA. In addi-
tion, it was also investigated that the anti-inflammatory ef-
fect of the BVA on an acute inflammatory process using the
carrageenan-induced edema test (Winter et al., 1962). Treat-
ment with BVA could inhibit the onset and development of
arthritis and the immune responses to collagen, but that BVA
cannot change the severity when the disease was established.
It was suggested that the local conversion of sex steroid
precursors to estrogens could be involved in the pathogen-
esis of postmenopausal osteoporosis. Estrogen biosynthesis
is catalyzed by the enzyme complex aromatase/cytochrome
P450 mainly in the adipose tissue with androstenedione as
the principal precursor (Grodin et al., 1973; Simpson et al.,
1989). However, there is increasing evidence that glucocor-

0378-8741/$ – see front matter © 2005 Elsevier Ireland Ltd. All rights reserved.
doi:10.1016/j.jep.2005.02.025
246 K.-S. Kim et al. / Journal of Ethnopharmacology 99 (2005) 245–252
ticoids, known stimulators of estrogen formation in adipose
tissue (Simpson et al., 1981), enhance both aromatase activ-
ity (Tanaka et al., 1993; Nawata et al., 1995) and its gene
expression in osteoblast-like cells (Nawata et al., 1995), sug-
gesting that locally synthesized estrogen may act directly on
bone formation. Thus, aromatase activation stimulates skele-
tal modeling and increases bone size and mass in growing
rats, and aromatase inhibition impairs skeletal modeling and
decreases bone size and mass.
Therefore, in this study, we examined the influence of
BVA on osteoblastic cellular responses by using human os-
teoblastic cells. To evaluate the possible synthesis of estro-
gen in cells of the osteoclastic lineage, we used the human
leukemic cell line FLG 29.1, which is induced to differentiate
toward the osteoclastic phenotype by phorbol esters (Gattei
et al., 1992) and transforming growth factor-␤1 (TGF-␤1)
(Fiorelli et al., 1994), and also the primary first-passage os-
teoblastic cells (hOB). The present results clearly demon-
strated that the BVA strongly stimulated aromatase activation
in FLG19.1 and hOB cells in vitro. In this paper, we have
evaluated BVA for its effectiveness on cellular responses to
aromatase expression in the human osteoblastic cells. In an
attempt to gain further insight into the mode of action of
BVA, we also investigated the effects of BVA on the enzyme
activity.
The results clearly demonstrate that FLG 29.1 and hOB
cells express functional aromatase and that BVA, with to-
gether phorbol esters and TGF-␤1, induce an increase of both
aromatase mRNA and enzymatic activity.
2. Materials and methods
2.1. Materials
Saline-mixed BVA was purchased from Monmouth Pain
Institute Inc., New Jersey, USA as an i.p. injection grade for
human. Each bial contained 10 ml of the BVA. For applica-
tion in cell culture, randomly selected bials were suspended in
normal saline at a concentration of 5 ␮l/100 ␮l. In some case,
original concentration of BV was used. Culture flasks and
dishes were obtained from Nunc (Roskilde, Denmark). Media
and sera for cell culture were purchased from Jeil Biotech Ser-
vices (Daegu, Korea). [␣-32 P]-dCTP was from DuPont-NEN
(Boston, MA) or from Amersham International Co. (Seoul,
Korea). The human ␤-actin cDNA insert and the ExpressHyb
hybridization solution were purchased from Clontech (Palo
Alto, CA). All other chemicals and biochemicals were of
analytical grade and were purchased from Sigma Chemical
Co. (St. Louis, MO) or Boehringer Mannheim Biochemicals
(Seoul, Korea).
2.2. Cell culture
FLG 29.1 cells were cultured in RPMI-1640 culture
medium, supplemented with 10% fetal calf serum (FCS) as
previously described (Hong et al., 2002). For primary hu-
man osteoblastic cells, bone specimens were obtained from
the iliac crest of a patient (men; 35 years) undergoing cor-
rective surgery after traumatic fracture. The patient had not
signs or symptoms of bone or joint disease. The study was
approved by the Institutional Review Board of the Dong-
guk University, and written informed consent was obtained
from patient. We obtained RNA from primary first-passage
hOB from cultures of trabecular bone explants as previously
described (Siggelkow et al., 1999). These hOB cells have
been shown to represent the phenotype of the mature os-
teoblast, were grown at 37 ◦ C, maintained in phenol red-
free minimal essential medium (MEM) supplemented with
10% charcoal-stripped fetal calf serum (cs-FCS), and were
cultured in serum-free MEM supplemented with 0.125%
(w/v) bovine serum albumin (BSA) for 4 days prior to RNA
isolation.
2.3. Reverse transcription-polymerase chain reaction
(RT-PCR)
Poly(A)+ RNA was isolated from FLG 29.1 using
oligo (dT) affinity chromatography according to Oligotex
kit instructions (Quiagen Korea Co., Seoul, Korea). To-
tal RNA from adipose tissue specimens, obtained from
women undergoing elective abdominal surgery who gave
written consent, was isolated using a commercial kit (Quia-
gen Co. or Promega Co.). First strand cDNA synthesis
and PCR amplification were performed as previously de-
scribed (Kim et al., 2001) with minor modifications. Briefly,
100 ng of poly(A)+ RNA or 1 ␮g of total RNA was re-
verse transcribed using 20 units of moloney leukemia
virus reverse transcriptase (Stratagen, La Jolla, CA, USA)
in a 50 ␮l volume. PCR amplification was carried out
in 50 ␮l PCR buffer (10 mM Tris–HCl, pH 8.3) with
2.5 mM MgCl2 , 200 ␮M dNTP with 0.5 units of cloned
Thermus aquaticus DNA polymerase (Amplitaq, Perkin-
Elmer, Korea), and 0.1 ␮M of each primer. One PCR cy-
cle (30 cycles total) consisted of denaturation at 94 ◦ C for
1 min, annealing at 60 ◦ C or 66 ◦ C for 1 min, and poly-
merization at 72 ◦ C for 1 min. PCR products were elec-
trophoresed on 1–1.5% agarose gel, visualized by ethid-
ium bromide staining and photographed under UV light.
The sequences of sense and anti-sense primers (Bioneer Co.,
Korea) were 5 -GAATATTGGAAGGATGCACAGACT, cor-
responding to a sequence in exon 9, and 5 -GGGTAAA-
GATCATTTCCAGCATGT, complementary to a sequence
of exon 10 of the human aromatase gene (Steele et al.,
1987), respectively; with an expected product of 293 bp,
previously used in human breast tumor tissues (Koos et
al., 1993), or 5 -CCGGCCTTGTTCGTATGGTCA, corre-
sponding to a sequence in exon 5 (sense primer) and 5 -
GTCTCATCTGGGTGCAAGGA, complementary to a se-
quence of exon 10 of the human aromatase gene (anti-
sense primer) with an expected product of 987 bp, previ-
ously used in human osteoblast-like cells (Nawata et al.,
 K.-S. Kim et al. / Journal of Ethnopharmacology 99 (2005) 245–252
1995). The mRNA integrity and the amplification efficiency
of aromatase transcripts were evaluated by the amplification
of a ␤-actin sequence (expected size = 224 bp) from equiv-
alent amounts of poly(A)+ RNA of each sample. The se-
quences of sense and anti-sense primers for ␤-actin ampli-
fication were 5 -CCC AGC ACA ATG AAG ATC AA-3
(sense primer), corresponding to a sequence in exon 4, and
5 -TTT CTG CGC AAG TTA GGT TTT GAC AA-3 , cor-
responding to a sequence in exon 5 (anti-sense primer). PCR
analyses were repeated 2–4 times on each sample to con-
trol whether relative differences in yield of PCR products
between samples reflected differences in mRNA concentra-
tions or random assay variability. The transcripts were vi-
sualized by ethidium bromide staining of agarose gel. To
test the specificity of the transcripts, the RT-PCR products
were electrophoresed through a 1.5% agarose gel, blotted
onto a nylon membrane, and hybridized with a 32 P-labeled
human aromatase cDNA probe (Kim et al., unpublished
results).
2.4. Aromatase activity assay
The aromatase activity was estimated by determining the
incorporation of tritium from [3 H]androstenedione ([3 H]A;
1b, 2b-N-3 H)androst-4-ene-3,17-dione; 42 Ci/mM; 1Ci = 42
GBq; New England Nuclear, UK) into [3 H]water (Means et
al., 1989) in FLG 29.1 cells. Cells were seeded in the appro-
priate growth medium with or without 5% dextran-charcoal
stripped FCS (DCS-FCS) in the absence or presence of var-
ious stimuli. After 3–48 h, cells were washed, re-suspended
in fresh medium with or without 5% DCS–FCS, and in-
cubated (1 × 106 cells/well) in 6-well plates with [3 H]A
at 0.5 nM to 100 nM concentrations for kinetic studies, or
with 2 nM [3 H]A for single point determination of enzy-
matic activity, at 37 ◦ C in humidified atmosphere for 6 h,
unless otherwise stated. After condensing water paper by
placing the culture plates on ice for 15 min, cells were
then pelleted and the incubation medium was removed. Af-
ter cells were then washed twice with phosphate-buffered
saline (2.6 mM KCl/1.4 mM KH2 PO4 /140 mM NaCl/8 mM
Na2 HPO4 ·7H2 O/0.5 mM MgCl2 ·6H2 O/1 mM CaCl2 ), pro-
tein content was determined. The incubation medium and
the combined saline washes were pushed through a pre-
equilibrated Sep-Pak C18 minicolumn into a counting vial
(Nestler, 1993). The column was washed with water to re-
move residual [3 H]water. Scintillation liquid (15 ml) was
added and the radioactivity was counted after equilibra-
tion. Each experiment was conducted in triplicate. To
establish the non-specific release of [3 H]water duplicate
aliquots of [3 H]A-supplemented cell-free medium were in-
cubated and the blank value, which averaged 0.8% of the
added radioactivity after 6 h incubation, was subtracted
from the amount measured in the experimental incuba-
tions. The aromatase activity was expressed as fmol of
[3 H]A metabolized/mg cell protein/6 h. Each experiment
was conducted in triplicate and was repeated at least
247
two times to ensure that the results were quantitatively
reproducible.
2.5. Densitometric analysis
The intensity of the bands obtained from PCR studies was
estimated with Gel-Print System (Core Bio Corp., Seoul, Ko-
rea), as described previously (Park et al., 2005). The values
are expressed as means ± S.E.
2.6. Analytical methods
Protein contents were determined by a Protein assay kit
of Bio-Rad Laboratories (Richmond, CA, USA).
2.7. Statistics
Data were expressed as mean ± S.D. Statistical differ-
ences were analyzed using one-way analysis of variance.
Significance was adjusted for multiple comparisons of means
using Bonferroni’s approximation.
3. Results
3.1. Effect of BVA on aromatase expression in the cells
To amplify aromatase mRNA, poly(A) RNA from un-
treated and TPA-treated FLG 29.1 cells and total RNA from
human adipose tissue, used as control, were reverse tran-
scribed. The aromatase cDNA was amplified by using either
a sense primer corresponding to a sequence in exon 9 and an
anti-sense primer corresponding to a sequence in exon 10 of
the human aromatase gene (Means et al., 1989). The products
of the expected size from the different amplification (987 bp)
were observed in samples from FLG 29.1 cells and adipose
tissue (Fig. 1). Treatment of BV induced the expression of
the aromatase with increasing activity by a dose-dependent
manner (0–10 ␮l/ml). It was clearly induced by 24 h treat-
ment with 50 nM TPA (Fig. 1), known to affect FLG 29.1
cell differentiation (Nestler, 1993). The BVA induction of the
987 bp transcript appeared to be dose-dependent with max-
imal expression after 2–4 h of treatment (Fig. 2). Similarly,
TGF-␤1 induced aromatase expression by dose-dependent
manner after 3 h treatment, although the expression level was
much lower than those of BVA or TPA. The same products
of the expected size as that of FLG 29.1 cells were also ob-
served in samples from the primary first-passage hOB from
cultures of trabecular bone explants (Fig. 3). Treatment of
BVA induced the expression of the aromatase with increasing
activity by a dose-dependent manner (0 to 10 ␮l/ml). Treat-
ments for 50 nM TPA or TGF-␤1 induced the aromatase ex-
pression. However, the expression level by TGF-␤1 was al-
most same level of BVA or TPA, as compared to the FLG
29.1 cells.
248 K.-S. Kim et al. / Journal of Ethnopharmacology 99 (2005) 245–252
Fig. 1. RT-PCR amplification of aromatase mRNA from FLG 29.1 cells and
human adipose tissue. Poly(A)+RNA from cells treated with 10 ␮l/ml BVA
(lane 1), 5 ␮l/ml BVA (lane 2) or untreated (lane 3) for 24 h. RNAs from
50 nM TPA-treated cells (lane 5) and human adipose tissue (lane 4) were
reverse transcribed using couples of primers and the amplification products
were visualized by ethidium bromide staining. The position and the size of
marker fragments are reported on the left, while the position and the expected
sizes of the transcripts are reported on the right (987 bp). Result treated with
10 ␮l/ml BVA has been used as control (100%).
3.2. Effect of BVA on aromatase activity
Aromatase activity was determined in FLG 29.1 cells and
the primary first-passage hOB by measuring [3 H]H2 O re-
Fig. 2. Time- and dose-dependent effect of BVA and TGF-␤1 on aromatase
RT-PCR products. FLG 29.1 cells were treated with 5 ␮l/ml BVA for 0 (lane
1), 2 h (lane 2) and 4 h (lane 3). Also, cells were treated with 0.01 ng/ml
TGF-␤1 (lane 4), 0.1 ng/ml TGF-␤1 (lane 5) and 1.0 ng/ml TGF-␤1 (lane
6) for 24 h and the aromatase mRNA expression was evaluated by RT-PCR
analysis. The size and the position of the expected transcript of 987 bp is
reported. Equivalent amounts of poly(A)+ mRNA of each sample were ana-
lyzed for the amplification of a human ␤-actin sequence(not shown). Result
treated with 5 ␮l/ml BVA for 4 h has been used as control (100%).
Fig. 3. RT-PCR amplification of aromatase mRNA from the primary first-
passage hOB and Southern blot of RT-PCR products from the hOB with a
32 P-labeled human aromatase cDNA. (A) Poly(A)+RNA from cells treated
with 50 nM TPA (lane 1), 1.0 ng/ml TGF-␤1 (lane 2), 5.0 ␮l/ml BVA (lane
3), 2.0 ␮l/ml BVA (lane 4), 0.5 ␮l/ml BVA (lane 5) for 24 h or untreated (lane
6) were reverse transcribed using couples of primers and the amplification
products were visualized by ethidium bromide staining. (B) Southern blot
analysis of panel A. The expected sizes of the transcripts are reported on
the right. (C) Equivalent amounts of poly(A)+ mRNA of each sample were
analyzed for the amplification of a human ␤-actin sequence.
leased from [3 H]A. In all experimental conditions the rate
of aromatase activity was linear for up to 24 h incubation
(data not shown). Therefore, the enzymatic activity was eval-
uated by incubating [3 H]A for 6 h. BVA markedly increased
the enzymatic activity in a dose-dependent fashion, reach-
ing the maximum at 5 ␮l/ml concentration with no signifi-
cant differences up to 10 ␮l/ml concentration (Table 1). To
evaluate the specificity of the assay, FLG 29.1 cells and
the primary first-passage hOB after 4 h exposure to culture
medium supplemented with 5 ␮l/ml BVA were incubated
with 2 nM [3 H]A in the absence or presence of 100 nM to
1 ␮M concentration of the non-steroidal aromatase inhibitor
CGS16949A (Buzdar, 2001). CGS16949A inhibited the aro-
matase activity with a dose-dependent fashion reaching ap-
proximately 90% suppression of the enzyme activity (not
shown). A similar pattern of induction was shown by TPA
and TGF-␤1 in both cell types. After 24 h incubation, al-
though the mean values of aromatase activity in both cells
treated with the different agents were higher than in untreated
cells, only those under BVA and TPA treatment were sig-
nificantly different from the control (Table 2). On the con-
trary, either 0.5 mM dibutyryl cAMP (Bt2-cAMP) or 50 nM
dexamethasone (DEX) did not significantly affect the basal
rate of the enzyme activity (Table 2). With respect to the
DEX effect on aromatase activity, Shozu et al. (2001) re-
ported that DEX induces aromatase activity in the THP-1
cell line and fetal human osteoblast-like cells. However, the
THP-1 cell line is different cell line from our present FLG
29.1 cells that differentiates into macrophage/osteoclast-like
 K.-S. Kim et al. / Journal of Ethnopharmacology 99 (2005) 245–252 249

Table 1
Effect of different concentrations of BVA on the aromatase activity by FLG 29.1 cells and the primary first-passage hOB
BVA (␮l/ml)
0 0.1 1 2 5 10
Aromatase activity (fmol/mg/protein/6 h) in FLG 29.1 cells
12.3 ± 1.3 23.5 ± 1.6 32.4 ± 2.5 48.4 ± 3.6 89.5 ± 6.5 93.2 ± 6.5
Aromatase activity (fmol/mg/protein/6 h) in hOB cells
16.4 ± 1.2 31.3 ± 2.3 38.3 ± 3.6 54.3 ± 5.6 121.2 ± 8.3 95.6 ± 7.8
After 24 h in the appropriate medium supplemented with the indicated concentrations (␮l/ml) of BVA, 2 nM [3 H]Awas added to the cells. The enzymatic
activity was measured after 2 h incubation. Results are expressed as mean ± S.D. of triplicates from two separate experiments.

cells which possesses high aromatase activity. In addition,
fetal human osteoblast-like cells show different phenotype
that can differentiate into osteoblastic or osteoclastic lineage
during cultivation, showing difference from the present pri-
mary human osteoblastic cells obtained from the adult bone
tissues.
4. Discussion
BVA is widely used in the chronic management and the
treatment of RA, particularly, in Korea. However, the mech-
anism by which the BV modify the clinical status of RA
are not well understood. There is general consensus that
CD4+ T cells act as initiators of RA, by migrating to the
affected joints, recognizing peptides derived from processed
antigens, and releasing several types of cytokines (Firestein
and Zvaifler, 1990; Panayi et al., 1992). Such cytokines en-
hance the function of other cells, especially macrophages
to produce pro-inflammatory cytokines including IL-1␤ and
TNF-␣ (Feldmann et al., 1996). BVA also inhibited produc-
tion of IL-1␤ and TNF-␣ from macrophages in response to
in vivo stimulation with bacterial lipopolysaccharides when
the extract was administered into mice once a day for 7 days
(Shin, 2002; Kwon et al., 2001), suggesting that the BVA ad-
ministered into the patients inhibit cytokine production from
both T cells and macrophages and potent effects on RA.
On the other hand, BVA treatment, which began concur-
rently with a booster injection, also significantly suppressed
the development of arthritis and immune responses to col-
lagen. The precise mechanisms accounting for these phe-
nomena are not clear, but similar observations were made by
Asano et al. (1998), who showed that delayed traditional Chi-
nese extract treatment could suppress development of arthritis
and of immunity to collagen. It is observed that BVA is able
to suppress clonal expansion of helper T cells, when it is ad-
ministered intraperitoneally into rat. Therefore, although the
mechanism(s) by which BVA exerts suppressive effects on
clonal T cell expansion is not well understood, this regimen
might theoretically lead to specific clonal depletion and result
in inhibition of development of the diseases. An alternative
explanation is that the time of a booster injection may still be
within the induction phase of arthritis. Since the clinical treat-
ment with immunosuppressing agents such as cyclosporin A
and FK-506 had a beneficial effect in patients with refractory
RA (Weinblatt et al., 1987; Yocum, 1994), BVA might be a
useful tool for the treatment of RA. It would be incredible if
the drugs as powerful as this did not have serious toxicity, but

Table 2
Effect of BVA, TPA, TGF-␤1, Bt2cAMP and dexamethasone on aromatase activity in FLG 29.1 cells and hOB cells
Agents Aromatase activity (fmol/mg protein/2 h) after time treatment
2h 12 h 24 h
FLG 29.1 cells
None 16.7 ± 2.4 (n = 6) 11.4 ± 1.6 (n = 5) 10.5 ± 3.5 (n = 4)
+5 ␮l/ml BVA 87.3 ± 14.3 (n = 4)** 76.8 ± 4.5 (n = 5)** 33.3 ± 5.3 (n = 6)*
+50 nM TPA 43.3 ± 4.3 (n = 4)* 41.5 ± 6.2 (n = 3)* 21.3 ± 2.5 (n = 5)*
+TGF-␤1 (0.1 ng/ml) 45.3 ± 5.2 (n = 5)* 36.5 ± 4.3 (n = 4)* 25.2 ± 3.5 (n = 4)*
+0.5 mM Bt2cAMP 14.3 ± 1.6 (n = 3) 10.5 ± 2.2 (n = 3) 9.4 ± 1.1 (n = 4)
+50 nM DEX 12.2 ± 3.1 (n = 4) 12.1 ± 2.1 (n = 3) 9.6 ± 2.3 (n = 3)
hOB cells
None 16.5 ± 2.4 (n = 3) 13.6 ± 2.2 (n = 4) 12.1 ± 1.2 (n = 3)
+5 ␮l/ml BVA 95.4 ± 21.2 (n = 5)** 68.6 ± 7.2 (n = 4)** 43.3 ± 4.6 (n = 3)*
+50 nM TPA 56.7 ± 5.7 (n = 3)* 47.3 ± 5.4 (n = 3)* 42.2 ± 4.4 (n = 5)*
+TGF-␤1 (0.1 ng/ml) 62.3 ± 5.6 (n = 3)** 42.4 ± 6.4 (n = 5)* 34.3 ± 6.4 (n = 3)*
+0.5 mM Bt2cAMP 16.3 ± 2.3 (n = 4) 14.3 ± 3.2 (n = 4) 12.2 ± 4.3 (n = 4)
+50 nM DEX 13.4 ± 5.2 (n = 3) 12.3 ± 3.6 (n = 4) 10.4 ± 2.2 (n = 4)
After the indicated incubation times with the different agents, 2 nM [3 H]A was added to the cells and the enzymatic activity was evaluated after 6 h incubation.
∗ P < 0.05, significantly different from each normal control as expressed to “None”.
∗∗ P < 0.01, significantly different from each normal control as expressed to “None”.
250 K.-S. Kim et al. / Journal of Ethnopharmacology 99 (2005) 245–252
further studies will be necessary to answer this question. The
recommended dose of BVA in the management and treatment
of rat CIA will be 20 ␮l/kg, which is two-firth of human ther-
apeutic dose. However, biochemical and metabolic analysis
of the constituents of BVA have to be analyzed in further
delineating its mechanisms of action in arthritis.
Sex hormones appear to play an important role as mod-
ulators of autoimmune disease onset/perpetuation. Steroid
hormones are implicated in the immune response, with es-
trogens as enhancers at least of humoral immunity, and
androgens and progesterone (and glucocorticoids) as nat-
ural immune suppressors. Steroid hormones can be con-
verted along defined pathways to downstream hormones in
the periphery. The estrogen-synthesizing enzyme complex
termed aromatase cytochrome P450 is implicated in bone
metabolism. The cells of osteoclastic lineage can express
aromatase cytochrome P450 gene and the enzyme activity
was markedly and transiently induced by the phorbol ester
TPA or TGF-␤1. The regulation of the human aromatase
cytochrome P450 gene expression by various agents, such
as glucocorticoids, cAMP analogs, a variety of growth fac-
tors and phorbol esters (Simpson et al., 1994; Harada et al.,
1993), is suggestive of a control of aromatase expression.
In in vivo effects of estrogen deficiency in a murinemodel
for RA, the RA lesions were entirely recovered by pharma-
cological levels of estrogen administration (Yoneda et al.,
2004), indicating that estrogen deficiency may play a cru-
cial role in acceleration of autoimmune arthritis. Another ro-
dent model of estrogen deficiency is the aromatase-knockout
(ArKO) mouse. Using the ArKO mice, Shim et al. (2004)
revealed that estrogen deficiency results in an autoimmune
disease, suggesting that estrogen might have clinical value
in the prevention or treatment of RA. In patients with RA,
17␤-estradiol was thought to play a dual pro- and anti-
inflammatory role depending on its concentration or probably
conversion to downstream mitogenic 16 ␣-hydroxyestrone or
naturally occurring anti-estrogens such as 2-hydroxyestrone.
This study in RA patients clearly demonstrates a large shift to
mitogenic estrogens in relation to endogenous anti-estrogens.
Both steroids are converted from the precursor 17␤-estradiol
and estrone. In patients with RA, the magnitude of conversion
to the mitogenic 16 ␣-hydroxyestrone is greatly upregulated,
which likely contributes to maintenance of the proliferative
state in these diseases (Weidler et al., 2004).
FLG 29.1 and hOB cell aromatase activities are not in-
duced by cAMP analogs and dexamethasone. This is in con-
trast to other systems (Simpson et al., 1989; Simpson et al.,
1994; Purohit et al., 1992). However, the stimulation by TGF-
␤1 is inductive. Bone matrix is one of the major storage sites
for TGF-␤1 and TGF-␤ isoforms are directly involved in
bone remodeling via an autocrine and/or paracrine mecha-
nism of action (Centrella et al., 1994). Moreover, it was re-
cently demonstrated that FLG 29.1 and hOB cells produce
TGF-␤1 and bear functional receptors for the growth fac-
tor (Fiorelli et al., 1994). Interestingly, both TGF-␤1 and
phorbol ester appear to induce aromatase mRNA expres-
sion in a transient fashion, however, enzyme activity although
time-dependently modulated by the different agents, are de-
tectable. However, cAMP was ineffective in stimulating aro-
matase activity in both cells of FLG 29.1 cells and hOB cells.
Thus, it can be speculated that the induction of aromatase
gene is probably mediated by protein kinase C-dependent
transcriptional mechanism. In fact, TPA is well known acti-
vators of protein kinase C-dependent early gene transcription
(Treisman, 1986; Nishizuka, 1984). In addition, there is in-
creasing evidence that also TGF-␤ action can be transduced
by phosphorylation events (Purohit et al., 1992).
On the other hand, serum levels of estrogens have been
found to be normal in RA patients and synovial fluid levels
(SF) of proinflammatory estrogens relative to androgens are
significantly elevated in RA patients (Cutolo et al., 2003).
The increased estrogen concentrations observed in RA SF
are characterized mainly by the hydroxylated forms, in par-
ticular 16 ␣-hydroxyestrone, having a mitogenic stimulat-
ing role, suggesting that steroid pre-hormones are converted
to pro-inflammatory estrogens in the synovial tissue in the
presence of inflammatory cytokines. It was also reported
that 17-␤ estradiol (E2) enhances the expression of mark-
ers of cell growth and proliferation (Cutolo et al., 2003).
Recently, the same group reported that the increased estro-
gen concentration observed in RA SF is characterized by
the hydroxylated forms, in particular 16␣-hydroxyestrone,
that is a mitogenic and proliferative endogenous hormone
(Cutolo et al., 2004). In contrast to 16␣-hydroxylated es-
trogens, the 2-hydroxylated forms inhibit growth promoting
effects of E2 and were found low in RA SF. Therefore, it
was suggested that dose-related conversion to pro- or anti-
inflammatory downstream metabolites of estrogens might
support the dual role of estrogens (pro- or anti-inflammatory)
for example during estrogen replacement therapy, depending
on local concentration (i.e. SF in RA) of 16␣-hydroxyestrone
or 2-hydroxyestrogens. The presence in the RA SF of an
altered sex hormone balance resulting in lower immuno-
suppressive androgens and higher immunoenhancing estro-
gens, might determine a favorable condition for the devel-
opment of the immunomediated RA synovitis and synovial
hyperplasia.
In conclusion, the present results clearly demonstrated that
the BVA strongly stimulated aromatase activation in FLG19.1
and hOB cells in vitro, allowing possible in vitro estrogen
production by bone-derived cells, as also demonstrated in
cells of the osteoblastic lineage (Tanaka et al., 1993; Nawata
et al., 1995; Centrella et al., 1994; Fiorelli et al., 1998). The
results also explain that BVA is mechanistically effective for
the bone metabolism.
Acknowledgment
This work was supported by National Research Labora-
tory Program (2002-2007) of Ministry of Science and Tech-
nology, Korean.
 K.-S. Kim et al. / Journal of Ethnopharmacology 99 (2005) 245–252
References
Asano, K., Matsuishi, J., Yu, Y., Kasahara, T., Hisamitsu, T., 1998. Sup-
pressive effects of Tripterygium wilfordii Hook f, a Chinese traditional
medicine, on collagen arthritis. Immunopharmacology 39, 117–126.
Buzdar, A.U., 2001. A summary of second-line randomized studies of
aromatase inhibitors. Journal of Steroid Biochemistry and Molecular
Biology 79, 109–114.
Cutolo, M., Capellino, S., Montagna, P., Villaggio, B., Sulli, A., Seriolo,
B., Straub, R.H., 2003. New roles for estrogens in rheumatoid arthritis.
Clinical and Experimental Rheumatology 21, 687–690.
Cutolo, M., Villaggio, B., Seriolo, B., Montagna, P., Capellino, S., Straub,
R.H., Sulli, A., 2004. Synovial fluid estrogens in rheumatoid arthritis.
Autoimmunology Review 3, 193–198.
Feldmann, M., Brennan, F.M., Maini, R.N., 1996. Role of cytokines in
rheumatoid arthritis. Annual Review of Immunology 14, 397–440.
Centrella, M., Horowitz, M.C., Wozney, J.M., McCarthy, T.L., 1994.
Transforming growth factor-␤b gene family members and bone. En-
docrinology Review 15, 27–39.
Fiorelli, G.R., Ballock, T., Wakefield, L.M., Sporn, M.B., Gori, F., Masi,
L., Frediani, U., Tanini, A., Bernabei, P.A., Brandi, M.L., 1994.
Role for autocrine TGF-␤ 1 in regulating differentiation of a human
leukemic cell line toward osteoclast-like cells. Journal of Cellular
Physiology 160, 482–490.
Fiorelli, G., Frediani, U., Martineti, V., Franchi, A., Gori, F.,
Franceschelli, F., Tanini, A., Serio, M., Brandi, M.L., 1998. Aromatase
expression and activity in the human leukaemic cell line FLG 29.1.
Journal of Steroid Biochemistry and Molecular Biology 66, 105–112.
Firestein, G.S., Zvaifler, N.J., 1990. How important are T cells in chronic
rheumatoid synovitis? Arthritis and Rheumatism 33, 768–773.
Gattei, V., Bernabei, P.A., Pinto, A., Bezzini, R., Ringressi, A., Formigli,
L., Tanini, A., Attadia, V., Brandi, M.L., 1992. Phorbol ester induced
osteoclast-like differentiation of a novel human leukemic cell line
(FLG 29.1). Journal of Cell Biology 116, 437–447.
Grodin, J.M., Siiteri, P.K., MacDonald, P.C., 1973. Source of estrogen
production in the postmenopausal women. Journal of Clinical and
Endocrinological Metabolism 36, 207–214.
Harada, N., Utsumi, T., Takagi, Y., 1993. Tissue-specific expression of
the human aromatase cytochrome P-450 gene by alternative use of
multiple exons 1 and promoters, and switching of tissue-specific exons
1 in carcinogenesis. Proceeding of National Academy of Sciences of
U.S.A. 90, 11312–11316.
Hong, H.T., Kim, H.J., Kim, D.W., Lee, Y.C., Park, Y.G., Kim, H.M.,
Choo, Y.K., Kim, C.H., 2002. Inhibitory effect of a Korean traditional
medicine, Honghwain-Jahage (water extracts of Carthamus tinctorius
L. seed and Homminis placenta) on interleukin-1-mediated bone re-
sorption. Journal of Ethnopharmacology 79, 143–148.
Kim, K.W., Kim, S.W., Min, D.S., Kim, C.H., Lee, Y.C., 2001. Genomic
structure of human GM3 synthase gene (hST3Gal V) and identifi-
cation of mRNA isoforms on the 5 untranslated region. Gene 273,
163–171.
Koos, R.D., Banks, P.K., Inkster, S.E., Yue, W., Brodie, A.M., 1993.
Detection of aromatase and keratinocyte growth factor expression in
breast tumors using reverse transcription-polymerase chain reaction.
Journal of Steroid Biochemistry and Molecular Biology 45, 217–
225.
Kwon, Y.B., Lee, J.D., Lee, H.J., Han, H.J., Mar, W.C., Kang, S.K., Beitz,
A.J., Lee, J.H., 2001. Bee venom injection into an acupuncture point
reduces arthritis associated edema and nociceptive responses. Pain 90,
271–280.
Kwon, Y.B., Lee, H.J., Han, H.J., Mar, W.C., Kang, S.K., Yoon, O.B.,
Beitz, A.J., Lee, J.H., 2002. The water-soluble fraction of bee venom
produces antinociceptive and anti-inflammatory effects on rheumatoid
arthritis in rats. Life Sciences 71, 191–204.
Means, G.D., Mahendroo, M.S., Corbin, C.J., Mathis, J.M., Powell, F.E.,
Mendelson, C.R., Simpson, E.R., 1989. Structural analysis of the gene
encoding human aromatase cytochrome P-450, the enzyme responsi-
251
ble for estrogen biosynthesis. Journal of Biological Chemistry 264,
19385–19391.
Nawata, H., Tanaka, S., Tanaka, S., Takayanagi, R., Sakai, Y., Yanase,
T., Ikuyama, S., Haji, M., 1995. Aromatase in bone cell: associa-
tion with osteoporosis in postmenopausal women. Journal of Steroid
Biochemistry and Molecular Biology 53, 165–174.
Nestler, J.E., 1993. Interleukin-1 stimulates the aromatase activity of hu-
man placental cytotrophoblasts. Endocrinology 132, 566–570.
Nishizuka, Y., 1984. The role of protein kinase C in cell surface signal
transduction and tumor promotion. Nature 308, 693–698.
Panayi, G.S., Lachburry, J.S., Kingsley, J.S., 1992. The importance of the
T cell in initiating and maintaining the chronic synovitis of rheumatoid
arthritis. Arthritis and Rheumatism 35, 729–736.
Park, W.H., Kim, S.H., Kim, C.H., 2005. A new matrix metalloproteinase-
9 inhibitor 3, 4-dihydroxycinnamic acid (caffeic acid) from methanol
extract of Euonymus alatus: isolation and structure determination.
Toxicology 207, 383–390.
Purohit, A., Flanagan, A.M., Reed, M.J., 1992. Estrogen synthesis by
osteoblast cell lines. Endocrinology 131, 2027–2029.
Shim, G.J., Warner, M., Kim, H.J., Andersson, S., Liu, L., Ekman, J.,
Imamov, O., Jones, M.E., Simpson, E.R., Gustafsson, J.A., 2004.
Aromatase-deficient mice spontaneously develop a lymphoprolifera-
tive autoimmune disease resembling Sjogren’s syndrome. Proceed-
ings of the National Academy of Sciences U.S.A. 101, 12628–
12633.
Shin, Y.S., 2002. Bee venom produces antinociceptive and anti-
inflammatory effects on rheumatoid arthritis in rats. Thesis for Master
Degree, Dongguk University Graduate School, Kyungju, Korea.
Shozu, M., Sumitani, H., Murakami, K., Segawa, T., Yang, H.J., Inoue,
M., 2001. Regulation of aromatase activity in bone-derived cells: pos-
sible role of mitogen-activated protein kinase. Journal of Steroid Bio-
chemistry and Molecular Biology 79, 61–65.
Siggelkow, H., Rebenstorff, K., Kurre, W., Niedhart, C., Engel, I., Schulz,
H., Atkinson, M.J., Hufner, M., 1999. Developmental of the osteoblast
phenotype in primary human osteoblasts in culture: comparison with
rat calvarial cells in osteoblast differentiation. Journal of Cellular Bio-
chemistry 75, 22–35.
Simpson, E.R., Ackerman, G.E., Smith, M.E., Mendelson, C.R., 1981. Es-
trogen formation in stromal cells of adipose tissue of women: induc-
tion of glucocorticoids. Proceeding of National Academy of Sciences
of U.S.A. 78, 5690–5694.
Simpson, E.R., Merrill, J.C., Hollub, A.J., Graham-Lorence, S., Mendel-
son, C.R., 1989. Regulation of estrogen biosynthesis by human adi-
pose cells. Endocrinology Review 10, 136–148.
Simpson, E.R., Mahendroo, M.S., Means, D., Kilgore, M.W., Hinshel-
wood, M.M., Graham-Lorence, S., Amarneh, B., Ito, Y., Fisher, C.R.,
Michael, D., Mendelson, C.R., Bulun, S.E., 1994. Aromatase cy-
tochrome P450, the enzyme responsible for estrogen biosynthesis.
Endocrinology Review 15, 342–355.
Steele, R.E., Mellor, L.B., Sawyer, W.K., Wasvary, J.M., Browne, L.J.,
1987. In vitro and in vivo studies demonstrating potent and se-
lective estrogen inhibition with the nonsteroidal aromatase inhibitor
CGS16949A. Steroids 50, 147–161.
Tanaka, S., Haji, M., Nishi, Y., Yanase, T., Takayanagi, R., Nawata, H.,
1993. Aromatase activity in human osteoblast-like osteosarcoma cell.
Calcified Tissue International 52, 107–109.
Treisman, R., 1986. Identification of a protein-binding site that mediates
transcriptional response of the c-fos gene to serum factors. Cell 46,
567–574.
Weidler, C., Harle, P., Schedel, J., Schmidt, M., Scholmerich, J., Straub,
R.H., 2004. Patients with rheumatoid arthritis and systemic lupus ery-
thematosus have increased renal excretion of mitogenic estrogens in
relation to endogenous antiestrogens. Journal of Rheumatology 31,
489–494.
Weinblatt, M.E., Coblyn, J.S., Fraser, P.A., 1987. Cyclosporin A treat-
ment of refractory rheumatoid arthritis. Arthritis and Rheumatism 30,
11–17.
252 K.-S. Kim et al. / Journal of Ethnopharmacology 99 (2005) 245–252

Winter, C.A., Risley, E.A., Nuss, G.W., 1962. Carrageenan-induced edema
in hind paw of the rat as an assay for antiinflammatory drugs. Pro-
ceedings of the Society of Experimental Biology and Medicine 111,
544–547.
Yoneda, T., Ishimaru, N., Arakaki, R., Kobayashi, M., Izawa, T.,
Moriyama, K., Hayashi, Y., 2004. Estrogen deficiency accelerates
murine autoimmune arthritis associated with receptor activator of nu-
clear factor-kappa B ligand-mediated osteoclastogenesis. Endocrinol-
ogy 145, 2384–2391.
Yocum, D.E., 1994. The use of immunomodulators in early rheuma-
toid arthritis. Seminars in Arthritis and Rheumatism 23, 44–
49.
 Journal of Ethnopharmacology 99 (2005) 253–257

Antibacterial properties of common herbal remedies of the southwest

Christopher David Romero, Suzzette Fontenelle Chopin ∗ , Gregory Buck,
Elvia Martinez, Michelle Garcia, Lisa Bixby
Texas A and M University-Corpus Christi, Physical and Life Sciences, 6300 Ocean Drive, CS 130D, Corpus Christi, TX 78412, USA

Received 26 August 2004; received in revised form 11 February 2005; accepted 17 February 2005
Available online 7 April 2005

Abstract

Curanderismo, widely practiced in the southwest, is an alternative medical system that has been neglected by scientific research. This project
analyzed the antibiotic properties of 23 common herbal remedies used in South Texas to treat wounds and infections. Ethanolic tinctures
and aqueous extracts of each plant were prepared and applied to blank diffusion disks. These disks were desiccated and used in Kirby-Bauer
disk diffusion susceptibility tests on three bacteria: Staphylococcus aureus, Pseudomonas aeruginosa, and Escherichia coli. Control disks
contained solvent only. The efficacy of the tinctures and aqueous extracts was compared to that of commercially prepared antibiotic diffusion
disks. No inhibition was observed with the aqueous extracts. The various tincture-saturated disks produced zones of clearance ranging from 1
to 5 mm. Ten plants consistently inhibited bacterial growth of Staphylococcus aureus. None of the plants tested produced consistent inhibition
of the two Gram-negative species, Pseudomonas aeruginosa and Escherichia coli. No zones of clearance were produced by the solvent-only
control disks. The zones of clearance produced by commercial antibiotics were, on average, larger and more uniform than those produced by
the tincture disks. Thus, it appears that some of the herbal remedies used in folk medicine are potentially effective antibacterial agents against
Staphylococcus aureus.
© 2005 Elsevier Ireland Ltd. All rights reserved.

Keywords: Antibacterial activity; Herbal remedies; Curanderismo; Folk medicine

1. Introduction
The use of complementary and alternative medicine
(CAM) has increased dramatically over the past 15 years.
In 1990, an estimated 34% of Americans used some form of
CAM, spending $14 billion dollars out of pocket (Eisenberg
et al., 1998). By 1997, this figure had jumped to 42% of the
U.S. population using CAM, at a cost of $34 billion dollars
(Eisenberg et al., 1998). By 1998, visits to CAM providers
had risen to 629 million (Neal, 2001). This trend is expected
to increase within the United States. Reliable scientific in-
formation about the safety and efficacy of such treatments is
lacking. One CAM modality that has received little attention
is Curanderismo. This health care system has evolved within
the Hispanic communities of North America since Spanish
colonialism. It is a blend of indigenous beliefs and practices
∗ Corresponding author. Tel.: +1 361 825 6022; fax: +1 361 825 3719.
E-mail address: schopin@falcon.tamucc.edu (S.F. Chopin).
with Spanish herbal lore and Catholicism. This vibrant sys-
tem has roots in Moorish Spain, Grecian humoral medicine,
and Aztecan mythology. Curanderismo is not a static
system; it has continued its evolution and now often
incorporates allopathic pharmaceuticals (Trotter, 2001). The
acceptance of Curanderismo in predominantly Hispanic
communities throughout the United States is still very high
(Trotter, 2001). A survey of Hispanic outpatients in Denver
Colorado showed that 91.3% of them were familiar with
Curanderismo, and 29.1% had been to a Curandero (Padilla
et al., 2001). This is probably an under-representation of
usage within the Hispanic community because for many
individuals, Curanderismo is the primary and sole form
of health care. Thus, this survey, which was taken in a
clinic, missed the most devout and dependent users of
Curanderismo. One of the main tools used for healing within
Curanderismo is herbal remedy. Many of these remedies are
used to treat conditions that commonly result from bacterial
infections of the gastrointestinal and urinary tracts and in

0378-8741/$ – see front matter © 2005 Elsevier Ireland Ltd. All rights reserved.
doi:10.1016/j.jep.2005.02.028
254 C.D. Romero et al. / Journal of Ethnopharmacology 99 (2005) 253–257
wound infections. The aim of this study was to determine
if these treatments were efficacious through direct antibac-
terial actions. Aqueous and ethanolic plant extracts were
evaluated using Kirby-Bauer disk diffusion susceptibility
tests against three common bacteria: Staphylococcus aureus,
Pseudomonas aeruginosa, and Escherichia coli.
2. Materials and methods
2.1. Plant material
Herbs used in this study were selected based upon his-
torical use, anecdotal evidence, and availability. Family
members and local herbalists were consulted for their ad-
vice on plant selection. Leonardo Carillo, Ph.D., a pro-
fessor of Mexican–American studies and an expert in
Mexican–American folk medicine, provided initial guidance
in plant selection. Frank Fregoso, a respected figure in the
Hispanic community of Corpus Christi and herbal purveyor,
also supplied direction. In addition, several texts (Moore,
1990; Gruenwald, 1998; Peirce, 1999; WHO, 1999, 2001)
were used as references for determining the accepted tradi-
tional usage of the plants tested. All plants tested were re-
ported as being anti-infectives.
The following plants were analyzed using fresh sam-
ples: Artemisia ludoviciana (Asteraceae), Castela emoryi
(Simaroubaceae), Chenopodium ambrosioides (Chenopo-
diaceas), Equisetum hyemale (Equisetaceae), Leucophyl-
lum frutescens (Scrophulariaceae), Rosmarinus officinalis
(Lamiaceae), Salvia farinacea (Lamiaceae), Salvia greg-
gii (Lamiaceae), Salvia leucantha (Lamiaceae), Salvia
officinalis (Lamiaceae), Salvia sinaloensis (Lamiaceae),
Spilanthes acmella (Asteraceae), Tagetes lucida (Aster-
aceae/Compositae).
The following plants were analyzed using desiccated sam-
ples: Achillea millefolium (Asteraceae), Berberis vulgaris
(Berberidaceae), Commiphora molmol (Burseraceae), Echi-
nacea purpurea (Asteraceae/Compositae), Galium aparine
(Rubiaceae), Glycyrrhiza glabra (Fabaceae), Matricaria
chamomilla (Asteraceae), Pimenta dioica (Myrtaceae), Un-
caria tomentosa (Rubiaceae), Zea mays (Poaceae).
The plant samples used in this experiment were obtained
from a variety of sources. Some were purchased live from
nurseries and maintained in the University’s greenhouse.
Plants obtained from commercial nurseries were reported
to be pesticide free. Others were gathered from the Laguna
Atascosa National Wildlife Refuge in South Texas with per-
mission from the refuge. Some of the plant samples were
purchased in whole, dried form at health food stores and folk
healing shops in Corpus Christi. Tammy White, Texas A&M
University-Corpus Christi’s resident botanist, authenticated
live plant specimens. The portions of the living plants used
in this study were not desiccated prior to testing at the advice
of folk healers within the community.
2.2. Tincture preparation
Tinctures of the 23 herbs were prepared for the disk dif-
fusion test. The active portion of each plant sample was pul-
verized in 95% ethanol using a mortar and pestle. Bark sam-
ples were macerated in a coffee grinder before they were
pulverized. The samples were then placed into individual
jars and additional ethanol was added until the samples were
fully saturated. The final volume of ethanol was recorded but
varied among the samples due to variations in absorbance
between the plant materials. The labelled jars were stored
in the dark at room temperature for one week and agitated
daily to facilitate extraction. Tinctures were not filtered prior
to use to prevent the exclusion of any potentially active
constituents.
2.3. Aqueous preparation
Aqueous extracts were made from the 10 plants that pro-
duced clearance in the ethanolic analysis. Two to three grams
of plant material was placed in 100 ml of 100 ◦ C sterile de-
ionized water (DI H2 O). The plant material was allowed to
steep in the water for up to 10 min with the temperature
maintained at 100 ◦ C and then returned to room tempera-
ture. Aqueous extracts were stored at 3 ◦ C and used within
24 h of preparation.
2.4. Disk preparation
Sterile blank diffusion disks were weighed and placed
into labelled trays for each tincture or aqueous extract.
Each disk was saturated with 25 ␮l of an individual ethanol
tincture or aqueous extract. After the solvent had fully
evaporated, the disks were re-weighed and the extract
concentrations were calculated (Table 1). Control disks were
prepared by saturating sterile blank disks in either ethanol
or sterile DI H2 O and allowing all the solvent to evaporate.
Commercially available antibiotic diffusion disks were used
as standards for comparison. Ten micrograms of ampicillin
was used on Escherichia coli, 30 ␮g of cefotaxime was used
against Pseudomonas aeruginosa, and 30 ␮g of vancomycin
was used on Staphylococcus aureus.
2.5. Kirby-Bauer disk diffusion susceptibility testing
2.5.1. Bacterial dilutions
Isolated colonies of the three bacteria were placed into in-
dividual tubes containing 10 ml of room temperature, sterile
DI H2 O. The tubes were then adjusted to a turbidity of 0.5
McFarland Units by the addition of isolate colonies or sterile
DI H2 O. Turbidity was verified through spectrophotometry
comparison with a 0.5 McFarland Standard. The dilutions
were used within 15 min of their preparation and were vor-
texed prior to each use.
 C.D. Romero et al. / Journal of Ethnopharmacology 99 (2005) 253–257 255

Table 1
Average clearance for 10 effective ethanol tinctures
Kirby-Bauer disk diffusion susceptibility analysis results: effective plants Average zone clearance diameter (mm)
Plant tested Common name Portion used Average Staphylococcus Escherichia coli Pseudomonas
concentration aureus aeruginosa
(␮g/␮l)
12 h 18 h 12 h 18 h 12 h 18 h
Achillea millefoliuma Yarrow Stems/flowers 26 2.5 2.5 0 0 0 0
Berberis vulgarisa Barberry Bark 18 1 1 0 0 0 0
Commiphora molmola Myrrh Resin 192 1 1 0 0 0 0
Galium aparinea Cleavers Stems 27 2 2 0 0 0 0
Glycyrrhiza glabraa Licorice root Root 21 2 2.5 0 0 0.5 0.5
Matricaria chamomillaa Chamomile Flowers 27 3 3 0 0 0 0
Pimenta dioicaa Allspice Dried berries 45 1 1 0 0 0.5 0
Salvia greggiib Autumn sage Leaves 12 1 1 0 0 0 0
Uncaria tomentosaa Cat’s claw Bark 29 1 1 0 0 0 0
Zea maysa Corn silk Silk 28 1 1 0 0 0 0
a Desiccated plant material tested.
b Fresh plant material tested.

2.5.2. Disk diffusion analysis
One hundred fifty millimetre plates of Mueller Hinton agar
were inoculated using sterile swabs with the bacterial dilu-
tions. Inoculations were done along three axes in a rolling
motion to ensure uniform bacterial distribution and growth.
After the plates were labelled, the disks were placed on the
surface of the agar along with a commercial antibiotic and a
solvent control disk. The plates were inverted and incubated
at 35 ◦ C. Observations were made at 12 and 18 h. Measure-
ments were made from the outer edge of the disks to the inner
edge of any zones of clearance produced. Six trials were con-
ducted for each plant species on the three bacteria.
Solvent-only and commercially prepared antibiotic (ampi-
cillin, cefotaxime and vancomycin) diffusion disks were used
as controls.
3. Results and discussion
No zones of clearance were produced by the solvent-only
control disks (Table 2). The zones of clearance produced
by commercial antibiotics were, on average, larger and
more uniform than those produced by the tincture disks
(Tables 1 and 2). Ten of the ethanol extracts tested pro-
duced consistent zones of clearance on Staphylococcus
aureus (Table 1). None of the aqueous extracts produced
zones of clearance. Consistent zones of clearance were
Table 2
Average clearance zone diameters for control disks
Kirby-Bauer disk diffusion susceptibility analysis
results: controls
Controls Average concentration ( ␮g)
not produced on either Escherichia coli or Pseudomonas
aeruginosa.
A. millefolium (yarrow) produced an average zone of
clearance measuring 2.5 mm with a range of 1–3 mm.
Berberis vulgaris (barberry) produced consistent zones of
clearance measuring 1 mm. Clearance with Commiphora
molmol (myrrh) ranged from slight to 1 mm clearance.
Galium aparine (cleavers) produced an average zone of
clearance of 2 mm with a range of 1–3 mm. Glycyrrhiza
glabra (licorice root) produced an average zone of clearance
measuring 2.5 mm with a range of 2–3 mm.
Matricaria chamomilla (chamomile) produced a 2.5 mm
average zone of clearance with a range of 1.5–4 mm. Pi-
menta dioica (allspice) produced an average zone of clear-
ance measuring 1 mm with a range of slight inhibition to
2 mm of clearance. Salvia greggii (autumn sage) produced
consistent zones of clearance measuring 1 mm. Uncaria to-
mentosa (cat’s claw) produced an average zone of clearance
measuring 1 mm with a range of 0.5–1 mm. Zea mays (corn
silk) produced an average zone of clearance measuring 1 mm
with a range of no clearance to 2 mm.
The ineffectiveness of some tinctures might reflect the
lack of antibacterial compounds in the plants. However, the
observed lack of bacterial inhibition might be attributed to the
season at which the plants were harvested or the conditions in
which they grew. Soil composition and seasonal variations in
temperature, light and water availability can greatly influence
Average zone clearance diameter (mm)
Staphylococcus aureus Escherichia coli Pseudomonas aeruginosa

12 h 18 h 12 h 18 h 12 h 18 h
Ethanol n/a 0 0 0 0 0 0
Ampicillin 10 n/a n/a 9 9 n/a n/a
Cefotaxime 30 n/a n/a n/a n/a 8 8
Vancomycin 30 6 6 n/a n/a n/a n/a
256 C.D. Romero et al. / Journal of Ethnopharmacology 99 (2005) 253–257
the biochemical composition of plants. It is also possible that
the active chemical constituents might not have been soluble
in ethanol or water.
The plant material obtained from folk healing shops
could not be fully authenticated. In 1994, Congress passed
the Dietary Supplement Health and Education Act, which
classified herbal remedies as supplements and restricted
FDA control to ensuring that these supplements do not claim
to affect disease. Thus, unlike Germany and Japan the United
States does not regulate the production process for herbal
products.
Another confounding factor was that the plant material
obtained from health food stores and folk healing shops
was desiccated, whereas the plant material used from
living specimens was not. The drying process may cause
conformational changes to occur in some of the chemical
constituents found in these herbs. Thus, both fresh and
dried plant material should be tested to determine if such
a difference exists. The active factor would be expected to
be more concentrated in dried preparations than in fresh
plant material, and in this study desiccated samples were on
average more efficacious. Some herbalists consulted about
plant selection believed that herbs obtained from traditional
folk healing shops would be more efficacious than those from
health food stores, but such differences were not noted in this
study.
Many of the antibiotic compounds already identified in
herbs are aromatic or saturated organic molecules, making
ethanol an ideal solvent (Cowan, 1999). It is common in Cu-
randerismo for herbal tinctures to be made using grain al-
cohol or Tequila, setting a precedent for ethanol extraction.
However, the most common mode of use in the community
is as an aqueous tea. The method of plant extract preparation
did mirror traditional preparation techniques with the excep-
tion that a higher concentration of ethanol was employed and
preparation was conducted in an aseptic fashion. None of the
aqueous extracts produced zones of inhibition in the Kirby-
Bauer analysis. This might have resulted from the lack of
solubility of the active constituents in aqueous solutions, or,
perhaps, the hot water denatured such constituents. In either
event, these results call into question the efficacy of herbal
teas made from these plants. Future trials using solvents of
various polarities will explore the effects of solvent compo-
sition on extract efficacy.
It is quite possible that some of the plants that were in-
effective in this study do not possess antibiotic properties.
Some plants produced slight to moderate bacterial inhibition
(1–5 mm) but did so inconsistently and without any true clear-
ance. A possible explanation for this is that some of the plant
extracts may have contained antibacterial constituents, but
were not present in sufficient concentrations to be effective.
Some of the plants tested were selected for their history of
treating gastrointestinal infections. Such infections might not
have bacterial etiologies, but rather be caused by viral or pro-
tozoan infections. These herbal remedies might very well be
effective in treating viral or protozoan gastrointestinal infec-
tions, but ineffective against bacterial infections. In addition,
this study did not address the issue of metabolite efficacy.
Once metabolized by the human body, the metabolites of the
extracts may become effective.
Minimal inhibition concentration assays will be run to de-
termine the concentration at which the extracts are effective.
The two Gram-negative species of bacteria were relatively
resistant to all of the tinctures tested, suggesting that the bac-
tericidal effect might be related to the peptidoglycan layer
in Gram-positive cell walls. Alternatively, the passage of the
active compound through the Gram-negative cell wall may
be inhibited. Other bacterial species will be used to deter-
mine if the tinctures are selectively effective against Gram-
positive bacteria. Additional plants used medicinally in the
southwest will also be studied, as will the chemical compo-
sition of the efficacious plants. This research highlights the
pressing need for further investigation into indigenous and
CAM therapies. The use of such treatments has far outpaced
the amount of scientific information available to consumers
and health care providers. A precarious environment exists
where patient safety is jeopardized because of a lack of qual-
ity research. One example is the negative and potentially life
threatening interaction between St. John’s wort and alpra-
zolam (Markowitz et al., 2003). Other examples include the
bleeding associated with Ginkgo biloba (Rowin and Lewis,
1996; Gilbert, 1997; Vale, 1998).
Another concern is that patients often do not report their
CAM usage to their physicians (Giveon et al., 2004). This
situation becomes even more critical in the Hispanic com-
munity. For many Hispanics language and cultural barriers
prevent them from receiving proper health care (Duggleby,
2003). This sense of alienation and economic constraints
cause portions of the Hispanic population to depend solely
on Curanderismo for their health care. The more information
available about the efficacy and limitations of Curanderismo,
the better health care providers can treat those individuals
who rely so heavily upon it.
Antibiotic resistance has become a global concern (Westh
et al., 2004). In a recent study done in New York City, up to
50% of Streptococcus pneumonia isolates obtained from two
institutions were resistant to erythromycin (Lin et al., 2004).
Since its emergence in 1961, methicillin-resistant Staphylo-
coccus aureus (MRSA) has spread to nearly every continent,
reaching near epidemic proportions in some countries becom-
ing one of the most common pathogens in hospitals world-
wide (Aires de Sousa and de Lencastre, 2004). Numerous
studies have identified compounds within herbal plants that
are effective antibiotics (Basile et al., 2000; Cowan, 1999).
Traditional healing systems around the world that utilize
herbal remedies are an important resource for the discov-
ery of new antibiotics (Okpekon et al., 2004); some tradi-
tional remedies have already produced compounds that are
effective against antibiotic-resistant strains of bacteria (Koné
et al., 2004; Sato et al., 2000). The results of this study in-
dicate the need for further research into traditional health
systems.
 C.D. Romero et al. / Journal of Ethnopharmacology 99 (2005) 253–257
4. Conclusions
Several of the herbs used by Curanderismo in the south-
west exhibit some degree of antibacterial activity towards
Staphylococcus aureus. These herbs include A. millefolium,
Berberis vulgaris, Commiphora molmol, Galium aparine,
Glycyrrhiza glabra, Matricaria chamomilla, Pimenta dioica,
Salvia greggii, Uncaria tomentosa, and Zea mays. None
of the plants tested in this study consistently inhibited the
growth of Pseudomonas aeruginosa or Escherichia coli.
Further research is necessary to determine the identity of the
antibacterial compounds found within these plants and also
to determine their full spectrum of efficacy.
Acknowledgments
National Science Foundation grants #0139195, #0331686
and #9624602; Texas A&M University-Corpus Christi;
Leonardo Carillo, PhD; Lillian Waldbaser, PhD; Tammy
White, M.S.; Laguna Atascosa National Wildlife Refuge;
Frank Fregoso of Tex-Mex Curios Inc.
References
Aires de Sousa, M., de Lencastre, H., 2004. Bridges from hospitals to
the laboratory: genetic portraits of methicillin-resistant Staphylococcus
aureus clones. FEMS Immunology and Medical Microbiology 40,
101–111.
Basile, A., Sorbo, S., Giordano, S., Ricciardi, L., Ferrara, S., Montesano,
D., Castaldo Cobianchi, R., Vuotto, M.L., Ferrara, L., 2000. Antibac-
terial and allelopathic activity of extract from Castanea sativa leaves.
Fitoterapia 71, 110–116.
Cowan, M.M., 1999. Plant products as antimicrobial agents. Clinical Mi-
crobiology Reviews 12, 564–582.
Duggleby, W., 2003. Helping Hispanic/Latino home health patients man-
age their pain. Home Healthcare Nurse 21, 174–179.
Eisenberg, D.M., Davis, R.B., Ettner, S.L., Appel, S., Wilkey, S., Van
Rompay, M., Kessler, R.C., 1998. Trends in alternative medicine use
in the United States, 1990–1997: results of a follow-up national sur-
vey. Journal of the American Medical Association 11, 1569–1575.
Gilbert, G., 1997. Ginkgo biloba (Correspondence). Neurology 4, 1137.
Giveon, S.M., Liberman, N., Klang, S., Kahan, E., 2004. Are people who
use “natural drugs” aware of their potentially harmful side effects and
reporting to family physician? Patient Education and Counseling 53,
5–11.
257
Gruenwald, J. (Ed.), 1998. Physicians Desk Reference for Herbal
Medicines, 2nd ed. Medical Economics, Montvale, NJ.
Koné, W.M., Kamanzi Atindehou, K., Terreaux, C., Hostettmann, K.,
Traoré, D., Dosso, M., 2004. Traditional medicine in North Côte-
d’Ivoire: screening of 50 medicinal plants for antibacterial activity.
Journal of Ethnopharmacology 93, 43–49.
Lin, K., Tierno, P.M., Komisar, A., 2004. Increasing antibiotic resis-
tance of streptococcus species in New York City. Laryngoscope 114,
1147–1150.
Markowitz, J.S., Donovan, J.L., DeVane, C.L., Taylor, R.M., Ruan, Y.,
Wang, J.S., Chavin, K.D., 2003. Effect of St John’s wort on drug
metabolism by induction of cytochrome P450 3A4 enzyme. Journal
of the American Medical Association 290, 1500–1504.
Moore, M., 1990. Los Remedios: Traditional Herbal Remedies of the
Southwest. Red Crane Books, Santa Fe.
Neal, R., 2001. Report by David M. Eisenberg, M.D., on complementary
and alternative medicine in the United States: overview and patterns
of use. Journal of Alternative and Complementary Medicine 7, 19–21.
Okpekon, T., Yolou, S., Gleye, C., Roblot, F., Loiseau, P., Bories, C.,
Grellier, P., Frappier, F., Laurens, A., Hocquemiller, R., 2004. An-
tiparasitic activities of medicinal plants used in Ivory Coast. Journal
of Ethnopharmacology 90, 91–97.
Padilla, R., Gomez, V., Biggerstaff, S.L., Mehler, P.S., 2001. Use of cu-
randerismo inapublic healthcare system. Archives of Internal Medicine
161, 1336–1340.
Peirce, A., 1999. Practical Guide to Natural Medicines. William Morrow
and Company, Inc., New York.
Rowin, J., Lewis, S., 1996. Spontaneous bilateral subdural hematomas
associated with chronic Ginkgo biloba ingestion. Neurology 46,
1775–1776.
Sato, Y., Suzaki, S., Nishikawa, T., Kihara, M., Shibata, H., Higuti, T.,
2000. Phytochemical flavones isolated from Scutellaria barbata and
antibacterial activity against methicillin-resistant Staphylococcus au-
reus. Journal of Ethnopharmacology 72, 483–488.
Trotter, R.T., 2001. Curanderismo: a picture of Mexican-American folk
healing. The Journal of Alternative and Complementary Medicine 7,
129–131.
Vale, S., 1998. Subarachnoid haemorrhage associated with Ginkgo biloba.
Lancet 352, 3.
Westh, H., Zinn, C.S., Rosdahl, V.T., Sarisa Study Group, 2004. An inter-
national multicenter study of antimicrobial consumption and resistance
in Staphylococcus aureus isolates from 15 hospitals in 14 countries.
Microbial Drug Resistance 10, 169–176.
WHO, 1999. WHO monographs on selected medicinal plants. Vol. 1.
World Health Organization, Geneva: (http://www.who.int/medicines/
library/trm/medicinalplants/monograph volume one.shtml).
WHO, 2001. WHO monographs on selected medicinal plants. Vol. 2.
World Health Organization, Geneva: (http://www.who.int/medicines/
library/trm/medicinalplants/monograph volume two.shtml).
 Journal of Ethnopharmacology 99 (2005) 259–264

Antioxidant phenolic constituents from Fagopyrum dibotrys

Kai-Jin Wang, Ying-Jun Zhang ∗ , Chong-Ren Yang ∗∗
State Key Laboratory of Phytochemistry and Plant Resources in West China, Kunming Institute of Botany,
Chinese Academy of Sciences, Kunming 650204, PR China

Received 14 October 2004; received in revised form 13 February 2005; accepted 19 February 2005
Available online 7 April 2005

Abstract

Fagopyrum dibotrys (D. Don.) Hara. is an erect perennial Polygonaceous herb. In China, its rhizome was used as folk medicine for
the treatment of lung diseases, dysentery and rheumatism. The crude aqueous acetone extract from the rhizomes of this plant exhibited high
antioxidant activity (SC50 = 10.95 ␮g/mL) in 1,1-diphenyl-2-picryldydrazyl (DPPH) radical scavenging assay. Detailed chemical investigation
on the extract led to the isolation of two new phenols (1 and 2), together with 14 known antioxidant phenolic compounds (3–16). Their
structures were determined by detailed spectroscopic analysis. The two new compounds were characterized as 3-methyl-gossypetin 8-O-
␤-d-glucopyranoside (1) and 1,3,6 -tri-p-coumaroyl-6-feruloyl sucrose (diboside A, 2). The radical scavenging activity of all the isolated
compounds was also described.
© 2005 Elsevier Ireland Ltd. All rights reserved.

Keywords: Fagopyrum dibotrys; Antioxidant phenolics; Diboside A; Flavonol glycoside

1. Introduction et al., 1994), but there are no reports on their antioxidant

The genus Fagopyrum (Polygonaceae), comprising of 15
species, is mainly distributed in the North Temperate Zone.
Eight species, including some common crops and medicinal
plants occur in China: buckwheat (Fagopyrum esculentum
Moench.), tartary buckwheat (Fagopyrum tartaricum (L.)
Gaertn.), Fagopyrum urophyllum (Bur. Et Franch.) H. Gross.,
etc. Fagopyrum dibotrys (D. Don.) Hara. is an erect perennial
herb, growing mainly in China, India, Vietnam, Thailand
and Nepal. Its rhizome was used as folk medicine in China
for the treatment of lung diseases, dysentery and rheumatism
(Editorial Board of Zhong Hua Ben Cao (China Herbal),
State Administration of Traditional Chinese Medicine,
1999). Previous chemical studies showed the presence of
some phenolics and other compounds in the rhizome, such
as hecogenin, ␤-sitosterol, p-coumaric acid, ferulic acid
and shakuchirin (Liu et al., 1983; Yao et al., 1989; Zhang
activity. Our preliminary experiment showed that the 60%
aqueous acetone extract of the rhizomes of Fagopyrum
dibotrys exhibited considerable antioxidant activity on
1,1-diphenyl-2-picryldydrazyl (DPPH) radical scavenging
assay. This observation propelled us to perform a detailed
bioassay-guided chemical investigation on this plant, which
led to the isolation of a new flavonol glycoside methyl ether
(1) and a new phenylpropanoid ester sucrose (2), together
with 14 known compounds. This paper describes the struc-
ture elucidation of the new compounds (1–2) on the basis of
spectroscopic method and the antioxidant activity of these
isolated compounds on DPPH radical scavenging assay.
2. Materials and methods
2.1. Plant material

∗
The dried rhizome of Fagopyrum dibotrys was bought
Corresponding author. Tel.: +86 871 5223235; fax: +86 871 5150124.
∗∗ Co-corresponding author.
from Kunming herbal medicinal market and identified by
E-mail addresses: zhangyj@mail.kib.ac.cn (Y.-J. Zhang), Prof. C. R. Yang, Kunming Institute of Botany, Chinese
cryang@mail.kib.ac.cn (C.-R. Yang). Academy of Sciences.

0378-8741/$ – see front matter © 2005 Elsevier Ireland Ltd. All rights reserved.
doi:10.1016/j.jep.2005.02.029
260 K.-J. Wang et al. / Journal of Ethnopharmacology 99 (2005) 259–264

2.2. General experimental procedures Table 1

1 H (400 MHz) and 13 C (100 MHz) NMR spectral data of 1 in DMSO-d
6

[␣]D was carried out on a JASCO-20 polarimeter. IR spec- No. C H (J in Hz)

tra were recorded on a Bio-Rad FTS-135 spectrometer with 2 155.4 (s)
KBr pellets. UV spectra were recorded on a UV 210A Shi- 3 137.5 (s)
madzu spectrometer. 1D- and 2D-NMR spectra were run on 4 177.5 (s)
4a 103.3 (s)
Bruker AM-400 and DRX-500 instruments with TMS as in- 5 157.0 (s) 12.55 (s, OH-5)
ternal standard. The MS data were recorded on a VG Auto 6 99.3 (d) 6.19 (1H, s)
Spec-3000 spectrometer. DPPH radical (Aldrich Chemical 7 157.0 (s)
Co.) scavenging assay was performed on Emax precision mi- 8 125.6 (s)
croplate reader. Column chromatography was performed on 8a 148.8 (s)
1 121.6 (s)
Diaion HP20SS (Mitsubishi Chemical Co.), MCI-gel CHP- 2 115.5 (d) 7.74 (1H, d, 2.00)
20P (75–150 ␮m, Mitsubishi Chemical Co.), Sephadex LH- 3 145.0 (s)
20 (25–100 ␮m, Pharmacia Fine Chemical Co. Ltd.), Chro- 4 148.5 (s)
matorex ODS (100–200 mesh, Fuji Silysia Chemical Co. 5 115.8 (d) 7.72 (1H, d, 8.15)
Ltd.), and Toyopearl HW-40F (37–70 ␮m, Tosoh Co.). TLC 6 121.1 (d) 6.90 (1H, dd, 2.00, 8.15)
3-OCH3 59.6 (q) 3.78 (3H, s)
was carried out on silica gel G precoated plates (Qingdao 1 106.7 (d) 4.59 (1H, d, 7.75)
Haiyang Chemical Co.) with benzene–ethyl formate–formic 2 74.2 (d)
acid (3:6:1). Spots were detected by spraying with ferric chlo- 3 76.2 (d)
ride (FeCl3 ) and 10% sulfuric acid reagents followed by heat- 4 69.3 (d)
ing. 5 77.2 (d)
6 60.6 (t) 3.15–3.72 (2H, m, overlapped)

2.3. Extraction and isolation

The dried rhizome (6.0 kg) of Fagopyrum dibotrys was ex-
tracted three times with 15 L of 60% aqueous acetone at room
temperature. The combined extract was concentrated under
reduced pressure to give a residue (600 g), which showed
SC50 value as 10.95 ␮g/mL on the DPPH assay. Accordingly,
further isolation was carried out.
The crude extract was applied to Diaion HP20SS col-
umn eluted with H2 O–MeOH (1:0–0:1) and then 50% ace-
tone to give nine fractions (A1 –A9 ). Fraction A7 was sub-
jected to column chromatography on Sephadex LH-20 eluted
with H2 O–MeOH (1:0–0:1) and EtOH to give 1 (10 mg),
4 (11 mg) and 5 (14 mg). A9 was separated by column
chromatography on Sephadex LH-20 (EtOH) and silica
gel (CH3 Cl–MeOH–H2 O, 10:1:0.1, lower layer) to give 2
(13 mg) and 3 (11 mg). Fraction A5 was chromatographed
on Sephadex LH-20 and Chromatorex ODS eluted with
H2 O–MeOH (1:0–0:1) to give 7 (150 mg), 15 (50 mg) and
16 (70 mg). A8 was subjected to column chromatography
on Sephadex LH-20 eluted with H2 O–MeOH (1:0–0:1) and
EtOH to give 6 (12 mg) and 8 (8 mg). A1 was separated by
column chromatography on Sephadex LH-20 eluted with
EtOH–H2 O (1:0–1:1) and Chromatorex ODS eluted with
H2 O–MeOH (1:0–0:1) to give 9 (100 mg) and 10 (20 mg).
A3 was repeatedly chromatographed on Sephadex LH-20,
Chromatorex ODS, MCI-gel CHP-20P and Toyopearl HW-
40F eluted with H2 O–MeOH (1:0–0:1) to give 11 (20 mg),
12 (17 mg), 13 (10 mg) and 14 (11 mg).
2.3.1. 3-Methyl-gossypetin 8-O-␤-d-glucopyranoside
(1)
◦ (0.095,
Yellow amorphous powder, [α]21 D + 31.58
DMSO); UV (MeOH) λmax (nm) (log ε): 203 (4.33), 278
(3.78); IR (KBr) νmax 3441, 2924 and 1629 cm−1 ; 1 H NMR
(400 MHz, DMSO-d6 ) and 13 C NMR (100 MHz, DMSO-
d6 ) see Table 1; negative ion HRFAB-MS m/z: 493.0977
[M − H]− , calcd. for [C22 H21 O13 ]− : 493.0982.
2.3.2. Diboside A (2)
◦
White amorphous powder, [α]21 D + 15.56
(0.68,
MeOH); UV (MeOH) λmax (nm) (log ε): 228 (4.16),
315 (4.40); IR (KBr) νmax 3400, 1700, 1630,
1515, 1268 and 1170 cm−1 ; 1 H NMR (500 MHz,
CD3 OD) and 13 C NMR (125 MHz, CD3 OD) data
see Table 2; negative FAB-MS m/z: 955 [M − H]− ,
809 [M − H − 146(coumaroyl)]− , 779 [M − H − 176
(feruloyl)]− , 663 [M − H − 146(coumaroyl)-146(coumaro-
yl)]− , 517 [M − H − 146(coumaroyl)-146(coumaroyl)-
146(coumaroyl)]− , 341 [M − H − 146(coumaroyl)-146(cou-
maroyl)-146 (coumaroyl)-176(feruloyl)]− ; negative ion
HRFAB-MS m/z: 955.2706 [M − H]− , calcd. for
[C49 H47 O20 ]− : 955.2660.
2.4. DPPH radical scavenging assay
The DPPH assay was performed as described (Yoshida
et al., 1989). In this assay, ascorbic acid was used as positive
control, reaction mixtures containing an ethanolic solution
of 200 ␮M DPPH (100 ␮L) and two-fold serial dilutions
of sample (dissolved in 100 ␮L ethanol, with amounts of
sample ranging from 2 to 1000 ␮g/mL) were placed in
a 96-well microplate and incubated at 37 ◦ C for 30 min.
After incubation, the absorbance was read at 517 nm by
an Emax precision microplate reader and mean value was
obtained from three duplicated readings. Scavenging activity
was determined by the following equation: % scavenging
 K.-J. Wang et al. / Journal of Ethnopharmacology 99 (2005) 259–264 261

Table 2 activity = 100 × (Acontrol − Asample )/Acontrol . The SC50 value

1H (500 MHz) and 13 C (100 MHz) NMR spectral data of 2 in CD3 OD was obtained through extrapolation from linear regression
No. 1H (J in Hz) 13 C
analysis and denoted the concentration of sample required
Fructose to scavenge 50% of DPPH radicals.
1 4.35 (2H, m) 66.3 t
2 103.4 s
3 5.67 (1H, d, 8.76) 79.3 d
4 4.74 (1H, m) 74.1 d
3. Results and discussion
5 4.23 (1H, m) 81.0 d
6 4.57 (2H, m) 65.5 t The 60% aqueous acetone extract of air-dried rhizomes
Glucose of Fagopyrum dibotrys exhibited obvious antioxidant ac-
1 5.59 (1H, d, 3.83) 92.9 d tivity (SC50 = 10.95 ␮g/mL) on DPPH radical scavenging
2 3.50 (1H, m) 72.9 d assay. The crude extract was further fractionated and pu-
3 3.69 (1H,m) 74.9 d rified over Diaion HP 20SS, Sephadex LH-20, Chroma-
4 3.30 (1H, m) 72.2 d
torex ODS, MCI-gel CHP-20P and silica gel to give two
5 3.32 (1H, m) 72.4 d
6 4.33 (1H, m), 4.73 (1H, m) 65.6 t new compounds 1 and 2, as well as 14 known compounds
(3–16). The known ones were identified as lapathoside A
Phenylpropanoids
Glu-6 -O-p-coumaroyl
(3) (Takasaki et al., 2001), quercetin (4) (Wenkert and Got-
1 127.1 s tlieb, 1977), 3-methylquercetin (5) (Bacon et al., 1978), 3,5-
2 7.30 (1H, d, 8.67) 131.1 d dimethylquercetin (6), rutin (7) (Wenkert and Gottlieb, 1977),
3 6.76 (1H, d, 8.67) 116.1 d emodin-8-O-␤-d-glucopyranoside (8) (Steglich and Losel,
4 161.3 s 1969), gallic acid (9), 6-O-galloyl-d-glucose (10) (Nonaka
5 6.76 1H, d, 8.67) 116.1 d
6 7.30 (1H, d, 8.67) 131.1 d
and Nishioka, 1983), (+)-catechin (11) (Nonaka et al., 1983a),
7 7.55 (1H, d, 16.00) 146.8 d (−)-epicatechin (12) (Nonaka and Nishioka, 1982), procyani-
8 6.23 (1H, d, 16.00) 114.8 d din B-1 (13) (Nonaka et al., 1981), procyanidin B-2 (14)
9 169.3 s (Nonaka et al., 1981), 3,3 -di-O-galloyl-procyanidin B-2 (15)
Fru-1-O-p-coumaroyl (Nonaka et al., 1981) and 3 -O-galloyl-procyanidin B-2 (16)
1 127.4 s (Nonaka et al., 1983b) by the spectroscopic evidences and
2 7.44 (1H, d, 8.80) 131.5 d comparing with literature data (Fig. 1).
3 6.79 (1H, d, 8.80) 116.7 d
Compound 1 was obtained as a yellow amorphous pow-
4 161.0 s
5 6.78 (1H, d, 8.80) 116.7 d der. Its molecular formula was assigned as C22 H22 O13 on
6 7.44 (1H, d, 8.80) 131.5 d the basis of the negative ion high-resolution (HR) FAB mass
7 7.70 (1H, d, 15.90) 148.2 d spectrum (MS) (m/z: 493.0977 [M − H]− , calcd. 493.0982)
8 6.43(1H, d, 15.90) 114.3 d and the 13 C DEPT NMR spectrum. The 13 C NMR spectrum
9 168.4 s
showed the presence of 15 carbon signals due to the flavonol
Fru-3-O-p-coumaroyl skeleton, a set of signals arising from a glucopyranosyl moi-
1 127.2 s ety [anomeric H: δ 4.59 (J = 7.75 Hz), anomeric C: δ 103.4
2 7.38 (1H, d, 8.70) 131.2 d
3 6.77 (1H, d, 8.70) 116.3 d
(d)] and a methoxyl group [δH 3.78 (3H, s), δC 59.6 (q)]. The
1 H NMR spectrum exhibited a characteristic proton signal
4 161.2 s
5 6.77 (1H, d, 8.70) 116.3 d at δ 12.55 corresponding to a free hydroxyl at C-5, a singlet
6 7.38 (1H, d, 8.70) 131.2 d proton signal at δ 6.19 arising from H-6 of ring A and an
7 7.63 (1H, d, 8.70) 147.1 d ABX coupling system [δ 7.74 (1H, d, J = 2.00 Hz), 7.72 (1H,
8 6.30 (1H, d, 8.70) 114.7 d
9 168.4 s
d, J = 8.15 Hz), 6.90 (1H, dd, J = 2.00, 8.15 Hz)] referring
to the 3 ,4 -dihydroxylated ring B. These 1 H and 13 C NMR
Fru-6-O-feruloyl
spectral features were closely related to those of gossypetin
1 127.7 s
2 7.16 (1H, d, 1.76) 111.7 d 8-O-glucoside (Nawwar and Buddrus, 1981), except for the
3 149.2 s appearance of the additional methoxyl signal. In the HMBC
4 150.4 s spectrum (Fig. 2), the methoxyl proton signal at δ 3.78 was
5 6.79 (1H, d, 8.20) 116.3 d correlated with δ 137.5 (C-3), indicating that the methoxyl
6 6.99 (1H, dd, 1.76, 8.20) 124.4 d
group was linked at C-3 of the flavonol skeleton. In addi-
7 7.59 (1H, d, 15.82) 147.1 d
8 6.46 (1H, d, 15.82) 115.9 d tion, HMBC correlations of the 5-OH proton at δ 12.55 with
9 168.9 s δ 99.3 (C-6), 100.3 (C-4a) and 157.0 (C-5), and the glucose
(O-Me) 3.80 (3H, s) 56.5 q
anomeric proton signal at δ 4.59 with δ 125.6 (C-8) were also
observed, which confirmed the location of the glucopyranosyl
moiety on C-8 position. On the basis of the above evidences,
compound 1 was determined to be 3-methyl-gossypetin 8-O-
␤-d-glucopyranoside.
262 K.-J. Wang et al. / Journal of Ethnopharmacology 99 (2005) 259–264
Fig. 1. Structures of phenolic antioxidants from Fagopyrum dibotrys.
The molecular formula of compound 2 was determined
to be C49 H48 O20 on the basis of negative ion HRFAB-MS
(m/z: 955.2706, [M − H]− calcd. 955.2660) and the 13 C
DEPT NMR spectrum. The UV (228, 315 nm) and IR
Fig. 2. Important HMBC correlations of compound 1.
(3400, 1700, 1630, 1515, 1268 and 1170 cm−1 ) absorptions
suggested the existence of hydroxyl and ␣, ␤-unsaturated
aromatic ester groups in 2. The 1 H and 13 C NMR spectra
exhibited typical signals rising from p-coumaroyl moiety,
feruloyl moiety and a sucrose unit (Table 2), which were
similar to those of vanicoside B (1,3,6-tri-p-coumaroyl-6 -
feruloyl sucrose) isolated from Polygonum pensylvanicum
(Zimmermann and Sneden, 1994). In the NOESY spectrum
of 2 (Fig. 3), cross peaks between the methoxyl group
at δ 3.80 (3H, s) and an aromatic proton at δ 7.16 (1H,
d, J = 1.76 Hz) confirmed the presence of the feruloyl
moiety, in which the methoxyl group was linked to C-3 .
Characteristic fragment ion peaks in negative FAB-MS were
also observed at m/z 809 [M − H − 146(coumaroyl)]− , 779
[M − H − 176(feruloyl)]− , 663 [M − H − 146(coumaroyl)-
146(coumaroyl)]− , 517 [M − H − 146 (coumaroyl)-
146(coumaroyl)-146(coumaroyl)]− and 341 [M − H − 146
(coumaroyl)-146 (coumaroyl)-146(coumaroyl)-176(ferul-
 K.-J. Wang et al. / Journal of Ethnopharmacology 99 (2005) 259–264
Fig. 3. Important HMBC and NOESY correlations of compound 2.
oyl)]− . The above observations indicated that 2 was a
sucrose acylated by three p-coumaric acids and one ferulic
acid.
Locations of p-coumaroyl and feruloyl moieties on su-
crose were determined as follows. The proton and carbon
signals of p-coumaroyl, feruloyl and sucrose moieties of 2
were assigned by 2D NMR techniques, including the 1 H–1 H
COSY, HMQC and NOESY. In the 13 C NMR spectrum of
2, signals of C-1, C-6 of fructose and C-6 of glucose in the
sucrose moiety were shifted to lower field (+2 to +3 ppm),
while C-2, C-5 of fructose and C-5 of glucose were shifted
to higher field (−2 to −3 ppm), comparing with those of su-
crose [13 C NMR data (100 MHz, in CD3 OD): δ 64.0 (C-1),
105.3 (C-2), 79.3 (C-3), 75.7 (C-4), 83.8 (C-5), 63.4 (C-6),
93.6 (C-1 ), 73.2 (C-2 ), 74.7(C-3 ), 71.3 (C-4 ), 74.41 (C-5 )
and 62.2 (C-6 )]. These observations suggested that the C-1,
C-6 of fructose and C-6 of glucose were esterified. In the
HMBC spectrum of 2 (Fig. 3), the long-range correlations
of H-1, H-3 and H-6 of sucrose with C-9, C-9 and C-9
rising from three p-coumaroyl groups, and H-6 of sucrose
with C-9 of feruloyl group indicated that the acylated po-
sitions of the three coumaroyl groups were at C-1, C-3 and
C-6 of sucrose and the feruloyl group was attached at C-6
of the sucrose. Accordingly, compound 2 was characterized
as 1,3,6 -tri-p-coumaroyl-6-feruloyl sucrose, named diboside
A.
The antioxidant activity of compounds 1–16 was mea-
sured in DPPH assay (Table 3). Comparing with the positive
control ascorbic acid, compounds 4, 6 and 9–16 displayed
higher activities, while 1–3, 5, 7 and 8 showed only lower
activities.
Gallic acid (9), the well-known natural antioxidant found
widely in plants, and its derivative, 10, exhibited higher free
radical-scavenging activities than ascorbic acid. While, com-
pounds 2, 3 and 8, the minor constituents from Fagopyrum di-
botrys and without trihydroxylphenyl or o-dihydroxylphenyl
groups existing in the molecule, showed lower activities. This
result is consistent with the previous reports and suggests that
three or two adjacent phenolic hydroxyl group in the molecule
is a key factor for enhancing the activity (Guo et al., 1999;
Okawa et al., 2001).
263
Table 3
DPPH radical scavenging activity of compounds 1–16 from Fagopyrum
dibotrys
Compounds SC50 (␮M)
Ascorbic acid (CK) 30.79
1 37.99
2 199.48
3 165.52
4 13.68
5 31.23
6 24.40
7 42.49
8 61.80
9 12.10
10 25.17
11 22.64
12 17.39
13 18.40
14 15.31
15 10.12
16 7.94
SC50 : radical scavenging activity (concentration in ␮M required for 50%
reduction of DPPH radical).
Flavonoids have generally been considered as important
antioxidants. Eleven flavonoids, including quercetin (4) and
its derivatives 1, 5–7, as well as the major constituents of
Fagopyrum dibotrys, flavan-3-ols and its derivatives (11–16),
were isolated from Fagopyrum dibotrys. The activity order of
quercetin derivatives was shown to be 4 > 6 > 5 > 1 > 7, sug-
gesting that the presence of 3-hydroxyl group is important
to their radical-scavenging capabilities. When the hydroxyl
group at C-3 of quercetin was substituted with methoxyl
group, it gave a negative influence for the activity. And if a
bigger substituent like O-glycosyl was linked at C-3, the ac-
tivity was greatly reduced probably for the steric hindrance
(Cioffi et al., 2002; Braca et al., 2003).
All of the flavan-3-ols displayed higher radical-
scavenging activities (7.94–22.64 ␮M) than ascorbic acid.
Among the isolated compounds, 15 and 16 were the most
active ones due to the molecule possessing more phenolic hy-
droxyl groups, particularly the galloyl and catechol groups.
These main constituents may play an important role for the
antioxidant activity of Fagopyrum dibotrys. The above results
will promote the reasonable usage of this herb.
Acknowledgement
The authors are grateful to the staff of the analytical group
at the state key laboratory of phytochemistry and plant re-
sources in West China, Kunming Institute of Botany, Chinese
Academy of Sciences for their measurement of spectral data.
References
Bacon, J.D., Urbatsch, L.E., Bragg, L.H., Mabry, T.J., Neuman, P., Jack-
son, D.W., 1978. The flavonoids of tetragonotheca (Compositae). Phy-
tochemistry 17, 1939–1943.
264 K.-J. Wang et al. / Journal of Ethnopharmacology 99 (2005) 259–264
Braca, A., Fico, G., Morelli, I., Simone, F.D., Tome, F., Tommasi, N.D.,
2003. Antioxidant and free radical scavenging activity of flavonol
glycosides from different Aconitum species. Journal of Ethnopharma-
cology 86, 63–67.
Cioffi, G., D’Auria, M., Braca, A., Mendez, J., Castillo, A., Morelli,
I., Simone, F.D., Tommasi, N.D., 2002. Antioxidant and free-radical
scavenging activity of constituents of leaves of Tachigalia paniculata.
Journal of Natural Products 65, 1526–1529.
Editorial Board of Zhong Hua Ben Cao (China Herbal), State Adimin-
istration of Traditional Chinese Medicine, 1999. Zhong Hua Ben
Cao (China Herbal), vol. 2. Shanghai Science and Technology Press,
Shanghai, pp. 629–632.
Guo, Q., Zhao, B., Shen, S., Hou, J., Xin, W., 1999. ESR study on the
structure–antioxidant activity relationship of tea catechins and their
epimers. Biochimica et Biophysica Acta 1427, 13–23.
Liu, Y.L., Fang, Q.N., Zhang, X.C., Feng, X.X., Zhang, L.F., He, X.W.,
1983. Study on the active constituents from Fagopyrum dibotrys. Acta
Pharmaceutica Sinica 18, 545–547.
Nawwar, M., Buddrus, J., 1981. A gossypetin glucuronide sulphate from
the leaves of Malva sylvestris. Phytochemistry 20, 2446–2448.
Nonaka, G., Ezaki, E., Hayashi, K., Nishioka, I., 1983a. Flavanol gluco-
sides from rhubarb and Rhaphiolepis umbellate. Phytochemistry 22,
1659–1661.
Nonaka, G., Kawahara, O., Nishioka, I., 1983b. Tannins and related com-
pounds XV. A new class of dimeric flavan-3-ol gallate, theasinensins
A and B, and proanthocyanidin gallate from green tea leaf. (1). Chem-
ical and Pharmaceutical Bulletin 31, 3906–3914.
Nonaka, G., Nishioka, I., 1982. Tannins and related compounds VII.
Phenylpropanoid-substituted epicatechin, cinchonains from Cinchona
succirubra(1). Chemical and Pharmaceutical Bulletin 30, 4268–4276.
Nonaka, G., Nishioka, I., 1983. Tannins and related compounds X.
Rhubarb (2): Isolation and structures of a glycerol gallate, gallic acid
glucoside gallate, galloylglucose and isolindleyin. Chemical and Phar-
maceutical Bulletin 31, 1652–1658.
Nonaka, G., Nishioka, I., Nagasawa, T., Oura, H., 1981. Tannins and re-
lated compounds. I. Rhubarb (1). Chemical and Pharmaceutical Bul-
letin 29, 2862–2870.
Okawa, M., Kinjo, J., Nohara, T., Ono, M., 2001. DPPH (1, 1-diphenyl-
2-picrylhydrazyl) radical scavenging activity of flavonoids obtained
from some medicinal plants. Biological and Pharmaceutical Bulletin
24, 1202–1205.
Steglich, W., Losel, W., 1969. Bestimmung der stellung von on O-
substituenten bei 1,8-dihydroxy-anthrachinon-derivaten mit hilfe der
NMR-spektroskopie. Tetrahedron 25, 4391–4399.
Takasaki, M., Kuroki, S., Kuzuka, M., Konoshima, T., 2001. New phenyl-
propanoid esters of sucrose from Polygonum lapathifolium. Journal of
Natural Products 64, 1305–1308.
Wenkert, E., Gottlieb, H.E., 1977. Carbon-13 nuclear magnetic resonance
spectroscopy of flavonoid and isoflavonoid compounds. Phytochem-
istry 16, 1811–1816.
Yao, R.C., Huang, M.F., Wu, Y.R., Yang, C.R., 1989. Active constituents
of anti-tumor from Fagopyrum cymosum. Acta Botanica Yunnanica
11, 215–218.
Yoshida, T., Mori, K., Hatano, T., Okumura, T., Uehara, I., Komagoe,
K., Fujita, Y., Okuda, T., 1989. Studies on inhibition mechanism of
autoxidation by tannins and flavonoids. V1) Radical-scavenging effects
of tannins and related polyphenols on 1, 1-diphenyl-2-picrylhydrazyl
radical. Chemical and Pharmaceutical Bulletin 37, 1919–1921.
Zhang, W.J., Li, X.C., Liu, Y.Q., Yao, R.C., Nonaka, G., Yang, C.R.,
1994. Phenolic constituents from Fagopyrum dibotrys. Acta Botanica
Yunnanica 16, 354–356.
Zimmermann, M.L., Sneden, A.T., 1994. Vanicosides A and B, protein
kinase C inhibitors from Polygonum pensylvanicum. Journal of Natural
Products 57, 236–242.
 Journal of Ethnopharmacology 99 (2005) 265–272

Influence of extracts of Stryphnodendron polyphyllum

Mart. and Stryphnodendron obovatum Benth. on the
cicatrisation of cutaneous wounds in rats
Gisely C. Lopes a , Andréia C.C. Sanches b , Celso V. Nakamura a , Benedito P. Dias Filho a ,
Luzmarina Hernandes c , João Carlos P. de Mello a,∗
a Programa de Pós-graduação em Ciências Farmacêuticas da Universidade Estadual de Maringá, Maringá, PR, BR-87020-900, Brazil
b Programa de Pós-graduação em Fármacos e Medicamentos da Unesp, Araraquara, Brazil
c Departamento de Ciências Morfofisiológicas da Universidade Estadual de Maringá, Maringá, Brazil

Received 14 January 2005; received in revised form 24 February 2005; accepted 24 February 2005
Available online 26 April 2005

Abstract

Stem bark of the two species Stryphnodendron polyphyllum Mart. and Stryphnodendron obovatum Benth., Leguminosae, was investigated for
wound healing, antibacterial and antioxidant activity. These plants contain 12 and 19% tannins in their stem bark, respectively, and are widely
used in traditional medicine in Brazil. The total content of phenolics of the crude extract (CE) of Stryphnodendron obovatum was 76.95 ± 2.98%
(CV = 3.87%) and of the ethyl-acetate fraction (EAF) was 89.13 ± 0.34% (CV = 0.38%); whereas in Stryphnodendron polyphyllum the CE
phenolics content was 51.62 ± 1.53% (CV = 2.96%) and the EAF phenolics content was 59.00 ± 1.91% (CV = 3.24%). The tannin content of
CE from Stryphnodendron obovatum [36.58 ± 0.35% (CV = 0.98%)] was about 11% higher than in CE from Stryphnodendron polyphyllum
[25.43 ± 0.96% (CV = 3.77%)]. The difference between the species was even greater in the EAF: in Stryphnodendron obovatum the EAF
phenolics content was 55.01 ± 0.36% (CV = 0.65%), whereas in Stryphnodendron polyphyllum the content was 36.16 ± 0.42% (CV = 1.16%).
The healing effect of ointments containing 2.5% crude lyophilised extract (PCE) and 2.5% ethyl-acetate lyophilised fraction (PEA) of the
stem bark of Stryphnodendron polyphyllum and Stryphnodendron obovatum was studied in cutaneous wounds of Wistar® rats after 4, 7 and
10 days of treatment. Epithelial cell proliferation in the area of re-epithelialisation of the wounds was evaluated by counting the metaphases
blocked by vincristine sulfate. With PCE an increase in epidermal growth was observed after 4 and 7 days of treatment with Stryphnodendron
polyphyllum, and after 7 and 10 days of treatment with Stryphnodendron obovatum. Wounds treated with PEA of Stryphnodendron obovatum
showed increased epidermal growth only 4 days after the treatment; for Stryphnodendron polyphyllum, epidermal growth was observed after
4 and 7 days of treatment. Both the CE and the EAF fractions of Stryphnodendron polyphyllum and Stryphnodendron obovatum showed
antibacterial activity against Staphylococcus aureus with MIC values of 125 and 250 ␮g/ml, respectively. Gram-negative bacteria tested were
not inhibited by extracts and fractions at concentrations >1000 ␮g/ml. The antioxidant activity through reduction of the DPPH radical in TLC,
confirmed the anti-radical properties of these extracts in both species. CE and EAF of both species showed a radical scavenging activity (RSA)
and protected DPPH from discolouration, already at 0.032 ␮g/ml. The extract from Stryphnodendron polyphyllum were more effective than
those Stryphnodendron obovatum, although the former had a lower tannin content.
© 2005 Elsevier Ireland Ltd. All rights reserved.

Keywords: Stryphnodendron obovatum; Stryphnodendron polyphyllum; Epidermal proliferation; Antibacterial activity; Antioxidant activity; Tannins

1. Introduction

The genus Stryphnodendron Mart., a member of the fam-

ily Leguminosae, presently includes 32 taxa: 29 species, 1
∗ Corresponding author. Tel.: +55 44 2614816; fax: +55 44 2636231.
subspecies and 2 varieties, with characteristic geographi-
E-mail address: mello@uem.br (J.C.P.d. Mello). cal distribution and habitat (Occhioni, 1990). The species

0378-8741/$ – see front matter © 2005 Elsevier Ireland Ltd. All rights reserved.
doi:10.1016/j.jep.2005.02.019
266 G.C. Lopes et al. / Journal of Ethnopharmacology 99 (2005) 265–272
Stryphnodendron polyphyllum Mart. and Stryphnodendron
obovatum Benth. grow in open fields and savannah regions
in Brazil, where they are both popularly known as “barba-
timão”. Extracts of the stem bark are used traditionally by
the local population to treat leucorrhea and diarrhea, as anti-
inflammatory and antiseptic agents and to promote blood
clotting and wound healing (Corrêa, 1926).
Cicatrisation is a natural biological process, through which
the damaged tissue re-establishes haemostasis. In this pro-
cess, three phases are recognised in response to injury of
the skin in adult mammals: inflammation, epithelialisation,
and remodeling. When the lesion reaches the dermis, the de-
struction of capillary vessels results in formation of a clot that
functions as a temporary barrier and as a source of chemotac-
tic signals which attract several types of inflammatory cells
to the injury site. This haemostatic inflammatory phase is fol-
lowed by the migration and proliferation of the keratinocytes
from those tissues remaining intact at the site (Coulombe,
1997).
Restoration of epithelial continuity is defined as closing
of the wound. Closing is accomplished by the combination
of two mechanisms: the migration of the keratinocytes to the
insulted site, and the contraction of myofibroblasts around
the site, which exercise a centripetal force that moves the
edges of the wound closer to each other (Coulombe, 1997;
Montandon et al., 1977).
In recent years, interest has increased in obtaining drugs
from plants with high tannin contents, which have poten-
tial use in promoting cicatrisation of wounds (Schulz et al.,
2002). Studies on stem-bark extracts of Stryphnodendron ad-
stringens (Mart.) Coville have demonstrated that these have
significant wound-healing (Eurides et al., 1996; Panizza et
al., 1988; Vieira et al., 1998), anti-inflammatory (Lima et al.,
1998) and anti-ulcerogenic properties (Audi et al., 1999).
Because of this biological activity, the chemical composi-
tion of several species of Stryphnodendron has been investi-
gated, including Stryphnodendron adstringens (Mello et al.,
1996a, 1996b, 1999), Stryphnodendron obovatum (Sanches
et al., 2002; Sanches, 2004) and Stryphnodendron polyphyl-
lum (Lopes et al., 2003). All three have similar chemical
constitutions but vary in the content of the total tannins
which may be responsible for the pharmacological activity
of members of this genus. Tannins promote the cicatri-
sation of wounds through several cellular mechanisms:
chelation of free radicals and reactive species of oxygen,
promoting contraction of the wound and increasing the
formation of capillary vessels and fibroblasts (Fernandez
et al., 2002) and inducing keratinocyte proliferation, but do
not act on the differentiation towards cornified cells (Deters
et al., 2001).
In the present work, we evaluated the influence of crude
and ethyl-acetate extracts of stem bark from Stryphnoden-
dron polyphyllum and Stryphnodendron obovatum on the re-
epithelialisation of cutaneous wounds in Wistar® rats, and
analysed the antibacterial and antioxidant activity of these
extracts.
2. Materials and methods
2.1. Plant material and preparation of extracts
Stem bark was collected from individuals of Stryphnoden-
dron polyphyllum Mart. in May 2002, in the city of Abadia
de Goiás, State of Goiás in central Brazil (16◦ 45 32.4 S;
49◦ 25 06.5 W; altitude 860 m). Stem bark from Stryphn-
odendron obovatum Benth. was collected in February 2001
in the city of Assis, State of São Paulo (22◦ 35 20.8 S;
50◦ 24 18.7 W; altitude 546 m).
The species were identified by Prof. Dr. Cassia Mônica
Sakuragui. Voucher specimens are deposited in the herbar-
ium of the Department of Biology of the State University of
Maringá under numbers HUM 9139 and 8583.
Air-dried stem bark (900 and 500 g) was extracted with
acetone:water (7:3; 9 and 5 l) by turbo-extraction (Ultra-
turrax® UTC115KT; 20 min; t ≤ 40 ◦ C). The combined ex-
tracts were filtered and evaporated under reduced pressure
and then lyophilised (CE; 253 and 119 g). A portion (200
and 100 g) was redissolved in 2 and 1 l H2 O and extracted
with EtOAc (6 and 4 l). After evaporation of solvents under
reduced pressure and lyophilisation, the EtOAc extract and
the remaining H2 O phase yielded dark brown solids of 31.2
and 17.9 g (EAF), and 114 and 70.5 g (WF), respectively from
Stryphnodendron polyphyllum and Stryphnodendron obova-
tum, as described by Mello et al. (1999).
2.2. Animal treatment
Adult male albino Wistar® rats (Rattus norvegicus albi-
nus) weighing from 180 to 200 g were used for the study.
The animals were maintained in individual cages, on a 12-
h light/dark cycle, temperature 22 ◦ C, with water and chow
(Nuvital® ) ad libitum. The animals were divided into three
groups of five animals each. The Animal Ethics Committee
of the University of Maringá approved the experimental pro-
cedure (protocol number 040/2003).
The animals were anaesthetised by inhalation of ethyl
ether. After manual depilation and asepsis, two square cuta-
neous excisions were made on the back of each animal, close
to the cervical area, after demarcation with a stainless steel
delimitor measuring about 7 mm in diameter. The wounds
were then washed and measured. Each experimental wound
(left side) was treated daily with an ointment containing the
crude extract (PCE) or ethyl-acetate fraction (PEA), each at
2.5% concentration. Each control wound (right side) on each
animal was treated only with ointment base (O/W with hy-
drophilic characteristics and aseptic preparation) (Prista and
Da Fonseca, 1993).
After 4, 7 and 10 days, the animals of each group
were killed. Two hours before it was killed, each animal
was injected with 1 mg/kg body weight of vincristine
sulfate (Oncovin® , Eli Lilly), a metaphase arrest agent
that blocks mitosis primarily by inhibiting the dynamics of
spindle microtubules (Jordan et al., 1992). The rats were
 G.C. Lopes et al. / Journal of Ethnopharmacology 99 (2005) 265–272
anaesthetised by ethyl-ether inhalation and the wounded
skin was removed. The samples were spread on cards,
fixed in Bouin’s solution for 6 h and embedded in paraffin.
Sections of 4 ␮m thickness were prepared. The slides were
then stained with haematoxylin and eosin. The samples
taken from the skin were used for studies of epithelial cell
growth.
2.3. Morphometry of the wounds
The maximum length and width of each wound were mea-
sured with calipers on the day the wound was made and the
day the animal was killed; the area of the wound was calcu-
lated from these measurements. The degree of contraction of
the wound was determined from the difference between the
initial and final areas. The means of the differences between
the experimental wounds and controls were compared, for
each group of subjects and for each extract studied.
2.4. Cell proliferation
The cellular proliferation of the epidermis was evaluated
by counting the epithelial cells blocked in metaphase, in the
basal and supra-basal layers in the area of re-epithelialisation.
In each wound of each animal, the number of blocked
metaphases was counted in 40 microscope fields, with the
aid of a 250 ␮m ocular reticle fitted in an Olympus BX40®
microscope, and a 40× objective. The results were expressed
as number of metaphases/10 mm.
2.5. Statistical analysis
The results were analised by unpaired Student’s t-test.
The significance level adopted was P < 0.05 for cicatrisa-
tion analyse. The radical scavenging activity was analised by
nonparametric test (one-way ANOVA and Newman–Keuls;
P < 0.0001).
2.6. Antibacterial activity
The antibacterial activity of the crude extract (CE) and
ethyl-acetate fraction (EAF) against Staphylococcus aureus
(ATCC 25923), Bacillus subtilis (ATCC 6623), Escherichia
coli (ATCC 25922), and Pseudomonas aeruginosa (ATCC
15442) was studied. The antibacterial property was studied
by the microdilution method for determination of the mini-
mum inhibitory concentration (MIC) and minimum bacterici-
dal concentration (MBC), using the reference antimicrobials
penicillin, vancomycin and tetracycline (NCCLS, 2000).
2.7. Determination of total phenolics and tannins in the
crude and ethyl-acetate extracts
The total phenolics (TP) content in the crude extract (CE)
and ethyl-acetate fraction (EAF) from both species was esti-
mated by a colorimetric assay based on procedures described
267
by Glasl (1983), with slight modifications. Briefly, 117 mg
of the CE or 211 mg of the EAF was dissolved in water
(250 ml; MS). A 5 ml aliquot was diluted in water to 25 ml.
A 2 ml aliquot was transferred to a 25-ml vial with 1 ml of
Folin–Ciocalteu phenol reagent and 10 ml water, and made
up to volume with a solution of 14.06% sodium carbonate.
After 15 min the absorbance was measured at 691 nm (TP).
Water was used as the blank. For determination of the non-
adsorbent polyphenols (NAP), 10 ml of the MS was trans-
ferred with 100 mg of hide-powder and vortexed for 60 min.
Next, the solution was filtered and 5 ml was diluted in water
to 25 ml. A 2-ml aliquot was transferred to 25-ml vial with
1 ml of the Folin–Ciocalteu phenol reagent and 10 ml water,
and made up to volume with a 14.06% sodium carbonate so-
lution. After 15 min the absorbance was measured at 691 nm
(NAP). Water was used as the blank. The percentage of to-
tal phenolics and tannins were determined (in triplicate) as
follows:
15625Abs 15625Abs
TP(%) = NAP(%) =
1000m 1000m
TT(%) = TP − NAP
where TP = total phenolics (%); NAP = non-adsorbent pheno-
lics (%); TT = total tannins (%); Abs = absorbance; m = mass
(g) of CE or EAF.
2.8. Antioxidant activity
The antioxidant potential was evaluated by the method
of reduction of the radical 2,2-diphenyl-1-picrylhydrazyl
(DPPH) 0.2% in methanol by thin-layer chromatography
(TLC), using n-butanol:acetic acid:water (3:1:1) as the elu-
ent system. The standards were quercetin (Merck), gal-
lic acid (Roth) and rutin (Merck), each at a concentration
of 10 mg/5 ml. The CE and the EAF test solutions were
made up to a concentration of 100 mg/5 ml (Hostettmann
et al., 2003). All solutions were applied at 20 ␮l on the
TLC.
The capacity of the prepared extracts to scavenge the “sta-
ble” free radical 2,2-diphenyl-1-picrylhydrazyl (DPPH) was
monitored according to the method of Hatano et al. (1988),
with slight modifications. CE or EAF (5 mg) was dissolved
in 10 ml of methanol and diluted to obtain five solutions
(0.032–20 ␮g/ml) with a final volume of 5 ml. A 4 ml aliquot
was added to a methanolic solution of DPPH (1 mM, 0.5 ml).
The mixture was vortexed for 15 s and then left to stand at
room temperature for 30 min. The absorbance of the result-
ing solutions was read spectrophotometrically at 517 nm. A
methanolic solution of DPPH that had decayed and hence
no longer exhibited a purple colour (i.e., 2 mg of BHT dis-
solved in 4 ml of methanol with 0.5 ml of the DPPH solu-
tion added) was chosen for background correction, instead
of pure methanol. A solution of 0.5 ml DPPH and 4 ml of the
methanol was used as a positive control. The radical scaveng-
ing activity (RSA) was calculated as a percentage of DPPH
268 G.C. Lopes et al. / Journal of Ethnopharmacology 99 (2005) 265–272
discolouration using the equation:


1 − Ae
%RSA = 100 ×
Ad
where Ae is the absorbance of the solution when an extract
has been added at a particular level, and Ad is the absorbance
of the DPPH solution with nothing added.
3. Results
3.1. Clinical evaluation
Wounds treated daily with ointments containing extracts
of Stryphnodendron polyphyllum Mart. and Stryphnodendron
obovatum Benth., and with ointment base, were observed af-
ter 4, 7 and 10 days. In all the experimental groups, the 4-, 7-
and 10-day-old wounds formed a dry, dark-brown crust which
thickened with time. No exudate or contamination was ob-
served. Removal of the crust at 10 days did not cause bleeding,
indicating that by this time the wounds were re-epithelialised.
The control wounds formed a moist red crust, with no con-
tamination (Fig. 1).
3.2. Morphometry of the wounds
In the experiments with wounds treated with PCE of both
species of Stryphnodendron and in the control wounds, cica-
trisation usually developed. There was no significant differ-
ence between the treated wounds and the controls.
Fig. 2 compares the differences between the initial and fi-
nal areas of the control wounds and the wounds treated with
PEA from Stryphnodendron polyphyllum after 4, 7 and 10
days. There was no significant difference between the treated
and control wounds, for the PEA from Stryphnodendron obo-
vatum (results not shown).
Fig. 1. Cutaneous wounds in Wistar® rats after 7 days of treatment. Left:
wound treated with PEA; right: control wound treated with ointment base.
Fig. 2. Differences between the initial and final areas (mm2 ) of cuta-
neous wounds treated with 2.5% PEA of Stryphnodendron polyphyllum.
Mean ± S.D. (n = 5) * P < 0.05 compared to the control.
3.3. Evaluation of cellular epithelial proliferation
In the experiments with extracts of Stryphnodendron obo-
vatum, the number of metaphases increased after 7 and 10
days of treatment in the wounds treated with PCE. With PEA,
cellular proliferation in the area of re-epithelialisation (epi-
dermis) increased significantly over the control by day 4. Af-
ter this period, the number of mitoses in the treated wounds
declined, with inhibition by day 7 (Figs. 3 and 4).
In the experiments with extracts of Stryphnodendron poly-
phyllum, wounds treated with PCE and PEA showed an in-
crease in cellular proliferation of the epidermis after 4 and
7 days of treatment; after 10 days there was no significant
increase (Figs. 5 and 6).
3.4. Antibacterial activity
The inhibitory and bactericidal effects of CE and EAF
against the pathogens studied by the microdilution method
are shown in Table 1. CE and EAF obtained from Stryphn-
odendron polyphyllum showed inhibitory activity against the
Gram-positive bacteria Staphylococcus aureus with MIC val-
ues of 125 ␮g/ml and MBC values of 250 ␮g/ml. In Bacil-
Fig. 3. Effect of the treatment of cutaneous wounds with 2.5% PCE of
Stryphnodendron obovatum on the number of metaphases in the epidermis,
counted in 40 microscope fields, each field 250 ␮m. Mean ± S.D. (n = 5)
* P < 0.05 compared to the control.
 G.C. Lopes et al. / Journal of Ethnopharmacology 99 (2005) 265–272 269

Table 1
Minimum inhibitory concentration (MIC) and minimum bactericidal con-
centration (MBC) of crude extract and ethyl-acetate fraction of Stryphnoden-
dron polyphyllum and Stryphnodendron obovatum using the microdilution
method
Extracts MIC (MBC) (␮g/ml)

Staphylococcus Bacillus Pseudomonas Escherichia

aureus subtilis aeruginosa coli
Stryphnodendron polyphyllum
CE 125 (250) 250 (250) >1000 >1000
EAF 125 (250) 250 (250) >1000 >1000
Stryphnodendron obovatum
Fig. 4. Effect of the treatment of cutaneous wounds with 2.5% PEA of CE 250 (250) 1000 (>1000) >1000 >1000
Stryphnodendron obovatum on the number of metaphases in the epidermis, EAF 250 (250) 1000 (>1000) >1000 >1000
counted in 40 microscope fields, each field 250 ␮m. Mean ± S.D. (n = 5)
* P < 0.05 compared to the control.
3.5. Determination of total phenolics and tannins in the
crude and ethyl-acetate extracts

The content of total phenolics and tannins of the CE

Fig. 5. Effect of the treatment of cutaneous wounds with 2.5% PCE of
Stryphnodendron polyphyllum on the number of metaphases in the epider-
mis, counted in 40 microscope fields, each field 250 ␮m. Mean ± S.D. (n = 5)
* P < 0.05 compared to the control.
lus subtilis, MIC and MBC were 250 ␮g/ml. CE and EAF
of Stryphnodendron obovatum showed lower activity, with
MICs of 250 and 1000 ␮g/ml in Staphylococcus aureus
and Bacillus subtilis respectively. All extracts and fractions
at concentrations >1000 ␮g/ml did not inhibit the Gram-
negative bacteria species studied.
Fig. 6. Effect of the treatment of cutaneous wounds with 2.5% PEA of
Stryphnodendron polyphyllum on the number of metaphases in the epider-
mis, counted in 40 microscope fields, each field 250 ␮m. Mean ± S.D. (n = 5)
* P < 0.05 compared to the control.
and EAF of both species was evaluated, adapted from
the method proposed by Glasl (1983), calculated as a
percentage of the total phenolics and total tannin con-
tent. The total phenolics of the CE of Stryphnoden-
dron obovatum was 76.95 ± 2.98% (CV = 3.87%) and in
the EAF was 89.13 ± 0.34% (CV = 0.38%), whereas in
Stryphnodendron polyphyllum the total phenolics of the
CE was 51.62 ± 1.53% (CV = 2.96%) and in the EAF
was 59.00 ± 1.91% (CV = 3.24%). The tannin content of
the CE of Stryphnodendron obovatum [36.58 ± 0.35%
(CV = 0.98%)] was about 11% higher than the CE of Stryphn-
odendron polyphyllum [25.43 ± 0.96% (CV = 3.77%)]. In the
EAF the difference between the species was even greater. In
Stryphnodendron obovatum the content was 55.01 ± 0.36%
(CV = 0.65%), whereas in Stryphnodendron polyphyllum the
content was 36.16 ± 0.42% (CV = 1.16%).
3.6. Antioxidant activity
The CE and EAF of Stryphnodendron polyphyllum and
Stryphnodendron obovatum all showed a capacity to re-
duce the radical 2,2-diphenyl-1-picrylhydrazyl (DPPH. ) to
the same degree as the reference substances through TLC.
The two species differed with respect to radical scaveng-
ing activity (RSA). Whereas Stryphnodendron polyphyllum
showed activity between 70.10% and 74.78%, Stryphnoden-
dron obovatum fell to nearly half this value (35.85% to
36.40%) at a concentration of 4 ␮g/ml. At higher concen-
trations (8 and 20 ␮g/ml), the extracts from both species
showed practically the same RSA. At the lowest concentra-
tion (0.032 ␮g/ml), the CE of both species showed similar
RSA values (40.01% and 32.70%). However, the EAF
showed a higher RSA for Stryphnodendron polyphyllum
(37.18%), versus 12.54% for Stryphnodendron obovatum.
The results were analysed and the significance was obtained
by P < 0.0001 at concentration of 0.032 ␮g/ml for CE and
EAF of both species (Fig. 7).
270 G.C. Lopes et al. / Journal of Ethnopharmacology 99 (2005) 265–272
Fig. 7. Radical scavenger activity of CE and EAF from the stem bark of
Stryphnodendron polyphyllum Mart. and Stryphnodendron obovatum Benth.
on 2,2-diphenyl-1-picrylhydrazyl free radical (DPPH). (
) CE of Stryphn-
odendron polyphyllum, () EAF of Stryphnodendron polyphyllum, () CE
of Stryphnodendron obovatum, ( ) EAF of Stryphnodendron obovatum.
*** P < 0.0001.
4. Discussion
Cutaneous injury is characterised by fibroplasia, angio-
genesis and re-epithelisation. The response to injury involves
the migration and proliferation of cells such as fibroblasts, en-
dothelial and epithelial cells, deposition of connective tissue
and contraction of the wound (Clark, 1996). The cicatrisation
process proceeds naturally, as the damaged tissue attempts to
re-establish haemostasis. However, risk factors such as infec-
tions and excessive inflammatory reaction may compromise
the repair process.
Stem bark of Stryphnodendron adstringens (Mart.) Cov-
ille, Stryphnodendron obovatum Benth. and Stryphnoden-
dron polyphyllum Mart. have been used for the treatment
of wounds, burns and other cutaneous injuries. The tannins
present in the preparations are thought to be responsible for
this activity (Corrêa, 1926; Favoretto et al., 1985; Jorge Neto
et al., 1996).
In the cicatrisation experiment, the application of ointment
containing crude extract (PCE) from Stryphnodendron obo-
vatum stimulated proliferation significantly: the epidermis
re-epithelised (P < 0.05) after 7 and 10 days of treatment. In
the wounds treated with Stryphnodendron polyphyllum, the
number of blocked metaphases was significantly (P < 0.05)
higher after 4 and 7 days of treatment (Figs. 3 and 5).
The ointment containing the ethyl-acetate fraction (PEA)
stimulated cellular proliferation in the initial phase of cicatri-
sation. This action was more lingering for Stryphnodendron
polyphyllum, lasting for up to 7 days (Fig. 6). For Stryphn-
odendron obovatum, PEA stimulated proliferation after only
4 days of treatment (Fig. 4). However, there was a decline in
the number of mitoses after 7 days. The stimulation returned
by treatment day 10, although this change was not significant
in relation to the control wounds.
Tannins have been used in dermatology because of their
strong astringent property, which positively affects wound
healing. When applied topically onto the skin or mucous
membranes, tannins cause the precipitation of proteins, which
renders the superficial layers impermeable to noxious agents
(Haslam et al., 1989), shrinking colloidal structures. This
astringent action deprives bacteria of a favourable growth
medium, producing an indirect antibacterial effect (Schulz et
al., 2002). The tannins also promote capillary vasoconstric-
tion, which decreases vascular permeability and causes a lo-
cal anti-inflammatory effect (Kapu et al., 2001; Mota et al.,
1985) and impedes the formation of inflammatory exudates,
hindering the development of microorganisms.
The mechanism by which barbatimão stimulates the cellu-
lar proliferation of keratinocytes in cicatrisation is unknown.
The difference between the two species studied in the degree
of stimulation of cellular proliferation may be a function of
the difference in the tannin content of the stem bark, which
in Stryphnodendron polyphyllum is 12% and in Stryphnoden-
dron obovatum is 19%; alternatively, the difference may be
due to the presence of different types of these compounds. In
both species, several condensed tannins have been isolated
and identified (Sanches, 2004; Sanches et al., 2002; Lopes
et al., 2003) and this discussion is according Santos et al.
(2002). The tannins may act directly by stimulating the occur-
rence of mitoses. Alternatively, the tannins may act indirectly
by preventing development of edema at the lesion site, since
excessive edema retards cicatrisation (Sanchez Neto et al.,
1993).
The anti-inflammatory properties of the tannins may have
contributed to the superior results from PEA in the acute
treatment, compared to the groups treated with PCE, be-
cause EAF contains a narrower range of condensed tan-
nins (monomers, dimers, trimers, tetramers, up to the size
of oligomers), whereas CE contains all these and also much
larger polymers (Mello et al., 1996a, 1996b, 1999; Thompson
et al., 1972). Moreover, the content of total tannins present
in the EAF and consequently in PEA is higher than that de-
termined in CE, and also by inference in PCE.
In a comparative study of the composition of tannins of
three species, all popularly known as barbatimão (Stryphn-
odendron adstringens, Stryphnodendron polyphyllum and
Dimorphandra mollis), Santos et al. (2002) demonstrated the
existence of differences in the structure of the tannins be-
tween the two genera, as well as between the two species of
Stryphnodendron. TLC analyses showed a larger degree of
polymerisation for the extracts from the genus Stryphnoden-
dron, compared with Dimorphandra. According to Santos et
al. (2002), the degree of polymerisation is an important factor
in biological activity, for instance the affinity for proline-rich
proteins such as skin collagen.
The results obtained with Stryphnodendron polyphyllum
are similar to those obtained by Palermo et al. (2002), who
analysed epidermal proliferation in excisional wounds in
Wistar® rats treated with 1% PEA of Stryphnodendron ad-
stringens. The authors observed a significant increase in the
number of blocked metaphases after 4 and 7 days of treat-
ment. According to Santos et al. (2002), Stryphnodendron
polyphyllum contains higher levels of phenolic compounds
 G.C. Lopes et al. / Journal of Ethnopharmacology 99 (2005) 265–272
that precipitate proteins than Stryphnodendron adstringens.
However, both species contain similar levels of condensed
tannins, which implies that the analysed activity is affected
by the content of condensed tannins and not by the content
of total phenols.
In the evaluation of the effect of 2.5% PCE and PEA,
there was no significant difference in the contraction of
wounds treated with Stryphnodendron obovatum, and the
controls. Wounds treated with PEA of Stryphnodendron
polyphyllum contracted significantly less than the con-
trol wounds by day 7 (Fig. 2). This may be related to
the higher tannin content in Stryphnodendron obovatum
[55.01 ± 0.36% (CV = 0.65%)] than in Stryphnodendron
polyphyllum [36.16 ± 0.42% (CV = 1.16%)].
The contraction of a skin wound involves the reduction of
all or part of the defect through centripetal movement of the
surrounding skin (Montandon et al., 1977). Wounds treated
with barbatimão extract generally formed a dry, thick brown
crust. The crust of control wounds was moist, red and ap-
parently thinner. It is possible that the crust of the wounds
treated with barbatimão acted as a physical barrier, hindering
the contraction of the wounds treated with PEA of Stryphn-
odendron polyphyllum. Nevertheless, sub-crustal cicatrisa-
tion was not compromised. Studies by Eurides et al. (1996)
and Vieira et al. (1998), both with Stryphnodendron adstrin-
gens, reported the same effect.
According to Montandon et al. (1977), in practice, when a
wound is made experimentally, independently of its form, the
elastic forces of the neighbouring skin will increase the size
of the wound considerably and give it a form corresponding
to the local lines of tension. In Fig. 2, that effect was observed
after 4 days of treatment with PEA of Stryphnodendron poly-
phyllum.
On the other hand, the formation of a crust over a non-
exudative wound favours the cicatrisation process, because
the exudates promote the disaggregation of the crust and the
development of microorganisms (Oliveira, 1992).
Microbial infections cause increased complications in the
healing process. The results observed with CE and EAF of
Stryphnodendron polyphyllum and Stryphnodendron obo-
vatum indicated a moderate activity against Gram-positive
bacteria, the pathogens that are usually involved in skin
infections.
Antioxidant activity contributes favourably to the cicatri-
sation of wounds, because the production of reactive oxygen
species during the process of inflammatory reaction aggra-
vates the disorders in the tissues. The anti-radical properties
observed in CE and EAF of both species probably favoured
cicatrisation, but this activity cannot be correlated exclusively
with tannins (Fernandez et al., 2002; Haslam, 1996).
A synergistic effect of all these factors evaluated may be
involved in the wound healing observed in the species stud-
ied. Synergistic effects were more pronounced in Stryphn-
odendron polyphyllum.
Although the exact physiological mechanisms of action
of the tannins in wound healing are not totally explained,
271
comparative studies such as the present one add to existing
information and increase confidence in the healing properties
of members of the genus Stryphnodendron, confirming the
ethnopharmacological value of the genus.
Acknowledgments
The authors are grateful for financial support from Capes,
CNPq and the Fundação Araucária. The Instituto Florestal
of the state of São Paulo gave permission to collect Stryphn-
odendron obovatum. Our gratitude to Maria Euride Carlo
Cancino, Admir Arantes, Cláudio Roberto Novello for tech-
nical support. Special thanks to Dr. Eneri Vieira de Souza
Leite Mello for valuable contributions to the accomplishment
of this work.
References
Audi, E.A., Toledo, D.P., Peres, P.G., Kimura, E., Pereira, W.K.V.,
Mello, J.C.P. de Nakamura, C.V., Alves-do-Prado, W., Cuman,
R.K.N., Bersani-Amado, C.A., 1999. Gastric antiulcerogenic effects
of Stryphnodendron adstringens in rats. Phytotherapy Research 13,
264–266.
Clark, R.A.F., 1996. Wound repair: overview and general considerations.
In: Clark, R.A.F. (Ed.), The Molecular and Cellular Biology of Wound
Repair. Plenum Press Co, New York, pp. 3–50.
Corrêa, M.P., 1926. Dicionário das plantas úteis do Brasil e das exóticas
cultivadas. Imprensa Oficial VI, Rio de Janeiro, p. 747.
Coulombe, P.A., 1997. Towards a molecular definition of keratinocute
activation after acute injury to stratified epithelia. Biochemical and
Biophysical Research Communications 236, 231–238.
Deters, A., Dauer, A., Schnetz, E., Fartasch, M., Hensel, A., 2001. High
molecular compounds (polysaccharides and proanthocyanidins) from
Hamamelis virginiana bark: influence on human skin keratinocyte
proliferation and differentiation and influence on irritated skin. Phy-
tochemistry 58, 949–958.
Eurides, D., Mazzani, A., Belleff, M.E., Silva, L.A.F., Fioravante, M.C.S.,
Troncoso Neto, N.S., Campos, V.A., Silvestrini Junior, P.L., 1996.
Morfologia e morfometria da reparação tecidual de feridas cutâneas
de camundongos tratadas com solução aquosa de barbatimão (Stryphn-
odendron barbatiman Mart.). Revista da Faculdade de Zootecnia. Vet-
erinária e Agronomia de Uruguaiana 3, 37–42.
Favoretto, A.L., Contrera, M.G.D., Petenusci, S.O., Silva-Netto, C.R.,
Lopes, R.A., 1985. Ação cicatrizante do extrato aquoso de casca
de barbatimão Stryphonodendron obovatum Benth. em úlceras por
contenção em ratos. Revista da Escola de Farmácia e Odontologia de
Alfenas 8, 7–12.
Fernandez, O., Capdevila, J.Z., Dalla, G., Melchor, G., 2002. Efficacy
of Rhizophora mangle aqueous bark extract in the of open surgical
wounds. Fitoterapia 73, 564–568.
Glasl, H., 1983. Zur Photometrie in der Drogenstandardisierung –
3. Gehaltsbestimmung von Gerbstoffdrogen. Deutsche Apotheker
Zeitung 123, 1979–1987.
Haslam, E., Lilley, T.H., Ya, C., Gaffney, S.H., Spencer, C.M., Martin,
R., Magnolato, D., 1989. Some observations on the role of plant
polyphenols in traditional herbal medicines. Farmaceutisch tijdschrift
voor Belgie 66, 21–33.
Haslam, E., 1996. Natural polyphenols (vegetable tannins) as drugs: pos-
sible modes of action. Journal of Natural Products 59, 205–215.
Hatano, T., Kagawa, H., Yasuhara, T., Okuda, T., 1988. Two news
flavonoids and other constituents in licorice root: their relative astrin-
272 G.C. Lopes et al. / Journal of Ethnopharmacology 99 (2005) 265–272
gency and radical scavenging effects. Chemical and Pharmaceutical
Bulletin 36, 2090–2097.
Hostettmann, K., Queiroz, E.F., Vieira, P.C., 2003. Princı́pios ativos de
plantas superiores. EdUFSCar, São Carlos, 152 p.
Jordan, M.A., Thrower, D., Wilson, L., 1992. Effects of vinblastine,
podophyllotoxin and nocodazole on mitotic spindles. Implications for
the role of microtubule dynamics in mitosis. Journal of Cell Science
102, 401–416.
Jorge Neto, J., Fracasso, J.F., Camargo Neves, M.C.L., Santos, L.E.,
Banuth, V.L., 1996. Tratamento de úlcera varicosa e lesões de pele
com Calendula officinalis L. e/ou com Stryphnodendron barbadetiman
(Vellozo) Martius. Revista de Ciências Farmacêuticas 17, 181–186.
Kapu, S.D., Ngwai, Y.B., Kayode, O., Akah, P.A., Wambebe,
C., Gamaniel, K., 2001. Anti-inflammatory, analgesic and anti-
lymphocytic activities of the aqueous extract of Crinum giganteum.
Journal of Ethnopharmacology 78, 7–13.
Lima, J.C.S., Martins, D.T.O., De Souza Jr., P.T., 1998. Experimental
evaluation of stem bark of Stryphnodendron adstringens (Mart.) Cov-
ille for antiinflammatory activity. Phytotherapy Research 12, 218–220.
Lopes, G.C., Nakamura, C.V., Dias Filho, B.P., Mello, J.C.P., 2003. Es-
tudos fı́sico-quı́mico, quı́mico e biológico de extratos das cascas de
Stryphnodendron polyphyllum Mart. (Leguminosae). Revista Brasileira
de Farmacognosia 13, 24–27.
Mello, J.C.P. de Petereit, F., Nahrstedt, A., 1996a. Flavan-3-ols and
Prodelphinidins from Stryphnodendron adstringens. Phytochemistry
41, 807–813.
Mello, J.C.P. de Petereit, F., Nahrstedt, A., 1996b. Prorobinetinidins from
Stryphnodendron adstringens. Phytochemistry 42, 857–862.
Mello, J.C.P., de Petereit, F., Nahrstedt, A., 1999. A dimeric proan-
thocyanidin from Stryphnodendron adstringens. Phytochemistry 51,
1105–1107.
Montandon, D., D’andiras, G., Gabbiani, G., 1977. The mechanism of
wound contraction and epithelialization. Clinics in Plastic Surgery 4,
325–346.
Mota, M.L.R., Thomas, G., Barbosa Filho, J.M., 1985. Anti-inflammatory
actions of tannins isolated from the bark of Anacardium occidentale
L. Journal of Ethnopharmacology 13, 289–300.
NCCLS (National Committee for Clinical Laboratory Standards), 2000.
Methods for Dilution Antimicrobial Susceptibility Tests for Bacte-
ria that Grow Aerobically. Approved Standard M7-A5, vol. 20, #2.
National Committee for Clinical Laboratory Standards, Wayne, PA;
5th ed.
Occhioni, E.M.L., 1990. Considerações taxonômicas no genêro Stryphn-
odendron Mart. (Leguminosae-Mimosoideae) e distribuição geográfica
das espécies. Acta Botânica Brasilica 4, 153–158.
Oliveira, H.P., 1992. Traumatismo nos animais domésticos. Cadernos
Técnicos da Escola de Veterinária de Belo Horizonte 1, 01–57.
Palermo, D., Pereira, L.C.M.S., Mello, J.C.P., Hernandes, L., 2002. Ativi-
dade cicatrizante do barbatimão [Stryphnodendron adstringens (Mar-
tius) Coville] em feridas cutâneas. Arquivos da Apadec 6, 2.
Panizza, S., Rocha, A.B., Gecchi, R., Silva, R.A.P., 1988. Stryphnoden-
dron barbadetiman (Vellozo) Martius: teor em tanino na casca e
sua propriedade cicatrizante. Revista de Ciências Farmacêuticas 10,
101–106.
Prista, L.N., Da Fonseca, A., 1993. Manual de Terapia Dermatológica e
Cosmetologia. Roca, São Paulo, pp. 226–229.
Sanches, A.C.C., Mundo, S.R., Silva, P.E.R., Nakamura, C.V., Mello,
J.C.P., 2002. Pharmacognostic study and antibacterial activity of the
stem bark extract Stryphnodenderon obovatum Benth, Leguminosae.
50th Annual Congress of the Society for Medicinal Plant Research,
2, Barcelona-Espanha, p. 301.
Sanches, A.C.C., 2004. Estudo farmacognóstico das cascas de Stryphn-
odendron obovatum Benth., atividade antioxidante, antimicrobiana e
da ação cicatrizante dos seus extratos. Master of Science Dissertation.
UNESP, Araraquara, SP, Brazil, 210 p.
Sanchez Neto, R., Barone, B., Teves, D.C., Simões, M.J., Novo,
N.F., Juliano, Y., 1993. Aspectos morfológicos e morfométricos da
reparação tecidual de feridas cutâneas de ratos com e sem trata-
mento com solução de papaı́na a 2%. Acta Cirúrgica Brasileira 8,
18–23.
Santos, S.C., Costa, W.F., Ribeiro, J.P., Guimarães, D.O., Ferri, P.H., Fer-
reira, H.D., Seraphin, J.C., 2002. Tannin composition of barbatimão
species. Fitoterapia 73, 292–299.
Schulz, V., Hänsel, R., Tyler, V.E., 2002. Fitoterapia Racional – Um guia
de fitoterapia para as ciências da saúde, 4th ed. Manole, São Paulo.
Thompson, R.S., Jacques, D., Haslam, E., Tanner, R.J.N., 1972. Plant
proantocyanidins. Part 1. Introduction; the isolation, structure, and
distribution in nature of plant procyanidins. Journal of the Chemical
Society, Perkin Transactions 1, 1387–1399.
Vieira, F.C., Leite-Mello, E.V.S., Mello, J.C.P., 1998. Cicatrização cutânea
em feridas de ratos após aplicação tópica de pomadas de barbatimão
e nebacetin. In: Simpósio de Plantas Medicinais do Brasil. Águas de
Lindóia: Departamento de Psicobiologia e Farmacologia da Escola
Paulista de Medicina, 188.
 Journal of Ethnopharmacology 99 (2005) 273–279

Ethnobotanical study of some Ghanaian anti-malarial plants

Alex Asase a,b , Alfred A. Oteng-Yeboah a ,
George T. Odamtten a , Monique S.J. Simmonds b,∗
a Department of Botany, University of Ghana, P.O. Box LG 55 Legon, Ghana
b Royal Botanic Gardens, Kew, Richmond, Surrey TW9 3AB, UK

Received 18 January 2005; received in revised form 24 February 2005; accepted 24 February 2005
Available online 18 April 2005

Abstract

An ethnobotanical study was conducted in the Wechiau Community Hippopotamus Sanctuary area in Ghana, through interviews and
quadrate studies, to investigate the range and abundance of species used in the treatment of malaria. Forty-one species belonging to 17
families were encountered during the study. Of the 17 families studied Leguminosae and Anacardiaceae predominated in terms of number of
species used to treat malaria. Eight plant species namely, Afraegle paniculata (Rutaceae), Haematostaphis barteri (Anacardiaceae), Indigo
era pulchra (Leguminosae), Monanthotaxis sp. (Annonaceae), Ozoroa insignis (Anacardiaceae), Strychnos innocua (Loganiaceae), Strychnos
spinosa (Loganiaceae) and Xeroderris stuhlmannii (Leguminosae) have not previously been documented for the treatment of malaria in Ghana.
The results are discussed and recommendations made for future research to support the conservation and sustainable harvesting of the species
reported to have medicinal properties.
© 2005 Elsevier Ireland Ltd. All rights reserved.

Keywords: Ethnobotany; Malaria; Wechiau; Medicinal plants; Conservation

1. Introduction 2003). Thus it is important to search for new anti-malarial

Malaria is caused by a single celled protozoan para-
sites called Plasmodium and transmitted to man thought the
anopheles mosquito. It is one of the major fatal diseases in
the world, especially in the tropics and is endemic in some
102 countries with more than half of the world population at
risk (Symth, 1994).
In spite of control programmes in many countries there
has been very little improvement in the control of malaria
and infections can reduce the effectiveness of labour and can
lead to both economic and human loses. Control of malaria is
complex because of the appearance of drug resistant strains of
Plasmodium and with the discovering that man may become
infested with species of simian (monkey) malaria (Symth,
1994). At the same time the anopheles mosquito have devel-
oped resistance to many insecticides (Srisilam and Veersham,
∗ Corresponding author. Tel.: +44 208 332 5340; fax: +44 208 332 5328.
E-mail address: m.simmonds@rbgkew.org.uk (M.S.J. Simmonds).
compounds, either synthetic or natural compounds that kill
either the vector or parasite.
The use of plant-derived drugs for the treatment of malaria
has a long and successful tradition. For example, quinine iso-
lated from Cinchona and quinghaosu from Artemisia annua
L. illustrates the potential value of investigating tradition-
ally used anti-malarial plants for developing pharmaceuti-
cal anti-malarial drugs (Srisilam and Veersham, 2003). In
Ghana, several plant species including Alstonei boonei De
Willd (Apocynaceae), Azadirachta indica A. Juss, (Meli-
aceae), Cryptolepis sanguinolenta (Lindl.) Schttr. (Asclepi-
daceae), Morinda lucida Benth. (Rubiaceae), Nauclea latifo-
lia Sm. (Rubiaceae) and Ocimum viride Willd. (Lamiaceae)
are used in the treatment of malaria (Ayitey-Smith, 1989;
Abbiw, 1990; Mshana et al., 2001).
The aim of this study was to collate information from an
indigenous group of people living in the Wechiau Community
Hippopotamus Sanctuary area of Ghana about their current
traditional uses of plants for the treatment of malaria.

0378-8741/$ – see front matter © 2005 Elsevier Ireland Ltd. All rights reserved.
doi:10.1016/j.jep.2005.02.020
274 A. Asase et al. / Journal of Ethnopharmacology 99 (2005) 273–279

2. Materials and methods 2.2. Ethnobotanical survey

2.1. Study area
The study area at Wechiau is about 42 km southwest of Wa
in the Upper West Region of Ghana and positioned on lati-
tude 09◦ 49 762 N and longitude 02◦ 40 965 W. The area has
been demarcated as a conservation sanctuary called Wechiau
Community Hippopotamus Sanctuary and covers an area of
40 km2 along the banks of the Black Volta River. The vege-
tation is Guinea savannah. There are two main ethnic groups
in the area namely the Brefo and Wale. The area has an es-
timated population of 8700 people. The sanctuary is one of
the few in Ghana where local people are taking full control
of the management of their natural resources.
Table 1
Methods of identification and percentage of people with knowledge their anti-malarial use (PPK) and preference ranking (PR) of species used to treat malaria
in the Wechiau Community Hippopotamus Sanctuary, Ghana
Species (voucher numbers) Families
The following three techniques were used to obtain infor-
mation about the species of plants used in the treatment of
malaria in the study area:
1. Field interviews; involved walking with local people in
the areas where they normally collected their medicinal
plants while interviewing them. After picking a plant, they
consulted among themselves the anti-malarial uses of the
plant. The three local people involved in this study were
those selected by the sanctuary management board as hav-
ing the greatest knowledge about the traditional uses of
plants in the area.
2. House-to-house interviews; 14 local people were inter-
viewed using a questionnaire. Local trained guides served
Method of interviews PPK PR

Field House-to-house Plants collected by people

Acanthospermum hispidum DC (GC 47761) Asteraceae * 9.8 1
Afraegle paniculata (Shum & Thonn.) Engl. (GC 47780) Rutaceae * 4.8 1
Afzelia africana Sm. (GC 47762) Leguminosae * 9.8 1
Anogeissus leiocarpa Guill & Perr. (GC 47763) Combretaceae * * 4.8 2
Azadirachta indica A. Juss. (GC 47764) Meliaceae * 29.3 2
Carica papaya L. (GC 47765) Caricaceae * 9.8 2
Cassia sieberiana DC (GC 47799, AA) Leguminosae * 9.8 3
Cochlospermum tinctorium Perr. (GC 47766) Bixaceae * 9.8 3
Combretum ghasalense Engl. & Diels (GC47767) Combretaceae * * 9.8 2
Combretum sp. L. (GC 47768) Combretaceae * 4.8 1
Ficus gnaphalocarpa Steud. ex Miq. (GC 47769) Moraceae * 14.6 1
Ficus platyphylla Del. (GC4770) Moraceae * 4.8 1
Gardenia ternifolia Schum. & Thonn (GC 47771) Rubiaceae * * 9.8 2
Haematostaphis barteri Hook. f. (GC 47772) Anacardiaceae * 9.8 3
Hyptis spicigera Lam. (GC 47773) Lamiaceae * 4.8 1
Indigofera pulchra Willd. (GC 47774) Papilionaceae * * 9.8 3
Jatropha curcas L. (GC 47775) Euphorbiaceae * 9.8 1
Jatropha gossypiifolia L. (GC 47776) Euphorbiaceae * 9.8 1
Khaya senegalensis A.Juss. (GC 47777) Meliaceae * * 4.8 2
Lannea acida A. Rich. (GC 47778) Anacardiaceae * 9.8 1
Leucas martinicensis (Jacq.) R. Br. (GC 47779) Lamiaceae * 9.8 1
Mangifera indica L. (GC 47780) Anacardiacae * 24.4 1
Mitragyna inermis (Willd). K. Schum. (GC 47799) Rubiaceae * * * 24.4 3
Monanthotaxis sp. Baill. (GC 47781) Annonaceae * 19.5 2
Nauclea latifolia Sm. (GC 47782) Rubiacaea * * 4.8 2
Ocimum canum L. (GC 47800) Lamiaceae * 4.8 1
Ozoroa insignis Del. (GC 47783) Anacardiaceae * 4.8 2
Parinari polyandra Benth. (GC 47784) Chrysobalanaceae * 4.8 2
Parkia biglobosa (Jacq.) R Br. ex G. Don. (GC 47785) Leguminosae * 4.8 2
Paullinia pinnata L. (GC 47786) Sapindaceae * 4.8 1
Pericopsis laxiflora (Benth ex Baker) (GC 47787) Leguminosae * 9.8 1
Pseudocedrela kotschyi Harms (GC 47798) Meliaceae * 14.6 3
Pterocarpus erinaceus Cam (GC 47789) Leguminosae * 4.8 1
Ricinus communis L. (GC 47790) Euphorbiaceae * 4.8 1
Senna occidentalis L. (GC 47791) Leguminosae * 4.8 2
Sterculia setigera Del. (GC 47792) Sterculiaceae * 4.8 1
Strychnos innocua Del. (GC 47793) Loganiaceae * * 4.8 3
Strychnos spinosa Lam. (GC 47794) Loganiaceae * 4.8 2
Tamarindus indica L. (GC 47795) Leguminosae * 4.8 2
Vernonia amygdalina Del. (GC 47796) Asteraceae * * 14.6 3
Xeroderris stuhlmannii (Taub.) Mendonca. (GC 47797) Leguminosae * * 4.8 1
 A. Asase et al. / Journal of Ethnopharmacology 99 (2005) 273–279
as interpreters during the conduct of the interviews. The
questionnaire had prompts for the source of information,
identify of the plant species, methods of preparation, pre-
scription and administration.
3. Interviews with herbalist; four herbalists in the area were
identified with the assistance of the sanctuary manage-
ment board. It was arranged for them to collect plants
they used in the treatment of malaria. They were then in-
terviewed about how they used these plants.
In addition to the above techniques, samples of the species
identified as having anti-malarial activity were collected and
further informal interviews were conducted in order to collect
information about other uses of these species in the sanc-
tuary. Vouchers of the species collected during the study
were deposited at the Ghana Herbarium (GC), Legon, Ghana
(Table 1). The identification of the species was authenticated
by comparison with herbarium vouchers and with the Flora
of West Tropical Africa (Hutchinson and Dalziel, 1937). The
authorities of the species were confirmed using the Electronic
Plant Information Centre (EPIC, 2004).
Twenty-two people from the Brefo (17) and Wale (5) areas
were interviewed over a period of 6 months. In most cases
they were interviewed on more than one occasion. Twelve
out of the 22 (54.5%) people interviewed were males and all
of them were older than 20 years. The people interviewed
included Christians, Muslims and believers of local spiritual
tradition and other non-religious people. Only two of the peo-
ple had some level of formal education.
2.3. Distributional ranges of species
To determine the distributional ranges of the anti-
malarial plants identified through the ethnobotanical surveys,
quadrates of sizes, 25 m × 25 m, 5 m × 5 m and 1 m × 1 m
were randomly taken in the study area. Forty-one quadrates
of each size were studied. The 25 m × 25 m and 5 m × 5 m
quadrates were used to assess species of trees and shrubs,
whereas the 1 m × 1 m quadrates were used to assess the
herbaceous or ground cover species.
2.4. Data analyses
The information obtained through the ethnobotanical in-
terviews was analysed with regard to the following parame-
ters:
(i) Taxonomic diversity, growth forms and parts of the plant
used to treat malaria.
(ii) The percentage of people who have knowledge about the
use of a species in the treatment of malaria was evaluated
using the formula (PPK): (number of people interviewed
citing species/number of people interviewed) × 100.
(iii) Preference ranking (PR) method was similar to that used
by Martin (1995). In this case the plants were ranked
according to their level of effectiveness in the treatment
of malaria by the local people. Each rank is given an
275
integer (1, 2 or 3) with the most effective plants assigned
a value of 3. For example, if a plant was thought to be
very effective in the treatment of malaria it was given a
value 3.
The data from the ecological sampling were used to deter-
mine the distribution and density of the anti-malarial plants
from the sanctuary area. The distribution of the plants was de-
termined from the number of times a species occurred in the
total number of quadrates examined. The density of a species
was also evaluated from the mean number of individuals of
the species per unit area.
3. Results
3.1. Anti-malarial plants
A total of 41 species from 36 genera and 17 plant fami-
lies were identified during the ethnobotanical surveys as be-
ing used to treat malaria. The species, their families, survey
method used to identify their uses, percentage of people in-
terviewed with knowledge about their use to treat malaria
and the preference ranking of the species are presented in
Table 1. The greatest number of species used to treat malaria
in the sanctuary were identified during the house-to-house
and field interviews which identified 31 (75.6%) and 14
(34%) of the species, respectively. Only seven species were
identified by asking herbalists to collect anti-malaria plants.
However, five of these seven species were considered to
be very effective anti-malarial species (Table 1). There was
some overlap in the species identified using the different in-
terviewing methods. Mitragyna inermis (Willd) K. Schum
was the only species identify by all three survey methods.
The other species frequently identified included Azadirachta
indica and Mangifera indica L. (Table 1: high PPK val-
ues). Eight species were reported to be most effective for
the treatment of malaria in the sanctuary included the most
frequently cited, Mitragyna inermis, as well as Cassia siebe-
riana DC, Cochlospermum tinctorium Perr, Haematostaphis
barteri Hook. f., Indigofera pulchra Willd., Pseudocedrela
kostchyi Harms, Strychnos innocua Del., and Vernonia amyg-
dalina Del.
Of the 17 families containing anti-malarial species the
most predominant family in terms of number of species was
the Leguminosae with nine species (Table 1). A list of the lo-
cal names, habits and how the plants are used in the treatment
of malaria in the area are presented in Table 2. Trees consti-
tuted 62% of the total plant species used to treat malaria in
the study area and only two (5%) species were climbers. A
total of 45 herbal preparations were recorded as some prepa-
rations included the use of more than one species. For ex-
ample, Azadirachta indica and Ocimum canum L. were of-
ten used in more than one of the preparations. Most of the
preparation involved boiling the leaves and then drinking the
infusion.
276 A. Asase et al. / Journal of Ethnopharmacology 99 (2005) 273–279

Table 2
Growth forms and local names of species of plants that are used to treat malaria in the Wechiau Community Hippopotamus Sanctuary, Ghana and information
about the other uses of these species
Species Growth forms Lobi name Wale name How plants are used to treat malaria and other uses
Acanthospermum hispidum Herb Bongore Malaria: grind whole plant with hot pepper, sieve and drink as
required.
Afraegle paniculata Tree Malaria: boil roots and drink as required. Other uses: extract of
boiled roots used to treat stomach aches
Afzelia africana Tree Malaria: boil leaves and drink as required. Other uses: leaves fed
to livestock; stems used to carve lobi sculptures
Anogeisus leiocarpus Tree Sisinrah Siirah Malaria: boil leaves and twigs, and massage body with decoction
for 3 days. Other uses: extract of boiled stem bark used to treat
stomach aches
Azadirachta indica Tree Akagyatia Malaria: (1) pound leaves, sieve and use for enema. (2) Boil leaves
with leaves of Jatropha gossypifolia and Combretum sp., drink and
use for steam baths. Other uses: grown as a shade tree; leaf extracts
used to treat fevers
Carica papaya Tree Kwalentia Malaria: boil leaves with leaves of Azadirachta indica. Drink as
desired and use for steam baths. Other uses: peeled fruits eaten raw
Cassia sieberiana Shrub Vabine Malaria: boil chopped roots and drink as desired. Add sugar to
taste. Other uses: extract of boiled roots used to treat stomach
aches and taken as aphrodisiac
Cochlospermum tinctorium Herb Gbelonbile Malaria: boil chopped roots and drink as desired. Other uses:
extract of boiled roots used to treat yellow fever
Combretum ghasalense Shrub Popal Kpamara Malaria: boil leaves with that of Jatropha gossipifolia and whole
plant of Ocimum canum, and drink. Use also for steam baths.
Other uses: used as fuel wood
Combretum sp. Shrub Kpekakra Malaria: boil leaves with stem bark of Mangifera indica, leaves of
Azadirachta indica and drink as desired. Other uses: leaves fed to
livestock
Ficus gnaphalocarpa Tree Konkon Malaria: pound roots with roots of Gardenia ternifolia and
Anogessius leiocarpus. Mould into ball and dry. Mash in water and
drink
Ficus platyphylla Tree Selinge Malaria: boil leaves and stems barks, drink as desired. Massage
body with decoction. Other uses: extract of boiled leaves used as a
“body builder”
Gardenia tenifolia Shrub Dajeda Dajugo Malaria: boil leaves and twigs, and drink as desired. Other uses:
planted around houses as a hedge
Haematostaphis barteri Tree Dole Genbereni Malaria: boil leaves with leaves of Pseudocedrela kotschyi and
Ficus ghaphalocarpa. Drink mornings and evenings and massage
body. Other uses: fruits eaten raw
Hyptis spicigera Herb Donbeleva Malaria: boil leaves and drink. Other uses: insect repellent against
mosquitoes
Indigofera pulchra Herb Balesama Malaria: boil whole plants, drink and massage body
Jatropha curcas Shrub Nato Malaria: boils leaves with leaves of Azadirachta indica and Carica
papaya. Drink and use for bathing. Other uses: planted as a hedge.
Latex from twigs used to treat mouth sores
Jatropha gossypiifolia Shrub Natogyere Malaria: boil leaves with leaves of Combretum ghaselensis and
whole plant of Ocimum canum,and drink. Use also for steam
baths. Other uses: planted as a hedge
Khaya senegalensis Tree Koke Malaria: boil stem bark and drink. Other uses: stems and leaves
boiled together and extract drunk as a blood tonic; stems used for
building boats
Lannea acida Tree Manvora/Vaaworo Gbentore Malaria: boil leaves with leaves of Azadirachta indica and
Mangifera indica. Drink and use in steam baths. Other uses:
timber used in house building
Leucas martinicensis Herb Donbeleva Malaria: boil whole plant with Hyptis spicigeria and drink as
required
Mangifera indica Tree Mango Mango Malaria: boil stems barks and drink as required. Other uses: fruits
eaten raw
Mitragyna inermis Tree Yiela Yiele Malaria: (1) Boil leaves and twigs, and drinks. (2) Boil twigs with
whole plant of Indigofera pulchra. Drink 3 times daily. Other uses:
branches used for roofing houses
Monanthotaxis sp. Climber Woretia Malaria: boil leaves and drink three times daily. Massage body
with decoction. Other uses: extract of boiled roots boiled taken to
treat stomach aches
 A. Asase et al. / Journal of Ethnopharmacology 99 (2005) 273–279 277

Table 2 ( Continued )
Species Growth forms Lobi name Wale name How plants are used to treat malaria and other uses
Nauclea latifolia Shrub Gongan Gounge Malaria: (1) pound roots, add lemon juice and palm wine, and
drink as desired. (2) Boil leaves and drink as desired. Other uses:
fruits eaten raw
Ocimum canum Herb Worobagnui Malaria: (1) boil whole plant with leaves of Azadirachta indica,
Combretum ghaselensis and Mitrgyana inermis and drink. (2)
Boil leaves with that of Mangifera indica, Mitragyna inermis
and whole plants of Indigofera indica and drink. Use also for
steam baths. Other uses: seeds soaked and infusion applied to
eyes to treat eye problems
Ozoroa insignis Shrub Dato Malaria: boils leaves and twigs, and drink. Other uses: used as
fuel wood
Parinari polyandra Shrub Bongekapala Malaria: boil leaves, drink and use for bathing
Parkia biglobosa Tree Dowa Dowa Malaria: boil leaves and steam barks, and drink as required.
Other uses: extract of boiled stem bark, fruits and seeds used to
treat stomach aches. Fruit eaten raw and seed used as spice
Paullinia pinnata Shrub Chiau Malaria: boil leaves and drink. Bath mornings and evenings
Pericopsis laxiflora Tree Malaria: boil leaves with that of Combretum sp. and Pericopsis
laxiflora, and drink as required. Other uses: timber used for
roofing
Pseudocedrela kotschyi Tree Kpela Kpela Malaria: boil twigs and leaves, and drink as required. Other uses:
extracts from boiled stem bark used to treat stomach aches and
timber used for building
Pterocarpus erinaceus Tree Pulinyie Malaria: boils leaves with leaves of Afzelia africana. Drink and
use for steam baths. Other uses: leaves used to feed livestock and
branches used for fuel wood
Ricinus communis Shrub Beton Malaria: squeeze leaves in a pot to ferment. Bath with fermented
solution. Other uses: planted as a hedge
Senna occidentalis Herb Bontore Malaria: boil leaves with leaves of Mangifera indica and Carica
papaya. Drink and bath decoction. Other uses: boil whole plant
and extract drunk to reduce swelling
Sterculia setigera Tree Bulinyanie Malaria: boil leaves and drink. Other uses: branches used for
roofing
Strychnos innocua Tree Kolan Polea Malaria: boil leaves and drink as required
Strychnos spinosa Tree Dajekokora Polane Malaria: boil leaves and drink. Grind twigs, add to pomade and
smear on body. Other uses: fruit eaten raw
Tamarindus indica Tree Malaria: boil leaves and stem bark, and drink. Other uses: leaves
cooked with porridge to make it taste sour. Fruit eaten raw
Vernonia amygdalina Shrub Jankpantire Malaria: boil leaves in a maize dough solution (‘Konbire’ in
Lobi) and drink
Xeroderris stuhlmannii Tree Malaria: boil leaves with that of Combretum sp. and Pericopsis
laxiflora, and drink as required. Other uses: branches used for
roofing

Information about the other uses of the anti-malarial plants
species in the sanctuary is outlined in Table 2. For example,
boiled roots of Cassia sieberiana were used to treat stom-
ach aches and also as an aphrodisiac. The boiled stem bark
and leaves of Khaya senegalensis A. Juss. were also drunk
as a blood tonic and the boiled roots of Monathotaxis sp.
Baill. were used to treat stomach aches. In contrast, many
of the species including Mitragyna inermis, Lannea acida
A. Rich., Khaya senegalensis and Xerroderis stuhlmannii
(Taub.) Mendonca. were used as sources of timber. Species
such as Combretum ghaselensis Engl. & Diels, Ozoroa in-
signis Del. and Pterocarpus erinaceus Cam. were used as
domestic sources of energy. Combretum L. sp. and Ptero-
carpus erinaceus were also used for feeding livestock and
Afzelia africana Sm. was used to carve the popular lobi
sculptures.
3.2. Distributional ranges of anti-malarial plants in
study area
Thirteen of the 41 species used in the treatment of malaria
were found around the vicinity of habitations. These species
were often those frequently used by the residents, such as
Acanthospermum hispidum DC, Azadirachta indica, Carica
papaya L., Indigofera pulchra, Mangifera indica, Jatropha
curcas L., Jatropha gossypiifolia L., Hyptis spicigera Lam.,
Leucas martinicensis (Jacq.) R. Br, Ocimum canum, Ricinus
communis L., Senna occidentalis L., and occasionally Parkia
biglobosa (Jacq.) R. Br. Ex G. Dom. The remaining 28 species
were found in the wild. Of these 28 species, 17 was recorded
during the ecological survey and their distribution and density
are presented in Table 3. Of these species, the most widely
distributed species were Combretum ghasalense, Pterocar-
278 A. Asase et al. / Journal of Ethnopharmacology 99 (2005) 273–279

Table 3
Distribution and density of species used to treat malaria in the core area of Wechiau Community Hippopotamus Sanctuary
Species Numbers of quadrates Relative frequency Density (m2 ) Relative density
included/total
Afzelia africana 6 5.3 0.0061 4.2
Anogeissus leiocarpa 12 10.6 0.0061 4.2
Cassia sieberenia 5 4.4 0.0072 5.0
Cochlospermum tinctorium 2 1.8 0.0016 1.1
Combretum ghasalense 25 22.1 0.034 23.4
Combretum sp. 11 9.7 0.012 8.3
Gardenia ternifolia 2 1.8 0.0016 1.1
Haematostaphis barteri 2 1.8 0.0032 2.2
Lannea acida 5 4.4 0.0048 3.3
Mitragyna inermis 15 13.3 0.012 8.3
Nauclea latifolia 2 1.8 0.0016 1.1
Ozoroa insignis 1 0.9 0.0016 1.1
Parkia biglobosa 2 1.8 0.0016 1.1
Pseudocedrela kotschyi 3 2.7 0.042 28.9
Pterocarpus erinaceus 17 15.0 0.0057 3.9
Sterculia setegera 2 1.8 0.0016 1.1
Tamarindus indica 4 3.5 0.0024 1.7

pus erinaceous, Mitragyna inermis and Anogeissus leiocarpa
Guill & Perr. Some of the species reported to treat malaria
were not found during the quadrat studies. Such species were
flagged as ‘rare’ in the sanctuary and included two of the
species classed as being most effective in the treatment of
malaria, Strychnos spinosa Lam. and Vernonia amygdalina,
as well as Afraegle paniculata (Shum & Thonn.) Engl., Ficus
gnaphalocarpa Steud ex Miq., Ficus platyphylla Del., Khaya
senegalensis, Monanthotaxis sp., Parinari polyandra Benth.,
Paullinia pinnata L., Pericopsid laxiflora (Benth. & Baker),
Strychnos innocua and Xeroderris stuhlmannii.
4. Discussion
The present survey has provided information about 41
of species of plants used in the treatment of malaria in
the Wechiau Community Hippopotamus Sanctuary area of
Ghana. The species used in the treatment of malaria rep-
resent 19.5% of the 210 species reported for the sanctuary
(Oteng-Yeboah and Asase, 2002). The study has also shown
how different interviewing methods can influence the scope
of information obtained about the uses of each species. In-
terviews based on plants collected by the person being inter-
viewed identified the least number of species, whereas the
house-to-house interviews identified the most species. The
field interviews were the most effective use of time as they
took less time than the house-to-house interviews. Field inter-
views have also proved very successful in other ethnobotan-
ical studies in Ghana (Oteng-Yeboah, 1999). It is of interest
that although the interviews with the herbalists identified only
a few species as being anti-malarial most of the species they
selected were considered by the community to be active. The
herbalists also collected two of the effective species, Strych-
nos spinosa and Vernonia amygdalina, that were not reported
to be grown in home gardens and not found during the eco-
logical surveys. This suggests that these herbalists had a very
good knowledge of the local flora, especially the growing
places of some of their important medicinal plants.
Most of the species used to treat malaria in the sanctuary
are known to be anti-malarial plants and thus corroborate data
from many other sources including Irvine (1961), Ampofo
(1983), Ayitey-Smith (1989), Abbiw (1990), PORSPI (1992),
Dokosi (1998) and Mshana et al. (2001). The study has also
identified and documented the anti-malarial use for the first
time in Ghana of eight species namely, Afraegle paniculata,
Haematostaphis barteri, Indigofera pulchra, Monathotaxis
sp., Ozoroa insignis, Strychnos innocua, Strychnos spinosa
and Xeroderris stuhlmannii. We were not able to find any pub-
lished literature on the use of these species for the treatment
of malaria in Ghana. The high diversity of plants reported
to have anti-malaria activity during the house-to-house in-
terviews could be because people were reflecting, not only
on what they now use to treat malaria but also on what they
remember being used to treat malaria. Thus an element of
hearsay can occur when collecting information within a group
of people. These data need to be confirmed.
Plant species used in the treatment of malaria in the sanc-
tuary area were derived from a diverse range of plant fam-
ilies and there are no phylogenetic relationships among the
17 families of plants used to treat malaria in the sanctuary
(Chase et al., 1993; Takhtajan, 1997). However, some of the
families containing anti-malarial species including the Anac-
ardiaceae, Asteraceae, Leguminosae, and Rubiaceae contain
other species that are used to treat other illnesses and diseases
in Ghana (PORSPI, 1992; Mshana et al., 2001).
The majority of the herbal preparations identified in this
study involved boiling the plant material and then drinking
the extract. However, none of the people interviewed pro-
vided any information about how they might “standardize”
treatments and the amounts used were generally vague. Thus
the quality could vary greatly among prescriptions.
 A. Asase et al. / Journal of Ethnopharmacology 99 (2005) 273–279
This lack of standardization and quality control is seen
by as one of the main disadvantages of traditional medicine
(Evans-Anfom, 1986; Sofowora, 1982). Some species were
also used as mixtures, which makes it more complex to stan-
dardize as well as investigate and monitor the levels of bi-
ologically active compounds. This investigation would need
to be done if quality control methods were to be developed.
The fact that the most common parts of the plant species
used in the treatment of malaria were leaves and twigs is very
encouraging for sustainable harvesting of the plants. Harvest-
ing roots and bark can easily threaten local populations of
plants unless a sustainable harvesting strategy has been de-
veloped (Cunningham, 2001). If a successful conservation
strategy is to be developed for the sanctuary then, priority
should be given to supporting the sustainable harvesting of the
most effective anti-malarial plants in the sanctuary, especially
those with other uses such as Cassia sieberiana, Mitragyna
inermis, Haematostaphis barteri, Pseudocedrla kostchyi and
Indigofera pulchra. As more people become aware of the
uses of these species they could be among the most exploited
in the sanctuary and are thus likely to be the most threatened.
Plants earmarked as ‘rare’ in the present study could be culti-
vated as part of the home gardening strategy being developed
in the sanctuary.
In this study recording the uses and abundance of the anti-
malarial species of plants has highlighted the importance fact
that some species with medicinal uses are not abundant. The
people living in the sanctuary area were not fully aware that
some of their medicinal plant species were becoming threat-
ened or extinct. This information can assist identify which
species should be given priority when developing sustainable
harvesting strategies for species within the communities. To
enable people in the sanctuary maximize the use of their flora
in their day-to-day activities. It is important that the entire
ethnoflora of the sanctuary is documented as this information
could assist identify conservation strategies for target species
and thus support the health and economy of the community.
Virtually, all people in the Wechiau Community Hip-
popotamus Sanctuary rely on medicinal plants for the treat-
ment of malaria since the nearest hospital is at Wa, about
42 km away accentuated by poor roads and means of trans-
port. Further research should be done on the comparative
anti-malarial activity of the different species to see if the lo-
cal evaluation of the efficacy of the different species can be
scientifically validated.
Acknowledgements
We are grateful to the communities of the Wechiau Com-
munity Hippopotamus Sanctuary area and the Sanctuary
Management Board for providing facilities during the course
279
of the study and for their permission to publish the data. We
are also thankful to ENRECA-DANIDA through the Accra-
Copenhagen Research Link project on Malaria, Earthwatch
Institute and NCRC for support and funding.
References
Abbiw, D.K., 1990. Useful Plants of Ghana. Intermediate Technology
Publication/Royal Botanic Gardens, London/Kew.
Ampofo, O., 1983. First Aid in Plant Medicine. Accra Waterville.
Ayitey-Smith, E., 1989. Prospects and Scope of Plant Medicine in Health
Care. Ghana University Press.
Chase, M.W., Soltis, D.E., Olmstead, R.G., Morgan, D., Les, D.H., Mish-
ler, B.D., Duvall, M.R., Price, R.A., Hills, H.G., Qui, Y., Kron, K.A.,
Rettig, J.H., Conti, E., Palmer, J.D., Manhart, J.R., Systema, K.J.,
Michaels, H.J., Kress, W.J., Karo, K.G., Clark, W.D., Hedren, M.,
Gaut, B.S., Jansen, R.K., Kim, K., Wimpee, C.F., Smith, J.F., Furnier,
G.R., Strauss, S.H., Xiang, Q., Plunkett, G.M., Soltis, P.S., Swensen,
S.M., William, S.E., Gadek, P.A., Quinn, C.J., Equiatre, L.E., Golen-
berg, E., Learn Jr., G.H., Graham, S.W., Barrett, S.C.H., Dayanandan,
S., Albert, C.A., 1993. Phylogenetics of seed plants: analysis of nu-
cleotide sequences from plastid gene rbcL. Annals of the Missouri
Botanical Garden 80, 528–580.
Cunningham, A.B., 2001. Applied Ethnobotany; People, Wild Plant Use
and Conservation. Earthscan Publishers Limited, London.
Dokosi, O.B., 1998. Herbs of Ghana. Ghana University Press.
EPIC, 2004. Electronic Plant Information Centre, Royal Botanic Gardens,
Kew Published on the Internet. http://www.kew.org/epic/ (accessed 27
December 2004).
Evans-Anfom, E., 1986. Traditional Medicine in Ghana: Practice, Prob-
lems and Prospects. Ghana Academy of Arts and Sciences.
Hutchinson, J., Dalziel, J.M., 1937. Flora of West Tropical Africa. The
Crown Agents, London.
Irvine, F.R., 1961. Woody Plants of Ghana. Oxford University Press.
Martin, G., 1995. Ethnobotany—A Manual of Methods. Earthsacn Pub-
lishers Limited, London.
Mshana, R.N., Abbiw, D.K., Addae-Mensah, I., Adjanouhoun, E., Ahyi,
M.R.A., Ekpere, J.A., Enow-Rock, E.G., Gbile, Z.O., Noamesi, G.K.,
Odei, M.A., Odunlami, H., Oteng-Yeboah, A.A., Sarpong, K., So-
forowa, A., Tackie, 2001. Traditional Medicine and Pharmacopoeia;
Contribution to the Revision of Ethnobotanical and Floristic Studies
in Ghana. Science and Technology Press, CSIR.
Oteng-Yeboah, A.A., 1999. A survey of plant uses in three traditional
groves in Guinea savanna zone of northern Ghana. In: Timberlake,
J.M., Kativu, S. (Eds.), African Plants: Biodiversity, Taxonomy and
Uses. Royal Botanic Gardens, Kew, pp. 472–482.
Oteng-Yeboah, A.A., Asase A., 2002. Wechiau Community Hippopota-
mus Sanctuary—preliminary data on floristics. Ghana Journal of Sci-
ence. Book of Abstract, p. 57.
PORSPI, 1992. Ghana Herbal Pharmacopoeia. Policy Research and Strate-
gic Planning Institute, Council for Scientific and Industrial Research,
CSIR, Ghana.
Sofowora, A., 1982. Medicinal Plants and Traditional Medicine in Africa.
Wiley, New York.
Srisilam, K., Veersham, C., 2003. Antimalarials of plant origin. In: Nis-
han, I., Khanu, A. (Eds.), Role of Biotechnology in Medicinal and
Aromatic Plants, vol. VII, pp. 17–47.
Symth, J.D., 1994. Animal Parasitology. Cambridge University Press.
Takhtajan, A., 1997. Diversity and Classification of Flowering Plants.
Columbia University Press.
 Journal of Ethnopharmacology 99 (2005) 281–286

Research of enzymatic activities of fresh juice and

water infusions from dry herbs
Alina Chudnicka a , Grażyna Matysik b,∗
a Department of Medical Microbiology, Medical University, Chodzki 1, 20-093 Lublin, Poland
b Department of Chemistry, Medical University, Staszica 6, 20-081 Lublin, Poland

Received 17 September 2003; received in revised form 11 February 2005; accepted 25 February 2005
Available online 12 April 2005

Abstract

Research was done on the presence of enzymes in juice obtained from fresh plant material from Chamomilla recutita L. (Rauschel)-
anthodium, Lamium album L.-flos, Calendula officinalis L.-flos, Plantaginis lanceolata L.-folium and Euphrasiae rostkoviana Hayne-herba,
and in the prepared water infusion of these materials; the objective was to determine the activity of enzymes which beside biologically active
substances may have an influence of the final therapeutic effect of the applied plant preparations. The research was conducted by means of
the API ZYM system (bioMèrieux). Higher enzymatic activities were found in fresh juices of the examined plant material than in prepared
water infusions from dried plants. In both cases naphthol-AS-BI-phosphohydrolase should have highest activity. The second one in terms of
activity out of 17 studied enzymes was acidic phosphatase. The highest enzymatic activity of fresh juice was found in Lamii albi flos and
Calendulae officinalis flos. Water infusions showed the highest enzymatic activity in Lamii albi flos, Chamomille recutita anthodium and
Plantaginis lanceolata folium. Drying the plant material resulted in decreased enzymatic activities but not in the case of naphthol-AS-BI-
phosphohydrolase and acidic phosphatase which showed very low activities. The complex composition of plant materials in terms of content
of biologically active substances may imply that the therapeutic effect might be directly related to the quantity and activity of plant enzymes
present in preparations applied in therapeutics.
© 2005 Elsevier Ireland Ltd. All rights reserved.

Keywords: Enzymes; Herbs; API ZYM

1. Introduction oil, flavonoids, coumarins, phenolic acids, mucilage. Pharma-

Due to the very complex chemical nature of herbs ap-
plied in therapeutics and the presence of different biologically
active substances, the determination of the biologically ac-
tive compounds in a given plant preparation may sometimes
present serious difficulties.
1.1. Characteristics of plant material
Chamomilla recutita (syn. Matricaria chamomilla L.)
(family Asteraceae) contains as the main compounds: volatile
∗ Corresponding author. Tel.: +48 8153220413; Fax: +48 8153220413.
E-mail address: kosiorma@wp.pl (Grażyna Matysik).
cological actions of Chamomilla recutita anthodium are: anti-
inflammatory, spasmolytic, vulnerary antimicrobial, mildly
sedative, antispasmodic and antiseptic properties. It has
been used for flatulent nervous dyspepsia, travel sickness
and specifically for gastro-intestinal disorders with asso-
ciated nervous irritability in children. It has been used
topically for haemorrhoids, mastitis and leg ulcers (Isaac,
1979; Hausen et al., 1984; Tubaro, 1984; Mann and Staba,
1986).
Lamium album L. (family Labiatae) contains as main
compounds: iridoids, flavonoids, phenolic acids, triterpenes
and mucilage. Pharmacological actions of Lamii albi flos
are: inflammatory diseases of mucous membranes, treatment
of cough, antispasmodic, antibiotic, bacteriostatic properties
(Jaroniewski, 1992; Lewandowski, 1997).

0378-8741/$ – see front matter © 2005 Elsevier Ireland Ltd. All rights reserved.
doi:10.1016/j.jep.2005.02.016
282 A. Chudnicka, Grażyna Matysik / Journal of Ethnopharmacology 99 (2005) 281–286
Calendula officinalis L. (family Asteraceae) contains
as main compounds: flavonoids, terpenoids, volatile oil,
sesquiterpene glycosides, carotenoids, polysaccharides.
Pharmacological actions of Calendulae officinalis flos are:
antibacterial, antiviral activities; anti-inflammatory, cyto-
toxic activity and antitumour activity (against mouse Ehlich
carcinoma) have been documented for Calendulae officinalis
flos (Peyroux, 1981; Fleischner, 1985; Wagner et al., 1985;
Gracza, 1987; Mascolo and Capasso, 1987; Boucard-Maitre,
1988).
In Plantaginis lanceolata L. (family Plantaginaceae) the
main compounds are: iridoids, flavonoids, phenolic acids,
tannins and polysaccharides. Pharmacological actions of
Plantaginis lanceolata folium are: the liquid extract and the
pressed juice of fresh plantain herb possess proven bacterio-
static and bactericidal effects due to the tannins content. In-
dications and usage: common cold, cough/bronchitis, fevers
and colds, inflammation of the mouth and pharynx, inflam-
mation of the skin and tendency to infection. In folk medicine,
the pressed juice is used to treat wounds and inflammations
and as a hemotyptic (Elich, 1962; Koedam, 1977).
Euphrasia rostkoviana Hayne (family Scrophulariaceae)
contains as main compounds: iridoids, lignans, flavonoids,
tannins, phenolic acids, coumarins, volatile oil, mucilage,
sterols and alkaloids. Pharmacological actions of Euphrasia
rostkoviana herba are: bacteriostatic, purgative action in mice
has been documented. Euphrasia rostkoviana herba is used
for blepharitis, conjunctivitis, styes, eye fatigue symptoms,
functional eye disorders of muscular and nervous origin,
coughs and hoarseness (Salama, 1981; Sticher and Salama,
1981; Salama and Sticher, 1983; Swiatek et al., 1984). Be-
side precisely determined biologically active substances in
plant materials, such as, e.g. glycosides, flavonoids, iridoids
or alkaloids, in relation to the biological character of the
plant material, also enzymes occur—specific proteins with
catalytic properties accelerating chemical reactions in plant
cells. Their presence in plants used in therapeutics may also
contribute to the final therapeutic effect. Therefore, it is nec-
essary to make a dependable characteristics of enzymes oc-
curring in plant preparations that may influence their action.
The objective of this work was the determination of the
enzymatic activity of juices obtained from fresh plant raw ma-
terials of Chamomilla recutita anthodium, Lamium albi flos,
Calendula officinalis flos, Plantaginis lanceolata folium, Eu-
phrasiae rostkoviana herba and the water infusion obtained
from these dried raw materials as well as a comparison of
the enzymatic activity of both kinds of these solutions. The
plants have been applied in European folk medicine for a long
time.
2. Materials and methods
The research material was plant raw materials of
Chamomilla recutita anthodium, Lamium albi flos, Cal-
endula officinalis flos, Plantaginis lanceolata folium, Eu-
phrasiae rostkoviana herba, fresh and dried, in the form used
for making infusions according to Polish Pharmacopoea V
(Polish Pharmacopoea, 1990).
Water solutions of fresh juices were used in the study. They
were obtained by crushing collected fresh plant materials and
diluting their juices with aseptic distilled water (1:100) and
by making water infusions of appropriately dried materials.
They were obtained by infusion of 5 g (the equivalent of one
teaspoonful) in 100 mL of aseptic distilled water at 80 ◦ C
until the infusion cooled to the room temperature (22 ◦ C).
The study of enzymatic activities of diluted juices and
prepared infusions was conducted by means of the API
ZYM system (bioMèrieux, France). It contained a set of 20
microtubes in which, besides the control microtube, dehy-
drated substrates were included of 19 enzymes: acidic phos-
phatase, esterase (C4), esterase lipase (C8), lipase (C14),
leucine arylamidase, valine arylamidase, cystine arylami-
dase, trypsin, chymotrypsin, alkaline phosphatase, naphthol-
AS-BI-phosphohydrolase, ␣-galactosidase, ␤-galactosidase,
␤-glucuronidase, ␣-glucosidase, ␤-glucosidase, N-acetyl-␤-
glucosaminidase, ␣-mannosidase and ␣-fucosidase.
The obtained solutions were introduced to microtubes
after a prior filtering by sterile Acrodisc 0.2 ␮m (Gelman
Sciences) which permitted removal of microorganisms and
impurities that might cause false positive or negative results in
the performed determination. An amount of 65 ␮L of the ex-
amined solutions was dispensed to all strip cupules containing
dehydrated substrates for enzymes. After incubation at 37 ◦ C
for 4 h, one drop of ZYM A reagent (Tris–hydroxymethyl-
aminomethane, hydrochloric acid 37%, sodium lauryl
sulfate, H2 O) was added and one drop of ZYM B (Fast Blue
BB, 2-methoxyethanol) to develop a positive color reaction.
After 5 min, the result was read (Table 1) of the activity
of the examined enzyme based on the arisen color reaction
comparing with the result sheet enclosed to the system by
the manufacturer. Determination of activity of enzymes
present in the examined solution was expressed in ␮M/min
(the quantity of hydrolyzed substrate). The results were read
according to the instruction provided by the manufacturer.
In this work, the enzymatic activity was compared for the
same concentrations of juice solutions and water infusions,
and therefore further dilutions were not made when the results
with values >16.0 × 10−5 ␮M/min were obtained.
A strip filled with aseptic distilled water was used as a
control, which was treated in the manner analogous with the
ones used in the study.
3. Results
The activity of 17 enzymes was examined by means
of the API ZYM system (Table 1). The highest enzy-
matic activity of fresh juice (dilution 1:100) (Table 2)
was found in Lamium albi flos in relation to acidic phos-
phatase and naphthol-AS-BI-phosphohydrolase—over
16.0 × 10−5 ␮M/min of the hydrolyzed substrate, and in the
 A. Chudnicka, Grażyna Matysik / Journal of Ethnopharmacology 99 (2005) 281–286 283

Table 1
Reading table (API ZYM)
No. Enzyme assayed Substrate pH Corolles or color of the sample if it
has an intense coloration
Positive Negative
1 Control
2 Alkaline phosphatase 2-Naphthyl phosphate 8.5 Violet No colour or colour of the control if the strip
has been exposed to an intense light source
after addition of the reagents
3 Esterase (C4) 2-Naphthyl butyrate 6.5 Violet Very pale yellow if the strip has not been ex-
posed to an intense light
4 Esterase lipase (C8) 2-Naphthyl caprylate 7.5 Violet
5 Lipase (C14) 2-Naphthyl myristate 7.5 Violet
6 Leucine arylamidase l-Leucyl-2-naphthylamide 7.5 Orange
7 Valine arylamidase l-Valyl-2-naphthylamide 7.5 Orange
8 Cystine arylamidase l-Cystyl-2-naphthylamide 7.5 Orange
Trypsin N-benzoyl-dl-arginine-2-naphthylamide 8.5 Orange
Chymotrypsin N-glutaryl-phenylalanine-2-naphthylamine 7.5 Orange
9 Acidic phosphatase 2-Naphthyl phosphate 5.4 Violet
10 Naphthol-AS-BI-phosphohydrolase Naphthol-AS-BI-phospholate 5.4 Blue
11 ␣-Galactosidase 6-Br-2-naphthyl-␣d-galactopyranoside 5.4 Violet
12 ␤-Galactosidase 2-Naphthyl-␤d-galactopyranoside 5.4 Violet
13 ␤-Glucuronidase Naphthyl-AS-BI-␤d-glucuronide 5.4 Blue
14 ␣-Glucosidase 2-Naphthyl-␣d-glucopyranoside 5.4 Violet
15 ␤-Glucosidase 6-Br-2-naphthyl-␤d-glucopyranoside 5.4 Violet
16 N-acetyl-␤-glucosaminidase 1-Naphthyl-N-acetyl-␤d-glucosaminide 5.4 Brown
17 ␣-Mannosidase 6-Br-2-naphthyl-␣d-mannopyranoside 5.4 Violet
18 ␣-Fucosidase 2-Naphthyl-␣l-fucopyranoside 5.4 Violet

quantity of 12.0 × 10−5 ␮M/min for alkaline phosphatase,
esterase (C4), ␣-galactosidase and ␤-galactosidase, whereas
8.3 × 10−5 ␮M/min was found for esterase lipase (C8) and
N-acetyl-␤-glucosaminidase. The activity of 2.0 × 10−5
to 4.1 × 10−5 ␮M/min was shown by leucine arylamidase,
valine arylamidase, ␣-glucosidase and ␣-mannosidase.
Water infusion of dry (Table 3) Lamium albi flos also showed
the highest activity for naphthol-AS-BI-phosphohydrolase
and acidic phosphatase but with lower values, 8.3 × 10−5
and 4.1 × 10−5 ␮M/min, respectively. The third active
enzyme was esterase (C4) but with a minimum value
in comparison to fresh juice, since it amounted to only

Table 2
Enzymatic activity of water solutions (dilution 1:100) of fresh herb juices from Chamomillae recutita anthodium, Lamii albi flos, Calendulae officinalis flos,
Plantaginis lanceolata folium, Euphrasiae officinalis herba
No. Enzyme assayed Water solution of fresh herbs juice (quantity of hydrolyzed substrate in ␮M/min)

Chamomillae recutita Lamii albi Calendulae Plantaginis Euphrasiae

anthodium flos officinalis flos lanceolate rostkoviana
folium herba
1 Control 0 0 0 0 0
2 Alkaline phosphatase 4.1 × 10−5 12.0 × 10−5 4.1 × 10−5 0 2.0 × 10−5
3 Esterase (C4) 8.3 × 10−5 12.0 × 10−5 2.0 × 10−5 2.0 × 10−5 2.0 × 10−5
4 Esterase lipase (C8) 2.0 × 10−5 8.3 × 10−5 2.0 × 10−5 2.0 × 10−5 0
5 Lipase (C14) 0 0 0 0 0
6 Leucine arylamidase 2.0 × 10−5 4.1 × 10−5 >16.0 × 10−5 12.0 × 10−5 2.0 × 10−5
7 Valine arylamidase 2.0 × 10−5 2.0 × 10−5 0 2.0 × 10−5 2.0 × 10−5
8 Cystine arylamidase 0 0 0 0 0
9 Acidic phosphatase 4.1 × 10−5 >16.0 × 10−5 >16.0 × 10−5 >16.0 × 10−5 >16.0 × 10−5
10 Naphthol-AS-BI-phosphohydrolase 4.1 × 10−5 >16.0 × 10−5 >16.0 × 10−5 >16.0 × 10−5 >16.0 × 10−5
11 ␣-Galactosidase 4.1 × 10−5 12.0 × 10−5 0 2.0 × 10−5 0
12 ␤-Galactosidase 4.1 × 10−5 12.0 × 10−5 4.1 × 10−5 2.0 × 10−5 0
13 ␤-Glucuronidase 0 0 0 0 0
14 ␣-Glucosidase 0 2.0 × 10−5 0 0 0
15 ␤-Glucosidase 4.1 × 10−5 0 0 0 0
16 N-acetyl-␤-glucosaminidase 2.0 × 10−5 8.3 × 10−5 2.0 × 10−5 4.1 × 10−5 0
17 ␣-Mannosidase 0 2.0 × 10−5 0 2.0 × 10−5 0
18 ␣-Fucosidase 0 0 0 0 0
284 A. Chudnicka, Grażyna Matysik / Journal of Ethnopharmacology 99 (2005) 281–286

Table 3
Enzymatic activity of water infusions from dried herbs Chamomillae recutita anthodium, Lamii albi flos, Calendulae officinalis flos, Plantaginis lanceolate
folium, Euphrasiae officinalis herba
No. Enzyme assayed Water infusions from dried herbs (quantity of hydrolyzed substrate in ␮M/min)
Chamomillaerecutita Lamii albi Calendulae Plantaginis Euphrasiae
anthodium flos officinalis lanceolate rostkoviana
flos folium herba
1 Control 0 0 0 0 0
2 Alkaline phosphatase 0 0 0 0 0
3 Esterase (C4) 2.0 × 10−5 2.0 × 10−5 0 0 0
4 Esterase Lipase (C8) 0 0 0 0 0
5 Lipase (C14) 0 0 0 0 0
6 Leucine arylamidase 0 0 0 0 0
7 Valine arylamidase 0 0 0 0 2.0 × 10−5
8 Cystine arylamidase 0 0 0 0 0
9 Acidic phosphatase >16.0 × 10−5 4.1 × 10−5 0 >16.0 × 10−5 2.0 × 10−5
10 Naphthol-AS-BI-phosphohydrolase 12.0 × 10−5 8.3 × 10−5 8.3 × 10−5 >16.0 × 10−5 2.0 × 10−5
11 ␣-Galactosidase 0 0 0 0 0
12 ␤-Galactosidase 0 0 0 0 0
13 ␤-Glucuronidase 0 0 0 0 0
14 ␣-Glucosidase 0 0 0 0 0
15 ␤-Glucosidase 0 0 0 0 0
16 N-acetyl-␤-glucosaminidase 0 0 0 0 0
17 ␣-Mannosidase 0 0 0 0 0
18 ␣-Fucosidase 0 0 0 0 0

2.0 × 10−5 ␮M/min. High enzymatic activity was also
shown by fresh juice from Calendulae officinalis flos.
Similarly as in case of Lamii albi flos its activity was above
16.0 × 10−5 ␮M/min for acidic phosphatase, naphthol-
AS-BI-phosphohydrolase and the third enzyme of leucine
arylamidase. Other enzymes—alkaline phosphatase, es-
terase (C4), esterase lipase (C8), ␤-galactosidase and
N-acetyl-␤-glucosaminidase showed activity of 2.0 × 10−5
to 4.1 × 10−5 ␮M/min. In water infusion of dry herbs
only the activity of naphthol-AS-BI-phosphohydrolase
was found of 8.3 × 10−5 ␮M/min of the substrate. In
case of fresh juice from Plantaginis lanceolata folium the
activity of over 16.0 × 10−5 ␮M/min was shown by acidic
phosphatase and naphthol-AS-BI-phosphohydrolase and
also high activity of 12.0 × 10−5 ␮M/min by leucine ary-
lamidase. Other enzymes like esterase (C4), esterase lipase,
valine arylamidase, ␣-galactosidase, ␣-mannosidase and
N-acetyl-␤-glucosaminidase showed activity of 2.0 × 10−5
to 4.1 × 10−5 ␮M/min. In water infusion of Plantaginis
lanceolata folium high activity of two enzymes was found:
acidic phosphatase and naphthol-AS-BI-phosphohydrolase
16.0 × 10−5 ␮M/min each. In fresh juice from Euphrasiae
rostkoviana herba just like in the solutions examined
before the highest activity of over 16.0 × 10−5 ␮M/min
was also shown by acidic phosphatase and naphthol-AS-
BI-phosphohydrolase, whereas other discovered enzymes:
alkaline phosphatase, esterase (C4), leucine arylamidase
and valine arylamidase-showed only minimum activity of
2.0 × 10−5 ␮M/min. In water infusion presence of only
three enzymes was found—valine arylamidase, acidic
phosphatase and naphthol-AS-BI-phosphohydrolase of
minimum activity of 2.0 × 10−5 ␮M/min. In case of
fresh juice from Chamomilla recutita anthodium the
highest activity of 8.3 × 10−5 ␮M/min was found for
esterase (C4), 4.1 × 10−5 ␮M/min for alkaline phosphatase,
acidic phosphatase, naphthol-AS-BI-phosphohydrolase,
␣-galactosidase, ␤-galactosidase, ␤-glucosidase, and the
minimum activity of 2.0 × 10−5 ␮M/min for esterase
lipase (C8), leucine arylamidase, valine arylamidase and
N-acetyl-␤-glucosaminidase. In water infusion, the activity
of acidic phosphatase was over 16.0 × 10−5 ␮M/min and
of naphthol-AS-BI-phosphohydrolase also amounted to
12.0 × 10−5 ␮M/min. The third enzyme, of very low activity
of 2.0 × 10−5 ␮M/min was esterase (C4). No enzymatic
activity of any examined solutions was found in case of
trypsin and chymotrypsin.
For the control strip where cupules were filled with asep-
tic distilled water no color reactions were found that would
indicate falsely positive results.
An additional observation in the research was finding that
some enzymes still maintained their activity even after 48 h
from the preparation of the infusion.
4. Discussion
Plant preparations applied in medicine exhibit their ther-
apeutic activity due to biologically active substances which
are present in plant cells. Nowadays, the types of biologically
active compounds are well known in most commonly applied
plant drugs. Undoubtedly, the final therapeutic effect is also
influenced by other elements occurring in vegetal cells that
often are not defined precisely, which might be also related to
the difference in therapeutic effects of particular preparations.
 A. Chudnicka, Grażyna Matysik / Journal of Ethnopharmacology 99 (2005) 281–286
Plant enzymes are characterized by diversified biochem-
ical activity differentiated in relation to the place of their
occurrence and the kind of cells. Out of the examined
enzymes ␤-glucosidase was immunocytochemically local-
ized in the chloroplasts of mesophyll cells (Minami et al.,
1997).
The commercial API ZYM system (bioMèrieux, France)
used in this work for determination of enzymes in water solu-
tions of fresh plant juice and water infusion from dry plants is
widely applied to study enzymatic activities of different bac-
terial species, which are often difficult to identify (Citron
et al., 1996; Bascomb and Manafi, 1998; De La Higuera
et al., 1999; Heroldova et al., 2001; Sakamoto et al., 2002;
Samaranayake et al., 2003). Making a phenotype character-
istics by means of this test of the examined species through
the identification of active enzymes is a precise and simple
method.
API ZYM system is also applied to study enzymatic ac-
tivities of other biological materials, such as the human skin
used for transplantation (Chang et al., 1998), human den-
tal plaque microcosm biofilms enzymatic activities (Wong et
al., 2001) of cryopreserved porcine heart valve (Suh et al.,
1999), or e.g. enzymatic activity of microorganisms isolated
from wine cork (Centeno and Calvo, 2001). API ZYM sys-
tem has found applications also in examination of enzymatic
activities of home dust, which is a serious allergen (Martinez
et al., 1999) and manure composting (Tiquia, 2002).
The examination of juice and plant infusions showed a
high differentiation. In fresh juice the activity of 13 en-
zyme activites were found (Table 2). After drying of the
plant, a decrease of enzymatic activity was observed. Out
of the examined enzymes only four were still found ac-
tive (Table 3), acidic phosphatase and naphthol-AS-BI-
phosphohydrolase, esterase (C4) and valine arylamidase. The
two former ones showed very high activity of 16.0 × 10−5
and 12.0 × 10−5 ␮M/min for Calendula officinalis flos and of
16.0 × 10−5 ␮M/min for both enzymes in Plantaginis lance-
olata folium.
The highest enzymatic activity of fresh juice (Table 2)
was found in Lamii albi flos, Calendulae officinalis
flos and Plantaginis lanceolate folium for acidic phos-
phatase and naphthol-AS-BI-phosphohydrolase (over 16.0 ×
10−5 ␮M/min). After drying of the plant material, a high
activity of these enzymes remained in Chamomille recutita
anthodium and Plantaginis lanceolata folium. Naphthol-AS-
BI-phosphohydrolase was also found in pollen contaminated
with other plants parts through the enzyme activity, the esti-
mation of purity of the pollen is possible, which is applied in
the study of allergic reactions (Bousquet et al., 1978, 1980).
Enzymatic activity of water plant extracts used in therapeu-
tics results in the fact that the therapeutic effect, especially
with local application of these preparations, may be the sum
of activity of the main biologically active compounds and
the enzymes maintaining their activity, which in plant blends
may even increase their strength. This effect might be higher
in case of fresh plant juices.
285
5. Conclusions
Higher enzymatic activities were found in case of fresh
juices of the examined plant materials than in prepared water
infusions from dried plants. In both cases naphthol-AS-BI-
phosphohydrolase had the highest quantity, in fresh juice its
activity was 100 times higher. The second enzyme in terms
of activity was acidic phosphatase. The highest enzymatic
activity of fresh juice was found in Lamii albi flos and next
in Calendulae officinalis flos. Of the infusions, the highest
enzymatic activity was found in case of Lamii albi flos,
Chamomille recutita anthodium and Plantaginis lanceolata
folium.
Drying of the examined plant materials caused a decrease
of enzymatic activity of infusions prepared from them. The
highest activities in infusion were the same as obtained for
juice solutions. Due to the complex composition of plant ma-
terials in terms of content of biologically active substances
as well as the discovered enzymatic activity of the obtained
infusions, the therapeutic effect may also be connected with
the presences of plant enzymes.
References
Bascomb, S., Manafi, M., 1998. Use of enzyme test in charac-
terization and identification of aerobic and facultatively anaero-
bic Gram-positive cocci. Clinical Microbiology Reviews 11, 318–
340.
Boucard-Maitre, Y., 1988. Cytotoxic and antitumoral activity of Calendula
officinalis extracts. Pharmazie 43, 220–226.
Bousquet, J., Hale, R., Guerin, B., Michel, F.B., 1980. Enzymatic activi-
ties of house dust extracts. Annals of Allergy 45, 316–321.
Bousquet, J., Marty, J.P., Coulomb, Y., Robinet-Levy, M., Cour, P.,
Michel, F.B., 1978. Enzyme determination and RAST inhibition as-
says for orchard grass (Dactylis glomerata): a comparison of com-
mercial pollen extracts. Annals of Allergy 12, 11–18.
Centeno, S., Calvo, M.A., 2001. Enzymatic activity of micro-organisms
isolated from cork wine stooppers. Microbios 106, 69–73.
Chang, P., Rosenquist, M.D., Lewis II, R.W., Kealey, G.P., 1998. A
study of functional viability and metabolic degeneration of human
skin stored at 4 ◦ C. Journal of Burn Care and Rehabilitation 19,
25–28.
Citron, D.W., Hunt Gerardo, S., Claros, M.C., Abrahamian, F., Ta-
lan, D., Goldstein, E.J., 1996. Frequency of isolation of Porphy-
romonas species from infected dog and cat bite wounds in humans
and their characterization by biochemical tests and arbitrarily primed-
polymerase chain reaction fringerprinting. Clinical Infection Diseases
23, 78–82.
De La Higuera, A., Gutierrez, J., Garcia-Mendoza, A., Castillo, A., 1999.
A new biotyping method for Streptococcus mutans with the API ZYM
system. Clinical Microbiology Infection 5, 88–91.
Elich, J., 1962. Die antibakterille Aktivität einiger einheimischer
Plantago-Arten. Disseratieon Universität, Berlin.
Fleischner, A.M., 1985. Plant extracts: to accelerate healing and reduce
inflammation. Cosmet Toilet 100, 45–49.
Gracza, L., 1987. Oxygen-containing terpene derivatives from Calendula
officinalis. Planta Medica 53, 227–229.
Hausen, B.M., Busker, E., Carle, R., 1984. Sensitizing capacity of comp-
posite plants. VII. Experimental studies with extracts and compounds
of Chamomilla recutita L. Rauschert and Anthemis cotula L. Planta
Medica 50, 229–234.
286 A. Chudnicka, Grażyna Matysik / Journal of Ethnopharmacology 99 (2005) 281–286
Heroldova, M., Nemec, M., Hubalek, Z., Halouzka, J., 2001. Enzyme
activities of Borrelia burgdorferi sensu lato. Folia Microbiologica 46,
179–182.
Isaac, O., 1979. Pharmacological investigations with compounds of
chamomile. I. The pharmacology of (−)alpha-bisabolol and bisabolol
oxides (review). Planta Medica 35, 118–124.
Jaroniewski, W., 1992. Lamii albi in medicine. Herbs News, Warsaw 7,
10 (in Polish).
Koedam, A., 1977. Plantago-history and use. Pharmaceutisch Weekblad
112, 246–252.
Lewandowski, A., 1997. Lamii albi—description and use in medicine.
Herbs News, Warsaw 5, 18–23 (in Polish).
Mann, C., Staba, E.J., 1986. The chemistry, pharmacology, and commer-
cial formulations of Chamomille. In: Craker, L.E., Simon, J.E. (Eds.),
Herbs, Spuices, Medicinal Plants: Recent Advantages in Botany, Hor-
ticulture, and Pharmacology, vol. 1. Oryx Press, Arizona, pp. 235–280.
Martinez, J., Eraso, E., Palacios, R., Guisantes, J.A., 1999. Enzy-
matic analyses of house dust mite extracts from Dermatophagoides
pteronyssnus and Dermatophagoides farinae (Acari Poroglyphidae)
during different phases of culture growth. Journal of Medical Ento-
mology 36, 370–375.
Mascolo, N., Capasso, F., 1987. Biological screening of Italian medicinal
plants for anti-inflammatory activity. Phytotherapy Research 1, 28–31.
Minami, Y., Takao, H., Kanafuji, T., Minura, K., Hara-Nishimura, I.,
Nishimura, M., Matsubara, H., 1997. Beta-glucosidase in the Indigo
plant: intracellular localization and tissue specific expresion in leaves.
Plant and Cell Physiology 28, 1069–1074.
Peyroux, J., 1981. Propriétés anti-oedémateuses et anti-hyperhémiantes du
Calendula officinalis L. Planta Medical Phytotherapy 15, 210–216.
Polish Pharmacopoea (Farmakopea Polska V), 1990. Panstwowy Zaklad
Wydawnictw Lekarskich (PZWL), pp. 50–96.
Sakamoto, M., Sukuzuki, M., Umeda, M., Ishikawa, I., Benno, Y., 2002.
Reclassiofication of Bacteroides fosythus (Tanner et al., 1986). In-
ternational Journal of Systematic and Evolutionary Microbiology 52,
841–849.
Salama, O., 1981. A lignan glucoside from Euphrasia rostkoviana. Phy-
tochemistry 20, 2003–2004.
Salama, O., Sticher, O., 1983. Iridoid glucosides von Euphrasia ros-
tkoviana. 4. Mitteilung uber Euphrasia-Glykoside. Planta Medica 47,
90–94.
Samaranayake, Y.H., Samaranayake, L.P., Yau, J.Y., Dassanayake, R.S.,
Li, T.K., Anil, S., 2003. Phenotypic diversity of oral C. albicans
isolated on single and sequential visits in an HIV-infectied Chinese
cohord. Acta Pathologica, Microbiologica et Immunologica Scandi-
navica 1, 329–337.
Sticher, O., Salama, O., 1981. Irydoid glukosides from Euphrasia rostko-
viana. Planta Medica 42, 122–123.
Suh, H., Lee, J.E., Park, J.C., Han, D.W., Yoon, C.S., Park, Y.H., Cho,
B.K., 1999. Viability and enzymatic of cryopreserved parcine heart
valve. Yonsei Medical Journal 40, 184–190.
Swiatek, L., Grabias, B., Chaudhuri, R.K., Calis, L., Lehmann, D., Meier,
B., Sticher, O., 1984. Iridoid glycosides from Lathraea squamaria L.
(Scrophulariaceae). Farmacie Tijdschrift Belgie 61, 377–385.
Tiquia, S.M., 2002. Evolution of extracellular enzyme activities dur-
ing manure composting. Journal of Applied Microbiology 92, 764–
775.
Tubaro, A., 1984. Evaluation of antiinflammatory activity of a chamomile
extract after topical application. Planta Medica 50, 359–363.
Wagner, H., Proksch, A., Riess-Maurer, J., Vollmar, A., Odenthal, S.,
Stuppner, H., Jurcic, K., Le Turdu, M., Heur, Y.H., 1985. Im-
munostimulating polysaccharides (heteroglycans) of higher plants.
Arzneimittelforschung 35, 1069–1071.
Wong, L., Sisson, C., Sisson, C.H., 2001. A comparison of human den-
tal plaque microcosms biofilms grown in an undefined medium and
a chemically defined artificial saliva. Archives of Oral Biology 46,
477–486.
 Journal of Ethnopharmacology 99 (2005) 287–292

Isolation and antimicrobial activity of two phenolic compounds

from Pulicaria odora L.
A. Ezoubeiri a , C.A. Gadhi a,∗ , N. Fdil b , A. Benharref c , M. Jana a , M. Vanhaelen d
a Laboratory of Phytochemistry and Medicinal Plants, Department of Biology, Faculty of Sciences, Semlalia, B.P. 2390, Marrakesh 40 000, Morocco
b Laboratory of Microbiology, CHU Mohammed VI, Hospital Ibn Tofaı̈l, Gueliz Marrakesh 40 000, Morocco
c Laboratory of Chemistry of Natural Substances and Heterocycles, Department of Chemistry, Faculty of Sciences,

Semlalia, B.P. 2390, Marrakesh 40 000, Morocco

d Laboratory of Pharmacognosy and Bromatology, ULB, Institute of Pharmacy, Campus de la plaine-CP 205-4

Boulevard du Triomphe, B-1050 Brussels, Belgium

Received 6 May 2004; received in revised form 16 February 2005; accepted 25 February 2005
Available online 7 April 2005

Abstract

The essential oil of Pulicaria odora, a Moroccan medicinal plant; was analyzed by GC–MS, and subjected to column chromatography
on silica gel. Two major constituents were isolated and identified as 2-isopropyl-4-methylphenol (1) and isobutyric acid 2-isopropyl-4-
methylphenylester (2), by analysis of spectroscopic data (MS, 1 H NMR, 13 C NMR, DEPT, COSY, HMQC and HMBC experiments). The
isolated compounds are reported for the first time from Pulicaria genus.
The essential oil and its major constituents (compounds 1 and 2) were examined for antibacterial and antifungal activity in vitro using
the diffusion and dilution methods. Results showed that the essential oil and the 2-isopropyl-4-methylphenol (1) exhibited a very significant
antibacterial and antifungal activity, while the isobutyric acid 2-isopropyl-4-methylphenylester (2) was inactive for all tested strains.
© 2005 Elsevier Ireland Ltd. All rights reserved.

Keywords: Pulicaria odora; Compositae; Essential oil; 2-Isopropyl-4-methylphenol; Isobutyric acid 2-isopropyl-4-methylphenylester; Antimicrobial activity

1. Introduction Various biological activities have been reported for some

Pulicaria genus belongs to the family of the Composi-
tae, tribe Inuleae, which contains 100 species (Emberger
and Chadefaud, 1960). The chemical investigation of the
genus showed the occurrence of molecules such as diter-
penes (Rustaiyan et al., 1981; Singh et al., 1985; Muhammad
et al., 1992), sesquiterpenes (Bohlmann et al., 1979; Zdero
et al., 1988; San Feliciano et al., 1989; Mossa et al., 1992;
Dendougui et al., 2000); caryophyllenes and caryophyllane
derivatives (Bohlmann and Zdero, 1981; Bohlmann et al.,
1982; Hafez et al., 1987; Marco et al., 1992) and flavonoids
(Pares et al., 1981; El-Negoumy et al., 1982; Mossa et al.,
1988; Mansour et al., 1990; Christine et al., 2003).
∗ Corresponding author. Tel.: +212 44 43 46 49; fax: +212 44 43 74 12.
E-mail address: radi.gadhi@iam.net.ma (C.A. Gadhi).
species of Pulicaria, such as cytotoxic activity of Pulicaria
crispa and Pulicaria orientalis (Al-Yahya et al., 1988; Awadh
et al., 2001), antibacterial activity of Pulicaria undulata and
Pulicaria dysenterica (El-Kamali et al., 1998; Bahman et al.,
2002), antispasmodic activity of Pulicaria glutinosa (Tanira
et al., 1996) and antihistaminic effect of Pulicaria dysenterica
(Mahfouz et al., 1973).
Pulicaria odora L. (Compositae) is a Moroccan medicinal
plant widely used in traditional medicine to treat back-pain,
intestinal disorders and menstrual cramps (our own investiga-
tion). The plant is also a constituent of the traditional remedy
called “Mssakhen”, which is given to women after childbirth.
It is also a spice appreciated for its flavour, which is used to
perfume bread and meat.
No previous phytochemical work has been done on the
essential oil of this specie, nor any biological study.

0378-8741/$ – see front matter © 2005 Elsevier Ireland Ltd. All rights reserved.
doi:10.1016/j.jep.2005.02.015
288 A. Ezoubeiri et al. / Journal of Ethnopharmacology 99 (2005) 287–292

In this work, we report the isolation and the total struc- Table 1
1 H and 13 C-NMR data of compound 1 (300 MHz, in CDCl )
tural elucidation of two major essential oil constituents of 3
1H NMR 13 C NMR
Pulicaria odora, as well as their antibacterial and antifungal
activities. 1 – 150.5
2 – 134.4
3 7.12 (s) 127.0
4 – 130.1
2. Materials and methods 5 6.96 (d, J = 8.1 Hz) 127.0
6 6.73 (d, J = 8.1 Hz) 115.3
2.1. Plant material CH3 2.38 (s) 20.8
1 3.31 (t, J = 6.9 Hz) 27.0
Pulicaria odora was collected in March from Mrissat, at 2 1.35 (d, J = 6.9 Hz) 22.7
3 1.35 (d, J = 6.9 Hz) 22.7
70 km on the East of Rabat (Morocco). The plant was iden- OH 5.28 –
tified by Professor A. Ouyahya from the Scientific Institute
␦ values in ppm and coupling constants (in parentheses) in Hz.
(Rabat). A voucher specimen was deposited in the botanic
department (RAB No. 65346).
petroleum ether–diethylether to give seven fractions. Fraction
2.2. General instrumental equipment VI (170 mg, petroleum ether–diethylether (97:3), 500 ml) and
fraction IV (752 mg, petroleum ether–diethylether (98:2),
1Hand 13 C NMR spectra were recorded on a Bruker 150 ml) gave pure compounds 1 and 2, respectively, while
Avance 300 spectrometer, operating at 300.13 MHz for 1 H fraction I (20 mg, 100% petroleum ether, 100 ml), fraction
and 75.47 MHz for 13 C. 1 H chemical shifts were referred to II (12.5 mg, 100% petroleum ether, 100 ml), fraction III
the residual chloroform signal (7.26 ppm); 13 C NMR were (6 mg, petroleum ether–diethylether (98:2), 400 ml), fraction
referred to the central peak of CDCl3 (77.16 ppm). V (13 mg, petroleum ether–diethylether (98:2), 200 ml) and
Electron impact (70 eV) GC–MS experiment was carried fraction VII (120 mg, petroleum ether–diethylether (95:5),
out with a Varian 3800 Gas chromatograph coupled with a 200 ml) were mixtures.
Saturn 2000 Mass spectrometer.
Column chromatography was performed on silica gel 60
2.6. Identification of pure compounds
(70–230 mesh, Fluka). For TLC, plastic sheets silica gel 60
F254 (Merck) were used. Spots were detected under UV light
2.6.1. 2-Isopropyl-4-methylphenol (1)
or after they were sprayed with iode. Optical rotations were
Yellow oil; represents 20.26% of the essential oil; EI-MS
measured with a polarimeter 341 (Perkin-Elmer) at 589 nm
m/z 150: 135 (100), 150 (41), 107 (25), 91 (11), 105 (10), 79
at 20 ◦ C.
(3), 77 (2.5); 1 H and 13 C-NMR data see Table 1.
2.3. Extraction of essential oil (EO)
2.6.2. Isobutyric acid 2-isopropyl-4-methyl-phenylester (2)
The air-dried roots of Pulicaria odora (1 kg) were sub- Yellow oil; represents 61.93% of the essential oil. EI-MS
jected to steam distillation for 4 h; they yielded a yellow oil m/z 220: 135 (100), 150 (75), 219 (56), 220 (37), 221 (53),
with a strong aromatic odour (yield of oil 0.6–0.8% w/w) and 71 (11), 105 (6); 1 H and 13 C NMR data: see Table 2.
[␣]D 20 : −14 (c 0.005, CHCl3 ). The oil, dried over anhydrous
sodium sulphate, was stored in air-tight glass vials, which are
covered with aluminium foil at 4 ◦ C. Table 2
1 H and 13 C-NMR data of compound 2 (300 MHz, in CDCl )
3
1H 13 C
2.4. GC–MS analysis NMR NMR
1 – 146.1
Gas chromatography was performed on a capillary silica 2 – 139.7
BP5 column (25 m × 0.32 mm i.d.; film thickness 0.25 ␮m). 3 7.22 (d, J = 1.8 Hz) 127.2
GC was programmed from 60 to 220 ◦ C with a heating rate 4 – 135.5
5 7.10 (dd, J = 8.1, 2.1 Hz) 127.1
of 3 ◦ C/min. The carrier gas was helium (1 ml/min) and the 6 6.97 (d, J = 8.1 Hz) 122.0
injector temperature was of 250 ◦ C. Mass spectrometer was CH3 2.43 (s) 21.1
an electron impact (EI) type (70 eV), programmed from m/z 1 3.13 (t, J = 6.9 Hz) 27.2
45 to m/z 500. 2 1.34 (d, J = 0.6 Hz) 23.0
3 1.32 (d, J = 0.9 Hz) 22.9
1 – 175.7
2.5. Fractionation of essential oil of Pulicaria odora 2 2.93 (t, J = 6.9 Hz) 34.3
3 1.46 (d, J = 0.9 Hz) 19.0
The essential oil (1.3 g) was subjected to column chro- 4 1.43 (d, J = 0.9 Hz) 18.9
matography (CC) on silica gel, using a stepwise gradient of ␦ values in ppm and coupling constants (in parentheses) in Hz.
 A. Ezoubeiri et al. / Journal of Ethnopharmacology 99 (2005) 287–292
2.7. Reduction of 2 by LiAlH4
To a solution of 0.1 g of compound 2 in 50 ml of anhydrous
diethylether, it was added two equivalents of lithium and alu-
minium hydrid (LiAlH4 ). The mixture was refluxed for 24 h.
After hydrolyse, the reactional mixture was extracted with
diethylether (3 × 20 ml). The organic layers were dried over
anhydrous sodium sulphate, then evaporated under vacuum
yielding compound 1.
2.8. Thymol
Commercial thymol was purchased from Sigma. 1 H NMR
(300.13 MHz, CDCl3 ): ␦ = 1.29 (d, 6H, J = 6.9 Hz, H-2 , H-
3 ), 2.31 (s, 3H, CH3 -5) 3.22 (t, 1H, J = 6.9 Hz, H-1 ), 4.89 (s,
1H, OH-1), 6.61 (s, 1H, H-6), 6.79 (d, 1H, J = 7.8 Hz, H-3),
7.14 (d, 1H, J = 7.8 Hz, H-4); 13 C NMR (75.47 MHz, CDCl3 ):
␦ = 21.1 (CH3 -C-5), 23.0 (C-2 , C-3 ), 26.9 (C-1 ), 116.4 (C-
6), 122.0 (C-4), 126.5 (C-3), 131.8 (C-2), 136.8 (C-5), 152.7
(C-1); MS (EI, 70 eV), m/z: 150.
2.9. Antimicrobial assay
2.9.1. Tested compounds
The essential oil of Pulicaria odora as well as compounds
1 and 2 were tested for antimicrobial activity. They were ster-
ilized by filtration through a 0.45 ␮m membrane filter before
testing. Amoxicillin with clavulanic acid (AMC) (Smithkline
Beecham) served as positive controls for the tested bacteria
whereas Nystatin (Ny) (Bristol-Myers Squibb) served
as positive control for Candida albicans, and dimethyl-
sulfoxide (DMSO) (10%) solution was tested as solvent
control.
2.9.2. Microorganisms
Six strains of bacteria were tested: Staphylococcus
aureus (ATCC 25923), Escherichia coli (ATCC 25922),
Pseudomonas aeruginosa (ATCC 27853), Salmonella ty-
phimurium (ATCC 43971), Vibrio colerae (ATCC 14033),
Streptococcus pyogenes (groupe A) (HITM 100) as well as
one fungal strain Candida albicans (HITM 22). These two
latter strains, Streptococcus pyogenes and Candida albicans,
were isolated from patients hospitalised in the University
Hospital Center of Marrakech (Morocco) and preserved in the
Laboratory of Bacteriology of this Center (Hôpital Ibn Tofail
Marrakech, Morocco). They were identified using standard
methods (Murray et al., 1995).
2.9.3. Preparation of inocula
An 18 h-old culture of selected bacteria/yeast was mixed
with sterile physiological saline and the turbidity was cor-
rected by adding sterile physiological saline until a Mac
Farland turbidity standard of 0.5 (106 colony forming units
(CFU) per ml).
289
2.9.4. Preparation of test discs
Whatman no. 1 sterile filter paper discs (6 mm) were im-
pregnated respectively with the essential oil (10 ␮l), com-
pound 1 (2 ␮l) and compound 2 (2 and 5 ␮l).
Commercial antibacterial test discs (Oxoid) containing
30 ␮g/disc of Amoxicillin with clavulanic acid (AMC) was
used. The solution of nystatin (6 mg/ml) was prepared in
DMSO (10%) and deposited on filter paper disc to give
30 ␮g/disc. Disc impregnated with 10% of DMSO served
as solvent control.
2.9.5. Screening of antimicrobial activities
The antibacterial and antifungal susceptibilities tests were
carried out using the agar diffusion method (Janssen et al.,
1987) followed by the dilution method for products which
presented a bioactivity. Petri plates were prepared by pouring
20 ml of Mueller Hinton agar (BIO-RAD) supplemented with
5% defibrinated sheep blood for Streptococcus pyogenes,
Mueller Hinton agar for all the other bacteria and Sabouraud
Dextrose agar for yeast. The inoculum was spread on the
top of the solidified media and allowed to dry for 10 min.
The discs were then applied and the plates were left 30 min
at room temperature to allow the diffusion of the oil before
their incubation for 24 h at 37 ◦ C in 5% CO2 for Streptococ-
cus pyogenes, at 37 ◦ C in air for other bacteria and at 25 ◦ C
for yeast (Collins et al., 1989). The inhibition zones formed
around the discs were evaluated in millimeters. Each test was
carried out in triplicate.
Minimum inhibitory concentration (MIC) was determined
by the dilution method as recommended by the National
Committee for Clinical Laboratory Standards (NCCLS)
(1997). To obtain stable dispersion, stock solutions of es-
sential oil and compound 1 were prepared in 0.2% agar sus-
pension according to the technique of Remmal et al. (1993).
Further dilutions were then performed using the same sus-
pension. The final concentrations of tested products in petri
dishes were 0% (control), 0.01%, 0.1%, 0.2%, 0.4% and 1%
(v/v) (Benjilali et al., 1986; Tantaoui-Elaraki et al., 1993).
Stock solutions of AMC and Nystatin were prepared in
DMSO. Further dilutions were achieved using sterile dis-
tilled water yielding concentrations from 0.06 to 128 ␮g/ml.
Solvent control was prepared with DMSO. Experiments were
carried out in triplicate. Inhibition of microbial growth in the
plates containing tested solutions was judged by comparison
with growth in blank control plates. Solvent at 10% had no
inhibition effect. Minimum inhibitory concentration (MIC)
was defined as the lowest concentration of test samples that
resulted in a complete inhibition of visible growth.
3. Results and discussion
Steam distillation of Pulicaria odora roots produced a yel-
low oil with a yield of 0.6–0.8%. GC–MS analysis of the
essential oil indicated that it consists of a mixture of more
than 70 compounds, among which five represents 90% of the
290 A. Ezoubeiri et al. / Journal of Ethnopharmacology 99 (2005) 287–292
Fig. 1. Structures of compounds 1 and 2 isolated from the essential oil of
Pulicaria odora.
total oil. Comparison of their retention times and mass spec-
tra with those of authentic samples and/or Nist mass spectral
database was unfruitful and no compounds could be identi-
fied. Therefore, we carried out the separation of the essential
oil on column chromatography over silica gel, using a gra-
dient of petroleum ether and diethylether as eluents. It led
to the isolation of two pure compounds 1 and 2 (Fig. 1),
which represent the two major constituents with a yield of
20.26 and 61.93%, respectively. The analysis of 1 H NMR,
13 C NMR, DEPT, COSY, HMQC and HMBC spectral data
gave the total 1 H and 13 C assignments for these compounds
as in Tables 1 and 2.
Compound 1 was obtained as a yellow oil with a molecular
ion signal at m/z = 150 (EI-MS) corresponding to the molec-
ular formula C10 H14 O. This formula was supported by 13 C
NMR and DEPT spectroscopy, which showed 10 carbon sig-
nals due to three methyls, four methines and three quaternary
carbons. 1 H NMR spectrum signals of 1 (Table 1) are consis-
tent with a disubstituted phenol nucleus, with a methyl and
an isopropyl moieties. The isopropyl group (␦ 3.31 (1H, t,
J = 6.9 Hz); ␦ 1.35 (6H, d, J = 6.9 Hz)) was easily determined
from 1 H–1 H COSY spectrum.
The comparison of 1 H NMR spectra of compound 1 and
thymol (Sigma) run in the same conditions showed identi-
cal signals, except for the aromatic singlet signal which was
downfield shifted from 6.61 ppm (thymol) to 7.12 ppm (com-
pound 1). To confirm this structural difference, a mixture
of thymol and compound 1 (1:1) was subjected to GC–MS
yielding two distinguished peaks with different, but close,
retention time. Therefore, the structure of 1 is supposed to
be one thymol isomer. This was confirmed by the long range
correlations observed in its HMBC spectrum (Fig. 2). In fact,
the occurrence of the long range correlations between the
aromatic proton (␦ 7.12 ppm) and the methine carbon of iso-
propyl group (C-1 , ␦ 27.0 ppm) and the quaternary carbon
(C-1, ␦ 150.5 ppm) suggests that the singlet should be as-
signed to a proton at the position 3 of the phenyl instead
of position 6 as in the thymol. Therefore, and in the basis
of all spectral data, the structure of 1 was determined as
2-isopropyl-4-methylphenol. This is the first time that this
compound was reported from a Pulicaria specie. However, it
has previously been found as a minor constituent (0.3–0.4%)
of the essential oil of Lippia graveolens HBK (Verbenaceae)
from El Salvador (Vernin et al., 2001). Its identification was
based only on the comparison with mass spectral data and
retention indices, but no NMR spectral data were reported.
Compound 2 was a yellow oil, its molecular formula
C14 H20 O2 was inferred from the M+ peak at m/z = 220 (EI-
MS). Compounds 1 and 2 showed similar features in their 1 H
and 13 C NMR spectra (Tables 1 and 2), with the occurrence
of a second isopropyl group signals in the 1 H NMR spectrum
of compound 2. The 13 C NMR resonance at ␦ 175.7 of 2 sug-
gested that a carbonyl moiety existed in the structure. Lower
field shift of C-1 (␦ 146.1 ppm) signal indicated the bonding
site of the acyl function (Chari et al., 1977). Unequivocal in-
formation could be obtained from 2D NMR (COSY, HMBC)
and by the reduction of 2 with LiAlH4 which afforded 1.
Therefore compound 2 is the isobutyric acid 2-isopropyl-4-
methyl-phenylester. To our knowledge, it is a new compound
and it represents the major constituent of the essential oil of
Pulicaria odora.
Compounds 1 and 2 can be considered as two thymol iso-
mers isolated for the first time from Pulicaria genus while
thymol and some thymol derivatives have been previously
reported in others Pulicaria species (Metwally et al., 1986;
Mossa et al., 1987; Zdero et al., 1988; Weyerstahl et al., 1999).
The antibacterial assay carried out by the diffusion method
on the essential oil and the compounds 1 and 2, showed that
the essential oil of Pulicaria odora and compound 1 possess
an inhibitory activity against all bacteria and yeast tested, ex-
cept for Pseudomonas aeruginosa; by contrast compound 2
was inactive for all (Table 3). The most susceptible strains
were the Gram positive Staphylococcus aureus and Strepto-
coccus pyogenes; the Gram negative strain Vibrio colerae and
the yeast Candida albicans.
Minimum inhibitory concentrations (MIC) were deter-
mined for compound 1 and the essential oil by the dilution
method in solid media (Table 3). Compound 1 demonstrated
the most interesting inhibitory activities with MIC ranging
from 1 to 2 ␮l/ml (v/v), compared to the essential oil which
showed MIC ranging from 2 to 10 ␮l/ml (v/v).
Fig. 2. The most important long range correlations observed in the HMBC
spectrum of compound 1.
 A. Ezoubeiri et al. / Journal of Ethnopharmacology 99 (2005) 287–292 291

Table 3
Antimicrobial activity of essential oil (EO) of Pulicaria odora and of its main component 1
Microorganisms Inhibition zonea (mm) Minimum inhibitory concentration

Pulicaria odora (␮l) Antibiotics (␮g) Pulicaria odora (␮l/ml) Antibiotics (␮g/ml)

EO 1 AMCb Nyc EO 1 AMC Ny

10 2 30 30
Escherichia coli (ATCC 25922) 10 30 20 NT 10 2 2 NT
Staphylococcus aureus (ATCC 25923) 20 30 35 NT 2 1 0.5 NT
Pseudomonas aeruginosa (ATCC 27853) – – – NT NT NT NT NT
Salmonella typhimurium (ATCC 43971) 8 24 24 NT 4 2 0.25 NT
Vibrio colerae (ATCC 14033) 18 35 20 NT 4 1 1 NT
Streptococcus pyogenes (A) (HITM 100) 16 30 20 NT 4 2 1 NT
Candida albicans (HITM 22) 16 32 NT 18 2 1 NT 1
(–) Inactive; NT: not tested.
a Includes diameter of disc (6 mm).
b AMC: Amoxicillin with clavulanic acid.
c Ny: Nystatin.

In conclusion, this study shows very interesting antimi-
crobial properties of the essential oil of Pulicaria odora and
its major constituent, compound 1.
The high bioactivity of 1 is possibly related to its
chemical structure as a phenol derivative. In fact, according
to Franchomme (1981) and Kurita and Koike (1983),
phenols are more active than alcohols than aldehydes
than ketones than ethers and esters than hydrocarbons (phe-
nols > alcohols > aldehydes > ketones > ethers > hydrocarbons).
This may also explain the inactivity of compound 2.
The fact that the essential oil exhibits such antimicrobial
activity provides some scientific basis for the traditional use
of the plant by women after childbirth as an antiseptic and an-
tiinflammatory remedy to avoid post-partum complications.
Based on this, further chemical and pharmacological in-
vestigations to isolate and identify minor essential oil con-
stituents of Pulicaria odora, and to screen other potential
bioactivities may be recommended.
Acknowledgements
The authors are grateful to Professor A. Ouyahya; from
the Scientific Institute of Rabat (Morocco), for the botanical
identification and to Prof. R. Vanhaelen-Fastre from Institute
of Pharmacy of Brussels, for her excellent guidance.
References
Al-Yahya, M.A., El-Sayed, A.M., Mossa, J.S., Kozlowski, J.F., Antoun,
M.D., Ferin, M., Baird, W.M., Cassady, J.M., 1988. Potential cancer
chemopreventive and cytotoxic agents from Pulicaria cripa. Journal
of Natural Products 51 (3), 621–624.
Awadh, N.A.A., Julich, W.D., Kusnick, C., Lindequist, U., 2001. Screen-
ing of Yemeni medicinal plants for antibacterial and cytotoxic activi-
ties. Journal of Ethnopharmacology 74, 173–179.
Bahman, N., Gholam reza, A., Parivash, G., 2002. Antimicrobial activity
of Pulicaria dysenterica. Iranian Journal of Pharmaceutical Research
1, 31–32.
Benjilali, B., Tantaoui-Elaraki, A., Ismaili-Alaoui, M., Ayadi, A., 1986.
Méthode d’étude des propriétés antiseptiques des huiles essentielles
par contact direct en milieu gélosé. Plantes Médicinales et Phytother-
apie 20, 155–167.
Bohlmann, F., Knoll, K.H., El-Emary, N.A., 1979. New type of
sesquiterpene lactone from Pulicaria crispa. Phytochemistry 18 (7),
1231–1233.
Bohlmann, F., Zdero, C., 1981. Caryophyllene derivatives and a hy-
droxyisocomene from Pulicaria dysenterica. Phytochemistry 20 (11),
2529–2534.
Bohlmann, F., Maniruddin, A., Jakupovic, J., 1982. Caryophyllane deriva-
tives from Pulicaria scabra. Phytochemistry 21 (7), 1659–1661.
Chari, V.M., Jordan, M., Wagner, H., Thies, P.W., 1977. A 13 C NMR
study of the structure of an acyl-linarin from Valeriana wallichii.
Phytochemistry 16 (7), 1110–1112.
Christine, A.W., Jeffrey, B.H., Jenny, G., Renee, J.G., Geoffrey, C.K.,
John, E., 2003. Variation in lipophilic and vacuolar flavonoids among
European Pulicaria species. Phytochemistry 64, 275–283.
Collins, C.H., Lyne, P.M., Grange, J.M., 1989. Microbiological Methods,
6th ed. Butterworths, London, p. 410.
Dendougui, H., Benayache, S., Benayache, F., Connoly, J.D., 2000.
Sesquiterpene lactones from Pulicaria crispa. Fitoterapia 71, 373–
378.
El-Kamali, H.H., Ahmed, A.H., Mohammed, A.S., Yahia, A.A.M., El-
Tayeb, I.H., Ali, A.A., 1998. Antibacterial properties of essential oils
from Nigella sativa seeds, Cymbopogon citratus leaves, and Pulicaria
undulata aerial parts. Fitoterapia 69 (1), 77–78.
El-Negoumy, S.I., Mansour, R.M.A., Saleh, N.A.M., 1982. Flavonols of
Pulicaria arabica. Phytochemistry 21 (4), 953–954.
Emberger, L., Chadefaud, M., 1960. Traité De Botanique. Masson & Cie,
Paris.
Franchomme, P., 1981. Fiche monographique: Origanum compactum car-
vacroliferum Bentham. Phytomédecine 1 and 2, 13–23.
Hafez, S., Sarg, T.M., El-Domiaty, M.M., Ahmed, A.A., Melek, F.R.,
Bohlmann, F., 1987. Caryophyllene derivatives from Pulicaria arabica.
Phytochemistry 26 (12), 3356–3358.
Janssen, A.M., Scheffer, J.J.C., Baerheim Svendsen, A., 1987-. Antimicro-
bial activity of essential oils: a 1976–1986 literature review Aspects
of the test methods. Planta Medica, 395–398.
Kurita, N., Koike, S., 1983. Synergetic antimicrobial effect of ethanol,
sodium chloride, acetic acid and essential oil components. Agricultural
and Biological Chemistry 47, 67–75.
Mahfouz, M., Ghazal, A., El-Dakhakhny, M., Ghoneim, M.T., 1973. Phar-
macological studies on the active principle isolated from Pulicaria
dysenterica. Journal of Drug Research 5 (2), 151–172.
292 A. Ezoubeiri et al. / Journal of Ethnopharmacology 99 (2005) 287–292
Mansour, R.M.A., Ahmed, A.A., Melek, F.R., Saleh, N.A.M., 1990. The
flavonoids of Pulicaria incisa. Fitoterapia 61 (2), 186–187.
Marco, J.A., Sanz, J.F., Albiach, R., 1992. Caryophyllene derivatives from
Pulicaria dysenterica. Phytochemistry 31 (7), 2409–2413.
Metwally, M., Dawidar, A., Metwally, S., 1986. A new thymol derivative
from Pulicaria undulata. Chemical and Pharmaceutical Bulletin 34
(1), 378–379.
Mossa, J.S., Hifnawy, M.S., Al-Yahya, M.A., Al-Mesha, I.A., Mekkawi,
A.G., 1987. GC/MS analysis of essential oil of Pulicaria arabica and
P. undulata. International Journal of Crude Drug Research 25 (2),
113–119.
Mossa, J.S., Hifnawy, M.S., Al-Yahya, M.A., Hafez, M.M., Shehata, A.A.,
El-Feraly, F.S., 1988. Flavonoids and coumarins from three Saudi
Arabian compositae species. International Journal of Crude Drug Re-
search 26 (4), 181–184.
Mossa, J.S., Muhammad, I., El-Feraly, F.S., Hufford, C.D., McPhail, D.R.,
McPhail, A.T., 1992. Bisabolene and guaiane sesquiterpenes from
Pulicaria glutinosa. Phytochemistry 31 (2), 575–578.
Muhammad, I., El-Feraly, F.S., Mossa, J.S., Ramadan, A.F., 1992.
Terpenoids from Pulicaria glutinosa. Phytochemistry 31 (12),
4245–4248.
Murray, P.R., Baron, E.J., Pfaller, M.A., Tenover, F.C., Yolke, R.H., 1995.
Manual of Clinical Microbiology, 6th ed. ASM, Washington, DC.
National Committee for Clinical Laboratory Standards, 1997. Methods for
dilution antimicrobial susceptibility tests of bacteria that grow aero-
bically. Approved Standard M7-A4, National Committee for Clinical
Laboratory Standards, Wayne, PA.
Pares, J.O., Oksuz, S., Ulubelen, A., Mabry, T.J., 1981. 6-Hydroxy-
flavonoids from Pulicaria dysenterica (Compositae). Phytochemistry
20 (8), 2057.
Remmal, A., Bouchikhi, T., Tantaoui-Elaraki, A., Ettayebi, M., 1993.
Inhibition of antibacterial activity of essential oils by tween 80 and
ethanol in liquid medium. Journal de Pharmacie de Belgique 48 (5),
352–356.
Rustaiyan, A., Simozar, E., Ahmadi, A., Grenz, M., Bohlmann, F., 1981.
A hardwickiic acid derivative from Pulicaria gnaphalodes. Phyto-
chemistry 20 (12), 2772–2773.
San Feliciano, A., Medarde, M., Gordaliza, M., Del Olmo, E., Miguel
del Corral, J.M., 1989. Sesquiterpenoids and phenolics of Pulicaria
paludosa. Phytochemistry 28 (10), 2717–2721.
Singh, P., Sharma, M.C., Joshi, K.C., Bolhamann, F., 1985. Diterpenes
derived from clerodanes from Pulicaria angustifolia. Phytochemistry
24 (1), 190–192.
Tanira, M.O.M., Ali, B.H., Bashir, A.K., Wasfi, I.A., Chandranath, I.,
1996. Evaluation of the relaxant activity of some United Arab Emi-
rates plants on intestinal smooth muscle. Journal of Pharmacy and
Pharmacology 48 (5), 545–550.
Tantaoui-Elaraki, A., Lattaoui, N., Errifi, A., Benjilali, B., 1993. Compo-
sition and antimicrobial activity of the essential oil of Thymus brous-
sonettii, T. zygis and T. satureioides. Journal of Essential Oil Research
5, 45–53.
Vernin, G., Lageot, C., Gaydou, E.M., Parkanyi, C., 2001. Analysis of
the essential oil of Lippia graveolens HBK from El Salvador. Flavour
and Fragrance Journal 16, 219–226.
Weyerstahl, P., Marschall, H., Wahlburg, H.C., Christiansen, C., Rus-
taiyan, A., Mirdjalili, F., 1999. Constituents of the essential oil of
Pulicaria gnaphalodes (Vent) Boiss. from Iran. Flavour and Fragrance
Journal 14 (2), 121–130.
Zdero, C., Bohlmann, F., Rizk, A.M., 1988. Sesquiterpene lactones from
Pulicaria sicula. Phytochemistry 27 (4), 1206–1208.
 Journal of Ethnopharmacology 99 (2005) 293–300

Ultrasound-assisted extraction methodology as a tool to improve the

antioxidant properties of herbal drug Xiao-chia-hu-tang
Chu-Ting Liu, Ching-Yi Wu, Yih-Ming Weng, Chin-Yin Tseng ∗
Department of Food Science, National Chiayi University, 300 University Road, Chiayi 600, Taiwan, ROC

Received 7 February 2005; received in revised form 24 February 2005; accepted 25 February 2005
Available online 7 April 2005

Abstract

Xiao-chai-hu-tang (XCHT) is an important Chinese herbal prescription for curing many types of liver diseases. The contents of bioactive
constituents (saikosaponins a, c and d, baicalin, baicalein, and glycyrrhizic acid), and antioxidant properties of XCHT extracts prepared with
ultrasound-assisted (US) extraction in combination with ethanol (up to 95%) as extraction modifier were studied. The results showed that the
US extraction significantly increased the bioactive constituents concentrations and antioxidant properties of XCHT extracts when compared
with the XCHT prepared with traditional boiling-water extraction. Among the XCHT extracts made with US extraction, the sample prepared
with 95% ethanol showed the highest bioactive constituent concentrations and the best antioxidant functionalities. The results suggest that US
extraction of XCHT is feasible to replace the traditional time-consuming and low efficiency preparation procedure in the future modernized
and commercialized manufacture of this highly valuable Chinese herbal medicine.
© 2005 Elsevier Ireland Ltd. All rights reserved.

Keywords: Ultrasound-assisted extraction; Herbal medicine; Antioxidant activity; Hepatoprotective functionality

1. Introduction
Extraction efficiency of bioactive compounds from medic-
inal herbs plays a key role in exerting the therapeutic func-
tionality. In the traditional preparation procedures, the herbs
usually are disintegrated with grounding or smashing ma-
chines in order to increase the extraction efficiency during
the water extraction stage. Although the extraction efficiency
is somewhat increased by converting the herbal tissues to
smaller pieces, boiling large amount of disintegrated herbal
Abbreviations: ABTS, 2,2 -azino-bis(3-ethylbenzothiazoline-6-
sulfonic acid); DPPH, 1,1-diphenyl-2-picryl hydrazyl; EDTA, ethylene-
diaminetetraacetic acid; GA, glycyrrhizic acid; IC50 , 50% inhibition
concentration; MDA, malondialdehyde; PHC, potassium hexacyanoferrate;
SDS, sodium dodecyl sulfate; TBA, thiobarbituric acid; TBARS, thiobar-
bituric acid reactive substances; TCA, trichloroacetic acid; TEAC, Trolox
equivalent antioxidant capacity; TMP, 1,1,3,3-tetramethoxy propane;
Tris–HCl, Tris-(hydroxymethyl) aminomethane hydrochloride; US,
ultrasound-assisted; XCHT, Xiao-chai-hu-tang
∗ Corresponding author. Tel.: +886 5 2717618; fax: +886 5 2775484.
E-mail address: cytseng@mail.ncyu.edu.tw (C.-Y. Tseng).
plant tissues in hot water for hours does not meet the re-
quirement of productivity if the herbs are subjected for com-
mercial production. Instead of the traditional boiling water
extraction (decocting), various novel extraction techniques,
including microwave digestion (Parr et al., 2001), enzymatic
extraction (Wilkes et al., 2000) and ultrasound-assisted (US)
extraction (Wu et al., 2001), have been developed. Increased
molecular movement rate and enhanced solvent penetration
are believed to be the main reasons for the improved extrac-
tion efficiency during US extraction (Toma et al., 2001). Other
advantages of US extraction include shorter extraction time,
lower extraction temperature, and less bioactive compound
loss (Valachovic et al., 2001; Vinatoru, 2001).
However, the successful application of new extraction pro-
cedure on a specific herbal medicine prescription needs solid
evidence based on the analysis of the bioactive ingredient
contents and functional properties of the resulting herbal
products (Ong and Len, 2003). Xiao-chai-hu-tang (XCHT)
is an important Chinese herbal prescription for curing many
kinds of liver diseases (Yamashiki et al., 1996; Ohtake et al.,
2000). Other beneficial functionalities of XCHT reported in

0378-8741/$ – see front matter © 2005 Elsevier Ireland Ltd. All rights reserved.
doi:10.1016/j.jep.2005.02.018
294 C.-T. Liu et al. / Journal of Ethnopharmacology 99 (2005) 293–300
the recent literature include antioxidation (Sakaguchi et al.,
1993), antimutagenesis (Ohtsuka et al., 1995), anticarcino-
genesis (Huang et al., 1997), immunoregulation (Borchers
et al., 2000; Ohtake et al., 2000), and antiinflammation
(Kusunose et al., 2002). Since we are interested in the scale-
up production of this particular hepatoprotective herbal pre-
scription, the objective of the present research was conducted
to investigate the feasibility of US extraction on the prepara-
tion of XCHT extract. The contents of major bioactive com-
pounds (saikosaponins a, c and d, baicalin, baicalein, and
glycyrrhizic acid) and antioxidant functional properties of
extracts were analyzed to demonstrate the enhanced extrac-
tion efficiency.
2. Materials and methods
2.1. Chemicals
Baicalin, baicalein, glycyrrhizic acid, saikosaponin
a, saikosaponin c and saikosaponin d were purchased
from Wako Pure Chemical Industries Ltd. (Osaka, Japan).
Ascorbic acid, 2,2 -azino-bis(3-ethylbenzothiazoline-
6-sulfonic acid) (ABTS), cytochrome c, ethylenedi-
aminetetraacetic acid (EDTA), ferric chloride, ferrozine,
Folin–Ciocalteu’s reagent, gallic acid, iron(II) chloride
tetrahydrate (FeCl2 ·4H2 O), 1,1-diphenyl-2-picryl hydrazyl
(DPPH), potassium hexacyanoferrate (PHC), dipotassium
hydrogen phosphate (K2 HPO4 ), potassium dihydrogen
phosphate (KH2 PO4 ), peroxidase, quercetin, sodium
carbonate (Na2 CO3 ), sodium dodecylsulphate (SDS),
1,1,3,3-tetraethoxy propane (TEP), trichloroacetic acid
(TCA), xanthine and xanthine oxidase were purchased from
Sigma Chemical Co. (St. Louis, MO). Acetonitrile, ethanol,
hydrochloric acid (HCl) and methanol were purchased
from Merck Co. (Darmstadt, Germany). Aluminum nitrate
(Al(NO3 )3 ) and potassium acetate (CH3 COOK) were
purchased from J.T. Baker Co. (Phillipsburg, NJ). Hydrogen
peroxide (H2 O2 ) was purchased from Sigma–Aldrich Inc.
(St. Louis, MO). Tris-(hydroxymethyl) aminomethane
hydrochloride (Tris–HCl) and thiobarbituric acid (TBA)
were from Acros Chemical (Morris Plains, NJ). n-Butanol
was purchased from Fisher Co. (Fair Lawn, NJ).
2.2. Preparation of Xiao-chai-hu-tang extracts
The dried roots of Bupleurum kaoi Liu were provided
by Green Health Biotechnology Corporation (Yunlin, Tai-
wan). Pinelliae tuber, Ginseng radix, Zizyphi fructus, Scutel-
lariae radix, Glycyrrhizae radix, and Zingiberis rhizoma
were purchased from a local herb pharmacy. The formula-
tion of XCHT was prepared according to Sakaguchi et al.
(1993); the ratio of Bupleurum kaoi, Pinelliae tuber, Ginseng
radix, Zizyphi fructus, Scutellariae radix, Glycyrrhizae radix,
and Zingiberis rhizoma was 7:5:3:3:3:2:1 (w/w/w/w/w/w/w).
All herbal ingredients were pooled together and powdered
with a blender. The powdered herbs was mixed with 10
times of extraction solution (w/v) and placed in the ul-
trasonic apparatus (DC600H DELTA Ultrasonic machine,
Kwang-Hwa Electronic Material Co. Ltd., Taiwan) for 2 h
at 40 ◦ C.
The extraction solutions used were water and ethanol mix-
tures with the ethanol contents adjusted to 0%, 30%, 70%
and 95% (v/v). The resulting extraction mixture was filtered
with cheese close and the filtrate was concentrated with a
rotary evaporator (Laborota 4001, Heidolph, Germany) and
freeze-dried (12ES Freeze Dryer, Virtis Co., Gardiner, NY)
giving XCHT powder. The powders derived with 0%, 30%,
70% and 95% ethanol in the extraction solution were desig-
nated as SE-0, SE-30, SE-70 and SE-95, respectively. The
freeze-dried powder was stored under −20 ◦ C for further
tests. The XCHT powder (designated as HE-0) prepared
by boiling herbs in distilled water without ethanol for 2 h
was also prepared and used in the tests for comparison pur-
pose.
2.3. Analysis of saikosaponins, baicalin, baicalein, and
glycyrrhizic acid
The freeze-dried XCHT powder was dissolved in dou-
ble distilled water and the concentrations of saikosaponins
(saikosaponin a, c and d) were analyzed by a high per-
formance liquid chromatograph (HPLC L-7000, Hitachi,
Tokyo, Japan) equipped with an Inertsil ODS-3 C18 column
(250 mm × 4.6 mm, GL Sciences, Japan). The programmed
gradient elution using acetonitrile–water from 40:60 (v/v) to
50:50 (v/v) in 10 min at a flow rate of 1.0 mL/min and detec-
tion wavelength of 203 nm were used (Park et al., 2000). For
the analysis of baicalin, baicalein and glycyrrhizic acid, the
elution solution consisted of (A) 25 mM NaH2 PO4 (pH 2.5)
and (B) acetonitrile. The initial eluent composition was set at
30% of B, gradually shifted to 100% B in 25 min, and held
for 10 min before returning to initial condition. Detection
wavelength was 277 nm for baicalin, 280 nm for baicalein
and 252 nm for glycyrrhizic acid. Standard curves established
with saikosaponins (a, c and d), baicalin, baicalein, and gly-
cyrrhizic acid were used for the calculation.
2.4. Determining of flavonoid content
Freeze-dried XCHT powder was dissolved in double
distilled water and flavonoid concentration was determined
following the method described by Jia et al. (1999). XCHT so-
lution (500 ␮L), ethanol (1.5 mL), Al(NO3 )3 (100 ␮L, 10%),
CH3 COOK (100 ␮L, 1 M) and H2 O (2.8 mL) were thor-
oughly mixed and kept at ambient temperature for 40 min.
The absorbance of reaction mixture at 415 nm was measured
with a spectrophotometer (U-2000 Spectrophotometer,
Hitachi, Tokyo, Japan). Total flavonoid content was calcu-
lated according to a standard curve established with quer-
cetin.
 C.-T. Liu et al. / Journal of Ethnopharmacology 99 (2005) 293–300
2.5. Determination of total phenolic compounds
Freeze-dried XCHT powder was dissolved in double
distilled water and the concentration of total phenolic
compounds was spectrophotometrically determined using
Folin–Ciocalteu’s reagent as described by Taga et al.
(1984). XCHT solution (100 ␮L), Folin–Ciocalteu’s reagent
(500 ␮L), sodium carbonate (400 ␮L, 7.5%) and distilled
H2 O (5 mL) were thoroughly mixed and kept at room
temperature for 30 min before the absorbance at 760 nm
was measured. Total phenolic concentration was determined
using gallic acid as standard.
2.6. Scavenging DPPH radical
The scavenging of DPPH radical was assayed following
the method of Hatano et al. (1989). A mixture of the XCHT
powder dissolved in methanol with an equal volume of DPPH
solution (0.1 mM) was shaken vigorously. The mixture was
kept at room temperature for 50 min before the absorbance
at 517 nm was measured. The scavenging activity was deter-
mined by comparing the absorbance with that of the blank
(100%) containing only DPPH solution and solvent.
2.7. Reducing power
The XCHT powder (0–10 mg) dissolved in phosphate
buffer (2.5 mL, 0.2 M, pH 6.6) was added to potassium fer-
ricyanide (2.5 mL, 10 mg/mL) to determine the reducing
power (Oyaizu, 1986). After incubation at 50 ◦ C for 20 min,
trichloroacetic acid (2.5 mL, 100 mg/mL) was added to the
mixture; and the precipitate was removed with centrifuga-
tion (650 × g, 10 min). The absorbance of the supernatant
(2.5 mL) mixed with distilled water (2.5 mL) and ferric chlo-
ride (0.5 mL, 1.0 mg/mL) was measured at 700 nm.
2.8. Total antioxidant activity
Total antioxidant activity was measured according to
the method described by Miller and Rice-Evans (1997)
and Arnao et al. (2001) with modifications. Peroxidase
(4.4 units/mL, 0.2 mL), H2 O2 (50 mM, 0.2 mL), ABTS [2,2 -
azino-bis(3-ethylbenzothiazoline-6-sulfonic acid), 100 mM,
0.2 mL] and distilled water (1 mL) were mixed and kept in
the dark for 1 h to form a bluish-green complex. After adding
aqueous XCHT solution (1 mL), the absorbance at 734 nm
was measured and represented the total antioxidant activity.
2.9. Inhibiting the formation of superoxide anions
The formation of superoxide anions was conducted
according to the method described by Chang et al. (1994).
Xanthine buffer solution (0.1 mM) was prepared by dissolv-
ing 3.04 mg of xanthine in 100 mL of 50 mM KH2 PO4 buffer
solution (pH 7.8) with gentle heating and ultrasonic shaking
until it was completely dissolved and then diluted to the
295
designated concentration. XCHT solution (50 ␮L), xanthine
buffer solution (400 ␮L) and H2 O (530 ␮L) were thoroughly
mixed; and then xanthine oxidase (20 ␮L, 1 unit/mL) was
added and mixed. The absorbance was measured spec-
trophotometrically at 295 nm for 2 min against a solvent
blank that contained no xanthine oxidase.
2.10. Scavenging superoxide anions
Superoxide scavenging activity of XCHT extract was as-
sayed with the cytochrome c reduction method (McCord and
Fridovich, 1969). Xanthine buffer solution was prepared as
described above. Xanthine buffer solution was mixed with
2 mL KH2 PO4 (50 mM), 2 mL EDTA (0.1 mM), 2 mL cy-
tochrome c (0.1 mM) and 40 mL xanthine solution (0.1 mM)
to form a working solution. Aqueous XCHT solution (50 ␮L),
working solution (400 ␮L) and H2 O (530 ␮L) were thor-
oughly mixed and xanthine oxidase (20 ␮L, 1 unit/mL) was
then added to the mixture. The absorbance was measured at
a wavelength of 550 nm for 70 s against the solvent blank
without xanthine oxidase.
2.11. Inhibition of FeCl2 /ascorbic acid-induced lipid
peroxidation
Lipid peroxidation of rat liver homogenate inhibited by
XCHT extracts was conducted. The liver homogenate of male
Sprague–Dawley rats (8-week old, ca. 240 g B.W.; National
Laboratory Animal Center, Taiwan) was used for the test.
After rat was sacrificed, the liver tissue was taken out and ho-
mogenized (Homogenizer, Glas-Col, Terre Haute, IN) with
150 mM Tris–HCl buffer (pH 7.2) to obtain the homogenate
(10%, w/v). The homogenate was centrifuged (3500 × g,
15 min; Allegra 6R, Beckman Coulter, Fullerton, CA) and
the protein content of the supernatant was determined with
the method described by Lowry et al. (1951). Ferrous chlo-
ride/ascorbic acid-induced lipid peroxidation was conducted
with the method described by Yoden et al. (1980) and Kimura
et al. (1981) with modifications. The supernatant of liver
homogenate (250 ␮L), Tris–HCl buffer (pH 7.2, 50 ␮L),
ascorbic acid (0.1 mM, 50 ␮L), ferrous chloride (4 mM,
50 ␮L) and XCHT extract solution (50 ␮L) were mixed and
incubated at 37 ◦ C for 1 h. Immediately after incubation,
HCl (0.1N, 500 ␮L), SDS (9.8%, 200 ␮L), distilled water
(900 ␮L) and TBA (0.6%, 2 mL) were added into each
tube. The tubes were further kept at 95 ◦ C for 30 min.
After cooling to room temperature, n-butanol (5 mL) was
added into each tube. The tubes were vigorously shaken
and centrifuged (1000 × g, 25 min). The MDA in n-butanol
layer was analyzed with a fluorescence spectrophotometer
(F-2500 Fluorescence Spectrophotometer, Hitachi, Tokyo,
Japan) with excitation wavelength 515 nm and emission
wavelength 553 nm. Sample with distilled water replacing
XCHT extract solution and sample using phosphate buffer
replacing FeCl2 /ascorbic acid solution were included as the
positive or negative controls, respectively. Concentrations of
296 C.-T. Liu et al. / Journal of Ethnopharmacology 99 (2005) 293–300

MDA were determined from a standard curve prepared using

TEP.

2.12. Statistical analysis

Data were expressed as mean ± S.D. of triplicate samples.

ANOVA procedure was used to analyze the variance among
the samples. Duncan’s multiple range tests, at p < 0.05, was
used to determine significant differences among sample
means.

3. Results

3.1. Bioactive components in XCHT extracts

Bioactive components in XCHT extracts prepared with

solvent containing different concentration of ethanol are
shown in Table 1. Generally speaking, the contents of bioac-
tive compounds increased when the concentration of ethanol
in the extraction fluid increased. The significantly higher
amounts (p < 0.05) of all analyzed major bioactive com-
pounds were detected when XCHT was extracted with 95%
ethanol (i.e. SE-95 samples).
3.2. DPPH radical scavenging activity
The lipid autooxidation is accelerated when free radi-
cals are formed as the results of losing a hydrogen atom
from the double bond in the structure of unsaturated fatty
acids. Scavenging of free radicals is one of the major an-
tioxidation mechanisms to inhibit the chain reaction of lipid
oxidation. The scavenging activity of XCHT extracts is
shown in Fig. 1. The scavenging activities for all types of
XCHT extracts increased as the concentration of the ex-
tracts increased. However, the calculated 50% inhibition
concentration (IC50 ) values are 4.19, 4.19, 1.46, 0.58 and
0.43 mg/mL for HE-0, SE-0, SE-30, SE-7 and SE-95, re-
spectively. The results indicate that the extract obtained
from 95% ethanol exerted the strongest scavenging activ-
ity.
Fig. 1. Scavenging activity (%) of Xiao-chai-hu-tang extracts on 1,1-
diphenyl-2-picryl hydrazl (DPPH) radicals. Mean of triplicate samples.
3.3. Reducing power of XCHT extracts
Combination of ferric ion with K4 Fe(CN)6 gives rise to
the formation of Prussian blue Fe4 [Fe(CN)6 ]3 . Since the
K4 Fe(CN)6 is derived from the reduction of potassium fer-
ricyanide K3 Fe(CN)6 , the formation of Fe4 [Fe(CN)6 ]3 can
be used to represent the reducing power of the test system
(Oyaizu, 1986). The reducing power of XCHT extracts is
shown in Fig. 2. For each type of XCHT extract, the reduc-
ing power increased as the concentration increased. However,
SE-30 and SE-70 showed higher reducing power when higher
dose range (2.5–10.0 mg/mL) was used; SE-95 demonstrated
better reducing power when low dose range (0.1–1.0 mg/mL)
was tested.
3.4. Total antioxidant activity of XCHT extracts
The scavenging ability of ABTS+ free radicals is defined
as TEAC (Trolox equivalent antioxidant capacity) and used
to represent the total antioxidant activity of the testing system
(Miller et al., 1993, 1996). The total antioxidant activities of

Table 1
The contents of saikosaponin a, saikosaponin c, saikosaponin d, baicalin, baicalein, glycyrrhizic acid (GA), flavonoids and total phenolics in Xiao-chai-hu-tang
extracts
Treatment Contenta (mg/g freeze-dried powder)

Saikosaponin a Saikosaponin c Saikosaponin d Baicalin Baicalein Glycyrrhizic acid Flavonoidsb Total phenolicsc
HE-0 0.32 ± 0.09 e 0.40 ± 0.01 e 0.19 ± 0.05 e 0.56 ± 0.07 c 0.38 ± 0.01 d 0.29 ± 0.01 e 3.618 ± 0.05 d 12.01 ± 0.43 e
SE-0 0.85 ± 0.13 d 1.73 ± 0.05 d 0.11 ± 0.01 d 0.08 ± 0.01 d 0.05 ± 0.01 e 0.74 ± 0.02 d 3.748 ± 0.14 d 14.46 ± 0.48 d
SE-30 4.32 ± 0.19 c 3.89 ± 0.07 c 0.91 ± 0.11 c 0.49 ± 0.04 c 1.07 ± 0.07 c 2.68 ± 0.18 c 11.65 ± 0.41 c 27.69 ± 1.41 c
SE-70 8.91 ± 0.53 b 4.47 ± 0.21 b 4.19 ± 0.16 b 19.53 ± 0.29 b 1.63 ± 0.01 a 6.41 ± 0.33 b 32.01 ± 0.69 b 53.11 ± 1.48 b
SE-95 22.24 ± 0.39 a 8.03 ± 0.15 a 12.92 ± 1.16 a 23.87 ± 0.30 a 3.58 ± 0.01 b 14.05 ± 0.16 a 36.80 ± 1.46 a 64.87 ± 2.51 a
a Each value represents mean ± S.D. (n = 3). Means with different letters within the same column are significantly different (p < 0.05).
b The total phenolics content expressed as gallic acid equivalent.
c The flavonoids content expressed as quercetin equivalent.
 C.-T. Liu et al. / Journal of Ethnopharmacology 99 (2005) 293–300
Fig. 2. Reduction power of Xiao-chai-hu-tang extracts. Mean of triplicate
samples.
XCHT extracts are shown in Fig. 3. While the dose-dependent
relationships were found for all types of XCHT extracts, SE-
70 and SE-95 possessed better total antioxidant activity than
other types of extracts. At the level of 10 mg/mL, all types of
extracts exerted 95% or above total antioxidant activity.
3.5. Inhibiting superoxide anion formation
The inhibition of superoxide formation by XCHT extracts
is shown in Fig. 4. For HE-0 and SE-0 extracts, only weak
inhibition effects were observed up to the level of 10 mg/mL.
As for SE-30, SE-70 and SE-95 extracts, the inhibition ef-
fects were greater than 85% at the level of 10 mg/mL. The
Fig. 3. Total antioxidant activity (%) of Xiao-chai-hu-tang extracts. Mean
of triplicate samples.
297
Fig. 4. Inhibition effect (%) of Xiao-chai-hu-tang extracts on superoxide
anion radical formation. Mean of triplicate samples.
calculated IC50 for SE-70 and SE-95 extracts were 0.89 and
0.85 mg/mL, respectively. The calculated IC50 for extracts
prepared without ethanol (i.e. HE-0 and SE-0) were greater
than 10 mg/mL.
3.6. Scavenging superoxide anions
The scavenging activities of XCHT extracts are shown in
Fig. 5. While the scavenging activities for HE-0 and SE-0
were relatively low, the percentage of scavenging activities
for all types of extracts increased as the dose increased. When
compared at the same dose level, the scavenging activity in-
creased as the ethanol concentration used for preparation of
Fig. 5. Scavenging activity (%) of Xiao-chai-hu-tang extracts on superoxide
anion radicals. Mean of triplicate samples.
298 C.-T. Liu et al. / Journal of Ethnopharmacology 99 (2005) 293–300
Table 2
Effects of Xiao-chai-hu-tang extract on the format of MDA in FeCl2 /ascorbate-induced lipid peroxidation of rat liver homogenate
Treatment MDA (nmol/mg protein of liver homogenate)
0.1 0.5
HE-0 2.18 ± 0.03* 2.12 ± 0.08*
SE-0 2.42 ± 0.06 2.93 ± 0.14*
SE-30 2.02 ± 0.04* 1.98 ± 0.14*
SE-70 2.05 ± 0.11* 2.07 ± 0.16*
SE-95 1.92 ± 0.06* 1.87 ± 0.18*
Positive control: 2.36 ± 0.06 (nmol/mg protein of liver homogenate, lipid peroxidation induced with FeCl2 /ascorbate). Negative control: 1.03 ± 0.06 (nmol/mg
protein of liver homogenate). Each value represents mean ± S.D. (n = 3).
∗ Significantly different from positive control.
extract increased. The calculated IC50 values for SE-70 and
SE-95 were 1.49 and 0.82 mg/mL, respectively.
3.7. Inhibition of FeCl2 -ascorbic acid inducted lipid
peroxidation
Since the liposome peroxidation induced by reactive metal
ions and reducing agents is widely used to simulate the in
vivo lipid peroxidation, inhibition of ascorbate-dependent
lipid peroxidation induced with ferrous ions of rat liver ho-
mogenate by XCHT extracts was conducted (Table 2). In
this testing system, the detected amount of MDA, an oxi-
dized product, is used to demonstrate the antioxidant prop-
erty of XCHT extracts. HE-0 and SE-0 samples showed the
highest amounts of MDA formation for the test range of
0.1–10 mg/mL. The least MDA was formed when SE-95 was
used; and the calculated IC50 was 0.91 mg/mL.
4. Discussion
Xiao-chai-hu-tang (XCHT) has been used as a major cur-
ing prescription for chronic hepatitis in the traditional Chi-
nese herbal medicine (Yamashiki et al., 1997; Yagura et al.,
2001). Baicalein (a flavonoid compound) and baicalin (gly-
coside of baicalein) are reported to be the major bioactive
components in the XCHT (Inoue and Jackson, 1999; Ueda
et al., 2001). Flavonoids consist of a flavan nucleus that is
made of two phenyl rings (denoted as A and B rings) and
an oxygen-containing pyran ring. The antioxidant activities
of flavonoids are determined by the degree of hydroxyla-
tion and by the substitution position of hydroxy groups in
the rings (Pietta, 2000). The free radical scavenging activity
of flavonoid compounds is attributed to the ortho-positioned
hyroxyl groups in the A ring (Gao et al., 1999).
Flavonoids are currently used as therapeutic agents for
several chronic liver diseases in China and Japan (Ueda et
al., 2001). Baicalin and baicalein possess antioxidant ac-
tivity (Bors et al., 1990). Gao et al. (2003) reported that
baicalin reduced the TBARS content in rat liver homogenate
and this property was attributed to the antioxidant capabil-
ity of baicalin because the liver is the primary metabolism
organ for this compound. Baicalein has also been reported
1.0 2.5 5.0 10.0
2.07 ± 0.08* 2.09 ± 0.03* 2.10 ± 0.09* 1.85 ± 0.08*
2.46 ± 0.21 2.30 ± 0.03 1.99 ± 0.06* 1.74 ± 0.15*
2.05 ± 0.15* 1.94 ± 0.04* 1.70 ± 0.03* 1.51 ± 0.27*
1.93 ± 0.11* 1.82 ± 0.12* 1.62 ± 0.14* 1.19 ± 0.04*
1.54 ± 0.03* 1.41 ± 0.11* 1.05 ± 0.05* 0.53 ± 0.06*
to decrease TBARS formation in the FeCl3 -induced epilep-
tic model system and to inhibit hippocampal neuronal death
induced by 5 min of cerebral ischemia in gerbils (Hamada
et al., 1993). Baicalin and baicalein exerted strong hydroxyl
radical, DPPH radical and alkyl radical scavenging activities
in a dose-dependent pattern. Moreover, baicalin and baicalein
showed ferrous ion chelating activity and interfered with the
oxidation–reduction of ferric–ferrous ions (Gao et al., 1999).
Since the sugar moiety in the glycoside structure is reported to
reduce the overall free radical scavenging activity originated
from aglycone moiety (Shahidi and Wanasundara, 1992),
baicalein showed better scavenging activity than baicalin.
As the highest baicalin and baicalein contents were de-
tected in the SE-95 sample (Table 1), the best inhibitory effect
on lipid peroxidation and the highest DPPH and superoxide
anion radical scavenging activity were observed with SE-95
extract (Figs. 2–4). Because the polarity difference between
baicalin and extraction solvents, extraction of bacialin with
ethyl acetate and acetone was not successful (Lin et al., 1999).
Although methanol could be used as the extraction medium in
ultrasonic extraction of bacialin from Scutellariae radix (Lin
et al., 1999), the safety concern precludes the use of methanol
in consumer products as proposed in the present study. From
a practical point of view, ethanol was chosen to serve as the
extraction medium and the effect of ethanol concentration on
the extraction efficiency was demonstrated.
Glycyrrhizin is 50 times sweeter than sucrose and is
the major sweet component in Glycyrrhizae radix. Upon
hydrolysis, glycyrrhizin loses two molecules of glucuronic
acids and converts to the aglycone glycyrrhizic acid (Pan et
al., 2000). Since glycyrrhizic acid inhibits FeCl2 /ascorbate-
induced lipid peroxidation in rat liver homogenate and ex-
presses superoxide radical scavenging activity, it is used as
protective agent for liver cell injury caused by many chem-
icals, and is used in the treatment of chronic hepatitis and
cirrhosis in China and Japan (Jeong et al., 2002). Although
GA is reported to be freely soluble in alcohol, the addition
of ethanol at the level up to 30% did not increase the ex-
traction efficiency of GA from Glycyrrhizae radix (Ong and
Len, 2003). Higher concentrations of GA in the extraction
fluids were obtained when ethanol levels were 70% and 95%
(Table 1). Furthermore, the enhanced beneficial bioactivi-
ties including superoxide radical scavenging activity (Fig. 5)
 C.-T. Liu et al. / Journal of Ethnopharmacology 99 (2005) 293–300
and inhibition of lipid peroxidation in rat liver homogenate
(Table 2) were observed as the GA contents in the extracts
increased.
Saikosaponins possessed scavenging activity against reac-
tive oxygen species (Hattori et al., 1991) and inhibited perox-
idation of rat liver homogenate (Abe et al., 1982). The highest
saikosaponin content was detected in the XCHT extract pre-
pared with 95% ethanol (i.e. SE-95; Table 1); moreover, the
best inhibition of FeCl2 /ascorbic acid-induced lipid peroxi-
dation (Table 2) was derived from the SE-95 extract. Saikos-
aponins are typical triterpenoid glycosides that contain an
oxy-ether ring in their chemical structure. The oxy-ether ring
will be destroyed under acidic conditions or during prolonged
extraction process (Shimizu et al., 1985). The application
of high-level ethanol in the extraction process enhances the
preservation of oxy-ether ring and increases the antioxidant
activity.
In conclusion, US extraction combining with higher lev-
els of ethanol markedly increased the extraction efficiency
of bioactive components including flavonoids and phenolics
from XCHT raw materials. The best antioxidant capability of
XCHT extracts was obtained when ethanol level was at 95%.
The results provide the optimal extraction conditions for the
preparation of XCHT products when this health-promoting
Chinese herbal medicinal prescription would be produced in
a commercial scale.
Acknowledgements
The financial support (NSC-91-2317-B-415-002) from
the National Science Council, the Republic of China (Tai-
wan) is gratefully acknowledged.
References
Abe, H., Sakaguchi, M., Odashima, S., Arichi, S., 1982. Protective ef-
fect of saikosaponin-d isolated from Bupleurum falcatum L. on CCl4 -
induced liver injury in the rat. Naunyn-Schmiedeberg’s Archives of
Pharmacology 320, 266–271.
Arnao, M.B., Cano, A., Acosta, M., 2001. The hydrophilic and lipophilic
contribution to total antioxidant activity. Food Chemistry 73, 239–244.
Borchers, A.T., Sakai, S., Henderson, G.L., Harkey, M.R., Keen, C.L.,
Stern, J.S., Terasawa, K., Gershwin, M.E., 2000. Shosaiko-to and other
Kampo (Japanese herbal) medicines: a review of the immunomodu-
latory activities. Journal of Ethnopharmacology 73, 1–13.
Bors, W., Heller, W., Michel, C., Saran, M., 1990. Flavonoids as antiox-
idants: determination of radical scavenging efficiencies. Methods in
Enzymology 186, 343–356.
Chang, W.S., Chang, Y.H., Lu, F.J., Chiang, H.C., 1994. Inhibitory effects
of phenolics on xanthine oxidase. Anticancer Research 14, 501–506.
Gao, Z., Huang, K., Yang, X., Xu, H., 1999. Free radical scavenging
and antioxidant activities of flavonoids extracted from the radix of
Scutellaria baicalensis Georgi. Biochimica et Biophysica Acta 1472,
643–650.
Gao, Z., Xu, H., Chen, X., Chen, H., 2003. Antioxidant status and mineral
contents in tissues of rutin and baicalin fed rats. Life Sciences 73,
1599–1607.
299
Hamada, H., Hiramatsu, M., Edamatsu, R., Mori, A., 1993. Free radical
scavenging action of baicalein. Archives of Biochemistry and Bio-
physics 306, 261–266.
Hatano, T., Edamatsu, R., Mori, A., Fujita, Y., Yasuhara, T., Yoshida,
T., Okuda, T., 1989. Effects of the interaction of tannins with co-
existing substances. VI. Effects of tannins and related polyphenols on
superoxide anion radical, and on 1,1-diphenyl-pierylhydrazyl-radical.
Chemical and Pharmaceutical Bulletin 37, 2016–2021.
Hattori, T., Ito, M., Suzuki, Y., 1991. Studies on antinephritic effects of
plant components in rat (1). Effects of saikosaponins original-type
anti-GBM nephritis in rats and its mechanisms. Nippon Yakurigaku
Zasshi 97, 13–21.
Huang, Y., Marumo, K., Murai, M., 1997. Antitumor effects and phar-
macological interaction of xiao-chai-hu-tang (sho-saiko-to) and inter-
leukin 2 in murine renal cell carcinoma. The Keio Journal of Medicine
46, 132–137.
Inoue, T., Jackson, E.K., 1999. Strong antiproliferative effects of baicalein
in cultured rat hepatic stellate cells. European Journal of Pharmacol-
ogy 378, 129–135.
Jeong, H.G., You, H.J., Park, S.J., Moon, A.R., Chung, Y.C., Kang, S.K.,
Chun, H.K., 2002. Hepatoprotective effects of 18 β-glycyrrhetinic acid
on carbon tetrachloride-induced liver injury: inhibition of cytochrome
P450 2E1 expression. Pharmacological Research 46, 222–227.
Jia, Z., Tang, M., Wu, J., 1999. The determination of flavonoid content
in mulberry and their scavenging effects on superoxide radicals. Food
Chemistry 64, 555–559.
Kimura, Y., Kubo, M., Tani, T., Arichi, S., Okuda, H., 1981. Studies
on scutellariae radix IV: effects on lipid peroxidation in rat liver.
Chemical and Pharmaceutical Bulletin 29, 2610–2617.
Kusunose, M., Qiu, B., Cui, T., Hamada, A., Yoshioka, S., Ono, M.,
Miyamura, M., Kyotani, S., Nishioka, Y., 2002. Effect of Sho-saiko-
to extract on hepatic inflammation and fibrosis in dimethylnitrosamine
induced liver injury rats. Biological and Pharmaceutical Bulletin 25,
1417–1424.
Lin, M.-C., Tsai, M.-J., Wen, K.-C., 1999. Supercritical fluid extraction
of flavonoids from Scutellariae radix. Journal of Chromatography A
830, 387–395.
Lowry, O.H., Rosebrough, N.J., Farr, A.L., Randall, R.J., 1951. Protein
measurement with the folinphenol reagent. The Journal of Biological
Chemistry 193, 265–275.
McCord, J.M., Fridovich, I., 1969. Superoxide dismutase: an enzymic
function for erhtyrocuprein (hemocuprein). The Journal of Biological
Chemistry 244, 6049–6055.
Miller, N.J., Rice-Evans, C.A., 1997. The relative contributions of ascor-
bic acid and phenolic antioxidants to the total antioxidant activity of
orange and apple fruit juices and blackcurrant drink. Food Chemistry
60, 331–337.
Miller, N.J., Rice-Evans, C.A., Davies, M.J., Gopinathan, V., Miller, A.,
1993. A novel method for measuring antioxidant capacity and its
application to monitoring the antioxidant status in premature neonates.
Clinical Science 84, 407–412.
Miller, N.J., Sampson, J., Candeias, L.P., Bramley, P.M., Rice-Evans,
C.A., 1996. Antioxidant activities of carotenes and xanthophylls.
FEBS Letters 384, 240–242.
Ohtake, N., Suzuki, R., Daikuhara, H., Nakai, Y., Yamamoto, M., Am-
agaya, S., Ishige, A., Sasaki, H., Komatsu, Y., Fukuda, K., Hayashi,
S., 2000. Modulation of lung local immune responses by oral admin-
istration of a herbal medicine Sho-saiko-to. International Journal of
Immunopharmacology 22, 419–430.
Ohtsuka, M., Fukuda, K., Yano, H., Kojiro, M., 1995. Effects of nine
active ingredients in Chinese herbal medicine Sho-saiko-to on 2-(2-
furyl)-3-(5-nitro-2-furyl)acrylamide mutagenicity. Japanese Journal of
Cancer Research 86, 1131–1135.
Ong, E.S., Len, S.M., 2003. Pressurized hot water extraction of berberine,
baicalein and glycyrrhizin in medicinal plants. Analytica Chimica Acta
482, 81–89.
300 C.-T. Liu et al. / Journal of Ethnopharmacology 99 (2005) 293–300
Oyaizu, M., 1986. Antioxidative activity of browning products of glu-
cosamine fractionated by organic solvent and thin-layer chromatogra-
phy. Nippon Shokuhin Kogyo Gakkaishi 35, 771–775.
Pan, X., Liu, H., Jia, G., Shu, Y.Y., 2000. Microwave-assisted extraction of
glycyrrhizic acid from licorice root. Biochemical Engineering Journal
5, 173–177.
Park, I.S., Kang, E.M., Kim, N., 2000. High-performance liquid chro-
matographic analysis of saponin compounds in Bupleurum falcatum.
Journal of Chromatographic Science 38, 229–233.
Parr, J.F., Dolic, V., Lancaster, G., Boyd, W.E., 2001. A microwave di-
gestion method for the extraction of phytoliths from berbarium spec-
imens. Review of Palaeobotany and Palynology 116, 203–212.
Pietta, P.G., 2000. Flavonoids as antioxidants. Journal of Natural Products
63, 1035–1042.
Sakaguchi, S., Tsutsumi, E., Yokota, K., 1993. Preventive effects of a
traditional Chinese medicine (Sho-Saiko-to) against oxygen toxicity
and membrane damage during endotoxemia. Biological and Pharma-
ceutical Bulletin 16, 782–786.
Shahidi, F., Wanasundara, P.K.J., 1992. Phenolic antioxidants. Critical
Reviews in Food Science and Nutrition 32, 67–103.
Shimizu, K., Amagaya, S., Ogihara, Y., 1985. Structural transforma-
tion of saikosaponins by gastric juice and intestinal flora. Journal
of Pharmacobio-Dynamics 8, 718–725.
Taga, M.S., Miller, E.E., Pratt, D.E., 1984. Chia seeds as a source of nat-
ural lipid antioxidants. Journal of the American Oil Chemists’ Society
61, 928–931.
Toma, M., Vinatoru, M., Paniwnyk, L., Mason, T.J., 2001. Investigation of
the effects of ultrasound on vegetal tissues during solvent extraction.
Ultrasonics Sonochemistry 8, 137–142.
Ueda, S., Nakamura, H., Masutani, H., Sasada, T., Takabayashi, A., Ya-
maoka, Y., Yodoi, J., 2001. Baicalin induces apoptosis via mito-
chondrial pathway as prooxidant. Molecular Immunology 38, 781–
791.
Valachovic, P., Pechova, A., Mason, T.J., 2001. Towards the industrial
production of medicinal tincture by ultrasound assisted extraction.
Ultrasonics Sonochemistry 8, 111–117.
Vinatoru, M., 2001. An overview of the ultrasonically assisted extrac-
tion of bioactive principles from herbs. Ultrasonics Sonochemistry 8,
303–313.
Wilkes, J.G., Conte, E.D., Kim, Y., Holcomb, M., Sutherland, J.B., Miller,
D.W., 2000. Sample preparation for the analysis of flavors and off-
flavors in foods. Journal of Chromatography A 880, 3–33.
Wu, J., Lin, L., Chau, F., 2001. Ultrasound-assisted extraction of ginseng
saponins from ginseng roots and cultured ginseng cells. Ultrasonics
Sonochemistry 8, 347–352.
Yagura, M., Murai, S., Kojima, H., Tokita, H., Kamitsukasa, H., Harada,
H., 2001. Does the control of alanine aminotransferase levels lead to a
regression of liver fibrosis in chronic hepatitis C patients? Hepatology
Research 19, 144–157.
Yamashiki, M., Nishimura, A., Nobori, T., Nakabayashi, S., Takagi,
T., Inoue, K., Ito, M., Matsushita, K., Ohtaki, H., Kosaka, Y.,
1997. In vitro effects of Sho-saiko-to on production of granulocyte
colony-stimulating factor by mononuclear cells from patients with
chronic hepatitis C. International Journal of Immunopharmacology
19, 381–385.
Yamashiki, M., Nishimura, A., Sakaguchi, S., Suzuki, H., Kosaka, Y.,
1996. Effects of Japanese herbal medicine ‘Sho-saiko-to’ as a cy-
tokine inducer. Environmental Toxicology and Pharmacology 2, 301–
306.
Yoden, K., Iio, T., Tabata, T., 1980. Measurement of thiobarbituric acid
value in tissue homogenate solubilized with sodium dedecylsulphate.
Yakugaku Zasshi 100, 553–559.
 Journal of Ethnopharmacology 99 (2005) 301–308

Ethnopharmacological Communication

Antifungal activities of six South African Terminalia

species (Combretaceae)
P. Masoko a , J. Picard b , J.N. Eloff a,∗
a
Phytomedicine Programme, Department of Paraclinical Sciences, University of Pretoria,
Private Bag X04, Onderstepoort, 0110, South Africa
b Department of Veterinary Tropical Diseases, Faculty of Veterinary Sciences, University of Pretoria,
Private Bag X04, Onderstepoort, 0110, South Africa

Received 10 September 2004; received in revised form 24 January 2005; accepted 25 January 2005
Available online 22 April 2005

Abstract

A serial microplate dilution method developed for bacteria was modified slightly and gave good results with several fungi. The antifun-
gal activity of acetone, hexane, dichloromethane and methanol leaf extracts of six Terminalia species (Terminalia prunioides, Terminalia
brachystemma, Terminalia sericea, Terminalia gazensis, Terminalia mollis and Terminalia sambesiaca) were tested against five fungal ani-
mal pathogens (Candida albicans, Cryptococcus neoformans, Aspergillus fumigatus, Microsporum canis and Sporothrix schenkii). Methanol
extracted the highest quantity, but the acetone extracts had the highest antifungal activity. Some of the extracts had antioxidant activity. Most
of the antifungal extracts had MIC values of c. 0.08 mg/ml, some were with MIC values as low as 0.02 mg/ml. Microsporum canis was the
most susceptible microorganism and Terminalia sericea extracts were the most active against nearly all microorganisms tested.
© 2005 Elsevier Ireland Ltd. All rights reserved.

Keywords: Combretaceae; Terminalia species; Antifungal activity; MIC

1. Introduction based medications have been handed down from generation

A large proportion of the South African population use
traditional medicine to serve the health needs of humans and
animals. Medicinal plants have become the focus of intense
study recently in terms of conservation and as to whether
their traditional uses are supported by actual pharmacological
effects or merely on folklore (Locher et al., 1995). With the
increasing acceptance of herbal medicine as an alternative
form of health care, the screening of medicinal plants for
bioactive compounds is important.
More than 80% of the population in developing countries
depend on plants for their medical needs (Farnsworth, 1988;
Balick et al., 1994). Medicinal and poisonous plants have
always played an important role in African society. Tradi-
tions of collecting, processing and applying plants and plant-
∗ Corresponding author. Tel.: +27 12 529 8244; fax: +27 12 529 8252.
E-mail address: kobus.eloff@up.ac.za (J.N. Eloff).
to generation. In South Africa and also in many other African
countries, traditionally used medicinal plants are sold in mar-
ket places or prescribed by traditional healers in their homes
(Fyhrquist et al., 2002). Because of this strong dependence
on plants as medicines, it is important to study their safety
and efficacy (Farnsworth, 1994).
Many medicinal plants produce a variety of compounds
of known therapeutic properties. Substances that can either
inhibit the growth of pathogens or kill them and have little or
no toxicity to host cells are considered good candidates for
developing new antimicrobial drugs. In recent years, antimi-
crobial properties of medicinal plants have been increasingly
reported from different parts of the world (Cowan, 1999).
Higher plants are still regarded as potential sources of new
medicinal compounds. Throughout the world, plants are used
traditionally to treat many ailments, particularly infectious
diseases, such as diarrhoea, fever and colds (Mitscher et al.,
1987).

0378-8741/$ – see front matter © 2005 Elsevier Ireland Ltd. All rights reserved.
doi:10.1016/j.jep.2005.01.061
302 P. Masoko et al. / Journal of Ethnopharmacology 99 (2005) 301–308
Members of the Combretaceae are used for many medic-
inal purposes by traditional healers. This includes treating
abdominal disorders, abdominal pains, backache, bilharzia-
sis, chest coughs, colds, conjunctivitis, diarrhoea, dysmenor-
rhoea, earache, fattening babies, fever, headache, hookworm,
infertility in women, leprosy, pneumonia, scorpion bite,
snake bite, swelling caused by mumps, syphilis, toothache,
gastric ulcer, venereal diseases, heart diseases, cleanse the
urinary system, dysentery, gallstones, sore throats, nose-
bleeds and general weakness (Hutchings et al., 1996; Van
Wyk et al., 1997).
The Combretaceae consists of 18 genera, the largest of
which are Combretum with about 370 species, and Termina-
lia with about 200 species (McGaw et al., 2001). Species
from the genus Combretum and to a lesser extent Termi-
nalia are most widely used for medicinal purposes, as they
are common and widely distributed throughout western and
southern Africa (McGaw et al., 2001). Many members of the
Combretaceae are easily characterized by the wing-shaped
appendages of the fruits (Carr, 1988).
Several investigations into the antimicrobial activity of
members of the Combretaceae have been undertaken in
recent years. Although the antibacterial properties of various
Terminalia species (Silva et al., 1996; Eloff, 1999; Fyhrquist
et al., 2002) have been investigated in depth, this is not the
case regarding their antifungal properties. Antifungal activity
of Terminalia extracts was demonstrated, but no quantitative
data was provided (Bhatt and Saxena, 1979; Baba-Moussa
et al., 1998). This may be because the adequate methods for
determining MIC values are not available. Our aim in this
work was to expand a serial microplate technique developed
for bacteria (Eloff, 1998c) for fungi in order to determine
quantitative data on antifungal activities of Terminalia
species occurring in southern Africa. Further motivation
was that antifungal agents are becoming more important
to combat infections of immune-compromised patients
suffering from the acquired immune-deficiency syndrome
Fig. 1. Percentage of samples extracted by acetone (
), hexane (), dichloromethane , and methanol , from the six Terminalia species: T. pru.: Terminalia
prunioides, T. bra.: Terminalia brachystemma, T. ser.: Terminalia sericea, T. gaz.: Terminalia gazensis, T. mol.: Terminalia mollis and T. sam.: Terminalia
sambesiaca.
(AIDS) and Terminalia species occuring widely in southern
Africa.
2. Materials and methods
2.1. Plant collection
Leaves were collected in summer from trees in the
Lowveld National Botanical Garden in Nelspruit, South
Africa. Voucher specimens in the garden herbarium verified
the identity of the plants. Leaves collected were from the fol-
lowing five species with the section (Carr, 1988) in brackets:
Terminalia prunioides M.A. Lawson (Abbreviatae), Termi-
nalia brachystemma Welw. ex Hiern (Psidiodes), Terminalia
sericea Burch ex DC (Psidiodes), Terminalia gazensis Bak.f.
(Platycarpae), T. mollis Laws. (Platycarpae) and T. sambesi-
aca Engl. & Diels. (Platycarpae).
2.2. Plant storage
Leaves were separated from stems and dried at room tem-
perature. Most scientists have tended to use dried material
because there are a few problems associated with large-scale
extraction of dried plants rather than fresh plant material
(Eloff, 1998a). The dried plants were milled to a fine powder
in a Macsalab mill (Model 200 LAB), Eriez® , Bramley, and
stored at room temperature in closed containers in the dark
until used.
2.3. Extraction procedure
Plant samples from each species were individually ex-
tracted by weighing four aliquots of 1 g of finely ground
plant material and extracting with 10 ml of acetone, hex-
ane, dichloromethane (DCM) or methanol (technical grade
– Merck) in polyester centrifuge tubes. Tubes were vigor-
 P. Masoko et al. / Journal of Ethnopharmacology 99 (2005) 301–308 303

Fig. 2. Chromatograms sprayed with vanillin to show compounds extracted with acetone (Ac), hexane (Hex), dichloromethane (D) and methanol (Met), in
lanes from left to right for each group.

ously shaken for 3–5 min in Labotec model 20.2, shaking exhaustively extract the plant material and the extracts were
machine at a high speed. After centrifuging at 3500 rpm for combined. The solvent was removed under a stream of air
10 min, the supernatant was decanted into pre-weighed la- in a fume cupboard at room temperature to quantify the
beled containers. The process was repeated three times to extraction.

Fig. 3. Chromatograms of extracts of different Terminalia species separated by EMW and sprayed with 0.2% DPPH, clear zones indicate antioxidant activity.
Lanes from left to right in each group are acetone (Ac), hexane (Hex), dichloromethane (D) and methanol (Met).
304 P. Masoko et al. / Journal of Ethnopharmacology 99 (2005) 301–308

2.4. Phytochemical analysis

Average Amph.Ba

0.4

0.3

0.2

0.4

0.2

Chemical constituents of the extracts were analyzed by

thin layer chromatography (TLC) using aluminium-backed
0.46

0.12
0.15

0.45

0.05
0.27

0.03
0.3

2.5

0.1

TLC plates (Merck, silica gel 60 F254 ). The TLC plates

Acetone Hexane DCM Methanol Acetone Hexane DCM Methanol Acetone Hexane DCM Methanol Acetone Hexane DCM Methanol Acetone Hexane DCM Methanol Acetone Hexane DCM Methanol

were developed under saturated conditions with one of the

0.32 0.32
0.64 0.64

0.02
0.02

0.16

0.04
0.02

0.02
0.02

0.38
2.5

three eluent systems developed in our laboratory that sepa-

0.16
0.16

1.25

0.04
0.16

0.08
0.08

0.54

rates components of Combretaceae extracts well, i.e., ethyl

Terminalia sambesiaca

2.5

acetate/methanol/water (40:5.4:5): [EMW] (polar/neutral);

0.32
0.64

0.16
0.16

1.25

0.04
0.04

0.08
0.08

0.53

chloroform/ethyl acetate/formic acid (5:4:1): [CEF] (inter-

2.5

mediate polarity/acidic); benzene/ethanol/ammonia hydrox-

0.16
0.64

0.02
0.02

0.16

0.02
0.04

0.02
0.02

0.36

ide (90:10:1): [BEA] (non-polar/basic) (Kotze and Eloff,

2.5

2002).
To detect the separated compounds, vanillin-sulphuric
0.32 0.16
0.64 0.64

0.08
0.08

0.64

0.08
0.02

0.02
0.04

0.43
2.5

acid (0.1 g vanillin (Sigma® ): 28 methanol: 1 ml sulphuric

0.08
0.08

0.32

0.02
0.04

0.02
0.08

0.41

acid) was sprayed on the chromatograms and heated at 110 ◦ C

2.5
Terminalia mollis

to optimal colour development.

0.64
0.64

0.16
0.16

0.04
0.16

0.02
0.08

0.69
2.5
2.5

2.5. Antioxidant activity

0.32
0.32

0.02
0.02

0.32

0.08
0.08

0.02
0.02

0.37
2.5

a Values in ␮g/ml; originally all were <20 ␮g/ml in combined experiment, data provided here was determined in separate experiments.

TLC was used to separate extracts as above. To de-

0.16 0.64
0.32 0.64

0.04
0.04

0.32

0.04
0.16

0.02
0.08

0.45

tect antioxidant activity, chromatograms were sprayed with

2.5

0.2% 1,1-diphenyl-2-picryl-hydrazyl (Sigma® )(DPPH) in

0.16
0.16

0.16

0.08
0.16

0.02
0.16

0.39
2.5

methanol as an indicator (Deby and Margotteaux, 1970).

Terminalia gazensis

0.16
0.32

0.08
0.08

0.64

0.08
0.16

0.02
0.08

0.41
2.5

2.6. Fungal test organisms

0.32
0.32

0.04
0.04

0.16

0.08
0.08

0.02
0.04

0.36
2.5

Five microorganisms namely, Candida albicans, Cryp-

Minimum Inhibitory Concentration (MIC) of six Terminalia species after 24- and 48-h incubation at 37 ◦ C

tococcus neoformans var. gattii, Aspergillus fumigatus,

0.08 0.32
0.64 0.64

0.16
0.16

0.64

0.02
0.32

0.02
0.08

0.49
2.5

Sporothrix schenckii and Microsporum canis cultured from

clinical cases of disease in animals were used in the Depart-
0.16
0.32

0.16

0.02
0.64

0.02
0.08

0.46
2.5

ment of Veterinary Tropical Diseases, Faculty of Veterinary

Terminalia sericea

Science. Candida albicans was isolated from a Goldian finch,

0.16
0.64

0.08
0.16

0.32

0.02
0.64

0.02
0.08

0.46
2.5

Cryptococcus neoformans from a cheetah, and Aspergillus fu-

migatus from a chicken, all of which suffered from a systemic
0.64
0.64

0.16
0.16

0.16

0.08
0.32

0.02
0.04

0.47
2.5

mycosis. Microsporum canis was isolated from a cat suffering

from dermatophytosis and Sporothrix schenckii from a horse
0.16 0.64
0.16 0.64

0.32
0.16

0.16

0.04
0.64

0.02
0.32

0.54
2.5

with cutaneous lymphangitis. None of the animals had been

Terminalia brachystemma

0.08
0.32

0.08

0.02
0.32

0.02
0.16

0.38

treated prior to sampling. These fungi represent the differ-

2.5

ent morphological forms of fungi, namely yeasts (Candida

0.16
0.16

0.16
0.16

0.16

0.02
0.64

0.02
0.16

0.41

albicans and Cryptococcus neoformans), thermally dimor-

2.5

phic fungi (Sporothrix schenckii) and moulds (Aspergillus

0.32
0.32

0.16
0.32

0.32

0.04
0.32

0.02
0.16

0.45

fumigatus) and are the most common and important disease-

2.5

causing fungi of animals. All fungal strains were maintained

Positive control: Amphotericin B (Amph.B).

on Sabouraud dextrose agar (Oxoid, Basingstoke, UK).

0.16 0.32
0.16 0.32

0.16
0.16

0.32

0.08
0.32

0.02
0.08

0.43
2.5
0.04
0.16

0.16

0.04
0.64

0.02
0.16
2.5

0.4

2.7. Antifungal assays

Terminalia prunioides
Microorganisms Time MIC values (mg/ml)

0.16
0.16

0.08
0.16

0.16

0.04
0.32

0.02
0.16

0.38
2.5

2.7.1. Microdilution assay

A serial microdilution assay with tetrazolium violet added
0.16

0.32

0.16

0.04

0.02
0.16

0.32

0.32

0.08

0.4
2.5

as growth indicator (Eloff, 1998c) was used to determine the

minimum inhibitory concentration (MIC) values for plant ex-
(h)

24
48

24
48

24
48

24
48

24
48

tracts. This method had previously been used only for antibac-
Cryptococcus

Microsporum

terial activities (Eloff, 1998c; McGaw et al., 2001). Motsei et

neoformans

Aspergillus

Sporothrix
fumigatus
Table 1

schenckii
Candida
albicans

Average

al. (2003) also used a serial microplate dilution assay in deter-

canis

mining the antifungal activity of 24 South African medicinal

 P. Masoko et al. / Journal of Ethnopharmacology 99 (2005) 301–308 305

Average
plants to three Candida albicans isolates. They determined

1150

2036
202
212

807
645

194

692

799
growth with an ELISA reader. In our experience, measur-

41
ing growth by turbidity measurement has several complica-
Acetone Hexane DCM Methanol Acetone Hexane DCM Methanol Acetone Hexane DCM Methanol Acetone Hexane DCM Methanol Acetone Hexane DCM Methanol Acetone Hexane DCM Methanol

1450
1450

1450

1450
1450
tions (Eloff, 1998c). By applying the tetrazolium violet assay

181

725

830
91
45

12
for measuring the antifungal activities, a slight modification 131
131

525
131

263
263

157
Terminalia sambesiaca

was made to suit fungal growth conditions. Residues of the

66
33

17
8
different extracts were dissolved in acetone to a concentra-
125
125

500
500

250
250

187
tion of 10 mg/ml. The plant extracts (100 ␮l) were serially
63
31

16
8

diluted up to 50% with water in 96 well microtitre plates

5600
5600

5600
2800

5600
5600

3242
700
175

700

(Eloff, 1998c). Fungal cultures were transferred into fresh

45

Sabouraud dextrose broth, and 100 ␮l of this was added to

1513
1513

1513
6050

6050
3025

each well. Amphotericin B was used as the reference an- 2085

756
189

189
48

tibiotic and positive control, and appropriate solvent blanks

were included. As an indicator of growth, 40 ␮l of 0.2 mg/ml
225
225

900
450

900
225

307
56
28

56
7

of p-iodonitrotetrazolium violet (Sigma® ) (INT) dissolved in

Terminalia mollis

275

550
138

121
17
17

69
69

69

water was added to each of the microplate wells. The cov-

4
4

ered microplates were incubated for 2–3 days at 35 ◦ C and

2350

2350

2350

2350

1102
147

147

588

588

127

100% relative humidity. The MIC was recorded as the lowest

19

concentration of the extract that inhibited antifungal growth

1950
1950

1950

3900

1173

after 24 and 48 h.
122
122

244

488

975
31

One is tempted to consider the 48-h value as a minimal

113

113
113

113

225
113

900
113

186

lethal concentration, especially since no growth was apparent

56

7
Terminalia gazensis

in the particular well after 120 h. When the cells from wells
125
125

125

500
125

118
63
31

16

63

showing no growth after 48 h were incubated in fresh growth

4

medium, fungal growth however resumed. We are following

2000
2000

1000
1000

4000
2000

1303
250
250

500

up on this matter.
32

100

100
13
13

25

27
6
3

3
1

3. Results and discussion

2300

2300
575

288
144

288

575

663
72

18

72
Terminalia sericea

Six Terminalia species were selected for antifungal-

1600

1600
200

400
200

100

400

461
50

13

50

activity screening based on their use in traditional medicinal

treatments for both domestic animals and humans in southern
2750
1375
344
344

344

688
172

621
Total activity in ml/g of six Terminalia species after 24- and 48-h incubation at 37 ◦ C

86
86

22

Africa and availability. The majority of traditional healers use

water to isolate active compounds from these plants, because
water is not harmful to domestic animals and humans and
325

650

128
20
20

41
81

81

20

41
5

is generally the only extractant available. Using only water

Terminalia brachystemma

2050

2050
256
256

513
128

513

128

256

617
16

Table 2
1150

1150
144
144

144
144

144

144

321
36

Average MIC values for different extractants on all test organisms

9

Extractants Average MIC values (mg/ml)

1875

3750
234
234

469
234

234

234

469

776
30

Hexane 0.259
DCM 0.147
1300

Acetone 0.146
163
163

325

325

261
81
81

81
10

81

Methanol 0.195
1700
213
213

850
213

213

850

213

453
14

53
Terminalia prunioides
Time Total activity (ml/g)

Table 3
1100
138
138

275
138

138

550

138

269

Average MIC values of different Terminalia species

69
9

Terminalia ssp. Average MIC values (mg/ml)

1850

3700
463
463

231
231

463

231

925

859
30

24 h 48 h
(h)

24
48

24
48

24
48

24
48

24
48

Terminalia prunioides 0.124 0.68

Terminalia brachystemma 0.146 0.75
Terminalia sericea 0.163 0.80
Microorganisms

Cryptococcus

Microsporum

Terminalia gazensis 0.162 0.64

neoformans

Aspergillus

Sporothrix
fumigatus
Table 4

schenckii
Candida

Terminalia mollis 0.293 0.62

albicans

Average
canis

Terminalia sambesiaca 0.232 0.66

306 P. Masoko et al. / Journal of Ethnopharmacology 99 (2005) 301–308
leads to difficulties in extracting non-polar active compounds.
Success in isolating compounds from plant material is largely
dependent on the type of the solvent used in the extraction
procedure. The total percentages extracted by using different
solvents (acetone, hexane, DCM and methanol) are shown in
Fig. 1. Methanol was the best extractant, extracting a greater
quantity of plant material than any of the other solvents. There
was a major difference in the methanol extractability of Ter-
minalia gazensis leaves compared with all the other species.
This difference is not related to the sectional division of the
species (Carr, 1988). The extract probably contained more
polar compounds (Fig. 2) that may not be that interesting for
clinical application.
Hexane, dichloromethane and methanol extracts were re-
dissolved in acetone because this solvent was not found to
be harmful towards bacteria (Eloff, 1998b). We found that
acetone was also not harmful towards fungi at the concentra-
tions used in the plant extracts. Because fungi grow slower
than bacteria, we modified Eloff’s (1998c) method by adding
the tetrazolium violet before incubating the fungi. This made
it possible to see when sufficient growth had taken place to
determine MIC value.
There was similarity in the chemical composition of the
non-polar components of extracts using extractants of vary-
ing polarity. This may indicate the presence of saponin-like
compounds in the leaves.
The acetone and methanol extracts had antioxidant activ-
ity after spraying chromatogram with 0.2% DPPH (Fig. 3).
Hexane and dichloromethane extracts apparently did not have
any antioxidant activity.
To determine MIC values, growth was checked after 24
and 48 h (Table 1) to determine the end point. The MIC val-
ues of most of the extracts were in the order of 0.08 mg/ml
and some had values as low as 0.02–0.04 mg/ml after 24-h in-
cubation. Amphotericin B was used as a positive control and
there was no growth in any of the wells containing antibiotic
indicating an MIC < 0.02 mg/ml. In subsequent experiments,
the MIC value for Candida albicans, Cryptococcus neofor-
Fig. 4. The average antifungal activity of different leaf extracts of six Terminalia species towards Candida albicans , Cryptococcus neoformans (),
Aspergillus fumigatus (
) Sporothrix schenckii , Microsporum canis . (Antifungal activity expressed as the inverse of MIC in mg/ml indicating the volume
to which 1 mg of extract can be diluted and still inhibit the growth of the fungus).
mans var. gattii, Sporothrix schenckii and Microsporum canis
were 0.4, 0.3, 0.4, and 0.2 ␮g/ml, respectively, after 48-h in-
cubation and for Aspergillus fumigatus, it was 0.2 ␮g/ml after
24 h.
The average value for all the extracts and Terminalia
species after 24 h was 0.3 mg/ml (Table 1). Motsei et al.
(2003) found much less activity with different plants and ex-
tractants. Of the 273 extracts evaluated, 211 (77%) had MIC
values as high or even higher than the highest concentration
tested (8.35 mg/ml). This indicates that the tested plants were
much less active than the Terminalia species, or that the tech-
nique they used was not as sensitive as the tetrazolium violet
technique we used.
Acetone and DCM extracts had the lowest average MIC
values on the tested organisms (Table 2) which were 0.146
and 0.147 mg/ml, respectively, after 24 h. Acetone and DCM
are followed by methanol which had 0.195 mg/ml after
24 h, and hexane had the highest average MIC value after
24 h which was 0.259 mg/ml. Terminalia prunioides, Ter-
minalia brachystemma, Terminalia sericea and Terminalia
gazensis had the lowest average values after 24 h (Table 3),
which were 0.124, 0.146, 0.163 and 0.162 mg/ml, respec-
tively. All the Terminalia species had almost the same
average MIC value after 48 h ranging between 0.62 and
0.80 mg/ml.
The quantity of antifungal compounds present was also
determined in Table 4. To determine which plants can be
used for further testing and isolation, not only the MIC value
is important, but also the total activity. Because the MIC
value is inversely related to the quantity of antifungal com-
pounds present, an arbitrary measure of the quantity of an-
tifungal compounds present was calculated by dividing the
quantity extracted in milligrams from 1 g leaves by the MIC
value in mg/ml. This value indicates the volume to which
the biologically active compound present in 1 g of the dried
plant material can be diluted and still kill the fungi (Eloff,
1999). Extracts with higher values were considered the best to
work with. From Table 4, all 96 extracts had substantial total
 P. Masoko et al. / Journal of Ethnopharmacology 99 (2005) 301–308
Fig. 5. The sensitivity of different fungal pathogens to different acetone (
), hexane (), dichloromethane
(Antifungal activity expressed as inverse of MIC in mg/ml).
activity against Microsporum canis followed by Sporothrix
schenckii, especially after 24 h. Cryptococcus neoformans
and Candida albicans were also reasonably sensitive, but
Aspergillus fumigatus was relatively resistant.
All of the six tested Terminalia species (Fig. 4) had an-
tifungal properties against the tested organisms. The values
are expressed as the reciprocal of MIC, which means that
1 mg of the acetone extract diluted to 50 ml would still inhibit
the growth of Microsporum canis. Microsporum canis and
Sporothrix schenckii were highly sensitive and Aspergillus
fumigatus was less sensitive (Fig. 5). The acetone extract of
Terminalia mollis was the only extract which was not ac-
tive against Aspergillus fumigatus after 24 h at the highest
level tested. After 48-h incubation, there were changes in As-
pergillus fumigatus wells; all showed fungal growth, even
at the highest extract concentrations. Aspergillus fumigatus
is a filamentous fungus and has hyphae which grows over
surfaces and inside nearly all wells. Although there was inhi-
bition of the Aspergillus fumigatus after 24 h of incubation,
this inhibition was overcome by 48 h of incubation. The active
antifungal compounds may have broken down allowing the
inhibited fungus to grow, or the fungus was able to overcome
the initial inhibitory effects of the antifungal compounds, and
that the minimal lethal concentration was higher than highest
level tested (final concentration 2.5 mg/ml).
4. Conclusion
The serial dilution microplate method worked well with
fungi after slight modifications. The antifungal activity of
some of the extracts were at levels that would probably al-
ready therapeutically useful, leading to the distinct possibility
that some of the extracts may be applied clinically for der-
matophyte infections, e.g., Microsporum canis. If one extrap-
olates from in vitro to in vivo activity, especially in topical
applications, it means that an acetone leaf extract from 1 g
of Terminalia sericea leaves diluted to 2.7 l would still in-
hibit the growth of Microsporum canis. Extracts from other
307
, and methanol extracts of six Terminalia
species had values as high as 6.05 l/g. We intend to follow
the in vitro experiments up with in vivo work.
An important question is, whether the same compound
inhibits different fungi and also whether the same compound
is present in different Terminalia species. We hope to address
these aspects by bioautography, but there are still difficulties
in the bioautography using fungi as test organisms.
The results of the present work indicate that the Termina-
lia species assayed possess substantial antifungal properties.
This explains the use of these plants in folk medicine for the
treatment of various diseases related to fungal infections. We
have started isolating the active compounds responsible for
the antifungal effects from Terminalia sericea.
Acknowledgement
The National Research Foundation (NRF) and the Re-
search Committee, Faculty of Veterinary Science, University
of Pretoria provided financial assistance.
References
Baba-Moussa, F., Akpagana, K., Bouchet, P., 1998. Antifungal activities
of seven West African Combretaceae used in traditional medicine.
Journal of Ethnopharmacology 66, 335–338.
Balick, M.J., Arvigo, R., Romero, L., 1994. The development of an en-
thnobiomedical forest reserve in Belixe: its role in the preservation of
biological and cultural diversity. Conservation Biology 8, 316–317.
Bhatt, S.K., Saxena, V.K., 1979. Efficacy of successive extracts of seeds of
Anogeissus leiocarpus against some human pathogenic fungi. Indian
drugs 16, 263–264.
Carr, J.D., 1988. Combretaceae in southern Africa. Tree Society of south-
ern Africa, Johannesburg.
Cowan, M.M., 1999. Plant products as antimicrobial agents. Clinical Mi-
crobiology Reviews 12, 564–582.
Deby, C., Margotteaux, G., 1970. Relationship between essential fatty
acids and tissue antioxidant levels in mice. C R Seances Society
Biology Fil. 165, 2675–2681.
Eloff J.N., 1998a. Conservation of Medicinal Plants: Selecting Medicinal
Plants for Research and Gene Banking. Monographs in systematic
308 P. Masoko et al. / Journal of Ethnopharmacology 99 (2005) 301–308
botany from the Missouri Garden 71, 209–222 In: Conservation of
plants Genes III: Conservation, utilisation of African plants., Robert,
P., Adams, Janice, E., Adams, eds., Missouri Botanical Garden Press,
St. Louis, USA.
Eloff, J.N., 1998b. Which extractant should be used for the screening
and isolation of antimicrobial components from plants? Journal of
Ethnopharmacology 60, 1–8.
Eloff, J.N., 1998c. A sensitive and quick microplate method to determine
the minimal inhibitory concentration of plants extracts for bacteria.
Planta Medica 64, 711–713.
Eloff, J.N., 1999. The antibacterial activity of 27 sourthern African mem-
bers of the Combretaceae. South African Journal of Science 95,
148–152.
Farnsworth, N.R., 1988. Screening plants for new medicines. In: Wilson,
E.O. (Ed.), Biodiversity. National Academic Press, Washington, DC,
pp. 83–97.
Farnsworth N.R., 1994. The ethnobotanical approach to drug discovery:
strengths and limitations. In: Prance G.T. (Ed), Ethnobotany and the
search for new drugs. In: Ciba Foundation Symposium, 185. Chich-
erster, 42–59.
Fyhrquist, P., Mwasumbi, L., Haeggstrom, C.A., Vuorela, H., Hiltunen,
R., Vuorela, P., 2002. Ethnobotanical and antimicrobial investi-
gation of some species of Terminalia and Combretum (Combre-
taceae) growing in Tanzania. Journal of Ethnopharmacology 79, 169–
177.
Hutchings, A., Scott, A.H., Lewis, G., Cunninghan, A., 1996. Zulu Medic-
inal Plants, An Inventory. University of Natal Press, Pietermarizburg,
South Africa.
Kotze, M., Eloff, J.N., 2002. Extraction of antibacterial compounds from
Combretum microphyllum (Combretaceae). South African Journal of
Botany 68, 62–67.
Locher, C.P., Burch, M.T., Mower, H.F., Berestecky, J., Davis, H., van
Poel, B., Lasure, A., Vanden Berghe, D.A., Vlietinck, A.J., 1995. Anti-
microbial activity and anti-complement activity of extracts obtained
from selected Hawaiian medicinal plants. Journal of Ethnopharmacol-
ogy 49, 23–32.
McGaw, L.J., Rabe, T., Sparg, S.G., Jäger, A.K., Eloff, J.N., van Staden,
J., 2001. An investigation of the biological activity of Combretum
species. Journal of Ethnopharmacology 75, 45–50.
Mitscher, L.A., Drake, S., Goliapudi, S.R., Okwute, S.K., 1987. A mod-
ern look at folkloric use of anti-infective agents. Journal of Natural
Products 50, 1025–1040.
Motsei, M.L., Lindsey, K.L., van Staden, J., Jager, A.K., 2003. Screen-
ing of traditionally used South African plants for antifungal activity
against Candida albicans. Journal of Ethnopharmacology 86, 235–241.
Silva, O., Duarte, A., Cabrita, J., Pimentel, M., Diniz, A., Gomes, E.,
1996. Antimicribial activity of Guinea-Bissau traditional remedies.
Journal of Ethnopharmacology 50, 55–59.
Van Wyk, B.-E., van Oudtshoorn, B., Gericke, N., 1997. Medicinal plants
of South Africa. Briza Publications, Pretoria, South Africa.
 Journal of Ethnopharmacology 99 (2005) 309–312

Short communication

Antibacterial screening of some Peruvian medicinal plants used

in Callerı́a District
P. Kloucek a , Z. Polesny a , B. Svobodova b , E. Vlkova c , L. Kokoska a,∗
a Department of Crop Sciences and Agroforestry, Institute of Tropics and Subtropics, Czech University of Agriculture Prague, Kamycka 129,
165 21 Prague 6-Suchdol, Czech Republic
b Department of Biochemistry, Faculty of Science, Charles University in Prague, Albertov 6, Prague 128 43, Czech Republic
c Department of Microbiology, Nutrition and Dietetics, Faculty of Agronomy, Czech University of Agriculture Prague, Kamycka 129,

165 21 Prague 6-Suchdol, Czech Republic

Received 22 October 2004; received in revised form 22 December 2004; accepted 28 January 2005
Available online 8 April 2005

Abstract

Nine ethanol extracts of Brunfelsia grandiflora (Solanaceae), Caesalpinia spinosa (Caesalpiniaceae), Dracontium loretense (Araceae),
Equisetum giganteum (Equisetaceae), Maytenus macrocarpa (Celastraceae), Phyllanthus amarus (Euphorbiaceae), Piper aduncum (Piper-
aceae), Terminalia catappa (Combretaceae), and Uncaria tomentosa (Rubiaceae), medicinal plants traditionally used in Callerı́a District
for treating conditions likely to be associated with microorganisms, were screened for antimicrobial activity against nine bacterial strains
using the broth microdilution method. Among the plants tested, Phyllanthus amarus and Terminalia catappa showed the most promising
antibacterial properties, inhibiting all of the strains tested with minimum inhibitory concentrations (MICs) ranging from 0.25 to 16 mg/ml.
The extract from aerial part of Piper aduncum was significantly more active against Gram-positive (MICs ranging from 1 to 2 mg/ml) than
against Gram-negative bacteria (MICs >16 mg/ml).
© 2005 Elsevier Ireland Ltd. All rights reserved.

Keywords: Antibacterial activity; Crude extracts; Peruvian medicinal plants; Phyllanthus amarus; Terminalia catappa

1. Introduction habitants, who still largely depend on natural resources, the

Callerı́a District, part of the Coronel Portillo Province in
the Ucayali Department, lies in the lowlands of Peruvian
Amazonia. Pucallpa, its administrative centre and also the
capital of the Ucayali Department, is situated on the banks
of the river Ucayali, a principal tributary of the Amazon. The
largest indigenous ethno-linguistic group living in this region
is the Shipibo-Conibo group. The Ucayali department, for-
merly very isolated from other parts of Peru, is now one of the
fastest developing Peruvian regions, mainly due to extensive
logging. However, timber production together with shifting
agriculture has a devastating effect on natural ecosystems and
can lead to high genetic erosion. Thanks to the indigenous in-
∗ Corresponding author. Tel.: +420 224382180; fax: +420 234381829.
E-mail address: kokoska@itsz.czu.cz (L. Kokoska).
important ethnomedicinal knowledge of this region survives.
Nevertheless, it should be verified and preserved by modern
scientific methods.
The phytochemical research based on ethnopharmacolog-
ical informations is generally considered an effective ap-
proach in the discovery of new anti-infective agents from
higher plants. In Peru about 20,000 plant species or 8%
of the total number of plants in the world can be found.
Most of them are native or grow in the Peruvian Amazonia.
However, probably less than 1% has been studied for their
chemical composition and medicinal use (Desmarchelier
and Schaus, 2000). In this study, we chose nine promis-
ing medicinal plants used traditionally by local inhabi-
tants of Callerı́a District for treating conditions likely to
be associated with microorganisms, and evaluated them for
potential antibacterial activity, in order to confirm their

0378-8741/$ – see front matter © 2005 Elsevier Ireland Ltd. All rights reserved.
doi:10.1016/j.jep.2005.01.062
310 P. Kloucek et al. / Journal of Ethnopharmacology 99 (2005) 309–312

Table 1
Ethnobotanical data on medicinal plants
Species (family) and voucher Common name Part tested Ethnomedicinal uses
specimen number
Brunfelsia grandiflora D. Don Chirisanango Roots Diuretic, febrifuge, antirheumatic, antisyphilitic, against yellow fever
(Solanaceae) POL 0001 (Schultes and Raffauaf, 1990; Plowman, 1977; Desmarchelier and
Schaus, 2000)
Caesalpinia spinosa (Molina) Kuntze Tara Pods Eyewash (Duke and Reed, 1981)
(Caesalpiniaceae) POL 0002
Dracontium loretense K. Krause Sacha jergón Tubers Treatment of snakebites (Desmarchelier and Schaus, 2000),
(Araceae) POL 0003 antidiarrheic (Schultes and Raffauaf, 1990)
Equisetum giganteum L. Cola de caballo Aerial part Astringent, antidiarrheic, diuretic, emmenagogue, wound healing
(Equisetaceae) POL 0004 (Desmarchelier and Schaus, 2000)
Maytenus macrocarpa Briq. Chuchuhuasi Bark Anti-inflammatory, antirheumatic, tonic, aphrodisiac (Desmarchelier
(Celastraceae) POL 0005 and Schaus, 2000)
Phyllanthus amaraus Schum. et Chanca piedra Aerial part Diuretic, sedative, astringent, tonic, antidiabetic, antihemorrhagic,
Thonn. (Euphorbiaceae) POL 0007 against jaundice and kidney diseases (Schultes and Raffauaf, 1990;
Desmarchelier and Schaus, 2000)
Piper aduncum L. (Piperaceae) POL Matico Aerial part Antiseptic, antidiarrheic, tonic, astringent, antirheumatic, styptic
0006 (Schultes and Raffauaf, 1990; Desmarchelier and Schaus, 2000)
Terminalia catappa L. Almendra Leaves Treatment of bilious fevers and dysentery (Schultes and Raffauaf, 1990)
(Combretaceae) POL 0008
Uncaria tomentosa DC. (Rubiaceae) Uña de gato Bark Anti-inflammatory, antidiabetic, anticancer (Desmarchelier and
POL 0009 Schaus, 2000)

popular use and to detect new sources of antibacterial
agents.
2. Materials and methods
2.1. Plant material and extract preparation
After consultations with village elders and herbalists and
comparing their information with literature, we chose nine
plants that offered good prospects (Table 1). Samples for this
study were obtained from marketplace vendors and herbalists
in Pucallpa, and authenticated by Z. Polesny. Voucher speci-
mens are deposited at the Institute of Tropics and Subtropics,
Czech University of Agriculture Prague.
Air dried plant material (15 g of each species) was finely
ground and macerated at room temperature in 80% ethanol
for 5 days. The extract was subsequently filtered and concen-
trated in vacuo at 40 ◦ C. The residue was dissolved in 10%
(v/v) solution of dimethylsulfoxide (DMSO) in Tris buffer
saline (TBS) of pH 7.6 (Sigma, USA) to create a concentra-
tion of 32 mg/ml of stock solution.
(Oxoid, UK). Other microorganisms were grown and tested
in Mueller–Hinton broth.
All microbial strains and cultivation media were pur-
chased from Oxoid (UK). Ciprofloxacin (Sigma, USA) was
checked as positive control (Table 2).
2.3. Antibacterial assay
In vitro antimicrobial activity was determined by the broth
microdilution method (Jorgensen et al., 1999) using 96-well
microtitre plates. Two-fold dilutions (six) of each extract were
carried out, starting from a concentration of 16 mg/ml. Each
well was inoculated with 5 ␮l of bacterial suspension at a
density of 107 CFU/ml and incubated at 37 ◦ C for 24 h. The
growth of microorganisms was observed as turbidity deter-
mined by the UV–vis spectrometer Helios ␧ (Spectronic Uni-
cam, UK) at 600 nm. The MIC was determined as the lowest
dilution which completely prevented microbial growth. The
solution of DMSO (5%, v/v) in TBS served as the negative
control. All samples were tested in triplicate.

2.2. Microorganisms 3. Results

The following strains of bacteria were used: Bacillus
cereus ATCC 11778, Bacillus subtilis ATCC 6633, Bac-
teroides fragilis ATCC 25285, Enterococcus faecalis ATCC
29212, Escherichia coli ATCC 25922, Pseudomonas aerug-
inosa ATCC 27853, Staphylococcus aureus ATCC 25923,
Staphylococcus epidermidis ATCC 12228, and Streptococ-
cus pyogenes ATCC 19615.
Streptococci were grown and tested in brain–heart infu-
sion broth, Bacteroides fragilit in Wilkins-Chalgren anaerobe
broth under anaerobic conditions using Anaerobic Jar HP11
Table 1 shows the botanical name, local name, voucher
specimen number, plant part investigated and popular uses
of the selected plant species. Table 2 gives a summary of the
investigated species, the percentage yield and the obtained
MIC values. With exception of Maytenus macrocarpa, all
plants tested possessed antibacterial activity against at least
four bacterial strains (Bacillus cereus, Enterococcus faecalis,
and both staphylococci) at the concentrations of 16 mg/ml or
below. Extracts from aerial part of Phyllanthus amarus and
from leaves of Terminalia catappa showed the broadest spec-
 P. Kloucek et al. / Journal of Ethnopharmacology 99 (2005) 309–312 311

Table 2
Minimum inhibitory concentrations (mg/ml) of ethanol extracts of nine Peruvian medicinal plants
Species, reference compound Extract yield (%) Gram-positive Gram-negative

B.c. B.s. E.f. S.a. S.e. S.p. B.f. E.c. P.a.

Brunfelsia grandiflora 13.53 4 16 8 4 4 NA 16 NA 16
Caesalpinia spinosa 48.67 8 16 0.5 16 16 – 16 NA NA
Dracontium loretense 7.87 8 NA 8 8 16 NA NA NA NA
Equisetum giganteum 7.33 8 16 8 8 16 4 8 NA NA
Maytenus macrocarpa 11.93 NA NA NA NA NA – NA NA NA
Piper aduncum 6.07 1 1 2 1 2 2 NA NA NA
Phyllanthus amarus 13.13 16 1 0.25 4 1 4 4 16 8
Terminalia catappa 14.53 2 4 8 1 0.25 16 16 8 4
Uncaria tomentosa 6.67 1 1 0.25 1 1 NA NA 8 NA
CIP (␮g/ml)a 1 2 1 0.5 1 1 2 0.015 0.25
–: Not performed; NA: not active (>16). B.c., Bacillus cereus; B.s., Bacillus subtilis; B.f., Bacteroides fragilis; E.f., Enterococcus faecalis; E.c., Escherichia
coli; P.a., Pseudomonas aeruginosa; S.a., Staphylococcus aureus; S.e., Staphylococcus epidermidis; S.p., Streptococcus pyogenes.
a CIP, ciprofloxacin.

trum of action against bacteria, inhibiting all of the strains
tested with minimum inhibitory concentrations (MICs) rang-
ing from 0.25 to 16 mg/ml. The strongest activity (MIC
0.25 mg/ml) was shown by Phyllanthus amarus and Uncaria
tomentosa against Enterococcus faecalis, and Terminalia cat-
appa against Staphylococcus epidermidis. The extract from
aerial part of Piper aduncum was significantly more active
against Gram-positive (MICs ranging from 1 to 2 mg/ml) than
against Gram-negative bacteria (MICs >16 mg/ml). Good ac-
tivity was observed also in the Uncaria tomentosa extract,
which inhibited six bacteria and five of them with MICs from
0.25 to 1 mg/ml. Other extracts showed only slight inhibition
of tested microorganisms.
Of the bacteria tested, Escherichia coli proved to be the
most difficult to inhibit with only slight susceptibility to
the Phyllanthus amarus, Terminalia catappa and Uncaria
tomentosa extracts (MICs ranging from 8 to 16 mg/ml).
Gram-negative bacteria were generally less susceptible than
Gram-positive. The most sensitive bacterium was Enterococ-
cus faecalis, which was inhibited by all tested species ex-
cept Maytenus macrocarpa with MICs ranging from 0.25 to
8 mg/ml.
No growth inhibition was observed in the negative control.
4. Discussion and conclusions
The use of these plants in Peruvian Amazon folk medici-
nal remedies for treating various health problems has already
been reported (Schultes and Raffauaf, 1990; Desmarchelier
and Schaus, 2000); with the most frequent medicinal uses
of the investigated plants being antirheumatic, antidiarrheic,
astringent, diuretic and tonic (3 plants), antidiabetic and an-
tiinflammatory (2 plants). However, apart from Phyllanthus
amarus, Piper aduncum and Terminalia catappa, no scien-
tific information concerning the antibacterial properties of
these plants has been reported.
Crude extract of Phyllanthus amarus collected in In-
dia possessed antibacterial activity against Bacillus subtilis,
Klebsiella pneumonia, Pseudomonas aeruginosa, Proteus
mirabilis, Salmonella paratyphi and Staphylococcus aureus
(Srinivasan et al., 2001). Among compounds isolated from
Phyllanthus amarus, tannins corilagin, geraniin and gallic
acid (Foo, 1993) showed in vitro activity against Bacillus sub-
tilis, Staphylococcus aureus and Escherichia coli (Adesina et
al., 2000; Gohar et al., 2003).
Antimicrobial properties of Piper aduncum have been
reported (Lentz et al., 1998; Lemos et al., 2000). Ben-
zoic acid and benzene derivates, dihydrochalcones and
chromenes isolated from its leaves were active against a
variety of microorganisms including Bacillus subtilis, Es-
cherichia coli, Staphylococcus aureus, Cryptococcus neofor-
mans, Mycobacteria intracellulare, Micrococcus luteus and
Pseudomonas aeruginosa (Nair and Burke, 1990; Orjala et
al., 1993; Orjala et al., 1994; Okunade et al., 1997). The chem-
ical composition of essential oil and its antibacterial proper-
ties have also been described (Tirillini et al., 1996; Maia et
al., 1998; Pino et al., 2004).
High antifungal but no antibacterial activity of methanol
and methylene chloride extracts from Terminalia catappa
aerial part (Goun et al., 2003) has been reported. On the
other hand different authors (Pawar and Pal, 2002) investi-
gated roots of Terminalia catappa and detected good antimi-
crobial activity of chloroform and methanol extracts against
Escherichia coli and Staphylococcus aureus, which supports
our results. The phytochemical studies on Terminalia cat-
appa bark and leaves demonstrate the presence of tannins and
flavonoid glycosides (Lin and Hsu, 1999; Lin et al., 2000).
Among them, gallic acid, corilagin, ellagic acid and rutin
showed in vitro antibacterial activity (Adesina et al., 2000;
Basile et al., 2000; Thiem and Goslinska, 2004).
No previous reports on the antibacterial activity of the
other species could be found in literature. Flavonol glyco-
sides were isolated from aerial parts of Brunfelsia grandi-
flora (Brunner et al., 2000) and some of these structures are
known to be responsible for antibacterial activity of higher
plants (Yadava and Reddy, 1998; Cui et al., 2003). Pods of
Caesalpinia spinosa contain up to 25% of gallic acid (Galvez
312 P. Kloucek et al. / Journal of Ethnopharmacology 99 (2005) 309–312
et al., 1997) and previously this tannin isolated from Acalypha
wilkesiana, Acalypha hispida and Rubus ulmifolius showed
in vitro antimicrobial activity when tested against B. cereus,
Staphylococcus aureus, and Escherichia coli (Adesina et al.,
2000; Panizzi et al., 2002). Among the classes of compounds
identified in Uncaria tomentosa (Montoro et al., 2004), an-
tibacterial activity is attributed to some triterpenes (Akbar
and Malik, 2002).
From nine plants, eight showed antimicrobial properties
(89%), which confirm their popular use and justify the eth-
nobotanical approach in the search for novel biologically ac-
tive compounds. For five of them this is the first report of
such activity. Among the medicinal plants tested in this work,
Phyllanthus amarus and Terminalia catappa showed the most
promising antibacterial properties, indicating the potential for
discovery of antibacterial principles. We assume that some
of the previously isolated compounds could be present in
the extracts investigated and could partially contribute to an-
timicrobial activity reported in this study. However, further
phytochemical studies are required to determine the types of
compounds responsible for the antibacterial effects of these
species.
Acknowledgements
This work was supported by projects 80/03-06/MZe/B and
GACR 523/03/H076.
References
Adesina, S.K., Idowu, O., Ogundaini, A.O., Oladimeji, H., Olugbade,
T.A., Onawunmi, G.O., Pais, M., 2000. Antimicrobial constituents of
the leaves of Acalypha wilkesiana and Acalypha hispida. Phytotherapy
Research 14, 371–374.
Akbar, E., Malik, A., 2002. Antimicrobial triterpenes from Debregeasia
salicifolia. Natural Product Letters 16, 339–344.
Basile, A., Sorbo, S., Giordano, S., Ricciardi, L., Ferrara, S., Montesano,
D., Cobianchi, R.C., Vuotto, M.L., Ferrara, L., 2000. Antibacterial and
allelopathic activity of extract from Castanea sativa leaves. Fitoterapia
71, 110–116.
Brunner, G., Burger, U., Castioni, P., Kapetanidis, I., Christen, P., 2000. A
novel acylated flavonol glycoside isolated from Brunfelsia grandiflora
ssp. grandiflora. Structure elucidation by gradient accelerated NMR
spectroscopy at 14T. Phytochemical Analysis 11, 29–33.
Cui, G.Y., Liu, J.Y., Tan, R.X., 2003. A new antimicrobial flavonol glyco-
side from Alchornea davidii. Chinese Chemical Letters 14, 179–180.
Desmarchelier, C., Schaus, F.W., 2000. Sixty medicinal plants from the
Peruvian Amazon, 1st ed. Lima, Peru, pp. 81–243 (privately pub-
lished).
Duke, J.A., Reed, C.F., 1981. Caesalpinia spinosa (Mol.) Ktz. In: Duke,
J.A. (Ed.), Handbook of Legumes of World Economic Importance.
Plenum Press, New York, USA, pp. 32–33.
Foo, L.Y., 1993. Amariin, a di-dehydrohexahydroxydiphenoyl hydrolyz-
able tannin from Phyllanthus amarus. Phytochemistry 33, 487–491.
Galvez, J.M.G., Riedl, B., Conner, A.H., 1997. Analytical studies on tara
tannins. Holzforschung 51, 235–243.
Gohar, A.A., Lahloub, M.F., Niwa, M., 2003. Antibacterial polyphe-
nol from Erodium glaucophyllum. Zeitschrift fur Naturforschung 58,
670–674.
Goun, E., Cunningham, G., Chu, D., Nguyen, C., Miles, D., 2003. An-
tibacterial and antifungal activity of Indonesian ethnomedical plants.
Fitoterapia 74, 592–596.
Jorgensen, J.H., Turnidge, J.D., Washington, J.A., 1999. Antibacterial sus-
ceptibility tests: dilution and disk diffusion methods. In: Murray, P.R.,
Baron, E.J., Pfaller, M.A., Tenover, F.C., Yolken, R.H. (Eds.), Manual
of Clinical Microbiology, 7th ed. ASM Press, Washington, DC, pp.
1526–1543.
Lemos, G.C.S., Oliveira, L.O., Eberli, B.B., Motta, O.V., Folly, M.M.,
2000. Bactericidal activity of macela (Achyrocline satureioides (Lam.)
DC.) and jaborandi-falso (Piper aduncum L.) against strains of Staphy-
lococcus aureus isolated from subclinical bovine mastitis. Revista
Brasileira de Plantas Medicinais 3, 67–72.
Lentz, D.L., Clark, A.M., Hufford, C.D., Meurer-Grimes, B., Passreiter,
C.M., Cordero, J., Ibrahimi, O., Okunade, A.L., 1998. Antimicrobial
properties of Honduran medicinal plants. Journal of Ethnopharmacol-
ogy 63, 253–263.
Lin, T.C., Hsu, F.L., 1999. Tannin and related compounds from Terminalia
catappa and Terminalia parviflora. Journal of the Chinese Chemical
Society 46, 613–618.
Lin, Y.L., Kuo, Y.H., Shiao, M.S., Chen, C.C., Ou, J.C., 2000. Flavonoid
glycosides from Terminalia catappa L. Journal of the Chinese Chem-
ical Society 47, 253–256.
Maia, J.G.S., Zohhbi, M.D.B., Andrade, E.H.A., Santos, A.S., da Silva,
M.H.L., Luz, A.I.R., Bastos, C.N., 1998. Constituents of the essential
oil of Piper aduncum L. growing wild in the Amazon region. Flavour
and Fragrance Journal 13, 269–272.
Montoro, P., Carbone, V., Quiroz, J.D., De Simone, F., Pizza, C., 2004.
Identification and quantification of components in extracts of Uncaria
tomentosa by HPLC-ES/MS. Phytochemical Analysis 15, 55–64.
Nair, M.G., Burke, B.A., 1990. Antimicrobial Piper metabolite and re-
lated compounds. Journal of Agricultural and Food Chemistry 38,
1093–1096.
Okunade, A.L., Hufford, C.D., Clark, A.M., Lentz, D., 1997. Antimicro-
bial properties of the constituents of Piper aduncum. Phytotherapy
Research 11, 142–144.
Orjala, J., Erdelmeier, C.A.J., Wright, A.D., Rali, T., Sticher, O., 1993. 5
new prenylated p-hydroxybenzoic acid-derivatives with antimicrobial
and molluscicidal activity from Piper aduncum leaves. Planta Medica
59, 546–551.
Orjala, J., Wright, A.D., Behrends, H., Folkers, G., Sticher, O., Ruegger,
H., Rali, T., 1994. Cytotoxic and antibacterial dihydrochalcones from
Piper Aduncum. Journal of Natural Products 57, 18–26.
Panizzi, L., Caponi, C., Catalano, S., Cioni, P.L., Morelli, I., 2002.
In vitro antimicrobial activity of extracts and isolated constituents
of Rubus ulmifolius. Journal of Ethnopharmacology 79, 165–
168.
Pawar, S.P., Pal, S.C., 2002. Antimicrobial activity of extracts of Termi-
nalia catappa root. Indian Journal of Medical Sciences 56, 276–278.
Pino, J.A., Marbot, R., Bello, A., Urquiola, A., 2004. Essential oils of
Piper peltata (L.) Miq. and Piper aduncum L. from Cuba. Journal of
Essential Oil Research 16, 124–126.
Plowman, T., 1977. Brunfelsia in ethnomedicine. Botanical museum
leaflets 25, 289–320.
Schultes, R.E., Raffauaf, R.F., 1990. The healing forest. Dioscorides press,
Portland, USA, p. 484.
Srinivasan, D., Nathan, S., Suresh, T., Perumalsamy, P.L., 2001. Antimi-
crobial activity of certain Indian medicinal plants used in folkloric
medicine. Journal of Ethnopharmacology 74, 217–220.
Thiem, B., Goslinska, O., 2004. Antimicrobial activity of Rubus chamae-
morus leaves. Fitoterapia 75, 93–95.
Tirillini, B., Velasquez, E.R., Pellegrino, R., 1996. Chemical composi-
tion and antimicrobial activity of essential oil of Piper angustifolium.
Planta Medica 62, 372–373.
Yadava, R.N., Reddy, K.I.S., 1998. A new big-active flavonol glycoside
from the stems of Butea superba Roxb. Journal of Asian Natural
Products Research 1, 139–145.