Вы находитесь на странице: 1из 4

Gene expression and mutation- ILT

Resources to assist in completing this ILT

Intro to https://www.khanacademy.org/science/biology/gene-expression-central-
gene dogma/central-dogma-transcription/a/intro-to-gene-expression-central-
expression dogma

Stages of https://www.khanacademy.org/science/biology/gene-expression-central-
transcription dogma/transcription-of-dna-into-rna/a/overview-of-transcription

Pre-mRNA https://www.khanacademy.org/science/biology/gene-expression-central-
processing dogma/transcription-of-dna-into-rna/a/eukaryotic-pre-mrna-processing

Stages of https://www.khanacademy.org/science/biology/gene-expression-central-
translation dogma/translation-polypeptides/a/the-stages-of-translation

Anatomy of http://learn.genetics.utah.edu/content/basics/geneanatomy/
a gene

Transcription and Translation- answer the questions by filling in the relevant space in the
table on the next page. Use the resources provided and reading from the ebook.

 Starting molecule
 Key enzyme(s)/ cellular machinery
 Initiation
- What is the name of the gene region that is recognised?
- What recognises the region/sequence?
- What is the first reaction that is performed?
- What aspects of this step are crucial to its success?
 Elongation
- What reaction is catalysed during this step?
- What type of chemical bond is formed?
- Termination
- What signals termination?
- What happens to the starting molecule after termination?
 End product
- What is it and how does it differ from the starting molecule?
- Is there more than one type of product that can be produced?
- Are there any additional steps or changes to final product? If so, why?
 Key differences between Prokaryotes and Eukaryotes
 Extension Q: What would be the impact on an error that occurs during this
process?
Transcription Translation

Starting molecule

Key enzyme(s)/ cellular


machinery

Initiation

Elongation

Termination

End product

Key differences between


Prokaryotes and Eukaryotes

Extension Q:
What would be the impact on
an error that occurs during this
process?
Coding sequence question

The following sequence contains part of the GFP gene from jelly fish

5’ ATCGAATTCCTGCAGCCCCATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGT 3’
3’ TAGCTTAAGGACGTCGGGGTACCACTCGTTCCCGCTCCTCGACAAGTGGCCCCA 5’

The mRNA sequence is 5’ AUG GUG AGC AAG …..3’.

Identify the coding sequence for the GFP gene in the DNA sequence and label the template
and non-template strands.

Intron Splicing Question

The following is an pre-mRNA sequence that contains an intron to be spliced out.

5’ GGGCCGCUCCGACUCUCCUCCUCUUACUCCAGGUAUGUUUUUAUCGAUGUCACGGGAGCA
GUAUUUAUCCACCCGCCCUCACUCACAACCAACUCCUCC 3’

The intron sequence starts with GUAUGU and ends with GGAGCAG

Indicate the Exon-Intron boundaries and show how the exons would be joined together in
the mature mRNA.

Practice at using the genetic code

Use the single letter amino acid abbreviations (i.e. Methionine =M) to spell a word from the
following sequences

• Sequence 1- mRNA
– 5’ AUG GCC GGU AAU AUC UUU AUA UGC GAG AAC ACA UAA 3’

• Sequence 2- template strand of a DNA


– 5’ TCA AGT TGC TTC CCG CCC 3’
Mutation Problem

Loss or addition of nucleotides- underlined nucleotides are deleted or inserted


Work out the mRNA and amino acid sequence for each of the pairs of wild-type and mutant
sequences provided.
What (if any) are the differences between the wild-type and mutant sequences?
Do you think that there are the same consequences on gene function for mutation #1 and
#2?

#1Wild-type 5'- ATG TGC GAT AGC TAC CTA GTC TAA -3’
3'- TAC ACG CTA TCG ATG GAT CAG ATT -5'

#1 Mutant 5'- ATG TGC TAC CTA GTC TAA -3'


3'- TAC ACG ATG GAT CAG ATT-5

#2Wild-type 5'- ATG TGC GAT AGC TAC CTA GTC TAA -3
3'- TAC ACG CTA TCG ATG GAT CAG ATT -5'

#2 Mutant 5'- ATG TGC GAT AGC TCA GGT ACC TAG TCT AA -3'
3'- TAC ACG CTA TCG AGT CCA TGG ATC AGA TT -5'