Case Endocrinol Metab 2014;29:195-201

http://dx.doi.org/10.3803/EnM.2014.29.2.195
Report pISSN 2093-596X · eISSN 2093-5978

A Novel PHEX Gene Mutation in a Patient with Sporadic

Hypophosphatemic Rickets
Yea Eun Kang1, Jun Hwa Hong2, Jimin Kim1, Kyong Hye Joung1, Hyun Jin Kim1, Bon Jeong Ku1, Koon Soon Kim1
1
Research Center for Endocrine and Metabolic Diseases, Department of Internal Medicine, Chungnam National University
School of Medicine, Daejeon; 2Department of Internal Medicine, Kyungpook National University Hospital, Daegu, Korea

Phosphate regulating gene with homologies to endopeptidases on the X-chromosome (PHEX) is a common cause of X-linked
hypophosphatemic (XLH) rickets. Diverse PHEX gene mutations have been reported; however, gene mutations in sporadic rick-
ets are less common than in XLH rickets. Herein, we describe a 50-year-old female patient with sporadic hypophosphatemic rick-
ets harboring a novel splicing-site mutation in the PHEX gene (c.663+1G>A) at the exon 5-intron 5 boundary. The patient had
recently suffered from right thigh pain and an aggravated waddling gait. She also presented with very short stature, generalized
bone pain, and muscle weakness. Despite low serum phosphate levels, her phosphate reabsorption rate was lower than normal.
Additionally, her 1,25-dihydroxyvitamin D3 concentration was lower than normal, although FGF23 level was normal. After treat-
ment with alfacalcidol and elemental phosphate, her rachitic symptoms subsided, and callus formation was observed in the frac-
ture site on the right femur.

Keywords: Phosphate regulating gene with homologies to endopeptidases on the X-chromosome; Rickets, hypophosphatemic;
Fibroblast growth factor 23

INTRODUCTION and sporadic hypophosphatemic rickets [6].

Hypophosphatemic rickets consists of inherited and acquired
forms, which share common pathophysiology and clinical fea-
tures [1]. In hereditary cases, X-linked hypophosphatemic
rickets (XLH) with inactivating mutations of the phosphate
regulating gene with homologies to endopeptidases (PHEX)
gene is the most common [2]. Autosomal dominant hypophos-
phatemic rickets and autosomal recessive hypophosphatemic
rickets have also been reported [3,4]. Acquired hypophospha-
temic rickets includes tumor-induced osteomalacia (TIO) [5]
 PHEX is located on the X chromosome at Xp22.1 [7]. PHEX
has been observed in cartilage, bone, and teeth osteoblasts [8]
and is thought to act on substrates that suppress phosphate ex-
cretion in the proximal renal tubule [9]. Recently, several mu-
tational analyses of the PHEX gene in XLH rickets and spo-
radic hypophosphatemic rickets reported deletion, insertion,
missense, nonsense, and splicing site mutations [10]. Here, we
present the first report of a new splicing-site PHEX gene mu-
tation in a Korean patient with sporadic hypophosphatemic
rickets.

Received: 19 April 2013, Accepted: 27 June 2013
Corresponding author: Koon Soon Kim
Research Center for Endocrine and Metabolic Diseases, Department of Internal
Medicine, Chungnam National University Hospital, Chungnam National
University School of Medicine, 282 Munhwa-ro, Jung-gu, Daejeon 301-721,
Korea
Tel: +82-42-280-7134, Fax: +82-42-280-7995, E-mail: kunsunkim@naver.com
Copyright © 2014 Korean Endocrine Society
This is an Open Access article distributed under the terms of the Creative Com­
mons Attribution Non-Commercial License (http://creativecommons.org/
licenses/by-nc/3.0/) which permits unrestricted non-commercial use, distribu­
tion, and reproduction in any medium, provided the original work is properly
cited.

www.e-enm.org  195
 Kang YE, et al.
CASE REPORT
A 50-year-old woman visited the hospital for evaluation of
right thigh pain. She had recently suffered from generalized
bone pain and generalized weakness, which were aggravated
after a fall 6 months prior. Additionally, her waddling gait had
worsened. She was born at full term, and her body weight and
height were within normal ranges at birth. She had short stat-
ure and difficulty in walking when she was a teenager but was
not referred to the Department of Pediatrics for evaluation or
treatment because she experienced no pain or weakness at that
time. She had very short stature (129 cm, just below the 10th
percentile for her age) and bowing leg deformities. She was
born from healthy parents of normal heights. Her daughter and
son have normal stature (her daughter is 160 cm and her son is
180 cm), and the rest of her family is healthy. DNA samples of
the family were not available.
  She presented with hypophosphatemia 2.0 mg/dL (normal
range, 2.5 to 4.7). Her measured serum calcium level was 9.0
mg/dL (normal range, 8.7 to 10.6), alkaline phosphatase was
elevated (139 IU/L; normal range, 42 to 98), parathyroid hor-
mone was 45.68 pg/mL (normal range, 10.00 to 65.00), 25-hy-
droxyvitamin D3 was 11.10 ng/mL (normal range, 10.00 to
30.00), and 1,25-dihydroxyvitamin D3 was 21.6 pg/mL (nor-
mal range, 25.1 to 66.1). Nephrologic evaluation demonstrated
normal diuresis (1,000 mL/24 hours) and normal renal func-
tion (estimated glomerular filtration rate of 95 mL/min/1.73
m2). The tubular reabsorption rate of phosphate was 81% (nor-
mal range, 80 to 100). The maximum tubular capacity of phos-
phate per unit volume of glomerular filtrate was decreased to
0.51 mM (normal range, 0.88 to 1.42 for her age group),
which revealed insufficient reabsorption of phosphorus in the
kidneys. We also evaluated her serum fibroblast growth factor
23 (FGF23) level using sandwich enzyme-linked immunosor-
bent assay (ELISA) and found it was 109 RU/mL (normal
range, <189 for her age group). The interindividual coefficient
of variation (CV) for this ELISA assay is 3.8% to 6.4%, and
the intraindividual CV is 2.5% to 6.1%.
  Her plain radiograph presented diffuse bowing deformities
in the upper and lower extremities and osteoporotic changes in
the extremities, spine, and pelvis. There was a right subtro-
chanteric fracture that included the cortex of one long bone. If
she had preferred surgery, it might have been possible. How-
ever, the symptoms were not severe, and she could walk by
herself without orthoses. Furthermore, multiple pseudofrac-
ture lines were also observed in the right proximal femur, left
196 www.e-enm.org
iliac bone, and proximal shaft of the both fibulas with antero-
lateral bowing (Fig. 1). Dual energy X-ray absorptiometry
measurement showed that the mean bone mineral density in
the lumbar spine (L1 to L4) was 0.845 g/cm2, and that in the
femoral neck was 0.661 g/cm2, resulting in T-scores of –2.7
and –2.3, respectively. After obtaining informed consent from
the patient, genomic DNA was extracted from peripheral
blood leukocytes using QuickGene Blood kit (Fujifilm, To-
kyo, Japan). For PHEX gene analyses, all 22 exons and exon-
intron junctions of the PHEX gene were amplified using poly-
merase chain reaction (PCR) with the appropriate primers (Ta-
ble 1). Subsequently sequence analyses were performed with
BigDye terminator version 3.1 (Applied Biosystems, Foster
City, CA, USA) and the same primers used for PCR amplifi-
cation. We found a novel splicing mutation in the exon 5-in-
tron 5 boundary of PHEX, a heterozygote of the c.663+1G>A
variation, which had not been previously reported (Fig. 2).
  In chromosomal analyses of 20 cells in metaphase which
were performed using 72-hour culture and G banding stain of
peripheral blood, mosaicism for trisomy X, and tetrasomy X
were unusually expressed. We investigated serum tumor mark-
ers and whole body bone scintigraphy using Tc-99m hydroxy
methylene diphosphonate (Fig. 3) to identify neoplastic le-
sions and found no evidence of TIO.
  The patient was treated using alfacalcidol and elemental
phosphate (Joulie’s solution; 10 mL of 4.9 mmol phosphate in
1 mL water) four times a day. After 22 days of outpatient care,
her measured serum phosphate level increased to 3.6 mg/dL
(normal range, 2.5 to 4.7), alkaline phosphatase decreased to
124 IU/L (normal range, 42 to 98), and her generalized bone
pain was decreased to allow daily walking. In addition, follow
up X-ray findings of her right femur showed improved frac-
ture union (Fig. 4).
DISCUSSION
XLH is the main cause of hypophosphatemic rickets. The gene
that causes XLH was identified on Xp22.1, which was found
to be PHEX [7]. Although a physiologically relevant PHEX
function has not been established, several recent studies indi-
cate that PHEX inactivates a phosphaturic hormone, such as
FGF23, or interacts with membrane proteins that modulate
phosphorus activity [5]. FGF23 is a representative phosphato-
nin that stimulates the renal excretion of phosphate in its full-
length state by inhibiting sodium-phosphate transport. Physio-
logically, FGF23 is inactivated by cleavage at the potential
Copyright © 2014 Korean Endocrine Society
 PHEX Mutation in a Patient with Rickets

Fig. 1. The plain films of the patient’s long bones. Both humeri, femurs, tibias, and fibulas show anterolateral bowing. The arrow indi-
cates the fracture line on the right metaphysis of the femur.

recognition/cleavage sites for the enzymes of the proprotein
convertase family (RXXR motif) [11]. Elevated circulating
levels of FGF23 were observed in autosomal dominant hypo-
phosphatemic rickets of RXXR motif mutation and also in
XLH and TIO [3]. In XLH, an elevated FGF23 level is fre-
quently observed in association with hypophosphatemia.
Therefore, some authors have suggested that PHEX controls
the inactivation of FGF23, and PHEX gene mutations, such as
loss of function mutations, increase the circulating level of
FGF23 [12]. In in vitro experiments, a furin-like enzyme
cleaved FGF23, not directly mediated by PHEX using the Hyp
mouse that is homologous to XLH. However, PHEX inactiva-

Copyright © 2014 Korean Endocrine Society www.e-enm.org  197

 Kang YE, et al.

Table 1. Sequences of Primers for Polymerase Chain Reaction

Normal
Splicing donor site
Sense (5’-to-3’) Antisense (5’-to-3’)
Exon1 ttagtagaagagcaagaaagcc ctgtgttatgacaagttttgct
Exon2 tcaaatatcttgcgtatgtttc tcaaaattgcatttcgtactt
Exon3 ttgttgtttaatttggaaaaga gcatggtagttaaaaagtgaga
Exon4 ggaggttggaattgtgattat gaattcttagtagttctcttcttcct
Patient
Exon5 gcacttaaattctagtgtgctg tatttcactaaggcagcatga
Exon6 atggtgacatgagctcaaaata acactgctcatttccaataaa
Exon7 ctacctgctattttctgctctt tcattcaggatatactgccttt
Exon8 aatactatgcagatgttttggc caagactgagagcaggttttac
Exon9 tgaaatcaaaagaaatgaatga agttttcaaaggatgtgagaag c.663+1G>A, heterozygote
Exon10 ctgtttctctcaagatgttctg ccctgtctaatccctaaagatg
Fig. 2. Partial genomic DNA sequence of the PHEX gene. A het-
Exon11 agactgttttcttcaggttgtt acaatacccacaggccactac
erozygote mutation within the splicing donor site, c.663+1G>A
Exon12 taaagagtcatttctcatgcaa tatgtattcatccaaaagcaga was found in the boundary of exon 5 and intron 5 on the PHEX
Exon13 ttcagtaaatggagttttcagat atcaccagttttaattgctagg gene.
Exon14 ccttcctatgctgaagtatttt tactctgacttgaggggaatta
Exon15 cattgttccatgttatctgcta aatgtcttaccctccatcatag matrix extracellular phosphorglycoprotein (MEPE), and fibro-
Exon16 ggtctttgaaacctcagtgtta ttctttctgctgaataaccttt blast growth factor 7 (FGF7). Especially, MEPE transcripts are
Exon17 ctagaaagcagtttatcttggc atcttcaagctatgatgctgc increased in Hyp mice, which have poorly mineralizing bone
Exon18 ctgttatgactgctttttgaag acagatgctgttgatcttgtaa [15]. An in vitro study reported that cathepsin B-dependent
Exon19 ttgctataatattgatgcctctt ttccataatatctaactaactaactcc cleavage is suppressed by PHEX; therefore, MEPE and FGF
Exon20 cgtggcaggagtatatatttg tttgtttgaaatctttctttga have been reported as important phosphatonins affecting phos-
Exon21 ggttctaaaattgttcctcagt tttttcagatcacctatctggt phate homeostasis and skeletal mineralization [16]. In our case,
Exon22–23 agcaatattctgctacagtttt gtctccaggcctaaagcaat there is a possibility that another phosphatonin may have led to
Primers were designed with primer 3 web version 4.0 served from the resulting rickets phenotype. However, our study is limited
Whitehead Institute (http://primer3.wi.mit.edu/) using sequences from in that we did not measure the levels of the other factors like
GenBank accession number of NT_167197.1.
MEPE.
  Several studies have identified genotype-phenotype correla-
tion resulted in a tendency to increase FGF23 level in a mouse tions of the PHEX gene in hypophosphatemic rickets. In geno-
model. Although FGF23 is not a direct substrate of PHEX, the type-phenotype analyses of Korean patients with hypophos-
PHEX gene might be associated with FGF23 expression [13]. phatemic rickets, there was no genotype-phenotype correlation,
In our case, normal level of FGF23 and a lower than normal even though skeletal disease is more severe in C-terminal mu-
tubular reabsorption rate of phosphate might contribute to the tations compared to N-terminal mutations [17]. Remarkably, a
late onset of rachitic symptoms, including generalized bone novel PHEX mutation was discovered in the C terminus of
pain and muscle weakness, despite PHEX gene mutation. In exon 5 here, but the rachitic symptoms were less severe com-
the renal phosphate wasting state, an elevated FGF23 level is pared to other hypophosphatemic rickets diagnosed in child-
frequently found. Although the relationship of elevated FGF23 hood or adolescence. The patient did not suffer from bone pain
with PHEX mutation was not elucidated, most hypophospha- or gait disturbance until middle age.
temic rickets present with elevated FGF23. However, Jonsson   In previous cases, 124 sporadic mutations of PHEX gene
et al. [12] reported elevated FGF23 levels in 13 of 21 patients. have been reported (online PHEX mutation data base; http://
Therefore, not all patients with hypophosphatemic rickets www.phexdb.mcgill.ca), and 22 of them are splicing muta-
have elevated FGF23. In normal adults and children, the tions. Table 2 summarizes four splicing mutations in some of
FGF23 levels were definitely normal [12]. Shaikh et al. [14] the previous cases [6,10,18,19]. As shown in the Table 2, muta-
suggested other circulating factors controlling phosphorous tion site does not correlate with disease severity. In one case,
metabolism such as secreted frizzled-related protein (sFRP-4), even though serum FGF23 was elevated to 2,430 pg/mL, the

198 www.e-enm.org Copyright © 2014 Korean Endocrine Society

 PHEX Mutation in a Patient with Rickets

RT ELBOW IV
ANT POST

Fig. 3. Whole body bone scan of the patient. A hot spot was found in the right femur fracture site and also in multiple pseudofractures in
both lower extremities.

patient had normal height and no bone fractures, and the maxi-
Rt. Rt.
mum tubular reabsorptive rate of phosphate decreased to 0.41
mmol/L. In addition, the patient showed a mild phenotype un-
related to FGF23 level, as in our case [10]. Based on these re-
sults, we hypothesized that C-terminal splicing mutations of
PHEX could represent mild clinical phenotypes.
  The case we report is also a sporadic gene mutation case
that is expressed by a novel splicing mutation (c.663+1G>A)
in the exon 5 and intron 5 junction. The radiologic and labora-
tory findings of the patient were reviewed to exclude TIO, and
this is the first sporadic case reported with a splicing site mu-
tation in exon 5 of PHEX and a normal FGF23 level. Although
morphologic changes including short stature, leg bowing, and
waddling gait were found at an early age, the rachitic symp-
toms were initiated by a traumatic event (falling down) in
At visit After 2 months
middle age. After treatment with alfacalcidol and elemental
Fig. 4. After 2 months of alfacalcidol and elemental phosphate phosphate, the rachitic symptoms subsided.
treatment, callus formation was observed in the fracture site on   In conclusion, we have identified a novel splicing site muta-
the right femur metaphysis. tion in the PHEX gene in a Korean patient with sporadic hypo-

Copyright © 2014 Korean Endocrine Society www.e-enm.org  199

 Kang YE, et al.

Table 2. Summary of Splicing Mutations of PHEX in Patients with Sporadic Hypophosphatemic Rickets
Case no. DNA Codon change Clinical phenotype Biochemical phenotype Reference
1 c.118+1g>a Splice donor Rickets, height deficiency: –3.76 SD (16 years), Hypophosphatemia [18]
–4.55 SD (18 years)
2 c.118+1G>A Loss of entire Leg deformities, height deficiency –3.76 SD Hypophosphatemia [19]
protein
3 c.2148-1G>T Splice acceptor Male, 23 years, normal height 175 cm (-0.6 SD), skeletal and Serum FGF23 2,430 pg/mL, [10]
dental phenotype, 3 HPT surgical removal of 3.5 parathyroid Hypophosphatemia, TmP/
glands, impaired renal function. No fractures, GFR 0.41 mmol/L
DXA: spine Z-score 1.7 SD
4 c.1483-2A>G Splice acceptor Female, 11 years, inability to walk, bowing of legs Hypophosphatemia [6]

SD, standard deviation; HPT, height for piston-type imbibition in throat; DXA, dual-energy X-ray absorptionetry; FGF, fibroblast growth factor;
TmP/GFR, the maximum tubular reabsorptive rate of phosphate.

phosphatemic rickets. Our results indicate that the inactivating
PHEX mutation contributes to hypophosphatemia, but is not
related to FGF23. Showing a novel mutation in exon 5, these
data will provide an opportunity for further analyses of the
genotype-phenotype association.
CONFLICTS OF INTEREST
No potential conflict of interest relevant to this article was re-
ported.
ACKNOWLEDGMENTS
This work was supported by Daejeon Geriatric Medical Cen-
ter of Chungnam National University Hospital Research Fund
2011.
REFERENCES
1. Rajah J, Thandrayen K, Pettifor JM. Clinical practice: diag-
nostic approach to the rachitic child. Eur J Pediatr 2011;
170:1089-96.
2. The HYP Consortium. A gene (PEX) with homologies to
endopeptidases is mutated in patients with X-linked hypo-
phosphatemic rickets. Nat Genet 1995;11:130-6.
3. ADHR Consortium. Autosomal dominant hypophospha-
taemic rickets is associated with mutations in FGF23. Nat
Genet 2000;26:345-8.
4. Lorenz-Depiereux B, Bastepe M, Benet-Pages A, Amyere
M, Wagenstaller J, Muller-Barth U, Badenhoop K, Kaiser
SM, Rittmaster RS, Shlossberg AH, Olivares JL, Loris C,
Ramos FJ, Glorieux F, Vikkula M, Juppner H, Strom TM.
DMP1 mutations in autosomal recessive hypophosphate-
mia implicate a bone matrix protein in the regulation of
phosphate homeostasis. Nat Genet 2006;38:1248-50.
5. Bowe AE, Finnegan R, Jan de Beur SM, Cho J, Levine
MA, Kumar R, Schiavi SC. FGF-23 inhibits renal tubular
phosphate transport and is a PHEX substrate. Biochem
Biophys Res Commun 2001;284:977-81.
6. Durmaz E, Zou M, Al-Rijjal RA, Baitei EY, Hammami S,
Bircan I, Akcurin S, Meyer B, Shi Y. Novel and de novo
PHEX mutations in patients with hypophosphatemic rick-
ets. Bone 2013;52:286-91.
7. Grieff M, Mumm S, Waeltz P, Mazzarella R, Whyte MP,
Thakker RV, Schlessinger D. Expression and cloning of
the human X-linked hypophosphatemia gene cDNA. Bio-
chem Biophys Res Commun 1997;231:635-9.
8. Ruchon AF, Marcinkiewicz M, Siegfried G, Tenenhouse
HS, DesGroseillers L, Crine P, Boileau G. Pex mRNA is
localized in developing mouse osteoblasts and odonto-
blasts. J Histochem Cytochem 1998;46:459-68.
9. Lajeunesse D, Meyer RA Jr, Hamel L. Direct demonstra-
tion of a humorally-mediated inhibition of renal phosphate
transport in the Hyp mouse. Kidney Int 1996;50:1531-8.
10. Beck-Nielsen SS, Brixen K, Gram J, Brusgaard K. Muta-
tional analysis of PHEX, FGF23, DMP1, SLC34A3 and
CLCN5 in patients with hypophosphatemic rickets. J Hum
Genet 2012;57:453-8.
11. Shimada T, Mizutani S, Muto T, Yoneya T, Hino R, Takeda
S, Takeuchi Y, Fujita T, Fukumoto S, Yamashita T. Cloning
and characterization of FGF23 as a causative factor of tu-
mor-induced osteomalacia. Proc Natl Acad Sci U S A 2001;
98:6500-5.
12. Jonsson KB, Zahradnik R, Larsson T, White KE, Sugimoto

200 www.e-enm.org Copyright © 2014 Korean Endocrine Society


T, Imanishi Y, Yamamoto T, Hampson G, Koshiyama H,
Ljunggren O, Oba K, Yang IM, Miyauchi A, Econs MJ,
Lavigne J, Juppner H. Fibroblast growth factor 23 in onco-
genic osteomalacia and X-linked hypophosphatemia. N
Engl J Med 2003;348:1656-63.
13. Liu S, Guo R, Simpson LG, Xiao ZS, Burnham CE, Quar-
les LD. Regulation of fibroblastic growth factor 23 expres-
sion but not degradation by PHEX. J Biol Chem 2003;278:
37419-26.
14. Shaikh A, Berndt T, Kumar R. Regulation of phosphate
homeostasis by the phosphatonins and other novel media-
tors. Pediatr Nephrol 2008;23:1203-10.
15. Argiro L, Desbarats M, Glorieux FH, Ecarot B. Mepe, the
gene encoding a tumor-secreted protein in oncogenic hy-
pophosphatemic osteomalacia, is expressed in bone. Ge-
nomics 2001;74:342-51.
Copyright © 2014 Korean Endocrine Society
PHEX Mutation in a Patient with Rickets
16. Guo R, Rowe PS, Liu S, Simpson LG, Xiao ZS, Quarles
LD. Inhibition of MEPE cleavage by Phex. Biochem Bio-
phys Res Commun 2002;297:38-45.
17. Song HR, Park JW, Cho DY, Yang JH, Yoon HR, Jung SC.
PHEX gene mutations and genotype-phenotype analysis of
Korean patients with hypophosphatemic rickets. J Korean
Med Sci 2007;22:981-6.
18. Sulek A, Poposka E, Rowe PS, Goulding J, Rowinska E,
Pronicka E. Molecular diagnosis of PEX gene mutations in
Polish patients with X-linked hypophosphatemic rickets.
Acta Med Litu 1998;5:64-7.
19. Popowska E, Pronicka E, Sulek A, Jurkiewicz D, Rowins-
ka E, Sykut-Cegielska J, Rump Z, Arasimowicz E, Kra-
jewska-Walasek M. X-linked hypophosphatemia in Polish
patients. 2. Analysis of clinical features and genotype-phe-
notype correlation. J Appl Genet 2001;42:73-88.
www.e-enm.org  201