Tips - Inducible Gene Expression in Plants PDF

00 Inducible Gene prelims 3/9/99 11:59 AM Page i
INDUCIBLE GENE EXPRESSION IN PLANTS

00 Inducible Gene prelims 3/9/99 11:59 AM Page ii
00 Inducible Gene prelims 3/9/99 11:59 AM Page iii
Inducible Gene Expression in Plants
Edited by
P.H.S. Reynolds
Ministry of Research, Science and Technology
PO Box 5336
Wellington
New Zealand
Formerly at:
The Horticulture and Food Research Institute of New Zealand
Palmerston North
New Zealand
CABI Publishing
00 Inducible Gene prelims 3/9/99 11:59 AM Page iv
CABI Publishing is a division of CAB International
CABI Publishing CABI Publishing

CAB International 10 E 40th Street
Wallingford Suite 3203
Oxon OX10 8DE New York, NY 10016
UK USA
Tel: +44 (0)1491 832111 Tel: +1 212 481 7018
Fax: +44 (0)1491 833508 Fax: +1 212 686 7993
Email: cabi@cabi.org Email: cabi-nao@cabi.org
© CAB International 1999. All rights reserved. No part of this publication

may be reproduced in any form or by any means, electronically, mechanically, by
photocopying, recording or otherwise, without the prior permission of the
copyright owners.
A catalogue record for this book is available from the British Library, London, UK.
Library of Congress Cataloging-in-Publication Data

Inducible gene expression in plants / edited by P.H.S. Reynolds.
p. cm.
Includes bibliographical references and index.
ISBN 0–85199–259–5 (alk. paper)
1. Plant genetic regulation. 2. Plant gene expression.
I. Reynolds, P. H. S. (Paul H. S.)
QK981.4.I558 1998
572.89652––dc21 98–25843
CIP
ISBN 0 85199 259 5
Typeset in 10/12pt Photina by Columns Design Ltd, Reading.

Printed and bound in the UK at the University Press, Cambridge.
00 Inducible Gene prelims 3/9/99 11:59 AM Page v
Contents
Contributors vii
1 Inducible Control of Gene Expression: an Overview 1
P.H.S. Reynolds
2 Use of the TN10-encoded Tetracycline Repressor to Control
Gene Expression 11
C. Gatz
3 Ecdysteroid Agonist-inducible Control of Gene Expression in 23
Plants
A. Martinez and I. Jepson
4 Glucocorticoid-inducible Gene Expression in Plants 43
T. Aoyama
5 Tissue-specific, Copper-controllable Gene Expression in Plants 61
V.L. Mett and P.H.S. Reynolds
6 Nitrate Inducibility of Gene Expression Using the Nitrite 83
Reductase Gene Promoter
S.J. Rothstein and S. Sivasankar
7 Use of Heat-shock Promoters to Control Gene Expression 97
in Plants
R.T. Nagao and W.B. Gurley
8 Wound-inducible Genes in Plants 127
L. Zhou and R. Thornburg
v
00 Inducible Gene prelims 3/9/99 11:59 AM Page vi
vi Contents
9 Developmental Targeting of Gene Expression by the Use of a 169

Senescence-specific Promoter
S. Gan and R.M. Amasino
10 Abscisic Acid- and Stress-induced Promoter Switches in the 187
Control of Gene Expression
Q. Shen and T.-H.D. Ho
11 Potential Use of Hormone-responsive Elements to Control 219
Gene Expression in Plants
T.J. Guilfoyle and G. Hagen
Index 237
00 Inducible Gene prelims 3/9/99 11:59 AM Page vii
Contributors
Richard M. Amasino, Department of Biochemistry, 420 Henry Mall,

University of Wisconsin, Madison, WI 53706-1569, USA.
Takashi Aoyama, Institute for Chemical Research, Kyoto University, Uji, Kyoto
611, Japan.
Susheng Gan, Tobacco and Health Research Institute and Department of
Agronomy, Cooper and University Drives, University of Kentucky,
Lexington, KY 40546-0236, USA.
Christiane Gatz, Albrecht von Haller Institut für Pflanzenwissenschaften,
Universität Göttingen, Untere Karspüle 2, 37073 Göttingen, Germany.
Tom J. Guilfoyle, University of Missouri, Department of Biochemistry, 117
Schweitzer Hall, Columbia, MO 62511, USA.
William B. Gurley, Department of Microbiology and Cell Science, University
of Florida, Gainesville, FL 32611, USA.
Gretchen Hagen, University of Missouri, Department of Biochemistry, 117
Schweitzer Hall, Columbia, MO 62511, USA.
Tuan-Hua David Ho, Plant Biology Program, Department of Biology, Division
of Biology and Biomedical Sciences, Washington University, St Louis, MO
63130, USA.
Ian Jepson, Zeneca Agrochemicals, Jealott’s Hill Research Station, Bracknell,
Berkshire RG42 6ET, UK.
Alberto Martinez, Zeneca Agrochemicals, Jealott’s Hill Research Station,
Bracknell, Berkshire RG42 6ET, UK.
Vadim L. Mett, Plant Improvement Division, The Horticulture and Food
Research Institute of New Zealand, Batchelar Research Centre, Highway
57, Private Bag 11030, Palmerston North, New Zealand.
vii
00 Inducible Gene prelims 3/9/99 11:59 AM Page viii
viii Contributors
Ronald T. Nagao, Botany Department, University of Georgia, Athens, GA

30602, USA.
Paul H.S. Reynolds, Plant Improvement Division, The Horticulture and Food
Research Institute of New Zealand, Batchelar Research Centre, Highway
57, Private Bag 11030, Palmerston North, New Zealand.
Steven J. Rothstein, Department of Molecular Biology and Genetics,
University of Guelph, Guelph, Ontario N1G 2W1, Canada.
Qingxi Shen, Monsanto Company, Mail Zone AA2G, 700 Chesterfield Village
Parkway, Chesterfield, MO 63198, USA.
Sobhana Sivasankar, Department of Molecular Biology and Genetics,
University of Guelph, Guelph, Ontario N1G 2W1, Canada.
Robert Thornburg, Department of Biochemistry and Biophysics, Iowa State
University, Ames, IA 50011, USA.
Lan Zhou, Department of Biochemistry and Biophysics, Iowa State University,
Ames, IA 50011, USA.
01 Inducible Gene 01 3/9/99 11:59 AM Page 1
Inducible Control of Gene

1
Expression: an Overview
Paul H.S. Reynolds
Plant Improvement Division, The Horticulture and Food

Research Institute of New Zealand, Batchelar Research
Centre, Highway 57, Private Bag 11030, Palmerston North,
New Zealand
There is considerable interest in the use of inducible systems for the expression
of genes introduced into plants, not only because they allow expression of genes
which may, for example, be developmentally lethal, but also because they allow
for controlled experiments to be performed in a true isogenic background. Such
systems also find use in the manipulation of levels of expression in order to
understand more fully individual gene function, or to provide a means for the
overproduction or deletion, by reverse genetics, of a particular gene product.
This is a rapidly developing area of plant molecular biological research. The
need for inducible expression systems is high, not only for their obvious use as
research tools, but also for their potential in the future in field-based systems for
the inducible expression of desired characters.
A wide range of promoter systems can be envisioned which could
potentially allow inducible control of genes introduced into plants. These could
be broadly described as falling into three general areas. Firstly, there are those
which rely on plant-based developmental processes. Such promoters could, for
example, include those regulated by plant hormones or which are otherwise
developmentally regulated. The advantage of such systems is clearly that all
components of the necessary signal transduction pathways are already present
in the plant. They also provide a means for the coordinated expression of a gene
product within a defined stage of plant growth and development.
The second group of promoter systems includes control sequences which
respond to particular environmental signals. These potential control systems
include heat-shock- and senescence-specific promoters, as well as systems
which are responsive to nutritional status. These sorts of promoter systems may
well be attractive for the controlled expression of characters in the field, as
opposed to the laboratory situation. This is because no application of specific
© CAB International 1999. Inducible Gene Expression
(ed. P.H.S. Reynolds) 1
2 P.H.S. Reynolds
inducers or defined conditions for growth are necessary, and the desired
expression of a gene at a particular growth stage of the plant could be ‘self-
regulating’.
The third group of control systems comprises those promoters which are
introduced from non-plant backgrounds. This includes animal hormone
receptor/activators, antibiotic resistance control mechanisms from bacteria and
promoters responsive to chemical inducers. Such systems require the
introduction of the appropriate transcription factor systems into the plant
background together with the inducible promoter. They have the potential
advantage that the signal transduction systems are therefore unique to the gene
which is being induced and allow timing of expression which is totally
independent from the timetable of plant processes and from plant transcription
factors.
CONTROL SYSTEMS FROM NON-PLANT BACKGROUNDS
The advantage offered by the use of control systems from non-plant sources to
be independent from plant processes also provides the disadvantage to their use
outside the laboratory. That is, they frequently require modified growth
conditions and/or the provision of specific inducers for their activation.
For example, the copper-controllable system (Mett et al., 1993, 1996) is
activated by copper levels commonly seen in the environment and so is not
amenable for use in the field. The tetracycline (Gatz et al., 1992; Weinmann et
al., 1994) and animal steroid hormone (Schena et al., 1991; Aoyama and Chua,
1997) systems require the provision of specific elicitors for their activation.
None the less these systems offer enormous potential in laboratory-based
studies to elucidate the roles of specific genes or to recover potentially lethal
signal transduction mutants. The increasing sophistication of plant cell culture
techniques and the emerging opportunities offered by the use of ‘plants as
factories’ suggests that such promoters will have an important role to play in
the commercial plant biotechnology of the future.
A recently reported system uses an ethanol-inducible gene switch which
may well be amenable to use in the field (Caddick et al., 1998). This system is
based on the alc regulator from Aspergillus nidulans, a self-contained genetic
system that controls cellular response to ethanol. The system developed for
expression in plants utilizes the AlcR transcription factor expressed constitutively,
together with the ‘gene of interest’ under the control of a promoter consisting of
the CaMV 35S RNA promoter TATA sequences fused to the AlcR binding sites
from the A. nidulans AlcA (alcohol dehydrogenase) promoter. Binding of the AlcR
transcription factor to the chimeric promoter is responsive to the inducer,
ethanol. In an experiment using the system with the chloramphenicol acetyl
transferase (CAT) reporter as the ‘gene of interest’, CAT protein was barely
detectable in the absence of ethanol. When ethanol was provided either by root
drenching as a 1% solution or by foliar spray, there was strong induction of CAT
Inducible Control of Gene Expression: an Overview 3
activity to 50% of that obtained in plants transformed with the CAT reporter
under control of the full CaMV 35S RNA promoter.
Four promoter systems utilizing transcriptional control systems from
outside the plant genome are reviewed here. These are the tetracycline
repressor (Chapter 2) and the copper-controllable promoter (Chapter 5)
systems. Chapters 3 and 4 discuss the use of mammalian nuclear receptor
systems in controlled expression of genes introduced into plants.
Use of the Tn10-encoded tetracycline repressor to control gene expression
In Gram-negative bacteria, the Tet repressor (TetR) negatively regulates

expression of the tetracycline resistance gene. Induction of this resistance gene
is mediated by tetracycline (tc) which binds to TetR and abolishes its DNA-
binding activity, thus relieving the repression.
This function of TetR is used in two ways to provide inducible expression in
plants.
1. TetR is used to repress plant gene expression. This is achieved by the
expression of the TetR gene in plants together with the ‘gene of interest’ under
control of a chimeric promoter which contains target operator sequences which
are bound by TetR about the TATA motif. Repression is relieved by providing tc
to plants and the gene of interest is then expressed.
2. TetR is used to activate plant gene expression. This is achieved by expressing
a fusion of TetR with the transcriptional activation domain of herpes simplex
virus protein VP16 together with the ‘gene of interest’ under the control of a
target promoter containing seven tet operators upstream of a minimal promoter.
In the absence of tc the TetR-activation fusion binds to the operator sequence
and is able to activate transcription. In the presence of tc the fusion protein no
longer binds and transcriptional activation is not favoured.
Ecdysteroid agonist-inducible control of gene expression in plants
A nuclear receptor functions both as a sensor for its ligand as well as a

transcription factor regulating the expression of target genes by binding to specific
DNA sequences. Nuclear receptors consist of at least four domains. The A/B and
D domains function in transactivation and nuclear targeting, respectively. The
DNA-binding (C) domain is the most conserved and consists of two zinc finger
structures which bind specific DNA sequences. The carboxyl terminal (E) domain
plays multiple roles in ligand binding, dimerization and transcriptional regulation.
This domain structure of the nuclear receptors make them ideal candidates for
engineering of novel receptors with unique behaviour. A low-background, high-
expression system has been developed based on the Heliothis ecdysteroid ligand-
binding domain and the glucocorticoid receptor transactivation and DNA-binding
domains.
4 P.H.S. Reynolds
This two component system consists of an ‘effector’ which comprises a

chimeric receptor containing the glucocorticoid receptor transactivation and
DNA-binding domains fused to the Heliothis ecdysteroid receptor ligand-
binding domain. The second ‘response’ component contains the ‘gene of
interest’ under control of a chimeric promoter with six copies of the gluco-
corticoid response element fused to a minimal CaMV 35S RNA promoter. In the
presence of a suitable ecdysone agonist the system is activated and transcrip-
tion of the ‘gene of interest’ is initiated from the chimeric promoter.
Glucocorticoid-inducible gene expression in plants
A novel glucocorticoid-inducible system which functions in transgenic plants has

been developed. It uses only the hormone-binding domain of the glucocorticoid
receptor protein as a regulatory domain in a chimeric transcription factor.
The chimeric transcription factor ‘GVG’ consists of the yeast GAL4 DNA-
binding domain, the transactivating domain of the herpes viral protein VP16
and the hormone-binding domain of the rat glucocorticoid receptor. This
chimeric protein strongly activates transcription of the ‘gene of interest’ from a
promoter which contains GAL4 upstream activating sequences only in the
presence of glucocorticoid.
Tissue-specific copper-controllable gene expression in plants
The copper-controllable system makes use of the yeast copper metallothionein

regulatory system. In Saccharomyces cerevisiae this consists of a constitutively
expressed metallo-responsive transcription factor, targeted to the nucleus,
which activates yeast metallothionein transcription. This activation is mediated
by copper ions which alter the conformation of the transcription factor
allowing it to bind its cognate binding site in the metallothionein promoter, thus
activating transcription.
This mechanism has been translated into a plant background in a system
in which there is constitutive expression of the ace1 gene and control of
expression of the ‘gene of interest’ from a chimeric promoter consisting of a
minimal promoter fused to the cognate binding site of the ACE1 transcription
factor. In the presence of copper ions the ACE1 protein is competent to bind the
chimeric promoter and so activate expression. Control over place of expression
is effected by controlling the site of expression of the transcription factor.
PLANT PROMOTER SYSTEMS RESPONSIVE TO ENVIRONMENTAL

SIGNALS
Plants survive in the environment without the ability to avoid many of its
rigours, unlike animals, who take shelter, hide or physically modify the
environment to enhance survival. This means that plants have developed a

wide range of mechanisms for defence against disease (Hammond-Kosack and
Jones, 1997; Sticher et al., 1997), insect or other predator attack (Green and
Ryan, 1972) and are able to respond to a wide range of chemical/nutritional
threats provided by the environment. An increasing number of gene regulation
systems which activate these processes have been elucidated and a number of
these systems can readily be used to control the expression of introduced genes.
Three systems amenable for use are described here in three review chapters
which identify a wide range of current and potential future mechanisms for the
control of gene expression by environmental signals. These are wound induci-
bility (Chapter 8), nutrient control of expression (specifically, nitrate inducibility,
Chapter 6), together with a discussion of the heat-shock response and its
applicability to inducible control of gene expression (Chapter 7).
Wound-inducible control of gene expression in plants
A wide range of plant genes are induced in response to wounding. This chapter
identifies classes of proteins produced and discusses the overall biochemical
processes important in the wound response. Mechanisms of gene activation of
seemingly unrelated proteins (the proteinase inhibitor genes of solanaceous
plants and the vegetative storage proteins), in response to wounding are also
examined.
Nitrate inducibility of gene expression using the nitrate reductase gene

promoter
The essential nutrient for plant growth, nitrate, is itself involved in the activation
of genes required for its assimilation. The nitrite reductase gene promoter has
been extensively studied and the promoter elements responsible for nitrate-
inducible expression have been identified. However, the mechanism of repression
by both glutamine and asparagine has not yet been elucidated, nor have
transcription factors binding identified sequence motifs important in nitrate
inducibility been cloned.
As more information becomes available and it is possible to construct
chimeric promoters, the possibility exists for nutritional status control of
expression to be obtained.
Use of heat-shock promoters to control gene expression in plants
Heat induction of gene expression depends on the presence of heat-shock

consensus elements in the promoter. There are three types of promoter: type A
are totally dependent on heat-shock transcription factor binding to heat-shock
6 P.H.S. Reynolds
elements (HSEs) in the promoter; type B promoters exhibit HSE-dependent

expression which is responsive to developmental signals under non-heat-shock
conditions; and type C promoters have multiple mechanisms of induction, only
one of which is dependent on HSEs.
Heat-shock promoters have been used to provide an inducible expression
system with which to answer a range of basic research questions from thermo-
tolerance (Lee and Schoffl, 1996) to the role of the T-6B oncogene of
Agrobacterium on plant growth and development (Tinland et al., 1992). Transient
heat induction has been shown to be sufficient to express an introduced gene.
Heat-shock promoters have been used in mutagenesis screens to isolate heat-
shock response regulatory mutants and to investigate the consequences of
expression of genes which are normally down-regulated during the heat-shock
response. There is a wide range of characterized heat-shock promoters available.
To successfully express a gene using an inducible heat-shock promoter requires
matching of the expression profile of the gene in question with the optimum
parameters desired for transgenic expression.
PROMOTER SYSTEMS BASED ON PLANT DEVELOPMENTAL PROCESSES
As more research is carried out in the area of development a greater under-

standing is being obtained of the genes which regulate these processes. The
explosion of information in plant vegetative (Taylor, 1997) and floral (Ma, 1998)
development will in the future provide elegant mechanisms for the targeted
expression of characters in the reproductive growth phase of plant development.
Continued research into the signalling mechanisms involved in plant–microbe
interactions (Hahn, 1996) will create a fertile hunting ground for potential new
inducible control systems. Recent research (Guilfoyle, 1997) has described
specific sequence elements in hormone-responsive promoters which will, in the
near future, allow the controlled expression of characters by endogenous
regulatory pathways. Other plant developmental processes such as organo-
genesis (for example, the development of the leguminous root nodule (Long,
1996)) and senescence (Gan and Amasino, 1997) offer characterized promoter
systems that are amenable for the controlled expression of introduced genes.
Three inducible promoter systems which allow the expression of genes
introduced into plants by developmental processes are covered. These are
senescence-specific promoters (Chapter 9), together with promoters responsive
to the plant hormones abscisic acid (ABA) (Chapter 10) and auxin (Chapter 11).
Developmental targeting of gene expression by the use of a senescence-

specific promoter
The process of senescence is driven by changes in gene expression, involving the

activation and inactivation of specific sets of genes. Using differential screening
techniques a number of senescence-associated genes (SAG) have been identified

which are activated only during senescence.
Two specific genes, SAG12 and SAG13 have transcripts which were only
detected in senescing tissues. That is, these two genes were expressed in a highly
senescence-specific manner. The promoter regions of both these genes have
been fused to the GUS reporter and were shown, in Arabidopsis and tobacco, to
direct expression in a senescence-specific manner. Although the signal trans-
duction pathway which activates expression of these genes is not yet known,
the identification of their promoter regions now makes it possible to specifically
target the expression of genes introduced into plants in senescing tissues.
Abscisic acid-inducible promoters in the control of gene expression in

plants
Abscisic acid (ABA) appears to be a ‘stress hormone’. In addition to drought,

other stresses such as cold and salinity also cause an increase in ABA content.
ABA induces the expression of a variety of genes, including those encoding
seed storage proteins and late embryogenesis abundant (lea) and RAB
(response to ABA) proteins. It has also been implicated in the suppression of
gene expression.
Studies of the promoters of these genes has allowed the characterization
of a core ACGT box which, together with a coupling element, gives ABA
signal response specificity. Molecular switches have been constructed which
demonstrate different levels of ABA induction and transcription strength. It is
particularly significant that these switches function not only in the model
barley aleurone tissue but in vegetative tissue as well.
Potential use of hormone-response elements to control gene expression in

plants
Hormone-response elements are minimal DNA sequence motifs that confer

hormone responsiveness to a promoter. Recently, there has been considerable
progress in the understanding of auxin response elements (AuxRE), such that
there are now identified sequences which have been shown to function in
synthetic composite promoters. Two major types of AuxRE, the ocs or as-1
elements (Ellis et al., 1987) and TGTCTC elements (Hagen et al., 1991), have been
characterized and minimal sequences identified and tested for functionality in
vivo.
Ocs/as-1 elements, fused to minimal promoter-GUS reporter genes can be
induced by most of the biologically active auxins and, most importantly, by
inactive auxin analogues such as 2,3-D. The potential also exists to manipulate
promoters with composite AuxRE to enable auxin regulation in unique tissue-
specific, organ-specific or developmentally specific fashion.
8 P.H.S. Reynolds
CONCLUDING COMMENTS
The utility of inducible promoter systems in laboratory-based research is self-

evident and there is clear potential for their usefulness in the genetically
modified plants of the future. For example, there is considerable concern about
the place of genetically engineered plants in modern agriculture/horticulture
and forestry. This concern is wide-ranging, from the effects of prolonged
constitutive expression of pest resistance genes to the effects of expressed genes
on the metabolism and fitness of the engineered plants. Studies which address
the multiple effects caused at multiple trophic levels by the introduction of a
new gene into a plant are only now beginning. The precise timing and control
over place of expression are important aspects of the increasing sophistication
in genetic engineering which in the future will be combined with the ability to
control the chromosomal site of insertion.
The boundaries to the development of different methods of control over
expression of introduced genes are limited only by the scope of human ingenuity
and its ability to trap and utilize the masterful and intricate systems that control
the growth, development and survival of all organisms on the planet. For example,
the universality of the heat-shock response has the potential to allow almost
continuous expression of an introduced gene. The potential usefulness of wound-
inducible promoter systems for the control of expression of genes introduced to
effect pest resistance is obvious. The precise timing of expression offered by the use
of specific signal compounds which activate introduced non-plant control
mechanisms can allow targeted expression of genes outside of intrinsic
programmed control processes. In contrast, hormonal promoters allow control of
expression of introduced genes as part of programmed developmental cycles.
No one inducible control system can provide all of the answers. Clearly
what is required is the careful analysis of all the available systems and selection
of the one which is most amenable to the particular gene being expressed.
REFERENCES
Aoyama, T. and Chua, N.-M. (1997) A glucocorticoid-mediated transcriptional

induction system for transgenic plants. The Plant Journal 11, 605–612.
Caddick, M.X., Greenland, A.J., Jepson, I., Krause K.-P., Qu, N., Riddell, K.V., Salter M.G.,
Schuch, W., Sonnewald, U. and Tomsett, A.B. (1998) An ethanol inducible gene switch
for plants used to manipulate carbon metabolism. Nature Biotechnology 16, 177–180.
Ellis, J.G., Llewellyn, D.J., Walker, J.C., Dennis, E.S. and Peacock, W.J. (1987) The ocs
element: a 16 base pair palindrome essential for activity of the octopine synthase
enhancer. The EMBO Journal 6, 3203–3208.
Gan, S. and Amasino, R.M. (1997) Making sense of senescence. Molecular genetic
regulation and manipulation of leaf senescence. Plant Physiology 113, 313–319.
Gatz, C., Frohberg, C. and Wendenburg, R. (1992) Stringent repression and
homogeneous de-repression by tetracycline of a modified CaMV 35S promoter in
intact transgenic tobacco plants. The Plant Journal 2, 397–404.
Green, T. and Ryan, C. (1972) Wound-induced proteinase inhibitor in plant leaves: a

possible defense mechanism against insects. Science 175, 776–777.
Guilfoyle, T.J. (1997) The structure of plant gene promoters. In: Setlow, J.K. (ed.) Genetic
Engineering, Principles and Methods, Vol. 19. Plenum Press, New York, pp. 15–47.
Hagen, G., Martin, G., Li, Y. and Guilfoyle, T.J. (1991) Auxin induced expression of the
soybean GH3 promoter in transgenic tobacco plants. Plant Molecular Biology 17,
567–579.
Hahn, M.G. (1996) Microbial elicitors and their receptors in plants. Annual Review of
Phytopathology 34, 387–412.
Hammond-Kosack, K.E. and Jones, J.D.G. (1997) Plant disease resistance genes. Annual
Review of Plant Physiology and Plant Molecular Biology 48, 575–607.
Lee, J.H. and Schoffl, F. (1996) An Hsp70 antisense gene affects the expression of
HSP70/HSC70, the regulation of HSF, and the acquisition of thermotolerance in
transgenic Arabidopsis thaliana. Molecular and General Genetics 252, 11–19.
Long, S.R. (1996) Rhizobium symbiosis: Nod factors in perspective. The Plant Cell 8,
1885–1898.
Ma, H. (1998) To be, or not to be, a flower – control of floral meristem identity. Trends in
Genetics 14, 26–32.
Mett, V.L., Lochhead, L.P. and Reynolds, P.H.S. (1993) Copper controllable gene
expression system for whole plants. Proceedings of the National Academy of Sciences
USA 90, 4567–4571.
Mett, V.L., Podivinsky E., Tennant, A.M., Lochhead, L.P., Jones, W.T. and Reynolds, P.H.S.
(1996) A system for tissue-specific copper controllable gene expression in transgenic
plants: nodule-specific antisense of aspartate aminotransferase-P2. Transgenic
Research 5, 105–113.
Schena, M., Lloyd, A.M. and Davis, R.W. (1991) A steroid-inducible gene expression
system for plant cells. Proceedings of the National Academy of Sciences USA 88,
10421–10425.
Sticher, L., Mauch-Mani, B. and Metraux, J.P. (1997) Systemic acquired resistance.
Annual Review of Phytopathology 35, 235–270.
Taylor, C.B. (1997) Plant vegetative development: from seed and embryo to shoot and
root. The Plant Cell 9, 981–988.
Tinland, B., Fournier, P., Heckel, T. and Otten, L. (1992) Expression of a chimeric heat-
shock-inducible Agrobacterium 6b oncogene in Nicotiana rustica. Plant Molecular
Biology 18, 921–930.
Weinmann, P., Gossen, M., Hillen, W., Bujard, H. and Gatz, C. (1994) A chimeric
transactivator allows tetracycline-responsive gene expression in whole plants. The
Plant Journal 5, 559–569.
Use of the Tn10-encoded

2
Tetracycline Repressor to
Control Gene Expression
Christiane Gatz
Albrecht von Haller Institut für Pflanzenwissenschaften,

Universität Göttingen, Untere Karspüle 2, 37073 Göttingen,
Germany
The Tn10-encoded Tet repressor (TetR) negatively regulates expression of the

Tn10-encoded tetracycline resistance gene in Gram-negative bacteria (for
review see Hillen and Berens, 1994). Induction is mediated by tetracycline (tc),
which binds to TetR, thus abolishing its DNA-binding activity. Taking
advantage of the high specificity of the TetR–tet operator interaction, the high
affinity of tc to TetR and the favourable transport properties of tc, tc-regulatable
gene expression systems have been developed for a variety of eukaryotes. This
chapter reviews the features of TetR important for its use to regulate eukaryotic
gene expression and describes two different approaches to use TetR for this
purpose. Most recent applications of these systems in plants are briefly
described.
THE Tn10-ENCODED Tet REPRESSOR (TetR)
TetR regulates expression of its own gene (tetR) as well as expression of the tc
resistance gene tetA (Fig. 2.1). Both genes are oriented with divergent polarity;
between them is a central regulatory region with overlapping promoters and two
tet operators. TetR, a dimer of two 24 kDa subunits, binds via a helix–turn–helix
motif to two tet operators, resulting in repression of both genes. Induction is
based on binding of tc to TetR, resulting in a TetR–tc complex being unable to
bind to DNA. This efficient tc-dependent genetic switch might have evolved
because of selective pressure against constitutive expression of the resistance
gene; which is an integral membrane protein pumping tc out of the cell.
The molecular mechanism of the TetR–tet operator interaction has been
studied thoroughly (for review see Hillen and Berens, 1994). The sequence of the
12 C. Gatz
Fig. 2.1. Genetic organization and mechanism of regulation of the Tn10-encoded

tc-resistance determinant. Upper panel: autoregulatory expression of TetR (grey
circles) leads to TetR levels that repress transcription of tetR and tetA by binding to
the two operators O1 and O2. Lower panel: tc binds to TetR, enforcing its
dissociation from the DNA, which leads to transcription of both genes. Tc-
resistance protein TetA, which is an integral membrane protein that exports tc out
of the cell, is represented by cylinders.
two Tn10-encoded tet operators are shown in Fig. 2.2. Each operator is a 19 bp
palindrome consisting of two 9 bp half sites flanking a central bp. Five of the
9 bps of each half site are directly contacted by amino acids of the N-terminal
helix–turn–helix motif of TetR, thus contributing strongly to the specificity of the
interaction. The binding constants at an assumed physiological salt concentra-
tion of 160 mM sodium chloride are 3 3 102 M21 for non-specific, and
2 3 1011 M21 for specific binding. The ratio of specific over non-specific binding
constants (7 3 108) guarantees that non-specific DNA does not effectively
compete with operator DNA for repressor binding. Considering the genome size
of higher plants (6 3 1010 bp in the allo-diploid species tobacco) this high
specificity of binding is an essential feature of TetR for its use in eukaryotes. TetR
mutants with altered recognition specificities are also available, thus providing
potentially valuable tools for further refinements of tc-dependent expression
systems in higher plants.
TetR-regulated promoter systems respond to tc, because binding of tc to
TetR leads to a conformational change rendering the protein into a non-DNA-
Use of the Tn10-encoded Tetracycline Repressor 13
Fig. 2.2. Sequence of the two tet operators. Asterisks indicate the central bp of the
palindrome, arrows illustrate the palindromic nature of the sequence and boxes
indicate bp that are directly contacted by TetR.
binding conformation. The high association constant of the inducer tc to TetR

(Kass = 3 3 109 M21) makes induction sensitive to even nanomolar concen-
trations of the drug. The crystal structure of the TetR–tc complex has offered
insight into the conformational changes associated with the switch between
inducing and repressing structures of TetR. Moreover it might provide clues to
develop new inducing tc derivatives lacking antibiotic activities. Using a
mutagenesis screen to isolate TetR mutants which repress prokaryotic gene
expression in the presence of tc, a TetR mutant was isolated that requires tc for
efficient binding to tet operator DNA. This mutant has been successfully used in
mammalian systems to regulate gene expression in a reverse manner as
compared to TetR (Gossen et al., 1995; see below).
Apart from the Tn10-encoded tc-resistance determinant, similar operons
have been found to be encoded by other transposons (Tn1721) or plasmids
(RA1, pSC101, pJA 8122, pSL1456). They all show the same arrangement of
tetA and tetR with tet operators being located overlapping to the promoters in
the central regulatory region (Fig. 2.1). The amino acid sequences of the
encoded proteins are 43–78% identical. Based on sequence analysis the
different tc-resistance determinants are grouped into classes A to G. The
operator sequences of the different classes show sequence similarities, but tet
operators of classes A, C and G are only poorly recognized by class B and D
repressors. This set of naturally occurring TetR derivatives with different
operator binding specificities, combined with mutants differing in their response
to various tc derivatives opens potential avenues for controlling several
transgenes by individual repressor molecules.
USING TetR TO REPRESS PLANT GENE EXPRESSION
In the prokaryotic system, TetR represses transcription by sterically interfering

with binding of RNA polymerase to the promoter due to the overlapping
arrangement of tet operators with promoter sequences. This principle of
14 C. Gatz
regulating gene expression is a common mechanism in bacteria but is found

infrequently in higher eukaryotes, where protein–protein interactions are the
primary mechanism to mediate stimulating or inhibitory effects on the
transcription machinery. Nevertheless, initial experiments using transiently
transformed protoplasts revealed that this principle of steric hindrance could
also be applied to control a plant promoter (Gatz and Quail, 1988). Two
operators were positioned flanking the TATA box of the cauliflower mosaic virus
(CaMV) 35S promoter. Expression of TetR was achieved by putting tetR under
the control of the wild-type (wt) CaMV 35S promoter. TetR was able to repress
the modified CaMV 35S promoter, presumably by interfering with the assembly
of a functional transcription initiation complex in this region of the promoter.
Repression was relieved by addition of tc.
Transfer of these regulatory modules to transgenic plants did not
immediately result in an efficient expression system indicating that the principle
of repression is less efficient when the target promoter is integrated into the
chromosome. Two important adjustments had to be made. The chimeric CaMV
35S:tetR construct used in transient assays provided considerable lower TetR
expression levels when integrated into the genome. By shortening the untrans-
lated leader by 50 bp, steady-state levels of one million TetR molecules per cell
were achieved in the transgenic situation (Gatz et al., 1991). Second, the location
of the operators had to be adjusted. Systematic analysis of 22 CaMV 35S promoter
derivatives containing a single tet operator in different positions (Fig. 2.3) demon-
strated that repression by TetR depended very much on the exact location of the
operator. For instance, when the distance between the 3′ end of the operator and
the 5′ end of the TATA box was only 1 bp, repression was very efficient; repression
was less efficient at a distance of 3 bp and at a distance of 5 bp no repression was
observed (Frohberg et al., 1991). Also, when the distance between the 5′ end of
the tet operator and the transcriptional start site exceeded 9 bp the operator was
not able to contribute to repression in the presence of TetR (Heins et al., 1992).
Whereas occupation of a single operator within the CaMV 35S promoter medi-
ated repression in transiently transformed protoplasts, one operator was not effi-
cient when integrated into the plant genome. However, integration of three
operators into the CaMV 35S promoter, with each operator being able to con-
tribute to repression as determined by transient analysis, led to the development
of a tightly repressible CaMV 35S promoter derivative (Gatz et al., 1992). Thus,
high TetR levels as well as multiple operator sites are required for efficient repres-
sion. In contrast with the prokaryotic system, where it only has to interfere with
binding of RNA polymerase, TetR has to compete against at least 40 proteins in
eukaryotic systems (Fig. 2.4), which cooperate to form a functional transcription
initiation complex (Roeder, 1991). Sequence alterations in the vicinity of the TATA
Fig. 2.3. (Opposite) Schematic drawing of the promoter derivatives constructed to

define functional operator locations. Using transient assays, 22 CaMV
35S:chloramphenicol acetyl transferase (cat) constructs were tested in TetR-encoding
tobacco protoplasts.
Fig. 2.3. (Continued)

Expression was monitored after incubation of protoplasts with or without tc. Only the
region from 282 to +30 of the CaMV 35S promoter derivatives is shown with each bp
being represented by one square. Except for activating sequence-1 (as-1) and the TATA
box, sequences can be replaced without altering promoter activity. The 19 bp tet
operator is indicated as a black, grey or white box. Black boxes indicate locations,
where TetR interferes with transcription; the grey box indicates a location, where TetR
has a weaker negative effect on transcription; and white boxes indicate locations,
where TetR has no effect on transcription. Only, the promoter with three operators
mediates stringent repression in the transgenic situation. TSS, transcriptional start site.
16 C. Gatz
Fig. 2.4. Schematic representation of the use of TetR to repress transcription. TetR is
synthesized under the control of a strong constitutive promoter (upper panel) and
controls a target promoter in a tc-dependent manner (lower two panels). The DNA
is represented as a string of white squares, the operators are indicated in black and
the enhancer module is indicated as a white box. In the absence of the inducer tc
(filled triangles), binding of TetR (grey circles) to the operators interferes with
assembly of the transcription initiation complex at the TATA box (left panel).
Binding of tc to TetR triggers a conformational change in the protein, so that it can
no longer bind to DNA, enforcing rapid dissociation from the DNA. Thus, the
multifactorial initiation complex, which contains TFIID, TFIIA, TFIIB, TFIIF, TFIIE,
other associated factors and RNA polymerase II, can assemble and transcription is
initiated (right panel). Tissue specificity of the system can be achieved by choosing
appropriate enhancer modules of the target promoter.
box did not reduce expression from the CaMV 35S promoter (Gatz et al., 1992).
In tobacco expression of this promoter can be modulated 500-fold by tc. The
induction factor is independent of position effects. High-expressing plants have
background GUS levels of 2000 pM 4-MU produced min21 (mg protein)21 and
can be induced to 180,000 pM 4-MU produced min21 (mg protein)21; low-
expressing plants show, in the absence of tc, GUS levels barely distinguishable from
GUS levels detectable in untransformed plants but can only be induced to 1000 to
2000 U.
Induction of gene expression is achieved by tc treatment; only 0.1 mg l21 tc
is required when single leaves are infiltrated (Gatz et al., 1991). Under these
conditions, induction is extremely fast (10 min) reflecting the short signal
transduction chain. At the whole plant level, various modes of tc treatment can
be applied. Systemic induction can be achieved by cultivating plants in

hydroponic culture (1 mg l21; Gatz et al., 1992). This method is somehow tedious,
as the solution has to be renewed every other day. Depending on the size of the
plants, full induction is achieved after 1 or 2 weeks. Alternatively, plants can be
grown in sand or rockwool in a setup that allows drainage of the solution (Corlett
et al., 1996). Unfortunately, tc treatment reduces root growth, but plant height,
chlorophyll content and assimilation rates are only marginally affected. Daily
painting of leaves with tc (10 mg l21) is an alternative method of induction. Tc
stays in the painted leaf, so that local induction is possible. In tissue culture
containers transpiration is not sufficient for homogenous distribution of the
inducer but expression in roots and leaves touching the medium is highly induced
(Gatz et al., 1992). If fresh tc is not added constantly, TetR turns transcription off
again indicating that tc is not very stable in planta.
The tc-inducible system has been used to express a dominant negative
mutant of the TGA family of transcription factors in transgenic tobacco plants,
leading to the conditional reduction of transcription factor complex ASF-1
(Rieping et al., 1994). Conditional reduction of ASF-1 provided the possibility
to directly correlate the subsequent reduction of expression from a reporter
construct with the reduction of ASF-1, thus concluding that low expression of
the reporter construct was simply due to position effects. Plants expressing the
Agrobacterium rhizogenes-encoded rolB gene grew normally in the absence of tc,
and a very severe phenotype (chlorosis, stop of growth, no flower development)
could be induced by adding tc to the hydroponic nutrient solution (Röder et al.,
1994). Upon removal of tc, healthy leaves developed again. Tc-inducible
expression of the Agrobacterium rhizogenes-encoded rolC gene allowed the
analysis of primary effects of RolC on cytokinin levels, thus ruling out the
possibility that homeostatic mechanisms might mask primary events (Faiss et
al., 1996). Local tc-inducible expression of the Agrobacterium tumefaciens-
encoded ipt gene helped to prove that the consequences of enhanced cytokinin
synthesis remained restricted to the site of hormone production (Faiss et al.,
1997). The system further served to obtain transgenic plants overexpressing
oat arginine decarboxylase (Masgrau et al., 1996) and S-adenosylmethionine
decarboxylase (Kumar et al., 1995) and to evaluate their phenotypes under
vegetative and reproductive growth.
Originally, the system was developed for tobacco plants. Only one paper
describes its use in potato (Kumar et al., 1995). Establishment of the system in
tomato and Arabidopsis has failed. In tomato, high levels of TetR caused reduced
shoot dry weight, leaf chlorophyll content and leaf size, and an altered photo-
synthetic capacity when grown in the summer (Corlett et al., 1996). This phe-
notype was almost completely reversed by the application of tc. In addition, the
phenotype was not visible when plants were grown in the winter. Thus TetR
seems to interfere with high growth rates under strong light conditions. In
Arabidopsis, it seems that repressor concentrations sufficient for transcriptional
control cannot be tolerated, a phenomenon that has been also reported for
mammalian cells (Gossen et al., 1993).
18 C. Gatz
USING TetR TO ACTIVATE PLANT GENE EXPRESSION
As originally described by Gossen and Bujard (1992), TetR can be turned into
a tc-controlled transcriptional activator (tTA) when fused to the potent
transcriptional activation domain of herpes simplex virus protein 16. Despite
this C-terminal extension, TetR retains its DNA-binding activity and tc-
inducibility. tTA can regulate gene expression from a target promoter contain-
ing seven tet operators upstream of a minimal promoter over a range of five
orders of magnitude in the mammalian HeLa cell line, which was stably trans-
formed with the construct. The same principle was shown to work in transgenic
tobacco plants, thus establishing a promoter system that can be shut off in the
presence of tc (Weinmann et al., 1994). The advantage of this system is that
background levels are lower than with the tc-inducible system described above.
This is due to the fact that inactivation of tTA by tc leads to a target promoter
that is not activated (Fig. 2.5). Basal expression from the TATA box in the
absence of any activators is very low when the DNA is packed in chromatin. In
contrast, repression depends on competition of TetR with a number of proteins
assembling around the TATA box and even 99% occupancy of the binding sites
only guarantees 100-fold repression. This can be explained by the free access of
tTA to the operator sites, thus abolishing the requirement for high levels of tTA.
In addition, 50% occupancy of binding sites can be sufficient for transcriptional
activation, but is definitely not sufficient for stringent repression. The system
has been shown to work in Arabidopsis (M. Roever, U. Treichelt, C. Gatz, J.
Schiemann and R. Hehl, Braunschweig/Göttingen, 1995, personal communi-
cation). Thus, Arabidopsis seems to tolerate the amount of TetR derivatives
needed for transcriptional activation.
The tTA-based system has been successfully applied for measuring mRNA
decay rates in tobacco BY-2 cells (Gil and Green, 1995). Because of the fast
uptake of tc by suspension cultured cells, the target promoter can be shut off
very efficiently which allows the observation of first-order decay of transcripts
within 15 min after tc treatment. The tTA-dependent promoter provides an
important alternative to using general inhibitors of polymerase II like
actinomycin D. Actually, it proved to be essential in the analysis of the effect of
the 3′-untranslated region of one of the small auxin up-regulated RNAs (SAUR)
transcripts on mRNA stability. The destabilizing effect of the sequence was not
visible when actinomycin D was used for half-life studies, which indicates that
some mRNA decay pathways require ongoing transcription to function.
Despite its favourable properties for measuring RNA or protein decay rates,
the tTA-dependent expression system has not yet reached its optimum
performance. First, expression levels in the absence of tc only reach 30% of the
levels reached by the inducible system and drop as transgenic plants age
(Weinmann et al., 1994). This problem has been solved recently by
reconstructing the target promoter (S. Böhner, I. Lenk and C. Gatz, Göttingen,
1997, personal communication). In addition, cultivating plants permanently on
tc to keep the promoter silent can be disadvantageous. A promising alternative
Fig. 2.5. Schematic representation of the use of TetR to activate transcription. The
fusion protein consisting of TetR and an activation domain (tTA) is synthesized
under the control of a strong constitutive promoter (upper panel) and controls a
target promoter in a tc-dependent manner (lower two panels). The DNA is
represented as a string of white squares, the multimerized operators are indicated
as a black box in brackets. In the absence of the effector tc (filled triangles), binding
of tTA (grey pear-shaped symbol) to the operators activates transcription (left panel),
by favouring the functional assembly of the initiation complex consisting of TFIID,
TFIIA, TFIIB, TFIIF, TFIIE, other associated factors and polymerase II. Binding of tc
to tTA triggers a conformational change in the protein, so that it can no longer bind
to DNA and transcription is not activated (right panel). Whether some basal
transcription factors keep sitting on the DNA is pure speculation. Tissue specificity
of the system can be achieved by choosing appropriate promoters to drive
expression of tTA.
was to use the above mentioned TetR mutant that binds to DNA only in the
presence of tc (Gossen et al., 1995). Thus, by fusing this mutant to the VP16
domain, a chimeric transcriptional activator (rtTA) was made available. The
activity of a target promoter can be induced by tc when rtTA is used, a principle
that has been shown to work in mammalian cells. When either Arabidopsis or
tobacco was transformed with this construct, no tc-inducible activation of the
target promoter was observed. Although mRNA levels similar to tTA mRNA
levels were found, no protein was detectable in Western blot analysis using TetR
antibodies, indicating that rtTA cannot accumulate in plant cells.
We have recently fused tTA to the glucocorticoid receptor hormone-
binding domain, resulting in the transcriptional activator TGV, which renders
20 C. Gatz
transcriptional activation dexamethasone (dx)-inducible. A dx-inducible

promoter was already established by combining the DNA-binding domain of
yeast transcription factor GAL4 with the transcriptional activation domain of
VP16 and the glucocorticoid receptor hormone-binding domain (Aoyama and
Chua, 1997). This trimeric protein (GVG) activates an artificial promoter
consisting of six GAL4 binding sites upstream of the 246 to +1 region of the
35S promoter. As the binding constant of GAL4 (Parthun and Jachnig, 1990)
to its target sequence is 100-fold lower than the binding constant of TetR to the
tet operators, it could well be that TGV might mediate higher expression levels
as compared with GVG. However, this will have to be tested. In addition, back-
ground levels of the respective target promoters will have to be compared. An
additional feature of TGV is that its activity can be abolished by addition of tc. It
remains to be shown whether shutting down transcription by the addition of tc
is kinetically more favourable than depletion of dx. The target promoter for tTA
or TGV offers a number of useful options. A gene of interest under the control
of this promoter can be introduced in either tTA or TGV expressing plants. If the
transgene only interferes with regeneration, tTA expressing host plants are
recommended. Regeneration could be done in the presence of tc and further
analysis could be done without the need of any inducer. If regeneration is done
in the absence of tc, expression is constitutive, but can be silenced later, e.g. if
the transgene interferes with reproduction. Introduction of the construct into
TGV expressing plants keeps the transgene silent in the absence of any
chemical. Transcription can be induced and turned off by the subsequent
addition of the effectors dx and tc. Moreover, induction can be done at the whole
plant level with transcription turned off in selected leaves.
In summary, several years of experience with the use of Tn10-encoded
regulatory elements for regulating gene expression in eukaryotes has led to a
variety of adjustments after the first publication of tc-controlled gene expression
in 1988. As the principle of turning TetR into an activator by fusing it to other
protein domains has proven to be a more successful strategy than using TetR as
a bona fide repressor, the latest development of TGV controlling a target
promoter in a dx- and tc-dependent manner seems to be the most promising
way to flexibly regulate the expression of transgenes.
REFERENCES
Aoyama, T. and Chua, N.-H. (1997) A glucocorticoid-mediated transcriptional induc-

tion system for transgenic plants. The Plant Journal 11, 605–612.
Corlett, J.E., Myatt, S.C. and Thompson, A.J. (1996) Toxicity symptoms caused by high
expression of Tet repressor in tomato (Lycopersicon esculentum Mill. L.) are alleviated
by tetracycline. Plant Cell Environment 19, 447–454.
Faiss, M., Strnad, M., Redig, P., Dolezal, K., Hanus, J., Van Onckelen, H. and Schmülling,
T. (1996) Chemically induced expression of the rolC-encoded b-glucosidase in
transgenic tobacco plants and analysis of cytokinin metabolism: rolC does not
hydrolyze endogenous cytokinin glucosides in plants. The Plant Journal 10, 33–46.
Faiss, M., Zalubilova, J,, Strnad, M. and Schmülling, T. (1997) Conditional transgenic
expression of the ipt gene indicates a function for cytokinins in paracrine signaling
in whole tobacco plants. The Plant Journal 12, 401–415.
Frohberg, C., Heins, L. and Gatz, C. (1991) Characterization of the interaction of plant
transcription factors using a bacterial repressor protein. Proceedings of the National
Academy of Sciences USA 88, 10470–10474.
Gatz, C. and Quail, P.H. (1988) Tn10-encoded Tet repressor can regulate an operator-
containing plant promoter. Proceedings of the National Academy of Sciences USA 85,
1394–1397.
Gatz, C., Kaiser, A. and Wendenburg, R. (1991) Regulation of a modified CaMV 35S
promoter by the Tn10-encoded Tet repressor in transgenic tobacco. Molecular and
General Genetics 227, 229–237.
Gil, P. and Green, P.J. (1995) Multiple regions of the Arabidopsis SAUR-AC1 gene control
transcript abundance: the 3′-untranslated region functions as an mRNA instability
determinant. The EMBO Journal 15, 1678–1686.
Gossen, M. and Bujard, H. (1992) Tight control of gene expression in mammalian cells
by tetracycline-responsive promoters. Proceedings of the National Academy of Sciences
USA 89, 5547–5551.
Gossen, M., Bonin, A.L. and Bujard, H. (1993) Control of gene activity in higher
eukaryotic cells by prokaryotic regulatory elements. Trends in Biochemical Science
18, 471–475.
Gossen, M., Freundlieb, S., Bender, G., Müller, G., Hillen, W. and Bujard, H. (1995)
Transcriptional activation by tetracycline in mammalian cells. Science 268,
1766–1769.
Heins, L., Frohberg, C. and Gatz, C. (1992) The Tn10 encoded Tet repressor blocks early
but not late steps of assembly of the RNA Polymerase II initiation complex in vivo.
Molecular and General Genetics 232, 328–331.
Hillen, W. and Berens, C. (1994) Mechanisms underlying expression of Tn10 encoded
tetracycline resistance. Annual Review of Microbiology 48, 345–369.
Kumar, A., Taylor, M.A., Arif, S.A.M. and Davies, H.V. (1995) Potato plants expression
antisense and sense S-adenosylmethionine decarboxylase (SAMDC) transgenes
show altered levels of polyamines and ethylene: antisense plants display abnormal
phenotypes. The Plant Journal 9, 147–158.
Masgrau, C., Altabella, T., Farrás, R., Flores, D., Thompson, A.J., Besford, R.T. and
Tiburcio, A.F. (1996) Inducible overexpression of oat arginine decarboxylase in
transgenic tobacco plants. The Plant Journal 11, 465–473.
Parthun, M.R. and Jachnig, J.A. (1990) Purification and characterization of the yeast
transcriptional activator GAL4. Journal of Biological Chemistry 265, 209–213.
Rieping, M., Fritz, M., Prat, S. and Gatz, C. (1994) A dominant negative mutant of PG13
suppresses transcription from a cauliflower mosaic virus 35S truncated promoter
in transgenic tobacco plants. Plant Cell 6, 1087–1098.
Roeder, R.G. (1991) The complexities of eukaryotic transcription initiation: regulation
of preinitiation complex assembly. Trends in Biochemical Sciences 16, 402–408.
Röder, F.T., Schmülling, T. and Gatz, C. (1994) Efficiency of the tetracycline-dependent
gene expression system: complete suppression and efficient induction of the rolB
phenotype in transgenic plants. Molecular and General Genetics 243, 32–38.
22 C. Gatz
03 Inducible Gene 03 3/9/99 12:20 PM Page 23
Ecdysteroid Agonist-inducible
3
Control of Gene Expression
in Plants
Alberto Martinez and Ian Jepson
Zeneca Agrochemicals, Jealott’s Hill Research Station,

Bracknell, Berkshire RG42 6ET, UK
TRANSCRIPTIONAL CONTROL OF TRANSGENE EXPRESSION IN

PLANTS
A number of approaches have been reported for the chemical control of

transgene expression in plants (Gatz, 1996). Several systems are available
including those which rely on plant-inducible promoters as well as relief of
repression systems which use bacterial operator repressors and heterologous
promoter/transcription factor combinations.
Plant promoters which display chemically inducible expression can be
exploited to develop heterologous systems for gene regulation. This approach
has been adopted in the case of the PR-1 promoter, the activity of which is
induced by salicylic acid (Williams et al., 1992). Although this approach has
been used successfully with both reporter and insecticidal genes, it may be of
limited use due to unspecific induction by pathogens and other chemical
triggers. Chemical-dependent regulation of the maize GST-27 promoter has
been described using herbicide safeners (Jepson et al., 1994a, b). Inducible
regulation was detected in transgenic plants, however, constitutive expression
was observed in root tissues.
Inducible regulation of transgenes in plants has been achieved by relief of
repression or activation of transcription. In the case of the tetracycline (Gatz et
al., 1992) and lacI (Wilde et al., 1992) systems, operator sequences were
inserted within a target promoter region. The repressor protein binds to these
operator sequences in the absence of ligand (i.e. tetracycline or isopropyl-β-D-
thiogalacto pyranoside (IPTG)) preventing transcription of the target gene.
Addition of the ligand prevents repressor binding to the operator sequence, thus
transcription is initiated (Gatz et al., 1992; Wilde et al., 1992). The tetracycline
24 A. Martinez and I. Jepson
system has been used in protoplasts and transgenic plants. Recently, the system
was shown to tightly regulate mRNA levels of arginine decarboxylase in tobacco
plants (Masgrau et al., 1997). The lacI system has been exemplified in tobacco
protoplasts (Wilde et al., 1992). Due to the nature of their inducing chemicals
(IPTG, tetracycline) it is likely these systems will be restricted to research
applications only.
Chemical-dependent induction of transcription can also be achieved by
using ligand-dependent transcription factors and responsive promoter
sequences. One such system is that based on the introduction of ACE1, a copper-
dependent transcriptional activator from yeast, into plants. The addition of
inducer (i.e. Cu2+) leads to activation of reporter gene expression (Mett et al.,
1993). A second gene control system based on components of the alcohol
dehydrogenase regulon of Aspergillus nidulans has been used to provide
chemical-inducible gene expression in plants. The alcR regulatory protein in
the presence of certain alcohols and ketones will bind to the alcA promoter and
achieve gene expression. This system has been used successfully in tobacco,
oilseed rape (Sweetman et al., 1997; Tomsett et al., 1997) and tomato (Garoosi
et al., 1997; Tomsett et al., 1997). Another example of a switch system based
on heterologous transcription factors will be described later in the nuclear
receptor section.
Although the utility of these systems for research purposes has been
documented, a number are not tightly regulated, exhibit low levels of inducible
expression or utilize chemistry which is phytotoxic or incompatible with
agricultural use.
NUCLEAR RECEPTORS
Nuclear receptors are a large well-defined family of transcription factors with

over 150 members. Although the presence of lipophilic hormones in
mammalian and insect systems has been established for many years, the first
nuclear receptors (glucocorticoid and oestrogen receptors) were not isolated
until the mid-1980s (Mangelsdorf et al., 1995). Members of the steroid/retinoic
acid/thyroid receptor superfamily have been isolated from both invertebrates
and vertebrates and include receptors with different developmental functions.
Many of these receptors lack a recognized ligand and are known as orphan
receptors. The nuclear receptor superfamily encompasses four classes of
receptors (Mangelsdorf et al., 1995). Class I are the steroid receptors which
generally form homodimers. These receptors are bound by heat-shock proteins
(Hsp70, Hsp90) and p59 to form a complex in the cytoplasm (e.g. gluco-
corticoid receptor (GR)). When bound by ligand, the receptor is released from
the complex allowing translocation into the nucleus and binding to a cognate
response element as a dimer (see Evans, 1988; Beato, 1991; Green and
Chambon, 1988, for reviews). These receptors are only found in vertebrates and
thus represent a new evolutionary branch of the superfamily (Mangelsdorf et
Ecdysteroid Agonist-inducible Control 25
al., 1995). Class II receptors, or retinoic-X receptor (RXR) heterodimers, are

those belonging to the retinoic/thyroid receptor family. These receptors may
interact with response elements as heterodimers. Class II receptors are normally
found bound to DNA in the absence of ligand (Mangelsdorf et al., 1995). An
example of class II receptors is in the ecdysteroid receptor (EcR) of insects which
interacts with ultraspiracle (USP; insect homologue of RXR) to form a hetero-
dimer responsive to ecdysone (Yao et al., 1992, 1993). Class III receptors or
dimeric orphan receptors, bind as homodimers to direct repeats in the target
promoter. Examples of this family are RXR or COUP (chicken ovalbumin
upstream promoter transcription factor-1). Finally, Class IV, or monomeric
orphan receptors, bind to extended core site, an example of which is SF1
(Mangelsdorf et al., 1995).
Nuclear receptors have six different protein domains (Fig. 3.1a) (see Evans,
1988; Beato, 1991; Green and Chambon, 1988; Mangelsdorf et al., 1995 for
reviews). Domains A and B are involved in ligand-independent transactivation.
The DNA-binding domain, or domain C, is the best conserved region within the
superfamily. This domain is between 66 and 68 amino acids long and has eight
invariant cysteine residues implicated in the formation of zinc fingers which are
responsible for interacting with DNA response elements. This domain also
contributes to dimer formation. Domain D, or the hinge region, is variable and
contains the sequences required for direct targeting to the nucleus. The ligand-
binding domain is also well-conserved and is not only involved in interactions
with ligands but also in dimerization and ligand-dependent activation. The F
domain is highly variable in size, and has yet to be ascribed a function. The
domain structure of the nuclear receptors make them ideal candidates for
engineering of novel receptors with unique behaviour.
Inducible nuclear receptor systems in mammalian systems
The use of a number of nuclear receptors for chemical-inducible transcription

control has been illustrated in animal cells. Chimeric receptors based on a fusion
of the Drosophila ecdysone ligand-binding domain with the glucocorticoid
receptor (GR) DNA-binding domain were shown to activate reporter gene
activity in HEK 293 and CV-1 cells in the presence of muristeroneA (an
ecdysone agonist) (Christopherson et al., 1992). Activation levels were
modulated by altering the transactivation domain of the chimeric receptor
(Christopherson et al., 1992). The whole Drosophila EcR has been transformed
into Chinese hamster ovary (CHO) cells. Addition of ponasteroneA (an
ecdysone agonist) resulted in reporter gene activation (Yang et al., 1995),
however, levels of activation were not high due to the reliance of the system on
the weak transactivation domain of the EcR. No et al. (1996) recently
constructed chimeric receptors based on the Drosophila ecdysone ligand-
binding domain. The chimeric receptors contain strong transactivator
sequences and a modified GR DNA-binding region. The expression levels in
Fig. 3.1. (a) Nuclear receptor structure. The receptors have six different domains:
(A and B) transactivation domain; (C) DNA-binding domain; (D) hinge domain; (E)
ligand-binding domain; and (F) C-terminus. (b) Ecdysteroids. MuristeroneA and 20-
hydroxyecdysone. (c) Non-steroidal compound belonging to the dibenzylhydrazine
chemistry. RH5992 (Tebufenozide).
transformed mammalian cells were elevated by 20,000-fold following treat-

ment with muristeroneA. This system was shown to activate gene expression
in transgenic mice after the application of muristeroneA. Finally, a progesterone
receptor (PR)-based transcription control system has been described (Wang et
al., 1997) based on a PR mutant which activates gene expression in the
presence of RU486 (an antiprogestin) (Vegeta et al., 1992). Here, the altered
specificity ligand-binding domain was fused to the GAL4 DNA-binding domain
and a strong transactivator sequence and was shown to activate gene
expression in liver cells of transgenic mice by up to 33,000-fold following

application of RU486 (Wang et al., 1997). Both systems used in transgenic mice
have been optimized to reduce background levels and have high inducible
levels in host cells.
The work in mammalian systems has exemplified the modular nature of
nuclear receptors and the advantages of manipulating these receptors. In
plants, nuclear receptors have been used to control gene expression, and both
transcriptional and post-translational approaches have been studied.
Transcriptional control
Initial work in tobacco protoplasts demonstrated that expression of the rat

glucocorticoid receptor in plants activated reporter gene activity in the presence
of dexamethasone (Schena et al., 1991). However, the levels of induced activity
were very low when compared to 35S CaMV:CAT controls. Transgenic plants
containing the GR failed to induce in the presence of dexamethasone (Lloyd et
al., 1994). An alternative system has been recently described in which the
GAL4 DNA-binding domain was fused to the herpes simplex VP16 transactiva-
tion domain and the GR ligand-binding domain. Arabidopsis and tobacco
transgenic plants containing VP16-GAL4-GR were induced with micromolar
amounts of dexamethasone (Aoyama and Chua, 1997). Further development
of chimeric receptors has used lacI mutants fused to transactivation domain of
GAL4 and the GR ligand-binding domain (Moore et al., 1997). The mutant lacI
sequences confer high binding affinity to operator sequences (Lehming et al.,
1987, 1990). Expression levels in transformed Arabidopsis protoplasts were
elevated in the presence of dexamethasone while in the absence of ligand the
system remained silent (Moore et al., 1997). These systems show the utility of
the nuclear receptor transcriptional control in plants. However, the nature of
the GR-inducing compounds (agonists to mammalian glucocorticoid hormone)
will restrict their use to research applications.
Post-transcriptional control
Steroid receptor ligand-binding domains are amenable to use in the post-

transcriptional control of gene expression. In this approach the GR ligand-
binding domain is fused to transcription factors controlling plant development.
The GR ligand-binding domain fusion causes compartmentalization of the
transcription factor in the cytoplasm due to the binding of heat-shock proteins
to GR sequences. The transcription factor fusion is released and translated into
the nucleus upon inducer interaction with GR ligand-binding domain, where it
binds to and activates target genes. This approach has been shown to work in
fusions with transcription factors controlling trichoma development (Lloyd et
al., 1994), leaf morphology (Aoyama et al., 1995) and flowering time (Simon et
al., 1996). The GR ligand-binding domain fusions show the flexibility of nuclear
receptor components to control gene activity in plants. Although this approach
is useful for research studies, it is limited to the regulation of transcription
factors and it is difficult to assess the required amounts of transcription factor
to deliver the effect.
ECDYSONE RECEPTORS
The pleiotropic effect of the moulting hormone, 20-hydroxyecdysone (herein

ecdysone) in insects, has been the focus of study for many decades. Ashburner
et al. (1974 and references therein) showed that the addition of ecdysone to
Drosophila third instar larvae salivary glands resulted in the induction of two
sets of genes. The ‘early genes’ are induced upon addition of ecdysone and are
necessary for the induction of the ‘late genes’. The induction of early gene
expression is mediated by the ecdysone receptor which when bound by ligand
activates transcription (Yao et al., 1993).
The ecdysteroid receptor (EcR) was first isolated from Drosophila melanogaster
and has been shown to be a member of the steroid/retinoic/ thyroid receptor
superfamily (Koelle et al., 1991). A number of homologues have been isolated
from other insects which show strong similarity to the Drosophila EcR. However,
only the Drosophila (Koelle et al., 1991; Thomas et al., 1993; Yao et al., 1992,
1993) and Bombyx mori (Swevers et al., 1996) EcRs have been shown to be
functional. We have isolated the Heliothis virescens EcR homologue by a combina-
tion of degenerate polymerase chain reaction (PCR), library screening and 5′RACE
(Martinez et al., 1999). Figure 3.2 shows the alignment of the hinge and ligand-
binding domains of the Drosophila, Bombyx and Heliothis EcR proteins. The
Drosophila (Thomas et al., 1993; Yao et al., 1992, 1993), Bombyx (Swevers et al.,
1996), Chironomus tentans (Elke et al., 1997), Aedes aegipti (Kapitskaya et al.,
1996), Choristoneura fumiferana (Kothapalli et al., 1995) and Heliothis virescens
(Martinez et al., 1999) EcR proteins have been shown to form a heterodimer with
ultraspiracle (USP) suggesting that all these ecdysteroid receptors are part of the
active ecdysone receptor. The EcR–USP complex binds ecdysone and subsequently
activates reporter gene expression in mammalian cells (Yao et al., 1992, 1993).
Yao et al. (1993) showed that EcR complexed with RXR, the mammalian counter-
part of USP, was able to bind muristeroneA (an agonist of ecdysone, see below) but
unable to bind ecdysone. The binding of muristeroneA to EcR–RXR is at lower
affinity when compared to muristeroneA binding to the EcR–USP complex.
Similar data have been obtained with the Heliothis EcR receptor in Chinese
hamster ovary (CHO) cells in the presence of muristeroneA (Martinez et al., 1999).
A chimeric receptor, containing the GR transactivation and DNA-binding domain
fused to the hinge and ligand-binding domains of Drosophila EcR (Christopherson
et al., 1992) or Heliothis EcR, were shown to activate reporter gene expression in
mammalian cells in the presence of muristeroneA (Fig. 3.3) but did not activate
expression in the presence of ecdysone.
Fig. 3.2. Alignment of ecdysone ligand-binding domains from EcR proteins shown
to be active. Bombyx mori (BmLBD, Swevers et al., 1995), Drosophila
melanogaster (DmLBD, Koelle et al., 1991) and Heliothis virescens (HvLBD,
Martinez et al., 1999). The sequence in bold is that of the ligand-binding domain
(Domain E). Multiple sequence alignment was carried out using CLUSTAL in PCGENE
version 1.0. * indicates residues are identical. . indicates conserved substitution.
ECDYSONE AGONISTS
Ecdysteroid compounds
Plants are a rich source of agonists of 20-hydroxyecdysone. One such

compound is muristeroneA which was isolated from Ipomeoea calonyction.
Blackford and coworkers (Blackford et al., 1996; Blackford and Dinan, 1997)
have assayed a number of plants in order to ascertain the distribution of
ecdysteroidal active compounds in the plant kingdom (Table 3.1). Two assay
Fig. 3.3. Ecdysone agonist transcriptional activation of reporter gene in

mammalian cells. HEK 293 cells transfected with reporter and chimeric receptor
show activation of lacZ reporter gene following treatment with 10 mM
muristeroneA and 20 mM RH5992 mimic. The chimeric receptor contains the
transactivation and DNA-binding domain of GR fused to the ligand-binding
domain of the Heliothis ecdysteroid receptor.
systems were adopted. The first relies on immunodetection of ecdysteroid

compounds, while the second is based on a cell division bioassay using
Drosophila Kc cells. A number of plants have been found to contain ecdysteroidal
compounds as judged by both assay methods. While certain species contain
relatively high levels of ecdysone agonists, crop plants appear not to contain
significant levels of these compounds. The Drosophila Kc cell bioassay has been
used to determine the activity of purified ecdysteroids and was found to be a
sensitive system for determination of ecdysone agonists (Harmatha and Dinan,
1997) and a good indicator of ecdysone agonist activity (Blackford et al., 1996).
While these steroidal agonists are important to gain further understanding on
ligand/receptor interactions, they are not suitable candidates for insecticides or
transcription system triggers.
Non-steroidal compounds
Steroidal compounds are complex, expensive to produce, hydrophilic in nature

and detoxification processes in insects are well adapted to deal with them (Hsu,
1991). Despite efforts to discover non-steroidal chemistry mimicking the
activity of ecdysone, little advance has been made until recently. A number of
compounds from the dibenzylhydrazine chemistry have been shown to have
insecticidal activity (Wing, 1988). These compounds bind with high affinity to
Table 3.1. Activity of plant extracts and purified ecdysteroid.
Common Radioimmuno- Drosophila

Plant name assaya Kc cells Reference
Beta vulgaris ssp. maritima Sea beet – – Blackford and Dinan, 1997
Brassica oleracea cv.
botrytis Cauliflower – – Blackford and Dinan, 1997
Brassica oleracea cv.
capitata Cabbage – – Blackford and Dinan, 1997
Lycopersicon esculentum Tomato – – Blackford and Dinan, 1997
Solanum tuberosum Potato – – Blackford and Dinan, 1997
Dianthus caryophyllus Carnation – – Blackford and Dinan, 1997
Gossipium hirsutum Cotton 0.071 – Blackford et al., 1996
Helianthus annus Sunflower 0.093 – Blackford et al., 1996
Brassica napus Rape, – – Blackford et al., 1996
oilseed rape
Oryza sativa Rice 0.094 – Blackford et al., 1996
Zea mays Maize – – Blackford et al., 1996
Sorghum bicolor Sorghum – – Blackford et al., 1996
Glycine max Soybean – – Blackford et al., 1996
Nicotiana tabacum Tobacco NL – Blackford et al., 1996
20-Hydroxyecdysone nt 7.5 3 1029 Mb Harmatha and Dinan, 1997
PonasteroneA nt 3.1 3 10210 Mb Harmatha and Dinan, 1997
MakisteroneA nt 1.3 3 1028 Mb Harmatha and Dinan, 1997
a, µg ecdysone equivalents g21 dry weight; b, ED50; NL, non-linear response; nt, not tested; 2, negative.
ecdysone receptors from insects (Wing, 1988; Wing et al., 1988; Dhadialla and
Tzertzinis, 1997). The compounds when applied to growing larvae cause
premature head encapsulation, preventing feeding, which leads to death (Wing,
1988). RH5992 (Fig. 3.1b) is a highly substituted member of the family with
high activity in lepidopteran species (Carlson et al., 1992). This compound has
a narrow spectrum of activity. Two other compounds are in development,
RH0345 (Heller et al., 1992) and RH2485 (Carlson et al., 1996; Le et al., 1996),
both of which have a different spectrum of activities.
Other non-steroidal compounds have been reported in the literature, 3,5-
di-tert-butyl-4-hydroxy-N-isobutyl-benzamide (DTBHIB) (Mikitani, 1996) and
8-O-acetylharpagide (Elbrecht et al., 1996), but these show poor affinity when
compared to ecdysone in cell extracts containing the Drosophila ecdysone
receptor.
The use of dibenzylhydrazines to control gene expression offers advantages
over ecdysteroidal compounds as they are non-phytotoxic yet stable enough for
use in the field.
ECDYSONE RECEPTOR SWITCH (ERS)
The use of nuclear receptors to control gene transcription has been

demonstrated in plants and discussed previously (Schena et al., 1991; Aoyama
and Chua, 1997; Moore et al., 1997). The systems described use dexamethasone,
a steroidal compound which is unsuitable for field use. The ecdysone receptor
presents an approach to design a novel inducible system for plants. The system
is based on two components. The first component, the effector cassette, is a
chimeric receptor containing the GR-transactivation and DNA-binding domain
fused to the Heliothis EcR ligand-binding domain (Fig. 3.4). The second
component, or reporter cassette, has six copies of the glucocorticoid response
element (GRE) fused to the 260 minimal 35S CaMV promoter and β-
glucuronidase (GUS) gene (Fig. 3.4). A chimeric ecdysone receptor-based system
has a number of attractive features as a gene switch. Synthetic, non-steroidal and
non-phytotoxic chemistry is available and the system is modular in nature and
may be modified. For example, the basal level can be manipulated by altering the
minimal promoter context. Furthermore, the use of the GR components favours
homodimer formation and thus negates the requirement of USP, the natural
partner of EcR.
Transient expression of ecdysone chimeric receptor in maize protoplasts
The effector and reporter constructs (Fig. 3.4) were tested in both maize and
tobacco protoplasts in the presence of RH5992. Figure 3.5 shows that, in the
absence of inducer, low levels of GUS expression were observed. Following
treatment of maize and tobacco protoplasts with 100 mM or 10 mM RH5992,
respectively, a significant increase in gene expression was observed. The
absolute levels of expression observed in maize and tobacco protoplasts were
10% that of the 35S CaMV:GUS controls. These levels are similar to those
reported in tobacco protoplasts transformed with GR (Schena et al., 1991).
These data demonstrate the system functions in both monocotyledonous and
dicotyledonous cells.
Transformation of tobacco with ERS
The activation of reporter gene activity in protoplasts by the effector construct

containing the Heliothis EcR ligand-binding domain showed the potential of the
ERS system. However, Lloyd et al. (1994) reported that GR was also capable of
inducing reporter gene expression in protoplasts but not in transgenic plants.
This may be a result of poor transactivating potency of the GR sequences. In
order to address this, we constructed a new effector cassette containing the
strong transactivator domain from herpes simplex VP16 protein (Fig. 3.6)
which has been shown to function in plants (Ma et al., 1988; Wilde et al., 1994;
Aoyama et al., 1995; Weinmann et al., 1994; Aoyama and Chua, 1997). The
effector and reporter gene cassettes were transferred to a Bin19 plant
transformation vector to give pERS3.
Fig. 3.4. The effector construct consists of transactivation and DNA-binding

domains of the GR fused to the hinge and ligand-binding domains of Heliothis EcR.
The reporter construct contains six repeats of glucocorticoid response element
(GRE) fused to the 260 minimal 35S CaMV promoter and the reporter gene β-
glucoronidase.
Transgenic plant analysis
Agrobacterium-mediated transformation with pERS3 yielded a transgenic

plant population containing 60 independent transformants. PCR, using
primer pairs 1–2 and 3–4 (Fig. 3.6), revealed 38 plants containing both effec-
tor and reporter cassettes. Seed was collected from and screened for reporter
gene activity in the presence of RH5992 (0.1 mM). The assay system involved
growing seed from the primary transformants in the presence or absence of
inducer. The germinated seedlings were collected 2 days post-germination
and GUS activity compared between induced and uninduced treatments
Fig. 3.5. RH5992 activates reporter gene expression in both maize and tobacco. (a)
Maize protoplasts, transformed with both effector and reporter constructs, show
activation of GUS reporter gene activity. RH5992 was applied at 100 mM. (b)
Tobacco protoplasts were transformed with the dicot version of the effector and
reporter constructs. The tobacco protoplast growth media was supplemented with
10 mM of RH5992. GUS activity is expressed as nmol 4-methylumbelliferyl h21
mg21 protein.
(Jefferson et al., 1987). The screen indicated that nine primary transgenic
plants did not induce whilst two demonstrated constitutive GUS activity.
Twenty-three plants were found to induce GUS activity in the presence of
RH5992 ranging from 20 to 150% that of 35S CaMV:GUS seedlings. The
induction levels observed throughout the population varied between two- and
430-fold. An example of one transgenic line is shown in Fig. 3.7. High
inducibility of the GUS reporter gene was observed following treatment with
muristeroneA and RH5992. Phenoxycarb, a juvenile hormone (JH) agonist,
does not induce GUS activity even when applied at high levels (0.13 mM). The
treatment of ERS3 plants with ecdysone has a small but significant effect on
GUS reporter gene expression. The lack of a stronger ecdysone effect in ERS
plants may be explained by the requirement for USP by EcR for efficient
activation (Thomas et al., 1993; Yao et al., 1992, 1993). Ecdysone treatment
of animal cells transfected with similar chimeric constructs failed to activate
reporter gene activity (Christopherson et al., 1992), it is perhaps due to the
metabolism of ecdysone in tobacco that renders it a better activator than
expected. The GUS activity observed in transgenic seedlings treated with
muristeroneA and RH5992 is comparable to that of 35S CaMV:GUS
transgenic seedlings. The activity observed in plants is higher than that
observed in transients and is likely to be due to the presence of VP16 in the
modified effector construct. Similar results were observed in transients
experiments with the VP16 chimeric receptor (data not shown). It is
Fig. 3.6. ERS plant transformation vector. The effector and reporter cassettes were
combined in a pBin19-based vector to give pEGS3. LB and RB denotes the left and
right borders of the construct. Arrows denote the PCR primer positions.
important to note that the inducible GUS activity is from a segregating

population of ERS3 seed while the 35S CaMV:GUS plants are homozygous.
This implies that in homozygous ERS3 seedlings the RH5992 may exhibit
improved inducibility with lower variability.
Ligand induction of ERS is dose dependent
The effect of muristeroneA and RH5992 on reporter gene activity of a selected

ERS3 plant is shown in Fig. 3.8. The experiment shows that RH5992 has a
higher affinity for the chimeric receptor than muristeroneA, where maximal
induction was observed with muristeroneA at 75 mM and RH5992 at
25 mM. The IC 50 (amount of compound required for 50% induction) was
observed to be 7.5 mM for muristeroneA and 2 mM for RH5992.
Comparisons between muristeroneA affinity and the non-steroidal
compounds in insect systems have not been reported. However, it has been
established that a homodimer of EcR binds muristeroneA with lower affinity
than the native receptor (EcR/USP).
Fig. 3.7. Seed from EGS3-37 plant were grown for 2 days post-germination in the
presence or absence of the following compounds: DMSO (1.8% v/v); muristeroneA
(0.4 mM); RH5992 (0.05 mM); 20-hydroxyecdysone (0.1 mM); and phenoxycarb
(0.13 mM). GUS activity is expressed as nmol 4-methyl umbelliferyl h21 mg21
protein.
Induction of ERS is specific
The ERS can be activated by certain ecdysone agonists but not others. This has
been demonstrated by the lack of activation in the presence of ecdysone,
makisteroneA and ponasteroneA in maize protoplasts transformed with
effector and reporter plasmid (data not shown). The data indicate that the
chimeric ecdysone receptor has different ligand specificity to that of the native
insect ecdysone receptor. The narrow specificity of the chimeric homodimeric
receptor may be an advantage when the ERS is introduced into plant species
containing endogenous ecdysteroids.
Environmental factors may interfere with the activity of an inducible system
by triggering activation when it is not required. To address this, an ERS3 line was
subjected to a number of stresses. Two-day-old seedlings were subjected to 24 h
4°C incubation, heat-shock at 40°C for 2 h followed by 12 h recovery and 12 h
heat-shock at 40°C with no recovery. The three replicate samples of ten seedlings
were collected and assayed for GUS activity (Jefferson et al., 1987) following
exposure to stress conditions. None of the treatments induced GUS activity above
control seedling levels (data not shown). Six-week-old greenhouse ERS3 plants
were wounded (second leaf was cut from midrib to edge six times each 1 cm
apart), grown under waterlog or drought conditions. Samples from drought-
treated, wounded and control leaves were taken 24 h post-treatment. Plant roots
were submerged for 48 h and then samples were collected from leaves of the
treated and untreated plant. All samples were assayed for GUS activity (Jefferson
et al., 1987). The abiotic stresses tested to date give no induction of the ERS.
Fig. 3.8. A dose response for a steroidal and non-steroidal inducer of the ecdysone
receptor switch. Seeds from EGS3-44 plant were grown for 2 days in the presence
of different amounts of muristeroneA or RH5992. The concentration of the
compounds ranged from 0.1 mM to 100 nM. GUS activity is expressed as nmol
4-methyl umbelliferyl h21 mg21 protein.
CONCLUSIONS
The experiments shown here demonstrate the use of the ecdysone-based

transcription control system. We have shown that the ERS system activates
reporter gene activity in the presence of inducer in protoplasts isolated from
both monocotyledonous and dicotyledonous species. ERS-transformed tobacco
plants treated with micromolar levels of a commercial ecdysteroid agonist
RH5992 show comparable levels of expression to that seen with a strong con-
stitutive promoter (35S CaMV:GUS). The ERS system is specific to ecdysone ago-
nists and environmental factors (drought, water logging, high and low
temperature, and wounding) do not trigger activation of the system. The ERS
provides the basis for a plant-inducible system which has broad utility for both
basic research and commercial applications.
ACKNOWLEDGEMENTS
The authors acknowledge the support of Zeneca Agrochemicals in conducting

this work. We also thank P. Broad, D. Scanlon, S. Green (Zeneca Pharmaceuticals),
D. Pearson, B. Gross, P. Drayton, C. Sparks, J. Thompson and A. Greenland (Zeneca
Agrochemicals) for discussions and practical help.
REFERENCES
Aoyama, T. and Chua, N.-M. (1997) A glucocorticoid-mediated transcriptional

Aoyama, T., Dong, C.-H., Wu, Y., Carabelli, M., Sessa, G., Ruberti, I., Morelli, G. and
Chua, N.-H. (1995) Ectopic expression of the Arabidopsis transcriptional activator
Athb-1 alters leaf cell fate in tobacco. Plant Cell 7, 1773–1785.
Ashburner, M., Chihara, C., Meltzer, P. and Richards, G. (1974) Temporal control of
puffing activity in polytene chromosomes. Cold Spring Harbor Symposium.
Quantitative Biology 38, 655–662.
Beato, M. (1991) Transcriptional control by nuclear receptors. Federation of American
Societies for Experimental Biology Journal 5, 2044–2051.
Blackford, M. and Dinan, L. (1997) The tomato moth Locanobia oleracea (Lepidoptera:
Noctuidae) detoxifies ingested 20-hydroxyecdysone, but is susceptible to the agonist
RH5849 and RH5992. Insect Biochemistry and Molecular Biology 27, 167–177.
Blackford, M., Clarke, B. and Dinan, L. (1996) Tolerance of the Egyptian cotton leafworm
Spodoptera littoralis (Lepidoptera: Noctuidae) to ingested phytoecdysteroids. Journal
of Insect Physiology 42, 931–936.
Carlson, G.R., Aller, H.E., Ramsay, R., Slawecki, R., Thirugnanam, M. and Wing, K.
(1992) The insecticidal properties of non-steroidal ecdysone agonists. In: X Ecdysone
workshop, Liverpool, April 6–9, 1992, p. 31.
Carlson, G.R., Dhadialla, T.S., Ramsay, J.R., Thirugnanam, M., James, W.N., Aller, H.E.,
Hunter, R., Le, D.P. and Lidert, Z. (1996) New ecdysteroid agonist. In: XII Ecdysone
workshop, Barcelona, July 22–26, 1996, p. 39.
Christopherson, K.S., Melanie, M.R., Bajaj, V. and Godowski, P.J. (1992) Ecdysteroid-
dependent regulation of genes in mammalian cells by a Drosophila ecdysone
receptor and chimeric transactivators. Proceedings of the National Academy of Sciences
USA 89, 6314–6318.
Dhadialla, T.S. and Tzertzinis, G. (1997) Characterisation and partial cloning of
ecdysteroid receptor from a cotton boll weevil embryonic cell line. Archive Insect
Biochemistry Physiology 35, 45–57.
Elbrecht, A., Chen, Y., Jurgen, T., Hensens, O.D., Zink, B.L., Beck, H.T., Balick, M.J. and
Borris, R. (1996) 8-O-Acetylharpagide is a nonsteroidal ecdysteroid agonist. Insect
Biochemistry and Molecular Biology 26, 519–523.
Elke, C., Vogtli, M., Rauch, P., Spindle-Barth, M. and Lezzi, M. (1997) Expression of EcR
and USP in Escherichia coli: purification and functional studies. Archive Insect
Biochemistry Physiology 35, 59–69.
Evans, R.M. (1988) The steroid and thyroid hormone receptor superfamily: transcrip-
tional regulators of development and physiology. Science 240, 889–895.
Garoosi, G.A., Salter, M.G., Collin, H.A., Caddick, M.X. and Tomsett, A.B. (1997) The use
of an inducible gene expression cassette for transgenic tomato. Journal of
Experimental Botany 48S, 51.
Gatz, C. (1996) Chemically inducible promoters in transgenic plants. Current Opinion in
Biotechnology 7, 168–172.
Green, S. and Chambon, P. (1988) Nuclear receptors enhance our understanding of
transcriptional regulation. Trends in Genetics 4, 309–314.
Harmatha, J. and Dinan, L. (1997) Biological activity of natural and synthetic

ecdysteroids in the BII Bioassay. Archive Insect Biochemistry Physiology 35, 219–225.
Heller, J.J., Mattioda, H., Klein, E. and Sagenmuller, A. (1992) Proceedings of the 1992
Brighton Crop Protection Conference – Pest and Diseases. British Crop Protection
Council, Farnham Royal, pp. 59–65.
Hsu, A.C.-T. (1991) 1,2-Diacyl-1-alkylhydrazines, A new class of insect growth
regulator. In: Synthesis and Chemistry of Agrochemicals. American Chemical Society,
pp. 478–490.
Jefferson, R.A., Kavanagh, R.H. and Bevan, M.W. (1987) GUS fusions: β-glucuronidase
as a sensitive and versatile gene fusion marker in higher plants. The EMBO Journal
8, 3901–3907.
Jepson, I., Lay, V.J., Holt, D.C., Bright, S.W.J. and Greenland, A.J. (1994a) Cloning and
characterisation of maize herbicide safener-induced cDNAs encoding subunits of
glutathione S-transferase isoforms I, II and IV. Plant Molecular Biology 26, 1855–1866.
Jepson, I., Bell, P., Bright, S., Holt, D., Wright, S. and Greenland, A. (1994b) Control of
gene expression in transgenic plants using a chemically inducible promoter. Journal
of Cellular Biochemistry 18A, 110.
Kapitskaya, M., Wang, S., Cress, D.E., Dhadialla, T.S. and Raikhel, A.S. (1996) The
mosquito ultraspiracle homologue, a partner of ecdysteroid receptor heterodimer:
cloning and characterisation of isoforms expressed during vitellogenesis. Molecular
and Cellular Endocrinology 121, 119–132.
Koelle, M.R., Talbot, W.S., Segraves, W.A., Bender, M.T., Cherbas, P. and Hogness, D.S.
(1991) The Drosophila EcR gene encodes an ecdysone receptor, a new member of
the steroid receptor superfamily. Cell 67, 59–77.
Kothapalli, R., Palli, S.R., Ladd, T.R., Sohi, S.S., Cress, D., Dhadialla, T.S., Tzertzinis, G.
and Rethakaran, A. (1995) Cloning and developmental expression of the ecdysone
receptor gene from the spruce budworm, Choristoneura fumiferana. Developmental
Genetics 17, 319–330.
Le, D.P., Thirugnanam, M., Lidert, Z., Carlson, G.R. and Byan, J.B. (1996) RH2485: a new
selective insecticide for caterpillar control. Brighton Crop Protection Conference, Pest
and Diseases 1996. British Crop Protection Council, Farnham Royal, pp. 481–486.
Lehming, N., Sartoris, J., Niemoeller, M., Genenger, G., Wilcken-Bergmann, V. and
Mueller-Hill, B. (1987) The interaction of the recognition helix of the lac operator.
The EMBO Journal 6, 3145–3153.
Lehming, N., Sartoris, J., Kisters-Woike, B., Wilcken-Bergmann, V. and Mueller-Hill, B.
(1990) Mutant lac repressors with new specificities hint at rules for protein–DNA
recognition. The EMBO Journal 9, 615–621.
Lloyd, A.M., Schena, M., Walbot, V. and Davis, R.W. (1994) Epidermal cell fate
determination in Arabidopsis: patterns defined by a steroid inducible regulator.
Science 266, 436–439.
Ma, J., Przibilla, E., Hu, J., Bogorad, L. and Ptashne, M. (1988) GAL4-VP16 is an
unusually potent transcriptional activator. Nature (London) 334, 631–633.
Mangelsdorf, D.J., Thummel, C., Beato, M., Herrlich, P., Schutz, G., Umesono, K.,
Blumberg, B., Kastner, P., Mark, M., Chambon, P. and Evans, R. (1995) The nuclear
receptor superfamily: the second decade. Cell 83, 835–839.
Martinez, A,. Scanlon, D., Gross, B., Perara, A., Palli, S.R., Greenland, A., Windass, J.,
Pongs, O., Broad. P. and Jepson, I. (1999) Transcriptional activation of the cloned
Heliothis virescens (Lepidoptera) ecdysteroid receptor (HvEcR) by muristeroneA.
Insect Biochemistry and Molecular Biology (submitted).
Masgrau, C., Altabella, T., Farras, R., Flores, D., Thompson, A.J., Besford, R.T. and
Tiburcio, A.F. (1997) Inducible overexpression of oat arginine decarboxylase in
transgenic tobacco plants. The Plant Journal 11, 465–473.
Mett, V.L. Lockhead, L.P. and Reynolds, P.H.S. (1993) Copper-controllable gene
USA 90, 4567–4571.
Mikitani, K. (1996) A new nonsteroidal class of ligand for the ecdysteroid receptor 3,5-
di-tert-butyl-4-hydroxy-N-isobutyl-benzamide shows apparent insect molting
hormone activities at molecular and cellular levels. Biochemical and Biophysical
Research Communications 227, 427–432.
Moore, I., Baroux, C., Gaelweiter, L., Grosskopt, D., Mader, P., Schell, J. and Palme, K.
(1997) A transactivation system for regulating expression of transgenes in whole
plants. Journal of Experimental Botany 48S, 51.
No, D., Yao, T.-P. and Evans, R.M. (1996) Ecdysone inducible gene expression in
mammalian cells and transgenic mice. Proceedings of the National Academy of Sciences
USA 93, 2246–3351.
10421–10425.
Simon, R., Igeno, I.-M. and Coupland, G. (1996) Activation of floral meristem identity
genes in Arabidopsis. Nature 384, 59–62.
Sweetman, J.P., Paine, J.A.M., Greenland, A.J., Jones, H. and Jepson, I. (1997)
Characterisation of an ethanol inducible gene switch in tobacco and oil seed rape.
Journal of Experimental Botany 48S, 52.
Swevers, L., Drevet, J.R., Lunke, M.D. and Iatrou, K. (1995) The silkmoth homolog of the
Drosophila ecdysone receptor (B1 isoform): cloning and analysis of expression
during follicular cell differentiation. Insect Biochemistry and Molecular Biology 25,
857–866.
Swevers, L., Cherbas, L., Cherbas, P. and Iatrou, K. (1996) Bombyx EcR (BmEcR) and
Bombyx USP (BMCF1) combine to form a functional ecdysone receptor. Insect
Biochemistry and Molecular Biology 26, 217–221.
Thomas, H.E., Stunnenberg, H.G. and Steward, A.F. (1993) Heterodimerisation of the
Drosophila ecdysone receptor with retinoid X receptor and ultraspiracle. Nature 362,
471–475.
Tomsett, A.B., Salter, M.G., Garoosi, G.A., Caddick, M.X., Paine, J.A.M., Sweetman, J.,
Greenland, A.J. and Jepson, I. (1997) A chemically-inducible gene cassette for
transgenic plants. Journal of Experimental Botany 48S, 46.
Vegeta, E., Allan, G.T., Schrader, W.T., Tsai, M.-J., McDonnell, D.P. and O’Malley, B.W.
(1992) The mechanism of RU486 antagonism is dependent on the conformation of
the carboxy-terminal tail of the human progesterone receptor. Cell 69, 703–713.
Wang, Y., DeMayo, F.J., Tsai, S.Y. and O’Malley, B.W. (1997) Ligand-induced and liver
expression in transgenic mice. Nature Biotechnology 15, 239–243.
Wilde, R.J., Shufflebottom, D., Cooke, S., Jasinska, I., Merryweather, A., Beri, R.,
Brammar, W.J., Bevan, M. and Schuch, W. (1992) Control of gene expression in
tobacco cells using a bacterial operator-repressor system. The EMBO Journal 11,
1251–1259.
Wilde, R.J., Cooke, S.E., Brammar, W.J. and Schuch, W. (1994) Control of gene
expression in plant cells using a 434:VP16 chimeric protein. Plant Molecular Biology
24, 381–388.
Williams, S., Friedrich, L., Dincher, S., Carozzi, N., Kessmann, H., Ward, E. and Ryals, J.
(1992) Chemical regulation of Bacillus thuringiensis d-endotoxin expression in
transgenic plants. Biotechnology 10, 540–543.
Wing, K.D. (1988) RH5948, a non steroidal ecdysone agonist: effects on a Drosophila cell
line. Science 241, 467–469.
Wing, K.D., Slawecki, R.A. and Carlson, G.R. (1988) RH5849, a nonsteroidal ecdysone
agonist: effects on larval lepidoptera. Science 241, 470–472.
Yang, G., Hannan, G.N., Lockett, T.J. and Hill, R.J. (1995) Functional transfer of an
elementary ecdysone gene regulatory system to mammalian cells: transient trans-
fections and stable cell lines. European Journal of Entomology 92, 379–389.
Yao, T.P., Segraves, W.A., Oro, A.E., McKeown, M. and Evans, R.M. (1992) Drosophila
ultraspiracle modulates ecdysone receptor function via heterodimer formation. Cell
71, 63–72.
Yao, T.P., Forman, B.M., Jiang, Z., Cherbas, L., Chen, J.D., McKeown, M., Cherbas, P. and
Evans, R.M. (1993) Functional ecodysone receptor is the product of EcR and
ultraspiracle genes. Nature 366, 476–479.
Glucocorticoid-inducible Gene
4
Expression in Plants
Takashi Aoyama
Institute for Chemical Research, Kyoto University, Uji, Kyoto

611, Japan
INTRODUCTION
Transgenic techniques have become a general approach in both basic and

applied plant sciences. Many genes have been introduced into plants and
expressed under the control of various promoters. Quite often ectopic over-
expression of transgenes by a constitutively active promoter is sufficient to
provide evidence of their actions. On the other hand, the judicious choice of
the most appropriate promoter for transgene expression is critical in realizing
the huge potential of transgenic plants. Many native promoters characterized
in the literature can be used to express a transgene. Promoters active in specific
cell types and responding to specific environmental stimuli or plant hormones
are useful in limiting the location or the timing of transgene expression.
Transgenic experiments with well-characterized promoters have actually
provided us with valuable evidence for functions of plant genes.
Although the use of native promoters is a promising way of expressing
transgenes, other types of expression systems are still required for a variety of
purposes. For example, in the case of a transgene product whose ectopic
expression is toxic to plants, it is difficult to use native promoters acting either
constitutively or at different developmental stages, because plants expressing
the transgene cannot be maintained. A more common problem is the need to
induce transgene expression without any pleiotropic effects on plants, i.e. the
need to observe the effect of transgene expression. Transcriptional induction
using native plant promoters responding to either environmental stimuli or
plant hormones is necessarily accompanied by the normal physiological
responses of the plant, which may complicate analysis of the effects of the
transgenes. For these reasons, induction systems which differ from those
44 T. Aoyama
normally found in plants, and which have no background level or pleiotropic

effects, are highly desirable (for a review see Gatz, 1996).
Three types of transcriptional induction systems have been developed as
candidates for such an expression system. They are: (i) systems using the
tetracycline repressor of the bacterial transposon TetR (Gatz et al., 1992;
Weinmann et al., 1994); (ii) the copper ion-responding yeast transcription
factor ACE1 (Mett et al., 1993); and (iii) the mammalian glucocorticoid
receptor (GR) (Aoyama and Chua, 1997). This chapter describes the system
using the GR regulatory mechanism.
For many years, an induction system in plants based on GR has been
thought of as ideal, since glucocorticoid is highly permeable in cells and has no
detectable effects on plants. In fact, a system based on GR and glucocorticoid
response elements (GREs) was used as an effective transient expression system
in cultured plant cells (Schena et al., 1991), although the system did not work
in transgenic plants (Lloyd et al., 1994). Recently, a novel glucocorticoid-
inducible transcription system that functions in transgenic plants has been
developed, which uses only the hormone-binding domain (HBD) of the GR
protein as a regulatory domain in a chimeric transcription factor (Aoyama and
Chua, 1997). In the following sections, the regulation and utility of the GR HBD
are outlined first. Then, the construction, use and characteristics of the
glucocorticoid-inducible gene expression system are described. Finally, the
potential of this steroid-inducible system as an ideal induction system in plants
is discussed.
REGULATORY MECHANISM OF THE GR
GR is a member of the nuclear receptor super-family. This family includes

receptors for various hydrophobic ligands including thyroid hormones, vitamin
D, retinoic acid and steroids (for reviews see: Evans, 1988; Green and Chambon,
1988; Beato, 1989; Laudet et al., 1992). Each nuclear receptor functions as the
sensor for its ligand as well as a transcription factor regulating the expression
of target genes by binding to specific cis-acting sequences. Nuclear receptors
consist of at least four domains (Fig. 4.1a). The A/B and D domains function as
a transactivating domain and a hinge domain, respectively. The DNA-binding
(C) domain is the most conserved and contains two zinc finger structures which
bind specific DNA sequences (Green et al., 1988; Umesono and Evans, 1989).
The carboxyl terminal (E) domain plays a role in ligand-binding, dimerization,
and transcriptional regulation (Rusconi and Yamamoto, 1987; Forman and
Samuels, 1990). The E domains of hormone receptors are also called hormone-
binding domains (HBDs). Many systems for the artificial regulation of gene
expression have been developed which employ nuclear receptors and their
specific cis-acting elements (Picard et al., 1990; No et al., 1996).
Rather than using the nuclear receptors themselves, a more attractive
approach for regulation of protein functions is to make use of the HBDs of
Glucocorticoid-inducible Gene Expression 45
(a)
N9 C9
A/B C D E (HBD)
(b)
HSP90 complex
Inactive Functional domain HBD
Hormone
Active
Fig. 4.1. (a) General structure of nuclear receptor proteins (Evans, 1988; Green and
Chambon, 1988; Forman and Samuels, 1990). The A/B, C and D domains function
as a transactivating domain, a DNA-binding domain and a hinge domain,
respectively. The E domain (HBD) plays a role in ligand binding, dimerization and
regulation of transcription. (b) Model for the regulatory mechanism of HBDs (Picard
et al., 1988; Beato, 1989; Picard, 1993, 1994). In the absence of hormone, the
HBDs repress the function of sterically neighbouring domains by forming a
complex with multiple proteins including the heat-shock protein HSP90 (inactive
state). Hormone-binding releases the complex resulting in de-repression (active
state).
steroid hormone receptors. HBDs can function as regulatory domains in cis with
fusion proteins, as well as with their own receptors (Picard et al., 1988). A
model of the regulatory mechanism of HBDs is illustrated in Fig. 4.1b. It is
believed that, in the absence of ligands, HBDs repress the function of sterically
neighbouring domains by forming a complex with multiple proteins including
the heat-shock protein HSP90. Ligand binding releases the complex resulting
in de-repression (Picard et al., 1988; Beato, 1989; Picard, 1993, 1994).
Although the HSP90 complex is necessary for the regulation of HBDs, the inter-
action between the complex and the HBDs does not seem to be species-specific,
since mammalian GR functions in other eukaryotes, including yeast and plants
(Schena and Yamamoto, 1988; Schena et al., 1991). It is believed that this role
of the HSP90 complex is evolutionarily conserved among eukaryotes (Stancato
et al., 1996). Table 4.1 shows examples of experiments in which HBDs have
been used for the regulation of heterologous proteins. The proteins listed include
04 Inducible Gene 04
46
Table 4.1. Heterologous proteins regulated by HBDs.
Proteins Functions HBDs Systems References
E1A Transcription factor GR Tissue culture cells Picard et al., 1988

c-Myc Transcription factor ERa Tissue culture cells Eilers et al., 1989
3/16/99 11:09 AM
Rev Post-transcriptional activator GR Tissue culture cells Hope et al., 1990
c-Fos Transcription factor GR, ER Tissue culture cells Superti-Furga et al., 1991
c-Myb Transcription factor ER Tissue culture cells Burk and Klempnauer, 1991
C/EBP Transcription factor GR, ER Tissue culture cells Umek et al., 1991
v-Rel Transcription factor ER Tissue culture cells Boehmelt et al., 1992
GATA-2 Transcription factor ER Tissue culture cells Briegel et al., 1993
GAL4-VP16 Transcription factor ER Yeast Louvion et al., 1993
MyoD Transcription factor ER Tissue culture cells Hollenberg et al., 1993
T. Aoyama
Page 46
c-Abl Tyrosine kinase ER Tissue culture cells Jackson et al., 1993
RafI Serine/threonine kinase ER Tissue culture cells Samuels et al., 1993
GCN4 Transcription factor ER, MRb Tissue culture cells Fankhauser et al., 1994
R Transcription factor GR Transgenic Arabidopsis Lloyd et al., 1994
ATHB1-VP16 Transcription factor GR Transgenic tobacco Aoyama et al., 1995
Cre Site-specific recombinase ER Tissue culture cells Metzger et al., 1995
CO Putative transcription factor GR Transgenic Arabidopsis Simon et al., 1996
Fas Cell surface receptor ER Tissue culture cells Kawaguchi et al., 1997
GAL4-VP16 Transcription factor GR Transgenic plants Aoyama and Chua, 1997
a ER, oestrogen receptor; b MR, mineralocorticoid receptor.
not only transcription factors but also protein kinases (Jackson et al., 1993;
Samuels et al., 1993), a site-specific DNA recombinase (Metzger et al., 1995)
and a cell surface receptor (Kawaguchi et al., 1997). Initially, most experiments
were performed with mammalian and avian tissue cultures. Although this
method should work in transgenic mammals, it is difficult to analyse the results
of such induction experiments in animals because of the effects of endogenous
steroid hormones and their receptors.
On the other hand, this induction system could become a powerful tool in
transgenic plants, which have no natural receptors for the vertebrate steroids.
Experiments in which transcription factors and a putative transcription factor
were regulated with the rat GR HBD in transgenic plants have been described
(Lloyd et al., 1994; Aoyama et al., 1995; Simon et al., 1996). The maize
regulatory factor R belongs to the family of Myc-type transcription factors
(Ludwig et al., 1989). Expression of this gene product complements the
Arabidopsis regulatory mutation transparent testa glabra (ttg) (Lloyd et al., 1992).
Lloyd et al. (1994) constructed a gene encoding a fusion protein between R and
the rat GR (R-GR) HBD, and introduced it into the ttg mutant. In generated
transgenic plants, trichome formation on the developing leaf epidermis was
artificially induced by glucocorticoid treatment. In an experiment with
ATHB-1, an Arabidopsis homeodomain protein (Ruberti et al., 1991), a chimeric
transcription factor consisting of the ATHB-1 DNA-binding domain, the
transactivating domain of the herpes viral protein VP16, and the rat GR HBD
(HDZip1-VP16-GR) was expressed in transgenic tobacco plants (Aoyama et al.,
1995). The transgenic plants showed aberrant palisade parenchyma develop-
ment and de-etiolated phenotypes when grown in the dark only when they were
treated with glucocorticoid. In another example, the GR HBD was fused to the
putative transcription factor encoded by the Arabidopsis flowering-time gene
CONSTANS (CO) (Putterill et al., 1995; Simon et al., 1996). Transgenic co
mutant plants expressing the fusion protein (CO-GR) flowered earlier when
treated with glucocorticoid.
The artificial control of a protein function by HBDs is a very powerful
technique for studying the regulatory cascade involving that protein. Fusion
proteins formed from transcription factors and HBDs are especially useful for
the analysis of a transcription network. Since the induction of transcriptional
activation does not require de novo protein synthesis, we can identify those
transcripts directly activated by that transcription factor from others which are
activated indirectly, by using conditions in which protein synthesis is inhibited.
Direct target genes of the Myc transcription factor have been identified using a
fusion protein to an oestrogen receptor HBD in animal tissue cultures (Eilers et
al., 1991; Grandori and Eisenman, 1997). It is anticipated that appropriate
studies will be performed that reveal the network of transcriptional regulation
involved in plant morphogenesis by using the induction systems for R-GR,
HDZip1-VP16-GR and CO-GR.
In general, it is difficult to construct a fusion protein with novel charac-
teristics. We cannot always design a successful fusion protein, even if the 3-D
48 T. Aoyama
structure of each domain is known. One promising method is to mimic the

design of a fusion protein that has already been found to work successfully.
Therefore, fusion with the HBDs of steroid hormone receptors is one of the most
promising ways of artificially regulating a protein’s function. The various
applications of HBD fusion shown in Table 4.1 suggest that the HBD mechanism
of regulating protein function in eukaryotes has the potential for widespread use.
CONSTRUCTION OF THE GVG SYSTEM
Because the HBD of mammalian GR functions in transgenic plants, a

transcriptional induction system was constructed using the HBD as a regulatory
domain in a chimeric transcription factor. To avoid cross-communication with
endogenous regulatory systems in plants, the other components of the system
were also obtained from non-plant sources. The chimeric transcription factor
consisted of the DNA-binding domain of the yeast GAL4 (Keegan et al., 1986),
the transactivating domain of the herpes viral protein VP16 (Triezenberg et al.,
1988), and the HBD of rat GR (Picard et al., 1988) (Fig. 4.2a). GAL4 belongs to
the class of zinc finger proteins and binds to specific DNA sequences designated
as GAL4 upstream activating sequences (UASGs) (Giniger et al., 1985). The
minimum DNA-binding domain of GAL4 (amino acids 1–74) (Laughon and
Gesteland, 1984) was used. The VP16 domain, an acidic-type transactivating
domain, is expected to act as a strong transactivator in all cell types, because it
interacts directly with general transcription factors, which are thought to be
evolutionarily conserved among eukaryotes (Sadowski et al., 1988; Lin et al.,
1991; Goodrich et al., 1993). Amino acids 413–490 of VP16 (Dalrymple et al.,
1985) were fused to the C terminus of the GAL4 domain. The resulting fusion
protein, GAL4–VP16, strongly activated transcription from a promoter
containing six copies of UASG in a transient expression experiment assayed by
particle bombardment of tobacco leaves (T. Aoyama et al., unpublished). The
HBD of the rat GR (amino acids 519–795) (Miesfeld et al., 1986) was added to
this strong transcription factor. The resulting transcription factor was designated
as GVG because it consisted of one domain each from GAL4, VP16 and GR. The
GVG protein strongly activates transcription from a promoter containing UASGs
only in the presence of glucocorticoid. As shown in Fig. 4.2a, the coding
sequence of GVG was placed between the 35S promoter of the cauliflower mosaic
virus (Odell et al., 1985) and the polyA addition sequence of the pea ribulose
bisphosphate carboxylase small subunit rbcS-E9 gene (Coruzzi et al., 1984). In
the trans construct, the 35S promoter can be replaced by other promoters using
restriction sites at its ends. The expression of GVG by a tissue-specific promoter
allows us to induce transgene expression only in a specific tissue.
A DNA fragment containing six copies of UASG was chosen as the cis-
acting element and placed upstream of the TATA box sequence of the 35S
promoter. As shown in Fig. 4.2b, there are two restriction sites between the
promoter and the polyA addition sequence of the pea rbcS-3A that can be used
(a)
Sse8387l PmeI
35S
promoter GAL4 VP16 GR E9
XhoI SpeI
(b)
GxGAL4
UAS TATA 3A
Fig. 4.2. Structures of the trans and cis constructs in the GVG system. (a) Structure
of the trans construct. The DNA fragments encoding the chimeric transcription
factor GVG was placed between the cauliflower mosaic virus 35S promoter (Odell
et al., 1985) and the poly(A) addition sequence of the pea ribulose bisphosphate
carboxylase small subunit rbcS-E9 (Coruzzi et al., 1984). The 35S promoter can be
replaced with other promoters using the restriction sites indicated as Sse8387I and
PmeI. (b) Structure of the cis construct. The inducible promoter contains six copies
of the UASG and the TATA box region (246 to +1) of the 35S promoter. A DNA
fragment to be transcribed inducibly can be placed between the promoter and the
polyA addition sequence of the pea rbcS-3A (Fluhr et al., 1986) using the restriction
sites indicated as XhoI and SpeI.
for cloning (Fluhr et al., 1986). We can make transgenic plants that express a
specific, hormone-inducible, gene by cloning the coding region in the cis
construct and introducing it into plants along with the trans construct.
INDUCTION EXPERIMENTS WITH THE GVG SYSTEM
The inducibility of the GVG system has been studied in transgenic tobacco
(Aoyama and Chua, 1997). The 35S-driven GVG gene was introduced into
transgenic tobacco together with a cis construct containing the luciferase (luc)
gene (de Wet et al., 1987) as a reporter. Induction of luciferase activity was
observed when the transgenic tobacco plants were treated with dexamethasone
(DEX), a strong synthetic glucocorticoid. The maximum expression level was
over 100 times that of non-induction levels. The induction levels correlated
with DEX concentrations ranging from 0.1 to 10 mM when the plants were
grown on an agar medium containing DEX. In Northern hybridization analysis
with RNAs from hydroponic plants, luc mRNA was detected 1 h after DEX
treatment and levels increased to a maximum over 4 h (Aoyama and Chua,
1997). In this section, important aspects of induction experiments are described
as well as the results of experiments with transgenic Arabidopsis.
50 T. Aoyama
The same cis and trans constructs used in transgenic tobacco were
introduced into Arabidopsis thaliana (ecotype Columbia) and induction
experiments were carried out with homozygous T3 plants. In experiments using
whole plants, water flow through the vascular system and molecular diffusion
are both factors involved in the delivery of glucocorticoid to tissues. Since
glucocorticoid is a small hydrophobic chemical and diffuses directly into
vertebrate cells without any special transport mechanisms, it is thought that
glucocorticoid can also diffuse through plant cell walls and membranes. There
are two general methods for treating plants with glucocorticoid. In the first,
glucocorticoid is absorbed from the plant surface. Spraying is an easy way to
deliver a glucocorticoid solution to the plant surface. This method is especially
effective when the exposed epidermal tissue is the target of induction. Figure
4.3a shows the result of a spraying experiment with transgenic Arabidopsis
carrying the luc reporter gene. In this experiment, induced luciferase activity
was detectable within 30 min of spraying.
The other group of methods involve the uptake of glucocorticoid by the
vascular system, e.g. from roots or the cut ends of shoots. Induction can be
stimulated by simply pouring DEX solution into a pot (Fig. 4.3b). This method
allows us to perform induction experiments with healthy plants grown under
natural conditions, although we cannot be certain how much DEX is taken up
by individual plants. Hydroponic plants, cuttings and leaves all take up
glucocorticoids through their roots or cut ends. As long as plants are grown
under open air conditions, glucocorticoid is delivered through the vascular
system to peripheral tissues quickly. In the experiment shown in Fig. 4.3b, the
induction of luciferase activity was detectable in leaves 30 min after adding
DEX. Under open air conditions, however, hormone concentrations are thought
to vary throughout a plant. The hormone accumulates in leaves in higher
concentrations, as a result of transpirational water flow.
It is very difficult to deliver glucocorticoid uniformly throughout a plant.
One possible way of doing so is by growing enclosed plants on an agar medium
containing DEX under airtight conditions. Under these conditions, there is little
Fig. 4.3. (Opposite) Luciferase activity induced in Arabidopsis. Induction

experiments were performed with transgenic Arabidopsis carrying the 35S-driven
GVG gene and the luc reporter gene. (a) Transgenic plants grown in a pot for 4
weeks were sprayed with the luciferin solution containing 0.5 µM potassium
luciferin and 0.01% (w/v) Tween 20. After 30 min, luciferase luminescence from
the plants was imaged using a high-sensitivity camera system (Hamamatsu
Photonic Systems) (left). Then the plants were sprayed with a solution containing
30 µM DEX and 0.01% (w/v) Tween 20. Twenty-four hours later, the plants were
sprayed again with the luciferin solution and imaged (right). (b) Transgenic plants
grown in a pot for 4 weeks were sprayed with the luciferin solution and luciferase
luminescence from the plants was imaged as described above (left). Then a solution
containing 30 µM DEX was poured into the pot. Twenty-four hours later, the plants
were sprayed again with the luciferin solution and imaged (right).
Fig. 4.3. (Continued)

52 T. Aoyama
transpirational water flow, so hormone concentrations remain relatively similar

throughout the plant. The induction level of transgene expression can be
controlled by varying the DEX concentration in the agar medium. Figure 4.4
shows how induction depends on the concentration of DEX. A good correlation
between DEX concentrations and induction levels was obtained over concen-
trations from 3 nM to 300 nM. A significant level of induced luciferase activity
was detected at a concentration of 3 nM or higher and the maximum induction
level was over 1000 times higher than the non-induction level in Arabidopsis. In
a similar experiment with tobacco (Aoyama and Chua, 1997), a 30-fold higher
concentration was required for detectable induction and the maximum
induction level was about 100 times that of the non-induction level. It is thought
that both the high sensitivity and inducibility of Arabidopsis are due to the low
non-induction level. Non-induction levels were generally lower in Arabidopsis
than in tobacco, although levels vary among transgenic lines in both species.
Fig. 4.4. Luciferase activity induced by different concentrations of DEX. Transgenic

Arabidopsis plants carrying the 35S-driven GVG gene and the luc reporter gene
were germinated and grown on an agar medium for 14 days, then transferred to a
fresh agar medium containing different concentrations of DEX for an additional 2
days. Relative luciferase activities were plotted against DEX concentrations. The
value obtained at 0 nM DEX (the non-induction level) was arbitrarily set as 1.
Extraction of luciferase and assays for relative luciferase activities were carried out
as described by Millar et al. (1992).
CHARACTERISTICS OF THE GVG SYSTEM
One of the characteristics of an ideal induction system is that the inducer must
not evoke pleiotropic effects that might complicate the analysis of the resulting
phenomena. DEX, at least at the concentrations used in induction experiments,
does not have any observable physiological effects in wild-type (wt) tobacco or
Arabidopsis. Even in experiments in which DEX was assumed to accumulate at
high concentrations in leaves, no adverse effects have been observed in the
leaves. A class of steroids, the brassinosteroids, has strong physiological effects
in plants (for reviews see Mandava, 1988; Li et al., 1996; Hooley, 1996). It is
thought that glucocorticoids do not interact with the signal transduction
pathway of brassinosteroids, since the molecular structure required for the
biological activity of brassinosteroids (Yokota and Mori, 1992) is not found in
glucocorticoids.
Another requirement of an ideal induction system is that the non-
induction level of transgene expression is minimal or absent. Most of the
transgenic Arabidopsis lines carrying the 35S-promoter-driven GVG gene and
the luc reporter gene have very low levels of luciferase activity under non-
induction conditions. In some Arabidopsis lines, no activity was detected at non-
induction levels. Nevertheless, there may be a basal level of constitutive
induction because the inducible promoter of the GVG system contains an ideal
TATA box sequence. It might be possible to find a transgenic plant whose non-
induction level is zero by screening many transgenic lines, as both the non-
induction and induction levels vary from line to line. As a case in point,
transgenic Arabidopsis plants carrying the 35S-driven GVG gene and an
inducible diphtheria toxin gene have been produced (T. Aoyama et al.,
unpublished). Expression of diphtheria toxin kills a cell even at a very low level
(Palmitter et al., 1987; Thorsness et al., 1991). The plants that survived under
non-induction conditions were killed immediately by DEX treatment, so the
non-induction level of the toxin gene expression is believed to be almost zero in
these plants.
The characteristics of glucocorticoid as an inducer provide an advantage
to the GVG system. Since glucocorticoid permeates cells easily, rapid induction
of gene expression can be initiated in a variety of ways. By measuring luciferase
activity, induction of gene expression was detectable within 30 min of DEX
treatment under open air conditions. Glucocorticoid is one of the most-studied
biological compounds and has many derivatives. The intensity and sustain-
ability of induction vary with the use of different glucocorticoids (Aoyama and
Chua, 1997). In an experiment with transgenic tobacco, plants treated with
DEX maintained an induced level of luciferase activity for a longer period than
those treated with triamcinolone acetonide, while both groups of plants showed
the same initial level of induction. It is hypothesized that triamcinolone
acetonide is less stable in plants than DEX. Over 100 different glucocorticoid
derivatives are available from commercial sources. Some of these may be very
stable in plants, while others are degraded rapidly. The respective types of
54 T. Aoyama
glucocorticoids would be useful for stable and transient induction. Moreover,

glucocorticoid antagonists might be used for suppressing induction.
It is possible to control the amount of transgene expression using the GVG
system. As shown by the experiment in Fig. 4.4, the induction level can be
regulated using different concentrations of DEX. This feature allows us to
analyse dose-dependent effects of induced gene products under a constant
genetic background. Such regulation, however, can only be performed
effectively under enclosed conditions, where the concentration of DEX is
relatively even throughout a plant. In open-air conditions, it is difficult to
control the concentration of glucocorticoid throughout a plant, as discussed
above. In such cases, the induction level might be regulated by using different
glucocorticoids. The level of induced luciferase activity using an excess
concentration of hydrocortisone, a natural glucocorticoid, was over 30-times
less than that in response to DEX in tobacco (Aoyama and Chua, 1997).
PROSPECT OF THE STEROID-INDUCIBLE SYSTEM IN PLANTS
The GVG system is the first steroid-inducible transcription system developed in

transgenic plants. Although the system has been designed to work effectively in
a variety of experiments, aspects of the system can be improved for specific
experiments. First, modifications in the cis construct might reduce the non-
induction level. It is hypothesized that replacement of the ideal TATA box
sequence of the inducible promoter would decrease both the non-induction and
induction levels. Such a modification would be effective in cases that require a
low non-induction level rather than a high induction level. Conversely,
increasing the number of UASG repeats might elevate induction levels.
The trans construct, i.e. the GVG gene, can also be modified in many ways.
Since each of the three domains that make up the GVG protein can function
independently, they should be interchangeable with other domains of similar
functions. A chimeric transcription factor consisting of the DNA-binding
domain from ATHB-1 and the same VP16-GR cassette of the GVG protein
worked as a regulatable transcription factor in transgenic tobacco (Aoyama et
al., 1995). Many bacterial repressors, whose structures and functions are well
characterized (e.g. lacI (Labow et al., 1990), LexA (Godowski et al., 1988) and
TetR (Gossen and Bujard, 1992; Weimann et al., 1994)), might be used as
alternative DNA-binding domains in the GVG system. With TetR it might be
possible to develop a dual-control system, in which transgene expression is
induced and repressed by glucocorticoid and tetracycline, respectively. Such a
system would be very useful when quick induction and repression of transgene
expression are both required. The HBD of the GVG protein can also be replaced
by that of other hormone receptors. As shown in Table 4.1, the HBD of an
oestrogen receptor (e.g. Eilers et al., 1989; Superti-Furga et al., 1991) and a
mineralocorticoid receptor (Fankhauser et al., 1994) have both been used as
regulatory domains in chimeric transcription factors. Using a different DNA-
binding domain and the HBD of another steroid hormone receptor, it is possible
to develop a second steroid induction system that could be used in combination
with the GVG system.
The promoter of the GVG gene can also be modified, as previously described.
Induction of transgene expression in a specific tissue, so-called spacio-temporal
gene expression, is possible using a tissue-specific promoter for the GVG gene.
In unicellular systems, like yeast and tissue culture cells, we can perform
induction uniformly and analyse the events that are induced in a single type of
cell, but in multicellular organisms, such as higher plants, it is very difficult to
perform induction uniformly in all cell types. Even assuming that uniform
induction is possible, it would be difficult to assess the results due to the variety
of responses by different cell types. Inducible gene expression in multicellular
organisms is thus fundamentally different from that in unicellular systems. To
overcome this weakness, induction should be limited to specific types of cells.
Spatio-temporal gene expression by the GVG system will allow us to perform
simpler induction experiments in complex organisms.
The GVG system is designed to be very flexible and hence the steroid-
inducible system has the potential to become the ideal induction system in
plants. As described above, an ideal induction system for plants should have no
non-induction levels or pleiotropic effects. Even if such an ideal system exists
theoretically, it is very difficult to prove that any system really satisfies these
criteria. It is important that users of induction systems understand the charac-
teristics of the systems thoroughly and carefully design each experiment to
obtain the optimal results.
ACKNOWLEDGEMENTS
Research by this laboratory has been supported in part by a Grant-in-Aid for

scientific research on priority areas from the Ministry of Education, Science and
Culture, Japan (09251210). I would like to thank Drs Nam-Hai Chua and
Kazuhiko Umesono for their suggestions on the chapter.
REFERENCES
Aoyama, T. and Chua, N.-H. (1997) A glucocorticoid-mediated transcriptional

Aoyama, T., Dong, C.-H., Wu, Y., Carabelli, M., Sessa, G., Ruberti, I., Morelli, G. and
Chua, N.-H. (1995) Ectopic expression of the Arabidopsis transcription activator
Athb-1 alters leaf cell fate in tobacco. Plant Cell 7, 1773–1785.
Beato, M. (1989) Gene regulation by steroid hormones. Cell 56, 335–344.
Boehmelt, G., Walker, A., Kabrun, N., Mellitzer, G., Beug, H., Zenke, M. and Enrietto, P.J.
(1992) Hormone-regulated v-rel estrogen receptor fusion protein: reversible
induction of cell transformation and cellular gene expression. The EMBO Journal 11,
4641–4652.
56 T. Aoyama
Briegel, K., Lim, K.C., Plank, C., Beug, H., Engel, J.D. and Zenke, M. (1993) Ectopic
expression of a conditional GATA-2/estrogen receptor chimera arrests erythroid
differentiation in a hormone-dependent manner. Genes & Development 7,
1097–1109.
Burk, O. and Klempnauer, K.H. (1991) Estrogen-dependent alterations in differentiation
state of myeloid cells caused by a v-myb/estrogen receptor fusion protein. The EMBO
Journal 10, 3713–3719.
Coruzzi, G., Broglie, R., Edwards, C. and Chua, N.-H. (1984) Tissue-specific and light-
regulated expression of a pea nuclear gene encoding the small subunit of ribulose-
1,5-bisphosphate carboxylase. The EMBO Journal 3, 1671–1679.
Dalrymple, M.A., McGeoch, D.J., Davison, A.J. and Preston, C.M. (1985) DNA sequence
of the herpes simplex virus type 1 gene whose product is responsible for transcrip-
tional activation of immediate early promoters. Nucleic Acids Research 13,
7865–7879.
de Wet, J.R., Wood, K.V., DeLuca, M., Helinski, D.R. and Subramani, S. (1987) Firefly
luciferase gene: structure and expression in mammalian cells. Molecular and Cellular
Biology 7, 725–737.
Eilers, M., Picard, D., Yamamoto, K.R. and Bishop, J.M. (1989) Chimaeras of myc
oncoprotein and steroid receptors cause hormone-dependent transformation of
cells. Nature 340, 66–68.
Eilers, M., Sabine, S. and Bishop, J.M. (1991) The MYC protein activates transcription of
the a-prothymosin gene. The EMBO Journal 10, 133–141.
Evans, R.M. (1988) The steroid and thyroid hormone receptor super-family. Science 240,
889–895.
Fankhauser, C.P., Briand, P.A. and Picard, D. (1994) The hormone binding domain of
the mineralcorticoid receptor can regulate heterologous activities in cis. Biochemical
and Biophysical Research Communications 200, 195–201.
Fluhr, R., Moses, P., Morelli, G., Coruzzi, G. and Chua, N.-H. (1986) Expression dynamics
of the pea rbcS multigene family and organ distribution of the transcripts. The
EMBO Journal 5, 2063–2071.
Forman, B.M. and Samuels, H.H. (1990) Interaction among a subfamily of nuclear
hormone receptors: the regulatory zipper model. Molecular Endocrinology 4,
1293–1301.
Gatz, C. (1996) Chemically inducible promoters in transgenic plants. Current Opinion in
Biotechnology 7, 168–172.
Giniger, E., Varnum, S. and Ptashne, M. (1985) Specific DNA binding of GAL4, a positive
regulatory protein of yeast. Cell 40, 767–774.
Godowski, P.J., Picard, D. and Yamamoto, K.R. (1988) Signal transduction and
transcriptional regulation by glucocorticoid receptor–LexA fusion proteins. Science
241, 812–816.
Goodrich, J.A., Hoey, T., Thut, C.J., Admon, A. and Tjian, R. (1993) Drosophila TAFII40
interacts with both a VP16 activation domain and the basal transcription factor
TFIIB. Cell 75, 519–530.
Gossen, M. and Bujard, H. (1992) Tight control of gene expression in mammalian cells
by tetracycline responsive promoters. Proceedings of the National Academy of Sciences
USA 89, 5547–5551.
Grandori, C. and Eisenman, R.N. (1997) Myc target genes. Trends in Biochemical Science
22, 177–181.
Green, S. and Chambon, P. (1988) Nuclear receptors enhance our understanding of
transcription regulation. Trends in Genetics 4, 309–314.
Green, S., Kumar, V., Theulaz, I., Wahli, W. and Chambon, P. (1988) The N-terminal
DNA-binding ‘zinc finger’ of the oestrogen and glucocorticoid receptors determines
target gene specificity. The EMBO Journal 7, 3037–3044.
Hollenberg, S.M., Cheng, P.F. and Weintraub, H. (1993) Use of a conditional MyoD
transcription factor in studies of MyoD trans-activation and muscle determination.
Proceedings of the National Academy of Sciences USA 90, 8028–8032.
Hooley, R. (1996) Plant steroid hormones emerge from the dark. Trends in Genetics 12,
281–283.
Hope, T.J., Huang, X.J., McDonald, D. and Parslow, T.G. (1990) Steroid receptor fusion of
the human immunodeficiency virus type 1 Rev transactivator: mapping cryptic
functions of the arginine-rich motif. Proceedings of the National Academy of Sciences
USA 87, 7787–7791.
Jackson, P., Baltimore, D. and Picard, D. (1993) Hormone-conditional transformation by
fusion proteins of c-Abl and its transforming variants. The EMBO Journal 12,
2809–2819.
Kawaguchi, Y., Takebayashi, H., Kakizuka, A., Arii, S., Kato, M. and Imamura, M. (1997)
Expression of Fas–estrogen receptor fusion protein induces cell death in pancreatic
cancer cell lines. Cancer Letters 116, 53–59.
Keegan, L., Gill, G. and Ptashne, M. (1986) Separation of DNA binding from the
transcription-activating function of eukaryotic regulatory protein. Science 231,
699–704.
Labow, M.A., Bain, S.B., Shenk, T. and Levine, A.J. (1990) Conversion of the lac repressor
into an allosterically regulated transcriptional activator for mammalian cells.
Molecular and Cellular Biology 10, 3343–3356.
Laudet, V., Hanni, C., Coll, J., Catzeflis, F. and Stehelin, D. (1992) Evolution of the nuclear
receptor gene superfamily. The EMBO Journal 11, 1003–1013.
Laughon, A. and Gesteland, R. (1984) Primary structure of the Saccharomyces cerevisiae
GAL4 gene. Molecular and Cellular Biology 4, 260–267.
Li, J., Nagpal, P., Vitart, V., McMorris T.C. and Chory, J. (1996) A role for brassinosteroids
in light-dependent development of Arabidopsis. Science 272, 398–401.
Lin, Y.-S., Maldonado, E., Reinberg, D. and Green, M.R. (1991) Binding of general
transcription factor TFIIB to an acidic activating region. Nature 353, 569–571.
Lloyd, A.M., Walbot, V. and Davis, R.W. (1992) Arabidopsis and Nicotiana anthocyanin
production activated maize regulators R and C1. Science 258, 1773–1775.
Lloyd, A.M., Schena, M., Walbot, V. and Davis, R.W. (1994) Epidermal cell fate
determination in Arabidopsis: patterns defined by a steroid-inducible regulator.
Science 266, 436–439.
Louvion, J.-F., Havaux-Copf, B. and Picard, D. (1993) Fusion of GAL4-VP16 to a steroid-
binding domain provides a tool for gratuitous induction of galactose-response genes
in yeast. Gene 131, 129–134.
Ludwig, S.R., Habera, L.F., Dellaporta, S.L. and Wessler, S.R. (1989) Lc, a member of the
maize R gene family responsible for tissue-specific anthocyanin production,
encodes a protein similar to transcriptional activators and contains the myc-
homology region. Proceedings of the National Academy of Sciences USA 86,
7092–7096.
58 T. Aoyama
Mandava, N.B. (1988) Plant growth-promoting brassinosteroids. Annual Review of Plant

Physiology and Plant Molecular Biology 39, 23–52.
Mett, V.L., Lockhead, L.P. and Reynolds, P.H.S. (1993) Copper controllable gene
USA 90, 4567–4571.
Metzger, D., Clifford, J., Chiba, H. and Chambon, P. (1995) Conditional site-specific
recombination in mammalian cells using a ligand-dependent chimeric Cre
recombinase. Proceedings of the National Academy of Sciences USA 92, 6991–6995.
Miesfeld, R., Rusconi, S., Godowski, P.J., Maler, B.A., Okret, S., Wikstroem, A.-C., Gustafsson,
J.-A. and Yamamoto, K.R. (1986) Genetic complementation to a glucocorticoid
receptor deficiency by expression of cloned receptor cDNA. Cell 46, 389–399.
Millar, A.J., Short, S.R., Chua, N.-H. and Kay, S.A. (1992) A novel circadian phenotype
based on firefly luciferase expression in transgenic plants. Plant Cell 4, 1075–1087.
No, D., Yao, T.-P. and Evans, R.M. (1996) Ecdysone-inducible gene expression in
mammalian cells and transgenic mice. Proceedings of the National Academy of Sciences
USA 93, 3346–3351.
Odell, J.T., Nagy, F. and Chua, N.-H. (1985) Identification of DNA sequences required for
activity of the cauliflower mosaic virus 35S promoter. Nature 313, 810–812.
Palmitter, R.D., Behringer, R.R., Quaife, C.J., Maxwell, F., Maxwell, I.H. and Brinster, R.L.
(1987) Cell lineage ablation in transgenic mice by cell-specific expression of a toxin
gene. Cell 50, 435–443.
Picard, D. (1993) Steroid-binding domains for regulating the functions of heterologous
proteins in cis. Trends in Cell Biology 3, 278–280.
Picard, D. (1994) Regulation of protein function through expression of chimeric
proteins. Current Opinion in Biotechnology 5, 511–515.
Picard, D., Salser, S.J. and Yamamoto, K.R. (1988) A movable and regulable inactivation
function within the steroid binding domain of the glucocorticoid receptor. Cell 54,
1073–1080.
Picard, D., Schena, M. and Yamamoto, K.R. (1990) An inducible expression vector for
both fision and budding yeast. Gene 86, 257–261.
Putterill, J., Robson, F., Lee, K., Simon, R. and Coupland, G. (1995) The CONSTANS gene
of Arabidopsis promotes flowering and encodes a protein showing similarities to zinc
finger transcription factors. Cell 80, 847–857.
Ruberti, I., Sessa, G., Lucchetti, S. and Morelli, G. (1991) A novel class of plant proteins
containing a homeodomain with a closely linked leucine zipper motif. The EMBO
Journal 10, 1787–1791.
Rusconi, S. and Yamamoto, K.R. (1987) Functional dissection of the hormone and DNA
binding activities of the glucocorticoid receptor. The EMBO Journal 6, 1309–1315.
Sadowski, I., Ma, J., Triezenberg, S. and Ptashne, M. (1988) GAL4-VP16 is an unusually
potent transcription activator. Nature 335, 563–564.
Samuels, M.L., Weber, J.M., Bishop, J.M. and McMahon, M. (1993) Conditional
transformation of cells and rapid activation of the mitogen-activated protein kinase
cascade by an estradiol-dependent human raf-1. Molecular and Cellular Biology 13,
6241–6252.
Schena, M. and Yamamoto, K.R. (1988) Mammalian glucocorticoid receptor derivatives
enhance transcription in yeast. Science 241, 965–967.
10421–10425.
Simon, R., Igeno, M.I. and Coupland, G. (1996) Activation of floral meristem identity
genes in Arabidopsis. Nature 384, 59–62.
Stancato, L.F., Hutchison, K.A., Krishna, P. and Pratt, W.B. (1996) Animal and plant cell
lysates share a conserved chaperone system that assembles the glucocorticoid
receptor into a functional heterocomplex with hsp90. Biochemistry 35, 544–561.
Superti-Furga, G., Gergers, G., Picard, D. and Busslinger, M. (1991) Hormone-dependent
transcriptional regulation and cellular transformation by Fos-steroid receptor fusion
proteins. Proceedings of the National Academy of Sciences USA 88, 5114–5118.
Thorsness, M.K., Kansasamy, M.K., Nasrallah, M.E. and Nasrallah, J.B. (1991) A
brassica S-locus gene promoter targets toxic gene expression and cell death to the
pistil and pollen of transgenic Nicotiana. Developmental Biology 143, 173–184.
Triezenberg, S.J., Kingsbury, R.C. and McKnight, S.L. (1988) Functional dissection of
VP16, the transactivator of herpes simplex virus immediate early gene expression.
Genes and Development 2, 718–729.
Umek, R.M., Friedman, A.D. and McKnight, S.L. (1991) CCAAT-enhancer binding
protein: a component of a differentiation switch. Science 251, 288–292.
Umesono, K. and Evans, R.M. (1989) Determinants of target gene specificity for
steroid/thyroid hormone receptors. Cell 57, 1139–1146.
Yokota, T. and Mori, K. (1992) Molecular structure and biological activity of
brassinolide and related brassinosteroids. In: Duax, W.L. and Bohl, M. (eds)
Molecular Structure and Biological Activity of Steroids (Uni-science Report Series). CRC
Press, Washington, DC, pp. 317–340.
Tissue-specific, Copper-
5
controllable Gene Expression
in Plants
Vadim L. Mett and Paul H.S. Reynolds
Plant Improvement Division, The Horticulture and Food

Research Institute of New Zealand, Batchelar Research
Centre, Highway 57, Private Bag 11030, Palmerston North,
New Zealand
The copper-controllable gene expression system has been shown to give tight
control over time and place of expression of a gene of interest in response to
the application of copper to transformed plants either in the nutrient
solution or as a foliar spray. Whilst the levels of expression from this system
are not high when compared to the cauliflower mosaic virus (CaMV) 35S
RNA promoter, they have been shown to be sufficient to, for example, drive
effective antisense of a metabolic gene, to express plant hormone
biosynthetic genes resulting in phenotype changes and to express potentially
lethal avirulence genes. Perhaps the most significant aspect of this system is
the tight control it effects allowing the recovery of transgenic plants
expressing genes which are conditionally lethal or of plants carrying genes
which, if expressed in tissue culture, would compromise plant developmental
processes.
The system has been successfully used in tobacco, Lotus and Arabidopsis
backgrounds. Its functionality in Arabidopsis is particularly useful in that other
systems, such as the tetracycline repressor, do not function in this background.
On the other hand, experiments in poplar (S.H. Strauss, Oregon, USA, 1998,
personal communication) have suggested that, in this plant, the copper system
operates constitutively.
Here, the basis of the copper-controllable system is described together with
examples of its successful use in plants. A vector system for convenient use is
presented, together with practical information on the conducting of
experiments in plants.

62 V.L. Mett and P.H.S. Reynolds
BASIS AND FUNCTIONING OF THE COPPER-CONTROLLABLE

EXPRESSION SYSTEM
The copper-controllable gene expression mechanism is based on the yeast

copper–metallothionein (MT) regulatory system with copper ion as the ‘inducer
molecule’. The yeast copper–MT system, consists of a constitutively expressed
activating copper-metallothionein expression-1 (ace1) gene which encodes a
metallo-responsive transcription factor, targeted to the nucleus, which activates
yeast MT gene transcription (Wright et al., 1988). This activation is mediated
by copper ions which alter the conformation of the regulatory protein (Szczypka
and Thiele, 1989) allowing it to bind to specific upstream sequences in the yeast
MT promoter (Butt et al., 1984; Furst et al., 1988). The yeast copper–MT
regulatory system thus represents a simple model in which the effective
binding conformation of the regulatory protein to the MT promoter (and hence,
activation of the MT gene) is controlled by the copper ion concentration (Thiele
and Hamer, 1986). To translate this mechanism into a plant background (Fig.
5.1) would require constitutive expression of the ace1 gene using, for example,
the CaMV 35S RNA promoter, together with a chimeric promoter to drive
expression of the ‘gene of interest’ consisting of some basic plant-compatible
TATA sequence together with the binding site for the ACE1 protein.
MTs are characteristically low-molecular-weight, cysteine-rich polypeptides
which fall into three classes based on the arrangement of their cysteine residues.
Animals, yeasts and other fungi synthesize class I or II MTs which are encoded in
the nuclear genome. Higher plants, on the other hand, produce phytochelatins
(class III MTs), which are enzyme-synthesized peptides with the structure poly(γ-
glutamyl-cysteinyl)glycine (Thiele, 1992). Recent evidence suggests that plants
contain metal-binding proteins in addition to phytochelatins. Studies of the
copper-tolerant flowering plant Mimulus guttatus have revealed that root extracts
contain several copper-binding elements, only one of which is a phytochelatin
(Grill et al., 1987). Interestingly, transcription of the MT-like genes investigated in
this work did not appear to be induced by copper ions. In fact, half of the
transcripts analysed were repressed by high copper ion concentrations. Genes
encoding MT-like proteins have also been isolated from a range of other plants.
Some plant MT-like genes are induced by metal treatment (DeFramond, 1991;
Robinson et al., 1993; Zhou and Goldsbrough, 1994; Hsein et al., 1995) whilst
others respond to different environmental and developmental signals such as
senescence, abscission, wounding and tobacco mosaic virus (TMV) infection
(Buchanan-Wollaston, 1994; Coupe et al., 1995; Choi et al., 1996). Even when
‘induced’ by copper, the level of induction driven from the promoters of these
genes is low. For example, treatment of Arabidopsis seedlings with 50 µM CuSO4
for 30 h produced only a 5.5-fold increase in the level of MT2 mRNA, as
determined by densitometry (Zhou and Goldsbrough, 1994). The exact role of
MT-like plant proteins is yet to be determined though at present it does not seem
to relate directly to metal tolerance but rather, may be important in the directed
delivery of copper to protein complexes in which it is important.
Tissue-specific, Copper-controllable Gene Expression 63
Application of
copper
Inactive ACE1 ACE1 Active
Reporter
protein
ACE1
p35S ace 1 MRE Reporter
Fig. 5.1. The copper-inducible expression system. The system consists of a

constitutively expressed cysteine-rich nucleoprotein encoded by the ace1 gene,
under the control of the CaMV 35S RNA promoter (p35S). This protein activates
transcription of the ‘gene of interest’ (reporter) by binding to its cognate binding site
(the metal regulatory element, MRE) in a chimeric promoter which also contains
sequences necessary for transcription in plants. The competence of the ACE1
protein to bind the MRE is mediated by copper which alters its conformation to
allow effective binding and activation of transcription from the chimeric promoter.
The key question, therefore, in investigating the feasibility of a copper-

control system in plants (Fig. 5.1) is to determine:
1. Whether or not activation of the introduced yeast regulatory copper–MT
system by manipulation of copper ion concentration is possible in plants against
a background of multiple metal binding systems, and;
2. If such manipulation of copper ion levels has widespread physiological
effects in the plant.
To test the functioning of the system in plants a construct, containing the
β-glucuronidase (GUS) reporter gene under control of the chimeric promoter
(containing the ACE1-binding site and domain A from CaMV 35S RNA
promoter) together with the ace1 gene fused to the CaMV 35S RNA promoter,
was prepared and transgenic tobacco plants produced (Mett et al., 1993).
Transgenic plants were also produced using a control construct which
contained the GUS reporter under control of the chimeric promoter but from
which the ACE1 coding region had been omitted. Clonal replicates were used in
the experiments to allow direct comparisons of data to be made, since variation
of expression due to differing sites of insertion into the tobacco genome could
be avoided. Non-transformed plants gave an apparent fluorometric GUS
activity of 20 pmol 4-methylumbelliferyl-β-glucuronide cleaved min21 mg21
protein (20 units mg21) (Fig. 5.2). This background activity, which was clearly
not due to GUS expression, was identical in the presence or absence of copper
1200
900
(pmol min–1 mg–1 protein)
GUS activity
600
300
0
Copper (–) (+) (–) (+) (–) (+)
treatment
Plant Wild- Control- Full-
type construct construct
Fig. 5.2. Copper responsiveness of gene expression. Wild-type plants are non-
transformed Nicotiana tabacum. Control-construct plants are N. tabacum
transformed with a construct which contained the GUS reporter gene under control
of a chimeric promoter consisting of a copy of the MRE fused to domain A of the
CaMV 35S RNA promoter, but which does not contain the ace1 gene. Full-
construct plants are N. tabacum transformed with a construct which contains the
ace1 gene under control of the CaMV 35S RNA promoter, together with the GUS
reporter under control of the chimeric promoter. Following an acclimatization
period of 7 days after transfer of plants from agarose to solution culture, CuSO4 was
added to the nutrient solution to a final concentration of 50 µM. After 5 days these
plants (+) and plants grown in the absence of copper (2) were harvested and the
leaves assayed fluorometrically for GUS activity.
ions. The control-construct plants showed the GUS assay background of 20

units mg21 in the absence of copper but, after 5 days in the presence of 50 µM
copper, these plants showed a GUS activity of 40 units mg21 (Fig. 5.2). In
contrast, the full-construct plants, grown in the presence of 50 µM CuSO4 for 5
days, showed an increase in leaf GUS specific activity to 1200 units mg21.
Northern analysis confirmed the correct functioning of the whole yeast
metallo-regulatory system transferred into the plants. The ace1 gene transcript
was constitutively present, whereas the GUS transcript was detectable only in
the presence of inducing copper ion concentrations. The fact that no copper
induction was observed in plants transformed with the control-construct which
did not contain the ace1 regulatory gene suggested that the yeast transcription
factor was essential for the functioning of the system in plants and that its
nuclear targeting was unaffected in the plant background.
The activity of the described chimeric promoter was shown to be directly
dependent on the copper ion concentration. The copper ion concentration
required for activation (in our hands 5 µM or higher) was shown to be
significantly above that usually found in plant nutrient solutions (for example,
standard MS medium contains copper at a concentration of 0.1 mM).
Maintenance of plants for extended periods in the presence of the ‘inducing’
copper ion concentration in the nutrient solution resulted in development of
copper toxicity symptoms. This problem could be circumvented by the
application of copper ions in a foliar spray. The concentration of copper required
in these sprays was considerably lower at 0.5 µM.
It was further shown that if, following activation of GUS expression by
addition of copper to the nutrient solution (or its application as a foliar spray),
copper was then removed from the system then expression of the GUS gene was
repressed; that is, the system could be used in experiments demanding precise
timing of expression. Data showing the time-course of activation and repression
of GUS expression in response to the addition and removal of 50 µM CuSO4 from
the nutrient solution is shown in Fig. 5.3. GUS activity before the addition of
copper was 48 units mg21. A twofold increase in specific activity was observed
after 24 h, increasing to 1030 units mg21 after 4 days. Removal of CuSO4 from
the nutrient solution resulted in a dramatic decrease in GUS activity to 80 units
mg21 after 4 days.
The same induction/repression was also observed in plants which had
copper applied as a foliar spray. If leaves were sprayed to drip point daily with a
0.5 µM CuSO4 solution, maximal induction occurred after 5 days. If plants were
thereafter sprayed to drip point daily with water, GUS activity decreased to back-
ground levels after a further 5 days. When plants were sprayed only once to drip
point with the 0.5 µM copper solution, GUS activity was induced within 5 days
and remained high for a further 7 days, before decreasing to background levels.
In experiments using Arabidopsis, foliar application of 5 µM CuSO4 gave
maximal induction of a GUS reporter gene after 4 days, but the period of
maximal induction was short lived (F. Johnson-Potter, Australia, 1997, personal
communication).
MODIFICATION OF THE SYSTEM TO OVERCOME BACKGROUND

EXPRESSION IN ROOTS
Whilst the system described above showed a very low background activity in
the uninduced state in the leaves of transgenic plants, activity of the reporter
enzyme GUS in roots was significant, even in half-strength MS growth medium
with a concentration of CuSO4 (0.05 µM), which is below the induction
threshold observed in leaves. Apparently this resulted from the presence of the
ASF1 transcription factor binding site, which lies within the 35S promoter 90
1200
1000
(pmol min–1 mg–1 protein)
800
GUS activity
600
Add Remove
copper copper
400
200
0
(Cu)– 1 2 4 2 4
Days Days
Fig. 5.3. Time-course of activation/repression of gene expression. Following

acclimatization, duplicate clonal Nicotiana tabacum plants transformed with the
full construct (see Fig. 5.2) were harvested and the leaves assayed for GUS activity.
The nutrient solution of the remaining ten plants was adjusted to contain 50 µM
CuSO4, and duplicate plants were harvested after 1, 2 and 4 days, and leaves were
assayed for GUS activity. The nutrient solution of the remaining plants was then
changed to one lacking copper; duplicate plants were harvested, and the leaves
were assayed for GUS activity after a further 2 and 4 days.
base pair (bp) domain A (Lam et al., 1989). Indeed, it has been shown that the
35S promoter 90 bp domain A is sufficient for low level constitutive expression
in roots (Benfey and Chua, 1990). To eliminate this background expression of
the system in the roots the ASF1 binding site was removed from the chimeric
promoter leaving the 35S promoter 246 bp TATA fragment only. In addition,
the effect of increasing the number of repeats of the MRE (metal regulatory
element) fused in tandem to the TATA fragment (Mett et al., 1996) was
investigated.
Three variants of the chimeric promoter containing one, two or four copies
of the MRE were constructed to evaluate the effect of the number of MRE on the
level of expression. Due to the very close position of the expression cassette to
the ace1 coding region under control of the potent CaMV 35S RNA promoter,
the influence of the orientation (D (direct) or R (reverse)) of the chimeric
promoter with respect to the direction of ace1 transcription was also
investigated.
Tobacco plants from transformations in which the various chimeric

promoter constructs were fused to the GUS reporter coding sequence, were used
in an experiment in which GUS activity was measured in extracts from the roots
and leaves of solution cultured plants before and after addition of copper to the
medium. All plants showed very low GUS activity (typically between 20 and
100 units mg21) in the leaves and roots, in the absence of copper. Following
induction with 50 µM CuSO4, all plants showed elevated GUS levels in the roots.
However, there was no significant difference between plants for measured GUS
activity regardless of the numbers of MRE present and, by inference, for the
levels of activity of chimeric promoters containing one, two or four copies of
MRE. This result could be explained by incorrect spacing between individual
elements in comparison with the spacing of the two MRE in the native yeast-
metallothionein promoter (Thiele and Hamer, 1986) or, despite high transcrip-
tion, be due to low concentrations of ace1 protein actually being present in the
nucleus. The lack of effect of orientation suggested low impact of the adjoining
full 35S promoter which drives ace1 transcription. Over the total experiment,
‘4R’-transformed plants gave the highest GUS activity in roots after induction
and the lowest background activity in the uninduced state, making this variant
Fig. 5.4. Copper-controllable gene expression system: vectors for convenient use.
pPMB 768 and pPMB 7066 are pUC-based plasmids allowing for cloning of the
gene of interest behind the desired chimeric promoter. pPMB 768 contains four
tandem copies of the metal regulatory element (MRE) and the 246 bp fragment of
the CaMV 35S RNA promoter (TATA), whereas pPMB 7066 contains only one copy
of the MRE fused to domain A of the CaMV 35S promoter. pPMB 765 is a binary
vector containing, in addition to the selectable marker gene and NotI site for
cloning the gene of interest, the ace1 gene under control of the full CaMV 35S RNA
promoter. The pPMB 7088 vector contains a promoterless ace1 gene with a HindIII
site for cloning the desired tissue/organ-specific promoter.
the best candidate for copper-controllable gene expression in the roots of

transgenic plants (see Fig. 5.4; pPMB 768/pPMB 765).
The ‘4R’ tobacco plants were further investigated using four independent
transformants (4R1, 4R2, 4R3, 4R4). Copper-induction experiments were
performed on three re-regenerated clones from each independent transformant.
One set of three clones was used as a minus copper control and a second set of
clones was used to measure GUS activity after 5 days treatment with 50 µM
CuSO4 in the nutrient solution. The third set of three clones was assayed for
GUS activity 5 days after copper was removed from the nutrient solution. As
shown in Table 5.1, very low GUS activity was observed in the roots before
induction by the addition of 50 µM CuSO4 to the nutrient solution ((2) CuSO4).
Five days after the addition of copper to the nutrient solution an up-to-160-
fold increase in GUS activity was observed ((+) CuSO4). When copper was then
removed from the nutrient solution, a significant drop in GUS activity was
observed after 5 days ((±) CuSO 4). These results clearly demonstrate that
elimination of the ASF1-binding site has allowed tight control of expression in
the roots.
However, in all of these experiments using transgenic tobacco plants, very
low GUS activity was measurable in the leaves before and after the induction
(less than 50 units mg21). The introduction of an ASF2-binding site between
MRE and TATA in the chimeric promoters did not restore expression in the
leaves (data not shown, New Zealand, 1997), in spite of the fact that the ASF2-
binding site confers leaf expression when fused to domain A of the 35S promoter
(Lam et al., 1989).
It is therefore highly significant that recent experiments in Arabidopsis
(Fumiaki Katagiri, USA, 1998, personal communication), using the
pPMB 768/765 system (see Fig. 5.4) have allowed tight, copper-inducible
control in leaves. Also, experiments performed in Arabidopsis seedlings with the
pPMB 768/765 system using a GUS reporter gene, have revealed tight copper-
dependent expression both in leaves and in roots (S. Kurup and M. Holdsworth,
UK, 1997, personal communication).
USE OF THE COPPER SYSTEM TO EFFECT CONTROL OVER PLACE, AS

WELL AS TIME, OF EXPRESSION
The ‘ideal’ gene expression system must provide both temporal and spatial
control of a ‘gene of interest’ in transgenic plants. Tissue-specificity was
introduced into the copper-controllable gene expression system by the use of a
tissue-specific promoter to effect spatial control of the expression of the ACE1
transcription factor (Mett et al., 1996).
As we were interested in the development of a tissue-specific copper-
controllable expression system for use in the nitrogen-fixing nodules of leguminous
plants, the promoter of the nod45 gene from lupin (Rice et al., 1993) was used to
drive the expression of the ace1 gene. The product of the nod45 gene, a late nodulin
Table 5.1. Copper inducibility of GUS expression in the roots of transgenic

tobacco plants.
GUS activitya
(nmol min21 mg21 protein)
Plant (2) CuSO4 (+) CuSO4 (±) CuSO4
4R1 15.0 1665 140

4R2 21.0 820 120
4R3 20.0 1391 85
4R4 7.5 1216 20
a Values given are the average of three clonal replicates for each treatment.
with unidentified function, is localized only in nitrogen-fixing nodules and activity

of the promoter has been shown to be associated strictly with developed nodules
(MacKnight et al., 1995).
To demonstrate the feasibility of this approach, the GUS-expression cassette
containing a chimeric promoter with four copies of the MRE was cloned into a
plasmid containing the ace1 gene under control of the nod45 promoter in the
reverse orientation with respect to the direction of ace1 transcription (pACE-
NOD). A second construct containing the same GUS-expression cassette and the
ace1 gene driven by the constitutive 35S promoter (pACE-in-ART), was used as
a control. Both constructs were tested in ‘transgenic roots–wild-type tops’ Lotus
corniculatus plants. After the development of nitrogen-fixing nodules (4 weeks)
the plants were transferred into liquid culture and copper-induction
experiments were performed.
As shown in Fig. 5.5b histochemical GUS staining was localized only in
nodules when expression of the ace1 gene was controlled by the nod45
promoter, whilst when transgenic roots were produced using the pACE-in-ART
vector, GUS staining was also present in the tips of secondary roots (Fig. 5.5a).
The apparent absence of GUS activity in the rest of the root tissue could be
explained by the higher level of GUS expression in metabolically active cells of
root tips. These results clearly demonstrated that the use of a specific promoter
to limit the expression of the transcription factor ACE1 to a particular
tissue/organ to be compatible with the copper-controllable system and to
provide a mechanism to introduce tissue/organ-specificity into this system.
Theoretically, it seems possible that the combination of an appropriate tis-
sue/organ-specific promoter to drive the expression of the metallo-regulatory
transcription factor ACE1 together with the elements of the chimeric promoter
could be applicable to the temporal and spatial control of gene expression in any
plant organ or tissue, provided that a TATA domain in the chimeric promoter
has the capability to support expression in all tissues of the particular plant
being used.
Fig. 5.5. Spatial control of GUS reporter gene expression in transgenic roots of
Lotus corniculatus using the copper system. (a) Histochemical localization of GUS
reporter gene activity in both roots and nodules of transgenic L. corniculatus roots
transformed with the pPMB 768/pPMB 765 or ‘pACE-in-ART’ construct. (b)
Histochemical localization of GUS reporter gene activity in nodules only of
transgenic L. corniculatus roots transformed with the pPMB 768/pPMB 7088 or
‘pNOD-ACE’ construct in which expression of ACE1 is under the control of the
nodule-specific nod45 promoter.
THE ‘EASE OF USE’ VECTORS FOR COPPER-CONTROLLABLE GENE

EXPRESSION
The copper-controllable gene expression system has been formulated for

convenient use in four basic vectors (Fig. 5.4). Two of these are pUC-based
plasmids allowing for cloning of the gene of interest and two are binary vectors
for transfer to plants, one of which allows for control of the ace1 gene by an
organ-specific promoter.
pPMB 768
This is a pUC119-based plasmid containing four copies of the MRE fused to the
246 bp fragment from the CaMV 35S RNA promoter, separated from a nos
terminator by a cloning cassette. Following cloning of a gene of interest, the
sequence can then be excised NotI and cloned into the appropriate binary
vector (pPMB 765 (p-ACE-in-ART) or pPMB 7088). In our experience, genes
cloned under control of the chimeric promoter in this plasmid give inducible
expression in roots with no expression in the absence of inducing copper
concentrations. However, we see no leaf expression in tobacco, although there
is clearly induction in leaves (F. Katagiri, Maryland, USA, 1998, personal
communication) from this construct in Arabidopsis.
pPMB 7066
This is a pUC119-based plasmid containing one copy of the MRE fused to the
290 bp domain A from the CaMV 35S RNA promoter, separated from a nos
terminator by a cloning cassette. Following cloning of a gene of interest, the
sequence can then be excised NotI and cloned into the appropriate binary
vector (pPMB 765 (pACE-in-ART) or pPMB 7088). Genes cloned under control
of the chimeric promoter in this plasmid will give background expression in
roots (at least in tobacco) in the absence of copper due to the 290 bp 35S
promoter. Full control of expression has been obtained in leaves with no back-
ground expression in the absence of inducing copper concentrations. We have
noticed a rather low percentage of tobacco transformants which demonstrate
copper-inducible phenotype. At present, we cannot explain this phenomenon
which results in the need to analyse a large number of primary transformants
in order to find the appropriate phenotype.
pPMB 765 (pACE-in-ART)
This is a binary vector for transfer to plants. It is based on the pART system of
Gleave (1992). A NotI site allows for cloning of the gene of interest under
control of the chosen chimeric promoter (from pPMB 768 or pPMB 7066). The
ace1 gene is constitutively expressed throughout the plant and so gives expres-
sion of the induced gene in all plant organs under copper inducing conditions.
pPMB 7088
This is a binary vector for transfer to plants. It is based in the pART system of
Gleave (1992). A NotI site allows for cloning of the gene of interest under
control of the chosen chimeric promoter (from pPMB 768 or pPMB 7066). A
HindIII site is provided 5′ to the ace1 gene to allow cloning of an organ-spe-
cific promoter. In this way the ace1 gene will be expressed only in the plant
organ defined by the introduced promoter region and will give expression of
the introduced gene (under inducing copper concentrations) only in that
organ.
All the vectors are provided in an E. coli DH5a background. pPMB 768 and
pPMB 7066 grow on LB amp, 100 µg ml21. pPMB 765 and pPMB 7088 grow
on LB spec, 100 µg ml21.
USE OF THE SYSTEM FOR TISSUE-SPECIFIC ANTISENSE EXPERIMENTS
Functional use of the system was demonstrated by its ability to drive effective
antisense constructs in an organ-specific manner. The nodule-specific system
was used to express antisense constructs of aspartate aminotransferase-P2
(AAT-P2) in transgenic L. corniculatus plants (Mett et al., 1996). Aspartate
aminotransferase plays a key role in plant carbon and nitrogen metabolism. It
exists as at least two isoenzymic forms in nodules and one of these, AAT-P2, is
thought to function as part of the pathway which assimilates ammonia
produced by the nitrogen fixation process (Reynolds and Farnden, 1979).
Controlled, organ-specific expression of the antisense construct of this isoform
offered the possibility of an in vivo demonstration of its direct role in the
assimilation of ammonia into the amino acid asparagine.
Three antisense constructs (7048, 7049 and 7050), derived from the lupin
AAT-P2 cDNA (Reynolds et al., 1992), were expressed in transgenic L.
corniculatus plants using the pACE-NOD vector (see Fig. 5.4 above and results
in Table 5.2). Of the three constructs, 7050 gave the most effective antisense
effect, with AAT-P2 enzyme activity below the level of detection in two of the
three plants tested. In plant 7050-1 there was a 77% decrease in nodule
asparagine concentration. In the 7049 plants, an antisense effect on AAT-P2
activity was seen in all three plants. However, in only one of these plants,
7049-1, was there a dramatic decrease in nodule asparagine concentration.
This could be due to sufficient AAT-P2 activity remaining in the other plants to
allow unimpeded asparagine synthesis. Full analysis of the 7048 plants was
compromised by the lack of nodules in plant 7048-3(+) and the lack of an
AAT-P2 determination in 7048-1(+), due to low nodule-weight. However, a
significant antisense effect on AAT-P2 enzyme activity was seen in plant
7048-2 with only 18% of the AAT-P2 activity remaining after copper induction.
A dramatic effect of AAT-P2 antisense expression on the nodule asparagine
concentration was also observed, with 83% and 91% reductions observed in
plants 7048-1 and 7048-2, respectively. Consistently, across the whole
experiment, plants with very low or undetectable AAT-P2 activity showed large
decreases in nodule asparagine concentration. In plants where the antisense
effect was not high, or where significant residual levels of AAT-P2 activity (for
example, plant 7049-3) remained, asparagine levels were either unaffected or
only slightly reduced. In untransformed L. corniculatus plants there was no effect
of copper on the activity of AAT-P2, and the asparagine levels in the nodules of
these plants were comparable to those levels seen in the nodules of transformed
plants which had not been exposed to antisense expression-inducing levels of
copper.
Table 5.2. Effect of expression of AAT-P2 antisense constructs on nodule AAT-P2

enzyme activity and on nodule asparagine levels.
AAT-P2 activity Asparagine

(mmol min21 g21 nodules) (mmol g21 nodules)
Plant (+) Cu (2) Cu (+) Cu (2) Cu
7048–1 nd 0.236 4.9 28.6

7048–2 0.051 0.284 1.8 19.1
7048–3 No nodules 0.663 No nodules 40.4
7049–1 0.080 0.593 8.7 37.6
7049–2 0.368 0.609 28.8 44.9
7049–3 0.175 1.042 36.3 34.3
7050–1 <0.020 0.342 4.0 17.3
7050–2 <0.020 No nodules 7.6 No nodules
7050–3 0.098 0.294 8.8 19.4
nd, not determined.
These experiments have clearly demonstrated that the copper-inducible

gene expression system described here is a useful system in a physiological
situation, providing high enough levels of transcription from the chimeric
promoter to produce a clear antisense effect. Furthermore, the use of this
system has enabled a direct link to be established between the enzyme activity
of the proplastid-localized AAT-P2 activity and the eventual synthesis of
asparagine in the nodule. Experiments of this nature demand temporal and
spatial control of expression, firstly to enable transgenic plants containing the
antisense construct to be successfully regenerated and nodulated and, secondly
to target the antisense effect to the particular plant organ being studied.
USE OF THE SYSTEM TO EXPRESS ‘CONDITIONAL-LETHAL’ GENES
Expression of potentially lethal metabolic genes
The enzyme L-asparaginase is present in many plant meristematic tissues where

it plays an important role in the provision of nitrogen to the developing tissue.
One exception to this is the nitrogen-fixing leguminous nodule. Upon establish-
ment of an active symbiosis the expression of the L-asparaginase gene is
dramatically reduced with a concomitant decrease in the measurable activity
of L-asparaginase enzyme (Scott et al., 1976). This is essential to avoid the
establishment of a futile metabolic cycle and so allow the export of asparagine
from the nodule to fuel plant growth and development. The transcriptional
repression of this gene has been shown to be associated with a 59 bp TATA
proximal element (Vincze et al., 1994).
Fig. 5.6. Expression of L-asparaginase in transgenic Lotus corniculatus. Transgenic L.

corniculatus plants were inoculated with Rhizobium loti NZP2037 and grown under
minus N conditions. (a) Transformed L. corniculatus plants where L-asparaginase was
expressed in a modified pNOD-ACE vector in which the L-asparaginase gene 59 bp
repressor element had been inserted between the TATA and first MRE sequences.
The first three plants were grown in the absence and the second three plants were
grown in the presence of 5 µM CuSO4. (b) Lotus corniculatus plants transformed
with an additional copy of the L-asparaginase open reading frame, expressed in the
pNOD-ACE vector (see Fig. 5.5). The first three plants were grown in the absence
and the second three plants in the presence of 5 µM copper.
The copper-controllable expression system has been used to allow

transgenic plants to be obtained in which the consequences of nodule-specific
expression of L-asparaginase can be observed in a mature, nodulated plant (E.
Vincze and P.H.S. Reynolds, 1998, unpublished results). The results in Fig.
5.6b show transgenic L. corniculatus transformed with a copy of the
L -asparaginase gene under control of the copper promoter. The first three
plants were grown in the absence of copper and so did not express the
L-asparaginase gene. The second three plants were grown in the presence of
5 µM CuSO4 and show the ‘conditional lethal’ phenotype due to the estab-
lishment of a metabolic futile cycle in which asparagine is both synthesized
and degraded in the nodule.
The copper system was further used in this research to allow demonstra-
tion of the functionality of the 59 bp TATA proximal element. Inclusion of this
domain in the construct, between the MRE and TATA sequences, was sufficient
to repress transcription of the introduced gene, even under copper-inducing
conditions, and to allow the continuation of an effective symbiosis. The
resulting plants were indistinguishable from wild-type (Fig. 5.6a).
Expression of bacterial avirulence genes
Expression of bacterial avirulence genes in plants is sufficient to elicit the

specific resistance response, providing the corresponding resistance gene is
present in the plant background (Leister et al., 1996).
For example, if the Pseudomonas syringae avirulence gene (avrRpt2) is placed
under the control of the weak, constitutive RPS2 promoter and transformed to
either RPS2 wild-type (RPS2 is the plant resistance gene which corresponds to
avrRpt2) or to RPS2 mutant Arabidopsis plants, then transgenic plants are only
recovered from the mutant plants. That is, in the absence of the corresponding
receptor.
When these experiments were performed using the copper-controllable gene

expression system some interesting results were obtained (F. Katagiri,
Maryland, USA, 1998, personal communication). Firstly, if the pPMB 7066
(see Fig. 5.4) system was used, which gives significant constitutive expression
in roots, transgenic plants were only recovered when the RPS2 mutant back-
ground was used. In contrast, use of the pPMB 768-based system resulted in
transgenic plants being generated in both the wild-type and mutant
Arabidopsis RPS2 backgrounds. These data imply that, in this case, there is no
background expression of the avrRpt2 gene in the absence of the copper
inducer and attest to the tight control of expression provided by the pPMB
768-based system.
When selected transgenic plants from the pPMB 768-avrRpt2/RPS2 wild-
type experiment were treated with 10 µM copper a ‘hypersensitive response’
phenotype was observed. This phenotype was not seen when control
pPMB 768-avrRpt2/RPS2 mutant plants were treated with 10 µM copper.

Plants which exhibit the copper-inducible resistance-response will be
invaluable for the selection of mutants which have defects in the resistance-
response signal transduction pathway; under inducing conditions such plants
will survive.
USE OF THE SYSTEM TO CONTROL EXPRESSION OF PLANT

HORMONES
The cytokinin group of plant hormones regulates aspects of plant growth and
development including the release of lateral buds from apical dominance and
the delay of senescence. The tight temporal-control exhibited by the pPMB 768
system together with confinement of expression to the roots made it ideal for the
control of expression of an introduced cytokinin synthase (ipt) gene (McKenzie
et al., 1998).
Uncontrolled cytokinin expression results in a grossly aberrant morphology
in regenerating plants, whereas control of expression using the copper system
Fig. 5.7. Morphological comparison of transgenic tobacco lines containing a

copper-inducible ipt gene. (a) Morphologically normal line ID8, 21 days after
subculture on to a solid MS medium containing 150 mg ml21 kanamycin but which
did not contain CuSO4. (b) Morphologically aberrant lines 1D9 and (c) 1R19,
grown under the same conditions.
allowed recovery of morphologically normal plants under non-inducing

conditions (McKenzie et al., 1998). Tobacco transformed with a construct
containing the ipt gene under control of the copper-inducible promoter (Cu-ipt)
was morphologically identical, under non-inductive conditions, to GUS-
transformed control plants transformed with the same construct except that the
GUS receptor was expressed in places of ipt (Cu-GUS) in almost all lines produced
(see for example, line ID8 in Fig. 5.7). However, three lines grew in an altered
state which was indicative of cytokinin overproduction (see for example, lines ID9
and ID19 in Fig. 5.7), and this was confirmed by a full cytokinin analysis.
The exogenous application of cytokinin to leaf tissue has been show to delay
its senescence (Richmond and Lang, 1957) and this delayed senescence
phenotype was observed in tissue-cultured plants transformed with a copper-
controlled ipt construct, and which were grown in the presence of copper
(McKenzie et al., 1998). Following 97 days of treatment with 5, 10 or 50 µM
Fig. 5.8. Comparison of leaf senescence in Cu-GUS and Cu-ipt tobacco

transformants following treatment with copper. Cu-GUS (left) and Cu-ipt (right)
plants after 97 days growth in the presence of 50 µM CuSO4.
copper, the leaves of the Cu-ipt plants were clearly greener than the control Cu-
GUS plants, under the same copper regime. The trend was most dramatic in
plants treated with 50 µM copper (Fig. 5.8). An experiment carried out with
clonal replicates of one line, grown under minus copper control and plus 50 µM
copper conditions, showed only trace cytokinin concentration in the control
plant, whereas the plus copper treatment plants showed a total cytokinin
concentration of 132 pmol g21 fresh weight.
Whole transgenic plants grown under copper-inducing conditions showed
significant morphological changes indicating a release of lateral buds from
apical dominance. Cu-ipt plants had significantly different morphology when
compared with Cu-GUS controls after 30 days of exposure to copper. Whereas
the controls displayed strong apical dominance, the Cu-ipt plants displayed a
clear release of lateral buds from apical dominance. This was confirmed by
significant increases in lateral bud number, lateral bud length, lateral bud leaf
number and total plant leaf number, as well as the presence of stems on some of
the lateral buds.
PRACTICAL USEFULNESS OF THE SYSTEM
The preceding examples have shown that, whilst the level of expression
obtained from the copper-controllable system is not high when compared with
the CaMV 35S RNA promoter, it is sufficient to enable experiments to be
performed which require expression of metabolic genes, genes involved in
hormone biosynthesis and avirulence genes. The tight control over expression
effected by the copper system has also been demonstrated with the recovery of
plants expressing ‘conditional lethal’ constructs. Promoters giving high levels
of expression frequently have background levels of expression high enough to
prevent recovery of such plants.
The aspartate aminotransferase antisense experiments demonstrate that
expression from the copper-inducible promoter is sufficient to cause physio-
logical effect. The AAT-P2 transcript is present in high levels (112 pg µg21 RNA)
in 22-day-old legume root nodules (E. Podivinsky and P.H.S. Reynolds, 1998,
unpublished results). This is, for example, 20 times higher than the transcript
level of the AAT-P1 isoform (5 pg µg21 RNA). The control of expression of
cytokinin and avirulence genes are examples of applications which demand
tight control over expression. Without tight control, transgenic plants
expressing the ipt gene are irrecoverable as there is either grossly aberrant mor-
phology (see Fig. 5.7) or plantlets are simply unable to form roots. In the case of
the expression of the avirulence gene avrRpt2, it is clear that tight control of
expression of this gene was essential to enable the recovery of transgenic wild-
type plants expressing the RPS2 resistance gene. In the case of the study of the
effects of the ‘out of time’ expression of the L-asparaginase gene, use of the cop-
per-inducible system also allowed the in vivo demonstration of the functionality
of a transcriptional repression element.
The ability to recover plants expressing conditional lethal genes not only
provides an environment in which the effects of expression can be determined in
controlled experiments but also which allows the investigation of other factors
involved in their expression. For example, in the avirulence gene study the ability
to express this conditional lethal gene will allow the direct selection of mutants in
signal transduction. The demonstration of the functionality of a repressor element
implicated in the transcriptional repression of the L-asparaginase gene in nitrogen-
fixing legume root nodules was possible as, using the copper promoter, an exper-
iment could be designed in which only those plants with constructs which
included the repressor element would survive under copper-inducing conditions
and in which the plants were totally dependent on nitrogen fixation.
PRACTICAL TIPS FOR USE OF THE COPPER-CONTROLLABLE SYSTEM
We have obtained the best results for whole-plant induction of expression when
plants are maintained in solution culture. Commonly used plant media such as
vermiculite and pumice have been found to contain high enough concentra-
tions of copper to activate the system. Our usual procedure has been to recover
plants from tissue culture and, following transfer to solution culture, to
maintain the plants in the absence of copper for 1–2 weeks. After this
acclimatization period, copper is added to the nutrient solution at the desired
concentration. Experiments using germinated seedlings of transgenic plants can
be easily performed using standard solid media containing the desired copper
ion concentration.
Copper is toxic to plant roots. After 10 days exposure to 50 µM CuSO4, roots
are already affected. To circumvent this problem we usually expose the roots to
50 µM copper for 4 days and thereafter maintain the plants in the presence of
5 µM copper. We have recently found that copper–ethylenediaminetetraacetic
acid (EDTA) can act as a suitable inducer also, prolonged exposure of plants to
Cu–EDTA did not result in toxicity to the roots.
ACKNOWLEDGEMENTS
We wish to thank Drs Eva Vincze, Steve Strauss, Felicity Johnson-Potter,

Fumiaki Katagiri, Smita Kurup and Michael Holdsworth for making available
recent and unpublished results. We also wish to thank Michael Holdsworth for
Fig. 5.1.
REFERENCES
Benfey, P.N. and Chua, N.-H. (1990) The cauliflower mosaic virus 35S promoter:
combinatorial regulation of transcription in plants. Science 250, 959–966.
Buchanan-Wollaston, V. (1994) Isolation of cDNA clones for genes that are expressed
during leaf senescence in Brassica napus: identification of a gene encoding a
senescence-specific metallothionein-like protein. Plant Physiology 105,
839–846.
Butt, T.R., Sternberg, E.J., Gorman, J.A., Clark, P., Hamer. D., Rosenberg. M. and
Crooke, S.T. (1984) Copper metallothionein of yeast, structure of the gene, and
regulation of expression. Proceedings of the National Academy of Sciences USA 81,
3332–3336.
Choi, D., Kim H.M., Yun, H.K., Park, J.-A., Kim, W.T. and Bok, S.H. (1996) Molecular
cloning of a metallothionein-like gene from Nicotiana glutinosa L. and its induc-
tion by wounding and tobacco mosaic virus infection. Plant Physiology 112,
353–359.
Coupe, S.A., Taylor, J.E. and Roberts, J.A. (1995) Characterisation of an mRNA encoding
a metallothionein-like protein that accumulates during ethylene-promoted leaf
abscission in Sambucus nigra L. leaflets. Planta 197, 442–447.
DeFramond, A.J. (1991) A metallothionein-like gene from maize (Zea mays): cloning and
characterisation. Federation of European Biochemical Societies Letters 290, 103–106.
Furst, P., Hu, S., Hackett, R. and Hamer, D. (1988) Copper activates metalothionein gene
transcription by altering the conformation of a specific DNA binding protein. Cell
55, 705–717.
Gleave, A.P. (1992) A versatile binary vector system with a T-DNA organisational
structure conductive to efficient integration of cloned DNA into the plant genome.
Plant Molecular Biology 20, 1203–1207.
Grill, E., Winnacker, E.L. and Zenk, M.H. (1987) Phytochelatins: the principal heavy-
metal complexing peptides of higher plants. Proceedings of the National Academy of
Sciences USA 84, 439–443.
Hsein, H.-M., Liu, W.-K. and Huang, P.C. (1995) A novel stress inducible
metallothionein-like gene from rice. Plant Molecular Biology 28, 381–389.
Lam, E., Benfey, P.N., Gilmartin, P.M., Fang, R.-X. and Chua, N.-H. (1989) Site-specific
mutations alter in vitro factor binding and change promoter expression pattern in
transgenic plants. Proceedings of the National Academy of Sciences USA 86, 7890–7894.
Leister, D., Ballvora, A., Salamini, R. and Gebhardt, C.A. (1996) PCR based approach for
isolating pathogen resistance genes from potato with a potential for wide
application in plants. Nature Genetics 14, 421–429.
MacKnight, R.C., Reynolds, P.H.S. and Farnden, K.J.F. (1995) Analysis of the lupin
Nodulin-45 promoter: conserved regulatory sequences are important for promoter
activity. Plant Molecular Biology 27, 457–466.
McKenzie, M.J., Mett, V.L., Reynolds, P.H.S.and Jameson, P.E. (1998) Controlled cytokinin
production in transgenic tobacco plants. Plant Physiology (in press).
Mett, V.L., Lochhead, L.P. and Reynolds, P.H.S. (1993) Copper controllable gene
USA 90, 4567–4571.
Mett, V.L., Podivinsky, E., Tennant, A.M., Lochhead, L.P., Jones, W.T. and Reynolds, P.H.S.
(1996) A system for tissue-specific copper controllable gene expression in transgenic
plants: nodule-specific antisense of aspartate aminotransferase-P2. Transgenic
Reynolds, P.H.S. and Farnden, K.J.F (1979) The involvement of aspartate amino-
transferases in ammonium assimilation in lupin nodules. Phytochemistry 18,
1625–1630.
Reynolds, P.H.S., Smith, L.A., Dickson, J.M.J.J., Jones, W.T., Jones, M., Rodber, K.A., Carne,
A. and Liddane, C.P. (1992) Molecular cloning of a cDNA encoding aspartate
aminotransferase-P2 from lupin root nodules. Plant Molecular Biology 19, 465–472.
Rice, S.J., Grant, M.R., Reynolds, P.H.S. and Farnden, K.J.F. (1993) DNA sequence of
nodulin 45 from Lupinus angustifolius. Plant Science 90, 155–166.
Richmond, A.E. and Lang, A. (1957) Effect of kinetin on protein content and survival of
detached Xanthium leaves. Science 125, 650–651.
Robinson, N.J., Tommey, A.M., Kuske, C. and Jackson, P.J. (1993) Plant metallothioneins.
Biochemistry Journal 295, 1–10.
Scott, D.B., Robertson, J.G. and Farnden, K.J.F. (1976) Ammonia assimilation in lupin
nodules. Nature 263, 703–705.
Szczypka, M.S. and Thiele, D.J. (1989) A cysteine-rich nuclear protein activates yeast
metallotionein gene transcription. Molecular Cell Biology 9, 421–429.
Thiele, D.J. (1992) Metal-regulated transcription in eukaryotes. Nucleic Acids Research
20, 1183–1191.
Thiele, D.J. and Hamer, D.H. (1986) Tenderly duplicated upstream control sequences
mediate copper-induced transcription of the Saccharomyces cerevisiae copper-
metallothionein gene. Molecular Cell Biology 6, 1158–1163.
Vincze, E., Reeves, J.M., Lamping, E., Farnden, K.J.F. and Reynolds, P.H.S. (1994)
Repression of the L-asparaginase gene during nodule development in Lupinus
angustifolius. Plant Molecular Biology 26, 303–311.
Wright, C.F., Hamer, D.H. and McKenney, K. (1988) Autoregulation of the yeast copper
metallothionein gene depends on metal binding. Journal of Biological Chemistry 263,
1570–1574.
Zhou, J. and Goldsbrough, P.B. (1994) Functional homologues of fungal metallothionein
genes from Arabidopsis. Plant Cell 6, 875–884.
Nitrate Inducibility of Gene

6
Expression Using the Nitrite
Reductase Gene Promoter
Steven J. Rothstein and Sobhana Sivasankar
Department of Molecular Biology and Genetics, University of

Guelph, Guelph, Ontario N1G 2W1, Canada
INTRODUCTION
Nitrogen is an essential nutrient required for plant growth, being a principal

constituent of important macromolecules such as proteins, nucleic acids and
chlorophyll. Nitrate is the predominant form of inorganic nitrogen utilized by
plants in most agricultural situations. Other sources of inorganic nitrogen
include atmospheric nitrogen, which is utilized by legumes and a very limited
number of other plant species, and ammonium, which is rapidly nitrified to
nitrate by soil bacteria in well-aerated soils.
Nitrate in the environment is absorbed by plant roots by the action of
specific uptake permease(s). Once absorbed, it can be reduced in the root itself,
stored in vacuoles or transported to the shoot, where it can again undergo
either vacuolar storage or reduction. Nitrate assimilation by plants involves its
reduction to nitrite by nitrate reductase (NR), the conversion of nitrite to
ammonium by nitrite reductase (NiR) and the incorporation of that ammonium
into organic compounds through the cyclic action of the enzymes, glutamine
synthetase (GS) and glutamine-2-oxoglutarate aminotransferase (GOGAT)
(Fig. 6.1).
Gene expression and enzyme activity of the various proteins involved in the
nitrate assimilatory pathway are regulated by both endogenous and environ-
mental stimuli including nitrate, light, sucrose, circadian rhythms and end-
products of assimilation, namely, glutamine and asparagine (for most recent
reviews see, Crawford and Arst, 1993; Crawford, 1995; Sivasankar and Oaks,
1996). Nitrate, the substrate, serves as the primary and most important signal
in regulating its own assimilation. The expression of the nitrate uptake system,
NR and NiR, the most stringently regulated proteins in the nitrate assimilatory
84 S.J. Rothstein and S. Sivasankar
– – –
NO 3 NO 3 NO 3 Vacuole
Permease
NR
–
NO 2
Plastid
–
NO 2
NiR
+ GS
NH 4 Gln
GOGAT
Glu
Fig. 6.1. Schematic representation of the nitrate assimilatory pathway in plants.

NO32 enters the root cell by the action of specific uptake permease(s), and is
reduced to NO22 in the cytosol by nitrate reductase (NR) or is stored in the
vacuole. NO22 is reduced to NH4+ within the plastid by nitrite reductase (NiR) and
NH4+ is incorporated into glutamine (Gln) by glutamine synthetase (GS). Glutamate
(Glu) is derived from Gln by the action of glutamine-2-oxoglutarate
aminotransferase (GOGAT). Gln and Glu are exported from the cell.
pathway, are coordinately induced by nitrate. In addition, nitrate also induces

expression of GS and the ferredoxin-dependent GOGAT (Redinbaugh and
Campbell, 1993). In this chapter, we examine in detail the current status of
knowledge regarding nitrate-inducible gene expression, with particular
emphasis on the spinach NiR gene. However, a brief overview of the other
stimuli influencing nitrate assimilation is also presented to provide an under-
standing of the intricate regulatory machinery involved.
Light is required for the optimum induction of NR and NiR gene expression
in the presence of nitrate in photosynthetic tissue. In etiolated plants the
induction by light occurs through phytochrome (Melzer et al., 1989; Neininger
et al., 1992). In green plants the effect of light occurs through photosynthetic
carbon fixation, and sucrose is capable of replacing light in the induction of NR
mRNA (Kannangara and Woolhouse, 1967; Cheng et al., 1992). Light is also
involved in the post-translational regulation of NR, whereby a protein
phosphorylation/dephosphorylation mechanism permits rapid adjustment of
nitrate-reduction rates to fluctuations in carbohydrate availability (reviewed by
Lillo, 1994; Huber et al., 1996). Expression of NR and NiR is further controlled
by circadian rhythms, with transcript levels increasing during the night and
peaking during the early hours of the morning (Galangau et al., 1988; Bowsher
et al., 1991; Deng et al., 1991). If NR activity is inhibited by substituting
Nitrate Inducibility Using the Nitrite Reductase Gene Promoter 85
molybdenum, which is integral to one of its functional domains, with tungstate,

or if NR is inactivated by mutation, the circadian rhythmicity observed with NR
mRNA is completely eliminated (Deng et al., 1989; Pouteau et al., 1989). Under
these conditions NR transcript levels remain at high constitutive levels,
suggesting that expression of the NR gene is inhibited by some product of nitrate
assimilation when it reaches a certain concentration within the cell. Glutamine
concentrations in cells are known to oscillate in a diurnal cycle in direct
opposition to levels of NR mRNA (Deng et al., 1991). Exogenous addition of
glutamine and asparagine to the plant growth medium can repress the uptake
of nitrate as well as the transcription of NR and NiR (Vincentz et al., 1993;
Sivasankar et al., 1997).
The isolation of plant mutants defective in the regulation of nitrate
assimilation has not been successful yet and our understanding of the
molecular basis of this regulation is limited. On the other hand, the molecular
nature of the regulatory machinery involved in nitrate assimilation, specifically
in nitrate induction and nitrogen catabolite repression, has been unravelled to
a considerable extent in the filamentous fungi, Neurospora crassa and Aspergillus
nidulans. As recent research evidence indicates significant analogy between
plant and fungal systems with regard to nitrate induction of NR and NiR, it is
appropriate that a discussion of nitrate assimilation and its regulation in fungi
precedes that in higher plants.
REGULATION OF NO32 ASSIMILATION IN FUNGAL SYSTEMS
In the filamentous fungi, N. crassa and A. nidulans, inorganic nitrate is utilized only
when the cells are depleted of the preferred nitrogen sources, namely, ammonia,
glutamate and glutamine. The nitrogen circuit in both organisms comprises a set
of unlinked structural genes encoding enzymes that permit them to utilize
secondary nitrogen sources, such as nitrate, purines and amino acids (Marzluf,
1981). These nitrogen-related enzymes include NR and NiR, involved in the
assimilation of nitrate, purine catabolic enzymes, required for purine catabolism,
and extracellular protease, L-amino acid oxidase and phenylalanine ammonia
lyase, involved in the assimilation of proteins and amino acids. Expression of these
unlinked genes is regulated by repression imposed by the preferred primary
nitrogen sources, and by induction exerted by specific secondary nitrogen sources
(Marzluf and Fu, 1989). Under conditions of nitrogen de-repression, global
positive-acting regulatory proteins turn on the expression of these genes. At the
same time, the action of pathway-specific regulatory proteins mediate the
induction of specific enzymes in the circuit by their respective substrates.
The utilization of nitrate requires the de novo synthesis of nitrate uptake
permease(s) as well as that of NR and NiR. This occurs through nitrogen
catabolite de-repression mediated by a single global positive-acting regulatory
gene (nit-2 in N. crassa and areA in A. nidulans), and nitrate induction mediated
by a pathway-specific regulatory gene (nit-4 in N. crassa and nirA in A. nidulans)
(reviewed by Marzluf, 1993). The structural genes for NR and NiR in

A. nidulans, niaD and niiA, respectively, are closely linked but transcribed in
opposite directions implying coregulation by the common central region. In
N. crassa, nit-3 and nit-6, encoding NR and NiR, respectively, are unlinked but
are also coregulated by nitrogen de-repression and nitrate induction.
Global N regulatory genes, nit-2 and areA
The molecular cloning of nit-2 of N. crassa and areA of A. nidulans has

contributed greatly to the understanding of nitrogen control in filamentous
fungi (Caddick et al., 1986; Fu and Marzluf, 1987). The NIT2 and AREA
proteins contain a single Cys2/Cys2 type zinc finger motif with a central loop of
17 amino acids and an immediately adjacent downstream basic region, which
together constitute a DNA-binding domain. This region shows strong sequence
similarity to the finger motifs in the tissue-specific trans-acting GATA factor in
mammals, except the latter consists of two adjacent finger motifs (Marzluf,
1993). NIT2 and AREA have 98% amino acid identity within their DNA-
binding domains, and the nit-2 gene of N. crassa can complement an areA gene
mutation in A. nidulans and turn on the expression of several nitrogen
structural genes (Davis and Hynes, 1987). The DNA-binding domain of NIT2
comprising the zinc finger and the basic carboxy terminal region has been fused
to β-galactosidase and expressed in an expression vector (Fu and Marzluf,
1990). In electrophoretic mobility-shift assays, the NIT2-βGAL fusion protein
binds to three distinct sites in the 5′ promoter region of the N. crassa nit-3 gene,
and to specific promoter sequences of the genes encoding allantoicase and L-
amino acid oxidase (Fu and Marzluf, 1990; Xiao and Marzluf, 1993; Chiang
and Marzluf, 1995). It also binds to several closely related sites in the promoter
region between the divergently transcribed niaD and niiA genes of A. nidulans
(Fu and Marzluf, 1990). NIT2-binding sites in these promoters are very
different except for the presence of at least two copies of a core recognition
sequence with a consensus of TATCTA (or TAGATA in the opposite strand)
within an effective distance of not more than 30 bp of each other. If there is only
a single GATA element or if the distance between the two GATA elements is
more than 40 bp, binding affinity is reduced (Chiang and Marzluf, 1994). The
orientation of the GATA elements and their flanking sequences have only a
modest influence on binding; however, alteration of even a single nucleotide in
any one of the two GATA core sequences eliminates binding. Site-directed
mutagenesis leading to amino acid substitutions for Trp754 within the zinc
finger loop of NIT2 results in a non-functional protein (Xiao and Marzluf,
1993). Substitution of Leu753 with alanine, valine or methionine gives a
functional protein, but with altered specificity of binding. There are two NIT2-
binding sites within the nit-2 gene itself, which suggests that it might be subject
to autogenous regulation (Chiang and Marzluf, 1994). However, the NIT2 and
AREA proteins do not appear to be regulated themselves (Marzluf, 1993).
Pathway-specific N regulatory genes, nit-4 and nirA
While NIT2 and AREA regulate the expression of several nitrogen-catabolic

enzymes in a global manner, the expression of specific enzymes in the nitrogen
circuit is under the control of pathway-specific regulatory proteins. In N. crassa,
the nit-4 gene controls the nitrate-induced expression of nitrate reductase and
nitrite reductase. The NIT4 protein contains a GAL4-like Cys6/Zn binuclear
type zinc finger which constitutes the DNA-binding domain, a polyglutamine
region composed of 27 glutamine residues occurring in the carboxy-terminus,
and a glutamine-rich region occurring further upstream (Yuan et al., 1991).
Dissection of the NIT4 protein with the yeast two-hybrid system using
GAL4–NIT4 fusions identified its activation domain as the carboxy-terminus
consisting of 385 amino acids which encompass the polyglutamine region,
glutamine-rich region as well as a glycine-rich region (Feng and Marzluf, 1996).
The latter two regions appear to be more important for activation than the
polyglutamine region. All other regions of NIT4 including its DNA-binding
domain fail to support transcriptional activation in yeast, indicating that the
DNA-binding domain and activation domain of NIT4 are structurally and
functionally separable. NIRA, the NIT4 homologue from A. nidulans, exhibits
60% amino acid identity with NIT4 at the amino-terminal half. However, the
carboxy-terminal half is completely divergent in the two. A fusion of the amino-
terminal half of NIT4 with the carboxy-terminal half of NIRA is functional in
vivo in N. crassa and is capable of transforming a nit-4 mutant (Yuan et al.,
1991). Thus, the glutamine-rich and glycine-rich regions in the C-terminus of
NIT4 appear to be substituted by some domain in the C-terminus of NIRA.
Electrophoretic mobility-shift assays and DNA-footprinting experiments
reveal two NIT4-binding sites of different strengths in the promoter of the nit-3
gene, one of which is stronger with a symmetrical octameric sequence of
TCCGCGGA (Fu et al., 1995). The related sequences in the nit-6 gene promoter
include TCCGGTGA and TCCCTCGA. Three NIT2-binding sites and two NIT4-
binding sites are present in the 1.3 kb nit-3 promoter, of which two NIT2-
binding sites and two NIT4-binding sites which are clustered together are
required for expression. Detectable transcription of nit-3 cannot be elicited by
either NIT2 or NIT4 alone, but only by the combined presence of the two. On
the basis of the clustered occurrence of NIT2- and NIT4-binding sites, the
requirement of both proteins to elicit nit-3 expression and the observation that
neither protein regulates the expression of the other, it is reasonable to presume
a protein–protein interaction between NIT2 and NIT4.
It has been postulated that NR might autogenously regulate its own
expression by directly interacting with NIT4 (Tomsett and Garrett, 1981). This
speculation is based on the fact that mutations in the nit-3 gene or in any of the
NR cofactor genes result in the constitutive expression of nit-3 and nit-6 mRNA
and protein in the absence of nitrate. The hypothesis was that in the absence of
nitrate, the low levels of NR protein present in the cytoplasm binds to NIT4, but
in the presence of nitrate NR binds to this substrate releasing NIT4 so that the
regulatory protein can enter the nucleus to mediate transcription. However,

both in vivo studies with the yeast two-hybrid system and direct in vitro binding
experiments eliminate the possibility of a binding between NIT4 and NR (Feng
and Marzluf, 1996).
Negative-acting regulatory gene, nmr
Another nitrogen regulatory gene, nmr, in N. crassa, which is unlinked to nit-2,

nit-4 or any of the nitrogen structural genes, appears to act negatively by
preventing the expression of NR, NiR and other N-related genes in the presence
of sufficient ammonia or glutamine (Premakumar et al., 1980; Dunn-Coleman
et al., 1981). In nmr mutants, the nitrogen structural genes are constitutively
expressed even in the presence of primary nitrogen sources. The NIT2 and NMR
proteins are capable of interacting with each other, as demonstrated by
mobility-shift experiments in vitro and the yeast two-hybrid system in vivo (Xiao
et al., 1995). Two separate α-helical regions of NIT2, one which occurs within
the zinc finger region, make direct contact with NMR. Mutations leading to
single amino acid substitutions in the zinc finger of NIT2 abolish NIT2–NMR
interaction. The nmr gene itself is not subject to regulation, and is constitutively
expressed.
NITRATE INDUCIBILITY OF GENE EXPRESSION IN HIGHER PLANTS
In higher plants, the nitrate uptake system, NR and NiR, are induced as a
primary response to environmental nitrate. In addition to these, nitrate also
induces the expression of GS and the ferredoxin-dependent GOGAT
(Redinbaugh and Campbell, 1993). As energy, reductant and carbon skeletons
are utilized in the uptake and reduction of nitrate and in the subsequent
incorporation of reduced nitrogen into organic compounds, the expression of
enzymes involved in the supply of these requirements may also be induced by
nitrate (Fig. 6.1). One example is the ferredoxin-NADP+ oxidoreductase which
supplies reductant for nitrite reduction in root plastids (Bowsher et al., 1993).
Environmental nitrate leads to a series of other events as well, such as the
transport of nitrate from root to shoot, proliferation of root tissue, changes in
root to shoot growth ratios and enhancement of respiration (Redinbaugh and
Campbell, 1991). Although these are physiologically and biochemically less
defined than the responses mentioned earlier, the fact that these events occur
indicate that nitrate could lead to gene expression in pathways both related and
unrelated to nitrate assimilation.
The first evidence for the ‘adaptive formation of NR’ in the presence of
nitrate was presented by Tang and Wu in 1957. Research since then has led to
the understanding that this induction occurs at the level of gene expression. In
the absence of nitrate, the transcript level of NR is either very low or
undetectable in leaves and roots of plants. Upon the addition of nitrate there is
a short lag phase, followed by a rapid increase in NR mRNA to a maximum level
and then a decline to steady-state (Galangau et al., 1988; Melzer et al., 1989).
RNA analysis and transcription assays with isolated nuclei indicate that nitrate
induction of NR mRNA is due to de novo synthesis of transcript and not due to
activation of pre-mRNA or reduced degradation of mRNA (Melzer et al., 1989;
Callaci and Smarrelli, 1991).
NiR gene expression in response to nitrate
The molecular nature of nitrate-induced gene expression in higher plants has

been examined to the greatest extent using the spinach NiR gene promoter and
the Arabidopsis NR gene promoter (Rastogi et al., 1993, 1997; Lin et al., 1994;
Hwang et al., 1997). In this review, we concentrate on the analysis of the
spinach NiR gene and its expression in the presence of nitrate. NiR catalyses the
six-electron reduction of nitrite to ammonium, using reduced ferredoxin as
reductant in chloroplasts of green leaves or a ferredoxin-like protein in root
plastids (Suzuki et al., 1985; Wray, 1993). The ferredoxin-like protein obtains
its reducing power from NADPH initially generated in the oxidative pentose
phosphate pathway (Bowsher et al., 1989). The NiR enzyme is a monomeric
protein of about 63 kDa containing sirohaem and a 4Fe4S centre as prosthetic
groups (Siegel and Wilkerson, 1989). It is encoded by nuclear DNA and
synthesized as a precursor protein with a N-terminal transit peptide targeting it
to the chloroplast or plastid. There is only one NiR apoprotein gene per haploid
genome in barley and spinach, while there are at least two in maize and four in
tobacco (reviewed by Wray, 1993). The four NiR genes in tobacco are known to
encode two distinct isoforms of the protein in shoots and a further two in roots.
The spinach NiR gene, when transcribed, gives a 2.3 kb mRNA which codes
for a protein of 594 amino acids (Back et al., 1988, 1991). There is a 32 amino
acid extension at the N-terminus of the protein, serving as the chloroplast
transit peptide. In spinach, nitrate is the primary determinant of NiR transcript
level, while light affects enzyme synthesis (Seith et al., 1991). In barley and
tobacco, on the other hand, both nitrate and light coact at the level of NiR gene
transcription (Neininger et al., 1992). In barley, while both these signals
determine transcription in leaves, nitrate alone is sufficient for gene expression
in roots (Duncanson et al., 1992). Since there is only one NiR gene in barley
expressed in both leaves and roots, it has been reasoned that the observed
difference in nitrate and light inducibility of NiR in leaves and roots might occur
in the signal transduction pathway leading to expression (Wray, 1993). This
might also explain the difference in nitrate and light inducibility between
spinach and tobacco, since the β-glucuronidase (GUS) reporter gene fused to
the 3.1 kb upstream regulatory sequence of the spinach NiR gene and expressed
in tobacco is induced by nitrate and light in accordance with the host, tobacco
(Neininger et al., 1993).
Analysis of a series of five deletions in the 3.1 kb upstream region of the

spinach NiR gene, which were fused to the GUS reporter gene and expressed in
transgenic tobacco, show that there is similar induction of GUS activity in the
presence of nitrate in all deletion constructs between 23100 and 2330
(Rastogi et al., 1993) (Fig. 6.2). These deletions do not affect the qualitative
nitrate-induced tissue-specific expression of GUS, which in all cases is confined
to mesophyll cells in leaves and vascular tissue in stem and roots. Induction of
GUS activity in roots and shoots occurs, respectively, within 2 h and 6 h, after
first exposure to nitrate. When the NiR gene promoter is deleted to 2200, the
nitrate-induced expression of GUS is lost indicating the presence of important
cis-acting elements between 2330 and 2200 which mediate the induction of
gene expression in response to nitrate.
Further deletion analysis of the promoter between 2330 and 2200, in vivo
DMS footprinting and electrophoretic mobility-shift assays reveal, for the first
time, a significant similarity between higher plants and filamentous fungi in
their regulatory machinery involved in nitrate induction (Rastogi et al., 1997).
The GUS gene is expressed in response to nitrate in transgenic tobacco plants
harbouring deletions from 2330 to 2230, but not in plants harbouring the
2200 deletion construct. This pin-points a cis-acting region involved in nitrate
induction that is at least in part located between 2230 and 2200. In vivo DMS
footprinting of the 2300 to 2130 region reveals several nitrate-inducible
footprints, two of them being in the 2230 to 2180 region. This region of the
spinach NiR promoter contains two adjacent GATA elements separated by 24
base pairs, located at 2214 to 2211 and at 2186 to 2183 (Fig. 6.3). The
–
TS NO 3 inducibility
–3100 GUS +
–330 +
–200 –
+67
–225 +
+5
–225 –
Fig. 6.2. Schematic representation of 5′ and 3′ deletions of the spinach NiR

promoter and nitrate inducibility of the GUS gene under the control of these
promoter deletions. TS indicates transcription start site, + indicates induction by
nitrate and 2 indicates lack of induction by nitrate.
Fig. 6.3. The 5′ upstream region of the spinach NiR gene promoter between 254
and 2294, which harbours the two GATA elements (boxed) and the A(C/G)TCA
sequence motifs (underlined).
G-residues in both the GATA elements are DMS protected, suggesting the
binding of trans-acting proteins to these cis-elements in the DNA. One possible
reason for the lack of nitrate-induced GUS activity in transgenic tobacco plants
harbouring the 2200 deletion construct could be the deletion of one of these
two crucial GATA elements, specifically the one located between 2214 and
2211. However, one cannot rule out the possibility that there are other
important cis-elements located in the 2230 to 2200 region which, upon
deletion in the 2200 construct, leads to lack of nitrate-induced GUS expression.
The 2240 to 2110 fragment of the spinach NiR gene promoter, which
contains the two adjacent GATA consensus core elements, binds in vitro to a
fusion protein comprising the zinc finger region of the NIT2 protein of N. crassa
(Rastogi et al., 1997). Similarily, two upstream fragments of the nitrate
reductase gene of Lycopersicon esculentum, each with a core GATA element,
binds to a NIT2-βGAL fusion protein (Jarai et al., 1992). If a mutated version of
the NIT2 protein is used, it fails to bind to the tomato NR promoter, indicating
that the binding is specific. However, NIT2 binds more strongly to the nit-3
promoter DNA fragment than it does to the plant NR or NiR promoters, as
indicated by dissociation kinetics and by competition in electrophoretic
mobility-shift assays. GATA core elements are also present in the 5′ upstream
region of genes encoding NR in tobacco, tomato, petunia and Arabidopsis
(Salanoubat and Ha, 1993; Lin et al., 1994). However, their significance in
nitrate-induced gene expression is not known at present. In Arabidopsis,
however, the GATA sequences are further upstream of the regions 2238 and
2330, identified as being sufficient to confer induction by nitrate in NR1 and

NR2, respectively, which encode nitrate reductase (Lin et al., 1994).
The importance of GATA elements in nitrate induction of the spinach NiR
gene expressed in transgenic tobacco imply the existence of NIT2-like DNA-
binding regulatory proteins in both spinach and tobacco. Several distinct GATA-
binding proteins have been identified in tobacco including those involved in
regulation of gene expression by circadian rhythm, light and phytochrome, but
it is not known whether any of these mediate nitrate-induced gene expression
(Anderson et al., 1994). A gene which encodes a zinc finger protein with 60%
amino acid identity to the zinc finger domain of NIT2 has been cloned in
tobacco (Daniel-Vedele and Caboche, 1993). However, it remains to be
established whether this protein interacts with the NR and NiR gene promoters
in tobacco, and whether it mediates nitrate-induced gene expression.
All the constructs used in the analysis of the spinach NiR gene promoter
contain a 130 bp 5′ untranslated leader sequence, which if deleted to +5 causes
complete loss of nitrate-inducible expression (Sivasankar et al., 1998). However,
the presence of at least 67 bp of the leader sequence together with the 2230
promoter region gives reporter gene expression in the presence of nitrate. This
implies that the presence of both the region around 2230 as well as specific
sequence motif(s) in the leader sequence are required for nitrate-induced
expression of spinach NiR.
In addition to the cis-acting elements discussed above, an AT-rich region
followed by a sequence motif, A(C/G)TCA, has also been identified as being
important for nitrate-induced gene expression, specifically in the case of Arabidopsis
NR. The significance of this sequence was discovered by linker-scanning analysis
of the 2238 and 2330 regions, respectively, of the NR1 and NR2 genes of
Arabidopsis (Hwang et al., 1997). This motif is present in the 5′ flanking regions of
NR and NiR genes of other plant species such as tobacco, maize, spinach, petunia,
barley and kidney bean. In the spinach NiR gene promoter there are two of these
motifs, one which occurs between 2200 bp and the transcription start site, and
the other upstream of 2300 bp. Both of these are outside the region identified by
promoter deletion analysis as being required for nitrate-induced expression
(Rastogi et al., 1993, 1997). Thus these sequence motifs do not appear to be
important for nitrate inducibility of the spinach NiR gene.
In addition to induction by nitrate, the spinach NiR promoter is also
repressed by nitrogen metabolites such as glutamine and asparagine. This
repression by nitrogen metabolites occurs in the case of NR and NiR in other
plant species such as maize and tobacco as well (Vincentz et al., 1993;
Sivasankar et al., 1997). All deletion constructs of the spinach NiR gene
promoter that respond to induction by nitrate are also subject to repression by
glutamine and asparagine (Sivasankar et al., 1998). This implies one of three
possibilities. One, cis-acting DNA-binding site(s) of a negative-acting regulatory
protein mediating repression occurs in the same vicinity of the promoter as
those of a positive-acting protein mediating induction. Two, a negative-acting
regulatory protein, which does not require DNA binding to be functional,
interacts with a NIT2-like protein preventing the latter from mediating

expression of nitrate-inducible genes in the presence of the repressor. Three, the
nitrogen catabolites cause a primary repression of nitrate uptake, in which case
the repression observed with the NiR promoter would be the result of reduced
nitrate uptake.
CONCLUSIONS AND PERSPECTIVES
Gene expression of NR and NiR, two key enzymes in the nitrate assimilatory
pathway, is induced by nitrate and repressed by nitrogen metabolites in both
higher plants and filamentous fungi. The presence of NIT2-binding GATA
consensus elements in the spinach NiR promoter, its importance in nitrate-
induced gene expression and the binding, in vitro, of the spinach NiR promoter
and the tomato NR promoter to the N. crassa NIT2 zinc finger domain, are all
lines of evidence indicating possible analogy between higher plants and
filamentous fungi in their regulatory machinery leading to nitrate-induced
expression. However, NIT2-binding sites may not be the only cis-acting elements
required for gene expression in the presence of nitrate. It is possible that the
combined presence of more than one regulatory motif in a full-length promoter
is required for optimal nitrate-induced expression, at least with regard to the
spinach NiR. Although the cis-acting elements involved in nitrate-induced gene
expression have been analysed in some detail, the isolation of trans-acting
factors mediating this phenomenon has not been successful so far, mostly due
to the difficulty in isolating regulatory mutants. Thus our understanding of the
molecular mechanisms underlying the induction of gene expression in the
presence of nitrate is still in its infancy.
REFERENCES
Anderson, S.L., Teakle, G.R., Martino-Catt, S.J. and Kay, S.A. (1994) Circadian clock- and
phytochrome-regulated transcription is conferred by a 78 bp cis-acting domain of
the Arabidopsis CAB2 promoter. The Plant Journal 6, 457–470.
Back, E., Burkhart, W., Moyer, M., Privalle, L. and Rothstein, S. (1988) Isolation of cDNA
clones coding for spinach nitrite reductase: Complete sequence and nitrate
induction. Molecular and General Genetics 212, 20–26.
Back, E., Dunne, W., Schneiderbauer, A., de Framond, A., Rastogi, R. and Rothstein, S.J.
(1991) Isolation of the spinach nitrite reductase gene promoter which confers
nitrate inducibility on GUS gene expression in transgenic tobacco. Plant Molecular
Biology 17, 9–18.
Bowsher, C.G., Hucklesby, D.P. and Emes, M.J. (1989) Nitrite reduction and carbohydrate
metabolism in plastids purified from roots of Pisum sativum L. Planta 177, 359–366.
Bowsher, C.G., Long, D.M., Oaks, A. and Rothstein, S.J. (1991) Effect of light/dark cycles
on expression of nitrate assimilatory genes in maize shoots and roots. Plant
Physiology 95, 281–285.
Bowsher, C.G., Hucklesby, D.P. and Emes, M.J. (1993) Induction of ferredoxin-NADP+
oxidoreductase and ferredoxin synthesis in pea root plastids during nitrate
assimilation. The Plant Journal 3, 463–467.
Caddick, M.X., Arst, H.N., Taylor, L.H., Johnson, R.I. and Brownlee, A.G. (1986) Cloning
of the regulatory gene areA mediating nitrogen metabolite repression in Aspergillus
nidulans. The EMBO Journal 5, 1087–1090.
Callaci, J.J. and Smarrelli, J. Jr. (1991) Regulation of the inducible nitrate reductase
isoform from soybeans. Biochimica et Biophysica Acta 1088, 127–130.
Cheng, C.-L., Acedo, G.N., Christinsin, M. and Cronkling, M.A. (1992) Sucrose mimics
the light induction of Arabidopsis nitrate reductase gene transcription. Proceedings
of the National Academy of Sciences USA 89, 1861–1864.
Chiang, T.-Y. and Marzluf, G.A. (1994) DNA recognition by the NIT2 nitrogen
regulatory protein: importance of the number, spacing and orientation of GATA
core elements and their flanking sequences upon NIT2 binding. Biochemistry 33,
576–582.
Chiang, T.-Y. and Marzluf, G.A. (1995) Binding affinity and functional significance of
NIT2 and NIT4 binding sites in the promoter of the highly regulated nit-3 gene,
which encodes nitrate reductase in Neurospora crassa. Journal of Bacteriology
177(21), 6093–6099.
Crawford, N.M. (1995) Nitrate: nutrient and signal for plant growth. Plant Cell 7,
859–868.
Crawford, N.M. and Arst, H.N.J. (1993) The molecular genetics of nitrate assimilation in
fungi and plants. Annual Review of Genetics 27, 115–146.
Daniel-Vedele, F. and Caboche, M. (1993) A tobacco cDNA clone encoding a GATA-1 zinc
finger protein homologous to regulators of nitrogen metabolism in fungi. Molecular
and General Genetics 240, 365–373.
Davis, M.A. and Hynes, M.J. (1987) Complementation of areA2 regulatory gene
mutations of Aspergillus nidulans by the heterologous regulatory gene nit-2 of
Neurospora crassa. Proceedings of the National Academy of Sciences USA 84, 3753–3757.
Deng, M.-D., Moureaux, T. and Caboche, M. (1989) Tungstate, a molybdate analogue
inactivating nitrate reductase, deregulates the expression of the nitrate reductase
structural gene. Plant Physiology 91, 304–309.
Deng, M.-D., Moureaux, T., Cherel, I., Boutin, J.-P. and Caboche, M. (1991) Effects of
nitrogen metabolites on the regulation and circadian expression of tobacco nitrate
reductase. Plant Physiology and Biochemistry 29, 239–247.
Duncanson, E., Ip, S.-M., Sherman, A., Kirk, D.W. and Wray, J.L. (1992) Synthesis of
nitrite reductase is regulated differently in leaf and root of barley (Hordeum vulgare
L.). Plant Science 87, 151–160.
Dunn-Coleman, N.S., Tomsett, A.B. and Garrett, R.H. (1981) The regulation of nitrate
assimilation in Neurospora crassa: biochemical analysis of NMR1 mutants. Molecular
Feng, B. and Marzluf, G.A. (1996) The regulatory protein NIT4 that mediates nitrate
induction in Neurospora crassa contains a complex tripartite activation domain with
a novel leucine-rich, acidic motif. Current Genetics 29, 537–548.
Fu, Y.-H. and Marzluf, G.A. (1987) Characterization of nit-2, the major nitrogen regulatory
gene of Neurospora crassa. Molecular and Cellular Biology 7(5), 1691–1696.
Fu, Y.-H. and Marzluf, G.A. (1990) nit-2, the major positive-acting nitrogen regulatory
gene of Neurospora crassa, encodes a sequence-specific DNA-binding domain.
Fu, Y.-H., Feng, B., Evans, S. and Marzluf, G.A. (1995) Sequence-specific DNA binding
by NIT4, the pathway-specific regulatory protein that mediates nitrate induction in
Neurospora. Molecular Microbiology 15(5), 935–942.
Galangau, F., Daniel-Vedele, F., Moureaux, T., Dorbe, M.-F., Leydecker, M.-T. and Caboche,
M. (1988) Expression of leaf nitrate reductase genes from tomato and tobacco in
relation to light–dark regimes and nitrate supply. Plant Physiology 88, 383–388.
Huber, S.C., Bachmann, M. and Huber, J.L. (1996) Post-translational regulation of
nitrate reductase activity: a role for Ca2+ and 14-3-3 proteins. Trends in Plant Science
1(12), 432–438.
Hwang, C.-F., Lin, Y., D’Souza, T. and Cheng, C.-L. (1997) Sequences necessary for
nitrate-dependent transcription of arabidopsis nitrate reductase genes. Plant
Jarai, G., Truong, H.-N., Daniel-Vedele, F. and Marzluf, G.A. (1992) NIT2, the nitrogen
regulatory protein of Neurospora crassa, binds upstream of nia, the tomato nitrate
reductase gene, in vitro. Current Genetics 21, 37–41.
Kannangara, C.G. and Woolhouse, H.W. (1967) The role of carbon dioxide, light and
nitrate in the synthesis and degradation of nitrate reductase in leaves of Perilla
frutescens. New Phytologist 66, 553–561.
Lillo, C. (1994) Light regulation of nitrate reductase in green leaves of higher plants.
Physiologia Plantarum 90, 616–620.
Lin, Y., Hwang, C.-F., Brown, J.B. and Cheng, C.-L. (1994) 5′ proximal regions of
Arabidopsis nitrate reductase genes direct nitrate-induced transcription in transgenic
tobacco. Plant Physiology 106, 477–484.
Marzluf, G.A. (1981) Regulation of nitrogen metabolism and gene expression in fungi.
Microbiological Reviews 45, 437–461.
Marzluf, G.A. (1993) Regulation of sulfur and nitrogen metabolism in filamentous fungi.
Annual Review of Microbiology 47, 31–55.
Marzluf, G.A. and Fu, Y.-H. (1989) Genetic regulation of nitrogen metabolism in
Neurospora crassa. In: Wray, J.L. and Kinghorn, J.R. (eds) Molecular and Genetic
Aspects of Nitrate Assimilation. Oxford Science Publications, Oxford, pp. 296–302.
Melzer, J.M., Kleihofs, A. and Warner, R.L. (1989) Nitrate reductase regulation: effects
of nitrate and light on nitrate reductase mRNA accumulation. Molecular and General
Genetics 217, 341–346.
Neininger, A., Kronenberger, J. and Mohr, H. (1992) Coaction of light, nitrate and a
plastidic factor in controlling nitrite reductase gene expression in tobacco. Planta
187, 381–387.
Neininger, A., Bichler, J., Schneiderbauer, A. and Mohr, H. (1993) Response of a nitrite-
reductase 3.1-kilobase upstream regulatory sequence from spinach to nitrate and
light in transgenic tobacco. Planta 189, 440–442.
Pouteau, S., Cherel, I., Vaucheret, H. and Caboche, M. (1989) Nitrate reductase mRNA
regulation in Nicotiana plumbaginifolia nitrate reductase-deficient mutants. Plant Cell
1, 1111–1120.
Premakumar, R., Sorger, G.J. and Gooden, D. (1980) Repression of nitrate reductase in
Neurospora studied by using L-methionine-DL-sulfoximine and glutamine auxotroph
gln-lb. Journal of Bacteriology 143, 411–415.
Rastogi, R., Back, E., Schneiderbauer, A., Bowsher, C.G., Moffatt, B. and Rothstein, S.J.
(1993) A 330 bp region of the spinach nitrite reductase gene promoter directs
nitrate-inducible tissue-specific expression in transgenic tobacco. Plant Journal 4,
317–326.
Rastogi, R., Bate, N., Sivasankar, S. and Rothstein, S.J. (1997) Footprinting of the spinach
nitrite reductase gene promoter reveals the preservation of nitrate regulatory
elements between fungi and higher plants. Plant Molecular Biology 34, 465–476.
Redinbaugh, M.G. and Campbell, W.H. (1991) Higher plant responses to environmental
nitrate. Physiologia Plantarum 82, 640–650.
Redinbaugh, M.G. and Campbell, W.H. (1993) Glutamine synthetase and ferredoxin-
dependent glutamate synthase expression in the maize (Zea mays) root primary
response to nitrate. Evidence for an organ-specific response. Plant Physiology
101(4), 1249–1255.
Salanoubat, M. and Ha, D.B.D. (1993) Analysis of the petunia nitrate reductase
apoenzyme-encoding gene: a first step for sequence modification analysis. Gene 128,
147–154.
Seith, B., Schuster, C. and Mohr, H. (1991) Coaction of light, nitrate and a plastidic
factor in controlling nitrite-reductase gene expression in spinach. Planta 184,
74–80.
Siegel, L.M. and Wilkerson, J.Q. (1989) Structure and function of spinach ferredoxin
nitrite reductase. In: Wray J.L. and Kinghorn, J.R. (eds) Molecular and Genetic Aspects
of Nitrate Assimilation. Oxford Science Publications, Oxford, pp. 263–283.
Sivasankar, S. and Oaks, A. (1996) Nitrate assimilation in higher plants: the effect of
metabolites and light. Review. Plant Physiology and Biochemistry 34(5), 609–620.
Sivasankar, S., Rothstein, S.J. and Oaks, A. (1997) Regulation of the accumulation and
reduction of nitrate by nitrogen and carbon metabolites in Zea mays L. seedlings.
Plant Physiology 114, 583–589.
Sivasankar, S., Rastogi, R., Jackman, L., Oaks, A. and Rothstein, S.J. (1998) Analysis of
cis-acting DNA elements mediating induction and repression of the spinach nitrate
reductase gene. Planta 206, 66–71.
Suzuki, A., Oaks, A., Jacquot, J.P., Vidal, J. and Gadal, P. (1985) An electron transport
system in maize roots for reactions of glutamate synthase and nitrite reductase.
Tang, P.S. and Wu, H.Y. (1957) Adaptive formation of nitrate reductase in rice seedlings.
Nature 179, 1355–1356.
Tomsett, A.B. and Garrett, R.H. (1981) Biochemical analysis of mutants defective in
nitrate assimilation in Neurospora crassa: evidence for autogenous control by nitrate
reductase. Molecular and General Genetics 184, 183–190.
Vincentz, M., Moureaux, T., Leydecker, M.-T., Vaucheret, H. and Caboche, M. (1993)
Regulation of nitrate and nitrite reductase expression in Nicotiana plumbaginifolia
leaves by nitrogen and carbon metabolites. Plant Journal 3, 315–324.
Wray, J.L. (1993) Molecular biology, genetics and regulation of nitrite reduction in higher
plants. Physiologia Plantarum 89, 607–612.
Xiao, X.D. and Marzluf, G.A. (1993) Amino-acid substitutions in the zinc finger of NIT2,
the nitrogen regulatory protein of Neurospora crassa, alter promoter element
recognition. Current Genetics 24, 212–218.
Xiao, X.D., Fu, Y.-H. and Marzluf, G.A. (1995) The negative-acting NMR regulatory
protein of Neurospora crassa binds to and inhibits the DNA-binding activity of the
positive-acting nitrogen regulatory protein NIT2. Biochemistry 34, 8861–8868.
Yuan, G.-F., Fu, Y.-H. and Marzluf, G.A. (1991) nit-4, a pathway-specific regulatory gene
of Neurospora crassa, encodes a protein with a putative binuclear zinc DNA-binding
domain. Molecular and Cellular Biology 11(11), 5735–5745.
Use of Heat-shock Promoters

7
to Control Gene Expression
in Plants
Ronald T. Nagao1 and William B. Gurley2
1Botany Department, University of Georgia, Athens, GA

30602, USA; 2Department of Microbiology and Cell Science,
University of Florida, Gainesville, FL 32611, USA
INTRODUCTION
Inducible gene systems are useful for a variety of reasons: they provide a means
to manipulate levels of gene expression in order to better understand the
functions of individual genes in an experimental setting, or allow the regulated
production of large amounts of specific gene products in order to capitalize on
the known function of a specific gene. The ability to introduce inducible
promoters into plants by a variety of transformation procedures provides a
flexible and powerful system to control foreign gene expression. Such regula-
tion can be achieved by the use of promoters from developmental and cell-
specific genes which are responsive to developmental cues, promoters induced
by environmental stimuli, or promoters induced by chemical or synthetic
compounds. Many considerations are important in the selection of a promoter
for expression of an introduced gene. For example, use of a cell-specific or
developmentally controlled promoter limits expression to a particular cell,
tissue or developmental window which may be desirable for some genes, but
may be too limited to be effective for other genes. With chemical inducers,
regulation is not limited by localized expression but by the need for the constant
presence or repeated application of the inducer which may be expensive,
impractical and environmentally unsound. Additionally, the imposition of
special growth conditions for the purpose of gene induction will not generally
be useful in agricultural situations (Ward et al., 1993). And finally, a complica-
tion in the use of bacterial regulatory systems is that the metabolic principles
that underlie chemical gene regulation in microbes do not readily extrapolate
to plants. In some circumstances, depending on the gene in question, a general
widespread expression may be more useful than cell-specific expression. Thus
98 R.T. Nagao and W.B. Gurley
depending on a number of factors, including the properties of the gene product

in question, species, economic and environmental constraints, and cultivation
practices, a single promoter system is unlikely to be suitable for all situations.
In this chapter we summarize the use of a heat-shock (HS) promoter
system for inducible expression of introduced genes in transgenic plants. The
HS promoter system offers numerous advantages, not the least of which is a
system whose metabolic and regulatory principles readily extrapolate to all
plants. In agricultural settings, the system inducer, heat, is naturally present
without additional input or adverse environmental impact often associated with
application of chemicals. Continued expression is assured by repeated activa-
tion of the system on an almost daily basis by the natural diurnal temperature
cycle of the growing season. The HS promoter system offers an alternative to
present systems that is reliable, economical and virtually maintenance free.
THE HEAT-SHOCK RESPONSE IN PLANTS
High temperature stress is only one of many different stresses that plants and
other organisms encounter. The needs dictated to respond to high temperature
have evolved into a highly conserved phenomenon called the heat-shock
response. The HS response was first observed in Drosophila (Ritossa, 1962) and
is characterized by dramatic and rapid changes in both transcription and
translation with the onset of heat stress (see Ashburner and Bonner, 1979). The
HS response occurs in most, if not all, organisms ranging from bacteria and
lower eukaryotes to mammals and plants.
Heat-shock proteins (HSPs) are induced at different temperatures in
different organisms, but in each case induction occurs at a temperature that
constitutes a stress for that particular organism. In plants the HS response
occurs after an elevation of approximately 8–12°C above the normal growing
temperature and is characterized by a very rapid induction of HS gene
transcription with a concomitant decline in the transcription of most other
genes. Selective translation of HS mRNAs at HS temperatures (or rapid turnover
of non-HS mRNAs in bacteria and yeast) results in selective and rapid
accumulation of HSPs at elevated temperature.
An additional feature of the HS response is the transient nature of HS gene
expression, ranging from a few minutes in Escherichia coli to a few hours in
higher eukaryotes. This characteristic of short-lived expression suggests that
the response is self-regulated. While a common mechanism has not been
demonstrated among various groups of organisms, the phenomenon is a highly
conserved component of the HS response. One of the considerations in
developing models to explain autoregulation is the observation that different
HS promoters are induced with different kinetics of expression. Most aspects of
differential expression can be accounted theoretically in the configuration of
perfect and imperfect heat-shock consensus elements (HSEs) in the promoter as
discussed in more detail later.
Use of Heat-shock Promoters 99
HSPs were originally defined by the property of being heat inducible. A

number of classes of HSPs have been described and are generally designated by
their approximate molecular weights in kDa as HSP100, HSP90, HSP70,
HSP60 and low molecular weight (LMW) HSPs (15–30 kDa). Ubiquitin, a small
protein involved in ATP-dependent proteolysis, does not have sequence
homology to HSP classes but is also referred to as an HSP because of its heat
inducibility (Hershko, 1988). One distinguishing feature of the plant HS
response is the high abundance and complexity of the LMW HSPs (Key et al.,
1981; Mansfield and Key, 1987). In most species of plants where it has been
examined, the LMW HSPs number 20 or more different proteins compared to a
much smaller number in other eukaryotes. For example, Drosophila has four
major LMW HSP genes, while yeast and mammals have only one (Nagao et al.,
1986; Lindquist and Craig, 1988). The LMW HSPs have been classified into at
least six gene families targeted to different cellular components including the
cytosol, chloroplasts, mitochondria and endoplasmic reticulum (LaFayette et
al., 1996; for reviews see Vierling, 1991; Waters et al., 1996). A high diversity
and the organellar localization of LMW HSPs are unique to plants.
The extraordinary conservation of various aspects of the HS response has
been used as a functional argument for the ancient origin of this complex of
genes and regulatory circuits, and for its continued benefit to present day
organisms. The evolution of HS promoters has been shaped by selection
pressures that have favoured the rapid and large-scale induction of HSPs
during emergency processes or conditions such as heat stress where abnormally
folded/denatured proteins are produced. An overwhelming volume of data is
consistent with this idea. A number of excellent reviews detail both the
historical background and recent progress in protein folding and molecular
chaperones (Lindquist and Craig, 1988; Ellis and van der Vies, 1991; Gething
and Sambrook, 1992; Craig et al., 1993; Georgopoulos and Welch, 1993;
Hendrick and Hartl, 1993; Parsell and Lindquist, 1993; Landry and Gierasch,
1994; Morimoto et al., 1994; Boston et al., 1996). Furthermore, a remarkable
amount of research leads to the conclusion that not only is the HS response very
complex with major features conserved among organisms, but members of the
HSP families play a central role in a constantly increasing number of cellular
functions. A number of important books and reviews have been written on
various aspects of the subject (see Nover and Scharf, 1997; Waters et al., 1996;
Boston et al., 1996 and references therein).
THERMOTOLERANCE
Most organisms, including plants, can survive an otherwise lethal high

temperature treatment if they are first pretreated at a non-lethal high
temperature leading to HSP synthesis. This phenomenon is called induced or
acquired thermotolerance. Many experiments have shown that the acquisition
of thermotolerance correlates with conditions resulting in synthesis of HSPs
(Lin et al., 1984; Kimpel and Key, 1985; Nagao et al., 1986; Lindquist and Craig,
1988; Parsell and Lindquist, 1994). While the volume of correlative data is
impressive, it does not prove the involvement of HSPs in thermotolerance. A
compelling demonstration that an HSP is required for induced thermotolerance
was demonstrated for Hsp104 from yeast. A deletion mutant lacking the
HSP104 gene failed to acquire thermotolerance; however, reintroduction of the
HSP104 gene rescued the thermotolerant phenotype (Sanchez and Lindquist,
1990). These results demonstrate that at least one HSP plays a critical role in
cell survival at extreme temperatures. Similar verification of protein function
was demonstrated for plants where HSP101 genes from soybean and
Arabidopsis complemented a yeast HSP104 deletion mutant in acquiring
thermotolerance (Lee et al., 1994; Schirmer et al., 1994).
The focus of this chapter is on the transcriptional regulation of the HS
response in plants and the use of HS promoters to control inducible transcrip-
tion in plants. Emphasis is placed on plant examples of promoter function with
possible uses as well as some considerations and precautions. As a foundation
for the beneficial use of HS promoters, a summary discussion of HS promoter
expression and the fundamentals of how HS promoters work and their
organization and types are presented.
DEVELOPMENTAL EXPRESSION
Although HSPs were initially defined as proteins whose expression is highly

induced by elevated temperature, many recent studies indicate that these
proteins are also regulated by a variety of environmental and developmental
signals in animals (Pauli and Tissières, 1990; Arrigo and Landry, 1994) and
plants (Zimmerman and Cohill, 1991). A number of reports have documented
the expression or detection of LMW HSP mRNAs in cases other than induction
by heat stress (see Waters et al., 1996). A remarkable aspect of induction of
HSPs associated with development is that, typically, only certain classes of HSPs
(e.g. LMW HSPs) and/or specific members of a class are expressed. This supports
two ideas regarding the role of HSPs: (i) that HSPs can be functionally distinct
between classes and perhaps even between members of the same class; and (ii)
that HSPs so induced provide functions essential to the developmental process.
The promoters regulating these genes must therefore be functionally distinct,
either containing developmentally activated motifs or unique configurations of
HS elements as discussed later.
POLLEN DEVELOPMENT
Developmental regulation of HSP gene expression without the imposition of

elevated temperature is illustrated in pollen development in several species
including lily (Bouchard, 1990), maize (Dietrich et al., 1991; Atkinson et al.,
1993) and tobacco (Zarsky et al., 1995). In maize, HSP mRNA transcripts
encoding 18 kDa HSPs are expressed in a stage-specific manner during
microsporogenesis without heat stress (Dietrich et al., 1991; Atkinson et al.,
1993). The genes encoding two 18 kDa HSPs are expressed and/or accumulate
independently during microsporogenesis implying gene-specific developmental
regulation rather than general activation of the HS or stress response (Atkinson
et al., 1993). In tobacco pollen embryogenesis, Northern analysis showed that
expression of a class I LMW HSP, NtHsp18P, is activated at normal temperatures
during the dehydration phase of pollen development just before anthesis. It was
further shown that these same transcripts accumulated when pollen embryo-
genesis was induced in vitro by starvation (Zarsky et al., 1995). Thus, while it
has not been demonstrated that HSPs are directly involved in the induction of
pollen embryogenesis, the selective and stage-specific induction of these genes
implies that the expression of LMW HSPs plays an important role in pollen
development.
POLLEN
In general, mature pollen of most plant species lacks a normal HS response. In

several species either no HSPs are synthesized in response to HS or, if
synthesized, only a subset is made (Mascarenhas and Crone, 1996).
Previous studies have shown that the typical HSPs cannot be induced by
heat in germinating pollen of several species including maize (Cooper et al.,
1984; Frova et al., 1989; Dupuis and Dumas, 1990; Hopf et al., 1992), lily
(Schrauwen et al., 1986), petunia (Schrauwen et al., 1986), tobacco (Spena and
Schell, 1987), tomato (Duck and Folk, 1994), and Tradescantia (Altschuler and
Mascarenhas, 1982; Xiao and Mascarenhas, 1985). A notable exception is
Sorghum pollen where immature pollen and in vitro germinating pollen
synthesize a subset of HSPs made in vegetative tissues at heat stress
temperatures (Frova et al., 1991).
The importance of the lack of HSP induction in pollen for many temperate
crop species is illustrated in maize where environmental stress, especially high
temperature stress, can interfere with productivity. The pollination and
fertilization period, which determines seed set, is particularly sensitive to stress,
and substantial loss of yield occurs if heat stress coincides with these sensitive
times (Herrero and Johnson, 1980). Even a minor improvement of pollen heat
resistance (1–2°C) could have significant impact on crop yield. Mechanistically,
it is known that HS treatment of germinating maize pollen does not induce
HSPs, as in vegetative tissues (Hopf et al., 1992). While low levels of HS mRNAs
were detected, accumulation of mRNAs to high levels did not occur. This failure
to exhibit a typical HS response cannot be attributed to a general inability to
transcribe genes, because α-tubulin is actively transcribed in maize pollen
during heat stress (Hopf et al., 1992). This deficiency of promoter activation was
also seen using Drosophila Hsp70 fused to a neomycin phosphotransferase
reporter gene which was expressed in all tissues of transgenic tobacco in

response to HS except pollen (Spena and Schell, 1987). This general deficiency
in promoter activation/recognition in response to high temperature in pollen is
a major factor that must be overcome before improved heat-stress resistance in
pollen can be attained. It would be interesting to measure HS transcription
factor (HSF; discussed later) ratios and abundance to see if they are different in
pollen and whether a change in HSF(s) could improve or modify the HS
response of pollen.
EMBRYO DEVELOPMENT AND SEEDS
The expression or detection of LMW HSP mRNAs in developing embryos of

seeds from a number of different species including: sunflower (Almoguera and
Jordano, 1992; Coca et al., 1994); sorghum (Howarth, 1990); pea (Vierling and
Sun, 1989; DeRocher and Vierling, 1994); maize (Shen et al., 1994); and wheat
(Helm and Abernethy, 1990) has been reported. Experiments performed under
controlled environments demonstrated that expression of HSPs in seeds is due
to endogenous developmental signals rather than stressful environmental
signals (Coca et al., 1994; DeRocher and Vierling, 1994). Recent experiments
using antibody detection of HSP17 demonstrated tissue-specific expression of
HSP17 in developing seeds of different plant species including Lycopersicon
esculentum, Pisum sativum, Zea mays, Vicia faba and Nicotiana rustica (zur Nieden
et al., 1995). The intracellular localization showed species-specific variations,
and, in contrast to heat stress, the developmentally regulated HSP17 is found
mainly in the nucleus rather than forming large cytoplasmic aggregates (zur
Nieden et al., 1995). HSP70 genes have also been shown to be differentially
expressed during development. In pea leaves PsHSP71.2 is strictly heat
inducible, PsHSC71.0 is present constitutively and PsHSP70b is constitutively
expressed at low levels, but strongly induced by heat stress. PsHSP71.2 is also
expressed in zygotic, but not maternal, organs of developing pea seeds, while
PsHSC71.0 and PsHSP70b are expressed in maternal and zygotic organs
throughout seed development (DeRocher and Vierling, 1995). Taken together
these results further document the selective activation of HSP gene expression
and the precise activation by specific HSP promoters under non-heat stress
conditions. This selective activation of specific sets of HS promoters by develop-
mental signals may be an important consideration for future use of HS
promoters in engineering gene expression.
Additional regulatory control of HS gene expression at the translational
level was reported by Zimmerman et al. (1989) who showed that normal HS-
induced transcription of HSP genes does not occur as undifferentiated carrot
callus cells undergo the process of somatic embryogenesis. These globular
embryos accumulate very low levels of HS mRNA for LMW HSPs (Zimmerman
et al., 1989) and HSP70 (Lin et al., 1991) after HS, but are fully capable of
synthesizing the full complement of HSPs at levels comparable to those of
heat-stressed callus cells (Zimmerman et al., 1989). The level of HSP

synthesized is regulated by translational control where callus cells translate
only a fraction of the abundant HS mRNAs they accumulate, while globular
embryos more selectively translate the fewer HS mRNAs they contain
(Zimmerman et al., 1989; Apuya and Zimmerman, 1995).
FLORAL DEVELOPMENT
LMW HSPs are normally induced only under stress conditions except where a
subset may accumulate during seed development or pollen maturation, as
discussed. Expression in floral organs provides another example where LMW
HSP genes are activated in response to developmental cues. An Arabidopsis HS
promoter (HSP18.2) fused to the GUS reporter gene showed constitutive floral
organ-specific expression under normal growth temperature (22°C). Under
non-stress conditions the fusion gene is expressed in sepals, filaments and the
styles of floral organs, suggesting the involvement of HSP18.2 gene during
floral development (Tsukaya et al., 1993). Consistent with normal HS promoter
activity, very high levels of GUS activity were induced by heat stress in all organs
except seeds (Takahashi et al., 1992).
CONSTITUTIVE PROMOTERS WITH ENHANCED HEAT-SHOCK

EXPRESSION
Depending on the transgenic application of a promoter, one desirable expression

type is constitutive expression at control temperatures but inducibility to higher
levels upon HS. Two plant promoters with these general characteristics are the
polyubiquitin genes, Ubi 1 and Ubi 2, from maize (Christensen et al., 1992) and
the general stress gene, GmHsp26A, from soybean which encodes a glutathione-
S-transferase (Czarnecka et al., 1984, 1988; Ulmasov et al., 1995). Studies
among ubiquitin plant genes show some tissue specificity but most are
constitutively expressed in all organs (Bond and Schlesinger, 1986; Finley et al.,
1987; Burke et al., 1988; Christensen and Quail, 1989). The GmHsp26A gene
has the additional property of being induced by many different stress agents or
treatments (Czarnecka et al., 1984).
CONSTITUTIVE EXPRESSION OF LMW HSPS
In general, the expression of LMW HSPs is programmed either by environ-

mental stress or by special developmental situations. However, an example of
constitutive expression of LMW HSPs is seen in the vegetative tissues of the
resurrection plant Craterostigma plantagineum where expression was detected by
immunocross-reactivity of antibodies raised to sunflower LMW HSPs. In
unstressed plants, the cross-reacting polypeptides showed homogeneous tissue

distributions and were abundant in the roots and lower parts of the shoots
(Alamillo et al., 1995).
WINTER ACCLIMATION
Additional complexity of promoter function is indicated in woody plants where

seasonal patterns of HSP70, cognate HSP70 (constitutive; HSC70) and BiP
protein expression associated with winter acclimation were observed in each of
eight species of woody plants (Wisniewski et al., 1996). Further research is
required to determine whether the promoters of these genes contain specific
environmental motifs for winter acclimation, or are induced, perhaps, by
general desiccation stress. If non-HSE elements are responsible, prudence is
required in the selection of a specific promoter for transgene expression, since
many HS promoters may lack these specialized elements and may be inadequate
to achieve the desired expression. It seems reasonable to suggest that this type
of expression is a highly evolved extension to the HS response to insure HSP
chaperone-like function during winter acclimation. The bulk of present data
would suggest the need for this type of specialized function to be the exception
rather than the rule.
INDUCTION BY OTHER STRESSES
As research continues in the area of stress biology, more examples of selective

expression of HSPs and HSP-like proteins associated with specific stresses,
environmental factors or chemical agents are reported. One additional example
to further illustrate the apparent diversity of potential inducing agents is the
oxidative stress induction of a LMW HSP cDNA by ozone. In this example, a
cDNA library from parsley plants was differentially screened using labelled
reverse-transcribed poly(A+) RNA isolated from ozone-treated parsley plants
(Eckey-Kaltenbach et al., 1997). In addition to isolating pathogenesis-related
proteins (PR1-3 and PR1-4), a LMW HSP was also isolated. Northern analyses
showed a transient induction of the three mRNA species after ozone fumigation.
HS treatment resulted in an increase of LMW HSP mRNA, whereas no increase
for transcripts of PR1-3 or PR1-4 was observed.
ORGANIZATION AND TYPES OF HEAT-SHOCK PROMOTERS
Heat induction of gene expression is dependent on the presence of HS

consensus elements (HSEs) in the promoter (Pelham, 1982). A trimer of the HS
transcription factor (HSF) binds to these elements after the cell has experienced
a heat stress and strongly activates transcription of HS genes (for review see Wu,
1995). For HSF1 in humans, the binding is very dependent on cooperativity

between HSF trimers. This dependence on cooperativity in HSF binding is
reflected in the organization of HS promoters which contain multiple HSEs with
varying degrees of match to the consensus HSE core (5′-GAA-3′). A detailed
functional analysis of the soybean Gmhsp15.5 promoter in vivo indicated that
the optimum HSE core is preceded by an A and followed by G to give the
sequence 5′-aGAAg-3′, or 5′-cTTCt-3′ depending on the orientation (Barros et
al., 1992). Similar studies in Drosophila indicated that the core HSE is
5′-AGAAn-3′ (Cunniff and Morgan, 1994; Fernandes et al., 1994; Kroeger and
Morimoto, 1994). For optimal function, an HSE must contain at least four
recognizable HSE cores located 2 bp apart in an alternating array
(5′-GAAnnTTCnnGAAnnTTC-3′). This provides for the binding of two trimers
assuming that functional association of each HSF trimer with the promoter only
requires that two of its subunits make strong contact with the promoter DNA
(Perisic et al., 1989). There is usually at least one perfect HSE core within 30 bp
upstream of TATAA embedded within a cluster of imperfect HSE cores to
comprise site I (Fig. 7.1, class A) (Topol et al., 1985; Czarnecka-Verner et al.,
1994; Wu, 1995). A single cluster of HSE cores usually contains one functional
HSE. There are often two clusters of core elements located within approximately
120 bp upstream from the start of transcription (for plants see Czarnecka-
Verner et al., 1994; Gurley and Key, 1991). The first cluster at site I is TATAA-
proximal and usually shows greater homology to the HSE consensus. For full
activation, HSFs must occupy both site I and site II clusters (Topol et al., 1985).
In the Drosophila hsp70 promoter occupancy of the TATAA-distal site II is
dependent on cooperative interactions with HSFs bound to site I. The affinity of
HSF for site II is about ten times greater if site I is already occupied (Topol et al.,
1985), and the cooperativity in binding between two adjacent HSEs is around
2000-fold (Xiao et al., 1991). Factors that affect HS promoter strength include
the number and arrangement of HSE core sequences, the degree of match of
HSE cores to the consensus, and the spacing between HSE clusters (Cohen and
Meselson, 1984). The spacing of clusters determines the helical alignment of
HSFs bound at the two sites which results in a periodic affect on the coopera-
tivity of HSF binding, especially if one of the sites exhibits low affinity for HSF.
However, if two high-affinity HSE sites are present, there is no requirement that
the bound HSFs show stereo-specific alignment for transcriptional activation.
Likewise, there seems to be no preferred alignment between HSFs and general
transcription factors bound at the TATAA motif (Amin et al., 1994).
In addition to HSEs, HS promoters usually contain auxiliary elements such
as the GAGA factor binding site in Drosophila (Lee et al., 1992; Tsukiyama et al.,
1994), or AT-rich elements in plants, that have little or no activity alone, but
enhance heat-inducible expression when present upstream of HS genes
(Czarnecka et al., 1992; Gurley et al., 1993). Proteins that bind auxiliary
elements seem to facilitate the binding of HSF by occupying the promoter under
non-stress conditions to keep the chromatin open and the HSEs and TATAA
sequences accessible. In the case of the GAGA factor, nucleosome displacement
Fig. 7.1. General classes of heat-shock (HS) promoters. Class A promoters are
primarily regulated by the binding of activated HSF under heat stress conditions.
Auxiliary elements such as AT-rich sequences enhance the amplitude of heat
induction. Class B promoters are also dependent on HSEs for activity, but require
either specialized HSFs that are active under non-HS conditions, analogous to
HSF2 in mammals, or tissue-specific recruitment of the normally stress-responsive
HSF. The class B-1 promoter is designed to interact with specialized HSFs that do
not rely on protein–protein cooperativity between trimers for DNA binding. The
hypothetical class B-2 promoter illustrates a possible configuration involving other
elements in addition to HSE cores that bind factors that are unable to activate
transcription directly, but facilitate recruitment of HSF to the promoter to bind to
the HSE. The third schematic shown with class B promoters represents a typical HS
promoter (class A) that could be activated under non-HS conditions if hypothetical
tissue-specific factors, or cellular conditions, activate the normal HSF which, in
turn, would activate class A promoters in a developmentally specific manner. Class
C promoters also usually contain HSEs but have other types of elements that
independently activate transcription of HS genes under non-stress conditions. In
some cases heat induction is minimal for class C promoters.
in vitro is ATP-dependent suggesting that chromatin remodelling involves an

energy-dependent nucleosome sliding mechanism (Tsukiyama et al., 1994; Wall
et al., 1995). There are also numerous examples of other types of cis-elements
being present in HS promoters intermingled with the HSE clusters. For example,
steroid responsive elements are present in the Drosophila hsp23 and hsp27 genes
(Kay et al., 1986; Riddihough and Pelham, 1986), and the human hsp70 gene
contains elements for Sp1, CCAAT-box-binding factor (CTF) and the G1 element
responsive to cell cycle activation (Greene et al., 1987; Morgan et al., 1987;
Morgan, 1989; Taira et al., 1997). These additional elements have the ability to
regulate transcription independently of the HSEs.
In most organisms the arrangement and types of elements in HS
promoters ranges from promoters containing only HSEs to those containing, in
addition, multiple types of elements that confer varying degrees of HSE-
independent regulation. The regulatory mechanisms of HS promoters can be
grouped into three general classes, all of which typically show some degree of
dependence on HSEs for activity (Fig. 7.1).
CLASS A PROMOTERS: TYPICAL HEAT-SHOCK REGULATION (HSE-

DEPENDENT)
Heat-shock promoters with this type (Fig. 7.1, class A) are totally dependent on
the binding of HSF proteins to HSEs at sites I and II or to clusters of HSEs that
show less defined patterns of organization. Although the TATAA-proximal HSE
cores usually show a relatively high degree of match with the consensus, HSEs
having imperfect cores are quite common since the binding to imperfect cores
is greatly facilitated by the cooperativity effect. Typical heat-regulated
promoters often contain auxiliary cis elements as discussed above, but these
elements are not strictly required for HSE function since experimental
promoters with activity in plants have been constructed that only contain
consensus HSEs (Strittmatter and Chua, 1987; Czarnecka et al., 1989; Treuter
et al., 1993). The auxiliary elements probably exert their greatest effect in a
natural context where HSEs are often imperfect and the chromatin may be less
accessible than is the case in transient assays and in T-DNA-based vectors.
CLASS B PROMOTERS: HSE-DEPENDENT EXPRESSION RESPONSIVE TO

DEVELOPMENTAL SIGNALS UNDER NON-HEAT-SHOCK CONDITIONS
The defining characteristic for this class of promoter (class B) is its dependence
on HSEs for developmental, or non-stress-related, induction. Although the
details of mechanism have not been investigated for many promoters in this
class, several scenarios seem plausible as outlined in Fig. 7.1. The first
hypothetical model (class B-1) invokes a specialized-HSF binding to the HSEs
and activating transcription without the involvement of other primary
elements. The best example of this class of induction is hemin-induced hsp70
synthesis in human erythrocytes (Sistonen et al., 1992, 1994). Here transcrip-
tion is mediated by HSF2 binding. Human HSF2 is not activated by heat stress
and is much less dependent on cooperativity in binding to multiple HSEs than

HSF1 (Kroeger and Morimoto, 1994). It seems likely that the organization and
degree of consensus match in the HSEs may be different for promoters targeted
by HSF2 since imperfect sites cannot function well without the cooperativity
effect. The degree of selectivity that HSF2 shows in promoter activation in
mammalian cells is not well documented, but it seems feasible that the speci-
ficity in HSF2 versus HSF1 binding may reside in the organization and degree
of homology in HSE cores, rather than in the presence of additional types of cis
elements in the promoter. HSF2-regulated promoters are predicted to contain
fewer, but higher consensus homology HSEs. Plants contain multiple classes
of HSFs, but a group analogous to mammalian HSF2 has not been currently
identified; thus, the applicability of class B-1 promoters to plants remains to be
seen.
There are also several other possible modes of regulation for developmentally
specific, HSE-dependent activation. One mechanism illustrated in class B-2
promoters (Fig. 7.1) is that the HSF normally involved in the HS response may be
recruited to the promoter under non-HS conditions in a tissue-specific manner,
perhaps through interactions involving other regulatory factors that show a
tissue-specific distribution. There are several theoretical ways in which the class
B-2 promoter may function. In one scheme, as yet unidentified factors may bind
to the promoter at their respective elements and recruit activated HSF through
direct protein–protein interactions. These hypothetical factors are predicted to be
unable to activate the promoter directly since class B-2 promoters are dependent
on the presence of HSEs. A more likely scenario is that class B-2 promoters are
highly synergistic in the recruitment of factors and components of the transcrip-
tional preinitiation complex. In this model, illustrated in Fig. 7.2, the promoter
contains low-affinity binding sites for HSFs (imperfect HSE cores) as well as
imperfect binding sites for developmentally specific factors. The stable binding of
both HSF and the developmental factor to the promoter would require that both
types of factors simultaneously bind the promoter and make contact with
components of the preinitiation complex which is loosely anchored to the
promoter at the TATA motif. A three-way cooperativity involving the HSF, the
developmental factor and the preinitiation complex would be required for a stable
complex to exist. This model is most valid when all three sites of contact with the
promoter are of low affinity and are, therefore, dependent on cooperative
interactions with other proteins that also make contact with the promoter DNA.
Although cooperative interactions at the promoter are most commonly thought
to be involved in the recruitment of the preinitiation complex, the recruitment
can function in the opposite direction with interactions by members of the
preinitiation complex facilitating more stable binding of activator proteins to
upstream elements. For example, the contribution of TBP–TATA interactions to
activator-binding to low- and moderate-affinity sites upstream has been
demonstrated using GAL4 DNA-binding domain–VP16 fusion proteins in yeast
where the GAL4–VP16 fusion protein showed greater affinity for its binding site
when a TATA motif was located nearby (Vashee and Kodadek, 1995).
Fig. 7.2. Hypothetical interactions of activator proteins and general transcription

factors with two types of heat-shock (HS) promoters. The typical HS promoter (class
A) is regulated by the binding of four trimers of the HSF to HSE sites I and II.
Cooperative interactions between adjacent HSF trimers facilitate binding to the
imperfect HSE cores of sites I and II. The class B-2 promoter is dependent on
cooperativity in binding involving three components: HSF trimers; developmental
factors; and the preinitiation complex. The affinity of each component alone for its
respective binding site on the DNA is insufficient for promoter activation. Each
component stabilizes the DNA binding of the other two components.
Note that the configuration of the class B-2 promoter is very similar to the
class A promoter, with the main differences being the composition of the non-
HSE elements and the affinities of the elements. Under non-stress conditions
where the activated form of the heat stress-specific HSF is not abundant, the
class B-2 promoter would only be activated under certain developmental
situations as discussed above. However, during moderate to severe heat stress,
the levels of activated HSF would be expected to be relatively high. Under these
conditions, a class B-2 promoter may be activated due to the large amounts of
activated HSFs present in the nucleus that would override the need for
cooperativity from developmentally specific factors in order to achieve inducible
expression.
A third possibility is that tissue-specific factors that bind to auxiliary
elements may recruit HSF to the promoter under non-stress conditions. In this
case, tissue- or developmentally specific recruitment of activated HSF present at
low levels in non-stressed cells would provide the basis for the selective
induction of a small subset of HS genes in select tissues. A problem with this last
model is the need to postulate a highly efficient recruitment mechanism since
activated HSF levels are likely to be very low under non-stress conditions.
Alternatively, the interactions between the tissue-specific factor and HSF may
result in HSF activation during the process of recruitment.
CLASS C PROMOTERS: MULTIPLE PATHWAY REGULATION (MIXTURE

OF HSES AND OTHER ELEMENTS)
The third class (class C) of HS promoters contains HSEs in addition to other cis
elements that are unrelated to HSEs and independently regulated. These non-
HSE elements differ from the auxiliary elements found in the first class of
promoters in that they are capable of activating transcription alone. Promoters
in this class have multiple mechanisms of induction, only one of which
is dependent on HSEs (Sorger and Pelham, 1987). In non-plant sources,
examples of these additional elements are the Sp1 element and CCAAT boxes in
rat hsc73 (Sorger and Pelham, 1987) and human hsp70 (Morgan et al., 1987;
Morgan, 1989), and the ecdysterone receptor-binding sequence in the
Drosophila hsp27 gene (Mestril et al., 1986).
PLANT HEAT-SHOCK PROMOTERS
In plants the distinctions between classes of HS promoters are not always clear.
In most cases the difficulty in classification is due to the absence of information
regarding the types of induction possible and the types of cis elements present
in the promoter. Despite this lack of detailed information, many plant HS
promoters can be tentatively placed into the first category (class A) since they
appear to only be induced by heat and related stresses, and seem to contain no
other recognizable consensus elements in the promoter. Examples include most
of the promoters for the LMW HSPs (or small hsps, sHSPs) of soybean and other
plants. Even though these genes are induced in vegetative tissues by a variety of
stresses, including heavy metals, no study has unequivocally demonstrated the
presence of functional elements other than typical HSEs and AT-rich auxiliary
elements.
In addition to heat-inducible expression, LMW HSPs are often expressed
late in seed development at the stage associated with rapid desiccation, which
poses an interesting question of whether HSEs are capable of conferring a

degree of developmental expression. Prändl and Schöffl (1996) showed that
both heat-inducible expression and expression during late seed development
were dependent on the presence of HSEs in the promoter. These experiments
were conducted by monitoring the soybean Gmhsps17.3 B promoter and a
minimal CaMV 35S promoter containing synthetic HSEs in transformed
tobacco plants. The Gmhsps17.3 B promoter appears to represent a class B
promoter with two clusters of HSE cores corresponding to sites I and II upstream
from the putative TATA box; however, the spacing between several HSE cores is
anomalous in site II. The function of site II may be aided by the presence of three
CCAAT-box elements immediately upstream of site II from position 2312 to
2276 (Rieping and Schöffl, 1992). Although deletion of a region of the
promoter containing the three putative CCAAT boxes greatly reduced
transcriptional activity, it is not entirely clear that the CCAAT-box elements were
responsible for activity since the DNA fragment in question also contained a
cluster of two perfect and one imperfect HSE cores.
Assuming that the normal stress-responsive HSFs are totally responsible for
expression of the Gmhsps17.3 B promoter, expression in seeds under non-HS
conditions suggests that a limited degree of developmental regulation may be
imposed on class A HS promoters by the tissue distribution and abundance of
the HSFs within the plant, not the promoter configuration. This conclusion is
reinforced by the finding that DNA sequences controlling expression in seeds
colocalized with HSEs in the Gmhsps17.3 B promoter and by the observation
that seed expression could also be obtained by inserting synthetic HSE cores
upstream of a minimal CaMV 35S TATA (Prändl and Schöffl, 1996).
Superimposed on differential HSF distribution is the pattern physiological stress
experienced by the different organs and tissues at any given stage of growth and
development. Since LMW HSPs are often induced most strongly in mature
leaves, vascular tissues and regions immediately above root tips (Prändl et al.,
1995), the expectation is that HSFs will also be most abundant and physio-
logical conditions optimal for HSF activation in these tissues. Expression in
mature seeds is more problematic since expression is independent of prior heat
stress. Two possible conditions may exist to explain this constitutive activity. One
is that the normal stress-responsive HSF is activated by the special circum-
stances of the desiccating seed, and the other possibility is that a specialized HSF
may be present in mature seeds that is activated by signals not related to heat
stress. These two theoretical considerations for expression are incorporated in
the description of HS promoters outlined in Fig. 7.1 by listing a class A promoter
with the class B promoters as a special circumstance where a class A promoter
may be expressed in a developmentally specific manner.
In plants the best candidate for a HS promoter under multiple pathway
control (class C) is the sunflower LMW HSP gene HaHsp17.7 G4 described by
Almoguera et al. (1998). This gene is heat inducible in leaves and other vegetative
tissues and is expressed in developing seeds. Expression in early seed maturation
(16 days post-anthesis (dpa)) is independent of the HSE/HSF mechanism since
deletion of HSEs required for heat induction has little effect on early seed expres-
sion. The mechanism of promoter regulation changes during the course of seed
maturation becoming increasingly dependent on HSEs by 20 and 28 days (late
maturation or desiccation stage). Expression of HaHsp17.7 G4 in seeds occurs in
the absence of heat stress at both early and late stages of development. Although
it seems likely that expression during early maturation is HSE-independent,
precise identification of the developmental element(s) responsible for expression
at this stage is still not complete. This putative element has been mapped to a
location within the site I HSE based on the results of a single construct that greatly
reduced expression in 16 dpa seeds. A complicating factor is the lack of an easily
recognizable non-HSE element at that location, while several other potential
element motifs are located in the 5′ untranslated leader sequence. A more
definitive identification of this seed maturation element awaits further study.
The sunflower HaHsp17.6 G1 gene is expressed during seed development
but is non-inducible by heat stress (Carranco et al., 1997). At present it is
uncertain whether this promoter should be considered class B or class C
depending on whether or not HSEs are involved in its expression. Although the
HaHsp17.6 G1 promoter is not inducible by heat stress, a cluster of perfect and
imperfect HSE cores is located approximately 50 bp upstream from the putative
TATA box, a position that roughly corresponds to site II in class A promoters. It
is possible that this HSE core interacts with HSFs in late maturation. However,
the lack of heat-inducible expression in the seed and other tissues may indicate
that additional factors are required for promoter activation to occur (class B-2
promoter, Figs 7.1 and 7.2). Without further information, it cannot be ruled out
that a specialized HSF binds to the imperfect HSE at site II or that expression is
completely independent of the HSEs and relies on uncharacterized elements. In
the later case, the promoter would be classified as class C.
Many genes encoding HSPs have been reported to be active in response to
desiccation stress, ABA treatment, or in seeds, but in most cases it is not known
whether their induction is dependent on HSEs (class B) or on other unrelated
cis elements (class C). Although it seems likely that many of these promoters
exhibit dual, or multiple pathway regulation, and should be considered as class
C promoters, the involvement of HSEs in both heat stress and non-heat stress
induction cannot be excluded.
HEAT-SHOCK TRANSCRIPTION FACTORS
Many organisms have multiple HSFs that show varying degrees of specializa-
tion with regard to their role in the perception of environmental or develop-
mental signals (for review see Wu, 1995). Of the four HSFs in mammals, only
HSF1 is primarily specialized for responding to heat stress. HSF2 and HSF3 are
involved in developmental expression of hsp genes, and HSF4 seems to have
little activity and may play a role in keeping HS genes shut down under non-
stress conditions (Nakai et al., 1997).
Multiple HSFs seem to be the rule in plants, with 14 characterized to date

(for reviews see Nover et al., 1996; Nover and Scharf, 1997): three in tomato
(Scharf et al., 1990, 1993; Treuter et al., 1993), five in soybean (Czarnecka-
Verner et al., 1995, 1998), three in maize (Gagliardi et al., 1995) and three in
Arabidopsis (Hübel and Schöffl, 1994). Analysis of the amino acid composition
of the highly conserved DNA-binding domains and the oligomerization domains
indicates that plant HSFs can be grouped into two major phylogenetic classes,
class A (eight members) and class B (six members) (Nover et al., 1996;
Czarnecka-Verner et al., 1998). Both classes of HSFs appear to be widely
distributed among plant species with class A1 present in tomato, maize and
Arabidopsis; class A2 in tomato, maize, Arabidopsis and soybean; and class B
HSFs present in soybean, tomato and Arabidopsis (Nover et al., 1996).
Parsimony analysis of the DNA-binding domains of all known HSFs from plants,
Drosophila, metazoans and fungi indicate that the plant classes are unique and
cannot be easily assigned to functional groups such as HSF1 and HSF2 in
animals by simple comparisons of amino acid sequence. The question of
whether plants contain HSFs that are specialized for developmental roles (non-
HS) analogous to HSF2 in mammals is still unresolved. In addition, there is no
direct evidence that any of the heat-activated HSFs are tissue-specific in their
distribution. It is known, however, that class A HSFs confer heat inducibility to
HS promoters, and many of the class B HSFs are able to bind the HSE, but show
no transcriptional activity in transient assays (Czarnecka-Verner et al., 1998).
LpHSFB1 (LpHsf24) of tomato is in the B1 class, and is the only class B HSF to
show transcriptional activity (Treuter et al., 1993). The finding that most of the
class B HSFs lack transcriptional activity raises the possibility that these
inactive HSFs function as repressors of HS genes under periods of non-stress
(Czarnecka-Verner et al., 1998). The possibility of differential specificity in
binding to HS promoters being exhibited by class A (activators) and class B
(repressors) HSFs, with its implications regarding positive and negative regula-
tion, is another parameter that must ultimately be considered in the design and
use of HS promoters to engineer control of gene expression.
USE OF THE HEAT-SHOCK PROMOTER IN TRANSGENIC PLANT

EXPERIMENTS
The potential applications of a conditionally inducible promoter, such as an HS

promoter, can be quite varied, encompassing a range of goals from the pursuit
of basic research questions to targeted crop improvement, depending on the
gene(s) of interest. For many purposes it is likely that any number of different
HS promoters can be used. The first use of a HS promoter in plants was in the
demonstration of conservation in HS promoter function by the heat-inducible
transcription of the Drosophila hsp70 promoter in transgenic tobacco callus
tissue (Spena et al., 1985) and later confirmed in regenerated tobacco plants
(Spena and Schell, 1987). The direct involvement of the HSEs was shown when
the insertion of two overlapping HSE-like sequences into heterologous promoters

conferred thermoinducibility in transgenic tobacco plants (Strittmatter and
Chua, 1987). These experiments also demonstrated that the temperature of
induction is independent of the origin of the promoter and dependent upon the
induction temperature of the host plant. As illustration of other uses of HS
promoters, a few selected examples will be presented.
RELATIVE STRENGTH OF HEAT-SHOCK PROMOTERS COMPARED

WITH OTHER PLANT PROMOTERS
Few studies have quantitatively compared the organ specificity and strength of dif-
ferent constitutive and inducible promoters. Holtorf et al. (1995) compared CaMV
35S, CaMV 35S-omega, Arabidopsis ubiquitin UBQ1, barley leaf thionin, the BTH6
promoter and a soybean HS promoter (GmHsp17.3B) in transgenic plants using
the GUS reporter gene. The CaMV 35S promoter had the highest expression,
which was enhanced two- to threefold by the addition of the TMV omega element
without changing the organ specificity of expression. The barley thionin promoter
was almost inactive, whereas the ubiquitin promoter expressed at an intermedi-
ate level. The soybean HS promoter was inducible up to 18-fold, but expression
was lower than the ubiquitin promoter. It should be noted that while direct com-
parative promoter strength experiments have not been conducted for the HSP pro-
moters, indirect evidence based on Northern analyses, hybrid-select translation
and nuclear run-off transcription experiments indicate that GmHsp17.5E (see
also below) is expressed at higher levels than GmHsp17.3B (Schöffl and Key,
1982; Kimpel et al., 1989; J. Key et al., Georgia, USA, unpublished data).
USE OF HEAT-SHOCK PROMOTERS TO ADDRESS QUESTIONS IN

BASIC RESEARCH
The soybean GmHsp17.3B HS promoter-gus fusion was used to analyse the HS

response in tobacco and Arabidopsis (Prändl et al., 1995). It was shown that
expression in both vegetative tissues and in developing seeds is dependent on
HSEs located upstream of the TATA motif (Prändl and Schöffl, 1996). In both
tobacco and Arabidopsis, high levels of GUS activity were detected in most
vegetative tissues and also in flowers exclusively after heat stress with the
highest levels of heat-inducible GUS activity found in the vascular tissues. As
discussed above, developmental regulation of GUS activity was observed by the
accumulation of high levels of GUS in transgenic tobacco seeds under non-stress
conditions; however, the corresponding expression in seeds was not observed in
transgenic Arabidopsis (Prändl et al., 1995). This lack of seed expression in
Arabidopsis was unexpected, but underscores the need to carefully evaluate
transgene expression in recipient plants, especially in the case of develop-
mentally regulated promoters.
As outlined in the previous section, class B promoters can be regulated in

several ways, some exclusively dependent on HSEs and specialized HSFs, and
others relying in highly cooperative interactions between factors binding to
developmentally regulated promoter elements and HSEs. Speculation regarding
the lack of expression of GmHsp17.3B in Arabidopsis seeds is probably not useful
until more is known regarding the types and activation states of HSFs present
in Arabidopsis seeds through the course of embryonic development.
Another example of the utilization of a HS promoter in basic research is the
testing of antisense constructs of a tobacco Hsp70 gene to study thermo-
tolerance and HSF regulation in Arabidopsis (Lee and Schöffl, 1996). In these
experiments a tobacco Hsp70 gene in antisense orientation was cloned down-
stream of the soybean Gmhsp17.6-L HS promoter in order to reduce expression
of endogenous Hsp70 genes in Arabidopsis. Northern analysis indicated that
Hsp70 mRNA, which is only present after HS, was absent from antisense
transgenic plants. Furthermore, Hsc70 mRNA, which is normally abundant at
normal temperatures in wild-type plants, was markedly reduced in antisense
transgenic plants and was totally absent after HS. In addition, Western analysis
confirmed the reduction in HSP70 expression showing a significant reduction
in HSP70/HSC70 proteins in transgenic antisense plants compared to wild-type
Arabidopsis (Lee and Schöffl, 1996). The negative effect on the expression of
Hsp70/Hsc70 transcripts was specific because mRNA levels of Hsp18 were heat-
inducible and detected at about the same levels in both transgenic and wild-type
plants. The involvement of HSP70/HSC70 in the acquisition of thermotolerance
was implied since heat stress assays indicated that basal thermotolerance (no
prior heat stress) was not affected by underexpression of HSP70, but acquired
thermotolerance (requires pre-shock treatment) was reduced by about 2°C.
The conditional nature of HS promoter expression can also be exploited to
look at the effects of over- or underexpression of non-HSP target genes. The
conditional expression of the Hsp81-1 promoter of Arabidopsis was used to estab-
lish the subcellular localization of a small GTP-binding protein (ARA-4) in
transgenic Arabidopsis plants (Ueda et al., 1996). Overexpression and heat-
inducible expression of this gene was examined, and at least two distinct forms
of this protein were found in membrane and cytosolic fractions. The cytosolic
form probably represents the unprocessed precursor. The membrane protein
was predominantly localized on Golgi-derived vesicles, Golgi cisternae and the
trans-Golgi network (Ueda et al., 1996).
The inducibility of the Drosophila hsp70 promoter provided a useful
experimental system to investigate the role of the T-6B oncogene of
Agrobacterium on the growth and development of transgenic Nicotiana rustica
(Tinland et al., 1992). Transformed progeny developed into normal plants, and
hsp70-T-6b-construct expression was shown by Northern analysis and by heat-
dependent growth alterations at the level of whole seedlings. Upon wounding
at normal temperature, hsp70-T-6b plants formed small tumours on leaves and
stems. The tumour-forming agent was not diffusible. Protoplast cultures from
hsp70-T-6b plants grew in the absence of hormones, unlike non-transformed
cells, which rapidly lost their sensitivity towards hormones and remained
hormone sensitive for a significantly longer period. Thus, the T-6b gene product
alters hormone sensitivity during the initial phases of protoplast culture
(Tinland et al., 1992). The ability to induce T-6b expression, conferred by the
HS promoter, was crucial to these experiments since premature expression
would severely disturb normal development.
In a novel application, the soybean HS gene promoter (GmHsp17.5E) has
been used to direct heat-inducible expression of the FLP recombinase gene in
plant cells, thereby regulating recombination mediated by the FLP/FRT
system. This complex heterologous recombination system (yeast recombinase
and soybean HS promoter) successfully altered stably transformed maize
genomic DNA structure in vivo (Lyznik et al., 1995). The conditionally
inducible activity of the GmHsp17.5E promoter in these experiments was
increased approximately 100-fold over a comparable CaMV 35S regulated
construct, demonstrating the effectiveness of the HS promoter in this
application. In Arabidopsis, inducible expression of FLP recombinase was
achieved from the soybean GmHsp17.6L HS promoter. The authors concluded
from the results of these experiments that the timing of recombination leading
to marked clonal sectors is readily controllable by the timing of the applied HS
(Kilby et al., 1995).
TRANSIENT HEAT INDUCTION MAY BE SUFFICIENT TO ACHIEVE

ADEQUATE EXPRESSION
A heat-inducible expression cassette was constructed using the soybean

GmHsp17.5E promoter to study the conditional expression of any sequence of
interest in transgenic plants or plant tissues (Ainley and Key, 1990). The heat-
inducible production of a cytokinin in transgenic tobacco plants was tested by
the insertion of an isopentenyl transferase gene into this HS cassette. Heat-
induced synthesis of endogenous cytokinin produced several effects previously
undocumented. Heat treatments of 1–2 h day21 for 1–4 days were sufficient
for observable phenotypic changes 3–4 weeks after the heat treatment,
indicating that transient heat induction is sufficient for expression (Ainley et
al., 1993).
Heat-inducible hygromycin resistance was attained in transgenic tobacco
by a construct consisting of the soybean GmHsp17.5L promoter fused to a
hygromycin phosphotransferase gene (Severin and Schöffl, 1990). Incubation
for 1 h at 40°C daily, applied for several weeks, was sufficient to express a
hygromycin-resistant phenotype. This experiment also demonstrates that in the
case of an antibiotic selection screen, transient heat induction may be sufficient
to accumulate enough product for resistance. These results raise the possibility
that in other unrelated applications the HS promoter may be sufficiently
induced by normal field growth conditions to make additional heat treatments
unnecessary.
USE OF HEAT-SHOCK PROMOTER IN MUTAGENESIS SCREENS
An HS promoter/reporter gene fusion was used in mutagenesis screens in an

attempt to isolate HS response regulatory mutants. Such a screen was
performed by Takahashi et al. (1992), where transgenic seeds from an
Arabidopsis Hsp18.2 promoter/gus gene fusion were mutagenized and screened
for the isolation of HS response-deficient regulatory mutants. Approximately
15,000 M2 plants were screened for decreased GUS inducibility of which three
lines reproducibly exhibited reduced heat-inducible GUS activity in their
progeny.
EXPRESSION OF GENES NORMALLY DOWN-REGULATED DURING THE

HEAT-SHOCK RESPONSE
One potentially very important use of HS gene promoters would be the

expression of genes normally shut down during periods of high temperature
stress. As described above, a general feature of the HS response is the cessation
of the transcription and translation of most control temperature genes as the
cell switches to synthesis of HSPs. Pathogenesis-related proteins (PR-proteins)
are a heterogeneous group of host-encoded proteins that are induced in plants
by pathogen attack or exposure to certain chemicals and are associated with
the hypersensitive defence response. It has been reported that synthesis of PR-
proteins is suppressed upon shifting to elevated temperature (van Loon, 1975;
Ohashi and Matsuoka, 1985). Thus, for many crop plants high-temperature
stress suppresses the synthesis of defence proteins during a significant portion
of the day when they are susceptible to pathogen infection. It is intriguing to
speculate that natural pathogen resistance of many crop plants may be
improved or extended by transformation with HS promoter/PR-protein fusions
to induce expression of PR-proteins normally repressed by the HS response. If
such constructs contribute to increased disease resistance, the economic and
environmental benefits could be enormous, since increased disease resistance
should lead directly to higher crop yields. Further economic benefit should be
realized in that reduced application of chemicals may be required thus lowering
the cost of production and the environmental burden of agrochemical
application and its associated costs.
SUMMARY
A unifying feature common to all conditions of HSP gene induction including,

HS, development, dehydration or other stresses, is that each of these conditions
or treatments can lead to the accumulation of denatured or abnormally folded
proteins. Consistent with the chaperone concept of HSP function, the induction
of HSP following these varied conditions serves to minimize and/or correct the
detrimental effects of misfolded proteins. It is apparent that not all HS

promoters respond identically under similar conditions. Thus, the prudent
investigator wanting to express a gene by an inducible HS promoter should try
to match the expression profile of the gene in question with the optimum
parameters desired for transgenic expression. For example, an experiment to use
an HS promoter for conditional temperature induction of a toxic substance in
transgenic plants may be impractical with many LMW HSP promoters because
the inherent developmentally regulated expression could be lethal. Hence,
selection of an HS promoter which is not developmentally regulated may be
mandatory in certain circumstances. This applies to the inappropriate
expression of any protein that can potentially interfere with development.
Similar precautions would hold for unexpected results from other secondary
inducers of HS promoter activity. While general precautions are easily stated,
unfortunately in most cases sufficient experimental data to fully address the
expression patterns of various HS promoters is unavailable to make a fully
informed choice. Substantially more research is required to understand these
and other parameters of the HS response to fully utilize the potential of the HS-
inducible promoter system. It is anticipated, however, that for most uses
developmental gene expression or expression as a result of secondary inducers
would not be a problem. In most situations, LMW HSP promoters would be
suitable to achieve the highest inducible expression with minimal constitutive
expression. If developmental expression is undesirable, a strictly heat-inducible
Hsp70 promoter may be preferred because it may have lower developmental
expression than some LMW HSP promoters, although further investigation
would be required to confirm this. For some genes it may be desirable to have
expression at normal temperatures and enhanced expression with elevated
temperature. For such criteria an Hsp90 class promoter, or heat-inducible
ubiquitin, or the soybean GmHsp26A promoter may be used. With further
research, promoters with more desirable, or specialized, activation properties
might be either identified or engineered. While there is a lot to be learned, the
future is bright for the use of this inducible system for both investigation and
crop improvement. The ever-increasing availability of transformation systems
for plant species means that the ultimate potential will only be limited by the
creative ingenuity and perseverance of scientists dedicated to basic research and
the concept of making something better.
ACKNOWLEDGEMENTS
We appreciate the technical assistance of Joyce Kochert in manuscript

preparation. The research from the authors’ laboratories was supported by USDA
grants 94-37100-0712 to J.L. Key and R.T. Nagao and by 95-37100-1617 to
W.B. Gurley.
REFERENCES
Ainley, W.M. and Key, J.L. (1990) Development of a heat shock inducible expression
cassette for plants: characterization of parameters for its use in transient expression
assays. Plant Molecular Biology 14, 949–967.
Ainley, W.M., McNeil, K.J., Hill, J.W., Lingle, W.L., Simpson, R.B., Brenner, M.L., Nagao, R.T.
and Key, J.L. (1993) Regulatable endogenous production of cytokinins up to ‘toxic’
levels in transgenic plants and plant tissues. Plant Molecular Biology 22, 13–23.
Alamillo, J., Almoguera, C., Bartels, D. and Jordano, J. (1995) Constitutive expression of
small heat shock proteins in vegetative tissues of the resurrection plant
Craterostigma plantagineum. Plant Molecular Biology 29, 1093–1099.
Almoguera, C. and Jordano, J. (1992) Developmental and environmental concurrent
expression of sunflower dry-seed-stored low-molecular-weight heat-shock protein
and Lea mRNAs. Plant Molecular Biology 19, 781–792.
Almoguera, C., Prieto-Dapena, P. and Jordano, J. (1998) Dual regulation of a heat shock
promoter during embryogenesis: stage-dependent role of heat shock elements. The
Altschuler, M. and Mascarenhas, J.P. (1982) The synthesis of heat-shock and normal
proteins at high temperatures in plants and their possible roles in survival under
heat stress. In: Schlesinger, M.J., Ashburner, M. and Tissières, A. (eds) Heat Shock
from Bacteria to Man. Cold Spring Harbor Laboratory Press, Cold Spring Harbor,
USA, pp. 321–327.
Amin, J., Fernandez, M., Ananthan, J., Lis, J.T. and Voellmy, R. (1994) Cooperative
binding of heat shock transcription factor to the Hsp70 promoter in vivo and in vitro.
Journal of Biological Chemistry 269, 4804–4811.
Apuya, N.R. and Zimmerman, J.L. (1995) Heat shock gene expression is controlled
primarily at the translational level in carrot cells and somatic embryos. Plant Cell 4,
657–665.
Arrigo, A.-P. and Landry, J. (1994) Expression and function of the low-molecular-weight
heat shock proteins. In: Morimoto, R.I., Tissières, A. and Georgopoulos, C. (eds) The
Biology of Heat Shock Proteins and Molecular Chaperones. Cold Spring Harbor
Laboratory Press, Plainview, USA, pp. 335–373.
Ashburner, M. and Bonner, J.J. (1979) The induction of gene activity in Drosophila by
heat shock. Cell 17, 241–254.
Atkinson, B.G., Raizada, M., Bouchard, R.A., Frappier, J.R.H. and Walden, D.B. (1993)
The independent stage-specific expression of the 18-kDa heat shock protein genes
during microsporogenesis in Zea mays L. Developmental Genetics 14, 15–26.
Barros, M.D., Czarnecka, E. and Gurley, W.B. (1992) Mutational analysis of a plant heat
shock element. Plant Molecular Biology 19, 665–675.
Bond, U. and Schlesinger, M.J. (1986) The chicken ubiquitin gene contains a heat shock
promoter and expresses an unstable mRNA in heat-shocked cells. Journal of
Biological Chemistry 6, 4602–4610.
Boston, R.S., Viitanen, P.V. and Vierling, E. (1996) Molecular chaperones and protein
folding in plants. Plant Molecular Biology 32, 191–222.
Bouchard, R.A. (1990) Characterization of expressed meiotic prophase repeat transcript
clones of Lilium: meiosis-specific expression, relatedness, and affinities to small heat
shock protein genes. Genome 33, 68–79.
Burke, T.J., Callis, J. and Vierstra, R.D. (1988) Characterization of a polyubiquitin gene
from Arabidopsis thaliana. Molecular and General Genetics 213, 435–443.
Carranco, R., Almoguera, C. and Jordano, J. (1997) A plant small heat shock protein
gene expressed during zygotic embryogenesis, but non-inducible by heat stress.
Journal of Biological Chemistry 272(43), 27470–27475.
Christensen, A.H. and Quail, P.H. (1989) Sequence analysis and transcriptional
regulation by heat shock of polyubiquitin transcripts from maize. Plant Molecular
Biology 12, 619–632.
Christensen, A.H., Sharrock, R.A. and Quail, P.H. (1992) Maize polyubiquitin genes:
structure, thermal perturbation of expression and transcript splicing, and promoter
activity following transfer to protoplasts by electroporation. Plant Molecular Biology
18, 675–689.
Coca, M.A., Almoguera, C. and Jordano, J. (1994) Expression of sunflower low-
molecular-weight heat-shock proteins during embryogenesis and persistence after
germination: localization and possible functional implications. Plant Molecular
Biology 25, 4790–4792.
Cohen, R.S. and Meselson, M. (1984) Inducible transcription and puffing in Drosophila
melanogaster transformed with hsp70-phage lambda hybrid heat shock genes.
Cooper, P., Ho, T.-H.D. and Hauptmann, R.M. (1984) Tissue specificity of the heat shock
response in maize. Plant Physiology 75, 431–441.
Craig, E.A., Gambill, D. and Nelson, R.J. (1993) Heat shock proteins: molecular
chaperones of protein biogenesis. Microbiological Reviews 57, 402–414.
Cunniff, N.F.A. and Morgan, W.D. (1994) Analysis of heat shock element recognition by
saturation mutagenesis of the human HSP70 gene promoter. Journal of Biological
Chemistry 268, 8317–8324.
Czarnecka, E., Edelman, L., Schöffl, F. and Key, J.L. (1984) Comparative analysis of
physical stress responses in soybean seedlings using cloned heat shock cDNAs. Plant
Molecular Biology 3, 45–58.
Czarnecka, E., Nagao, R.T., Key, J.L. and Gurley, W.B. (1988) Characterization of
Gmhsp26-A, a stress gene encoding a divergent heat shock protein of soybean: heavy-
metal-induced inhibition of intron processing. Molecular Cell Biology 8, 1113–1122.
Czarnecka, E., Key, J.L. and Gurley, W.B. (1989) Regulatory domains of the Gmhsp17.5-E
heat shock promoter of soybean: a mutational analysis. Molecular Cell Biology 9,
3457–3463.
Czarnecka, E., Ingersoll, J.C. and Gurley, W.B. (1992) AT-rich promoter elements of
soybean heat shock gene Gmhsp17.5E bind two distinct sets of nuclear proteins in
vitro. Plant Molecular Biology 19, 985–1000.
Czarnecka-Verner, E., Dulce-Barros, M. and Gurley, W.B. (1994) Regulation of heat
shock gene expression. In: Basra, A.S. (ed.) Stress-Induced Gene Expression in Plants.
Harwood Academic Publishers, Chur, Switzerland, pp. 131–161.
Czarnecka-Verner, E., Yuan, C.-X., Fox, P.C. and Gurley, W.B. (1995) Isolation and
characterization of six heat shock transcription factor genes from soybean. Plant
Czarnecka-Verner, E., Yuan, C.-X., Nover, L., Scharf, K.-D., Englich, G. and Gurley, W.B.
(1998) Plant heat shock transcription factors: positive and negative aspects of
regulation. Acta Physiologica Plantarum 19, 529–537.
DeRocher, A.E. and Vierling, E. (1994) Developmental control of small heat shock
protein expression during pea seed maturation. The Plant Journal 5, 93–102.
DeRocher, A.E. and Vierling, E. (1995) Cytoplasmic HSP70 homologues of pea:
differential expression in vegetative and embryonic organs. Plant Molecular Biology
27, 441–456.
Dietrich, P.S., Bouchard, R.A., Casey, E.S. and Sinibaldi, R.M. (1991) Isolation and
characterization of a small heat shock protein gene from maize. Plant Physiology 96,
1268–1276.
Duck, N.B. and Folk, W.R. (1994) Hsp70 heat shock protein cognate is expressed and
stored in developing tomato pollen. Plant Molecular Biology 26, 1031–1039.
Dupuis, I. and Dumas, C. (1990) Influence of temperature stress on in vitro fertilization
and heat shock protein synthesis in maize (Zea mays L.) reproductive tissues. Plant
Eckey-Kaltenbach, H., Kiefer, E., Grosskopf, E., Ernst, D. and Sandermann, H., Jr. (1997)
Differential transcript induction of parsley pathogenesis-related proteins and of a
small heat shock protein by ozone and heat shock. Plant Molecular Biology 33,
343–350.
Ellis, R.J. and van der Vies, S.M. (1991) Molecular chaperones. Annual Review of
Biochemistry 60, 321–347.
Fernandes, M., Xiao, H. and Lis, J.T. (1994) Fine structure analyses of the Drosophila and
Saccharomyces heat shock factor–heat shock interactions. Nucleic Acids Research 22,
167–173.
Finley, D., Özkaynak, E. and Varshavsky, A. (1987) The yeast polyubiquitin gene is
essential for resistance to high temperatures, starvation, and other stresses. Cell 48,
1035–1046.
Frova, C., Taramino, G. and Binelli, G. (1989) Heat-shock proteins during pollen
development in maize. Developmental Genetics 10, 324–332.
Frova, C., Taramino, G. and Ottaviano, E. (1991) Sporophytic and gametophytic heat
shock protein synthesis in Sorghum bicolor. Plant Science 73, 35–44.
Gagliardi, D., Breton, C., Chaboud, A., Vergne, P. and Dumas, C. (1995) Expression of
heat shock factor and heat shock protein 70 genes during maize pollen
development. Plant Molecular Biology 29, 841–856.
Georgopoulos, C. and Welch, W.J. (1993) Role of the major heat shock proteins as
molecular chaperones. Annual Review of Cell Biology 9, 601–634.
Gething, M.-J. and Sambrook, J. (1992) Protein folding in the cell. Nature 355, 33–45.
Greene, J.M., Larin, Z., Taylor, I.C.A., Prentice, H., Gwinn, K.A. and Kingston, R.E.
(1987) Multiple basal elements of a human hsp 70 promoter function differently in
human and rodent cell lines. Molecular Cell Biology 7, 3646–3655.
Gurley, W.B. and Key, J.L. (1991) Transcriptional regulation of the heat-shock response:
a plant perspective. Biochemistry 30, 1–12.
Gurley, W.B., Czarnecka, E. and Barros, M.D.C. (1993) Anatomy of a soybean heat shock
promoter. In: Verma, D.P.S. (ed.) Control of Plant Gene Expression. CRC Press, Boca
Raton, Florida, USA, pp. 103–123.
Helm, K.W. and Abernethy, R.H. (1990) Heat shock proteins and their mRNAs in dry
and early imbibing embryos of wheat. Plant Physiology 93, 1626–1633.
Hendrick, J.P. and Hartl, F.-U. (1993) Molecular chaperone functions of heat-shock
proteins. Annual Review of Biochemistry 62, 349–384.
Herrero, M.P. and Johnson, R.R. (1980) High temperature stress and pollen viability of
maize. Crop Science 20, 796–800.
Hershko, A. (1988) Ubiquitin-mediated protein degradation. Journal of Biological
Chemistry 263, 15237–15240.
Holtorf, S., Apel, K. and Bohlmann, H. (1995) Comparison of different constitutive and
inducible promoters for the overexpression of transgenes in Arabidopsis thaliana.
Hopf, N., Plesofsky-Vig, N. and Brambl, R. (1992) The heat shock response of pollen and
other tissues of maize. Plant Molecular Biology 19, 623–630.
Howarth, C. (1990) Heat shock proteins in Sorghum bicolor and Pennisetum americanum.
II. Stored RNA in sorghum seed and its relationship to heat shock protein synthesis
during germination. Plant, Cell and Environment 13, 57–64.
Hübel, A. and Schöffl, F. (1994) Arabidopsis heat shock factor: isolation and
characterization of the gene and the recombinant protein. Plant Molecular Biology
26, 353–362.
Kay, R.J., Boissy, R.J., Russnak, R.H. and Candido, E.P.M. (1986) Efficient transcription
of a Caenorhabditis elegans heat shock gene pair in mouse fibroblasts is dependent on
multiple promoter elements which can function bidirectionally. Molecular Cell
Biology 6, 3134–3143.
Key, J.L., Lin, C.Y. and Chen, Y.M. (1981) Heat shock proteins of higher plants.
Kilby, N.J., Davies, G.J., Snaith, M.R. and Murray, J.A.H. (1995) FLP recombinase in
transgenic plants: constitutive activity in stably transformed tobacco and
generation of marked cell clones in Arabidopsis. The Plant Journal 8, 637–652.
Kimpel, J.A. and Key, J.L. (1985) Heat shock in plants. Trends in Biochemical Science 10,
353–357.
Kimpel, J.A., Nagao, R.T., Goekjian, V. and Key, J.L. (1989) Regulation of the heat shock
response in soybean seedlings. Plant Physiology 94, 988–995.
Kroeger, P.E. and Morimoto, R.I. (1994) Selection of new HSF1 and HSF2 DNA-binding
sites reveals differences in trimer cooperativity. Molecular Cell Biology 14, 7592–7603.
LaFayette, P.R., Nagao, R.T., O’Grady, K., Vierling, E. and Key, J.L. (1996) Molecular
characterization of cDNAs encoding low-molecular-weight heat shock proteins of
soybean. Plant Molecular Biology 30, 159–169.
Landry, S.J. and Gierasch, L.M. (1994) Polypeptide interactions with molecular
chaperones and their relationship to in vivo protein folding. Annual Review of
Biophysics and Biomolecular Structure 23, 645–669.
Lee, H., Kraus, K.W., Wolfner, M.F. and Lis, J.T. (1992) DNA sequence requirements for
generating paused polymerase at the start of hsp70. Genes and Development 6,
284–295.
Lee, J.H. and Schöffl, F. (1996) An Hsp70 antisense gene affects the expression of
HSP70/HSC70, the regulation of HSF, and the acquisition of thermotolerance in
transgenic Arabidopsis thaliana. Molecular and General Genetics 252, 11–19.
Lee, Y.-R.J., Nagao, R.T. and Key, J.L. (1994) A soybean 101-kD heat shock protein
complements a yeast HSP104 deletion mutant in acquiring thermotolerance. Plant
Cell 6, 1889–1897.
Lin, C.Y., Roberts, J.K. and Key, J.L. (1984) Acquisition of thermotolerance in soybean
seedlings: synthesis and accumulation of heat shock proteins and their cellular
localization. Plant Physiology 74, 152–160.
Lin, X.Y., Chern, M.S. and Zimmerman, J.L. (1991) Cloning and characterization of a
carrot hsp70 Gene. Plant Molecular Biology 17, 1245–1249.
Lindquist, S. and Craig, E.A. (1988) The heat shock proteins. Annual Review of Genetics
22, 631–677.
Lyznik, L.A., Hirayama, L., Rao, K.V., Abad, A. and Hodges, T.K. (1995) Heat-inducible
expression of FLP gene in maize cells. The Plant Journal 8, 177–186.
Mansfield, M.A. and Key, J.L. (1987) Synthesis of the low molecular weight heat shock
proteins in plants. Plant Physiology 84, 1007–1017.
Mascarenhas, J.P. and Crone, D.E. (1996) Pollen and the heat shock response. Sexual
Plant Reproduction 9, 370–374.
Mestril, R., Schiller, P., Amin, J., Klapper, H., Ananthan, J. and Voellmy, R. (1986) Heat-
shock and ecdysterone activation of the Drosophila hsp23 gene: a sequence element
implied in developmental regulation. The EMBO Journal 5, 1667–1673.
Morgan, W.D. (1989) Transcription factor Sp1 binds to and activates a human hsp70
gene promoter. Molecular Cell Biology 9, 4099–4104.
Morgan, W.D., Williams, G.T., Morimoto, R.I., Greene, J., Kingston, R.E. and Tjian, R.
(1987) Two transcriptional activators, CCAAT-box-binding transcription factor and
heat shock transcription factor, interact with a human hsp70 gene promoter.
Molecular Cell Biology 7, 1129–1138.
Morimoto, R.I., Tissières, A. and Georgopoulos, C. (1994) Progress and perspectives on the
biology of heat shock proteins and molecular chaperones. In: Morimoto, R.I., Tissières,
A. and Georgopoulos, C. (eds) The Biology of Heat Shock Proteins and Molecular
Chaperones. Cold Spring Harbor Laboratory Press, Plainview, USA, pp. 1–30.
Nagao, R.T., Kimpel, J.A., Vierling, E. and Key, J.L. (1986) The heat shock response: a
comparative analysis. In: Miflin, B.J. (ed.) Oxford Surveys of Plant Molecular & Cell
Biology, Vol. 3. Oxford University Press, Oxford, UK, pp. 384–438.
Nakai, A., Tanabe, M., Kawazoe, Y., Inazawa, J., Morimoto, R.I. and Nagata, K. (1997)
HSF4, a new member of the human heat shock factor family which lacks properties
of a transcriptional activator. Molecular Cell Biology 17, 469–481.
Nover, L. and Scharf, K.-D. (1997) Heat stress proteins and transcription factors. Cell and
Molecular Life Sciences 53, 80–103.
Nover, L., Scharf, K.-D., Gagliardi, D., Vergne, P., Czarnecka-Verner, E. and Gurley, W.B.
(1996) The HSF world: classification and properties of plant heat shock stress
transcription factors. Cell Stress and Chaperones 1, 215–223.
Ohashi, Y. and Matsuoka, K. (1985) Synthesis of stress proteins in tobacco leaves. Plant
Cell Physiology 26, 473–480.
Parsell, D.A. and Lindquist, S. (1993). The function of heat-shock proteins in stress
tolerance: degradation and reactivation of damaged proteins. Annual Review of
Genetics 27, 437–496.
Parsell, D.A. and Lindquist, S. (1994) Heat shock proteins and stress tolerance. In:
Morimoto, R.I., Tissières, A. and Georgopoulos, C. (eds) The Biology of Heat Shock
Proteins and Molecular Chaperones. Cold Spring Harbor Laboratory Press, Plainview,
USA, pp. 457–494.
Pauli, D. and Tissières, A. (1990) Developmental expression of the heat shock genes in
Drosophila melanogaster. In: Morimoto, R.I., Tissières, A. and Georgopoulos, C. (eds)
Stress Proteins in Biology and Medicine. Cold Spring Harbor Laboratory Press, Cold
Spring Harbor, USA, pp. 361–378.
Pelham, H.R.B. (1982) A regulatory upstream promoter element in the Drosophila
HSP70 heat-shock gene. Cell 30, 517–528.
Perisic, O., Xiao, H. and Lis, J.T. (1989) Stable binding of Drosophila heat shock factor to
head-to-head and tail-to-tail repeats of a conserved 5 bp recognition unit. Cell 59,
797–806.
Prändl, R. and Schöffl, F. (1996) Heat shock elements are involved in heat shock
promoter activation during tobacco seed maturation. Plant Molecular Biology 31,
157–162.
Prändl, R., Kloske, E. and Schöffl, F. (1995) Developmental regulation and tissue-specific
differences of heat shock gene expression in transgenic tobacco and Arabidopsis
plants. Plant Molecular Biology 28, 73–82.
Riddihough, G. and Pelham, H.R.B. (1986) Activation of the Drosophila hsp27 promoter
by heat shock and by ecdysone involves independent and remote regulatory
sequences. The EMBO Journal 5, 1653–1658.
Rieping, M. and Schöffl, F. (1992) Synergistic effect of upstream sequences, CCAAT box
elements, and HSE sequences for enhanced expression of chimeric heat shock genes
in transgenic tobacco. Molecular and General Genetics 231, 226–232.
Ritossa, F. (1962) A new puffing pattern induced by heat shock and DNP in Drosophila.
Experimentia 18, 571–573.
Sanchez, Y. and Lindquist, S. (1990) HSP104 required for induced thermotolerance.
Science 248, 1112–1115.
Scharf, K.-D., Rose, S., Zott, W., Schöffl, F. and Nover, L. (1990) Three tomato genes code
for heat stress transcription factors with a region of remarkable homology to the
DNA-binding domain of the yeast HSF. The EMBO Journal 9, 4495–4501.
Scharf, K.-D., Rose, S., Thierfelder, J. and Nover, L. (1993) Two cDNAs for tomato heat
stress transcription factors. Plant Physiology 102, 1355–1356.
Schirmer, E.C., Lindquist, S. and Vierling, E. (1994) An Arabidopsis heat shock protein
complements a thermotolerance defect in yeast. Plant Cell 6, 1899–1909.
Schöffl, F. and Key, J.L. (1982) An analysis of mRNAs for a group of heat shock proteins of
soybean using cloned cDNAs. Journal of Molecular and Applied Genetics 1, 301–314.
Schrauwen, J.A.M., Reijnen, W.H., De Leeuw, H.C.G.M. and van Herpen, M.M.A. (1986)
Response of pollen to heat stress. Acta Botanica Neerlandica 35, 321–327.
Severin, K. and Schöffl, F. (1990) Heat-inducible hygromycin resistance in transgenic
tobacco. Plant Molecular Biology 15, 827–833.
Shen, B., Carneiro, N., Torres-Jerez, I., Stevenson, B., McCreery, T., Helentjaris, T.,
Baysdorfer, C., Almira, E., Ferl, R.J., Habben, J.E. and Larkins, B. (1994) Partial
sequencing and mapping of clones from two maize cDNA libraries. Plant Molecular
Biology 26, 1085–1101.
Sistonen, L., Sarge, K.D., Phillips, B., Abravaya, K. and Morimoto, R.I. (1992) Activation
of heat shock factor 2 during hemin-induced differentiation of human
erythroleukemia cells. Molecular Cell Biology 12, 4104–4111.
Sistonen, L., Sarge, K.D. and Morimoto, R.I. (1994) Human heat shock factors 1 and 2
are differentially activated and can synergistically induce hsp70 gene transcription.
Molecular Cell Biology 14, 2087–2099.
Sorger, P.K. and Pelham, H.R.B. (1987) Cloning and expression of a gene encoding hsc73,
the major hsp70-like protein in unstressed rat cells. The EMBO Journal 6, 993–998.
Spena, A. and Schell, J. (1987) The expression of a heat-inducible chimeric gene in
transgenic tobacco plants. Molecular and General Genetics 206, 436–440.
Spena, A., Hain, R., Ziervogel, U., Saedler, H. and Schell, J. (1985) Construction of a heat-
inducible gene for plants. Demonstration of heat-inducible activity of the Drosophila
hsp70 promoter in plants. The EMBO Journal 4, 2739–2743.
Strittmatter, G. and Chua, N.H. (1987) Artificial combination of two cis-regulatory
elements generates a unique pattern of expression in transgenic plants. Proceedings
Taira, T., Narita, T., Iguchi-Ariga, S.M. and Ariga, H. (1997) A novel G1-specific
enhancer identified in the human heat shock protein 70 gene. Nucleic Acids Research
25, 1975–1983.
Takahashi, T., Naito, S. and Komeda, Y. (1992) The Arabidopsis HSP 18.2 promoter/GUS
gene fusion in transgenic Arabidopsis plants: a powerful tool for the isolation of
regulatory mutants of the heat-shock response. The Plant Journal 2, 751–761.
Tinland, B., Fournier, P., Heckel, T. and Otten, L. (1992) Expression of a chimeric heat-
shock-inducible Agrobacterium 6b oncogene in Nicotiana rustica. Plant Molecular
Biology 18, 921–930.
Topol, J., Ruden, D.M. and Parker, C.S. (1985) Sequences required for in vitro
transcriptional activation of a Drosophila hsp70 gene. Cell 42, 527–537.
Treuter, E., Nover, L., Ohme, K. and Scharf, K.-D. (1993) Promoter specificity and
deletion analysis of three heat stress transcription factors of tomato. Molecular and
General Genetics 240, 113–125.
Tsukaya, H., Takahashi, T., Naito, S. and Komeda, Y. (1993) Floral organ-specific and
constitutive expression of an Arabidopsis thaliana heat-shock HSP18.2:GUS fusion
gene is retained even after homeotic conversion of flowers by mutation. Molecular
Tsukiyama, T., Becker, P.B. and Wu, C. (1994) ATP-dependent nucleosome disruption at
a heat-shock promoter mediated by binding of GAGA transcription factor. Nature
367, 525–532.
Ueda, T., Anai, T., Tsukaya, H., Hirata, A. and Uchimiya, H. (1996) Characterization and
subcellular localization of a small GTP-binding protein (Ara-4) from Arabidopsis:
conditional expression under control of the promoter of the gene for heat-shock
protein HSP81-1. Molecular and General Genetics 250, 533–539.
Ulmasov, T., Ohmiya, A., Hagen, G. and Guilfoyle, T. (1995) The soybean GH2/4 gene
that encodes a glutathione S-transferase has a promoter that is activated by a wide
range of chemical agents. Plant Physiology 108, 919–927.
van Loon, L.C. (1975) Polyacrylamide disk electrophoresis of the soluble leaf proteins
from Nicotiana tabacum var. ‘Samsun’ and ‘Samsun NN’. III. Influence of
temperature and virus strain on changes induced by tobacco mosaic virus.
Physiological Plant Pathology 6, 289–300.
Vashee, S. and Kodadek, T. (1995) The activation domain of GAL4 protein mediates
cooperative promoter binding with general transcription factors in vivo. Proceedings
Vierling, E. (1991) The roles of heat shock proteins in plants. Annual Review of Plant
Vierling, E. and Sun, A. (1989) Developmental expression of heat shock proteins in
higher plants. In: Cherry, J. (ed.) Environmental Stress in Plants. Springer-Verlag,
Berlin, pp. 343–354.
Wall, G., Varga-Weisz, P.D., Sandaltzopoulos, R. and Becker, P.B. (1995) Chromatin
remodeling by GAGA factor and heat shock factor at the hypersensitive Drosophila
hsp26 promoter in vitro. The EMBO Journal 14, 1727–1736.
Ward, E.R., Ryals, J.A. and Miflin, B.J. (1993) Chemical regulation of transgene
expression in plants. Plant Molecular Biology 22, 361–366.
Waters, E.R., Lee, G.L. and Vierling, E. (1996) Evolution, structure and function of the
small heat shock proteins in plants. Journal of Experimental Botany 47, 325–338.
Wisniewski, M., Close, T.J., Artlip, T. and Arora, R. (1996) Seasonal patterns of dehydrins
and 70-kDa heat-shock proteins in bark tissues of eight species of woody plants.
Physiologia Plantarum 96, 496–505.
Wu, C. (1995) Heat shock transcription factors: structure and regulation. Annual Review
of Cell Developmental Biology 11, 441–469.
Xiao, C.M. and Mascarenhas, J.P. (1985) High temperature-induced thermotolerance
in pollen tubes of Tradescantia and heat-shock proteins. Plant Physiology 78,
887–890.
Xiao, H., Perisic, O. and Lis, J.T. (1991) Cooperative binding of Drosophila heat shock
factor to arrays of a conserved 5 bp unit. Cell 64, 585–593.
Zarsky, V., Garrido, D., Eller, N., Tupy, J., Vicente, O., Schöffl, F. and Heberle-Bors, E.
(1995) The expression of a small heat shock gene is activated during induction of
tobacco pollen embryogenesis by starvation. Plant, Cell and Environment 18,
139–147.
Zimmerman, J.L. and Cohill, P.R. (1991) Heat shock and thermotolerance in plant and
animal embryogenesis. New Biologist 3, 641–650.
Zimmerman, J.L., Apuya, N., Darwish, K. and O’Carroll, C. (1989) Novel regulation of
heat shock genes during carrot somatic embryo development. Plant Cell 1,
1137–1146.
zur Nieden, U., Neumann, D., Bucka, A. and Nover, L. (1995) Tissue-specific localization
of heat-stress proteins during embryo development. Planta 196, 530–538.
Wound-inducible Genes
8
in Plants
Lan Zhou and Robert Thornburg
Department of Biochemistry and Biophysics, Iowa State

University, Ames, IA 50011, USA
INTRODUCTION
All living organisms are involved in a constant struggle with and against other
organisms to exploit their environment. Every organism exploits its own
environmental niche to gain nutrients for growth and development. However,
when multiple organisms interact, then a direct competition is established
between those organisms. The organism that is better able to compete usually
has an evolutionary advantage and is assured of survival. Some organisms
move when in direct competition, however, because of their sedentary lifestyle,
plants generally can not. Instead, plants have developed very potent
biochemical responses that serve to protect their integrity and to limit the
invasive nature of the competing organisms.
Structurally, plants have a polyester coating composed of cutin and suberin
(Kolatakuddy, 1980). This coating normally isolates the plant tissues from
competing organisms and plants are therefore relatively immune from the
presence of these competitors even on their surface. However, if a break or
wound occurs in this surface coating, then competing organisms gain entrance
into the plant’s tissues where they can cause injurious damage to those tissues.
Consequently, plants have developed a complex response to wounding that
dramatically alters the cellular physiology of plant tissues and results in the
activation of defences. These defences are particularly potent against micro-
organisms and are even effective against small herbivores.
The response of plants to wounding has been studied since the early 1970s
when Green and Ryan (1972) discovered that an inhibitor of chymotrypsin in
tomato leaves accumulated in response to wounding. Further, because
chymotrypsin-like proteins do not occur in plants, but are common in insect
128 L. Zhou and R. Thornburg
digestive tracts, they concluded that this inhibitor was part of a wound-
responsive plant defence system. Since that time, at least 70 other proteins have
been identified as also being wound-inducible.
Appendix 8.1 provides a list of different genes that have been demonstrated
to be wound-inducible. This list is not meant to be all inclusive, but it does give
a broad perspective of both the number and classes of plant genes that have
been identified to date as being wound-inducible. Many of these genes are
discussed in some detail below. In addition, Appendix 8.1 provides additional
information about the modes of regulation where known for each particular
gene. In some cases, genes encoding a particular protein have been described
from multiple species. There are sometimes differences in regulation of the genes
between species for individual genes. In addition, many of the genes listed in
Appendix 8.1 are members of multigene families. In these cases, the several
members are often differentially regulated, with only one or a few members of
the family being wound-inducible.
Any attempt to adequately discuss the expression of 70 different proteins
from at least 38 species across 20 families would result in a morass of
contradictory information. We will, therefore, limit this chapter to two areas of
discussion. First, because of this large number of proteins that are induced in
response to a wound, we can identify the classes of proteins produced and begin
to draw some conclusions about overall biochemical processes that are
important in response to a wound. Secondly, there are a few wound-inducible
proteins and their genes that have been studied in great detail, and the
mechanisms of gene activation of several seemingly unrelated proteins (i.e.
proteinase inhibitors of the Solanaceae and vegetative storage proteins of the
Fabaceae) share many details of gene activation. Therefore, we will also examine
the details of the mechanisms of gene activation for these well-studied systems.
THE MULTIPLE PHASES OF A WOUND RESPONSE
Wounding results in the activation of many different genes within a plant. The
types of genes and the timing of their activation allows the identification of
different phases following a wound. Each of these phases of the wound-
induction process biochemically solves a different problem that wounding
causes the plant. These problems include: placing mechanical barriers to
invading organisms; sealing the wound tissue; activating defensive compounds
against invading organisms; and recovering from the wound. The sum of these
processes results in recovery from a wound and a return to normal physiology.
The hydrogen peroxide response
The initial phase of a wound-response is a rapid reaction to close the wound

thereby protecting the plant from loss of cellular components and restricting
Wound-inducible Genes 129
entry of microorganisms into the plant tissues. This is composed of at least two
general processes. Initially there is an almost immediate oxidative burst that
results in a cross-linking of plant cell wall proteins (Bradley et al., 1992; Brisson
et al., 1994). This oxidative burst can be detected within 15 s. The cross-linking
of the cell wall proteins provides a structural barrier that inhibits the invasion
of microorganisms. In addition, H2O2 from this oxidative burst is thought to
activate some of the wound-inducible genes (Levine et al., 1994). Because H2O2
is itself toxic to plant cells (Lachman, 1986), numerous peroxidases are
produced in response to a wound to limit peroxide accumulation (Diehn et al.,
1993; Mohan et al., 1993).
Up-regulation of phenylpropanoids
In addition to this peroxide response, there is a general up-regulation of genes

encoding the phenylpropanoid pathway. The kinetics of this activation are also
extremely rapid, with new mRNAs for these enzymes appearing within 15 min
(Lawton et al., 1983; Templeton and Lamb, 1988). This up-regulation of the
phenylpropanoid pathway genes may be regulated by the H2O2 burst because
the direct addition of H2O2 to bean suspension cells induced the accumulation
of mRNAs encoding phenylalanine ammonia-lyase, chalcone synthase and
chalcone isomerase (Mehdy, 1994). The function of the up-regulation of these
genes is to provide the cell with lignin precursors which can reseal the wounded
surface and to provide cells with precursors of phenolic plant-defensive
compounds.
Inactivation of photosynthetic translation
The second phase of the wound response particularly in monocots, is a turn-off

of photosynthetic protein translation by arresting the translation of nuclear-
encoded photosynthetic genes (Criqui et al., 1992; Reinbothe et al., 1993c).
Because maintenance of the photosynthetic apparatus represents a major
expenditure of cellular energy, repressing the synthesis of new proteins would
save energy for the plant following the wound. Among these down-regulated
proteins are those for the small subunit of ribulose-1,5-bisphosphate
carboxylase/oxygenase (SSU, rbcS gene product) and several light-harvesting
chlorophyll protein complex apoproteins (LHCPs, cab gene products). However,
the changes in protein synthesis do not correspond to equivalent changes in the
rbcS and cab transcript levels. Rather, these mRNAs are shifted to smaller
polysomes in methyl jasmonate-exposed leaf tissues (Reinbothe et al., 1993a).
Control mRNAs encoding leucyl-tRNA synthetase (LRS1, lrs1 gene product)
neither changed its abundance nor its association with polysomes in methyl
jasmonate-treated leaves and was translated into the corresponding
polypeptide.
Several mechanisms are responsible for this altered regulation of the

photosynthetic machinery. First, methyl jasmonate induces a shift in the 5′
untranslated region of the rbcL transcript (Reinbothe et al., 1993b). The
primary transcript is initiated at 2316 from the translation start codon.
Under normal conditions, the 5′ end of the mature rbcL transcript is processed
to yield a mRNA with a 59 bp 5′ untranslated region. Following jasmonate
treatment, the mRNA is alternatively processed to give a 94 bp untranslated
region. This alternatively spliced transcript contains within the 5 ′
untranslated region, a 35-base motif that has high complementarity to the
3 ′-terminus of the 16S rRNA. That portion of the 16S rRNA is involved in
intramolecular base pairings within the ribosome and can associate with 30S
but not with 70S complexes. Normal transcripts lacking this 35-base motif are
active in terms of translation initiation. However, those transcripts having this
sequence interfere with translation initiation by competing for ribosome
binding leading to down-regulation of the large subunit which in turn leads
to regulation of the small subunit.
A second method that plants use to alter protein synthesis in stressed plant
tissues involves the expression of ribosome-inactivating proteins. These have
also been most highly studied in barley. One of these proteins, previously
identified as a 60 kDa jasmonate-induced protein (JIP60), has been shown to
cleave polysomes into ribosomal subunits (Chaudhry et al., 1994; Reinbothe et
al., 1994b).
Finally, chaperonins that interact with ribulose bisphosphate carboxylase/
oxygenase are also strongly repressed following wounding (Zabaleta et al.,
1994), thereby further indicating the role of wounding on inhibition of
photosynthesis.
Induction of ethylene biosynthesis
In addition to being developmentally regulated, ethylene is synthesized

following wounding. SAM synthase catalyses the formation of S-adenosyl-L-
methionine from methionine and ATP. Ethylene is then formed from S-adenosyl-
L -methionine in two steps (Kende, 1989). The first step is catalysed by the
enzyme aminocyclopropane carboxylic acid (ACC) synthase and the second step
by ACC oxidase.
These genes usually are developmentally expressed in fruit; however, each
of the steps in this pathway is also wound-inducible. This wound induction is
apparently self-propagating because these enzymes are also regulated by
ethylene itself (O’Donnell et al., 1996). Because these genes rely on the
synthesis of ethylene to regulate their wound-inducibility, they are often referred
to as ethylene-related genes. Varieties of fruit that produce the highest levels of
ethylene also induce higher levels of ethylene-related genes. Some of these genes
have unknown functions (Parsons and Mattoo, 1991).
Induction of plant defences
A major phase of the wound response is a generalized activation of plant

defences. Because the majority of microbial infections occur in plants following
a wound, plants have developed a variety of biochemical defences to combat
invading pathogens and even small herbivores. The accumulation of
phytoalexins after wounding has been a particularly rich area for study.
Phytoalexins are plant synthesized small molecular weight defensive com-
pounds that have biological activity against microorganisms or herbivores.
These include phenolic, terpenoid and alkaloid compounds that are a major
component of plant secondary metabolism. Many different plant species have
been shown to activate the synthesis of phytoalexins after a wound or after
methyl jasmonate treatment (methyl jasmonate has a proposed role in the reg-
ulation of defence genes, see below).
In the recent literature, some of the induced phytoalexins have been shown
to include furanocoumarin biosynthesis in Apium graveolens leaves (Miksch and
Boland, 1996); taxol biosynthesis in Taxus cuspidata suspension cultures
(Mirjalili and Linden, 1996); momilactone in suspension-cultured rice cells
(Nojiri et al., 1996); and alkaloid synthesis in Catharanthus roseus (Aerts et al.,
1996). In these cases, wounding or treatment with jasmonates activates the
genes encoding the biosynthetic pathways for these different biochemicals;
however, for many of these the individual biochemical steps leading to
phytoalexin biosynthesis are not known or have not been examined.
Some secondary metabolites are effective even against large phytophagous
insects. Ramputh and Brown (1996) report on the accumulation of the
inhibitory neurotransmitter, γ-aminobutyric acid (GABA), following
mechanical damage of soybean leaves. These authors also demonstrated that
increasing levels of GABA decreased the survival of larvae and increased the
length of time that larvae required to pupate.
Leaf damage by herbivores in Nicotiana sylvestris produces a damage
signal that dramatically increases de novo nicotine synthesis in the roots. The
increased synthesis leads to increases in nicotine pools, which is then
transported up the plant. This results in increased nicotine pools throughout
the plant making plants more resistant to further herbivore attack (Baldwin et
al., 1994). This signal, resulting in increased nicotine production, was later
shown to be methyl jasmonate (Baldwin, 1996).
In addition to the accumulation of the small molecular weight phyto-
alexins, plants also activate the synthesis of proteins following a wound. Many
of these wound-inducible proteins are directly active against the growth of
herbivores and microorganisms. Among these are the serine proteinase
inhibitors (Ryan, 1981b), α-amylase inhibitors (Ishimoto and Chrispeels,
1996), chitinases (Broglie et al., 1991), β-glucanases (Mauch et al., 1988),
osmotin (Grosset et al., 1990), lectins (Casalongué and Pont Lezica, 1985) and
many others. Each of these enzymes or inhibitors performs a specific function
in combating the invading herbivore or pathogen.
The serine proteinase inhibitors and the α-amylase inhibitors are

particularly effective against insects. These proteins block the digestive processes
that liberate free amino acids or glucose in an insect’s digestive tract. By
blocking these processes, the plant limits the nutrition that an insect can glean
from the tissue it eats. While these processes may be rather ineffective against
single insects that may move from plant to plant, they very effectively reduce
the fecundity of developing larvae that grow and develop on a single plant. It
should also be pointed out that while plants have many serine proteinase
inhibitors, the presence of serine proteinases in plants is rare (Ryan, 1981a).
Thus, plants apparently lack the specific target enzymes of these inhibitors.
These enzymes are however very rich in the digestive tract of insects, and this
has led to the conclusion that these inhibitors are targeted against insects.
Chitinases and β-1,3-glucanases are other defensive enzymes that have no
natural target in plants. Chitin does not exist in plants and β-1,3-glucans are
not major components of plant cells. Chitin and β-1,3-glucans are found
extensively in the cell walls of fungi, however. Thus, these defensive compounds
are apparently directed against invading yeast and fungal microorganisms. The
expression of these enzymes limits the growth and development of these
microorganisms, especially during spore germination.
Additional defensive proteins that accumulate in plants following a wound
target other specific features of microorganisms or herbivores to limit their
growth and development. Note that antibacterial responses and antiviral
responses apparently require specific interactions with surface or intracellular
receptors in plants that activate the hypersensitive responses (Reuber and
Ausubel, 1996; Ritter and Dangl, 1996). These responses are mediated by
different signal transduction pathways than the classical wound-induction
pathways and in general do not cross communicate. Recently, however, studies
on the overexpression of small GTP-binding proteins have demonstrated that
altered regulation of these G-proteins can lead to cross-signalling between these
two pathways (Sano et al., 1994; Sano and Ohashi, 1995).
Induction of storage proteins
In plant families, vegetative storage proteins accumulate in leaves prior to

anthesis, decline during pod filling and then accumulate again after seed
maturation (Staswick, 1989). In woody species such as poplar trees, a similar
set of proteins termed bark storage proteins accumulate in the autumn months
in the protein storage vacuoles of the inner-bark parenchyma and xylem ray
cells (Coleman et al., 1993). These proteins are remobilized during the spring
bud-burst when active growth dictates a need for nitrogen. This pattern of
expression is consistent with the role of these storage proteins as a temporary
sink for nitrogen in the growing tissues.
In addition to this developmental mode of gene regulation, these proteins
are also induced by wounding and by jasmonates (Francheschi and Grimes,
1991; Staswick et al., 1991; Mason et al., 1992). While the teleological reason
for induction of these storage proteins following a wound is unclear, perhaps,
these storage proteins serve to temporarily store nitrogen and carbon following
a wound. This storage would help protect from the loss of these metabolites
during the wound response. These wound-induced reserves could later serve as
a source for new growth after the wound-recovery phase.
Return to normal physiology
The final phase of the wound-response is a recovery phase that returns the plant
cell to a normal physiology. This phase is much longer in duration than the
earlier phases of the wound response, generally lasting from days to a week or
so after the wound.
Several unique processes occur during this phase. One of these processes
includes the uptake of carbohydrates into the wounded tissues. It is known that
both extracellular invertases (Sturm and Chrispeels, 1990) and sugar
transporters (Truernit et al., 1996) are induced following wounding. The extra-
cellular invertases cleave extracellular sucrose into its component sugars. The
sugar transporters then re-internalize the monosaccharides. This process
thereby limits the free carbohydrate content of the extracellular milieu for any
invading microorganisms.
Thus, wounding of plant tissues produces a large-scale alteration of plant
metabolism that is initiated almost immediately following a wound. Numerous
formerly quiescent genes are activated following a wound that mediate this
altered metabolism. The changes include sealing the wound at the surface of
the cell, limiting photosynthetic translation, induction of hormone
biosynthesis, producing secondary metabolites and defence proteins,
producing storage proteins and finally recovery after the wound to return to a
normal physiology.
MECHANISM OF WOUND INDUCTION
Because of the wide number of genes that are activated and the very different
time frames during which these genes become activated, it is certain that
numerous mechanisms are responsible for wound-inducible gene expression in
plants. While some of these mechanisms may involve peroxide induction of gene
expression (Levine et al., 1994), or ethylene (O’Donnell et al., 1996) perhaps the
best characterized of the wound-inducible genes are the proteinase inhibitor
genes of solanaceous plants and the vegetative storage protein genes that are
similarly regulated. The remainder of this chapter will discuss the mechanism
of wound induction of the proteinase inhibitor and vegetative storage protein
genes.
SYSTEMIC SIGNAL
One of the most striking characteristics about the wound-inducibility of the

proteinase inhibitor genes in solanaceous plants is the fact that local wounding
triggers expression of these genes at a distal site. Currently there are two
mechanisms that have been proposed to trigger the wound-induced systemic
accumulation of these proteinase inhibitor genes. These mechanisms are
mediated by either electrical or chemical signals.
Electrical signals
Wildon et al. (1992) have shown that wounding of the cotyledons of a young
tomato plant results in a slow moving action potential that propagates away
from the site of the wound toward the upper leaves. In all cases, this action
potential correlates with the induction of proteinase inhibitor genes. Plants are
unique, in that they have symplastic connections that continue throughout the
organism. These connections are made by plasmodesmata, and are well suited
for electrical signals.
This work has been confirmed (Herde et al., 1995; Stankovic and Davies,
1995) and expanded (Rhodes et al., 1996). Herde et al. (1995) showed that the
electrical induction of the proteinase inhibitor genes correlated with alterations
of the stomatal aperture. Stankovic and Davies (1995) showed that both
electrically stimulated action potentials and flame-induced hydraulic signals
could induce high levels of proteinase inhibitor mRNA. Rhodes et al. (1996)
showed that the electrical signals travelled from the wounded cotyledon to
distant unwounded leaves along sieve tubes and companion cells.
While it is clear that such an electrical action potential stimulates the
activation of the proteinase inhibitor genes in planta, the mechanisms that
translate this action potential into a chemical form that activates gene
transcription have not been fully elucidated. Recently, Herde et al. (1995) have
shown that electrical current and localized heating induce the accumulation
of abscisic acid (ABA) and jasmonate in wild-type plants to levels that
approach that of wounding. They also demonstrate that ABA-deficient plants
are able to synthesize jasmonate in response to heat, but not in response to
wounding. While the mechanism of electrical signal transduction is unknown,
there have been several ion channels identified in plants (Maathuis and
Sanders, 1995; Lurin et al., 1996) that could possibly participate in this
process. Additionally, one of the inhibitors of wound-inducible gene expression,
acetylsalicylic acid, is known to disrupt H +/K + transporters at the plasma
membrane (Glass and Dunlop, 1974). Also an induced oxidative stress has
been shown to be the result of electrical pulses in maize plants (Sabri et al.,
1996). It is also not clear whether the electrical stimulation of proteinase
inhibitor gene induction is capable of inducing the wide variety of genes that
wounding induces.
Systemin
One of the most intriguing recent findings in the area of plant biochemistry is
the finding that polypeptide signals may function in the activation of plant
defence genes in the same way that polypeptides activate defences in animal
cells (Bergey et al., 1996). These studies were initiated by the original finding
that a polypeptide from tomato leaves at very low concentrations was capable
of initiating the signal transduction cascade leading to the expression of
proteinase inhibitor genes in the absence of a wound (Pearce et al., 1991). A
synthetic polypeptide identical to the one purified from plants was also active in
proteinase inhibitor gene induction. Further this synthetic polypeptide was
readily mobile in the phloem, as opposed to oligosaccharide signals (Baydoun
and Fry, 1985).
The cDNA and gene encoding the signalling molecule, systemin, have been
isolated and characterized (McGurl and Ryan, 1992; McGurl et al., 1992). The
signalling molecule, systemin, is synthesized from a 200 amino acid proprotein
termed prosystemin that is encoded in 11 exons. The mRNA is found through-
out the tomato plants with the exception of the roots. Its expression was also
wound-inducible in leaves, indicating that its expression provides a self-
amplification of the wound signal.
Prosystemin must be proteolytically processed to release the active systemin
peptide. Recently, Gu et al. (1996) reported on the wound induction of a leucine
aminopeptidase that accumulates in tomato leaves. These authors speculate
that this amino peptidase activity may be important for plant defence response
possibly by processing of prosystemin to systemin.
A correlation of the activity of the systemin polypeptide with its structure
has been examined (Pearce et al., 1993). Alanine scanning mutations revealed
two regions required for activity: the first at Pro13 and the other at Thr17 near
the carboxyl-terminus of the peptide. Modifications at or near the carboxyl-
terminus were especially effective in reducing the activity of the polypeptide
although these modified systemins could compete with the native systemin
interactions with its receptor.
Alteration of systemin expression has been examined in transgenic tomato
plants. Plants transformed with an antisense copy of prosystemin cDNA showed
a dramatic suppression of proteinase inhibitor expression in the leaves of the
transgenic plants (McGurl et al., 1992). An overexpression of prosystemin cDNA
in tomato plants resulted in a constitutive expression of proteinase inhibitor
proteins in leaves (McGurl et al., 1994). These plants were still wound-inducible,
expressing high levels of proteinase inhibitors both locally and systemically
following wounding. Systemin is also capable of inducing other plant defensive
proteins including polyphenol oxidase (Constabel et al., 1995), indicating that
systemin has a role in signalling plant defensive genes other than proteinase
inhibitors. In this same study, these authors also grafted non-transformed, wild-
type scions on to the transgenic root stock and demonstrated elevated levels
of proteinase inhibitors in the non-transformed scions. These studies
demonstrated that a signal could be transmitted from root stock transformed

with the prosystemin cDNA through a graft junction to non-transformed leaves
in the absence of wounding.
To further investigate this systemic mobility of the systemin polypeptide,
Narvaez-Vasquez et al. (1994) have used p-chloromercuribenzenesulphonic
acid (PCMBS), an inhibitor of active apoplastic phloem loading. PCMBS was
shown to be a powerful inhibitor of wound-induced and systemin-induced
activation of proteinase inhibitor synthesis in tomato leaves. When placed on
fresh wounds, PCMBS severely inhibited systemic induction of proteinase
inhibitors, in both the presence and absence of exogenous systemin. This
process could be reversed by addition of various sulphydryl compounds.
Localized interactions
Once the long distance systemic signal reaches its local site of action, that
signal (whether electrical or chemical) must be transduced to the nucleus of the
cell where gene transcription occurs. Electrical signals are known to open ion
channels in cells that could lead to a transducing chemical signal; but, the
involvement of such ion channels has not been demonstrated with any of the
chemical signals known to induce wound-inducible genes. Typically, chemical
signals interact with a cell surface receptor that then transmits chemical energy
across the membrane to the cytoplasm.
Because of the variety and chemical diversity of the signals that are known
to activate wound-inducible genes (polyanionic, plant cell wall fragments,
(Bishop et al., 1981, 1984); polycationic, fungal cell wall fragments (Walker-
Simmons and Ryan, 1984); sucrose (Johnson and Ryan, 1990); and the
polypeptide, systemin (Pearce et al., 1991)) there should be numerous cell
surface receptors. However to date, no cell surface receptor has been identified.
There are, however, intriguing findings that imply the existence of such
receptors. For example, elicitation of Eschscholzia cell cultures (Blechert et al.,
1995) or tomato cells (Felix et al., 1993) leads to a rapid alkalinization of the
growth medium, possibly implying the involvement of membrane transport or
ion movement. This alkalinization of the medium occurred prior to jasmonate
formation and inhibition of this alkalinization process by the protein kinase
inhibitor staurosporine also inhibited jasmonate formation (Blechert et al.,
1995).
In addition, the interaction of oligosaccharide elicitors with cells leads to
several alterations in the plasma membrane. It is known that wounded plant
cells have increased membrane fragility (Walker-Simmons et al., 1984) perhaps
due to phospholipase action. Further, elicitor treatment of cells led to the
phosphorylation of various plant plasma membrane proteins in both potato and
tomato (Farmer et al., 1989; Felix et al., 1993). In tomato both a 34 kDa and a
29 kDa protein were phosphorylated, but in potato only a 34 kDa phospho-
protein was detected. In contrast to this, the elicitation with systemin resulted
in the hyperphosphorylation of a 27 kDa protein. These studies indicate that

protein kinases may play an important role in the mechanism of signal
transduction leading to defence gene expression. Indeed, Bögre et al. (1997)
have recently reported that the MMK4 MAP kinase is activated within 1 min of
wounding. This kinase shows maximal activity 5 min after wounding and then
activity dissappears by 40 min after wounding. The specific role of this or other
kinases in wound induction is unknown, however, protein kinase inhibitors
such as staurosporine can block the synthesis of jasmonates which are inter-
mediates in the signal transduction pathway (Blechert et al., 1995).
Recent evidence provided by Dammann et al. (1997) demonstrate that an
okadiac acid-sensitive protein phosphatase is involved in jasmonate-induced
signal transduction in leaves; however, jasmonate-induced gene activation in
roots does not require this protein phosphatase to activate gene transcription in
roots. Thus, multiple pathways of signal transduction occur in different tissues.
Oxylipins
As mentioned earlier, jasmonic acid and its methyl ester, methyl jasmonate, are
active in inducing the accumulation of numerous wound-inducible gene prod-
ucts in plants. Northern analysis of methyl jasmonate-induced inhibitors I and
II mRNAs in tomato leaves, and of lucerne trypsin inhibitor mRNA in lucerne
leaves, indicated that nascent inhibitor mRNAs were transcriptionally regulated
in a manner similar to wounding (Farmer and Ryan, 1990). Further, this
induction was systemic (Farmer et al., 1992).
After jasmonates were identified as potential mediators of the wound
response, numerous investigators examined the levels of jasmonates in
wounded plants. Creelman et al. (1992) used isotopically labelled standards to
demonstrate that wounded soybean stems rapidly accumulated jasmonic acid
and methyl jasmonate. Albrecht et al. (1993) used an enzyme-linked
immunosorbent assay (ELISA) to show that levels of jasmonic acid rose
immediately and transiently in leaves as a consequence of wounding. The rapid,
but transient, synthesis of cis-jasmonic acid was demonstrated after insect
attack and by microbial elicitor in plant suspension cultures (Blechert et al.,
1995). Leaf damage in Nicotiana sylvestris rapidly caused the level of shoot-
jasmonic acid pools to rise rapidly (<0.5 h). Root-jasmonic acid pools also rose
in response to leaf damage, but more slowly (<2 h). The levels of jasmonic acid
remained elevated for 24 h in shoots and 10 h in roots (Baldwin et al., 1994).
The pathways of jasmonic acid biosynthesis
The synthesis of jasmonic acid requires that the starting products be liberated
from membrane phospholipids. Ryu and Wang (1996) have demonstrated that
phospholipase D is rapidly activated by wounding in the leaves of castor bean
resulting in an accumulation of phosphatidic acid and free-choline throughout

the leaf. New synthesis of phospholipase D mRNA was not observed following a
wound, but rather, the wound-activation of the phospholipase resulted from
intracellular translocation of the protein from the cytosol to membranes.
Conconi et al. (1996) have found that the levels of linolenic acid (18:3) and
linoleic acid (18:2) increased within 1 h of a wound. Presumably this is due to
phospholipase A1 or A2 activity; although induction of these activities
following a wound has not been demonstrated. After 1 h, they found a 15-fold
excess of 18:3 over that required to account for the levels of newly synthesized
jasmonic acid.
The intracellular location of jasmonate biosynthesis is thought to be the
chloroplast envelope membranes (Blée and Joyard, 1996). It is currently
unclear whether the free fatty acids are liberated from chloroplast phospholipids
or from other membranes and are transported to the chloroplast via lipid
transfer proteins.
The conversion of free 18:3 fatty acids into jasmonic acid occurs in five
steps through an oxidative pathway. The intermediates are termed oxylipins
and these intermediates also activate wound-inducible gene expression
(Farmer et al., 1992). Initially, lipoxygenase catalyses the incorporation of
molecular O2 into certain polyunsaturated fatty acids having a cis, cis-1,4-
pentadiene system to form a fatty acid hydroperoxide. Typically in plants, there
are numerous lipoxygenases and only some isoforms of these enzymes are
wound-inducible (Avdiushko et al., 1995; Royo et al., 1996). Thus, like many
of the wound-inducible target genes, those genes which participate in the acti-
vation process are also wound-inducible. In addition, many of these lipoxyge-
nases are induced by a variety of biochemical components such as fungal
elicitor, plant and fungal cell wall oligosaccharides, and methyl jasmonate
(Bohland et al., 1997). In Arabidopsis, the lipoxygenase involved in jasmonate
biosynthesis is LOX2 (Bell et al., 1995). Cosuppression of LOX2 in transgenic
plants leads to reduced levels of jasmonate biosynthesis as well as reduced
levels of wound-inducible gene expression. The Arabidopsis lipoxygenase LOX2
that is involved in jasmonate biosynthesis is chloroplastic (Bell et al., 1995).
Following the formation of 13-hydroperoxylinolenic acid, the enzyme
allene oxide synthase forms an epoxide intermediate termed allene oxide. The
flax allene oxide synthase contains a 58 amino acid chloroplast transit
peptide (Harms et al., 1995). These same authors constitutively over-
expressed the flax allene oxide synthase cDNA in transgenic potato plants.
This expression led to an increase in the endogenous level of jasmonic acid
within the plants. However, despite the fact that the transgenic plants had
levels of jasmonates similar to those found in non-transgenic wounded
plants, the wound-inducible pin2 genes were not constitutively expressed in
the leaves of these plants (Harms et al., 1995). The reason for this lack of
expression is not clear, but perhaps compartmentalization of the signalling
factors is involved.
Following the formation of allene oxide, a cyclooxygenase acts to form 12-

oxo-phosphodienoic acid (12-oxo-PDA). Originally the substrate for this
enzymatic step was thought to be the 13-hydroperoxylinolenic acid (Vick et al.,
1980); but, Harms et al. (1995) indicate that allene oxide may be the substrate
for the cyclization. The ring double bond of the 12-oxo-PDA is then reduced by
a NADP+-utilizing enzyme to form 12-oxo-PMA. This is the rate-limiting step of
jasmonate biosynthesis (Vick and Zimmerman, 1986). Utilization of NADP+ is
consistent with the localization of these enzymes in the chloroplast. Finally
jasmonic acid is synthesized from the 12-oxo-PMA by three rounds of β-
oxidation. It is not clear whether a novel fatty acid β-oxidase functions in the
synthesis of jasmonic acid or even whether coenzyme A derivatives or acyl-
carrier proteins are involved.
It has also been proposed that a second oxylipin cascade exists in plants
starting from linoleic acid via 15,16-dihydro-12-oxo-phytodienoic acid to
9,10-dihydrojasmonate (Blechert et al., 1995). Recently, the cDNA encoding
allene oxide synthase has also been isolated from Arabidopsis thaliana (Laudert
et al., 1996). After expression of this enzyme in Escherichia coli, the protein was
enzymatically active with substrates derived from either linolenic acid or linoleic
acid, verifying that there are indeed duplicate pathways to the synthesis of
jasmonic acid and dihydrojasmonic acid.
In addition, to the synthesis of jasmonates, a wide variety of other oxylipin
products from n-hexenal to ketols to traumatic acid are also derived from these
same intermediates (Avdiushko et al., 1995; Blée and Joyard, 1996). Whether
these intermediates also have gene regulatory activity will require further
examination. It is known, however, that n-hexenal accumulates in the released
volatile gases of wounded plants and there has been speculation that this may
be involved in rejection of plants by insects (Röse et al., 1996).
Inhibitors of oxylipin metabolism
Numerous inhibitors of the expression of wound-inducible genes have been

reported. By far the majority of these inhibitors occur in the oxylipin path-
way. Inhibitors of lipoxygenases that inhibit wound-inducible gene
expression include phenidone (Farmer et al., 1994), ursolic acid (Wasternack
et al., 1994), SHAM and ZK139817 (Peña-Cortés et al., 1993). Propyl gallate
and piroxicam (Peña-Cortés et al., 1993) and salicylic acid (Doherty et al.,
1988; Peña-Cortez et al., 1993; Doares et al., 1995) are inhibitors of
hydroperoxide dehydrase (cyclooxygenase). Numerous studies involving
salicylic acid have demonstrated that this compound blocks activation of
proteinase inhibitor genes by electrical signals (Doherty et al., 1988),
oligouronide induction, systemin induction and linolenate induction (Doares
et al., 1995) as well as transcription of the genes encoding proteinase
inhibitor II, cathepsin D inhibitor and threonine deaminase (Peña-Cortés et
al., 1993).
Metabolism of jasmonates
The synthesis of jasmonates is a relatively transient response. Usually,

jasmonate levels decline rapidly following the burst of synthesis (Albrecht et al.,
1993; Blechert et al., 1995; Conconi et al., 1996); yet many plant responses
remain activated for many hours. In an attempt to explain this phenomenon,
Krumm et al. (1995) have investigated the role of amino acid conjugation of
jasmonates. These authors have prepared many jasmonate–amino acid
conjugates. They have shown that many of these amino acid conjugates are
inactive, however conjugates of leucine and isoleucine retain their activity.
These authors speculate that these active conjugates may function in the long-
term maintenance of jasmonate-mediated signalling in plants.
Of the four possible stereoisomers of jasmonic acid, growth-inhibitory
activity was associated with both of the 1R stereoisomers; however there was
no observed difference between the inhibition of straight growth of oat
coleoptiles indicating that there may be multiple receptors mediating jasmonate
activities (Koda et al., 1992). Further, stereochemically locked cis- and trans-7-
methyl derivatives of methyl jasmonate have low biological activity suggesting
that the introduction of the locking methyl group at position seven considerably
lowers affinity for the jasmonate receptor, presumably owing to a steric effect
(Koda et al., 1995).
Mutants in jasmonic acid synthesis and action
An ethylmethanesulphonate mutant (jar1) of Arabidopsis thaliana has been

isolated that showed decreased sensitivity to methyl jasmonate inhibition of root
elongation (Staswick et al., 1992). The jasmonate-inducibility of leaf proteins
was fourfold less in the jar1 mutants than in the wild-type Arabidopsis plants.
Signalling mutants have also been prepared in tomato (Lightner et al.,
1993). These mutants, JL1 and JL5, were blocked in the induction of proteinase
inhibitor genes. These mutants were deficient in the systemic induction of both
proteinase inhibitor I and II; however, these mutants showed some localized
induction of proteinase inhibitors. These results were interpreted as suggesting
that multiple signalling pathways (one systemic and another local) existed in
response to wounding. Further, these mutants were fully responsive to the
addition of methyl jasmonate, indicating that the lesion in these mutants was
located somewhere upstream of the final step in jasmonate biosynthesis.
Recently, Howe et al. (1996) demonstrated that the JL5 mutant are affected in
octadecanoid metabolism between the synthesis of hydroperoxylinolenic acid
and 12-oxo-phytodienoic acid.
Other mutants have been selected using coronatine. Coronatine is a
chlorosis-inducing phytotoxin produced by several pathovars of Pseudomonas
syringae. In tomato, coronatine induces the accumulation of proteinase
inhibitors (Palmer and Bender, 1995), but they are not protective against the
Pseudomonas pathogen. Treatment of Arabidopsis plants with coronatine leads

to inhibited root growth, anthocyanin accumulation and the induction of two
proteins of 31 and 29 kDa (Feys et al., 1994). Similar responses are induced in
response to jasmonates. Arabidopsis mutants have been isolated that are
resistant to this phytotoxin (Feys et al., 1994) and these mutants are also
insensitive to methyl jasmonate inhibition of root growth. These coi1 mutants
were all male sterile, producing abnormal pollen and had reduced levels of the
31 kDa protein. These authors conclude that the COI1 protein controls
jasmonate perception or response and also participates in flower development.
Jasmonates affect transcription
After jasmonates are synthesized, it is unclear how the biological activity of

these compounds are transmitted to the promoters of the various genes that
they activate. However, there is a recent report of a jasmonate-binding protein
that mediates the wound-inducible regulation of transcription of the potato
proteinase inhibitor 2 gene (Gurevich et al., 1996). In this work, a fragment of
the pin2 gene was isolated by PCR and used as an affinity sorbent. Nuclear
proteins were bound and the sorbent was eluted with physiological concentra-
tions of jasmonate. Four proteins were isolated by this procedure. The
characterization of these proteins will require further studies.
Another factor that affects proteinase inhibitor expression downstream of
jasmonates was discovered by Schaller et al. (1995). These authors found that
an inhibitor of some aminopeptidases, bestatin, was able to induce proteinase
inhibitor genes without affecting systemin, octadecanoids or jasmonate.
Furthermore, defence genes were induced by bestatin in the JL5 mutant tomato
line that has a defect in the octadecanoid pathway. Thus, bestatin appears to
function close to the level of transcription of wound-inducible genes. These
authors speculate that a regulatory protease may be involved.
INVOLVEMENT OF ADDITIONAL HORMONE FACTORS
ABA
There is significant evidence that the initial stages of wound induction require
the initial biosynthesis of ABA prior to transcription of wound-inducible genes
(Peña-Cortés et al., 1989, 1991; Hildmann et al., 1992). These studies
demonstrate that exogenous application of ABA induces a systemic pattern of
proteinase inhibitor II mRNA accumulation that is identical to mechanical
wounding. Numerous other wound-inducible genes are known to also be
induced by ABA (see Appendix 8.1). These same authors also demonstrated
that ABA-deficient plants do not respond to wounding unless ABA is supplied
exogenously. There is also an increase in ABA in the leaves of tomato, potato
and tobacco plants following a wound (Sanchez-Serrano et al., 1991). In

contrast to this, no increase in ABA was observed in leaves incubated with
jasmonic acid, suggesting that jasmonates act after ABA (Hildmann et al.,
1992). Recently, Peña-Cortés et al. (1995) have shown that either electrical
signals or systemin leads to an increase in ABA which in turn leads to an
increase in jasmonic acid which then regulates gene transcription. According
to this hypothesis, all jasmonate-regulated genes should also be ABA-regulated.
Lee et al. (1996), however, have identified four genes by differential display
which are regulated by jasmonate but are not regulated by ABA indicating that
the signalling pathways for ABA and jasmonates function independently and
not sequentially.
Specific roles for ABA have been proposed. ABA might lead to the
activation of a lipoxygenase that generates hydroperoxides from free fatty acids
within the cell (Peña-Cortés et al., 1995). Further evidence to support this
hypothesis is provided by Abián et al. (1991), who demonstrated alterations in
oxylipin metabolism in maize embryos in response to ABA. It is also known that
water stress also causes accumulation of ABA and activates a set of water-stress
genes; however it does not induce wound-inducible genes (Hildmann et al.,
1992). Thus different signal transduction mechanisms must regulate the ABA
induction of these different sets of genes.
Mutants affecting ABA induction

Because ABA has been identified as a factor involved in the activation of
proteinase inhibitor genes following wounding, there have been several
investigations examining wounding in ABA-deficient plants (Peña-Cortés et al.,
1989, 1991). Several different ABA-deficient plant lines have been used to
evaluate the involvement of ABA in wound-inducible gene expression. The
tomato mutants used for these studies are flaca and sitiens and the potato
mutant is droopy. In all of these plants, proteinase inhibitor genes are not
expressed unless ABA is added. However, care should be taken in interpretations
of the data derived from these hormone-deficient plants, because they are often
pleiotrophic mutations. For example the tomato mutant, flaca, is known to have
elevated levels of indoleacetic acid (IAA) in addition to reduced levels of ABA
(Tal and Imber, 1970). Further, there are numerous examples in the literature
that exogenous application of ABA to plant tissues can cause alterations in
endogenous levels of IAA within those tissues (Chang and Jacobs, 1973; Anker,
1975; Wodzicki and Wodzicki, 1981; Terek, 1982; Pilet and Rebeaud, 1983;
Dunlap and Robacker, 1990).
Ethylene
As mentioned above, ethylene is synthesized following a wound and many

wound-inducible genes are also responsive to ethylene. Recently, O’Donnell et
al. (1996) have demonstrated that ethylene is absolutely required for wound
induction of the proteinase inhibitor genes of tomato. These authors use

norbornadiene, which is an inhibitor of ethylene synthesis (Sisler et al., 1990),
and silver thiosulphate, which disrupts binding of ethylene to its receptor (Veen,
1987), to demonstrate that both jasmonic acid as well as ethylene are required
for proteinase inhibitor gene expression. They propose that both ethylene and
jasmonates are co-stimulatory for the other hormone, that is, after wounding
the synthesis of ethylene induces higher jasmonate levels and endogenous
jasmonates induce higher ethylene levels. In this way, a sufficient amount of
these hormones accumulate to regulate the wound process (O’Donnell et al.,
1996). Similar synergistic responses between ethylene and methyl jasmonate
have been observed for the PR1 and PR5 pathogenesis-related proteins (Xu et
al., 1994).
Additional studies in support of this hypothesis come from the study of a
tomato ethylene mutant, termed Never-ripe (NR), which have a partial loss of
ethylene sensitivity (Yen et al., 1995). In these plants, the wound-induced
accumulation of proteinase inhibitor transcripts is significantly delayed. Also,
transgenic tomato plants expressing an antisense ACC oxidase do not
accumulate proteinase inhibitor transcripts in response to wounding. Thus,
these studies also suggest that ethylene is required for wound-inducible gene
expression of the proteinase inhibitor genes.
Auxin
Auxin also has been demonstrated to prevent expression of wound-inducible

proteinase inhibitors (Kernan and Thornburg, 1989). This inhibition of
expression occurs both in tissue-cultured cells as well as in whole plants. It was
specific for biologically active auxins and occurred at near physiological IAA
concentrations. Auxin inhibition of gene expression has been demonstrated for
a number of wound-inducible genes (see Appendix 8.1). Auxin also inhibits
other chemical inducers. Auxin has also been shown to strongly inhibited
methyl jasmonate-induced wound-inducible gene expression in soybean
suspension-cultured cells (DeWald et al., 1994) and the expression of β-
glucanase in response to fungal elicitor in tobacco and soybean cells
(Jouanneau et al., 1991).
Thornburg and Li (1991) have also demonstrated that IAA in bulk leaf
tissues declines by two- to threefold following a wound and that the kinetics of
IAA decline inversely correlate with the induction of wound-inducible gene
expression.
Other cellular machinery required for induction of wound-inducible genes
has not been fully elucidated, however, recent work indicates that this is a rich
field for study. It is known that small GTP-binding proteins can mediate cross-
signalling between the wound- and pathogen-induced signal transduction
pathways (Sano et al., 1994; Sano and Ohashi, 1995). More recently, these
authors demonstrated that these transgenic plants overexpressing this small
GTP-binding protein can synthesize jasmonates more rapidly than control

plants. They also provide evidence based upon competition with 2-chloro-4-
cyclohexylamino-6-ethylamino-S-triazine (a potent cytokinin antagonist) that
cytokinins may be essential for accumulation of wound-inducible proteinase
inhibitor transcripts (Sano et al., 1996). Indeed it has been previously suggested
that wounding enhances endogenous cytokinin activity in cucumber (Crane
and Ross, 1986).
From all of these studies, we can see the involvement of multiple long-range
signals, both chemical and electrical, multiple short-range signals of plant and
fungal origin, several signal transduction cascades involving GTP-binding
proteins, kinases and phosphatases along with variations in multiple plant
hormones, ethylene, cytokinins, auxin and ABA in addition to the biosynthesis
of jasmonates. All of these factors clearly play a role in the transcriptional
activation of wound-inducible genes. It cannot be argued that these factors are
coordinated in a vastly complex, well-regulated network of responses leading to
gene activation. In spite of all that is currently known about the expression of
these genes, there is a long way to go before we fully understand wound-
inducible gene expression in plants.
REFERENCES
Abián, J., Gelpi, E. and Pagès, M. (1991) Effect of abscisic acid on the linoleic acid
metabolism in developing maize embryos. Plant Physiology 95, 1277–1283.
Adams, C.A., Nelson, W.S., Nunberg, A.N. and Thomas, T.L. (1992) A wound-inducible
member of the hydroxyproline-rich glycoprotein gene family in sunflower. Plant
Aerts, R.J., Schafer, A., Hesse, M., Baumann, T.W. and Slusarensko, A. (1996) Signaling
molecules and the synthesis of alkaloids in Catharanthus roseus seedlings.
Phytochemistry 42, 417–422.
Albrecht, T., Kehlen, A., Stahl, K., Knofel, H.D., Sembdner, G. and Weiler, E.W. (1993)
Quantification of rapid, transient increases in jasmonic acid in wounded plants
using a monoclonal antibody. Planta 191, 86–94.
Andresen, I., Becker, W., Schlüter, K., Burges, J., Parthier, B. and Apel, K. (1992) The
identification of leaf thionin as one of the main jasmonate-induced proteins of
barley (Hordeum vulgare). Plant Molecular Biology 19, 193–204.
Anker, L. (1975) Auxin-synthesis inhibition by abscisic acid, and its reversal by
gibberellic acid. Acta Botanica Neerlandica 24, 339–347.
Avdiushko, S., Croft, K.P.C., Brown, G.C., Jackson, D.M., Hamiltio-Kemp, T.R. and
Hildebrand, D. (1995) Effect of volatile methyl jasmonate on the oxylipin pathway
in tobacco, cucumber and Arabidopsis. Plant Physiology 109, 1227–1230.
Baldwin, I.T. (1996) Methyl jasmonate-induced nicotine production in Nicotiana
attenuata: inducing defenses in the field without wounding. Entomologia
Experimentalis et Applicata 80, 213–220.
Baldwin, I.T., Schmelz, E.A. and Ohnmeiss, T.E. (1994) Wound-induced changes in root
and shoot jasmonic acid pools correlate with induced nicotine synthesis in Nicotiana
sylvestris Spegazzini and Comes. Journal of Chemical Ecology 20, 2139–2157.
Barry, C.S., Beatrix, B., Mondher, B., Cooper, W., Hamilton, A.J. and Grierson, D. (1996)
Differential expression of the 1-aminocyclopropane-1-carboxylate oxidase gene
family of tomato. The Plant Journal 9, 525–535.
Baydoun, E. and Fry, S. (1985) The immobility of pectic substances in injured tomato
leaves and its bearing on the identity of the wound hormone. Planta 165,
269–276.
Bell, E. and Mullet, J.E. (1993) Characterization of an Arabidopsis lipoxygenase gene
responsive to methyl jasmonate and wounding. Plant Physiology 103, 1133–1137.
Bell, E., Creelman, R.A. and Mullet, J.E. (1995) A chloroplast lipoxygenase is required for
wound-induced jasmonic acid accumulation in Arabidopsis. Proceedings of the
National Academy of Sciences USA 92, 8675–8679.
Bell-Lelong, D.A., Cusumano, J.C., Meyer, K. and Chapple, C. (1997) Cinnamate-4-
hydroxylase expression in Arabidopsis: regulation in response to development and
the environment. Plant Physiology 113, 729–738.
Bergey, D., Howe, G.A. and Ryan, C.A. (1996) Polypeptide signaling for plant defensive
genes exhibits analogies to defense signaling in animals. Proceedings of the National
Bishop, P., Pearce, G., Bryant, J. and Ryan, C. (1984) Isolation and characterization of
the proteinase inhibitor-inducing factor from tomato leaves: identity and activity of
poly- and oligogalacturonide fragments. Journal of Biological Chemistry 259,
13172–13177.
Bishop, P.D., Makus, D.J., Pearce, G. and Ryan, C.A. (1981) Proteinase inhibitor-
inducing factor activity in tomato leaves resides in oligosaccharides enzymatically
released from cell walls. Proceedings of the National Academy of Sciences USA 78,
3536–3540.
Blechert, S., Brodschelm, W., Holder, S., Kammerer, L., Kutchan, T.M., Mueller, M.J., Xia,
Z.Q. and Zenk, M.H. (1995) The octadecanoic pathway: signal molecules for the
regulation of secondary pathways. Proceedings of the National Academy of Sciences
USA 92, 4099–4105.
Blée, E. and Joyard, J. (1996) Envelope membranes from spinach chloroplasts are a site
of metabolism of fatty acid hydroperoxides. Plant Physiology 110, 445–454.
Bögre, L., Ligterink, W., Meskiene, I., Barker, P.J., Heberle-Bors, E., Huskinsson, N.S. and
Hirt, H. (1997) Wounding induces the rapid and transient activation of a specific
MAP kinase pathway. Plant Cell 9, 75–83.
Bohland, C., Balkenhohl, T., Loers, G., Feussner, I. and Grambow, H.J. (1997) Differential
induction of lipoxygenase isoforms in wheat upon treatment with rust fungus
elicitor, chitin oligosaccharides, chitosan and methyl jasmonate. Plant Physiology
114, 679–685.
Bohlmann, H. and Apel, K. (1991) Thionins. Annual Review of Plant Physiology and Plant
Bolter, C.J. (1993) Methyl jasmonate induced papain inhibitor(s) in tomato leaves. Plant
Physiology 103, 1347–1353.
Botella, M.A., Xu, Y., Prabha, T.N., Zhao, Y., Narasimhan, M.L., Wilson, K., Nielsen, S.S.,
Bressan, R.A. and Hasegawa, P.M. (1996) Differential expression of soybean
cysteine proteinase inhibitor genes during development and in response to
wounding and methyl jasmonate. Plant Physiology 112, 1201–1210.
Bradley, D.J., Kjellbom, P. and Lamb, C.J. (1992) Elicitor and wound-induced oxidative
cross-linking of a proline-rich plant cell wall protein: a novel, rapid defense response.
Cell 70, 21–30.
Brignolas, F., Lacroix, B., Lieutier, F., Sauvard, D., Drouet, A., Claudot, A.-C., Yart, A.,
Berryman, A.A. and Christiansen, E. (1995) Induced responses in phenolic
metabolism in two Norway spruce clones after wounding and inoculations with
Ophiostoma poonicum, a bark beetle-associated fungus. Plant Physiology 109,
821–827.
Brisson, L.F., Tenhaken, R. and Lamb, C. (1994) Function of oxidative cross-linking of
cell wall structural proteins in plant disease resistance. Plant Cell 6, 1703–1712.
Broglie, K., Chet, I., Holliday, M., Cressman, R., Biddle, P., Knowlton, S., Mauvais, C.J. and
Broglie, R. (1991) Transgenic plants with enhanced resistance to the fungal
pathogen Rhizoctonia solani. Science 254, 1194–1197.
Brown, W.E. and Ryan, C.A. (1984) Isolation and characterization of a wound-inducible
trypsin inhibitor from alfalfa leaves. Biochemistry 23, 3418–3422.
Burnett, R.J., Maldonado-Mendoza, I.E., McKnight, T.D. and Nessler, C.L. (1993)
Expression of a 3-hydroxy-3-methylglutaryl coenzyme A reductase gene from
Camptotheca acuminata is differentially regulated by wounding and methyl
jasmonate. Plant Physiology 103, 41–48.
Callahan, A.M., Morgens, P.H., Wright, P. and Nichols, K.E. (1992) Comparison of
Pch313 (pTOM13 Homolog) RNA accumulation during fruit softening and
wounding of two phenotypically different peach cultivars. Plant Physiology 100,
482–488.
Cardemil, L. and Riquelme, A. (1991) Expression of cell wall proteins in seeds and
during early seedling growth of Araucaria araucana is a response to wound stress and
is developmentally regulated. Journal of Experimental Botany 42, 415–421.
Carollo, V.L. and Adams, D.O. (1996) The malic enzyme promoter directs wound-induced
GUS expression in transgenic tobacco. Plant Physiology 111 (suppl.), 130 (abstr.).
Casalongué, C. and Pont-Lezica, R. (1985) Potato lectin: a cell-wall glycoprotein. Plant
Cell Physiology 26, 1533–1539.
Chang, Y.-P. and Jacobs, W.P. (1973) The regulation of abscission and IAA by senescence
factor and abscisic acid. American Journal of Botany 60, 10–16.
Chaudhry, B., Muller-Uri, F., Cameron-Mills, V., Gough, S., Simpson, D., Skriver, K. and
Mundy, J. (1994) The barley 60 kDa jasmonate-induced protein (JIP60) is a novel
ribosome-inactivating protein. The Plant Journal 6, 815–824.
Choi, D., Ward, B.L. and Bostock, R.M. (1992) Differential induction and suppression of
potato 3-hydroxy-3-methylglutaryl coenzyme A reductase genes in response to
Phytophthora infestans and to its elicitor arachidonic acid. Plant Cell 4, 1333–1344.
Choi, D., Bostock, R.M., Avdiushko, S. and Hildebrand, D.F. (1994) Lipid-derived signals
that discriminate wound- and pathogen-responsive isoprenoid pathways in plants:
methyl jasmonate and the fungal elicitor arachidonic acid induce different
3-hydroxy-3-methylglutaryl-coenzyme A reductase genes and antimicrobial
isoprenoids in Solanum tuberosum L. Proceedings of the National Academy of Sciences
USA 91, 2329–2333.
Clarke, A.E., Anderson, R.L. and Stone, B.A. (1979) Form and function of arabino-
galactans and arabanogalactan-proteins. Phytochemistry 18, 521–540.
Clarke, H.R.G., Davis, J.M., Wilbert, S.M., Bradshaw, J., Harvey D. and Gordon, M.P.
(1994) Wound-induced and developmental activation of a poplar tree chitinase
gene promoter in transgenic tobacco. Plant Molecular Biology 25, 799–815.
Coleman, C.D., Englert, J.M., Chen, T.H.H. and Fuchigami, L.H. (1993) Physiological and
environmental requirements for poplar (Populus deltoides) bark storage protein
degradation. Plant Physiology 102, 53–59.
Conconi, A., Miquel, M., Browse, J.A. and Ryan, C.A. (1996) Intracellular levels of free
linolenic and linoleic acids increase in tomato leaves in response to wounding. Plant
Condit, C.M. and Meagher, R.B. (1987) Expression of a gene encoding a glycine-rich
protein in petunia. Molecular and Cellular Biology 7, 4273–4279.
Constabel, C.P., Bergey, D.R. and Ryan, C.A. (1995) Systemin activates synthesis of
wound-inducible tomato leaf polyphenol oxidase via the octadecanoid defense
signaling pathway. Proceedings of the National Academy of Sciences USA 92,
407–411.
Corbin, D.R., Sauer, N. and Lamb, C.J. (1987) Differential regulation of a hydroxyproline-
rich glycoprotein gene family in wounded and infected plants. Molecular and Cellular
Biology 7, 4337–4344.
Cordero, M.J., Dora, R. and San Segundo, B. (1994) Expression of a maize proteinase
inhibitor gene is induced in response to wounding and fungal infection: systemic
wound-response of a monocot gene. The Plant Journal 6, 141–150.
Crane, K.E. and Ross, C.W. (1986) Effects of wounding on cytokinin activity in
cucumber cotyledons. Plant Physiology 82, 1151–1152.
Creelman, R., Tierney, M.L. and Mullet, J.E. (1992) Jasmonic acid/methyl jasmonate
accumulate in wounded soybean hypocotyls and modulate wound gene expression.
Criqui, M.C., Durr, A., Parmentier, Y., Marbach, J., Fleck, J. and Jamet, E. (1992) How are
photosynthetic genes repressed in freshly-isolated mesophyll protoplasts of Nicotiana
sylvestris? Plant Physiology and Biochemistry 30, 597–601.
Curtis, M.D., Rae, A.L., Rusu, A.G., Harrison, S.J. and Manners, J.M. (1997) A peroxidase
gene promoter induced by phytopathogens and methyl jasmonate in transgenic
plants. Molecular Plant–Microbe Interactions 10, 326–338.
Dammann, C., Rojo, E. and Sanchez-Serrano, J.J. (1997) Abscisic acid and jasmonic acid
activate wound-inducible genes in potato through separate, organ-specific signal
transduction pathways. The Plant Journal 11, 773–782.
Danielle, T. (1992) Regulation of expression of the glutamine synthase GLN-a gene of
Phaseolus vulgaris L. PhD, University of Warwick, UK.
Davis, J.M., Egelkrout, E.E., Coleman, G.D., Chen, T.H.H., Haissig, B.E., Reimenschneider,
D.E. and Gordon, M.P. (1993) A family of wound-induced genes in Populus shares
common features with genes encoding vegetative storage proteins. Plant Molecular
Biology 23, 135–143.
DeWald, D.B., Sadka, A. and Mullet, J.E. (1994) Sucrose modulation of soybean Vsp gene
expression is inhibited by auxin. Plant Physiology 104, 439–444.
Diallinas, G. and Kanellis, A.K. (1994) A phenylalanine ammonia-lyase gene from melon
fruit: cDNA cloning, sequence and expression in response to development and
wounding. Plant Molecular Biology 26, 473–479.
Diehn, S.H., Burkhart, W. and Graham, J.S. (1993) Purification and partial amino acid
sequence of a wound-inducible, developmentally regulated anionic peroxidase from
soybean leaves. Biochemical and Biophysical Research Communications 195, 928–934.
Doares, S.H., Narváez-Vásquez, J., Conconi, A. and Ryan, C.A. (1995) Salicylic acid
inhibits synthesis of proteinase inhibitors in tomato leaves induced by systemin and
jasmonic acid. Plant Physiology 108, 1741–1746.
Doherty, H.M., Selvendran, R.R. and Bowles, D.J. (1988) The wound response of tomato
plants can be inhibited by aspirin and related hydroxy-benzoic acids. Physiological
and Molecular Plant Pathology 33, 377–384.
Dunlap, J.R. and Robacker, K.M. (1990) Abscisic acid alters the metabolism of indole-
3-acetic acid in senescing flowers of Cucumis melo L. Plant Physiology 94,
870–874.
Dyer, W.E., Henstrand, J.M., Handa, A.K. and Herrmann, K.M. (1989) Wounding
induces the first enzyme of the shikimate pathway in Solanaceae. Proceedings of the
National Academy of Sciences USA 86, 7370–7373.
Ebener, W., Fowler, T.J., Suzuki, H., Shaver, J. and Tierney, M.L. (1993) Expression of
DcPRP1 is linked to carrot storage root formation and is induced by wounding and
auxin treatment. Plant Physiology 101, 259–265.
Ellard-Ivey, M. and Douglas, C.J. (1996) Role of jasmonates in the elicitor- and wound-
inducible expression of defense genes in parsley and transgenic tobacco. Plant
Farmer, E.E. and Ryan, C.A. (1990) Interplant communication: airborne methyl
jasmonate induces synthesis of proteinase inhibitors in plant leaves. Proceedings of
the National Academy of Sciences USA 87, 7713–7716.
Farmer, E.E. and Ryan, C.A. (1992) Octadecanoid precursors of jasmonic acid activate
the synthesis of wound-inducible proteinase inhibitors. Plant Cell 4, 129–134.
Farmer, E.E., Pearce, G. and Ryan, C.A. (1989) In vitro phosphorylation of plant plasma
membrane proteins in response to the proteinase inhibitor inducing factor.
Farmer, E.E., Johnson, R.R. and Ryan, C.A. (1992) Regulation of expression of proteinase
inhibitor genes by methyl jasmonate and jasmonic acid. Plant Physiology 98,
995–1002.
Farmer, E.E., Caldelari, D., Pearce, G., Walker-Simmons, M.K. and Ryan, C.A. (1994)
Diethyldithiocarbamic acid inhibits the octadecanoid signaling pathway for the
wound induction of proteinase inhibitors in tomato leaves. Plant Physiology 106,
337–342.
Felix, G., Regenass, M. and Boller, T. (1993) Specific perception of subnanomolar
concentrations of chitin fragments by tomato cells: induction of extracellular
alkalinization, changes in protein phosphorylation and establishment of a
refractory state. The Plant Journal 4, 307–316.
Feys, B.J.F., Benedetti, C.E., Penfold, C.N. and Turner, J.G. (1994) Arabidopsis mutants
selected for resistance to the phytotoxin, coronatine, are male sterile, insensitive to
methyl jasmonate, and resistant to a bacterial pathogen. Plant Cell 6, 751–759.
Fincher, G.B., Stone, B.A. and Clarke, A.E. (1983) Arabinogalactan-proteins: structure,
biosynthesis, and function. Annual Review of Plant Physiology 34, 21–45.
Franceschi, V.R. and Grimes, H.D. (1991) Induction of soybean vegetative storage
proteins and anthocyanins by low-level atmospheric methyl jasmonate. Proceedings
Frank, M.R., Deyneka, J.M. and Schuler, M.A. (1996) Cloning of wound-induced
cytochrome P450 monooxygenases expressed in pea. Plant Physiology 110,
1035–1046.
Glass, A.D.M. and Dunlop, J. (1974) Influence of phenolic acids on ion uptake: IV.
Depolarization of membrane potentials. Plant Physiology 54, 855–858.
Green, T. and Ryan, C. (1972) Wound-induced proteinase inhibitor in plant leaves: a
possible defense mechanism against insects. Science 175, 776–777.
Grimes, H.D., Koetje, D.S. and Franceschi, V.R. (1992) Expression, activity, and cellular
accumulation of methyl jasmonate-responsive lipoxygenase in soybean seedlings.
Grosset, J., Marty, I., Chartier, Y. and Meyer, Y. (1990) mRNAs newly synthesized by
tobacco mesophyll protoplasts are wound-inducible. Plant Molecular Biology 15,
485–496.
Gu, Y.-Q., Chao, W.S. and Walling, L.L. (1996) Localization and post-translational
processing of the wound-induced leucine aminopeptidase proteins of tomato. Journal
of Biological Chemistry 271, 25880–25887.
Guevara-García, A., Mosqueda-Cano, G., Argüello-Astorga, G., Simpson, J. and Herrera-
Estrella, L. (1993) Tissue-specific and wound-inducible pattern of expression of the
mannopine synthase promoter is determined by the interaction between positive
and negative cis-regulatory elements. The Plant Journal 4, 495–505.
Gurevich, A.I., Tuzova, T.P., Shpak, E.D., Starkova, N.N., Esipov, R.S. and Miroshnikov,
A.I. (1996) Mechanism of action of the plant hormone jasmonate. I. Jasmonate-
interacting proteins that regulate transcription of the pinII potato gene.
Bioorganicheskaya Khimiya 22, 101–107.
Hansen, E., Harper, G., McPherson, M.J. and Atkinson, H.J. (1996) Differential
expression patterns of the wound-inducible transgene wun1-uidA in potato roots
following infection with either cyst or root knot nematodes. Physiological Molecular
Plant Pathology 48, 161–170.
Hansen, J.D. and Hannapel, D.J. (1992) A wound-inducible potato proteinase inhibitor
gene expressed in non-tuber-bearing species is not sucrose inducible. Plant
Harms, K., Atzorn, R., Brash, A., Kuhn, H., Wasternack, C., Willmitzer, L. and Peña-
Cortés, H. (1995) Expression of a flax allene oxide synthase cDNA leads to
increased endogenous jasmonic acid (JA) levels in transgenic potato plants but
not to a corresponding activation of JA-responding genes. Plant Cell 7,
1645–1654.
Herde, O., Fuss, H., Peña-Cortés, H. and Fisahn, J. (1995) Proteinase inhibitor II gene
expression induced by electrical stimulation and control of photosynthetic activity
in tomato plants. Plant Cell Physiology 36, 737–742.
Hildmann, T., Ebneth, M., Peña-Cortés, H., Sánchez-Serrano, J.J., Willmitzer, L. and Prat,
S. (1992) General roles of abscisic and jasmonic acids in gene activation as a result
of mechanical wounding. Plant Cell 4, 1157–1170.
Holdsworth, M.J., Schuch, W. and Grierson, D. (1988) Organization and expression of a
wound/ripening-related small multigene family from tomato. Plant Molecular
Biology 11, 81–88.
Howe, G.A., Lightner, J., Browse, J. and Ryan, C.A. (1996) An octadecanoid pathway
mutant (JL5) of tomato is compromized in signaling for defense against insect
attack. Plant Cell 8, 2067–2077.
Ishikawa, A., Yoshihara, T. and Nakamura, K. (1994) Jasmonate-inducible expression
of a potato cathepsin D inhibitor-GUS gene fusion in tobacco cells. Plant Molecular
Biology 26, 403–414.
Ishimoto, M. and Crispeels, M.J. (1996) Protective mechanism of the Mexican Bean
Weevil against high levels of α-amylase inhibitor in the common bean. Plant
Jacobsen, S.E. and Olszewski, N.E. (1996) Gibberellins regulate the abundance of RNAs
with sequence similarity to proteinase inhibitors, dioxygenases and dehydrogenases.
Planta 198, 78–86.
Johnson, R. and Ryan, C.A. (1990) Wound-inducible potato inhibitor II genes:
enhancement of expression by sucrose. Plant Molecular Biology 14, 527–536.
Jouanneau, J.-P., Lapous, D. and Guern, J. (1991) In plant protoplasts, the spontaneous
expression of defense reactions and the responsiveness to exogenous elicitors are
under auxin control. Plant Physiology 96, 459–466.
Kaufman, P.B., Ghosheh, N.S., LaCroix, J.D., Soni, S.L. and Ikuma, H. (1973) Regulation
of invertase levels in Avena stem segments by gibberellic acid, sucrose, glucose and
fructose. Plant Physiology 55, 221–228.
Keith, B., Dong, X., Ausubel, F.M. and Fink, G.R. (1991) Differential induction of 3-
deoxy-D-arabino-heptulosonate-7-phosphate synthase genes in Arabidopsis thaliana
by wounding and pathogenic attack. Proceedings of the National Academy of Sciences
USA 88, 8821–8825.
Keller, B., Sauer, N. and Lamb, C.J. (1988) Glycine-rich cell wall proteins in bean: gene
structure and association of the protein with the vascular system. The EMBO Journal
7, 3625–3633.
Kende, H. (1989) Enzymes of ethylene biosynthesis. Plant Physiology 91, 1–4.
Kernan, A. and Thornburg, R.W. (1989) Auxin levels regulate the expression of a
wound-inducible proteinase inhibitor II–chloramphenicol acetyl transferase gene
fusion in vitro and in vivo. Plant Physiology 91, 73–78.
Kim, C.-S., Kwak, J.-M., Nam, H.-G., Kim, K.-C. and Cho, B.-H. (1994) Isolation and
characterization of two cDNA clones that are rapidly induced during the wound
response of Arabidopsis thaliana. Plant Cell Reports 13, 340–343.
Kim, W.T. and Yang, S.F. (1994) Structure and expression of cDNAs encoding 1-
aminocyclopropane-1-carboxylate oxidase homologs isolated from excized mung
bean hypocotyls. Planta 194, 223–229.
Kleis-San Francisco, S.M. and Tierney, M.L. (1990) Isolation and characterization of a
proline-rich cell wall protein from soybean seedlings. Plant Physiology 94, 1897–1902.
Knight, M.R., Campbell, A.K., Smith, M.S. and Trewavas, A.J. (1991) Transgenic plant
aequorin reports the effects of touch and cold-shock and elicitors on cytoplasmic
calcium. Nature 352, 524–526.
Koda, Y. and Kikuta, Y. (1994) Wound-induced accumulation of jasmonic acid in tissues
of potato tubers. Plant and Cell Physiology 35, 751–756.
Koda, Y., Kuta, Y., Kitahara, T., Nishi, T. and Mori, K. (1992) Comparisons of various
biological activities of stereoisomers of methyl jasmonate. Phytochemistry 31,
1111–1114.
Koda, Y., Ward, J.L. and Beale, M.H. (1995) Biological activity of methyl 7-methyl-
jasmonates. Phytochemistry 38, 821–823.
Kolattukudy, P.E. (1980) Cutin, suberin, and waxes. In: Stumpf, P.K. and Conn, E.E. (eds)
The Biochemistry of Plants. Academic Press, New York, pp. 571–644.
Krumm, T., Bandemer, K. and Boland, W. (1995) Induction of volatile biosynthesis in
the lima bean (Phaseolus lunatus) by leucine- and isoleucine conjugates of 1-oxo-
and 1-hydroxyindan-4-carboxylic acid: evidence for amino acid conjugates of
jasmonic acid as intermediates in the octadecanoid signaling pathway. FEBS Letters
377, 523–529.
Lachman, P.J. (1986) A common form of killing. Nature (London) 321, 560.
Laudert, D., Pfannschmidt, U., Lottspeich, F., Hollander-Czytko, H. and Weiler, E.W.
(1996) Cloning, molecular and functional characterization of Arabidopsis thaliana
allene oxide synthase (CYP 74), the first enzyme of the octadecanoid pathway to
jasmonates. Plant Molecular Biology 31, 323–335.
Lawton, M.A. and Lamb, C.J. (1987) Transcriptional activation of plant defense genes
by fungal elicitor, wounding and infection. Molecular Cell Biology 7, 335–341.
Lawton, S., Dixon, R., Hahlbrock, H. and Lamb, C. (1983) Elicitor induction of mRNA
activity: rapid effects of elicitor on phenylalanine ammonia-lyase and chalcone
synthase mRNA activities in bean cells. Journal of Biochemistry 130, 131–139.
Lee, D. and Douglas, C.J. (1996) Two divergent members of a tobacco 4-coumarate:
coenzyme A ligase (4CL) gene family. Plant Physiology 112, 193–205.
Lee, J., Prathier, B. and Löbler, M. (1996) Jasmonate signaling can be uncoupled from
abscisic acid signaling in barley: identification of jasmonate-regulated transcripts
which are not induced by abscisic acid. Planta 199, 625–632.
Leopold, J., Hause, B., Lehmann, J., Graner, A., Parthier, B. and Wasternack, C. (1996)
Isolation, characterization and expression of a cDNA coding for a jasmonate-
inducible protein of 37 kDa in barley leaves. Plant Cell and Environment 19,
675–684.
Levine, A., Tenhaken, R., Dixon, R. and Lamb, C. (1994) H 2O 2 from the oxidative
burst orchestrates the plant hypersensitive disease resistance response. Cell 79,
583–593.
Lewinsohn, E., Gijzen, M. and Croteau, R. (1992) Wound-inducible pinene cyclase from
grand fir: purification, characterization and renaturation after SDS-PAGE. Archives
of Biochemistry and Biophysics 293, 167–173.
Lightner, J., Pearce, G., Ryan, C.A. and Browse, J. (1993) Isolation of signaling mutants
of tomato (Lycopersicon esculentum). Molecular and General Genetics 241, 595–601.
Lincoln, J.E., Campbell, A.D., Oetiker, J., Rottmann, W.H., Oeller, P.W., Shen, N.F. and
Theologis, A. (1993) LE-ACS4, a fruit ripening and wound-induced 1-aminocyclo-
propane-1-carboxylate synthase gene of tomato (Lycopersicon esculentum):
expression in Escherichia coli, structural characterization, expression characteristics,
and phylogenetic analysis. Journal of Biological Chemistry 268, 19422–19430.
Linthorst, H.J.M., van der Does, C., Brederode, F.T. and Bol, J.F. (1993) Circadian
expression and induction by wounding of tobacco genes for cysteine proteinase.
Liu, D., Li, N., Dube, S., Kalinski, A., Herman, E. and Mattoo, A.K. (1993) Molecular
characterization of a rapidly and transiently wound-induced soybean (Glycine max
L.) gene encoding 1-aminocyclopropane-1-carboxylate synthase. Plant Cell
Liu, T.-H.A., Hannapel, D.J. and Stephens, L.C. (1997) Induction of cathepsin D inhibitor
gene expression in response to methyl jasmonate. Journal of Plant Physiology 150,
279–282.
Logemann, J. and Schell, J. (1989) Nucleotide sequence and regulated expression of
a wound-inducible potato gene (wun1). Molecular and General Genetics 219,
81–88.
Lurin, C., Geelen, D., Barbier-Brygoo, H., Guern, J. and Maurel, C. (1996) Cloning and
functional expression of a plant voltage-dependent chloride channel. Plant Cell 8,
701–711.
Maathuis, F.J. and Sanders, D. (1995) Contrasting roles in ion transport of two K(+)-
channel types in root cells of Arabidopsis thaliana. Planta 197, 456–464.
Maldonado-Mendoza, I.F., Burnett, R.J., López-Meyer, M. and Nessler, C.L. (1994)
Regulation of 3-hydroxy-3-methylglutaryl-coenzyme A reductase by wounding and
methyl jasmonate. Plant Cell, Tissue and Organ Culture 38, 351–356.
Mason, H.S. and Mullet, J.E. (1990) Expression of two soybean vegetative storage protein
genes during development and in response to water deficit, wounding, and jasmonic
acid. Plant Cell 2, 569–579.
Mason, H.S., DeWald, D.B., Creelman, R.A. and Mullet, J.E. (1992) Coregulation of
soybean vegetative storage protein gene expression by methyl jasmonate and
soluble sugars. Plant Physiology 98, 859–867.
Mauch, F., Mauch-Mani, B. and Boller, T. (1988) Antifungal hydrolases in pea tissue: II.
Inhibition of fungal growth by combinations of chitinase and β-1,3-glucanase. Plant
McGurl, B. and Ryan, C.A. (1992) The organization of the prosystemin gene. Plant
McGurl, B., Pearce, G., Orozco-Cardenas, M. and Ryan, C.A. (1992) Structure,
expression and antisense inhibition of the systemin precursor gene. Science 255,
1570–1573.
McGurl, B., Orozco-Cardenas, M., Pearce, G. and Ryan, C.A. (1994) Overexpression of
the prosystemin gene in transgenic tomato plants generates a systemic signal that
constitutively induces proteinase inhibitor synthesis. Proceedings of the National
Medina, J., Hueros, G. and Carbonero, P. (1993) Cloning of cDNA, expression, and
chromosomal location of genes encoding the three types of subunits of the barley
tetrameric inhibitor of insect alpha-amylase. Plant Molecular Biology 23, 532–542.
Mehdy, M.C. (1994) Active oxygen species in plant defense against pathogens. Plant
Mehta, R.A., Warmbardt, R.D. and Mattoo, A.K. (1996) Tomato (Lycopersicon
esculentum cv. Pik-Red) leaf carboxypeptidase: identification, N-terminal sequence,
stress-regulation and specific localization in the paraveinal mesophyll vacuoles.
Plant Cell Physiology 37, 806–815.
Melan, M.A., Dong, X., Endara, M.E., Davis, K.R., Ausubel, F.M. and Peterman, T.K.
(1993) An Arabidopsis thaliana lipoxygenase gene can be induced by pathogens,
abscisic acid, and methyl jasmonate. Plant Physiology 101, 441–450.
Meyer, B., Houlné, G., Pozueta-Romero, J., Schantz, M.-L. and Schantz, R. (1996) Fruit-
specific expression of a defensin-type gene family in bell pepper. Plant Physiology
112, 615–622.
Miksch, M. and Boland, W. (1996) Airborne methyl jasmonate stimulates the
biosynthesis of furanocoumarins in the leaves of celery plants (Apium graveolens).
Experientia 52, 739–743.
Mirjalili, N. and Linden, J.C. (1996) Methyl jasmonate induced production of taxol in
suspension cultures of Taxus cuspidata: ethylene interaction and induction models.
Biotechnology Progress 12, 110–118.
Mohan, R., Peruman, V. and Kolattukudy, P.E. (1993) Developmental and tissue-specific
expression of a tomato anionic peroxidase gene by a minimal promoter, with wound
and pathogen induction by an additional 5′-flanking region. Plant Molecular Biology
22, 475–490.
Morelli, J.K., Shewmaker, C.K. and Vayda, M.E. (1994) Biphasic stimulation of
translational activity correlates with induction of translation elongation factor 1
subunit a upon wounding in potato tubers. Plant Physiology 106, 897–903.
Muday, G.K. and Herrmann, K.M. (1992) Wounding induces one of two isoenzymes of
3-deoxy-D-arabino-heptulosonate 7-phosphate synthase in Solanum tuberosum.
Narvaez-Vasquez, J., Orozco-Cardenas, M.L. and Ryan, C.A. (1994) Sulfhydryl reagent
modulates systemic signaling for wound-induced and systemin-induced proteinase
inhibitor synthesis. Plant Physiology 105, 725–730.
Nojiri, H., Sugimori, M., Yamane, H., Nishimura, Y., Yamada, A., Shibuya, N., Kodama,
O., Murofushi, N. and Toshio, O. (1996) Involvement of jasmonic acid in elicitor-
induced phytoalexin production in suspension-cultured rice cells. Plant Physiology
110, 387–392.
O’Donnell, P.J., Calvert, C., Atzorn, R., Wasternack, C., Leyser, H.M.O. and Bowles, D.J.
(1996) Ethylene as a signal mediating the wound response of tomato plants. Science
274, 1914–1917.
Oh, S., Kwak, J.M., Kwun, I.C. and Gil, N.H. (1996) Rapid and transient induction of
calmodulin-encoding gene(s) of Brassica napus by a touch stimulus. Plant Cell
Reports 15, 586–590.
Ohto, M., Nakamura-Kito, K. and Nakamura, K. (1992) Induction of expression of genes
coding for sporamin and beta-amylase by polygalacturonic acid in leaf-petiole
cuttings of sweet potato. Plant Physiology 99, 422–427.
Palmer, D.A. and Bender, C.L. (1995) Ultrastructure of tomato leaf tissue treated with
the pseudomonad phytotoxin coronatine and comparison with methyl jasmonate.
Molecular Plant–Microbe Interactions 8, 683–692.
Parmentier, Y., Durr, A., Marbach, J., Hirsinger, C., Criqui, M.-C., Fleck, J. and Jamet, E.
(1995) A novel wound-inducible extensin is expressed early in newly isolated
protoplasts of Nicotiana sylvestris. Plant Molecular Biology 29, 279–292.
Parsons, B.L. and Mattoo, A.K. (1991) Wound-induced accumulation of specific
transcripts in tomato fruit: interactions with fruit development, ethylene and light.
Pearce, G., Johnson, S. and Ryan, C.A. (1993) Structure-activity of deleted and
substituted systemin, an 18-amino acid polypeptide inducer of plant defensive
genes. Journal of Biological Chemistry 268, 212–216.
Pearce, G., Strydon, D., Johnson, S. and Ryan, C.A. (1991) A polypeptide from tomato
leaves induces wound-inducible proteinase inhibitor proteins. Science 253, 895–898.
Peña-Cortés, H., Sánchez-Serrano, J.J., Mertens, R., Willmitzer, L. and Prat, S. (1989)
Abscisic acid is involved in the wound-induced expression of the proteinase inhibitor
II gene in potato and tomato. Proceedings of the National Academy of Sciences USA 86,
9851–9855.
Peña-Cortés, H., Willmitzer, L. and Sánchez-Serrano, J.J. (1991) Abscisic acid mediates
wound induction but not developmental-specific expression of the proteinase
inhibitor II gene family. Plant Cell 3, 963–972.
Peña-Cortés, H., Liu, X.J., Sánchez-Serrano, J.J., Schmid, R. and Willmitzer, L. (1992)
Factors affecting gene expression of patatin and proteinase-inhibitor-II gene
families in detached potato leaves: implications for their co-expression in
developing tubers. Planta 186, 495–502.
Peña-Cortés, H., Albrecht, T., Prat, S., Weiler, E. and Willmitzer, L. (1993) Aspirin
prevents wound-induced gene expression in tomato leaves by blocking jasmonic
acid biosynthesis. Planta 191, 123–128.
Peña-Cortés, H., Fisahn, J. and Willmitzer, L. (1995) Signals involved in wound-inducible
proteinase inhibitor II gene expression in tomato and potato plants. Proceedings of
the National Academy of Sciences USA 92, 4106–4113.
Perez, A.G., Sanz, C., Richardson, D.G. and Olias, J.M. (1993) Methyl jasmonate vapor
promotes beta-carotene synthesis and chlorophyll degradation in golden delicious
apple peel. Journal of Plant Growth Regulation 12, 163–167.
Pilet, P.E. and Rebeaud, J.E. (1983) Effect of abscisic acid on growth and indoyl-3-acetic
acid levels in maize roots. Plant Science Letters 31, 117–122.
Pozueta-Romero, J., Klein, M., Houlné, G., Schantz, M.-L., Meyer, B. and Schantz, R.
(1995) Characterization of a family of genes encoding a fruit-specific wound-
stimulated protein of bell pepper (Capsicum annuum): identification of a new family
of transposable elements. Plant Molecular Biology 28, 1011–1025.
Ramputh, A.-I. and Brown, A.W. (1996) Rapid γ-aminobutyric acid synthesis and the
inhibition of the growth and development of oblique-banded leaf-roller larvae. Plant
Physiology 111, 1349–1352.
Reinbothe, S., Reinbothe, C., Heintzen, C., Seidenbecher, C. and Parthier, B. (1993a) A
methyl jasmonate-induced shift in the length of the 5′ untranslated region impairs
translation of the plastid rbcL transcript in barley. The EMBO Journal 12,
1505–1512.
Reinbothe, S., Reinbothe, C. and Parthier, B. (1993b) Methyl jasmonate represses
translation initiation of a specific set of mRNAs in barley. The Plant Journal 4,
459–467.
Reinbothe, S., Reinbothe, C. and Parthier, B. (1993c) Methyl jasmonate-regulated
translation of nuclear-encoded chloroplast proteins in barley (Hordeum vulgare L. cv.
Salome). Journal of Biological Chemistry 268, 10606–10611.
Reinbothe, S., Mollenhauer, B. and Reinbothe, C. (1994a) JIPs and RIPs: the regulation
of plant gene expression by jasmonates in response to environmental cues and
pathogens. Plant Cell 6, 1197–1209.
Reinbothe, S., Reinbothe, C., Lehmann, J., Becker, W., Apel, K. and Parthier, B. (1994b)
JIP60, a methyl jasmonate-induced ribosome-inactivating protein involved in plant
stress reactions. Proceedings of the National Academy of Sciences USA 91, 7012–7016.
Reuber, T.L. and Ausubel, F.M. (1996) Isolation of Arabidopsis genes that differentiate
between resistance responses mediated by the RPS2 and RPM1 disease resistance
genes. Plant Cell 8, 241–249.
Rhodes, J.D., Thain, J.F. and Wildon, D.C. (1996) The pathway for systemic electrical
signal conduction in the wounded tomato plant. Planta 200, 50–57.
Ritter, C. and Dangl, J.L. (1996) Interference between two specific pathogen recognition
events mediated by distinct plant disease resistance genes. Plant Cell 8, 251–257.
Roby, D., Toppan, A. and Esquerré-Tugayé, M.T. (1987) Cell surfaces in plant micro-
organism interactions. VIII. Increased proteinase inhibitor activity in melon plants
in response to infection by Colletotrichum lagenarium or treatment with an elicitor
fraction from this fungus. Physiological and Molecular Plant Pathology 30, 453–460.
Rohrmeier, T. and Lehle, L. (1993) WIP1, a wound-inducible gene from maize with
homology to Bowman-Birk proteinase inhibitors. Plant Molecular Biology 22,
783–792.
Röse, U.S.R., Manukian, A., Heath, R.R. and Tumlinson, J.H. (1996) Volatile semio-
chemicals released from undamaged cotton leaves. Plant Physiology 111, 487–495.
Royo, J., Vancanneyt, G., Pérez, A.G., Sanz, C., Störmann, K., Rosahl, S. and Sánchez-
Serrano, J.J. (1996) Characterization of three potato lipoxygenases with distinct
enzymatic activities and different organ-specific and wound-regulated expression
patterns. Journal of Biological Chemistry 271, 21012–21029.
Ryan, C.A. (1981a) Plant proteinases. In: Stumpf, P.K. and Conn, E.E. (eds) The
Biochemistry of Plants: a Comprehensive Treatise, Vol. 6. Academic Press, New York,
pp. 351–370.
Ryan, C.A. (1981b) Proteinase inhibitors. In: Stumpf, P.K. and Conn, E.E. (eds) The
Biochemistry of Plants: a Comprehensive Treatise, Vol. 6. Academic Press, New York,
pp. 351–370.
Ryu, S.B. and Wang, X. (1996) Activation of phospholipase D and the possible
mechanism of activation in wound-induced lipid hydrolysis in castor bean leaves.
Biochemica et Biophysica Acta 1303, 243–250.
Saarikoski, P., Clapham, D. and von Arnold, S. (1996) A wound-inducible gene from
Salix viminalis coding for a trypsin inhibitor. Plant Molecular Biology 31, 465–478.
Sabri, N., Pelissier, B. and Teissie, J. (1996) Electropermeabilization of intact maize cells
induces an oxidative stress. European Journal of Biochemistry 238, 737–743.
Sadka, A., DeWald, D.B., May, G.D., Park, W.D. and Mullet, J.E. (1994) Phosphate
modulates transcription of soybean VspB and other sugar-inducible genes. Plant Cell
6, 737–749.
Sanchez-Serrano, J.J., Amati, S., Ebneth, M., Hildmann, T., Mertens, R., Peña-Cortés, H.,
Prat, S. and Willmitzer, L. (1991) The involvement of ABA in wound responses of
plants. In: Davies, W.J. and Hones, H.G. (eds) Abscisic Acid Physiology and
Biochemistry. Bios Scientific, Oxford, UK, pp. 201–216.
Sano, H. and Ohashi, Y. (1995) Involvement of small GTP-binding proteins in defense
signal-transduction pathways of higher plants. Proceedings of the National Academy
of Sciences USA 92, 4138–4144.
Sano, H., Seo, S., Orudgev, E., Youssefain, S., Ishizuka, K. and Ohashi, Y. (1994)
Expression of the gene for a small GTP-binding protein in transgenic tobacco
elevates endogenous cytokinin levels, abnormally induces salicylic acid in response
to wounding and increases resistance to tobacco mosaic virus infection. Proceedings
Sano, H., Seo, S., Koizumi, N., Niki, T., Iwamura, H. and Ohashi, Y. (1996) Regulation
by cytokinins of endogenous levels of jasmonic acid and salicylic acids in
mechanically wounded tobacco plants. Plant Cell Physiology 37, 762–769.
Sauer, N., Corbin, D.R., Keller, B. and Lamb, C.J. (1990) Cloning and characterization of
a wound-specific hydroxyproline-rich glycoprotein in Phaseolus vulgaris. Plant, Cell
and Environment 13, 257–266.
Schaller, A. and Ryan, C.A. (1996) Molecular cloning of a tomato leaf cDNA encoding
an aspartic protease, a systemic wound response protein. Plant Molecular Biology
31, 1073–1077.
Schaller, A., Bergey, D.R. and Ryan, C.A. (1995) Induction of wound response genes in
tomato leaves by bestatin, an inhibitor of aminopeptidases. Plant Cell 7,
1893–1898.
Sheng, J., D’Ovidio, R. and Mehdy, M. (1991) Negative and positive regulation of a novel
proline-rich protein mRNA by fungal elicitor and wounding. The Plant Journal 1,
345–354.
Showalter, A.M., Butt, A.D. and Kim, S. (1992) Molecular details of tomato extensin and
glycine-rich protein gene expression. Plant Molecular Biology 19, 205–215.
Sisler, E.C., Blankenship, S.M. and Guest, M. (1990) Competition of cyclooctenes and
cyclooctadienes for ethylene binding and activity in plants. Plant Growth Regulation
9, 157–164.
Stanford, A.C., Northcote, D.H. and Bevan, M.W. (1990) Spatial and temporal patterns
of transcription of a wound-induced gene in potato. The EMBO Journal 9, 593–603.
Stankovic, B. and Davies, E. (1995) Direct electrical induction of gene expression in
tomato plants. Journal of Cellular Biochemistry Supplement 21A, 503.
Staswick, P.E. (1989) Developmental regulation and the influence of plant sinks on
vegetative storage protein gene expression in soybean leaves. Plant Physiology 89,
309–315.
Staswick, P.E., Huang, J.F. and Rhee, Y. (1991) Nitrogen and methyl jasmonate
induction of soybean vegetative storage protein genes. Plant Physiology 96,
130–136.
Staswick, P.E., Su, W. and Howell, S.H. (1992) Methyl jasmonate inhibition of root
growth and induction of a leaf protein are decreased in an Arabidopsis thaliana
mutant. Proceedings of the National Academy of Sciences USA 89, 6837–6840.
Sturm, A. (1992) A wound-inducible glycine rich protein from Daucus carota with
homology to single-stranded nucleic acid-binding proteins. Plant Physiology 99,
1689–1692.
Sturm, A. and Chrispeels, M. (1990) cDNA cloning of carrot extracellular β-fructosidase
and its expression in response to wounding and infection. Plant Cell 2, 1107–1119.
Taipalensuu, J., Falk, A. and Rask, L. (1996) A wound- and methyl jasmonate-inducible
transcript coding for a myrosinase-associated protein with similarities to an early
nodulin. Plant Physiology 110, 483–491.
Taipalensuu, J., Falk, A., Ek, B. and Rask, L. (1997) Myrosinase-binding proteins are
derived from a large wound-inducible and repetitive transcript. European Journal of
Biochemistry 243, 605–611.
Tal, M. and Imber, D. (1970) Abnormal stomatal behavior and hormonal imbalance in
flaca, a wilty mutant of tomato: II. Auxin- and abscisic acid-like activity. Plant
Templeton, M.D. and Lamb, C.J. (1988) Elicitors and defense gene activation. Plant, Cell
and Environment 11, 395–401.
Terek, O.I. (1982) Endogenous auxin and gibberellin in bean plants. Fiziologia Rasterii
(Sofia) VIII, 28–32.
Teutsch, H.G., Hasenfratz, M.P., Lesot, A., Stoltz, C., Garnier, J.-M., Jeltsch, J.-M., Durst,
F. and Werck-Reichhart, D. (1993) Isolation and sequence of a cDNA encoding the
Jerusalem artichoke cinnamate 4-hydroxylase, a major plant cytochrome P450
involved in the general phenylpropanoid pathway. Proceedings of the National
Thornburg, R.W. and Li, X. (1991) Wounding of the foliage of Nicotiana tabacum causes
a decline in the levels of endogenous foliar IAA. Plant Physiology 96, 802–805.
Truernit, E., Schmid, J., Epple, P., Illig, J. and Sauer, N. (1996) The sink-specific and stress-
regulated Arabidopsis STP4 gene: enhanced expression of a gene encoding a
monosaccharide transporter by wounding, elicitors, and pathogen challenge. Plant
Cell 8, 2169–2182.
Truesdell, G.M. and Dickman, M.B. (1997) Isolation of pathogen/stress-inducible cDNAs
from alfalfa by mRNA differential display. Plant Molecular Biology 33, 737–743.
Tymowska-Lalanne, Z., Schwebel-Dugué, N., Lecharny, A. and Kreis, M. (1996)
Expression and cis-acting elements of the Atbfruct1 gene from Arabidopsis thaliana
encoding a cell wall invertase. Plant Physiology and Biochemistry 34, 431–442.
Veen, H. (1987) Use of inhibitors of ethylene action. In: Reid, M.S. (ed.) Manipulation of
Ethylene Responses in Horticulture. Acta Horticulturae 201, pp. 213–222
Vick, B.A. and Zimmerman, D.C. (1983) The biosynthesis of jasmonic acid: a
physiological role for plant lipoxygenase. Biochemical and Biophysical Research
Communications 111, 470–477.
Vick, B.A. and Zimmerman, D.C. (1984) Biosynthesis of jasmonic acid by several plant
species. Plant Physiology 75, 458–461.
Vick, B.A. and Zimmerman, D.C. (1986) Characterization of 12-oxo-phytodienoic acid
reductase in corn: the jasmonic acid pathway. Plant Physiology 80, 202–205.
Vick, B.A., Feng, P. and Zimmerman, D.C. (1980) Formation of 12-[18O]-oxo-cis-10, cis-
15-phytodienoic acid from 13-[18O]-hydroperoxylinolenic acid by hydroperoxide
cyclase. Lipids 15, 468–471.
Vogt, T., Pollak, P., Tarlyn, N. and Taylor, L.P. (1994) Pollination- or wound-induced
kaempferol accumulation in petunia stigmas enhances seed production. Plant Cell
6, 11–23.
Walker-Simmons, M. and Ryan, C.A. (1984) Proteinase inhibitor synthesis in tomato
leaves: induction by chitosan oligomers and chemically modified chitosan and
chitin. Plant Physiology 76, 787–790.
Walker-Simmons, M.K., Hollander-Czytko, H., Andersen, J.K. and Ryan, C.A. (1984)
Wallace, W., Secor, J. and Schrader, L.E. (1984) Rapid accumulation of 4-aminobutyric
acid and alanine in soybean leaves in response to abrupt transfer to lower
temperature, darkness or mechanical manipulation. Plant Physiology 75,
170–175.
Warner, S.A.J., Scott, R. and Draper, J. (1992) Characterization of a wound-induced
transcript from the monocot asparagus that shares similarity with a class of
intracellular pathogenesis-related (PR) proteins. Plant Molecular Biology 19,
555–561.
Wasternack, C., Atzorn, R., Blume, B., Leopold, J. and Parthier, B. (1994) Ursolic acid
inhibits synthesis of jasmonate-induced proteins in barley leaves. Phytochemistry
35, 49–54.
Watson, A.T. and Cullimore, J.V. (1996) Characterization of the expression of the
glutamine synthetase gln-a gene of Phaseolus vulgaris using promoter-reporter gene
fusions in transgenic plants. Plant Science 120, 139–151.
Weiss, C. and Bevan, M. (1991) Ethylene and a wound signal modulate local and
systemic transcription of win2 genes in transgenic potato plants. Plant Physiology
96, 943–951.
Wildon, D.C., Thain, J.F., Minchin, P.E.H., Gubb, I.R., Reilly, A.M., Skipper, Y.D., Doherty,
H.M., O’Donnell, P.J. and Bowles, D.J. (1992) Electrical signaling and systemic
proteinase inhibitor induction in the wounded plant. Nature (London) 360, 62–65.
Wodzicki, T., J. and Wodzicki, A.B. (1981) Modulation of the oscillatory system involved
in polar transport of auxin by other phytohormones. Physiologia Plantarum 53,
176–180.
Xu, Y., Chang, P.F.L., Liu, D., Narasimhan, M.L., Raghothama, K.G., Hasegawa, P.M. and
Bressan, R.A. (1994) Plant defense genes are synergistically induced by ethylene
and methyl jasmonate. Plant Cell 6, 1077–1085.
Yasuda, E., Ebinuma, H. and Hiroetsu, W. (1997) A novel glycine rich/hydrophobic 16
kDa polypeptide gene from tobacco: similarity to proline-rich protein genes and its
wound-inducible and developmentally regulated expression. Plant Molecular Biology
33, 667–678.
Yen, H.-C., Lee, S., Tanksley, S.D., Lanahan, M.B., Klee, H.J. and Giovannoni, J.J. (1995)
The tomato Never-ripe locus regulates ethylene-inducible gene expression and is
linked to a homolog of the Arabidopsis ETR1 gene. Plant Physiology 107,
1343–1353.
Yeo, D., Abe, T., Abe, H., Sakurai, A., Takio, K., Dohmae, N., Takahashi, N. and Shigeo,
Y. (1996) Partial characterization of a 17 kDa acidic protein, EFP, induced by
thiocarbamate in the early flowering phase in Asparagus seedlings. Plant Cell
Zabaleta, E., Assad, N., Oropeza, A., Salerno, G. and Herrera-Estrella, L. (1994)
Expression of one of the members of the Arabidopsis chaperonin 60b gene family is
developmentally regulated and wound-repressible. Plant Molecular Biology 24,
195–202.
Zhang, L., Cohn, N.S. and Mitchell, J.P. (1996) Induction of a pea cell-wall invertase by
wounding and its localized expression pattern in phloem. Plant Physiology 112,
1111–1117.
Appendix 8.1. Wound-inducible genes in plants.
Induced by
Protein Species wound MeJA Comment Reference
3/16/99 11:16 AM
Wound induction/maintenance
Prosystemin Lycopersicon esculentum Yes Yes Systemically induced McGurl et al., 1992
Lipoxygenase Glycine max Yes Yes Auxin repressible Mason and Mullet, 1990
Pisum sativum Yes Inducible by water deficit Staswick et al., 1991
Triticum aestivum Yes Yes Phosphate repressible; Franceschi and Grimes,
accumulates in protein 1991; Mason et al., 1992;
inclusion bodies of Grimes et al., 1992; Sadka
plastids et al., 1994; DeWald et
al., 1994; Bohland et al.,
Page 159
1997
AtLox1 (Lipoxygenase) Arabidopsis thaliana Yes Inducible by ABA; Melan et al., 1993
inducible by both
virulent and avirulent
microorganisms
AtLox2 (Lipoxygenase) Arabidopsis thaliana Yes Yes Systemically induced; Bell and Mullet, 1993
may be in chloroplast;
inducible by ABA
Allene oxide synthase Arabidopsis thaliana Yes Yes Herde et al., 1995
Phospholipase D Ricinus communis Yes Ryu and Wang, 1996
Leucine aminopeptidase Lycopersicon esculentum Yes Yes LAP-A found in plastid Gu et al., 1996
Solanum tuberosum Inducible by ABA Hildemann et al., 1992
Calmodulin Brassica napus Transient induction by Oh et al., 1996
touch stimulus
Glutathione-S-transferase Arabidopsis thaliana Yes Kim et al., 1994
159
Continued over
Appendix 8.1. Wound-inducible genes in plants (continued).
160
Induced by
3/16/99 11:16 AM
Cell wall proteins
HGRPs – hydroxyproline- Phaseolus vulgaris Yes Multiple forms, some Lawton and Lamb, 1987
rich glycoproteins – Araucaria araucana Yes induced by Agrobacterium Corbin et al., 1987
extensins Prosopsis chilensis Yes infection or race-specific Cardemil and Riquelme,
elicitor induction 1991
Nicotiana sylvestris Yes Parmentier et al., 1995

Helianthus annuus Yes Sauer et al., 1990; Adams
et al., 1992
GRPs – glycine-rich Nicotiana sylvestris Yes Multiple forms some Parmentier et al., 1995
Page 160
proteins Lycopersicon esculentum Yes systemic; some induced Showalter et al., 1992
Petunia hybrida Yes locally by Agrobacterium Condit and Meager, 1987
Phaseolus vulgaris Yes infection or ABA; some Keller et al., 1988
Daucus carota Yes repressed by wounding Sturm, 1992
Solanaceous lectins Solanum tuberosum Yes Developmentally Casalongué and Pont
expressed and wound- Lezica, 1985
induced in tubers
AGPs – arabinogalactan Acacia senegal Yes Arabinogalactan gums Clarke et al., 1979;
proteins are secreted by wounded Fincher et al., 1983
tissues
PRPs – proline-rich Glycine max Yes Yes Multiple forms; some Keis-San Francisco and
proteins developmentally Tierney, 1990
Phaseolus vulgaris Yes expressed others Creelman et al., 1992
Daucus carota Yes wound-inducible Sheng et al., 1991
Nicotiana tabacum Yes Ebener et al., 1993;
Yasuda et al., 1997
Inhibition of photosynthetic translation
JIP 60 Hordeum vulgare Yes Ribosome inactivation Chaudhry et al., 1994
protein
GRP – single-stranded Daucus carota Yes Sturm, 1992
nucleic acid binding
3/16/99 11:16 AM
protein
Elongation factor 1 Solanum tuberosum Yes Biphasic response Morelli et al., 1994
subunit a
Chaperonin 60b Arabidopsis thaliana Repressed RUBISCO binding protein Zabaleta et al., 1994
Ethylene regulation
Page 161
S-adenosylmethionine Arabidopsis thaliana Yes Kim et al., 1994
synthase
ACC synthase Lycopersicon esculentum Yes Also ethylene induced Liu et al., 1993
Glycine max Yes Lincoln et al., 1993
Cucumis melo Yes Diallinas and Kanellis,
1994
ACC oxidase Cucumis melo Yes Diallinas and Kanellis,
1994
ACO1 Lycopersicon esculentum Yes Barry et al., 1996
Vigna radiata Yes Repressed Kim and Yang, 1994
TOM13 Lycopersicon esculentum Yes Induced by ethylene Holdsworth et al., 1988
biosynthesis
Pch313 Prunus persica Yes Induced by ethylene Callahan et al., 1992
biosynthesis
161
Continued over
162
Induced by
3/16/99 11:16 AM
Sn1 and Sn2 Capsicum annum Yes Sn1 shows developmental Pozueta-Romero et al.,
(ethylene-related) expression in fruit 1995
homology with latex
proteins
Secondary metabolism/phytoalexin biosynthesis

Phenylalanine ammonia Phaseolus vulgaris Yes Inducible with H2O2 Mehdy, 1994
lyase Cucumis melo Fruit developmental
expression
Page 162
Cinnamate 4-hydroxylase Helianthus tuberosus Yes Bell-LeLong et al., 1997
Arabidopsis thaliana Yes Teutsch et al., 1993
Pisum sativum Yes Frank et al., 1996
4-Coumarate:CoA ligase Nicotiana tabacum Yes Yes Constitutively expressed Lee and Douglas, 1996
Petroselinum crispum in old stem Ellard-Ivey and Douglas,
1996
Chalcone synthase Phaseolus vulgaris Yes Inducible with H2O2 Mehdy, 1994
Cucumis melo Yes Diallinas and Kanellis,
1994
Petunia hybrida Yes Vogt et al., 1994
Picea abies Brignolas et al., 1995
Chalcone isomerase Phaseolus vulgaris Inducible with H2O2 Mehdy, 1994
Cucumis melo Diallinas and Kanellis,
1994
Caffeic acid methyl Hordeum vulgare Yes Yes Not inducible by ABA Lee et al., 1996
transferase
HMG CoA reductase Solanum tuberosum Yes Yes Different isozymes Choi et al., 1994
Camptotheca acuminata Yes Inhibited expressed depending Maldonado-Mendoza et
upon signal al., 1994; Burnett et al.,
1993; Choi et al., 1992
Threonine dehydratase Solanum tuberosum Yes Yes ABA inducible Hildmann et al., 1992
3/16/99 11:16 AM
Polyphenol oxidase Lycopersicon esculentum Yes Yes Activated by systemin Constabel et al., 1995
Stilbene synthase Picea abies Yes Brignolas et al., 1995
Myrosinase-binding Brassica napus Yes Yes Similar to ENOD8; Taipalensuu et al., 1996;
proteins constitutively expressed in Taipalensuu et al., 1997
seed
Glutamine synthase Phaseolus vulgaris Yes Danielle, 1992; Watson
and Cullimore, 1996
Page 163
Malic enzyme Lycopersicon esculentum Yes Induced by glutathione Carollo and Adams, 1996
and dithiothreitol
DAHPS Solanum tuberosum Yes First step of aromatic Dyer et al., 1989
3-Deoxy-D-arabino- Arabidopsis thaliana Yes amino acid synthesis Keith et al., 1991;
heptulosonate-7- may be chloroplast Muday and Herrmann,
phosphate synthase targeted; Mn2+ isozyme 1992
induced; Co2+ isozyme
not induced
2-Oxoglutarate-dependent Lycopersicon esculentum Yes Repressed by auxin; Jacobsen and Olszewski,
dioxygenase repressed by GA3; 1996
induced by ABA
Bergaptol Petroselinum crispum Yes Yes Induced by fungal elicitor Ellard-Ivey and Douglas,
methyltransferase 1996
163
Continued over
164
Induced by
3/16/99 11:16 AM
Glutamate decarboxylase Glycine max Yes Induced by rapid increase Wallace et al., 1984
in cytosolic Ca2+ Knight et al., 1991
Proteinaceous plant defences

Proteinase inhibitor I Lycopersicon esculentum Yes Yes Auxin repressible, Numerous
sucrose induced

Solanum tuberosum Yes Yes Constitutive expression in See text
tubers; developmentally
expressed in fruits of wild
Page 164
species
Proteinase inhibitor II Lycopersicon esculentum Yes Yes ABA and inducible Numerous
Solanum tuberosum Yes Yes Auxin repressible; See text
phosphate repressible;
constitutive expression in
tubers and flower buds
Trypsin inhibitor Salix viminalix Yes Saarikoski et al., 1996
Cathepsin D inhibitor Solanum brevidens Yes Yes Inducible by chitinase Hansen and Hannapel,
1992
Solanum tuberosum Yes Yes Auxin repressible; Liu et al., 1997;
not sucrose induced; Ishikawa et al., 1994
constitutive expression in
tubers and flower buds
Papain inhibitor Lycopersicon esculentum No Yes Bolter, 1993
Bowman Birk inhibitor Medicago sativa Yes Brown and Ryan, 1984
Maize proteinase inhibitor Zea mays Yes Yes Systemically induced; Cordero et al., 1994
induced by fungal
elicitors, ABA
Cysteine proteinase Glycine max Yes Yes Both wounding and MJ Botella et al., 1996
inhibitor induction requires
3/16/99 11:16 AM
ethylene
Alpha amylase inhibitor Hordeum vulgare Yes Inhibited Medina et al.,1993
Cysteine proteinase Nicotiana tabacum Yes mRNA shows a circadian Linthorst et al., 1993
rhythm
Aspartic protease Lycopersicon esculentum Yes Schaller and Ryan, 1996
Carboxypeptidase Lycopersicon esculentum Yes Copper ions lowered Mehta et al., 1996
wound-induction of
Page 165
carboxypeptidase
WIP1 Zea mays Yes Rohrmeier and Lehle,
1993
win4 Populus sp. Yes Yes Systemic expression after Davis et al., 1993
wounding; identity with
vegetative storage proteins
SRG (stress response gene) Medicago sativa Yes Induced by Colletotrichum Truesdell and Dickman,
trifolii elicitor; similar to a 1997
variety of stress-induced
genes
AoPR1 Asparagus officialis Yes Warner et al., 1992
Wun1 Solanum tuberosum Yes Induced by invading Logemann and Schell,
nematodes; induced by 1989; Hansen et al.,
Phytophthora 1996
165
Continued over
166
Induced by
3/16/99 11:16 AM
win2 (chitin binding Solanum tuberosum Yes Systemic induction Stanford et al., 1990;
protein) required both wounding Weiss and Bevan, 1991
and ethylene
Anionic peroxidase Lycopersicon esculentum Yes Induced by Verticillium Mohan et al., 1993
(tap1 and tap2) Glycine max Yes elicitor and ABA Diehn et al., 1993
Stylosanthes humilis Yes Yes Curtis et al., 1997

Chitinase Populus sp. Yes Systemically induced in Clarke et al., 1994
Nicotiana tabacum Yes Populus Grosset et al., 1990
β-1,3-Glucanase Nicotiana tabacum Yes Grosset et al., 1990
Page 166
Osmotin Nicotiana tabacum Yes Grosset et al., 1990
(2)-Pinene synthase Abies grandis Yes Not affected by chitosan Lewinsohn et al., 1992
J1-defensin Capsicum annuum Yes Accumulates in fruit Meyer et al., 1996
during ripening
Thionin Hordeum vulgare Yes Yes Induced by powdery Andresen et al., 1992;
mildew Bohlmann and Apel, 1991
Storage proteins
VSP – vegetative storage Glycine max Yes Yes Auxin repressible Numerous
protein – (acid Arabidopsis thaliana Yes Yes Sucrose induced; See text
phosphatase) phosphate repressible
Sporamin Ipomoea batatas Yes No Inducible by chitosan, Ohto et al., 1992
sucrose, polygalacturonase
and ABA; repressed by
gibberellic acid
β-Amylase Ipomoea batatas Yes No Sucrose induced Ohto et al., 1992
Class-I patatin Solanum tuberosum Inducible by glutamine Peña-Cortés et al., 1992
and sucrose; phosphate
repressible; constitutive
expression in tubers
Early flowering protein Asparagus officialis Yes Induced by thiocarbamates Yeo et al., 1996
3/16/99 11:16 AM
Bark storage protein Populus deltoides Yes Davis et al., 1993
Return to normal physiology

β-Fructosidase Arabidopsis thaliana Yes Sucrose induced Sturm and Chrispeels,
1990
Daucus carota Yes Kaufman et al., 1973
Pisum sativum Yes Yes Induced by ABA Tymowska-Lalanne et al.,
1996; Zhang et al.,
1996
Page 167
STP4 – (monosaccharide Arabidopsis thaliana Yes Inducible by chitin and Truernit et al., 1996
transporter) bacterial elicitor
Proteins of unknown involvement

37 kDa protein Hordeum vulgare Yes Leopold et al., 1996
NT16 Nicotiana tabacum Yes Induced by Agrobacterium Yasuda et al., 1997
tumefaciens
Nopaline synthase Agrobacterium tumefaciens Yes Yes Auxin repressible; Kim et al., 1993
inducible by salicylic acid
Mannopine synthase Agrobacterium tumefaciens Yes Guevara-García et al.,
1993
167
Developmental Targeting of
9
Gene Expression by the Use of a
Senescence-specific Promoter
Susheng Gan1 and Richard M. Amasino2
1Tobacco and Health Research Institute and Department of

Agronomy, Cooper and University Drives, University of
Kentucky, Lexington, KY 40546-0236, USA; 2Department of
Biochemistry, 420 Henry Mall, University of Wisconsin,
Madison, WI 53706-1569, USA
INTRODUCTION
The terminal developmental phase in the life cycle of a plant is generally referred
to as senescence. The lifespan of individual organs of a plant can be much
shorter than that of the plant itself and the senescence of these specific organs
is often studied (e.g. leaf senescence, floral senescence, fruit senescence or
ripening, etc.). Plants exhibit two types of senescence: proliferative senescence
and post-mitotic senescence. An example of proliferative senescence is the arrest
of a shoot apical meristem in certain annual plants (Hensel et al., 1994). After
a certain number of divisions the stem cells of the shoot apical meristem will
stop mitotic division and therefore terminate the production of leaves or flowers.
This type of senescence is observed in yeast and mammalian cells and is
sometimes referred to as replicative senescence. In mammalian cells, telomere
shortening may cause this cellular senescence (Bodnar et al., 1998). Post-
mitotic senescence occurs in organs such as leaves or petals. Once formed, cells
in these organs rarely undergo cell division and thus their senescence is not due
to an inability to divide. In this chapter, only leaf senescence, which is post-
mitotic senescence, will be discussed.
Leaf senescence, like many other plant developmental processes, is a
genetically controlled programme that is regulated by a complex array of
environmental and internal factors (reviewed in Gan and Amasino, 1997).
Moreover, this last phase of plant development is different from other develop-
mental events not only temporally but also biochemically and genetically, which
provides unique opportunities for targeting gene expression for both basic and
170 S. Gan and R.M. Amasino
applied research. This chapter describes senescence-targeted isopentenyl

transferase (IPT) gene expression using a senescence-specific promoter for
studies of cytokinin biology and biotechnology.
LEAF SENESCENCE AND AGRICULTURE
Leaves are the primary site where the photosynthetic machinery operates to fix
CO2 into carbohydrates. However, when a leaf enters the terminal phase –
senescence – anabolic processes such as photosynthesis are replaced by
catabolism; e.g. chlorophyll is degraded (which contributes to leaf yellowing, a
visible marker of senescence), leaf proteins, especially those in chloroplasts, are
degraded, and the turnover of RNA and membrane lipids increases. For
example, approximately 60% of total protein is degraded during Arabidopsis leaf
senescence (Lohman et al., 1994). In many plant species it has been shown that
the nutrients released by these catabolic pathways are re-allocated to support
seed development and young tissue growth. Therefore, this degenerative process
may play an important role in the evolution of plant fitness by providing a
means to retain nutrients which are difficult to acquire and to provide those
nutrients to the next generation.
Although leaf senescence is thought to be an evolutionary adaptation to
recycle nutrients, this process may have negative effects in an agricultural
setting. During senescence, the photosynthetic capability of a leaf declines
sharply. Therefore, leaf senescence may limit yield and/or dry weight of certain
crops such as soybean and maize (Noodén, 1988a). Senescence also contributes
to much of the postharvest loss of vegetable crops and limits the shelf-life of
ornamental plants. In addition, a senescing leaf becomes more vulnerable to
pathogenic infections.
THE ROLE OF CYTOKININS IN PLANT SENESCENCE
Previous physiological and biochemical studies have shown that while there are
many external and internal cues (such as nutrient deficiency, pathogen
infection, temperature extremes, water stress, phytohormone levels, seed
development) that induce senescence, there are only a few factors that retard
senescence; among these factors is the level of the cytokinin class of phyto-
hormones.
The role of cytokinins in retarding leaf senescence was suggested in 1957
when Richmond and Lang found that kinetin treatment prevented the loss of
protein and chlorophyll in detached cocklebur leaves (Richmond and Lang,
1957). Since then three lines of experimentation have been performed to
investigate the inhibitory role of cytokinins in leaf senescence. One type involves
adding exogenous cytokinin to leaves. These studies show that exogenously
added cytokinin can inhibit senescence in some plant species while inconsistent
Developmental Targeting by the Use of a Senescence-specific Promoter 171
data were obtained from some other experiments (Noodén and Leopold, 1978).
Another type of experiment involves measurement of endogenous cytokinin
levels before and during senescence. These studies reveal an inverse correlation
between cytokinin levels and the progression of senescence in a variety of
tissues and plant species (reviewed by van Staden et al., 1988). The third type
of experiment involves manipulation of endogenous cytokinin production in
transgenic plants. As discussed later, the cloning of IPT, an Agrobacterium
tumefaciens gene involved in cytokinin synthesis, has made it possible to
genetically engineer cytokinin production in transgenic plants using a variety
of promoters such as heat-shock- and light-inducible promoters (for review, see
Gan and Amasino, 1995). When cytokinin levels in transgenic plants were
elevated, leaf senescence was usually delayed.
Although these lines of experimentation have provided much useful
information on the effect of cytokinins in plant senescence, further studies are
needed to define the specific role of cytokinins in this process. For example, there
is much variability in the effects of cytokinin treatments, and analyses of
endogenous cytokinin levels reveal only correlations between cytokinin levels
and senescence. Furthermore, in the transgenic plants in which cytokinin
production was manipulated by expression of the IPT gene from various
promoters there were a variety of morphological and developmental aberrations
because of the imprecision in targeting cytokinin production spatially,
temporally and quantitatively. The abnormalities of the transgenic plants
complicates the interpretation of the role of cytokinins because senescence is
often under correlative control; i.e. the developmental state of various parts of
the plant affects other parts to achieve a coordination of the senescence
programme. Thus it is difficult to distinguish whether the delay of senescence
in a transgenic plant is directly due to cytokinin production in leaves or due
indirectly to the developmental alterations caused by cytokinin overproduction.
If a leaf senescence-specific promoter is used to direct the expression of the
cytokinin-synthesizing gene, IPT, cytokinin production in a transgenic plant
will be targeted to leaves at the onset of senescence. This should prevent the
aforementioned abnormalities associated with cytokinin production driven by
other promoters, and the inhibitory role of cytokinins in leaf senescence can be
specifically studied. In addition, this technology may provide a way to
genetically manipulate senescence for agricultural improvement.
DEVELOPING A SYSTEM FOR TARGETING IPT EXPRESSION TO

SENESCING LEAVES
Identification of senescence-associated genes (SAGs)
Senescence is accompanied by, and is likely to be driven by, changes in gene

expression (Gan and Amasino, 1997). Many studies have demonstrated that
a subset of gene transcripts increases in abundance while the levels of the
majority of leaf mRNAs rapidly diminish with the progression of leaf senescence.
This change was demonstrated using in vitro translation followed by gel
electrophoresis to detect changes in translatable mRNA populations during
senescence (Watanabe and Imaseki, 1982; Davies and Grierson, 1989; Becker
and Apel, 1993; Buchanan-Wollaston, 1994; Smart et al., 1995). Although leaf
senescence is associated with both activation and inactivation of distinct sets of
genes, gene inactivation per se is not sufficient for causing senescence but rather,
gene expression within leaf cells is required for senescence to proceed. This is
because the senescence process can be blocked by inhibitors of RNA and
protein synthesis (Noodén, 1988a). For this reason, efforts have been focused
on the identification of genes whose expression is activated during senescence
(i.e. senescence-associated genes or SAGs). Differential screening has been the
main technique that has been employed for isolating SAGs (Davies and
Grierson, 1989; Becker and Apel, 1993; Hensel et al., 1993; Taylor et al., 1993;
Buchanan-Wollaston, 1994; Lohman et al., 1994; Smart et al., 1995). This
technique involves: (i) construction of cDNA libraries using mRNAs of
senescent tissues; (ii) making duplicate sets of filters of the cDNA library; and
(iii) hybridization of one set of the filters with cDNA probes made from young,
non-senescent tissues and the other set with senescent cDNA probes.
Comparison of the two sets of filters allows one to identify cDNA clones that
hybridize only to ‘senescent’ cDNA probes but not to non-senescent probes and
therefore identify mRNAs that increase during senescence. Using this
technique, we have previously identified six cDNA clones designated
SAG12–SAG17 (Lohman et al., 1994). Nuclear run-on and Northern analyses
revealed that transcription of both SAG12 and SAG13 was detected only in
senescing tissues but not in young, non-senescent tissues, i.e. these two genes
were expressed in a highly senescence-specific manner, while SAG14–SAG17
showed a moderate basal level expression in young tissues and an increased
expression in senescing tissues (S. Gan and R.M. Amasino, USA, unpublished
data). The senescence-specific expression of SAG12 as revealed by a RNA gel
blot analysis is shown in Fig. 9.1.
The gene organization of SAG12 and SAG13 have been characterized.
SAG12, a single-copy gene which consists of two exons and one intron, encodes
a protein that belongs to the superfamily of cysteine proteinases, which includes
ICE and CED3. ICE/CED3 genes are involved in programmed cell death (PCD) in
animals (Steller, 1995). SAG13, which consists of four exons and three introns,
was duplicated recently in evolution; both copies have an identical sequence
except for a single nucleotide polymorphism in the promoter region. SAG13
appears to encode a short-chain alcohol dehydrogenase related to
TASSELSEED2 (TS2). TS2 is required for sex determination-related PCD in
maize (DeLong et al., 1993). The promoter regions of both SAG12 and SAG13
have been fused to the β-glucuronidase (GUS) reporter gene, and in transgenic
Arabidopsis and tobacco plants, these promoters direct GUS expression in a
senescence-specific manner (S. Gan and R.M. Amasino, USA, unpublished
data). Although the signal transduction pathways that regulate expression of
NS
S1
S2
S3
S4
S5
Fig. 9.1. Northern blot analysis of SAG12 expression in rosette leaves of
Arabidopsis thaliana (ecotype Landsberg erecta). Each lane contained 5 µg of total
RNA from leaves at the indicated stages of senescence. NS, non-senescent, fully
expanded leaves; S1, first visible signs of senescence: chlorophyll loss at leaf tip;
S2, up to 25% loss of chlorophyll; S3, 25–50% loss of chlorophyll; S4, 40–75%
loss of chlorophyll; S5, >75% loss of chlorophyll, leaves at this stage appeared
completely yellow.
SAG12 and SAG13 remain unknown, the identification of their promoters has
made it possible to target gene expression in senescing tissues.
The role of IPT in cytokinin production
Although tRNA catabolites could provide some cytokinins, it is believed that

cytokinins in planta are produced primarily through a de novo biosynthetic
pathway, which branches from the mevalonate pathway at ∆3-isopentenyl-
pyrophosphate (∆3-IPP). The first step is the transfer of the isopentenyl group
from ∆2-IPP (isomerized from ∆3-IPP) to AMP, resulting in the formation of
isopentenyladenosine ribotide that is then converted to various cytokinins (for
reviews, see Binns, 1994; Gan and Amasino, 1996; Kaminek, 1992). This first
step is catalysed by isopentenyl transferase (IPT). Although this enzyme
activity has been detected in plant extracts, it has not been purified (Chen and
Ertl, 1994) and the gene encoding it has not been characterized. The
molecular analysis of the Ti (tumour-inducing) plasmid of A. tumefaciens has
resulted in the identification of an IPT gene on the transferred DNA fragment
(T-DNA) of the plasmid (Akiyoshi et al., 1984; Barry et al., 1984). The T-DNA
IPT enzyme expressed in Escherichia coli has been shown to add the isopentenyl
group into the N6 position of AMP (Akiyoshi et al., 1984; Barry et al., 1984).
Since the identification of the T-DNA IPT gene, efforts have been made to
express this gene in transgenic plants using a variety of promoters and strategies.
These include promoters inducible by heat, light, tetracycline and wounding or
infection (Medford et al., 1989; Schmülling et al., 1989; Smart et al., 1991;
Smigocki, 1991; Ainley et al., 1993; Smigocki et al., 1993; Hamdi et al., 1995;
Thomas et al., 1995; Faiss et al., 1997), tissue-specific promoters (elongation-zone-
specific and fruit-specific) (Li et al., 1992; Martineau et al., 1994), constitutive
promoters (CaMV 35S and the native IPT promoter) (Ooms et al., 1991; Smigocki
and Owens, 1988), and transposition and random insertion approaches (Estruch
et al., 1991; Hewelt et al., 1994). IPT transgenic Arabidopsis, cucumber, potato,
tomato and tobacco plants displayed developmental and morphological changes
that are characteristic of cytokinin overproduction in plants. Typically, these
transgenic plants have a stunted stature, smaller leaves, underdeveloped vascular
system and impaired root growth (reviewed in Gan and Amasino, 1996). Indeed,
quantitative analyses of the cytokinin levels in some of the transgenic plants
showed a significantly increased endogenous cytokinin production. For example,
the zeatin level in tobacco plants expressing IPT under the control of a maize heat-
shock promoter was increased up to 50-fold over the level in non-heat-treated
plants (Medford et al., 1989). Even under non-heat-shock conditions, the zeatin
ribotide level was elevated sevenfold over non-transgenic controls, which most
likely resulted from the ‘leaky’ expression of the maize heat-shock promoter
(Medford et al., 1989). The ‘leaky’ expression level was below the sensitivity of
Northern blot analysis; thus, the developmental abnormalities caused by traces of
IPT expression are a sensitive test for promoter activity.
Use of SAG promoters to target IPT gene to senescing leaves
To target IPT expression to senescing leaves, we constructed a chimeric gene

consisting of the SAG12 promoter, the coding region of IPT and the terminal
sequence of the nopaline synthase gene. As shown in Fig. 9.2, the expression of
this construct in plant cells forms an autoregulatory loop for controlling
cytokinin levels. At the onset of senescence the SAG12 promoter directs the
expression of IPT in senescing leaf cells. The increased IPT enzyme activity
results in the elevated cytokinin production, which prevents the leaf cells from
senescing. The prevention of senescence in turn attenuates the SAG12
promoter because this promoter is active only in senescing cells. This negative
feedback loop therefore prevents overproduction of cytokinins.
Technically, a 2.18 kb SAG12 promoter fragment (including 106 bp of the
5′ untranslated region) from the EcoRV site at 22073 to an NcoI site (artificially
created at the SAG12 start codon by oligomutagenesis) was fused to the IPT
coding region (at the IPT translation start codon) along with the nopaline
Fig. 9.2. Use of the SAG12 promoter to target IPT gene to senescing leaves;
rationale and plasmid construction. The senescence-specific SAG12 promoter was
fused to IPT. After introduced into plant cells, this chimeric gene forms an
autoregulatory loop: the SAG12 promoter directs IPT gene expression at the onset
of leaf senescence, resulting in the production of cytokinins (e.g.
isopentenyladenine). An increased cytokinin level in turn inhibits senescence,
which leads to the suppression of the SAG12 promoter. The suppression of this
promoter prevents cytokinin overproduction. LB and RB are left and right T-DNA
border, respectively. E, EcoRV; N, NcoI; Sc, SacI; S/X or X/S, ligated SpeI and XbaI
sites. Reproduced by permission of Science 270, 1986–1988.
synthase gene terminator. The SAG12 promoter–IPT construct (hereafter

SAG12–IPT) was then cloned into a binary vector (pSG529 in Fig. 9.2) and
transferred into A. tumefaciens strain LBA4404 for plant transformation.
CREATION AND CULTIVATION OF TRANSGENIC TOBACCO PLANTS
Transformation of tobacco plants was performed by cocultivation of leaf discs

of Nicotiana tabacum cv. Wisconsin 38 (hereafter, W38 or wild-type) with
Agrobacterium. The regenerated plants (R1) were transplanted into a mixture of
peat moss and vermiculite (1:1) saturated with nutrient solution (Peters
20–20–20 fertilizer at the concentration of 473 parts per million of nitrogen,
Peters Fertilizer Products, W.R. Grace & Co.) and grown in a growth room at
25°C and 60% relative humidity under 120 mmol m22 s21 of continuous light
(Gan and Amasino, 1995). These plants were scored for a delayed leaf
senescence phenotype and allowed to self-pollinate to produce R2 seeds. These
R2 seeds were put on agar plates containing 125 mg ml21 kanamycin to test for
segregation of the inserted genes one of which confers resistance to kanamycin.
All seedlings, including those of wild-type and kanamycin-resistant SAG12–IPT
were transplanted into 3-litre clay pots containing nutrient solution-saturated
peat/vermiculite mixture and grown in a greenhouse facility with a 16 h

photoperiod at approximately 26°C. The plants were sub-irrigated as needed
with water only, and no more nutrients were supplied thereafter.
PHENOTYPICAL, PHYSIOLOGICAL AND BIOCHEMICAL

OBSERVATIONS OF SAG12–IPT TRANSGENIC PLANTS
Phenotypically, the SAG12–IPT transgenic tobacco plants are developmentally

normal except for markedly retarded leaf and floral senescence. All original
transgenic plants (R1) produced viable seeds (R2). There were no observable
differences as to their germination compared with that of the non-transgenic
parental plants. Kanamycin-resistant transgenic R2 seedlings (12 plants for
each line) were transplanted into a greenhouse for observation of their growth
and development. All plants appeared normal except for significantly delayed
leaf senescence. We then randomly chose one of the eight lines for examination
of its R3 progeny in both a greenhouse and a growth chamber. Again, the
transgenic plants appeared normal in all aspects of growth and development
other than leaf and floral senescence. SAG12–IPT transgenic and non-transgenic
seedlings showed equally developed leaf, shoot and root systems at 3.5 weeks
old (Gan and Amasino, 1995). Both transgenic and wild-type plants formed
visible flower buds after 6 weeks (Fig. 9.3a), and the first flowers opened at the
same time. The numbers of flowers produced at the age of 12 weeks were very
similar in control and transgenic plants (Fig. 9.3b). There were no statistically
meaningful differences in overall plant height and leaf number on main stems
(Gan and Amasino, 1995). There was also no observable difference in their root
systems throughout development (data not shown). We did not anatomically
examine the vascular system in the transgenic plants, but the leaf vein pattern
appeared to be regular.
Although the plants grew and developed normally, the retarded senescence
progression in the SAG12–IPT transgenic plants was obvious. This difference
in senescence between SAG12–IPT transgenic and wild-type plants can be
observed in as early as 3.5-week-old seedlings; the cotyledons of wild-type
seedlings were already senescing while those of transgenic plants were not (Gan
and Amasino, 1995). As usual, senescence started from the bottom (Fig. 9.3a)
through the middle (Fig. 9.3b) to the top (Fig. 9.3c) leaves in wild-type plants.
By the time wild-type plants were 12 weeks old, senescence had progressed into
the middle leaves; however, there was still no visible sign of yellowing even in
the very bottom leaf on SAG12–IPT plants (Fig. 9.3b). By the time wild-type
plants were 20 weeks old, the very top leaves had undergone senescence and
flowering terminated after production of approximately 180 flowers; by
contrast, there was still no visible chlorophyll loss even in the oldest leaves on
SAG12–IPT plants and these plants were still producing flowers at that time
(Fig. 9.3c). As a result of the extended flowering period, the SAG12–IPT plants
produced more than 320 flowers (Gan and Amasino, 1995).
Fig. 9.3. Comparison of a SAG12–IPT transgenic tobacco (on the left in each
panel) to wild-type (on the right) at various stages of development (a–c) or 30 days
after detachment of leaves (d). (a) shows plants 6 weeks after seedlings were
transplanted into soils, (b) 12 weeks and (c) 20 weeks. Reproduced by permission
of Science 270, 1986–1988.
Not only was the flowering period prolonged in the SAG12–IPT transgenic
plants, but the longevity of the petals of individual flowers was extended by over
50% from 3 days in wild-type plants to at least 4.5 days in the transgenic plants
(Gan, 1995). Thus there were more non-senescent flowers on the floral stalks in
transgenic plants than on the corresponding stalks of wild-type ones (Gan, 1995).
To determine if senescence could be markedly delayed in detached leaves of
SAG12–IPT plants, leaves that had just fully expanded from SAG12–IPT and
wild-type plants (grown in a greenhouse) were excised at the petiole bottom,
inserted in jars filled with water and maintained in a growth chamber. The
leaves of wild-type plants started senescing in about 10 days while the leaves
from SAG12–IPT plants remained green for over 40 days (Fig. 9.3d).
Biochemically, the chlorophyll and protein levels of SAG12–IPT transgenic
plants were higher than those of non-transgenic plants. Under the growth
conditions used, the seventh leaf of wild-type plants had lost greater than 90%
of chlorophyll and 70% of protein by 68 days after emergence. At that time,
these leaves were brown and desiccated. In contrast, more than 70% of
chlorophyll and protein were retained in 68-day-old leaves in plants containing
SAG12–IPT (Gan, 1995).
Physiologically, senescence-retarded leaves are photosynthetically active as
measured by CO2 uptake. The photosynthetic rates were almost the same in
upper non-senescent young leaves (leaf no. 22 and no. 26) on both SAG12–IPT
and control plants. This rate remained unchanged in older leaves (no. 15 and
no. 18) of SAG12–IPT plants but decreased to less than 15% in the senescing
counterparts of the control plants. At the measurement time, the oldest leaf
from which we made measurements was leaf no. 7 which still had one-third of
the full photosynthetic capacity. The corresponding leaf no. 7 of control plants
was completely senesced and desiccated by this time (Gan, 1995). Thus,
cytokinin production can provide some preservation of photosynthetic capacity
but cannot ultimately prevent photosynthetic decline from occurring. The
degree of preservation appears to be dependent upon the growth conditions of
the plants (Wingler et al., 1998). In our growth conditions, the preservation of
photosynthetic activity in SAG12–IPT transgenic plants resulted in about 50%
increases in both seed yield and dry weight accumulation with comparison to
those of wild-type plants (Gan and Amasino, 1995).
AUTONOMOUS NATURE OF SAG12–IPT SYSTEM
The normal development of SAG12–IPT plants indicated that the autoregulatory

system operated only in senescing leaves without exerting an effect on other
parts of the plant through translocation of cytokinins. To further examine the
autonomous nature of the system, we reciprocally grafted SAG12–IPT plants and
wild-type plants to create genetically chimeric plants. Six pairs of such chimeric
grafts were created. In either graft orientation, senescence progressed normally
in leaves of wild-type parts of the chimeric plants but not in those leaves
containing SAG12–IPT (Fig. 9.4), suggesting that cytokinin produced in the
transgenic leaves is not translocated upwards or downwards in sufficient
amounts to affect leaf senescence in the wild-type regions.
MOLECULAR GENETIC EVIDENCE FOR THE AUTOREGULATORY

NATURE OF SAG12–IPT SYSTEM
We have hypothesized that production of cytokinin directed by the senescence-

specific SAG12 promoter will inhibit senescence, which in turn will attenuate
Fig. 9.4. Senescence progression in grafted plants. The SAG12–IPT transgenic and
wild-type tobacco plants were reciprocally grafted, and the grafts were grown in a
greenhouse. Arrows indicate the graft junctions, the plant part above the junction is
the scion and below the junction is the stock. The plant on the left had a wild-type
scion and a SAG12–IPT transgenic stock, while the plant at the right had a
SAG12–IPT scion and a wild-type stock. Reproduced by permission of Science
270, 1986–1988.
the senescence-specific promoter and prevent further accumulation of cytokinin

(Fig. 9.2). The fact that transgenic plants were phenotypically normal except
for the effect on senescence indicated that this autoregulatory senescence-
inhibition system appeared to be operating. To confirm that such autoregula-
tion indeed exists in the transgenic plants, we measured the expression from the
SAG12 promoter as a function of leaf age in the presence or absence of the
SAG12–IPT transgene. To measure SAG12 promoter activity, we used
the SAG12 promoter fused to GUS. In transgenic plants containing this
SAG12–GUS construct, enzyme activity is detected at a very high level in
senescing leaves (GUS activity profile 1 in Fig. 9.5b) but no activity is detected
in non-senescent leaves (i.e. the senescence-specific expression of this
Arabidopsis promoter is faithfully maintained in tobacco plants). If this
SAG12–GUS construct is introduced into SAG12–IPT plants, GUS expression
should be suppressed (GUS profile 2 in Fig. 9.5b) because the SAG12 promoter
in the SAG12–GUS construct should be subject to the same negative feedback
regulation (Fig. 9.5a). It should be noted that in these experiments the identical
region of the SAG12 promoter was used to drive expression of IPT or GUS.
We crossed a homozygous SAG12–IPT plant and a homozygous
SAG12–GUS plant to create double hemizygous transgenic plants containing
one copy of SAG12–IPT and one copy of SAG12–GUS. These homozygous
plants were also crossed with wild-type W38 plants to create hemizygous
SAG12–GUS and hemizygous SAG12–IPT plants (Fig. 9.5c). The GUS activity
in leaf no. 7 of the SAG12–GUS plants increased sharply with the progression
of senescence until the leaves were completely desiccated 71 days after their
emergence. By contrast, GUS expression in the corresponding leaves of double
hemizygous SAG12–GUS/SAG12–IPT plants was significantly suppressed and
its activity maintained at a very low level slightly above the background
detected in W38 and SAG12–IPT plants (Gan and Amasino, 1995), which was
similar to the GUS activity profile 2 illustrated in Fig. 9.5b. This result
demonstrates the existence of the proposed autoregulation.
Furthermore, we investigated whether the cytokinin production in the
proposed autoregulatory loop contributed to the suppression of gene expression
from the SAG12 promoter. Protein and RNA samples were prepared from a leaf
of a SAG12–GUS transgenic tobacco plant which had started senescing to
provide a baseline of mRNA level (lane 1 of insert in Fig. 9.6) and GUS activity
(column 1 in Fig. 9.6). Half of this leaf was treated with 50 µM 6-benzyl-
aminopurine (BA, a cytokinin) once every 3 days, and the other half was treated
with the same volume of buffer only (i.e. 2cytokinin). The leaf tissues were
sampled 18 days after the start of treatment. At this time the leaf tissue
receiving cytokinin treatment was rejuvenated while the leaf tissue without
cytokinin application was completely yellowed. GUS expression was suppressed
by cytokinin treatment (Fig. 9.6). The inhibition of senescence and the
suppression of the SAG12–GUS expression by external cytokinin application are
consistent with the proposed negative feedback exerted by cytokinin
production.
Fig. 9.5. Investigation of the autoregulatory nature of the SAG12–IPT senescence-

inhibition system. GUS activity in transgenic SAG12–GUS plants increases with the
progression of leaf senescence (GUS activity profile 1 in (b)). However, when the
SAG12–GUS is introduced in the SAG12–IPT background, the identical SAG12
promoter of the SAG12–GUS will be subject to the same negative feedback
regulation by cytokinins as that of the SAG12 promoter in the SAG12–IPT plants
(a), resulting in a suppressed GUS expression (GUS activity profile 2 in (b)). (c)
outlines the genetic schemes used to create the SAG12–GUS/SAG12–IPT double
hemizygous plants by crossing a homozygous SAG12–GUS plant to a homozygous
SAG12–IPT plant. Both homozygotes were also crossed to wild-type (wt) plants to
create plants hemizygous for SAG12–GUS and plants hemizygous for SAG12–IPT.
The SAG12–IPT hemizygote and wt were used for GUS negative controls.
Fig. 9.6. Effect of exogenous cytokinin on SAG12–GUS expression. GUS transcript

levels (insert) were determined by RNA gel blot (10 µg lane21 total RNA), and GUS
activity was assayed with 4-methylumbelliferyl-β-D-glucuronidase as substrate.
Lane 1: samples from transgenic SAG12–GUS tobacco leaf at the earliest stages of
senescence. Lanes 2 and 3 are from samples prepared 18 days after the time point
shown in lane 1. Lane 2 shows the control treated with buffer only and lane 3
shows leaf samples treated at 3-day intervals with 50 µM 6-benzylaminopurine (BA).
CONCLUSIONS
The utility of autoregulatory systems for studies of cytokinin biology
An important tool for studying cytokinin biology is the development of

transgenic plant strategies in which the A. tumefaciens IPT gene can be joined to
various promoters to direct cytokinin production in a defined temporal and
spatial pattern. Many such studies using a variety of plant species and a variety
of promoters have demonstrated the effectiveness of IPT expression for cytokinin
production in planta. These studies have also demonstrated the extreme
sensitivity of many aspects of plant development to perturbations of cytokinin
levels; in such studies the transgenic plants were generally abnormal,
exhibiting reduced size, less developed vascular and root systems, reduced
apical dominance and, in one study, defective fruit coloration (Martineau et al.,
1994). An ideal transgenic system for the studies of hormone effects would
allow precise targeting of hormone production quantitatively, spatially and
temporally so that the relationship between hormone production and
phenotype can be clearly determined. We have developed an autoregulatory
senescence-inhibition system in which IPT was fused to a senescence-specific
promoter. At the onset of senescence, this promoter directs expression of IPT

resulting in the synthesis of cytokinins which in turn attenuates the promoter
by retarding senescence. This system has the following features that are useful
for studying the role of cytokinin in leaf senescence: quantitatively the cytokinin
production is precisely regulated and maintained at a minimum level that is
sufficient for the inhibition of senescence; spatially the production of cytokinins
has been precisely targeted to the senescing tissues of the shoot, and the
produced cytokinin is not translocated in sufficient amounts (if any) to affect
other parts of the plant (Fig. 9.4); and temporally the cytokinin production has
been limited to a time when senescence starts. Because of these features, the
transgenic plants exhibit no abnormalities in plant growth and development
other than retarded leaf and floral senescence. Specifically, the longevity of
certain leaves (from leaf emergence to the time 50% of chlorophyll lost) has
been extended from 47 days in wild-type plants to >100 days in the transgenic
plants. The longevity of floral petal has also been extended by 50%. This permits
an examination of the relationship between locally produced cytokinin and
retarded senescence without concern about possible complications associated
with other effects caused by treatment to induce promoters (such as heat-shock)
or abnormalities of plant development.
The minimum dose of cytokinin that is sufficient for delaying leaf
senescence is not known. Although a series of known concentrations of
cytokinin can be externally applied, it is not known how much of the applied
hormone has been transported to and taken up by a target tissue. An
endogenous level of cytokinin can be measured from a healthy leaf, but it does
not necessarily reflect the amount of cytokinin sufficient for the inhibition of
leaf senescence. The autoregulatory cytokinin production system provides an
opportunity for the quantification of cytokinin levels necessary for retarding
senescence because, in this system, cytokinin should be maintained at a
minimum level that is effective for delaying senescence.
Potential applications of an autoregulatory senescence-inhibition system
Leaf senescence is thought to play an important role in the evolution of fitness

by recycling nutrients from dying cells to actively growing parts such as
reproductive organs (Noodén, 1988b). However, leaf senescence is not always
desirable in agriculture. For example, the loss of assimilatory capacity as
senescence progresses is thought to contribute to yield limitation in some
monocarpic crops such as soybean (Noodén, 1984). Senescence also devalues
ornamental plants and vegetables during transportation and storage. Forage
crops such as lucerne generally lose some nutritional quality due to leaf
senescence. Therefore, manipulation of leaf senescence with an autoregulatory
senescence-inhibition system may result in agricultural benefits. In the
transgenic plants containing this system, senescence of both detached and
intact leaves is delayed (Fig. 9.3), the protein levels in senescence-delayed leaves
have been preserved, the flowering period and the longevity of individual
flowers have been prolonged, and seed yield and plant biomass have been
increased. In transgenic plants there is often a transgene dosage effect; e.g.
hemizygous and homozygous transgenic plants have different levels of
transgene expression which can result in different phenotypes of hemizygous
and homozygous plants (Hewelt et al., 1994). In our studies, there was no
phenotypic difference among transgenic lines that contained one or more
transgene loci nor between hemizygous and homozygous transgenic plants
(data not shown). This lack of phenotypic variation presumably results from the
autoregulatory feature; regardless of transgene position in the genome or copy
number, the autoregulatory feature ‘titrated’ the level of cytokinin production
to that required for senescence inhibition. Thus, we believe this autoregulatory
system has potential in agricultural and horticultural applications.
REFERENCES
Ainley, W.M., McNeil, K.J., Hill, J.W., Lingle, W.L., Simpson, R.B., Brenner, M.L., Nagao,
R.T. and Key, J.L. (1993) Regulatable endogenous production of cytokinins up to
‘toxic’ levels in transgenic plants and plant tissues. Plant Molecular Biology 22,
13–24.
Akiyoshi, D.E., Klee, H., Amasino, R.M., Nester, E.W. and Gordon, M. (1984) T-DNA of
Agrobacterium tumefaciens encodes an enzyme of cytokinin biosynthesis. Proceedings
Barry, G.F., Rogers, S.G., Fraley, R.T. and Brand, L. (1984) Identification of a cloned
cytokinin biosynthetic gene. Proceedings of the National Academy of Sciences USA 81,
4776–4780.
Becker, W. and Apel, K. (1993) Differences in gene expression between natural and
artificially induced leaf senescence. Planta 189, 74–79.
Binns, A.N. (1994) Cytokinin accumulation and action: biochemical, genetic, and
molecular approaches. Annual Review of Plant Physiology and Plant Molecular Biology
45, 173–196.
Bodnar, A.G., Ouellette, M., Frolkis, M., Holt, S.E., Chiu, C.-P., Morin, G.B., Harley, C.B.,
Shay, J.W., Lichtsteiner, S. and Wright, W.E. (1998) Extension of life-span by
introduction of telomerase into normal human cells. Science 279, 349–352.
Buchanan-Wollaston, V. (1994) Isolation of cDNA clones for genes that are expressed
during leaf senescence in Brassica napus. Identification of a gene encoding a
senescence-specific metallothionein-like protein. Plant Physiology 105, 839–846.
Chen, C.-M. and Ertl, J.R. (1994) Cytokinin biosynthetic enzymes in plants and slime
mold. In: Mok, D.W.S. and Mok, M.C. (eds) Cytokinins: Chemistry, Activity, and
Function. CRC Press, Boca Raton, USA, pp. 81–85.
Davies, K.M. and Grierson, D. (1989) Identification of cDNA clones for tomato
(Lycopersicon esculentum Mill.) mRNAs that accumulate during fruit ripening and
leaf senescence in response to ethylene. Planta 179, 73–80.
DeLong, A., Calderon-Urrea, A. and Dellaporta, S.L. (1993) Sex determination gene
TASSELSEED2 of maize encodes a short-chain alcohol dehydrogenase required for
stage-specific floral organ abortion. Cell 74, 757–768.
Estruch, J.J., Prinsen, E., Van Onckelen, H., Schell, J. and Spena, A. (1991) Viviparous
leaves produced by somatic activation of an inactive cytokinin-synthesizing gene.
Science 254, 1364–1367.
Faiss, M., Zalubilova, J., Strnad, M. and Schmülling (1997) Conditional transgenic
expression of the ipt gene indicates a function for cytokinins in paracrine signaling
in whole tobacco plants. Plant Journal 12, 401–415.
Gan, S. (1995) Molecular characterization and genetic manipulation of plant
senescence. PhD thesis, University of Wisconsin-Madison, Madison, USA.
Gan, S. and Amasino, R.M. (1995) Inhibition of leaf senescence by autoregulated
production of cytokinin. Science 270, 1986–1988.
Gan, S. and Amasino, R.M. (1996) Cytokinins in plant senescence: from spray and pray
to clone and play. BioEssays 18, 557–565.
Gan, S. and Amasino, R.M. (1997) Making sense of senescence. Molecular genetic
regulation and manipulation of leaf senescence. Plant Physiology 113, 313–319.
Hamdi, S., Creche, J., Garnier, F., Mars, M., Decendit, A., Gaspar, T. and Rideau, M.
(1995) Cytokinin involvement in the control of coumarin accumulation in
Nicotiana tabacum. Investigations with normal and transformed tissues carrying the
isopentenyl transferase gene. Plant Physiology and Biochemistry 33, 283–288.
Hensel, L.L., Grbic, V., Baumgarten, D.A. and Bleecker, A.B. (1993) Developmental and
age-related processes that influence the longevity and senescence of photosynthetic
tissues in Arabidopsis. Plant Cell 5, 553–564.
Hensel, L.L., Nelson, M.A., Richmond, T.A. and Bleeker, A.B. (1994) The fate of
inflorescence meristems is controlled by developing fruits in Arabidopsis. Plant
Hewelt, A., Prinsen, E., Schell, J., Van Onckelen, H. and Schmülling, T. (1994) Promoter
tagging with a promoterless ipt gene leads to cytokinin-induced phenotypic
variability in transgenic tobacco plants: implications of gene dosage effects. Plant
Journal 6, 879–891.
Kaminek, M. (1992) Progress in cytokinin research. Trends in Biotechnology 10,
159–164.
Li, Y., Hagen, G. and Guilfoyle, T.J. (1992) Altered morphology in transgenic tobacco
plants that overproduce cytokinins in specific tissues and organs. Developmental
Biology 153, 386–395.
Lohman, K.N., Gan, S., John, M.C. and Amasino, R.M. (1994) Molecular analysis of
natural leaf senescence in Arabidopsis thaliana. Physiologia Plantarum 92,
322–328.
Martineau, B., Houck, C.M., Sheehy, R.E. and Hiatt, W.R. (1994) Fruit-specific
expression of the A. tumefaciens isopentenyl transferase gene in tomato: effects on
fruit ripening and defense-related gene expression in leaves. Plant Journal 5, 11–19.
Medford, J.I., Horgan, R., El-Sawi, Z. and Klee, H.J. (1989) Alterations of endogeneous
cytokinins in transgenic plants using a chimeric isopentenyl transferase gene. Plant
Cell 1, 403–413.
Noodén, L.D. (1984) Integration of soybean pod development and monocarpic
senescence. Physiologia Plantarum 62, 273–284.
Noodén, L.D. (1988a) The phenomenon of senescence and aging. In: Noodén, L.D. and
Leopold, A.C. (eds) Senescence and Aging in Plants. Academic Press, San Diego, USA,
pp. 1–50.
Noodén, L.D. (1988b) Whole plant senescence. In: Noodén, L.D. and Leopold, A.C. (eds)
Senescence and Aging in Plants. Academic Press, San Diego, USA, pp. 391–439.
Noodén, L.D. and Leopold, A.C. (1978) Phytohormones and the endogenous regulation
of senescence and abscission. In: Letham et al. (eds) Phytohormones and Related
Compounds: a Comprehensive Treatise. Elsevier/North-Holland Biomedical Press, New
York, USA, pp. 329–369.
Ooms, G., Risiott, R., Kendall, A., Keys, A., Lawlor, D., Smith, S., Turner, J. and Young,
A. (1991) Phenotypic changes in T-cyt-transformed potato plants are consistent
with enhanced sensitivity of specific cell types to normal regulation by root-derived
cytokinin. Plant Molecular Biology 17, 727–743.
Richmond, A.E. and Lang, A. (1957) Effect of kinetin on protein content and survival of
detached Xanthium leaves. Science 125, 650–651.
Schmülling, T., Beinsberger, S., De Greef, J., Schell, J., Van Onckelen, H. and Spena, A.
(1989) Construction of a heat-inducible chimeric gene to increase the cytokinin
content in transgenic plant tissue. FEBS Letters 249, 401–406.
Smart, C.M., Scofield, S.R., Bevan, M.W. and Dyer, T.A. (1991) Delayed leaf senescence
in tobacco plants transformed with tmr, a gene for cytokinin production in
Agrobacterium. Plant Cell 3, 647–656.
Smart, C.M., Hosken, S.E., Thomas, H., Greaves, J.A., Blair, B.G. and Schuch, W. (1995)
The timing of maize leaf senescence and characterization of senescence-related
cDNAs. Physiologia Plantarum 93, 673–682.
Smigocki, A.C. (1991) Cytokinin content and tissue distribution in plants transformed
by a reconstructed isopentenyl transferase gene. Plant Molecular Biology 16,
105–115.
Smigocki, A.C. and Owens, L.D. (1988) Cytokinin gene fused with a strong promoter
enhances shoot organogenesis and zeatin levels in transformed plant cells.
Smigocki, A.C., Neal, J.W., McCanna, I. and Douglass, L. (1993) Cytokinin-mediated
insect resistance in Nicotiana plants transformed with the ipt gene. Plant Molecular
Biology 23, 325–335.
Steller, H. (1995) Mechanisms and genes of cellular suicide. Science 267, 1445–1449.
Taylor, C.B., Bariola, P.A., Delcardayre, S.B., Raines, R.T. and Green, P.J. (1993) RNS2 –
a senescence-associated RNase of Arabidopsis that diverged from the S-RNases before
speciation. Proceedings of the National Academy of Sciences USA 90, 5118–5122.
Thomas, J.C., Smigocki, A.C. and Bohnert, H.J. (1995) Light-induced expression of ipt
from Agrobacterium tumefaciens results in cytokinin accumulation and osmotic stress
symptoms in transgenic tobacco. Plant Molecular Biology 27, 225–235.
van Staden, J., Cook, E. and Noodén, L.D. (1988) Cytokinins and senescence. In: Noodén,
L.D. and Leopold, A.C. (eds) Senescence and Aging in Plants. Academic Press, San
Diego, USA, pp. 281–328.
Watanabe, A. and Imaseki, H. (1982) Changes in translatable mRNA in senescing wheat
leaves. Plant and Cell Physiology 23, 489–497.
Wingler, A., von Schaewen, A., Leegood, R.C., Lea, P.J. and Quick, W.P. (1998)
Regulation of leaf senescence by cytokinin, sugars, and light effects on NADH-
dependent hydroxypyruvate reductase. Plant Physiology 116, 329–335.
Abscisic Acid- and Stress-

10
induced Promoter Switches in
the Control of Gene Expression
Qingxi Shen1 and Tuan-Hua David Ho
Plant Biology Program, Department of Biology, Division of

Biology and Biomedical Sciences, Washington University, St
Louis, MO 63130, USA
INTRODUCTION
Field-grown plants are constantly under unfavourable environmental

conditions, such as drought, flooding, extreme temperatures, excessive salts,
heavy metals, high intensity irradiation and infection by pathogenic agents.
Because of their immobility, plants have to make necessary metabolic and
structural adjustments to cope with stressful environmental conditions. To this
end, the genetic programme in normal plants is altered by the stress stimuli to
produce specific proteins and/or to activate biochemical pathways which are
essential for survival. For example, flooded plant tissues synthesize alcohol
dehydrogenase (ADH) to catalyse ethanol formation coupled to the oxidation of
NADH, thereby maintaining glycolysis in the anaerobically stressed cells (Sachs
and Ho, 1986). Some stress-induced proteins may play a role in structural
alterations that protect cells from being damaged by the stress conditions. The
cell wall hydroxyproline-rich proteins (HRGP) are induced in mechanically
wounded tissues (Showalter and Varner, 1989). Because of their rigid structure,
it is conceivable that the elevated levels of these proteins in the cell walls may
help to seal off the tissues from further injuries.
It has been estimated that biotic stresses routinely depress the yield of major
US crops by more than 60% (Boyer, 1982; Table 10.1). Therefore, elucidating
the mechanisms by which stresses exert adverse effects on the performance of
crop plants would not only help us to understand the basic biology of stress
responses but also facilitate the development of applications for enhancing stress
1Current address: Monsanto Company, Mail Zone AA2G, 700 Chesterfield Village Parkway,
Chesterfield, MO 63198, USA.
188 Q. Shen and T.-H.D. Ho
Table 10.1. Record yields, average yields and yield loss due to unfavourable
physicochemical environments for major US crops. Values are kg ha21. Adapted
from Boyer (1982).
Loss due to
Crop Record yield Average yield environment
Corn 19,300 4,600 12,700

Wheat 14,500 1,880 11,900
Soybean 7,390 1,610 5,120
Potato 94,100 28,300 50,900
Mean % of record yield 21.6% 69.1%
tolerance. It has long been established that drought, cold and salinity stress
conditions often enhance the synthesis of the phytohormone, abscisic acid
(ABA), which in turn regulates many other processes including the closure of
stomata and the alteration of gene expression (reviewed by Zeevaart and
Creelmann, 1988). However, not all stress-induced gene expression is mediated
by ABA. Using ABA-deficient Arabidopsis mutants, Gilmore and Thomashow
(1991) and Lång and Palva (1992) have shown that certain genes can still be
induced by cold even in the absence of elevated ABA. It has now become
apparent that stress/ABA-induced genes could be grouped into two classes:
those regulated by stress conditions independent of the stress-induced ABA
synthesis; and those regulated by the stress-induced ABA (Shinozaki and
Shinozaki-Yamaguchi, 1997; Liu et al., 1998). In this chapter, we will only
emphasize the stress-regulated gene expression which is mediated by the stress-
induced ABA. Several recent reviews have addressed issues related to stress-
regulated gene expression independent of the stress-induced ABA (Shinozaki
and Yamaguchi, 1996; Bray, 1997).
GENES REGULATED BY ABA
ABA is known to regulate the expression of a variety of genes, including those

encoding seed storage proteins (Bray and Beachy, 1985), LEA (late embryo-
genesis abundant) and RAB (response to ABA) proteins in wheat, rice, barley,
rape, cotton, maize, carrot and Arabidopsis (reviewed in Dure et al., 1989;
Skriver and Mundy, 1990; Chandler and Robertson, 1994; Ingram and Bartels,
1996; Shinozaki and Shinozaki-Yamaguchi, 1997). Table 10.2 contains a
comprehensive collection of stress/ABA-regulated genes and the pertinent
information published before the end of 1997. Four sets of genes are included
in this table: ABA-inducible genes, ABA-suppressible genes, genes mediating
ABA responses and ABA biosynthesis genes. The accession numbers for each
of these genes are also provided so that interested readers can retrieve more
information about these genes from the National Center for Biotechnology
Table 10.2. Genes regulated by ABA, mediating ABA responses and involved in ABA biosynthesis.
Gene Description Function Accession
I. ABA-inducible genes
Di21 Arabidopsis thaliana (Columbia) cold-inducible mRNA X78585
3/16/99 11:19 AM
Abscisic Acid- and Stress-induced Promoter Switches
AthH2 Arabidopsis thaliana blue light-inducible intrinsic membrane protein Z17399
cor15b Arabidopsis thaliana cold-inducible gene, complete cds L24070
cor15a Arabidopsis thaliana cold-inducible gene, complete cds U01377
lti78 Arabidopsis thaliana cold-inducible gene X67671
lti65 Arabidopsis thaliana cold-inducible gene X67670
kin2 Arabidopsis thaliana cold-inducible gene X62281
cor47 Arabidopsis thaliana cold-inducible mRNA X59814
Cor6.6/Kin1 Arabidopsis thaliana cold-inducible L21929
Page 189
rd22 Arabidopsis thaliana drought-inducible gene, complete cds D10703
rab18 Arabidopsis thaliana drought-inducible gene X68042
D19h/GEA6 Arabidopsis thaliana gene for embryogenesis abundant protein (LEA) X66023
T1G11.19 Arabidopsis thaliana gene, homologous to wheat membrance protein AC002376
ARSK1 Arabidopsis thaliana gene, complete cds Protein kinase L22302
p5csB Arabidopsis thaliana gene Pyrroline-5-carboxylate synthetase B X86778
kin1 Arabidopsis thaliana gene for cold- and ABA-inducible protein X51474
Lea Arabidopsis thaliana mRNA for LEA protein in group 3, complete cds D64140
Lea Arabidopsis thaliana mRNA for LEA protein in group 5, complete cds D64139
A1494 Arabidopsis thaliana mRNA for putative thiol protease Thiol protease X74359
Lox1 Arabidopsis thaliana mRNA, complete cds Lipoxygenase L04637
p5csA Arabidopsis thaliana mRNA Pyrroline-5-carboxylate synthetase A X86777
SIMIP Arabidopsis thaliana plasma membrane intrinsic protein AF003728
SITIP Arabidopsis thaliana salt-stress-induced tonoplast intrinsic protein AF004393
Lea76 Brassica napus LEA mRNA X15348
189
Continued over
Table 10.2. Genes regulated by ABA, mediating ABA responses and involved in ABA biosynthesis (continued).
190
pBGA61 Bromus inermis complete cds Aldose reductase L12042

pcC3–06 Craterostigma plantagineum desiccation-related mRNA, complete cds M62989
3/16/99 11:19 AM
Unknown Cicer arietinum LEA mRNA X79680
Unknown Cicer arietinum mRNA related to soybean calmodulin (L01431) CaM protein Y09853

gapC Craterostigma plantagineum desiccation-related mRNA Glyceraldehyde-3-phosphate X78307
CDeT6–19 Craterostigma plantagineum desiccation-related mRNA X74067
Page 190
dsp-22 Craterostigma plantagineum desiccation-related mRNA X66598
CDeT27–45 Craterostigma plantagineum desiccation-related mRNA X69883
PIPc Craterostigma plantagineum major intrinsic protein AJ001294
PIPb Craterostigma plantagineum major intrinsic protein AJ001293
PIPa2 Craterostigma plantagineum major intrinsic protein AJ001292
Unknown Craterostigma plantagineum mRNA hypothetical protein Y11822
CDet11–24 Craterostigma plantigineum AJ002974
Cpsps2 Craterostigma plantigineum Sucrose-phosphate synthase Y11795
Cpsps1 Craterostigma plantigineum Sucrose-phosphate synthase Y11821
CaMF Fagus sylvatica mRNA for CaMF protein Calmodulin X97546
CaMF-1 Fagus sylvatica mRNA for CaMF-1 protein Calmodulin X97612
PKF1 Fagus sylvatica mRNA for PKF1 protein X97547
gGmpm9 Glycine max 16 kDa seed maturation protein (gGmpm9) gene exons 1–2 M97285
p24 Glycine max Century 84 gene, complete cds Oleosin isoform B U09119
LeaA2-D Gossypium hirsutum LEA gene, complete cds M83304
Lea3-D147 Gossypium hirsutum LEA gene, complete cds M81655
Lea3-D11 Gossypium hirsutum LEA gene, complete cds M81654
Lea5-A Gossypium hirsutum LEA gene, complete cds M88324
Lea5-D Gossypium hirsutum LEA gene, complete cds M88323
Lea14-A Gossypium hirsutum LEA gene, complete cds M88321
Lea5 Gossypium hirsutum LEA gene X54448
3/16/99 11:19 AM
Lea2 Gossypium hirsutum LEA gene X54518
LeaA2-A Gossypium hirsutum LEA gene M83303
D113 Gossypium hirsutum LEA gene M19406
Page 191
pHAdhng1 Helianthus annuus gene encoding dehydrin-like protein, partial Dehydrin AJ002741
Unknown Helianthus annuus mRNA for ACC oxidase-related protein ACC oxidase X92651
Sdi-8 Helianthus annuus mRNA for dehydrin-related protein X92650
Unknown Helianthus annuus mRNA for drought-induced protein X92649
Unknown Helianthus annuus mRNA for homologous dehydrin X92647
Unknown Helianthus annuus mRNA for homologous early light-induced protein Early light-induced protein X92646
nsLTP Helianthus annuus mRNA for non-specific lipid-transfer protein Non-specific lipid-transfer protein X92648
HVA1 Hordeum vulgare (Himalaya) HVA1 LEA gene X78205
ABA7 Hordeum vulgare ABA7 mRNA for ABA-induced protein X69817
HVA22 Hordeum vulgare ABA- and stress-inducible gene L19119
pG22–69 Hordeum vulgare gene Aldose reductase X57526
ABA3 Hordeum vulgare mRNA for dehydrin X72748
B19.4 Hordeum vulgare mRNA for LEA protein X62806
191
Continued over
192

B32E Hordeum vulgare mRNA for seed protein X64254
3/16/99 11:19 AM
pJRG5c1 Hordeum vulgare mRNA, partial cds O-methyltransferase U43498
pBAD Hordeum vulgare mRNA Betaine aldehyde dehydrogenase D26448
LtCyp1 Lavatera thuringiaca stress-induced Cysteine proteinase AF007215
pcht28 Lycopersicon chilense mRNA, complete cds Endochitinase L19342
PLC3015 Lycopersicon chilense mRNA Dehydrin M97211
ER5 Lycopersicon esculentum ethylene-responsive LEA-like Endochitinase U77719

TAP2 Lycopersicon esculentum gene Anionic peroxidase X15854
TAP1 Lycopersicon esculentum gene Anionic peroxidase X15853
Page 192
LE20 Lycopersicon esculentum gene H1 histone-like Z11842
LE25 Lycopersicon esculentum LEA gene M76552
le16 Lycopersicon esculentum Non-specific lipid transfer protein U81996
TAS14 Lycopersicon esculentum X51904
pSM2075 M. falcata environmental stress- and ABA-inducible mRNA X59930
pun90 Medicago sativa ABA- and environmental stress-inducible protein S40947
Unknown Medicago sativa environmental stress-inducible protein mRNA M74189
ppd Mesembryanthemum crystallinum gene Pyruvate, orthophosphate dikinase X82489
pOG Nicotiana tabacum osmotin mRNA, complete cds M29279
af70 Norway spruce mRNA for antifreeze-like protein, complete cds D86598
osr40g3 Oryza sativa ABA- and salt-regulated gene Y08988
osr40g2 Oryza sativa ABA- and salt-regulated gene Y08987
salT Oryza sativa ABA- and salt-regulated gene Z25811
Asr1 Oryza sativa ABA- and stress-inducible protein AF039573
SodCc1 Oryza sativa gene Cytosolic copper/zinc-superoxide L19435
dismutase
SodCc2 Oryza sativa gene Cytosolic copper/zinc-superoxide L19434
dismutase
Osem Oryza sativa LEA gene, complete cds U22102
Emp1 Oryza sativa LEA gene X63126
T92 Oryza sativa mRNA for ABA-inducible glycine-rich protein D10424
3/16/99 11:19 AM
Oslea3 Oryza sativa mRNA for group 3 LEA (type I) protein Z68090
osr40c1 Oryza sativa mRNA for novel protein X95402
Rab24 Oryza sativa mRNA, complete cds D63917
GAPDH Oryza sativa mRNA Glyceraldehyde-3-phosphate AF010582
dehydrogenase
rab16B Oryza sativa rab (rapidly response to ABA) gene X52422
rab16C Oryza sativa rab gene X52423
Page 193
rab16D Oryza sativa rab gene X52424
rab21 Oryza sativa water-stress-inducible gene Y00842
PvPRP2–37 Phaseolus vulgaris cell wall-type 2 proline-rich protein Proline-rich cell wall protein U72768
Unknown Phaseolus vulgaris dehydrin mRNA, complete cds U54703
PvLTP24 Phaseolus vulgaris gene Non-specific lipid transfer protein U72765
Unknown Phaseolus vulgaris group 4-late embryogenesis abundant protein U72767
Pvprp1–12 Phaseolus vulgaris LEA mRNA, partial cds U72769
Mip-1 Phaseolus vulgaris putative aquaporin-1mRNA, complete cds U97023
PvLEA-18 Phaseolus vulgaris putative osmoprotector LEA mRNA U72764
WS2 Picea glauca beta-coniferin mRNA, partial cds U19873
EMB15 Picea glauca LEA mRNA, 3′ end of cds L47607
EMB3 Picea glauca LEA mRNA, complete cds L47601
193
Continued over
194
EMB35 Picea glauca LEA mRNA L47605

EMB14 Picea glauca lea-like protein mRNA, complete cds L47606
3/16/99 11:19 AM
lp3-1 Pinus taeda water-stress-inducible protein (lp3-1) gene, complete cds U52865
P393 Pisum sativum cDNA AA430912
ABR17 Pisum sativum mRNA for ABA-responsive protein Z15127
ABR18 Pisum sativum mRNA for ABA-responsive protein Z15128
pAPR141 Prunus armeniaca ABA- and stress-induced ripening protein U93164
PM2.1 Pseudotsuga menziesii metallothionein-like protein mRNA, complete cds Metallothionein U55051

Unknown Riccia fluitans mRNA for landform specific protein X89041
Unknown Sequence 1 from patent US 5656474 Endochitinase I60506
Page 194
Unknown Sequence 3 from patent US 5656474 Endochitinase I60507
dhn1 Solanum commersonii dehydrin gene X83596
pA13 Solanum commersonii mRNA for osmotin-like protein X67121
SGRP-1 Solanum commersonii mRNA RNA-binding protein Y12424
Asr2 Solanum lycopersicum ABA- and ripening-induced protein gene L20756
Td Solanum tuberosum ABA-, jasmonate- and wound-inducible mRNA Threonine deaminase X67846
LAP Solanum tuberosum ABA-, jasmonate- and wound-inducible mRNA Leucine aminopeptidase X67845
Cys-pin Solanum tuberosum ABA-, jasmonate- and wound-inducible mRNA Cysteine proteinase inhibitor X67844
cdi Solanum tuberosum ABA-, jasmonate- and wound-inducible mRNA Cathepsin D inhibitor X67843
dhn1 Solanum tuberosum gene X83597
POTLX-3 Solanum tuberosum mRNA, complete cds Lipoxygenase U60202
pin2 Solanum tuberosum wound-induced mRNA X99095
dhn2 Sorghum bicolor dehydrin mRNA, partial cds U63831
p8/1/1 Spirodela polyrrhiza mRNA, induction by ABA is antagonized Basic peroxidase Z22920
by cytokinin
PDR5 Spirodela polyrrhiza mRNA ABC transporter Z70524
tur1 Spirodela polyrrhiza mRNA D-myo-inositol-3-phosphate synthase Z11693
H26 Stellaria longipes mRNA for dehydrin-like protein Z21500
MA56 Sugarcane mature stalk Saccharum sp. cDNA clone, stress inducible AA644713
PM-19 Triticum aestivum ABA-induced plasma membrane protein U80037
Em Triticum aestivum group 1 LEA Y00123
3/16/99 11:19 AM
Unknown Triticum aestivum mRNA for an ABA-responsive gene, rab X59133
pMA2005 Triticum aestivum mRNA for a group 3 LEA protein X56882
pMA1951 Triticum aestivum mRNA, partial cds U43718
Gbl1 Triticum aestivum storage protein gene, complete cds M81719
Orion Zea mays ABA- and ripening-inducible-like protein mRNA, complete U09276
zEST00632 Zea mays ABA- and salt-inducible cDNA clone AA054809
Page 195
Rab15 Zea mays ABA-inducible gene for glycine-rich protein RNA-binding protein X12564
rab28 Zea mays gene X59138
Fer2 Zea mays gene Ferritin X83077
Fer1 Zea mays gene Ferritin X83076
5C02G05-T7 Zea mays glycine-rich protein from endosperm T18666
EMB5 Zea mays LEA mRNA, complete cds M90554
zEST00336 Zea mays leaf, Stratagene #937005 Zea mays cDNA clone W49866
zEST00278-5 Zea mays leaf, Stratagene #937005 Zea mays cDNA clone T26946
Emb564 Zea mays mRNA from an embryo-specific ABA-inducible gene X55388
LIP Zea mays mRNA, complete cds Lipase L35913
Rab17 Zea mays rab gene X15994
sod4 Zea mays superoxide dismutase 4 gene, partial cds Superoxide dismutase U34726
195
Continued over
196
II. ABA-suppressible genes

Amy1 Hordeum vulgare gene for α-amylase (EC 3.2.1.1) X54643
3/16/99 11:19 AM
pHV19 Hordeum vulgare α-amylase type B isozyme mRNA, complete cds α-amylase K02638
pJRG14C3 Hordeum vulgare ribulose-1,5-bisphosphate carboxylase small subunit U43493
GAST1 Lycopersicon esculentum GA-inducible and ABA-suppressible gene X63093
ICL Zea mays isocitrate lyase (ICL) mRNA, partial cds Isocitrate lyase U69129

III. Genes mediating ABA responses
GBF3 Arabidopsis thaliana G box factor 3 mRNA, complete cds U51850
ABI3 Arabidopsis thaliana gene encoding ABI2 protein Embryo-specific transcription factor AJ002473
Page 196
ABI2 Arabidopsis thaliana gene encoding ABI3 protein Phosphatase Y08966
ABI1 Arabidopsis thaliana mRNA for ABI1 protein Phosphatase X77116
cpm7 Craterostigma plantagineum gene myb-related transcription factor U33917
GRPF1 Fagus sylvatica mRNA for GRPF1 protein samll GTP-binding protein X98539
GTP1 Fagus sylvatica mRNA for GTP1 protein samll GTP-binding protein X98540
DPBF-1 Helianthus annuus Dc3 promoter-binding factor-1 (DPBF-1) mRNA bZIP transcription factors AF001453
DPBF-2 Helianthus annuus Dc3 promoter-binding factor-2 (DPBF-2) mRNA bZIP transcription factors AF001454
EmBP-1 Hordeum vulgare mRNA for transcription factor EmBP-1 X98747
vp1 Hordeum vulgare mRNA for transcription factor vp1 Y09939
OSBZ8 Oryza sativa GBF-type bZIP protein OSBZ8 mRNA, complete cds bZIP protein U42208
OSBZ8 Oryza sativa GBF-type bZIP protein OSBZ8 mRNA, complete cds bZIP DNA-binding factor U42208
efa27 Oryza sativa mRNA for Ca2+-binding EF hand protein Ca2+-binding protein X89891
osZIP-1a Oryza sativa Nipponbare bZIP DNA-binding factor (osZIP-1a) mRNA bZIP DNA-binding factor U04295
osZIP-2a Oryza sativa Nipponbare bZIP DNA-binding factor (osZIP-2a) mRNA bZIP DNA-binding factor U04296
osZIP-2b Oryza sativa Nipponbare bZIP DNA-binding factor (osZIP-2b) mRNA bZIP DNA-binding factor U04297
PvAlf Phaseolus vulgaris gene homologous to Z. mays VP1 and Embryo-specific transcription factor U28645
A. thaliana ABA3
PtABI3 Populus trichocarpa cv. Trichobel ABI3 gene Embryo-specific transcription factor AJ003165
3/16/99 11:19 AM
PKABA1 Triticum aestivum ABA- and drought-inducible protein kinase mRNA Protein kinase M94726

EmBP-1b Triticum aestivum DNA-binding protein (EmBP-1b) mRNA, complete cds bZIP DNA-binding factor M62893
EmBP-1c Triticum aestivum DNA-binding protein (EmBP-1c) mRNA, partial cds bZIP DNA-binding factor M63999
VP1 Zea mays gene encoding VP1 protein Embryo-specific transcription factor AJ001635
IV. ABA biosynthesis genes
ABA2 Nicotiana plumbaginifolia mRNA for zeaxanthin epoxidase Zeaxanthin epoxidase X95732
VP14 Zea mays viviparous-14 (vp14) mRNA, complete cds U95953
Page 197
197
Information at the website: http://www.ncbi.nlm.nih.gov/. A large fraction of

the stress/ABA-induced proteins are neither enzymes nor storage proteins. It
has been suggested that they may function in protecting proteins and
membranes from damage due to loss of water in the cytoplasm during
desiccation usually at the last stage of seed development (Dure, 1993). For
example, it has been shown that the level of LEA proteins is closely correlated
with desiccation tolerance both in the naturally developing and germinating
seeds (Blackman et al., 1991). However, a causal relationship between the level
of LEA proteins and desiccation tolerance has yet to be demonstrated.
Specific mRNAs and proteins, such as some RAB and LEA proteins, also
accumulate in stressed vegetative tissues. Some of these proteins possess
conserved, positively charged domains. It was initially suggested that they may
bind nucleic acids and hence regulate gene expression (Mundy and Chua,
1988). In fact, pMAH9, a maize gene induced by ABA and water stress, encodes
a protein containing the consensus sequence (RGFGFVXF) of RNA-binding
protein (Gomez et al., 1988; Bandziulis et al., 1989). It has been shown that the
protein, MA16, is indeed a RNA-binding protein with preference for guanosine-
rich and uridine-rich sequences (Ludevid et al., 1992). Therefore, ABA-
responsive genes may encode RNA-regulatory proteins which might be capable
of altering developmental events in plants. Other notable ABA-regulated genes
include those encoding a barley aldose reductase (Bartels et al., 1991), a
Craterostigma plantagineum cytosolic glyceraldehyde-3-phosphate dehydrogenase
(Velasco et al., 1994) and a sucrose-phosphate synthase (Ingram et al., 1997),
an L-isoaspartyl protein methyltransferase (Mudgett and Clarke, 1996) and a
serine/threonine protein kinase (Anderberg and Walker-Simmons, 1992) in
wheat, a thioprotease (Williams et al., 1994) and a proline biosynthesis enzyme
(pyrroline-5-carboxylase synthetase) (Strizhov et al., 1997) in Arabidopsis, and
a duckweed peroxidase (Chaloupkova and Smart, 1994). Some of these ABA-
induced enzymes are involved in the biosynthesis of potential osmoprotectants,
such as sugar alcohols and proline, thus their induction by ABA/stress appears
to be physiologically relevant. In contrast to the large number of ABA-inducible
genes, only a handful of genes are known to be suppressed by ABA, most of
them being germination-specific enzymes such as α-amylase and protease in
barley grains (Jacobsen and Chandler, 1987; Mikkonen et al., 1996).
MECHANISM OF ABA ACTION AND ABA-RESPONSIVE PROMOTERS
The mechanism of ABA action has been the subject of intense interest to plant
biologists for many years. Although little progress has been made concerning
the initial perception of ABA by a putative receptor, there have been quite a few
reports about signal transduction pathways, the cis-acting promoter sequences
involved in ABA response and DNA-binding proteins interacting with the ABA-
responsive cis-acting sequence. In barley aleurone layers, ABA induces dozens
of genes and at least two of them, HVA1 and HVA22, have been shown to also
Abscisic Acid- and Stress-induced Promoter Switches 199
be induced by drought, salinity and temperature stress conditions (Fig. 10.1)

(Hong et al., 1992; Shen et al., 1993). The promoters of these genes have been
analysed by linking them to the coding region of a reporter gene, GUS, followed
by analysis of GUS expression in barley tissues which have been transformed
with these gene constructs via particle bombardment (biolistic technique). The
analyses of these promoters have revealed sequences which are necessary and
sufficient for ABA/stress induction. The prerequisite to analyse a promoter for
ABA-responsive cis-acting sequence is to demonstrate that the transcription
control is the main regulatory mechanism for a given gene. By comparing the
level of HVA22 mRNA and fold of induction of GUS expression from the reporter
construct, which contains the GUS coding sequence driven by the ABA-
responsive HVA22 promoter, we have demonstrated that the regulation of the
HVA22 promoter is mainly at the level of transcription (Shen et al., 1993). As
shown in Fig. 10.2, the level of the HVA22 mRNA is well correlated with the
fold of induction of GUS activity. This crucial experiment has clearly shown that
the effect of ABA observed in transient studies using an ABA promoter/reporter
gene construct reflects the in vivo effect of ABA on the expression of the native
gene.
Definition of cis-acting promoter sequences which are necessary and

sufficient for ABA-induced gene expression
To delineate the sequences that are important for ABA response of these genes,
several Rab and Lea genomic clones have been obtained. Sequence comparisons
of the 5′ upstream sequence of these genes have identified conserved sequences
that may be ABA-responsive DNA elements (Marcotte et al., 1989; Skriver et al.,
1991). Transient assays have been conducted with protoplasts isolated from
rice suspension cultures and chimeric genes with the wheat Em gene promoter
linking to the coding region of the GUS gene. A 260 bp fragment (2168 to +92)
of the Em gene triggers a 15- to 20-fold increase in GUS expression in the
presence of ABA (Marcotte et al., 1989). A 75 bp fragment of this gene, when
fused in either direction to a truncated 35S promoter, gives a more than tenfold
induction of GUS activity in the presence of ABA (Guiltinan et al., 1990). In this
region, there are three noticeable elements, designated as Em1a
(GGACACGTGGC), Em1b (GCACACGTGC) and Em2 (CGAGCAGGC) (Guiltinan
et al., 1990). With a similar system, Mundy et al. (1990) have reported that a
promoter fragment between 2294 and 252 of the rice Rab16A gene is
sufficient to confer ABA-dependent expression of the chloramphenicol
acetyltransferase reporter gene in rice protoplasts. Sequence comparisons of
ABA-inducible genes generate a consensus sequence with an ACGT-core.
Skriver et al. (1991) have demonstrated that six copies of the sequence
GTACGTGGCGC are able to confer ABA inducibility to a 246 35S minimal
promoter (a sixfold induction). This type of sequence containing an ACGT core
has since been named the ABA response element (ABRE).
Control ABA
Shoot
Shoot
Root
Root
Control Dehydration Control NaCl
Shoot
Shoot
Shoot
Shoot
Root
Root
Root
Root
22°C 1°C 22°C 22°C 37°C
Shoot
Shoot
Shoot
Shoot
Shoot
Root
Root
Root
Root
Root
Fig. 10.1. Northern blot analysis showing ABA and stress induction of the HVA1
gene in 3-day-old barley seedlings. The plants were treated with ABA, drought
(dehydration), NaCl, cold (1°C and recovery to 22°C) and heat (37°C). (From Straub
et al., 1994.)
The ACGT core containing ABRE is conserved in all ABA-regulated genes for
which sequence data are available (Michel et al., 1993). However, it is puzzling
that the sequence is similar to the consensus G box motif found in a number of
yeast promoters (Donald et al., 1990) and plant promoters responsive to visible
and ultraviolet light (Schulze-Lefert et al., 1989) as well as in the anaerobically
induced Adh-1 promoter from maize (Delisle and Ferl, 1990). This conserved G
box/ABRE sequence is important for transcription of some of these genes, but
none appear to be positively regulated by ABA. Furthermore, a sequence
similar to ABRE/G box is also found in the promoters of genes of bacteria
(Agrobacterium nopaline synthase, nos) and virus (CaMV 35S), yet none of them
are known to be directly regulated by ABA. A similar sequence (E box:
GGCCACGTGACC) is also found in the major later promoter of adenovirus and
in certain mammalian promoters and can compete with the G box element for
Fig. 10.2. Dosage response curve of ABA-inducible HVA22 RNA accumulation

(L) and dosage response of GUS gene expression driven by HVA22 promoter (l).
For the Northern analysis, RNA was isolated from mature imbibed aleurone layers
treated with ABA at the concentrations of 1029 to 1024 M respectively.
Correspondingly, protein extract was prepared from mature half-seeds treated with
or without 1029 to 1024 M ABA for 24 h, after the seeds having been shot with
PDraIIIGU and the internal control pAMC18 constructs. The ABA induction was
expressed as the ratio of normalized GUS activity of the samples treated with ABA
over that of those incubated with buffer only. Each point represents the mean of at
least six replicas. Each lane of Northern blot analysis was loaded with 5 µg of total
RNA prepared from the aleurone layers treated without (control) or with 1029 to
1024 M ABA. The autoradiography was quantified with a computing densitometer
(Model 300A, Molecular Dynamics, California). (From Shen et al., 1993.)
binding to plant nuclear extracts (Guiltinan et al., 1990). For the ease of
presentation, we designate the G box/ABRE sequences as ACGT boxes for the
rest of this chapter. The presence of ACGT boxes in non-ABA responsive
promoters raises a question: what confers the specificity of ABA response? Is it
the flanking sequence of the ACGT box or another cis-acting element?
In order to address this question, we have analysed the barley HVA22 and
HVA1 promoters following both the loss- and gain-of-function approaches.
Specifically, we have performed transient-expression studies of the GUS reporter
gene driven by the wild-type and various mutants of the HVA22 or HVA1
promoter (Shen et al., 1993; Straub et al., 1994; Shen and Ho, 1995; Shen et
al., 1996). The DNA construct, containing the GUS gene driven by the
promoters, is delivered into aleurone cells of barley embryo-less half-seeds by
particle bombardment. The bombarded seeds, after treatment with or without

ABA, are homogenized, and GUS activities are determined. Because of the
inherent variability of transfection efficiencies, another reporter gene, LUC,
coding for luciferase from firefly, is included as an internal control. The LUC-
coding sequence is driven by a non-ABA-responsive maize ubiquitin promoter
(Bruce et al., 1989). Therefore, the measured GUS activity of one construct
could be normalized with the luciferase activity from the same shot. This
approach has led us to define the promoter sequences which are necessary and
sufficient for ABA response in two ABA/stress-responsive barley genes, HVA22
and HVA1.
A short promoter fragment of HVA1 or HVA22 gene confers a high level of

ABA induction
To test whether the sequence containing ACGT boxes is able to confer ABA
inducibility, short promoter fragments containing an ACGT box are linked to
the 5′ end of a truncated (260) barley α-amylase gene (Amy64) promoter.
While the control (Amy64 minimal promoter only) construct is not affected by
ABA treatment, the addition of a 49 bp promoter fragment from the HVA22
gene in either orientation gives a high level (24–38-fold) of induction (1C+ and
1C2, Fig. 10.3). This 49 bp fragment contains an ACGT box named A3.
Similarly, a 68 bp promoter fragment from the HVA1 gene is also able to confer
a high level of ABA induction (Straub et al., 1994). Within this region, there is
also an ACGT box (A2). These data suggest that all information necessary and
sufficient for ABA response is present in these short promoter fragments.
An ACGT box is necessary but not sufficient for ABA induction

To determine the sequences within the 49 bp promoter region that govern the
ABA responsiveness of the fragment, a linker-scan analysis has been performed
with the construct 1C+ and the key observations are summarized in Fig. 10.4.
The sequence of the promoter fragment is replaced at 10 base intervals. The most
drastic reduction occurs with two mutants, LS-08 and LS-11; the absolute levels
of GUS activities obtained from these constructs drop to below 5% of that obtained
with the wild-type. Accordingly, the fold of induction decreases from the 44-fold
in the case of wild-type to only fourfold for these two mutants (Fig. 10.4a). In
construct LS-08 the ACGT box (A3) is mutated while in LS-11 the last 9 bp of the
49 bp promoter fragment is replaced with a random sequence. The results
presented in Fig. 10.4 clearly indicate that in addition to an ACGT box, the last 9
bp are also necessary for ABA induction. This 9 bp represents a novel cis-acting
sequence involving the ABA response and is denoted CE1 (coupling element).
Sequences similar to CE1 are present in other ABA-responsive genes such
as maize Rab17 (Vilardell et al., 1990) and rice Rab16A (Mundy and Chua,
1988). None of these elements have been tested to determine whether they are
indeed involved in the ABA responsiveness of those genes. In light of the
observations described above, it would be definitely worthwhile investigating
whether they function as coupling elements for ABA responses in those genes.
Fig. 10.3. A 49 bp fragment containing A3 confers ABA inducibility to a minimal

promoter. The minimal promoter (to 260) and the 5′ untranslated region (to +57)
from the barley Amy64 α-amylase gene was fused to the 5′ end of HVA22
intron1–exon2–intron2 fragment (thin black angled line) (Shen and Ho, 1995). The
3′ region (black bar to the right of the GUS coding sequence) was from the HVA22
SphI–SphI genomic fragment, including the polyadenylation sequence (AATAAA).
This minimal promoter (MP64) is not responsive to gibberellin or ABA. The 49 bp
HVA22 promoter fragment, shown at the bottom, was fused in either positive (i.e.
the same as in the native promoter) or negative orientation. The 2C+, 3C+ and 4C+
constructs contain two, three or four tandem copies of the 49 bp sequence,
respectively. The numbering of the 49 bp fragment is relative to the transcription
start site of the HVA22 gene. Relative GUS activity of each construct is the mean of
four replicas. Error bars indicate the standard error of each set of replicas.
3 indicates fold of increase. (From Shen and Ho, 1995.)
A similar approach has been used to study the 68 bp HVA1 promoter

fragment (Fig. 10.4b). This sequence is replaced at 10 or 12 bp intervals
(fragments I to VI, Fig. 10.4b). The most drastic mutations are in fragment III
and IV. When either of these two fragments is replaced with a random sequence,
Fig. 10.4. Linker-scan analyses of the short fragments from HVA22 and HVA1
genes define novel elements involved in the ABA response. The numbering of the
fragments is relative to the transcription start site of the HVA22 or HVA1 gene. (a)
The 49 bp HVA22 promoter sequence was mutated at 10 bp intervals. (b) The
68 bp HVA1 promoter sequence linker-scan analysis. These experiments
demonstrate that both the ACGT box and a novel coupling element (either CE1 or
CE3) are necessary for ABA response. (From Shen and Ho, 1995, and Shen et al.,
1996.)
the ABA induction drops from 38- to fivefold, with the absolute level of GUS
activity being less than 10% of that obtained with the wild-type fragment. The
negative effect from the fragment IV is expected because it appears to be an
ACGT box (A2). In contrast, fragment III shares no homology with any of the
cis-acting elements which may be involved in ABA response, including CE1.
Hence, fragment III in the HVA1 promoter sequence has been designated as CE3
(coupling element 3).
An ACGT box could interact with either a distal or a proximal coupling

element to confer ABA response
It has been shown that to achieve a high level of ABA induction, the ACGT box
sequence in the HVA22 promoter, i.e. A3, has to interact with a distal element,
CE1, and that in HVA1 the ACGT box sequence, A2, needs to couple with the
neighbouring sequence, CE3. Therefore, an exchanging experiment has been
performed and it is demonstrated that the two ACGT boxes are fully exchange-
able (Shen et al., 1996). Hence, it appears that an ACGT box can interact with
either a distal coupling element (CE1) or a proximal element (CE3) to form a
promoter complex capable of conferring a high level of ABA induction. Taking
all these observations together, it appears that the ABA response relies on the
interaction of an ACGT box and a coupling element. We therefore designate the
promoter complex containing A3 and CE1 from the HVA22 gene ABA response
complex 1 or ABRC1 and that from the HVA1 gene, containing A2 and CE3
ABA response complex 3 or ABRC3 (Fig. 10.5).
The interaction of an ACGT box with the distal coupling element is

different from that with a proximal element
Although the ACGT box can interact with a distal or a proximal coupling
element to confer a similar level of ABA induction, the coupling interaction
Fig. 10.5. The modular nature of ABA-response complexes in two ABA-responsive

barley genes, HVA1 and HVA22. In HVA22, an ABA-response complex is
composed of an ACGT box, A3 and a distal coupling element (CE1). In HVA1, in
contrast, an ABA-response complex consists of an ACGT box, A2 and a proximal
coupling element (CE3).
between these two cis-acting elements in ABRC1 appear to be quite different

from that in ABRC3. The orientation of both cis-acting elements is critical for
ABA induction in ABRC1 while the orientation of the ACGT box or CE3 in
ABRC3 has less impact on the response of this complex to ABA (Shen, Q.,
Zhang, P. and Ho, T.-H.D., unpublished data). Reversing the orientation of A3
or CE1 reduces the induction level to about 20% of that of the wild-type
sequence. When the orientations of both A3 and CE1 are reversed, the
induction level drops to only 5% of that obtained from the wild-type ABRC1.
These observations suggest that both A3 and CE1 have to be properly oriented
in the promoter so that they can interact with each other to confer a high level
of ABA induction. For the ABRC3 from the HVA1 gene promoter, the elements
of A2 and CE3 are less sensitive to changes in orientation. Reversing the
orientation of A2 results in a small decrease of ABA induction, up to 80% of the
ABA induction level is retained in comparison with that of the wild-type
ABRC3. In contrast, the orientation of CE3 is more critical than the A2 element
in this complex. When CE3 is reversed, the induction level decreased to 40% of
that of the wild-type ABRC3. When both elements are reversed, the mutant
ABRC3 complex still confers up to 29% of ABA induction, much higher than
the 5% from the double mutant of ABRC1 from the HVA22 gene.
The ABRC1, but not ABRC3, is phase-sensitive relative to their positions on

the DNA double helix
The two ABA-response promoter complexes, ABRC1 and ABRC3, are not only
different in terms of their sensitivities to the orientation of two cis-acting
elements, but these complexes also respond quite differently to the changes in
the distance between the ACGT box and the coupling element (Shen, Q., Zhang,
P. and Ho, T.-H.D., unpublished data). Figure 10.6 shows the ABA induction
level obtained from ABRC1 and ABRC3 mutants in which the distance between
the ACGT box and coupling elements is altered. When the A2 and CE1 are
separated by an increment of 10, 20 or 30 bp, the induction level is always
higher than elements separated by 5, 15 or 25 bp. For instance, the ABA
induction is only fivefold when A3 is 5 bp apart from CE1. When the distance
increases to 10 bp, the ABA induction rises to 16-fold. Because most DNA in a
physiological condition is in the B-form conformation and each turn of B-form
DNA consists of 10 bp, it is likely that the ABA induction from ABRC1 relies on
the in-phase interaction between protein factors binding to A3 and CE1.
Interestingly, the ABA induction level increases, in general, as the distance
between the ACGT box and the coupling element is lengthened. For example,
when A3 and CE1 are 30 bp apart, the induction level is as high as 26-fold,
compared to 20-fold at 20 bp apart and 16-fold at 10 bp apart.
In contrast, ABRC3, composed of A2 and CE3, does not appear to be phase-
sensitive. The highest induction (40-fold) is obtained with the wild-type
complex, in which CE3 lies immediately upstream to A3. When a 5 bp sequence
is inserted between the elements, the induction decreases to 26-fold. The induc-
tion level decreases as the distance between A2 and CE3 is lengthened. When
Fig. 10.6. The effect of distance between the ACGT box and CE elements on ABA
responsiveness. For the HVA1 gene promoter, the ABA response decreased when
the distance between CE3 and A2 elements is lengthened. For the HVA22 gene
promoter, the distance between CE1 and A3 elements does not seem to be relevant;
however, both elements must be in the same phase relative to the DNA double
helix, to achieve the maximal ABA response. The solid line refers to the HVA1 gene
promoter and the dashed line to the HVA22 gene promoter. (Shen, Q., Zhang, P.
and Ho, T.-H.D., unpublished data.)
these two elements are 20 bp apart, the induction drops to 19-fold. A further
increase of the distance to 25 bp results in almost complete loss of induction,
only sixfold is obtained. Therefore, it appears that ABRC3 is distance-sensitive
while ABRC1 is phase-sensitive.
Signal response specificity relies on the interaction of an ACGT box with a

coupling element
The ‘coupling model’ described above has at least partially resolved the puzzle
for the involvement of ACGT box in responding to a variety of different
environmental and physiological cues. As summarized in Fig. 10.7, similar to
the observation that ABA response relies on the interaction of an ACGT box
(A3, GCCACGTACA or A2, CCTACGTGGC) with a coupling element (CE1,
TGCCACCGG or CE3, ACGCGTGTCCTC), the presence of both an ACGT box (Box
II, TCCACGTGGC or Box III, TGTACGTGGA) and another element (Box I,
GTCCCTCCAACCTAACC or Box IV, CTTCACTTGATGTATC) is necessary for the
UV-light response of the chalcone synthase promoter (Schulze-Lefert et al.,
1989). Specific point mutations within either Box II or Box I result in a dramatic
reduction of light-induced gene expression (Block et al., 1990). Similarly, Donald
Fig. 10.7. Schematic model of signal-specific complexes. The ACGT cores in G

box-like sequences are in boldface letters. The distance between the G box-like
sequence and the coupling sequence is indicated by the number (N) of nucleotides.
The coumaric acid-response complex is adopted from Loake et al. (1992), UV-light-
response complexes are from Block et al. (1990), and white light-response
complexes are from Donald and Cashmore (1990). (Modified from Shen and Ho,
1995.)
and Cashmore (1990) have reported that mutations in either G box

(CTTCCACGTGGC, an ACGT box) or I box (I-1, AACGATAAGATT and I-2,
AGCCGATAAGGG) dramatically reduce the expression from the light-
responsive Arabidopsis rbcS-1A gene. In the case of a chalcone synthase gene,
the combination of H box (CCTACC-N7-CT) and ABRE (CACGTG) cis elements is
necessary for the response of this promoter to the phenylpropanoid-pathway

intermediate ρ-coumaric acid (Loake et al., 1992). Although the ACGT box
sequences in these genes are similar, elements interacting with them, as shown
in Fig. 10.7, are different in the complexes involved in the response to ABA
(Shen and Ho, 1995), coumaric acid (Loake et al., 1992), UV-light (Schulze-
Lefert et al., 1989a), and white light (Donald and Cashmore, 1990). Therefore,
it appears that the signal response specificity is at least partially determined by
the coupling elements (Fig. 10.7).
Construction of ABA switches with different levels of ABA induction and

transcription strength
The delineation of ABRC1 and ABRC3 leads to the conclusion that ACGT boxes
in HVA1 and HVA22 promoters can confer a high level of ABA response
provided that they are coupled with a distal or a proximal coupling element,
namely CE1 or CE3. At the same time, several recombinant DNA constructs
have been shown to be able to drive the expression of GUS reporter gene at high
levels. These ABA-responsive promoter switches are summarized and their
transcription strengths are shown in Fig. 10.8. One copy of the 49 bp HVA22
ABRC1 is able to confer more than 30-fold ABA induction and additional copies
of ABRC1 added to the reporter construct led to even higher level of ABA
induction (Fig. 10.8a). The 68 bp ABRC3 of HVA1 gene turns out to be even
stronger than the HVA22 ABRC1; one copy of this fragment led to 20-fold
induction with the absolute level of GUS activity twice as high as that obtained
with the HVA22 ABRC1 (Fig. 10.8b). Moreover, the presence of two coupling
elements further enhances the expression of the construct when they interact
with the ACGT box either from HVA22 or HVA1 (Fig. 10.8c and d).
ABA molecular switches are functional in vegetative tissues

All of the observations mentioned above are obtained with aleurone tissues in
barley seeds. However, it has been known that both HVA1 and HVA22 genes are
also expressed in vegetative tissues (Hong et al., 1992; Shen, Q. and Ho, T.-H. D.,
unpublished results). To investigate whether the defined ABA-response
complexes also function as ABA-responsive promoter switches in the vegetative
tissues, constructs C17 containing the 49 bp HVA22 ABRC1 and C1
containing the 68 bp HVA1 ABRC3 have been introduced into 6-day-old barley
leaf tissues. Data shown in Fig. 10.9 demonstrate that both ABA promoter
complexes are able to confer ABA induction in vegetative tissues. As observed
with the aleurone tissue, the HVA1 ABRC3 appears to be more responsive to
ABA than the HVA22 ABRC1.
ABA-responsive promoter switches are regulated by ABA, water deficit and

NaCl treatment in stably transformed rice plants
To test whether the ABRC1 defined in transient studies is functional in stably
transformed plants, one or four tandem copies of ABRC1 are fused to the
minimal (2100) promoter of the rice actin (Act1) promoter which is linked to
Fig. 10.8. Versions of DNA molecular switches controlling the expression of ABA-
inducible promoters. (a) HVA22 complex consists of an ACGT box (A3) and a distal
CE1. The normalized GUS activity from the ABA-treated sample of the single copy
ABRC1 construct is taken as 100% throughout the figure. ‘Fold’ stands for fold
induction calculated as described (Shen et al., 1996). (b) The ABA-response
complex in HVA1 promoter consists of an ACGT box (A2) and the proximal CE3.
(c) and (d) The ternary ABA-response complexes consisting of two coupling
elements and an ACGT box. (From Shen et al., 1996.)
the coding region of GUS reporter gene. The synthetic promoter is introduced
into rice embryos from which stably transformed plants containing one or
multiple copies of the transgene are generated. It is observed that transgenic
plants containing a single-copy transgene have a higher level of GUS expression
than those containing multiple copies. Northern blot analyses indicate that the
ABRC1 in these transgenic rice plants are responsive to the following
treatments: 50 µM ABA for 20 h, drought stress (withholding water for 6 days)
and salt stress (150 mM NaCl for 72 h) (Su et al., 1998). Quantitative analyses
of the GUS activities in the transgenic rice plants demonstrate that the
ABA/stress induction of GUS expression varies from three- to eightfold
depending on treatments and rice tissues studied. In all cases studied, however,
synthetic promoters containing four copies of ABRC1 confer higher levels of
ABA/stress induction than the promoter containing only a single copy of
ABRC1. It should be noted that the long (up to 2100) minimal promoter may
Fig. 10.9. Both the 49 bp HVA22 promoter containing ABRC1 and the 68 bp
HVA1 promoter containing ABRC3 are functional in a vegetative tissue. The DNA
constructs were bombarded into leaf tissue from 6-day-old greenhouse-grown
barley plants and treated with or without 1024 M ABA in H2O at 24°C for 24 h. The
relative GUS activity of each construct is the mean of four replicas. The error bar
indicates the standard error of each set of replicas. 3 indicates fold induction.
(From Shen et al., 1996.)
account for the lower induction level observed. In the transient studies in
barley, a much shorter (up to only 260) barley Amy6-4 promoter was used. As
a result, much higher induction is obtained in these transient expression
studies than in stably transformed rice plants (Shen and Ho, 1995).
Experiments are ongoing to express the synthetic gene containing the shorter
minimal promoter and one or four copies of ABRC1.
ABA signal transduction components
Genetic analyses have led to the cloning of several genes regulating the
sensitivity of plants to ABA (for review see Leung and Giradat, 1998). One of
these genes is maize Viviparous-1, or VP1. It has been shown that the VP1 gene
encodes a transcription factor involved in ABA induction (McCarty et al., 1991).
The ABA-induced expression of some genes, for instance, maize Rab28 (Pla et
al., 1991), is VP1-independent while the induction of others, such as the wheat
Em gene (McCarty et al., 1991), is VP1-dependent. Although the data presented
in Fig. 10.4 demonstrate that ABRC3 is different from ABRC1 in terms of their
transcription strengths and structures, it is also likely that different ABRCs are
mediated by different signal transduction pathways. To test this hypothesis, we
cobombard the effector construct consisting of the maize VP1 coding sequence
driven by a constitutive 35S promoter (McCarty et al., 1991) along with the
reporter construct, C1 (containing ABRC3) or C17 (containing ABRC1).

McCarty et al. (1991) have shown that coexpression of VP1 in maize protoplasts
enhanced the ABA response of the wheat Em promoter, and the presence of
both VP1 and ABA has a synergistic effect (McCarty et al., 1991). As shown in
the right half of Fig. 10.10, a similar pattern of VP1 activation on the ABRC3 of
the barley ABA-responsive HVA1 Lea gene is observed in barley aleurone cells.
Coexpression of VP1 leads to a fourfold induction of ABRC3, compared to the
14-fold induction by ABA. In the presence of ABA and VP1, the induction
increases to 31-fold, suggesting a synergistic effect of ABA and VP1 on ABRC3.
In contrast, ABRC1 does not appear to respond to VP1 at all (left half,
Fig.10.10). In the absence of ABA, VP1 coexpression fails to activate ABRC1,
giving no induction (13). The presence of both VP1 and ABA results in a
17-fold induction, similar to ABA treatment alone (15 3). Therefore, VP1
appears to be able to differentiate ABRC3 from ABRC1 in mediating ABA
responses.
Fig. 10.10. ABRC3, but not ABRC1, is activated by the maize VP1 transcription
regulator. The 35S-Sh-Vp1 construct containing the VP1 coding sequence driven by
the 35S constitutive promoter was cobombarded into barley aleurone layers along
with the construct containing ABRC1 (C17) or ABRC3 (C1) at 1 : 3 ratio (ABRC
construct : Vp1 construct). Similar results were obtained at 1 : 0.2 ratio. Symbols
below the bars indicate treatments with (+) or without (2) ABA- and the VP1-
effector construct. The relative GUS activity of each construct is the mean of four
replicas. The error bar indicates the standard error of each set of replicas. 3
indicates fold induction. (From Shen et al., 1996.)
In addition to VP1, other genes governing the sensitivity of plant to ABA

have been reported. A mutation of the Arabidopsis Era1 gene enhances
sensitivity of the plant to ABA. The Era1 gene has been cloned and shown to
encode the β-subunit of a protein farnesyl transferase (Cutler et al., 1996). ABA
treatment alters the level of cellular Ca2+ concentration (Gilroy and Jones,
1992) and an ABA-inducible gene which encodes a novel plant Ca2+-binding
protein in rice has been reported (Frandsen et al., 1996). More recently, Wu et
al. (1997) have identified cyclic ADP-ribose (cADPR) as a signalling molecule
in the ABA response and cADPR has been shown to exert its effects by way of
calcium.
Protein phosphorylation and dephosphorylation are also likely to be
involved in ABA-regulated gene expression. An ABA- and stress-inducible gene
cloned from wheat embryos encoded a protein with sequence homology to
protein kinases, i.e. it contained the feathers of serine/threonine protein kinases,
including all 12 conserved regions of the catalytic domain (Anderberg and
Walker-Simmons, 1992). Recently, an ABA-induced mitogen-activated protein
kinase activity has been suggested to be involved in ABA regulation in barley
aleurone protoplasts (Knetsch et al., 1996). A mutation in the Arabidopsis gene,
Abi1, encoding a protein phosphatase 2C abolishes ABA responsiveness (Leung
et al., 1994; Meyer et al., 1994). The potential role of Abi1 and the ABA-induced
protein kinase, PKABA1, has been tested in barley aleurone cells. It appears
that the expression of the mutant Abi1 blocks the ABA induction of LEA genes,
yet has no effect on the ABA suppression of GA-induced germination enzymes
such as α-amylase. On the other hand, the constitutive expression of PKABA1
mimics the action of ABA in suppressing GA-induced α-amylase expression, but
has no significant effect on the ABA induction of LEA genes. Thus, it has been
suggested that the ABA/stress-regulated gene expression follows two distinct
signal transduction pathways, i.e. the induction pathway mediated by Abi1 and
the suppression pathway mediated by PKABA1 (Gomez-Cadenas et al., 1999).
It is not clear, however, whether these two pathways share common early steps
such as the elevation of cADPR and Ca+2 levels.
CONCLUSION AND POTENTIAL BIOTECHNOLOGY APPLICATIONS
ABA-regulated gene expression has been under intensive studies for the past 15
years. Progress has been made in the cloning of ABA-regulated genes and the
definition of cis-acting elements involved in the regulation of ABA response in
promoters of these genes. The discovery of ABRCs demonstrates that a specific
ABA response relies on the interaction of two cis-acting elements, an ACGT box
and a coupling element (Shen et al., 1996). Although DNA-binding proteins
interacting with ACGT boxes have been reported (Guiltinan et al., 1990), CE
element-binding proteins have not been studied yet. It is expected that proteins
interacting with CE elements will be isolated by techniques such as yeast-one-
hybrid system and expression library screening. Both protein kinases and
phosphatases have been reported to be involved in the regulation of ABA signal

transduction pathways.
In recent years different stress-tolerant transgenic plants have been
obtained (Tarczynski et al., 1993; Kishore et al., 1995; Pilon-Smits et al., 1995;
Holmström et al., 1996; Xu et al., 1996; Hayashi et al., 1997) by producing
either low-molecular-weight osmoprotectants (such as glycine betaine,
mannitol, inositol, proline, fructan or trehalose) or a LEA protein. However,
under normal environmental conditions, overproduction of these compounds
or proteins needs extra energy and building blocks and may hamper the nor-
mal growth of plants. Thus, it is desirable to generate transgenic plants that
synthesize a high level of an osmoprotectants or a protein only under stress
conditions. To this end, the ABA/stress-responsive ‘molecular switches’,
naturally occurring or synthetic, described in this chapter would be valuable in
driving the expression, only on demand, of genes whose products are beneficial
in plant tissues under stresses.
ACKNOWLEDGEMENT
The original works published by Tuan-Hua David Ho and his associates were
supported by US National Science Foundation grants (DCB-9006591 and IBN-
9408900) and US Department of Agriculture/National Research Initiative
grants (91–37100–6625 and 94–37100–0316).
REFERENCES
Anderberg, R.J. and Walker-Simmons, M.K. (1992) Isolation of a wheat cDNA clone for
an abscisic acid-inducible transcript with homology to protein kinase. Proceedings
Bandziulis, R.J., Swanson, M.S. and Dreyfuss, G. (1989) RNA-binding proteins as
developmental regulators. Genes and Development 3, 431–437.
Bartels, D., Engelhardt, K., Roncarati, R., Schneider, K., Rotter, M. and Salamini, F.
(1991) An ABA and GA modulated gene expressed in the barley embryo encodes
an aldose reductase related protein. The EMBO Journal 10, 1037–1043.
Blackman, S.A., Wettlaufer, S.H., Obendorf, R.L. and Leopold, A.C. (1991) Maturation
protein associated with desiccation tolerance in soybean. Plant Physiology 96,
868–874.
Block, A., Dangl, J.L., Hahlbrock, K. and Schulze, L.P. (1990) Functional borders, genetic
fine structure, and distance requirements of cis elements mediating light
responsiveness of the parsley chalcone synthase promoter. Proceedings of the National
Academy of Sciences USA 87(14), 5387–5391.
Boyer, J. (1982) Plant productivity and environment: potential for increasing crop plant
productivity, genotypic selection. Science 218, 443–448.
Bray, E. (1997) Plant responses to water deficit. Trends in Plant Science 2, 48–54.
Bray, E.A. and Beachy, R.N. (1985) Regulation by ABA of β-conglycinin expression in
cultured developing soybean cotyledons. Plant Physiology 79, 746–750.
Bruce, W.B., Christensen, A.H., Klein, T., Fromm, M. and Quail, P.H. (1989)
Photoregulation of a phytochrome gene promoter from oat transferred into rice by
particle bombardment. Proceedings of the National Academy of Sciences USA 86,
9692–9696.
Chaloupkova, K. and Smart, C.C. (1994) The abscisic acid induction of a novel
peroxidase is antagonized by cytokinin in Spirodela polyrrhiza L. Plant Physiology
105(2), 497–507.
Chandler, P.M. and Robertson, M. (1994) Gene expression regulated by abscisic acid and
its regulation to stress tolerance. Annual Review of Plant Physiology and Plant
Cutler, S., Ghassemian, M., Bonetta, D., Cooney, S. and McCourt, P. (1996) A protein
farnesyl transferase involved in abscisic acid signal transduction in Arabidopsis.
Science 273, 1239–1241.
Delisle, A.J. and Ferl, R.J. (1990) Characterization of the Arabidopsis Adh G-box binding
factor. Plant Cell 2, 547–557.
Donald, R.G.K. and Cashmore, A.R. (1990) Mutation of either G box or I box sequences
profoundly affects expression from the Arabidopsis rbcS-1A promoter. The EMBO
Journal 9, 1717–1726.
Donald, R.G.K., Batschauer, A. and Cashmore, A.R. (1990) The plant G-box promoter
sequences activate transcription in Saccharomyces cerevisae and is bound in vitro by
a yeast activity similar to GBF, the plant G box binding factor. The EMBO Journal 9,
1727–1733.
Dure, L. III (1993) A repeating 11-mer amino acid motif and plant desiccation. Plant
Journal 3, 363–369.
Dure, L. III, Crouch, M., Harada, J., Ho, T.-H.D., Mundy, J., Quatrano, R.S., Thomas, T.
and Sung, Z.R. (1989) Common amino acid sequence domains among the LEA
proteins of higher plants. Plant Molecular Biology 12, 475–486.
Frandsen, G., Muller, U.F., Nielsen, M., Mundy, J. and Skriver, K. (1996) Novel plant
Ca(2+)-binding protein expressed in response to abscisic acid and osmotic stress.
Journal of Biological Chemistry 271, 343–348.
Gilmour, S.J. and Thomashow, M.F. (1991) Cold acclimation and cold-regulated gene
expression in ABA mutants of Arabidopsis thaliana. Plant Molecular Biology 17,
1233–1240.
Gilroy, S. and Jones, R.L. (1992) Gibberellic acid and abscisic acid coordinately regulate
cytoplasmic calcium and secretory activity in barley aleurone protoplasts.
Gomez, J., Sanchez-Martinez, D., Stiefel, V., Rigau, J., Puigdomenech, P. and Pages, M.
(1988) A gene induced by the plant hormone abscisic acid in response to water
stress encodes a glycine-rich protein. Nature 334, 262–264.
Gomez-Cadenas, A., Verhey, S.D., Holappa, L.D., Shen, Q., Ho, T.-H.D. and Walker-
Simmons, M.K. (1999) An abscisic acid-induced protein kinase, PKABA1, mediates
abscisic acid-suppressed gene expression in barley aleurone layers. Proceedings of the
National Academy of Sciences USA (in press).
Guiltinan, M.J., Marcotte, W.R., Jr and Quatrano, R.S. (1990) A plant leucine zipper
protein that recognizes an abscisic acid response element. Science 250, 267–271.
Hayashi, H., Alia, Mustardy, L., Deshnium, P., Ida, M. and Murata, N. (1997)
Transformation of Arabidopsis thaliana with codA gene for choline oxidase;
accumulation of glycinebetaine and enhanced tolerance to salt and cold stress. Plant
Journal 12, 133–142.
Holmström, K.O., Mäntylä, E., Welin, B., Mandal, A., Palva, E.T., Tunnela, O.E. and
Londesborough, J. (1996) Drought tolerance in tobacco. Nature 379, 683–684.
Hong, B., Barg, R. and Ho, T.-H.D. (1992) Developmental and organ-specific expression
of an ABA- and stress-induced protein in barley. Plant Molecular Biology 18,
663–674.
Ingram, J. and Bartels, D. (1996) The molecular basis of dehydration tolerance in plants.
Annual Review of Plant Physiology and Plant Molecular Biology 47, 377–403.
Ingram, J., Chandler, J.W., Gallagher, L., Salamini, F. and Bartels, D. (1997) Analysis of
cDNA clones encoding sucrose-phosphate synthase in relation to sugar inter-
conversions associated with dehydration in the resurrection plant Craterostigma
plantagineum Hochst. Plant Physiology 115, 113–121.
Jacobsen, J.V. and Chandler, P.M. (1987) Gibberellin and abscisic acid in germinating
cereals. In: Davies, P.J. (ed) Plant Hormones and their Role in Plant Growth and
Development. Martinus Nijhoff, Dordrecht, pp. 164–193.
Kishore, P., Hong, Z.L., Miao, G.H., Hu, C. and Verma, D. (1995) Overexpression of delta-
pyrroline-g-carboxylate synthetase increases proline production and confers
osmotolerance in transgenic plants. Plant Physiology 108, 1387–1394.
Knetsch, M.L.W., Wang, M., Snaar-Jagalska, B.E. and Heimovaara-dijkstra, S. (1996)
Abscisic acid induces mitogen-activated protein kinase activation in barley
aleurone protoplasts. Plant Cell 8, 1061–1067.
Lång, V. and Palva, E.T. (1992) The expression of a rab-related gene, rab18, is induced by
abscisic acid during the cold acclimation process of Arabidopsis thaliana (L.) Heynh.
Leung, J. and Giradat, J. (1998) Abscisic acid signal transduction. Annual Review of Plant
Leung, J., Bouvier-Durand, M., Morris, P.C., Guerrier, D., Chefdor, F. and Giraudat, J.
(1994) Arabidopsis ABA response gene ABI1: features of a calcium-modulated
protein phosphatase. Science 264, 1448–1452.
Liu, Q., Kasuga, M., Sakuma, Y., Abe, H., Miura, S., Yamaguchi-Shinozki, K. and
Shinozaki, K. (1998) Two transcription factors, DREB1 and DREB2, with an
EREBP/AP2 DNA binding domain separate two cellular signal transduction
pathways in drought- and low-temperature-responsive gene expression,
respectively, in Arabidopsis. Plant Cell 10, 1391–1406.
Loake, G.J., Faktor, O., Lamb, C.J. and Dixon, R.A. (1992) Combination of H-box
(CCTACCN7CT) and G-box (CACGTG) cis elements is necessary for feed-forward
stimulation of a chalcone synthase promoter by the phenylpropanoid-pathway
intermediate π-coumaric acid. Proceedings of the National Academy of Sciences USA
89, 9230–9234.
Ludevid, M.D., Freire, M.A., Gomez, J., Burd, C.G., Albericio, F., Giralt, E., Dreyfuss, G. and
Pages, M. (1992) RNA binding characteristics of a 16 kDa glycine-rich protein from
maize. Plant Journal 2, 999–1003.
Marcotte, W.R., Jr, Russell, S.H. and Quatrano, R.S. (1989) Abscisic acid-responsive
sequences from the Em gene of wheat. Plant Cell 1, 969–976.
McCarty, D.R., Hattori, T., Carson, C.B., Vasil, V., Lazar, M. and Vasil, I.K. (1991) The
Viviparous-1 developmental gene of maize encodes a novel transcriptional activator.
Cell 66, 895–905.
Meyer, K., Leube, M.P. and Grill, E. (1994) A protein phosphatase 2C involved in ABA
signal transduction in Arabidopsis thaliana. Science 264, 1452–1455.
Michel, D., Salamini, F., Bartels, D., Dale, P., Baga, M. and Szalay, A. (1993) Analysis of
a desiccation and ABA-responsive promoter isolated from the resurrection plant
Craterostigma plantagineum. Plant Journal 4, 29–40.
Mikkonen, A., Porali, I., Cercos, M. and Ho, T.-H.D. (1996) A major cysteine proteinase,
EPB, in germinating barley seeds: structure of two intronless genes and regulation
of expression. Plant Molecular Biology 31, 239–254.
Mudgett, M.B. and Clarke, S. (1996) A distinctly regulated protein repair L-isoaspartyl-
methyltransferase from Arabidopsis thaliana. Plant Molecular Biology 30, 723–737.
Mundy, J. and Chua, N.H. (1988) Abscisic acid and water-stress induce the expression of
a novel rice gene. The EMBO Journal 7, 2279–2286.
Mundy, J., Yamaguchi-Shinozaki, K. and Chua, N.-H. (1990) Nuclear proteins bind
conserved elements in the abscisic acid-responsive promoter of a rice rab gene.
Pilon-Smits, E.A.H., Ebskamp, M.J.M., Paul, M.J., Jeuken, M.J.W., Weisbeek, P.J. and
Smeekens, S.C.M. (1995) Improved performance of transgenic fructan-
accumulating tobacco under drought stress. Plant Physiology 107, 125–130.
Pla, M., Gomez, J., Goday, A. and Pages, M. (1991) Regulation of the abscisic acid-
responsive gene rab28 in maize viviparous mutants. Molecular and General Genetics
230, 394–400.
Sachs, M.M. and Ho, T.-H.D. (1986) Alteration of gene expression during environmental
stress in plants. Annual Review of Plant Physiology 37, 363–376.
Schulze-Lefert, P., Becker-Andre, M., Schulz, W., Hahlbrock, K. and Dangl, J.L. (1989a)
Functional architecture of the light-responsive chalcone synthase promoter from
parsley. Plant Cell 1, 707–714.
Shen, Q. and Ho, T.-H.D. (1995) Functional dissection of an abscisic acid (ABA)-inducible
gene reveals two independent ABA-responsive complexes each containing a G-box
and a novel cis-acting element. Plant Cell 7, 295–307.
Shen, Q., Uknes, S.J. and Ho, T.-H.D. (1993) Hormone response complex of a novel
abscisic acid and cycloheximide inducible barley gene. Journal of Biological Chemistry
268, 23652–23660.
Shen, Q., Zhang, P. and Ho, T.-H.D. (1996a) Modular nature of abscisic acid (ABA)
response complexes: composite promoter units which are necessary and sufficient
for ABA induction of gene expression in barley. Plant Cell 8, 1107–1119.
Shinozaki, K. and Shinozaki-Yamaguchi, K. (1997) Gene expression and signal
transduction in water-stress response. Plant Physiology 115, 327–334.
Shinozaki, K. and Yamaguchi, S.K. (1996) Molecular responses to drought and cold
stress. Current Opinion in Biotechnology 7, 161–167.
Showalter, A.M. and Varner, J.E. (1989) Plant hydroxyproline-rich proteins. In: Marcus,
A. (ed) The Biochemistry of Plants. Academic Press, Inc., pp. 484–520.
Skriver, K. and Mundy, J. (1990) Gene expression in response to abscisic acid and osmotic
stress. Plant Cell 2, 503–512.
Skriver, K., Olsen, F.L., Rogers, J.C. and Mundy, J. (1991) Cis-acting DNA elements
responsive to gibberellin and its antagonist abscisic acid. Proceedings of the National
Straub, P.F., Shen, Q. and Ho, T.-H.D. (1994). Structure and promoter analysis of an ABA-
and stress-regulated barley gene, HVA1. Plant Molecular Biology 26, 617–630.
Strizhov, N., Abraham, E., Okresz, L., Blickling, S., Zilberstein, A., Schell, J., Koncz, C. and
Szabados, L. (1997) Differential expression of two P5CS genes controlling proline
accumulation during salt-stress requires ABA and is regulated by ABA1, ABI1 and
AXR2 in Arabidopsis. Plant Journal 12, 557–569.
Su, J., Shen, Q., Ho, T.-H.D. and Wu, R. (1998) Dehydration-stress-regulated transgene
expression in stably transformed rice plants. Plant Physiology 117, 913–922.
Tarczynski, M.C., Jensen, R.G. and Bohnert, H.J. (1993) Stress protection of transgenic
tobacco by production of the osmolyte mannitol. Science 259, 508–510.
Velasco, R., Salamini, F. and Bartels, D. (1994) Dehydration and ABA increase mRNA
levels and enzyme activity of cytosolic GAPDH in the resurrection plant
Craterostigma plantagineum. Plant Molecular Biology 26, 541–546.
Vilardell, J., Goday, A., Freire, M.A., Torrent, M., Martínez, M.C., Torné, J.M. and Pagès,
M. (1990) Gene sequence, developmental expression, and protein phosphorylation
of RAB-17 in maize. Plant Molecular Biology 14, 423–432.
Williams, J., Bulman, M., Huttly, A., Phillips, A. and Neill, S. (1994) Characterization of
a cDNA from Arabidopsis thaliana encoding a potential thiol protease whose
expression is induced independently by wilting and abscisic acid. Plant Molecular
Biology 25, 259–270.
Wu, Y., Kuzma, J., Marechal, E., Graeff, R., Lee, H.C., Foster, R. and Chua, N.-H. (1997)
Abscisic acid signaling through cyclic ADP-ribose in plants. Science 278,
2126–2130.
Xu, D., Duan, X., Wang, B., Hong, B., Ho, T.-H.D. and Wu, R. (1996) Expression of a late
embryogenesis abundant protein gene, HVA1, from barley confers tolerance to
water deficit and salt stress in transgenic rice. Plant Physiology 110, 249–257.
Zeevaart, J.A.D. and Creelmann, R.A. (1988) Metabolism and physiology of abscisic acid.
Potential Use of Hormone-

11
responsive Elements to Control
Gene Expression in Plants
Tom J. Guilfoyle and Gretchen Hagen
University of Missouri, Department of Biochemistry, 117

Schweitzer Hall, Columbia, MO 62511, USA
INTRODUCTION
Hormone-response elements (HREs) are minimal DNA sequence motifs that

confer hormone responsiveness to a promoter. Over the last few years, a
number of plant hormone-responsive promoters have been examined at the fine
structure level, and these studies have defined minimal HREs for several plant
hormones, including auxin (reviewed by Guilfoyle, 1997). Understanding how
plant HREs function in terms of their minimal structures and identification of
transcription factors that interact with HREs can give insight into the
mechanisms of hormone-regulated gene expression and hormone action. This
information can also provide a framework for engineering novel cis elements
and trans factors that may function in ways which differ from natural HREs. In
this chapter, we discuss several different types of auxin-response elements
(AuxREs), including the octopine synthase (ocs) or activator sequence-1 (as-1)
element, natural composite AuxREs containing TGTCTC elements, synthetic
composite AuxREs, and synthetic TGTCTC AuxREs that function without a
coupling element. We also briefly discuss the identification of trans factors that
interact with these AuxREs. We do not attempt to discuss all types of auxin-
responsive promoters or putative AuxREs because in most cases, the AuxREs
have not been precisely mapped or functionally tested. We have restricted our
discussion to two types of AuxREs, the ocs or as-1 elements and TGTCTC
elements, that have been delimited to minimal sequences and tested for
functionality in vivo.

220 T.J. Guilfoyle and G. Hagen
THE ocs/as-1 AuxRE
The ocs element was originally identified as an enhancer element in the

promoter of the Agrobacterium tumefaciens octopine synthase gene which is
transferred to plant cells via the T-DNA (Ellis et al., 1987). Functional ocs
elements were subsequently identified in other opine synthase genes (e.g.
nopaline synthase and mannopine synthase) from A. tumefaciens T-DNAs and
in the 275 region of the cauliflower mosaic virus (CaMV) 35S promoter
(Bouchez et al., 1989; Fromm et al., 1989; Gatz et al., 1991; Leung et al., 1991;
Fox et al., 1992; Kononowicz et al., 1992; Kim et al., 1993, 1994). In CaMV, this
element is referred to as as-1 (Lam et al., 1989), and we refer to this family of
enhancer elements as ocs/as-1. DNA sequences similar to the ocs/as-1 element
are found also in the promoters of figwort mosaic virus (Cooke, 1990; Sanger et
al., 1990), commelina yellow mottle virus (Medberry et al., 1992) and cassava
vein mosaic virus (Verdaquer et al., 1996). The ocs/as-1 element within opine
synthase and DNA-virus promoters has been reported to be activated by exo-
genous auxin application to plant cells and tissues (Langridge et al., 1989; An
et al., 1990; Leung et al., 1991; Kim et al., 1994; Liu and Lam, 1994; Zhang
and Singh, 1994). More recently, a soybean glutathione S-transferase (GST)
gene, Gmhsp26-A (also referred to as GH2/4; Czarnecka et al., 1988; Hagen et
al., 1988; Ulmasov et al., 1995a) and a tobacco GST gene, NT103 (Droog et al.,
1995) have been shown to contain functional ocs/as-1 elements (Ellis et al.,
1993; Ulmasov et al., 1994; van der Zaal et al., 1996). While ocs/as-1 elements
within plant GST gene promoters have been functionally tested in only a few
cases, this element appears to be a common feature in promoters of Type III GST
genes (Marrs, 1996), which respond to exogenous auxins and a variety of other
hormones, chemical agents (e.g. heavy metals, hydrogen peroxide,
electrophiles), pathogens and wounding (Czarnecka et al., 1988; Hagen et al.,
1988; Taylor et al., 1990; Takahashi et al., 1991; van der Zaal et al., 1991;
Hahn and Strittmatter, 1994; Droog et al., 1995; Gough et al., 1995; Ulmasov
et al., 1995a; Kusaba et al., 1996; van der Kop et al., 1996; Xiang et al., 1996;
Marrs and Walbot, 1997).
The ocs/as-1 element is a 20-bp DNA sequence that consists of a direct repeat
separated by 4 bp, with the consensus sequence TGACGTAAGCGCTGACGTAA
(Fig. 11.1). Functional ocs/as-1 elements do not generally contain a perfect
consensus sequence, but instead contain variations of this element with exact
spacing (i.e. 4 bp) separating the direct repeats. The spacing between the direct
repeats has been shown to be crucial for ocs/as-1 element activity (Bouchez et al.,
1989; Singh et al., 1989). The ocs/as-1 element contains tandem binding sites
that resemble the cyclic AMP responsive element or CRE (i.e. consensus sequence
TGACGTCA) found in mammalian genes (Roesler et al., 1988). The two binding
sites in the ocs/as-1 element are functionally identical (Bouchez et al., 1989;
Tokuhisa et al., 1990) and both binding sites must be occupied for ocs/as-1
element activity (Bouchez et al., 1989; Singh et al., 1989). Mutations in one of the
two binding sites results in loss of ocs/as-1 element function. DNA-binding
Potential Use of Hormone-responsive Elements 221
Fig. 11.1. The ocs/as-1 and ocs/as-1-like elements in plant pathogen and GST gene
promoters. A consensus or perfect ocs/as-1 element is shown above the naturally
occurring ocs/as-1 elements from the octopine synthase (ocs) and nopaline
synthase (nos) promoter in the T-DNA of Agrobacterium tumefaciens, 35S promoter
(as-1) of cauliflower mosaic virus and promoters from plant class III GST genes
from soybean (Gmhsp26A/GH2/4) and tobacco (Nt103-1, Nt103-35 and parA). For
comparison, tandem AP-1 sites that regulate expression of the mouse GST-Ya gene
promoter are shown at the bottom. Positions of the DNA elements relative to the
transcription start sites are shown in parentheses.
proteins that interact with the ocs/as-1 element have been identified in plant
nuclear extracts (Lam et al., 1989; Prat et al., 1989; Tokuhisa et al., 1990), and
several basic region leucine zipper (bZIP) transcription factors that bind the
ocs/as-1 element have been cloned from a variety of plants (Katagiri et al., 1989;
Singh et al., 1990; Tabata et al., 1991; Ehrlich et al., 1992; Foley et al., 1993;
Zhang et al., 1993; Miao et al., 1994; Lam and Lam, 1995).
Transgenic tobacco plants that contain GUS reporter genes driven by
natural promoters containing ocs/as-1 elements or synthetic promoters
containing the ocs/as-1 element fused to a minimal promoter display specific
patterns of GUS gene expression. In these transgenic tobacco seedlings, the
highest level of GUS resporter gene expression is generally localized to the root
tip (Benfey et al., 1989; Fromm et al., 1989; van der Zaal et al., 1991;
Kononowicz et al., 1992; Niwa et al., 1994; Ulmasov et al., 1995a). Mutations
in ocs/as-1 element can lead to altered patterns of gene expression (Lam et al.,
1990). Ocs/as-l elements from CaMV, opine synthase and plant Class III GST
promoters have been shown to be responsive to exogenous applications of
auxins, salicylic acid (SA), and/or methyljasmonic acid (mJA) (Kim et al., 1993,
1994; Liu and Lam, 1994; Qin et al., 1994; Ulmasov et al., 1994; Zhang and
Singh, 1994; Xiang et al., 1996). The ocs/as-1 elements from the soybean
Gmhsp26-A and tobacco Nt103 genes have been reported to be equally

responsive to both biologically active (e.g. indole acetic acid (IAA), α-
naphthaleneacetic acid (a-NAA), (2,4-dichlorophenoxy) acetic acid (2,4-D),
(2,4,5-trichlorophenoxy) acetic acid (2,4,5-T)) and biologically inactive or weak
auxin analogues (e.g. 2,3-D, 2,4,6-T, β-NAA) as well as biologically active SA
and biologically inactive SA analogues (e.g. 3-hydroxybenzoate) (Ulmasov et al.,
1994; Droog et al., 1995; Xiang et al., 1996). These latter results suggest that
the ocs/as-1 element may respond to signal transduction pathways that are
activated by cellular stress (i.e. oxidative stress) induced by high levels of
hormones or electrophilic agents as opposed to signal transduction pathways
that respond only to biologically active hormones such as auxin, SA or mJA
(discussed by Ulmasov et al., 1994; Zhang and Singh, 1994). In this respect, the
ocs/as-1 element has some similarities to tandem AP-1 sites (Fig. 11.1) found
within inducible promoters of animal cells (Ney et al., 1990; Okuda et al., 1990),
including animal GST promoters that respond to oxidative stress (Friling et al.,
1992; Daniel, 1993). Plant ocs/as-1 sites are like AP-1 sites in some animal
GST promoters in that two tandem DNA-binding sites are required for promoter
activity. Furthermore, those cloned plant transcription factors that bind to
ocs/as-1 elements in vitro are bZIPs with similarity to Fos and Jun bZIP
transcription factors (i.e. Fos, Jun) that bind to AP1 sites in some animal GST
promoters (Diccianni et al., 1992; Daniel, 1993) and Yap1 and Yap2 bZIP
transcription factors that bind to AP1 sites in some stress-responsive genes in
yeast cells (Hirata et al., 1994; Ruis and Schuller, 1995).
NATURAL COMPOSITE AuxREs
Auxin-responsive genes, such as soybean GH3, SAURs, Aux22 and Aux28 and
pea PSIAA4/5 and PSIAA6, are activated specifically by biologically active
auxins and not by other agents (Walker and Key, 1982; Hagen et al., 1984;
Hagen and Guilfoyle, 1985; Theologis et al., 1985; Walker et al., 1985; McClure
and Guilfoyle, 1987). The promoters in these genes contain no apparent
ocs/as-1 element. Instead, these promoters contain one or more copies of a
conserved element, TGTCTC, or some variation of this element (e.g. TGTCCC,
TGTCAC) within small promoter-regions that confer auxin responsiveness
(Hagen et al., 1991; Ballas et al., 1993, 1995; Li et al., 1994; Liu et al., 1994;
Ulmasov et al., 1995b).
Fine structure mapping of the AuxREs in the soybean GH3 promoter
revealed that TGTCTC elements were critical for AuxRE function (Liu et al.,
1994; Ulmasov et al., 1995b). The GH3 promoter contains three AuxREs that
can function independently of one another, and each of these AuxREs,
designated E1, D1 and D4, contributed to the overall activity and auxin-
inducibility of the GH3 promoter and to the tissue- and organ-specific
expression patterns of the GH3 gene. A diagram of the AuxREs in the GH3
promoter is shown in Fig. 11.2. Ulmasov et al. (1995b) showed that the
Fig. 11.2. Diagram of the soybean GH3 promoter and its composite AuxREs. A 300
bp GH3 promoter is shown with relative positions of three AuxREs: E1; D1; and
D4. The D1 and D4 composite AuxREs contain a TGTCTC element (arrows). The
E1 AuxRE contains a TGA box or G box that overlaps with a TGTCNC element
(arrow showing inverse orientation). The transcription start site is indicated by an
arrow at the top. Boxed sequences include TGA box or G box in E1 and
functionally defined constitutive or coupling elements in D1 and D4.
sequence TGTCTC in the D1 and D4 AuxREs of the GH3 promoter confers auxin
responsiveness when coupled to a closely associated constitutive element. These
coupled elements are referred to as composite AuxREs. Composite AuxREs are
defined as two adjacent or overlapping elements, a constitutive element and a
TGTCTC element, that work in combination to confer auxin responsiveness to
a promoter. A constitutive element is defined as an element that confers
constitutive expression to a minimal promoter (i.e. 246 CaMV 35S RNA
promoter)-GUS reporter gene in transfected protoplasts. The E1 AuxRE in the
GH3 promoter has not been mapped in fine structure, but contains a G box
binding site overlapping an inverted TGTCTC element that may function as a
composite AuxRE (Liu et al., 1994, 1997). Ulmasov et al. (1995b) have pointed
out that composite AuxREs share some similarities with composite HREs found
in animal steroid-responsive genes (Yamamoto et al., 1992).
The composite nature of the D1 and D4 AuxREs in the GH3 promoter is
shown in Fig. 11.3. The D1 composite AuxRE is an 11 bp element (Ulmasov et
al., 1995a). A multimerized D1 construct (D1-4) fused to a minimal promoter-
GUS reporter gene is induced about sixfold by auxin in transient assays with
carrot protoplasts (Fig. 11.3). Mutations in the 3′ half of the TGTCTC (D1-3 and
D1-5 constructs) result in loss of auxin responsiveness and a gain in constitu-
tive expression, while a mutation 5′ to the TGTCTC element (D1-6) results in
loss of promoter activity. These results along with other results (Ulmasov et al.,
1994) indicate that in the D1 AuxRE, the TGTCTC represses constitutive
expression and is required but not sufficient for auxin responsiveness.
Constitutive expression is conferred by sequences upstream and including the
5′ region of the TGTCTC element (compare D1-1 construct with D1-3 and
D1-5). Thus, the D1 AuxRE contains a constitutive element that overlaps with
TGTCTC element.
Fig. 11.3. Composite nature of TGTCTC AuxREs. The D1 and D4 series of constructs
were derived from minimal AuxREs within the GH3 promoter. The synthetic series of
constructs (G4) contained a yeast GAL4 DNA-binding site fused or not fused to a
TGTCTC element. The TGTCTC element is underlined in the unmutated element in
each series of constructs. Mutant nucleotides are shown in lower case letters. Each
construct was fused as 3 (3X) or 4 (4X) tandem repeats to a minimal 246 CaMV 35S
promoter-GUS reporter gene. Constructs were tested using transient assays in carrot
protoplasts that were treated or not treated with the synthetic auxin, α-NAA. With the
synthetic series of constructs, an effector plasmid encoding a transcription factor with
a yeast GAL4 DNA-binding domain (i.e. recognizes the GAL4 DNA-binding sites)
and a chicken cREL activation domain was cotransfected with the GUS reporter gene
containing GAL4 DNA-binding sites. Details can be found in Ulmasov et al. (1995b).
A multimerized D4 construct (D4-6) fused to a minimal promoter-GUS

reporter gene is induced about fivefold by auxin in transient assays with carrot
protoplasts (Fig. 11.3). In contrast to the D1 AuxRE, the D4 composite AuxRE
contains a constitutive element (construct D4-4) separated by 4 bp from the
TGTCTC element. Like the D1 AuxRE, the D4 AuxRE requires a TGTCTC
element for auxin responsiveness (construct D4-7), but this is not sufficient for
auxin inducibility (constructs D4-8 and D4-2). Results summarized in Fig. 11.3
show that with both D1 and D4 composite AuxREs, the TGTCTC element
represses the constitutive element when auxin levels are low, and the composite
element is derepressed and activated when auxin levels are high.
Because the TGTCTC element is not sufficient to confer auxin responsive-
ness to a minimal promoter, the mere presence of a TGTCTC or related element
in a promoter is not adequate criteria to define an AuxRE. TGTCTC elements

that confer auxin responsiveness can only be identified by functional tests. Site-
specific mutations within the TGTCTC element indicate that the first four
nucleotides, TGTC (nucleotide positions 1 to 4), are critically important for
AuxRE function (Ulmasov et al., 1995b, 1997). While some substitutions in the
last two nucleotides (nucleotide positions 5 and 6) of the TGTCTC element are
tolerated, nucleotides 5 and 6 are, nevertheless, important for AuxRE activity
(Ulmasov et al., 1997).
The organization of AuxREs as composite elements provides a means of
obtaining diverse patterns of gene expression with a single hormonal signal.
Coupling or constitutive elements that function in composite elements may
control the tissue and organ, developmental, and/or temporal specificity of
hormone-induced expression for a particular gene. When multiple composite
elements with different coupling elements are present in a promoter, the
patterns of expression may become concerted or synergistic and, thus, more
complex. Results that support this prediction come from observations on
expression patterns displayed by the GH3 promoter-GUS reporter gene and each
of the three GH3 AuxRE-minimal promoter-GUS reporter genes in transgenic
tobacco or Arabidopsis plants (Hagen et al., 1991; Liu et al., 1994; Ulmasov et
al., 1995b; Liu et al., 1997; Z.-B. Liu, 1995, unpublished results). D1, D4 and
E1 GUS reporter genes showed distinct patterns of gene expression, while the
full length (i.e. 592 bp) GH3 promoter construct displayed a wider range of
expression patterns than individual AuxREs.
Natural composite HREs have also been found in the promoters of abscisic
acid-(ABA) and gibberellic acid-(GA) responsive genes. Shen and Ho (1995) and
Shen et al. (1996) showed that a barley ABA-responsive promoter contained two
modules of ABA response elements (ABREs). These each contained a G-box
element and a coupling element that was situated near the G box. Both elements
were required to confer ABA responsiveness to a minimal promoter-GUS reporter
gene. Rogers and Rogers (1992) and Rogers et al. (1994) showed that a
conserved GA response element (GARE) found in promoters of barley GA-
responsive α-amylase genes required a nearby coupling element to function.
Interestingly, Rogers and Rogers (1992) found that substitution of a G-box ABRE
for the GARE in a barley α-amylase gene changed the HRE from GA-responsive
to ABA-responsive. This latter result shows the versatility of a two element
system and suggests that identical coupling elements might function with
elements that confer ABA, GA and possibly other hormone responsiveness. It is
likely that many inducible plant promoters contain composite response elements
with one or more elements being specific for a given inducer (Guilfoyle, 1997).
SYNTHETIC COMPOSITE AuxREs
To determine if the TGTCTC element could confer auxin responsiveness when

paired with constitutive elements that were not resident in natural composite
AuxREs, Ulmasov et al. (1995b and unpublished results) constructed two

synthetic composite AuxREs. One of these constructs consisted of chicken c-Rel
DNA-binding sites fused or not fused to TGTCTC. In the absence of the TGTCTC
element, the c-Rel construct conferred constitutive expression to a minimal
246 CaMV 35S RNA promoter-GUS reporter gene when transfected in carrot
suspension culture protoplasts, indicating that these protoplasts possessed an
endogenous transcriptional activator that recognized the cRel DNA-binding
sites. This constitutive expression was repressed when a TGTCTC element was
placed immediately downstream of the c-Rel DNA-binding sites. Addition of
auxin relieved this repression and resulted in activation (i.e. 12-fold auxin
inducible; T. Ulmasov, unpublished results).
A second GUS reporter construct contained yeast GAL4 DNA-binding sites
fused or not fused to TGTCTC that were located upstream of a 246 CaMV 35S
promoter (Fig. 11.3; Ulmasov et al., 1995b). These reporter constructs displayed
no activity in protoplasts from suspension culture cells in the absence of a
cotransfected transactivator that recognized the GAL4 DNA-binding sites. In
the presence of a GAL4-cRel transactivator, the construct containing just GAL4
DNA-binding sites was constitutively expressed (Fig. 11.3; construct G4M),
while the construct containing the fused TGTCTC sites was repressed in the
absence of auxin and specifically induced when auxin was added to the
protoplasts (construct G4T). The composite nature of this synthetic construct
was verified by mutating the GAL4 DNA-binding site (construct mG4T).
These results indicated that an array of composite AuxREs could be created
by joining different types of constitutive or coupling elements with the TGTCTC
element and suggested that the TGTCTC element might function as a global
AuxRE within plant genomes. A wide variety of constitutive or coupling
elements might function with TGTCTC, even foreign elements, when trans-
activators that recognize the coupling element and the TGTCTC element are
present in plant cells.
SYNTHETIC SIMPLE AuxREs
While natural AuxREs within promoters of genes that specifically respond to

auxin may generally consist of composite elements, the question remained open
whether TGTCTC and related elements might function as AuxREs in the
absence of a coupling element if multimerized and properly organized. To test
this possibility, Ulmasov et al. (1997a, b) constructed a number of direct tandem
repeats and palindromic repeats of the TGTCTC element. A D1-4m construct
was created by carrying out site-directed mutations in the constitutive portion
of the natural 11 bp D1-4 composite AuxRE (Fig. 11.4). The multimerized (i.e.
six or seven tandem direct repeats of 11 bp) D1-4m synthetic AuxRE was found
to have several-fold greater activity and auxin inducibility (i.e. 30- to 50-fold)
in transient assays with carrot protoplasts than the multimerized, natural
D1-4 AuxRE (i.e. sixfold auxin inducible) or the 592 bp GH3 promoter itself (i.e.
Fig. 11.4. Simple TGTCTC AuxREs. The D series of constructs compares the
natural D1-4 AuxRE with a mutant D1-4m AuxRE that appears to have no coupling
element and functions as a simple AuxRE when multimerized. The P/ER series of
constructs represent palindroXmic simple AuxREs containing alternating inverted
(P3 or IR) and everted (ER) repeats. The P3(4X) construct contains 4 IRs and 3 ERs.
P3(1X) represents one copy of the IR, ER7(1X) represents one copy of the ER in the
P3(4X) construct. Nucleotide substitutions in mutant constructs (m) are shown in
small case letters. Spacing distances between ER constructs are shown as ER0
through ER9. Constructs were tested using transient assays in carrot protoplasts that
were treated or not treated with the synthetic auxin, α-NAA. Details can be found
in Ulmasov et al. (1997).
13- to 16-fold auxin inducible; Liu et al., 1994; Ulmasov et al., 1997a).
Furthermore, the D1-4m construct contained no apparent constitutive
element, based upon tests with site-specific mutations in the TGTCTC element.
In transgenic Arabidopsis plants, auxin activated the multimerized D1-4m
construct by up to 50-fold in various plant organs and tissues, whereas a
multimerized natural D1-4 construct was only five- to tenfold inducible with
auxin (Ulmasov et al., 1997b).
Another construct, P3(4X), consisting of four palindromic repeats of the
TGTCTC element, was also found to be strongly induced by auxin in transient
assays (i.e. >30-fold) (Fig. 11.4; Ulmasov et al., 1997a). Analysis of single copy
palindromic constructs indicated that orientation and spacing of TGTCTC

elements was important for auxin responsiveness. For example, while an
inverted repeat (construct P3(1X)), showed no auxin responsiveness, an
everted repeat (construct ER7(1X)) was auxin-responsive. Spacing between
half-sites (constructs ER0 to ER9) and maintenance of the TGTCTC element
within half-sites (constructs mP3(4X) and mER7(1X)) were found to be crucial
for AuxRE function, with 7–8 nucleotides being the optimal spacing between
half-sites.
TGTCTC AuxREs that have been defined at the fine structure level (e.g. in
the GH3 promoter) function as composite elements, and direct repeats or
palindromic TGTCTC AuxREs may not be common in natural promoters.
However, a database search for palindromic TGTCTC elements within auxin-
responsive promoters revealed a possible candidate within the pea PS-IAA4/5
promoter (Ulmasov et al., 1997a). An everted repeat with a spacing of nine
nucleotides, TGTCACccctataagGAGACA, was identified in an auxin-responsive
region of the pea promoter (Ballas et al., 1993, 1995), and this was shown to
function as an AuxRE in carrot protoplast transient assays (Ulmasov et al.,
1997a). Results reported by Ballas et al. (1995) showed that a second element
(i.e. TGTCCCat), located only 3 bp upstream of the palindromic element, within
this auxin-responsive region of the PS-IAA4/5 promoter functioned as an
AuxRE if the TGTCCCat was multimerized as tandem repeats. In this case, 12
tandem repeats of a TGTCCCat sequence were fused to a minimal PS-IAA4/5
(292 to +1)-CAT reporter gene and assayed in pea protoplasts. The activity and
auxin responsiveness of this TGTCCCat construct was several-fold less, however,
than the natural PS-IAA4/5 promoter construct. The natural PS-IAA4/5
promoter may use all three of these closely spaced TGTCNC elements as AuxREs
that function as direct or palindromic repeats with or without coupling
elements. Taken together, studies on repeats of the TGTCTC element (or
TGTCNC) indicate that if properly multimerized and spaced, the TGTCTC
element confers auxin inducibility in the absence of any obvious constitutive or
coupling element. Thus, the TGTCTC element itself appears to be a minimal
AuxRE, and these simple AuxREs resemble simple HREs described in animal
steroid-responsive genes (Yamamoto et al., 1992).
Ulmasov et al. (1997a) used the synthetic highly active palindromic
TGTCTC AuxRE, P3(4X) as bait in a yeast one-hybrid screen to isolate a novel
transcription factor that binds with specificity to TGTCTC AuxREs. This
transcription factor is referred to as auxin response factor 1 or ARF1. ARF1
contains a novel N-terminal DNA-binding domain (i.e. this domain binds with
specificity to TGTCNC sites) related to the C-terminal conserved region (referred
to as the B3 region; Suzuki et al., 1997) found in ABA-type transactivators,
viviparous-1 (VP1) and ABI3 (McCarty et al., 1991; Giraudat et al., 1992) and
a C-terminal domain related to domains III and IV found in the Aux/IAA class
of proteins (Ainley et al., 1988; Conner et al., 1990; Oeller et al., 1993; Abel et
al., 1995). The binding characteristics of ARF1 to TGTCTC elements in vitro is
perfectly correlated with the spacing and nucleotide composition requirements
for TGTCTC elements to function as AuxREs in vivo. A number of proteins

related to ARF1 have been identified that show the same DNA-binding
specificity as ARF1 (Ulmasov et al., 1997a; T. Ulmasov, unpublished results),
suggesting that a complex set of proteins may interact on TGTCTC AuxREs.
USING HORMONE-RESPONSIVE PROMOTERS TO CONTROL GENE

EXPRESSION
Studies on the AuxREs discussed above, as well as studies on other plant HREs,
suggest possible strategies for controlling gene expression with hormones
and/or other chemical agents. Novel approaches to regulating the expression
of selected genes might be achieved by taking advantage of the promoters
containing the ocs/as-1 element or composite AuxREs and other composite
plant HREs.
Natural promoters that contain functional ocs/as-1 elements or ocs/as-1
elements fused to minimal promoters can be used to drive expression of
heterologous genes by induction with a wide variety of agents. The natural
Gmhsp26-A/GH2/4 gene is induced by heat-shock, arsenite, cadmium chloride,
silver nitrate, copper chloride, sodium fluoride, potassium chloride, canavanine,
polyethylene glycol, ABA, 2,4-D, 2,4,5-T, α-NAA, IAA, benzoic acid,
cyclohexylacetic acid and kinetin (Czarnecka et al., 1984, 1988; Hagen et al.,
1984, 1988; Hagen and Guilfoyle, 1985). A Gmhsp26-A/GH2/4-GUS reporter
gene is induced by heat-shock, wounding, cadmium chloride, silver nitrate, iron
sulphate, hydrogen peroxide, glutathione, dithiothreitol, cysteine, sodium
fluoride, sodium chloride, 2,4-D, 2,3-D, 2,4,5-T, 2,4,6-T, α-NAA, β-NAA, IAA,
SA, ABA, benzyladenine and mJA (Ulmasov et al., 1995a). A tobacco Nt103
promoter-GUS reporter gene is induced by 2,4-D, 2,3-D, 2,5-D, 2,6-D, 3,4-D,
3,5-D, α-NAA, β-NAA and SA (van der Zaal et al., 1996). Ocs/as-1 elements
fused to minimal promoter-GUS reporter genes have been reported to be
induced by most of the biologically active auxins and inactive auxin analogues
mentioned above in transient assays with carrot protoplasts (Ulmasov et al.,
1994) or in assays with transgenic lines of tobacco BY-2 suspension culture
cells (van der Zaal et al., 1996).
Taken together, the above results indicate that a number of biologically
inactive chemical inducers could be used to control expression of selected genes
containing promoters with ocs/as-1 elements. Biologically inactive auxin
analogues like 2,3-D produce none of the growth responses elicited by
biologically active auxins (e.g. 2,4-D, 2,4,5-T, α-NAA), but are about as
effective as auxins in activating promoters containing at least some ocs/as-1
elements (Ulmasov et al., 1994, 1995a; van der Zaal et al., 1996). Biologically
inactive auxin analogues over a concentration range of 1–1000 µM can
activate these promoters 10- to 100-fold above basal activities in most organs
and tissues. A variety of other electrophilic agents that lack biological activity
might prove to be as effective or more effective than biologically inactive auxins
in activating the ocs/as-1 element. It may be possible to design promoters with

greater levels of inducibility by multimerizing the ocs/as-1 element or
combining specific enhancer elements or coupling elements (Zhang et al., 1995)
with the ocs/as-1 element. A potential negative aspect of using the ocs/as-1
element to control transcription of selected genes is that this element is
responsive to wounding and most likely is responsive to internal perturbations
in hormone levels (e.g. IAA, SA, mJA) and might also be responsive to a variety
of other chemicals found in plant cells, including hydrogen peroxide,
electrophiles, salts and reducing agents. Except in the case of wounding,
however, it is unlikely that changes in endogenous hormone or other chemical
concentrations are generally great enough to cause significant activation of the
ocs/as-1 element in plants. High levels of basal expression in root tips for genes
containing ocs/as-1 elements might result from extraordinarily high concen-
trations of one or more hormones and other inducing agents within this organ
region.
In combination with other cis elements, the ocs/as-1 element might be
induced by either a wider or narrower spectrum of hormones and nonhormonal
chemical agents. By building synthetic promoters containing specific cis
elements along with the ocs/as-1 element, it might be possible to achieve that
particular expression pattern and inducibility desired. The nucleotide
composition of the ocs/as-1 element and surrounding nucleotides might also
impact on the expression patterns.
In the case with promoters that respond specifically to auxins, the control
of gene expression is obviously much more restricted to the type of inducing
agent employed. Because plants typically respond to exogenous auxin by
undergoing abnormal growth and developmental processes, it would be
difficult to use auxin-specific promoters to control gene expression by auxin
application to plants. However, by manipulating AuxREs so that they respond
in different ways to internal auxin concentrations, altered patterns of gene
expression that have a beneficial effect on plant growth or development might
be achievable.
Higher levels of auxin-induced expression of auxin-responsive genes might
be achieved by multimerizing their natural AuxREs. This has already been
achieved with a subfragment of the GH3 promoter (J. Murfett, 1997, Columbia,
Missouri, USA, unpublished results). In this case, a second copy of the D0 region
of the GH3 promoter (see Fig. 11.2) was fused immediately upstream of the D0
element in the 2180 promoter/5′ UTR-GUS reporter gene (Liu et al., 1994).
This promoter construct containing a tandem direct repeat of the D0 element
was tested in transgenic Arabidopsis plants and found to have greater promoter
activity and higher auxin inducibility than the natural GH3 promoter (J.
Murfett, 1997, Columbia, Missouri, USA, unpublished results). Such constructs
might also reduce the threshold level of auxin required to achieve a significant
amount of gene expression.
It may be possible to manipulate promoters with composite AuxREs so that
genes will be regulated by auxins in unique tissue-specific, organ-specific or
developmentally specific manners. One possible way to modify expression of

auxin-responsive genes is to delete, add or exchange natural composite AuxRE
modules among different auxin-responsive or non-responsive promoters.
Another possible means of creating novel auxin-responsive genes is to fuse
TGTCTC elements with one or more tissue-, organ- or developmentally specific
cis-acting elements that are not naturally under auxin control. Exchanging the
TGTCTC in composite AuxREs for a G-box ABRE or a GARE might result in
novel ABA- or GA-responsive genes.
Modification of transcription factors that interact with AuxREs also provide
a possible target for manipulating hormone-responsive gene expression.
Because these transcription factors (i.e. bZIP proteins that bind ocs/as-1
elements and ARF proteins that bind TGTCTC elements) are modular with
distinct DNA-binding, activation/repression and possibly protein–protein
interaction domains, swapping domains among transcription factors and
amino acid substitutions within domains may create transcription factors that
regulate genes in novel ways. It may also be possible to modify hormone-
responsive gene expression by overexpressing these transcription factors in a
constitutive or tissue/developmental-specific manner or by knocking out their
expression (i.e. using antisense or gene disruption approaches).
REFERENCES
Abel, S., Nguyen, M.D. and Theologis, A. (1995) The PS-IAA4/5-like family of early
auxin-inducible mRNAs in Arabidopsis thaliana. Journal of Molecular Biology 251,
533–549.
Ainley, W.M., Walker, J.C., Nagao, R.T. and Key, J.L. (1988) Sequence and characteriza-
tion of two auxin-regulated genes from soybean. The Journal of Biological Chemistry
263, 10658–10666.
An, G., Costa, M.A. and Ha, S.-B. (1990) Nopaline synthase promoter is wound inducible
and auxin inducible. The Plant Cell 2, 225–233.
Ballas, N., Wong, L.-M. and Theologis, A. (1993) Identification of the auxin-responsive
element, AuxRE, in the primary indoleacetic acid-inducible gene, PS-IAA4/5, of pea
(Pisum sativum). Journal of Molecular Biology 233, 580–596.
Ballas, N., Wong, L.-M., Malcolm, K. and Theologis, A. (1995) Two auxin-responsive
domains interact positively to induce expression of the early indoleacetic acid-
inducible gene PS-IAA4/5. Proceedings of the National Academy of Sciences USA 86,
3483–3487.
Benfey, P.N., Ren, L. and Chua, N.-H. (1989) The CaMV 35S enhancer contains at least
two domains which can confer different developmental and tissue-specific
expression patterns. The EMBO Journal 8, 2195–2202.
Bouchez, D., Tokuhisa, J.G., Llewellyln, D.J., Dennis, E.S. and Ellis, J.G. (1989) The ocs-
element is a component of the promoters of several T-DNA and plant viral genes.
Conner, T.W., Goekjian, V.L., LaFayette, P.R. and Key, J.L. (1990) Structure and
expression of two auxin-inducible genes from Arabidopsis. Plant Molecular Biology
15, 623–632.
Cooke, R. (1990) The figwort mosaic virus gene VI promoter region contains a sequence
highly homologous to the octopine synthase (ocs) enhancer element. Plant
Czarnecka, E., Edelman, L., Schoffl, F. and Key, J.L. (1984) Comparative analysis of
physical stress responses in soybean seedlings using cloned heat shock cDNAs. Plant
Czarnecka, E., Nagao, R.T., Key, J.L. and Gurley, W.B. (1988) Characterization of
Gmhsp26-A, a stress gene encoding a divergent heat shock protein of soybean:
heavy-metal-induced inhibition of intron processing. Molecular and Cellular Biology
8, 1113–1122.
Daniel, V. (1993) Glutathione S-transferases: gene structure and regulation of
expression. CRC Critical Reviews in Biochemistry and Molecular Biology 28, 173–207.
Diccianni, M.B., Imagawa, M. and Muramatsu, M. (1992) The dyad palindromic
glutathione transferase P enhancer binds multiple factors including AP1. Nucleic
Acids Research 20, 5153–5158.
Droog, F.N.J., Spek, A., van der Kooy, A., de Ruyter, A., Hoge, H., Libbenga, K., Hooykaas,
P.J.J. and van der Zaal, B. (1995) Promoter analysis of the auxin-regulated tobacco
glutathione S-transferase Nt103-1 and Nt103-35. Plant Molecular Biology 29,
413–429.
Ehrlich, K.C., Cary, J.W. and Ehrlich, M. (1992) A broad bean cDNA clone encoding a
DNA-binding protein resembling mammalian CREB in its sequence specificity and
DNA methylation sensitivity. Gene 117, 169–178.
Ellis, J.G., Llewellyn, D.J., Walker, J.C., Dennis, E.S. and Peacock, W.J. (1987) The ocs
element: a 16 base pair palindrome essential for activity of the octopine synthase
enhancer. The EMBO Journal 6, 3203–3208.
Ellis, J.G., Tokuhisa, J.G. Llewellyn, D.J., Bouchez, D., Singh, K., Dennis, E.S. and Peacock,
W.J. (1993) Does the ocs-element occur as a functional component of the
promoters of plant genes? The Plant Journal 4, 433–443.
Foley, R.C., Grossman, C., Ellis, J.G., Llewellyn, D.J., Dennis, E.S., Peacock, W.J. and Singh,
K.B. (1993) Isolation of a maize bZIP protein subfamily: candidates for the ocs-
element transcription factor. The Plant Journal 3, 669–679.
Fox, C.P., Vasil, V., Vasil, K. and Gurley, W.B. (1992) Multiple ocs-like elements required
for efficient transcription of the mannopine synthase gene of T-DNA in maize
protoplast. Plant Molecular Biology 20, 219–233.
Friling, R.S., Bergelson, S. and Daniel, V. (1992) Two adjacent AP-1-like binding sites
from the electrophile-responsive element of the murine glutathione S-transferase
Ya subunit gene. Proceedings of the National Academy of Sciences USA 89, 668–672.
Fromm, H., Katagiri, F. and Chua, N.-H. (1989) An octopine synthase enhancer element
directs tissue-specific expression and binds to ASF-1, a factor from tobacco nuclear
extracts. The Plant Cell 1, 977–984.
Gatz, C., Katzek, J., Prat, S. and Heyer, A. (1991) Repression of the CaMV 35S promoter
by the octopine synthase enhancer element. FEBS Letters 293, 175–178.
Giraudat, J., Hauge, B.M., Valon, C., Smalle, J., Parcy, F. and Goodman, H.M. (1992)
Isolation of the Arabidopsis ABI3 gene by positional cloning. The Plant Cell 4,
1251–1261.
Gough, G., Hemon, P., Tronchet, M., Lacomme, C., Marco, Y. and Roby, D. (1995)
Developmental and pathogen-induced activation of an msr gene, str246C, from
tobacco involves multiple regulatory elements. Molecular and General Genetics 247,
323–337.
Guilfoyle, T.J. (1997) The structure of plant gene promoters. In: Setlow, J.K. (ed.) Genetic
Engineering, Principles and Methods, Vol. 19. Plenum Press, New York, pp. 15–47.
Hagen, G. and Guilfoyle, T.J. (1985) Rapid induction of selective transcription by auxin.
Molecular and Cellular Biology 5, 1197–1203.
Hagen, G., Kleinschmidt, A.J. and Guilfoyle, T.J. (1984) Auxin-regulated gene expression
in intact soybean hypocotyl and excized hypocotyl sections. Planta 16, 147–153.
Hagen, G., Uhrhammer, N. and Guilfoyle, T.J. (1988) Regulation of expression of an
auxin-induced soybean sequence by cadmium. The Journal of Biological Chemistry
263, 6442–6446.
Hagen, G., Martin, G., Li, Y. and Guilfoyle, T.J. (1991) Auxin-induced expression of the
soybean GH3 promoter in transgenic tobacco plants. Plant Molecular Biology 17,
567–579.
Hahn, K. and Strittmatter, G. (1994) Pathogen-defense gene prp-1 from potato encodes
an auxin-responsive glutathione S-transferase. European Journal of Biochemistry
226, 619–626.
Hirata, D., Yano, K. and Miyakawa, T. (1994) Stress-induced transcriptional activation
mediated by YAP1 and YAP2 genes that encode the Jun family of transcriptional
activators in Saccharomyces cerevisiae. Molecular and General Genetics 242, 250–256.
Katagiri, F., Lam, E. and Chua, N.-H. (1989) Two tobacco DNA-binding proteins with
homology to the nuclear factor CREB. Nature 340, 727–730.
Kim, S.R., Kim, Y. and An, G. (1993) Identification of methyljasmonate and salicylic acid
response elements from nopaline synthase (nos) promoter. Plant Physiology 103,
97–103.
Kim, S.R., Buckley, K., Costa, M.A. and An, G. (1994) A 20 nucleotide upstream element
is essential for the nopaline synthase (nos) promoter activity. Plant Molecular Biology
24, 105–117.
Kononowicz, H., Wang, E., Habeck, L.L. and Gelvin, S.B. (1992) Subdomains of the
octopine synthase upstream activation element direct cell-specific expression in
transgenic tobacco plants. The Plant Cell 4, 17–27.
Kusaba, M., Takahashi, Y. and Nagata, T. (1996) A multiple-stimuli-responsive as-1-
related element of parA gene confers responsiveness to cadmium but not to copper.
Lam, E. and Lam, Y. (1995) Binding site requirements and differential representation of
TGF factors in nuclear ASF-1 activity. Nucleic Acids Research 23, 3778–3785.
Lam, E., Benfey, P.N., Gilmartin, P.M., Fang, R.X. and Chua, N.-H. (1989) Site-specific
mutations alter in vitro binding and change promoter expression pattern in
transgenic plants. Proceedings of the National Academy of Sciences USA 86, 7890–7894.
Lam, E., Katagiri, F. and Chua, N.-H. (1990) Plant nuclear factor ASF-1 binds to an
essential region of the nopaline synthase promoter. The Journal of Biological
Chemistry 265, 9909–9913.
Langridge, W.H.R., Fitzgerald, K.J., Koncz, D., Schell, J. and Szalay, A.A. (1989) Dual
promoter of Agrobacterium tumefaciens mannopine synthase genes is regulated by
plant growth hormones. Proceedings of the National Academy of Sciences USA 86,
3219–3223.
Leung, J., Fukuda, H., Wing, D., Schell, J. and Masterson, R. (1991) Functional analysis
of cis-elements, auxin response and early developmental profiles of the mannopine
synthase bidirectional promoter. Molecular and General Genetics 230, 463–474.
Li, Y., Liu, Z.-B., Shi, X., Hagen, G. and Guilfoyle, T.J. (1994) Auxin-inducible elements
in the soybean SAUR promoters. Plant Physiology 106, 37–43.
Liu, X. and Lam, E. (1994) Two binding sites for the plant transcription factor ASF-1 can
respond to auxin treatments in transgenic tobacco. The Journal of Biological
Chemistry 269, 668–675.
Liu, Z.-B., Ulmasov, T., Shi, X., Hagen, G. and Guilfoyle, T.J. (1994) The soybean GH3
promoter contains multiple auxin-inducible elements. The Plant Cell 6, 645–657.
Liu, Z.-B., Hagen, G., and Guilfoyle, T.J. (1997) A G-box binding protein from soybean
binds to the E1 auxin response element in the soybean GH3 promoter and contains
a proline-rich repression domain. Plant Physiology 115, 397–407.
Marrs, K.A. (1996) The functions and regulation of glutathione S-transferases in plants.
Marrs, K.A. and Walbot, V. (1997) Expression and RNA splicing of the maize glutathione
S-transferase Bronze2 gene is regulated by cadmium and other stresses. Plant
McCarty, D.R., Hattori, T., Carson, C.B., Vasil, V., Lazar, M., and Vasil, I.K. (1991) The
viviparous-1 developmental gene of maize encodes a novel transcriptional activator.
Cell 66, 895–905.
McClure, B.A. and Guilfoyle, T. (1987) Characterization of a class of small auxin-
inducible soybean polyadenylated RNAs. Plant Molecular Biology 9, 611–623.
Medberry, S.L., Lockhart, B.E.L. and Olszewski, N.E. (1992) The commelina yellow
mottle virus promoter is a strong promoter in vascular and reproductive tissues. The
Plant Cell 4, 185–192.
Miao, Z.H., Liu, X.J. and Lam, E. (1994) TGA3 is a distinct member of the TGA family of
bZIP transcription factors in Arabidopsis thaliana. Plant Molecular Biology 25, 1–11.
Ney, P.A., Sorrentino, B.B., McDonagh, K.T. and Nienhuis, A.W. (1990) Tandem AP-1-
binding sites with the human β-globin dominant control region function as an
inducible enhancer in erythroid cells. Genes and Development 4, 993–1006.
Niwa, Y., Muranaka, T., Baba, A. and Machida, Y. (1994) Organ-specific and auxin-
inducible expression of two tobacco par A-related genes in transgenic plants. DNA
Oeller, P.W., Keller, J.A., Parks, J.E., Silbert, J.E. and Theologis, A. (1993) Structural
characterization of the early indoleacetic acid-inducible genes, PS-IAA4/5 and
PS-IAA6, of pea (Pisum sativum L). Journal of Molecular Biology 233, 789–798.
Okuda, A., Imagawa, M., Sakai, M. and Muramatsu, M. (1990) Functional cooperativity
between two TPA responsive elements in undifferentiated F9 embryonic stem cells.
Prat, S., Willmitzer, L. and Sanchez-Serrano, J.J. (1989) Nuclear proteins binding to a
cauliflower mosaic virus 35S truncated promoter. Molecular and General Genetics
217, 209–214.
Qin, X.-F., Holuique, L., Horvath, D.M. and Chua, N.-H. (1994) Immediate early
activation by salicylic acid via the cauliflower mosaic virus as-1 element. The Plant
Cell 6, 863–874.
Roesler, W.J., Vandenbark, G.R. and Hanson, R.W. (1988) Cyclic AMP and the induction
of eukaryotic gene transcription. The Journal of Biological Chemistry 263,
9063–9066.
Rogers, J.C. and Rogers, S.W. (1992) Definition and functional implications of gibberellin
and abscisic acid cis-acting hormone response complexes. The Plant Cell 4,
1443–1451.
Rogers, J.C., Lanahan, M.B. and Rogers, S.W. (1994) The cis-acting gibberellin response
complex in high-pI α-amylase gene promoters. Plant Physiology 105, 151–158.
Ruis, H. and Schuller, C. (1995) Stress signaling in yeast. BioEssays 17, 959–965.
Sanger, M., Daubert, S. and Godman, R. (1990) Characteristics of a strong promoter
from figwort mosaic virus: comparison with analogous 35S promoter from
cauliflower mosaic virus and the regulated mannopine synthase promoter. Plant
Shen, Q. and Ho, T.-H. D. (1995) Functional dissection of an abscisic acid (ABA)-
inducible gene reveals two independent ABA-responsive complexes each
containing a G-box and an novel cis-acting element. The Plant Cell 7, 295–307.
Shen, Q., Zhang, P. and Ho, T.-H.D. (1996) Modular nature of abscisic acid (ABA)
response complexes: composite promoter units that are necessary and sufficient for
ABA induction of gene expression in barley. The Plant Cell 8, 1107–1118.
Singh, K., Tokuhisa, J.G., Dennis, E.S. and Peacock, W.J. (1989) Saturation mutagenesis
of the octopine synthase enhancer: correlation of mutant phenotypes with binding
of a nuclear protein factor. Proceedings of the National Academy of Sciences USA 86,
3733–3737.
Singh, K., Dennis, E.S., Ellis, J.G., Llewellyn, D.J., Tokuhisa, J.G., Wahleithner, J.A. and
Peacock, W.J. (1990) OCSBF-1, a maize ocs enhancer binding factor: isolation and
expression during development. The Plant Cell 1, 891–903.
Suzuki, M., Kao, C.Y. and McCarty, D.R. (1997) The conserved B3 domain of
VIVIPAROUS1 has a cooperative DNA binding activity. The Plant Cell 9, 799–807.
Tabata, T., Nakayama, T., Mikami, K. and Iwabuchi, M. (1991) HBP-1a and HBP-1b:
leucine zipper-type transcription factors of wheat. The EMBO Journal 10, 1459–1467.
Takahashi, Y., Kusaba M., Hiraoka, Y. and Nagata, T. (1991) Characterization of the auxin-
regulated par gene from tobacco mesophyll protoplasts. The Plant Journal 1, 327–332.
Taylor, J.L., Fritzemeier, K.-H., Hauser, I., Kombrink, E., Rohwer, F., Schroder, M.,
Strittmatter, G. and Hahlbrock, K. (1990) Structural analysis and activation by
fungal infection of a gene encoding a pathogenesis-related protein in potato.
Molecular Plant–Microbe Interactions 3, 72–77.
Theologis, A., Huynh, T.V. and Davis, R.W. (1985) Rapid induction of specific mRNAs by
auxin in pea epicotyl tissue. Journal of Molecular Biology 183, 53–68.
Tokuhisa, J.G., Singh, K., Dennis, E.S. and Peacock, W.J. (1990) A DNA-binding protein
factor recognizes two binding domains within the octopine synthase enhancer
element. The Plant Cell 2, 215–224.
Ulmasov, T., Hagen, G. and Guilfoyle, T.J. (1994) The ocs element in the soybean GH2/4
promoter is activated by both active auxin and salicylic acid analogues. Plant
Ulmasov, T., Ohmiya, A., Hagen, G. and Guilfoyle, T.J. (1995a) The soybean GH2/4 gene
that encodes a glutathione S-transferase has a promoter that is activated by a wide
range of chemical agents. Plant Physiology 108, 919–927.
Ulmasov, T., Liu, Z.-B., Hagen, G. and Guilfoyle, T.J. (1995b) Composite structure of auxin
response elements. The Plant Cell 7, 1611–1623.
Ulmasov, T., Hagen, G. and Guilfoyle, T.J. (1997a) ARF1, a transcription factor that binds
auxin response elements. Science 276, 1865–1868.
Ulmasov, T., Murfett, J., Hagen, G. and Guilfoyle, T.J. (1977b) Aux/IAA proteins repress
expression of reporter genes containing natural and highly active synthetic auxin
response elements. Plant Cell 9, 1963–1971.
van der Kop, D.A., Schuyer, M., Scheres, B., van der Zaal, B.J. and Hooykaas, P.J. (1996)
Isolation and characterization of an auxin-inducible glutathione S-transferase gene
of Arabidopsis thaliana. Plant Molecular Biology 30, 839–844.
van der Zaal, E.J., Droog, F.N.J., Boot, C.J.M., Hensgens, L.A.M., Hoge, J.H.C., Schilperoort,
R.A. and Libbenga, K.R. (1991) Promoters of auxin induced genes from tobacco
can lead to auxin-inducible and root tip-specific expression. Plant Molecular Biology
16, 983–998.
van der Zaal, E.J., Droog, F.N.J., Pieterse, F.J. and Hooykaas, P.J.J. (1996) Auxin-sensitive
elements from promoters of tobacco GST genes and a consensus as-1-like element
differ only in relative strength. Plant Physiology 110, 79–88.
Verdaquer, B., de Kochko, A., Beachy, R.N. and Fauquet, C. (1996) Isolation and
expression in transgenic tobacco and rice plants of the cassava vein mosaic virus
(CVMV) promoter. Plant Molecular Biology 31, 1129–1139.
Walker, J.C. and Key, J.L. (1982) Isolation of cloned cDNAs to auxin-responsive poly(A)
RNAs of elongating soybean hypocotyl. Proceedings of the National Academy of
Sciences USA 79, 7185–7189.
Walker, J.C., Logocka, J., Edelman, L. and Key, J.L. (1985) An analysis of growth
regulator interactions and gene expression during auxin-induced cell elongation
using cloned complementary DNAs to auxin-responsive messenger RNAs. Plant
Xiang, C., Miao, Z.H. and Lam, E. (1996) Coordinated activation of as-1-type elements
and a tobacco glutathione S-transferase gene by auxins, salicylic acid, methyl-
jasmonate and hydrogen peroxide. Plant Molecular Biology 32, 415–426.
Yamamoto, K.R., Pearce, D., Thomas, J. and Miner, J. N. (1992) Combinatorial regula-
tion at a mammalian composite response element. In: McKnight, S.L. and
Yamamoto, K.R. (eds) Transcriptional Regulation. Cold Spring Harbor Laboratory
Press, Plainview, New York, pp. 1169–1192.
Zhang, B. and Singh, K.B. (1994) ocs element promoter sequences are activated by auxin
and salicylic acid in Arabidopsis. Proceedings of the National Academy of Sciences USA
91, 2507–2511.
Zhang, B., Foley, R. and Singh, K.B. (1993) Isolation and characterization of two related
Arabidopsis ocs-element bZIP binding proteins. The Plant Journal 4, 711–716.
Zhang, B., Chen, W., Foley, R., Buttner, M. and Singh, K.B. (1995) Interactions between
distinct types of DNA binding proteins enhance binding to ocs element promoter
sequences. The Plant Cell 7, 2241–2252.
12 Inducible Gene Index 3/16/99 11:26 AM Page 237
Index
abscisic acid (ABA) 7 abscisic acid (ABA) response elements

electrical stimulation, wounding (ABREs)/G box sequence see
134 ACGT boxes
genes regulated by 188–198 abscisic acid (ABA) responses, genes
induction mediating 188, 195–196
ACGT box requirement 202–205 abscisic acid (ABA)-inducible genes
mutant affecting 142 188–195, 198
mechanism of action 198–199 abscisic acid (ABA)-responsive promoters
molecular switches 198–199, 225
biotechnology potential 214 cis-acting promoter sequences
construction 209–210 199–211, 213
functional in vegetative tissues potential biotechnology applications
209 213–214
regulation, rice plants 209–211 abscisic acid (ABA)-suppressible genes
proteinase inhibitor genes 188, 195, 198
141–142 ace1 gene 62–63, 66, 68–71
signal transduction components ACE1 protein 4, 24, 44
211–213 copper-inducible expression system
stress-induced 188–214 63–64, 68
abscisic acid (ABA) biosynthesis genes acetylsalicyclic acid 134
188, 197 ACGT boxes 201
abscisic acid (ABA) response complexes and ABA inducibility 202–205
(ABRC) 205–206, 209–210 proximal/distal coupling element
phase sensitivities 206–207 interactions 205–206
signal transduction pathway signal specific complexes
mediation 211–213 207–209
abscisic acid (ABA) response elements actinomycin D 18
(ABREs) 199–201, 225, 231 activator sequence-1 (as-1) 219
237
238 Index
see also auxin-response elements Arabidopsis protoplasts, lac1 system 27

(AuxREs) Arabidopsis thaliana,
Agrobacterium rhizogenes-encoded rol ethylmethanesulphonate mutant
genes, tc-inducible expression 17 140
Agrobacterium T-6B oncogene 6, areA global regulatory gene 85–86
115–116 L-asparaginase gene expression 78–79
Agrobacterium tumefaciens transgenic Lotus corniculatus 73–75
IPT gene 171, 173 aspartate aminotransferase-P2 antisense
octopine synthase gene 220 expression 72–73, 78
Agrobacterium-mediated transformation, Aspergillus nidulans
ERS transgenic plants 33 alcohol dehydrogenase regulon 2, 24
allene oxide synthase 138–39 areA global regulatory gene 85–86
γ-aminobutyric acid (GABA) 131 niaD structural gene 86
aminocyclopropane carboxylic acid niiA structural gene 86
(ACC) synthase 130 nirA pathway-specific regulatory
α-amylase gene 225 gene 85, 87–88
α-amylase inhibitors 131–132 nitrate assimilation 85
animal hormone receptor/activators 2 auxin, role, proteinase inhibitor
antisense constructs expression 143–144
in copper-inducible gene expression auxin analogues, biologically inactive
72–73 229–230
thermotolerance, Arabidopsis 115 auxin-response elements (AuxREs) 7,
apical dominance, Cu-GUS and Cu-ipt 219
plants 78 as-1 element 219
Arabidopsis gene modification 231
35S-driven GVG gene 50–53 natural composite 222–225
copper treatment effects 62, 65 soybean GH3 promoter
copper-controllable gene expression multimerized constructs
61, 68 222–224, 230
Era1 gene, and ABA sensitivity 213 ocs element 219
FLP recombinase expression 116 ocs/as-1 element 220–222, 229–230
glucocorticoid treatment methods synthetic composite 225–226
50 synthetic simple 226–229
GR HBD transmutants 47 TGTCTC element 222–229, 231
heat-shock promoter 103 use to control gene expression
mutagenesis screen 117 229–231
heat-shock response 114–115 auxin-responsive genes 222
Hsp81-1 promoter conditional
expression 115
jasmonate biosynthesis 138 bacterial avirulence gene expression,
leaf senescence 170 copper system 75
luciferase activity induction 50–53 barley
NR gene promoter 89, 91–92 α-amylase gene 225
rbcS-1A gene 208 HVA1 and HVA22 genes 198–200
tc-controlled transcriptional HVA1 and HVA22 promoters 199,
activator 18 201–202
TetR repression 17 Lea gene 212
thermotolerance 115 NiR gene 89
ttg mutant 47 thionin promoter 114
Index 239
bestatin 141 ipt gene expression 76–78

biotic stresses, impact on crop yield practical tips for use 79
187–188 practical usefulness of 78–79
Bombyx ecdysone receptor 28 in roots, system modification
brassinosteroids 53 65–68
usage for tissue-specific antisense
experiments 72–73
cab gene transcripts 129 usage to control expression of plant
cauliflower mosaic virus (CaMV) 35S hormones 76–78
promoter 32–33, 48, 61, 114 vectors 69–70
in copper-inducible expression copper–EDTA complex 79
system 62–64 copper-metallothionein (MT) regulatory
GUS copper-control system 63–65 system 4, 62–63
GUS ecdysone transgenic seedlings coronatine 140–141
33–35, 37 coumaric acid 208–209
natural composite AuxREs 224, Craterostigma plantagineum 103
226 crop yield, biotic stress effects
TetR repression 14–16 187–188
CCAAT-box binding factor 107, 111 cutin 127
cell surface receptors 136 cyclooxygenase 139
chalcone isomerase 129 cytokinin biology, utility of
chalcone synthase 129 autoregulatory systems
chalcone synthase gene 208 182–183
chalcone synthase promoter 207 cytokinin production, IPT role in
chaperonins 130 173–174, 183
chimeric transcription factors 54 cytokinin synthase (ipt) gene expression
see also GVG system 76–78
chitinases 131–132 cytokinins
chloramphenicol acetyl transferase (CAT) effect on SAG12-GUS expression
2–3, 14 180, 182
p-chloromercuribenzenesulphonic acid role in plant senescence 170–171,
136 183
chymotrypsin inhibitor 127–128 role in proteinase gene inhibitor
conditional lethal gene expression, expression 144
copper system 73–75
control systems from non-plant
backgrounds 2–4 dexamethasone 20, 27, 32, 49–51, 53
copper-controllable gene expression and luciferase activity induction
system 2, 4, 24, 44, 61–79 50, 52
basis 62–63 dibenzylhydrazines 30–31
copper foliar spray effects 65 dimeric orphan receptors 25
effecting control over place and time Drosophila
of expression 68–69 ecdysone receptor (EcR) 25, 28–29
expression of bacterial avirulence GAGA factor binding site 105–106
genes 75 heat-shock proteins 99, 101, 110,
expression of conditional lethal 113, 115
genes 73–75 heat-shock response 98
functioning 63–65 Kc cell bioassay 30
GUS activity 63–65, 68, 76–78 steroid responsive elements 107
240 Index
ecdysone agonists 29–31 GAGA factor binding site 105–106

ecdysteroid compounds 29–30 GAL4 DNA-binding domain 4, 20, 27,
non-steroidal compounds 30–31 48, 108, 226
ecdysone chimeric receptor, transient gibberellic acid responsive element
expression 32–34 (GARE) 225, 231
ecdysone receptor switch (ERS) 32–33, gibberellic acid responsive genes 225
37 global nitrogen regulatory genes
induction specificity 36 85–86
ligand induction, dose dependence β-glucanases 131–132, 143
35 glucocorticoid
tobacco transformation 32 characteristics as inducer 53–54
transgenic plant analysis plant treatment methods 50–51
33–35 glucocorticoid-inducible gene expression
ecdysone receptors 25, 28–29 4, 19–20, 43–55
ecdysteroid agonists 3–4, 29–37 glucocorticoid receptor (GR)
ecdysteroid compounds 29–30 hormone-binding domain (HBD)
in plants 29, 31 44–48
ecdysteroid receptor of insects 25 ligand-binding domain 20, 24–25,
electrical action potential, proteinase 27–28, 32
inhibitor genes 134 regulatory mechanism 44–48
Em gene 199 glucocorticoid response elements (GREs)
Em promoter 212 44
embryo development, heat-shock β-glucuronidase gene see GUS
proteins 102–103 glutamine synthetase (GS) 83–84, 88
ERS see ecdysone receptor switch glutamine-2-oxyglutarate
Escherichia coli, heat-shock response aminotransferase (GOGAT)
98 83–84, 88
ethanol-inducible gene switch 2 GmHsp 17.3 B promoter 111,
ethylene 114–115
biosynthesis induction 130 GmHsp 17.3 B promoter-GUS fusion
effects, wound-inducible genes 114
142–143 GmHsp 17.5 E promoter
eukaryotes heat-inducible expression, FLP
heat-shock response 98 recombinase gene 116
TetR repression of transcription transient heat induction 116
14–16 GmHsp 26-A gene 103, 220
extracellular invertases 133 GmHsp 26-A/GH2/4 gene 229
GUS (β-glucuronidase gene) 32
activity
Fabaceae, vegetative storage proteins copper-control system 63–65, 66
128 ecdysone receptor switch 33–36
floral development, heat-shock proteins apical dominance 78
103 expression in roots 65–68
FLP recombinase gene, heat-inducible leaf senescence 77, 172
expression 116 NiR fusion, transgenic tobacco
fungal systems, nitrate assimilation 89–90
regulation 85–88 SAG fusion
furanocoumarin biosynthesis 131 SAG12-IPT plants 180
fusion proteins 47–48 transgenic Arabidopsis 172–173
Index 241
GVG system 4, 20 gene expression, developmental

characteristics 53–54 regulation 100–101
cis and trans constructs 49–50, 54 induction by other stresses 104
construction of 48–49 induction in pollen 101–102
HBD alternatives 54–55 low molecular weight 99–104, 118
induction experiments 49–52 expression in plants 110–112
promoter modification 55 molecular weights 99
as steroid-inducible transcription pollen development 100–101
system 54–55 role in thermotolerance 99–100
winter acclimation 104
heat-shock regulation, HSE-dependent
HaHsp 17.6 G1 gene 112 106–107
HaHsp 17.7 G4 gene 111–112 heat-shock response
HBD see hormone-binding domains expression of genes down-regulated
heat-shock consensus elements (HSEs) during high temperature stress
104–105 117
dependent activation 106–110 in plants 98–9
heat-shock regulation 107 heat-shock transcription factors (HSF)
multiple pathway regulation 110 104–105, 107–110
heat-shock gene expression 98 in mammals 112
heat-shock promoters 5–6, 8, 98–99 phylogenetic classes 113
auxiliary elements 105–107 in plants 113
cis-elements 106–107, 110 Heliothis, ecdysone receptors 3–4, 28,
class A 5–6, 106–107 32–33
class B 6, 106–107 hemin-induced hsp70 synthesis, human
B-1 promoters 107–108 erythrocytes 107–108
B-2 promoters 108–110 herpes viral protein (VP 16) 3, 20, 27,
class C 6, 110 32, 47–48
consensus elements 104–105 heterodimers 25
with enhanced heat-shock n-hexenal 139
expression 103 high-temperature stress, heat-shock gene
organization 104–107 promoter use 117
in plants 110–112 homodimers 24–25, 36
relative strength compared to other hormone-binding domains (HBDs)
promoters 114 44–48
transcription factor 104–105 heterologous proteins regulated by
transient heat induction 116 44–47
types 5–6, 105–106 protein function control 47
use in basic research 114–116 regulatory mechanism 45
use in mutagenesis screens 117 see also GVG system
use in transgenic plant experiments hormone-responsive elements (HREs)
113–114 219–231
heat-shock proteins 98 natural composite 225
constitutive expression 103–104 use to control gene expression
developmental expression 229–231
100–102, 106–110, 117–118 see also auxin-response elements
embryo development and seeds (AuxREs)
102–103 hsp genes 100, 102, 105, 107, 110,
floral development 103 112, 115
242 Index
HVA1 gene kanamycin-resistant SAG12-IPT tobacco

ABA and stress induction, barley plants 176–177
seedlings 198–200
coupling element interactions
205–206 lac1 system 24, 27
short promoter fragment, and ABA Lea gene 199, 212
induction 202, 204 LEA proteins 198, 214
HVA1 promoter 201, 203 leaf senescence 169
HVA22 gene 198–199, 205 and agriculture 170
ABA-inducible, GUS activity 2, application of autoregulatory
199, 201 senescence-inhibition system
coupling element interactions 183–184
205–206 Cu-ipt and Cu-GUS tobacco
short promoter fragment, and ABA transformants 77
induction 202–204 cytokinins role 170–171, 183
HVA22 promoter 201 SAG promoters to target IPG gene
interaction with distal/proximal 174–175
coupling element 205 senescence-associated genes in
hydrogen peroxide response 128–129 171–173
13-hydroperoxylinolenic acid 138, 140 lectins 131
20-hydroxyecdysone 28–29 lethal metabolic gene expression, copper
hydroxyproline-rich proteins, cell walls system 73–75
187 light-harvesting chlorophyll protein
hygromycin resistance, heat-inducible complex apoproteins 129
116 light-induced gene expression
207–209
lipoxygenase 138–139, 142
induced thermotolerance 99–100 Lotus, copper-controllable gene
inducible gene systems 1–2, 97–98 expression 61
invertases, extracellular 133 Lotus corniculatus
ipt (cytokinin synthase) gene expression AAT-P2 antisense constructs 72
76–78, 116 L-asparaginase gene expression
IPT (isopentenyl transferase) gene 171 73–75
expression in transgenic plants roots, copper inducibility of GUS
170, 174 expression 67
role in cytokinin production low molecular weight heat-shock
173–174 proteins 99–103, 118
constitutive expression 103–104
expression in plants 110–112
jasmonates 130, 132, 136 luciferase activity induction 202
affect on transcription 141 through GVG system 49–50,
electrical stimulation, wounding 134 52–53
metabolism 140
see also methyl jasmonate
jasmonic acid maize
biosynthetic pathways 137–139 heat-shock promoter 174
stereoisomers 140 Myc transcription factor 47
synthesis, mutants 140–141 pMAH9 gene 198
in wound response 137 polyubiquitin genes 103
Index 243
Rab17 gene 202 nitrate assimilatory pathway, plants

VP1 gene, and ABRC activation 83–85
211–113 nitrate reductase 83
maize protoplasts, ecdysone chimeric gene expression 5, 84–85, 88, 93
receptor expression 3, 32–33 nitrate-inducibility of gene expression 5,
makisteroneA 36 88–93
mammalian systems, inducible nuclear AT-rich region 92
receptor systems 25–27 cis-acting region 90–91
metallothionein-copper regulatory trans-acting region 91, 93
system 4, 62–63 nitrite reductase 83
methyl jasmonate 129–131, 137, 140 gene expression 84–85, 88, 93
Mimulus guttatus roots, copper-binding see also spinach NiR gene
elements 62 nitrogen regulatory genes
mineralocorticoid receptors 46, 54 global 85–86
momilactone 131 negative-acting 88
monomeric orphan receptors 25 pathway-specific 85, 87–88
muristeroneA 25–26, 28–29, 35 nmr negative-acting regulatory gene 88
mutagenesis screens, heat-shock nod45 promoter 67–69
promoter use 117 nodule-specific system, AAT-P2 antisense
expression 72–73, 78–79
norbornadiene 143
negative-acting nitrogen regulatory gene nuclear receptors
88 classes 24–25, 44
neomycin phosphotransferase reporter in mammalian systems 25–27
gene 101–102 post-transcriptional control 27–28
Neurospora crassa protein domains 25–26, 44–45
nit-2 global regulatory gene 85–86, transcriptional control 27
91
nit-3 structural gene 86, 91
nit-4 pathway-specific regulatory ocs/as-1 element AuxRE 220, 229
gene 85, 87 activation through biologically
nit-6 structural gene 86 inactive auxins 229–230
nitrate assimilation 85 gene expression 221–222
Nicotiana rustica, T-6B oncogene hormonal induction 230
expression 115–116 sequence structure 220–221
Nicotiana sylvestris, jasmonic acid role, wounding concerns 230
wound response 137 octopine synthase (ocs) 219–220
Nicotiana tabacum see tobacco see also auxin-response elements
NiR enzyme, protein structure 89 (AuxREs)
NiR gene expression in response to oestrogen receptors 46, 54
nitrate 89–93 okadiac acid-sensitive protein
nirA pathway-specific regulatory gene phosphatase 137
85, 87–88 oligosaccharide elicitors 136
nit-2 global regulatory gene 85–86, osmoprotectants 214
91 osmotin 131
nit-4 pathway-specific regulatory gene 12-oxo-phosphodienoic acid 139–140
85, 87–88 oxylipin 137–139, 142
nitrate assimilation regulation, fungal inhibitor metabolism 139
systems 85–88 ozone, heat-shock protein induction 104
244 Index
pACE-in-ART vector 71 prosystemin cDNA 135–136

pathogenesis-related proteins 117 protein kinases 137
pathway-specific nitrogen regulatory ABA-induced 213
genes 85, 87–88 proteinase inhibitor genes 128
peroxidases 129 abscisic acid role, wound-induction
phenidone 139 141–142
phenoxycarb 34 auxin role 143–144
phenylalanine ammonia-lyase 129 coronatine effects 140–141
phenylpropanoids, up-regulation 129 cytokinin role 144
phospholipase D 137–138 electrical action potential
photosynthetic translation inactivation, stimulation 134
wound response 129–130 ethylene role 143
phytoalexins 131 jasmonic acid synthesis 140–141
phytochelatins 62 systemin effects 135–136
piroxicam 139 wound-inducibility 128,
plant defence induction, wound response 133–144
131–132 Pseudomonas syringae
plant hormone expression, copper system avirulence gene 75
use 76–78 coronatine pathovar 140
plant promoter systems responsive to pUC-based plasmids 70–71
environmental signals 1–2,
4–6
plant senescence Rab genes 199, 202
cytokinins role in 170–171, 183 RAB proteins 198
see also senescence-associated genes rat GR HBD 48
(SAGs) expression in transgenic plants 47
pollen, heat-shock response 101–102 rbcL transcripts 130
pollen development, HSP gene expression rbcS gene product 129
100–101 replicative senescence 169
polyubiquitin genes 103 retinoic-X receptor 25
ponasteroneA 25, 36 ribosome-inactivating proteins,
poplar, copper-controllable gene expression 130
expression 61 rice
post-mitotic senescence 169 ABA responsive promoter switch
post-transcriptional control, nuclear regulation 209–211
receptors 27–28 Rab16A gene 202
pPMB 765 vector 71 roots
pPMB 768 vector 70–71, 75–76 copper toxicity to 79
pPMB 7066 vector 70–71, 75 copper-binding elements, Mimulus
pPMB 7088 vector 71 62
progesterone receptor 26–27 copper-controllable gene expression
prokaryotes, TetR repression of modification 65–68
transcription 13–14 RPS2 promoter 75
proliferative senescence 169
promoter systems 8
based on plant-based developmental S-adenosyl-L -methionine (SAM)
processes 1, 6–7 synthase 130
types 1–2 SAG12-GUS construct 180
propyl gallate 139 SAG12-IPT construct 174–175
Index 245
SAG12-IPT transgenic tobacco plants steroid receptor ligand-binding domains

autonomous nature 178–179 24–25, 27–8
autoregulatory nature 178–182 see also glucocorticoid
biochemical observations 178 storage protein induction, wound
cytokinin effect 178, 180, 182 response 128, 132–133
phenotypical observations 176–178 stress-induced proteins 187
physiological observations 178 stress-regulated gene expression
salicyclic acid 139 independent of stress-induced ABA
seeds, heat-shock proteins 102 188
senescence-associated genes (SAGs) regulated by stress-induced ABA
identification 171–173 188–198
use to target IPT gene to senescing stressed vegetative tissues, protein
leaves 174–175 accumulation 198
see also SAG12-IPT transgenic suberin 127
tobacco plants sugar transporters 133
senescence-inhibition system, sunflower
autoregulatory, applications HaHsp 17.6 G1 gene 112
183–184 HaHsp 17.7 G4 gene 111–112
senescence-specific promoters 6–7, systemin 135–136
169–184
developing a system for targeting
IPT expression 171–175 taxol biosynthesis 131
see also IPT (isopentenyl transferase) tc-controlled transcriptional activator
gene (tTA) 18
serine proteinase inhibitors 131–132 fusion to glucocorticoid
silver thiosulphate 143 receptor-binding domain 19–20
Solanaceae, proteinase inhibitors 128 mRNA decay rate measurement 18
soybean use of 18–19
GH3 promoter, and composite tc-inducible expression 15–17
AuxREs 222–225, 230 tet operator sequences 12–13
GmHsp 17.3 B promoter 111, 114 tetA 11–13
GmHsp 17.5 E promoter tetR 11–13
heat-inducible expression, FLP TetR see Tn10-encoded tetracycline
recombinase gene 116 repressor (TetR)
transient heat induction 116 tetracycline repressor 2–3, 11–20,
GmHsp 26-A gene 103, 220 23–24, 44
spacio-temporal gene expression 55 TGTCTC elements 231
spinach NiR gene 89, 92 natural composite AuxREs
deletion analysis, GUS fusion, 222–225
transgenic tobacco 89–91 synthetic composite AuxREs
spinach NiR gene promoter 90 225–226
nitrate induction 91–92 synthetic simple AuxREs 226–229
nitrogen metabolite repression D1-4 constructs 226–227
92–93 P3(4X) construct 227–228
spinach NiR promoter, importance of TGV (transciptional activator) 19–20
GATA core elements 90–92 thermotolerance 99–100
staurosporine 136–137 antisense constructs, Arabidopsis
steroid-inducible transcription system in 115
plants 54–55 thyroid receptors 24–25, 44
246 Index
Tn10-encoded tetracycline repressor triamcinolone acetonide 53

(TetR) 2–3, 11–20, 23–24, 44 α-tubulin 101
genetic organization and
mechanism of regulation
11–12 ubiquitin 99, 103, 114, 202
tet operator sequences 12–13 ultra-violet induced gene expression
TetR-tc binding 12–13 207–209
use to activate plant gene expression up-regulation of phenylpropanoids 129
18–20 ursolic acid 139
use to repress plant gene expression
13–17
tobacco vectors, copper-controllable gene
copper-controllable gene expression expression system 69–71
61, 63–66 vegetative storage proteins 128,
creation and cultivation of 132–133
transgenic plants 175–176
Cu-ipt and Cu-GUS expression
76–77 wheat
heat-shock response 114 Em gene 199
leaf senescence, Cu-ipt and Cu-GUS Em promoter 212
expression 77 white light-induced gene expression
luciferase activity induction 49 207–209
SAG12-IPT transgenic plants winter acclimation, heat-shock proteins
176–182 104
spinach Nir gene-GUS fusion, wound induction, mechanism
deletion analysis 89–91 133–141
tc inducible-expression 16–17 wound response 127–128
transformation with ERS 32 ethylene biosynthesis induction
see also SAG12-IPT transgenic 130
tobacco plants hydrogen peroxide response
tobacco protoplasts 128–129
ecdysone chimeric receptor photosynthetic translation
expression 3, 32–33 inactivation 129–130
lac1 system 24, 27 plant defence induction 131–132
tobacco roots, copper inducibility of GUS return to normal physiology 133
expression 67–69 storage protein induction
tomato 132–133
NR gene 91 up-regulation of phenylpropanoids
NR promoter 93 129
TetR effects 17 wound-inducible genes in plants 128,
transcriptional control 159–167
nuclear receptors 27 abscisic acid role 141–142
transgene expression 23–24 auxin role 143–144
transgenic plant analysis, ecdysone cell surface receptors 136
receptor switch 33–35 cytokinin role 144
transgenic plants ethylene effects 142–143
HS promoter use 113–114 jasmonic acid biosynthesis
rat GR HBD expression 47 137–141
see also specific plants, e.g. tobacco oxylipin metabolism inhibitors 139
Index 247
oxylipins 137 yeast copper-metallothionein regulatory

protein kinase role 136–137 system 4, 62–63
see also proteinase inhibitor genes
wound-inducible promoter system 5, 8
wound-inducible proteins 131–132 zeatin ribotide 174

Tips - Inducible Gene Expression in Plants PDF

Загружено:

Сведения о документе

Оригинальное название

Авторское право

Доступные форматы

Поделиться этим документом

Поделиться или встроить документ

Параметры публикации

Этот документ был вам полезен?

Это неприемлемый материал?

Авторское право:

Доступные форматы

Tips - Inducible Gene Expression in Plants PDF

Загружено:

Авторское право:

Доступные форматы

00 Inducible Gene prelims 3/9/99 11:59 AM Page i

INDUCIBLE GENE EXPRESSION IN PLANTS

Inducible Gene Expression in Plants

CABI Publishing is a division of CAB International

CABI Publishing CABI Publishing

© CAB International 1999. All rights reserved. No part of this publication

Library of Congress Cataloging-in-Publication Data

ISBN 0 85199 259 5

Typeset in 10/12pt Photina by Columns Design Ltd, Reading.

9 Developmental Targeting of Gene Expression by the Use of a 169

Richard M. Amasino, Department of Biochemistry, 420 Henry Mall,

Ronald T. Nagao, Botany Department, University of Georgia, Athens, GA

Inducible Control of Gene

Plant Improvement Division, The Horticulture and Food

CONTROL SYSTEMS FROM NON-PLANT BACKGROUNDS

Inducible Control of Gene Expression: an Overview 3

Use of the Tn10-encoded tetracycline repressor to control gene expression

In Gram-negative bacteria, the Tet repressor (TetR) negatively regulates

Ecdysteroid agonist-inducible control of gene expression in plants

A nuclear receptor functions both as a sensor for its ligand as well as a

This two component system consists of an ‘effector’ which comprises a

Glucocorticoid-inducible gene expression in plants

A novel glucocorticoid-inducible system which functions in transgenic plants has

Tissue-specific copper-controllable gene expression in plants

The copper-controllable system makes use of the yeast copper metallothionein

PLANT PROMOTER SYSTEMS RESPONSIVE TO ENVIRONMENTAL

Inducible Control of Gene Expression: an Overview 5

environment to enhance survival. This means that plants have developed a

Wound-inducible control of gene expression in plants

Nitrate inducibility of gene expression using the nitrate reductase gene

Use of heat-shock promoters to control gene expression in plants

Heat induction of gene expression depends on the presence of heat-shock

elements (HSEs) in the promoter; type B promoters exhibit HSE-dependent

PROMOTER SYSTEMS BASED ON PLANT DEVELOPMENTAL PROCESSES

As more research is carried out in the area of development a greater under-

Developmental targeting of gene expression by the use of a senescence-

The process of senescence is driven by changes in gene expression, involving the

Inducible Control of Gene Expression: an Overview 7

techniques a number of senescence-associated genes (SAG) have been identified

Abscisic acid-inducible promoters in the control of gene expression in

Abscisic acid (ABA) appears to be a ‘stress hormone’. In addition to drought,

Potential use of hormone-response elements to control gene expression in

Hormone-response elements are minimal DNA sequence motifs that confer

The utility of inducible promoter systems in laboratory-based research is self-

Aoyama, T. and Chua, N.-M. (1997) A glucocorticoid-mediated transcriptional

Inducible Control of Gene Expression: an Overview 9

Green, T. and Ryan, C. (1972) Wound-induced proteinase inhibitor in plant leaves: a

Use of the Tn10-encoded

Albrecht von Haller Institut für Pflanzenwissenschaften,

The Tn10-encoded Tet repressor (TetR) negatively regulates expression of the

THE Tn10-ENCODED Tet REPRESSOR (TetR)

Fig. 2.1. Genetic organization and mechanism of regulation of the Tn10-encoded

Use of the Tn10-encoded Tetracycline Repressor 13

binding conformation. The high association constant of the inducer tc to TetR

USING TetR TO REPRESS PLANT GENE EXPRESSION

In the prokaryotic system, TetR represses transcription by sterically interfering

regulating gene expression is a common mechanism in bacteria but is found

Fig. 2.3. (Opposite) Schematic drawing of the promoter derivatives constructed to

Use of the Tn10-encoded Tetracycline Repressor 15

Fig. 2.3. (Continued)

Use of the Tn10-encoded Tetracycline Repressor 17

be applied. Systemic induction can be achieved by cultivating plants in

USING TetR TO ACTIVATE PLANT GENE EXPRESSION