Granada

Evidence-Based Complementary and Alternative Medicine
Pomegranate: Its Health and

Biomedical Potential
Guest Editors: Ari M. Mackler, David Heber, and Edwin L. Cooper

Guest Editors: Ari M. Mackler, David Heber,

and Edwin L. Cooper
Copyright © 2013 Hindawi Publishing Corporation. All rights reserved.
This is a special issue published in “Evidence-Based Complementary and Alternative Medicine.” All articles are open access articles
distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any
medium, provided the original work is properly cited.
Editorial Board
M. A. Abdulla, Malaysia J.-H. Chiu, Taiwan Ching-Liang Hsieh, Taiwan
Jon Adams, Australia W. C. S. Cho, Hong Kong Jing Hu, China
Zuraini Ahmad, Malaysia Jae Youl Cho, Korea Gan Siew Hua, Malaysia
U. P. Albuquerque, Brazil S.-H. Cho, Republic of Korea Sheng-Teng Huang, Taiwan
Gianni Allais, Italy Chee Y. Choo, Malaysia B. T. Kwong Huat, Singapore
Terje Alraek, Norway R. Choue, Republic of Korea Roman Huber, Germany
Souliman Amrani, Morocco Shuang-En Chuang, Taiwan A. A. Izzo, Italy
Akshay Anand, India J.-H. Chung, Republic of Korea Kong J., USA
Shrikant Anant, USA Edwin L. Cooper, USA Suresh Jadhav, India
Manuel Arroyo-Morales, Spain G. D. Cramer, USA K. Jarukamjorn, Thailand
Syed M. B. Asdaq, Saudi Arabia Meng Cui, China Yong Jiang, China
Seddigheh Asgary, Iran R. K. N. Cuman, Brazil Zheng L. Jiang, China
Hyunsu Bae, Republic of Korea V. De Feo, Italy Stefanie Joos, Germany
Lijun Bai, China Rocı́o Vázquez, Spain Sirajudeen K.N.S., Malaysia
S. K. Bandyopadhyay, India Martin Descarreaux, USA Z. Kain, USA
Sarang Bani, India Alexandra Deters, Germany Osamu Kanauchi, Japan
Vassya Bankova, Bulgaria S. S. K. Durairajan, Hong Kong Wenyi Kang, China
Winfried Banzer, Germany Mohamed Eddouks, Morocco Dae Gill Kang, Republic of Korea
V. A. Barnes, USA Thomas Efferth, Germany Shao-Hsuan Kao, Taiwan
Samra Bashir, Pakistan Tobias Esch, Germany Krishna Kaphle, Nepal
Jairo Kenupp Bastos, Brazil S. Esmaeili-Mahani, Iran Kenji Kawakita, Japan
Sujit Basu, USA Nianping Feng, China Jong Yeol Kim, Republic of Korea
David Baxter, New Zealand Yibin Feng, Hong Kong Ch.-H. Kim, Republic of Korea
A.-M. Beer, Germany J. Fernandez-Carnero, Spain Y. Chul Kim, Republic of Korea
Alvin J. Beitz, USA Juliano Ferreira, Brazil Yoshiyuki Kimura, Japan
Yong Ch. Boo, Republic of Korea Fabio Firenzuoli, Italy Joshua K. Ko, China
F. Borrelli, Italy Peter Fisher, UK Toshiaki Kogure, Japan
Gloria Brusotti, Italy W. F. Fong, Hong Kong N. Krishnadas, India
I. A. Bukhari, Pakistan Romain Forestier, France Yiu Wa Kwan, Hong Kong
Arndt Büssing, Germany Joel J. Gagnier, Canada Kuang Chi Lai, Taiwan
R. W. Bussmann, USA Jian-Li Gao, China Ching Lan, Taiwan
Raffaele Capasso, Italy Gabino Garrido, Chile Alfred Längler, Germany
Opher Caspi, Israel M. N. Ghayur, Pakistan Lixing Lao, Hong Kong
Han Chae, Korea A. H. Gilani, Pakistan Clara B.-S. Lau, Hong Kong
Shun-Wan Chan, Hong Kong Michael Goldstein, USA Jang-Hern Lee, Republic of Korea
I.-M. Chang, Republic of Korea M. P. Gupta, Panama Tat leang Lee, Singapore
R. Chaturvedi, India Mitchell Haas, USA Myeong S. Lee, UK
Chun Tao Che, USA Svein Haavik, Norway Christian Lehmann, Canada
Hubiao Chen, Hong Kong Abid Hamid, India Marco Leonti, Italy
J.-G. Chen, China N. Hanazaki, Brazil Ping-Chung Leung, Hong Kong
Kevin Chen, USA KB Harikumar, India Lawrence Leung, Canada
T.-J. Chen, Taiwan Cory S. Harris, Canada K.N. Leung, Hong Kong
Yunfei Chen, China Thierry Hennebelle, France Ping Li, China
J.-T. Cheng, Taiwan Seung-Heon Hong, Korea Min Li, China
E. P. Cherniack, USA Markus Horneber, Germany Man Li, China
ChunGuang Li, Australia Andrea Pieroni, Italy Mei Tian, China
Xiu-Min Li, USA Richard Pietras, USA Evelin Tiralongo, Australia
Shao Li, China Waris Qidwai, Pakistan S. C. Tjen-A-Looi, USA
Yong Hong Liao, China Xianqin Qu, Australia Michał Tomczyk, Poland
Sabina Lim, Korea Cassandra L. Quave, USA Yao Tong, Hong Kong
Bi-Fong Lin, Taiwan Roja Rahimi, Iran K. V. Trinh, Canada
Wen Chuan Lin, China Khalid Rahman, UK Karl W.-K. Tsim, Hong Kong
Ch. G. Lis, USA Cheppail Ramachandran, USA Volkan Tugcu, Turkey
Gerhard Litscher, Austria Gamal Ramadan, Egypt Yew-Min Tzeng, Taiwan
Ke Liu, China Ke Ren, USA Dawn M. Upchurch, USA
I-Min Liu, Taiwan Man Hee Rhee, Republic of Korea M. Van de Venter, South Africa
Gaofeng Liu, China Mee-Ra Rhyu, Republic of Korea Sandy van Vuuren, South Africa
Yijun Liu, USA José Luis Rı́os, Spain Alfredo Vannacci, Italy
Cun-Zhi Liu, China P. R. di Sarsina, Italy Mani Vasudevan, Malaysia
Gail B. Mahady, USA Bashar Saad, Palestinian Authority Carlo Ventura, Italy
Juraj Majtan, Slovakia Sumaira Sahreen, Pakistan Wagner Vilegas, Brazil
Subhash C. Mandal, India Omar Said, Israel Pradeep Visen, Canada
J. L. Marnewick, South Africa L. A. Salazar-Olivo, Mexico Aristo Vojdani, USA
V. S. Martino, Argentina M. Zaki Salleh, Malaysia Y. Wang, USA
J. H. McAuley, Australia A. Sandner-Kiesling, Austria Shu-Ming Wang, USA
Karin Meissner, USA Adair Santos, Brazil Chenchen Wang, USA
Andreas Michalsen, Germany G. Schmeda-Hirschmann, Chile Chong-Zhi Wang, USA
David Mischoulon, USA Andrew Scholey, Australia Kenji Watanabe, Japan
Syam Mohan, Malaysia Veronique Seidel, UK J. W., Thailand
J. Molnar, Hungary Senthamil R. Selvan, USA W. Weidenhammer, Germany
Valério Monteiro-Neto, Brazil Tuhinadri Sen, India Jenny M. Wilkinson, Australia
H.-I. Moon, Republic of Korea Hongcai Shang, China D. R. Williams, Republic of Korea
Albert Moraska, USA Karen J. Sherman, USA Haruki Yamada, Japan
Mark Moss, UK Ronald Sherman, USA Nobuo Yamaguchi, Japan
Yoshiharu Motoo, Japan Kuniyoshi Shimizu, Japan Yong-Qing Yang, China
Frauke Musial, Germany Kan Shimpo, Japan Junqing Yang, China
MinKyun Na, Republic of Korea Byung-Cheul Shin, Korea Ling Yang, China
Richard L. Nahin, USA Yukihiro Shoyama, Japan E. J. Yang, Republic of Korea
Vitaly Napadow, USA Chang Gue Son, Korea Xiufen Yang, China
F. R. F. Nascimento, Brazil Rachid Soulimani, France Ken Yasukawa, Japan
Sh. Nayak, Trinidad And Tobago Didier Stien, France Min H. Ye, China
Isabella Neri, Italy Shan-Yu Su, Taiwan M. Yoon, Republic of Korea
T. B. Nguelefack, Cameroon M. R. Sulaiman, Malaysia Jie Yu, China
Martin Offenbacher, Germany Venil N. Sumantran, India Jin-Lan Zhang, China
Ki-Wan Oh, Republic of Korea John R. S. Tabuti, Uganda Zunjian Zhang, China
Y. Ohta, Japan Toku Takahashi, USA Wei-bo Zhang, China
Olumayokun A. Olajide, UK Rabih Talhouk, Lebanon Hong Q. Zhang, Hong Kong
Thomas Ostermann, Germany Wen-Fu Tang, China Boli Zhang, China
Stacey A. Page, Canada Yuping Tang, China Ruixin Zhang, USA
Tai-Long Pan, Taiwan Lay Kek Teh, Malaysia Hong Zhang, Sweden
Bhushan Patwardhan, India Mayank Thakur, India Haibo Zhu, China
Berit S. Paulsen, Norway M. C. Thounaojam, India
Contents
Pomegranate: Its Health and Biomedical Potential, Ari M. Mackler, David Heber, and Edwin L. Cooper
Volume 2013, Article ID 903457, 2 pages
Pomegranate Supplementation Protects against Memory Dysfunction after Heart Surgery: A Pilot
Study, Susan A. Ropacki, Sapna M. Patel, and Richard E. Hartman
Pomegranate Juice Augments Memory and fMRI Activity in Middle-Aged and Older Adults with Mild
Memory Complaints, Susan Y. Bookheimer, Brian A. Renner, Arne Ekstrom, Zhaoping Li,
Susanne M. Henning, Jesse A. Brown, Mike Jones, Teena Moody, and Gary W. Small
Protective Effect of Punica granatum L. against Serum/Glucose Deprivation-Induced PC12 Cells Injury,
Fatemeh Forouzanfar, Amir Afkhami Goli, Elham Asadpour, Ahmad Ghorbani, and Hamid Reza Sadeghnia
A Review on Antihyperglycemic and Antihepatoprotective Activity of Eco-Friendly Punica granatum

Peel Waste, Sushil Kumar Middha, Talambedu Usha, and Veena Pande
Erratum to “Pomegranate Extracts in the Management of Men’s Urologic Health: Scientific Rationale
and Preclinical and Clinical Data”, Nils Kroeger, A. S. Belldegrun, and A. J. Pantuck
Volume 2013, Article ID 870454, 1 page
Biological Significance of Urolithins, the Gut Microbial Ellagic Acid-Derived Metabolites: The Evidence
So Far, Juan Carlos Espı́n, Mar Larrosa, Marı́a Teresa Garcı́a-Conesa, and Francisco Tomás-Barberán
The Pomegranate: Effects on Bacteria and Viruses That Influence Human Health, Amy B. Howell and
Doris H. D’Souza
Preventive and Prophylactic Mechanisms of Action of Pomegranate Bioactive Constituents,

Monica Viladomiu, Raquel Hontecillas, Pinyi Lu, and Josep Bassaganya-Riera
Pomegranate Juice Metabolites, Ellagic Acid and Urolithin A, Synergistically Inhibit

Androgen-Independent Prostate Cancer Cell Growth via Distinct Effects on Cell Cycle Control and
Apoptosis, Roberto Vicinanza, Yanjun Zhang, Susanne M. Henning, and David Heber
Pomegranate Supplementation Improves Affective and Motor Behavior in Mice after Radiation
Exposure, Melissa S. Dulcich and Richard E. Hartman
Pomegranate Bioactive Constituents Suppress Cell Proliferation and Induce Apoptosis in an

Experimental Model of Hepatocellular Carcinoma: Role of Wnt/𝛽-Catenin Signaling Pathway,
Deepak Bhatia, Roslin J. Thoppil, Animesh Mandal, Karishma A. Samtani, Altaf S. Darvesh,
and Anupam Bishayee
Pomegranate Extracts in the Management of Men’s Urologic Health: Scientific Rationale and Preclinical
and Clinical Data, Kroeger N., Belldegrun A. S., and Pantuck A. J.
A Review on the Anti-Inflammatory Activity of Pomegranate in the Gastrointestinal Tract,

Elisa Colombo, Enrico Sangiovanni, and Mario Dell’Agli
Pomegranate Protection against Cardiovascular Diseases, Michael Aviram and Mira Rosenblat
Hindawi Publishing Corporation
http://dx.doi.org/10.1155/2013/903457
Editorial
Pomegranate: Its Health and Biomedical Potential
Ari M. Mackler,1 David Heber,2 and Edwin L. Cooper3

1
Clinical Development, POM Wonderful, Los Angeles, CA 90064-1549, USA
2
Division of Clinical Nutrition, David Geffen School of Medicine at UCLA, University of California, Los Angeles,
CA 90095-1742, USA
3
David Geffen School of Medicine at UCLA, University of California, Los Angeles, CA 90095-1763, USA
Correspondence should be addressed to Edwin L. Cooper; ecam@roll.com
Received 9 September 2013; Accepted 9 September 2013
Copyright © 2013 Ari M. Mackler et al. This is an open access article distributed under the Creative Commons Attribution License,
which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
Diet and lifestyle have long been recognized as important phytochemicals include anthocyanins, flavanols, and a seed
modifiers of health status. Modern scientific methods are oil which can be converted to conjugated linoleic acid.
being used to uncover, demystify, and validate the benefits Among fruits, the hydrolysable tannin called punicalagin
of dietary constituents in health promotion. Likewise, many is uniquely found in the pomegranate. This is the largest
different foods are currently being studied for their role in the polyphenol antioxidant with a molecular weight of over 1000
management of numerous disorders and conditions ranging Daltons. These large molecules are hydrolyzed in the intestine
from metabolic and inflammatory disorders to cardiovas- and release ellagic acid into the bloodstream. Punicalagin,
cular disease and cancer. Indeed, our best medicines may punicalin, gallagic acid, and ellagic acid account for the
ultimately turn out to be botanicals, sourced from the 150,000 majority of the ellagitannins. The gut bacteria convert these
to 200,000 edible plant species on earth. These compounds ellagitannins into urolithins which are small molecules with
are simply awaiting discovery and development. The concept antioxidant and other biological effects. Interestingly, the
of functional foods is evolving with insights into the mecha- relevance of newly identified compounds to the mechanisms
nisms of action of a number of bioactive compounds found of action underlying the benefits of pomegranate juice and
in foods. In this regard, this special issue focuses its attention extracts has become an important path for future exploration
on the emerging science of the pomegranate and its rich store and scientific investigation. To this end, purified extracts
of bioactive phytochemicals. have proven to be valuable tools to explore and understand
The pomegranate’s ability to combat oxidative stress, mechanisms of action of pomegranate juice.
augment the activity of nitric oxide, and modulate inflam- The pomegranate occupies a prominent place in art, reli-
matory pathways serves as the scientific basis for much of gious symbolism, and traditional medicine dating back thou-
its recently discovered health benefits. As an example, a sands of years. A look into our modern literature will point
balance between free radicals and antioxidants is necessary to research from as far back as 1821. Rigorous investigation,
for proper physiological function. If free radicals overwhelm however, only began some 20 years ago. Within this special
the body’s ability to regulate them, a condition known as issue both original research and review articles, covering
oxidative stress ensues. Downstream, free radicals adversely both mechanism of action and clinical investigations, are
alter lipid, protein, and DNA within cells, contributing to included. From a mechanism perspective, articles in this issue
the etiology of a number of common chronic diseases and evaluate the biological effects of urolithins and assess the role
conditions associated with aging. The health benefits of of these gut-produced metabolites in potential mechanism-
pomegranate juice and extracts is derived from a spectrum of of-action schemas for pomegranate activity. Additionally,
bioactive agents. In addition to the unique family of polyphe- authors describe work with cancer models that are helping to
nols in the pomegranate called punicalagins, pomegranate identify subcellular molecular mechanisms of action, such as
2 Evidence-Based Complementary and Alternative Medicine
the 𝛽-Catenin Signaling Pathway. From a clinical perspective,

authors have prepared analyses on such varied clinically rele-
vant topics as cardiovascular health, memory loss, immunity,
and cancer. As described by these investigators, although
pomegranate demonstrates promise across different patient
types, the underlying mechanisms of action are often similar
(e.g., protecting against the damaging effects of hypoxia).
It is our hope that this compilation of data will advance
our knowledge of this ancient fruit’s chemistry and further
its application to the most perplexing chronic diseases facing
mankind today.
Ari M. Mackler
David Heber
Edwin L. Cooper
http://dx.doi.org/10.1155/2013/932401
Research Article
Pomegranate Supplementation Protects against
Memory Dysfunction after Heart Surgery: A Pilot Study
Susan A. Ropacki,1 Sapna M. Patel,2 and Richard E. Hartman2

1
Veterans Affairs Palo Alto Health Care System, PTRP-MB2A, 3801 Miranda Aveune, Palo Alto, CA 94304, USA
2
Department of Psychology, Loma Linda University, 11130 Anderson Street, Loma Linda, CA 92592, USA
Correspondence should be addressed to Richard E. Hartman; behavioralneuroscience@gmail.com
Received 28 December 2012; Revised 18 July 2013; Accepted 5 August 2013
Academic Editor: Ari M. Mackler
Copyright © 2013 Susan A. Ropacki et al. This is an open access article distributed under the Creative Commons Attribution
License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly
cited.
Memory dysfunction is a common complaint following heart surgery and may be related to a diffuse ischemic state induced by
microemboli dislodged during the procedure. Ischemia can induce damage by a number of mechanisms, including oxidative
stress. Because pomegranates contain a variety of polyphenols with antioxidant and other potentially beneficial effects, we tested
whether supplementation with a pomegranate extract before and after heart surgery could protect against postoperative cognitive
dysfunction. Patients undergoing elective coronary artery bypass graft and/or valve surgery were given either 2 g of pomegranate
extract (in 2 POMx pills) or placebo (pills containing no pomegranate ingredients) per day from one week before surgery to 6
weeks after surgery. The patients were also administered a battery of neuropsychological tests to assess memory function at 1
week before surgery (baseline), 2 weeks after surgery, and 6 weeks after surgery. The placebo group had significant deficits in
postsurgery memory retention, and the pomegranate treatment not only protected against this effect, but also actually improved
memory retention performance for up to 6 weeks after surgery as compared to presurgery baseline performance.
1. Introduction potentially neurotoxic protein linked to Alzheimer’s disease

and acute cognitive deficits, in the brain [8–10].
Postoperative cognitive dysfunction (POCD) has been Increasing evidence suggests that dietary manipulations
observed in patients following surgery with general anesthe- may reduce neuropathology and/or cognitive deficits in a
sia [1], especially following heart surgery [2]. The well-known number of disease states. In particular, foods with high
case study of a patient who developed relatively severe and concentrations of bioactive polyphenols have been shown to
permanent amnesia following open-heart surgery, presum- be neuroprotective against rodent models of stroke [11] and
ably due to ischemic hippocampal damage suffered during Alzheimer’s disease [12, 13]. These neuroprotective polyphe-
the surgery, is a striking illustration of these deficits [3]. Coro- nols include epigallocatechin-3-gallate (green tea), curcumin
nary artery bypass grafting (CABG) and valve replacement (turmeric), resveratrol (red wine, grape juice), quercetin
surgery have been shown by a number of studies to induce (grapefruit), and ellagic acid (raspberries, pomegranates).
prolonged POCD [4–6]. Proposed mechanisms for POCD For example, dietary supplementation of pregnant mice
following heart surgery include general hypoperfusion of the with pomegranate juice was shown to protect against brain
brain (global ischemia), leading to critically low levels of damage in the hippocampus when the neonatal mice were
oxygen and glucose throughout the brain, and focal ischemia subjected to hypoxic-ischemic brain injury (a model of
due to microembolic particles released into the vasculature insufficient blood supply to the brain during birth) [11]. In
during surgery [7]. Additionally, inhaled anesthetics have other studies with transgenic mouse models of Alzheimer’s
been shown to induce the formation of amyloid-beta, a disease, pomegranate juice reduced both neuropathology
and behavioral deficits [12, 13]. The potential protective 2. Materials and Methods
mechanisms of polyphenols include antioxidant properties
and suppression of inflammatory and other pathways [14], 2.1. Subjects. The subjects were elective cardiac surgery
as well as inhibiting accumulation of amyloid-beta in the (CABG and/or valve repair/replacement) patients who were
brain [12]. Polyphenolic substances may also be transformed recruited from the Loma Linda University International
into potentially beneficial metabolic by-products by colonic Heart Institute at the time they presented for a preoperative
microflora (microbes in the gut) [15]. It should be noted that evaluation and scheduled surgery. Exclusion criteria included
whole foods often contain several phenolic substances, and less than 6 years of education, a history of previous cardiac
research suggests that synergistic activity between multiple surgery, planned concomitant noncoronary procedures, his-
polyphenols may prove more beneficial than treatment with tory of allergy to pomegranates, history of head injury, neu-
isolated polyphenols [16]. rodegenerative disease or neurologic condition with known
Pomegranate juice contains relatively high concentrations cognitive impact (e.g., Alzheimer’s disease, muscular sclero-
of polyphenolic substances [17]. Human studies have detected sis), history of drug or alcohol abuse, DSM-IV psychiatric
these substances and their metabolic by-products in the disorder, active renal disease (serum creatinine concentration
blood after oral administration [18–21], and data from rodent >2.0 mg per deciliter), active liver disease, or left ventricular
studies suggests that they can positively affect the brain [11– ejection fraction of less than 20%.
13, 22, 23]. Because of its neuroprotective and cardiovascular-
enhancing properties, and because it is relatively inexpensive 2.2. Treatment. Subjects were randomly assigned to the
(compared to pharmaceuticals) and well tolerated, pre- and pomegranate or placebo groups. Participants in the pome-
postsurgical dietary supplementation with pomegranate may granate group (𝑛 = 5) were given two POMx (Pom Wonder-
prove to be effective in preventing or reducing post-operative ful, CA, USA) capsules (one in the morning and one in the
cognitive deficits. evening). Each 1 g capsule contained a concentrated blend of
Cardiac surgery patients are the ideal population to test the polyphenols derived from 240 mL of pomegranate juice
this hypothesis because of their relatively high risk of POCD. (∼375 mg punicalagins, 93 mg anthocyanins, 29 mg ellagic
It has been shown by several animal studies that both global acid, and 100 mg other tannins). We chose a dose of two pills
and focal ischemia can induce brain damage and learn- per day because doses of 1-2 have proven safe and effective in
ing/memory deficits (e.g., see [24]). Therefore, reduction of other human studies [20, 26–28]. Participants in the placebo
the brain damage and/or dysfunction putatively caused by group (𝑛 = 5) were given two placebo capsules that looked
cardiac surgery may prevent the associated cognitive deficits. identical to the PomX pills but contained no pomegranate
Although findings on cognitive declines have been con- ingredients.
sistent in CABG and heart valve surgery research, preventive
or treatment options for cardiac surgery-related cognitive 2.3. Data Collection. Information was gathered on a num-
dysfunction have not been examined extensively. In recent ber of biomedical risk factors and demographic variables,
years, there has been a great deal of emphasis on the beneficial including prior history of smoking, hypertension, cholesterol,
effects of pomegranate on health, including diseases of the diabetes, education, and social support. An IQ estimate
brain and the heart. Few studies, however, have explored the was calculated using the sum of scaled scores from the
impact of pomegranate on cognitive functions. Thus, the cur- Wechsler Adult Intelligence Scale–III (WAIS-III; Wechsler,
rent study is unique in its exploration of the effects of pomeg- 1997) Vocabulary and Matrix Reasoning subtests (ERSET
ranate on various health parameters and its effectiveness in operations manual).
reducing cognitive declines (specifically memory) after heart The mean age of the pomegranate group was approxi-
surgery. mately 62.4 years, the mean number of years of education
Heart disease is the leading cause of death in the US and was 15.3 years, and the mean estimated IQ was 100.6. The
is associated with cognitive declines. CABG and heart valve mean age of the placebo group was approximately 70.2 years,
surgery have been employed as treatments to help restore car- the mean number of years of education was 15 years, and the
diac functioning to an optimal level and have decreased mor- mean IQ estimate was 106.6. CABG and valve replacement
tality rates associated with heart disease. However, there is surgeries were equally represented in each group (see Table 1).
evidence of relatively long-term memory deficits in the post- Treatment began one week before surgery and continued
operative period [25]. Nutritional supplements can success- through 6 weeks after surgery. Trained graduate students in
fully moderate some of these heart disease risk factors, so we psychology, or the licensed clinical psychologist associated
speculated that they might also ameliorate the negative cogni- with this study, performed all cognitive assessments under
tive consequences of heart disease and surgical interventions standardized conditions. All examiners and subjects were
as well. Preventive options for the cognitive declines observed blinded to treatment group.
after cardiac surgery have not been examined extensively.
The aim of the current study was to examine the impact of 2.4. Neuropsychological Tests. Tests to assess memory func-
pomegranate supplementation on memory performance after tion were administered just prior to the first pomegranate pill
cardiac surgery. This was examined by comparing the results administration one week before surgery (baseline), 2 weeks
of baseline neuropsychological tests for immediate memory, after surgery (short term), and 6 weeks after surgery (long
delayed memory, and retention in treatment and placebo term). The memory tests included the WAIS-III Digit Span
groups to post-operative test results. subtest, Hopkins Verbal Learning Test-Revised (HVLT-R),
Evidence-Based Complementary and Alternative Medicine 3
Table 1: Demographic and perioperative data for the overall study sample by treatment group.
All Pomegranate Placebo Signif.

Age in years (mean ± standard deviation) 66.3 ± 8.9 62.4 ± 8.6 70.2 ± 8.1 𝑝 = .178
Years of education (mean ± standard deviation) 15.1 ± 1.96 15.3 ± 2.2 15.0 ± 2.0 𝑝 = .864
IQ estimate (mean ± standard deviation) 103.6 ± 17.0 100.6 ± 20.5 106.6 ± 14.4 𝑝 = .607
Gender (%) 𝜒2 = .444
Male 80 100 60
Female 20 0 40
Ethnicity (%) 𝜒2 = 1.00
Caucasian 60 60 60
Hispanic 20 20 20
Asian 20 20 20
Marital status (%) 𝜒2 = .444
Married 88.9 75 100
Single 0 0 0
Divorced 11.1 25 0
Widowed 0 0 0
Diabetes (%) 𝜒2 = .524
Yes 55.6 60 25
No 44.4 40 75
High cholesterol (%) 𝜒2 = .444
Yes 88.9 100 75
No 11.1 0 25
Hypertension (%) 𝜒2 = .167
Yes 77.8 100 50
No 22.2 0 50
Smoking history (%) 𝜒2 = .048
Yes 44.4 80 0
No 55.6 20 100
Surgery type (%) 𝜒2 = .444
CABG 60 60 60
Valve 30 40 20
CABG + valve 10 0 20
CPB minutes (mean ± standard deviation) 142.4 ± 48.1 151.3 ± 50.6 107.0 ± 0.0 𝜒2 = .491
Cross-clamp minutes (mean ± standard deviation) 104.5 ± 50.7 127.5 ± 44.4 58.5 ± 4.7 𝜒2 = .120
the Rey Complex Figure Test with recognition trial (RCFT), number of words recalled after the delay, and a recogni-
the Logical Memory subtest of Wechsler Memory Scales tion score which is the total number of words recalled in
(WMS-III), and the Brief Visuospatial Memory Test-Revised a list of target words and distractors. A retention score
(BVMT-R). representing the percentage of information retained was
The WAIS-III Digit Span subtest was administered as a created using the following formula: {[(learning score −
measure of working memory. It is comprised of a forward delayed recall score)/learning score] × 100} − 100.
digit span repetition task, in which the respondent repeats The RCFT assesses visuospatial memory. It consists of a
back an increasingly long series of single-digit numbers and a copy trial, an immediate recall trial (3 minutes), a delayed
backward digit span repetition task, in which the respondent recall trial (30 minutes), and a recognition trial. Scores
repeats an increasingly long series of single-digit numbers in include a copy score (which reflects the accuracy of the
reverse order. A total score is calculated based on the number original figure and the time required to copy the figure),
of correctly repeated number strings. immediate and delayed recall scores (assess the amount of
The HVLT-R assesses verbal learning and memory. It is a information retained over time), and the number of items
list-learning task that consists of three immediate recall trials, correctly and incorrectly identified on a recognition task.
a 20-minute delayed recall trial and a recognition trial, con- A retention score representing the percentage of informa-
sisting of 12 words. There is an immediate recall score tion retained was calculated using the following formula:
(total of all three trials), learning score (highest of T2 or {[(learning score − delayed recall score)/learning score] ×
T3 minus T1), delayed memory score which is the total 100} − 100.
The WMS-III Logical Memory subtest assesses contextual Composite memory score
1
verbal learning and memory. It consists of two stories that
2 weeks 6 weeks
are read out loud by the examiner. The first story is read
once and the second story is read twice. Participants are
to recall the stories immediately and after a 25–35-minute 0.5
delay and are given a yes/no recognition trial following
Z-score ± SEM
Improved
the delays. Scores include an immediate recall and delayed compared to
recall (reflecting the amount of information retained over baseline
time) for all the details of both stories, learning score 0
for the second story, and a recognition score. A retention Impaired
compared to
score representing the percentage of information retained baseline
was created using the following formula: {[(learning score − −0.5
delayed recall score)/learning score] × 100} − 100.
The BVMT-R assesses visuospatial memory. It consists of
three trials in which a display of 6 figures is presented for 10
seconds and participants are required to draw the figures in −1
their correct locations on the page after each trial. They are
required to recall these figures after a 20-minute delay and are Placebo
given a yes/no recognition trial following the delays. Scores Pomegranate
include immediate recall (total of all trials), delayed recall,
learning, and recognition. A retention score representing the Figure 1: Pooling data across all four memory domains revealed
percentage of information retained was created using the fol- a trend for an improvement from presurgery baseline scores for
lowing formula: {[(learning score − delayed recall score)/ the pomegranate group at both short- and long-term time points,
learning score] × 100} − 100. whereas the placebo group performed slightly worse than baseline
at both time points.
Raw scores on the selected memory test variables were
converted into z-scores using normative data (taking into
account age and educational level), and average compos-
ite scores were calculated for immediate memory, delayed baseline performance (𝐹[3, 24] = 3.03, 𝑝 < .05; Figure 2).
memory, and retention by averaging the z-scores from When domain and time point were analyzed together, it
each test for each of these domains. Each patient’s short- became clear that digit span (working memory), immediate
term (2 weeks after surgery) and long-term (6 weeks after memory, and delayed memory all improved at least slightly
surgery) scores were then normalized to their baseline (1 week from baseline at both short- and long-term time points for
before surgery) scores to assess whether scores improved the pomegranate group. In contrast, scores for the placebo
or deteriorated following surgery. Statistical analyses were group on these domains did not change significantly from
carried out using the SPSS (PASW Statistics 18) statistical baseline (Figure 3). However, retention scores for the placebo
software package (SPSS, Inc., Chicago, IL, USA). A repeated- group were worse than baseline 2 weeks after surgery and
measures between-groups analysis of variance (ANOVA) was continued to decline for up to 6 weeks after surgery. In
conducted using short- versus long-term working memory contrast, retention scores for the pomegranate group were
data and composite scores for immediate memory, delayed significantly improved from baseline at both 2 and 6 weeks
memory, and retention to examine differences between and after surgery (𝐹[1, 8] = 5.64, 𝑝 < .05; Figure 3).
within groups at each post-operative time point. These results suggest that the post-operative memory
dysfunction following heart surgery consists mostly of reten-
3. Results and Discussion tion issues rather than problems with working memory,
immediate memory, or delayed memory. Retention scores on
3.1. Neuropsychological Tests. There were no significant dif- these neuropsychological tests reflect how much information
ferences between groups on demographic factors such as is recalled relative to how much was actually learned and
age, education, estimated IQ, or any of the surgical or thus provides a measure of memory consolidation. In con-
perioperative variables available on participants (see Table 1). trast, working memory (digit span) scores reflect the ability
Pooling data across all four memory domains (working, to attend and to maintain information for use in a task,
immediate, delayed, and retention) revealed a trend for immediate memory scores reflect how much information is
an improvement from presurgery baseline scores for the learned in the short term, and delayed memory scores reflect
pomegranate group at both short- and long-term time points, how much information is recalled relative to how much
whereas the placebo group was slightly impaired compared to information was actually presented.
baseline at both time points (Figure 1). Additionally, pooling
data across both time points revealed a significant and 3.2. Potential Mechanisms. The data also suggest that sup-
striking difference, in that retention was the memory domain plementation with pomegranate polyphenols can protect
most severely impacted by the surgery. The pomegranate against surgery-induced retention deficits and may actually
treatment not only protected against this effect, but also improve memory retention even after heart surgery. The
seemed to improve retention performance from presurgery specific mechanisms by which pomegranate polyphenols
Average performance by domain Working Immediate Delayed Retention

1.5 Working Immediate Delayed Retention weeks weeks weeks weeks
2 6 2 6 2 6 2 6
∗ ∗
1.5
1
1
0.5 Improved
Z-score ± SEM
compared to
baseline 0.5 Improved
Z-score ± SEM
0 compared to
Impaired baseline
compared to 0
−0.5 baseline Impaired
compared to
−0.5 baseline
−1
−1
−1.5
−1.5
Placebo
Pomegranate Placebo
Pomegranate
Figure 2: Pooling data across both time points revealed a specific
retention memory deficit in the placebo group after surgery, whereas Figure 3: Working memory, immediate memory, and delayed
the pomegranate group’s performance across all domains improved memory all improved at least slightly from baseline at both short-
after surgery (∗ 𝑝 < .05). and long-term time points for the pomegranate group. Scores for
the placebo group on these domains did not change significantly
from baseline. Retention scores for the placebo group were impaired
compared to baseline 2 weeks after surgery and continued to decline
affect memory are currently unknown. In addition to the neu- for up to 6 weeks after surgery. Retention scores for the pomegranate
roprotective properties described above, pomegranates have group were significantly improved from baseline at both 2 and 6
been shown to improve a number of cardiovascular measures, weeks after surgery (𝑝 < .05).
including lipid metabolism and blood pressure. For example,
pomegranate juice reduced low-density lipoprotein (LDL)
aggregation, oxidative stress [14], serum angiotensin con-
verting enzyme, and systolic blood pressure in hypertensive 3.3. Implications. The most important implication for
patients [29]. In patients with carotid artery stenosis, pome- patients is that if we are able to offset the amount of memory
granate juice reduced LDL oxidation, atherosclerosis, and decline immediately after surgery, then their long-term
systolic blood pressure [30]. In patients with ischemic coro- prognosis may be better. Alternatively, there are important
nary heart disease, pomegranate juice (PJ) decreased stress- implications for both patients and healthcare personnel.
induced ischemia but had no effect on blood sugar levels Several factors can prolong intensive care and length of hos-
or blood pressure [31]. Studies with diabetic patients have pital stay, including intraoperative cerebral oxygen desat-
shown that PJ decreased blood lipid oxidation, total choles- uration. If pomegranate is indeed targeting hypoxic mech-
terol, and LDL cholesterol with no effects on high-density anisms, then it may lead to shorter intensive care unit and
lipoprotein (HDL) or serum triacylglycerol [32]. A study with hospital stays, thereby decreasing hospital costs and costs to
healthy volunteers showed that PJ decreased blood platelet the healthcare system. Another general implication for indi-
aggregation/clotting [33]. However, a study with chronic viduals is to increase engagement in health behaviors that
obstructive pulmonary disease patients found no effects on are easily incorporated into daily life, are relatively free of
respiratory function or lipid profile. In animal studies, PJ was negative side effects, and are comparatively inexpensive, to
shown to reduce LDL aggregation [14] and atherosclerosis limit the number of factors (e.g., hypertension, high choles-
[34] in hypercholesterolemic mice and improved cardiac lipid terol, and smoking) that put them at greater risk for heart
metabolism in a rat model of diabetes. It is possible that disease necessitating cardiac surgery and the subsequent
some of the vascular effects of PJ are due to its effects on cognitive deficits. Ultimately, continued research would lead
nitric oxide synthase in the vasculature [34]. Also, PJ has been to better treatments that improve the outcome of cardiac
shown to inhibit cytochrome P450 3A (CYP3A), an enzyme surgery and the cognitive well-being of the multitude of men
involved in the regulation of blood vessel tone. However, and women who undergo these types of surgeries.
unlike grapefruit juice, pomegranate juice has not been
shown to inhibit drug clearance in humans by suppression of 4. Conclusions
CYP3A [35] or CYP2C9 [36]. Moreover, multiple studies have
shown that PJ also has anticancer [27, 37] and antimicrobial Other studies using pomegranate have focused on its pro-
properties [38]. See Figure 4 for an illustration of potential cardiovascular [14, 29–35], anti-cancer [27, 37], and antimi-
mechanisms for the protective actions of pomegranate after crobial [38] properties. In 2006, we were the first to
open heart surgery. show that pomegranate can improve cognitive functions
General Open-heart
anesthesia surgery
Amyloid Reactive
Brain
aggregation oxygen
in the brain species ischemia
Suppressed Vascular
Apoptosis Inflammation
neurogenesis damage
Anti-
Neuroprotective Antioxidant Provascular inflammatory
Pomegranate
Figure 4: Pomegranates may protect the brain (and therefore memory) from the effects of open-heart surgery by a number of potential
mechanisms. General anesthesia can induce amyloid aggregation in the brain and the surgery can induce brain ischemia, both leading
to reactive oxygen species (e.g., free radicals). These insults may cause neuronal cell death (apoptosis), suppression of the birth of new
neurons (neurogenesis), vascular damage, and inflammation in the brain. Pomegranate’s antiapoptotic, antioxidant, anti-inflammatory, and
provascular (via nitric oxide synthase) properties may protect against those effects.
in mice [12]. In this study, we are the first to show that and vegetables have a similar effect? Will isolated polypheno-
pomegranate can improve cognitive functions in humans. We lic compounds provide as many beneficial effects as the com-
have generated intriguing data suggesting that pomegranate bined range of compounds found in the whole fruit? Finally,
polyphenols may provide long-lasting protection from heart future studies should analyze additional information regard-
surgery-induced memory retention deficits. We showed a ing length of hospital stay, possible complications, preopera-
clear pattern of postsurgical memory improvement in the tive and postoperative use of medications like beta-blockers
pomegranate group across all of the memory domains that we and statins, and evaluation for delirium. Future clinical stud-
tested, with an especially strong and long-lasting protective ies may provide the answers to these questions, and animal or
effect in the memory retention domain. It remains possible in vitro studies may help to elucidate the molecular mecha-
that the extra statistical power provided by a larger sample nisms behind the neuroprotective properties of polyphenols.
size may allow for the detection of statistically significant Finally, perhaps the most intriguing prospect raised by this
improvements across the remaining memory domains as study is the possibility that dietary supplementation with
well. It is also possible that extending the pre- and/or post- pomegranate polyphenols can improve cognition. If this
surgical treatment regimen may provide added benefit. treatment can improve memory retention performance for
individuals who have undergone a surgical treatment shown
to cause a decline in performance, perhaps this treatment can
improve the cognitive function of healthy individuals.
4.1. Future Directions. The results of this study also raise
a number of other interesting questions. Although we did Acknowledgment
not analyze neuropsychological data from other cognitive
domains, it is possible that one or more other mental fac- The authors would like to thank Pom Wonderful for supply-
ulties could be negatively impacted by heart surgery and/or ing the PomX and placebo pills to this project. The authors
positively impacted by pomegranate treatment. Furthermore, have no conflicting interests with any of the companies
we initiated treatment before the heart surgery. It remains to mentioned in this paper.
be seen whether starting treatment after surgery would have
strong (if any) effects and also whether the dose we chose was
the most effective dose. Would a larger dose provide more
References
benefits and/or would a smaller dose prove equally as effec- [1] K. P. Grichnik, A. J. J. Ijsselmuiden, T. A. D’Amico et al., “Cog-
tive? Also, pomegranates were chosen because of their high nitive decline after major noncardiac operations: a preliminary
polyphenolic content. Would other polyphenol-rich fruits prospective study,” Annals of Thoracic Surgery, vol. 68, no. 5, pp.
1786–1791, 1999. pomegranate juice are metabolised into bioavailable but poor
[2] L. Gao, R. Taha, D. Gauvin, L. B. Othmen, Y. Wang, and G. antioxidant hydroxy-6H-dibenzopyran-6-one derivatives by
Blaise, “Postoperative cognitive dysfunction after cardiac sur- the colonic microflora of healthy humans,” European Journal of
gery,” Chest, vol. 128, no. 5, pp. 3664–3670, 2005. Nutrition, vol. 43, no. 4, pp. 205–220, 2004.
[3] S. Zola-Morgan, L. R. Squire, and D. G. Amaral, “Human [16] N. P. Seeram, L. S. Adams, S. M. Henning et al., “In vitro
amnesia and the medial temporal region: enduring memory antiproliferative, apoptotic and antioxidant activities of puni-
impairment following a bilateral lesion limited to field CA1 of calagin, ellagic acid and a total pomegranate tannin extract are
the hippocampus,” Journal of Neuroscience, vol. 6, no. 10, pp. enhanced in combination with other polyphenols as found in
2950–2967, 1986. pomegranate juice,” Journal of Nutritional Biochemistry, vol. 16,
no. 6, pp. 360–367, 2005.
[4] D. Van Dijk, A. M. A. Keizer, J. C. Diephuis, C. Durand, L. J. Vos,
and R. Hijman, “Neurocognitive dysfunction after coronary [17] N. S. Kelawala and L. Ananthanarayan, “Antioxidant activity of
artery bypass surgery: a systematic review,” Journal of Thoracic selected foodstuffs,” International Journal of Food Sciences and
and Cardiovascular Surgery, vol. 120, no. 4, pp. 632–639, 2000. Nutrition, vol. 55, no. 6, pp. 511–516, 2004.
[18] N. P. Seeram, R. Lee, and D. Heber, “Bioavailability of ellagic
[5] J. Uekermann, B. Suchan, I. Daum, S. Kseibi, M. Perthel, and J.
acid in human plasma after consumption of ellagitannins from
Laas, “Neuropsychological deficits after mechanical aortic valve
pomegranate (Punica granatum L.) juice,” Clinica Chimica Acta,
replacement,” Journal of Heart Valve Disease, vol. 14, no. 3, pp.
vol. 348, no. 1-2, pp. 63–68, 2004.
338–343, 2005.
[19] N. P. Seeram, S. M. Henning, Y. Zhang, M. Suchard, Z. Li, and D.
[6] K. A. Büsing, C. Schulte-Sasse, S. Flüchter et al., “Cerebral
Heber, “Pomegranate juice ellagitannin metabolites are present
infarction: incidence and risk factors after diagnostic and
in human plasma and some persist in urine for up to 48 hours,”
interventional cardiac catheterization—prospective evaluation
Journal of Nutrition, vol. 136, no. 10, pp. 2481–2485, 2006.
at diffusion-weighted MR imaging,” Radiology, vol. 235, no. 1,
pp. 177–183, 2005. [20] N. P. Seeram, Y. Zhang, R. McKeever et al., “Pomegranate juice
and extracts provide similar levels of plasma and urinary ellag-
[7] C. Schmitz, S. Weinreich, J. White et al., “Can particulate extrac- itannin metabolites in human subjects,” Journal of Medicinal
tion from the ascending aorta reduce neurologic injury in car- Food, vol. 11, no. 2, pp. 390–394, 2008.
diac surgery?” Journal of Thoracic and Cardiovascular Surgery,
vol. 126, no. 6, pp. 1829–1838, 2003. [21] S. U. Mertens-Talcott, P. Jilma-Stohlawetz, J. Rios, L. Hingorani,
and H. Derendorf, “Absorption, metabolism, and antioxidant
[8] P. K. Mandal, J. W. Pettegrew, D. W. McKeag, and R. Mandal, effects of pomegranate (Punica granatum L.) polyphenols after
“Alzheimer’s disease: halothane induces A𝛽 peptide to oligo- ingestion of a standardized extract in healthy human volun-
meric form—solution NMR studies,” Neurochemical Research, teers,” Journal of Agricultural and Food Chemistry, vol. 54, no.
vol. 31, no. 7, pp. 883–890, 2006. 23, pp. 8956–8961, 2006.
[9] P. K. Mandal, J. P. Williams, and R. Mandal, “Molecular under- [22] S. J. Choi, J.-H. Lee, H. J. Heo et al., “Punica granatum protects
standing of A-𝛽 peptide interaction with isoflurane, propofol, against oxidative stress in PC12 cells and oxidative stress-
and thiopental: NMR spectroscopic study,” Biochemistry, vol. induced alzheimer’s symptoms in mice,” Journal of Medicinal
46, no. 3, pp. 762–771, 2007. Food, vol. 14, no. 7-8, pp. 695–701, 2011.
[10] R. E. Hartman, Y. Izumi, K. R. Bales, S. M. Paul, D. F. Wozniak, [23] M. S. Dulcich and R. E. Hartman, “Pomegranate supple-
and D. M. Holtzman, “Treatment with an amyloid-𝛽 antibody mentation improves affective and motor behavior in mice
ameliorates plaque load, learning deficits, and hippocampal after radiation exposure,” Evidence-Based Complementary and
long-term potentiation in a mouse model of Alzheimer’s dis- Alternative Medicine, vol. 2013, Article ID 940830, 8 pages, 2013.
ease,” Journal of Neuroscience, vol. 25, no. 26, pp. 6213–6220, [24] R. E. Hartman, J. M. Lee, G. J. Zipfel, and D. F. Wozniak,
2005. “Characterizing learning deficits and hippocampal neuron loss
[11] D. J. Loren, N. P. Seeram, R. N. Schulman, and D. M. Holtzman, following transient global cerebral ischemia in rats,” Brain
“Maternal dietary supplementation with pomegranate juice Research, vol. 1043, no. 1-2, pp. 48–56, 2005.
is neuroprotective in an animal model of neonatal hypoxic- [25] R. P. Kesner and R. O. Hopkins, “Mnemonic functions of the
ischemic brain injury,” Pediatric Research, vol. 57, no. 6, pp. 858– hippocampus: a comparison between animals and humans,”
864, 2005. Biological Psychology, vol. 73, no. 1, pp. 3–18, 2006.
[12] R. E. Hartman, A. Shah, A. M. Fagan et al., “Pomegranate [26] D. Heber, N. P. Seeram, H. Wyatt et al., “Safety and antioxidant
juice decreases amyloid load and improves behavior in a mouse activity of a pomegranate ellagitannin-enriched polyphenol
model of Alzheimer’s disease,” Neurobiology of Disease, vol. 24, dietary supplement in overweight individuals with increased
no. 3, pp. 506–515, 2006. waist size,” Journal of Agricultural and Food Chemistry, vol. 55,
[13] L. Rojanathammanee, K. L. Puig, and C. K. Combs, “Pome- no. 24, pp. 10050–10054, 2007.
granate polyphenols and extract inhibit nuclear factor of acti- [27] C. J. Paller, X. Ye, P. J. Wozniak et al., “A randomized phase II
vated T-cell activity and microglial activation in vitro and in a study of pomegranate extract for men with rising PSA following
transgenic mouse model of Alzheimer,” The Journal of Nutrition, initial therapy for localized prostate cancer,” Prostate Cancer and
vol. 143, no. 5, pp. 597–605, 2013. Prostatic Diseases, vol. 16, no. 1, pp. 50–55, 2012.
[14] M. Aviram, L. Dornfeld, M. Rosenblat et al., “Pomegranate juice [28] A. Balbir-Gurman, B. Fuhrman, Y. Braun-Moscovici, D.
consumption reduces oxidative stress, atherogenic modifica- Markovits, and M. Aviram, “Consumption of pomegranate
tions to LDL, and platelet aggregation: studies in humans and decreases serum oxidative stress and reduces disease activity in
in atherosclerotic apolipoprotein E-deficient mice,” American patients with active rheumatoid arthritis: a pilot study,” Israel
Journal of Clinical Nutrition, vol. 71, no. 5, pp. 1062–1076, 2000. Medical Association Journal, vol. 13, no. 8, pp. 474–479, 2011.
[15] B. Cerdá, J. C. Espı́n, S. Parra, P. Martı́nez, and F. A. Tomás- [29] M. Aviram and L. Dornfeld, “Pomegranate juice consumption
Barberán, “The potent in vitro antioxidant ellagitannins from inhibits serum angiotensin converting enzyme activity and
reduces systolic blood pressure,” Atherosclerosis, vol. 158, no. 1,

pp. 195–198, 2001.
[30] M. Aviram, M. Rosenblat, D. Gaitini et al., “et al. Pomegranate
juice consumption for 3 years by patients with carotid artery
stenosis reduces common carotid intima-media thickness,
blood pressure and LDL oxidation,” Clinical Nutrition, vol. 23,
pp. 423–433, 2004.
[31] M. D. Sumner, M. Elliott-Eller, G. Weidner et al., “Effects
of pomegranate juice consumption on myocardial perfusion
in patients with coronary heart disease,” American Journal of
Cardiology, vol. 96, no. 6, pp. 810–814, 2005.
[32] A. Esmaillzadeh, F. Tahbaz, I. Gaieni, H. Alavi-Majd, and L.
Azadbakht, “Concentrated pomegranate juice improves lipid
profiles in diabetic patients with hyperlipidemia,” Journal of
Medicinal Food, vol. 7, no. 3, pp. 305–308, 2004.
[33] J. A. Polagruto, D. D. Schramm, J. F. Wang-Polagruto, L. Lee,
and C. L. Keen, “Effects of flavonoid-rich beverages on prosta-
cyclin synthesis in humans and human aortic endothelial cells:
association with ex vivo platelet function,” Journal of Medicinal
Food, vol. 6, no. 4, pp. 301–308, 2003.
[34] F. De Nigris, S. Williams-Ignarro, L. O. Lerman et al., “Beneficial
effects of pomegranate juice on oxidation-sensitive genes and
endothelial nitric oxide synthase activity at sites of perturbed
shear stress,” Proceedings of the National Academy of Sciences
of the United States of America, vol. 102, no. 13, pp. 4896–4901,
2005.
[35] D. Farkas, L. E. Oleson, Y. Zhao et al., “Pomegranate juice does
not impair clearance of oral or intravenous midazolam, a probe
for cytochrome P450-3A activity: comparison with grapefruit
juice,” Journal of Clinical Pharmacology, vol. 47, no. 3, pp. 286–
294, 2007.
[36] M. J. Hanley, G. Masse, J. S. Harmatz, M. H. Court, and D.
J. Greenblatt, “Pomegranate juice and pomegranate extract do
not impair oral clearance of flurbiprofen in human volunteers:
divergence from in vitro results,” Clinical Pharmacology and
Therapeutics, vol. 92, no. 5, pp. 651–67, 2012.
[37] R. Longtin, “The pomegranate: nature’s power fruit?” Journal of
the National Cancer Institute, vol. 95, no. 5, pp. 346–348, 2003.
[38] L. C. Braga, J. W. Shupp, C. Cummings et al., “Pomegranate
extract inhibits Staphylococcus aureus growth and subsequent
enterotoxin production,” Journal of Ethnopharmacology, vol. 96,
no. 1-2, pp. 335–339, 2005.
http://dx.doi.org/10.1155/2013/946298
Research Article
Pomegranate Juice Augments Memory and fMRI Activity in
Middle-Aged and Older Adults with Mild Memory Complaints
Susan Y. Bookheimer,1,2 Brian A. Renner,1,2 Arne Ekstrom,1,2 Zhaoping Li,1,2 Susanne M.

Henning,1,2 Jesse A. Brown,1,2 Mike Jones,1,2 Teena Moody,1,2 and Gary W. Small1,2
1
Center for Cognitive Neurosciences, Department of Psychiatry and Biobehavioral Sciences and Semel Institute for
Neuroscience and Human Behavior, University of California, Los Angeles, 760 Westwood Plaza, Los Angeles, CA 90024, USA
2
Center for Human Nutrition, David Geffen School of Medicine, and the UCLA Longevity Center, University of California,
Los Angeles, Los Angeles, CA, USA
Correspondence should be addressed to Susan Y. Bookheimer; sbook@ucla.edu
Received 17 March 2013; Accepted 14 May 2013
Academic Editor: Edwin L. Cooper
Copyright © 2013 Susan Y. Bookheimer et al. This is an open access article distributed under the Creative Commons Attribution
cited.
Despite increasing emphasis on the potential of dietary antioxidants in preventing memory loss and on diet as a precursor of
neurological health, rigorous studies investigating the cognitive effects of foods and their components are rare. Recent animal
studies have reported memory and other cognitive benefits of polyphenols, found abundantly in pomegranate juice. We performed
a preliminary, placebo-controlled randomized trial of pomegranate juice in older subjects with age-associated memory complaints
using memory testing and functional brain activation (fMRI) as outcome measures. Thirty-two subjects (28 completers) were
randomly assigned to drink 8 ounces of either pomegranate juice or a flavor-matched placebo drink for 4 weeks. Subjects received
memory testing, fMRI scans during cognitive tasks, and blood draws for peripheral biomarkers before and after the intervention.
Investigators and subjects were all blind to group membership. After 4 weeks, only the pomegranate group showed a significant
improvement in the Buschke selective reminding test of verbal memory and a significant increase in plasma trolox-equivalent
antioxidant capacity (TEAC) and urolithin A-glucuronide. Furthermore, compared to the placebo group, the pomegranate group
had increased fMRI activity during verbal and visual memory tasks. While preliminary, these results suggest a role for pomegranate
juice in augmenting memory function through task-related increases in functional brain activity.
1. Introduction [7]. Epidemiological studies have suggested a link between

antioxidant consumption and cognitive protection [8–11],
As people age, their risk for cognitive decline increases. and studies using a rodent model of Alzheimer’s disease
An estimated 40% of people 65 years and older have suggest that tau phosphorylation occurs as a compensatory
age-associated memory impairment characterized by self- response to oxidative stress [12]. Several clinical trials of
perception of memory loss and a standardized memory test antioxidant use in subjects with normal aging or Alzheimer’s
score demonstrating lower objective memory performance disease suggest memory benefits [13–15], while others yielded
compared with young adults [1–3]. While genetic factors negative results [16–19].
play an important role in age-related memory decline, such While many fruits are rich in various antioxidants,
nongenetic lifestyle factors as diet and exercise contribute as including ascorbic acid, carotenoids, and phenolics, com-
well [4]. In particular, a growing body of evidence indicates monly consumed fruits show large differences in antioxidant
that accumulation of oxidative damage to macromolecules capacity, as determined by the ferric reducing/antioxidant
increases progressively during the aging process [5, 6] and power (FRAP) assay [20]. In particular, there is special
contributes to neurodegeneration in Alzheimer’s disease interest in the pomegranate polyphenols, which have been
studied extensively in animal models of Alzheimer’s disease Table 1: Demographic and clinical characteristics of subjects at
[21, 22]. The emerging data on pomegranate fruits and their baseline.
inherent polyphenols suggest positive benefits ranging from Mean (SD)
neuroprotective effects [23, 24] to staving off effects of senes- Characteristic Pomegranate Placebo
cent neurodegeneration in animal models of Alzheimer’s (𝑛 = 15) (𝑛 = 13)
disease [25–27].
Previously, we found that pomegranate juice has the high- Mini-mental state examination 28.0 (1.5) 27.8 (1.5)
est antioxidant capacity among fruit juices using five different Age, y 63.1 (8.0) 62.0 (7.8)
in vitro antioxidant assays [28]. In comparison, apple juice, Female, no. (%) 11 (73.3) 10 (76.9)
which is low in antioxidant capacity, was less effective than TEAC baseline 1712 (299) 1927 (461)
pomegranate juice in affecting antioxidant capacity based on Buschke selective reminding test
FRAP assays in 26 elderly subjects consuming pomegranate
Recall 85.0 (11.7) 86.5 (12.5)
juice or apple juice over a 4-week period [29].
Overexpression of antioxidant enzymes or supplemen- Consistent long-term retrieval 52.8 (19.9) 55.8 (25.5)
tation of some antioxidants appears effective in extending
the life span in several animal models [5, 6], and a few
studies have specifically found memory-enhancing effects of increase task-related brain activation in the left and right
polyphenols in mice [30, 31]. However, evidence for memory hemispheres for verbal and nonverbal memory tasks, respec-
enhancement from polyphenols in human-controlled trials is tively. Together these metrics provide preliminary evidence
limited. One preliminary study [15] found beneficial effects of bioavailability, clinical efficacy, and brain mechanisms of
of grape juice on memory in five older adults with age- pomegranate juice in older adults with memory complaints.
associated memory impairment compared to seven placebo
controls; to our knowledge this small study is the only 2. Methods
placebo-controlled human trial of polyphenols that assessed
memory change. Therefore, more well-controlled studies are 2.1. Subjects. Thirty-two volunteers were initially enrolled
needed to determine potential beneficial effects of antiox- into the study out of 39 who were screened; of these, 28
idants that occur naturally in various food sources and to completed the clinical trial (Table 1). Subjects were recruited
elucidate the possible underlying mechanisms. via advertisements through local newspapers, flyers, posters,
Moreover, studies that examine possible brain mecha- lectures, and word-of-mouth. We specifically recruited non-
nisms of polyphenol treatment in humans are limited. One demented, older right-handed subjects with self-reported
potential method for identifying mechanisms of recovery in age-related memory complaints. The subjects did not carry
drug trials is functional magnetic resonance imaging (fMRI). a diagnosis of mild cognitive impairment (MCI) and were
While structural MRI studies measure long-term changes in screened using the mini-mental state examination (MMSE).
metrics, such as cortical thickness and volume [32–34], fMRI Subjects randomized to placebo versus control groups did
measures blood flow changes in response to memory chal- not differ in mean age, percentage of women, mean MMSE
lenge, which has proven to be effective in determining brain scores, or baseline memory performance (Table 1). Potential
differences among subjects with Alzheimer’s disease, mild subjects were excluded who had documented neurological,
cognitive impairment, or nondemented subjects at risk for psychiatric, or major medical conditions, including heart
Alzheimer’s disease [35–40]. Further, fMRI has proven to be disease, diabetes, and gastrointestinal disease, that might
sensitive in measuring changes in neural activation patterns affect cognitive function or interfere with study procedures.
among older subjects in response to memory-enhancing We also excluded subjects who routinely ate more than three
drugs, such as donepezil [41] and memantine [42], with servings per day of fruits and vegetables or were taking
results showing increased activation or restoration of resting- vitamin supplements, any medication, or dietary supplement
state brain networks following treatment. One investigation that interferes with the absorption of polyphenols. Potential
used fMRI to examine the effects of antioxidants (flavonoids) subjects participating in regular vigorous exercises other than
in young healthy controls and demonstrated increased fMRI ordinary daily walks or who were unwilling to maintain a
activity to cognitive challenge with flavonoid administration sedentary lifestyle during the 28-day study were excluded,
[43]; however, no studies to date have examined fMRI effects as were those for whom MRI was contraindicated (e.g.,
of antioxidant therapy in older adults with or without mem- claustrophobia, dental braces, or implanted ferromagnetic or
ory complaints. To address this knowledge gap, we explored electronic devices). Seven potential subjects were screened
potential neuroprotective effects derived from polyphenols out based on one or more of these exclusion criteria.
in pomegranate juice in older volunteers with mild memory Subjects were instructed that they would be removed
complaints in a placebo-controlled, randomized, and double- from the study if they failed to follow the prescribed low
blind trial and measured three aspects: (1) metabolites of polyphenol diet during the one-week run-in period based
pomegranate juice using blood biomarkers; (2) effects of on self-report in-person interview with a study dietitian.
pomegranate juice on memory performance; and (3) evi- The study was approved by the UCLA Institutional Review
dence of functional MRI changes during memory activa- Board; all subjects gave informed consent to participate in all
tion. We hypothesized that pomegranate juice compared to procedures and were reconsented for followup evaluations.
placebo would increase metabolites, improve memory, and Funding for this study was provided by the UCLA Center
for Human Nutrition from a “various donors” account. The recalled (TR) on the Buschke-Fuld selective reminding task
investigators were blind to the contributors to this fund, (sum of all items recalled on all trials) and on the consistent
and there was no communication or input from donors or long term retrieval (CLTR) score (sum of items recalled in
commercial entities at any stage of the study. consecutive trials without item repetition). The TR score
emphasizes immediate recall, while CLTR depends upon
memory consolidation processes. To determine memory
2.2. General Procedures. Following phone screening, vol-
change, we first examine the 𝑡2 versus 𝑡1 difference in scores
unteers participated in an initial clinical evaluation, which
within groups using a paired 𝑡-test. To determine whether
included an explanation of the study procedures, consent,
the treatment effects differed between groups, we then tested
medical screening, MMSE, and routine CBC and chemistry
for differences between the pomegranate juice and placebo
panel. Prior to the intervention phase, each subject met with
groups using a 2-group unpaired 𝑡-test. Because memory
a registered dietitian and was instructed on a low polyphenol
performance in this age range is highly variable, we used time
diet, which required that they restrict their intake of several
2 minus time 1 difference scores as our dependent variables.
fruits and vegetables, onions, tea, chocolate, and dried beans,
At baseline, there were no differences between groups on
for one week prior to the baseline visit and for the duration for
either TR performance (two-tailed 𝑡 = .8; 𝑃 ≥ .4) or CLTR
the study. At baseline, subjects underwent neuroimaging and
(two-tailed 𝑡 = .5; 𝑃 > .9). For this reason our analysis did
neurocognitive testing (described later). We also acquired
not covary baseline performance; instead we performed a 𝑡-
blood samples to perform the antioxidant assay and to verify
test of group differences on the change scores.
compliance with the protocol. Subjects were then randomized
to either the pomegranate or placebo groups; investigators
and subjects were blind to group membership. 2.4. Plasma Biomarkers. Plasma obtained from all sub-
After these procedures, subjects were given a one-week jects prior to and at the end of the trial was tested for
supply of 8-ounce containers of pomegranate or placebo TEAC and urolithin A-glucuronide. The trolox-equivalent
juice with instructions to consume 8 ounces of juice daily. antioxidative capacity (TEAC) was determined using 2󸀠 , 2󸀠 -
The pomegranate drink was the commercial Pom Wonderful azinobis(3-thylbenzo thiazoline-6-sulfonic-acid) diammo-
product. The flavor-matched drink contained sugar, citric nium (ABTS) radical cations oxidized with by adding solid
acid, and food color to match the calorie, taste, and color manganese dioxide in 75 mmol/L sodium/potassium phos-
of the juice. Each week, subjects returned their empty juice phate (Na/K) buffer of pH 7. Trolox (6-hydroxy-2,5,7,8-
containers to ensure compliance, picked up their juice supply tetramethylchroman-2-carboxylic acid), a water-soluble ana-
for the following week, and met briefly with the dietitian to log of vitamin E, was used as an antioxidant standard. Plasma
ensure compliance with the low polyphenol diet. At the end of was diluted 1 : 20 in Na/K buffer pH 7. Diluted plasma samples
the study (day 28), subjects again underwent neuroimaging, were assayed in four replicates. TEAC values were calculated
cognitive assessment, and blood draws. from the trolox standard curve (0–350 𝜇mol/L) and expressed
A placebo drink using sugars and natural colorings and as trolox equivalents (in mmol/L) [46]. Plasma urolithin A-
flavoring to imitate the taste and appearance of pomegranate glucuronide was measured using high performance liquid
juice was used. The research personnel were blinded as to the chromatography mass spectrometry (LC-MS) as described
assignment of subjects to placebo or pomegranate juice. previously [47]. Of all biomarker data across the two time
points, only three data points were missing (one placebo
subject, TEAC Day 0; two PJ subjects, UA-Glu day 28); the
2.3. Behavioral Testing Procedures. Each subject underwent calculations were therefore based on the remaining subjects.
fMRI and brief memory testing immediately prior to begin- Plasma TEAC was equivalent between groups at baseline (𝑃 >
ning the trial and following 28 days of pomegranate juice .17; see Table 1), so we calculated the percent change in TEAC
or placebo. Subjects received a memory testing battery for each subject and compared the change scores.
and underwent functional MRI scanning on the same day.
Memory tests administered were the Buschke-Fuld selective
reminding task [44], from which we calculated two perfor- 2.5. MRI Procedures. Functional and structural images were
mance measures, total items recalled and consistent long- collected on a 3T Siemens Trio MRI scanner using a 32-
term retrieval; an experimental unrelated word pair asso- channel head coil. Structural MRI was collected using a
ciates learning task [36], based on the Wechsler memory scale 𝑇1-weighted magnetization prepared rapid gradient echo
paired associates learning [45] in which we used identical (MPRAGE) volumetric scan sequence using axial acquisition
procedures to that used in the fMRI scan but with different slicing, TR = 2.3 sec, TE = 2.93 msec, field of view =
stimuli. We also obtained behavioral data from the MRI tasks 256×256 mm2 , flip angle = 8∘ , resolution 160×192×192, voxel
administered in the scanner (described below). Of the 28 size = 1.5 mm3 . Scans were reviewed to rule out subjects with
subjects completing the study, 26 had behavioral data on both brain abnormalities (evidence of stroke, structural lesion, or
occasions (two did not participate in one testing session; their atrophy indicative of dementia).
remaining behavioral data were eliminated from analysis). Functional MRI was collected using a 𝑇2∗ -weighted
Subjects were administered one of two alternate forms of echoplanar pulse sequence with a TR = 2.5 sec, TE =
each task, with the order of forms counterbalanced across 35 msec, field of view = 200 × 200 mm, flip angle = 90∘ ,
subjects, to avoid practice effects. To assess changes in verbal collecting whole brain images with resolution = 64 × 64 ×
memory, we compared performance on total number of items 28, voxel size = 3 mm3 . For localization, image registration,
and spatial normalization, we collected a coplanar, matched- (location identification), respectively. Condition 3 required
bandwidth, spin-echo echoplanar scan on each subject (TR = subjects to identify the store (source) for a specific item
5000 ms, TE = 33 ms, 128 × 128 matrix size). Experimental that might be purchase there, requiring the participant to
tasks (described below) were presented via magnet compat- encode the association between an item and a spatial location.
ible video and audio system (Resonance Technologies, Inc, For this source task, subjects had to recall whether the
Northridge, CA), which included video goggles with lenses store was in the first or second town (memory for object-
for vision correction optimized for each subject. Responses location associations). Only the latter condition tapped into
were recorded and made using a button press. Stimuli were the associative memory processes. The order of the three
presented via a Macintosh computer running MATLAB. conditions was counterbalanced across subjects.
For the functional MRI tasks, subjects received computer
training of tasks prior to scan sessions. Two memory tasks
reported previously by our group were presented during
scanning: a verbal memory task (unrelated word-pair asso- 2.8. fMRI Analysis. All functional data were analyzed
ciates learning) [36] and a visual memory task (spatial using FSL version 4.1.4 (FMRIB’s Software Library,
navigation) [48]. Following 28 days of intervention (𝑡2), the http://www.fmrib.ox.ac.uk/fsl). Preprocessing included
fMRI and behavioral testing procedures were repeated and motion correction to the mean image, spatial smoothing
compared to 𝑡1 using alternate forms. (Gaussian kernel FWHM = 5 mm), and high-pass temporal
filtering (𝑡 > 0.01 Hz). Subjects with head motion exceeding
an average of 2 voxels were removed from analysis. Twenty-
2.6. Verbal Memory Task. The unrelated word-pair task was
three (13 pomegranate juice, 10 placebo) subjects were
identical to that previously reported by Bookheimer et al.
able to complete the visual memory fMRI task without
[36]. Briefly, subjects were presented seven pairs of unrelated
significant head motion, while for the verbal memory
words (e.g., table flower) in six learning blocks, interspersed
task, eight pomegranate juice and nine placebo subjects
with baseline fixation and retrieval blocks. During each
were able to complete both scanning sessions with high
learning block, subjects heard each word pair presented over
quality images. Each functional scan was registered to its
two seconds with a two-second interval before the next pair
corresponding coplanar high-resolution image with rigid
(total block length = 28 sec). Following a 20-second fixation
body transformations and to the MNI152 standard brain
baseline, they performed the retrieval task in which they were
using nonlinear transformation (12 degrees of freedom).
presented the first word in each pair and asked to generate
Additionally, a high-pass temporal filtering of 100 sec was
the matching word. The word lists were matched for word
applied to the functional images. Individual preprocessing
frequency, imageability, and form. Behavioral performance
and statistical analysis of each subject’s functional scan
was collected at the end of each scan and in an alternate form
was run using FSL FMRI Expert Analysis Tool (FEAT);
administered outside the scanner to obtain a learning curve.
FEAT was then used to analyze data at the group level.
The total scan length was 9 minutes.
Without strong a priori hypotheses about region-specific
effects of polyphenols (other than presuming left versus
2.7. Visual Memory Task. The spatial navigation task involved right hemispheric changes for verbal and visual memory
learning and recalling routes on a virtual map, while subjects tasks, resp.), we corrected for multiple comparisons across
play the role of a “taxi driver.” During the encoding phase, the entire brain using FSL’s FEAT, correcting at the cluster
subjects watched and rewatched two sets of video clips. In level. FEAT uses an FWE (family-wise error) cluster-based
each video, subjects first saw the name of the imaginary town, thresholding using random field theory to correct for
such as “Johnsberg,” then for 15 second blocks they saw a multiple comparisons across space. Thresholding defines
first-person view of “driving” to a virtual town laid out in contiguous clusters; each cluster’s estimated significance
5 × 5 block grids, to a storefront destination with unique level from Gaussian random field-theory is compared with
characteristics for specific storefronts, stopping for 3 seconds the cluster probability threshold.
before proceeding to a new store within the same town First, for both the verbal and visual memory tasks, we
starting from a different location. After each city, subjects contrasted task versus baseline for each subject at each time
performed a 30-second distractor task where they pressed a point (before and after treatment). To minimize the number
left or right button in response to a probe. This was repeated of comparisons, we restricted our analysis to learn versus
while subjects learned 6 cities in total. baseline and recall versus baseline for the verbal memory
The fMRI data were then collected during memory task and task versus baseline for each of the three visual
retrieval in three conditions. Subjects were asked to remem- memory conditions, (item, source, and spatial). Next, for each
ber one of three characteristics about each storefront for task, the individual subject data were entered into a second-
the separate tasks. Two conditions focused on the physical level analysis of within-group means for each contrast. To
features of the environment (specific stores-item task and test the hypothesis that pomegranate juice and placebo
physical placement-location task). In condition 1, partici- groups differed in 𝑡2 versus 𝑡1 activation patterns, between-
pants were asked to identify an appearance change of the group, between time point contrasts were generated using an
store (identification), such as signs, colors, and doors. In ANOVA model in FSL, cluster-corrected at 𝑍 > 2.0, 𝑃 =
condition 2, they were asked to identify the spatial location .05, and corrected for multiple comparisons. Finally, for each
change of the store within the town, relative to other buildings task, the individual subject data were entered into additional
analyses of within-group between time point, and between- (𝑃 < .05), additional regions in the left inferior frontal gyrus
group within time point. and left middle frontal gyrus were recruited. In contrast and
as predicted, no brain regions were more active in 𝑡2 versus
𝑡1 for the placebo group compared to the pomegranate group
3. Results
(no voxels exceeded threshold).
3.1. Peripheral Biomarkers. At baseline, the groups did not To further examine the effects of the PJ intervention
differ in antioxidant levels (TEAC; 𝑡 = 1.37, 𝑃 > .17). on visual memory, we performed a secondary analysis
The pomegranate juice group had significantly higher TEAC com-paring the PJ versus placebo groups for the visual
values after day 28 compared with baseline than the placebo memory versus control contrast at 𝑡2 only. This analysis
group (unpaired 𝑡 = 2.8, df = 25, 𝑃 < .05; Figure 1). directly compares visual memory processing between groups
Similarly, plasma urolithin A-glucuronide increased signifi- after treatment. The results of this analysis are shown in
cantly in the pomegranate juice, but not in the placebo group Figure 4. Using unpaired 𝑡-tests for comparing patterns of
(unpaired 𝑡 = 3.75; df = 24, 𝑃 < .001). To evaluate activation during the posttreatment scan between groups, the
compliance, we identified the number of participants whose pomegranate group showed significantly greater activation
urolithin A-glucuronide values increased versus remained than the placebo group in right occipital and right fusiform
the same or less after day 28 across the groups. Two of regions, extending into parahippocampal cortex (Figure 4).
13 placebo subjects had increased urolithin A-glucuronide These regions are typically engaged during visual naviga-
values after 28 days versus 11 of 14 pomegranate juice subjects, tion memory tasks, indicating greater recruitment of visual
a difference that was significant (chi-square = 4.8; 𝑃 < .03). memory regions in the treatment group compared with the
placebo subjects. In contrast, and as expected, the placebo
group did not activate any brain regions significantly more
3.2. Memory Performance. The within-group analysis of
than the pomegranate group (no voxels exceeding threshold).
changes following treatment found that, on average, the
pomegranate juice group performed significantly better at
𝑡2 compared with 𝑡1 (using alternate test forms; two-tailed
3.3.2. Verbal fMRI Memory Task. We first identified brain
𝑡 = 2.8, 𝑃 = .017). For the placebo group, there was no
regions activated during the verbal memory task compared
significant difference between 𝑡2 and 𝑡1 performance scores
to the baseline condition across all subjects and time inter-
(two-tailed 𝑡 = 1.1, 𝑃 > .3).
vals. Consistent with prior studies, the task verbal memory
Between groups, the 𝑡2 versus 𝑡1 improvement in mem-
activated a wide network of brain regions, including bilateral
ory scores was significantly greater in the pomegranate juice
occipital cortex, frontal lobe, and medial temporal lobe and
group compared to the placebo group on the total recall
subcortical regions including thalamus, putamen, and the
measure (two-tailed 𝑡 = 2.3; 𝑃 = .029; Figure 2). Similarly on
hippocampus. Of note, for the verbal task, the pomegranate
consistent long-term retrieval the pomegranate juice group
group activated basal ganglia, thalamus, and hippocampus
recalled more items compared to the placebo group (two-
in the posttreatment session and the placebo group did not
tailed 𝑡 = 2.4; 𝑃 = .022; Figure 2).
(Figure 5).
We then compared the group by time interaction of fMRI
3.3. Imaging Results. Performance on the visual and verbal activations for the PJ versus control group differences using
memory tasks during scanning did not differ between groups ANOVA, identifying brain regions that showed greater fMRI
at either timepoint (all 𝑃 values >.1); thus subsequent activation signal after treatment, for 𝑡2 versus 𝑡1. For the
analyses of activation differences could not be attributed to verbal learning versus control contrast, we found that the
differential performance. PJ group showed significantly greater increases in activation
compared to the placebo group for 𝑡2 versus 𝑡1. Regions
3.3.1. Visual Memory fMRI Task. Looking at within-group showing differences were found in the left hemisphere,
means for both groups and at both time points, we found including regions of the left occipital lobe and left fusiform
significant activation in visual pathways including bilat- gyrus (𝑍 > 2.0, 𝑃 = .05, corrected for multiple comparisons),
eral occipital cortex extending into temporal fusiform and shown in Figure 6 and listed in Table 3. By contrast, but as
parahippocampal gyrus, as well as activation in subcortical expected, there were no regions in which the placebo group
region across the three task conditions, consistent with visual showed greater activation than the pomegranate juice group
memory processing and spatial navigation [48]. for 𝑡2 > 𝑡1.
To test the hypothesis that brain activity during a visual To further examine treatment-related effects, we then
memory task increased for the treatment group exclusively, examined regions of brain activity greater for 𝑡2 versus 𝑡1
we first performed a whole brain, voxel-wise ANOVA com- within groups using paired 𝑡-tests. Only the pomegranate
paring the PJ and control groups on the 𝑡2 versus 𝑡1 contrast, group showed significant differences in activation in the post-
corrected for multiple comparisons and thresholded at 𝑍 > treatment session compared to pretreatment for any brain
2.0. Results of the ANOVA are shown in Figure 3; coordinates regions for the learn versus rest condition. Before treatment,
of active brain regions are listed in Table 2. The pomegranate the PJ group showed significantly greater fMRI activation
group showed greater fMRI activation than the placebo group in the left inferior temporal gyrus and right occipital lobe
in the 𝑡2 versus 𝑡1 contrast, located bilaterally in regions of the compared to the first session (Figure 7). As predicted, the
basal ganglia and thalamus. At a lower threshold of 𝑍 = 1.7 placebo group did not show any regions with significantly
Plasma TEAC change (day 4 to day 28)

∗ Plasma urolithin A-glucuronide
40
240 ns ∗∗
Percent change from baseline
30 200
Concentration (ng/mL)
160
20 120
80
10
40
0 0
−40
−10 Placebo PJ
−80 Placebo PJ
Day 4
Day 28
(a) (b)
Figure 1: Metabolite results. (a) The pomegranate juice group had significantly higher change in TEAC after day 28 compared with baseline
than the placebo group (∗ unpaired 𝑡 = 2.8, df = 25, 𝑝 < .05). (b) Plasma urolithin A-glucuronide significantly increased in the pomegranate
juice group (∗∗ paired 𝑡 = 3.93, df = 13, 𝑝 < .00064), but not in the placebo group (paired 𝑡 = 1.7, df = 11, 𝑝 > .09).
80 Consistent long-term retrieval 100 Buschke total recall score
75 ∗
95
Average number of items recalled
Total consistently of recalled items
70
90
65
85
60
55 80
50 75
45
70
40
65
35
30 60
PJ Placebo PJ Placebo
Time 1 Time 1
Time 2 Time 2
(a) (b)
Figure 2: Buschke selective reminding test results. (a) On the total recall measure, the 𝑡2 versus 𝑡1 change in memory scores was significantly
greater in the pomegranate juice group compared to the placebo group (mean change, number of items recalled: PJ = 7.7, placebo = −2.77;
𝑡 = 2.3; 𝑃 = .029). (b) Similarly, on the consistent long-term retrieval score the pomegranate juice group recalled more items compared to
the placebo group (mean change, number of items consistently recalled: PJ = 15.2, placebo = −9.7; 𝑡 = 2.4; 𝑃 = .022).
greater activation in the second session compared to the first. Therefore, the ANOVA results appear to reflect both increases
It is important to note that between groups differences in in the PJ group and decreases in the placebo group following
change over time could be due either to increases in the PJ intervention.
group or decreases in the placebo group at 𝑡2 relative to time
1. Within the PJ group, there was greater activation in 𝑡2 4. Discussion
compared to 𝑡1 and no regions showed the reverse effect;
thus the PJ group clearly demonstrated an increase in MRI Our results support the hypothesis that polyphenols derived
activation following treatment. However, by examining the from pomegranate juice may improve memory in older
reverse contrast (time 1 > time 2), we found that the placebo persons with age-related memory decline. Figure 8 sum-
group only also showed a decrease in fMRI activation at 𝑡2. marizes our major findings integrating the hypothesized
4.2
R R R R R
2 z = −10 z = −4 z=2 z=6 z = 10
(a) (b) (c) (d) (e)
4.2
R R R R R
2 z = 14 z = 16 z = 22 z = 24 z = 32
4.2 (f) (g) (h) (i) (j)
(n)
(a)
2 R R R R
z = 36 z = 38 z = 46 z = 48
(k) (l) (m) (n)
Figure 3: Visual memory fMRI task: between-groups 𝑇2 versus 𝑇1 ANOVA. Regions showing greater activation for 𝑡2 > 𝑡1, for the
pomegranate juice group > placebo group (group by time interaction), were found bilaterally in the basal ganglia and thalamus, including
caudate, putamen, and pallidum (ANOVA, 𝑍 > 2.0, 𝑃 = .05, corrected for multiple comparisons). Additional regions significant at an
uncorrected threshold (𝑍 > 1.7) are listed in Table 2.
mechanism for effects of pomegranate juice on polyphenol 27, 49, 50]. Joseph and coworkers found that such supple-
metabolites, task-related cerebral blood flow, and memory mentation reversed age-related deficits in working memory
performance. Peripheral measures of TEAC and urolithin performance in the Morris water maze [49]. Other studies
A-glucuronide indicated that our subjects were compliant have shown that blueberry supplementation was effective in
with their regimen and that the dose administered was suffi- reversing cognitive declines in object recognition [51] Possi-
cient to increase polyphenol metabolites. Moreover, memory ble mechanisms for this effect of polyphenol supplementation
assessments indicated that subjects who drank 8 ounces include antioxidant, direct effects on signaling to enhance
of pomegranate juice for a month experienced significant neuronal communication [50], and the ability to buffer
improvements on a sensitive measure of memory perfor- against excess calcium [50]. These animal studies showing
mance. As in fMRI studies of pharmacological interventions putative polyphenol antioxidant effects on cognitive led to
in memory-impaired subjects, the pomegranate juice inter- our choice of pomegranate juice as an intervention, given the
vention activated only memory-related brain regions, with no high polyphenol antioxidant properties of pomegranates [52].
increases in the control group and no decreases in activation The changes in fMRI activity in the pomegranate group
following intervention in the pomegranate juice group. Taken are consistent with results seen on pharmacological trials
together, these findings support the hypothesis that drinking in patients with mild cognitive impairment and Alzheimer’s
pomegranate juice may increase task-related brain activation dementia. It is striking that both the verbal and nonverbal
and improve memory ability in older adults with preexisting memory tasks showed virtually exclusive increases in activity
mild memory complaints. following intervention (there were some parietal increases
These findings are also consistent with animal studies for placebo). Saykin and colleagues [41] found that short-
showing positive effects of polyphenols on memory labo- term treatment with the cholinesterase inhibitor donepezil
ratory animals; previous studies have shown that combat- enhanced frontal circuitry activity in patients with amnestic
ing oxidative stress through berry extract supplementation mild cognitive impairment, and this increase in activation
attenuates age-related cognitive deficits in aged rodents [26, was related to improved cognition. Such increases may occur
Table 2: Spatial memory fMRI activation clusters. ANOVA results showing the coordinates of maximally activated voxels of clusters for
pomegranate juice group > placebo group for 𝑡2 greater than 𝑡1 (𝑍 > 2.0, corrected 𝑃 = 0.05). No regions were found for placebo >
pomegranate for 𝑡2 > 𝑡1.
MNI coordinates (mm)

Spatial memory task
𝑥 𝑦 𝑧 𝑍 stat
𝑍 > 2.0
Subcortical regions
Right thalamus 18 −14 8 2.60
Right pallidum 22 −4 2 2.98
Right putamen 30 −20 0 3.51
Left thalamus −12 −14 10 3.44
Left pallidum −18 −4 −2 3.34
Left caudate −12 4 10 3.06
𝑍 > 1.7
Frontal Lobe
Left paracingulate gyrus, superior frontal gyrus −4 36 38 4.23
Left middle frontal gyrus −38 24 44 3.19
Left middle frontal gyrus −26 2 40 3.1
Left precentral gyrus −44 0 52 3.06
Left inferior frontal gyrus, pars opercularis −42 12 28 2.78
Left middle frontal gyrus, frontal pole −46 32 28 2.75
Subcortical
Right putamen 30 −20 0 3.49
Right pallidum 26 −20 0 3.25
Left pallidum −18 −6 0 3.15
Left Thalamus −16 −14 12 3.67
Left Thalamus −14 −18 0 3.39
3.3
(c)
(b)
(a)
R R R
2 z = −2 z=6 z = 30
3.3
(a) (b) (c)
x = −28 x = −12 x=2

2
(d) (e) (f) (d)(e)(f)
Figure 4: Visual memory fMRI task: between-groups 𝑇2. Activations for time point, 𝑡2, for pomegranate > placebo. For the visual memory
task, at 𝑡2, between groups, pomegranate > placebo, there were significant activations in right lateral occipital cortex and fusiform gyrus
(unpaired 𝑡-test, 𝑍 > 2.0, 𝑃 = .05, corrected for multiple comparisons).
3.3 CBF, acutely and over short time intervals as in the present
study. For example, Huang et al. [56] measured CBF, BOLD
response to forepaw stimulation, and oxygen metabolic rate
(CMRO2) in rats treated with the antioxidant methylene blue
USP; they found increases in task-related BOLD response
and CBF under normal breathing conditions; Bitner et al.
[57] found that antioxidant carbon clusters restored CBF in
an experimental traumatic brain injury model in rate under
hypotension. The antioxidant black cumin oil administered
over 10 weeks improved spatial cognition in a water maze
R
task in rats, a task reminiscent of our spatial navigation
2 task [58]. One recent study in humans found an increase in
PJ: y = −16
BOLD activation during a simple attention-switching task in
(a)
subjects after 5 days of treatment with flavanol-rich cocoa
3.3 [43]. In addition, they performed a second, preliminary study
(𝑁 = 4) of acute flavanol administration during arterial spin
labeling (ASL) MRI, which provides a quantitative measure of
cerebral blood flow, finding increased CBF following flavanol
administration. Together, these studies suggest that antiox-
idants administered either acutely or chronically increase
cerebral blood flow and in one animal study also improved
spatial memory [55].
It is also notable that the regional distribution of increased
activations was largely specific to each task (i.e., left hemi-
sphere for verbal memory, right hemisphere for visual mem-
2 R
Placebo: y = −16 ory). Of the three conditions in the visual spatial navigation
(b)
task, the intervention significantly affected bold activation
pattern in the source memory task. The source task placed
Figure 5: Verbal memory fMRI task: within-group activations at 𝑡2. particular emphasis on episodic memory, requiring subjects
Comparing the within-group results for time point 𝑡2, there were to learn and retrieve novel associations between specific items
activation similarities and differences in the placebo group ((a): top) and the context in which they were encoded (i.e., episodic
and the pomegranate group ((b): bottom). Only the pomegranate memory). Similarly, the verbal memory task was designed to
group recruited the hippocampus, bilaterally (group mean: placebo, tap associative encoding in the verbal domain. In the verbal
𝑍 > 2.0, 𝑃 = .05, corrected for multiple comparisons, pomegranate, task, there were increases in left hemisphere regions after
𝑍 > 2.0, 𝑃 = .05, corrected for multiple comparisons).
treatment, and the pomegranate group showed activation in
the temporal lobe in the posttreatment session that was not
apparent in the placebo group. Associative, episodic memory
because the subjects can better focus on the cognitive task tasks rely particularly on temporal lobe systems, which are
(increased cognitive effort) or alternatively may indicate critically involved in both age-related memory decline and
greater task-related increases in cerebral blood flow. This Alzheimer’s disease.
fMRI method cannot distinguish between these possibilities; The two measures of the Buschke selective reminding
however, changes in task strategy tend to produce both task are thought to assay different memory processes. In
task-related increases and decreases in fMRI signal [53, 54], this test, subjects hear a long list of words and repeat back
whereas an hypothesis of increased blood flow responses as many as they can recall; on subsequent trials they are
would tend to predict only fMRI increases. Our data show reminded only of those words they did not recall on the last
evidence that the PJ group showed increases in fMRI activa- trial (hence, “selective” reminding). The total score reflects
tion at 𝑡2 that were greater than those for placebo, with no all recalls across up to 10 trials until all words are recalled
regions greater for the placebo group at time 2. However we consistently. By contrast, the consistent long-term retrieval
also found some regions in which the placebo group showed score only counts items once they are consistently recalled for
reduced activation at 𝑡2 compared to 𝑡1. Thus the group all subsequent trials (without reminders) and thus appears
by time interaction appears to reflect both increases in the to depend upon consolidation processes mediated by the
experimental and decreases in the control group. Reduction hippocampus. While the scores are not entirely independent
in activation with repeated testing in fMRI is a common (high scores on total recall require consistent retrieval),
finding (e.g., [55]); however we can only conclude that there they are also not fully redundant, as it is possible to have
is relatively greater fMRI activation among the PJ group as we recall scores of up to 80 (approximately the mean of our
do not have absolute measures of cerebral blood flow. subjects’ performance) while never retrieving a memory
Although the duration of our study was short, there is item consistently. The subjects in this study improved on
evidence in the animal literature suggesting that antioxidant both measures suggesting that the intervention may affect
use can affect cerebral blood flow, including task-related cognition broadly. Because our cognitive battery was limited
4.2
R R R
2 z=0 z=2 z=4 z=6
(a) (b) (c) (d)
4.2
(a)
(g)
R R R
2 z=8 z = 14 z = 16
(e) (f) (g) (h)
Figure 6: Verbal memory fMRI task: between-groups 𝑇2 versus 𝑇1 ANOVA. Regions showing greater activation for 𝑡2 > 𝑡1, for pomegranate
group > placebo group, were found in the left hemisphere in occipital polar regions (ANOVA, 𝑍 > 2.0, 𝑃 = .05, corrected for multiple
comparisons).
Table 3: Verbal memory fMRI activation CLusters. ANOVA results that of those completing the memory tests; with the reduced
showing the coordinates of maximally activated voxels of clusters sample size we were unable to make these direct correlations.
for pomegranate juice group > placebo group for 𝑡2 greater than 𝑡1 Further studies with larger samples will allow us to test this
(𝑍 > 2.0, corrected 𝑃 = 0.05). No regions were found for placebo > model more directly.
pomegranate for 𝑡2 > 𝑡1. Other limitations of this study include the small sample
MNI coordinates (mm) size and brief treatment duration. Thus our results should
Verbal memory task be considered preliminary and should be validated in a
𝑥 𝑦 𝑧 𝑍 stat
larger scale, multicenter study. Because the functional MRI
Brain region
measure is a relative one and not a direct measure of cerebral
Occipital lobe blood flow, reduced base-line blood flow could provide an
Left occipital pole −14 −98 16 3.97 alternative explanation for the results. Differences between
Left fusiform gyrus −18 −90 −4 3.55 groups in the 𝑇2 versus 𝑇1 comparison could be due to
Left lingual gyrus −16 −76 −6 2.82 either increases in task-related blood flow relative to 𝑇1
Left lateral occipital −32 −80 −2 2.54 in the pomegranate group or to decreases in blood flow
at 𝑇2 in the placebo group. Future studies could measure
cerebral blood flow quantitatively using either H15 2 O positron
in this preliminary study, however, we cannot tell if other emission tomography or arterial spin-labeled MRI. In this
aspects of cognition are affected by pomegranate juice. Thus, study our regional hypotheses were limited to hemispheric
future studies should examine the effects of pomegranate specificity for verbal versus visual tasks, given the lack of prior
juice or extract using a more comprehensive cognitive battery studies in humans. Accordingly we corrected our results for
of tests. multiple comparisons across the whole brain, which may have
Based on this work and the work on animals, we hypoth- been overly conservative. Future studies with larger N’s could
esize that polyphenols (and other antioxidants) enhance rest- target specific regions of interest in relation to treatment-
ing and task-related cerebral blood flow. Increased metabolic related memory changes.
activity should improve cognitive processing efficiency, in In summary, this preliminary randomized placebo-con-
this case during memory tasks, increasing memory perfor- trolled, double-blind trial of pomegranate juice in older
mance. If correct, we would predict a correlation between adults with mild memory complaints suggests that 8 ounces
the magnitude of increased task-related activation in these of pomegranate juice taken daily over one month improve a
brain regions and the degree of memory improvement after sensitive measure of verbal memory and alter neural activity
treatment. In our study, the number of subjects completing during a visual source memory task. The presence of polyphe-
the fMRI procedures without head motion was smaller than nol metabolites validated compliance with the experimental
(c)
(b)
(a)
R R R
2 z = −8 z = −6 z = −10
(a) (b) (c)
3 (d) (f)
2 x = 12 x = 14 x = 16
(d) (e) (f) (e)
Figure 7: Verbal memory fMRI task: activations for the pomegranate group for 𝑡2 > 𝑡1. For the pomegranate group in the verbal memory
task, there were significant activations between sessions, in the left inferior temporal gyrus and right occipital lobe (paired 𝑡-test between
time points, 𝑍 > 2.0, 𝑃 = .05, corrected for multiple comparisons). No regions were more active for 𝑡2 versus 𝑡1 in the placebo group.
Increased memory
performance
Verbal fMRI- Spatial fMRI-

LH activation RH activation
Pomegranate
antioxidant
properties
Increased task-
Increase metabolites related cerebral
TEAC blood flow
plasma urolithin
Figure 8: Summary of study results. Our data suggest that the antioxidant properties of pomegranate produce increased task related cerebral
blood flow, with lateralized effects for verbal versus visual memory challenge, which in turn increased cerebral blood flow facilitates memory
performance. Metabolic measures confirm the increase in polyphenols among the experimental group.
regimen and efficacy of pomegranate juice in releasing in a biracial community study,” Journal of the American Medical
polyphenols. fMRI results suggest that the mechanisms of Association, vol. 287, no. 24, pp. 3230–3237, 2002.
change may involve increases in task-related cerebral blood [11] F. Grodstein, J. Chen, and W. C. Willett, “High-dose antioxidant
flow, particularly during associative encoding tasks. Future supplements and cognitive function in community-dwelling
studies are needed to validate these results within larger elderly women,” The American Journal of Clinical Nutrition, vol.
samples and determine the long-term effects of pomegranate 77, no. 4, pp. 975–984, 2003.
juice on a range of comprehensive cognitive functions. [12] A. Koudinov, E. Kezlya, N. Koudinova, and T. Berezov,
“Amyloid-𝛽, Tau protein, and oxidative changes as a physiologi-
cal compensatory mechanism to maintain CNS plasticity under
Acknowledgment Alzheimer’s disease and other neurodegenerative conditions,”
Journal of Alzheimer’s Disease, vol. 18, no. 2, pp. 381–400, 2009.
Dr. Bookheimer, Dr. Renner, Dr. Ekstrom, Dr. Li, Dr. Hen-
[13] W. K. Summers, R. L. Martin, M. Cunningham, V. L. Deboyn-
ning, Dr. Brown, Mr. Jones, and Dr. Moody have no relevant
ton, and G. M. Marsh, “Complex antioxidant blend improves
financial conflict of interests. Dr. Gary Small has received memory in community-dwelling seniors,” Journal of Alzheimer’s
an unrestricted educational grant from Pom Wonderful, Disease, vol. 19, no. 2, pp. 429–439, 2010.
Inc.; this funding was not used to fund the present study
[14] R. Krikorian, T. A. Nash, M. D. Shidler, B. Shukitt-Hale, and J. A.
and was received after study completion; he has no other Joseph, “Concord grape juice supplementation improves mem-
relevant financial conflict of interests. Funding for this study ory function in older adults with mild cognitive impairment,”
was provided by the UCLA Nutrition Department research British Journal of Nutrition, vol. 103, no. 5, pp. 730–734, 2010.
funds. POM Wonderful or any other corporate entity or [15] P. P. Zandi, J. C. Anthony, A. S. Khachaturian et al., “Reduced
representative had no role in design or analysis of this study. risk of Alzheimer disease in users of antioxidants vitamin
supplements: the Cache County study,” Archives of Neurology,
References vol. 61, no. 1, pp. 82–88, 2004.
[16] D. Laurin, K. H. Masaki, D. J. Foley, L. R. White, and L. J. Launer,
[1] A. Ward, H. M. Arrighi, S. Michels, and J. M. Cedarbaum, “Mild “Midlife dietary intake of antioxidants and risk of late-life
cognitive impairment: disparity of incidence and prevalence incident dementia: the Honolulu-Asia Aging Study,” American
estimates,” Alzheimer’s and Dementia, vol. 8, no. 1, pp. 14–21, Journal of Epidemiology, vol. 159, no. 10, pp. 959–967, 2004.
2012. [17] H. K. Jae, N. Cook, J. Manson, J. E. Buring, and F. Grodstein, “A
[2] T. Crook, R. T. Bartus, S. H. Ferris et al., “Age-associated mem- randomized trial of vitamin E supplementation and cognitive
ory impairment: proposed diagnostic criteria and measures of function in women,” Archives of Internal Medicine, vol. 166, no.
clinical change-report of a National Institute of Mental Health 22, pp. 2462–2468, 2006.
Work Group,” Developmental Neuropsychology, vol. 2, pp. 261– [18] J. H. Kang, N. R. Cook, J. E. Manson, J. E. Buring, C. M. Albert,
276, 1986. and F. Grodstein, “Vitamin E, Vitamin C, Beta carotene, and
[3] G. J. Larrabee and T. H. Crook III, “Estimated prevalence of cognitive function among women with or at risk of cardiovascu-
age-associated memory impairment derived from standardized lar disease: the women’s antioxidant and cardiovascular study,”
tests of memory function,” International Psychogeriatrics, vol. 6, Circulation, vol. 119, no. 21, pp. 2772–2780, 2009.
no. 1, pp. 95–104, 1994.
[19] J. A. Luchsinger, M.-X. Tang, S. Shea, and R. Mayeux, “Antiox-
[4] T. Seeman and X. Chen, “Risk and protective factors for idant vitamin intake and risk of Alzheimer disease,” Archives of
physical functioning in older adults with and without chronic Neurology, vol. 60, no. 2, pp. 203–208, 2003.
conditions: MacArthur studies of successful aging,” Journals of
Gerontology B, vol. 57, no. 3, pp. S135–S144, 2002. [20] C. Guo, J. Yang, J. Wei, Y. Li, J. Xu, and Y. Jiang, “Antioxidant
activities of peel, pulp and seed fractions of common fruits as
[5] R. S. Sohal, R. J. Mockett, and W. C. Orr, “Mechanisms of aging:
determined by FRAP assay,” Nutrition Research, vol. 23, no. 12,
an appraisal of the oxidative stress hypothesis,” Free Radical
pp. 1719–1726, 2003.
Biology and Medicine, vol. 33, no. 5, pp. 575–586, 2002.
[6] A. Bokov, A. Chaudhuri, and A. Richardson, “The role of [21] J. Wang, I. Santa-Maria, L. Ho et al., “Grape derived polyphenols
oxidative damage and stress in aging,” Mechanisms of Ageing attenuate Tau neuropathology in a mouse model of alzheimer’s
and Development, vol. 125, no. 10-11, pp. 811–826, 2004. disease,” Journal of Alzheimer’s Disease, vol. 22, no. 2, pp. 653–
661, 2010.
[7] D. A. Butterfield, M. L. Bader Lange, and R. Sultana, “Involve-
ments of the lipid peroxidation product, HNE, in the patho- [22] Y. Feng, S. G. Yang, X. T. Du et al., “Ellagic acid promotes
genesis and progression of Alzheimer’s disease,” Biochimica et A𝛽42 fibrillization and inhibits A𝛽42-induced neurotoxicity,”
Biophysica Acta, vol. 1801, no. 8, pp. 924–929, 2010. Biochemical and Biophysical Research Communications, vol. 390,
[8] A. J. Perkins, H. C. Hendrie, C. M. Callahan et al., “Association no. 4, pp. 1250–1254, 2009.
of antioxidants with memory in a multiethnic elderly sample [23] J. A. Joseph, N. A. Denisova, G. Arendash et al., “Blueberry
using the Third National Health and Nutrition Examination supplementation enhances signaling and prevents behavioral
survey,” American Journal of Epidemiology, vol. 150, no. 1, pp. deficits in an Alzheimer disease model,” Nutritional Neuro-
37–44, 1999. science, vol. 6, no. 3, pp. 153–162, 2003.
[9] K. H. Masaki, K. G. Losonczy, G. Izmirlian et al., “Association [24] T. West, M. Atzeva, and D. M. Holtzman, “Pomegranate
of vitamin E and C supplement use with cognitive function and polyphenols and resveratrol protect the neonatal brain against
dementia in elderly men,” Neurology, vol. 54, no. 6, pp. 1265– hypoxic-ischemic injury,” Developmental Neuroscience, vol. 29,
1272, 2000. no. 4-5, pp. 363–372, 2007.
[10] M. C. Morris, D. A. Evans, J. L. Bienias et al., “Dietary intake of [25] M. D. R. Campos-Esparza and M. A. Torres-Ramos, “Neu-
antioxidant nutrients and the risk of incident Alzheimer disease roprotection by natural polyphenols: molecular mechanisms,”
Central Nervous System Agents in Medicinal Chemistry, vol. 10, [41] A. J. Saykin, H. A. Wishart, L. A. Rabin et al., “Cholinergic
no. 4, pp. 269–277, 2010. enhancement of frontal lobe activity in mild cognitive impair-
[26] R. E. Hartman, A. Shah, A. M. Fagan et al., “Pomegranate ment,” Brain, vol. 127, no. 7, pp. 1574–1583, 2004.
juice decreases amyloid load and improves behavior in a mouse [42] M. Lorenzi, A. Beltramello, N. B. Mercuri et al., “Effect of
model of Alzheimer’s disease,” Neurobiology of Disease, vol. 24, memantine on resting state default mode network activity in
no. 3, pp. 506–515, 2006. Alzheimer’s disease,” Drugs and Aging, vol. 28, no. 3, pp. 205–
[27] S. J. Choi, J.-H. Lee, H. J. Heo et al., “Punica granatum protects 217, 2011.
against oxidative stress in PC12 cells and oxidative stress- [43] S. T. Francis, K. Head, P. G. Morris, and I. A. Macdonald, “The
induced alzheimer’s symptoms in mice,” Journal of Medicinal effect of flavanol-rich cocoa on the fMRI response to a cognitive
Food, vol. 14, no. 7-8, pp. 695–701, 2011. task in healthy young people,” Journal of Cardiovascular Phar-
[28] N. P. Seeram, M. Aviram, Y. Zhang et al., “Comparison of macology, vol. 47, supplement 2, pp. S215–S220, 2006.
antioxidant potency of commonly consumed polyphenol-rich [44] H. Buschke and P. Altman Fuld, “Evaluating storage, retention
beverages in the United States,” Journal of Agricultural and Food and retrieval in disordered memory and learning,” Neurology,
Chemistry, vol. 56, no. 4, pp. 1415–1422, 2008. vol. 24, no. 11, pp. 1019–1025, 1974.
[29] C. Guo, J. Wei, J. Yang, J. Xu, W. Pang, and Y. Jiang, [45] D. Wechsler, Wechsler Memory Scale, The Psychological Corpo-
“Pomegranate juice is potentially better than apple juice in ration, San Antonio, Tex, USA, 3rd edition, 1997.
improving antioxidant function in elderly subjects,” Nutrition [46] S. M. Henning, Y. Zhang, N. P. Seeram et al., “Antioxidant
Research, vol. 28, no. 2, pp. 72–77, 2008. capacity and phytochemical content of herbs and spices in dry,
[30] J. Rubio, S. Yucra, M. Gasco, and G. F. Gonzales, “Doseresponse fresh and blended herb paste form,” International Journal of
effect of black maca (Lepidium meyenii) in mice with memory Food Sciences and Nutrition, vol. 62, no. 3, pp. 219–225, 2011.
impairment induced by ethanol,” Toxicology Mechanisms and [47] N. P. Seeram, S. M. Henning, Y. Zhang, M. Suchard, Z. Li, and D.
Methods, vol. 21, no. 8, pp. 628–634, 2011. Heber, “Pomegranate juice ellagitannin metabolites are present
[31] M. A. Papandreou, A. Dimakopoulou, Z. I. Linardaki et al., in human plasma and some persist in urine for up to 48 hours,”
“Effect of a polyphenol-rich wild blueberry extract on cognitive Journal of Nutrition, vol. 136, no. 10, pp. 2481–2485, 2006.
performance of mice, brain antioxidant markers and acetyl- [48] A. D. Ekstrom and S. Y. Bookheimer, “Spatial and temporal
cholinesterase activity,” Behavioural Brain Research, vol. 198, no. episodic memory retrieval recruit dissociable functional net-
2, pp. 352–358, 2009. works in the human brain,” Learning and Memory, vol. 14, no.
10, pp. 645–654, 2007.
[32] M. W. Weiner, C. Sadowsky, J. Saxton et al., “Magnetic reso-
nance imaging and neuropsychological results from a trial of [49] J. A. Joseph, B. Shukitt-Hale, N. A. Denisova et al., “Reversals of
memantine in Alzheimer’s disease,” Alzheimer’s and Dementia, age-related declines in neuronal signal transduction, cognitive,
vol. 7, no. 4, pp. 425–435, 2011. and motor behavioral deficits with blueberry, spinach, or
strawberry dietary supplementation,” Journal of Neuroscience,
[33] P. M. Thompson, K. M. Hayashi, R. A. Dutton et al., “Tracking
vol. 19, no. 18, pp. 8114–8121, 1999.
Alzheimer’s disease,” Annals of the New York Academy of
Sciences, vol. 1097, pp. 183–214, 2007. [50] J. A. Joseph, N. A. Denisova, G. Arendash et al., “Blueberry
supplementation enhances signaling and prevents behavioral
[34] A. C. Burggren, B. Renner, M. Jones et al., “Thickness in deficits in an Alzheimer disease model,” Nutritional Neuro-
entorhinal and subicular cortex predicts episodic memory science, vol. 6, no. 3, pp. 153–162, 2003.
decline in mild cognitive impairment,” International Journal of
[51] P. Goyarzu, D. H. Malin, F. C. Lau et al., “Blueberry supple-
Alzheimer’s Disease, vol. 2011, Article ID 956053, 9 pages, 2011.
mented diet: effects on object recognition memory and nuclear
[35] A. J. Saykin, L. A. Flashman, S. A. Frutiger et al., “Neu- factor-kappa B levels in aged rats,” Nutritional Neuroscience, vol.
roanatomic substrates of semantic memory impairment in 7, no. 2, pp. 75–83, 2004.
Alzheimer’s disease: patterns of functional MRI activation,”
[52] F. Afaq, M. Saleem, C. G. Krueger, J. D. Reed, and H. Mukhtar,
Journal of the International Neuropsychological Society, vol. 5,
“Anthocyanin- and hydrolyzable tannin-rich pomegranate fruit
no. 5, pp. 377–392, 1999.
extract modulates MAPK and NF-𝜅B pathways and inhibits
[36] S. Y. Bookheimer, M. H. Strojwas, M. S. Cohen et al., “Patterns of skin tumorigenesis in CD-1 mice,” International Journal of
brain activation in people at risk for Alzheimer’s disease,” New Cancer, vol. 113, no. 3, pp. 423–433, 2005.
England Journal of Medicine, vol. 343, no. 7, pp. 450–456, 2000. [53] J. H. Callicott, V. S. Mattay, A. Bertolino et al., “Physiological
[37] R. A. Sperling, J. F. Bates, E. F. Chua et al., “fMRI studies of characteristics of capacity constraints in working memory as
associative encoding in young and elderly controls and mild revealed by functional MRI,” Cerebral Cortex, vol. 9, no. 1, pp.
Alzheimer’s disease,” Journal of Neurology Neurosurgery and 20–26, 1999.
Psychiatry, vol. 74, no. 1, pp. 44–50, 2003. [54] E. Zarahn, B. Rakitin, D. Abela, J. Flynn, and Y. Stern, “Positive
[38] B. C. Dickerson, D. H. Salat, J. F. Bates et al., “Medial temporal evidence against human hippocampal involvement in working
lobe function and structure in mild cognitive impairment,” memory maintenance of familiar stimuli,” Cerebral Cortex, vol.
Annals of Neurology, vol. 56, no. 1, pp. 27–35, 2004. 15, no. 3, pp. 303–316, 2005.
[39] M. W. Bondi, W. S. Houston, L. T. Eyler, and G. G. Brown, [55] D. Tomasi, T. Ernst, E. C. Caparelli, and L. Chang, “Practice-
“fMRI evidence of compensatory mechanisms in older adults induced changes of brain function during visual attention: a
at genetic risk for Alzheimer disease,” Neurology, vol. 64, no. 3, parametric fMRI study at 4 Tesla,” NeuroImage, vol. 23, no. 4,
pp. 501–508, 2005. pp. 1414–1421, 2004.
[40] S. Erk, A. Spottke, A. Meisen, M. Wagner, H. Walter, and F. [56] S. Huang, F. Du, Y. Y. Shih, Q. Shen, F. Gonzalez-Lima, and T.
Jessen, “Evidence of neuronal compensation during episodic Q. Duong, “Methylene blue potentiates stimulus-evoked fMRI
memory in subjective memory impairment,” Archives of General responses and cerebral oxygen consumption during normoxia
Psychiatry, vol. 68, no. 8, pp. 845–852, 2011. and hypoxia,” Neuroimage, vol. 72, pp. 237–242, 2013.
[57] B. R. Bitner, D. C. Marcano, J. M. Berlin et al., “Antioxidant

carbon particles improve cerebrovascular dysfunction follow-
ing traumatic brain injury,” ACS Nano, vol. 6, no. 9, pp. 8007–
8014, 2012.
[58] M. S. Azzubaidi, A. K. Saxena, N. A. Talib, Q. U. Ahmed,
and B. B. Dogarai, “Protective effect of treatment with black
cumin oil on spatial cognitive functions of rats that suffered
global cerebrovascular hypoperfusion,” Acta Neurobiologiae
Experimentalis, vol. 72, no. 2, pp. 154–165, 2012.
[59] S. T. Francis, K. Head, P. G. Morris, and I. A. Macdonald, “The
effect of flavanol-rich cocoa on the fMRI response to a cognitive
task in healthy young people,” Journal of Cardiovascular Phar-
macology, vol. 47, supplement 2, pp. S215–S220, 2006.
http://dx.doi.org/10.1155/2013/716730
Research Article
Protective Effect of Punica granatum L. against Serum/Glucose
Deprivation-Induced PC12 Cells Injury
Fatemeh Forouzanfar,1,2 Amir Afkhami Goli,2 Elham Asadpour,1

Ahmad Ghorbani,1 and Hamid Reza Sadeghnia1,3
1
Pharmacological Research Center of Medicinal Plants, Department of Pharmacology, School of Medicine,
Mashhad University of Medical Sciences, Mashhad 917794-8564, Iran
2
School of Veterinary Medicine, Ferdowsi University of Mashhad, Mashhad, Iran
3
Neurocognitive Research Center, Department of Modern Sciences and Technology, School of Medicine,
Mashhad University of Medical Sciences, Mashhad 917794-8564, Iran
Correspondence should be addressed to Hamid Reza Sadeghnia; sadeghniahr@mums.ac.ir
Received 2 December 2012; Revised 1 May 2013; Accepted 4 June 2013
Copyright © 2013 Fatemeh Forouzanfar et al. This is an open access article distributed under the Creative Commons Attribution
cited.
The discovery and development of natural products with potent antioxidant, anti-inflammatory, and antiapoptotic properties have
been one of the most interesting and promising approaches in the search for the treatment of many neurodegenerative diseases
including ischemic stroke. Serum/glucose deprivation (SGD) has served as an excellent in vitro model for the understanding
of the molecular mechanisms of neuronal damage during ischemia and for the development of neuroprotective drugs against
ischemia-induced brain injury. Recent studies suggested that pomegranate (Punica granatum L.) or its active constituents exert
pharmacological actions such as antioxidant, anti-inflammatory, and neuroprotective properties. Therefore, in this study we
investigated the possible protective effects of different extracts of pomegranate against SGD-induced PC12 cells injury. Initially,
the cells were pretreated with different concentrations of pulp hydroalcoholic extract (PHE), pulp aqueous extract (PAE) and
pomegranate juice (PJ) for 2 h and then deprived of serum/glucose (SGD) for 6 and 12 h. SGD caused a significant reduction in
cell viability (measured by the MTT assay) after 6 and 12 h, as compared with control cells (𝑃 < 0.001). Pretreatment with PHE,
PAE, and PJ significantly and concentration-dependently increased cell viability following SGD insult for 6 and 12 h. A significant
increase in DNA damage (measured by the comet assay) was seen in nuclei of cells following SGD for 12 h (𝑃 < 0.001). In control
groups, no significant difference was seen in DNA damage between PHE, PAE, and PJ-pretreated and vehicle-pretreated PC12 cells
(𝑃 > 0.05). PHE, PAE, and PJ pretreatment resulted in a significant decrease in DNA damage following ischemic insult (𝑃 < 0.001).
This suppression of DNA damage by PHE, PAE and PJ was found to be concentration dependent. These data indicate that there is
a cytoprotective property in PHE, PAE, and PJ under SGD condition in PC12 cells, suggesting that pomegranate has the potential
to be used as a new therapeutic strategy for neurodegenerative disorders.
1. Introduction deprivation (SGD) neuronal damage which could character-

ize the molecular mechanism of brain injury during cerebral
In spite of remarkable promotion in the prevention and ischemia [2, 3].
treatment of cerebral ischemia, stroke still remains one of Punica granatum L., (family Punicaceae), is a fruit-
the most important causes of death and cripple in the aged bearing deciduous shrub or small tree growing between five
population [1]. Designing the neuroprotective drugs and and eight meters tall. The pomegranate is native to the region
studying the cytoprotective effects of valid component could of Persia and the western Himalayan range [4] and has
be done with an efficient in vitro model like serum/glucose been cultivated in Iran, Mediterranean region, California,
and many other regions [5]. In Ayurvedic medicine the of Iran) and authenticated by herbarium of Ferdowsi Univer-
pomegranate is considered “a pharmacy unto itself ” and is sity of Mashhad (Mashhad, Iran; voucher specimen no. 311-
used as an antidiabetic, antiparasitic agent and to heal gas- 0203-1).
trointestinal disorders such as aphthae, diarrhea, and ulcers The pulps and peels of pomegranate were washed, dried,
[6]. Recently, it has been shown that pomegranate possesses and crushed to a powder with an electric microniser. The
several pharmacological activities such as antioxidant [6–8], powdered pulps were then shaken with ethanol (70%) and
anticarcinogenic [7, 8], and anti-inflammatory properties [9]. water for 2 days. The resulting extracts were then filtered and
It is documented that consumption of pomegranate appears concentrated under reduced pressure to get pulp hydroalco-
to correlate with treatment and preventing widespread range holic extract (PHE) and pulp aqueous extract (PAE), respec-
of diseases such as cancer [7, 8], diabetes [10], cardiovas- tively. The yield was found to be about 36% w/w. To obtain
cular disease [11, 12], rheumatoid arthritis, and ulcerative pomegranate juice extract (PJ), the seeds were separated and
colitis [9]. The neuroprotective effects of pomegranate have ground to obtain juice. The juice was then filtered and dried
been shown in hypoxic-ischemic brain injuries [13, 14], A𝛽- under reduced pressure (yielding 4.1% w/w). The extracts
induced oxidative stress and learning and memory deficits, were kept at −20∘ C until use.
and also H2 O2 -induced oxidative stress in PC12 cells [15]. Stock solutions of PHE and PAE were prepared in
Since it has been shown that Punica granatum has dimethyl sulfoxide (DMSO), and desired concentrations were
many beneficial consequences correlating with its antioxidant made from the stock using complete medium. Stock and
effect, we decided to study its protective effect against the working solutions of PJ were prepared in complete medium.
SGD-induced PC12 cells injury.
2.5. Total Phenolics Measurement. The total phenolics con-
2. Material and Methods centration of PHE, PAE, and PJ was determined by the
Folin-Ciocalteu method as previously described [17]. Briefly,
2.1. Cell Line and Reagents. A PC12 cell line was obtained 50 mg of the dried extract was extracted with 100 mL of
from Pasteur Institute (Tehran, Iran). High glucose acidified methanol : water (60 : 40 v/v, 0.3% HCl) before sub-
Dulbecco’s modified Eagles medium (DMEM, 4.5 g/L), sequent filtration. 100 𝜇L of filtrate was then mixed with
glucose-free DMEM (0 g/L), and fetal calf serum (FCS) equal amounts of the Folin-Ciocalteu reagent, while 2.0 mL
were purchased from Gibco (Carlsbad, CA). The Folin- of sodium bicarbonate was added and mixed thoroughly.
Ciocalteu reagent, the 3-(4,5-dimethylthiazol-2-yl)-2,5- Absorbance was measured at 750 nm, and the values were
diphenyl tetrazolium (MTT), and other cell culture derived from a standard curve prepared using tannic acid (0–
materials were purchased from Sigma (St. Louis, MO). 1.0 mg/mL in acidified methanol : water) after 2 hours. Values
Low melting point (LMP) agarose and normal melting were expressed as tannic acid equivalents (TAE, mg/g dry
point (NMP) agarose were obtained from Fermentas mass).
(Glen Burnie, MD). Other chemicals mainly ethylene
diamine tetraacetic acid disodium salt (Na2 EDTA), 2.6. Cell Proliferation (MTT) Assay. MTT was used to
Tris (hydroxymethyl) aminomethane (Trizma base), t- identify viable cells which reduce it to a violet formazan
octylphenoxy polyethoxyethanol (Triton X-100), dimethyl [18]. PC12 cells (5000/well) were seeded out in 96-well
sulfoxide (DMSO), sodium lauroyl sarcosinate (sarkosyl, tissue culture plates, and after 24 h, the cells were pretreated
SLS), and ethidium bromide were purchased from Merck with PHE, PAE and PJ (6.25–800 𝜇g/mL) for 2 h and then
(Darmstadt, Germany). incubated simultaneously for another 6 or 12 h in serum and
glucose free (SGD) condition. These doses were chosen based
2.2. Cell Culture. PC12 cells were cultured in high glucose on IC50 (concentration of 50% inhibition) calculated from
DMEM (4.5 g/L) supplemented with 10% FCS and 100 earlier experiments. Blank and solvent controls were treated
units/mL of penicillin/streptomycin. All cells were main- identically. At 6 and 12 h after SGD insult, MTT solution
tained in a humidified atmosphere (90%) containing 5% CO2 in phosphate-buffered saline (PBS, 5 mg/mL) was added
at 37∘ C. to a final concentration of 0.05%. After 2 h, the formazan
precipitate was dissolved in DMSO containing 10% glycine
buffer (pH = 10.5). The microplates were then gently shaken
2.3. Induction of Cell Death by Serum/Glucose Depriva- in the dark for 30 min, and the absorbance at 570 and 620 nm
tion. For SGD-induced cytotoxicity, PC12 cells were seeded (background) was measured using a StatFAX303 plate reader.
overnight and then were subjected to SGD for 6 and 12 h All experiments were carried out in triplicate; the per-
by replacing the standard culture medium (high glucose centage of viable cells was calculated as the mean ± SEM with
DMEM, 4.5 g/L) with the glucose-free DMEM (0 g/L), sup- controls set to 100%. Morphological deformations of the cells
plemented with 100 U/mL penicillin and 100 U/mL strepto- were also examined.
mycin [16].
2.7. Single Cell Gel Electrophoresis (SCGE, Comet) Assay. The
2.4. Preparation of Pulp Hydroalcoholic Extract (PHE), alkaline SCGE assay was conducted based on the method
Pulp Aqueous Extract (PAE) and Pomegranate Juice (PJ). described previously [19]. Briefly, PC12 cells (3 × 105 ) were
Pomegranate fruits were collected from Saveh region (center incubated for 2 h with three different concentrations of PHE,
PAE, and PJ (6.25, 400, and 800 𝜇g/mL) and subjected to SGD significant toxic effect on cell viability was seen following
for 12 h in which the same treatments were applied. After treatment with these extracts for 6 and 12 h (Figures 1–3).
removing the medium, the cells were washed three times with SGD caused a significant reduction in cell viability after
cold PBS, harvested and centrifuged at 3000 rpm for 5 min at 6 and 12 h, as compared with control group (Figures 1–3).
4∘ C. The pellets were then resuspended in PBS at a cell density As shown in Figures 2(a)-2(b), treatment with PHE resulted
of 1 × 105 . For the comet assay, 100 𝜇L NMP agarose was in significant and concentration-dependent increase in cell
quickly layered on conventional slides, covered with a cover viability following ischemic insult for 6 h (𝑃 < 0.05 at
slip, and then the slides were placed on ice to allow agarose 100 𝜇g/mL) and 12 h (𝑃 < 0.01 at 200 𝜇g/mL).
to gel. 10 𝜇L of the cell suspension, prepared as above, was A significant and concentration-dependent increase in
mixed with 100 𝜇L LMP agarose, and the mixture was quickly cell viability was seen following treatment with PAE after
layered over the NMP agarose layer after removal of the ischemic insult for 6 h (𝑃 < 0.05 at 200 𝜇g/mL) and 12 h
cover slip. Finally, another layer of LMP agarose was added (𝑃 < 0.01 at 400 𝜇g/mL) (Figures 1(a)-1(b)). Pretreatment
on top. The slides were immersed immediately in a chilled with PJ also significantly and dose-dependently decreased
lysing solution (pH = 10) made up of 2.5 M NaCl, 100 mM SGD-induced cell death following 6 and 12 h (𝑃 < 0.01 at
Na2 EDTA, 10 mM Trizma, 1% sarkosyl, 10% DMSO, and 1% 400 𝜇g/mL and 𝑃 < 0.01 at 800 𝜇g/mL, resp., Figures 3(a)-
triton X-100 and kept at 0∘ C in the dark overnight. Then, 3(b)).
the slides were placed on a horizontal gel electrophoresis
platform and covered with a prechilled alkaline solution 3.3. PHE, PAE, and PJ Significantly Decrease SGD-Induced
made up of 300 mM NaOH and 1 mM Na2 EDTA (pH > DNA Damage. In this study, %tail DNA was measured as an
13). They were left in the solution in the dark at 0∘ C for indicator of DNA damage. The results showed that exposure
40 min and then electrophoresed at 0∘ C in the dark for 30 min of PC12 cells to SGD significantly increased DNA fragmenta-
at 25 V and approximately 300 mA. The slides were rinsed tion (DF), compared with control cells (𝑃 < 0.001, Figure 4).
gently three times with 400 mM Trizma solution (adjusted A significant decrease in SGD-induced DF was seen following
to pH 7.5 by HCl) to neutralize the excess alkali, stained pretreatment with high doses (400, 800 𝜇g/mL) of PHE, PAE,
with 50 𝜇L of 20 𝜇g/mL ethidium bromide and covered with and PJ (𝑃 < 0.001, Figure 4).
a cover slip. For comet analysis, 150 nuclei were randomly
selected from three replicated slides (50 nuclei on one 4. Discussion
slide), examined and photographed through a fluorescence
microscope (Nikon, Japan), at 400x magnification equipped Ischemic stroke is a third leading cause of death and a major
with an excitation filter of 520–550 nm and a barrier filter of cause of disability in industrialized countries. Currently,
580 nm. Undamaged cells resemble an intact nucleus without therapeutic options for treatment of stroke are limited,
a tail, and damaged cells have the appearance of a comet. and much more attempts are being made to identify novel
The percent of DNA in the comet tail (% tail DNA), which neuroprotective agents with antiapoptotic properties [23, 24].
is an estimation of DNA damage, was analyzed using the Oxidative damage and induction of apoptotic cell death
computerized image analysis software (CASP software). The is a characteristic feature of many neurodegenerative dis-
experiments were done as triplicate. eases including ischemic stroke [25]. In this study, the
protective effect of Punica granatum (pomegranate) against
serum/glucose deprivation- (SGD-) induced cell death in
2.8. Statistical Analysis. The results are presented as the mean PC12 cells is investigated here for the first time. We showed
± standard error (SEM). The values were compared using the that pomegranate exhibits no cytotoxicity on PC12 cells
one-way analysis of variance (ANOVA) followed by Tukey’s at used concentrations (up to 800 𝜇g/mL). Moreover, we
post hoc test for multiple comparisons. The 𝑃 values less than found that pretreatment with different pomegranate extracts
0.05 were considered to be statistically significant. significantly decreased cell loss and DNA damage under
SGD condition in a concentration-dependent manner, which
showed that neuroprotective activity of pomegranate proba-
3. Results bly mediated through attenuation of DNA damage.
3.1. Total Phenolics Content of PHE, PAE and PJ. Polyphenols SGD is regarded as a reliable model mimicking the
including hydrolysable tannins and ellagitannins account for effects of ischemia in vitro. Lorenz et al. compared the
the main known antioxidant properties of pomegranate [20]. validity of SGD in vitro, with permanent middle cerebral
The PHE, PAE, and PJ were found to contain 353 ± 8, 224 ± 5, artery occlusion (MCAO) in vivo. SGD for 4 h induced half-
and 119 ± 6 mg/L total polyphenolics expressed as tannic acid maximal neuronal cell death, while MCAO for the same
equivalents (TAE, mg/g of TAE), respectively. period resulted in significant neuronal loss, suggesting the
validity of SGD as a suitable stroke-like in vitro model [26].
In our study, about 50% and 65% cell losses were seen under
3.2. PHE, PAE, and PJ Dose-Dependently Inhibit SGD- SGD condition for 6 h and 12 h, respectively, which are in
Induced Cell Death. To examine the probable toxic effects of agreement with previous reports [16, 26, 27]. The previous
pomegranate extracts, PC12 cells were incubated with high studies also correspond to our findings that SGD for 18 or
concentrations of PHE, PAE, and PJ (800 𝜇g/mL) alone, and 24 h caused significant DNA fragmentation in the nuclei of
the viability was determined 6 and 12 h after treatment. No PC12 cells [28, 29] suggesting apoptotic/necrotic cell death.
∗∗∗
∗∗∗ ∗∗∗ ∗∗∗ ∗∗∗
∗∗∗ 100
100
∗∗∗ 80
80 ∗
Viability (%)
∗∗
Viability (%)
60 60
40 40
20 20
0 0
PAE conc. 0 0 6.25 12.5 25 50 100 200 400 800 800 PAE conc. 0 0 6.25 12.5 25 50 100 200 400 800 800
(𝜇g/mL) (𝜇g/mL)
SGD − + + + + + + + + + − SGD − + + + + + + + + + −
Viability (%) at 6 h Viability (%) at 12 h
(a) (b)
Figure 1: Effects of pulp aqueous extract (PAE) on PC12 cells viability exposed to SGD (serum/glucose deprivation) for 6 and 12 h. The
percentage cell viability (quantitated by MTT assay) was normalized against the control (0 𝜇M). Mean and SEM of the three independent
experiments were shown. ∗ 𝑃 < 0.05, ∗∗ 𝑃 < 0.01, ∗∗∗ 𝑃 < 0.001 as compared with control.
∗∗∗
∗∗∗ ∗∗∗ ∗∗∗ ∗∗∗ ∗∗∗ ∗∗∗ ∗∗∗
100 100
∗∗
80 ∗ 80
Viability (%)
Viability (%)
∗∗
60 60
40 40
20 20
0 0
PHE conc. 0 0 6.25 12.5 25 50 100 200 400 800 800 PHE conc. 0 0 6.25 12.5 25 50 100 200 400 800 800
SGD − + + + + + + + + + − SGD − + + + + + + + + + −
(a) (b)
Figure 2: Effects of pulp hydroalcoholic extract (PHE) on PC12 cells viability exposed to SGD (serum/glucose deprivation) for 6 and 12 h.
The percentage cell viability (quantitated by MTT assay) was normalized against the control (0 𝜇M). Mean and SEM of the three independent
experiments were shown. ∗ 𝑃 < 0.05, ∗∗ 𝑃 < 0.01, ∗∗∗ 𝑃 < 0.001 as compared with control.
It is generally believed that pathophysiological basis of [21, 34, 35]. Recent studies have shown that neuroprotection
many neurodegenerative disorders such as ischemic stroke afforded by pomegranate could be attributed to the
is probably mediated through glutamate excitotoxicity, over- antioxidant or other properties of these phenolic compounds.
production of oxygen free radicals (ROS), and resulting Therefore, the total phenolic concentration of PHE, PAE,
oxidative damage to cellular macromolecules, including and PJ was determined by the Folin-Ciocalteu method. The
membrane lipids, proteins and nucleic acids, neuroinflamma- results indicated that PHE displayed the highest amount
tion, and induction of delayed cell death or apoptosis [30]. of polyphenol compounds (353 mg/g as TAE) rather than
P. granatum has potent antioxidant and anti- PAE (224 mg/g) or PJ (119 mg/L). These results in agreement
inflammatory properties. According to previous studies, with previous reports showed that pomegranate peels and
pomegranate is an important source of polyphenols including pulps have higher total phenolics and antioxidant activity
phenolic acids, ellagic tannins (punicalin, punicalagin, than juice [36, 37]. Yasoubi at al. also identified that the
gallagic, and ellagic acid), flavnoids (anthocyanins, catechins, concentration of phenolics in the pomegranate peel extracts
rutin, epigallocatechin-3-gallate), and anthocyanins depends on the polarity of solvent. It was shown that more
(delphinidin, cyaniding, and pelargonidin) [31–33], which phenolic materials are present in the alcoholic extract than
possess potent antioxidant and radical scavenger properties in aqueous extract [38]. It has been shown that hydrolyzable
∗∗∗ ∗∗∗ ∗∗∗ ∗∗∗ ∗∗∗

100 100
80 ∗∗ 80
Viability (%)
Viability (%)
∗∗
60 60
40 40
20 20
0 0
PJ conc. 0 0 6.25 12.5 25 50 100 200 400 800 800 PJ conc. 0 0 6.25 12.5 25 50 100 200 400 800 800
SGD − + + + + + + + + + − SGD − + + + + + + + + + −
(a) (b)
Figure 3: Effects of PJ (pomegranate juice) on PC12 cells viability exposed to SGD (serum/glucose deprivation) for 6 and 12 h. The percentage
cell viability (quantitated by MTT assay) was normalized against the control (0 𝜇M). Mean and SEM of the three independent experiments
were shown. ∗∗ 𝑃 < 0.01, ∗∗∗ 𝑃 < 0.001 as compared with control.
tannins (HT) account for about 92% of pomegranate rheumatoid arthritis due to its antioxidant potency [48]. It
antioxidant activity [39]. The predominant pomegranate is shown that pomegranate constituents afford chemopre-
HT is punicalagin, which is responsible for about half of vention against hepatocarcinogenesis through antioxidant
pomegranate total antioxidant capacity [40, 41] but its water properties [49].
solubility has been reported to be very low (about 0.2–1.0%) The flavonoid rich fractions of pomegranate fruit extract
[42]. Both flavonoids and tannins are also most abundant in have also been shown to exert antiperoxidative effect
pomegranate pulp extracts (i.e. PHE and PAE). Our study by decreasing the concentrations of malondialdehyde and
demonstrated that PHE has the most potent protective effect hydroperoxides and enhancing the activities of enzymes cata-
against SGD than PAE and PJ, which could be as a result of lase, superoxide dismutase, glutathione peroxidase, and glu-
the higher phenolic contents with less water solubility such tathione reductase in the liver [50, 51]. It is concluded that the
as ellagic tannins like gallic acid and punicalagin [43]. On antioxidative characteristics of pomegranate unique phenolic
the other hand, the protective effects of PJ against SGD could compounds, punicalagin and gallic acid, could be related,
be explained as the consequence of anthocyanins, which are at least in part, to their stimulatory effect on macrophage
the water-soluble pigments responsible for the bright red paraoxonase 2 (PON 2) expression, a phenomenon which was
color of pomegranate [32, 44]. shown to be associated with activation of the transcription
As mentioned, pomegranate has appreciable antioxidant factors PAPR-𝛾 and AP-1 [22]. The other mechanisms that
and free radical scavenger properties. Therefore, the pro- could be attributed to pomegranate protective effects are mast
tective activity of pomegranate against SGD seen in this cell stabilizing and anti-inflammatory actions. The Punica
study probably mediated through attenuation of oxidative granatum potency in ameliorating colitis is attributed to its
damage. These findings are in agreement with other reports ellagic acid rich fraction [21]. Other studies have shown
on PC12 cell line, showing that the ethanol extract of P. that prodelphinidins which are present in pomegranate fruit
granatum mitigated H2 O2 -induced oxidative stress in PC12 inhibit cyclooxygenase-2 (COX-2) and lipoxygenase activ-
cells. In addition, the extract inhibited learning and mem- ity and production of prostaglandins E2 (PGE2 ) in vitro
ory deficits and neuronal cell death caused by A𝛽-induced suggesting the anti-inflammatory properties of pomegranate
oxidative stress in mouse hippocampus, and it also improves [52]. Recently it has been shown that pomegranate extract
behavior and decreases hippocampal amyloid load in a inhibited the expression of inflammatory cytokines IL-1𝛽
mouse model of Alzheimer’s disease [15, 45]. Polyphenol-rich and IL-6 in adjunctive periodontal therapy [53]. NF-𝜅B
pomegranate juice also protected the neonatal mouse brain is an important transcriptional regulator of inflammatory
against hypoxic-ischemic injury via caspase-3 inhibition cytokines gene expression and plays a crucial role in immune
[14]. It has been shown that pomegranate flowers (PGFs) and inflammatory responses. It has been shown that pretreat-
supplementation decreases oxidative stress and ameliorates ment with pomegranate extract inhibited the degradation
impairment in learning and memory performances in dia- of I𝜅B𝛼 and nuclear translocation of NF-𝜅B in KU812 cells
betic rats [46]. [54]. Antioxidant potency of a methanolic pomegranate fruit
Punicalagin extracted from PJ and pomegranate peel peel extract (PPE) and its relation with antiproliferative and
inhibits LDL oxidation and atherosclerosis development in apoptotic effects on MCF-7 human breast cancer cells have
mice [47]. Daily supplementation with pomegranate in diet been evaluated, and the results showed that it has significant
could also control sign and symptoms in patients with antioxidant and apoptotic effects [55]. The hydroxybenzoic
60 60
50 50
40 40
Tail DNA (%)

Tail DNA (%)
30 30
20 20
∗∗∗ ∗∗∗ ∗∗∗
10 ∗∗∗ 10
∗∗∗ ∗∗∗ ∗∗∗ ∗∗∗
0 0
PHE conc. PAE conc.
(𝜇g/mL) 0 0 6.25 400 800 800 (𝜇g/mL) 0 0 6.25 400 800 800
SGD − + + + + − SGD − + + + + −
(a) (b)
60
50
40
Tail DNA (%)
30
20
∗∗∗
10 ∗∗∗
∗∗∗ ∗∗∗
0
PJ conc.
(𝜇g/mL) 0 0 6.25 400 800 800
SGD − + + + + −
(c)
Figure 4: Representative micrographs of comets from PC12 cells of different treatment groups (top panel); %tail DNA (as an indicator of
DNA damage) induced by serum/glucose deprivation (SGD) in PC12 cells after 12 h (bottom panel). Cells were pretreated with different
concentrations of pulp hydroalcoholic extract (PHE), pulp aqueous extract (PAE), and pomegranate juice (PJ). All data were represented as
the means ± SEM of three independent experiments. ∗∗∗ 𝑃 < 0.001 as compared with SGD.
damage, suggesting its antiapoptogenic properties. But fur-

SGD ther studies are needed to elucidate the possible underlying
mechanisms of these beneficial effects (Figure 5), as well as
whether substances in pomegranate extract may be useful in
stroke should be considered.
PC12 cells
Conflict of Interests
All the authors declared no conflict of interests.
PJ
ROS Acknowledgment
PHE and
PAE The authors gratefully acknowledge the Office of the Vice
Chancellor for Research of Mashhad University of Medical
DNA damage Sciences for financial support.
Cell death
References
Figure 5: Schematic representation of the protective effects of [1] D. Amantea, M. C. Marrone, R. Nisticò et al., “Oxidative stress
pomegranate extracts against serum/glucose deprivation- (SGD-) in stroke pathophysiology validation of hydrogen peroxide
induced PC12 cells injury. SGD may induce mitochondrial dysfunc- metabolism as a pharmacological target to afford neuroprotec-
tion, calcium overload, overproduction of reactive oxygen species tion,” International Review of Neurobiology, vol. 85, pp. 363–374,
(ROS), and resulting oxidative damage to cellular macromolecules, 2009.
including membrane lipids, proteins and DNA, neuroinflammation,
[2] L.-F. Chu, W.-T. Wang, V. K. Ghanta, C.-H. Lin, Y.-Y. Chi-
and induction of cell death. Antioxidant (by scavenging of free
ang, and C.-M. Hsueh, “Ischemic brain cell-derived condi-
radicals or upregulation of paraoxonase 2 expression, leading
tioned medium protects astrocytes against ischemia through
to inhibition of oxidative damage) [21, 22], anti-inflammatory,
GDNF/ERK/NF-kB signaling pathway,” Brain Research, vol.
neuroprotective, and antiapoptotic properties (by inhibition of
1239, pp. 24–35, 2008.
cyclooxygenase 2 expression, leading to decreased production of
prostaglandins and by decreased transcription of proinflammatory [3] J. A. Hillion, K. Takahashi, D. Maric, C. Ruetzler, J. L. Barker,
cytokines such as tumor necrosis factor 𝛼 (TNF-𝛼), interleukin 6 and J. M. Hallenbeck, “Development of an ischemic tolerance
(IL-6), and IL-1𝛽 through the modulation of PPAR-𝛾, NF-𝜅B, AP-1, model in a PC12 cell line,” Journal of Cerebral Blood Flow and
or MAPK signaling) [6, 9, 14] of pomegranate phytochemicals may Metabolism, vol. 25, no. 2, pp. 154–162, 2005.
block these pathways. PAE: aqueous extract of pomegranate peel and [4] L. Bilderback, The Complete Idiot’s Guide To Spices and Herbs,
pulp, PHE: hydroalcoholic extract of pomegranate peel and pulp, PJ: 2007.
pomegranate juice, ↓: activation, ⊥: inhibition. [5] S. D. Doijode, Seed Storage of Horticultural Crops, Food Prod-
ucts Press, New York, NY, USA, 2001.
[6] M. Viladomiu, R. Hontecillas, P. Lu, and J. Bassaganya-
Riera, “Preventive and prophylactic mechanisms of action of
acid constituents of pomegranate (gallic and ellagic acids) pomegranate bioactive constituents,” Evidence Based Comple-
induced p53/p21 expression, G1 arrest and apoptosis in mentary and Alternative Medicine, vol. 2013, Article ID 789764,
bladder cancer cells [56], as well as human DU-145 prostate 18 pages, 2013.
cancer cell line [57]. In addition, it has been shown that [7] F. Afaq, N. Khan, D. N. Syed, and H. Mukhtar, “Oral feeding
pomegranate juice metabolites, ellagic acid and urolithin of pomegranate fruit extract inhibits early biomarkers of UVB
radiation-induced carcinogenesis in SKH-1 hairless mouse
A, synergistically inhibit cell proliferation and induce cell
epidermis,” Photochemistry and Photobiology, vol. 86, no. 6, pp.
cycle arrest and apoptosis in DU-145 and PC-3 androgen- 1318–1326, 2010.
independent prostate cancer cells [58]. It is also reported
[8] V. M. Adhami and H. Mukhtar, “Anti-oxidants from green
that other active constituents of pomegranate like proantho- tea and pomegranate for chemoprevention of prostate cancer,”
cyanidins and anthocyanidins have anticarcinogenic effects Molecular Biotechnology, vol. 37, no. 1, pp. 52–57, 2007.
through antiangiogenic, antimutagenic activities [59, 60] and [9] E. Colombo, E. Sangiovanni, and M. Dell’agli, “A review on
inhibition of cyclooxygenase activity, nitric oxide production, the anti-inflammatory activity of pomegranate in the gastroin-
and epidermal growth factor receptors [61]. A recent study testinal tract,” Evidence Based Complementary and Alternative
also provides evidence that pomegranate phytochemicals Medicine, vol. 2013, Article ID 247145, 11 pages, 2013.
exert chemoprevention against diethylnitrosamine-induced [10] V. Jain, G. L. Viswanatha, D. Manohar, and H. N. Shivaprasad,
rat hepatocellular carcinoma through antiproliferative and “Isolation of antidiabeticprinciple from fruit rinds of Punica
proapoptotic mechanisms by modulating NF-𝜅B and Wnt/𝛽- granatum,” Evidence-Based Complementary and Alternative
catenin signaling pathways [62]. Medicine, vol. 2012, Article ID 147202, 11 pages, 2012.
At last, we conclude that Punica granatum has pro- [11] F. de Nigris, S. Williams-Ignarro, C. Botti, V. Sica, L. J. Ignarro,
tective effects against SGD-induced cytotoxicity in PC12 and C. Napoli, “Pomegranate juice reduces oxidized low-
cells through its antioxidant activity and subsequent DNA density lipoprotein downregulation of endothelial nitric oxide
synthase in human coronary endothelial cells,” Nitric Oxide, vol. [26] L. Lorenz, J. Dang, M. Misiak, A. Tameh Abolfazl, C. Beyer,
15, no. 3, pp. 259–263, 2006. and M. Kipp, “Combined 17𝛽-oestradiol and progesterone
[12] M. Aviram and M. Rosenblat, “Pomegranate protection against treatment prevents neuronal cell injury in cortical but not
cardiovascular diseases,” Evidence Based Complementary and midbrain neurones or neuroblastoma cells,” Journal of Neuroen-
Alternative Medicine, vol. 2012, Article ID 382763, 20 pages, docrinology, vol. 21, no. 10, pp. 841–849, 2009.
2012. [27] I. Papandreou, N. C. Denko, M. Olson et al., “Identification of an
[13] D. J. Loren, N. P. Seeram, R. N. Schulman, and D. M. Holtzman, Ire1alpha endonuclease specific inhibitor with cytotoxic activity
“Maternal dietary supplementation with pomegranate juice against human multiple myeloma,” Blood, vol. 117, no. 4, pp. 1311–
is neuroprotective in an animal model of neonatal hypoxic- 1314, 2011.
ischemic brain injury,” Pediatric Research, vol. 57, no. 6, pp. 858– [28] S. Soeda, Y. Tsuji, T. Ochiai et al., “Inhibition of sphingomyeli-
864, 2005. nase activity helps to prevent neuron death caused by ischemic
[14] T. West, M. Atzeva, and D. M. Holtzman, “Pomegranate stress,” Neurochemistry International, vol. 45, no. 5, pp. 619–626,
polyphenols and resveratrol protect the neonatal brain against 2004.
hypoxic-ischemic injury,” Developmental Neuroscience, vol. 29, [29] B. Babazadeh, H. R. Sadeghnia, E. S. Kapurchal, H. Parsaee,
no. 4-5, pp. 363–372, 2007. S. Nasri, and Z. Tayarani-Najaran, “Protective effect of Nigella
sativa and thymoquinone on serum/glucose deprivation-
[15] S. J. Choi, J.-H. Lee, H. J. Heo et al., “Punica granatum protects
induced DNA damage in PC12 cells,” Avicenna Journal of
against oxidative stress in PC12 cells and oxidative stress-
Phytomedicine, vol. 2, no. 3, pp. 125–132, 2012.
induced alzheimer’s symptoms in mice,” Journal of Medicinal
Food, vol. 14, no. 7-8, pp. 695–701, 2011. [30] M.-F. Guo, J.-Z. Yu, and C.-G. Ma, “Mechanisms related to
neuron injury and death in cerebral hypoxic ischaemia,” Folia
[16] S. H. Mousavi, Z. Tayarani-Najaran, M. Asghari, and H. R.
Neuropathologica, vol. 49, no. 2, pp. 78–87, 2011.
Sadeghnia, “Protective effect of Nigella sativa extract and
thymoquinone on serum/glucose deprivation-induced PC12 [31] X. Su, M. Y. Sangster, and D. H. D’Souza, “In vitro effects of
cells death,” Cellular and Molecular Neurobiology, vol. 30, no. pomegranate juice and pomegranate polyphenols on foodborne
4, pp. 591–598, 2010. viral surrogates,” Foodborne Pathogens and Disease, vol. 7, no. 12,
pp. 1473–1479, 2010.
[17] G. Kaur, Z. Jabbar, M. Athar, and M. S. Alam, “Punica grana-
tum (pomegranate) flower extract possesses potent antioxidant [32] C. El Kar, A. Ferchichi, F. Attia, and J. Bouajila, “Pomegranate
activity and abrogates Fe-NTA induced hepatotoxicity in mice,” (Punica granatum) juices: chemical composition, micronutrient
Food and Chemical Toxicology, vol. 44, no. 7, pp. 984–993, 2006. cations, and antioxidant capacity,” Journal of Food Science, vol.
76, no. 6, pp. C795–C800, 2011.
[18] T. Mosmann, “Rapid colorimetric assay for cellular growth and
[33] Z. Li and L. Gu, “Effects of mass ratio, pH, temperature, and
survival: application to proliferation and cytotoxicity assays,”
reaction time on fabrication of partially purified pomegranate
Journal of Immunological Methods, vol. 65, no. 1-2, pp. 55–63,
ellagitannin-gelatin nanoparticles,” Journal of Agricultural and
1983.
Food Chemistry, vol. 59, no. 8, pp. 4225–4231, 2011.
[19] H. Hosseinzadeh, A. Abootorabi, and H. R. Sadeghnia, “Pro- [34] M. Rosenblat, T. Hayek, and M. Aviram, “Anti-oxidative effects
tective effect of Crocus sativus stigma extract and crocin (trans- of pomegranate juice (PJ) consumption by diabetic patients on
crocin 4) on methyl methanesulfonate-induced DNA damage serum and on macrophages,” Atherosclerosis, vol. 187, no. 2, pp.
in mice organs,” DNA and Cell Biology, vol. 27, no. 12, pp. 657– 363–371, 2006.
664, 2008.
[35] T. M. Rababah, F. Banat, A. Rababah, K. Ereifej, and W.
[20] R. Tzulker, I. Glazer, I. Bar-Ilan, D. Holland, M. Aviram, Yang, “Optimization of extraction conditions of total phenolics,
and R. Amir, “Antioxidant activity, polyphenol content, and antioxidant activities, and anthocyanin of oregano, thyme,
related compounds in different fruit juices and homogenates terebinth, and pomegranate,” Journal of Food Science, vol. 75,
prepared from 29 different pomegranate accessions,” Journal of no. 7, pp. C626–C632, 2010.
Agricultural and Food Chemistry, vol. 55, no. 23, pp. 9559–9570,
[36] Ş. Gözlekçi, O. Saraçoǧlu, E. Onursal, and M. Özgen, “Total
2007.
phenolic distribution of juice, peel, and seed extracts of four
[21] K. Singh, A. S. Jaggi, and N. Singh, “Exploring the ameliorative pomegranate cultivars,” Pharmacognosy Magazine, vol. 7, no. 26,
potential of Punica granatum in dextran sulfate sodium induced pp. 161–164, 2011.
ulcerative colitis in mice,” Phytotherapy Research, vol. 23, no. 11,
[37] W. Elfalleh, N. Tlili, N. Nasri et al., “Antioxidant capaci-
pp. 1565–1574, 2009.
ties of phenolic compounds and tocopherols from Tunisian
[22] M. Shiner, B. Fuhrman, and M. Aviram, “Macrophage paraox- pomegranate (Punica granatum) fruits,” Journal of Food Science,
onase 2 (PON2) expression is up-regulated by pomegranate vol. 76, no. 5, pp. C707–C713, 2011.
juice phenolic anti-oxidants via PPAR𝛾 and AP-1 pathway [38] P. Yasoubi, M. Barzegar, M. A. Sahari, and M. H. Azizi, “Total
activation,” Atherosclerosis, vol. 195, no. 2, pp. 313–321, 2007. phenolic contents and antioxidant activity of pomegranate
[23] W. Rosamond, K. Flegal, G. Friday et al., “Heart disease and (Punica granatum L.) peel extracts,” Journal of Agricultural
stroke statistics: 2007 update: a report from the American Science and Technology, vol. 9, no. 1, pp. 35–42, 2007.
Heart Association Statistics Committee and Stroke Statistics [39] N. P. Seeram, L. S. Adams, S. M. Henning et al., “In vitro
Subcommittee,” Circulation, vol. 115, no. 5, pp. e69–e171, 2007. antiproliferative, apoptotic and antioxidant activities of puni-
[24] K. A. Rotha and J. J. Shackaa, “Apoptosis in neurodegenerative calagin, ellagic acid and a total pomegranate tannin extract are
disease,” in Encyclopedia of Neuroscience, pp. 531–537, 2009. enhanced in combination with other polyphenols as found in
[25] A. Butterfield, M. Perluigi, T. Reed et al., “Redox proteomics in pomegranate juice,” The Journal of Nutritional Biochemistry, vol.
selected neurodegenerative disorders: from its infancy to future 16, no. 6, pp. 360–367, 2005.
applications,” Antioxidant and Redox Signaling, vol. 17, no. 11, pp. [40] M. I. Gil, F. A. Tomas-Barberan, B. Hess-Pierce, D. M. Holcroft,
1610–1655, 2012. and A. A. Kader, “Antioxidant activity of pomegranate juice
and its relationship with phenolic composition and processing,” [54] Z. Rasheed, N. Akhtar, A. N. Anbazhagan, S. Ramamurthy,
Journal of Agricultural and Food Chemistry, vol. 48, no. 10, pp. M. Shukla, and T. M. Haqqi, “Polyphenol-rich pomegranate
4581–4589, 2000. fruit extract (POMx) suppresses PMACI-induced expression
[41] A. P. Kulkarni, S. M. Aradhya, and S. Divakar, “Isolation and of pro-inflammatory cytokines by inhibiting the activation of
identification of a radical scavenging antioxidant—punicalagin MAP kinases and NF-𝜅B in human KU812 cells,” Journal of
from pith and carpellary membrane of pomegranate fruit,” Food Inflammation, vol. 6, article 1, 2009.
Chemistry, vol. 87, no. 4, pp. 551–557, 2004. [55] M. Dikmen, N. Ozturk, and Y. Ozturk, “The antioxidant
[42] C. Ben Nasr, N. Ayed, and M. Metche, “Quantitative deter- potency of Punica granatum L. fruit peel reduces cell pro-
mination of the polyphenolic content of pomegranate peel,” liferation and induces apoptosis on breast cancer,” Journal of
Zeitschrift fur Lebensmittel-Untersuchung und -Forschung, vol. Medicinal Food, vol. 14, no. 12, pp. 1638–1646, 2011.
203, no. 4, pp. 374–378, 1996. [56] T.-M. Li, G.-W. Chen, C.-C. Su et al., “Ellagic acid induced
[43] T. Tanaka, G.-I. Nonaka, and I. Nishioka, “Tannins and related p53/p21 expression, G1 arrest and apoptosis in human bladder
compounds. XLI. Isolation and characterization of novel ellag- cancer T24 cells,” Anticancer Research, vol. 25, no. 2, pp. 971–979,
itannins, punicacorteins A, B, C and D, and Punigluconin from 2005.
the bark of Punica granatum L.,” Chemical and Pharmaceutical [57] R. Veluri, R. P. Singh, Z. Liu, J. A. Thompson, R. Agarwal, and
Bulletin, vol. 34, no. 2, pp. 656–663, 1986. C. Agarwal, “Fractionation of grape seed extract and identi-
[44] F. Hernández, P. Melgarejo, F. A. Tomás-Barberán, and F. fication of gallic acid as one of the major active constituents
Artés, “Evolution of juice anthocyanins during ripening of causing growth inhibition and apoptotic death of DU145 human
new selected pomegranate (Punica granatum) clones,” European prostate carcinoma cells,” Carcinogenesis, vol. 27, no. 7, pp. 1445–
Food Research and Technology, vol. 210, no. 1, pp. 39–42, 1999. 1453, 2006.
[45] R. E. Hartman, A. Shah, A. M. Fagan et al., “Pomegranate [58] R. Vicinanza, Y. Zhang, S. M. Henning, and D. Heber,
juice decreases amyloid load and improves behavior in a mouse “Pomegranate juice metabolites, ellagic acid and urolithin A,
model of Alzheimer’s disease,” Neurobiology of Disease, vol. 24, synergistically inhibit androgen-independent prostate cancer
no. 3, pp. 506–515, 2006. cell growth via vistinct effects on cell cycle control and apopto-
[46] Z. Cambay, G. Baydas, M. Tuzcu, and R. Bal, “Pomegranate sis,” Evidence Based Complementary and Alternative Medicine,
(Punica granatum L.) flower improves learning and memory vol. 2013, Article ID 247504, 12 pages, 2013.
performances impaired by diabetes mellitus in rats,” Acta [59] D. Bagchi, C. K. Sen, M. Bagchi, and M. Atalay, “Anti-
Physiologica Hungarica, vol. 98, no. 4, pp. 409–420, 2011. angiogenic, antioxidant, and anti-carcinogenic properties of a
[47] M. Aviram, N. Volkova, R. Coleman et al., “Pomegranate novel anthocyanin-rich berry extract formula,” Biochemistry,
phenolics from the peels, arils, and flowers are antiatherogenic: vol. 69, no. 1, pp. 75–80, 2004.
studies in vivo in atherosclerotic apolipoprotein E-deficient [60] F. Galvano, L. La Fauci, G. Lazzarino et al., “Cyanidins:
(E0) mice and in vitro in cultured macrophages and lipopro- metabolism and biological properties,” The Journal of Nutri-
teins,” Journal of Agricultural and Food Chemistry, vol. 56, no. 3, tional Biochemistry, vol. 15, no. 1, pp. 2–11, 2004.
pp. 1148–1157, 2008. [61] D. X. Hou, T. Ose, S. Lin et al., “Anthocyanidins induce
[48] A. Balbir-Gurman, B. Fuhrman, Y. Braun-Moscovici, D. apoptosis in human promyelocytic leukemia cells: structure-
Markovits, and M. Aviram, “Consumption of pomegranate activity relationship and mechanisms involved,” International
decreases serum oxidative stress and reduces disease activity in Journal of Oncology, vol. 23, no. 3, pp. 705–712, 2003.
patients with active rheumatoid arthritis: a pilot study,” Israel [62] D. Bhatia, R. J. Thoppil, A. Mandal, K. A. Samtani, A. S.
Medical Association Journal, vol. 13, no. 8, pp. 474–479, 2011. Darvesh, and A. Bishayee, “Pomegranate bioactive constituents
[49] A. Bishayee, D. Bhatia, R. J. Thoppil, A. S. Darvesh, E. Nevo, suppress cell proliferation and induce apoptosis in an exper-
and E. P. Lansky, “Pomegranate-mediated chemoprevention imental model of hepatocellular carcinoma: role of Wnt/𝛽-
of experimental hepatocarcinogenesis involves Nrf2-regulated catenin signaling pathway,” Evidence Based Complementary and
antioxidant mechanisms,” Carcinogenesis, vol. 32, no. 6, pp. 888– Alternative Medicine, vol. 2013, Article ID 371813, 15 pages, 2013.
896, 2011.
[50] S. Sudheesh and N. R. Vijayalakshmi, “Flavonoids from Punica
granatum-potential antiperoxidative agents,” Fitoterapia, vol.
76, no. 2, pp. 181–186, 2005.
[51] M. Aviram, L. Dornfeld, M. Kaplan et al., “Pomegranate
juice flavonoids inhibit low-density lipoprotein oxidation and
cardiovascular diseases: studies in atherosclerotic mice and in
humans,” Drugs under Experimental and Clinical Research, vol.
28, no. 2-3, pp. 49–62, 2002.
[52] N. Garbacki, L. Angenot, C. Bassleer, J. Damas, and M.
Tits, “Effects of prodelphinidins isolated from Ribes nigrum
on chondrocyte metabolism and COX activity,” Naunyn-
Schmiedeberg’s Archives of Pharmacology, vol. 365, no. 6, pp.
434–441, 2002.
[53] G. Sastravaha, G. Gassmann, P. Sangtherapitikul, and W.-
D. Grimm, “Adjunctive periodontal treatment with Centella
asiatica and Punica granatum extracts in supportive periodontal
therapy,” Journal of the International Academy of Periodontology,
vol. 7, no. 3, pp. 70–79, 2005.
http://dx.doi.org/10.1155/2013/656172
Review Article
A Review on Antihyperglycemic and Antihepatoprotective
Activity of Eco-Friendly Punica granatum Peel Waste
Sushil Kumar Middha,1 Talambedu Usha,2 and Veena Pande1

1
Department of Biotechnology, Bhimtal Campus, Kumaun University, Nainital, Uttarakhand 263136, India
2
Department of Biotechnology & Biochemistry, Maharani Lakshmi Ammanni College for Women, Bangalore 560012, India
Correspondence should be addressed to Veena Pande; veena kumaun@yahoo.co.in
Received 28 December 2012; Revised 25 March 2013; Accepted 25 April 2013
Copyright © 2013 Sushil Kumar Middha et al. This is an open access article distributed under the Creative Commons Attribution
cited.
Over the past decade, pomegranate (Punica granatum) is entitled as a wonder fruit because of its voluminous pharmacological
properties. In 1830, P. granatum fruit was first recognized in United States Pharmacopeia; the Philadelphia edition introduced
the rind of the fruit, the New York edition the bark of the root and further 1890 edition the stem bark was introduced. There
are significant efforts and progress made in establishing the pharmacological mechanisms of peel (pericarp or rind) and the
individual constituents responsible for them. This review provides an insight on the phytochemical components that contribute
too antihyperglycemic, hepatoprotective, antihyperlipidemic effect, and numerous other effects of wonderful, economic, and eco-
friendly pomegranate peel extract (PP).
1. Introduction containing sacs packed with a fleshy, juicy, red or whitish

pulp. Each sac holds an angular, soft or hard seeds which are
The family Punicaceae contains a single genus, Punica,
usually red or white in colour. About 52% of the mass, of the
and two species the most predominant species is Punica
entire fruit is represented by these seeds [1].
granatum (pomegranate), and the less predominant is Punica
protopunica (Socotran pomegranate), atypical to the island of Pomegranate peels or skin or rind (PP) are underesti-
Socotra. mated as an agricultural waste, though it is part of an ancient
In spite of its wide prehistoric background, the pome- fruit with exceptionally rich ethnomedical applications and
granate has attained relatively few universally recognized astringent properties. PP acts as ecofriendly waste because of
names as mentioned in Table 1 [1]. its numerous uses such as reducing agent in making silver
nanoparticles. PP also used for cattle feed and extraction of
1.1. Scientific Classification. Pomegranate (Punica granatum) natural dyes [4].
has been placed under the subclass Rosidae, order Myrtales,
along with other fruits such as guava and feijoa [2]. It is an 1.2. Historical Uses of Punica granatum. Many researchers
evergreen or deciduous and spiny plant with multiple trunks have focused on the biological waste part of this wonder fruit,
and small slender leaves with tiny stems that is believed to pomegranate, for the purpose of discovering many mirac-
have originated in Iran then moved to the Himalayas in ulous effects for human health. The potential therapeutic
northern India. Heterostylous funnel-shaped red flowers are properties of PP are wide-ranging and include treatment
characteristic to this plant and are found either in singles or and prevention for cancer [5, 6], cardiovascular disease [7],
in clusters of up to five [3]. The fruit is almost round in shape diabetes [8], dental conditions [9], and erectile dysfunction
with a crown at the base created by the calyx. The skin is tough [10], protection from ultraviolet (UV) radiation [10], and
and leathery in texture, yellow or deep pink/red in color, and antimicrobial [11]. Other potential applications include infant
about 2 to 5 inches in width. The interior of the fruit contains brain ischemia, Alzheimer’s disease [8], male infertility,
white spongy membranous walls that form compartments arthritis [10], dermal wounds [11], and obesity [10] (Figure 1).
Antiaging
Antiviral
Antimicrobial
Dental Male
conditions infertility
Cardiovascular Hepatoprotective
disease
Antineoplastic Antilipidemic
Alzheimer’s
Antiarthritics disease
Antihyperglycemic Dermal
Ultraviolet Infant brain

(UV) radiation ischemia
Anticancer
Antifungal Obesity
Figure 1: Principal therapeutic effects of pomegranate peel.
Table 1: Few commonly renowned vernacular names of Punica Table 2: Nutrient content of pomegranate peel per 100 g [12].
granatum.
Composition Content
Country Recognized name Total solid 94.50
Roman Carthage (Punica) Moisture 5.40
Italian Melogranato, melogranogranato, pomogranato, Total sugars 17.70
or pomopunico Reducing sugars 4.34
Spanish Granada (the fruit), granado (the plant) Protein 4.90
Dutch Granaatappel Crude fiber 16.30
French Grenade Fat content 1.26
German Granatapfel Ash 3.40
India Dadima or dalima or dalim or Anar
Persian Dulim or dulima once the juice is extracted) powder contains protein, fat, ash,
Guatemala Granad total dietary fiber, insoluble dietary fiber, and soluble dietary
Indonesia Gangsalan fiber of 10.94, 20.86, 2.55, 50.29, 30.41, and 19.88 g/100 g,
Samoan Limoni
respectively [13]. However, the quantification of many com-
ponents such as vitamins, minerals, and other pharmacolog-
Brazilian Roma, romeira, or romazeira
ical properties has to be evaluated in detail.
Thailand Tab tim
Malaya Delima
2. Phytochemicals/Active Constituents
In order to facilitate further investigation and utilization, During the ancient era, significant efforts and progress were
we summarized the research achievements on phyto-chemi- made in establishing the pharmacological mechanisms of PP
cal components that contribute for anti-hyperglycemic, anti- and the individual constituents responsible for them. PP is
lipidemic, and hepato-protective effects of Punica granatum known to possess diverse phytochemicals, most of which are
peel waste till date. observed to have therapeutic properties. The major chemical
constituents along with their bioactivity are tabulated in
1.3. Proximate Physicochemical Composition/Nutritional Val- Table 3. Figure 2 depicts the structure of all these chemical
ues of PP. Studies have shown that PP is highly nutritive constituents of Table 3.
and contains important raw materials like crude fibers, Punicalin and punicalagin are the major constituents
protein, and carbohydrates. The compositions of some of the of pericarp ranging up to 0.2% of the total amount. The
ingredients are tabulated in Table 2 [12]. brilliant red colour of peel is attributed to anthocyanidins
Another study showed that the chemical composition of and flavan-3-ols. Flavones and flavonols constitute the major
pomegranate bagasse (the dried part of the fiber that remains flavonoids of peel. The methanolic extract of dried PP showed
Table 3: Active constituents and their biological activity of Punica peel.
Compound Bioactivity Reference

Major tannins of pomegranate peel
Casuarinin Antiviral, antioxidant [14]
Corilagin Antihypertensive, antineoplastic [14–16]
Ellagic acid [EA] Antineoplastic, skin whitening [17, 18]
Gallic acid Antimutagenic, anti-inflammatory, antiviral, antioxidant [17, 19]
Methyl gallate Antioxidant [20]
Granatin A Antioxidant, anti-inflammatory [21]
Granatin B Antioxidant, anti-inflammatory [21, 22]
Pedunculagin Antineoplastic, antioxidant [14]
Punicalagin Antioxidant, antihypertensive, anti-hyperglycemic [22–24]
Punicalin Antioxidant, anti HIV, anti-hyperglycemic [21–23]
Major flavonoids of pomegranate peel
Catechin Antineoplastic, antioxidant [25]
Cyanidin Antioxidant [26]
Epicatechin Antineoplastic [25]
Epigallocatechin 3-gallate Antineoplastic [25]
Flavan-3-ol Antineoplastic [25]
Kaempferol Antioxidant, anti-inflammatory [27]
Kaempferol-3-0-glucoside Antioxidant [27]
Kaempferol-3-0-rhamnoglycoside Antihypertensive [27]
Luteolin Antioxidant, antioxidant [27]
Luteolin-7-0-glucoside Antioxidant [27]
Naringin Antiviral, antibacterial [28]
Pelargonidin Antiviral, antibacterial [26]
Quercetin Antiviral, antioxidant, antineoplastic [29]
Rutin Antiviral, antioxidant, antihypertensive [29]
Major alkaloids of pomegranate peel
Pelletierine Antioxidant [30, 31]
Valoneic acid dilactone Antidiabetic [32]
the presence of high content of phenolic compounds (44.0%) phenolic antioxidant activity and hydrolysable tannins were
along with other constituents [34]. Phenolic acids such as reduced during maturation, while the anthocyanin level
caffeic acid, fumaric acid, chlorogenic acid and p-coumaric increased. This knowledge could help establish the optimum
acid are present in the pericarp [17]. The amount of ellagic harvest date ensuring the maximum nutritional properties of
acid in fruit peel of 12 varieties examined by Akbarpour et al. PP [38]. The results of Turkish researchers showed that the
[33] fluctuates considerably with a maximum of 50 mg/100 g levels of total phenolic compounds changed depending on
(Syah-e-saveh) and a minimum of 10 mg/100 g (Rabbab and cultivars and fruit parts. In all cultivars, the highest levels of
Shishe-Kap) (Table 4). Gil et al. [23] reported that the amount total phenolic content were obtained from the peel extracts.
of total phenolics in peel was evidently higher than arils of
pomegranate fruit [33, 35].
3. Physical Properties
Ben Nasr et al. [36] have described that PP has ellagic acid
(EA), ellagitannins and gallic acid. PP contains hydroxyben- Twelve pomegranate (Punica granatum L.) cultivars from
zoic acids such as gallagic acid, EA, and EA glycosides [17]. different regions of Iran were analyzed for their physical prop-
Anthocyanidins are principally cyanidin, pelargonidin and erties by Akbarpour et al. [33]. The amount of EA ranged 10–
delphinidin [26] and flavonoids such as kaempferol, luteolin, 50 mg/100 g in different varieties of PP. The highest amount
and quercetin [27]. Murthy et al. [37] quantified methanolic of EA was found in Syah-e-Saveh variety (50 mg/100 g).
extract of PP using HPLC and reported the presence of gallic
acid (34.03%) and catechin (3.31%). 4. Validated Pharmacological
Studies on PP were undertaken to investigate the changes Properties of Pomegranate Peel
in the major chemical composition during fruit maturation
in two Israeli commercial varieties, “Wonderful” and “Rosh- 4.1. Antioxidant Activity. Superfluous generation of the free
Hapered”. The result of the study revealed the levels of total radicals is proved to instigate and aggravate many human
O HO
HO HO OH OH
O O
OH
HO O OH HO OH O O
HCl O O CH3
O OH
HO HOOC HCl OH O
O O OH CH3 OH
O HO
HO OH O HO OH
OH OH
Valoneic acid dilactone (VAD) HO O O OH
OH
Naringin Quercetin-7-rhamnoside Methyl gallate
OH
OH
HO O
OH
O OH
HO O HO HO O OH
O O
OH OH HO
HO
O O O C OH
O C HO OH
OH O O O
OH HO O O
O O OH O O OH OH O
OH
OH O CH2 OH
HO OH O
Epigallocatechin-3-gallate Ellagic acid (EA) OH
OH
(EGCG) HO HO OH OH OH
Pedunculagin
OH Kaempferol-3-glucoside
HO O OH OH OH
O OH OH OH
HO O OH
OH O
O HO O+ O
HO
OH O
H3 C O
Flavan 3-ol HO OH OH
HO OH OH
OH
Rutin Cyanidin Catechin
OH
HO OH
HO OH OH
HO OH
OH HO HO OH OH
HO
HO O+ HO O O O O
O OH HO O OH
O O O
O O
OH HO O O O O O O
OH O HO O HO OH
OH O HO O
O O HO
OH O O
O HO HO
Pelargonidin O OH HO
HO
HO
OH O OH
HO HO
HO OH OH Punicalin Corilagin
HO Tellimagrandin II OH OH
HO HO OH OH
OH
HO OH
O HO HO O OH
O HO
O
OH
O
O
OH O O O CH2 OH
HO O OH O
HO O O O O OH
OH O HO O
O OH HO O O
O HO OH
O OH OH
O OH
OH O O
O HO
O OH HO
OH OH O OH OH OH
HO OH
HO OH OH
Gallagic acid Hexahydroxydiphenic acid Punicalagins Proanthocyanidin
OH OH
OH
OH OH OH
O HO O
HO O HO O HO OH OH
OH OH
O C
OH OH OH
OH O
OH O OH OH
OH
Luteolin Epicatechin (EC) Epigallocatechin (EGC) Epicatechin-3-gallate (ECG)

OH
OH O
HO O OH
OH
OH
OH Quercetin Gallic acid
OH
OH O
Figure 2: Structures of polyphenolic compounds found in pomegranate peel (Punica granatum) (figures were sketched using ChemSketch
software alias Marvin Sketch).
Table 4: Amount of EA in different varieties of peel [33].
S. no Variety Thickness Antioxidant activity Amount of ellagic acid

(mm) (mmol/100 g) (mg/100 g)
1 Rabbab 6.01 229.67 10.00
2 Malas-e-Yazd 4.06 234.33 30.00
3 Malas-e-Saveh 1.92 440.50 20.00
4 Shishe-Kap 2.53 303.83 10.00
5 Khazar-e-Bardeskan 2.10 640.17 25.00
6 Naderi 2.91 225.17 30.00
7 Alak 2.62 463.50 20.00
8 Abdandan 2.13 284.93 37.75
9 TabriziPoost 2.57 374.38 32.50
10 Syah-e-Saveh 1.60 314.89 50.00
11 Syah-e-Badrood 2.33 327.63 40.00
12 Lamsari-e-Behshahr 1.727 705.50 45.00
ailments like arthritis, cancer, Alzheimer’s disease, Parkin- Al-Mustafa and Al-Thunibat [58] have revealed the anti-
son’s disease, AIDS and diabetic complications [51, 52]. oxidant activity of some Jordanian medicinal plants used
Reports indicate that plants rich in anthocyanin, flavonoids traditionally for treatment of diabetes. They were catego-
and polyphenols are observed to be effective in scavenging rized PP under high antioxidant potential plants. The activity
the free radicals [53, 54]. Total antioxidant activity of 12 investigated in methanolic and aqueous extract was DPPH-
different varieties was determined by FRAP (ferric reducing TEAC IC50 365 ± 5.0 mg/g GAE, 2,2󸀠 -azinobis-(3-ethylben-
antioxidant power) method described by Akbarpour et zothiazoline-6-sulfonic acid) (ABTS)-IC50 6.9 ± 0.1 𝜇g/mL;
al. are enlisted in Table 4 and it ranged from 225.17 to and DPPH-TEAC IC50 267.1 ± 3.5 mg/g GAE; and ABTS+ -
705.50 mmol/g. According to Akbarpour et al. [33] study, the IC50 9.8 ± 0.1 𝜇g/mL, respectively. Among all the plants cho-
highest antioxidant activity level was detected in “Lamsari- sen by traditional healers, methanolic and aqueous extracts
e-Behshahr” and the lowest in “Naderi”. The same study has of PP both were having potent radical scavenging activity.
revealed that the antioxidant activity of peel is higher than Methanolic extract of PP exhibited the highest phenolic
that of juice and this difference is attributed to the presence content (103 GAE mg/g) among all their experimental plants.
of pomegranate peel tannins [38]. In a recent study [59], the antioxidant activity of meth-
anolic extract of PP on brain of normal rats demonstrated
The first report on antioxidant property of PP using in
that it reduced lipid peroxidation and nitric oxide in both
vitro models was elucidated by Singh et al. [55]. The meth-
serum and brain tissue homogenate, having an effect on
anolic extract of peels showed 83% and 81% antioxidant
the scavenging capacity of superoxide anion and hydrogen
activity at 50 ppm using the 𝛽-carotene-linoleate and 2,2-
peroxide.
diphenyl-2-picrylhydrazyl (DPPH) model systems, respec-
Pan et al. [60] described a continuous (CUAE) and pulsed
tively. Similar group also showed 56, 58, and 93.7% inhibition ultrasound-assisted (PUAE) method for the extractions of
using the thiobarbituric acid (TBA) method, hydroxyl radical antioxidants from PP since there is a great demand for devel-
scavenging activity, and serum low-density lipoprotein LDL oping efficient extraction methods in order to reduce extrac-
oxidation, respectively, at 100 ppm [56]. Owing to this prop- tion time and increase the yield and activity of functional
erty, the studies can be further extended to exploit PP for their antioxidants. Cumulatively, all these observations suggest the
possible application in the preservation of food products as potential antioxidant activity of PP (Table 5).
well as their use as health supplements and nutraceuticals.
Additional studies have also shown that PP had the
highest antioxidant activity among the peel, pulp, and seed 4.2. Antihyperglycemic Effect. Over the past decade, sig-
fractions of 28 kinds of fruits commonly consumed in China nificant progress has been made in establishing the anti-
as determined by FRAP assay [57]. A mixture of ethanolic, hyperglycemic pharmacological mechanism of PP and the
methanolic and acetone PP extract had markedly higher individual compounds responsible for it. Various solvent
antioxidant capacity than the pulp extract in scavenging extracts of PP appear to have anti-diabetic property. On
capacity against superoxide anion, hydroxyl, and peroxyl their Jordanian medicinal plants survey, native authors have
radicals as well as inhibiting CuSO4 -induced LDL oxidation. revealed 61% traditional healers recommend PP for diabetes
The contents of total phenolics, flavonoids and Proantho- treatment [58]. Similar kind of studies done by the authors
cyanidins were also higher in peel extract than in pulp extract. in India also revealed the uses of PP by traditional healers
The large amount of phenolics contained in peel extract may (vaidya) (49%) and anti-hyperglycemic effect using in vitro
contribute to its strong antioxidant ability [46]. glucose oxidase method [61].
Table 5: Overview of antioxidant pomegranate studies.
Assays Effect Reference

Trolox Equivalent Antioxidant [39]
Aqueous extract Prodelphinidinshowed active antioxidant activity
Concentration (TEAC)
Methanolic extract revealed lowest antioxidant activity followed by ethyl acetate, [40]
Phospho-molybdenum complex
acetone, and water extract
DPPH and ABTS radicals Remarkable free radical-scavenging power [41]
DPPH and ABTS radicals Robust antioxidant activity [42]
DPPH and ABTS radicals Extraordinary free radical-scavenging power [43]
FRAP Peel had superior antioxidant activity than pulp and seed [44]
FRAP Seed exhibited lower antioxidant activity as compared to peels [45]
Methanolic extract of PP exhibited the highest phenolic content and free [46]
DPPH and ABTS radicals
radical-scavenging power
The first report on the antidiabetic properties of PP using serum antioxidant capacity in a dose-dependent manner.
an in vivo model was elucidated by Nogueira and Pereira, fol- Phytochemical investigation demonstrates that the gallic acid
lowed by Zafar and Singh and Nozire and Serpil, reproduced in the methanolic extract of peels is mainly responsible for
by several other studies [47–50, 62–66]. this activity [8]. This group suggested that the effect may be
Diabetic rats treated with 0.43 g/kg B.W. of aqueous peel due to the presence of terpenoids such as ursolic acid and
extract for four weeks displayed significantly lowered blood oleanolic acid, which may help to scavenge the free radicals
sugar level and increased number of 𝛽 cells which relatively generated during diabetes (Table 6).
help in intensification of insulin level [47]. The mechanis-
tic anti-diabetic activity of the extract is by stimulation, 4.3. Antihyperlipidemic Effect. Alterations in lipid profile are
regeneration, and increased number of 𝛽 cells, by protecting one of the most common complications in diabetes mellitus
pancreatic tissue and subsequent release of insulin. Also, and affects 40% of all diabetic patients [51]. A comparative
it may increase the stimulation and activation of insulin study was carried out by Cheng et al. (2004) [67] to elucidate
receptor [47]. the hypolipidemic effect of crude PP and polyphenolic
Oral administration of aqueous extract of PP at doses extract. Male Sprague-Dawley (SD) rats were fed with a high-
of 50 and 100 mg/kg for 21 days brought down the fasting fat diet to induce hyperlipidemia and the treatment was
blood glucose, total serum cholesterol (TC), triglycerides carried out for 28 days. The results revealed decrease in the
(TG), serum low density lipoprotein cholesterol (LDL-c), levels of TC/HDL-c ratio and serum LDL-c levels concluding
VLDL-C (very low-density lipoprotein cholesterol) and tissue PP polyphenolic extract is effective in lowering serum and
LPO (lipid peroxidation) levels together with boost on high- hepatic lipids (Table 6).
density lipoprotein cholesterol (HDL-c), GSH (glutathione)
content and antioxidant enzymes in contrast with diabetic 4.4. Hepatoprotective Effects. Recent in vivo animal studies
control group. These authors recommended the uses of aque- have evaluated the hepatoprotective effects of pomegranate,
ous extract of the peel as a dietary supplement in the cure however, the exact mechanism and significant compounds
and inhibition of chronic diseases categorized by aggravated have not yet been described.
antioxidant status and diminished glucose metabolism [48]. The effects of continuous administration of PP on experi-
The same group emphasized on oral administration of mentally induced liver fibrosis in rats have been examined by
the aqueous-ethanolic extract of PP which led to signifi- Toklu et al. [68]. The levels of serum aspartate aminotrans-
cant blood glucose lowering effect in normal, glucose-fed ferase (AST), lactate dehydrogenase (LDH), and alanine
hyperglycemic in their another report on alloxan-induced aminotransferase (ALT) were ascertained in order to evaluate
diabetic rats. This report suggested that the effect can be due liver functions and the amount of tissue damage. The AST,
to increased peripheral glucose utilization or retardation of LDH, ALT, and cytokine levels in the serum, which were ele-
intestinal glucose absorption may also be partly responsible vated in liver fibrosis models, were found to be considerably
for inhibition of hyperglycaemia in glucose-fed rats [49]. reduced and brought to near-normal levels after PP treat-
Althunibat et al. [50] had shown in their study on STZ- ment. Similarly, the increase in hepatic collagen levels was
(streptozotocin-) induced diabetic rats that intraperitoneal also diminished leading to an improvement in the structure
(i.p.) administration of 10 and 20 mg/kg BW of PP for four and functions of the liver. It was thus ascertained that PP
weeks significantly enhanced the activities of antioxidant possesses certain hepato-protective properties making it an
enzymes in liver, kidney, and RBC. The methanolic extract important therapeutic agent in the treatment of fibrosis and
of PP (75 and 150 mg/kg, daily) inhibits glucose level in oxidative damage [68, 69].
alloxan-induced diabetic wistar rats. The extract also caused Previous work showed that feeding of rats with PP pro-
a significant reduction in malondialdehyde (MDA), a lipid vided protective effect against carbon tetra chloride (CCl4 )
peroxides marker, in diabetic rat tissues and elevated the total toxicity [55]. Studies in rats with CCl4 -induced liver damage
Table 6: Overview of in vivo Punica peel studies for diabetes and its complications.
Nature of peel Statistically

Preclinical In vivo studies Day/week Reference
extract/dosages Outcome significant
trial
(per kg BW/day) results?
Lowering of blood sugar
Diabetes Albino Wistar rats 28/4 Aqueous/0.42 g level and increased number Yes [47]
of 𝛽 cells
Increase of the activities of
antioxidant enzymes
catalase, superoxide
Albino Wistar rats 10/1.3 dismutase, glutathione [48]
Diabetes Methanolic/200 mg Yes
peroxidase,
glutathione-S-transferase,
and glutathione reductase,
in liver and kidney
Improvement of hepatic,
Albino Wistar rats 15/2.3 cardiac, and renal LPO and [49]
Diabetes Methanolic/200 mg Yes
serum T3, T4, insulin, and
glucose concentrations
Reduction of total
cholesterol,
Sprague-Dawley rats 28/7 Methanolic/5%, [50]
Hyperlipidemic LDL-cholesterol, Yes
10%, 15%
triglycerides.
VLDL-cholesterol H
antioxidant enzymes
Albino Wistar rats 28/7 Methanolic/10 mg, dismutase, glutathione [50]
Diabetes Yes
20 mg peroxidase,
glutathione-S-transferase,
and glutathione reductase,
in liver and kidney
antioxidant enzymes
Albino Wistar rats 42/6 Methanolic/75 mg [8]
Diabetes dismutase, glutathione Yes
and 150 mg
peroxidase, and decreased
LPO level in hippocampal
and cortex region of brain
Reduction of aldose
Albino Wistar rats 21/3 Methanolic/200 mg [32]
Diabetes reductase, amylase, PTP1B Yes
and 400 mg
inhibition assay
demonstrated pretreatment with PP enhanced or maintained and multiplicity of the hepatic nodules. In addition, PE also
the free radical scavenging activity of the hepatic enzymes alleviated lipid peroxidation and oxidation of proteins in the
catalase, superoxide dismutase, and peroxidase and resulted liver. The report thus suggests and supports the use of pome-
in 54% reduction of lipid peroxidation values compared to granate-derived agents in the treatment and prevention of
controls confirming the antioxidant property of the PP [50]. HCC in humans [70].
A discrete investigation in rats with CCl4 -induced liver
damage demonstrated pretreatment with PP extract boosted 5. Mechanisms of Action
the free radical scavenging activity of the hepatic enzymes A recent study by Jain et al. [32] has shown the probable
superoxide dismutase, and catalase, and showed 54% decline mechanism of action of PP. They have isolated and purified
in lipid peroxidation as compared to controls [69]. a compound Valoneic acid dilactone (VAD) from the meth-
Hepatocellular carcinoma (HCC), a common and fatal anolic extract of Punica granatum (MEPG). MEPG-(400,
cancer, is majorly driven by oxidative stress. The effect of 370 mg/kg, p.o.) and VAD-(25, 50 mg/kg, p.o.) treated groups
pomegranate emulsion (PE) on DENA-induced hepatocar- have shown very minimal acinar damage and adequate
cinogenesis, which mimics HCC in humans, was examined number of pancreatic islets. Their findings suggest that some
in an animal model. Robust chemopreventive activities were pancreatic 𝛽-cells are still surviving to exert their insulin
reported owing to reduction in the incidence, size, volume releasing effect. In diabetic condition, weight loss arises due to
the impairment in insulin action in the conversion of glucose Conflict of Interest

into glycogen. The catabolism of fats does not occur as there
is an inhibition of lipolysis due to its unavailability which The authors do not have any conflict of interest.
is because of destruction in beta cells. VAD and MEPG
were found to inhibit the alpha amylase activity which is Acknowledgments
a carbohydrate-hydrolysing enzyme, thus decreases post-
prandial hyperglycemia and improves glucose metabolism. The authors acknowledge (Dr.) Dinesh Babu, Ghent Uni-
The extracts VAD and MEPG were found to inhibit PTP1B versity, Belgium, and Dr. E. L. Cooper, UCLA-CCIM, Los
activity which showed increase in insulin receptor tyrosine Angeles, CA, USA for critically reviewing this paper. The
phosphorylation which mimicked in vivo action of insulin authors are thankful to Kumaun University, Nainital, and Dr.
thereby decreased plasma glucose levels in a dose-dependent T. L. Shantha, Director, Maharani Lakshmi Ammanni College
manner. The findings of their studies such as, blood glucose for Women, Bangalore, India, for providing the facilities to
levels, oral glucose tolerance test, body weight, mortality carry out this review work.
and histopathology were in correlation with each other and
indicate that MEPG and VAD could be beneficial in man- References
agement of diabetes and associated complications. VAD was
observed to be a more powerful inhibitor of aldose reductase, [1] J. F. Morton, “Pomegranate,” in Fruits of Warm Climates, pp.
𝛼-amylase, and protein tyrosine phosphatase PTP1B, when 352–355, ECHO, Miami, Fla, USA, 1987.
compared to MEPG because of its polyphenolic nature. [2] S. K. Middha, Y. Mittal, T. Usha et al., “Phyto-mellitus: a phyto-
chemical database for diabetes,” Bioinformation, vol. 4, no. 2, pp.
78–79, 2009.
6. Toxicity Studies/Safety/Adverse Effects [3] E. Stover and E. W. Mercure, “The pomegranate: a new look at
There are relatively none in vivo or in vitro studies reporting the fruit of paradise,” HortScience, vol. 42, no. 5, pp. 1088–1092,
the toxic or adverse effect of the PP on any of the mammalian 2007.
system. The LD50 of the aqueous extract of PP in mice was [4] A. Shabtay, H. Eitam, Y. Tadmor et al., “Nutritive and antiox-
found to be 1321 ± 15 mg/kg i.p. [71]. idative potential of fresh and stored pomegranate industrial
byproduct as a novel beef cattle feed,” Journal of Agricultural and
Food Chemistry, vol. 56, no. 21, pp. 10063–10070, 2008.
7. Conclusion [5] M. Dikmen, N. Ozturk, and Y. Ozturk, “The antioxidant poten-
cy of Punica granatum L. fruit peel reduces cell proliferation and
Industries have moved towards usage of naturally derived induces apoptosis on breast cancer,” Journal of Medicinal Food,
compounds, biologics as they are easily extractable and can vol. 14, no. 12, pp. 1638–1646, 2011.
be cultured in labs. Amongst these sources, ecofriendly [6] M. Y. Hong, N. P. Seeram, and D. Heber, “Pomegranate polyphe-
[4] Punica granatum peel has showed effectiveness due to nols down-regulate expression of androgen-synthesizing genes
the array of compounds present in it. These compounds in human prostate cancer cells overexpressing the androgen
have good antioxidant activity and also serve as excellent receptor,” Journal of Nutritional Biochemistry, vol. 19, no. 12, pp.
nutritional supplements. This review highlights the work 848–855, 2008.
that has been done in the recent past on the PP, which [7] J. Jurenka, “Therapeutic applications of pomegranate (Punica
includes anti-hyperglycemic [8], hepatoprotective [56], and granatum L.): a review,” Alternative Medicine Review, vol. 13, no.
anti-hyperlipidemic effects [67]. These experiments have 2, pp. 128–144, 2008.
shown productive results both in in vivo and in vitro domains. [8] S. K. Middha, T. Usha, and T. RaviKiran, “Influence of Punica
Hence more labs are moving towards PP as a suitable granatum L. on region specific responses in rat brain during
therapeutic agent in various diseases. alloxan-induced diabetes,” Asian Pacific Journal of Tropical
Biomedicine, vol. 2, no. 2, pp. S905–S909, 2012.
[9] M. Viuda-Martos, J. Fernández-López, and J. A. Pérez-Álvarez,
8. Future Direction “Pomegranate and its many functional components as related to
Despite the documented roles in nutrition, there are very few human health: a review,” Comprehensive Reviews in Food Science
phytochemical studies. The actions of mechanism of these and Food Safety, vol. 9, no. 2, pp. 635–654, 2010.
compounds are still not very clearly understood, however, it [10] S. R. Kanatt, R. Chander, and A. Sharma, “Antioxidant and
antimicrobial activity of pomegranate peel extract improves the
is predicted that the mechanisms are quite complicated since
shelf life of chicken products,” International Journal of Food
there may be numerous factors involved in it. Science and Technology, vol. 45, no. 2, pp. 216–222, 2010.
There is a dearth in the field of pharmacodynamics and
[11] E. A. Hayouni, K. Miled, S. Boubaker et al., “Hydroalcoholic
pharmacokinetics or safety aspects of the PP. There have extract based-ointment from Punica granatum L. peels with
been very few studies pertaining to the molecular aspects of enhanced in vivo healing potential on dermal wounds,” Phy-
PP, which is clearly evident by the sequence of information tomedicine, vol. 18, no. 11, pp. 976–984, 2011.
available in the public domains. Even though PP is rich [12] C. N. Aguilar, A. Aguilera-Carbo, A. Robledo et al., “Produc-
in healing properties, due to the lacunae in many aspects, tion of antioxidant nutraceutlcals by solid-state cultures of
there is an urgent requirement for further investigations to pomegranate (Punica granatum) peel and creosote bush (Larrea
delineate its precise mechanisms and possible therapeutic tridentata) leaves,” Food Technology and Biotechnology, vol. 46,
values, particularly in the field of diabetes mellitus. no. 2, pp. 218–222, 2008.
[13] M. Viuda-Martos, Y. Ruiz-Navajas, A. Martin-Sanchez et al., [29] N. Artik, “Determination of phenolic compounds in pome-
“Chemical, Physico-chemical and Functional properties of granate juice by using HPLC,” Fruit Processing, vol. 8, no. 1, pp.
Pomegrante (Punica granatum) Bagasse powder co-product,” 492–499, 1998.
Journal of Food Engineering, vol. 110, no. 2, pp. 220–224, 2012. [30] H. Neuhofer, L. Witte, M. Gorunovic, and F. C. Czygan,
[14] H. Satomi, K. Umemura, A. Ueno, T. Hatano, T. Okuda, and T. “Alkaloids in the bark of Punica granatum L. (Pomegranate)
Noro, “Carbonic anhydrase inhibitors from the pericarps of from Yugoslavia,” Pharmazie, vol. 48, no. 5, pp. 389–391, 1993.
Punica granatum L.,” Biological and Pharmaceutical Bulletin, [31] A. Vidal, A. Fallarero, B. R. Peña et al., “Studies on the toxicity of
vol. 16, no. 8, pp. 787–790, 1993. Punica granatum L. (Punicaceae) whole fruit extracts,” Journal
[15] M. A. M. Nawwar, S. A. M. Hussein, and I. Merfort, “Leaf phe- of Ethnopharmacology, vol. 89, no. 2-3, pp. 295–300, 2003.
nolics of Punica granatum,” Phytochemistry, vol. 37, no. 4, pp. [32] V. Jain, G. L. Viswanatha, D. Manohar, and H. N. Shivaprasad,
1175–1177, 1994. “Isolation of antidiabetic principle from fruit rinds of Punica
[16] M. A. M. Nawwar, S. A. M. Hussein, and I. Merfort, “NMR spec- granatum,” Evidence-Based Complementary and Alternative
tral analysis of polyphenols from Punica granatum,” Phytochem- Medicine, vol. 2012, Article ID 147202, 11 pages, 2012.
istry, vol. 36, no. 3, pp. 793–798, 1994. [33] V. Akbarpour, K. Hemmanti, and M. Sharifani, “Physical and
[17] Y. Amakura, M. Okada, S. Tsuji, and Y. Tonogai, “High-per- chemical properties of pomegranate (Punica granatum L.) fruit
formance liquid chromatographic determination with photodi- in maturation stage,” The American-Eurasian Journal Agricul-
ode array detection of ellagic acid in fresh and processed fruits,” ture and Environmental Science, vol. 6, no. 4, pp. 411–416, 2009.
Journal of Chromatography A, vol. 896, no. 1-2, pp. 87–93, 2000. [34] T. Usha, P. Tripathi, V. Pande, and S. K. Middha, “Molecular
[18] R. F. Wang, W. D. Xie, Z. Zhang et al., “Bioactive compounds docking and quantum mechanical studies on pelargonidin-3-
from the seeds of Punica granatum (pomegranate),” Journal of glucoside as renoprotective ACE inhibitor,” ISRN Computa-
Natural Products, vol. 67, no. 12, pp. 2096–2098, 2004. tional Biology, vol. 2013, Article ID 428378, 4 pages, 2013.
[19] T. H. W. Huang, G. Peng, B. P. Kota et al., “Anti-diabetic action [35] H. X. Li, Z. Wang, and Y. Z. Liu, “Progress in studies on chemical
of Punica granatum flower extract: activation of PPAR-𝛾 and constituents and pharmacological effects of Punicaceae,” Chi-
identification of an active component,” Toxicology and Applied nese Traditional and Herbal Drugs, vol. 33, pp. 765–769, 2002.
Pharmacology, vol. 207, no. 2, pp. 160–169, 2005. [36] C. Ben Nasr, N. Ayed, and M. Metche, “Quantitative deter-
[20] K. Rena, A. Palida, and X. Y. Zhang, “Studies on the chemical mination of the polyphenolic content of pomegranate peel,”
constituents from Xinjiang Punica granatum,” Journal of Chi- Zeitschrift fur Lebensmittel-Untersuchung und-Forschung, vol.
nese Medicinal Materials, vol. 32, no. 3, pp. 363–365, 2009. 203, no. 4, pp. 374–378, 1996.
[21] T. Tanaka, G. I. Nonaka, and I. Nishioka, “Tannins and related [37] K. N. C. Murthy, K. V. Reddy, J. M. Veigas, and U. D. Murthy,
compounds. C. Reaction of dehydrohexahydroxydiphenic acid “Study on wound healing activity of Punica granatum peel,”
esters with bases, and its application to the structure determina- Journal of Medicinal Food, vol. 7, no. 2, pp. 256–259, 2004.
tion of pomegranate tannins, granatins A and B,” Chemical and [38] E. Shwartz, I. Glazer, I. Bar-Ya’akov et al., “Changes in chemical
Pharmaceutical Bulletin, vol. 38, no. 9, pp. 2424–2428, 1990. constituents during the maturation and ripening of two com-
[22] Y. Z. Liu and H. X. Li, “Tannins and polyphenols in pericarps of mercially important pomegranate accessions,” Food Chemistry,
Punica granatum L,” Chinese Traditional and Herbal Drug, vol. vol. 115, no. 3, pp. 965–973, 2009.
38, pp. 502–504, 2007. [39] G. W. Plumb, S. de Pascual-Teresa, C. Santos-Buelga, J. C. Rivas-
[23] M. I. Gil, F. A. Tomas-Barberan, B. Hess-Pierce, D. M. Holcroft, Gonzalo, and G. Williamson, “Antioxidant properties of gallo-
and A. A. Kader, “Antioxidant activity of pomegranate juice catechin and prodelphinidins from pomegranate peel,” Redox
and its relationship with phenolic composition and processing,” Report, vol. 7, no. 1, pp. 41–46, 2002.
Journal of Agricultural and Food Chemistry, vol. 48, no. 10, pp. [40] P. S. Negi and G. K. Jayaprakasha, “Antioxidant and antibacterial
4581–4589, 2000. activities of Punica granatum peel extracts,” Journal of Food
[24] A. P. Kulkarni, S. M. Aradhya, and S. Divakar, “Isolation and Science, vol. 68, no. 4, pp. 1473–1477, 2003.
identification of a radical scavenging antioxidant—punicalagin [41] Y. Li, C. Guo, J. Yang, J. Wei, J. Xu, and S. Cheng, “Evaluation of
from pith and carpellary membrane of pomegranate fruit,” Food antioxidant properties of pomegranate peel extract in compar-
Chemistry, vol. 87, no. 4, pp. 551–557, 2004. ison with pomegranate pulp extract,” Food Chemistry, vol. 96,
[25] S. de Pascual-Teresa, C. Santos-Buelga, and J. C. Rivas-Gonzalo, no. 2, pp. 254–260, 2006.
“Quantitative analysis of flavan-3-ols in Spanish foodstuffs and [42] S. Rout and R. Banerjee, “Free radical scavenging, anti-glycation
beverages,” Journal of Agriculture and Food Chemistry, vol. 48, and tyrosinase inhibition properties of a polysaccharide frac-
no. 11, pp. 5331–5337, 2000. tion isolated from the rind from Punica granatum,” Bioresource
[26] Y. Noda, T. Kaneyuki, A. Mori, and L. Packer, “Antioxidant Technology, vol. 98, no. 16, pp. 3159–3163, 2007.
activities of pomegranate fruit extract and its anthocyanidins: [43] S. Okonogi, C. Duangrat, S. Anuchpreeda, S. Tachakittirun-
delphinidin, cyanidin, and pelargonidin,” Journal of Agricultural grod, and S. Chowwanapoonpohn, “Comparison of antioxidant
and Food Chemistry, vol. 50, no. 1, pp. 166–171, 2002. capacities and cytotoxicities of certain fruit peels,” Food Chem-
[27] D. A. van Elswijk, U. P. Schobel, E. P. Lansky, H. Irth, and J. istry, vol. 103, no. 3, pp. 839–846, 2007.
van der Greef, “Rapid dereplication of estrogenic compounds [44] M. Hajimahmoodi, M. R. Oveisi, N. Sadeghi et al., “Antioxidant
in pomegranate (Punica granatum) using on-line biochemical properties of peel and pulp hydro extract in ten Persian
detection coupled to mass spectrometry,” Phytochemistry, vol. pomegranate cultivars,” Pakistan Journal of Biological Sciences,
65, no. 2, pp. 233–241, 2004. vol. 11, no. 12, pp. 1600–1604, 2008.
[28] E. P. Lansky and R. A. Newman, “Punica granatum (pomegran- [45] S. Surveswaran, Y. Z. Cai, H. Corke, and M. Sun, “Systematic
ate) and its potential for prevention and treatment of inflamma- evaluation of natural phenolic antioxidants from 133 Indian
tion and cancer,” Journal of Ethnopharmacology, vol. 109, no. 2, medicinal plants,” Food Chemistry, vol. 102, no. 3, pp. 938–953,
pp. 177–206, 2007. 2007.
[46] Y. Li, C. Guo, J. Yang, J. Wei, J. Xu, and S. Cheng, “Evaluation of [61] S. K. Middha, T. Usha, P. Tripathi et al., “An in vitro studies on
antioxidant properties of pomegranate peel extract in compar- indigenous ayurvedic plants, having hypoglycemic activity,”
ison with pomegranate pulp extract,” Food Chemistry, vol. 96, Asian Pacific Journal of Tropical Disease, vol. 2, supplement 1,
no. 2, pp. 254–260, 2006. pp. 46–49, 2012.
[47] E. A. M. Khalil, “Antidiabetic effect of an aqueous extract of [62] D. G. Nogueira and N. A. Pereira, “Effect of an extract of Punica
pomegranate (Punica granatum L.) peels in normal and alloxan granatum (pomegranate) in hyperglycemic mice treated with
diabetic rats,” The Egyptian Journal of Hospital Medicine, vol. 16, propranolol,” Revista Brasileira de Farmacia, vol. 65, no. 1–3, pp.
no. 1, pp. 92–99, 2004. 46–51, 1984.
[48] H. S. Parmar and A. Kar, “Antidiabetic potential of Citrus [63] D. G. Nogueira and N. A. Pereira, “Effect of an alcoholic extract
sinensis and Punica granatum peel extracts in alloxan treated from the pericarp of roma (Punica granatum L.) on insulin
male mice,” BioFactors, vol. 31, no. 1, pp. 17–24, 2007. hypoglycemia mice,” Review Brasial Farm, vol. 67, p. 59, 1986.
[49] H. S. Parmar and A. Kar, “Medicinal values of fruit peels from [64] D. G. Nogueira and N. A. Pereira, “Inhibitory action of intestinal
Citrus sinensis, Punica granatum, and Musa paradisiaca with absorption of glucose of the pericarp of roma (Punica grantum
respect to alterations in tissue lipid peroxidation and serum L.),” Review Brasial Farm, vol. 67, p. 129, 1986.
concentration of glucose, insulin, and thyroid hormones,” [65] R. Zafar and J. Singh, “Antidiabetic activity of Punica granatum
Journal of Medicinal Food, vol. 11, no. 2, pp. 376–381, 2008. Linn.,” Science Culture, vol. 56, no. 7, article 3, 1990.
[50] O. Y. Althunibat, A. H. Al-Mustafa, K. Tarawneh, K. M. [66] O. Nozire and D. Serpil, “Valuation of the pomegranate (Punica
Khleifat, B. H. Ridzwan, and H. N. Qaralleh, “Protective role granatum L.) peels from the stand point of pharmacy,” Ankara
of Punica granatum L. peel extract against oxidative damage in Üniversitesi Eczacılık Fakültesi Dergisi, vol. 22, pp. 121–122, 1993.
experimental diabetic rats,” Process Biochemistry, vol. 45, no. 4, [67] S. Cheng, C. Guo, J. Yang, J. Wei, Y. Li, and J. Xu, “Experimental
pp. 581–585, 2010. study on hypolipidemic effect of polyphenolic extract from
[51] S. K. Middha, B. Bhattacharjee, D. Saini, M. S. Baliga, M. B. pomegranate peel,” Journal of Preventive Medicine of Chinese
Nagaveni, and T. Usha, “Protective role of Trigonella foenum People’s Liberation Army, vol. 3, pp. 160–163.
graceum extract against oxidative stress in hyperglycemic rats,” [68] H. Z. Toklu, M. U. Dumlu, O. Sehirli et al., “Pomegranate peel
European Review for Medical and Pharmacological Sciences, vol. extract prevents liver fibrosis in biliary-obstructed rats,” Journal
15, no. 4, pp. 427–435, 2011. of Pharmacy and Pharmacology, vol. 59, no. 9, pp. 1287–1295,
[52] R. Singh, M. K. Singh, L. R. Chandra et al., “In vitro antioxidant 2007.
and free radical scavenging activity of Macrotyloma uniflorum [69] Z. Z. Xu, J. H. Feng, H. W. Lu, L. Bao, and H. Kurihara, “Effect
(Gahat dal) from Kumauni region,” International Journal of of pomegranate peel extracts on oxidative stress in restrained
Fundamental and Applied Science, vol. 1, no. 1, pp. 7–10, 2012. mice,” Zhong Yao Cai, vol. 31, no. 8, pp. 1193–1196, 2008.
[53] B. Kiran, V. Lalitha, and K. A. Raveesha, “Psoralea corylifolia [70] A. Bishayee, D. Bhatia, R. J. Thoppil, A. S. Darvesh, E. Nevo,
L. a potent medicinal plant with broad spectrum of medicinal and E. P. Lansky, “Pomegranate-mediated chemoprevention
properties,” International Journal of Fundamental and Applied of experimental hepatocarcinogenesis involves Nrf2-regulated
Science, vol. 2, no. 1, pp. 20–22, 2013. antioxidant mechanisms,” Carcinogenesis, vol. 32, no. 6, pp. 888–
[54] M. P. Prasad, S. Shekhar, and B. Amit, “Phytochemical analysis 896, 2011.
and antioxidant potential of Piper species and its molecular [71] E. Y. Qnais, A. S. Elokda, Y. Y. A. Ghalyun, and F. A. Abdulla,
characterization by RAPD markers,” International Journal of “Antidiarrheal activity of the aqueous extract of Punica grana-
Fundamental and Applied Science, vol. 1, no. 1, pp. 7–10, 2012. tum (pomegranate) peels,” Pharmaceutical Biology, vol. 45, no.
[55] R. P. Singh, K. N. C. Murthy, and G. K. Jayaprakasha, “Studies on 9, pp. 715–720, 2007.
the antioxidant activity of pomegranate (Punica granatum) peel
and seed extracts using in vitro models,” Journal of Agricultural
and Food Chemistry, vol. 50, no. 1, pp. 81–86, 2002.
[56] K. N. C. Murthy, G. K. Jayaprakasha, and R. P. Singh, “Studies
on antioxidant activity of pomegranate (Punica granatum) peel
extract using in vivo models,” Journal of Agricultural and Food
Chemistry, vol. 50, no. 17, pp. 4791–4795, 2002.
[57] L. Zhang, X. Yang, Y. Zhang, L. Wang, and R. Zhang, “In
vitro antioxidant properties of different parts of pomegranate
flowers,” Food and Bioproducts Processing, vol. 89, no. 3, pp. 234–
240, 2011.
[58] A. H. Al-Mustafa and O. Y. Al-Thunibat, “Antioxidant activity
of some Jordanian medicinal plants used traditionally for
treatment of diabetes,” Pakistan Journal of Biological Sciences,
vol. 11, no. 3, pp. 351–358, 2008.
[59] E. A. Moneim, “Antioxidant activities of Punica granatum
(pomegranate) peel extract on brain of rats,” Journal of Medici-
nal Plants Research, vol. 6, no. 2, pp. 195–199, 2012.
[60] Z. Pan, W. Qu, H. Ma, G. G. Atungulu, and T. H. McHugh,
“Continuos and pulsed ultrasound assisted extractions of
antioxidants from pomegranate peel,” Ultrasonic Sonochemistry,
vol. 19, no. 2, pp. 365–372, 2012.
Volume 2013, Article ID 870454, 1 page
http://dx.doi.org/10.1155/2013/870454
Erratum
Erratum to ‘‘Pomegranate Extracts in the Management of
Men’s Urologic Health: Scientific Rationale and Preclinical and
Clinical Data’’
Nils Kroeger,1,2 A. S. Belldegrun,1 and A. J. Pantuck1

1
Department of Urology, Institute of Urologic Oncology, David Geffen School of Medicine at the University of California,
924 Westwood Boulevard, Suite 1050, Los Angeles, CA 90095-7384, USA
2
Department of Urology, University Medicine Greifswald, F.-Sauerbruch-Straße, 17489 Greifswald, Germany
Correspondence should be addressed to A. J. Pantuck; apantuck@mednet.ucla.edu
Received 23 May 2013; Accepted 23 May 2013
Copyright © 2013 Nils Kroeger et al. This is an open access article distributed under the Creative Commons Attribution License,
The authors’ names were incorrectly listed as Kroeger N.,

Belldegrun A. S., and Pantuck A. J.; the correct format is
shown above.
http://dx.doi.org/10.1155/2013/270418
Review Article
Biological Significance of Urolithins, the Gut Microbial Ellagic
Acid-Derived Metabolites: The Evidence So Far
Juan Carlos Espín, Mar Larrosa, María Teresa García-Conesa,

and Francisco Tomás-Barberán
Research Group on Quality, Safety and Bioactivity of Plant Foods, Department of Food Science and Technology,
CEBAS-CSIC, Campus de Espinardo, P.O. Box 164, 30100 Murcia, Spain
Correspondence should be addressed to Francisco Tomás-Barberán; fatomas@cebas.csic.es
Received 4 January 2013; Revised 15 April 2013; Accepted 17 April 2013
Academic Editor: David Heber
Copyright © 2013 Juan Carlos Espı́n et al. This is an open access article distributed under the Creative Commons Attribution
cited.
The health benefits attributed to pomegranate have been associated with its high content in polyphenols, particularly ellagitannins.
This is also the case for other ellagitannin-containing fruits and nuts including strawberry, raspberry, blackberry, walnuts,
and muscadine grapes. The bioavailability of ellagitannins and ellagic acid is however very low. These molecules suffer
extensive metabolism by the gut microbiota to produce urolithins that are much better absorbed. Urolithins circulate in
plasma as glucuronide and sulfate conjugates at concentrations in the range of 0.2–20 𝜇M. It is therefore conceivable that
the health effects of ellagitannin-containing products can be associated with these gut-produced urolithins, and thus the
evaluation of the biological effects of these metabolites is essential. Recent research, mostly based on in vitro testing, has
shown preliminary evidence of the anti-inflammatory, anticarcinogenic, antiglycative, antioxidant, and antimicrobial effects of
urolithins, supporting their potential contribution to the health effects attributed to pomegranate and ellagitannin-rich foods.
The number of in vivo studies is still limited, but they show preventive effects of urolithins on gut and systemic inflammation
that encourage further research. Both in vivo and mechanistic studies are necessary to clarify the health effects of these
metabolites. Attention should be paid when designing these mechanistic studies in order to use the physiologically relevant
metabolites (urolithins in gut models and their conjugated derivatives in systemic models) at concentrations that can be reached
in vivo.
1. Introduction with a multitarget action that involves antioxidant, anti-

inflammatory, and anticarcinogenic effects [2, 5]. It is well
The health effects of pomegranate and pomegranate juice established that ellagitannins and ellagic acid absorption
have been associated withthe high content in antioxidant is very low and that the unabsorbed compounds are fur-
polyphenols [1] and particularly in ellagitannins (punicala- ther metabolized to urolithins by the gut microbiota in
gins). This is also the case for many other ellagitannin- the colon [6–10]. This poor bioavailability and the extensive
containing fruits and nuts such as strawberry, raspberry, gut catabolism suggest that urolithins rather than ellagitan-
blackberry, walnuts, and muscadine grapes [2, 3]. nins or ellagic acid may be the actual bioactive molecules
[7, 11].
Both ellagic acid and ellagitannins have shown relevant Urolithins are dibenzopyran-6-one derivatives with dif-
biological effects in animal models and human studies ferent hydroxyl substitutions. Chemically they can be con-
which suggests potential preventive effects against chronic sidered a combination of coumarin and isocoumarin (benzo-
diseases such as cancer, diabetes, cardiovascular diseases, and coumarins) (Figure 1). They are produced from ellagic acid by
neurodegenerative diseases [4]. These effects are associated the gut microbiota through the loss of one of the two lactones
O 2. Urolithins Chemical Nature,

O Detection, and Identification
HO OH Urolithins constitute a whole metabolic family produced
by the opening and decarboxylation of one of the lactone
Urolithin A rings of ellagic acid and the sequential removal of hydroxyls
from different positions (Figure 2). After decarboxylation the
O O first metabolite is urolithin M-5 (pentahydroxy-urolithin),
O O and from this, several tetrahydroxy-urolithin isomers are
produced by removal of one hydroxyl group from different
HO OH positions (urolithin D, urolithin M-6). Trihydroxy-urolithins
(urolithin C, urolithin M-7) were then produced after the
Coumarin Isocoumarin removal of a second hydroxyl and dihydrox- urolithins
(urolithin A and isourolithin A) after the removal of a
Figure 1: Chemical structure of urolithin A, a benzocoumarin. third one. Monohydroxy-urolithin (urolithin B) was also
detected, particularly in those cases in which isourolithin A
was produced (Figure 2). Further degradation of urolithins
to remove the second lactone ring has not been reported
so far, although it should not be discarded. Urolithins show
present in ellagic acid (lactonase/decarboxylase activity) and characteristic UV spectra that can be used for the identi-
by successive removals of hydroxyls (dehydroxylase activi- fication of different hydroxyl-substitution patterns on the
ties) [12] (Figure 2). urolithin nucleus, as well as the further conjugation with
Urolithins are not common molecules in nature, but they methyl, glucuronic acid, or sulfate [21]. The UV spectra of
have been reported in plants rich in ellagitannins, as it is the urolithins in methanol exhibit two major absorption bands
case of Tamarix nilotica flowers [13] and Punica granatum in the region of 240–400 nm (Figure 4). These are referred to
leaves that contain urolithin M-5 (3,4,8,9,10-pentahydroxy- as band I (300–380 nm) and band II (240–280 nm). In many
dibenzo[b,d]pyran-6-one) [14]. They have also been found cases, an additional band III (between 280 and 300 nm) is also
in some herbivore-derived products, such as the castoreum observed. Unfortunately, bands I and II cannot be associated
produced by beavers [15], a product of interest for the with a specific ring of the urolithin nucleus [21]. Two groups
perfume industry, and the Pteropi faeces (faeces of the squirrel of urolithin UV spectra were distinguished after a study of the
Trogopterus xanthipes) that are used in traditional Chinese plots of the different spectra: urolithins with a hydroxyl in the
medicine [16]. Urolithins are also relevant constituents of 9-position and those without hydroxylation in the 9-position
shilajit, a soil-derived medicinal product used in Ayurvedic (Figure 4). The occurrence of the hydroxyl at position 9, as is
medicine [17]. the case of isourolithin A, produces a hypsochromic shift in
The name urolithin was first given to two metabolites band I and an increase in the absorption of band II, displaying
isolated from the renal calculus of sheep (Trifolium sub- a maximum around 256 nm, which is the main absorption
terraneum has been reported as the cause of clover stone band of the spectrum of urolithins with a hydroxyl in the 9-
and might be a relevant source of ellagitannins) that were position. Conjugation with glucuronic acid or sulfate also has
named urolithin A and urolithin B [18]. These two molecules measurable effects on the UV spectrum, and could be used as
coincided with pigments I and II previously described from a diagnostic method for urolithin metabolites identification.
castoreum and beaver glands [15].
The intake of large amounts of ellagitannins, and particu-
larly of punicalagin, from Terminalia oblongata by cattle was 3. Bioavailability, Metabolism, and Tissue
associated with hepatotoxicity and nephrotoxicity [19]. How- Distribution of Pomegranate Ellagitannins
ever, the subchronic oral administration of large amounts and Their Metabolites
of pomegranate ellagitannins was not toxic to rats where
these compounds were found to be extensively metabolized Due to the potential health effects and the expectation
to urolithins [20]. raised by the high antioxidant activity of pomegranate juices
Since urolithins are ellagitannin-derived catabolites that that was thought to be due to punicalagins, punicalins and
can be absorbed and reach different tissues in the body, they other ellagitannins [1, 22], a sensible step in the research
have been suggested as the molecules potentially respon- was the determination of the absorption and metabolism of
sible for the biological effects observed as a consequence these compounds in animals and humans. The first study
of the consumption of pomegranate or other ellagitannin- testing the bioavailability of pomegranate ellagitannins was
containing foods [3, 7, 9, 11]. Here we review the state of the carried out on rats, and this showed that after the intake of
art in urolithin metabolites production by gut microbiota, large amounts of pomegranate husk ellagitannins, the main
their absorption, tissue distribution and pharmacokinetics, metabolites detected in plasma and urine were urolithins
the cell and molecular mechanisms for their biological effects A, B, and C (Figure 2) and smaller amounts of ellagic
reported so far using different in vitro models, and the in vivo acid-dimethyl ether glucuronide [6]. Interestingly, a small
evidence in animals and humans. amount of punicalagin was also detected in plasma and urine,
O
O OH
HO OH COOH
Ellagitannins HO OH
HO O
O HO OH
Ellagic acid
HO O Intermediate
O
HO OH
Urolithin M-6
OH HO OH
HO OH
HO HO O
OH HO OH
O
HO O Urolithin M-5
O
O O
Urolithin D
Urolithin C OH Urolithin M-7
HO
HO OH
HO OH
O
O O
O
OH
HO OH
HO
O
O Urolithin A
Isourolithin A O
O
OH
HO
O Urolithin B
O Isourolithin B
O
O
Figure 2: Gut microbiota metabolism of ellagitannins and ellagic acid.
particularly after a long period of intake, but this has not the potential health effects after consumption of ellagitannin-
been confirmed in further studies in humans in which dietary rich foods [12]. No correlation between urolithin production
relevant amounts of pomegranate ellagitannins were supplied from ellagitannins and equol production from isoflavones
[7]. was observed [12], and this indicated that different bacterial
Urolithin A was produced from ellagic acid, punicalagin, strains are involved in the gut metabolism of isoflavones and
and an ellagitannin-rich walnut extract by fecal microbiota ellagitannins.
from six volunteers, demonstrating for the first time the The Iberian pig was used as a model to study urolithin
production of urolithins by human gut microbiota [12]. In production from ellagitannins. This particular pig feeds on
addition, a large interindividual variability was observed in oak acorns that are very rich in ellagitannins, and this
this ex vivo experiment [12] in agreement with the results model was used to evaluate ellagitannin metabolism and
observed in vivo [7] suggesting that differences in the micro- tissue distribution [23] and to help in understanding the
biota composition affect urolithin production and therefore ellagitannin metabolism in humans. This study showed that
Ellagitannins
O
HO O
HO OH Ellagic acid
O OH
O Esophagus
O
O
Tetrahydroxy-
HO OH benzopyran-6-one
OH (URO-M6)
HO
O
Bacterial metabolism
O
Trihydroxy-
HO OH benzopyran-6-one
OH (URO-C)
O
O
HO OH Urolithin A
(URO-A)
O
O
Urolithin B
HO
(URO-B)
Figure 3: Sequential production of urolithins in the gut.
different urolithins were produced in the gut starting with the occurrence of ellagitannin metabolites in human tissues
tetrahydroxy-urolithin through the removal of one of the (prostate biopsies), and the occurrence of urolithin A glu-
lactone rings of ellagic acid, and by sequential removal of curonide (2 ng/g tissue) and traces of urolithin B glucuronide
hydroxyls to end with urolithins A and B (Figure 3). The and ellagic acid dimethyl ether was reported [25].
analysis of plasma and urine samples showed that urolithin There are no studies on the pharmacokinetics and tissue
A glucuronide and sulfate were the main metabolites, with distribution of urolithins after their direct intake in humans.
urolithin C and B glucuronides and sulfates as minor metabo- There is, however, indirect evidence of both aspects after
lites. Ellagic acid dimethyl ether glucuronide was also a the intake of ellagitannins or ellagic acid-rich food products.
significant metabolite. The analysis of the gall bladder and bile In the case of pomegranates or derived beverages, it is
showed that tetrahydroxy-urolithin was absorbed in the first well established that ellagitannins are not absorbed when
portion of the gut, and was detected in the liver, where it was dietary doses are ingested and that the released ellagic acid
conjugated and excreted with the bile to the small intestine. is absorbed in the first part of the gastrointestinal tract
An entero-hepatic recirculation was clearly revealed in this and is detected as such in plasma with 𝐶max concentrations
animal model study [23]. Regarding the tissue distribution, around 100 nM with 𝑇max 1 hour after the intake [10, 26].
urolithin metabolites only accumulated in the urine bladder Ellagic acid conjugates have also been detected, and these
and the gall bladder where they reached high concentrations, include methyl ether and glucuronyl and sulphate conjugates.
but they did not accumulate in any of the analyzed tissues The most common metabolite found in urine and plasma
(muscle, adipose tissue, kidney, liver, heart, etc.) [23]. is ellagic acid dimethyl ether glucuronide, which involves
The occurrence of low concentrations or urolithin met- the methylation by COMT and then the glucuronidation
abolites in mouse prostate gland after pomegranate ellagi- by glucuronyl-transferase [3, 7]. The peak plasma levels of
tannins intake [24] and in human prostate after the intake urolithin A were 14–25 𝜇M depending on the volunteers.
of pomegranate juice and walnuts [25] has been reported. These metabolites started to appear in plasma 6–8 hours
This last study is the only one available on the evaluation of after the intake, which confirms urolithin production in the
Band II Band III Band I

O 300
280
O 246
200 305
mAU
HO OH
100 356
0
Urolithin A
200 250 300 350 400
𝜆 (nm)
(a)
Band II Band III Band I

O 2500
O 2000 256
1500
mAU
HO
1000
302
500 329
OH
0
Isourolithin A 200 250 300 350 400
𝜆 (nm)
(b)
Figure 4: UV characteristic spectra of urolithins.
colon [7], and persisted in urine and plasma 48–72 hours 4. Production of Urolithins by
after the ellagitannins intake showing an active enterohepatic Different Animals
recirculation [3, 7, 9, 12].
Seeram et al. [24] described the pharmacokinetics and The production of urolithins from ellagitannins has been
tissue distribution of urolithins in mice after oral or intra- reported in different animals (Table 1). Those animals that
peritoneal administration of chemically synthesized urolithin feed on bark and wood, as is the case of beavers and squirrels,
A (human equivalent dose, HED ∼85 mg for a 70 kg person). produce urolithins in their gut, and they are present in their
Urolithin A peaked in plasma after 2 h and reached the feces and in excretions/secretions as is the case of castoreum.
highest concentrations in the prostate followed by the small In addition, ruminants that feed on ellagitannin-rich fod-
intestine and colon, with a peak at 4 h [24]. Urolithin A, ders (oak leaves, Trifolium subterraneum, etc.) also produce
urolithin A sulfate, and methyl-urolithin A were mainly urolithins that circulate in plasma as conjugated derivatives
detected in the prostate gland whereas urolithin A glu- and are excreted in urine and feces. The production of
curonide was primarily detected in liver and kidney tissues. urolithins in the rumen of cattle has been demonstrated, and
Other studies with animal models, including rats and pigs, isourolithin A and urolithin B were the main metabolites
confirmed the urolithin production in the colon, and the observed, while urolithin A seems to be mainly produced
sequential loss of hydroxyls when the metabolites advance in in the intestine [31]. The kinetics of the production of the
the intestinal tract [3, 12]. different metabolites suggests that urolithin B production
González-Sarrı́as et al. [25] reported the occurrence of from isourolithin A is more favored than its production from
urolithin metabolites and ellagic acid dimethyl ether glu-
urolithin A that seems to be an end product. The occurrence
curonide in prostate biopsies after the intake of pomegranate
of urolithins in milk seems likely, although it has not been
juice. This is the only study carried out so far to evaluate the
demonstrated so far.
occurrence of urolithin metabolites in human tissues. The
concentration detected in the prostate gland was however In monogastric animals, urolithins are produced in rat,
low, although higher concentrations should not be discarded, mouse, and pig and in all these cases the main metabolite
as suggested by a parallel study carried out in rats [25] and present in feces, urine, and plasma is urolithin A and its
also in agreement with the results obtained by Seeram et al. glucuronide and sulfate conjugates. Urolithins C and B are
[24]. less frequent, but they have also been detected together with
Table 1: Production of urolithins as ellagitannin metabolites in different animals and humans.
Animal production Ellagitannin source Metabolites References

Rat (Rattus norvegicus) Pomegranate husk Uro A, Uro B, Uro C [6, 20]
Rat (Rattus norvegicus) Ellagic acid Uro A [27]
Rat (Rattus norvegicus) Oak-flavored milk Uro A, Uro B, Uro C [28]
Rat (Rattus norvegicus) Pomegranate extract Uro A [29]
Uro A, Uro M-6, Uro M-7,
Rat (Rattus norvegicus) Geraniin (from Geranium thunbergii) [30]
Uro M5
Mouse (Mus musculus) Pomegranate extract Uro A [24]
Mouse (Mus musculus) Pomegranate husk Uro A [21]
[15]
Beaver (Castor canadensis) Wood Uro A; Uro B
[21]
Complex-toothed squirrel (Trogopterus
Unknown Uro A [16, 21]
xanthipes)
Sheep (Ovis aries) Trifolium subterraneum Uro A, Uro B [18]
∗
Sheep (Ovis aries) Quebracho Uro A
Cattle (Bos primigenius) Young oak leaves Uro A, IsoUro A, Uro B [31]
Pig (Sus scrofa domesticus) Acorns Uro A, Uro C, Uro D, Uro B [23]
[7, 9, 25,
Uro A, Uro C, Isouro A,
Humans (Homo sapiens) Pomegranate juice 32]
Uro B
Humans (Homo sapiens) Pomegranate extract Uro A, UroB, Uro C [10]

[8]
Humans (Homo sapiens) Walnuts Uro A, Uro B, Uro C
[25]
Uro A, Isouro A, Uro B,
Humans (Homo sapiens) Strawberry [8, 33]
Uro C
Humans (Homo sapiens) Raspberry Uro A, IsoUro A, Uro B [8, 34]
∗
Humans (Homo sapiens) Blackberry Uro A, Uro C
∗
Humans (Homo sapiens) Cloudberry Uro A
Humans (Homo sapiens) Oak-aged red wine Uro A [8]
Humans (Homo sapiens) Tea Uro A [35]
Humans (Homo sapiens) Nuts Uro A, Isouro A, Uro B [36]
Uro A (urolithin A); Uro B (urolithin B); Uro C (urolithin C); Uro D (urolithin D); Isouro A (isourolithin A); Uro M-5 (urolithin M-5); Uro M-6 (urolithin
M-6); and Uro M-7 (urolithin M-7). ∗Tomás-Barberán et al., unpublished results.
small amounts of isourolithin A (Table 1). The same behavior to metabolize ellagic acid to produce urolithins. In termites
is observed in humans after the intake of pomegranates, feeding on wood, ellagitannins are hydrolyzed to ellagic acid,
walnuts, tea, muscadine grapes, strawberries, raspberries, and then hydroxyls are removed to produce nasutins, and
blackberries, cloudberries, oak acorns, and oak-aged red it seems that termite microbiota does not have the ability
wine. Urolithins will also be eventually produced after the of removing the lactone ring of ellagic acid to produce
intake of all ellagitannin-containing foods and medicinal urolithins [21]. It has been reported that the hemolymph of
plants as is the case of camu camu (Myrciaria dubia), arctic some Australian termites of the genus Nasutitermes contains
bramble, rose hip, sea buckthorn, cranberry, Geranium, and nasutin A that is also present in feces, but no urolithin was
oak-aged spirits (whisky, etc.). detected [38].
The studies to evaluate urolithin production in other In birds the only study available was done with green-
animals, including birds and insects, are very limited [21], finches (Carduelis chloris) that were fed for 2 weeks with
but the evidence so far indicates that they do not produce blackberries. Feces were collected and analyzed, and only
urolithins from ellagitannins. In insects, ellagitannins are ellagic acid was detected [21].
hydrolyzed to release ellagic acid, which is detected in feces. These results show that urolithins are generally produced
This was shown in the acorn beetle (Thorectes lusitanicus) by mammals after the intake of ellagitannins. There is,
[21]. Indirect evidence shows that honeybees harvesting however, interindividual variability that has been suggested
nectar containing ellagitannins hydrolyze them to release to be associated with different gut microbiota composition,
ellagic acid during honey maturation [37], but no urolithins and this means that the health effects observed after the intake
are detected suggesting that honeybee microbiota is not able of pomegranates and other ellagitannin-containing food can
Table 2: Biological effects of urolithins assayed on human cell lines.
Test compound Activity Test model Dose/duration Effect Ref.

PMA
Inhibit cellular injury caused by
UA, UB, UC, UD Antioxidant DCFH-DA 0.04–137 𝜇M, 0.5 h [39]
ROS
HL-60 cells
DMNQ
UA, UB Antioxidant 0.1–20 𝜇M, 0.5 h Increase cell survival [40]
SK-N-MC cells
Induction of cell proliferation
(estrogenic)/inhibition of cell
Estrogenic
UA, UB MCF-7 cells 0.1–40 𝜇M, 7 d proliferation in the presence of [41]
Anti-estrogenic
estradiol (anti-estrogenic)
THP-1 stimulated with Inhibit the release and expression

UA, UB Antimalarial 25 𝜇M, 48 h [42]
haemozoin or TNF-𝛼 of MMP-9
Decrease fibroblasts migration
CCD18-Co/THP-1
UA, UB Anti-inflammatory 5–40 𝜇M, 48 h and monocyte adhesion to [43]
stimulated with TNF-𝛼
fibroblasts
CCD18-Co stimulated with Inhibit PGE2 production and
UA, UB Anti-inflammatory 0.1–40 𝜇M, 18 h [44]
IL-1𝛽 mPGES-1 and COX-2 expression
HAOEC/THP-1 stimulated Inhibit monocyte adhesion and
UA, UB, UAG, UBG Anti-inflammatory 1–20 𝜇M, 4–24 h [45]
with TNF-𝛼 endothelial cell migration
Inhibit CYP1B1 and CYP1A1
UA, UB, UC, UD Anticancer 22Rv1 EROD assay 6.75–50 𝜇M, 0.5, 24 h [46]
activity
Cell cycle arrest in S and G2 /M
UA, UB Anticancer Caco-2 cells 40 𝜇M, 24–96 h [47]
phases
HEK T293 cells Wnt 0.2–200 𝜇g/mL
UA Anticancer Wnt pathway inhibition [48]
luciferase assay 48 h
Apoptosis induction and CYP1
UA, UB, UC, UD Anticancer HT-29 cells 25–70 𝜇M [49]
activity inhibition
Caco-2: human colon carcinoma cell line; CCD18-Co: human colon fibroblast cell line; CYP1A1: cytochrome P450, family 1, member A1; CYP1B1: cytochrome
P450, family 1, member B1; DCFH-DA: 2󸀠 ,7󸀠 -dichlorodihydrofluorescein diacetate; DMNQ: 2,3-dimethoxy-1,4-naphthoquinone; EROD: ethoxyresorufin-O-
deethylase assay; HAOEC: human aortic endothelial cell line; HEK T293: human embryonic kidney cell line; HL-60: promyelocytic leukaemia cells; HT-29
human colon carcinoma cell line; MCF-7: human breast cancer cell line; PGE2: prostaglandin E2; PMA: phorbol 12-myristate-13-acetate; SK-N-MC: human
neuroblastoma cells; THP-1: human acute monocytic leukaemia cell line; UA: urolithin A; UAG: urolithin A glucuronide; UB: urolithin B; UBG: urolithin B
glucuronide; UC: urolithin C; UD: urolithin D; 22Rv1: human prostate carcinoma cell line.
be modulated by the occurrence of specific microbiota to a suitable physiological concentration range, in the order of
produce urolithins [50, 51]. submicromolar-low micromolar concentrations, similar to
those that urolithins can reach in the gut and plasma after
5. Biological Activity of Urolithins the ingestion of ellagitannin-rich foods (Table 2). From all the
studies carried out in vitro, it is important to highlight a recent
The bioavailability and metabolism studies clearly indicate study in which the biological effects of urolithin glucuronides,
which metabolites should be tested and at what concentra- the major circulating metabolites in plasma after ingestion
tions in the mechanistic studies to understand the biological of ellagitannin-rich foods, were explored in human aortic
activity of pomegranate ellagitannins. A combination of endothelial cells [45]. This type of study is still very scarce,
punicalagin, ellagic acid and urolithins should be tested although highly desirable, when studying the mechanism
in those studies using models of gastrointestinal tract cells of action of polyphenols or their metabolites outside the
where they can reach concentrations around several hundred gastrointestinal tract, as polyphenols and their gut microbiota
𝜇M (for punicalagin and ellagic acid) and tens 𝜇M for metabolites are glucuronidated by Phase II enzymes after
urolithins. absorption, and they are found in this conjugated form in the
The health effects attributed to urolithins based on studies circulatory system and peripheral tissues.
carried out in vitro are numerous and diverse, from anti-
malarial properties or topoisomerase inhibitors to quenchers
of bacterial quorum sensing. In general, the number of 5.1. Antioxidant Activity. Given the high antioxidant proper-
publications regarding each biological activity is still very ties of ellagitannin-rich foods, as is the case of pomegranate
limited, although these studies are generally carried out using [1], one of the first activities that had been explored for
urolithins was their antioxidant capacity. The first available 5.3. Anti-Inflammatory-Related Activities
study reported that urolithin A had an antioxidant capacity
42-times lower than that of its precursor punicalagin when it 5.3.1. Antimalarial Activity. In an attempt to clarify whether
was tested in the DPPH assay and 3,500 times lower when it the properties of the sun-dried rind of immature Punica
was tested in the ABTS assay [7]. These results were consistent granatum, that is, used as an anti-malarial herbal rem-
with the concentrations of urolithins necessary to reach an edy, are at least in part due to urolithins, their activity
inhibiting the MMP-9 enzyme (directly involved in the
IC50 in several antioxidant assays (DPPH, xanthine-XOD,
pathogenesis of malaria) was tested. Urolithins A and B at
and PMS-NADH) that were above 100 𝜇M [29]. However,
concentrations of 25 𝜇M inhibited the release of MMP-9 and
using the ORAC assay, all urolithins tested exhibited potent
its mRNA expression, in hemozoin and TNF-𝛼 stimulated
antioxidant properties compared with those of ascorbic acid, monocytic cells [42]. These results indicated that the anti-
urolithin A being the most potent among them [29]. In a malarial properties of pomegranate rind may partly be due to
similar study, in which the antioxidant activity of a large urolithins.
number of polyphenols and their metabolites produced
in vivo was compared by the ORAC method, the antioxidant
activity of urolithin A was one of the most powerful, only 5.3.2. Histone Acetylation Status. Histone acetylation/
beaten by some proanthocyanidin oligomers, catechin, epi- deacetylation status plays an important role in inflammation
catechin and 3,4-dihydroxyphenyl acetic acid [52]. Using a since it is associated with the activation/deactivation of
cell-based method, in which the transport through the cell transcription factors as NF-𝜅B and AP-1, directly implicated
membrane was considered, Bialonska et al. [39] determined in inflammation. One of the mechanisms by which urolithins
that urolithin C showed the highest antioxidant power (IC50 = exert their anti-inflammatory activity could be the inhibition
0.16 𝜇M) whereas urolithin A showed an IC50 of 13.6 𝜇M, still of histone acetyltransferases (HAT) as in fact has been
in the range of the plasma concentrations achievable in vivo demonstrated for 5 𝜇M urolithin A and B that were able of
but in a lesser degree than its precursor ellagic acid (1.1 𝜇M) inhibiting HAT activity [53].
or vitamin C (1.9 𝜇M) [39]. In neuronal cells in which an
oxidative stress was induced, urolithin B (0.5–20 𝜇M) and
urolithin A (10 𝜇M) exhibited a protective effect increasing 5.3.3. Anti-Inflammatory Effects on Human Colon Fibroblasts.
cell survival [40]. In general, it is assumable that urolithins Colon fibroblasts have an important role in the gut immune
have higher antioxidant capacity than was originally thought response and can be exposed to significant quantities of
but the antioxidant capacity depends on the measurement colon dietary metabolites. Following ellagitannins intake,
method and needs to be studied in more detail and with other urolithin A and urolithin B as well as traces of ellagic
in vivo methods given the importance of free radicals in many acid can be found in the intestine. Thus, cultured human
diseases. colon fibroblasts stimulated with proinflammatory cytokines
were exposed to a mixture of urolithins A and B and
5.2. Estrogenic Modulators. In the last few years, there ellagic acid at concentrations representative of those that
has been an increasing interest in the study of the estro- may be found in vivo (5–40 𝜇M) [43]. Urolithin A and,
genic/antiestrogenic activity of plant-derived compounds most significantly, the mixture of metabolites were able to
(phytoestrogens) due to their potential benefits as part of the inhibit the migration capacity of the fibroblasts and the
diet, that is, regulation of cholesterol levels or maintenance adhesion of monocytes to the fibroblasts giving evidence
of the bone density after menopause. Many polyphenols of a potential amelioration of inflammation in the colon
(isoflavones, flavanones, estilbenes, etc.) show phytoestro- cells [43]. Further molecular insights into these responses
genic effects. In some cases, dietary polyphenols may be revealed that these effects were concomitant with a significant
the precursors of the so-called enterophytoestrogens that downregulation of the levels of prostaglandin-E2 (PGE2),
are produced by the colon microbiota by catabolism of PAI-1, and interleukin 8 (IL-8) as well as of other key
the original phenolics. The potential activity of urolithins regulators of cell migration and adhesion (Table 2). The study
as enterophytoestrogens has recently been investigated [41]. of the individual metabolites indicated that urolithin A was
In this work, structure-activity studies revealed that the the most active compound. In addition to the inhibition of
urolithins A and B had specific molecular characteristics that PGE2, urolithin A and also urolithin B were able to inhibit
made these molecules potentially able to bind with the 𝛼- the expression of the two major enzymes responsible for the
and 𝛽-estrogenic receptors (ER) [41]. The ER Competitive synthesis of prostaglandins under inflammatory conditions
Binding Assays showed that both urolithins had an affinity (mPGES-1 and COX-2) whereas ellagic acid did not show
for the ER𝛼 and ER𝛽 receptors, that urolithin A bound more any effect [44]. The anti-inflammatory effects of urolithins
effectively than urolithin B, and that the affinity was higher for may be mediated through regulation of the transcription
the ER𝛼 than for the ER𝛽 receptor. Using a proliferation assay factor NF-𝜅B since both urolithins are able to inhibit the
with cells sensitive to estrogens (E-screen) urolithins A and activation of this factor and also exhibit an inhibitory effect
B exhibited estrogenic activity (in the absence of estradiol) on the mitogen-activated protein kinase pathways (MAPK
and antiestrogenic activity (in the presence of estradiol) in a pathways), c-Jun (urolithin A), and p38 (urolithins A and B)
similar fashion to other known phytoestrogens [41]. [44].
5.3.4. Anti-Inflammatory Effects on Human Endothelial Cells. (urolithin D) whereas higher concentrations were needed
The anti-inflammatory effects of urolithin glucuronides have for CYP1A1 activity inhibition (12.4–2,907 𝜇M). The changes
recently been investigated by Giménez-Bastida et al. [45]. in 𝑉max and 𝐾𝑚 parameters with increasing concentrations
Using cytokine-induced human aortic endothelial cells, this of CYP1B1 inhibitor suggested an uncompetitive inhibition
study explored the effects of physiologically relevant con- for urolithin A. The lack of changes for these parameters,
centrations (low 𝜇M range, 1–20 𝜇M) of urolithin A and however, suggested a noncompetitive inhibition for urolithin
B glucuronides (the main metabolites detected in human B. Furthermore, the decrease in CYP1B1 activity exerted
plasma after the oral intake of ellagitannin-containing foods by urolithins was accompanied by a decrease in CYP1B1
[7]) on two early atherosclerotic events: monocyte adhesion expression [46].
to endothelial cells and endothelial cell migration. The main
outcome of this research was that urolithin A glucuronide, 5.4.3. Anticancer Effects against Human Colon Cancer Cells.
the most abundant circulating conjugate after the intake The in vitro studies conducted in colon cancer cells are of
of ellagitannins, exhibited the highest anti-inflammatory great relevance since it is in this portion of the GI tract where
activity. Urolithin A glucuronide moderately but significantly urolithins are produced and can reach bioactive concentra-
inhibited monocyte adhesion to the endothelial cells as well tions. A mixture of urolithin A, urolithin B, and ellagic acid,
as the migration capacity of these endothelial aortic cells at concentrations representative of those attainable in the
[45]. These effects were associated with a moderate but intestine through the diet, inhibited the proliferation of the
significant regulation of the levels of several key molecular human colon cancer Caco-2 cells [47]. This inhibition was
markers associated with the atherosclerotic process: (i) down- mostly mediated through an S and G2 /M cell cycle arrest in
regulation of chemokine (C-C motif) ligand 2 (CCL2), (ii) association with the modulation of the expression of genes
downregulation of plasminogen activator inhibitor-1 (PAI-1), involved in cell cycle regulation (CCNB1 and CCNB1IP1)
and (iii) regulation of several growth factors. These results and in cancer development, such as the oncogenes K-Ras
were, in some cases, comparable to those observed for the and c-Myc, the tumor suppressors DUSP6 and Fos, and the
corresponding aglycone urolithin A and suggested that the growth factors receptors FGFR2 and EGFR [47]. These results
glucuronidation of urolithin A does not entirely eliminate are concomitant with a general regulation of the ERK1/2
the activity of the aglycone and that the glucuronide may signaling pathway. Another pathway that may be a target for
contribute to the beneficial effects against cardiovascular urolithins is the Wnt pathway. Using a luciferase reporter
diseases attributed to the consumption of pomegranate (or of the canonical Wnt pathway in HEK T293 colon cells,
pomegranate juice) [22] and other ellagitannin-containing Sharma et al. [48] showed that urolithin A was able to
foods [2]. inhibit Wnt signaling with an IC50 of 39 𝜇M whereas ellagic
acid showed an IC50 of 63 𝜇M, concentrations that can be
achieved in the colon after pomegranate or ellagitannin-
5.4. Anticarcinogenic-Related Activities rich foods consumption [48]. Kasimsetty et al. [49] also
tested and compared the effects of urolithins on human colon
5.4.1. Topoisomerase II and CK2 Inhibitors. The anticarcino- cancer HT-29 cells, and found that urolithins A, B, C, and
genic activity of urolithins is one of the most explored so far.
D were able to induce apoptosis in a concentration range
Urolithins seem to exert anticarcinogenic activity by affecting
between 25 and 50 𝜇M, whereas much higher concentrations
numerous molecular pathways [5]. Urolithins are inhibitors
(∼500 𝜇M) were necessary to promote cell cycle arrest.
of the CK2 enzyme, a ubiquitous protein kinase implicated
Urolithins A, B, C, and D also inhibited CYP1 activity (by
in a wide variety of cell functions that when altered lead
to processes like inflammation and cancer. Using submi- approximately 50%) using concentrations in the range of
cromolar concentrations in in silico screening, urolithin A 50 to 75 𝜇M. All these results suggest that regular dietary
was discovered to be a potent and selective CK2 inhibitor consumption of ellagitannin-containing foods, which can
(IC50 = 0.39 𝜇M) [54]. Urolithin M5 and another synthetic yield and maintain 𝜇M concentrations of urolithins in the
urolithin (never detected as an ellagic acid or ellagitannin colon, may have a protective effect against colon cancer
metabolite in animals) showed topoisomerase inhibitory development.
activity at concentrations below 1 𝜇M, showing an even
more potent activity than that of the chemotherapeutic drug 5.5. Protein Glycation Inhibitors. The production of advanced
doxorubicin. The molecular mechanism of action toward glycation end products is a secondary effect of hyperglycemia
human topoisomerase II seems to be the competition with that has a significant role in the cardiovascular complica-
ATP for the ATP binding pocket of the human enzyme [55]. tions associated with diabetes and also with Alzheimer’s
disease. Urolithins A and B (1 𝜇M) showed significant
5.4.2. Human Prostate Cells. The human prostate gland is antiglycative activity that increased when increasing the
one of the organs where urolithins can be detected after concentrations up to 10 𝜇M in the case of urolithin A.
the consumption of pomegranate juice and walnuts [25]. In The same increase was not observed for urolithin B [40].
prostate cancer cells, urolithins (A, B, C, and D) inhibited This activity, however, was not related to their antioxidant
CYP1B1 activity (a target in prostate cancer chemopreven- activity (measured as ABTS) or to their glyoxal-binding
tion) in a dose ranging from 1.15 𝜇M (urolithin A) to 137 𝜇M capacity.
5.6. Antimicrobial Activity through the Inhibition of Quorum ellagic acid. Taking into account that urolithin A is the main
Sensing. Quorum Sensing (QS) is a bacterial communica- metabolite produced after pomegranate intake, the objective
tion mechanism that responds to small molecules or auto- of that study was to evaluate a possible direct effect of
inducers and by which bacteria are able to detect popula- urolithin A ingested as synthetic compound and to compare
tion density, regulate gene expression, and control several this effect with that exerted by the in vivo generated urolithin
key processes related to the infection progression such as A after pomegranate extract consumption. A number of
virulence, biofilm formation, and motility. An important area measurements were carried out, including the evaluation
of recent research focuses on finding natural compounds of colon tissue damage, microbiota changes, antioxidant
able to inhibit QS that may pose an efficient alternative to status, prostaglandin E2 (PGE2), nitric oxide production,
the use of antibiotics against pathogen infections. Dietary- cyclooxygenase-2 (COX-2), inducible nitric oxide synthase
derived polyphenol metabolites present in the intestine may (iNOS), prostaglandin E synthase (PTGES), gene expression
contribute to reduce the ability of pathogens to invade the in colon mucosa (microarrays and RT-PCR) and polyphe-
intestine through inhibition of their QS capacity. Urolithins nol metabolism (LC-MS-MS). The administration of both
A and B have been shown to reduce biofilm biomass and pomegranate extract and urolithin A for 25 days before the
swimming motility of the enteropathogen Yersinia entero- induction of inflammation was reported to be safe according
colitica at concentrations as low as 4 𝜇M [56]. These effects to serobiochemical analysis and evaluation of the animals.
were associated with a significant reduction of the levels of Both pomegranate extract and urolithin-A decreased the
the bacteria autoinducers acylhomoserine lactones (AHLs) anti-inflammatory markers iNOS, COX-2, PTGES and PGE2
released by the bacteria to the culture media and were in colonic mucosa. However, the anti-inflammatory activity
accompanied by the alteration of the expression levels of exerted by 15 mg/kg urolithin A at both colonic and sys-
genes critically involved in the synthesis of lactones (yenI temic levels was relatively stronger than that produced by
and yenR) and the synthesis of the flagella (flhDC, fliA, 250 mg/kg pomegranate extract. Only urolithin A was able
and fleB) [56]. These results suggest that the microbiota- to preserve the colonic architecture. However, pomegranate
derived metabolites urolithin A and urolithin B may exert extract but not urolithin A decreased oxidative stress in
antipathogenic effects in the colon against Y. enterocolitica plasma and colon mucosa (TBARs and FRAP methods).
and may contribute to maintain the microbial equilibrium in Regarding gene expression analyses in the colon mucosa
the gut. of a rat model of ulcerative colitis, the expression of 2,058
and 6,996 genes was found to be significantly modified by
the consumption of the pomegranate extract and urolithin A,
6. The In Vivo Evidence respectively. From those, a total of 667 genes were commonly
regulated both by the pomegranate extract and urolithin
The poor bioavailability of ellagitannins, and ellagic acid A. These genes were used for Functional Analyses using
derivatives as well as their extensive metabolism in the the Ingenuity Pathways Analysis (IPA, Ingenuity Systems,
gastrointestinal tract has raised the question whether these Redwood City, CA, USA). Figure 5 shows the main top
parent molecules, found as such in the food, were the functions and diseases that were most significant to the
real active compounds systemically that could be related gene expression altered by the intake of the pomegranate
to the health benefits exerted by pomegranate juice and extract or urolithin A. Of note, some of the main functions
other ellagitannin-containing foodstuffs. Our group reported and disorders detected were associated to colon cancer
for the first time the occurrence of urolithins in humans development, for example, “cell death,” “cell proliferation,”
after consuming pomegranate juice [7]. These metabolites “cancer,” “gastrointestinal disease,” “organismal survival,” and
reached micromolar concentrations in the bloodstream, “cell cycle.”
and we launched the hypothesis that linked the potential Using the Canonical Pathways Analysis tool of IPA, it
systemic biological effects of pomegranate juice ingestion was also possible to identify the main pathways from the
with urolithins rather than with the polyphenols present IPA library that were most significant to the gene expression
in pomegranate juice [7] or other ellagitannin-containing data analyzed. Figure 6 shows the main molecules specifically
foodstuffs such as walnuts, strawberries, and raspberries [8]. involved in signaling pathways, transcription regulation, cell
The first direct in vivo evidence regarding the biological growth, cell cycle, and apoptosis for which deregulation has
activity of urolithins was also reported by our group five
been implicated in cancer development and whose transcript
years later after launching the above hypothesis. Larrosa et
levels were significantlymodulated by urolithin A (upregu-
al. [29] reported the anti-inflammatory and prebiotic effects
lated in red, downregulated in green). The different molecules
of the most significant urolithin metabolite (urolithin A)
are depicted in their corresponding cellular compartment,
in a rat model of ulcerative colitis. The rats received a
standard chow supplemented either with 250 mg/kg/day of an and reported interactions between them are indicated by
ellagitannin-rich pomegranate extract (PE) (HED ∼2.5 g in a arrows. This figure illustrates the complexity of the molecular
70 kg person) or with 15 mg/kg/day of synthetic urolithin A mechanisms that may be triggered in a cell as a response to
(UroA) (HED ∼154 mg in a 70 kg person) for 25 days before the exposure to a potential bioactive compound, for example,
inducing colon inflammation with dextran sodium sulfate urolithin A. It should be noted that among the changes
(DSS). The pomegranate extract contained 35% punicalagins, detected, some important tumor suppressors such as p53 and
13% punicalin, 4.5% ellagic acid glycosides, and 8.9% free Rb1 were upregulated whereas the antiapoptotic genes BclXL
Threshold The second study dealing with the in vivo evidence of

Cell death urolithins was carried out by Ishimoto et al. [57]. These
Cell proliferation authors reported the acute (24 h) anti-inflammatory effect
Protein synthesis of urolithin A on carrageenan-induced paw edema in mice.
Cancer In this case, urolithin A (300 mg/kg; HED ∼1.5 g in a 70 kg
Gastrointestinal disease person) was orally administered to mice at 1 or 6 h before the
Hematological disease
injection of carrageenan. The inflammatory effect was eval-
Genetic disorder
uated for 24 h after carrageenan injection by measuring the
Respiratory disease
Organismal survival
hind paw volume. Unfortunately no inflammatory markers
Cell cycle
were measured in this study. The authors claimed a rapid
absorption of urolithin A which peaked at 1 h in mice [57].
0 5 10 15 20 25 30 35 However, this was not in agreement with a previous study
− log(𝑃-value) dealing with the pharmacokinetic and tissue distribution
Pomegranate extract
of urolithins where urolithin A peaked in plasma after 2 h,
Uro-A being almost undetectable after 6 h [24]. Ishimoto et al.
[57] described a high antioxidant activity of urolithin A in
Figure 5: Common top ten functions and diseases identified by mouse plasma using the ORAC method and suggested that
functional analysis (IPA, Ingenuity Pathways Analysis; Ingenuity this activity could be correlated with the anti-inflammatory
Systems, Redwood City, CA, USA) and that were most significant
effects. These results were not in agreement with those of
to gene expression altered by the intake of pomegranate extract
or Urolithin A in the colon mucosa of a rat model of ulcerative Larrosa et al. [29] who suggested that anti-inflammatory
colitis (gene expression data from Larrosa et al. [29]). Black bars: effects of urolithin A were not mediated by its antioxidant
pomegranate extract. Grey bars: urolithin A. A Fischer’s exact test activity since no significant antioxidant effects in plasma and
was used to calculate a P-value determining the probability that each colon of rats were found (TBARs and FRAP methods). In
function or disease assigned to the data was due to chance. We set addition, Cerdá et al. [7] did not observe any increase in the
a threshold at P value ≤ 0.05 (dashed line) which corresponds to a antioxidant status of human plasma after the intake of 1 L of
False Discovery Rate (FDR) ≤ 5% of false positives. Note: On the y- pomegranate juice for 5 days (ABTS and DPPH methods).
axis, the significance is expressed as the minus log (10-based) of the Perhaps, the high dose of urolithin A assayed by Ishimoto
P values. The higher the bar, the lower the P value and hence the et al. [57] as well as the specific use of the ORAC method
more significant for the enrichment of the function/disease. to measure the antioxidant activity could be behind this
apparent controversy. Overall, the human extrapolation of the
results obtained by Ishimoto et al. [57] could be doubtful due
to their assay conditions. These authors assayed a single dose
and Akt were downregulated by urolithin A. These changes of 1.5 g HED of urolithin A which raises safety concerns in
were also observed after treatment with the pomegranate contrast to the assay conditions approached by Larrosa et al.
extract. These results are indicative of in vivo molecular [29].
modulation in the colon mucosa cells in response to urolithin
A or pomegranate extract that may be associated with the
prevention or reduction of malignant changes and cancer 7. Outlook and Further Research
development. In support of these results, in vitro studies using
human colon cancer cells Caco-2 also reported the inhibition Urolithins can reach significant concentrations in the human
of these cells proliferation and a cell cycle block by urolithin A body after the intake of ellagitannin-containing products;
(Table 2). In addition, many of those genes involved in these however, the direct biological activity of urolithins has been
functions were found to be modulated by urolithin A in the scarcely studied so far. In this regard, these metabolites could
human cells [47]. be the missing link to explain the health benefits associated to
Our group also reported for the first time the in vivo the consumption of ellagitannin-containing products such as
prebiotic effect of pomegranate extract and urolithin A pomegranate. There are a number of urolithins produced by
[29]. Both pomegranate extract and urolithin A modulated the human gut microbiota. Some studies reveal the relevant
favorably the gut microbiota in healthy rats (before inflam- turnover of these metabolites in the human body, with a high
mation) which could contribute to the protective effects urine excretion, significant concentration in the bloodstream,
of pomegranate juice and urolithin A against the further and also disposition in the human prostate gland. To date,
induced colon inflammation. In the case of urolithin A, the only two studies (animal models) have described the in
effect was unequivocally due to synthetic metabolite orally vivo anti-inflammatory [29, 57] and possible cancer chemo-
administered and could be associated to the inhibition of preventive activities [29] of the most abundant urolithin
some specific gut microbiota species to favor the growing of produced in humans, urolithin A. In addition to this limited
some (beneficial) microbial groups such as lactobacilli and evidence, the direct in vivo activity of the rest of urolithins is
bifidobacteria. In the case of pomegranate extract, the same not yet known, and thus more animal studies are needed. In
explanation could be also given, but a prebiotic effect exerted vitro studies with specific cell models and specific metabolites
by other compounds present in the extract (fibers, sugars, (type of urolithin and conjugates such as glucuronides or
etc.) could not be ruled out [29]. sulfates) are useful to unravel mechanisms. In this context,
Molecular mechanisms of cancer
Growth Growth
Hormones ECM Cytokines
factors protein factors
Plasma membrane
Integrin Cytokine RTK
GPCR RTK receptor
DAG PIP2 AC Ras
PLC C3G CRK SHC SHC
𝛽 GRB2 SHC
ATP GRB2 FAK GAB
IP3 G𝛼 GRB2 SOS CbI IRS1
SOS Cdc42 SHP2 1/2
EPAC1 SOS
Ca2+ NF1∗
Src
cAMP B-Raf JAK
Rap Ras
PKC
Fyn
CAMK PKA PI3K PI3K
II
Ras
GRP PI3K Rho
MEK
1/2 PI3K
PIP3 PIP2 Raf
Ras RaIGEF A/B
GAP∗
Ras
GRF SynGAP AKT
Ras
MP1
GEF AKT GSK3 I𝜅B PAK
Ral
ERK NF-𝜅B
GAP MDM2
Ras 1/2
PI3K/AKT
MP1 Signaling
MEK I𝜅B c-Raf
ERK 1/2 c-Raf
1/2 JNK
RAC
Cell NF-𝜅B P53∗
UV irradiation
proliferation
Proteasomal
degradation
Nucleus
DNA damage
DNA repair ERK
JNK Cyclin FoxO1
1/2 BAD
D Bcl2
ERK
1/2 BclXL
DNA NF-𝜅B
HIPK2 ATM ATR Noxa
PK FANCD2
Repression of
apoptosis and
cell cycle Cell tBID
c-Jun arrest survival
NBS1 c-Jun MMP
Chk1
PUMA
c-Fos Aurora Chk2 Elk-1 BIM
Cyclin
A P53∗ c-Fos
regulation
JNK
BAK
Cell cycle c-Jun Myc

BRCA1
regulation and BAX
c-Fos MIZ1 MAX
DC25 oncogenesis Mitochondria
Cyclin
regulation MMP: mitochondrial
p16 CDK p38 membrane
p21 c-Fos 4/6 Cyclin MAPK
MDM2 Cell cycle arrest INK4A permeabilization
CIP1 P D
Rb
WNT and PTCH p14 Cyclins p19 JNK CytoC
regulation ARF CDKs CDK2+ p18
INK4D
CKIs Rb SMAC
Cyclin INK4C p15
Activation of
target genes E INK4B
E2F p21 MKK
Hedgehog target E2F CIP1 3/6
genes
CytoC
HIF1𝛼 RBPJK HAT1
p27 CIAP Caspase
Gli Cell survival
NICD KIP1 APAF1 9
NICD P300
SMAD4 RBL1
LEF1 SMAD
SMAD 2/3 Apoptosis
E2F
CBP∗ CTNN
TCF 3/4
1/5/8 SMAD4
𝛽
NICD
Caspase
TAK1 3/6/7
TAB2 TAB1
SMAD4 SMAD
CTNN 2/3 BID tBID
APC
CTNN 𝛽 SMAD
NICD TAK1 1/5/8 SMAD4
𝛽
AXIN GSK3 NLK SMAD4
𝛽 TAB2 TAB1 Caspase
8,10 JNK
Gli CTNN SMAD6
𝛾 -Secretase 𝛽 ERK
G complex SMAD SMAD7 ASK1
SuFu protein SMAD 1/2 2/3
CTNN CTNN Src 1/5/8
Fu Dsh 𝛼 𝛿 FLIP FADD
PSEN Daxx
1/2 SMAD7
PEN2 Notch Ras TGF TGF
PTCH Smo APH1 BMPR1 BMPR2 Fas
1 Fzd LRP CDH 𝛽R1 𝛽R2
1/5/8 E
NCSTN
Hedgehog
WNT FasL
5A Cd2+ BMP TGF-𝛽
WNT 1
c 2000-2010 Ingenuity systems, Inc. all rights reserved.
Figure 6: Graphical representation of main genes involved in signaling pathways, transcription regulation, cell growth, cell cycle, and
apoptosis for which deregulation has been implicated in cancer development. Genes depicted in red color were upregulated and genes
represented in green color were downregulated in the colon mucosa of rats following the consumption of urolithin A, (Larrosa et al. [29]).
Analyses were carried out using the Canonical Pathways Analysis tool of Ingenuity Pathways Analysis (Ingenuity Systems, Redwood City,
CA, USA).
appropriate concentrations and type of metabolites should be foodstuffs, and therefore they cannot be considered as dietary
carefully chosen to draw relevant conclusions from these in compounds. In this regard, the toxicological evaluation of
vitro models. urolithins in animal models is also missing.
The evaluation of urolithins in humans could be more
difficult. Although these metabolites are produced in the
human gut, the administration of synthetic urolithins to Conflict of Interests
humans can raise safety concerns since these metabolites are
not found as such (at least in relevant concentrations) in The authors declare no conflict of interests.
Acknowledgments human colon microflora from ellagic acid and related com-
pounds,” Journal of Agricultural and Food Chemistry, vol. 53, no.
This work has been supported by the Projects Con- 14, pp. 5571–5576, 2005.
solider Ingenio 2010, CSD2007-00063 (Fun-C-Food), CICYT [13] M. A. M. Nawwar and A. M. A. Souleman, “3,4,8,9,10-
AGL2011-22447, Fundación Séneca de la Región de Murcia Pentahydroxy-dibenzo[b,d]pyran-6-one from Tamarix nilot-
(grupo de excelencia GERM 06, 04486), and BACCHUS (FP7 ica,” Phytochemistry, vol. 23, no. 12, pp. 2966–2967, 1984.
European Commission Grant Agreement 312090). [14] M. A. M. Nawwar, S. A. M. Hussein, and I. Merfort, “NMR
spectral analysis of polyphenols from Punica granatum,” Phy-
References tochemistry, vol. 36, no. 3, pp. 793–798, 1994.
[15] E. Lederer, “Chemistry and biochemistry of some mammalian
[1] M. I. Gil, F. A. Tomás-Barberán, B. Hess-Pierce, D. M. Holcroft, secretions and excretions,” Journal of the Chemical Society, pp.
and A. A. Kader, “Antioxidant activity of pomegranate juice 2115–2125, 1949.
and its relationship with phenolic composition and processing,” [16] S. J. Jeong, N. Y. Kim, D. H. Kim et al., “Hyaluronidase
Journal of Agricultural and Food Chemistry, vol. 48, no. 10, pp. inhibitory active 6H-dibenzo[b,d]pyran-6-ones from the feces
4581–4589, 2000. of Trogopterus xanthipes,” Planta Medica, vol. 66, no. 1, pp. 76–
[2] M. Larrosa, M. T. Garcı́a-Conesa, J. C. Espı́n, and F. A. Tomás- 77, 2000.
Barberán, “Ellagitannins, ellagic acid and vascular health,” [17] S. Ghosal, “Chemistry of shilajit, an immunomodulatory
Molecular Aspects of Medicine, vol. 31, no. 6, pp. 513–539, 2010. Ayurvedic rasayan,” Pure & Applied Chemistry, vol. 62, no. 7, pp.
[3] F. A. Tomás-Barberán, J. C. Espı́n, and M. T. Garcı́a-Conesa, 1285–1288, 1990.
“Bioavailability and metabolism of ellagic acid and ellagitan- [18] G. S. Pope, “Isolation of two benzocoumarins from “clover
nins,” in Chemistry and Biology of Ellagitannins, S. Quideau, Ed., stone” a type of renal calculus found in sheep,” Biochemical
chapter 7, pp. 293–297, World Scientific, New Yersey, NJ, USA, Journal, vol. 93, no. 3, pp. 474–477, 1964.
2009.
[19] L. J. Filippich, J. Zhu, P. Oelrichs et al., “Hepatotoxic and
[4] N. P. Seeram, R. N. Schulman, and D. Heber, Pomegranates. nephrotoxic principles in Terminalia oblongata,” Research in
Ancient Roots to Modern Medicine, CRC Press, Boca Raton, FL, Veterinary Science, vol. 50, no. 2, pp. 170–177, 1991.
USA, 2006.
[20] B. Cerdá, J. J. Cerón, F. A. Tomás-Barberán, and J. C. Espı́n,
[5] D. Heber, “Multitargeted therapy of cancer by ellagitannins,”
“Repeated oral administration of high doses of the pomegranate
Cancer Letters, vol. 269, no. 2, pp. 262–268, 2008.
ellagitannin punicalagin to rats for 37 days is not toxic,” Journal
[6] B. Cerdá, R. Llorach, J. J. Cerón, J. C. Espı́n, and F. A. Tomás- of Agricultural and Food Chemistry, vol. 51, no. 11, pp. 3493–3501,
Barberán, “Evaluation of the bioavailability and metabolism 2003.
in the rat of punicalagin, and antioxidant polyphenol of
[21] R. González-Barrio, P. Truchado, H. Ito, J. C. Espı́n, and F.
pomegranate juice,” European Journal of Nutrition, vol. 42, no.
A. Tomás-Barberán, “UV and MS identification of urolithins
1, pp. 18–28, 2003.
and nasutins, the bioavailable metabolites of ellagitannins and
[7] B. Cerdá, J. C. Espı́n, S. Parra, P. Martı́nez, and F. A. Tomás- ellagic acid in different mammals,” Journal of Agricultural and
Barberán, “The potent in vitro antioxidant ellagitannins from Food Chemistry, vol. 59, no. 4, pp. 1152–1162, 2011.
pomegranate juice are metabolised into bioavailable but poor
antioxidant hydroxy-6H-dibenzopyran-6-one derivatives by [22] M. Aviram, L. Dornfeld, M. Rosenblat et al., “Pomegranate juice
the colonic microflora of healthy humans,” European Journal of consumption reduces oxidative stress, atherogenic modifica-
Nutrition, vol. 43, no. 4, pp. 205–220, 2004. tions to LDL, and platelet aggregation: studies in humans and
in atherosclerotic apolipoprotein E-deficient mice,” American
[8] B. Cerdá, F. A. Tomás-Barberán, and J. C. Espı́n, “Metabolism
Journal of Clinical Nutrition, vol. 71, no. 5, pp. 1062–1076, 2000.
of antioxidant and chemopreventive ellagitannins from straw-
berries, raspberries, walnuts, and oak-aged wine in humans: [23] J. C. Espı́n, R. González-Barrio, B. Cerdá, C. López-Bote, A.
identification of biomarkers and individual variability,” Journal I. Rey, and F. A. Tomás-Barberán, “Iberian pig as a model to
of Agricultural and Food Chemistry, vol. 53, no. 2, pp. 227–235, clarify obscure points in the bioavailability and metabolism
2005. of ellagitannins in humans,” Journal of Agricultural and Food
[9] N. P. Seeram, S. M. Henning, Y. Zhang, M. Suchard, Z. Li, and D.
Heber, “Pomegranate juice ellagitannin metabolites are present [24] N. P. Seeram, W. J. Aronson, Y. Zhang et al., “Pomegranate
in human plasma and some persist in urine for up to 48 hours,” ellagitannin-derived metabolites inhibit prostate cancer growth
Journal of Nutrition, vol. 136, no. 10, pp. 2481–2485, 2006. and localize to the mouse prostate gland,” Journal of Agricultural
[10] S. U. Mertens-Talcott, P. Jilma-Stohlawetz, J. Rios, L. Hingorani, and Food Chemistry, vol. 55, no. 19, pp. 7732–7737, 2007.
and H. Derendorf, “Absorption, metabolism, and antioxidant [25] A. González-Sarrı́as, J. A. Giménez-Bastida, M. T. Garcı́a-
effects of pomegranate (Punica granatum L.) polyphenols after Conesa et al., “Occurrence of urolithins, gut microbiota ellagic
ingestion of a standardized extract in healthy human volun- acid metabolites and proliferation markers expression response
teers,” Journal of Agricultural and Food Chemistry, vol. 54, no. in the human prostate gland upon consumption of walnuts and
23, pp. 8956–8961, 2006. pomegranate juice,” Molecular Nutrition and Food Research, vol.
[11] F. A. Tomás-Barberán, N. P. Seeram, and J. C. Espı́n, “Bioavail- 54, no. 3, pp. 311–322, 2010.
ability of pomegranate polyphenols,” in Pomegranates. Ancient [26] N. P. Seeram, R. Lee, and D. Heber, “Bioavailability of ellagic
Roots to Modern Medicine, N. P. Seeram, R. N. Schulman, and acid in human plasma after consumption of ellagitannins from
D. Heber, Eds., Chapter 3, pp. 45–60, CRC Press, Boca Raton, pomegranate (Punica granatum L.) juice,” Clinica Chimica Acta,
FL, USA, 2006. vol. 348, no. 1-2, pp. 63–68, 2004.
[12] B. Cerdá, P. Periago, J. C. Espı́n, and F. A. Tomás-Barberán, [27] B. Doyle and L. A. Griffiths, “The metabolism of ellagic acid in
“Identification of urolithin A as a metabolite produced by the rat,” Xenobiotica, vol. 10, no. 4, pp. 247–256, 1980.
[28] M. Azorı́n-Ortuño, C. Urbán, J. J. Cerón et al., “Safety evalu- [42] M. Dell’Agli, G. V. Galli, M. Bulgari et al., “Ellagitannins of the
ation of an oak-flavored milk powder containing ellagitannins fruit rind of pomegranate (Punica granatum) antagonize in vitro
upon oral administration in the rat,” Journal of Agricultural and the host inflammatory response mechanisms involved in the
Food Chemistry, vol. 56, no. 8, pp. 2857–2865, 2009. onset of malaria,” Malaria Journal, vol. 9, no. 1, article 208, 2010.
[29] M. Larrosa, A. González-Sarrı́as, M. J. Yáñez-Gascón et al., [43] J. A. Giménez-Bastida, M. Larrosa, A. González-Sarrı́as, F. A.
“Antiinflammatory properties of a pomegranate extract and its Tomás-Barberán, J. C. Espı́n, and M. T. Garcı́a-Conesa, “Intesti-
metabolite urolithin A in a colitis rat model and the effect of nal ellagitannin metabolites urolithins and ellagic acid amelio-
colon inflammation on the phenolic metabolism,” Journal of rate cytokine induced inflammation and associated molecular
Nutritional Biochemistry, vol. 21, no. 8, pp. 717–725, 2010. markers in human colon fibroblasts,” Journal of Agricultural and
[30] H. Ito, “Metabolites of the ellagitannin geraniin and their Food Chemistry, vol. 60, no. 36, pp. 8866–8876, 2012.
antioxidant activities,” Planta Medica, vol. 77, no. 11, pp. 1110– [44] A. González-Sarrı́as, M. Larrosa, F. A. Toms-Barberán, P.
1115, 2011. Dolara, and J. C. Espı́n, “NF-𝜅B-dependent anti-inflammatory
[31] R. González-Barrio, P. Truchado, R. Garcı́a-Villalba et al., activity of urolithins, gut microbiota ellagic acid-derived
“Metabolism of oak leaf ellagitannins and urolithin production metabolites, in human colonic fibroblasts,” British Journal of
in beef cattle,” Journal of Agricultural and Food Chemistry, vol. Nutrition, vol. 104, no. 4, pp. 503–512, 2010.
60, no. 12, pp. 3068–3077, 2012. [45] J. A. Giménez-Bastida, A. González-Sarrı́as, M. Larrosa et
[32] B. Cerdá, C. Soto, M. D. Albaladejo et al., “Pomegranate juice al., “Ellagitannin metabolites, urolithin A glucuronide and its
supplementation in chronic obstructive pulmonary disease: aglycone urolithin A, ameliorate TNF-𝛼 induced inflammation
a 5-week randomized, double-blind, placebo-controlled trial,” and associated molecular markers in human aortic endothelial
European Journal of Clinical Nutrition, vol. 60, no. 2, pp. 245– cells,” Molecular Nutrition & Food Research, vol. 56, no. 5, pp.
253, 2006. 784–796, 2012.
[33] P. Truchado, M. Larrosa, M. T. Garcı́a-Conesa et al., “Strawberry [46] S. G. Kasimsetty, D. Bialonska, M. K. Reddy, C. Thornton, K.
processing does not affect the production and urinary excretion L. Willett, and D. Ferreira, “Effects of pomegranate chemical
of urolithins, ellagic acid metabolites, in humans. A cross-over constituents/intestinal microbial metabolites on CYP1B1 in
study,” Journal of Agricultural and Food Chemistry, vol. 60, no. 22Rv1 prostate cancer cells,” Journal of Agricultural and Food
23, pp. 5749–5754, 2012. Chemistry, vol. 57, no. 22, pp. 10636–10644, 2009.
[34] R. González-Barrio, C. A. Edwards, and A. Crozier, “Colonic [47] A. González-Sarrı́as, J. C. Espı́n, F. A. Tomás-Barberán, and
Catabolism of ellagitannins, ellagic acid, and raspberry antho- M. T. Garcı́a-Conesa, “Gene expression, cell cycle arrest and
cyanins: in vivo and in vitro studies,” Drug Metabolism and MAPK signalling regulation in Caco-2 cells exposed to ellagic
Disposition, vol. 39, no. 9, pp. 1680–1688, 2011. acid and its metabolites, urolithins,” Molecular Nutrition & Food
[35] J. J. J. van der Hooft, R. C. H. de vos, V. Mihaleva et al., “Struc- Research, vol. 53, no. 6, pp. 686–698, 2009.
tural elucidation and quantification of phenolic conjugates [48] M. Sharma, L. Li, J. Celver, C. Killian, A. Kovoor, and N. P.
present in human urine after tea intake,” Analytical Chemistry, Seeram, “Effects of fruit ellagitannin extracts, ellagic acid, and
vol. 84, no. 16, pp. 7263–7271, 2012. their colonic metabolite, urolithin A, on Wnt signaling,” Journal
[36] S. Tulipani, M. Urpi-Sarda, R. Garcı́a-Villalba et al., “Urolithins of Agricultural and Food Chemistry, vol. 58, no. 7, pp. 3965–3969,
are the main urinary microbial-derived phenolic metabolites 2010.
discriminating a moderate consumption of nuts in free-living
[49] S. G. Kasimsetty, D. Bialonska, M. K. Reddy, G. Ma, S. I. Khan,
subjects with diagnosed metabolic syndrome,” Journal of Agri-
and D. Ferreira, “Colon cancer chemopreventive activities of
cultural and Food Chemistry, vol. 60, no. 36, pp. 8930–8940,
pomegranate ellagitannins and Urolithins,” Journal of Agricul-
2012.
tural and Food Chemistry, vol. 58, no. 4, pp. 2180–2187, 2010.
[37] F. Ferreres, P. Andrade, M. I. Gil, and F. A. Tomás-Barberán,
“Floral nectar phenolics as biochemical markers for the botan- [50] M. V. Selma, J. C. Espı́n, and F. A. Tomás-Barberán, “Interaction
ical origin of heather honey,” Zeitschrift fur Lebensmittel- between phenolics and gut microbiota: role in human health,”
Untersuchung und-Forschung, vol. 202, no. 1, pp. 40–44, 1996. Journal of Agricultural and Food Chemistry, vol. 57, no. 15, pp.
6485–6501, 2009.
[38] B. P. Moore, “Coumarin-like substances from Australian ter-
mites,” Nature, vol. 195, no. 4846, pp. 1101–1102, 1962. [51] F. A. Tomas-Barberan and C. Andres-Lacueva, “Polyphenols
and health: current state and progress,” Journal of Agricultural
[39] D. Bioalonska, S. G. Kasimsetty, S. I. Khan, and D. Ferreira,
“Urolithins, intestinal microbial metabolites of pomegranate ∼
ellagitannins, exhibit potent antioxidant activity in a cell-based [52] H. Ishimoto, A. Tai, M. Yoshimura et al., “Antioxidative prop-
assay,” Journal of Agricultural and Food Chemistry, vol. 57, no. erties of functional polyphenols and their metabolites assessed
21, pp. 10181–10186, 2009. by an ORAC assay,” Bioscience, Biotechnology and Biochemistry,
vol. 76, no. 2, pp. 395–399, 2012.
[40] E. Verzelloni, C. Pellacani, D. Tagliazucchi et al., “Antiglyca-
tive and neuroprotective activity of colon-derived polyphenol [53] A. K. Kiss, S. Granica, M. Stolarczyk, and M. F. Melzig,
catabolites,” Molecular Nutrition and Food Research, vol. 55, “Epigenetic modulation of mechanisms involved in inflamma-
supplement 1, pp. S35–S43, 2011. tion: influence of selected polyphenolic substances on histone
[41] M. Larrosa, A. González-Sarrı́as, M. T. Garcı́a-Conesa, F. A. acetylation state,” Food Chemistry, vol. 131, no. 3, pp. 1015–1020,
Tomás-Barberán, and J. C. Espı́n, “Urolithins, ellagic acid- 2012.
derived metabolites produced by human colonic microflora, [54] G. Cozza, A. Gianoncelli, P. Bonvini et al., “Urolithin as a con-
exhibit estrogenic and antiestrogenic activities,” Journal of verging scaffold linking ellagic acid and coumarin analogues:
Agricultural and Food Chemistry, vol. 54, no. 5, pp. 1611–1620, design of potent protein kinase CK2 inhibitors,” ChemMed-
2006. Chem, vol. 6, no. 12, pp. 2273–2286, 2011.
[55] V. Furlanetto, G. Zagotto, R. Pasquale, S. Moro, and B. Gatto,

“Ellagic acid and polyhydroxylated urolithins are potent cat-
alytic inhibitors of human topoisomerase II: an in vitro study,”
Journal of Agricultural and Food Chemistry, vol. 60, no. 36, pp.
9162–9170, 2012.
[56] J. A. Giménez-Bastida, P. Truchado, M. Larrosa et al.,
“Urolithins, ellagitannin metabolites produced by colon micro-
biota, inhibit quorum sensing in Yersinia enterocolitica: phe-
notypic response and associated molecular changes,” Food
[57] H. Ishimoto, M. Shibata, Y. Myojin et al., “In vivo anti-
inflammatory and antioxidant properties of ellagitannin
metabolite urolithin A,” Bioorganic & Medicinal Chemistry
Letters, vol. 21, no. 19, pp. 5901–5904, 2011.
http://dx.doi.org/10.1155/2013/606212
Review Article
The Pomegranate: Effects on Bacteria and Viruses That
Influence Human Health
Amy B. Howell1 and Doris H. D’Souza2

1
Marucci Center for Blueberry and Cranberry Research, Rutgers, The State University of New Jersey, Chatsworth, NJ 08019, USA
2
Department of Food Science and Technology, The University of Tennessee, Knoxville, TN 37996, USA
Correspondence should be addressed to Amy B. Howell; ahowell@aesop.rutgers.edu
Received 30 December 2012; Accepted 13 March 2013
Copyright © 2013 A. B. Howell and D. H. D’Souza. This is an open access article distributed under the Creative Commons
Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is
properly cited.
Pomegranates have been known for hundreds of years for their multiple health benefits, including antimicrobial activity. The recent
surge in multidrug-resistant bacteria and the possibility of widespread global virus pandemics necessitate the need for additional
preventative and therapeutic options to conventional drugs. Research indicates that pomegranates and their extracts may serve as
natural alternatives due to their potency against a wide range of bacterial and viral pathogens. Nearly every part of the pomegranate
plant has been tested for antimicrobial activities, including the fruit juice, peel, arils, flowers, and bark. Many studies have utilized
pomegranate peel with success. There are various phytochemical compounds in pomegranate that have demonstrated antimicrobial
activity, but most of the studies have found that ellagic acid and larger hydrolyzable tannins, such as punicalagin, have the highest
activities. In some cases the combination of the pomegranate constituents offers the most benefit. The positive clinical results on
pomegranate and suppression of oral bacteria are intriguing and worthy of further study. Much of the evidence for pomegranates’
antibacterial and antiviral activities against foodborne pathogens and other infectious disease organisms comes from in vitro cell-
based assays, necessitating further confirmation of in vivo efficacy through human clinical trials.
1. Introduction: Pomegranates and Their in hydrolyzable tannins (punicalins and punicalagins), ellagic
Effects on Human Bacteria acid, a component of ellagitannins, and gallic acid, a compo-
nent of gallotannins [10] (Figure 1). Mass spectrometry data
Pomegranates (Punica granatum L.) have a long history of shows that pomegranate contains oligomeric ellagitannin
antibacterial use dating back to biblical times. Egyptians used with a degree of polymerization of up to 5 core glucose units
pomegranates to treat a number of different infections [1]. It [11]. These molecules may be the most potent antibacterial
was utilized as a traditional remedy for thousands of years compounds in pomegranate. However, other compounds
under the Ayurvedic system of medicine, with extracts from also have activity and may contribute synergistically as
the rind of the fruit and bark of the tree being effective against mixtures to bring about the effects, including anthocyan-
diarrhea and dysentery [2]. Over the years there have been ins (pelargonidin-3-galactose and cyanidin-3-glucose) and
many small studies undertaken in different areas of the world flavonols (quercetin and myricetin) [8].
on the bactericidal effects of pomegranates on a number of
highly pathogenic and drug-resistant strains. These studies
normally determine bactericidal potency of different extracts 2. Evidence for Pomegranate in Controlling
of the pomegranate plant against a range of different bacteria, Bacteria That Affect the Human Body
utilizing disc diffusion assays or minimum inhibitory con-
centration (MIC). Methanol extracts of the fruit, especially 2.1. Effects on Enteric Bacteria. Enteric bacteria can be either
the peel, exhibit the broadest antibacterial activity [3–8] probiotic and exert beneficial effects on the gut microflora,
(Table 1), which can vary depending on the pomegranate or they can be pathogenic and cause life-threatening infec-
variety tested [9]. Methanol extracts of pomegranate are high tions and disease. Pomegranate has positive effects on both
Table 1: Effect of pomegranate extracts on growth of bacteria that influence human health.
Bacteria Pomegranate extract Growth inhibition (−) or promotion (+) Citation

Enteric
Escherichia coli O157:H7 Peel, bark − [2, 12]
Salmonella Typhi Peel − [14, 15]
Salmonella Typhimurium Peel − [21]
Salmonella enterica serovars Peel [19]
Vibrio cholerae Peel − [16, 17]
Yersinia enterocolitica Peel − [7]
Shigella spp. Peel − [16, 18]
Shigella sonnei Peel − [21]
Listeria monocytogenes Peel, dried juice powder − [7, 19, 20]
Staphylococcus aureus Peel, juice, and POMx − [19, 21, 22, 25]
Clostridium spp. POMx
Probiotic
Bifidobacterium spp. POMx + [24]
Lactobacillus spp. POMx + [24]
Bifidobacterium breve POMx + [25]
Bifidobacterium infantis POMx + [25]
Wound
Pseudomonas aeruginosa Peel, flower extract − [27–29]
Staphylococcus aureus Peel − [27–29]
Escherichia coli Peel − [27–29]
Klebsiella pneumoniae Peel − [27–29]
Salmonella Anatum Peel − [27–29]
Salmonella Typhimurium Peel − [27–29]
Streptococcus pneumoniae Peel − [27–29]
Oral
Staphylococcus aureus Peel − [30]
Staphylococcus epidermidis Peel − [30]
Streptococcus mutans Peel − [30, 31]
Streptococcus salivarius Peel − [30]
Streptococcus sanguis Peel − [31]
Streptococcus mitis Peel − [31]
Porphyromonas gingivalis Peel − [32, 33]
Aggregatibacter actinomycetemcomitans Peel − [32]
Prevotella intermedia Peel − [33]
Proteus spp. Peel − [34]
Drug resistant
Methicillin-resistant Staphylococcus aureus Peel − [35–41]
Acinetobacter baumannii Peel − [42]
Helicobacter pylori Peel − [43]
probiotic and pathogenic bacteria. It also shows promise in and herbal extracts, especially in lesser-developed countries
food preservation by protecting against pathogenic bacteria where traditional antibiotics may not be readily available.
that can cause food poisoning. In Thailand, a study was undertaken in which extracts of
pomegranate were tested for their antibacterial activity
2.1.1. Inhibition of Enteric Pathogenic Bacteria. Many food- against different strains of E. coli, including 3 strains of E. coli
borne bacteria cause serious gastrointestinal infections, such O157:H7 [12]. Growth inhibition zones, using the agar disc
as enterohemorrhagic Escherichia coli (E. coli) O157:H7 which diffusion method, ranged from 7 to 17 mm. An aqueous
can lead to hemorrhagic diarrhea. These infections can be extract of pomegranate was highly effective against E. coli
life-threatening to young children and the elderly. There is an O157:H7 with MIC and minimal bactericidal concentra-
incentive to find alternative control measures, such as plant tion (MBC) values of 0.19 and 0.39 mg/mL, respectively.
Putative active
molecules
Gallic acid
Ellagic acid
Punicalin
Punicalagin
Anthocyanins
Flavonols
Bacterial effects Viral diseases

∙ Growth ∙ Replication
∙ Viral binding and infectivity
∙ Cell signaling ∙ Structural damage
∙ Suppress enteric infections ∙ Foodborne/intestinal

∙ Food preservation ∙ Pox
∙ Wound healing ∙ Herpes
∙ Gut health ∙ HIV
∙ Oral health
Figure 1
In another Thai study, an ethanolic extract of pomegranate lower activity than trimethoprim [18]. Shigella sonnei showed
had MICs of 0.49 to 1.95 mg/mL and MBCs of 1.95 to the highest susceptibility to the extracts.
3.91 mg/mL against E. coli O157:H7 [13]. This extract exhib- Pomegranate extract was evaluated in several studies for
ited both bacteriostatic and bactericidal activities, indicating the ability to decontaminate meat surfaces and maintain food
that it may be an effective adjunct treatment for E. coli quality. A pomegranate peel extract at 250 𝜇g/mL was most
O157:H7 infection. effective at inhibiting antibiotic resistant strains of Salmonella
Pomegranate has exhibited bactericidal activity against Typhimurium (S. Typhimurium) and Staphylococcus aureus
other food and waterborne pathogenic bacteria including (S. aureus) on meat surfaces and improved sensory evalua-
Salmonella Typhi (S. Typhi)[14, 15], Vibrio cholerae [16, 17], tions of quality [21]. In another study, dipping raw chicken
Yersinia enterocolitica [7], Shigella spp. [16, 18], and Listeria breasts in 0.02% pomegranate fruit juice solution reduced
monocytogenes (L. monocytogenes) [7, 19, 20]. Typhoid fever protein oxidation, inhibited microbial growth, and increased
(causal agent, S. Typhi) is a life-threatening enteric infection
sensory acceptability for up to 12 days of refrigerated storage
that can be transmitted by consuming food or drinking
at 4∘ C [22]. Dried pomegranate juice powder was heated to
water contaminated with feces from an infected person. It
100 degrees C for 0, 30, 60, or 120 minutes and added at 2%
is more common in less industrialized countries. Extracts of
(wt/wt) to ground top round beef to determine if heat would
pomegranate fruit pericarp were tested by agar well diffusion
and found to be highly active when compared to a reference alter the antilisterial activity of the powder [20]. The meat was
concentration-response curve for ampicillin [14]. In another then cooked and inoculated with individual L. monocytogenes
study which screened plants of importance in the Ayurvedic strains. Samples of meat stored at 5∘ C were taken at days 1,
system of medicine, strong antibacterial activity was exhib- 8, 14, and 21 and plated on media for evaluation of bacterial
ited by the methanol extracts of pomegranate [15]. V. cholerae, growth. All the heat-treated pomegranate juice powder treat-
the cause of cholera infections, is most commonly acquired ments significantly inhibited growth of all five L. monocyto-
from feces-infected drinking water. In one study examining genes strains in refrigerated ground cooked beef by 1.80 to
bactericidal activity of plants used by Peruvian people to 4.61 log CFU/g at day 21, suggesting that heating does not
combat cholera, pomegranate peel extract and tea infusions impact the antilisterial activity of pomegranate. In another
were effective [17]. Shigella spp. are an important cause of study, an 80% methanolic pomegranate peel extract resulted
diarrhea and dysentery in the Mexican population. In one in a >1 log(10) reduction of L. monocytogenes in fish during
study, ethanolic pomegranate extracts exhibited greater anti- storage at 4∘ C [7]. One study examined the effectiveness
bacterial activity than the antibiotic chloramphenicol, but of pomegranate peel to inhibit growth of L. monocytogenes,
S. aureus, and Salmonella enterica in cheese at room tem- rats showed significant reduction in the wound area when
perature (∼23∘ C) [19]. The pomegranate treatment increased compared with the control. Another study in which flower
the stability of cheese against lipid oxidation, improving shelf extracts of pomegranate were applied to wounds resulted in
life. A pomegranate sour sauce had an antimicrobial effect decreased wound size compared to the control group and
when mixed with lettuce, spring onion, and parsley, either a significant increase in the rate of wound contraction and
inoculated with S. aureus and E. coli O157:H7 or containing collagen turnover [29].
the naturally existing bacterial flora [23].
2.3. Reductions in Oral Bacteria. Studies suggest a role for
2.1.2. Beneficial Effects on Enteric Probiotic Bacteria. pomegranate extracts in reducing and preventing pathogenic
Preservation and/or enhancement of probiotic bacteria in dental bacteria and reducing the risk of plaque, gingivitis, and
the gut is important for maintaining gastrointestinal health. A periodontal disease. Many of these studies are human clinical
hydrolyzable tannin-rich pomegranate by-product (POMx) trials.
incubated with faecal bacteria resulted in formation of the
dibenzopyranone-type urolithins which enhanced the 2.3.1. In Vitro Antibacterial Activity against Oral Bacteria.
growth of Bifidobacterium spp. and Lactobacillus spp. [24]. In The effects of three different concentrations of a methanolic
another study, POMx significantly enhanced the growth of pomegranate peel extract at 4 mg/mL, 8 mg/mL, and
Bifidobacterium breve and Bifidobacterium infantis while 12 mg/mL on growth of dental bacteria were compared using
inhibiting the growth of pathogenic clostridia and Staphyl- the disc diffusion method [30]. All concentrations of the
ooccus aureus [25]. The effects of individual pomegranate pomegranate extract had antibacterial activity against S.
ellagitannins were evident but less pronounced than the aureus and S. epidermidis. Extract concentrations of 8 mg/mL
tannin mixture in the POMx formulation. and 12 mg/mL were effective against L. acidophilus, S. mutans,
Pomegranate extract had a beneficial effect on rumen and S. salivarius. The extract did not inhibit Actinomyces
bacterial populations in lactating cows [26]. The peel extract viscosus. In another similar in vitro study, ethanol and water
was fed at levels of 1, 2, or 4% on voluntary intake. The sup- extracts of pomegranate both had inhibitory effects against
plementation had a significant positive dose-dependent effect S. mutans and Porphyromonas gingivalis (P. gingivalis) [32]. A
on the entire ruminal bacterial community, as determined Brazilian in vitro study investigated the antimicrobial effect of
by automated ribosomal intergenic spacer analysis. In cows a pomegranate-based oral gel (made from an extract of dried
fed at the 4% extract level, there were significant increases in peel combined with Carbopol, water, and triethanolamine)
digestibility of dry matter, crude protein, and neutral deter- against Streptococcus sanguis, Streptococcus mitis, and S.
gent fiber, as well as milk yields. mutans [31]. The MICs required to inhibit adherence of the
bacteria to glass were assessed using increasing and doubled
2.2. Enhancement of Wound Healing. Pomegranate skin prep- concentrations of the diluted solution of the pomegranate
arations hold promise in increasing the rate of wound healing. gel at concentrations ranging from 1 : 1 to 1 : 1024. The MICs
Pomegranate peel (5% methanolic extract) prepared as an of adherence of pomegranate gel against the bacteria were
ointment was applied to guinea pig wounds daily for 12 days 1 : 16 for S. mutans and S. sanguis and 1 : 128 for S. mitis. These
[27]. The treatment significantly enhanced wound healing by results suggest that pomegranate gel might be useful in the
increasing collagen, DNA and protein synthesis as well as control of adherence of different bacteria in the oral cavity.
contraction rate and tensile strength. The extract exhibited In other in vitro studies, pomegranate extract also inhibited
significant antibacterial activity against wound bacteria, strains of periodontal bacteria, Aggregatibacter actinomycete-
including strains of Pseudomonas aeruginosa, S. aureus, E. mcomitans, P. gingivalis, Prevotella intermedia [33], Klebsiella,
coli, Klebsiella pneumoniae (K. pneumoniae), Salmonella Ana- E. coli, and Proteus spp. [34].
tum, S. Typhimurium, and Streptococcus pneumoniae. There
were no toxic effects noted from use of the skin ointment. 2.3.2. Clinical Studies on Prevention of Dental Plaque. Several
Another study using the methanolic extract of pomegranate clinical trials have explored the effectiveness of pomegranate
peels formulated into a 10% (wt/wt) water-soluble gel showed extract rinses on reductions in oral plaque [33, 34]. In one
similar enhancements in wound healing in a Wistar rat model trial, the amount of plaque accumulation was measured at
compared to a commercial topical antibacterial product [44]. days 0 and 5 in thirty periodontally healthy volunteers who
The group treated with 5.0% gel had a 59.5% increase in refrained from all mechanical oral hygiene measures for 4
contraction of the skin, a 2-fold increase in collagen content, days and instead used either pomegranate extract, chlorhex-
and positive microscopic changes to the skin. Participant’s idine, or a placebo rinse twice daily [33]. At day 5, those
wounds were completely healed after 10 days, compared to volunteers using the pomegranate extract had significantly
16–18 days for the group receiving a blank control gel. The less plaque buildup (𝑃 < 0.05) than those using the placebo
activity was postulated to be due to the high phenolic content rinse. The pomegranate extract prevented as much plaque
(44%) in the peel extract. as the chlorhexidine rinse. These results on pomegranate’s
Pomegranate flower extracts also hold promise for aug- effect on plaque reduction are supported by another human
menting wound healing. A diethyl ether flower extract was trial in which pomegranate extract rinse was compared to
applied to wounds in alloxan-induced diabetic rats at a chlorhexidine and placebo rinse [34]. After 24 hours with-
dose of 200 mg/kg/day [28]. The extract-treated diabetic out tooth brushing, plaque samples were taken from sixty
healthy, younger patients between the ages of 9 and 25 who MRSA strains are not necessarily more virulent than antibi-
wore orthodontic appliances. Dental plaque samples were otic-susceptible strains of S. aureus, but they are more dan-
plated on media for 48 hours, and the number of colony gerous because they do not respond to first-line antibiotics.
forming units per milliliter (CFU/mL) showed that the MRSA can cause life-threatening infections in people with
pomegranate extract rinse was effective against dental plaque weakened immune systems, especially in lesser-developed
microorganisms, decreasing the CFU/mL by 84%, similar countries where antibiotics are not readily available, and
to chlorhexidine (79% inhibition), and significantly different in hospitals and nursing homes. There is evidence from a
from the control rinse (11% inhibition). Authors speculated number of in vitro experiments that pomegranate extracts
that the ellagitannin and punicalagin may be responsible for moderately to strongly inhibit cultured MRSA strains [35–
the antibacterial activity of the pomegranate extract rinse. 41]. In one study, ethanolic extracts of pomegranate were
effective at inhibiting 35 hospital isolates of MRSA at MICs
2.3.3. Clinical Studies on Gingivitis. Gingivitis is an inflam- of 0.2–0.4 mg/mL [36]. In another study, an extract of high-
mation of the gums in response to bacterial plaque biofilms tannin pomegranate polyphenols at 1 and 5 mg/mL was found
adhering to tooth surfaces. If left untreated, gingivitis may to cause 1.1–2.3 log10 CFU/mL reduction of the two MRSA
progress to periodontal disease and subsequent tooth loss. strains after 2 hours at 37∘ C, and to undetectable levels
There is an incentive to use alternative plant-based prepara- in most strains within 24 hours [39]. Scanning electron
tions as an adjunctive to mechanical therapy in the prevention microscopy of the bacteria showed that the pomegranate
and treatment of gingivitis, due to the health risks imposed by extract caused alterations in the bacterial cell walls after 2
long-term use of chemical and pharmaceutical preparations hours of treatment.
and the lack of available dental care in lesser-developed coun- Multidrug-resistant Acinetobacter baumannii (A. bau-
tries. Results of a randomized clinical study of 40 patients mannii) is considered to be one of the most difficult bacterial
with chronic gingivitis showed that significant improvements infections to treat. A. baumannii survives for prolonged
were obtained in the group that used a pomegranate extract periods under a wide range of environmental conditions and
gel along with mechanical debridement for 7 days when causes serious infection outbreaks in hospitals. It is very
compared with patients using only control gel or mechanical difficult to control due to antibiotic resistance, so the need for
debridement for the 7-day test period [45]. Another placebo- alternative approaches is under investigation. Pomegranate
controlled human clinical trial of 32 young adults examined extract was tested as a resistance-modifying agent of the
salivary measures relevant to oral health and gingivitis after antibiotic novobiocin against A. baumannii using a growth
using a pomegranate extract mouth rinse three times per inhibition assay [42]. Pomegranate extract at 250 𝜇g/mL sig-
day for 4 weeks or a placebo rinse [46]. Compared to the nificantly enhanced the antibacterial activity of novobiocin at
control group, those participants using the pomegranate rinse 1 𝜇g/mL (1/8× MIC) against A. baumannii.
had reduced total protein associated with presence of plaque- Helicobacter pylori (H. pylori) is the causal agent of
forming bacteria, reduced activities related to cell injury, stomach ulcers, which if left untreated can lead to stomach
reduced levels of the sucrose-degrading enzyme alpha-glu- cancer. However, the bacteria are becoming resistant to the
cosidase, and increased activity of the enzyme ceruloplasmin, antibiotics used to treat ulcers, making this condition difficult
which protects against oral oxidative stress. Based on these to cure. Disc diffusion was utilized to test the in vitro suscepti-
results, the authors suggest the possibility of using pomegran- bility of H. pylori isolated from patients with gastroduodenal
ate extracts in oral health products such as toothpaste and complications to a pomegranate methanol extract [43]. The
mouthwashes. pomegranate extract exhibited strong activity against H.
pylori with a mean inhibition zone diameter of 39 mm at
100 𝜇g disc−1 . Pomegranate peel extracts from nine Iranian
2.3.4. Clinical Study on Periodontitis. A clinical study was cultivars were further assayed against the H. pylori isolates.
undertaken to test pomegranate peel extract impregnated The results demonstrated that most all cultivars showed
into biodegradable chips for use subgingivally as an adjunct to significant in vitro anti-H. pylori activity with the mean
scaling and root planning for maintenance of periodontal inhibition zone diameter ranging from 16 to 40 mm at
disease [47]. The pomegranate chips or placebo chips were
50 𝜇g disc−1 .
implanted in 20 patients with gum pocket depths of 5–8 mm.
Level of bacterial attachment, bleeding, and gingival and
plaque indexes were initially measured and again at 3 and 6 2.4.1. Enhancement of Antibiotic Susceptibility. Pomegranate
months. After 3 months, the pomegranate treatments resulted enhanced the activity of antibiotics against MRSA in one
in decreased plaque and significant decreases in pocket depth study [48]. Synergistic activity between a methanolic pome-
and bacterial attachment compared to placebo. A marker of granate extract and the antibiotics chloramphenicol, gen-
inflammation (IL-1beta) was also lower at 3 and 6 months tamicin, ampicillin, tetracycline, and oxacillin ranged from
compared to baseline. 38% to 73% against clinical isolates of MRSA. The bacteri-
cidal activity of the pomegranate extract (0.1 × MIC) with
2.4. Inhibition of Antibiotic-Resistant Bacteria. Methicillin- ampicillin (0.5 × MIC) was assessed and determined to
resistant Staphylococcus aureus (MRSA) is any strain of S. be synergistic. This combination increased the lag time to
aureus that has become resistant to beta-lactam antibiotics, bacterial growth by three hours over that of ampicillin alone
including the penicillins and the cephalosporins. These and resulted in a 99.9% reduction in MRSA. The mechanism
of action of the pomegranate extract was to either inhibit 4. Evidence for Pomegranate in Controlling
the MRSA NorA efflux pump or to enhance the influx of the Viruses That Affect the Human Body
antibiotic.
The antibiotic activity of ciprofloxacin was enhanced 4.1. Inhibition of Nonenveloped Clinically Relevant Foodborne
by a methanolic pomegranate peel extract against resistant Viral Pathogens. Recent studies indicate that viruses cause an
strains of extended-spectrum beta-lactamase-producing E. estimated 59% of all foodborne illnesses (5.5 million), 27%
coli, K. pneumoniae, and metallo-beta-lactamase-producing of hospitalizations, and 12% of deaths in the United States
P. aeruginosa [49]. Synergy with ciprofloxacin was observed alone [65]. Foodborne virus outbreaks are gaining immense
in 19 of 49 strains (FIC of 0.125–0.5 for ciprofloxacin) possibly attention due to their increased incidence and scope of illness.
due to the bacterial efflux pump inhibitor activity of the The epidemiologically significant foodborne viruses
pomegranate tannins. include human noroviruses, hepatitis A virus, rotaviruses,
Aichi virus, hepatitis E virus, astroviruses, adenoviruses,
parvoviruses, and other human enteroviruses and small
2.5. Influence on Bacterial Quorum-Sensing Mechanism. round structured viruses [66]. Among the foodborne viruses,
Quorum sensing is an intercellular signaling mechanism used human noroviruses are the main cause of viral gastroenteri-
by bacteria to communicate as a colony about critical survival tis outbreaks worldwide [65, 67, 68]. Human noroviruses
issues such as availability of nutrients, defense against other (HNoVs) belong to the family of Caliciviridae, being
microorganisms, virulence, and biofilm formation. Bacte- nonenveloped and round in shape with a diameter of 27 to
ria produce and detect signaling molecules important for 40 nm. There are currently five genogroups based on nucleic
pathogenic bacteria during infection of a host to coordinate acid sequence analysis, of which primarily genogroup I and
their virulence in order to escape the immune response of frequently genogroups II and IV are associated with human
the host and establish a successful infection. Interference norovirus outbreaks. Earlier studies indicated that HNoVs
of quorum-sensing signals is a strategy for disease control. are estimated to be solely responsible for up to 2.3 million
Pomegranate inhibited quorum-sensing signals in two bacte- infections, 50,000 hospitalizations, and 300 deaths per year
rial strains, interfering with purple pigment production and in the US alone [69].
bacterial swarming motility in Chromobacterium violaceum As HNoVs cannot be grown in cell culture, cultivable
and P. aeruginosa, respectively [50, 51]. The inhibition of these surrogates such as feline calicivirus (FCV-F9) [70], bacte-
particular processes may be due to direct or indirect inter- riophage MS2 [71], and murine norovirus (MNV-1) [72] are
ference on quorum-sensing by pomegranate polyphenols or used in infectivity assays to study antiviral or inactivation
the interactive effect of different compounds present in the effects, though the more recently cultivable Tulane virus
extract. is also being researched [73]. HNoVs can be transmitted
from person to person, through food, aerosols, water, and
contact with fomites [74]. They are reported to have a low
3. Introduction: Pomegranates and Their infectious dose of 10 to 100 viral particles with symptoms
Effects on Human Viruses including nausea, vomiting, diarrhea, abdominal pain, and
low-grade fever. The infection is self-limiting in healthy indi-
Limited studies have been conducted on the antiviral activi- viduals and lasts for up to 72 hours. However, newly emer-
ties associated with pomegranate and its extracts. The fruit’s gent strains (such as genogroup II.4) have become highly
antiviral effects have been reported against clinically rele- virulent and life-threatening especially to the elderly and
vant influenza virus, herpes virus, poxviruses, and human immunocompromised [68]. Currently, there are no known
immunodeficiency (HIV-1) virus [52–54]. The hydrolyzable vaccines available to prevent norovirus infection or disease
tannins and anthocyanins are the main compounds associ- onset. In addition, there is no effective treatment option
ated with the beneficial effects of pomegranate consumption available besides rehydration therapy.
on other health effects “including antibacterial” [55], and may The effectiveness of natural remedies such as pomegran-
be responsible for the antiviral activity. In one study, among ate juice and extracts as alternatives for the treatment or
four flavonoid compounds associated with pomegranates prevention of foodborne norovirus infections needs to be
(ellagic acid, caffeic acid, luteolin, and punicalagin), only explored more aggressively. Recently, pomegranate juice and
punicalagin was shown to have inhibitory effects on influenza polyphenols were shown to have significant antiviral effects
virus [56]. Natural antimicrobials from plant extracts have against foodborne viral surrogates, FCV-F9, MNV-1, and
become increasingly popular for use as alternative antivi- bacteriophage MS2 [75]. These researchers showed that the
rals [57–60]. The increased research and need for such juice could decrease low titers (∼5 log10 PFU/mL) of FCV-
alternatives are based on the many advantages of natural F9, MNV-1, and MS2 by 2.56, 1.32, and 0.32 log10 PFU/mL,
plant antimicrobials. These include the absence of reported/ respectively, after 1 hour at room temperature and high titers
observed toxic effects at recommended doses along with (∼7 log10 PFU/mL) by 1.20, 0.06, and 0.63 log10 PFU/mL.
additional benefits such as antioxidant, anticancer, anti- The most potent effect was on FCV-F9 after treatment with
inflammatory, and antimicrobial properties [3, 10, 39, 52, 53, 8, 16, or 32 mg/mL of pomegranate polyphenol (extracted
56, 61–64]. It is possible that pomegranate juice and extracts from fresh pomegranate fruit-POM obtained from POM
could be potentially useful in inhibiting viruses transmitted Wonderful). After 1 hour at room temperature, low and high
via infected food products, bodily fluids, and so forth. titers of FCV-F9 were completely undetectable. Following
1-hour incubation with 4, 8, or 16 mg/mL pomegranate in pomegranate juice, though the mechanism of action was
polyphenol, low initial titers of MNV-1 were reduced by 1.30, unknown. Poliovirus is transmitted through the fecal-oral
2.11, and 3.61 log10 PFU/mL and high initial titers by 1.56, route in a manner similar to other enteroviruses, being a
1.48, and 1.54 log10 PFU/mL, respectively. The titer reduction nonenveloped RNA virus. As preventive measures, poliovirus
effect of pomegranate against MNV-1 is notable in that this vaccines are available.
surrogate is considered to be more appropriate than FCV-
F9 by some researchers. Bacteriophage MS2 at low initial
4.2. Mechanism of Action against Human Norovirus Surro-
titers was reduced by 0.41, 0.45, and 0.93 log10 PFU/mL and
gates. In order to understand the mechanism of action, the
at high initial titers by 0.32, 0.41, and 0.72 log10 PFU/mL after
host cell monolayers for the respective viruses were treated
incubation with 4, 8, or 16 mg/mL of pomegranate polyphe-
with pomegranate juice and polyphenols prior to or after
nol, respectively. Overall effectiveness of pomegranate on
infection, where reduced infectivity of FCV-F9 and MNV-
reduction of virus titer rankings was FCV-F9 > MNV-1 >
1 was obtained [75]. Greater effects in titer reduction were
MS2 for the tested low-titer viruses (5 log10 PFU/mL), while
observed when the treatment was performed prior to infec-
for the high-titer viruses (7 log10 PFU/mL), the effectiveness
tion (corresponding to attachment/adsorption stage) than
rankings were FCV-F9 > MS2 > MNV-1 [75]. Pomegranate
after infection (corresponding to replication stage), suggest-
juice contains total phenolics of 3.6 mg/mL [55]; therefore,
ing that pomegranate juice and its polyphenols may play a
pomegranate polyphenols were tested at a similar concentra-
role in preventing virus binding to the host cell receptors by
tion (4 mg/mL) and exhibited consistently greater antiviral
blocking the cell surface receptors or the virus surface ligands.
effects than that of pomegranate juice against all viruses at
It was postulated that further work using transmission elec-
both high and low titers [75]. This difference may be due to
tron microscopy may determine if these polyphenols cause
variability in composition and bioavailability of polyphenols
structural damage to the virus or virus capsid.
in juice versus those extracted in pure form. In addition, the
Recently, a cranberry-pomegranate juice blend was
antiviral effects are not pH-dependent, as no differences in
shown to reduce the specific binding ability of human NoV
bioactivity were noted when juice pH was changed from 3.4
P particles to salivary human histoblood group antigens
to 7.0. Given that MNV-1 is quite resistant to most treatment
(HBGAs) using an enzyme-linked immunosorbent assay
conditions, including pH and heat [73], but inhibited by
(ELISA), where the binding pattern is reported to correspond
pomegranate juice and its polyphenols, it is possible that
with the probability of infection [77]. HBGAs are complex
additional research will reveal a role for pomegranate as
carbohydrates present on red blood cell surfaces, the mucosal
a natural alternative for treating and/or preventing human
epithelium of respiratory, genitourinary, and digestive tracts
norovirus infections.
and as free oligosaccharides in saliva, intestinal contents,
Comparison of the effects of cranberry juice, grape juice,
milk, and blood. These researchers reported that cranberry
and orange juice on the infectivity of foodborne viral surro-
juice at concentrations of 10 and 100% and cranberry-
gates revealed that the titer reduction for FCV-F9, MNV-1,
pomegranate at concentrations of 1% to 100% were found
and MS2 followed the order of cranberry juice > pomegranate
to reduce the binding of human NoV strains specifically to
juice > grape juice > orange juice in general, with the excep-
certain types of human HBGAs, in agreement with the study
tion that grape juice had a greater effect on high-titer FCV-
by Su et al. [75] that used infectivity plaque assays. Li et al.
F9 than cranberry juice [75].
[77] also postulated that the interaction of plant polyphe-
When the time-dependent effects of pomegranate juice
nolic compounds with the viral capsid protein may cause
and polyphenols at 2 and 4 mg/mL against foodborne viral
irreversible damage or reversible blocking of certain regions/
surrogates were further studied, varied titer reduction rates of
areas of the capsid protein.
FCV-F9, MNV-1, and MS2 over 1 hour at room temperature
were obtained [59]. There were no significant differences in
titer reductions when comparing different brands of com- 4.3. Inhibition of Other Clinically Relevant Viruses. Pome-
mercial pomegranate juice; however, titer reduction levels granate extracts have also shown antiviral effects against
were affected by different storage times. For all three viruses, influenza virus, HIV-1 and poxviruses [52, 53, 76]. Influenza
≥50% of the total reduction was found to be achieved within virus continues to be a major cause of morbidity and
20 minutes. Interestingly, upon immediate mixing with mortality each year with 31,000 deaths reported yearly in the
pomegranate juice or 2 or 4 mg/mL pomegranate polyphe- US, despite access to vaccines [52]. However, frequent recom-
nols, FCV-F9 was reduced by 1.35, 1.97, and 2.39 log10 bination events and viral evolution necessitate the change
PFU/mL, respectively, with further reductions of 1.74, 2.02, in vaccine composition requiring administration of new
and 2.68 log10 PFU/mL within the next 20 minutes. Com- vaccines yearly. Researchers have shown that pomegranate
pared to FCV-F9, bacteriophage MS2 and MNV-1 titers were polyphenols were virucidal against influenza A virus, sup-
not significantly reduced using this experimental regime. pressed the replication of the virus in host cells, and inhibited
These results indicate an in vitro effect of pomegranate against agglutination of chicken red blood cells caused by the virus
human norovirus surrogates; however, further in vivo work using real-time polymerase chain reaction, a plaque assay,
is necessary to determine if clinically relevant therapeutic or and a median tissue culture infective dose 50% hemaggluti-
preventive uses are viable. nation assay [52]. They also showed that among four polyphe-
Konowalchuk and Speirs [76] found that <1% of 3 log PFU nols (ellagic acid, caffeic acid, luteolin, and punicalagin),
poliovirus/0.05 mL survived after storage at 4∘ C for 24 hours punicalagin was found to be the most effective anti-influenza
component, blocking replication of influenza virus RNA and 5. Conclusions

inhibiting agglutination of chicken red blood cells by the
virus. There are a number of studies on pomegranate and their
Sundararajan et al. [78] also showed that the acidity antimicrobial activities against bacteria and viruses, with
of pomegranate juice and concentrated liquid pomegranate mechanisms of actions including pH-independent bacterial
extract (POMxl) solutions contributed to rapid anti-influenza and viral growth inhibition, effects on bacterial cell signal-
activity, whereas pomegranate polyphenol (PP) powder ing, reductions in viral infectivity and binding to host cell
(POMxp) did not. A 5-minute treatment at room temperature receptors, and structural damage to viruses. However, many
with 800 𝜇g/mL PP was shown to result in at least a 3 log titer of the study results are based on in vitro and cell-based
reduction of influenza viruses PR8 (H1N1), X31 (H3N2), and a assays. Therefore, the applicability of the results to human
reassortant H5N1 virus derived from a human isolate. Loss of health is mainly focused on diseases and infections that occur
hemagglutinating activity was reported to accompany the loss topically, such as those in the oral cavity or on the skin surface.
of influenza infectivity, with decreased antibody binding to It is difficult to extrapolate in vivo effects on infection from
viral surface molecules after treatments with PP. Viral struc- in vitro results using unmetabolized pomegranate juice or
tural damage was also reported using electron microscopic compounds on microbes. In addition, it is difficult to compare
analysis of PP-treated viral particles. However, they found results of studies that do not standardize the treatment
that the antiviral activity was less against avian isolates of extracts for the active components. Standard procedures
one coronavirus and reassortant H5N1 influenza viruses. should be adopted by the pomegranate industry that utilize
Kotwal [54] suggested that pomegranate juice can neutralize the same quantification methods. A method for determining
the infectivity of diverse enveloped viruses and a number ellagitannin levels using a novel pomegranate standard has
of subtypes of a given enveloped virus, indicating potential been published, which could be helpful in addressing this
for development as a treatment option that can be broadly issue [82, 83]. The current studies do support potential benefit
effective against pandemic viruses like HIV, potentially pan- of pomegranate extracts in food preservation and decontami-
demic viruses like influenza, and some carcinogenic viruses. nation. This application could be particularly useful in lesser-
It was shown that influenza A/HK/x31(H3N2), influenza developed countries where food sanitation can easily be
A/Vietnam/1203/04 (H5N1), and a reassortant x31 containing compromised. Results of the studies on antibacterial benefits
the NS gene segment of an H5N1 isolate were inactivated of pomegranate extracts against dental bacteria and infec-
when treated for 5 minutes at 37∘ C with pomegranate juice tions hold promise because they are clinically-based. Addi-
[54]. tional larger-scale trials should be conducted to confirm the
In 2003, the AIDS pandemic was reported to claim benefits.
30 million lives that resulted in ∼14,000 new HIV-1 global
infections daily [53]. In the absence of vaccines, antiretroviral Acknowledgment
chemotherapeutics have been used to decrease HIV-1 symp-
toms mainly in developed countries. Neurath et al. [53] The authors occasionally receive minimal research funds
showed that HIV-1 entry inhibitors from pomegranate juice from POM Wonderful, LLC; however, they have no financial
are adsorbed onto corn starch, block HIV-1 binding to interest or gain from the sale or endorsement of POM
CD4 and CXCR4/CCR5 host cell receptors, and inhibit products.
infection by primary virus clades A to G and group O. These
researchers showed the potential of producing anti-HIV-1
microbicides from naturally safe food sources.
References
[1] H. L. Farmahan, “Pomegranate,” in Recent Trends in Horticul-
ture in the Himalayas, K. K. Jindal and R. C. Sharma, Eds., p.
4.4. Mechanisms of Action of Other Polyphenols. Several other 139, Indus, New Dehli, India, 2004.
mechanisms of antiviral activity have been proposed for [2] G. K. Jayaprakasha, P. S. Negi, and B. S. Jena, “Antimicrobial
nonpomegranate polyphenols, which could offer valuable activities of pomegranate,” in Pomegranates: Ancient Roots to
insights for researchers studying the antiviral mechanisms Modern Medicine, N. P. Seeram, R. N. Schulman, and D. Heber,
related to pomegranate consumption. Haslam [79] suggested Eds., p. 168, CRC Press, New York, NY, USA, 2006.
that plant polyphenols exert a direct action on the viral [3] D. Prashanth, M. K. Asha, and A. Amit, “Antibacterial activity
particles, inhibiting the adsorption of the virus to the host cell of Punica granatum,” Fitoterapia, vol. 72, no. 2, pp. 171–173, 2001.
receptors. One study found that proanthocyanidin A-1 inhib- [4] T. Ismail, P. Sestili, and S. Akhtar, “Pomegranate peel and
ited viral attachment and penetration and affected the late fruit extracts: a review of potential anti-inflammatory and anti-
stages of herpes simplex virus type 2 infection [80]. Liu et al. infective effects,” Journal of Ethnopharmacology, vol. 143, no. 2,
[81] determined that the inhibitory effect of tea polyphenols is pp. 397–405, 2012.
through multiple mechanisms of action, including inhibiting [5] S. S. Dahham, M. N. Ali, and H. Tabassum, “Studies on antibac-
HIV-1 reverse transcriptase and protease activity, blocking terial and antifungal activity of pomegranate (Punica granatum
gp120-CD4 interaction by binding to cellular CD4 molecules, L.),” American-Eurasian Journal of Agricultural & Environmen-
and destroying viral particles. Further studies are needed to tal Sciences, vol. 9, no. 3, pp. 273–281, 2010.
identify additional antiviral mechanisms of action associated [6] O. A. Fawole, N. P. Makunga, and U. L. Opara, “Antibacterial,
with pomegranate and its constituents. antioxidant and tyrosinase-inhibition activities of pomegranate
fruit peel methanolic extract,” BMC Complementary and Alter- [22] S. Vaithiyanathan, B. M. Naveena, M. Muthukumar, P. S. Girish,
native Medicine, vol. 12, pp. 200–225, 2012. and N. Kondaiah, “Effect of dipping in pomegranate (Punica
[7] N. S. Al-Zoreky, “Antimicrobial activity of pomegranate (Punica granatum) fruit juice phenolic solution on the shelf life of
granatum L.) fruit peels,” International Journal of Food Microbi- chicken meat under refrigerated storage (4∘ C),” Meat Science,
ology, vol. 134, no. 3, pp. 244–248, 2009. vol. 88, no. 3, pp. 409–414, 2011.
[8] S. Naz, R. Siddiqi, S. Ahmad, S. A. Rasool, and S. A. Sayeed, [23] S. Karabiyikli and D. Kisla, “Inhibitory effect of sour pomegran-
“Antibacterial activity directed isolation of compounds from ate sauces on some green vegetables and kisir,” International
Punica granatum,” Journal of Food Science, vol. 72, no. 9, pp. Journal of Food Microbiology, vol. 155, pp. 211–216, 2012.
M341–M345, 2007. [24] D. Bialonska, P. Ramnani, S. G. Kasimsetty, K. R. Muntha, G.
[9] A. D. Duman, M. Ozgen, K. S. Dayisoylu, N. Erbil, and C. R. Gibson, and D. Ferreira, “The influence of pomegranate by-
Durgac, “Antimicrobial activity of six pomegranate (Punica product and punicalagins on selected groups of human intesti-
granatum L.) varieties and their relation to some of their pomo- nal microbiota,” International Journal of Food Microbiology, vol.
logical and phytonutrient characteristics,” Molecules, vol. 14, 140, no. 2-3, pp. 175–182, 2010.
no. 5, pp. 1808–1817, 2009. [25] D. Bialonska, S. G. Kasimsetty, K. K. Schrader, and D. Ferreira,
[10] M. K. Reddy, S. K. Gupta, M. R. Jacob, S. I. Khan, and D. “The effect of pomegranate (Punica granatum l.) byproducts
Ferreira, “Antioxidant, antimalarial and antimicrobial activities and ellagitannins on the growth of human gut bacteria,” Journal
of tannin-rich fractions, ellagitannins and phenolic acids from of Agricultural and Food Chemistry, vol. 57, no. 18, pp. 8344–
Punica granatum L,” Planta Medica, vol. 73, no. 5, pp. 461–467, 8349, 2009.
2007. [26] E. Jami, A. Shabtay, M. Nikbachat et al., “Effects of adding a con-
[11] J. D. Reed, C. G. Krueger, and M. M. Vestling, “MALDI-TOF centrated pomegranate-residue extract to the ration of lactating
mass spectrometry of oligomeric food polyphenols,” Phyto- cows on in vivo digestibility and profile of rumen bacterial pop-
chemistry, vol. 66, no. 18, pp. 2248–2263, 2005. ulation,” Journal of Dairy Science, vol. 95, no. 10, pp. 5996–6005,
[12] S. Voravuthikunchai, A. Lortheeranuwat, W. Jeeju, T. Sririrak, 2012.
S. Phongpaichit, and T. Supawita, “Effective medicinal plants [27] E. A. Hayouni, K. Miled, S. Boubaker et al., “Hydroalcoholic
against enterohaemorrhagic Escherichia coli O157:H7,” Journal extract based-ointment from Punica granatum L. peels with
of Ethnopharmacology, vol. 94, no. 1, pp. 49–54, 2004. enhanced in vivo healing potential on dermal wounds,” Phy-
[13] S. P. Voravuthikunchai and S. Limsuwan, “Medicinal plant tomedicine, vol. 18, no. 11, pp. 976–984, 2011.
extracts as anti-Escherichia coli O157:H7 agents and their effects [28] A. G. Pirbalouti, A. Shahrzad, K. Abed, and B. Hamedi, “Wound
on bacterial cell aggregation,” Journal of Food Protection, vol. 69, healing activity of Malva sylvestris and Punica granatum in
no. 10, pp. 2336–2341, 2006. alloxan-induced diabetic rats,” Acta Poloniae Pharmaceutica,
[14] C. Pérez and C. Anesini, “In vitro antibacterial activity of Argen- vol. 67, no. 5, pp. 511–516, 2010.
tine folk medicinal plants against Salmonella typhi,” Journal of [29] A. G. Pirbalouti, A. Koohpayeh, and I. Karimi, “The wound
Ethnopharmacology, vol. 44, no. 1, pp. 41–46, 1994. healing activity of flower extracts of Punica granatum and
[15] P. Rani and N. Khullar, “Antimicrobial evaluation of some Achillea kellalensis in Wistar rats,” Acta Poloniae Pharmaceutica,
medicinal plants for their anti-enteric potential against multi- vol. 67, no. 1, pp. 107–110, 2010.
drug resistant Salmonella typhi,” Phytotherapy Research, vol. 18, [30] S. Abdollahzadeh, R. Y. Mashouf, H. Mortazavi et al., “Antibac-
no. 8, pp. 670–673, 2004. terial and antifungal activities of Punica granatum peel extracts
[16] M. C. Mathabe, R. V. Nikolova, N. Lall, and N. Z. Nyazema, against oral pathogens,” Journal of Dentistry, vol. 8, no. 1, pp. 1–6,
“Antibacterial activities of medicinal plants used for the treat- 2011.
ment of diarrhoea in Limpopo Province, South Africa,” Journal [31] L. Vasconcelos, F. Correia, M. C. Correia et al., “Minimum
of Ethnopharmacology, vol. 105, no. 1-2, pp. 286–293, 2006. inhibitory concentration of adherence of Punica granatum Linn
[17] J. M. Guevara, J. Chumpitaz, and E. Valencia, “The in vitro (pomegranate) gel against S. mutans, S. mitis and C. albicans,”
action of plants on Vibrio cholerae,” Revista de Gastroenterologia Brazilian Dental Journal, vol. 17, no. 3, pp. 223–227, 2006.
del Peru, vol. 14, no. 1, pp. 27–31, 1994. [32] Y. Rosas-Pinón, A. Mejı́aa, G. Dı́az-Ruiz et al., “Ethnobotanical
[18] A. D. Alanı́s, F. Calzada, J. A. Cervantes, J. Torres, and G. M. survey and antibacterial activity of plants used in the Altiplane
Ceballos, “Antibacterial properties of some plants used in Mex- region of Mexico for the treatment of oral cavity infections,”
ican traditional medicine for the treatment of gastrointestinal Journal of Ethnopharmacology, vol. 141, pp. 860–865, 2012.
disorders,” Journal of Ethnopharmacology, vol. 100, no. 1-2, pp. [33] S. J. Bhadbhade, A. B. Acharya, S. V. Rodrigues, and S. L.
153–157, 2005. Thakur, “The antiplaque efficacy of pomegranate mouthrinse,”
[19] B. Shan, Y. Z. Cai, J. D. Brooks, and H. Corke, “Potential Quintessence International, vol. 42, no. 1, pp. 29–36, 2011.
application of spice and herb extracts as natural preservatives in [34] S. M. S. Menezes, L. N. Cordeiro, and G. S. B. Viana, “Punica
cheese,” Journal of Medicinal Food, vol. 14, no. 3, pp. 284–290, granatum (pomegranate) extract is active against dental plaque,”
2011. Journal of Herbal Pharmacotherapy, vol. 6, no. 2, pp. 79–92,
[20] D. L. Lucas and L. M. Were, “Anti-listeria monocytogenes 2006.
activity of heat-treated lyophilized pomegranate juice in media [35] P. A. Meléndez and V. A. Capriles, “Antibacterial properties of
and in ground top round beef,” Journal of Food Protection, vol. tropical plants from Puerto Rico,” Phytomedicine, vol. 13, no. 4,
72, no. 12, pp. 2508–2516, 2009. pp. 272–276, 2006.
[21] A. Tayel, W. El-Tras, S. Moussa, and S. El-Sabbagh, “Surface [36] S. P. Voravuthikunchai and L. Kitpipit, “Activity of medicinal
decontamination and quality enhancement in meat steaks using plant extracts against hospital isolates of methicillin-resistant
plant extracts as natural biopreservatives,” Foodborne Pathogens Staphylococcus aureus,” Clinical Microbiology and Infection, vol.
and Disease, vol. 9, no. 8, pp. 755–761, 2012. 11, no. 6, pp. 510–512, 2005.
[37] F. Aqil, M. S. A. Khan, M. Owais, and I. Ahmad, “Effect of cer- India for their anti-quorum sensing activity,” Indian Journal of
tain bioactive plant extracts on clinical isolates of 𝛽-lactamase Experimental Biology, vol. 48, no. 12, pp. 1219–1224, 2010.
producing methicillin resistant Staphylococcus aureus,” Journal [52] M. Haidari, M. Ali, S. W. Casscells, and M. Madjid, “Pome-
of Basic Microbiology, vol. 45, no. 2, pp. 106–114, 2005. granate (Punica granatum) purified polyphenol extract inhibits
[38] T. B. Machado, A. V. Pinto, M. C. F. R. Pinto et al., “In vitro influenza virus and has a synergistic effect with oseltamivir,”
activity of Brazilian medicinal plants, naturally occurring naph- Phytomedicine, vol. 16, no. 12, pp. 1127–1136, 2009.
thoquinones and their analogues, against methicillin-resistant [53] R. Neurath, N. Strick, Y. Y. Li, and A. K. Debnath, “Punica grana-
Staphylococcus aureus,” International Journal of Antimicrobial tum (pomegranate) juice provides an HIV-1 entry inhibitor and
Agents, vol. 21, no. 3, pp. 279–284, 2003. candidate topical microbicide,” in Natural Products and Molec-
[39] X. Su, A. B. Howell, and D. H. D’Souza, “Antibacterial effects of ular Therapy, G. J. Kotwal and D. K. Lahiri, Eds., vol. 1056, pp.
plant-derived extracts on methicillin-resistant Staphylococcus 311–327, New York Academy of Sciences, 2005.
aureus,” Foodborne Pathogens and Disease, vol. 9, no. 6, pp. 573– [54] G. J. Kotwal, “Genetic diversity-independent neutralization
578, 2012. of pandemic viruses (e.g. HIV), potentially pandemic (e.g.
[40] L. C. Braga, J. W. Shupp, C. Cummings et al., “Pomegranate H5N1 strain of influenza) and carcinogenic (e.g. HBV and
extract inhibits Staphylococcus aureus growth and subsequent HCV) viruses and possible agents of bioterrorism (variola) by
enterotoxin production,” Journal of Ethnopharmacology, vol. 96, enveloped virus neutralizing compounds (EVNCs),” Vaccine,
no. 1-2, pp. 335–339, 2005. vol. 26, no. 24, pp. 3055–3058, 2008.
[41] S. W. J. Gould, M. D. Fielder, A. F. Kelly, and D. P. [55] M. Aviram, N. Volkova, R. Coleman et al., “Pomegranate
Naughton, “Anti-microbial activities of pomegranate rind phenolics from the peels, arils, and flowers are antiatherogenic:
extracts: enhancement by cupric sulphate against clinical iso- studies in vivo in atherosclerotic apolipoprotein E-deficient (E-
lates of S. aureus, MRSA and PVL positive CA-MSSA,” BMC o) mice and in vitro in cultured macrophages and upoproteins,”
Complementary and Alternative Medicine, vol. 9, article 23, Journal of Agricultural and Food Chemistry, vol. 56, pp. 1148–
2009. 1157, 2008.
[42] P. N. Phatthalung, S. Chusri, and S. P. Voravuthikunchai, [56] S. G. Kasimsetty, D. Bialonska, M. K. Reddy, C. Thornton, K.
“Thai ethnomedicinal plants as resistant modifying agents for L. Willett, and D. Ferreira, “Effects of pomegranate chemical
combating Acinetobacter baumannii infections,” BMC Comple- constituents/intestinal microbial metabolites on CYP1B1 in
mentary and Alternative Medicine, vol. 12, no. 1, article 56, 8 22Rv1 prostate cancer cells,” Journal of Agricultural and Food
pages, 2012. Chemistry, vol. 57, no. 22, pp. 10636–10644, 2009.
[43] M. Hajimahmoodi, M. Shams-Ardakani, P. Saniee et al., “in vitro [57] S. M. Lipson, P. Cohen, J. Zhou, A. Burdowski, and G. Stotzky,
antibacterial activity of some Iranian medicinal plant extracts “Cranberry cocktail juice, cranberry concentrates, and proan-
against Helicobacter pylori,” Natural Product Research, vol. 25, thocyanidins reduce reovirus infectivity titers in African green
no. 11, pp. 1059–1066, 2011. monkey kidney epithelial cell cultures,” Molecular Nutrition and
[44] K. N. C. Murthy, K. V. Reddy, J. M. Veigas, and U. D. Murthy, Food Research, vol. 51, no. 6, pp. 752–758, 2007.
“Study on wound healing activity of Punica granatum peel,” [58] M. Schlesinger, E. I. Weiss, N. Hochman et al., “Effect of cran-
Journal of Medicinal Food, vol. 7, no. 2, pp. 256–259, 2004. berry juice constituents on haeamgglutination and infectivity of
[45] A. Somu, S. Ravindra, S. Ajith et al., “Efficacy of a herbal extract influenza virus,” Antiviral Research, vol. 57, no. 82, p. 140, 2003.
gel in the treatment of gingivitis: a clinical study,” Journal of [59] X. Su, M. Y. Sangster, and D. H. D’Souza, “Time-dependent
Ayurveda and Integrative Medicine, vol. 3, no. 2, pp. 85–90, 2012. effects of pomegranate juice and pomegranate polyphenols on
[46] R. A. DiSilvestro, D. J. DiSilvestro, and D. J. DiSilvestro, foodborne viral reduction,” Foodborne Pathogens and Disease,
“Pomegranate extract mouth rinsing effects on saliva measures vol. 8, no. 11, pp. 1177–1183, 2011.
relevant to gingivitis risk,” Phytotherapy Research, vol. 23, no. 8, [60] E. I. Weiss, Y. Houri-Haddad, E. Greenbaum, N. Hochman, I.
pp. 1123–1127, 2009. Ofek, and Z. Zakay-Rones, “Cranberry juice constituents affect
[47] G. Sastravaha, G. Gassmann, P. Sangtherapitikul, and W. D. influenza virus adhesion and infectivity,” Antiviral Research, vol.
Grimm, “Adjunctive periodontal treatment with Centella asi- 66, no. 1, pp. 9–12, 2005.
atica and Punica granatum extracts in supportive periodontal [61] C. J. Lee, L. G. Chen, W. L. Liang, and C. C. Wang, “Anti-
therapy,” Journal of the International Academy of Periodontology, inflammatory effects of Punica granatum Linne in vitro and in
vol. 7, no. 3, pp. 70–79, 2005. vivo,” Food Chemistry, vol. 118, no. 2, pp. 315–322, 2010.
[48] L. C. Braga, A. A. M. Leite, K. G. S. Xavier et al., “Synergic inter- [62] M. G. Miguel, S. Dandlen, and M. A. Neves, “Role of antho-
action between pomegranate extract and antibiotics against cyanins in the antioxidant ability of Pomegranate,” Agro Food
Staphylococcus aureus,” Canadian Journal of Microbiology, vol. Industry Hi-Tech, vol. 18, no. 6, pp. 48–50, 2007.
51, no. 7, pp. 541–547, 2005. [63] P. S. Negi and G. K. Jayaprakasha, “Antioxidant and antibacterial
[49] D. Dey, S. Debnath, S. Hazra et al., “Pomegranate pericarp activities of Punica granatum peel extracts,” Journal of Food
extract enhances the antibacterial activity of ciprofloxacin Science, vol. 68, no. 4, pp. 1473–1477, 2003.
against extended-spectrum 𝛽-lactamase (ESBL) and metallo-𝛽- [64] A. J. Pantuck, J. T. Leppert, N. Zomorodian et al., “Phase II
lactamase (MBL) producing Gram-negative bacilli,” Food and study of pomegranate juice for men with rising prostate-specific
Chemical Toxicology, vol. 50, pp. 4302–4309, 2012. antigen following surgery or radiation for prostate cancer,”
[50] K. H. Koh and F. Y. Tham, “Screening of traditional Chinese Clinical Cancer Research, vol. 12, no. 13, pp. 4018–4026, 2006.
medicinal plants for quorum-sensing inhibitors activity,” Jour- [65] E. Scallan, R. M. Hoekstra, F. J. Angulo et al., “Foodborne illness
nal of Microbiology, Immunology and Infection, vol. 44, no. 2, pp. acquired in the United States-Major pathogens,” Emerging
144–148, 2011. Infectious Diseases, vol. 17, no. 1, pp. 7–15, 2011.
[51] M. Zahin, S. Hasan, F. Aqil, M. S. A. Khan, F. M. Husain, [66] D. H. D’Souza, A. Sair, K. Williams et al., “Persistence of cali-
and I. Ahmad, “Screening of certain medicinal plants from civiruses on environmental surfaces and their transfer to food,”
International Journal of Food Microbiology, vol. 108, no. 1, pp. polyphenols,” Journal of the Science of Food and Agriculture, vol.
84–91, 2006. 89, no. 1, pp. 157–162, 2009.
[67] R. M. Turcios, M. A. Widdowson, A. C. Sulka, P. S. Mead, [83] S. Madrigal-Carballo, G. Rodriguez, C. G. Krueger, M. Dreher,
and R. D. Glass, “Reevaluation of epidemiological criteria for and J. D. Reed, “Pomegranate (Punica granatum) supplements:
identifying outbreaks of acute gastroenteritis due to norovirus: authenticity, antioxidant and polyphenol composition,” Journal
United States, 1998–2000,” Clinical Infectious Diseases, vol. 42, of Functional Foods, vol. 1, no. 3, pp. 311–318, 2009.
no. 7, pp. 964–969, 2006.
[68] J. J. Siebenga, H. Vennema, D. P. Zheng et al., “Norovirus illness
is a global problem: emergence and spread of norovirus gii.4
variants, 2001–2007,” Journal of Infectious Diseases, vol. 200, no.
5, pp. 802–812, 2009.
[69] P. S. Mead, L. Slutsker, V. Dietz et al., “Food-related illness and
death in the United States,” Emerging Infectious Diseases, vol. 5,
no. 5, pp. 607–625, 1999.
[70] J. Steinmann, “Surrogate viruses for testing virucidal efficacy
of chemical disinfectants,” Journal of Hospital Infection, vol. 56,
supplement 2, pp. S49–S54, 2004.
[71] D. J. Dawson, A. Paish, L. M. Staffell, I. J. Seymour, and H.
Appleton, “Survival of viruses on fresh produce, using MS2 as
a surrogate for norovirus,” Journal of Applied Microbiology, vol.
98, no. 1, pp. 203–209, 2005.
[72] C. E. Wobus, L. B. Thackray, and H. W. Virgin, “Murine
norovirus: a model system to study norovirus biology and
pathogenesis,” Journal of Virology, vol. 80, no. 11, pp. 5104–5112,
2006.
[73] J. Li, A. Predmore, E. Divers, and F. Lou, “New interventions
against human norovirus: progress, opportunities, and chal-
lenges,” Annual Review of Food Science and Technology, vol. 3,
pp. 331–352, 2012.
[74] R. L. Fankhauser, S. S. Monroe, J. S. Noel et al., “Epidemiologic
and molecular trends of “Norwalk-like viruses” associated with
outbreaks of gastroenteritis in the United States,” Journal of
Infectious Diseases, vol. 186, no. 1, pp. 1–7, 2002.
[75] X. Su, M. Y. Sangster, and D. H. D’Souza, “in vitro effects of
pomegranate juice and pomegranate polyphenols on foodborne
viral surrogates,” Foodborne Pathogens and Disease, vol. 7, no. 12,
pp. 1473–1479, 2010.
[76] J. Konowalchuk and J. I. Speirs, “Antiviral activity of fruit
extracts,” Journal of Food Science, vol. 41, pp. 1013–1017, 1976.
[77] D. Li, L. Baert, M. Xia et al., “Effects of a variety of food extracts
and juices on the specific binding ability of norovirus GII. 4 P
particles,” Journal of Food Protection, vol. 75, no. 7, pp. 1350–
1354, 2012.
[78] A. Sundararajan, R. Ganapathy, L. Huan et al., “Influenza
virus variation in susceptibility to inactivation by pomegranate
polyphenols is determined by envelope glycoproteins,” Antiviral
Research, vol. 88, no. 1, pp. 1–9, 2010.
[79] E. Haslam, “Natural polyphenols (vegetable tannins) as drugs:
possible modes of action,” Journal of Natural Products, vol. 59,
no. 2, pp. 205–215, 1996.
[80] H. Y. Cheng, T. C. Lin, C. M. Yang, D. E. Shieh, and C. C.
Lin, “in vitro anti-HSV-2 activity and mechanism of action of
proanthocyanidin A-1 from Vaccinium vitis-idaea,” Journal of
the Science of Food and Agriculture, vol. 85, no. 1, pp. 10–15, 2005.
[81] S. W. Liu, H. Lu, Q. Zhao et al., “Theaflavin derivatives in black
tea and catechin derivatives in green tea inhibit HIV-1 entry by
targeting gp41,” Biochimica et Biophysica Acta-General Subjects,
vol. 1770, pp. 312–312, 2007.
[82] K. R. Martin, C. G. Krueger, G. Rodriquez, M. Dreher, and J.
D. Reed, “Development of a novel pomegranate standard and
new method for the quantitative measurement of pomegranate
http://dx.doi.org/10.1155/2013/789764
Review Article
Preventive and Prophylactic Mechanisms of Action of
Pomegranate Bioactive Constituents
Monica Viladomiu,1,2 Raquel Hontecillas,1,2 Pinyi Lu,1,2 and Josep Bassaganya-Riera1,2,3

1
Nutritional Immunology and Molecular Medicine Laboratory, Virginia Bioinformatics Institute, Virginia Tech, Blacksburg,
VA 24060, USA
2
Center for Modeling Immunity to Enteric Pathogens, Virginia Bioinformatics Institute, Virginia Tech, Blacksburg, VA 24060, USA
3
Department of Biomedical Sciences and Pathobiology, Virginia-Maryland Regional College of Veterinary Medicine, Virginia Tech,
Blacksburg, VA 24061, USA
Correspondence should be addressed to Josep Bassaganya-Riera; jbassaga@vt.edu
Received 29 November 2012; Accepted 20 March 2013
Copyright © 2013 Monica Viladomiu et al. This is an open access article distributed under the Creative Commons Attribution
cited.
Pomegranate fruit presents strong anti-inflammatory, antioxidant, antiobesity, and antitumoral properties, thus leading to an
increased popularity as a functional food and nutraceutical source since ancient times. It can be divided into three parts: seeds, peel,
and juice, all of which seem to have medicinal benefits. Several studies investigate its bioactive components as a means to associate
them with a specific beneficial effect and develop future products and therapeutic applications. Many beneficial effects are related to
the presence of ellagic acid, ellagitannins (including punicalagins), punicic acid and other fatty acids, flavonoids, anthocyanidins,
anthocyanins, estrogenic flavonols, and flavones, which seem to be its most therapeutically beneficial components. However, the
synergistic action of the pomegranate constituents appears to be superior when compared to individual constituents. Promising
results have been obtained for the treatment of certain diseases including obesity, insulin resistance, intestinal inflammation, and
cancer. Although moderate consumption of pomegranate does not result in adverse effects, future studies are needed to assess safety
and potential interactions with drugs that may alter the bioavailability of bioactive constituents of pomegranate as well as drugs. The
aim of this review is to summarize the health effects and mechanisms of action of pomegranate extracts in chronic inflammatory
diseases.
1. Introduction respectively, and the peels, which include the mentioned

inner network of membranes [1] with distinct chemical
Pomegranate (Punica granatum), an ancient fruit-bearing compositions and potential medical benefits.
deciduous shrub, is the predominant member of two species Pomegranate extracts have been used since ancient times
comprising the Punicaceae family [1]. It is a native of the to treat several conditions including parasitic and microbial
Himalayas in northern India, but it has been cultivated and infections, diarrhea, ulcers, aphthae, hemorrhage, and res-
naturalized throughout the Middle East, the entire European piratory complications [3, 4]. Modern applications include
Mediterranean region, the drier parts of southeast Asia, hormone replacement therapy and oral hygiene as well
northern and tropical Africa, and to some extent the United as the treatment immune suppression and cardiovascular
States, specifically California and Arizona [2]. Pomegranate’s complications [5]. Moreover, other therapeutic properties
fruit is a large berry characterized by the presence of thin such as antitumor, anti-inflammatory, antiviral, antibacterial,
membranes in its interior, which allow the suspension of antidiarrheal, and antiobesity are currently under inves-
numerous arils, each surrounded by juice-containing sacs. tigation. Although pomegranate has been consumed and
The fruit can be divided into three parts: the seeds and the used as a medicinal food in the Middle East for thousands
juice, which represent about 3 and 30% of the fruit weight, of years, it has recently gained popularity in the United
States [6]. The high antioxidant activity of pomegranate can be hydrolyzed to ellagic acid, a natural phenol with high
when compared to other fruits and antioxidant beverages, antioxidant activity, thus prolonging the release of this acid
along with its anti-inflammatory and antiobesity proper- into the blood [8]. Antioxidants are important since they
ties, has increased the interest in investigating its potential have several important biological properties such as anti-
nutraceutical and functional food applications. The number inflammatory and antiaging protection against cholesterol
of scientific publications on pomegranate and its health- and atherosclerosis [12].
promoting benefits has increased significantly in the last Pomegranate juice is a rich source of polyphenols, tan-
decade. A PubMed search on November 23, 2012, retrieves nins, anthocyanins, including vitamin C, vitamin E, coen-
677 publications related to pomegranate, 619 of which have zyme Q10, and lipoic acid [13]. Its main antioxidative com-
been published within the last ten years and 425 in the last pounds are anthocyanins and ellagic acid derivatives, which
five. Moreover, several pomegranate-containing products, are the main constituents of the juice, giving the fruit its
including 100% juices, pomegranate-containing beverages, color [7]. Moreover, anthocyanins have been associated with
liquid and powdered polyphenolic extracts of pomegranate, prevention of cardiovascular disease, obesity, and diabetes
and skin care products containing pomegranate extracts or [14]. Some differences regarding the phenolic composition
seed oils, have been recently introduced in the United States are found between natural and commercial juices as well as
market and are being advertised for their beneficial health between juices obtained from the arils alone or from the
effects [6]. Therefore, studying the bioactive components of whole fruit [7]. Nevertheless, pomegranate juice is still the
pomegranate and linking them with specific mechanisms of main source for pomegranate ingestion, and its antioxidant
action and health effects holds promise for future therapeutic levels are greater than in other natural juices [15, 16].
development of pomegranate-derived natural products. The Although pomegranate seeds, which represent about 3%
aim of this review is to summarize the health effects and of the fruit weight, have a low polyphenol content and in vitro
mechanisms of action of pomegranate extracts in chronic antioxidant capacity, they contain other components that may
inflammatory diseases. contribute to pomegranate’s health benefits [10, 17]. They are
a rich source of lipids, and their oil, which constitutes 12–20%
2. Chemical Composition of Pomegranate of total seed weight, contains a unique fatty acid profile char-
acterized by high concentration of fatty acids such as linoleic
Over the last decade, there has been significant progress acid (LA) and linolenic acid (LN), as well as other lipids
in investigating the mechanisms of action of pomegranate including punicic, oleic, stearic, 𝛼-eleostearic, 𝛽-eleostearic,
components in health and disease. Extracts of all the different catalpic, gadoleic, arachidic, behenic, and palmitic acids LN
parts of the fruit seem to have medicinal benefits [1]. Inter- (Table 1). Interestingly, punicic acid, which is a conjugated
estingly, recent studies report that even the bark, roots, and isomer unique to pomegranate oil, constitutes 70–76% of the
leaves of the pomegranate plant also have therapeutic prop- seed oil. Moreover, seed oil also contains minor amounts of
erties [7]. The goal of most of the recent pomegranate studies other conjugated trienes such as eleostearic acid and catalpic
is to identify its therapeutic constituents. Ellagic acid, ellag- acid [13]. Other minor components are sterols, steroids,
itannins (including punicalagins), punicic acid, flavonoids, and cerebrosides in the seed oil [8, 18] and proteins, fibers,
anthocyanidins, anthocyanins, estrogenic flavonols, and vitamins, and minerals in the whole seed [13].
flavones appear to be the most therapeutically beneficial
The relationship between the chemical composition of
pomegranate components [8], specially ellagitannins, which
pomegranate and its respective therapeutic effects is still
release ellagic acid when hydrolyzed. Tables 1, 2, 3, and 4
summarize the chemical composition for each of the different not fully understood. However, significant progress has been
parts of the pomegranate fruit. made in the last decade in the establishment and iden-
The pomegranate peels make up about 60% of the fruit, tification of chemicals responsible for certain pharmaco-
and they are rich in many compounds such as phenolics, logical mechanisms. Although ellagic acid, which presents
flavonoids, ellagitannins (including punicalagins), proantho- both antioxidant [19] and anticarcinogenic [20] proper-
cyanidin compounds, complex polysaccharides, and many ties, is thought to be the main compound responsible for
minerals including potassium, nitrogen, calcium, magne- pomegranate health beneficial effects, recent studies suggest
sium, phosphorus, and sodium [2]. However, its biologi- that the synergistic action of several pomegranate con-
cal properties are mainly associated with the presence of stituents is superior to ellagic acid alone in the suppression of
flavonoids and tannins. The peel is the part of the fruit with prostate cancer [21, 22]. Therefore, and although ellagic acid
the highest antioxidant activity, which is in line with its is at the forefront of pomegranate research, one needs to be
high content of polyphenols [9, 10]. Moreover, pomegranate cautious and avoid ignoring other compounds present within
peels also show higher antioxidant capacity in vitro when pomegranate juice, peel, and seeds. Moreover, the health
compared to other fruits such as mangos, bananas, and effect of pomegranate can vary due to geographical region,
coconuts [11]. Ellagitannins present in the pomegranate peel harvesting, and season, which can alter the fruit composition
include punicalagin and punicalin, both of which contain [23]. Regardless of its composition, not all pomegranate-
the polyphenolic chemical compound gallagic acid, which is derived compounds elicit beneficial effects when ingested
the building block for several tannins. Punicalagin can be since some of them might not be metabolized and absorbed.
found in the seeds, peels, and juice of pomegranate, and it Therefore, there is a need to study the metabolism and
is unique to pomegranate. Both punicalagin and punicalin bioavailability of the pomegranate mixtures.
Table 1: Chemical constituents of the pomegranate fruit: fatty acids.
Pomegranate fruit
Constituent Chemical structure
part
O
Punicic acid HO Seed
(9Z,11E,13Z-octadeca-9,11,13-trienoic acid)
O
Linoleic acid (cis, cis-9,12-octadecadienoic 12 9 Seed
acid) 18 OH
𝛼-Linolenic acid O
18 15 12 9 Seed
(cis,cis,cis-9,12,15-octadecatrienoic acid) OH
O
𝛾-Linolenic acid 18 Seed
(all-cis-6,9,12-octadecatrienoic acid) 12 9 6 OH
O
Stearic acid (octadecanoic acid) Seed
OH
O
Palmitic acid (hexadecanoic acid) OH Seed
O
OH
Palmitoleic acid (hexadec-9-enoic acid) Seed
O
Oleic acid ((9Z)-octadec-9-enoic acid) Seed
OH
O
𝛼-Eleostearic acid HO
Seed
((9Z,11E,13E)-octadeca-9,11,13-trienoic acid)
O
Catalpic acid HO Seed
((9E,11E,13Z)-octadeca-9,11,13-trienoic acid)
O
Caproic acid (hexanoic acid) Seed
OH
O
Caprylic acid (octanoic acid) Seed
OH
O
Capric acid (decanoic acid) Seed
OH
O
Lauric acid (dodecanoic acid) Seed
OH
O
Myristic acid (tetradecanoic acid) OH Seed
O
9
OH
Gadoleic acid ((9Z)-9-icosenoic acid) Seed
20
HO
Behenic acid (docosanoic acid) Seed
O
O
Arachidic acid (icosanoic acid) OH Seed
H3 C
Table 2: Chemical constituents of the pomegranate fruit: minerals. 1 hour after extract administration, as well as an increased
antioxidant capacity 0.5, 1, and 2 hours after ingestion.
Constituent Chemical structure Pomegranate fruit part Using an acorn-fed Iberian pigs model system, 31 ellagi-
Iron 26 Fe Seed, juice tannin metabolites were found, but only urolithin A, urolithin
Copper 29 Cu Seed, juice B, dimethyl ellagic acid, and their metabolites were detected
Sodium 11 Na Seed, juice in plasma [33]. Urolithin metabolites are also absorbed in
Magnesium 12 Mg Seed, juice mouse models, with high levels accumulated in the prostate,
Potassium 19 K Seed, juice the colon, and other intestinal tissues [34]. In line with
Calcium 20 Ca Seed, juice these animal studies, urolithin A glucuronide, urolithin
Zinc B glucuronide, and dimethylellagic acid were detected in
30 Zn Seed, juice
Manganese
human prostate tissues 3 days after the administration of
25 Mn Seed, juice
pomegranate juice [35]. Therefore, it seems that ellagitannins
Phosphorus 15 P Seed, juice
are hydrolyzed in the stomach, where some ellagic acid
is absorbed into circulation. The rest of ellagic acid is
metabolized to urolithin derivatives by colonic microflora,
3. Pomegranate Constituent Bioavailability and the less polar urolithin derivatives are then absorbed
into circulation and further metabolized to glucuronides [6].
The high antioxidant capacity of pomegranate has been Therefore, pomegranate polyphenolic compounds may exert
mostly attributed to its high levels of polyphenolic com- their effects in different ways: they might be absorbed and
pounds, especially ellagitannins. However, little is known enter the bloodstream acting directly as antioxidants, or they
about the metabolism and bioavailability of ellagitannins can be digested by the gut microflora resulting in other
from food sources. Therefore, there is a need to provide biologically active compounds.
a link between these compounds and the health effects
related to antioxidant activity. Several human trials, as well 4. Mechanisms of Action and Health Effects
as animal studies, have studied the bioavailability, absorption,
and metabolism of pomegranate. In a case study, 31.9 ng/mL The adult human gut contains about 100 trillion microbial
of ellagic acid and its metabolites were detected in the plasma organisms [36]. The composition of the human gut micro-
of an individual subject one hour after the ingestion of 180 mL biota has been associated with both health improvement
pomegranate juice. Plasma was cleared 4 hours after con- and the development of several diseases since changes in
sumption, suggesting that ellagic acid from food is absorbed its composition can modulate the induction of regulatory
in humans [24]. In a follow-up study, the rapid absorption versus effector immune responses at the mucosal surfaces.
and plasma clearance of ellagitannins was confirmed, as Commensal bacteria provide the host with colonization
well as the persistent excretion of urolithin metabolites resistance against pathogens, stimulate the host immune
in the urine up until 48 hours after pomegranate juice system, prevent food allergies and tumors, produce vita-
ingestion [25], which present significant antioxidant and anti- mins, metabolize cholesterol and other lipids, and increase
inflammatory properties in vitro [26, 27]. Furthermore, no mineral bioavailability [37, 38]. However, the overgrowth
difference in bioavailability was found between pomegranate of these normally beneficial bacteria can cause acute and
juice, liquid extract, or powdered extracts as indicated by chronic intestinal diseases and has also been associated with
the levels of ellagic acid and its metabolites in plasma [28]. cancer, aging, and obesity [39]. Ellagitannins contained in
In contrast, no ellagic acid, punicalagin, anthocyanins, or pomegranate interact with the gut microflora. Pomegranate
any of their degradation products was found in plasma byproducts and punicalagins inhibit the growth of cer-
13 days after the administration of 1 L pomegranate juice tain pathogenic Clostridia species, Staphylococcus aureus,
containing 4.37 g/L punicalagins and 0.49 g/L anthocyanins and Pseudomonas aeruginosa but increase the growth of
for 5 days [29]. However, pomegranate juice metabolites Bifidobacterium breve and Bifidobacterium infantis as well
including urolithin A, urolithin B, and a third undetermined as the production of short chain fatty acids [37, 40],
metabolite were discovered in the plasma. Moreover, these 3 which have been shown to elicit beneficial effects through
metabolites were present in the urine after 24 hours along the activation of peroxisome proliferator-activated recep-
with an aglycone metabolite corresponding to each of the tors (PPARs). PPARs are the receptors for endogenous
plasma metabolites. Based on the timing of the appearance of lipid molecules (i.e., prostaglandins or hydroxy-containing
the metabolites in plasma and urine samples, which occurred PUFA such as 12/15-hydroxyeicosatetraenoic (HETE), 13-
3-4 days after juice ingestion, and along with previous work hydroxyoctadecadienoic (HODE)) and molecular targets
on punicalagin bioavailability in rats [30, 31], the authors for drugs against type 2 diabetes [41–43] and represent
suggested colonic microbial metabolism of pomegranate promising new targets for the treatment and prevention of
juice polyphenols. Finally, healthy individuals were placed inflammatory disorders [44, 45]. PPARs are ligand-induced
on a polyphenol- and antioxidant-free diet from 3 days transcription factors that belong to the nuclear hormone
prior the administration of a 800 mg capsuled pomegranate receptor superfamily with 48 members identified in the
extract containing 330.4 mg punicalagins and 21.6 mg ellagic human genome. They regulate gene expression by binding
acid [32]. Results from this third study also demonstrate a with Retinoid X Receptor (RXR) as a heterodimeric part-
significant increase in the levels of ellagic acid in plasma ner to specific DNA sequence elements named Peroxisome
Table 3: Chemical constituents of the pomegranate fruit: Anthocyanins, tannins and phenols.
Constituent Chemical structure Pomegranate fruit part
OH
OH
CL−
HO O+
Cyanidin 3,5-diglucoside Seed, peel, juice
OH OH
O
OHO O
OH OH
O
OH
OH
OH
OH
OH
Anthocyanins
HO O
Delphinidin 3-glucoside OH Seed, peel, juice
O OH
O
HO OH
OH HO
OH
OH
HO O
Cyanidin 3-glucoside Seed, peel, juice
O O OH
HO OH
OH HO
OCH3
OH
HO O
Pelargonidin 3-glucoside OCH3 Seed, peel, juice
O O OH
HO OH
OH HO
HO HO OH OH
O OH
O
O
HO OH O
Punicalin (4,6-(S,S)- O
O Seed, peel, juice
Gallagyl-D-glucose)
HO OH OH
O O
Gallagyl-type O OH
HO OH
tannins
Tannins HO
HO OH
HO
HO
O O
O O
Punicalagin (2,3-(S)- HO O
hexahydroxydiphenoyl- O
HO O Seed, peel, juice
4,6-(S,S)-gallagyl-D- OH
glucose) OH
O O O OH
HO O O
O
HO OH
HO OHOH OH
Table 3: Continued.
O HO H OH
H H
O OH
O H
Ellagic acid glucoside HO H O Seed, juice
OH
OH
O
HO
O
Ellagic acid O
derivatives Ellagic acid HO O
Tannins (2,3,7,8-tetrahydroxy-
chromeno[5,4,3- HO OH Seed, juice
cde]chromene-5,10- O OH
dione) O
OH
OH OH
Other hydrolyzable Galloyl glucose O O Juice
HO
tannins HO OH
OH
O
O OH
Gallic acid
(3,4,5-trihydroxybenzoic Juice
acid) OH
HO
OH
O
Phenols Caffeic acid
HO
(3-(3,4-dihydroxyphenyl OH Juice
2-propenoic acid) HO
OH
Catechin ((2R,3S)-2- HO O OH
(3,4-dihydroxyphenyl)-
Peel, juice
3,4-dihydro-2H-
chromene-3,5,7-triol) OH
OH
Proliferator Response Element (PPRE) [46]. PPARs are the including nutrients, nonnutrient endogenous ligands, and
main modulators of lipid and carbohydrate metabolism [47]. drugs (i.e., thiazolidinediones (TZDs) and fibrates) [55].
Functionally, PPARs regulate inflammation, immunity, and However, rosiglitazone and other PPAR𝛾 agonists of the
metabolism [48]. There are three known PPAR isoforms: 𝛼, TZD class of antidiabetic drugs are unlikely to be adopted
𝛽 or 𝛿, and 𝛾, which differ in their tissue distribution and by gastroenterologists due to associated side effects [56]
functional activity [49]. PPAR𝛼 is important in the clearance including hepatotoxicity, weight gain, fluid retention leading
of circulating or cellular lipids via the regulation of gene to edema, and congestive heart failure [57]. Therefore, the
expression involved in lipid metabolism in liver and skeletal use of natural therapeutics able to activate PPARs is a safer
muscle [50]. PPAR 𝛽/𝛿 is involved in lipid oxidation and alternative to TZDs. In this regard, the administration of
cell proliferation [51], whereas PPAR𝛾 promotes adipocyte PPARs naturally occurring agonists holds promise for the
differentiation to enhance blood glucose uptake [50]. More- treatment of a wide range of diseases including obesity,
over, ligand-induced activation of PPAR𝛾 can antagonize diabetes, and intestinal inflammation [55, 58–60].
the activity of proinflammatory transcription factors such
as nuclear factor kappa-light-chain-enhancer of activated B 4.1. Pomegranate Constituents in the Prevention of Obe-
cells (NF-𝜅B), signal transducer and activator of transcription sity and Insulin Resistance. Naturally occurring compounds
(STAT), and activator protein (AP)-1 [52] (Figure 1). Both that simultaneously activate PPAR𝛼, PPAR𝛽/𝛿, and PPAR𝛾
PPAR𝛾 and PPAR𝛿 serve as targets for the treatment of are promising therapeutic approaches to treat metabolic
inflammatory and immune-mediated diseases because of the syndrome, obesity, and diabetes since they reduce serum
role they play in maintaining homeostasis and suppressing triglyceride and glucose levels, improve insulin sensitivity,
inflammation [53, 54]. Their activation and expression is and increase the levels of the high-density lipoprotein (HDL)
controlled by a diverse set of natural and synthetic molecules, [61]. Pomegranate seed oil activates PPAR𝛾 in mice, thus
Table 4: Chemical constituents of the pomegranate fruit: sugars, organic acids, and antioxidants.

Sugars
OH OH O
HO
Glucose H Seed, peel, juice
OH OH
O
HO OH
Fructose Seed, peel, juice
HO
OH
HO
CH2 OH CH2 OH
O O
HO
Sucrose OH Seed, peel, juice
O
CH2 OH
OH OH
OH
OH OH
OH
Sorbitol HO Seed, peel, juice
OH OH
Organic acids
OH
OO O
Citric acid
Juice
(2-hydroxypropane-1,2,3-tricarboxylic acid) HO OH
OH
O OH
OH
Malic acid (hydroxybutanedioic acid) HO Juice
O
OH O
HO
Tartaric acid (2,3-dihydroxybutanedioic acid) OH Juice
O OH
OH
O
O
Isocitric acid
Juice
(1-Hydroxypropane-1,2,3-tricarboxylic acid) OH
HO
O
OH
Antioxidants
HO
H
HO O O
Ascorbic acid or vitamin C ((5R)-[(1S)-1,2-
Juice
dihydroxyethyl]-3,4-dihydroxyfuran-2(5H)-one)
HO OH
Table 4: Continued.
Antioxidants
HO
Vitamin E (𝛼-tocopherol) Juice
O
resulting in an alteration of adiposity, lower leptin levels, and as insulin resistance, diabetes, or systemic inflammation,
increased adiponectin when fed a high-fat diet (HFD) [62]. catalpic acid has a direct effect in reducing adipose tissue
PPAR reporter activity data demonstrated a dose-dependent accumulation. The treatment of diabetic mice with PPAR𝛼
increase in the ability of punicic acid to activate PPAR 𝛼 and agonists also normalizes circulating fatty acid and triacyl-
𝛾 in 3T3-L1 cells [62]. Furthermore, the similar patterns of glycerol levels and decreases myocardial fatty acid oxidation
PPAR 𝛼 and 𝛾 activation by punicic acid and pomegranate [66]. Therefore, the use of pomegranate-derived compounds
seed oil suggested that the effects of pomegranate seed oil on and fatty acids holds promise as prophylactic interventions
PPAR 𝛼 and 𝛾 reporter activities were mediated by punicic for obesity and diabetes since some of them are PPAR𝛼 and
acid. Punicic acid robustly bound and activated PPAR 𝛼 PPAR𝛾 activators that contribute to correct the abnormalities
and 𝛾, thus upregulating PPAR 𝛼 and its responsive genes of lipid metabolism and regulate inflammatory responses.
(Stearoyl-CoA desaturase-1, SCD1; Carnitine palmitoyltrans- Mounting evidence demonstrates that pomegranate-derived
ferase 1, Cpt-1; and acyl-coenzyme A dehydrogenase) as well compounds including punicic acid and catalpic acid can
as PPAR 𝛾-responsive genes expression (CD36 and Fatty Acid act on pharmacologic targets such as PPARs and elicit
Binding Protein4, FABP4) in intra-abdominal white adipose their therapeutic properties in mice. Specifically, punicic
tissue while suppressing expression of the inflammatory acid can be used to regulate blood sugar levels and control
cytokine tumor necrosis factor 𝛼 (TNF-𝛼) and NF-𝜅B acti- intestinal inflammation, whereas catalpic acid can be used for
vation. Moreover, these changes in gene expression cor- antiobesity and lipid-lowering applications (Figure 1).
related with improved fasting glucose concentrations and Other pomegranate constituents have been investigated
glucose-normalizing abilities in mice treated with punicic individually or in combination in relation to their lipid-
acid. Overall, dietary punicic acid ameliorated obesity-related normalizing effects. HFD-fed obese mice treated with dietary
inflammation and insulin resistance by activating PPAR
gallic acid, linolenic acid, or their mixture showed a body
𝛾, repressing TNF-𝛼 expression and NF-𝜅B DNA-binding
weight loss of 12.8%, 6.8%, and 12.20% after 7 weeks,
activity in white adipose tissue and liver. However, the loss
respectively [67]. Moreover, obese mice showed decreased
of PPAR 𝛾 in immune cells impaired the ability of punicic
total cholesterol, triacylglycerols, HDL cholesterol, and low-
acid to modulate glucose homeostasis and obesity-related
density lipoprotein (LDL) cholesterol when compared to
inflammation, thus suggesting that punicic acid ameliorates
control mice regardless of the treatment. Therefore, these
metabolic and inflammatory changes associated with obesity
through a PPAR 𝛾-dependent mechanism [62] (Figure 1). results suggest that gallic acid and linolenic acid present lipid-
In line with these results, pomegranate seed oil has been lowering effects and may protect patients from obesity and
found to inhibit TNF-𝛼-induced neutrophil hyperactivation other hyperlipidemia-related diseases.
and protect from experimental colonic inflammation in rats
by targeting the p38MAPKinase/Ser345-p47phox axis [63] 4.2. Pomegranate Constituents in Diabetes Prevention. Obe-
(Figure 2). sity is associated with a number of chronic diseases such
High-fat-diet- (HFD-) fed mice treated with pomegran- as type II diabetes, cardiovascular disease, chronic kidney
ate seed oil resulted in decreased body weight and fat mass disease, nonalcoholic fatty acid liver disease, and various
in CD-1 mice when compared to the control group, although types of cancers. In this regard, the effects of pomegranate
no differences were reported regarding the lean mass between in some of these disorders are also under investigation [55].
both groups [64]. Moreover, pomegranate seed oil adminis- During type II diabetes, cells become increasingly insensitive
tration improved glucose intolerance in HFD-fed mice, thus to insulin. Such decreased physiological insulin levels become
reducing type II diabetes risk. In line with these results, less effective at lowering the blood sugar levels by triggering
catalpic acid decreased the accumulation of abdominal white the uptake of glucose into cells as an energy source. The levels
adipose tissue, improved glucose tolerance, and upregulated of insulin required to elicit this same effect increase as the
adipose PPAR𝛼 in two different mouse models of obesity condition worsens, thus enhancing the insulin production in
[62]. Moreover, catalpic acid also increased HDL cholesterol the pancreas. However, insulin resistance cannot be overcome
and decreased triacylglycerol and insulin levels in plasma in advanced stages of the diseases, thus resulting in extremely
[65]. These changes were associated with an upregulation elevated levels of circulating glucose and insulin. Recent
of PPAR𝛼 and its responsive genes in white adipose tissue studies obtained promising results regarding the use of
of mice fed catalpic acid-supplemented diets. In contrast pomegranate for the treatment and prevention of type II
to punicic acid that modulates obesity comorbidities such diabetes [68, 69]
Ellagitannins: Fatty acids:

- Punicalin
- Linoleic acid
Commensal - Punicalagin - Punicic acid
bacteria - Catalpic acid
induction - Eleostearic acid
Bacterial metabolism
SCFA
Lumen
Microbiota
PPAR𝛾 PPAR𝛼
Epithelial barrier NF-𝜅B
PPAR𝛾 AP-1
CD36 SCD1
STAT
GLUT4 Cpt-1
FABP4
Epithelial cell
Anti-inflammatory Lipid-lowering and

effects antiobesity
effects
Macrophage
Lamina propria
PPAR𝛾
Figure 1: Anti-inflammatory and antiobesity effects of pomegranate constituents. Punicalin and punicalagin are able to increase the bacterial
production of short chain fatty acids (SCFAs) by inducing the growth and metabolism of commensal bacteria. SCFAs are then absorbed and
activate peroxisome proliferator-activated receptor 𝛾 (PPAR𝛾), which blocks the transcription of pro-inflammatory molecules by NF-𝜅B, AP-1
and STAT, thus resulting in anti-inflammatory effects. PPAR𝛾 can also be activated by fatty acids including linoleic acid, punicic acid, catalpic
acid, and stearic acid in both epithelial cells and macrophages. Such fatty acids are also able to activate PPAR𝛼 resulting in lipid-lowering and
antiobesity effects.
Obesity is associated with the infiltration of two pheno- against obesity-related inflammation and insulin resis-
typically and functionally distinct subsets of macrophages tance. In line with these results, macrophages treated with
(F4/80hi and F4/80lo ) into adipose tissue and a phenotypic pomegranate juice standardized to a polyphenol concen-
switch from an M2 anti-inflammatory phenotype to an M1, tration of 75 mmol/L for 90 minutes showed a decreased
pro-inflammatory phenotype [70]. PPAR 𝛾 is differentially degradation of oxidized LDL as well as reduced macrophage
expressed in F4/80hi versus F4/80lo ATM subsets, and its cholesterol synthesis and oxidative stress [72]. Moreover, the
deficiency favors a predominance of M1 markers and impairs intake of pomegranate juice by diabetic patients results in
M2 markers expression in white adipose tissue. Moreover, the decreased macrophage uptake of oxidized LDL and reduced
accumulation of F4/80hi macrophages in adipose tissue of serum oxidative stress, an unusually high level of oxida-
obese mice has also been associated with increased severity tion that may result in damage to vital biomolecules and
of colitis and impaired glucose tolerance [71]. Therefore, thereby increases disease risk [73]. Other studies showed
targeting macrophages arises as a therapeutic approach how polyphenols and flavonoids, both of which are present
Punicalagin
Anthocyanins
Flavonols
Tannins
TNF-𝛼
Anthocyanins:
PI3K
Ellagitannins:
- Punicalin
- Punicalagin
Punicic acid Akt MAPK
p65/
IKK p50
I𝜅B𝛼
NF-𝜅B P28
ERK1/2 (𝛼, 𝛽, 𝛾)
c-Jun JNK1,2
c-Fos
PPAR𝛾 Urolithin A
p65/
p50
NF-𝜅B AP-1
TNF𝛼
MMP COX-2
Arachidonic
COX-2 acid Prostaglandins
iNOS
Transcription of
Epithelial cell IL-6
inflammatory genes Cancer cell proliferation
IL-1𝛽 and apoptosis
Figure 2: Anticarcinogenic effects of pomegranate constituents. Several pomegranate constituents including anthocyanins, phenols,
ellagitannins (punicalin, punicalagin), and other tannins can reduce the expression of cyclooxygenase 2 (COX-2) through an NF-𝜅B and
MAPK pathways dependence. Such components can inhibit phosphatidylinositide 3-kinases (PI3K), protein kinase B or Akt, or NF-𝜅B
directly and result in decreased transcription of inflammatory genes such as tumor necrosis factor 𝛼 (TNF-𝛼), interleukin 6 (IL-6), and IL-1𝛽
among others. They can also inhibit MAPK-induced phosphorylation of ERK1/2, JNK1,2,3 and p38 which finally result in the inhibition of
activation protein 1 (AP-1), another transcription factor regulating the expression of pro-inflammatory molecules. Inhibited COX-2 expression
leads to reduced cell proliferation and apoptosis as well as decreased production of prostaglandins, which are important inflammatory
mediators.
in pomegranate juice, are able to inhibit LDL oxidation by alterations [78]. Hypoglycaemic activity in streptozotocin-
the protection of LDL from cell-mediated oxidation [74, induced diabetes has been reported due to treatment with
75]. In line with these results, the modulation of PPAR𝛾 pomegranate seed methanol extract in rats [79]. Moreover,
by pomegranate juice resulted in reduced oxidative stress pomegranate seed oil has also been associated with improved
in macrophages in vitro [76]. However, this effect was insulin sensitivity in rodent animals [13, 64, 79]. Three
abrogated by PPAR𝛾 inhibition and was also observed after human clinical trials have been performed with diabetic
macrophages were incubated with punicalagin and gallagic patients to assess the effect of pomegranate juice on plasma
acid, two of pomegranate’s polyphenols. Several parts of lipid and oxidation profiles. The effect derived from the
the pomegranate have demonstrated hypoglycaemic effects administration of 50 mL of pomegranate juice per day during
in vivo. However, their activity profiles are slightly differ- three months was evaluated in diabetic and healthy individ-
ent. Pomegranate peel methanolic extracts containing 7.5% uals [73]. Treated diabetic patients showed decreased serum
of gallic acid and 54.6% of ellagic acid along with other HDL cholesterol, increased triglyceride levels, and increased
minor components did not alter insulin levels but lowered values of hemoglobin A1C. Moreover, insulin levels were
glucose levels in normoglycaemic healthy rats [77]. The slightly lower in diabetic patients, and C-peptide, which is
administration of alloxan increased serum glucose levels a proinsulin metabolite marker for endogenously secreted
and reduced serum insulin. However, alloxan administra- insulin, was decreased in patients’ serum, thus indicating
tion along with pomegranate peel extract normalized such improved insulin sensitivity. Oxidative stress was decreased
after a 4-week consumption of 50 mL of pomegranate juice studies have associated the presence of certain organisms
per day [80]. This effect was attributed to increased serum and an increased risk of NEC [85, 86], although candidate
HDL-associated paraoxonase/arylesterase 1 (PON1) stability organisms differ. Bacterial diversity in NEC pathways appears
and activity, an enzyme that is part of the HDL complex. to be different from healthy individuals. Specifically, they
Pomegranate juice concentration intake during 8 weeks present reduced Firmicutes and a bloom in Proteobacteria
showed decreased total cholesterol, LDL cholesterol, and before NEC onset, and Enterobacteriaceae also seems to
LDL/HDL ratio [69]. Researchers did not report any adverse be associated with NEC [87]. Therefore, it seems that gut
effect during any of these long exposures to pomegranate. microbial contributions to NEC are mediated by changes in
commensal community relationships. A recent study showed
4.3. Modulation of Gut Inflammation by Pomegranate Seed that supplementation of pomegranate seed oil into milk
Oil Components. Inflammation is a natural process within formula reduces the incidence and severity of NEC in rats
the innate immune response for the maintenance of normal [88]. Moreover, the administration of pomegranate seed oil
tissue function [81]. It is the response to foreign stimuli and protects against NEC in a neonatal rat model. Pomegranate
leads to tissue healing in normal physiological processes. seed oil supplementation markedly reduced the incidence of
However, it can become chronic and excessive inflammation NEC from 61% to 26% and the severity of ileal damage. Since
if such process is dysregulated. This alteration is usual, and the supplementation of formula with 1.5% of pomegranate
it is the basis for a variety of severe diseases in the gut seed oil significantly increased conjugated linoleic acid levels
including inflammatory bowel disease and inflammation- but had no effect in other fatty acids such as CLA and
related colorectal cancer. PPAR𝛾 and 𝛿 are recognized as arachidonic acid, the authors concluded that conjugated
central inhibitors of intestinal inflammation in DSS colitis linoleic acid was the responsible for the protective effects of
[82]. Activation of PPAR𝛾 and 𝛿 by dietary punicic acid has pomegranate. An increased expression of proinflammatory
been shown to ameliorate intestinal inflammation in two cytokines including IL-6, IL-8, and TNF𝛼 was seen in the
mouse models of IBD in mice [60]. Punicic acid ameliorated ileum of NEC rats when compared with controls. However,
DSS-induced colitis and spontaneous panenteritis in IL- the supplementation of pomegranate seed oil reduced these
10−/− mice. However, punicic acid was not effective in IL- values. Pomegranate was also able to reduce IL-23 and IL-
10−/− mice with established severe inflammatory lesions such 12, both of which contribute to intestinal inflammation by
as rectal prolapses and PPAR𝛾: IL-10 DK mice. Therefore, the inducing a T helper 17 (Th17) and Th1 response. Therefore,
loss of PPAR𝛾 in immune and epithelial cells impairs the abil- pomegranate seed oil seemed to protect against NEC by
ity of punicic acid to ameliorate experimental colitis. Colonic downregulating the inflammatory response in the developing
expression of PPAR𝛿 and its responsive gene angiopoietin- intestinal mucosa. Pomegranate seed oil is a rich source of
like 4 was upregulated in IL-10−/− mice that received punicic fatty acids, which can be metabolized by gut microflora.
acid preventively. Interestingly, these findings are in line with Pomegranate administration activated the metabolism of
increased PPAR𝛿 reporter activity induced by punicic acid in punicic acid in the intestine of immature rats, thus resulting
vitro in intestinal epithelial cells and macrophages. However, in the preservation of the intestinal architecture. Overall,
the downregulation of TNF𝛼 in the colons of punicic-acid- pomegranate seed oil beneficial effects in NEC models are
fed mice and M1 macrophages treated with punicic acid is associated with improved enterocyte proliferation, protection
in line with the PPAR𝛾-dependent anti-inflammatory effects of intestinal architecture, and reduced expression of pro-
of this compound. At a cellular level, the loss of PPAR𝛾 inflammatory cytokines.
in macrophages completely abrogated the anti-inflammatory
activity of punicic acid, whereas its deletion in intestinal 4.4. Anticarcinogenic Effects of Pomegranate. Colorectal can-
epithelial cells or the whole body deletion of PPAR𝛿 impaired, cer (CRC) is the third most commonly diagnosed cancer in
but did not completely abrogate, the beneficial effects of the United States [89]. IBD is among the top three high-risk
punicic acid in the gut. Wild-type M1 classically activated conditions for CRC. Among ulcerative colitis (UC) patients,
macrophages showed suppressed TNF𝛼 and MCP-1 expres- one of the two main manifestations of IBD, the relative risk
sion after punicic acid treatment, whereas these suppressive of developing CRC correlates with the extent and duration
effects were not seen in PPAR𝛾 or PPAR𝛿 null macrophages. of disease [90]. Moreover, in patients with IBD, this risk
Therefore, punicic acid ameliorated IBD by downregulat- increases by 0.5–1.0% yearly after 8–10 years [91]. In this
ing inflammation in mucosal immune and epithelial cells regard, the anticarcinogenic activities of pomegranate are also
through a PPAR𝛾- and 𝛿-dependent mechanism (Figure 1). under investigation. In vitro studies using different cancer cell
Necrotizing colitis (NEC) is a devastating disease asso- lines demonstrated that pomegranate juice, seeds, and oil can
ciated with severe and excessive intestinal inflammation, inhibit cancer cell invasiveness and proliferation, cause cell
and it is the major cause of morbidity and mortality in cycle disruption, induce apoptosis, and inhibit tumor growth
premature infants. Although its etiology is unknown, it [92]. Moreover, the combination of different parts of the
is thought that the combination of intestinal immaturity, fruit seems to be more effective than each single extract [21].
high immunoreactivity of the intestinal mucosa, and genetic Two studies demonstrated that pomegranate fruit extracts
predisposition results in the development of NEC [83]. Gut can inhibit cell growth and induce apoptosis by modulating
bacteria play a crucial role in the development of immune the proteins that regulate apoptosis in mice implanted with
function, and they are thought to be implicated in the prostate cancer PC-3 cell line [93, 94]. Several studies have
predisposition and causal pathway for NEC [84]. Several shown a correlation between enhanced cyclooxygenase 2
(COX-2) expression and increase in cell proliferation [95]. this study contained on average 86.0% ellagitannins, 2.5%
COX-2 is a key enzyme for the conversion of arachi- ash, 3.2% sugars, 1.9% organic acids as citric acid equiva-
donic to prostaglandins, which are important inflammatory lents, 0.8% nitrogen, and 1.2% moisture. The approximate
mediators. The treatment of HT-29 colon cancer cells with percent distribution of pomegranate polyphenols in the
NS398, a COX-2 inhibitor, resulted in inhibition of prolifer- extract was as follows: 19% ellagitannins as punicalagins
ation [96, 97]. Pomegranate juice and punicalagin decreased and punicalins, 4% free ellagic acid, and 77% oligomers
COX-2 expression in HT-29 cells in a dose-dependent man- composed of 2–10 repeating units of gallic acid, ellagic acid,
ner. Pomegranate juice seemed to be more effective, most and glucose in different combinations. [106]. Moreover, treat-
likely due to significant interactions with other bioactive ment with urolithin A decreases certain pro-inflammatory
polyphenols such as anthocyanins and flavonols. Some stud- markers including iNOS, COX-2, prostaglandin E syn-
ies have concluded that COX-2 expression in HT-29 cells is thase, and prostaglandin E2 in a colon cancer model
NF-𝜅B dependent. In this line, pomegranate juice has been [107]. Recent studies also indicate that pomegranate extracts
shown to reduce COX-2 expression through the inhibition inhibit angiogenesis by downregulating vascular endothelial
of phosphatidylinositide 3-kinases (PI3K) and protein kinase growth factor in MCF-7 breast cancer and human umbil-
B or Akt, both necessary for NF-𝜅B activation [95, 98]. ical vein endothelial cell lines. The pomegranate extracts
However, in this case, the inhibition of NF-𝜅B by wortmannin employed in such study include pomegranate fermented juice
only partially decreased COX-2 expression. Therefore, other (pomegranate “wine”) polyphenols, pomegranate pericarp
signaling pathways might be important in the modulation polyphenols, cold-pressed pomegranate seed oil, supercriti-
of COX-2 expression in HT-29 cells along with the NF- cal fluid extracted pomegranate seed oil, pomegranate seed
𝜅B pathways. The authors suggested the MAPK pathways oil polyphenols, and unsaponified pomegranate seed oil
(ERK1/2, p38, and JNK1,2,3) as potential candidates for this fraction [108]. Another study showed how the pretreatment
role since MAPK has been shown to mediate COX-2 expres- with dietary pomegranate oil inhibited the incidence and
sion in several studies [99, 100] (Figure 2). Pomegranate has multiplicity of colonic adenocarcinomas in azoxymethane-
been also shown to reduce lipoxygenase, an enzyme that induced colorectal cancer in rats [109]. Interestingly, the
catalyzes the conversion of arachidonic acid to leukotrienes, inhibition of tumor incidence correlated with increased
which are also key inflammatory mediators [101]. There- expression of PPAR𝛾 protein in the nontumor mucosa. All
fore, pomegranate ingestion alters eicosanoid biosynthesis. these effects described in the different studies contribute to
Specifically, flavonoids extracted from pomegranate seed oil the anti-inflammatory activity of pomegranate as well as its
(0.015% polyphenols, 65.3% punicic acid, 4.8% palmitic acid, cancer treatment potential. Many studies have observed that
2.3% stearic acid, 6.3% oleic acid, and 6.6% linoleic acid) the extract or the juice of pomegranate is more beneficial in
showed a 31–44% inhibition of sheep cyclooxygenase and 69– terms of anticarcinogenic activity than individual or purified
81% inhibition of soybean lipoxygenase. Flavonoids extracted ingredients. Therefore, the chemical synergy when using
from pomegranate juice showed 21–30% inhibition of soy- extracts could explain the inhibition of multiple targets at the
bean lipoxygenase though no significant inhibition of sheep same time and consequently greater likelihood for producing
cyclooxygenase. Even though pomegranate juice may not cancer chemopreventive effects.
be an inhibitor of cyclooxygenase-catalyzed prostaglandin
formation, it may still have an indirect role in the inhibition of 5. Pomegranate Safety and Drug Interactions
inflammation. Pomegranate can also suppress inflammatory
cytokine expression [1, 96] as well inhibit matrix metallo- Pomegranate and its constituents have been safely consumed
proteinases (MMPs) in colon cancer cells [96, 102]. MMPs by humans for several millennia. Nevertheless, several animal
are a subgroup of collagenase enzymes expressed in arthritic studies and human clinical trials have investigated the toxicity
joints and involved in the degradation and catabolism of of pomegranate. No adverse side effects have been noted in
extracellular joint matrix. The downregulation of MMP any of these studies, therefore considering safe to consume
expression has also been seen in osteoarthritis chondrocytes the fresh fruit or pomegranate juice in general. No toxic
pretreated with pomegranate fruit extract, thus suggesting effects were seen after the repeated consumption of the
the prevention of collagen degradation which results in joint polyphenol antioxidant punicalagin by rats, which were
destruction inhibition in osteoarthritis patients [103]. confirmed by histopathological analyses of their organs [31].
Another pro-inflammatory pathway that can be down- Pomegranate juice administration in an acute or subchronic
regulated by pomegranate administration is NF-𝜅B. Con- approach resulted in no adverse effects in rats [110], and
stitutive activation of NF-𝜅B has been identified in some no mutagenicity or acute toxicity was seen in rats fed with
cancer cell lines [104], thus leading to inflammation and pomegranate seed oil during 28 days (0 to 150,000 ppm
cell proliferation by the upregulating the transcription of which resulted in a mean intake of 0 to 14,214 mg/kg body
collagenase, cell adhesion molecules, and pro-inflammatory weight/day) [111]. The no observable adverse effect level
cytokines such as TNF-𝛼, IL-1, IL-2, IL-6, and IL-8 [105]. (NOAEL) was 4.3 g pomegranate seed oil/kg body weight/day
Treatment with pomegranate extracts may be successful (= 50,000 ppm). In rats and mice, the oral LD50 (lethal
in the therapeutic treatment of inflammatory disease and dose or dose required to kill 50% of the tested population)
cancer since they have been shown to decrease the proof pomegranate fruit extract standardized to 30% puni-
duction of IL-6 and IL-8 and inhibit NF-𝜅B in human calagin was greater than 5 g/kg body weight, whereas the
mast cells and basophils. The powder extract used in intraperitoneal LD50 for rats was 217 mg/kg body weight and
187 mg/kg for mice [110]. These values suggest that a healthy
human individual may consume pomegranate juice, oil, or
powdered extracts in moderation without high risk. In line
with these results, no adverse effects or changes in renal or
liver function parameters were reported during a clinical trial
in 86 human overweight volunteers, which demonstrated the
safety of tableted pomegranate fruit extract administration in
amounts up to 1,420 mg/day during 28 days [112]. Moreover,
the consumption of pomegranate juice for up to 3 years did
not show any toxic effect in 10 patients with carotid artery
stenosis [74]. Although any of these studies has reported any Figure 3: Representative binding mode of the most stable docked
detrimental side effect, it is still not clear whether this safety orientation of catalpic acid and punicic acid with peroxisome
extends to all extracts or pure compounds that may be used proliferator-activated receptor 𝛾 (PPAR𝛾). The PPAR𝛾 model is
as dietary supplements in a more concentrated form. shown in ribbon mode. Catalpic acid and punicic acid poses
Some studies have reported detrimental interactions generated by AutoDock Vina are colored in blue and magenta,
respectively. Rosiglitazone is colored in yellow.
between pomegranate and other drugs. For instance, recent
studies have investigated the effect of pomegranate on
cytochrome P450, the hepatic enzyme system involved in
the metabolism of drugs and other xenobiotics along with structure-based virtual screening can complement tradi-
endogenous substrates. Food-drug or drug-drug interactions tional experimental methods for identification of potential
can lead to the inhibition of specific CYP enzymes, thus targets for each of these compounds. We have successfully
resulting altered oral bioavailability and effectiveness or established a protocol for screening fatty acid compounds
toxicity of the drug. Some studies showed that pomegranate against PPAR 𝛾 as a means to identify novel agonists, which
juice inhibits cytochrome P450 enzymes CYP2C9 [113] can be later verified through in vitro assays (Figure 3)
and CYP3A [114] in vitro and increases levels of absorbed [59, 120]. Computer-aided drug discovery approaches have
tolbutamide and carbamazepine, thus altering drug phar- been used in pharmaceutical investigation for about two
macokinetics. A decrease in liver CYP450 and increased decades. Using reverse docking approach, researchers should
sleepy effects of pentobarbital was reported after a 4-week be able to identify potential targets for each pomegranate
administration of pomegranate juice in mice [115]. More- compound. Moreover, structure-based virtual screening on
over, pomegranate juice also inhibited CYP3A using human known drug targets would provide an opportunity for de novo
microsomes [113, 116]. identification of natural active compounds.
Although results show that a moderate intake of
pomegranate is safe and does not result in any side effect, 7. Conclusions
there is still a need to further study the interactions between
pomegranate and other drugs as well as the effects of a long There is strong evidence that pomegranate elicits amelio-
exposure and the safety of pure compounds. rating health effects in several diseases. When considering
the pomegranate therapeutic studies along with the research
6. Computer-Aided Drug Discovery investigating the bioavailability of its compounds, one can
conclude that pomegranate’s bioactive constituents can be
Computer-aided drug discovery has become a crucial com- absorbed and exert their biological activity. However, this
ponent of many drug discovery studies. Compared with the fruit contains hundreds of different bioactive compounds,
traditional physical large-scale, high-throughput screening of thus requiring a better understanding of the beneficial effects
thematic compound libraries, which is very costly and yields elicited by each compound and not the fruit as a whole.
mixed results, computer-aided drug discovery is more cost- Moreover, some studies report that the administration of
effective. Structure-based virtual screening techniques have combinations of bioactive compounds has increased activity
been widely used in several discovery efforts since they allow when compared to single compounds. Therefore, there is a
the screening of thousands of compounds within a collective need to further study possible synergistic effects between
of large compound libraries in a cost-effective manner [117], pomegranate’s bioactive components through isobolograms
such as the discovery of anti-inflammatory drugs against in the context of ligand-binding assays and factorial designs
inflammatory bowel disease [118]. The basic procedure of in animal models. In this regard, the integration of compu-
SBVS is to sample binding geometry for compounds from tational and experimental nutritional immunology research
large libraries into the structure of receptor targets by using represents a cost, and time-efficient approach for the discov-
molecular modeling approaches. Each compound is sampled ery of novel interactions and mechanisms underlying such
in thousands to millions of possible poses and scored on the activities.
basis of its complementarity to the receptor. Of the hundreds Many of the pomegranate’s beneficial effects have been
of thousands of molecules in the library, tens of top-scoring widely related to the presence of ellagic acid and ellagitan-
predicted ligands are subsequently tested for activity in exper- nins, especially punicalagins, punicalins, and gallagic acid.
imental assays [119]. In an effort to expedite the mechanisms However, anthocyanins as well as pomegranate’s distinct and
underlying the beneficial effects of pomegranate constituents, unique fatty acid profile also contribute to the reported
health effects. Interestingly, several effects of pomegranate are Journal of Agricultural and Food Chemistry, vol. 48, no. 10, pp.
mediated by the activation of PPAR pathways by conjugated 4581–4589, 2000.
trienes derived from seed oil. Some studies suggest that [9] Y. Li, C. Guo, J. Yang, J. Wei, J. Xu, and S. Cheng, “Evaluation of
pomegranate metabolites may also contribute to its therapeu- antioxidant properties of pomegranate peel extract in compar-
tic effects along with the components of the fruit. In line with ison with pomegranate pulp extract,” Food Chemistry, vol. 96,
these findings, pomegranate has been suggested to stimulate no. 2, pp. 254–260, 2006.
probiotic bacteria thus enhancing their beneficial effects [10] C. Guo, J. Yang, J. Wei, Y. Li, J. Xu, and Y. Jiang, “Antioxidant
and fighting bacterial infections. Therefore, gut microflora activities of peel, pulp and seed fractions of common fruits as
determined by FRAP assay,” Nutrition Research, vol. 23, no. 12,
seems to be important for pomegranate therapeutic activi-
pp. 1719–1726, 2003.
ties. Pomegranate is safe at high doses in humans. So far,
[11] S. Okonogi, C. Duangrat, S. Anuchpreeda, S. Tachakittirun-
pomegranate has been shown to elicit beneficial effects for the
grod, and S. Chowwanapoonpohn, “Comparison of antioxidant
treatment of obesity, diabetes, inflammation-related diseases capacities and cytotoxicities of certain fruit peels,” Food Chem-
such as IBD and NEC, and several types of cancer, as well as istry, vol. 103, no. 3, pp. 839–846, 2007.
cardiovascular complications. However, there is still a need to [12] J. Sacheck, “Pediatric obesity: an inflammatory condition?”
identify individual active ingredients of pomegranate as well Journal of Parenteral and Enteral Nutrition, vol. 32, no. 6, pp.
as further explore synergistic preventive effects in laboratory, 633–637, 2008.
animal models, and human clinical studies. [13] I. O. C. M. Vroegrijk, J. A. van Diepen, S. van den Berg et al.,
“Pomegranate seed oil, a rich source of punicic acid, prevents
diet-induced obesity and insulin resistance in mice,” Food and
Conflict of Interests Chemical Toxicology, vol. 49, no. 6, pp. 1426–1430, 2011.
The authors have no conflict of interests whatsoever to [14] J. He and M. M. Giusti, “Anthocyanins: natural colorants with
declare. health-promoting properties,” Annual Review of Food Science
and Technology, vol. 1, pp. 163–187, 2010.
[15] A. Basu and K. Penugonda, “Pomegranate juice: a heart-healthy
Acknowledgments fruit juice,” Nutrition Reviews, vol. 67, no. 1, pp. 49–56, 2009.
[16] C. B. Stowe, “The effects of pomegranate juice consumption
This work was supported by funds of the Nutritional on blood pressure and cardiovascular health,” Complementary
Immunology and Molecular Medicine Laboratory. Therapies in Clinical Practice, vol. 17, no. 2, pp. 113–115, 2011.
[17] R. P. Singh, K. N. C. Murthy, and G. K. Jayaprakasha, “Studies on
References the antioxidant activity of pomegranate (Punica granatum) peel
and seed extracts using in vitro models,” Journal of Agricultural
[1] E. P. Lansky and R. A. Newman, “Punica granatum and Food Chemistry, vol. 50, no. 1, pp. 81–86, 2002.
(pomegranate) and its potential for prevention and treatment [18] A. P. Kulkarni, H. S. Mahal, S. Kapoor, and S. M. Aradhya, “In
of inflammation and cancer,” Journal of Ethnopharmacology, vitro studies on the binding, antioxidant, and cytotoxic action
vol. 109, no. 2, pp. 177–206, 2007. of punicalagin,” Journal of Agricultural and Food Chemistry, vol.
[2] M. Viuda-Martos, J. Fernández-Lóaez, and J. A. Pérez-álvarez, 55, no. 4, pp. 1491–1500, 2007.
“Pomegranate and its many functional components as related to [19] M. Falsaperla, G. Morgia, A. Tartarone, R. Ardito, and
human health: a review,” Comprehensive Reviews in Food Science G. Romano, “Support ellagic acid therapy in patients with
and Food Safety, vol. 9, no. 6, pp. 635–654, 2010. hormone refractory prostate cancer (HRPC) on standard
[3] S. A. H. Naqvi, M. S. Y. Khan, and S. B. Vohora, “Anti- chemotherapy using vinorelbine and estramustine phosphate,”
bacterial, anti-fungal and anthelmintic investigations on Indian European Urology, vol. 47, no. 4, pp. 449–454, 2005.
medicinal plants,” Fitoterapia, vol. 62, no. 3, pp. 221–228, 1991. [20] E. A. Hassoun, J. Vodhanel, and A. Abushaban, “The modula-
tory effects of ellagic acid and vitamin E succinate on TCDD-
[4] A. Caceres, L. M. Giron, S. R. Alvarado, and M. F. Torres,
induced oxidative stress in different brain regions of rats after
“Screening of antimicrobial activity of plants popularly used
subchronic exposure,” Journal of Biochemical and Molecular
in Guatemala for the treatment of dermatomucosal diseases,”
Toxicology, vol. 18, no. 4, pp. 196–203, 2004.
Journal of Ethnopharmacology, vol. 20, no. 3, pp. 223–237, 1987.
[21] E. P. Lansky, W. Jiang, H. Mo et al., “Possible synergistic prostate
[5] F. de Nigris, M. L. Balestrieri, S. Williams-Ignarro et al., “The cancer suppression by anatomically discrete pomegranate frac-
influence of pomegranate fruit extract in comparison to regular tions,” Investigational New Drugs, vol. 23, no. 1, pp. 11–20, 2005.
pomegranate juice and seed oil on nitric oxide and arterial
[22] E. P. Lansky, G. Harrison, P. Froom, and W. G. Jiang,
function in obese Zucker rats,” Nitric Oxide, vol. 17, no. 1, pp.
“Pomegranate (Punica granatum) pure chemicals show possible
50–54, 2007.
synergistic inhibition of human PC-3 prostate cancer cell
[6] S. D. Johanningsmeier and G. K. Harris, “Pomegranate as a invasion across Matrigel,” Investigational New Drugs, vol. 23, no.
functional food and nutraceutical source,” Annual Review of 2, pp. 121–122, 2005.
Food Science and Technology, vol. 2, pp. 181–201, 2011. [23] S. H. Mirdehghan and M. Rahemi, “Seasonal changes of mineral
[7] J. Jurenka, “Therapeutic applications of pomegranate (Punica nutrients and phenolics in pomegranate (Punica granatum L.)
granatum L.): a review,” Alternative Medicine Review, vol. 13, no. fruit,” Scientia Horticulturae, vol. 111, no. 2, pp. 120–127, 2007.
2, pp. 128–144, 2008. [24] N. P. Seeram, R. Lee, and D. Heber, “Bioavailability of ellagic
[8] M. I. Gil, F. A. Tomas-Barberan, B. Hess-Pierce, D. M. Holcroft, acid in human plasma after consumption of ellagitannins from
and A. A. Kader, “Antioxidant activity of pomegranate juice pomegranate (Punica granatum L.) juice,” Clinica Chimica Acta,
and its relationship with phenolic composition and processing,” vol. 348, no. 1-2, pp. 63–68, 2004.
[25] N. P. Seeram, S. M. Henning, Y. Zhang, M. Suchard, Z. Li, and D. [37] D. Bialonska, P. Ramnani, S. G. Kasimsetty, K. R. Muntha, G.
Heber, “Pomegranate juice ellagitannin metabolites are present R. Gibson, and D. Ferreira, “The influence of pomegranate by-
in human plasma and some persist in urine for up to 48 hours,” product and punicalagins on selected groups of human intesti-
Journal of Nutrition, vol. 136, no. 10, pp. 2481–2485, 2006. nal microbiota,” International Journal of Food Microbiology, vol.
140, no. 2-3, pp. 175–182, 2010.
[26] A. González-Sarrı́as, M. Larrosa, F. A. Toms-Barberán, P.
Dolara, and J. C. Espı́n, “NF-𝜅B-dependent anti-inflammatory [38] G. R. Gibson, “Prebiotics as gut microflora management tools,”
activity of urolithins, gut microbiota ellagic acid-derived Journal of Clinical Gastroenterology, vol. 42, supplement 2, pp.
metabolites, in human colonic fibroblasts,” British Journal of S75–S79, 2008.
Nutrition, vol. 104, no. 4, pp. 503–512, 2010. [39] R. A. Rastall, G. R. Gibson, H. S. Gill et al., “Modulation
of the microbial ecology of the human colon by probiotics,
[27] B. Dobroslawa, S. G. Kasimsetty, S. I. Khan, and F. Daneel,
prebiotics and synbiotics to enhance human health: an overview
“Urolithins, intestinal microbial metabolites of pomegranate
of enabling science and potential applications,” FEMS Microbi-
ellagitannins, exhibit potent antioxidant activity in a cell-based
ology Ecology, vol. 52, no. 2, pp. 145–152, 2005.
assay,” Journal of Agricultural and Food Chemistry, vol. 57, no.
21, pp. 10181–10186, 2009. [40] D. Bialonska, S. G. Kasimsetty, K. K. Schrader, and D. Ferreira,
“The effect of pomegranate (Punica granatum L.) byproducts
[28] N. P. Seeram, Y. Zhang, R. McKeever et al., “Pomegranate juice and ellagitannins on the growth of human gut bacteria,” Journal
and extracts provide similar levels of plasma and urinary ellag- of Agricultural and Food Chemistry, vol. 57, no. 18, pp. 8344–
itannin metabolites in human subjects,” Journal of Medicinal 8349, 2009.
Food, vol. 11, no. 2, pp. 390–394, 2008.
[41] A. H. Mokdad, B. A. Bowman, E. S. Ford, F. Vinicor, J. S. Marks,
[29] B. Cerdá, J. C. Espı́n, S. Parra, P. Martı́nez, and F. A. Tomás- and J. P. Koplan, “The continuing epidemics of obesity and
Barberán, “The potent in vitro antioxidant ellagitannins from diabetes in the United States,” Journal of the American Medical
pomegranate juice are metabolised into bioavailable but poor Association, vol. 286, no. 10, pp. 1195–1200, 2001.
antioxidant hydroxy-6H-dibenzopyran-6-one derivatives by [42] B. Desvergne and W. Wahli, “Peroxisome proliferator-activated
the colonic microflora of healthy humans,” European Journal of receptors: nuclear control of metabolism,” Endocrine Reviews,
Nutrition, vol. 43, no. 4, pp. 205–220, 2004. vol. 20, no. 5, pp. 649–688, 1999.
[30] B. Cerdá, R. Llorach, J. J. Cerón, J. C. Espı́n, and F. A. Tomás- [43] R. W. Nesto, D. Bell, R. O. Bonow et al., “Thiazolidinedione
Barberán, “Evaluation of the bioavailability and metabolism use, fluid retention, and congestive heart failure: a consensus
in the rat of punicalagin, an antioxidant polyphenol from statement from the American Heart Association and American
pomegranate juice,” European Journal of Nutrition, vol. 42, no. Diabetes Association,” Diabetes Care, vol. 27, no. 1, pp. 256–263,
1, pp. 18–28, 2003. 2004.
[31] B. Cerdá, J. J. Cerón, F. A. Tomás-Barberán, and J. C. Espı́n, [44] K. Katayama, K. Wada, A. Nakajima et al., “A novel PPAR𝛾 gene
“Repeated oral administration of high doses of the pomegranate therapy to control inflammation associated with inflammatory
ellagitannin punicalagin to rats for 37 days is not toxic,” Journal bowel disease in a murine model,” Gastroenterology, vol. 124, no.
of Agricultural and Food Chemistry, vol. 51, no. 11, pp. 3493–3501, 5, pp. 1315–1324, 2003.
2003. [45] L. Dubuquoy, E. Å Jansson, S. Deeb et al., “Impaired expression
of peroxisome proliferator-activated receptor 𝛾in ulcerative
[32] S. U. Mertens-Talcott, P. Jilma-Stohlawetz, J. Rios, L. Hingorani,
colitis,” Gastroenterology, vol. 124, no. 5, pp. 1265–1276, 2003.
and H. Derendorf, “Absorption, metabolism, and antioxidant
effects of pomegranate (Punica granatum L.) polyphenols after [46] T. Ogata, T. Miyauchi, S. Sakai, Y. Irukayama-Tomobe, K. Goto,
ingestion of a standardized extract in healthy human volun- and I. Yamaguchi, “Stimulation of peroxisome-proliferator-
teers,” Journal of Agricultural and Food Chemistry, vol. 54, no. activated receptor 𝛼 (PPAR𝛼) attenuates cardiac fibrosis and
23, pp. 8956–8961, 2006. endothelin-1 production in pressure-overloaded rat hearts,”
Clinical Science, vol. 103, supplement 48, pp. 284S–288S, 2002.
[33] J. C. Espı́n, R. González-Barrio, B. Cerdá, C. López-Bote, A.
[47] S. C. Hsu and C. J. Huang, “Changes in liver PPAR𝛼 mRNA
I. Rey, and F. A. Tomás-Barberán, “Iberian pig as a model to
expression in response to two levels of high-safflower-oil diets
clarify obscure points in the bioavailability and metabolism
correlate with changes in adiposity and serum leptin in rats and
of ellagitannins in humans,” Journal of Agricultural and Food
mice,” Journal of Nutritional Biochemistry, vol. 18, no. 2, pp. 86–
96, 2007.
[34] N. P. Seeram, W. J. Aronson, Y. Zhang et al., “Pomegranate [48] R. A. Daynes and D. C. Jones, “Emerging roles of PPARs in
ellagitannin-derived metabolites inhibit prostate cancer growth inflammation and immunity,” Nature Reviews Immunology, vol.
and localize to the mouse prostate gland,” Journal of Agricultural 2, no. 10, pp. 748–759, 2002.
[49] D. J. Mangelsdorf, C. Thummel, M. Beato et al., “The nuclear
[35] A. González-Sarrı́as, J. A. Giménez-Bastida, M. T. Garcı́a- receptor super-family: the second decade,” Cell, vol. 83, no. 6,
Conesa et al., “Occurrence of urolithins, gut microbiota ellagic pp. 835–839, 1995.
acid metabolites and proliferation markers expression response [50] G. Chinetti, S. Lestavel, V. Bocher et al., “PPAR-𝛼 and PPAR-𝛾
in the human prostate gland upon consumption of walnuts and activators induce cholesterol removal from human macrophage
pomegranate juice,” Molecular Nutrition and Food Research, vol. foam cells through stimulation of the ABCA1 pathway,” Nature
54, no. 3, pp. 311–322, 2010. Medicine, vol. 7, no. 1, pp. 53–58, 2001.
[36] P. A. Crawford and J. I. Gordon, “Microbial regulation of [51] B. H. Park, B. Vogelstein, and K. W. Kinzler, “Genetic disruption
intestinal radiosensitivity,” Proceedings of the National Academy of PPAR𝛿 decreases the tumorigenicity of human colon cancer
of Sciences of the United States of America, vol. 102, no. 37, pp. cells,” Proceedings of the National Academy of Sciences of the
13254–13259, 2005. United States of America, vol. 98, no. 5, pp. 2598–2603, 2001.
[52] M. Ricote, A. C. Li, T. M. Willson, C. J. Kelly, and C. K. Glass, BM 17.0744, a novel PPAR-𝛼 activator,” American Journal of
“The peroxisome proliferator-activated receptor-𝛾 is a negative Physiology, vol. 283, no. 3, pp. H949–H957, 2002.
regulator of macrophage activation,” Nature, vol. 391, no. 6662, [67] A. Jang, P. Srinivasan, N. Y. Lee et al., “Comparison of hypolipi-
pp. 79–82, 1998. demic activity of synthetic gallic acid-linoleic acid ester with
[53] W. Wahli, “A gut feeling of the PXR, PPAR and NF-𝜅B mixture of gallic acid and linoleic acid, gallic acid, and linoleic
connection,” Journal of Internal Medicine, vol. 263, no. 6, pp. acid on high-fat diet induced obesity in C57BL/6 Cr Slc mice,”
613–619, 2008. Chemico-Biological Interactions, vol. 174, no. 2, pp. 109–117, 2008.
[54] J. Bassaganya-Riera, K. Reynolds, S. Martino-Catt et al., “Acti- [68] A. Esmaillzadeh, F. Tahbaz, I. Gaieni, H. Alavi-Majd, and
vation of PPAR 𝛾 and 𝛿 by conjugated linoleic acid mediates L. Azadbakht, “Cholesterol-lowering effect of concentrated
protection from experimental inflammatory bowel disease,” pomegranate juice consumption in type II diabetic patients
Gastroenterology, vol. 127, no. 3, pp. 777–791, 2004. with hyperlipidemia,” International Journal for Vitamin and
[55] J. Bassaganya-Riera, A. J. Guri, and R. Hontecillas, “Treatment Nutrition Research, vol. 76, no. 3, pp. 147–151, 2006.
of obesity-related complications with novel classes of naturally [69] A. Esmaillzadeh, F. Tahbaz, I. Gaieni, H. Alavi-Majd, and L.
occurring PPAR agonists,” Journal of Obesity, vol. 2011, Article Azadbakht, “Concentrated pomegranate juice improves lipid
ID 897894, 7 pages, 2011. profiles in diabetic patients with hyperlipidemia,” Journal of
Medicinal Food, vol. 7, no. 3, pp. 305–308, 2004.
[56] J. D. Lewis, G. R. Lichtenstein, J. J. Deren et al., “Rosiglitazone
for active ulcerative colitis: a randomized placebo-controlled [70] J. Bassaganya-Riera, S. Misyak, A. J. Guri, and R. Honte-
trial,” Gastroenterology, vol. 134, no. 3, pp. 688–695, 2008. cillas, “PPAR𝛾 is highly expressed in F4/80hi adipose tissue
macrophages and dampens adipose-tissue inflammation,” Cel-
[57] T. A. Elasy and M. Griffin, “Thiazolidinedione use, fluid
lular Immunology, vol. 258, no. 2, pp. 138–146, 2009.
retention, and congestive heart failure: a consensus statement
from the American Heart Association and American Diabetes [71] A. J. Guri, R. Hontecillas, G. Ferrer et al., “Loss of PPAR𝛾 in
Association: response to Nesto,” Diabetes Care, vol. 27, no. 8, immune cells impairs the ability of abscisic acid to improve
article 2096, 2004. insulin sensitivity by suppressing monocyte chemoattractant
protein-1 expression and macrophage infiltration into white
[58] J. Bassaganya-Riera, M. Viladomiu, M. Pedragosa et al., “Probi- adipose tissue,” Journal of Nutritional Biochemistry, vol. 19, no.
otic bacteria produce conjugated linoleic acid locally in the gut 4, pp. 216–228, 2008.
that targets macrophage PPAR gamma to suppress colitis,” PLoS
One, vol. 7, no. 2, Article ID e31238, 2012. [72] B. Fuhrman, N. Volkova, and M. Aviram, “Pomegranate juice
inhibits oxidized LDL uptake and cholesterol biosynthesis in
[59] S. N. Lewis, L. Brannan, A. J. Guri et al., “Dietary alpha- macrophages,” Journal of Nutritional Biochemistry, vol. 16, no.
eleostearic acid ameliorates experimental inflammatory bowel 9, pp. 570–576, 2005.
disease in mice by activating peroxisome proliferator-activated
[73] M. Rosenblat, T. Hayek, and M. Aviram, “Anti-oxidative effects
receptor-gamma,” PLoS One, vol. 6, no. 8, Article ID e24031,
of pomegranate juice (PJ) consumption by diabetic patients on
2011.
serum and on macrophages,” Atherosclerosis, vol. 187, no. 2, pp.
[60] J. Bassaganya-Riera, M. DiGuardo, M. Climent et al., “Acti- 363–371, 2006.
vation of PPARgamma and delta by dietary punicic acid
[74] M. Aviram, L. Dornfeld, M. Rosenblat et al., “Pomegranate juice
ameliorates intestinal inflammation in mice,” British Journal of
consumption reduces oxidative stress, atherogenic modifica-
Nutrition, vol. 106, no. 6, pp. 878–886, 2011.
tions to LDL, and platelet aggregation: studies in humans and
[61] A. Tenenbaum, M. Motro, and E. Z. Fisman, “Dual and in atherosclerotic apolipoprotein E-deficient mice,” American
pan-peroxisome proliferator-activated receptors (PPAR) co- Journal of Clinical Nutrition, vol. 71, no. 5, pp. 1062–1076, 2000.
agonism: the bezafibrate lessons,” Cardiovascular Diabetology, [75] M. Aviram, L. Dornfeld, M. Kaplan et al., “Pomegranate
vol. 4, article 14, 2005. juice flavonoids inhibit low-density lipoprotein oxidation and
[62] R. Hontecillas, M. O’Shea, A. Einerhand, M. Diguardo, and J. cardiovascular diseases: studies in atherosclerotic mice and in
Bassaganya-Riera, “Activation of PPAR 𝛾 and 𝛼 by punicic acid humans,” Drugs under Experimental and Clinical Research, vol.
ameliorates glucose tolerance and suppresses obesity-related 28, no. 2-3, pp. 49–62, 2002.
inflammation,” Journal of the American College of Nutrition, vol. [76] M. Shiner, B. Fuhrman, and M. Aviram, “Macrophage paraox-
28, no. 2, pp. 184–195, 2009. onase 2 (PON2) expression is up-regulated by pomegranate
[63] T. Boussetta, H. Raad, P. Lettéron et al., “Punicic acid a juice phenolic anti-oxidants via PPAR𝛾 and AP-1 pathway
conjugated linolenic acid inhibits TNF𝛼-induced neutrophil activation,” Atherosclerosis, vol. 195, no. 2, pp. 313–321, 2007.
hyperactivation and protects from experimental colon inflam- [77] H. S. Parmar and A. Kar, “Medicinal values of fruit peels from
mation in rats,” PLoS ONE, vol. 4, no. 7, Article ID e6458, 2009. Citrus sinensis, Punica granatum, and Musa paradisiaca with
[64] B. K. McFarlin, K. A. Strohacker, and M. L. Kueht, respect to alterations in tissue lipid peroxidation and serum
“Pomegranate seed oil consumption during a period of concentration of glucose, insulin, and thyroid hormones,”
high-fat feeding reduces weight gain and reduces type 2 Journal of Medicinal Food, vol. 11, no. 2, pp. 376–381, 2008.
diabetes risk in CD-1 mice,” British Journal of Nutrition, vol. [78] H. S. Parmar and A. Kar, “Antidiabetic potential of Citrus
102, no. 1, pp. 54–59, 2009. sinensis and Punica granatum peel extracts in alloxan treated
[65] R. Hontecillas, M. Diguardo, E. Duran, M. Orpi, and J. male mice,” BioFactors, vol. 31, no. 1, pp. 17–24, 2007.
Bassaganya-Riera, “Catalpic acid decreases abdominal fat depo- [79] V. M. Abazov, B. Abbott, M. Abolins et al., “Search for neutral
sition, improves glucose homeostasis and upregulates PPAR 𝛼 higgs bosons in Multi-b-Jet events in 𝑝𝑝 collisions at √𝑠 =
expression in adipose tissue,” Clinical Nutrition, vol. 27, no. 5, 1.96TeV,” Physical Review Letters, vol. 101, no. 22, Article ID
pp. 764–772, 2008. 221802, 2008.
[66] E. Aasum, D. D. Belke, D. L. Severson et al., “Cardiac function [80] W. Rock, M. Rosenblat, R. Miller-Lotan, A. P. Levy, M. Elias, and
and metabolism in type 2 diabetic mice after treatment with M. Aviram, “Consumption of Wonderful variety pomegranate
juice and extract by diabetic patients increases paraoxonase [96] L. S. Adams, N. P. Seeram, B. B. Aggarwal, Y. Takada, D. Sand,
1 association with high-density lipoprotein and stimulates its and D. Heber, “Pomegranate juice, total pomegranate ellagitan-
catalytic activities,” Journal of Agricultural and Food Chemistry, nins, and punicalagin suppress inflammatory cell signaling in
vol. 56, no. 18, pp. 8704–8713, 2008. colon cancer cells,” Journal of Agricultural and Food Chemistry,
[81] S. Medjakovic and A. Jungbauer, “Pomegranate: a fruit that vol. 54, no. 3, pp. 980–985, 2006.
ameliorates metabolic syndrome,” Food & Function, vol. 194, no. [97] S. Shukla and S. Gupta, “Molecular mechanisms for apigenin-
1, pp. 19–39, 2013. induced cell-cycle arrest and apoptosis of hormone refractory
[82] A. Nakajima, K. Wada, K. Katayama et al., “Gene expression human prostate carcinoma DU145 cells,” Molecular Carcinogen-
profile after peroxisome proliferator activator receptor-𝛾 ligand esis, vol. 39, no. 2, pp. 114–126, 2004.
administration in dextran sodium sulfate mice,” Journal of [98] H. Matsuura, M. Sakaue, K. Subbaramaiah et al., “Regulation of
Gastroenterology, vol. 37, supplement 14, pp. 62–66, 2002. cyclooxygenase-2 by interferon 𝛾 and transforming growth fac-
[83] E. M. Carlisle, V. Poroyko, M. S. Caplan, J. A. Alverdy, and D. tor 𝛼 in normal human epidermal keratinocytes and squamous
Liu, “Gram negative bacteria are associated with the early stages carcinoma cells. Role of mitogen-activated protein kinases,”
of necrotizing enterocolitis,” PLoS ONE, vol. 6, no. 3, Article ID Journal of Biological Chemistry, vol. 274, no. 41, pp. 29138–29148,
e18084, 2011. 1999.
[84] M. J. Morowitz, V. Poroyko, M. Caplan, J. Alverdy, and D. C. Liu, [99] K. Subbaramaiah and A. J. Dannenberg, “Cyclooxygenase 2: a
“Redefining the role of intestinal microbes in the pathogenesis molecular target for cancer prevention and treatment,” Trends
of necrotizing enterocolitis,” Pediatrics, vol. 125, no. 4, pp. 777– in Pharmacological Sciences, vol. 24, no. 2, pp. 96–102, 2003.
785, 2010. [100] F. Afaq, M. Saleem, C. G. Krueger, J. D. Reed, and H. Mukhtar,
[85] C. M. M. W. Meijer, J. E. Degener, and G. Dzoljic Danilovic, “Anthocyanin- and hydrolyzable tannin-rich pomegranate fruit
“Quantitative study of the aerobic and anaerobic faecal flora extract modulates MAPK and NF-𝜅B pathways and inhibits
in neonatal necrotising enterocolitis,” Archives of Disease in skin tumorigenesis in CD-1 mice,” International Journal of
Childhood, vol. 58, no. 7, pp. 523–528, 1983. Cancer, vol. 113, no. 3, pp. 423–433, 2005.
[86] C. Hoy, M. R. Millar, P. MacKay, P. G. R. Godwin, V. Langdale, [101] S. Y. Schubert, E. P. Lansky, and I. Neeman, “Antioxidant and
and M. I. Levene, “Quantitative changes in faecal microflora eicosanoid enzyme inhibition properties of pomegranate seed
preceding necrotising enterocolitis in premature neonates,” oil and fermented juice flavonoids,” Journal of Ethnopharmacol-
Archives of Disease in Childhood, vol. 65, no. 10, pp. 1057–1059, ogy, vol. 66, no. 1, pp. 11–17, 1999.
1990. [102] T. Okamoto, T. Akuta, F. Tamura, A. van der Vliet, and T.
[87] V. Mai, C. M. Young, M. Ukhanova et al., “Fecal microbiota in Akaike, “Molecular mechanism for activation and regulation
premature infants prior to necrotizing enterocolitis,” PLoS ONE, of matrix metalloproteinases during bacterial infections and
vol. 6, no. 6, Article ID e20647, 2011. respiratory inflammation,” Biological Chemistry, vol. 385, no. 11,
[88] C. F. Coursodon-Boyiddle, C. L. Snarrenberg, C. K. Adkins- pp. 997–1006, 2004.
Rieck et al., “Pomegranate seed oil reduces intestinal damage [103] S. Ahmed, N. Wang, B. B. Hafeez, V. K. Cheruvu, and T. M.
in a rat model of necrotizing enterocolitis,” American Journal of Haqqi, “Punica granatum L. extracts inhibits IL-1𝛽-induced
Physiology, vol. 303, no. 6, pp. G744–G751, 2012. expression of matrix metalloproteinases by inhibiting the acti-
[89] A. Jemal, R. Siegel, E. Ward et al., “Cancer statistics, 2008,” CA vation of MAP kinases and NF-𝜅B in human chondrocytes in
Cancer Journal for Clinicians, vol. 58, no. 2, pp. 71–96, 2008. vitro,” Journal of Nutrition, vol. 135, no. 9, pp. 2096–2102, 2005.
[90] J. A. Eaden, K. R. Abrams, and J. F. Mayberry, “The risk of [104] D. Heber, “Multitargeted therapy of cancer by ellagitannins,”
colorectal cancer in ulcerative colitis: a meta-analysis,” Gut, vol. Cancer Letters, vol. 269, no. 2, pp. 262–268, 2008.
48, no. 4, pp. 526–535, 2001. [105] E. M. Conner and M. B. Grisham, “Inflammation, free radicals
[91] P. Munkholm, “Review article: the incidence and prevalence of and antioxidants,” Nutrition, vol. 12, no. 4, pp. 274–277, 1996.
colorectal cancer in inflammatory bowel disease,” Alimentary [106] Z. Rasheed, N. Akhtar, A. N. Anbazhagan, S. Ramamurthy,
Pharmacology and Therapeutics, vol. 18, supplement 2, pp. 1–5, M. Shukla, and T. M. Haqqi, “Polyphenol-rich pomegranate
2003. fruit extract (POMx) suppresses PMACI-induced expression
[92] M. Albrecht, W. Jiang, J. Kumi-Diaka et al., “Pomegranate of pro-inflammatory cytokines by inhibiting the activation of
extracts potently suppress proliferation, xenograft growth, and MAP kinases and NF-𝜅B in human KU812 cells,” Journal of
invasion of human prostate cancer cells,” Journal of Medicinal Inflammation, vol. 6, article 1, 2009.
Food, vol. 7, no. 3, pp. 274–283, 2004. [107] M. Larrosa, A. González-Sarrı́as, M. J. Yáñez-Gascón et al.,
[93] A. Malik and H. Mukhtar, “Prostate cancer prevention through “Anti-inflammatory properties of a pomegranate extract and
pomegranate fruit,” Cell Cycle, vol. 5, no. 4, pp. 371–373, 2006. its metabolite urolithin-A in a colitis rat model and the effect
of colon inflammation on phenolic metabolism,” Journal of
[94] A. Malik, F. Afaq, S. Sarfaraz, V. M. Adhami, D. N. Syed, and
Nutritional Biochemistry, vol. 21, no. 8, pp. 717–725, 2010.
H. Mukhtar, “Pomegranate fruit juice for chemoprevention and
chemotherapy of prostate cancer,” Proceedings of the National [108] M. Toi, H. Bando, C. Ramachandran et al., “Preliminary studies
Academy of Sciences of the United States of America, vol. 102, no. on the anti-angiogenic potential of pomegranate fractions in
41, pp. 14813–14818, 2005. vitro and in vivo,” Angiogenesis, vol. 6, no. 2, pp. 121–128, 2003.
[95] L. S. Meei, F. C. Kuo, J. S. Yen, W. L. Wan, Y. L. S. Shoei, and H. [109] H. Kohno, R. Suzuki, Y. Yasui, M. Hosokawa, K. Miyashita, and
L. Shing, “Activation of phosphoinositide 3-kinase in response T. Tanaka, “Pomegranate seed oil rich in conjugated linolenic
to inflammation and nitric oxide leads to the up-regulation of acid suppresses chemically induced colon carcinogenesis in
cyclooxygenase-2 expression and subsequent cell proliferation rats,” Cancer Science, vol. 95, no. 6, pp. 481–486, 2004.
in mesangial cells,” Cellular Signalling, vol. 17, no. 8, pp. 975–984, [110] C. Patel, P. Dadhaniya, L. Hingorani, and M. G. Soni, “Safety
2005. assessment of pomegranate fruit extract: acute and subchronic
toxicity studies,” Food and Chemical Toxicology, vol. 46, no. 8,

pp. 2728–2735, 2008.
[111] I. A. Meerts, C. M. Verspeek-Rip, C. A. Buskens et al., “Toxico-
logical evaluation of pomegranate seed oil,” Food and Chemical
Toxicology, vol. 47, no. 6, pp. 1085–1092, 2009.
[112] D. Heber, N. P. Seeram, H. Wyatt et al., “Safety and antioxidant
activity of a pomegranate ellagitannin-enriched polyphenol
dietary supplement in overweight individuals with increased
waist size,” Journal of Agricultural and Food Chemistry, vol. 55,
no. 24, pp. 10050–10054, 2007.
[113] M. Nagata, M. Hidaka, H. Sekiya et al., “Effects of pomegranate
juice on human cytochrome P450 2C9 and tolbutamide phar-
macokinetics in rats,” Drug Metabolism and Disposition, vol. 35,
no. 2, pp. 302–305, 2007.
[114] M. Hidaka, M. Okumura, K. I. Fujita et al., “Effects of
pomegranate juice on human cytochrome P450 3A (CYP3A)
and carbamazepine pharmacokinetics in rats,” Drug Metabolism
and Disposition, vol. 33, no. 5, pp. 644–648, 2005.
[115] A. Faria, R. Monteiro, I. Azevedo, and C. Calhau, “Pomegranate
juice effects on cytochrome p450s expression: in vivo studies,”
Journal of Medicinal Food, vol. 10, no. 4, pp. 643–649, 2007.
[116] H. Kim, Y. J. Yoon, J. H. Shon, I. J. Cha, J. G. Shin, and K. H.
Liu, “Inhibitory effects of fruit juices on CYP3A activity,” Drug
Metabolism and Disposition, vol. 34, no. 4, pp. 521–523, 2006.
[117] G. Klebe, “Virtual ligand screening: strategies, perspectives and
limitations,” Drug Discovery Today, vol. 11, no. 13-14, pp. 580–
594, 2006.
[118] P. Lu, R. Hontecillas, W. T. Horne et al., “Computational
modeling-based discovery of novel classes of anti-inflammatory
drugs that target lanthionine synthetase C-like protein 2,” PLoS
One, vol. 7, no. 4, Article ID e34643, 2012.
[119] B. K. Shoichet, “Virtual screening of chemical libraries,” Nature,
vol. 432, no. 7019, pp. 862–865, 2004.
[120] S. N. Lewis, J. Bassaganya-Riera, and D. R. Bevan, “Virtual
screening as a technique for PPAR modulator discovery,” PPAR
Research, vol. 2010, Article ID 861238, 10 pages, 2010.
http://dx.doi.org/10.1155/2013/247504
Research Article
Pomegranate Juice Metabolites, Ellagic Acid and
Urolithin A, Synergistically Inhibit Androgen-Independent
Prostate Cancer Cell Growth via Distinct Effects on Cell
Cycle Control and Apoptosis
Roberto Vicinanza, Yanjun Zhang, Susanne M. Henning, and David Heber

UCLA Center for Human Nutrition, David Geffen School of Medicine, University of California, Warren Hall,
900 Veteran Avenue 1-2-213, Los Angeles, CA 90095-1742, USA
Correspondence should be addressed to David Heber; dheber@mednet.ucla.edu
Received 21 November 2012; Accepted 19 February 2013
Copyright © 2013 Roberto Vicinanza et al. This is an open access article distributed under the Creative Commons Attribution
cited.
Ellagitannins (ETs) from pomegranate juice (PJ) are bioactive polyphenols with chemopreventive potential against prostate cancer
(PCa). ETs are not absorbed intact but are partially hydrolyzed in the gut to ellagic acid (EA). Colonic microflora can convert
EA to urolithin A (UA), and EA and UA enter the circulation after PJ consumption. Here, we studied the effects of EA and UA
on cell proliferation, cell cycle, and apoptosis in DU-145 and PC-3 androgen-independent PCa cells and whether combinations
of EA and UA affected cell proliferation. EA demonstrated greater dose-dependent antiproliferative effects in both cell lines
compared to UA. EA induced cell cycle arrest in S phase associated with decreased cyclin B1 and cyclin D1 levels. UA induced
a G2/M arrest and increased cyclin B1 and cdc2 phosphorylation at tyrosine-15, suggesting inactivation of the cyclin B1/cdc2 kinase
complex. EA induced apoptosis in both cell lines, while UA had a less pronounced proapoptotic effect only in DU-145. Cotreatment
with low concentrations of EA and UA dramatically decreased cell proliferation, exhibiting synergism in PC-3 cells evaluated by
isobolographic analysis and combination index. These data provide information on pomegranate metabolites for the prevention of
PCa recurrence, supporting the role of gut flora-derived metabolites for cancer prevention.
1. Introduction of 8 ounces of PJ significantly increased the PSA doubling

time, from 15 to 54 months, suggesting an inhibitory action
Prostate cancer (PCa) is the second most common cancer of PJ metabolites on PCa cell growth [6].
and the second leading cause of cancer-related death in men, PJ as well as pomegranate extract (PE) contains a family of
with over 300,000 cases diagnosed annually in the United several high molecular weight (ca.1000 Dalton) hydrolyzable
States [1] with an increasing incidence worldwide due to the tannins (e.g., punicalagin, punicalin) called ellagitannins
growth and aging of the global population [2]. Approximately (ETs) which have received increasing attention for their
30 percent of men treated for PCa with surgery or radiation potential as nontoxic chemopreventive dietary agents for
have evidence of recurrent disease, and in a subset of men, several malignancies, including PCa [7]. ETs are not absorbed
levels of prostate-specific antigen (PSA) continues to rise intact in the human gastrointestinal tract, but are hydrolyzed,
after treatment [3]. Under these circumstances, rising PSA generating different metabolites including ellagic acid (EA),
represents tumor growth, and men with shorter doubling which appears in the circulation between 30 minutes and
times of PSA value are presumed to have more rapidly 5 hours after consumption of PJ or PE [8, 9]. Through the
growing tumors [4, 5]. A phase II study examining the effects action of human colonic microflora, EA is partially converted
of pomegranate juice (PJ) in men with rising PSA following into metabolites including hydroxy-6H-benzopyran-6-one
surgery or radiation for PCa demonstrated that consumption derivatives, primarily urolithin A (UA) (Figure 1). EA and UA
OH
HO OH
OH
HO
O
O
O O
CH2
O
O O O OH
HO O O O
HO
OH O OH
OH
HO
OH
O OH
OH
HO
Punicalagins OH
OH OH
HO
O
O O
O O
O
OH
OH OH
Ellagic acid (EA) Urolithin A (UA)
Figure 1: Chemical structures of the major pomegranate ET, punicalagin (occurs as a pair of anomers hence referred to as punicalagins), and
its metabolites, EA and UA.
are both absorbed, transported in the blood, conjugated in decreased both activity and expression of tumor-specific
the liver, and excreted in glucuronidated form in the urine cytochrome P450, CYP1B1, in 22Rv1 PCa cells [19], while
between 12 and 56 hours after PJ consumption [10, 11]. EA induced apoptosis via a caspase-dependent pathway [15]
Accumulating experimental evidence has demonstrated and cell cycle arrest in G1 phase involving cyclin-dependent
that PE inhibits tumor angiogenesis [12], delays the transition kinase inhibitory protein p21 [20]. Furthermore, EA showed a
from androgen-dependent to androgen-independent pheno- selective antiproliferative activity for cancer cell lines without
type, and induces apoptosis through a nuclear factor-kB- affecting the viability of human non neoplastic cells [21, 22].
dependent mechanism in vitro and in tumor tissue excised Other in vitro studies demonstrated that specific compo-
from castrated severe combined immunodeficiency (SCID) nents of PJ inhibited both the growth and the migration
mice with Los Angeles Prostate Cancer-4 (LAPC-4) human of hormone-dependent and hormone-refractory PCa cell
PCa xenografts [13]. Previous in vitro studies have shown growth and their chemotaxis toward stromal cell-derived
that pomegranate metabolites, EA and UA, inhibited PCa factor 1𝛼 (SDF1𝛼) [23].
cell proliferation [14, 15] and affected multiple signaling Cell cycle progression is tightly regulated by different
pathways in several cell types [16–18]. For instance, UA cellular proteins which include the cyclin-dependent kinases
(CDKs) and their regulatory cyclin partners [24]. Like other at 72 hours by treating PC-3 cells with EA (from 1.875 to
forms of cancer, PCa tumor cells have acquired mutations 30 𝜇mol/L) and UA (from 5 to 180 𝜇mol/L). The tested con-
to genes that directly regulate the cell cycle, resulting in centrations were consistent with other in vitro studies [14, 15,
an unrestrained cell proliferation [25–28]. Indeed, loss or 21]. The amount of DMSO was normalized in all treatments.
attenuation of G2/M checkpoint, controlled by cyclin B1/cdc2 At the indicated time point, cells were kept for 30 minutes
(Cdk1) complex, has been shown to be closely involved at room temperature, and 100 𝜇L of the assay reagent was
in neoplastic transformation [24] and deregulated overex- added into each well. The content was mixed for 2 minutes
pression of cyclin D1 might be related to the evolution of using an orbital shaker to induce cell lysis. After 10 minutes
androgen-independent disease in PCa [29, 30]. Therefore, of incubation at room temperature, the luminescence was
treatment of tumor cells usually results in the breakdown read using a Microplate Reader (SpectraMax Gemini EM,
of the cell cycle machinery leading to the inhibition of Molecular Devices, Sunnyvale, CA, USA). The calculations
cell proliferation and induction of apoptosis. In order to for the IC40 and IC50 were then performed. Combination
improve our understanding on the mechanisms of action of effect was evaluated by determining the combination index
PJ metabolites in androgen-independent PCa cancer cells, the (CI) using the isobologram equation derived by Chou and
present in vitro study was designed to elucidate the effects Talalay [31]. In general, a CI value <0.9 indicates synergism, a
of EA and its main microflora-derived metabolite, UA, on value between 0.9 and 1.1 indicates additivity, and a CI value
cell proliferation, cell cycle distribution, apoptosis, and on the >1.1 indicates antagonism. In the isobologram, 𝐷1 and 𝐷2
expression of cell cycle-related control proteins. Furthermore, represent the doses of EA and UA alone required to produce
we examined the antiproliferative effect of cotreatment of EA the inhibition of cell growth by 40 percent (IC40 ), and 𝑑1 and
and UA to evaluate their potential synergistic, additive or 𝑑2 are the doses of EA and UA in combination required to
antagonistic interaction. produce the same effect (IC40 ). The area on the right side of
IC40 additive line represents the antagonist effect, while the
left side represents the synergic effect.
2. Materials and Methods
2.1. Chemicals and Antibodies. Ellagic acid was purchased 2.4. Protein Extraction and Western Blot Analysis. DU-145
from Sigma (St. Louis, MO, USA), while urolithin A was syn- and PC-3 were plated on 60 mm dishes in complete RPMI
thesized in our laboratory as described previously [9]. Both phenol-red-free medium. Cells were treated with different
chemicals were dissolved in DMSO and stored at −20∘ C. The concentrations of EA (15, 30, and 45 𝜇mol/L) or UA (30,
antibodies against cyclin B1, cyclin D1, p-cdc2 (Tyr.15), and 60, and 90 𝜇mol/L) for 48 and 72 hours. After treatment,
𝛽-actin were purchased from Cell Signaling (Beverly, MA, cells were washed with cold PBS, harvested, and cell lysates
USA). The CellTiter-Glo Luminescent Cell Viability Assay were prepared in RIPA buffer (50 mM Tris HCl pH 7.4,
kit was purchased from Promega Corporation (Madison, 150 mM NaCl, 2 mM EDTA, 1% Triton, and 0.1% SDS), con-
WI, USA). The Annexin V Cell Apoptosis Detection kit was taining protease inhibitors cocktail (1% v/v) (Sigma-Aldrich),
obtained from BD Pharmingen (San Diego, CA, USA). phosphatase inhibitors cocktail (1% v/v) (Sigma-Aldrich),
and 20 mM N-ethylmaleimide (Sigma-Aldrich), for 40 min at
2.2. Cell Culture. Androgen-independent PCa cell lines, DU- 4∘ C. Cell lysates were centrifuged for 10 minutes at 14,000 rpm
145 and PC-3, were obtained from American Type Culture at 4∘ C, and the supernatants were collected. Cell lysates were
Collection (ATCC, Manassas, VA, USA). Both cell lines analyzed for protein content by using BCA protein assay with
were maintained in RPMI-1640 medium complemented with bovine serum albumin as standard. Lysates were then mixed
10% fetal bovine serum, 2% L-glutamine, and 1% penicillin- with 4X LDS buffer (Invitrogen) and heated for 10 min at
streptomycin (Gibco-BRL, Frederick, MD, USA). Cells were 70∘ C.
used below passage 20, maintained at 37∘ C in a humidified A total of 55–65 𝜇g of whole-cell protein lysates was
5% CO2 at 37∘ C, and subcultured at 1 : 4 by trypsinization separated using 4–12% SDS-PAGE (NUPAGE, Invitrogen),
for 4 min at 37∘ C (Gibco-BRL). Before each experiment, cells transferred to PVDF membrane, and blocked for 1 hour in
were switched to complete RPMI phenol red-free medium, 5% milk in T-TBS, containing 0.1% Tween-20 (Sigma). The
and the control groups were treated with appropriate amount PVDF membranes were incubated overnight at 4∘ C with the
of DMSO. different primary antibodies in 5% milk in T-TBS and then
treated with specific horseradish peroxidase-conjugated anti-
rabbit or anti-mouse secondary antibodies. 𝛽-Actin was used
2.3. Cell Growth Inhibition Assay and Combination Data
as the internal loading control. Densitometric measurements
Analysis. Cell proliferation was determined using CellTiter-
of the bands in western blot analysis were performed using
Glo (ATP) assay (Promega) according to the manufacturer’s
Quantity One software (Bio-Rad).
instructions. Briefly, cells were seeded into 96-well opaque-
walled plates at a density of 12,000 cells per well in 100 𝜇L of
RPMI phenol red-free complete medium. After 24 hours, the 2.5. Cell Cycle Analysis. DU-145 and PC-3 cells were plated
medium was carefully removed and the cells were treated in in 100 mm dishes in red phenol-free RPMI complete medium
complete medium for 24, 48, 72, 96, and 120 hours with EA and treated with or without different concentrations of EA or
(from 15 to 60 𝜇mol/L), UA (from 15 to 90 𝜇mol/L) or DMSO UA for 48, 72, and 96 hours. Following 2 minutes incubation
only. The effects of cotreatments of EA and UA were evaluated in trypsin, both adherent and floating cells were collected.
A number of 1 × 106 cells were then spun down and washed These data indicate that PC-3 cells were more sensitive
once with cold PBS. Each pellet was resuspended in 500 𝜇L than DU-145 to EA treatments, while UA treatments exhib-
of hypotonic PI staining solution containing 0.1% (w/v) ited stronger antiproliferative effects in DU-145 compared to
sodium citrate, 0.3% (v/v) Triton X-100, 0.1 mg/mL PI, and PC-3 cells.
0.02 mg/mL ribonuclease A. Samples were kept in the dark
at 4∘ C for 20 minutes before acquisition. Acquisition was
3.2. EA and UA Induce Cell Cycle Arrest in S and G2/M Phases.
performed on a FACScan flow cytometer with CellQuest
The observed differences of EA and UA treatments on cell
software. A total of 20,000 events per sample were acquired.
proliferation suggested different mechanisms of action of
Data analysis was performed using ModFit LT software
these two compounds. By using FACScan flow cytometer,
(Verity Software House, Inc., Topsham, ME, USA).
we first investigated whether EA and UA could affect the
cell cycle. Following treatments with 30 and 45 𝜇mol/L
2.6. Detection of Apoptosis of EA for 72 hours, both DU-145 and PC-3 showed a
significant increase of cells in the S phase compared to the
2.6.1. Annexin V/PI Staining. DU-145 and PC-3 cells were DMSO control (DMSO control versus EA 30 𝜇mol/L, in
plated in 100 mm dishes in red phenol-free RPMI complete DU-145 cells, 17.10 ± 1.8% versus 30.7 ± 0.4%; in PC-3 cells,
medium and then treated with or without the different con- 5.7 ± 0.7% versus 29.8 ± 1.1%, both 𝑃 < 0.01 versus control).
centrations of EA (15, 30, and 45 𝜇mol/L) or UA (30, 60, and On the other hand, treatment with 60 and 90 𝜇mol/L of UA
90 𝜇mol/L) for 48 and 72 hours. After treatments, both adher- induced a significant cell accumulation in G2/M phase (UA
ents and floating cells were collected. A number of 1 × 106 cells 90 𝜇mol/L, in DU-145, 51.2 ± 2.8%; in PC-3 cells, 62.9 ± 2.6%,
were separated by centrifugation, and the pellet was washed both 𝑃 < 0.01 versus control (Figure 3)). The treatment with
once with cold PBS. Apoptotic cells were identified with EA resulted in a reduction in the percentage of cells in the G1
Annexin V-FITC and PI double staining, using the Annexin and G2, while UA resulted in a reduction in the percentage
V Cell Apoptosis Detection Kit, BD Pharmingen (San Diego, of cells in G1 and S phase. These events were observed at 48,
CA, USA), according to the manufacturer’s instructions. 72, and 96 hours indicating that the effects of EA and UA on
After staining, samples were incubated in the dark for 20 cell cycle persisted over 96 hours.
minutes at 4∘ C, and flow cytometric analysis was performed. In order to study the molecular mechanisms involved in
Data acquisition and analysis were performed with FACScan the observed effects of EA and UA on cell cycle, the changes
cytometer (Becton Dickinson, San Jose, CA, USA) using in cyclin D1, cyclin B1, and cdc2 phosphorylation at tyrosine-
CellQuest software. Cells in early stages of apoptosis were 15 were investigated by western blot. The activation of
Annexin V positive and PI negative, whereas cells in late cyclin B1/cdc2 complex (also called mitosis promoting factor
stages of apoptosis were both Annexin V and PI positive. (MPF)) is a necessary cell cycle step to promote the entrance
into mitosis from the G2 phase, and the cyclin B1/cdc2 com-
2.7. Statistical Analysis. All data are reported as mean ± SD plex is controlled by a series of reversible phosphorylations
and are representative of at least three independent experi- of cdc2 [32]. Phosphorylation of cdc2 at threonine-161 by
ments. Statistical analysis was performed using ANOVA and cdk-activating kinase (CAK) and dephosphorylation of cdc2
Tukey’s post hoc with Statistica software (Stat Soft Inc., Tulsa at tyrosine-15 by the cdc25C phosphatase are required for
OK, USA). The difference between groups was considered the MPF activation [33]. On the other hand, if tyrosine-15
statistically significant at 𝑃 < 0.05. phosphorylation of cdc2 by Wee/Mik1/Myt1 tyrosine kinases
occurs, MPF remains inactive leading to G2/M cell cycle
arrest [34, 35]. Following treatments for 48 and 72 hours,
3. Results at concentrations of 30, 60, and 90 𝜇mol/L, UA induced
cdc2 phosphorylation at tyrosine-15 and an accumulation of
3.1. EA and UA Differently Inhibit Cell Proliferation of DU-145
cyclin B1 (Figure 4(a)), consistent with the observed G2/M
and PC-3 Prostate Cancer Cells. The sensitivity of cell growth
cell cycle arrest. On the other hand, at concentrations of
inhibition in the presence of increasing concentrations of EA
15, 30, and 45 𝜇mol/L, EA treatments induced a decrease of
(from 15 to 60 𝜇mol/L) and UA (from 15 to 90 𝜇mol/L) was
cyclin B1 and cyclin D1 expression, consistent with S-phase
examined at 24, 48, 72, 96, and 120 hours in DU-145 and PC-
arrest, with no evidence of tyrosine-15 phosphorylation of
3, two androgen-independent PCa cell lines. The treatments
cdc2 (Figure 4(b)). Taken together, these data demonstrate
with EA and UA decreased cell growth in both cell lines in
that EA and UA have distinct effects on the modulation of
a time-dependent and dose-dependent manner (Figure 2).
cell cycle regulatory proteins leading to arrest the cell cycle in
However, the tested concentrations of EA and UA exhibited
two different phases.
differential effects in the two cell lines. Following treatments
with EA, the IC50 at 96 hours was 23.02±2.2 𝜇mol/L in DU145
cells, while in PC-3 the IC50 was obtained at a concentration 3.3. Effect of EA and UA on Apoptosis. We further examined
of 48.33 ± 1.2 𝜇mol/L at 48 hours, and 14.5 ± 1.5 𝜇mol/L at 96 the effect of EA and UA on apoptosis using the Annexin V-
hours (Figures 2(a) and 2(c)). Following treatments with UA, FITC/PI double staining method. Following treatments of
at 96 hours IC50 was 74.79 ± 2.4 𝜇mol/L (Figure 2(b)) in DU- DU-145 cells with 15, 30, and 45 𝜇mol/L of EA for 72 hours,
145 cells, while in PC-3 UA did not reach 50 percent inhibition the percentage of cells in early and late stages of apoptosis
of cell growth at the tested concentrations (Figure 2(d)). increased in a concentration-dependent manner, compared
120 120
DU-145 DU-145
100 100 ∗
∗ ∗ ∗
∗ ∗ ∗ ∗
∗
DMSO control (%)
DMSO control (%)

80 ∗ 80 ∗
∗ ∗ ∗
∗ ∗
60 60
40 ∗ 40 ∗
∗
∗
20 ∗ 20
∗
∗ ∗ ∗
0 0
0 15 30 45 60 75 0 15 30 45 60 75 90 105
Ellagic acid (𝜇M) Urolithin A (𝜇M)
24 h 96 h 24 h 96 h
48 h 120 h 48 h 120 h
72 h 72 h
(a) (b)
120 120
PC-3 PC-3
100 100 ∗
∗ ∗ ∗
∗
∗
DMSO control (%)
DMSO control (%)
80 ∗ 80 ∗
∗ ∗
60 ∗ ∗ 60 ∗
∗
40 ∗ ∗ 40
∗ ∗
∗
∗
20 ∗ 20
∗
0 0
0 15 30 45 60 75 0 15 30 45 60 75 90 105
Ellagic acid (𝜇M) Urolithin A (𝜇M)
24 h 96 h 24 h 96 h
48 h 120 h 48 h 120 h
72 h 72 h
(c) (d)
Figure 2: EA and UA inhibited proliferation of DU-145 and PC-3 cells. Cells were seeded into 96-well opaque-walled plates at a density of
12,000 cells. After 24 hours, cells were treated for 24, 48, 72, 96, and 120 with 0, 15, 30, 45, and 60 𝜇mol/L of EA or with 15, 30, 60, and 90 𝜇mol/L
of UA. Following treatments with EA, in DU-145 the IC50 at 96 hours was 23.02 ± 2.2 𝜇mol/L, while in PC-3 the IC50 was 48.33 ± 1.2 𝜇mol/L at
48 hours and 14.5 ± 1.5 𝜇mol/L at 96 hours (a, c). Following treatments with UA, in DU-145 the IC50 value at 96 hours was 74.79 ± 2.4 𝜇mol/L
(b), while in PC-3, UA did not inhibit the cell growth of 50 percent. Each experiment was performed in triplicate, and the results represented
the means ± SD; ∗ significantly different from DMSO control, 𝑃 < 0.05.
to control (DMSO control versus EA 45 𝜇mol/L, 7.14 ± 0.46% significant apoptosis (DMSO control versus UA 90 𝜇mol/L,
versus 38.82 ± 0.36%, 𝑃 < 0.001), while treatments of DU- 7.72% versus 5.72%, NS).
145 with 30, 60 and 90 𝜇mol/L of UA resulted in a less
pronounced proapoptotic activity compared to EA (Figure 5), 3.4. Cotreatment of EA and UA Synergistically Inhibit PC-
with no significant differences among the tested concentra- 3 Cell Proliferation. Since EA and UA caused a different
tions (DMSO control versus UA 90 𝜇mol/L, 7.14 ± 0.46% cell cycle and apoptosis responses, we further investigated
versus 14.24 ± 0.9, 𝑃 < 0.01). In PC-3 cells, EA treatment the combination of different doses of UA and EA on PC-3
resulted in a significantly increased number of apoptotic cell proliferation seeking evidence of a synergistic, additive,
cells only at the highest concentration tested (DMSO control or antagonistic interaction. We first evaluated the effect of
versus EA 45 𝜇mol/L, 16.05 versus 5.89 ± 0.23%, 𝑃 < 0.01), increased concentrations of UA (from 15 to 180 𝜇mol/L)
while the highest concentration tested of UA did not cause alone or in combination with 7.5 𝜇mol/L of EA at 72 hours.
PC-3 (72 h)
DMSO control Ellagic acid Urolithin A
×102 2
×10 30 𝜇M ×10 2
45 𝜇M
2
×10 60 𝜇M ×102 90 𝜇M
G1: 81.8% G1: 57.8% G1: 62.2% G1: 45.6% G1: 28.9%
12 S: 5.7% 8 S: 29.8% 10 S: 24.1% 5 S: 12.1% 5 S: 8.2%
G2/M: 12.5% G2/M: 12.4% G2/M: 13.7% G2/M: 42.3% G2/M: 62.9%
Number
Number
Number
Number
8 4 4
Number
9 6
6 3 3
6 4
4 2 2
3 2 2 1 1
0 0 0 0 0
0 30 60 90 120 150 0 30 60 90 120 150 0 30 60 90 120 150 0 30 60 90 120 150 0 30 60 90 120 150
Channels (FL2-A) Channels (FL2-A) Channels (FL2-A) Channels (FL2-A) Channels (FL2-A)
DU-145 (72 h)
DMSO control Ellagic acid Urolithin A
×102 ×102 30 𝜇M ×102 45 𝜇M ×102 60 𝜇M ×102 90 𝜇M
G1: 74.5% 5 G1: 67.2% 5 G1: 67.3% 5 G1: 42.9% G1: 38.9%
8 2.8
S: 17.1% S: 30.7% S: 31% S: 18.2% S: 9.9%
Number
4 4 4
Number
Number
Number
G2/M: 8.4% G2/M: 2.1% G2/M: 1.7% G2/M: 38.9% G2/M: 51.2%
Number
6 2.1
3 3 3
4 1.4
2 2 2
2 1 1 1 0.7
0 0 0 0 0
0 30 60 90 120 150 0 30 60 90 120 150 0 30 60 90 120 150 0 30 60 90 120 0 30 60 90 120 150
Channels (FL2-A) Channels (FL2-A) Channels (FL2-A) Channels (FL2-A) Channels (FL2-A)
(a)
90 90 90
DU-145 DU-145 DU-145
80 80 80
Relative cell population (%)

70 70 70
60 60 60 #
50 50 50 #
40 40 40 #
∗
30 30 30
20 20 20
10 10 10
0 0 0
48 h 72 h 96 h 48 h 72 h 96 h 48 h 72 h 96 h
Control/DMSO Ellagic acid (30 𝜇M) Urolithin A (90 𝜇M)
G1 G1 G1
S S S
G2/M G2/M G2/M
(b)
Figure 3: EA and UA induce cell cycle arrest in S and G2/M phases. Representative flow cytometry histograms of cell cycle alterations at 72 h
treatments of PC-3 and DU-145 with EA (30 and 45 𝜇mol/L) and UA (60 and 90 𝜇mol/L) (a). Effects of 30 𝜇mol/L EA and 90 𝜇mol/L UA on
cell cycle at 48, 72, and 96 h, expressed as the mean of three experiments ± SD of relative cell population (%) (b); ∗ significantly different from
S-phase in DMSO/control at 72 h, 𝑃 < 0.01; X significantly different from S phase in DMSO/control at 96 h, 𝑃 < 0.01; # significantly different
from G2/M phase in DMSO/control at 48, 72, and 96 h, 𝑃 < 0.01.
As showen in the Figure 6(a), none of the tested doses with UA was 40 percent at a concentration of 158 𝜇mol/L,
of UA induced the IC50 . However, treatments with low we used the IC40 for the isobolographic analysis of synergy
concentrations of EA and UA in combination significantly rather than the typical IC50 . Therefore, the IC40 was calculated
decreased cell proliferation compared to control, as well as and the synergistic effect was evaluated using isobolographic
compared to the individual doses of EA and UA (Figure 6(a)). analysis. The results of the isobologram equation, using three
Furthermore, PC-3 cells were treated for 72 hours with different concentrations of EA and UA, each dose inhibiting
different concentrations of EA (from 1.875 to 30 𝜇mol/L) and PC-3 cell growth by 40 percent (IC40 ), demonstrated a
UA (5 to 180 𝜇mol/L), alone or in combination. Since the synergistic inhibitory interaction of EA and UA as shown in
maximal inhibition of cell growth in PC-3 cells achieved the Figure 6(b), with a mean of three CI equal to 0.658 ± 0.05.
48 h 72 h 48 h 72 h
UA (𝜇M) 0 30 60 90 0 30 60 90 MW EA (𝜇M) 0 15 30 45 0 15 30 45 MW
p-cdc2 (Tyr.15) 34 p-cdc2 (Tyr.15) 34
Cyclin B1 60 Cyclin B1 60
Cyclin D1 36 Cyclin D1 36
𝛽-actin 45 𝛽-actin 45
(a) (b)
6
Cyclin B1
5 72 h
12
Densitometry (a.u.)
4
p-cdc2 (Tyr.15) ∗∗
10 72 h
3
∗∗
Densitometry (a.u.)
8
2
6
1
∗
4
0
Ellagic acid 0 15 30 45
2 (𝜇M)
Urolithin A 0 30 60 90
(𝜇M)
0
0 30 60 90 Ellagic acid
Urolithin A (𝜇M) Urolithin A
(c) (d)
Figure 4: Effect of EA and UA on protein expression of cell cycle regulatory molecules. DU-145 cells were cultured as described Section 2
and treated with 30, 60, and 90 𝜇mol/L of UA or with 0, 15, 30, and 45 𝜇mol/L of EA (b) for 48 and 72 hours. Representative western blots
from 3 independent experiments showing the different effects of EA and UA on cyclin B1, Cyclin D1, and phospho-cdc2 at Tyrosin-15 (a, b).
Quantification of bands was performed by densitometric analysis (c, d). Data are reported as mean of three independent experiments ± S.D;
∗
significantly different from DMSO/control, 𝑃 < 0.01; ∗∗ significantly different from DMSO/control, 𝑃 < 0.001.
4. Discussion investigations. The ET have multiple targets of action in

PCa including NF-𝜅B activation, angiogenesis, and androgen
PJ as well as PE contains hydrolyzable ETs which act to inhibit synthesis [12, 13, 37]. Therefore, similar to other botanicals,
cancer cell growth [36]. These ETs, when ingested, are the biological activity does not result from a single ET but
hydrolyzed rapidly in the intestine and lead to a rise in is the product of multiple tannins found in the natural
EA in the blood that begins 30 minutes after consumption product. In turn, these ETs have multiple effects. However,
and lasts several hours [8, 9]. EA is partially converted in the ingested and absorbed ETs are not the only potential
the intestine into other bioactive metabolites, including UA source of biological activity. As with soy isoflavones and green
which is metabolized by phase II enzymes and excreted in tea, the metabolic products of gut bacterial metabolism also
human urine for up to 48 hours after consumption of PJ demonstrate antiproliferative activity in cancer cells [38–40].
[8, 10, 11]. In an animal model, following oral administration The possibility of a synergy between ingested PJ phy-
of synthesized UA, high levels of UA were detected in mouse tochemicals and metabolites of the microbiome is a novel
prostate tissue [14] suggesting a potential role of UA for concept not previously explored and inspired the present
prostate health. However, the bioavailability and metabolism analysis of the antiproliferative actions of EA and its major
of ET metabolites present in pomegranate, as well as in metabolite UA.
other fruits, are dependent on colonic microflora, and full In this work, we demonstrated that EA and UA both
understanding of these variables is the subject of ongoing inhibit androgen-independent PCa cell proliferation in
104 PC-3 5.72% 104 EA 45 16.34% 104 UA 90 7.72%

DMSO (CT)
103 103 103
FL2-H
FL2-H
FL2-H
102 102 102

101 101 101
0
100 10 100
0 1 2 3 4 0 1 2 3 4
10 10 10 10 10 10 10 10 10 10 100 101 102 103 104 Apoptotic cells (%) PC-3 DU-145
PI
FL1-H FL1-H FL1-H

CT 5.89 ± 0.23 7.14 ± 0.46
104 DU-145 7.14%
104 EA 45 38.82%
104 UA 90 14.3%
14.3
3%
DMSO (CT) 15 7.22 ± 0.18 23.79 ± 1.87
103 103 103 Ellagic acid
30 12.39 ± 0.88 26.3 ± 0.46
FL2-H
FL2-H
FL2-H
102 102 102 (𝜇mol/L)

45 16.05 ± 0.41 38.82 ± 0.36
101 101 101
30 5.36 ± 0.14 13.03 ± 0.92
100 100 100
Urolithin A
10 0
10 1 2
10 10 3
10 4
10 0
10 1
10 10 2 3
10 4
10 0
10 1 2
10 10 3
10 4 60 9.05 ± 1.28 13.82 ± 0.16
(𝜇mol/L)
FL1-H FL1-H FL1-H 90 7.7 ± 0.39 14.24 ± 0.90
Annexin V
(a) (b)
𝑃 < 0.001
40 40
35 PC-3 35 DU-145
30 30
Apoptotic cells (%)
Apoptotic cells (%)
25 25
𝑃 < 0.01 ns
20 20
∗
15 15 ∗ ∗
10 10
5 5
0 0
CT 15 30 45 30 60 90 CT 15 30 45 30 60 90
Ellagic acid Urolithin A Ellagic acid Urolithin A
(𝜇mol/L) (𝜇mol/L) (𝜇mol/L) (𝜇mol/L)
(c)
Figure 5: Effect of UA and EA on apoptosis. PC-3 and DU-145 cells were cultured to 85% of confluence in 100 mm dishes and treated with
increasing concentrations of EA or with UA for 72 hours. Adherent and floating cells were collected. Cells were double stained with Annexin
V/PI and subjected to flow cytometry assay. Representative Annexin V/PI flow cytometry of PC-3 and DU-145 treated with DMSO control,
EA 45 𝜇mol/L, and UA 90 𝜇mol/L (a). Percentage of apoptotic cells of PC-3 and DU-145 treated for 72 hours with 15, 30, and 45 𝜇mol/L of EA
or with 30, 60, and 90 𝜇mol/L of UA (b, c). The data are mean ± SD of three independent experiments; ∗ significantly different from DMSO
control, 𝑃 < 0.01.
a time- and dose-dependent manner. However, the mech- with virtually no effect on apoptosis, while, in addition to
anisms of action of UA and EA were characterized by their cell cycle arrest in S phase, EA also exhibited a significant
ability to modulate different intracellular molecular targets, pro-apoptotic activity in both cell lines with a greater effect
ultimately inducing a distinct effect on cell cycle control in DU-145. In fact, treatments of DU-145 with 45 𝜇mol/L
and apoptosis. G1/S and G2/M checkpoints are key steps to of EA for 72 hours induced 38.82 ± 0.36% of apoptosis
modulate the passage of cells through the cell cycle and a (versus control 7.14 ± 0.46%), while in PC-3 the percentage
loss in these checkpoints is critical for the carcinogenesis of apoptotic cells was 16.05 ± 0.41% (versus control
process [41, 42]. Our experiments showed that UA induced 5.89 ± 0.23%) as shown by Annexin V/PI double staining.
cell cycle arrest in G2/M phase as a predominant mechanism This difference in apoptotic response between these two
120
PC-3
100 ∗ 𝑃 < 0.001 14 𝐷
DMSO control (%)
∗ 1
80 12
∗ ns ∗
∗ ∗ CI = 0.658 ± 0.05
60 ∗ IC40
∗ 10
Ellagic acid (𝜇M)

IC50
40 ∗ ∗ ∗ ∗ ∗ 8 (A)
20 6
0 4 𝑑1 (B)
Urolithin A 0 15 30 60 90 150 180 15 30 60 90 150 180 0
(𝜇M) (C)
Ellagic acid 7.5 𝜇M 2
𝑑2 𝐷2
UA 0
UA + EA 7.5 𝜇M 0 20 40 60 80 100 120 140 160 180
EA 7.5 𝜇M Urolithin A (𝜇M)
(a) (b)
Figure 6: Synergistic effect of EA and UA on proliferation in PC-3 cells. Cells were seeded into 96-well opaque-walled plates at a density of
12,000 cells. After 24 hours, cells were treated for 72 h with 15, 30, 60, 90, 150, and 180 𝜇mol/L of UA or with 7.5 𝜇mol/L alone or in combination
(a). The data are mean ± SD of three experiments; ∗ significantly different from DMSO/control, 𝑃 < 0.01; X significantly different from EA
7.5 𝜇mol/L, 𝑃 < 0.001. Isobologram analysis of the effect of cotreatments of three concentrations of EA and UA, and mean of their combination
index (CI) calculating using the classic isobologram equation derived by Chou and Talalay. In the isobologram, 𝐷1 and 𝐷2 represent the doses
of EA (𝐷1 ) and UA (𝐷2 ) alone, required to produce the IC40 , and 𝑑1 and 𝑑2 are the doses of EA and UA in combination required to produce
the same effect (IC40 ). The area on the left side of IC40 additive line represents a synergistic effect (b).
cell lines likely represents the underlying difference in their studies demonstrating that other dietary botanical agents,
molecular components as showen by previous in vitro studies such as apigenin and sulforaphane, inhibit the cyclin B1/cdc2
demonstrating that DU-145 and PC-3 respond differently to complex by increasing phosphorylation of cdc2 despite
the proapoptotic stimulus, even though both DU-145 and elevated levels of cyclin B1 [49, 50]. On the other hand,
PC-3 are androgen-independent cell lines [43, 44]. Skjøth consistent with the accumulation of cells in S phase, EA
and Issinger suggested that an impairment of PTEN/AKT decreased the expression of cyclin D1 and cyclin B1, with
pathway, together with low p38MAP kinase, found in PC-3 no evidence of increased levels of cdc2 phosphorylation at
cells, could be responsible for the observed resistance of tyrosine-15. Cyclin D1, together with its binding partners
PC-3 cells to the induction of apoptosis, whereas a functional CDK4 and CDK6, promote cell cycle progression [51, 52], but
PTEN/AKT pathway, as found in DU145, would facilitate recent studies demonstrated that cyclin D1 may also function
the entry of cells into apoptosis [44]. Molecular analysis as transcriptional modulator by regulating the activity of
of selected cell cycle regulatory proteins showed that the several transcription factors independently of CDK4 activity
effects of UA and EA on G2/M and S phases were associated [53]. The overexpression of Cyclin D1 is a common event in
with a different expression kinetics of cell cycle regulatory cancer cells and can be caused either by a gene amplification
molecules such as cyclin D1, cyclin B1, and phosphorylation or by a defective regulation at the posttranslational level
of cdc2 at tyrosine-15. During the G2/M checkpoint, cdc2 [54, 55].
binds to cyclin B1 forming the cyclin B1/cdc2 complex Therefore, the importance of cyclin D1 in cancer makes
which is the principal enzymatic activity responsible it an attractive target for chemoprevention, and several natu-
for the initiation of mitosis [45, 46]. However, the complex rally derived compounds may induce cyclin D1 degradation
formation is not sufficient to regulate the initiation of mitosis. in cancer cells [56].
Dephosphorylation of cdc2 at the tyrosine-15 site through These effects of EA and UA on cell cycle control and apop-
cdc25c phosphatase is a crucial event for activation of this tosis might therefore explain the different antiproliferative
complex while cdc2 phosphorylation at tyrosine-15 induces activity of individual doses of EA and UA, as well as the
its inactivation [47, 48]. In our experiments, we demonstrated synergistic effect of low concentrations of EA and UA in
that accumulation of cells at G2/M phase by UA treatments combination in PC-3 cells.
for 48 and 72 hours was associated with a persistent increase In fact, as shown in Figure 6(a), 7.5 𝜇mol/L of EA com-
in cdc2 phosphorylation at tyrosine-15 strongly suggesting bined with 15 𝜇mol/L of UA finally induced cell growth
the inhibition of cyclin B1/cdc2 complex and therefore the inhibition of 50 percent, while none of the tested doses of
arrest in the G2 phase. This was also confirmed by the UA induced the IC50 . The potential synergistic effect between
presence of cyclin D1 protein expression, which is commonly EA and UA was further investigated and confirmed by the
accumulated in G2 phase, maintained in G1, and suppressed isobolographic analysis and by the calculation of the CI which
in S phase [49, 50]. Our results are congruent with previous was less than 0.9 (0.658 ± 0.05) as shown in Figure 6(b).
5. Conclusions References
In a phase II clinical trial, PJ led to a prolongation of doubling [1] A. Jemal, R. Siegel, J. Xu, and E. Ward, “Cancer statistics, 2010,”
time of rising serum PSA in men with recurrent PCa, CA Cancer Journal for Clinicians, vol. 60, no. 5, pp. 277–300,
consistent with a direct effect of PJ metabolites on PCa cell 2010.
growth [3]. [2] J. Ferlay, H. R. Shin, F. Bray et al., GLOBOCAN, 2008, Cancer
The interpretation of increased serum PSA levels is Incidence and Mortality Worldwide: IARC CancerBase No. 10,
complicated by potential origin of PSA from both normal International Agency for Research on Cancer, Lyon, France,
2010.
cells and PCa cells, while a rising PSA level confirmed over
several months in men with recurrent PCa derives exclusively [3] M. Han, A. W. Partin, C. R. Pound, J. I. Epstein, and P. C. Walsh,
“Long-term biochemical disease-free and cancer-specific sur-
from PC cells, and PSA levels are used as an indicator
vival following anatomic radical retropubic prostatectomy: the
of disease progression [57]. The complex nature of human 15-year Johns Hopkins experience,” Urologic Clinics of North
PCa and the lack of clear biomarkers make primary pre- America, vol. 28, no. 3, pp. 555–565, 2001.
vention studies of nutrition interventions extremely difficult. [4] S. Sengupta, R. P. Myers, J. M. Slezak, E. J. Bergstralh, H. Zincke,
Therefore, the challenge in the prevention of PCa recurrence and M. L. Blute, “Preoperative prostate specific antigen dou-
is the inhibition of androgen-independent tumor growth bling time and velocity are strong and independent predictors of
after primary treatment. However, because of the diversity outcomes following radical prostatectomy,” Journal of Urology,
of advanced PCa and its capacity to adapt to changing vol. 174, no. 6, pp. 2191–2196, 2005.
conditions, targeting a single pathway may not ensure long- [5] A. V. D’Amico, M. H. Chen, K. A. Roehl, and W. J. Catalona,
term effects since PCa cells may activate surrogate kinases “Preoperative PSA velocity and the risk of death from prostate
or alternative pathways. In turn, cancer cells may develop cancer after radical prostatectomy,” New England Journal of
resistance to targeted inhibitors. Consequently, inhibition of Medicine, vol. 351, no. 2, pp. 125–202, 2004.
multiple pathways may be an encouraging strategy to avoid [6] A. J. Pantuck, J. T. Leppert, N. Zomorodian et al., “Phase II
adverse effects connected with target redundancy. study of pomegranate juice for men with rising prostate-specific
In the present study, we report that PJ metabolites antigen following surgery or radiation for prostate cancer,”
inhibit cell proliferation of PCa cells through two distinct Clinical Cancer Research, vol. 12, no. 13, pp. 4018–4026, 2006.
mechanisms of action, and they may interact synergistically [7] D. Heber, “Multitargeted therapy of cancer by ellagitannins,”
to inhibit androgen-independent PCa cell growth. This syn- Cancer Letters, vol. 269, no. 2, pp. 262–268, 2008.
ergism suggests that the potential chemopreventive source [8] N. P. Seeram, S. M. Henning, Y. Zhang, M. Suchard, Z. Li, and D.
of PJ may also be deriveed from the products of gut flora Heber, “Pomegranate juice ellagitannin metabolites are present
metabolism which can further amplify the antiproliferative in human plasma and some persist in urine for up to 48 hours,”
Journal of Nutrition, vol. 136, no. 10, pp. 2481–2485, 2006.
effects of specific bioactive components contained in PJ.
Furthermore, our results provide additional insight into the [9] N. P. Seeram, Y. Zhang, R. McKeever et al., “Pomegranate juice
and extracts provide similar levels of plasma and urinary ellag-
mechanisms of action of PJ metabolites for the prevention of
itannin metabolites in human subjects,” Journal of Medicinal
PCa recurrence. Food, vol. 11, no. 2, pp. 390–394, 2008.
[10] B. Cerdá, P. Periago, J. C. Espı́n, and F. A. Tomás-Barberán,
“Identification of urolithin A as a metabolite produced by
Abbreviations human colon microflora from ellagic acid and related com-
EA: Ellagic Acid pounds,” Journal of Agricultural and Food Chemistry, vol. 53, no.
ET: Ellagitannins 14, pp. 5571–5576, 2005.
PJ: Pomegranate juice [11] S. U. Mertens-Talcott, P. Jilma-Stohlawetz, J. Rios, L. Hingorani,
PE: Pomegranate Extract and H. Derendorf, “Absorption, metabolism, and antioxidant
PCa: Prostate Cancer effects of pomegranate (Punica granatum L.) polyphenols after
ingestion of a standardized extract in healthy human volun-
UA: Urolithin A.
teers,” Journal of Agricultural and Food Chemistry, vol. 54, no.
23, pp. 8956–8961, 2006.
[12] M. R. Sartippour, N. P. Seeram, J. Y. Rao et al., “Ellagitannin-rich
Acknowledgments pomegranate extract inhibits angiogenesis in prostate cancer in
vitro and in vivo,” International Journal of Oncology, vol. 32, no.
The authors’ responsibilities were as follows: Roberto Vic- 2, pp. 475–480, 2008.
inanza performed the study design, the cell culture exper- [13] M. B. Rettig, D. Heber, J. An et al., “Pomegranate extract inhibits
iments, and data and statistical analysis and prepared the androgen-independent prostate cancer growth through a nuc-
manuscript; Yanjun Zhang performed the preparation of lear factor-kappaB-dependent mechanism,” Molecular Cancer
chemical reagents; Susanne M. Henning participated in the Therapeutics, vol. 7, pp. 2662–2671, 2008.
preparation of the manuscript; David Heber participated in [14] N. P. Seeram, W. J. Aronson, Y. Zhang et al., “Pomegranate
the study design, discussion of the results, and preparation ellagitannin-derived metabolites inhibit prostate cancer growth
of the manuscript. The authors would like to thank Narine and localize to the mouse prostate gland,” Journal of Agricultural
Abgarayan for the assistance for the cell culture experiments. and Food Chemistry, vol. 55, no. 19, pp. 7732–7737, 2007.
This study was supported in part by “Fondazione Roma [15] A. Malik, S. Afaq, M. Shahid, K. Akhtar, and A. Assiri, “Influ-
Sapienza.” ence of ellagic acid on prostate cancer cell proliferation:
a caspase-dependent pathway,” Asian Pacific Journal of Tropical [32] W. G. Dunphy, “The decision to enter mitosis,” Trends in Cell
Medicine, vol. 4, no. 7, pp. 550–555, 2011. Biology, vol. 4, no. 6, pp. 202–207, 1994.
[16] A. González-Sarrı́as, J. C. Espı́n, F. A. Tomás-Barberán, and [33] D. Desai, H. C. Wessling, R. P. Fisher, and D. O. Morgan, “Effects
M. T. Garcı́a-Conesa, “Gene expression, cell cycle arrest and of phosphorylation by CAK on cyclin binding by CDC2 and
MAPK signalling regulation in Caco-2 cells exposed to ellagic CDK2,” Molecular and Cellular Biology, vol. 15, no. 1, pp. 345–
acid and its metabolites, urolithins,” Molecular Nutrition and 350, 1995.
Food Research, vol. 53, no. 6, pp. 686–698, 2009.
[34] N. J. Wells, N. Watanabe, T. Tokusumi, W. Jiang, M. A. Verdecia,
[17] M. Edderkaoui, I. Odinokova, I. Ohno et al., “Ellagic acid and T. Hunter, “The C-terminal domain of the Cdc2 inhibitory
induces apoptosis through inhibition of nuclear factor 𝜅B in kinase Myt1 interacts with Cdc2 complexes and is required for
pancreatic cancer cells,” World Journal of Gastroenterology, vol. inhibition of G2/M progression,” Journal of Cell Science, vol. 112,
14, no. 23, pp. 3672–3680, 2008. no. 19, pp. 3361–3371, 1999.
[18] T. M. Li, G. W. Chen, C. C. Su et al., “Ellagic acid induced
[35] N. Watanabe, M. Broome, and T. Hunter, “Regulation of the
p53/p21 expression, G1 arrest and apoptosis in human bladder
human WEE1Hu CDK tyrosine 15-kinase during the cell cycle,”
cancer T24 cells,” Anticancer Research A, vol. 25, no. 2, pp. 971–
EMBO Journal, vol. 14, no. 9, pp. 1878–1891, 1995.
979, 2005.
[19] S. G. Kasimsetty, D. Bialonska, M. K. Reddy, C. Thornton, K. [36] N. P. Seeram, L. S. Adams, S. M. Henning et al., “In vitro
L. Willett, and D. Ferreira, “Effects of pomegranate chemical antiproliferative, apoptotic and antioxidant activities of puni-
constituents/intestinal microbial metabolites on CYP1B1 in calagin, ellagic acid and a total pomegranate tannin extract are
22Rv1 prostate cancer cells,” Journal of Agricultural and Food enhanced in combination with other polyphenols as found in
Chemistry, vol. 57, no. 22, pp. 10636–10644, 2009. pomegranate juice,” Journal of Nutritional Biochemistry, vol. 16,
no. 6, pp. 360–367, 2005.
[20] B. A. Narayanan, O. Geoffroy, M. C. Willingham, G. G. Re, and
D. W. Nixon, “p53/p21(WAF1/CIP1) expression and its possible [37] M. Y. Hong, N. P. Seeram, and D. Heber, “Pomegranate polyphe-
role in G1 arrest and apoptosis in ellagic acid treated cancer nols down-regulate expression of androgen-synthesizing genes
cells,” Cancer Letters, vol. 136, no. 2, pp. 215–221, 1999. in human prostate cancer cells overexpressing the androgen
[21] J. N. Losso, R. R. Bansode, A. Trappey, H. A. Bawadi, and receptor,” Journal of Nutritional Biochemistry, vol. 19, no. 12, pp.
R. Truax, “In vitro anti-proliferative activities of ellagic acid,” 848–855, 2008.
Journal of Nutritional Biochemistry, vol. 15, no. 11, pp. 672–678, [38] T. D. Lund, C. Blake, L. Bu, A. N. Hamaker, and E. D. Lep-
2004. hart, “IEquol an isoflavonoid: potential for improved prostate
[22] A. Rocha, L. Wang, M. Penichet et al., “Pomegranate juice health, in vitro and in vivo evidence,” Reproductive Biology and
and specific components inhibit cell and molecular processes Endocrinology, vol. 9, p. 4, 2011.
critical for metastasis of breast cancer,” Breast Cancer Research [39] K. Gao, A. Xu, C. Krul et al., “Of the major phenolic acids
and Treatment, vol. 136, no. 3, pp. 647–658, 2012. formed during human microbial fermentation of tea, citrus,
[23] L. Wang, J. Ho, C. Glackin et al., “Specific pomegranate juice and soy flavonoid supplements, only 3,4-dihydroxyphenylacetic
components as potential inhibitors of prostate cancer metasta- acid has antiproliferative activity,” Journal of Nutrition, vol. 136,
sis,” Translational Oncology, vol. 5, no. 5, pp. 344–355, 2012. no. 1, pp. 52–57, 2006.
[24] K. Vermeulen, D. R. Van Bockstaele, and Z. N. Berneman, “The [40] S. M. Henning, P. Wang, N. Abgaryan et al., “Phenolic acid
cell cycle: a review of regulation, deregulation and therapeutic concentrations in plasma and urine from men consuming green
targets in cancer,” Cell Proliferation, vol. 36, no. 3, pp. 131–149, or black tea and potential chemopreventive properties for colon
2003. cancer,” Molecular Nutrition & Food Research, vol. 57, no. 3, pp.
[25] S. P. Balk and K. E. Knudsen, “AR, the cell cycle, and prostate 483–493, 2013.
cancer,” Nuclear Receptor Signaling, vol. 6, p. e001, 2008. [41] R. G. Syljuåsen, B. Krolewski, and J. B. Little, “Loss of normal G1
[26] E. K. Han, J. T. Lim, N. Arber et al., “Cyclin D1 expression in checkpoint control is an early step in carcinogenesis, indepen-
human prostate carcinoma cell lines and primary tumors,” dent of p53 status,” Cancer Research, vol. 59, no. 5, pp. 1008–1014,
Prostate, vol. 35, no. 2, pp. 95–101, 1998. 1999.
[27] M. T. Park and S. J. Lee, “Cell cycle and cancer,” Journal of Bio- [42] Y. Wang, P. Ji, J. Liu, R. R. Broaddus, F. Xue, and W. Zhang,
chemistry and Molecular Biology, vol. 36, no. 1, pp. 60–65, 2003. “Centrosome-associated regulators of the G2/M checkpoint as
[28] R. D. Mashal, S. Lester, C. Corless et al., “Expression of cell cycle- targets for cancer therapy,” Molecular Cancer, vol. 8, p. 8, 2009.
regulated proteins in prostate cancer,” Cancer Research, vol. 56,
[43] B. Karaca, Y. Kucukzeybek, G. Gorumlu et al., “Profiling
no. 18, pp. 4159–4163, 1996.
of angiogenic cytokines produced by hormone- and drug-
[29] M. Drobnjak, I. Osman, H. I. Scher, M. Fazzari, and C. Cordon- refractory prostate cancer cell lines, PC-3 and DU-145 before
Cardo, “Overexpression of cyclin D1 is associated with meta- and after treatment with gossypol,” European Cytokine Network,
static prostate cancer to bone,” Clinical Cancer Research, vol. 6, vol. 19, no. 4, pp. 176–184, 2008.
no. 5, pp. 1891–1895, 2000.
[44] I. H. E. Skjøth and O. G. Issinger, “Profiling of signaling mole-
[30] Y. Chen, L. A. Martinez, M. LaCava, L. Coghlan, and C. J. Conti,
cules in four different human prostate carcinoma cell lines
“Increased cell growth and tumorigenicity in human prostate
before and after induction of apoptosis,” International Journal
LNCaP cells by overexpression to cyclin D1,” Oncogene, vol. 16,
of Oncology, vol. 28, no. 1, pp. 217–229, 2006.
no. 15, pp. 1913–1920, 1998.
[31] T. C. Chou, “Theoretical basis, experimental design, and com- [45] D. O. Morgan, “Principles of CDK regulation,” Nature, vol. 374,
puterized simulation of synergism and antagonism in drug no. 6518, pp. 131–134, 1995.
combination studies,” Pharmacological Reviews, vol. 58, no. 3, [46] R. Ohi and K. L. Gould, “Regulating the onset of mitosis,”
pp. 621–681, 2006. Current Opinion in Cell Biology, vol. 11, no. 2, pp. 267–273, 1999.
[47] P. R. Mueller, T. R. Coleman, A. Kumagai, and W. G. Dunphy,

“Myt1: a membrane-associated inhibitory kinase that phospho-
rylates Cdc2 on both threonine-14 and tyrosine-15,” Science, vol.
270, no. 5233, pp. 86–90, 1995.
[48] D. J. Lew and S. Kornbluth, “Regulatory roles of cyclin depen-
dent kinase phosphorylation in cell cycle control,” Current
Opinion in Cell Biology, vol. 8, no. 6, pp. 795–804, 1996.
[49] V. Baldin, J. Lukas, M. J. Marcote, M. Pagano, and G. Draetta,
“Cyclin D1 is a nuclear protein required for cell cycle progres-
sion in G1,” Genes and Development, vol. 7, no. 5, pp. 812–821,
1993.
[50] D. W. Stacey, “Three observations that have changed our under-
standing of cyclin D1 and p27Kip1 in cell cycle control,” Genes
and Cancer, vol. 1, no. 12, pp. 1189–1199, 2011.
[51] J. Kato, H. Matsushime, S. W. Hiebert, M. E. Ewen, and C.
J. Sherr, “Direct binding of cyclin D to the retinoblastoma
gene product (pRb) and pRb phosphorylation by the cyclin D-
dependent kinase CDK4,” Genes and Development, vol. 7, no. 3,
pp. 331–342, 1993.
[52] A. S. Lundberg and R. A. Weinberg, “Functional inactivation
of the retinoblastoma protein requires sequential modification
by at least two distinct cyclin-cdk complexes,” Molecular and
Cellular Biology, vol. 18, no. 2, pp. 753–761, 1998.
[53] O. Coqueret, “Linking cyclins to transcriptional control,” Gene,
vol. 299, no. 1-2, pp. 35–55, 2002.
[54] C. Gillett, V. Fantl, R. Smith et al., “Amplification and overex-
pression of cyclin D1 in breast cancer detected by immunohisto-
chemical staining,” Cancer Research, vol. 54, no. 7, pp. 1812–1817,
1994.
[55] A. Russell, M. A. Thompson, J. Hendley, L. Trute, J. Armes, and
D. Germain, “Cyclin D1 and D3 associate with the SCF complex
and are coordinately elevated in breast cancer,” Oncogene, vol.
18, no. 11, pp. 1983–1991, 1999.
[56] J. P. Alao, “The regulation of cyclin D1 degradation: roles in can-
cer development and the potential for therapeutic invention,”
Molecular Cancer, vol. 6, p. 24, 2007.
[57] S. G. Roberts, M. L. Blute, E. J. Bergstralh, J. M. Slezak, and H.
Zincke, “PSA doubling time as a predictor of clinical progres-
sion after biochemical failure following radical prostatectomy
for prostate cancer,” Mayo Clinic Proceedings, vol. 76, no. 6, pp.
576–581, 2001.
http://dx.doi.org/10.1155/2013/940830
Research Article
Pomegranate Supplementation Improves Affective and Motor
Behavior in Mice after Radiation Exposure
Melissa S. Dulcich and Richard E. Hartman

Behavioral Neuroscience Laboratory, Department of Psychology, School of Behavioral Health, Loma Linda University, Suite 106, 11130
Anderson Street, Loma Linda, CA 92350, USA
Correspondence should be addressed to Richard E. Hartman; behavioralneuroscience@gmail.com
Received 28 December 2012; Accepted 4 March 2013
Copyright © 2013 M. S. Dulcich and R. E. Hartman. This is an open access article distributed under the Creative Commons
properly cited.
Currently, NASA has plans for extended space travel, and previous research indicates that space radiation can have negative effects
on cognitive skills as well as physical and mental health. With long-term space travel, astronauts will be exposed to greater radiation
levels. Research shows that an antioxidant-enriched diet may offer some protection against the cellular effects of radiation and may
provide significant neuroprotection from the effects of radiation-induced cognitive and behavioral skill deficits. Ninety-six C57BL/6
mice (48 pomegranate fed and 48 control) were irradiated with proton radiation (2 Gy), and two-month postradiation behaviors
were assessed using a battery of behavioral tests to measure cognitive and motor functions. Proton irradiation was associated with
depression-like behaviors in the tail suspension test, but this effect was ameliorated by the pomegranate diet. Males, in general,
displayed worse coordination and balance than females on the rotarod task, and the pomegranate diet ameliorated this effect.
Overall, it appears that proton irradiation, which may be encountered in space, may induce a different pattern of behavioral deficits
in males than females and that a pomegranate diet may confer protection against some of those effects.
1. Introduction numerous health benefits to humans [5, 6]. Foods contain-

ing phytochemicals have been shown to ameliorate cogni-
Astronauts have traveled outside Earth’s atmosphere into tive and behavioral deficits resulting from various diseases
lower Earth orbit and beyond for decades. However, these [7, 8]. These findings have often been attributed to the
individuals are constantly exposed to ionizing radiation that antioxidant, antiapoptotic, and anti-inflammatory properties
may have deleterious effects on motor and cognitive abilities, of phytochemicals [9]. Some fruits, for example, contain
as well as physical and mental health [1, 2] via increased polyphenols that can impart extensive protective properties
oxidative stress [3, 4]. With plans to extend space travel against damage from oxidative stress, neuroinflammation,
beyond lower Earth orbit for longer durations (i.e., manned and cognitive/behavioral deficits induced by radiation and/or
expeditions to Mars), radiation exposure will increase. A aging [10–12].
diet rich with polyphenols (which have antioxidant and Pomegranates (Punica granatum) have a high polyphenol
other biologically beneficial properties) may confer enough concentration, and the juice may have 2-3 times greater
protection to maintain the complex cognitive and fine motor antioxidant capacity compared to other antioxidant sources
skills required by astronauts. such as red wine or green tea [13–22]. Pomegranate
Phytochemicals, including the phenols, terpenes, and polyphenols include flavonoids (i.e., quercetin) and tannins
organosulfurs, are nonnutritive, bioactive compounds com- (i.e., punicalagins and ellagitannins). Flavonoids and tannins
monly found in plants and animals and are known for have specifically been shown to decrease oxidative stress by
their protective properties. Phytochemicals not only protect deactivating reactive oxygen species [19] and scavenging
the plants that produce them against metabolic and envi- free radicals [19, 22]. Although these isolated pomegranate
ronmental disease but also, when consumed, can provide polyphenols have antioxidant properties when acting
individually, research suggests that the whole range of 2.1. Water Maze Testing for Spatial Learning and Memory. The
polyphenols found in pomegranates combines synergistically water maze is the standard test of learning and memory abili-
to prevent oxidative stress-induced damage. Indeed, one ties in rodents [23, 24]. This test of spatial navigation requires
study analyzing the antiapoptotic properties of pomegranate the animal to learn the location of a hidden (submerged)
juice found the whole juice to be more effective than any one platform in a pool of water using visual cues from around
isolated component [18]. Furthermore, pomegranate juice the room. The water maze consisted of a metal pool (110 cm
has been found to ameliorate both amyloid-𝛽 plaque load as diameter) filled with water made opaque with white tempera
well as associated spatial learning deficits in a mouse model paint. The pool contained a round platform (11 cm diameter)
for Alzheimer’s disease [23]. that the animal could step on to escape the water. For each
Altogether, this evidence suggests that the polyphe- trial, an animal was released nose against the wall into the
nols found in pomegranates could provide an effective pool at one of four release points and allowed to swim to
therapy against radiation-induced neurological and cogni- the platform. The animals were given 10 trials per day. All
tive/behavioral deficits. No studies to date have looked at the trials lasted a maximum of 60 s. When an animal did not find
radioprotective effects of pomegranate antioxidants; however, the platform in the allotted 60 s, the experimenter manually
the evidence indicates that antioxidants may be beneficial guided the mouse to the platform. An overhead camera
in ameliorating the negative effects of ionizing radiation. recorded the animals’ swim paths by a computerized tracking
Therefore, this study explores the putative protective effects system (Noldus Ethovision), allowing for quantification of
of pomegranate juice on radiation-induced cognitive and distance, latency, proximity to target, and swimming speed.
behavioral deficits. Each animal received 10 trials on four consecutive days,
making a total of 40 trials per animal. Trials were performed
in blocks of 5 each day (2 trials per block), with approximately
2. Methods 30 min intervals between blocks. As performance improves,
escape latency and swim path length generally decrease.
Male and female C57BL/6 mice (4-month old) were obtained
from Charles River laboratory and housed approximately 3– 2.2. Cued Water Maze. This is a control task for assessing
6 per cage. All mice were maintained on a 12-hour light/dark sensorimotor and/or motivational deficits that could affect
schedule and fed standard rodent chow ad libitum. All performance during the spatial phase. For this phase, the
animals were treated in accordance with the requirements of surface of the escape platform was visible (1 cm above the
the National Institutes of Health Guide for the Care and Use surface of the water), and a pole was placed on top of
of Laboratory Animals, as well as the specifications stipulated the platform to make its location even more obvious. The
by the Loma Linda University Institutional Animal Care and platform’s location varied from trial to trial. The animals were
Use Committee. released into the pool opposite to the location of the platform
Male and female mice were separated into the following and were allowed to remain on the platform for 5 s.
groups: pomegranate/no pomegranate, radiation/no radia-
tion (yielding a total of 8 groups). Forty-eight animals were
started on a diluted pomegranate juice diet and continued 2.3. Spatial Water Maze. For this task, the surface of the
on this diet throughout the experiment. Pomegranate juice escape platform was submerged 1 cm below the surface of
(PomWonderful) was purchased from local grocery stores the opaque water, so the mouse had to find the platform
and kept refrigerated at 4∘ C throughout the experiment. The based on its relationship to the spatial cues rather than direct
juice was diluted 1 : 20 with filtered water and administered visualization. The location of the platform changed each day
through the animal’s water bottles. The amount of polyphe- for 3 days. After finding the platform, the animals were
nols that each mouse consumed per day was estimated to be allowed to remain on it for 5 s. At the beginning of the next
∼0.6 mg, which is roughly equivalent on a mg/kg basis to a day, the animals were given a “probe” trial in which the
human drinking two 8-ounce glasses of PJ per day. Forty- platform was removed from the water maze, and the animal
eight animals received sugar water that mimicked the sugar was allowed to search the pool for 60 s. The amount of time
content of the diluted PJ. spent searching the probe quadrant was measured, as well as
After three weeks, the mice were subjected to irradiation the total number of times that the animal crossed over the
or sham treatment. Half of the mice were placed into well- former location of the platform. An hour later, the platform
ventilated acrylic boxes and irradiated with a whole body was placed back into the pool in its new location, and the next
radiation beam of proton radiation (150 MeV/n) at a dose set of 10 trials was administered.
of 2 Gy for 5 minutes at the Loma Linda University Protons
Treatment Facility. The sham treatment animals were placed 2.4. Elevated Zero Maze Testing for Anxiety-Like Behaviors.
in the boxes for an amount of time equivalent to that of The elevated zero maze consisted of a plastic ring, 100 cm
the radiation group, but no radiation was administered. The outer diameter, 10 cm wide, with 35 cm walls enclosing 2
mice were not anesthetized, but movement was limited to opposing quadrants and elevated off the floor. The room lights
comfortable breathing during proton irradiation. Eight weeks were dimmed and halogen lights directly illuminated the
after irradiation, the mice were subjected to a battery of open spaces of the maze. Animals were initially placed in the
behavioral tests designed to assess a wide variety of cognitive center of one of the open spaces, and their activity was mon-
and motor functions over a 2-week time span. itored for the duration of five minutes. The percent amount
Tail suspension test counted as immobile even if it was still swinging back and
160 ∗ ∗
forth from a previous struggle but was now completely still in
140 its voluntary movements. The animal was also rated immobile
if it was curled up, appearing to rest while holding its front
Time spent immobile (s) ± SEM
120 paws to its back paws, but was not currently struggling or
moving.
100
80 2.7. Rotarod Testing for Sensorimotor Coordination/Balance.

The accelerating rotarod (Columbus Instruments) is a test of
60
sensorimotor coordination and balance. It consisted of a 3 cm
40 diameter rotating horizontal cylinder. The mouse was placed
onto the cylinder and had to continuously walk forward to
20 avoid falling. Latency to fall off was the dependent variable.
Performance over days of testing was a measure of motor
Control Pomegranate learning. The mice were tested every other day for 3 days.
Three blocks of 2 consecutive trials were administered per
Sham day: 2 stationary trials (at 5 RPM steady), 2 trials that started
Radiation at 5 RPM and accelerated by 3 RPM every 5 s, and 2 trials that
started at 5 RPM and increased by 3 RPM every 3 seconds.
Figure 1: Proton radiation was associated with increased Each steady trial lasted up to 60 s, and each accelerating trial
depression-like behaviors and pomegranate juice ameliorated lasted up to 120 s. There was approximately from 45 minutes
that effect; ∗ 𝑃 < .03. to an hour between trials.
2.8. Statistical Analyses. All statistical analyses were carried

of time spent within an enclosed space was calculated. Each out using SPSS. A mixed design ANOVA with 3 between-
animal received 2 trials, with the 2nd trial being conducted subjects variables (gender, pomegranate, and radiation) and
48 hours after the 1st. 1 repeated measure (test day) was conducted on behavioral
data. To control for sphericity and compound symmetry
2.5. Open Field Testing for General Activity Levels/Movement due to repeated measures in the test day (10 trials), the
Patterns. In the open field test, animals were placed in a Huynh-Feldt correction to the degrees of freedom was used
49 cm × 36 cm opaque open-topped plastic bin and allowed to determine the 𝑃 value. When appropriate, univariate
to explore for the duration of thirty minutes while the move- ANOVAs were used. An 𝛼 level of 0.05 was used for all
ments of each animal were recorded by an overhead camera tests of statistical significance. An a priori power analysis was
and analyzed by a computerized tracking system (Noldus conducted using G∗ Power 3.1 to determine the number of
Ethovision). Various parameters were analyzed, including animals necessary per group to reach a minimum power of
the distance the animal moved and the percent time spent 80% [27].
moving. Each animal received 2 trials, with the 2nd trial being
conducted 48 hours after the 1st.
3. Results
2.6. Tail Suspension Testing for Depression-Like Behaviors. In There were no effects of radiation or pomegranate treatment
the tail suspension test, mice were suspended by the tail with for the water maze (cued and spatial learning). The most
adhesive tape that was attached approximately 1 cm from the striking interaction between radiation and pomegranate
tip of the tail. The other end of the tape was wrapped around treatment on behavior was observed in the tail suspension
a hook embedded in the center of the ceiling of a wooden test (Figure 1), which provides an assessment of depression-
box measuring 19 cm × 21 cm and 40 cm in height. When like behaviors. Irradiated control-fed mice exhibited more
suspended, the animal’s rostral end was approximately 20 cm depression-like behaviors (i.e., the mice gave up sooner) than
from the floor of the device. The box was enclosed on all nonirradiated control-fed mice, but radiation did not have
sides except one (for viewing), and the room lighting and this effect on pomegranate-fed mice (𝐹(1, 82) = 4.92, 𝑃 <
sound were kept to a minimum in order to diminish visual .03). There was no difference in the performance of males
and acoustical disturbances. In addition, the nature of the box versus females on this test.
kept each animal visually isolated. While the mouse tried to Radiation and pomegranate treatment had gender-
escape its position, two assistants blinded to treatment group specific effects in the elevated zero maze test (Figure 2), which
individually rated the mouse on immobility and agitation for provides an assessment of anxiety-like behaviors through
the duration of 6 minutes. The time that the animal remained exploration of an anxiety-provoking environment (𝐹(1, 82) =
immobile during the final 4 minutes of a 6-minute duration 9.19, 𝑃 < .004). Overall, pomegranate-treated mice spent
was recorded [25]. Each animal received one 6-minute trial. more time in the dark quadrants compared to control-treated
Immobility was operationally defined as a complete lack of mice (𝐹(1, 82) = 7.12, 𝑃 < 0.01). Normal (nonirradiated
movement on the part of the mouse [26]. The animal was control fed) females spent more time hiding in the dark
Zero maze-radiation Zero maze-sham

100 100
90 ∗ ∗
90
Time spent in dark (±SEM) (%)
Time spent in dark (±SEM) (%)

80 80
70 70
60 60
50 50
40 40
30 30
20 20
10 10
Control Pomegranate Control Pomegranate
Male Male
Female Female
(a) (b)
Figure 2: Control females spent more time in the dark than control males (suggesting heightened anxiety). (a) Radiation induced more
exploration of the open quadrants in females (suggesting reduced anxiety and/or abnormal exploratory behavior), but this effect was blocked
by pomegranate. (b) Interestingly, radiation did not affect males’ performance, but pomegranate consumption in nonirradiated males induced
behavior similar to those of females; ∗ 𝑃 < 0.004.
quadrants than normal males (𝐹(1, 82) = 7.67, 𝑃 < 0.008), that measure the latency for an animal to stop struggling in an
suggesting heightened anxiety in females as compared to inescapable situation are often used to measure depression-
males. Radiation induced more exploration of the open like behaviors in animal models [26]. Other studies have
quadrants in females, suggestive of abnormally low anxiety also reported the amelioration of depression-like behavior
and/or an abnormal increase in exploratory behavior. This in animals receiving pomegranate treatment. Pomegranate
effect of radiation in females was blocked by the pomegranate extract successfully reduced depression-like behaviors in
treatment. However, both radiation and pomegranate treat- mice demonstrating ovariectomy-induced depression-like
ment induced more time spent hiding in the dark quadrants symptoms [28]. In addition, pomegranate seed extract
for male mice, and thus more female-like behavior. The effect was found to decrease depression-like behaviors similar to
of pomegranate on these behaviors in males was attenuated imipramine (an antidepressant drug) treatment in young and
by radiation exposure. old mice [29].
Radiation had no effect on rotarod performance, which Depression is associated with increased oxidative stress
provides an assessment of sensorimotor coordination and and decreased antioxidant enzyme activity, leading to sub-
balance. In general, males performed more poorly (fell off sequent DNA damage [30]. Furthermore, depression may
more quickly) than females (𝐹(1, 82) = 4.15, 𝑃 < .05). occur in response to neuroinflammation, increased oxidative
Pomegranate treatment improved the performance of males stress, decreased neurogenesis, and/or increased apopto-
to that of females (Figure 3), although it did not further sis [4]. Specifically, radiation-induced suppression of hip-
improve the performance of females (𝐹(1, 82) = 4.20, 𝑃 < pocampal neurogenesis in rodents has led to depression-like
.05). Finally, radiation had no effect on the open field test, behavior [31], suggesting that the incidence of depression
which provides an assessment of overall activity levels and may increase with radiation exposure and its associated
patterns. Pomegranate treatment, however, increased the oxidative stress induction. Thus, the antioxidant and anti-
total distance traveled for male mice, but not female mice inflammatory properties of pomegranate may have blocked
(𝐹(8.75, 708.94) = 2.23, 𝑃 < 0.03; Figure 4). this effect of radiation on depression-like behaviors.
This study also demonstrated gender specific differences
in anxiety-like behaviors and some interesting interactions
4. Discussion of radiation and pomegranate juice. Control females demon-
strated greater anxiety-like behaviors compared to control
The purpose of this study was to explore the putative males on the zero maze test, spending more time in the
protective effects of pomegranate juice on radiation-induced dark enclosed quadrants. Other studies have also shown
behavioral deficits in both male and female mice. Indeed, that C57BL/6 female mice spend more time in the dark
our findings demonstrated that mice exposed to radiation enclosed arms of the elevated plus maze compared to males
displayed more depression-like behaviors than nonirradiated [32, 33]. The elevated plus maze is a test of anxiety-like
mice but that pomegranate juice blocked this deficit. Tests behavior for mice and is analogous to the elevated zero maze.
25 Rotarod radiation attenuated this effect, leading to reduced anxiety-

like behaviors in mice, thus suggesting a direct connection
∗ between hippocampal neurogenesis and anxiety [34]. It is
20
Latency to fall (s) ± SEM
possible that the antioxidant and anti-inflammatory effects

of pomegranate may have ameliorated deleterious effects of
15 radiation on hippocampal neurogenesis in our female mice.
Dietary polyphenols have actually been shown to stimulate
10 neurogenesis in the hippocampus [35, 36]. Interestingly,
polyphenols found in green tea dose-dependently produced
an anxiolytic effect on mice, reducing the amount of time
5 spent in the enclosed areas of the elevated-plus maze [37].
Our findings also demonstrated that pomegranate juice
treatment led to gender-specific behavioral changes even in
Control Pomegranate the absence of radiation-induced deficits. Although radiation
had no detectable effects on sensorimotor coordination and
Male balance, females performed significantly better than males on
Female the rotarod task [33]. Pomegranate treatment improved the
rotarod performance of males to that of females. Again, even
Figure 3: Radiation did not affect rotarod performance. Males fell
though radiation had no effect on the open field test, which
off the rotating beam faster than females, but pomegranate treatment
improved their performance to that of females; ∗ 𝑃 < 05. provides an assessment of overall activity levels and patterns,
pomegranate treatment increased the total distance traveled
for male mice, but not female mice, suggesting an effect
on exploratory behaviors. Interestingly, most of the gender-
850 Open field
specific effects of pomegranate treatment functioned to make
800 the performance of males more similar to the performance of
females. Such an effect might be explained by the presence of
Distance traveled (cm) ±SEM
750 phytoestrogens in pomegranates [38, 39].

700 We did not detect a significant effect of radiation or
pomegranate treatment on spatial learning and memory as
650 measured by the water maze, but this is consistent with the
600 literature on spatial learning and proton irradiation. One
study measured male rats irradiated with a proton beam at
550 0, 1.5, 3, and 4 Gy and did not see any behavioral differences
500 in spatial learning and memory at any dose [40]. This is
in contrast to research on heavy atomic nuclei and high
450 energy level particle (HZE) radiation. Even low doses of HZE,
400 such as 56-Fe, have been shown to cause spatial learning
1 2 3 4 5 6 7 8 9 10 deficits in the water maze [41]. Furthermore, these deficits
3 min time increments have been ameliorated by antioxidants found in fruits such
as strawberries and blueberries [41], suggesting that HZE
Control
Pomegranate particle radiation may cause more extensive hippocampal
damage via oxidative stress than proton radiation and that
Figure 4: Radiation had no effect on the open field test. antioxidants may be protective against radiation-induced
Pomegranate treatment increased the total distance traveled for male hippocampal damage.
mice, but not female mice (data shown only for males); ∗ 𝑃 < 0.03.
5. Conclusion
Interestingly, radiation induced more exploration of the open
quadrants (suggesting abnormally low anxiety levels and/or Our findings suggest that pomegranate therapy may provide
increased risky behavior) in the female mice of our study. protection against radiation-induced changes in affective
Pomegranate treatment blocked this effect of radiation on behaviors, and some of these effects may be gender specific.
female behavior. Both radiation and pomegranate treatment Furthermore, pomegranates may provide gender specific
increased hiding in the enclosed quadrants for male mice, benefits to sensorimotor coordination. Our findings thus
and pomegranate treatment seemed to induce a “female-like” highlight the importance of understanding gender differ-
behavioral response in males. ences in the effects of radiation as well as pomegranate
One study reported that exercise-induced elevated levels treatment. Women have been part of the space program since
of hippocampal neurogenesis were correlated with increased its inception and comprise ∼11% of the astronauts who have
anxiety-like behavior on the O-maze (analogous to the flown in space. Previous research has demonstrated that radi-
zero maze), the open field, and dark/light box, but that ation affects males and females somewhat differently; specific
Radiation
particles
Reactive
DNA damage oxygen
species
Suppressed
Apoptosis Vascular damage Inflammation
neurogenesis
Neuroprotective Antioxidant Provascular (NOS) Anti-inflammatory
Pomegranate
Figure 5: Pomegranates may protect the brain (and therefore behavior) from the effects of radiation by a number of potential mechanisms.
Particles can strike DNA, causing damage and apoptosis. Particles can also strike water molecules, generating reactive oxidative species that
cause inflammation, vascular damage, and suppressed neurogenesis. Pomegranate’s neuroprotective, antioxidant, anti-inflammatory, and
provascular (via nitric oxide synthase) properties may protect against these effects.
health issues for space travel highlight gender differences intracellular targets,” European Journal of Pharmacology, vol.
in bone loss, orthostatic response, and disease risk, indi- 545, no. 1, pp. 51–64, 2006.
cating differential effects of the space environment on men [6] S. L. Albarracin, B. Stab, Z. Casas et al., “Effects of natural
and women [42–44]. Altogether, pomegranate consumption antioxidants in neurodegenerative disease,” Nutritional Neuro-
seems to induce beneficial effects, and the possible underlying science, vol. 15, no. 1, pp. 1–9, 2012.
mechanisms should be explored to better understand their [7] S. Kumar, K. K. Maheshwari, and V. Singh, “Protective effects of
putative benefits (Figure 5). Punica granatum seeds extract against aging and scopolamine
induced cognitive impairments in mice,” African Journal of
Traditional, Complementary and Alternative Medicines, vol. 6,
Conflict of Interests no. 1, pp. 49–56, 2009.
The authors have no conflict of interests with any of the [8] F. E. Harrison, A. H. Hosseini, S. M. Dawes, S. Weaver, and J.
M. May, “Ascorbic acid attenuates scopolamine-induced spatial
companies mentioned in this paper.
learning deficits in the water maze,” Behavioural Brain Research,
vol. 205, no. 2, pp. 550–558, 2009.
References [9] R. L. Blaylock and J. Maroon, “Natural plant products and
extracts that reduce immunoexcitotoxicity-associated neurode-
[1] M. Jahanshahi, A. K. Khoshnazar, N. S. Azami, and M. Hei- generation and promote repair within the central nervous
dari, “Radiation-induced lowered neurogenesis associated with system,” Surgical Neurology International, vol. 3, article 19, 2012.
shortened latency of inhibitory avoidance memory response,”
[10] J. A. Joseph, B. Shukitt-Hale, and F. C. Lau, “Fruit polyphenols
Folia Neuropathologica, vol. 49, no. 2, pp. 103–108, 2011.
and their effects on neuronal signaling and behavior in senes-
[2] J. A. Joseph, S. Erat, and B. M. Rabin, “CNS effects of heavy cence,” Annals of the New York Academy of Sciences, vol. 1100,
particle irradiation in space: behavioral implications,” Advances pp. 470–485, 2007.
in Space Research, vol. 22, no. 2, pp. 209–216, 1998.
[11] F. C. Lau, B. Shukitt-Hale, and J. A. Joseph, “The beneficial
[3] S. Baluchamy, Y. Zhang, P. Ravichandran et al., “Differential effects of fruit polyphenols on brain aging,” Neurobiology of
oxidative stress gene expression profile in mouse brain after Aging, vol. 26, no. 1, supplement, pp. S128–S132, 2005.
proton exposure,” In Vitro Cellular and Developmental Biology— [12] J. A. Joseph, N. A. Denisova, D. Bielinski, D. R. Fisher, and
Animal, vol. 46, no. 8, pp. 718–725, 2010. B. Shukitt-Hale, “Oxidative stress protection and vulnerability
[4] M. Maes, M. Kubera, E. Obuchowiczwa, L. Goehler, and J. in aging: putative nutritional implications for intervention,”
Brzeszcz, “Depression’s multiple comorbidities explained by Mechanisms of Ageing and Development, vol. 116, no. 2-3, pp.
(neuro)inflammatory and oxidative & nitrosative stress path- 141–153, 2000.
ways,” Neuroendocrinology Letters, vol. 32, no. 1, pp. 7–24, 2011. [13] M. Aviram, L. Dornfeld, M. Rosenblat et al., “Pomegranate juice
[5] C. Ramassamy, “Emerging role of polyphenolic compounds in consumption reduces oxidative stress, atherogenic modifica-
the treatment of neurodegenerative diseases: a review of their tions to LDL, and platelet aggregation: studies in humans and in
atherosclerotic apolipoprotein E-deficient mice,” The American [26] L. Steru, R. Chermat, B. Thierry, and P. Simon, “The tail
Journal of Clinical Nutrition, vol. 71, no. 5, pp. 1062–1076, 2000. suspension test: a new method for screening antidepressants in
[14] M. Kaplan, T. Hayek, A. Raz et al., “Pomegranate juice sup- mice,” Psychopharmacology, vol. 85, no. 3, pp. 367–370, 1985.
plementation to atherosclerotic mice reduces macrophage lipid [27] J. Cohen, Statistical Power Analysis for the Behavioral Sciences,
peroxidation, cellular cholesterol accumulation and develop- Routledge, London, UK, 2nd edition, 1998.
ment of atherosclerosis,” Journal of Nutrition, vol. 131, no. 8, pp. [28] J. Mori-Okamoto, Y. Otawara-Hamamoto, H. Yamato, and
2082–2089, 2001. H. Yoshimura, “Pomegranate extract improves a depressive
[15] M. Aviram, M. Rosenblat, D. Gaitini et al., “Pomegranate juice state and bone properties in menopausal syndrome model
consumption for 3 years by patients with carotid artery stenosis ovariectomized mice,” Journal of Ethnopharmacology, vol. 92,
reduces common carotid intima-media thickness, blood pres- no. 1, pp. 93–101, 2004.
sure and LDL oxidation,” Clinical Nutrition, vol. 23, no. 3, pp. [29] S. Kumar, K. K. Maheshwari, and V. Singha, “Central nervous
423–433, 2004. system activity of acute administration of ethanol extract of
[16] O. Rozenberg, A. Howell, and M. Aviram, “Pomegranate juice Punica granatum L. seeds in mice,” Indian Journal of Experimen-
sugar fraction reduces macrophage oxidative state, whereas tal Biology, vol. 46, no. 12, pp. 811–816, 2008.
white grape juice sugar fraction increases it,” Atherosclerosis, vol. [30] M. Maes, B. Leonard, A. Fernandez et al., “(Neuro)inflam-
188, no. 1, pp. 68–76, 2006. mation and neuroprogression as new pathways and drug targets
in depression: from antioxidants to kinase inhibitors,” Progress
[17] F. de Nigris, S. Williams-Ignarro, L. O. Lerman et al., “Beneficial
in Neuro-Psychopharmacology and Biological Psychiatry, vol. 35,
effects of pomegranate juice on oxidation-sensitive genes and
no. 3, pp. 659–663, 2011.
endothelial nitric oxide synthase activity at sites of perturbed
shear stress,” Proceedings of the National Academy of Sciences [31] J. S. Snyder, A. Soumier, M. Brewer, J. Pickel, and H. A.
of the United States of America, vol. 102, no. 13, pp. 4896–4901, Cameron, “Adult hippocampal neurogenesis buffers stress
2005. responses and depressive behaviour,” Nature, vol. 476, no. 7361,
pp. 458–461, 2011.
[18] N. P. Seeram, L. S. Adams, S. M. Henning et al., “In vitro
[32] X. L. An, J. X. Zou, R. Y. Wu et al., “Strain and sex differences
antiproliferative, apoptotic and antioxidant activities of puni-
in anxiety-like and social behaviors in C57Bl/6J and BALB/cJ
calagin, ellagic acid and a total pomegranate tannin extract are
mice,” Experimental Animals, vol. 60, no. 2, pp. 111–123, 2011.
enhanced in combination with other polyphenols as found in
pomegranate juice,” The Journal of Nutritional Biochemistry, vol. [33] R. E. Hartman, J. E. Kamper, R. Goyal, J. M. Stewart, and L. D.
16, no. 6, pp. 360–367, 2005. Longo, “Motor and cognitive deficits in mice bred to have low
or high blood pressure,” Physiology and Behavior, vol. 105, no. 4,
[19] M. Rosenblat, N. Volkova, R. Coleman, and M. Aviram, pp. 1092–1097, 2012.
“Pomegranate byproduct administration to apolipoprotein E-
deficient mice attenuates atherosclerosis development as a [34] J. Fuss, N. M. B. B. Abdallah, F. W. Hensley, K. J. Weber, R. Hell-
result of decreased macrophage oxidative stress and reduced weg, and P. Gass, “Deletion of running-induced hippocampal
cellular uptake of oxidized low-density lipoprotein,” Journal of neurogenesis by irradiation prevents development of an anxious
Agricultural and Food Chemistry, vol. 54, no. 5, pp. 1928–1935, phenotype in mice,” PLoS ONE, vol. 5, no. 9, Article ID e12769,
2006. 2010.
[35] T. Valente, J. Hidalgo, I. Bolea et al., “A diet enriched in
[20] L. C. Braga, J. W. Shupp, C. Cummings et al., “Pomegranate
polyphenols and polyunsaturated fatty acids, LMN diet, induces
extract inhibits Staphylococcus aureus growth and subsequent
neurogenesis in the subventricular zone and hippocampus of
enterotoxin production,” Journal of Ethnopharmacology, vol. 96,
adult mouse brain,” Journal of Alzheimer’s Disease, vol. 18, no. 4,
no. 1-2, pp. 335–339, 2005.
pp. 849–865, 2009.
[21] L. C. Braga, A. A. M. Leite, K. G. S. Xavier et al., “Synergic inter- [36] S. J. Kim, T. G. Son, H. R. Park et al., “Curcumin stimulates
action between pomegranate extract and antibiotics against proliferation of embryonic neural progenitor cells and neuro-
Staphylococcus aureus,” Canadian Journal of Microbiology, vol. genesis in the adult hippocampus,” The Journal of Biological
51, no. 7, pp. 541–547, 2005. Chemistry, vol. 283, no. 21, pp. 14497–14505, 2008.
[22] M. I. Gil, F. A. Tomas-Barberan, B. Hess-Pierce, D. M. Holcroft, [37] M. Vignes, T. Maurice, F. Lanté et al., “Anxiolytic properties
and A. A. Kader, “Antioxidant activity of pomegranate juice of green tea polyphenol (-)-epigallocatechin gallate (EGCG),”
and its relationship with phenolic composition and processing,” Brain Research, vol. 1110, no. 1, pp. 102–115, 2006.
Journal of Agricultural and Food Chemistry, vol. 48, no. 10, pp. [38] M. Kaufman and Z. Wiesman, “Pomegranate oil analysis with
4581–4589, 2000. emphasis on MALDI-TOF/MS triacylglycerol fingerprinting,”
[23] R. E. Hartman, A. Shah, A. M. Fagan et al., “Pomegranate Journal of Agricultural and Food Chemistry, vol. 55, no. 25, pp.
juice decreases amyloid load and improves behavior in a mouse 10405–10413, 2007.
model of Alzheimer’s disease,” Neurobiology of Disease, vol. 24, [39] L. Auerbach, J. Rakus, C. Bauer et al., “Pomegranate seed oil in
no. 3, pp. 506–515, 2006. women with menopausal symptoms: a prospective randomized,
[24] R. Morris, “Developments of a water-maze procedure for placebo-controlled, double-blinded trial,” Menopause, vol. 19,
studying spatial learning in the rat,” Journal of Neuroscience no. 4, pp. 426–432, 2012.
Methods, vol. 11, no. 1, pp. 47–60, 1984. [40] B. Shukitt-Hale, A. Szprengiel, J. Pluhar, B. M. Rabin, and J. A.
[25] S. Kwon, B. Lee, M. Kim, H. Lee, H. J. Park, and D. H. Joseph, “The effects of proton exposure on neurochemistry and
Hahm, “Antidepressant-like effect of the methanolic extract behavior,” Advances in Space Research, vol. 33, no. 8, pp. 1334–
from Bupleurum falcatum in the tail suspension test,” Progress 1339, 2004.
in Neuro-Psychopharmacology and Biological Psychiatry, vol. 34, [41] B. Shukitt-Hale, A. N. Carey, D. Jenkins, B. M. Rabin, and
no. 2, pp. 265–270, 2010. J. A. Joseph, “Beneficial effects of fruit extracts on neuronal
function and behavior in a rodent model of accelerated aging,”

Neurobiology of Aging, vol. 28, no. 8, pp. 1187–1194, 2007.
[42] M. A. Custaud, E. P. de Souza Neto, P. Abry et al., “Orthostatic
tolerance and spontaneous baroreflex sensitivity in men versus
women after 7 days of head-down bed rest,” Autonomic Neuro-
science: Basic and Clinical, vol. 100, no. 1-2, pp. 66–76, 2002.
[43] D. L. Harm, R. T. Jennings, J. V. Meck et al., “Genome and
hormones: gender differences in physiology invited review:
gender issues related to spaceflight: a NASA perspective,”
Journal of Applied Physiology, vol. 91, no. 5, pp. 2374–2383, 2001.
[44] J. R. Dynlacht, S. Valluri, J. Lopez et al., “Estrogen pro-
tects against radiation-induced cataractogenesis,” Radiation
Research, vol. 170, no. 6, pp. 758–764, 2008.
http://dx.doi.org/10.1155/2013/371813
Research Article
Pomegranate Bioactive Constituents Suppress Cell
Proliferation and Induce Apoptosis in an Experimental Model of
Hepatocellular Carcinoma: Role of Wnt/𝛽-Catenin
Signaling Pathway
Deepak Bhatia,1 Roslin J. Thoppil,1 Animesh Mandal,1 Karishma A. Samtani,1

Altaf S. Darvesh,1 and Anupam Bishayee2
1
Cancer Therapeutics and Chemoprevention Group, Department of Pharmaceutical Sciences, College of Pharmacy,
Northeast Ohio Medical University, Rootstown, OH 44272, USA
2
Department of Pharmaceutical Sciences, School of Pharmacy, American University of Health Sciences, Signal Hill, CA 90755, USA
Correspondence should be addressed to Anupam Bishayee; abishayee@auhs.edu
Received 3 January 2013; Accepted 12 February 2013
Copyright © 2013 Deepak Bhatia et al. This is an open access article distributed under the Creative Commons Attribution License,
Hepatocellular carcinoma (HCC) is the third leading cause of cancer-related death worldwide, and chemoprevention represents
a viable approach in lowering the mortality of this disease. Pomegranate fruit, an abundant source of anti-inflammatory
phytochemicals, is gaining tremendous attention for its wide-spectrum health benefits. We previously reported that a characterized
pomegranate emulsion (PE) prevents diethylnitrosamine (DENA)-induced rat hepatocarcinogenesis though inhibition of nuclear
factor-kappaB (NF-𝜅B). Since NF-𝜅B concurrently induces Wnt/𝛽-catenin signaling implicated in cell proliferation, cell survival,
and apoptosis evasion, we examined antiproliferative, apoptosis-inducing and Wnt/𝛽-catenin signaling-modulatory mechanisms
of PE during DENA rat hepatocarcinogenesis. PE (1 or 10 g/kg) was administered 4 weeks before and 18 weeks following DENA
exposure. There was a significant increase in hepatic proliferation (proliferating cell nuclear antigen) and alteration in cell cycle
progression (cyclin D1) due to DENA treatment, and PE dose dependently reversed these effects. PE substantially induced apoptosis
by upregulating proapoptotic protein Bax and downregulating antiapoptotic protein Bcl-2. PE dose dependently reduced hepatic
𝛽-catenin and augmented glycogen synthase kinase-3𝛽 expression. Our study provides evidence that pomegranate phytochemicals
exert chemoprevention of hepatic cancer through antiproliferative and proapoptotic mechanisms by modulating Wnt/𝛽-catenin
signaling. PE, thus, targets two interconnected molecular circuits (canonical NF-𝜅B and Wnt/𝛽-catenin pathways) to exert
chemoprevention of HCC.
1. Introduction contribute to a dismal prognosis coupled with high mortality

for this disease. A critical need exists for the discovery
Hepatocellular carcinoma (HCC), the major primary malig- and development of novel preventive as well as therapeutic
nant tumor of the liver, is one of the most life-threatening strategies to combat the current morbidity and mortality
human cancers in the world, resulting in almost one million associated with HCC [3–6].
deaths every year [1]. There has been a drastic surge (70% Persistent oxidative stress and unresolved inflammation
increase) in the incidence of HCC in the United States during are two primary driving forces behind the development and
the last quarter century with nearly 29,000 new cases and exacerbation of HCC [7–9]. Lingering infection with hepati-
more than 20,000 deaths expected to occur in 2012 alone tis B virus (HBV) and hepatitis C virus (HCV) represents the
[2]. Lack of effective diagnostic tools for early detection and major risk factor for HCC [10]. Chronic liver disease has been
limited treatment options for patients with advanced HCC proposed to be a predisposing factor for at least 80% of HCC
cases [11]. As a matter of fact, any condition that is linked to 2 genes [34]. Very recently, we have shown that suppression
development of fibrosis and cirrhosis is strongly associated of the inflammatory cascade through modulation of nuclear
with the occurrence of HCC. In response to hepatocyte factor-kappaB (NF-𝜅B) signaling pathway represents a novel
injury due to various factors, including inflammation and mechanism of liver tumor inhibitory effects of pomegranate
oxidative stress, hepatic stellate cells and portal fibroblasts phytochemicals against experimental hepatocarcinogenesis
undergo activation and transformation, resulting in fibrosis [35]. It is well known that NF-𝜅B, the cardinal regulator
and ultimately cirrhosis [12]. Under these circumstances, the of inflammation, acts as a hub for a number of intercon-
surviving hepatocytes proliferate to regenerate the injured nected signaling pathways implicated in malignancy, such
liver. This cellular proliferation in the background of sus- as cell proliferation, cell survival, differentiation, apoptosis,
tained inflammation and oxidative stress embodies a driving invasion, angiogenesis, and metastasis [36]. Emerging evi-
force for hepatic tumorigenesis [13]. Identification of cellular dence strongly suggests that NF-𝜅B may exhibit oncogenic
pathways necessary for the proliferation and survival of potential by coordinately activating the canonical Wnt/𝛽-
malignant cells in HCC not only aids in understanding catenin signaling pathway [37–39]. Functional proteomics
the pathophysiology, diagnosis, and progression, but also analysis revealed that enhanced expression of Wnt-1 protein
provides a valuable tool in designing effective prevention and associated with NF-𝜅B might be an important mechanism
intervention of the disease. One such relevant pathway is of hepatitis B- and C-related HCC [40]. Based on multiple
the Wnt/𝛽-catenin signaling cascade which plays a decisive targets of NF-𝜅B and the possibility of crosstalk between NF-
role in cell fate, favoring cell proliferation over apoptosis. 𝜅B and Wnt/𝛽-catenin signaling pathways as well as previous
Accumulating evidence has shown that the canonical Wnt/𝛽- reports from this laboratory [34, 35], we have hypothesized
catenin pathway is frequently activated in HCC and respon- that (i) pomegranate-mediated chemoprevention of exper-
sible for initiation and progression of the disease [13–16], imental hepatocarcinogenesis could be achieved by inhibi-
and this pathway could be an attractive and viable target for tion of abnormal hepatocyte proliferation and promotion
chemoprevention and therapy of HCC [17–19]. of apoptosis; and (ii) antiproliferative effects pomegranate
The pomegranate (Punica granatum, Punicaceae), a phytochemicals may be linked to suppression of activated
unique, mystical, and distinctive fruit, is a native of the Wnt/𝛽-catenin signaling. The current study was therefore
Himalayas in India and extensively cultivated in India, Israel, initiated to investigate the extent of cell proliferation and
Spain, and United States. In addition to its ancient historical apoptosis during DENA-induced chemical rat liver carcino-
uses, pomegranate is used in several systems of medicine genesis in the presence or absence of pomegranate treatment.
for a wide variety of ailments [20, 21]. The “superfruit” The involvement of Wnt/𝛽-catenin signaling under the same
pomegranate is receiving substantial importance because experimental condition has also been examined by monitor-
of its powerful antioxidant and anti-inflammatory proper- ing the expression of several key components of this pathway
ties attributed to polyphenolic components (such as antho- as a possible mechanism of pomegranate chemoprevention of
cyanins), hydrolysable tannins (e.g., ellagitannins and gal- experimental hepatic malignancy.
lotannins), and condensed tannins (proanthocyanidins) [22–
26]. Pomegranate constituents have been shown to possess
exceptional health effects, such as protection against and/or 2. Materials and Methods
treatment of cancer, neurodegenerative diseases, inflam-
mation, ulcers, diabetes, dental ailments, high cholesterol, 2.1. Materials. Pomegranate emulsion (PE) was purchased
cardiovascular disease, obesity, bacterial infections, erectile from Rimonest Ltd., Haifa, Israel. We previously provided the
dysfunction, and male infertility (reviewed in [27, 28]). detailed description of the preparation of this formulation
Pomegranate extracts and purified phytochemicals suppress [34]. The chemical analyses of this product showed the
the proliferation of human breast, prostate, lung, and colon presence of mixed octadecatrienoic acids, sterols and steroids
cancer cells in vitro as well as prevent and/or treat breast, skin, (such as 17-𝛼-estradiol), tocol, 𝛾-tocopherol in the lipid phase
lung, colon, and prostate tumors in preclinical animal models and caffeic acid, corilagin, ellagic acid, ferulic acid, gallic acid,
(reviewed in [24, 29–31]). Several phase II clinical trials 5-hydroxymethylfurfural, protocatechuic acid, punicalagins
have linked oral consumption of pomegranate juice with (A and B), and trans-p-coumaric acid in the aqueous phase
significant prolongation of prostate-specific antigen (PSA) [34]. Paraformaldehyde was procured from Ted Pella Inc.,
doubling time for men with prostate carcinoma with no Redding, CA. Primary antibodies, such as mouse monoclonal
accompanying serious adverse effects [32, 33]. proliferating cell nuclear antigen (PCNA, sc-56), rabbit poly-
Although pomegranate products have shown promising clonal cyclin D1 (sc-753), mouse monoclonal Bax (sc-70407),
antitumor activities in various organs of animals, the chemo- mouse monoclonal Bcl-2 (sc-7382), rabbit polyclonal 𝛽-
preventive potential of pomegranate has not been investi- catenin (sc-7199), rabbit polyclonal glycogen synthase kinase-
gated against the preclinical model of hepatic tumorigenesis 3𝛽 (GSK-3𝛽, sc-9166), 𝛽-actin (sc-47778), and mouse and
until very recently. Our laboratory has provided evidence, for rabbit ABC staining systems were purchased from Santa
the first time, that pomegranate-derived phytoconstituents Cruz Biotechnology (Santa Cruz, CA). TdT-FragEL DNA
exert a significant chemopreventive efficacy against dietary fragmentation detection assay kit was procured from EMD
hepatocarcinogen diethylnitrosamine (DENA)-induced liver Biosciences, Inc. (San Diego, CA). Pierce BCA protein assay
tumorigenesis in rats by potent antioxidant mechanisms kit was obtained from Thermo Scientific (Rockford, IL).
mediated by upregulation of hepatic antioxidant and phase Quick RNA mini Prep kit and Verso cDNA synthesis kit were
purchased from Zymo Research Corporation (Irvine, CA) to produce a 10% w/v tissue homogenate. The sample
and Thermo Scientific (Waltham, MA), respectively. was then centrifuged at 4∘ C at 14,000 ×g for 20 min. The
supernatant was collected, and protein concentration was
2.2. In Vivo Experimental Protocol and Tissue Harvesting. estimated using the Pierce BCA protein assay kit following
Liver tissue used for all assays in this study was harvested the accompanying instructions. Equal amounts of protein
from our previously published chemopreventive study in samples were loaded and run on a 10% Tris-HCl gel (Bio-Rad
which male Sprague-Dawley rats (Harlan Laboratories, Indi- Laboratories, Hercules, CA), transferred onto a nitrocellulose
anapolis, IN) fed with oral PE at a dose of 1 or 10 g/kg body membrane, and separately probed with anti-cyclin D1, anti-
weight exhibited 26 or 50% inhibition of hepatic nodule 𝛽-catenin, anti-GSK-3𝛽, or anti-𝛽-actin (all 1 : 1000 dilution)
incidence, respectively [34]. The animal experimentation antibody. The transferred proteins were visualized by an
was carried out at the Northeast Ohio Medical University enhanced chemiluminescence detection system (Thermo Sci-
(Rootstown, OH) following the animal protocol approved by entific, Rockford, IL) and analyzed using a Kodak analyzer.
the Institutional Animal Care and Use Committee. In brief, Loading of equal amounts of protein was ensured by 𝛽-actin.
following an acclimatization period (7 days), the animals
were randomly divided into five groups. While group A 2.5. Gene Expression Studies. Total RNA from ∼20 mg of liver
animals were maintained as untreated normal control, group sample was extracted using Quick RNA mini Prep kit as per
B animals were administered with a sham emulsion (Rimon- the vendor’s protocol. Complementary DNA (cDNA) was
est Ltd., Haifa, Israel) via oral gavage at a dose of 10 g/kg synthesized from 1 𝜇g of total RNA using the Verso cDNA
three times/week (Monday, Wednesday, and Friday). Three synthesis kit following the manufacturer’s instructions. Poly-
other animal groups (groups C, D, and E) were similarly fed merase chain reaction (PCR) was performed using specific
with PE at 1 g/kg (groups C) or 10 g/kg (groups D, and E). primers for rat cyclin D1, 𝛽-catenin, GSK-3𝛽, and glyceralde-
The aforementioned oral feeding was continued for 4 weeks, hyde 3-phosphate dehydrogenase (GAPDH) using following
and then hepatocarcinogenesis was initiated in animals from primer pairs: cyclin D1 sense: 5󸀠 -GCGTACCCTGACACC-
groups B, C and D by single intraperitoneal (i.p.) injection AATCT-3󸀠 ; antisense: 5󸀠 -GGCTCCAGAGACAAGAAA-
of DENA (200 mg/kg). Following a recovery period of two CG; 𝛽-catenin sense: 5󸀠 -GCCAGTGGATTCCGTACTGT-
weeks, phenobarbital (PB, a well-known promoter of rat 3󸀠 ; antisense: 5󸀠 -GAGCTTGCTTTCCTGATTGC; GSK-3𝛽
liver carcinogenesis) was introduced in the drinking water of sense: 5󸀠 -CAAGCAGACACTCCCTGTGA-3󸀠 ; antisense: 5󸀠 -
DENA-exposed animals at a concentration of 0.05% (w/v). GTGGCTCCAAAGATCAGCTC; GAPDH sense: 5󸀠 -AGA-
Oral feeding of rats with PE or sham emulsion was continued CAGCCGCATCTTCTTGT-3󸀠 ; and antisense: 5󸀠 -TACTCA-
till the end of the animal experiment. All animals were GCACCAGCATCACC-3󸀠 . These primer sequences were
sacrificed 18 weeks following the DENA administration, that designed utilizing the Primer3 program and synthesized by
is, 22 weeks after commencement of the study. Liver tissues Eurofins MWG Operon (Huntsville, AL). The PCR products
from various rat groups were collected and either preserved were analyzed by agarose gel electrophoresis and visualized
in paraformaldehyde for immunohistochemical work or using ethidium bromide staining. GAPDH was used as the
immediately snap frozen in liquid nitrogen, stored at –70∘ C, housekeeping gene.
and used for molecular studies as described in the following.
2.6. Statistical Analysis. All quantitative data reported here
2.3. Immunohistochemical Determination. Serial sections of are presented as mean ± standard error of mean (SEM).
liver tissue were prepared using a cryostat (Leica Microsys- Significant differences among various animal groups were
tems, Nussloch, Germany) and used for immunohistochem- detected by one-way ANOVA with post hoc analysis per-
ical analysis of PCNA, cyclin D1, Bax, Bcl-2, 𝛽-catenin, and formed by the Student-Neuman-Keuls test. A 𝑃 value less
GSK-3𝛽 protein expressions following our published meth- than 0.05 was considered statistically significant. Statistical
ods [41]. The presence of apoptotic cells in liver sections was analysis and graphical representation of data were performed
detected by TdT-FragEL DNA fragmentation detection assay using SigmaStat 3.1 software (Systat software, Inc., San Jose,
kit following the manufacturer’s protocol, as we described CA).
earlier [42]. The immunohistochemical slides were visualized
under a light microscope, and 1,000 hepatocytes/animal
were analyzed. The labeling index (LI) and apoptotic index 3. Results
(AI) were expressed as the number of PCNA-positive and 3.1. Antiproliferative Cellular Mechanism of Pomegranate
apoptotic cells per 100 hepatocytes, respectively. All other in DENA-Induced Hepatocarcinogenesis. As shown in
immunohistochemical results were expressed as percentage (Figure 1(A)a–d), the immunohistochemical staining depicts
of immunopositive cells. the differential expression levels of the proliferative marker,
PCNA, in liver sections obtained from the various experi-
2.4. Western Blot Analysis. Frozen liver tissue samples were mental rat groups. Near to complete absence of PCNA-
homogenized in ice-cold RIPA lysis buffer (containing positive cells was observed in both normal control
50 mM Tris-HCl, 1% Nonidet P-40, 0.5% sodium deoxy- (Figure 1(A)a) and only PE-treated (10 g/kg) (figure not
cholate, 40 mM NaF, 10 mM NaCl, 10 mM Na3 VO4 , 1 mM shown) groups. An increase in hepatic PCNA expression was
phenylmethanesulfonyl fluoride, and 10 mM dithiothreitol) contrastingly observed in animals treated with DENA alone
50
a
40
PCNA labeling index (%)

30
20
(a) (b)
b
10
0
Normal DENA POM1 POM10 POM10
(c) (d) + DENA + DENA control
(A) (B)
Figure 1: Effects of PE on PCNA expression during DENA-initiated hepatocarcinogenesis in rats. (A) Representative immunohistochemical
localization of PCNA (magnification: 100x). Arrows indicate immunohistochemical staining of PCNA. Several groups are (a) normal control;
(b) DENA control; (c) PE 1 g/kg plus DENA; and (d) PE 10 g/kg plus DENA. (B) Quantification of PCNA-positive cells based on 1,000
hepatocytes per animal and 4 animals per group. Each bar represents the mean ± SEM (𝑛 = 4). a 𝑃 < 0.001 as compared with normal
group; b 𝑃 < 0.001 as compared with DENA control.
(Figure 1(A)b), while PE treatment (1 g/kg) in conjunction D1-positive cells in the rats administered with DENA with
with DENA exposure resulted in insignificant decreases in respect to the normal control rats (Figure 2(B)). Elevated
PCNA-positive expression (Figure 1(A)c). These elevated immunohistochemical expression of cyclin D1 was signif-
PCNA levels were shown to be subsequently reversed icantly (𝑃 < 0.001) abrogated only in the rats treated
in the sections obtained from rats treated with PE at with PE, at the highest dose of 10 g/kg, when compared
10 g/kg in addition to DENA treatment (Figure 1(A)d). to the DENA-challenged rats, although reduction in the
Figure 1(B) represents the quantitative analysis performed percentage of immunopositive cells was noted in all PE-
on the immunohistochemical data, which shows significant treated groups. These data are further confirmed utilizing
(𝑃 < 0.001) elevation in the frequency of PCNA expressing Western blotting technique and RT-PCR (Figures 2(C) and
hepatocytes (PCNA LI) in the DENA-treated animals 2(D)). Hepatic cyclin D1 mRNA and protein expression levels
comparing to the normal control. In comparison to the were clearly upregulated in the DENA-treated animals, while
DENA-control rats, PE treatment is shown to decrease the PE treatment at both doses was found to consistently decrease
number of PCNA-positive cells. Nevertheless, a significant transcriptional and translational levels of cyclin D1.
(𝑃 < 0.001) reduction was only achieved in rats treated with
PE at the highest dose of 10 g/kg.
3.3. Proapoptotic Potential of Pomegranate in DENA-Evoked
Hepatocarcinogenesis. The DNA fragmentation assay per-
3.2. Differential Expression of Cell Cycle Specific Gene—Cyclin formed on the rat liver sections indicated almost no apop-
D1—in the Presence and Absence of Pomegranate Treatment in totic cells in both the normal control group (Figure 3(A)a)
Hepatocarcinogenesis. Represented in Figure 2(A)a–d is the and PE-administered group (figure not shown). Animals
immunocytochemical data depicting the expression of cell exposed to DENA alone (Figure 3(A)b) were similarly found
cycle specific gene cyclin D1 in hepatic sections procured to have absolutely no immunopositive cells which, upon
from several experimental animals. Cyclin D1 was found to treatment with PE at both doses, was found to be increased
be highly expressed in the DENA-control rats (Figure 2(A)b), (Figure 3(A)c-d). Interestingly, a substantial increase in
whereas this observation was not made in the rat liver apoptotic cells was noticed in liver sections obtained from
sections obtained from the normal control (Figure 2(A)a) animals treated with PE at 10 g/kg (Figure 3(A)d). Quantita-
as well as PE control (figure not shown) groups. A drastic tive analysis of immunohistochemical data revealed that the
reduction in the numbers of cyclin D1 immunoreactive cells frequency of apoptotic cells were significantly (𝑃 < 0.001)
was recorded in rats treated with PE at 10 g/kg (Figure 2(A)d). elevated in the rats subjected to PE treatment at 10 g/kg in
The subsequent quantitative analysis performed denotes a comparison to the animals administered with DENA alone
significant (𝑃 < 0.001) increase in the percentage of cyclin (Figure 3(B)).
12
a
10
Cyclin D1 labeling index (%)

8
6
(a) (b)
4 b
0
(A) (B)
POM10 + DENA
POM10 + DENA
POM10 control
POM1+ DENA
POM1+ DENA
Normal
Normal
DENA
DENA
Cyclin D1 Cyclin D1
𝛽-actin GAPDH
(C) (D)
Figure 2: Effects of PE on cyclin D1 expression during DENA-mediated hepatocarcinogenesis in rats. (A) Representative immunohisto-
chemical localization of cyclin D1 (magnification: 100x). Arrows indicate immunohistochemical staining of cyclin D1. Several groups are (a)
normal control; (b) DENA control; (c) PE 1 g/kg plus DENA; and (d) PE 10 g/kg plus DENA. (B) Quantification of cyclin D1-positive cells
based on 1,000 hepatocytes per animal and 4 animals per group. Each bar represents the mean ± SEM (𝑛 = 4). a 𝑃 < 0.001 as compared with
normal group; b 𝑃 < 0.001 as compared with DENA control. (C) Representative Western blot indicating protein expression levels of cyclin D1
in various experimental groups and (D) representative RT-PCR analysis of cyclin D1 expression in various groups of rats. Total hepatic RNA
was isolated, subjected to reverse transcription, and resulting cDNA was subjected to RT-PCR analysis using specific primer sequence. The
GAPDH was used as the housekeeping gene.
3.4. Regulation of Apoptosis-Related Proteins by Pomegranate exposed to the highest dose of PE (10 g/kg), when com-
during Experimental Rat Liver Carcinogenesis. Liver sections, pared to the DENA-exposed rats (Figure 4(B)). Figure 4(C)
obtained from the different experimental rat groups, were indicates a very high expression of the antiapoptotic protein
immunostained for the proapoptotic protein Bax and the Bcl-2 in the hepatocytes of DENA-control rats as well as in
antiapoptotic protein Bcl-2, and the results are shown in those of PE-treated (1 g/kg) animals; however, treatment with
Figure 4(A)a–f. Sections from rats exposed to DENA alone PE at the highest dose (10 g/kg) significantly (𝑃 < 0.001)
were shown to have very limited expression of the proapop- decreased the increased expression of Bcl-2. A significant
totic protein Bax (Figure 4(A)a), while treatment with PE at (𝑃 < 0.001) elevation in the Bax/Bcl-2 ratio was observed
1 g/kg (Figure 4(A)b) and 10 g/kg (Figure 4(A)c) reflected an in the liver tissue harvested from the PE-treated (10 g/kg) rats
increase in the expression of Bax. In stark contrast, immunos- in comparison to the DENA-exposed animals (Figure 4(D)).
taining for the antiapoptotic protein, Bcl-2, in the DENA-
control liver sections yielded very high expression levels of
the protein (Figure 4(A)d) which was subsequently reduced 3.5. Reversal of DENA-Mediated Induction of Hepatic 𝛽-
with PE exposure at both doses (Figure 4(A)e-f). Figures 4(B) Catenin Expression by Pomegranate. Based on immunohis-
and 4(C) represent the affirmative corresponding quantitative tochemical analysis,variations in the nuclear and cytoso-
analysis of the immunohistochemical data associated with lic expressions of 𝛽-catenin were clearly observed in the
Bax and Bcl-2, respectively. Although an increase in the liver sections harvested from several groups of animals
proapoptotic protein Bax is seen in the PE-treated (1 g/kg) (Figure 5(A)a–d). Expression of immunopositive cells was
rats, significant (𝑃 < 0.001) increases in the percentage clearly absent in sections obtained from both the normal
of Bax-positive cells were clearly observed in the animals control (Figure 5(A)a) as well rats treated with only PE
7 a
Apoptotic index (%)

4
(a) (b)
2
0
(A) (B)
Figure 3: Effects of PE on apoptosis in DENA-initiated hepatocarcinogenesis in rats. (A) Representative immunohistochemical localization
of apoptotic cells (magnification: 100x). Arrows indicate immunohistochemical staining of apoptotic cells. Several groups are (a) normal
control; (b) DENA control; (c) PE 1 g/kg plus DENA; and (d) PE 10 g/kg plus DENA. (B) Quantification of immunopositive cells based on
1,000 hepatocytes per animal and 4 animals per group. Each bar represents the mean ± SEM (𝑛 = 4). a 𝑃 < 0.001 as compared with DENA-
control group.
(figure not shown). Highly elevated frequency of both nuclear 3.6. Pomegranate-Mediated Modulation of Hepatic GSK-
and cytosolic 𝛽-catenin-positive cells was recorded in rats 3𝛽 Expression in Experimental Rat Liver Carcinogenesis.
exposed to DENA (Figure 5(A)b). In comparison, the rats Represented in Figure 6(A)a–e is the immunohistochem-
treated with different doses of PE (1 g/kg and 10 g/kg) had ical staining of GSK-3𝛽 in rat liver sections from the
decreased expression of nuclear as well as cytosolic expres- various experimental groups. The normal control group
sion of 𝛽-catenin (Figures 5(A)c and 5(A)d). Interestingly, demonstrated very low expression of GSK-3𝛽 (Figure 6(A)a).
the decrease was more pronounced in the animals treated A moderate increase in the expression of GSK-3𝛽 was
with the higher dose of PE. The corresponding quantitative observed in the DENA-control group (Figure 6(A)b), while
analysis presented in Figures 5(B) and 5(C) confirms our treatment with PE at 1 g/kg did not alter the expression
immunostaining data, indicating a significant (𝑃 < 0.001) of GSK-3𝛽 (Figure 6(A)c). However, treatment with PE at
increase in nuclear and cytosolic 𝛽-catenin expression in 10 g/kg depicted a substantial elevation in the number of
DENA-control rats, compared to the normal control, respec- immunopositive cells for GSK-3𝛽 (Figure 6(A)d). An ele-
tively. Treatment with PE at 1 g/kg did not significantly reduce vated expression of GSK-3𝛽 was also observed in the PE-
the elevated levels of 𝛽-catenin at both the nuclear and control liver sections (Figure 6(A)e) compared to normal
cytosolic front; however, PE treatment at 10 g/kg significantly control as well. The corresponding immunohistochemical
(𝑃 < 0.05) decreased both nuclear and cytosolic 𝛽- analysis of percentage of immunopositive cells is represented
catenin expression. Further confirmation of these results was in Figure 6(B). The quantitative expression of GSK-3𝛽 in the
shown utilizing Western blotting method as well as RT- DENA-control group was significantly (𝑃 < 0.001) greater
PCR technique (Figures 5(D) and 5(E), resp.). The former compared to that observed in the normal group. Treatment
shows elevated protein levels of 𝛽-catenin in the DENA- with PE at 10 g/kg significantly (𝑃 < 0.001) elevated the num-
administered rats in comparison to the normal control rat bers of GSK-3𝛽-immunopositive cells compared to DENA-
livers, while PE administration reversed this condition and control, whilst PE treatment at the lower dose did not change
brought down the high expression of 𝛽-catenin. Liver samples expression levels. Interestingly, a significant (𝑃 < 0.001)
from the different experimental groups, subjected to RT-PCR increase in GSK-3𝛽 levels was noticed in PE-control animals
analysis, depicted a high mRNA expression level of 𝛽-catenin in comparison to the normal control. Our immunohisto-
in the DENA-control rat livers, while markedly decreased chemistry data provide support to the Western blot analysis
expression was witnessed with PE treatment, especially at the of GSK-3𝛽 protein levels in liver samples collected from
highest dose of 10 g/kg. Interestingly, the basal transcriptional the experimental animals (Figure 6(C)). The protein level
(data not shown) and translational (Figure 5(D)) levels of 𝛽- of GSK-3𝛽 was slightly increased in DENA-administered
catenin were unaltered by the highest dose of PE. animals compared to the normal, while treatment with PE
(a) (b) (c)
(d) (e) (f)

(A)
12 a 30 1.2
a
Bcl-2-immunopositive cells (%)
Bax-immunopositive cells (%)
10 25 1
8 20
Bax/Bcl-2 ratio
0.8
6 15 0.6
a
4 10 0.4
2 5 0.2
0 0 0
DENA POM1 POM10 DENA POM1 POM10 DENA POM1 POM10
+ DENA + DENA + DENA + DENA + DENA + DENA
(B) (C) (D)
Figure 4: Effects of PE on Bax and Bcl-2 expressions during DENA-mediated hepatocarcinogenesis in rats. (A) Immunohistochemical
detection of Bax and Bcl-2 expression in the presence or absence of PE. (a)–(c) Representative immunohistochemical localization of Bax
(magnification: 100x). Arrows indicate immunohistochemical staining of Bax. (d)–(f) Representative immunohistochemical localization of
Bcl-2 (magnification: 100x). Arrows indicate immunohistochemical staining of Bcl-2. Several groups are ((a) and (d)) DENA control; ((b)
and (e)) PE 1 g/kg plus DENA; and ((c) and (f)) PE 10 g/kg plus DENA. (B) Quantification of Bax-positive cells based on 1,000 hepatocytes
per animal, and 4 animals per group. Each bar represents the mean ± SEM (𝑛 = 4). a 𝑃 < 0.001 as compared with DENA control. (C)
Quantification of Bcl-2-positive cells based on 1,000 hepatocytes per animal and 4 animals per group. Each bar represents the mean ± SEM
(𝑛 = 4). a 𝑃 < 0.001 as compared with DENA control. (D) Quantification of Bax/Bcl-2 ratio of positive cells based on 1,000 hepatocytes per
animal and 4 animals per group. Each bar represents the mean ± SEM (𝑛 = 4). a 𝑃 < 0.001 as compared with DENA control.
at both doses as well as PE control resulted in upregu- A conspicuous upregulation of GSK-3𝛽 expression at both
lated protein expressions of GSK-3𝛽. The mRNA analysis protein (Figure 6(C)) and mRNA (data not shown) was
of the liver samples harvested from the experimental rats visible following treatment with the highest dose of PE
was performed by the technique of RT-PCR, and results compared to normal control.
are depicted in Figure 6(D). The data are in affirmative of
our immunohistochemical and Western data, conclusively
exhibiting slightly elevated gene expression levels of GSK-3𝛽 4. Discussion
in DENA-exposed animals than in normal-control animals.
PE treatment at 10 g/kg was noted to have elevated mRNA We have recently shown that a complex pomegranate prod-
expression of GSK-3𝛽 comparing to DENA-control animals. uct (PE) containing a wide spectrum of phytoconstituents
(a) (b) (c) (d)
(A)
2 a 3
a
1.8
2.5
Cytoplasmic 𝛽-catenin-positive cells (%)

Nuclear 𝛽-catenin-positive cells (%)
1.6
1.4
2
1.2
1 1.5
b b
0.8
1
0.6
0.4
0.5
0.2
0 0
Normal DENA POM1 POM10 POM10 Normal DENA POM1 POM10 POM10
+ DENA + DENA control + DENA + DENA control
(B) (C)
POM10 + DENA
POM1+ DENA
POM10 + DENA
POM10 control
POM1+ DENA
Normal
DENA
Normal
DENA
𝛽-catenin 𝛽-catenin
𝛽-actin GAPDH
(D) (E)
Figure 5: Effects of PE on 𝛽-catenin expression during DENA-evoked hepatic preneoplasia in rats. (A) Representative immunohistochemical
localization of 𝛽-catenin in nucleus ((b), (c), and (d); red arrows) and cytosol ((b), (c), and (d); black arrows) (magnification: 100x). Several
groups are (a) normal control; (b) DENA control; (c) PE 1 g/kg plus DENA; and (d) PE 10 g/kg plus DENA. (B) Quantification of nuclear
𝛽-catenin-immunopositive cells in rat livers of several experimental groups. One thousand hepatocytes were counted per animal and the
results were based on 4 animals per group. Each bar represents the mean ± SEM (𝑛 = 4). a 𝑃 < 0.001 as compared to normal group; b 𝑃 < 0.05
as compared to DENA control. (C) Quantification of cytoplasmic 𝛽-catenin-immunopositive cells in rat livers of several experimental groups.
One thousand hepatocytes were counted per animal, and the results were based on 4 animals per group. Each bar represents the mean ± SEM
(𝑛 = 4). a 𝑃 < 0.001 as compared to normal group; b 𝑃 < 0.05 as compared to DENA control. (D) Representative Western blot indicating
protein expression levels of 𝛽-catenin in various experimental groups and (E) representative RT-PCR analysis of 𝛽-catenin expression in
various groups of rats. Total hepatic RNA was isolated, subjected to reverse transcription, and resulting cDNA was subjected to RT-PCR
analysis using specific primer sequence. The GAPDH was used as the housekeeping gene.
7 b
6 a
GSK-3𝛽-positive cells (%)

5
4
a
(a) (b) (c) 3
0
(d) (e) + DENA + DENA control
(A) (B)
POM10 + DENA
POM10 + DENA
POM1+ DENA
POM10 control
POM1+ DENA
Normal
Normal
DENA
DENA
GSK-3𝛽 GSK-3𝛽
𝛽-actin GAPDH
(C) (D)
Figure 6: Effects of PE on GSK-3𝛽 expressions during DENA-evoked hepatic preneoplasia in rats. (A) Representative immunohistochemical
localization of GSK-3𝛽 (magnification: 100x) in different rat groups. Several groups are (a) normal control; (b) DENA control; (c) PE 1 g/kg plus
DENA; (d) PE 10 g/kg plus DENA; and (e) PE 10 g/kg control. (B) Quantification of hepatic GSK-3𝛽-immunopositive cells. One thousand
hepatocytes were counted per animal, and the results were based on 4 animals per group. Each bar represents the mean ± SEM (𝑛 = 4).
a
𝑃 < 0.001 as compared to normal group; b 𝑃 < 0.001 as compared to DENA control. (C) Representative Western blot indicating protein
expression levels of GSK-3𝛽 in various experimental groups and (D) representative RT-PCR analysis of GSK-3𝛽 expression in various groups
of rats. Total hepatic RNA was isolated, subjected to reverse transcription, and resulting cDNA was subjected to RT-PCR analysis using specific
primer sequence. The GAPDH was used as the housekeeping gene.
afforded a striking chemoprevention against chemically hepatocytes may be of immense value in the prevention of
induced hepatocarcinogenesis in rats [34]. It is plausible that HCC. PCNA functions as a cofactor of DNA polymerase
various phytochemicals present in PE may target several and thus is directly involved in DNA replication. The pos-
interconnected molecular pathways to inhibit liver tumorige- itive expression of PCNA is considered a common index
nesis. Supporting this possibility, we have provided evidence for hepatocyte proliferation at late G1- and early S-phase.
that PE simultaneously target Nrf2-regulated redox signal- PCNA represents an important cellular marker for assessing
ing and NF-𝜅B-mediated inflammatory pathway to achieve the proliferation during hepatocarcinogenesis [44]. In our
chemoprevention of experimental hepatocarcinogenesis [34, study, the expression of PCNA was examined immuno-
35]. In the present study, we set ourselves at the aim of histochemically in livers from several animal groups. The
investigating additional and related mechanisms as regards elevated expression of PCNA, resulting in a drastic increase
to our previous findings to provide a comprehensive under- in PCNA LI, in the liver sections of DENA-treated animals
standing of pleiotropic mechanisms of action of pomegranate indicates accelerated cell proliferation during an early phase
phytochemicals in preventing liver cancer. of rat liver tumorigenesis, which supports our previous
Cell proliferation plays a fundamental role in the multi- observations [41, 42]. Significant decreases in the number
step carcinogenesis process, including initiation, promotion, of PCNA-positive hepatocytes and consequently PCNA LI
and progression, and is considered to be an important due to PE treatment clearly indicate a decrease in hepatocyte
mechanism for the pathogenesis of HCC [43]. Hence, explo- proliferation, possibly through inhibition of DNA synthesis
ration of agents that can affect abnormal proliferation of during experimental hepatocarcinogenesis. It is mostly likely
that the antiproliferative mechanisms of pomegranate phy- hepatocytes in DENA-treated animals. Our data showing
tochemicals eventually contributed to inhibition of DENA- apoptosis induction during experimental hepatocarcinogen-
induced tumorigenesis, as we previously observed [34]. Our esis in rats by pomegranate phytoconstituents are concordant
data are in agreement of several studies reported from other with a large number of studies showing proapoptotic effects
laboratories showing in vitro and in vivo antiproliferative of pomegranate-derived agents in various in vitro and in vivo
effects of various pomegranate phytochemicals in several preclinical cancer models [reviewed in ref. [31]].
cancer models [24, 45]. The apoptotic signal in hepatocytes is believed to be
Cyclin D1, a cell cycle regulatory protein, is responsible for transmitted through the complex interaction of intercellular
the transition from G1- to S-phase [46]. As cyclin D1 possesses proteins. The transcription factor NF-𝜅B and members of the
a critical role for cell cycle progression, dysregulated expres- Bcl-2 family consisting of both proapoptotic and antiapop-
sion of cyclin D1 gene may contribute to cellular genomic totic proteins contribute to the regulation of apoptosis in hep-
instability and malignancy [47]. Elevated expressions of atocytes [58]. Many of the genetic alterations of HCC lead to
cyclin D1 gene and protein disrupting G1/S regulatory point an imbalance in the proapoptotic and antiapoptotic proteins
of the cell cycle have been found to lead abnormal cell proof the Bcl-2 family [60]. The antiapoptotic proteins, including
liferation during DENA-induced sequential hepatocarcino- Bcl-2 and Bcl-xL, are known to inhibit mitochondrial apop-
genesis in rats [48–50]. As increased expression of cyclin D1 totic pathway by blocking the release and oligomerization of
protein has been found in HCC patients [51] and correlated proapoptotic proteins and are overexpressed in HCC [61]. On
with poor overall survival in HCC patients [52], it can be used the other hand, proapoptotic members of the Bcl-2 family,
as a prognostic marker and therapeutic target. The results of such as Bax, Bad, and Bid, initiate mitochondrial apoptosis
our immunohistochemical as well as Western blot analysis by facilitating pore formation and cytochrome 𝑐 release from
clearly demonstrate an upregulation of cyclin D1 protein the inner mitochondrial membrane with subsequent activa-
expression in the livers isolated from DENA control animals. tion of caspases resulting in cell death. These proapoptotic
These findings are supported by the increased expression of members are downregulated in HCC [62]. An alteration in
cyclin D1 gene following DENA treatment. Collectively, our Bax/Bcl-2 ratio plays a crucial role in deciding whether a cell
data underscore the critical role of cell cycle regulatory pro- should switch towards proliferation or apoptosis [63]. Our
tein in DENA hepatocellular carcinogenesis in rats under our present study revealed that PE registered an increase in the
experimental conditions. Interestingly, a similar transcrip- expression of proapoptotic gene Bax and decrease in the level
tional or translational upregulation of cyclin D1 in response of antiapoptotic gene Bcl-2, resulting in an extraordinary
to DENA exposure in rodents has been reported by various surge in Bax/Bcl-2 ratio. Based upon these results, it is clear
other laboratories [53–55]. A near normal level of cyclin D1 that pomegranate bioactive phytochemicals induce intrinsic
expression was observed due to PE treatment. Reversal of apoptosis and facilitate elimination of transformed cells
dysregulation of a critical checkpoint of the cell cycle could during hepatocellular carcinogenesis by targeting the Bcl-2
be one of the possible mechanisms of pomegranate-mediated family members.
inhibition of heptotumorigenesis, and it underscores the The Wnt/𝛽-catenin signaling pathway is implicated in
value of targeting a cell cycle progression protein to achieve liver physiology and pathology through regulation of various
chemoprevention of hepatocellular cancer. fundamental cellular events, including proliferation, differ-
Apoptosis or programmed cell death, a highly pre- entiation, survival, inflammation, oxidative stress, morpho-
served cellular mechanism, is involved in tissue homeostasis genesis, and regeneration [15, 64, 65]. In canonical Wnt
through targeted elimination of singe cells without disrupting pathway, the multifunctional protein 𝛽-catenin represents the
physiological function of a tissue. Apoptosis is marked by key signaling intermediate. Under normal physiological con-
distinct morphological alterations characterized by cytoplas- ditions, free cytoplasmic 𝛽-catenin undergoes degradation
mic as well as nuclear condensation, DNA fragmentation, through a coordinated action of a multiprotein destruction
phosphatidylserine externalization, and plasma membrane complex consists of GSK-3𝛽, adenomatous polyposis coli,
blebbing [56]. Dysregulation of apoptosis disturbing the casein kinase 1𝛼 (CK1𝛼), and Axin [66]. It is known that 𝛽-
balance between cell proliferation and cell death contributes catenin is first phosphorylated at serine-45 by CK1𝛼, facil-
to development and progression of hepatic malignancy [57, itating its subsequent phosphorylation at serine-33, serine-
58]. Apoptosis detection in tumor mass has emerged as an 37, and threonine-41 by GSK-3𝛽 [67, 68]. The phosphory-
important diagnostic tool and induction of tumor cell death lated 𝛽-catenin first undergoes ubiquitination by the cellular
by apoptosis has been accepted as one of the fundamental E3 ubiquitin ligase complex and then degradation by 26S
objectives of liver cancer therapy [59]. Promotion of apop- proteasome [69]. In the event of Wnt ligands binding with
tosis in tumor-target tissues has been identified as a novel the transmembrane Frizzled (FZD) receptor and coreceptor
mechanism of potential chemopreventive drug. In the present low-density lipoprotein receptor-related protein 5 or 6 (LRP
study, DNA fragmentation was detected to identify cells 5/6), activation of the canonical Wnt pathway is initiated.
undergoing apoptosis. Our results show an extremely low In this process, FZD recruits cytoplasmic scaffolding protein
order of DNA fragmentation in DENA-exposed rat livers Dishevelled (Dvl) which subsequently recruits Axin and
indicating apoptosis evasion. PE treatment showed a drastic GSK-3𝛽 to LRP 5/6 [70]. Consequently, LRP 5/6 is phospho-
increase in the formation of DNA fragments which provides rylated by CK1𝛼 and GSK-3𝛽, resulting in disruption of the
substantial evidence of induction of cell death by apoptosis formation of the destruction complex and inhibition of GSK-
and consequently reduction of proportion of transformed 3𝛽-mediated phosphorylation of 𝛽-catenin. The net result is
the stabilization and accumulation of 𝛽-catenin in the cytosol on the potential of a gamut of bioactive food components in
followed by its translocation to the nucleus. Once inside the prevention and treatment of various neoplastic diseases
the nucleus, 𝛽-catenin interacts with transcription factor T- by targeting the wingless signaling [reviewed in [82–84]],
cell factor/lymphoid enhancer factor and eventually activates very limited information is available on chemoprevention of
the transcription of various Wnt target genes implicated HCC by inhibiting activated Wnt/𝛽-catenin signaling path-
in a number of important biological functions, including way using nutraceuticals and dietary components [reviewed
proliferation (e.g., c-myc), cell cycle control (e.g., cyclin in [19]].
D1), apoptosis (e.g., survivin), and inflammation (e.g., COX-
2) [71–74]. Aberrant constitutive activation of the Wnt/𝛽- 5. Conclusion
catenin pathway leads to uncontrolled cell proliferation,
growth, and survival, promoting various human malignan- The results of our present study undoubtedly establish that
cies, including HCC [13, 16]. Emerging evidence based on pomegranate bioactive constituents suppress cell prolifera-
experimental as well as clinical observations indicate the tion (PCNA), regulate cell cycle progression (cyclin D1), and
involvement of activated Wnt/𝛽-catenin signaling at var- induce programmed cell death (apoptosis) during DENA-
ious stages of hepatic neoplasia, making it an attractive initiated and PB-promoted hepatic tumorigenesis in Sprague-
and viable target for prevention and treatment of HCC Dawley rats. Pomegranate-mediated apoptogenic signal dur-
[reviewed in refs. [17–19]]. Accumulation of 𝛽-catenin in ing experimental hepatocarcinogenesis may be transmit-
the cytoplasm and nucleus has previously been reported ted through up-relegation of proapoptotic protein Bax and
during stepwise progression of DENA-initiated hepatocar- downmodulation of antiapoptotic protein Bcl-2. We also
cinogenesis in rats [75] and DENA/PB-mediated HCC in present data that show, for the first time, that pomegranate
mice [76]. Our immunohistochemical study also reveals that phytochemicals diminish cell proliferation and survival pos-
hepatocytes from DENA-control animals exhibit a marked sibly through blockade of activated canonical Wnt/𝛽-catenin
overexpression of 𝛽-catenin in the cytoplasm and/or nucleus, signaling in hepatocarcinogen-exposed animals. The interfer-
confirming activation of Wnt/𝛽-catenin signaling pathway ence of Wnt/𝛽-catenin signaling may be achieved, at least in
at an early stage of DENA hepatocarcinogenesis in rats. part, through degradation of 𝛽-catenin protein, the cardinal
The accompanying Western blot and RT-PCR data provide effector of Wnt pathway, by up-regulation of GSK-3𝛽. This
further support to our observation regarding induction of the is further supported by the diminished hepatic expression
canonical Wnt/𝛽-catenin pathway. A dose-dependent inhibi- of cyclin D1, a 𝛽-catenin-dependent target gene, and an
tion of 𝛽-catenin expression in transcriptional and transla- indicator of activation of Wnt/𝛽-catenin pathway. Thus, our
tional levels by pomegranate constituents clearly underscores study provides encouraging preclinical evidence and novel
the impairment of the canonical Wnt/𝛽-catenin oncogenic mechanism of targeting activated Wnt/𝛽-catenin signaling
signaling in rat liver carcinogenesis. by pomegranate products to achieve chemoprevention of
Reduced expression of GSK-3𝛽 mRNA has been observed hepatocellular cancer. Previously, we have shown modula-
in human hepatic cancer linked to HCV infection [77]. tion of the NF-𝜅B pathway by pomegranate constituents in
HBV-X protein upregulated 𝛽-catenin with an inactivation DENA hepatocarcinogenesis in rats [35]. As functional cross
of GSK-3𝛽 in liver cancer [78]. Targeted downregulation of regulation between the NF-𝜅B and Wnt/𝛽-catenin signaling
𝛽-catenin protein has been associated with increased GSK- pathways has emerged as a pivotal mechanism for the regu-
3𝛽 protein expression in HCC [79]. A parallel induction of lation of a diverse array of genes involved in tumorigenesis,
hepatic GSK-3𝛽 protein following pomegranate treatment including HCC [37–40], results reported here in conjunction
has been an interesting finding of our study which indicates with our earlier communication [35] indisputably estab-
possible degradation of 𝛽-catenin protein via upregulation lish the “proof-of-principle” of simultaneously targeting two
of GSK-3𝛽. The activation of GSK-3𝛽 may be responsible, interconnected molecular circuits, namely, canonical NF-
at least in part, for the attenuation of oncogenic Wnt/𝛽- 𝜅B and Wnt/𝛽-catenin pathways, to achieve prevention of
catenin signaling and its effect on downstream gene expres- hepatocellular cancer (summarized in Figure 7). Obviously,
sion. While the involvement of GSK-3𝛽 in downregulation these do not exclude the possibility of other mechanisms.
of 𝛽-catenin protein following pomegranate treatment is Overall, our present results based on a clinically relevant
apparent from this study, it is not clear how pomegranate model of liver cancer coupled with an excellent safety
phytochemicals affect the expression of 𝛽-catenin at the profile of pomegranate bioactive substances may facilitate
transcriptional level and may suggest other mechanisms. the development of pomegranate-derived agents as complex,
Pomegranate bioactive compounds may have direct effects synergistic drug for the prevention and therapy of liver
on transcriptional regulation of 𝛽-catenin and GSK-3𝛽 genes. cancer, which represents a complex disease.
This is in line with a recent study that shows reduction
in mRNA expressions of 𝛽-catenin and GSK-3𝛽 in human Conflict of Interests
hepatocarcinoma cells following treatment with nimbolide, a The authors declare that no conflict of interests exists.
natural compound derived from neem tree [80]. Additionally,
methylated chrysin, a constituent of pepper tree leaves, has Acknowledgments
been found to abrogate the elevated expression of 𝛽-catenin
mRNA in preneoplastic lesions induced by DENA in rats [81]. A part of this work was carried out at the Northeast Ohio
Although emerging studies have provided credible evidence Medical University (Rootstown, OH) supported by a new
DENA
1 Wnt/ 2
NF-𝜅B
𝛽-catenin Pomegranate
Pomegranate
Cyclin D1 COX-2 Bcl-2
Bax
Cell Apoptosis
proliferation evasion
Preneoplastic lesions
HCC
Figure 7: Schematic representation of the possible molecular mechanisms of pomegranate-mediated chemoprevention of experimental
hepatocarcinogenesis in rats. COX-2: cyclooxygenase-2; DENA: diethylnitrosamine; HCC: hepatocellular carcinoma; NF-𝜅B: nuclear factor-
𝜅B. DENA simultaneously activates Wnt/𝛽-catenin and NF-𝜅B signaling pathways, which in turn, result in an elevated expression of target
genes, including cyclin D1, COX-2, and Bcl-2 and reduced expression of Bax. All these features contribute to accelerated hepatocyte
proliferation and evasion of apoptosis, which results in development of preneoplastic lesions and subsequently HCC. Pomegranate
phytochemicals block interconnected Wnt/𝛽-catenin and NF-𝜅B signaling pathways, which lead to antiproliferative and proapoptotic effects
contributing to chemoprevention of HCC. ↓: Activation and ⊥: downregulation. 1 and 2 indicate results of this study and that from [35],
respectively.
faculty start-up research Grant to A. Bishayee. The authors [6] A. Bishayee, “Editorial: recent advances in the prevention and
sincerely thank Danielle M. Petit and Thomas Mbimba for therapy of hepatocellular carcinoma,” Current Cancer Drug
assistance with the immunohistochemical studies. Targets, vol. 12, no. 9, pp. 1043–1044, 2012.
[7] S. Kawanishi, Y. Hiraku, S. Pinlaor, and N. Ma, “Oxidative
and nitrative DNA damage in animals and patients with
inflammatory diseases in relation to inflammation-related car-
References cinogenesis,” Biological Chemistry, vol. 387, no. 4, pp. 365–372,
2006.
[1] M. M. Center and A. Jemal, “International trends in liver
[8] H. L. Ha, H. J. Shin, M. A. Feitelson, and D. Y. Yu, “Oxidative
cancer incidence rates,” Cancer Epidemiology Biomarkers and
stress and antioxidants in hepatic pathogenesis,” World Journal
Prevention, vol. 20, pp. 2362–2368, 2011.
of Gastroenterology, vol. 16, pp. 6035–6043, 2010.
[2] R. Siegel, D. Naishadham, and A. Jemal, “Cancer statistics,” CA [9] M. Marra, I. M. Sordelli, A. Lombardi et al., “Molecular targets
Cancer Journal For Clinicians, vol. 62, pp. 10–29, 2012. and oxidative stress biomarkers in hepatocellular carcinoma: an
[3] M. B. Thomas, D. Jaffe, M. M. Choti et al., “Hepatocellular car- overview,” Journal of Translational Medicine, vol. 9, p. 171, 2011.
cinoma: consensus recommendations of the National Cancer [10] J. Gao, L. Xie, W. S. Yang et al., “Risk factors of hepatocellular
Institute Clinical Trials Planning Meeting,” Journal of Clinical carcinoma—current status and perspectives,” Asian Pacific Jour-
Oncology, vol. 28, pp. 3994–4005, 2010. nal of Cancer Prevention, vol. 13, pp. 743–752, 2012.
[4] T. R. Morgan, “Chemoprevention of hepatocellular carcinoma [11] P. A. Farazi and R. A. DePinho, “Hepatocellular carcinoma
in chronic hepatitis C,” Recent Results in Cancer Research, vol. pathogenesis: from genes to environment,” Nature Reviews
188, pp. 85–99, 2011. Cancer, vol. 6, no. 9, pp. 674–687, 2006.
[5] A. Bishayee, T. Politis, and A. S. Darvesh, “Resveratrol in the [12] C. M. Wong and O. L. Ng, “Molecular pathogenesis of hepa-
chemoprevention and treatment of hepatocellular carcinoma,” tocellular carcinoma,” Liver International, vol. 28, pp. 160–174,
Cancer Treatment Reviews, vol. 36, no. 1, pp. 43–53, 2010. 2008.
[13] K. N. Nejak-Bowen and S. P. Monga, “Beta-catenin signaling, prevention and therapy,” in Natural Compounds As Inducers of
liver regeneration and hepatocellular cancer: sorting the good Cell Death, M. Diederich, Ed., Springer, New York, NY, USA,
from the bad,” Seminars in Cancer Biology, vol. 21, pp. 44–58, 2012.
2011. [32] A. J. Pantuck, J. T. Leppert, N. Zomorodian et al., “Phase II
[14] H. C. Lee, M. Kim, and J. R. Wands, “Wnt/Frizzled signaling study of pomegranate juice for men with rising prostate-specific
in hepatocellular carcinoma,” Frontiers in Bioscience, vol. 11, pp. antigen following surgery or radiation for prostate cancer,”
1901–1915, 2006. Clinical Cancer Research, vol. 12, no. 13, pp. 4018–4026, 2006.
[15] Y. Takigawa and A. M. C. Brown, “Wnt signaling in liver cancer,” [33] C. J. Paller, X. Ye, P. J. Wozniak et al., “A randomized phase II
Current Drug Targets, vol. 9, pp. 1013–1024, 2008. study of pomegranate extract for men with rising PSA following
[16] S. Fatima, N. P. Lee, and J. M. Luk, “Dickkopfs and Wnt/𝛽- initial therapy for localized prostate cancer,” Prostate Cancer and
catenin signaling in liver cancer,” World Journal of Clinical Prostatic Diseases, vol. 16, no. 1, pp. 50–55, 2013.
Oncology, vol. 2, pp. 311–325, 2011. [34] A. Bishayee, D. Bhatia, R. J. Thoppil, A. S. Darvesh, E. Nevo,
[17] R. Dahmani, P. A. Just, and C. Perret, “The Wnt/𝛽-catenin path- and E. P. Lansky, “Pomegranate-mediated chemoprevention
way as a therapeutic target inhuman hepatocellular carcinoma,” of experimental hepatocarcinogenesis involves Nrf2-regulated
Clinics and Research on Hepatology and Gastroenterology, vol. antioxidant mechanisms,” Carcinogenesis, vol. 32, no. 6, pp. 888–
35, pp. 709–713, 2011. 896, 2011.
[18] S. B. Nambotin, J. R. Wands, and M. Kim, “Points of therapeutic [35] A. Bishayee, R. J. Thoppil, A. S. Darvesh, V. Ohanyan, J.
intervention along the wnt signaling pathway in hepatocellular G. Meszaros, and D. Bhatia, “Pomegranate phytoconstituents
carcinoma,” Anti-Cancer Agents in Medicinal Chemistry, vol. 11, blunt the inflammatory cascade in a chemically-induced rodent
no. 6, pp. 549–559, 2011. model of hepatocellular carcinogenesis,” Journal of Nutritional
Biochemistry, vol. 24, no. 1, pp. 178–187, 2013.
[19] A. Bishayee, “𝛽-Catenin: a novel biomarker and therapeutic
target in liver cancer,” in Cancer Biomarkers, A. Georgakilas, [36] B. B. Aggarwal and B. Sung, “NF-𝜅B in cancer: a matter of life
Ed., CRC Press, Boca Raton, Fla, USA, 2012. and death,” Cancer Discovery, vol. 1, pp. 469–471, 2011.
[20] V. V. Sivarajan and I. Balachandran, Ayurvedic Drugs and Their [37] Q. Du and D. A. Geller, “Cross-regulation between Wnt and NF-
Plant Sources, IBH Publishing, Oxford, UK, 1994. 𝜅B signaling pathways,” Forum on Immunopathological Diseases
and Therapeutics, vol. 1, pp. 155–181, 2010.
[21] A. Saxena and N. K. Vikram, “Role of selected Indian plants in
[38] M. Moreau, S. Mourah, and C. Dosquet, “𝛽-Catenin and NF-
management of type 2 diabetes: a review,” Journal of Alternative
𝜅B cooperate to regulate the uPA/uPAR system in cancer cells,”
and Complementary Medicine, vol. 10, no. 2, pp. 369–378, 2004.
International Journal of Cancer, vol. 128, no. 6, pp. 1280–1292,
[22] M. I. Gil, F. A. Tomas-Barberan, B. Hess-Pierce, D. M. Holcroft, 2011.
and A. A. Kader, “Antioxidant activity of pomegranate juice
[39] M. M. Chaturvedi, B. Sung, V. R. Yadav, R. Kannappan, and B.
and its relationship with phenolic composition and processing,”
B. Aggarwal, “NF-𝜅B addiction and its role in cancer: one size
Journal of Agricultural and Food Chemistry, vol. 48, no. 10, pp.
does not fit all,” Oncogene, vol. 30, no. 14, pp. 1615–1630, 2011.
4581–4589, 2000.
[40] T. H. Lee, D. I. Tai, C. J. Cheng et al., “Enhanced nuclear
[23] A. Faria, R. Monteiro, N. Mateus, I. Azevedo, and C. Calhau,
factor-kappa B-associated Wnt-1 expression in hepatitis B- and
“Effect of pomegranate (Punica granatum) juice intake on
C-related hepatocarcinogenesis: identification by functional
hepatic oxidative stress,” European Journal of Nutrition, vol. 46,
proteomics,” Journal of Biomedical Science, vol. 13, no. 1, pp. 27–
no. 5, pp. 271–278, 2007.
39, 2006.
[24] E. P. Lansky and R. A. Newman, “Punica granatum [41] A. Bishayee and N. Dhir, “Resveratrol-mediated chemopre-
(pomegranate) and its potential for prevention and treatment vention of diethylnitrosamine-initiated hepatocarcinogenesis:
of inflammation and cancer,” Journal of Ethnopharmacology, inhibition of cell proliferation and induction of apoptosis,”
vol. 109, no. 2, pp. 177–206, 2007. Chemico-Biological Interactions, vol. 179, no. 2-3, pp. 131–144,
[25] A. Faria and C. Conceição, “The bioactivity of pomegranate: 2009.
impact on health and disease,” Critical Reviews in Food Science [42] A. Bishayee, T. Mbimba, R. J. Thoppil et al., “Anthocyanin-
and Nutrition, vol. 51, no. 7, pp. 626–634, 2011. rich black currant (Ribes nigrum L.) extract affords chemo-
[26] D. Heber, “Chapter 10: pomegranate ellagitannins,” in Herbal prevention against diethylnitrosamine-induced hepatocellular
Medicine: Biomolecular and Clinical Aspects, I. F. F. Benzie and carcinogenesis in rats,” Journal of Nutritional Biochemistry, vol.
S. Wachtel-Galor, Eds., CRC Press, Boca Raton, Fla, USA, 2nd 22, pp. 1035–1046, 2011.
edition, 2011. [43] N. C. Teoh, “Proliferative drive and liver carcinogenesis: too
[27] J. Jurenka, “Therapeutic applications of pomegranate (Punica much of a good thing?” Journal of Gastroenterology and Hep-
granatum L.): a review,” Alternative Medicine Review, vol. 13, no. atology, vol. 24, no. 12, pp. 1817–1825, 2009.
2, pp. 128–144, 2008. [44] L. X. Qin and Z. Y. Tang, “The prognostic molecular markers
[28] A. Basu and K. Penugonda, “Pomegranate juice: a heart healthy in hepatocellular carcinoma,” World Journal of Gastroenterology,
fruit juice,” Nutrition Reviews, vol. 67, pp. 49–56, 2009. vol. 8, pp. 385–392, 2002.
[29] N. Khan, F. Afaq, and H. Mukhtar, “Cancer chemoprevention [45] D. Heber, “Multitargeted therapy of cancer by ellagitannins,”
through dietary antioxidants: progress and promise,” Antioxi- Cancer Letters, vol. 269, pp. 262–268, 2008.
dants and Redox Signaling, vol. 10, no. 3, pp. 475–510, 2008. [46] R. Donnellan and R. Chetty, “Cyclin D1 and human neoplasia,”
[30] V. M. Adhami, N. Khan, and H. Mukhtar, “Cancer chemo- Molecular Pathology, vol. 51, pp. 1–7, 1998.
prevention by pomegranate: laboratory and clinical evidence,” [47] K. Sugimachi, S. I. Aishima, K. I. Taguchi et al., “The role
Nutrition and Cancer, vol. 61, no. 6, pp. 811–815, 2009. of overexpression and gene amplification of cyclin D1 in
[31] A. Bishayee and A. S. Darvesh, “Pomegranate-derived con- intrahepatic cholangiocarcinoma,” Journal of Hepatology, vol.
stituents as inducers of cell death: implications in cancer 35, no. 1, pp. 74–79, 2001.
[48] M. Sundarrajan, S. Gupta, and K. V. K. Rao, “Overexpression [64] M. D. Thompson and S. P. Monga, “WNT/beta-catenin signal-
of cyclin D1 is associated with the decondensation of chro- ing in liver health and disease,” Hepatology, vol. 45, pp. 1298–
matin during den-induced sequential hepatocarcinogenesis,” 1305, 2007.
Cell Biology International, vol. 26, no. 8, pp. 699–706, 2002. [65] A. G. Lade and S. P. S. Monga, “Beta-catenin signaling in hepatic
[49] P. Parekh and K. V. K. Rao, “Overexpression of cyclin D1 is development and progenitors: which way does the WNT blow?”
associated with elevated levels of MAP kinases, Akt and Pak1 Developmental Dynamics, vol. 240, no. 3, pp. 486–500, 2011.
during diethylnitrosamine-induced progressive liver carcino- [66] C. Sakanaka, “Phosphorylation and regulation of beta-catenin
genesis,” Cell Biology International, vol. 31, no. 1, pp. 35–43, 2007. by casein kinase I epsilon,” Journal of Biochemistry, vol. 132, pp.
[50] D. H. Park, J. W. Shin, S. K. Park et al., “Diethylni- 697–703, 2002.
trosamine (DEN) induces irreversible hepatocellular carcino- [67] S. Amit, A. Hatzubai, Y. Birman et al., “Axin-mediated CKI
genesis through overexpression of G1/S-phase regulatory pro- phosphorylation of 𝛽-catenin at Ser 45: a molecular switch for
teins in rat,” Toxicology Letters, vol. 191, no. 2-3, pp. 321–326, the Wnt pathway,” Genes and Development, vol. 16, no. 9, pp.
2009. 1066–1076, 2002.
[51] A. A. Bahnassy, A. R. Zekri, S. A. Loutfy et al., “The role [68] C. Liu, Y. Li, M. Semenov et al., “Control of beta-catenin
of cyclins and cyclin dependent kinases in development and phosphorylation/degradation by a dual-kinase mechanism,”
progression of hepatitis C virus-genotype 4-associated hepatitis Cell, vol. 108, pp. 837–847, 2002.
and hepatocellular carcinoma,” Experimental and Molecular [69] H. Aberle, A. Bauer, J. Stappert, A. Kispert, and R. Kemler, “𝛽-
Pathology, vol. 91, pp. 643–652, 2011. catenin is a target for the ubiquitin-proteasome pathway,” The
[52] Y. Che, F. Ye, R. Xu et al., “Co-expression of XIAP and cyclin EMBO Journal, vol. 16, no. 13, pp. 3797–3804, 1997.
D1 complex correlates with a poor prognosis in patients with [70] X. Zeng, H. Huang, K. Tamai et al., “Initiation of Wnt signaling:
hepatocellular carcinoma,” American Journal of Pathology, vol. control of Wnt coreceptor Lrp6 phosphorylation/activation via
180, pp. 1798–1807, 2012. frizzled, dishevelled and axin functions,” Development, vol. 135,
[53] Y. Qian and C. Q. Lin, “Preventive effect of Ganfujian granule no. 2, pp. 367–375, 2008.
on experimental hepatocarcinoma in rats,” World Journal of [71] T. C. He, A. B. Sparks, C. Rago et al., “Identification of c-MYC
Gastroenterology, vol. 10, no. 5, pp. 755–757, 2004. as a target of the APC pathway,” Science, vol. 28, pp. 1509–1512,
[54] M. S. Khan, D. Halagowder, and S. N. Devaraj, “Methylated 1998.
chrysin induces co-ordinated attenuation of the canonical [72] M. Shtutman, J. Zhurinsky, I. Simcha et al., “The cyclin D1 gene
Wnt and NF-kB signaling pathway and upregulates apoptotic is a target of the 𝛽-catenin/LEF-1 pathway,” Proceedings of the
gene expression in the early hepatocarcinogenesis rat model,” National Academy of Sciences of the United States of America,
Chemico-Biological Interactions, vol. 193, no. 1, pp. 12–21, 2011. vol. 96, no. 10, pp. 5522–5527, 1999.
[55] B. Cui, Y. Chen, S. Liu et al., “Antitumour activity of Lycium [73] T. Zhang, T. Otevrel, Z. Gao et al., “Evidence that APC regulates
chinensis polysaccharides in liver cancer rats,” International survivin expression: a possible mechanism contributing to the
Journal of Biology and Macromolecules, vol. 5, pp. 314–318, 2012. stem cell origin of colon cancer,” Cancer Research, vol. 61, no.
[56] C. Burz, I. Berindan-Neagoe, O. Balacescu, and A. Irimie, 24, pp. 8664–8667, 2001.
“Apoptosis in cancer: key molecular signaling pathways and [74] Y. Araki, S. Okamura, S. P. Hussain et al., “Regulation of
therapy targets,” Acta Oncologica, vol. 48, no. 6, pp. 811–821, cyclooxygenase-2 expression by the Wnt and ras pathways,”
2009. Cancer Research, vol. 63, pp. 728–734, 2003.
[57] I. Fabregat, “Dysregulation of apoptosis in hepatocellular carci- [75] Q. M. Wang, K. M. Yang, H. Y. Zhou, Z. H. Yu, X. Li, and
noma cells,” World Journal of Gastroenterology, vol. 15, pp. 513– H. J. Yang, “Role of 𝛽-catenin in hepatocarcinogenesis of rats,”
520, 2009. Hepatobiliary and Pancreatic Diseases International, vol. 5, no.
[58] J. M. Schattenberg, M. Schuchmann, and P. R. Galle, “Cell death 1, pp. 85–89, 2006.
and hepatocarcinogenesis: dysregulation of apoptosis signaling [76] D. F. Calvisi, S. Ladu, V. M. Factor, and S. S. Thorgeirsson,
pathways,” Journal of Gastroenterology and Hepatology, vol. 26, “Activation of 𝛽-catenin provides proliferative and invasive
no. 1, pp. 213–219, 2011. advantages in c-myc/TGF-𝛼 hepatocarcinogenesis promoted by
[59] E. Karamitopoulou, L. Cioccari, S. Jakob et al., “Active caspase 3 phenobarbital,” Carcinogenesis, vol. 25, no. 6, pp. 901–908, 2004.
and DNA fragmentation as markers for apoptotic cell death in [77] A. R. N. Zekri, A. A. Bahnassy, S. A. Abdel-Wahab et al.,
primary and metastatic liver tumours,” Pathology, vol. 39, no. 6, “Expression of pro- and anti-inflammatory cytokines in relation
pp. 558–564, 2007. to apoptotic genes in Egyptian liver disease patients associated
[60] J. L. Mott and G. J. Gores, “Piercing the armor of hepatobiliary with HCV-genotype-4,” Journal of Gastroenterology and Hepa-
cancer: Bcl-2 homology domain 3 (BH3) mimetics and cell tology, vol. 24, no. 3, pp. 416–428, 2009.
death,” Hepatology, vol. 46, no. 3, pp. 906–911, 2007. [78] Q. Ding, W. Xia, J. C. Liu et al., “Erk associates with and primes
[61] T. Takehara, X. Liu, J. Fujimoto, S. L. Friedman, and H. Taka- GSK-3b for its inactivation resulting in upregulation of beta-
hashi, “Expression and role of Bcl-xL in human hepatocellular catenin,” Molecular Cell, vol. 19, pp. 159–170, 2005.
carcinomas,” Hepatology, vol. 34, no. 1, pp. 55–61, 2001. [79] X. H. Wang, X. W. Meng, H. Xing et al., “STAT3 and beta-
[62] W. Beerheide, Y. J. Tan, E. Teng, A. E. Ting, A. Jedpiyawongse, catenin signaling pathway may affect GSK-3beta expression in
and P. Srivatanakul, “Downregulation of proapoptotic proteins hepatocellular carcinoma,” Hepatogastroenterology, vol. 58, pp.
Bax and Bcl-X(s) in p53 overexpressing hepatocellular carci- 487–491, 2011.
nomas,” Biochemical and Biophysical Research Communications, [80] K. Kavitha, R. Vidya Priyadarsini, P. Anitha et al., “Nimbolide,
vol. 273, no. 1, pp. 54–61, 2000. a neem limonoid abrogates canonical NF-𝜅B and Wnt signaling
[63] M. D’Amelio, E. Tino, and F. Cecconi, “The apoptosome: to induce caspase-dependent apoptosis in human hepatocarci-
emerging insights and new potential targets for drug design,” noma (HepG2) cells,” European Journal of Pharmacology, vol.
Pharmaceutical Research, vol. 25, no. 4, pp. 740–751, 2008. 681, pp. 6–14, 2012.
[81] M. S. Khan, D. Halagowder, and S. N. Devaraj, “Methylated

chrysin induces co-ordinated attenuation of the canonical
Wnt and NF-kB signaling pathway and upregulates apoptotic
gene expression in the early hepatocarcinogenesis rat model,”
Chemico-Biological Interactions, vol. 193, no. 1, pp. 12–21, 2011.
[82] F. H. Sarkar, Y. Li, Z. Wang, and D. Kong, “The role of
nutraceuticals in the regulation of Wnt and Hedgehog signaling
in cancer,” Cancer and Metastasis Reviews, vol. 29, no. 3, pp. 383–
394, 2010.
[83] M. H. Teiten, F. Gaascht, M. Dicato, and M. Diederich, “Tar-
geting the wingless signaling pathway with natural compounds
as chemopreventive or chemotherapeutic agents,” Current Phar-
maceutical Biotechnology, vol. 13, pp. 245–254, 2012.
[84] R. S. Tarapore, I. A. Siddiqui, and H. Mukhtar, “Modulation
of Wnt/𝛽-catenin signaling pathway by bioactive food compo-
nents,” Carcinogenesis, vol. 33, pp. 483–491, 2012.
http://dx.doi.org/10.1155/2013/701434
Review Article
Pomegranate Extracts in the Management of Men’s Urologic
Health: Scientific Rationale and Preclinical and Clinical Data
Kroeger N.,1,2 Belldegrun A. S.,1 and Pantuck A. J.1

1
Department of Urology, Institute of Urologic Oncology, David Geffen School of Medicine at the University of California,
924 Westwood Boulevard, Suite 1050, Los Angeles, CA 90095-7384, USA
2
Department of Urology, University Medicine Greifswald, F.-Sauerbruch-Str., 17 489 Greifswald, Germany
Correspondence should be addressed to Allan J. Pantuck; apantuck@mednet.ucla.edu
Received 4 December 2012; Accepted 27 February 2013
Copyright © 2013 Kroeger N. et al. This is an open access article distributed under the Creative Commons Attribution License,
Multiple strands of research provide growing evidence that diet, nutrition, and life style play a role in the development and the
course of urological diseases. Numerous micronutrients and polyphenols found in soy, green tea, and many fruits and vegetables
have been described to impact diseases including erectile dysfunction, benign prostatic hyperplasia, and prostate cancer. However,
oftentimes these reports lack both a scientific rationale and supportive evidence base. The efficacy of pomegranate, on the other
hand, in the modulation of central biological processes like inflammation, hypoxia, and oxidative stress that are important in the
pathogenesis of urological maladies has been robustly demonstrated in preclinical in vitro and in vivo studies. Moreover, clinical
trials have further supported its use in the treatment of several diseases, in particular in the management of prostate cancer. Herein,
we critically review the scientific knowledge about the current role and future prospects for the use of pomegranate extracts in the
therapy of erectile dysfunction, benign prostatic hyperplasia, and prostate cancer.
1. Introduction compared with men in Western Europe and North America.

These differences frequently are mitigated after immigration
As men age, there are inevitable changes that occur in to Western countries after only one generation [3]. Authors
the genitourinary tract that increase their risk of develop- have suggested that this finding is a result of westernization,
ing urological diseases such as ED (erectile dysfunction), and adoption of western lifestyle and nutrition habits [4]. The
prostatitis, BPH (benign prostatic hyperplasia), and PCA increase in incidence of prostate cancer in Asian countries [5]
(prostate cancer). An autopsy study reported an incidence of along with a growing economy in these countries supports
BPH of only 8 percent in men during the fourth decade of life, the hypothesis that there are both environmental and genetic
while 50 percent of men have pathological BPH between ages influences which impact the development of prostate cancer.
51 and 60 [1]. Likewise, data from the Massachusetts Male Modifiable lifestyle and nutrition habits and the long
Aging Study (MMAS) have demonstrated an increase in the latency of many problems of men’s health make them ideal
incidence of ED with each decade of age, rising from 12.4 candidates for prevention as well as complementary treat-
cases per 1000 men years (95% CI 9.0 to 16.9) in men aged ment strategies. Moreover, urological patients have a high
40–49 to 46.4 cases per 1000 men years (95% CI 36.9 to 58.4) desire to get alternative and complementary treatments. A
in men aged 60–69 years [2]. meta-analysis has demonstrated that 30% of prostate can-
In the past years, there is a growing body of literature that cer patients are using complementary alternative medicine
supports the role of environmental and other life style factors (CAM) in addition to their standard treatments [6]. In search
in impacting pathological alterations of the genitourinary for new treatment and prevention approaches, research has
tract. For example, Asian men usually have a significantly suggested that reduction of oxidation and inflammation may
lower incidence of and mortality from prostate cancer when improve health outcomes. Increasing evidence suggests that
some of these risks appear to be reduced by nutritional 80–98% of prostate biopsies [21, 22]. Evidence supports the
interventions that may help support the maintenance of men’s role of proliferative inflammatory atrophy as a precursor
health in general and the lower urinary tract in particular to prostatic intraepithelial neoplasia and invasive prostate
(reviewed in [7]). cancer [23]. The risk of prostate cancer may be reduced with
Current dietary recommendations emphasize increasing the prophylactic intake of anti-inflammatory drugs. Meta-
the daily consumption of fruits and vegetables from diverse analyses, for example, have shown a ∼15–20% risk reduction
sources such as citrus fruits, cruciferous vegetables, and in patients who are using anti-inflammatory pharmaceuticals
green and yellow vegetables. There are potent phytochemicals such as nonsteroidal anti-inflammatory drugs (NSAIDs) or
in edible plants, which may have health benefits through aspirin on a regular basis [3, 24, 25]. However, the chronic
antioxidation, inhibition of inflammation, and via gene- use of NSAIDs and aspirin is limited by its associated side
nutrient interactions. In order to explain preventive as well effects, including gastric ulcers, renal insufficiency, and in
as therapeutic effects of nutrition components, investigators the case of COX-2 inhibitors, with cardiovascular events
have focused on the antioxidative effects of plant polyphenols (reviewed in [26]). Prostate cancer is a slow-growing disease
[7]. Extracts derived from pomegranate (Punica granatum) and, therefore, it will be mandatory to find prevention
have been intently studied over the past decade. Preclinical strategies which are effective in decreasing inflammation
and clinical studies provide evidence of their antiproliferative without causing side effects when used in the long term.
properties and modulatory effects on inflammatory pathways Inflammation is inextricably linked with hypoxia and
[8]. Herein, we will provide an overview on the current an occurrence of reactive oxygen species (ROS). Evidence
preclinical and clinical knowledge of the mode of action and supports that inflammation and secondary ROS play impor-
the use of pomegranate in the prevention and treatment of tant roles in prostate carcinogenesis [27]. An imbalance in
ED, BPH, and PCA. the intracellular production and clearance of ROS results
in oxidative stress, which in turn leads to an increased
2. Biological Rational for the Use of risk of DNA damage and other epigenetic changes [28].
Pomegranate Extracts in the Treatment As in other cancer types, oxidative stress, low levels of
of Urological Diseases antioxidative enzymes, and defective DNA repair of oxidative
DNA damage have been implicated in prostate carcinogenesis
Pomegranate phytochemicals have been shown to be effective [3, 29].
in reducing oxidative stress and to modulate inflammatory In the past few years, it has become increasingly apparent
pathways [9, 10]. The rationale for the use of pomegranate in that the nitric oxide (NO)/cyclic guanosine monophosphate
prevention and treatment of ED, BPH, and PCA, therefore, (cGMP) pathway has a major influence on the pathogen-
depends on the influence of inflammation and hypoxia on the esis of both LUTS and ED. LUTS is one of the most
pathogenesis of these diseases. important risk factors for the development of ED. A study
BPH is a urological disease that is characterized histo- of Germany has shown that 72.2% of men with ED had
logically by glandular hyperplasia in the periurethral and LUTS compared to only 37.7% without ED. In a multiple
transition zones of the prostate, and clinically by obstructive logistic regression analysis, age, diabetes, hypertension, pelvic
and irritative lower urinary tract symptoms (LUTS) [11]. surgery, and LUTS were all independent risk factors for the
Accumulating evidence suggests that inflammation may be development of ED [30]. In both conditions, an increase
involved in the development of BPH/LUTS [12]. In rodent of smooth muscle tension is thought to play a central role
models, induced prostatic inflammation has been shown to in the pathophysiology. The NO/cGMP pathway is one of
contribute to prostatic hyperplasia [13, 14], and in humans, the major regulators of smooth muscle contractility of the
inflammatory infiltrates are frequently observed in prostate lower urinary tract and the penile corpora cavernosum and
tissue specimens from men with BPH [15, 16]. Moreover, the spongiosum. NO is a neurotransmitter of the vegetative
presence or degree of inflammation has been found to be nervous system. It is released, that is, by sexual stimulation
correlated with prostate size [16, 17], severity of LUTS [18], from nonadrenergic, noncholinergic (NANC) neurons that
and greater risk of developing acute urinary retention [19]. innervate the corpus cavernosum of the penis [31]. The
Given these observations suggesting that inflammation may expression of NO is dependent on the presence of oxygen
contribute to BPH/LUTS, it is plausible to hypothesize that and reduced nicotinamide-adenine dinucleotide phosphate
anti-inflammatory agents may reduce the severity of lower (NADPH) and is catalyzed by the NO synthase (NOS).
urinary tract symptoms associated with BPH. NO activates the intracellular guanylate cyclase, the enzyme
In 1863, Rudolf Virchow firstly made a link between that further controls the conversion of 5-GTP to 3󸀠 , 5󸀠 -
inflammation and cancer when he noted “lymphoreticular cGMP. The accumulation of intracellular cGMP triggers a
infiltrates” within neoplastic lesions. It has been estimated cascade, leading to decreased intracellular calcium levels and
that about 15% of cancers may be attributed to infectious subsequent relaxation of smooth muscles of various organs,
agents and to the concomitant inflammation that is a major including the arteries and the lower urinary tract [32–34].
component of chronic infections [20]. Balkwill and Manto- BPH and ED are both diseases that become increasingly
vani have labeled genetic damage as the “match that lights prevalent as patients age, and in consequence, are often
the fire” and inflammation as the “fuel that feeds the flames” accompanied with disorders that also occur more frequently
[20]. Chronic inflammation is common in the prostate of in advanced ages like diabetes mellitus, hypertension, arte-
men with advanced ages and can be found in approximately riosclerosis, and hypercholestrolemia. All of these covariates
Inflammation
∙ Modulation of
NF-𝜅B pathway
∙ Reduction of pro-
inflammatory
cytokines and
chemokines
NO/cGMP Hypoxia
pathway ∙ Increase of blood
∙ Increase of NO Pomegranate flow by endothelial
concentration → extracts protection and
smooth muscle arteriole relaxation
relaxation
Oxidative stress
∙ Reduction of
superoxide (O2 ∙− )
Figure 1: Potential modulatory effects of pomegranate extracts on central biological processes that have a crucial role in the pathogenesis of
erectile dysfunction (ED), benign prostatic hyperplasia (BPH), and prostate cancer (PCA).
have been well described as risk factors of ED. Moreover, were considerably less affected (ED50 250 g/mL) [41]. Incu-
it has been demonstrated that these factors are associated bation of LNCaP cells over 24 h at various concentrations
with an increase in the intracavernosal expression/activity of revealed that punicic acid, a fatty acid present in pomegranate
reduced NADPH-oxidase, an enzyme that generates super- seeds, was able to stimulate apoptosis in a caspase-dependent
oxide (O2 ∙− ) [35]. O2 ∙− is a highly reactive radical that can manner [42]. Koyama et al. [43] examined the relationship
interrupt the physiological function of NO due to its ability between POMx- (POM Wonderful LLC, Los Angeles, CA,
to react with NO to form peroxynitrite (PN). NO as well USA), a pomegranate extract with standardized ellagitannin
as PN is able to mediate smooth muscle relaxation of the content (37% punicalagins by HPLC), induced apoptosis
corpus cavernosum, but PN is much less potent compared to and the insulin growth factor (IGF)/insulin growth factor
NO [36]. Recent phase III studies demonstrating the efficacy binding protein- (IGFBP-)3 system in LAPC4 prostate cancer
of phosphodiesterase (PDE) inhibitors in the treatment of cell lines. Cultivation with POMx and IGFBP-3 had addi-
LUTS and ED [37–40] have highlighted the crucial role of tive effects on apoptosis induction and growth inhibition.
a functional intact NO/cGMP pathway for both urological Western blot analyses of the proapoptotic c-Jun kinase (JNK)
disorders. On overview of potential effects of pomogranate and the growth inductors of the mTOR pathway indicated
on diverse biological mechanisms is shown in Figure 1. a downregulation of the mTOR pathway and an increase in
JNK expression.
Moreover, in addition to causing prostate cancer cell
3. Preclinical Evidence for death, pomegranate extracts have been reported to increase
the Use of Pomegranate Extracts in cell adhesion and decrease cell migration, processes impor-
Men’s Urologic Health tant for metastatic spread. For example, treatment of prostate
cancer with pomegranate extracts resulted in an upregulation
3.1. Prostate Cancer. The most striking evidence for the of genes involved in cell adhesion (E-cadherin, intercellu-
biological activity of pomegranate extracts was demonstrated lar adhesion molecule 1 (ICAM-1)) while genes that are
in prostate cancer cells. In vivo and in vitro studies have shown important for cell migration (hyaluronan-mediated motility
that pomegranate extracts are capable of inhibiting tumor cell receptor (HMMR) and type I collagen) were downregu-
proliferation, migration, and invasion, while also inducing lated. Furthermore, cytokines that are known mediators of
apoptosis. For example, only 70 microg/mL of pomegranate inflammation (IL-6, IL-12p40, and IL-1𝛽) and are capable of
extract was needed to suppress the growth of LNCaP prostate chemoattracting cancer cells via the SDF/CXCR4 axis were
cancer cells by 50%, whereas normal prostate cells (hPrECs) downregulated by pomegranate extracts [44].
Our institution has demonstrated the inhibitory effects a decreased erectile tissue blood flow, diminished intracav-
of pomegranate extracts on inflammatory pathways [10]. The ernosal perfusion pressures, and impaired metabolic waste
nuclear factor-kappaB (NF-𝜅B) is an important predictor clearance from the erectile tissues. Moreover, they detected
of prostate cancer biochemical recurrence [45, 46] and is an accumulation of oxidatively modified byproducts and an
activated in castration-resistant prostate cancer (CRPC) [47]. upregulation in levels of superoxide-dismutase and aldolase
Our investigations have demonstrated that inhibition of reductase, both of which are known to be oxidation-sensitive
NF-𝜅B is necessary for the maximal proapoptotic effect of genes. Contrarily, in the pomegranate-extract-treated group
pomegranate extracts. Moreover, these studies also showed animals had an increased intracavernosal blood flow, smooth
that pomegranate extracts not only inhibit the activation of muscle relaxation, and erectile activity compared to controls.
NF-𝜅B, but also delay the emergence of castration resistance However, the erectile activity of the pomegranate-treated
in a xenograft model through reduced proliferation and group did not normalize to the level of age-matched animals
increased apoptosis. These results were further supported by a without arteriosclerosis. The authors concluded from their
recent study that comparatively analyzed proteomic patterns study that antioxidative therapy appears to act promptly
of treated and untreated DU145 cells [48]. After treatment on molecular and ultrastructural alterations rather than on
with pomegranate extracts, 11 proteins were deregulated in anatomical structures like erectile tissue fibrosis. Addition-
treated DU145 cells. Three proteins were upregulated and ally, they suggested that long-term consumption of antioxida-
eight proteins were downregulated. Among the proteins that tive dietary improves ED by protection of NO bioavailability.
were downregulated after treatment with pomegranate was Similar results were reported by Azadzoi et al. [54] who also
valosin containing protein (VCP (p97)). Elevated expression reported an increased intracavernosal blood flow, improve-
of VCP is known to be a prognostic factor for tumor ment of erectile response, and smooth muscle relaxation in an
progression and metastasis of PCA [49]. Of note, VCP animal model. Furthermore, they found, opposite to Zhang et
belongs to the ATPase superfamily and is involved in the al., that long-term intake of pomegranate extracts also helped
ubiquitin/proteasome-mediated degradation of I𝜅B-𝛼, the to prevent erectile tissue fibrosis in the treated ED group.
endogenous inhibitor of NF-𝜅B. Therefore, VCP is capable of
regulating the activation of NF-𝜅B [50]. Thus, the decreased
expression of VCP could be one mechanism that may explain
the NF-𝜅B-inhibitory effect and consequently the proapop- 4. Clinical Evidence for the Efficacy of
totic and antiandrogen effects of pomegranate extracts. Pomegranate Extracts in Urological Diseases
Finally, remarkable results on the tumor growth
inhibitory properties of pomegranate extracts were recently 4.1. Prostate Cancer. A number of clinical studies have pro-
reported by Adhami and colleagues [51]. The transgenic vided evidence of biologic activity of pomegranate extracts
adenocarcinoma of the mouse prostate (TRAMP) model in human prostate cancer. In a phase II study, the effects
is one of the most relevant models to humans because of daily consumption of 8 oz. of pomegranate juice on PSA
mice uniformly spontaneously develop orthotopic prostate progression in 46 men with a biochemical recurrence after
tumors following the onset of puberty [52]. In their study, surgery or radiation were assessed [55]. Eligible patients
Adhami et al. [51] supplemented drinking water with 0.1% had a detectable PSA >0.2 and <5 ng/mL and s Gleason
and 0.2% of pomegranate extracts, comparable to 250 to score ≤7. The clinical endpoints of the study were safety,
500 mL of pomegranate juice. In the control group, 100% of effect on serum PSA, serum-induced in vitro proliferation
mice developed palpable tumors after 20 weeks compared and apoptosis induction of LNCaP cells, serum lipid per-
with only 30 and 20% in the 0.1 and 0.2% pomegranate oxidation, and serum nitric oxide levels. During the study
extract-supplemented groups, respectively. The median period, no serious adverse events were reported. There was
life expectancy was 43, 73, and 92 weeks in the control, a statistically significant prolongation of the PSA doubling
0.1%, and 0.2% groups, respectively. Unlike the control time from a mean of 15 months at baseline to 54 months
group, none of the mice in the pomegranate-extract- after treatment (𝑃 < 0.001). The effects of patient sera
treated groups developed metastases, and all tumors were following pomegranate consumption on proliferation and
without any evidence of poorly differentiated features. In apoptosis induction on LNCaP prostate cancer cells in vitro
concordance with previous in vitro studies, the authors were measured. Proliferation assays demonstrated a mean
reported a simultaneous and significant inhibition of the decrease of proliferation by 12% (𝑃 = 0.0048) between sera
IGF-I/Akt/mTOR pathways in the PCA resulting from at baseline and after 9 months of pomegranate consumption.
treatment with prostate extracts. In the same assay system, apoptosis increased by 17.5% (𝑃 =
0.0004) after cultivation with the same patient media. In
addition, susceptibility against oxidative stress, measured by
the content of serum lipid peroxides, significantly decreased
3.2. Erectile Dysfunction. In an effort to search for markers following pomegranate juice consumption. This was the
of oxidative stress in arteriogenic ED and to investigate first clinical study to provide evidence beyond preclinical
the protective role of dietary antioxidants, Zhang et al. investigations of the biologic activity of pomegranate juice
[53] developed atherosclerosis-induced ED in rabbits by consumption on recurrent prostate cancer.
balloon deendothelialization of the iliac arteries. Analogous Recently, Paller et al. [56] published a multicenter phase
to the situation in patients with atherosclerosis, they found II clinical trial of men with localized prostate cancer to
receive either 1 or 3 g of POMx pills. POMx is a standard- 8OHdG is formed as the result of oxidative damage to the
ized pomegranate (Punica granatum L., Wonderful variety) DNA base 2󸀠 -deoxyguanosine (dG) and is a major product
polyphenol extract developed for use as a dietary supplement of DNA oxidation. This study gave for the first time clini-
and which has received “Generally Recognized as Safe” cal evidence for the accumulation of pomegranate extracts
status. Each capsule contained up to 1000 mg of polyphe- in benign and malignant prostate tissues. Urolithin A (3,
nol extract, which delivers pomegranate polyphenols in an 8-dihydroxy-6H-dibenzo[b,d]pyran-6-one), a metabolite of
amount equivalent to approximately 8 oz of pomegranate ellagic acid, punicalagin, and the ellagitannin extract that
juice. The extract is well characterized, product specifications are all ingredients of pomegranate, was more often detected
have been established, and batch analyses data confirm that (𝑃 = 0.031) with higher levels in the POMx arm compared
the product is consistent in quality and free of microbial to placebo-treated patients (𝑃 = 0.007). In both benign and
or chemical contaminants. It contains the same compounds malignant prostate tissues, there was an inverse correlation
found in pomegranate juice, differing only in having lower between Urolithin A and the levels of oxidative DNA damage
anthocyanidins and significantly higher proportional con- as measured by 8-OHdG levels. POMx reduced benign
tent of pomegranate polyphenols, primarily punicalagin and prostate tissue 8-OHdG by 33% (𝑃 = 0.003) in men with
isomers, but the levels in food or supplement products are organ-confined disease. This was (a) a modest size study and
limited to the amount found in 8 oz of 100% juice. The (b) the time of treatment was within 4 weeks very short. As
study cohort of 104 patients was stratified according to their discussed in the previous sections, it has been suggested that
baseline PSA doubling time (PSADT) and Gleason score. the effects of pomegranate extracts become evident in long-
The primary endpoint of the study was a detection of a 6- term use by its ability to reduce chronic oxidative stress. Thus,
month on-study increase in PSADT. PSADT lengthened from the most important finding of this study was the proof of
11.9 months at baseline to 18.8 months after treatment in the metabolite accumulation in the prostate and the strong trend
intention to treat group (𝑃 < 0.001); however, there was for its association with reduced 8-OHdG in both benign and
no evidence of dose-response impact on PSADT between malignant tissues.
the two dosage groups (𝑃 = 0.554). A decline in PSA was Another point of criticism to the studies above is the
observed in 13% of patients. Again, there were no severe side use of PSADT as a surrogate parameter for standard clinical
effects of the treatment; however, mild diarrhea was reported outcomes such as survival. A retrospective study presented
in 1.9% of the low-dose group and 13.5% in the high-dose at the ASCO Meeting 2012 has shown that PSADT may
group. This study confirmed previously reported findings, increase even in the absence of therapy, possibly in part due
but in a more heterogeneous patient cohort (31% of patients to the duration of PSA followup [59]. The findings of these
in this study had PSA >5 ng/mL with up to 32 ng/mL). A investigations challenge the use of PSA kinetics in single-arm
major limitation of this study was the high dropout rate studies that do not have a placebo-controlled comparator.
of 42% of patients before the protocol definition of PSA In summary, the current clinical trials provide ample
progression or the 18 months of followup were reached. The evidence for the biological activity of pomegranate extracts in
most important reason for premature discontinuation of the prostate cancer. This conclusion has to be emphasized in the
trial was uncertainty of the patient and/or the investigator light of other alternative treatments with agents like celecoxib
in case of PSA progression. Collectively, 70% of the study or rosiglitazone that did not improve the mean PSADT when
population remained on study medication for 12 months, compared to a placebo control group in randomized clinical
judged to be sufficient enough to provide an adequate patient trials [57, 60].
number to reliably examine PSADT.
Major criticisms of these two phase II studies have been
the lack of placebo control, the lack of a dose-response 4.2. Erectile Dysfunction. One study investigated the
effect, and the lack of prostate tissue to correlate PSA improvement of ED in 60 sexually active, healthy males
change with in vivo biological effects. Moreover, the fact aged 21–70 years [61]. Inclusion criteria included mild-to-
that a prior placebo-controlled trial found 73% of men on moderate ED, as indicated (17–25 points of the International
placebo on a similarly designed study had longer on-study Index of Erectile Function (IIEF) questionnaire [62]), and a
PSADT than prestudy [57] makes interpreting these data stable monogamous relationship with a consenting female
challenging. Several clinical studies have been performed to partner. The study was designed as a crossover clinical trial.
address these deficiencies. A follow-up multicenter, phase Patients were assigned to two groups that either received
III, double-blind, placebo controlled study of pomegranate 8 oz of pomegranate juice or placebo for a total of 28
juice extract (NCT00060086) in 180 men with biochemically days. After a washout period of two weeks, the placebo
recurrent prostate cancer has recently been completed, with group switched to the active treatment and vice versa.
the results anticipated in the first quarter of 2013. Addition- At the end of the second period, subjects were evaluated
ally, a randomized, placebo-controlled clinical trial of POMx with the IIEF questionnaire again. An improvement in
daily for up to 4 weeks prior to radical prostatectomy in Global Assessment Questionnaire (GAQ) was the primary
order to obtain prostate tissue was conducted to objectively endpoint and a change of the erectile function domain in
measure whether pomegranate extracts and their metabolites the IIEF questionnaire was the secondary endpoint. The
were systemically absorbed and accumulated in the prostate authors observed a trend towards an improvement of GAQ
[58]. The primary study outcome was the difference between associated with the consumption of pomegranate juice
arms in prostate 8-hydroxydeoxyguanosine (8-OHdG) levels. treatement (𝑃 = 0.058). The secondary efficacy endpoint,
Table 1
Project
Trial name Intervention Outcome
finish date
Primary outcome measures:
(i) count of motile sperm per ejaculate (time frame: up to two years)
(designated as safety issue: no)
Secondary outcome measures:
Effects of plant extracts
Pomegranate (i) morphology: percentage of morphologically abnormal sperm in the ejaculate October
on semen quality
versus placebo (time frame: up to two years) (designated as safety issue: no) 2012
(NCT01357044) If we find an increase in the primary outcome measure in data from participants
receiving plant extracts and not in those receiving placebo tablets, we wish to
further investigate whether sperm morphology also improves when consuming the
plant extracts, for example, whether the percentage of abnormal sperm in an
ejaculate decreases in the group of participants receiving the active plant extracts
(i) tissue collection and bioanalysis of the specimens collected (time frame: tissue
collected on day 31 (after 30 days of study treatment)) (designated as safety issue:
Study of POMELLA
Pomegranate no) December
extract to treat prostate
versus placebo Prostate tissue are collected at radical prostatectomy. These specimens are used to 2013
cancer (NCT01100866)
explore the effects of treatment on the expression of the proliferation markers,
enzymes, hormones, receptors, and cell signaling proteins known to influence
prostate cancer progression
Pomegranate Juice in
treating patients with Pomegranate
(i) clinical efficacy, in terms of overall response rate, measured by serum December
recurrent prostate juice versus
prostate-specific antigen (PSA) levels every 3 months (time frame: evaluated every 3 2012
cancer placebo
months for 18 months) (designated as safety issue: no)
(NCT00060086)
(i) the primary outcome variable will be the mean PSA doubling time at the end of
12, 24, 36, and 48 months (time frame: 48 months) (designated as safety issue: no)
Extension to study of Secondary outcome measures:
effects of pomegranate (i) the mean change in PSA doubling time from baseline to end of treatment (time
Pomegranate frame: 48 months) (designated as safety issue: no)
extract on rising PSA January
extract versus (ii) response rates in positive and negative PSA doubling times with a clinically
levels after primary 2015
therapy for prostate
placebo significant positive doubling time is defined as >150% of baseline (time frame: 48
cancer (NCT00732043) months) (designated as safety issue: no)
(iii) overall efficacy responses categorized as objective response, progressive disease,
and stable disease (time frame: 48 months) (designated as safety issue: no)
(iv) measures of tolerability (adverse events) and toxicity (clinical chemistries, etc.)
(time frame: 48 months) (designated as safety issue: yes)
(i) change in sperm counts (time frame: baseline and 6 months) (designated as
A pilot study to safety issue: no)
evaluate the effect of The primary outcome will be change in sperm counts relative to baseline with and
pomegranate juice on
Pomegranate without POM May 2012
semen parameters in
healthy male volunteers Secondary outcome measures:
(NCT01595308) (i) change in sperm count (time frame: 6 months) (designated as safety issue: no)
The secondary outcome will be change in sperm counts relative to baseline with and
without POM
Open-label extension (i) the within-subject difference between the PSA doubling time from the end of
study of the effects of double-blind placebo treatment to the end of open-label pomegranate extract
pomegranate extract treatment (time frame: 12 months) (designated as safety issue: no)
Pomegranate January
on rising PSA after
liquid extract Secondary outcome measures: 2015
primary therapy for (i) the effect of treatments on response rates for positive PSA doubling times
prostate cancer (greater than 150% baseline), for negative posttreatment PSA doubling time (i.e.,
(NCT00731848) declining PSA), and for changes in absolute PSA values (time frame: 12 months)
(designated as safety issue: no)
For more information go to: http://clinicaltrials.gov/.
an upgrading of the erectile function domain of the IIEF double-blind, controlled trials are under way and will be
questionnaire, was not reached. The study was limited in completed soon.
being a small sample size trial with relatively short-term use
of pomegranate extracts for treatment of ED; nevertheless,
there was a signal for an efficacy of pomegranate extracts
Acknowledgment
to improve mild-to-moderate ED. Further randomized A. J. Pantuck has received grants and other research funding
controlled trials that are better powered to assess the efficacy donated to the University of California, Los Angeles (UCLA)
of pomegranate extracts in ED therapy are, therefore, needed. from POM Wonderful.
In addition to this clinical trial, studies have examined the
efficacy of pomegranate extracts to improve maladies that
are typical risk factors for the development and progress of References
ED, including hypertension and the ability to inhibit serum
[1] S. J. Berry, D. S. Coffey, P. C. Walsh, and L. L. Ewing, “The
angiotensin converting enzyme [63]. The management of development of human benign prostatic hyperplasia with age,”
these well-defined risk factors is an important factor in the The Journal of Urology, vol. 132, no. 3, pp. 474–479, 1984.
overall management of ED.
[2] C. B. Johannes, A. B. Araujo, H. A. Feldman, C. A. Derby,
K. P. Kleinman, and J. B. McKinlay, “Incidence of erectile
4.3. Benign Prostate Hyperplasia (BPH). There is currently no dysfunction in men 40 to 69 years old: longitudinal results from
completed clinical study evaluating the effect of pomegranate the Massachusetts male aging study,” The Journal of Urology, vol.
extracts in the treatment of BPH. However, a previous 163, no. 2, pp. 460–463, 2000.
clinical trial provided justification for clinical testing in [3] A. M. De Marzo, E. A. Platz, S. Sutcliffe et al., “Inflammation
subjects with BPH [55]. In this study, nitric oxide metabolites in prostate carcinogenesis,” Nature Reviews Cancer, vol. 7, no. 4,
were measured to evaluate the level of antioxidant activity pp. 256–269, 2007.
in patients treated with pomegranate juice. Compared to [4] A. W. Hsing, L. Tsao, and S. S. Devesa, “International trends
baseline, there was a 23% increase in serum nitric oxide and patterns of prostate cancer incidence and mortality,” Inter-
metabolites measured in patients serum at 9 months (𝑃 = national Journal of Cancer, vol. 85, pp. 60–67, 2000.
0.0085) with two-thirds of patients assayed having an increase [5] M. M. Center, A. Jemal, J. Lortet-Tieulent et al., “International
compared to baseline. As described above, the increase in NO variation in prostate cancer incidence and mortality rates,”
levels appears to be a key factor in lowering the tension of European Urology, vol. 61, pp. 1079–1092, 2012.
smooth muscle of the lower urinary tract via the NO/cGMP [6] F. L. Bishop, A. Rea, H. Lewith et al., “Complementary medicine
pathway and subsequently improving LUTS symptoms. Fur- use by men with prostate cancer: a systematic review of
thermore, the neoadjuvant POMx pill study [58] demon- prevalence studies,” Prostate Cancer and Prostatic Diseases, vol.
strated that POMx reduced 8-OHdG in both benign as well 14, pp. 1–13, 2011.
as malignant prostate tissue. The data suggesting decreasing [7] V. M. Adhami and H. Mukhtar, “Anti-oxidants from green
oxidative damage with simultaneous increase in serum NO tea and pomegranate for chemoprevention of prostate cancer,”
content support the study of the use of pomegranate extract Molecular Biotechnology, vol. 37, no. 1, pp. 52–57, 2007.
in order to improve LUTS. Thus, a randomized, double- [8] A. Faria and C. Calhau, “The bioactivity of pomegranate: impact
blind, placebo-controlled pilot study evaluating the efficacy on health and disease,” Critical Reviews in Food Science and
of POMx on BPH-related LUTS is currently under way at our Nutrition, vol. 51, no. 7, pp. 626–634, 2011.
institution. [9] M. Aviram, L. Dornfeld, M. Rosenblat et al., “Pomegranate juice
consumption reduces oxidative stress, atherogenic modifica-
5. Overview of Registered, Ongoing Clinical tions to LDL, and platelet aggregation: studies in humans and
in atherosclerotic apolipoprotein E-deficient mice,” American
Trials Evaluating the Effects of Pomegranate Journal of Clinical Nutrition, vol. 71, no. 5, pp. 1062–1076, 2000.
Extracts on Urological Diseases [10] M. B. Rettig, D. Heber, J. An et al., “Pomegranate extract
inhibits androgen-independent prostate cancer growth through
See Table 1. a nuclear factor-𝜅B-dependent mechanism,” Molecular Cancer
Therapeutics, vol. 7, no. 9, pp. 2662–2671, 2008.
6. Summary [11] C. G. Roehrborn, “Benign prostatic hyperplasia: etiology,
pathophysiology, epidemiology, and natural history,” in
The biological processes of inflammation, hypoxia, and Campbell-Walsh Urology, L. R. Kavoussi, A. W. Partin, C. A.
oxidative stress have a crucial function in the natural biology Peters, and A. C. Novick, Eds., Elsevier-Saunders, Philadelphia,
of men’s urological diseases including ED, BPH, and PCA. Pa, USA, 2012.
In vitro and in vivo preclinical experiments provide evidence [12] J. C. Nickel, “Inflammation and benign prostatic hyperplasia,”
supporting that pomegranate extracts are able to (i) inhibit Urologic Clinics of North America, vol. 35, no. 1, pp. 109–115,
proliferation, invasion, metastatic spread, development of 2008.
castration-resistant PCA growth, and angiogenesis, (ii) mod- [13] O. J. Kessler, Y. Keisari, C. Servadio, and A. Abramovici, “Role of
ulate inflammatory pathways, and (iii) reduce oxidative chronic inflammation in the promotion of prostatic hyperplasia
stress. Clinical biologic activities of pomegranate have been in rats,” The Journal of Urology, vol. 159, no. 3, pp. 1049–1053,
tested in subjects with PCA and ED. Further randomized, 1998.
[14] C. L. Robinette, “Sex-hormone-induced inflammation and [30] M. H. Braun, F. Sommer, G. Haupt, M. J. Mathers, B. Reifenrath,
fibromuscular proliferation in the rat lateral prostate,” Prostate, and U. H. Engelmann, “Lower urinary tract symptoms and
vol. 12, no. 3, pp. 271–286, 1988. erectile dysfunction: co-morbidity or typical “Aging Male”
[15] J. C. Nickel, J. Downey, I. Young, and S. Boag, “Asymptomatic Symptoms? Results of the “Cologne Male Survey”,” European
inflammation and/or infection in benign prostatic hyperplasia,” Urology, vol. 44, no. 5, pp. 588–594, 2003.
BJU International, vol. 84, no. 9, pp. 976–981, 1999. [31] J. Y. Jeremy, G. D. Angelini, M. Khan et al., “Platelets, oxidant
[16] F. Di Silverio, V. Gentile, A. De Matteis et al., “Distribution stress and erectile dysfunction: an hypothesis,” Cardiovascular
of inflammation, pre-malignant lesions, incidental carcinoma Research, vol. 46, no. 1, pp. 50–54, 2000.
in histologically confirmed benign prostatic hyperplasia: a [32] R. F. Furchgott and J. V. Zawadzki, “The obligatory role of
retrospective analysis,” European Urology, vol. 43, no. 2, pp. 164– endothelial cells in the relaxation of arterial smooth muscle by
175, 2003. acetylcholine,” Nature, vol. 288, no. 5789, pp. 373–376, 1980.
[17] V. C. Mishra, D. J. Allen, C. Nicolaou et al., “Does intraprostatic [33] M. A. Mamas, J. M. Reynard, and A. F. Brading, “Nitric oxide
inflammation have a role in the pathogenesis and progression of and the lower urinary tract: current concepts, future prospects,”
benign prostatic hyperplasia?” BJU International, vol. 100, no. 2, Urology, vol. 61, no. 6, pp. 1079–1085, 2003.
pp. 327–331, 2007. [34] S. Moncada, R. M. J. Palmer, and E. A. Higgs, “Nitric oxide:
[18] J. C. Nickel, C. G. Roehrborn, M. P. O’Leary, D. G. Bostwick, M. physiology, pathophysiology, and pharmacology,” Pharmaco-
C. Somerville, and R. S. Rittmaster, “The relationship between logical Reviews, vol. 43, no. 2, pp. 109–142, 1991.
prostate inflammation and lower urinary tract symptoms: [35] J. Y. Jeremy, R. A. Jones, A. J. Koupparis et al., “Re: oxidative
examination of baseline data from the REDUCE trial,” European stress in arteriogenic erectile dysfunction: prophylactic role of
Urology, vol. 54, no. 6, pp. 1379–1384, 2008. antioxidants,” The Journal of Urology, vol. 175, no. 3, pp. 1175–
[19] C. G. Roehrborn, “Definition of at-risk patients: baseline 1176, 2006.
variables,” BJU International, vol. 97, no. 2, pp. 7–11, 2006. [36] M. A. Khan, C. S. Thompson, F. H. Mumtaz et al., “The effect
[20] F. Balkwill and A. Mantovani, “Inflammation and cancer: back of nitric oxide and peroxynitrite on rabbit cavernosal smooth
to Virchow?” The Lancet, vol. 357, no. 9255, pp. 539–545, 2001. muscle relaxation,” World Journal of Urology, vol. 19, no. 3, pp.
220–224, 2001.
[21] G. T. MacLennan, R. Eisenberg, R. L. Fleshman et al., “The
[37] M. Gacci, G. Corona, M. Salvi et al., “A systematic review
influence of chronic inflammation in prostatic carcinogenesis:
and meta-analysis on the use of phosphodiesterase 5 inhibitors
a 5-year followup study,” The Journal of Urology, vol. 176, no. 3,
alone or in combination with alpha-blockers for lower urinary
pp. 1012–1016, 2006.
tract symptoms due to benign prostatic hyperplasia,” European
[22] P. W. Kohnen and G. W. Drach, “Patterns of inflammation in Urology, vol. 61, pp. 994–1003, 2012.
prostatic hyperplasia: a histologic and bacteriologic study,” The
[38] I. Goldstein, T. F. Lue, H. Padma-nathan, R. C. Rosen, W. D.
Journal of Urology, vol. 121, no. 6, pp. 755–760, 1979.
Steers, and P. A. Wicker, “Oral sildenafil in the treatment of
[23] A. M. De Marzo, V. L. Marchi, J. I. Epstein, and W. G. erectile dysfunction,” The New England Journal of Medicine, vol.
Nelson, “Proliferative inflammatory atrophy of the prostate: 338, no. 20, pp. 1397–1404, 1998.
implications for prostatic carcinogenesis,” American Journal of [39] H. Porst, H. Padma-Nathan, F. Giuliano, G. Anglin, L. Varanese,
Pathology, vol. 155, no. 6, pp. 1985–1992, 1999. and R. Rosen, “Efficacy of tadalafil for the treatment of erectile
[24] R. E. Harris, J. Beebe-Donk, H. Doss, and D. Burr Doss, dysfunction at 24 and 36 hours after dosing: a randomized
“Aspirin, ibuprofen, and other non-steroidal anti-inflammatory controlled trial,” Urology, vol. 62, no. 1, pp. 121–126, 2003.
drugs in cancer prevention: a critical review of non-selective [40] H. Porst, R. Rosen, H. Padma-Nathan, I. Goldstein, F. Giuliano,
COX-2 blockade (review),” Oncology Reports, vol. 13, no. 4, pp. and E. Ulbrich, “The efficacy and tolerability of vardenafil,
559–583, 2005. a new, oral, selective phosphodiesterase type 5 inhibitor, in
[25] S. Mahmud, E. Franco, and A. Aprikian, “Prostate cancer and patients with erectile dysfunction: the first at-home clinical
use of nonsteroidal anti-inflammatory drugs: systematic review trial,” International Journal of Impotence Research, vol. 13, no. 4,
and meta-analysis,” British Journal of Cancer, vol. 90, no. 1, pp. pp. 192–199, 2001.
93–99, 2004. [41] M. Albrecht, W. Jiang, J. Kumi-Diaka et al., “Pomegranate
[26] P. G. Conaghan, “A turbulent decade for NSAIDs: update on extracts potently suppress proliferation, xenograft growth, and
current concepts of classification, epidemiology, comparative invasion of human prostate cancer cells,” Journal of Medicinal
efficacy, and toxicity,” Rheumatology International, vol. 32, pp. Food, vol. 7, no. 3, pp. 274–283, 2004.
1491–1502, 2012. [42] J. Gasmi and J. T. Sanderson, “Growth inhibitory, antiandro-
[27] D. C. Malins, P. M. Johnson, E. A. Barker, N. L. Polissar, T. genic, and pro-apoptotic effects of punicic acid in LNCaP
M. Wheeler, and K. M. Anderson, “Cancer-related changes in human prostate cancer cells,” Journal of Agricultural and Food
prostate DNA as men age and early identification of metas- Chemistry, vol. 58, no. 23, pp. 12149–12156, 2010.
tasis in primary prostate tumors,” Proceedings of the National [43] S. Koyama, L. J. Cobb, H. H. Mehta et al., “Pomegranate extract
Academy of Sciences of the United States of America, vol. 100, no. induces apoptosis in human prostate cancer cells by modulation
9, pp. 5401–5406, 2003. of the IGF-IGFBP axis,” Growth Hormone and IGF Research, vol.
[28] E. Wainfan and L. A. Poirier, “Methyl groups in carcinogenesis: 20, no. 1, pp. 55–62, 2010.
effects on DNA methylation and gene expression,” Cancer [44] L. Wang, A. Alcon, H. Yuan, J. Ho, Q. J. Li, and M. Martins-
Research, vol. 52, no. 7, 1992. Green, “Cellular and molecular mechanisms of pomegranate
[29] A. R. Trzeciak, S. G. Nyaga, P. Jaruga, A. Lohani, M. Dizdaroglu, juice-induced anti-metastatic effect on prostate cancer cells,”
and M. K. Evans, “Cellular repair of oxidatively induced DNA Integrative Biology, vol. 3, no. 7, pp. 742–754, 2011.
base lesions is defective in prostate cancer cell lines, PC-3 and [45] J. Domingo-Domenech, B. Mellado, B. Ferrer et al., “Activation
DU-145,” Carcinogenesis, vol. 25, no. 8, pp. 1359–1370, 2004. of nuclear factor-𝜅B in human prostate carcinogenesis and
association to biochemical relapse,” British Journal of Cancer, prostate cancer and a rising serum prostate-specific antigen
vol. 93, no. 11, pp. 1285–1294, 2005. after radical prostatectomy and/or radiation therapy,” Journal of
[46] V. Fradet, L. Lessard, L. R. Bégin, P. Karakiewicz, A. M. Mes Clinical Oncology, vol. 24, no. 18, pp. 2723–2728, 2006.
Masson, and F. Saad, “Nuclear factor-𝜅B nuclear localization is [61] C. P. Forest, H. Padma-Nathan, and H. R. Liker, “Efficacy
predictive of biochemical recurrence in patients with positive and safety of pomegranate juice on improvement of erectile
margin prostate cancer,” Clinical Cancer Research, vol. 10, no. dysfunction in male patients with mild to moderate erectile
24, pp. 8460–8464, 2004. dysfunction: a randomized, placebo-controlled, double-blind,
[47] J. Suh, F. Payvandi, L. C. Edelstein et al., “Mechanisms of crossover study,” International Journal of Impotence Research,
constitutive NF-𝜅B activation in human prostate cancer cells,” vol. 19, no. 6, pp. 564–567, 2007.
Prostate, vol. 52, no. 3, pp. 183–200, 2002. [62] J. C. Cappelleri, R. C. Rosen, M. D. Smith, A. Mishra, and
[48] S. T. Lee, Y. L. Wu, L. H. Chien, S. T. Chen, Y. K. Tzeng, and T. I. H. Osterloh, “Diagnostic evaluation of the erectile function
F. Wu, “Proteomic exploration of the impacts of pomegranate domain of the International Index of Erectile Function,” Urol-
fruit juice on the global gene expression of prostate cancer cell,” ogy, vol. 54, no. 2, pp. 346–351, 1999.
Proteomics, vol. 12, no. 21, pp. 3251–3262, 2012. [63] C. B. Stowe, “The effects of pomegranate juice consumption
[49] Y. Tsujimoto, Y. Tomita, Y. Hoshida et al., “Elevated expression on blood pressure and cardiovascular health,” Complementary
of valosin-containing protein (p97) is associated with poor Therapies in Clinical Practice, vol. 17, no. 2, pp. 113–115, 2011.
prognosis of prostate cancer,” Clinical Cancer Research, vol. 10,
no. 9, pp. 3007–3012, 2004.
[50] T. Asai, Y. Tomita, S. I. Nakatsuka et al., “VCP (p97) regulates
NF𝜅B signaling pathway, which is important for metastasis of
osteosarcoma cell line,” Japanese Journal of Cancer Research, vol.
93, no. 3, pp. 296–304, 2002.
[51] V. M. Adhami, I. A. Siddiqui, D. N. Syed, R. K. Lall, and H.
Mukhtar, “Oral infusion of pomegranate fruit extract inhibits
prostate carcinogenesis in the TRAMP model,” Carcinogenesis,
vol. 33, pp. 644–651, 2012.
[52] A. A. Hurwitz, B. A. Foster, J. P. Allison, N. M. Greenberg, and E.
D. Kwon, “The TRAMP mouse as a model for prostate cancer,”
Current Protocols in Immunology, vol. 20, p. 20.5, 2001.
[53] Q. Zhang, Z. M. Radisavljevic, M. B. Siroky, and K. M.
Azadzoi, “Dietary antioxidants improve arteriogenic erectile
dysfunction,” International Journal of Andrology, vol. 34, no. 3,
pp. 225–235, 2011.
[54] K. M. Azadzoi, R. N. Schulman, M. Aviram, and M. B.
Siroky, “Oxidative stress in arteriogenic erectile dysfunction:
prophylactic role of antioxidants,” The Journal of Urology, vol.
174, no. 1, pp. 386–393, 2005.
[55] A. J. Pantuck, J. T. Leppert, N. Zomorodian et al., “Phase II
study of pomegranate juice for men with rising prostate-specific
antigen following surgery or radiation for prostate cancer,”
Clinical Cancer Research, vol. 12, no. 13, pp. 4018–4026, 2006.
[56] C. J. Paller, X. Ye, P. J. Wozniak et al., “A randomized phase II
study of pomegranate extract for men with rising PSA following
initial therapy for localized prostate cancer,” Prostate Cancer and
Prostatic Diseases, vol. 16, no. 1, pp. 50–55, 2012.
[57] M. R. Smith, J. Manola, D. S. Kaufman et al., “Rosiglitazone
versus placebo for men with prostate carcinoma and a rising
serum prostate-specific antigen level after radical prostatectomy
and/or radiation therapy,” Cancer, vol. 101, no. 7, pp. 1569–1574,
2004.
[58] S. Freedland, M. Carducci, N. Kroeger et al., “174 a phase
II randomized controlled trial of POMX vs. placebo prior to
radical prostatectomy,” The Journal of Urology, vol. 187, p. e73,
2012.
[59] C. J. Paller, S. Xie, D. Olatoye et al., “The effect of PSA frequency
and duration on PSA doubling time (PSADT) calculations in
men with biochemically recurrent prostate cancer (BRPC) after
definitive local therapy,” ASCO Meeting Abstracts, vol. 30, p.
4559, 2012.
[60] M. R. Smith, J. Manola, D. S. Kaufman, W. K. Oh, G. J. Bubley,
and P. W. Kantoff, “Celecoxib versus placebo for men with
http://dx.doi.org/10.1155/2013/247145
Review Article
A Review on the Anti-Inflammatory Activity of Pomegranate in
the Gastrointestinal Tract
Elisa Colombo,1 Enrico Sangiovanni,1 and Mario Dell’Agli1,2

1
Department of Pharmacological and Biomolecular Sciences, Università degli Studi di Milano, Via Balzaretti 9, Milano, Italy
2
Research Centre for Characterization and Safe Use of Natural Compounds-G. Galli, Università degli Studi di Milano,
Via Balzaretti 9, 20133 Milano, Italy
Correspondence should be addressed to Mario Dell’Agli; mario.dellagli@unimi.it
Received 28 December 2012; Accepted 20 February 2013
Copyright © 2013 Elisa Colombo et al. This is an open access article distributed under the Creative Commons Attribution License,
Several biological activities of pomegranate have been widely described in the literature, but the anti-inflammatory effect in the
gastrointestinal tract has not been reviewed till now. The aim of the present paper is to summarize the evidence for or against the
efficacy of pomegranate for coping with inflammatory conditions of the gastro-intestinal tract. The paper has been organized in
three parts: (1) the first one is devoted to the modifications of pomegranate active compounds in the gastro-intestinal tract; (2)
the second one considering the literature regarding the anti-inflammatory effect of pomegranate at gastric level; (3) the third part
considers the anti-inflammatory effect of pomegranate in the gut. In vivo studies performed on the whole fruit or juice, peel, and
flowers demonstrate antiulcer effect in a variety of animal models. Ellagic acid was the main responsible for this effect, although
other individual ellagitannins could contribute to the biological activity of the mixture. Different preparations of pomegranate,
including extracts from peels, flowers, seeds, and juice, show a significant anti-inflammatory activity in the gut. No clinical studies
have been found, thus suggesting that future clinical studies are necessary to clarify the beneficial effects of pomegranate in the
gastrointestinal tract.
1. Introduction L. fruit rind is traditionally used in the eastern province

of Orissa (India), an area endemic for both Plasmodium
Punica granatum L. (pomegranate, Family Lythraceae) is a falciparum and Plasmodium vivax, against malaria; in this
deciduous tree distributed throughout the world. Pomegran- regard, the beneficial effect of the fruit rind of PG for
ate (PG) fruit, in the form of extract of juice, is widely the treatment of malaria has been recently ascribed to the
promoted to consumers since the nineties as medicinal food antiparasitic activity [2] and to the inhibition of the proin-
in the United States and Europe; as a consequence, a large flammatory mechanisms involved in the onset of cerebral
number of pomegranate-containing products have recently malaria [3].
been introduced into the USA and European market and are The biological activity of PG has been widely investigated,
widely sponsored as healthy products. including in vitro, in vivo, and clinical studies. The bene-
PG is used in the traditional medicine of different Asian ficial effects are mostly the cardiovascular protective role,
cultures for the treatment of a variety of ailments. In India, neuroprotective activity, hypoglycemic effect, and anticancer
Tunisia, and Guatemala, dried PG peels are decocted and properties, in particular against prostate, colon, and breast
employed both internally and externally as astringents and cancer; the anticancer effect is limited only to in vitro and
germicides and used for treating aphthae and diarrhoea. In animal studies [1, 4, 5].
Ayurvedic medicine the plant, described under its Sanskrit The gastrointestinal tract represents an important barrier
name “dadima” (fruit), is considered as a “blood purifier” between the human hosts and microbial populations. One
and used to cure parasitic infections (for a review, see [1]), potential consequence of host-microbial interactions is the
and the decoction of the root is considered helpful against development of mucosal inflammation, which can lead to
fevers and chronic debility due to malaria. Punica granatum gastritis and ulcer.
Gastritis is defined as inflammation of the gastric mucosa. UV-B-irradiated keratinocytes, and the mechanism underly-
There are several etiological types of gastritis, differing for ing this effect was found to be NF-𝜅B-dependent [13].
clinical manifestations and pathological features. Gastritis Although some papers describe the beneficial effects of
can be caused by endogenous and exogenous factors, includ- this fruit against gastro-intestinal inflammation, surprisingly
ing acid, pepsin, stress, and noxious agents such as alcohol, this has not been reviewed till now.
nonsteroidal anti-inflammatory drug (NSAIDs), Helicobac- The aim of the present paper is to summarize the evidence
ter pylori (H. pylori) infection, and smoking. H. pylori, for or against the efficacy of PG for addressing inflammatory
a Gram-negative bacterium that colonizes the stomach of conditions of the gastro-intestinal tract.
humans and primates, is the most responsible pathogen The paper will be divided in three parts: (1) the first one
for these inflammatory processes. H. pylori infection in will be devoted to the modifications of PG active compounds
humans represents a serious public health concern: the in the gastro-intestinal tract, with particular attention to
WHO classifies this bacterium as a Type 1 carcinogen. the intestinal metabolites; (2) the second one considers the
The clinical course of H. pylori infection is highly variable literature regarding the anti-inflammatory effect of PG and
and is influenced by both microbial and host factors. The individual compounds at gastric level; (3) the third part
pattern and distribution of gastritis strongly correlate with considers the anti-inflammatory effect of PG and individual
the risk of clinical duodenal or gastric ulcers, mucosal compounds in the gut, taking into account also the main
atrophy, gastric carcinoma, or gastric lymphoma. It has been metabolites which are formed by microbial biotransforma-
demonstrated that gastric epithelial cells, after H. pylori tion after PG consumption.
infection, show higher levels of cytokines including IL-
1𝛽, IL-6, TNF-𝛼, and IL-8, a potent neutrophil-activating
chemokine that apparently plays a central role in gastric 2. Pomegranate Composition and Metabolism
diseases [6, 7]. H. pylori strains carrying the Cag-PAI (Cag in the Gastrointestinal Tract
Pathogenicity Island) induce a far stronger IL-8 response
than Cag-negative strains, and this response depends on PG has been shown to contain more than 100 different
activation of NF-𝜅B and the early-response transcription phytochemicals, and a substantial part of them contributes to
factor Activating Protein-1 (AP-1) [8]. IL-21 is constitutively the antioxidant activity elicited by the extracts [14]. However,
expressed in gastric mucosa as well and is more abun- several variables, such as the harvesting season, soil, and the
dant in biopsy specimens from H. pylori-infected patients kind of extract, can deeply affect chemical composition and
[9]. consequently the biological activity.
Inflammatory bowel diseases (IBDs), among which Ellagitannins (ETs) and anthocyanins (ANs) represent
Crohn’s disease (CD) and ulcerative colitis (UC), are the the most abundant polyphenols in PG juice. ETs constitute
most common inflammatory-related diseases in the gut; a complex class of polyphenols characterized by one or
IBDs occur in response to genetic or environmental fac- more hexahydroxydiphenoyl (HHDP) moieties esterified to
tors and are characterized by the uncontrolled response of a sugar, usually glucose. ETs content in PG juice is around
the intestinal immune system against the normal enteric 1500–1900 mg/L [15]. This part of the fruit contains several
microflora, leading to abdominal pain and chronic diarrhoea. ETs typical of PG such as punicalagins, and other minor
All components of the gut, including the epithelial barrier, tannins including punicalin and gallagic acid. Punicalagins
the mucosal immune system, and stromal/supportive cells, are unique to PG, and possess a molecular weight greater than
participate in the intestinal immune response. Immune and 1000. During the juice processing, the whole fruit is pressed,
nonimmune cells, that is, epithelial, endothelial, mesenchy- and ETs are extracted into PG juice in significant amount,
mal, and nerve cells, exchange regulatory signals via the reaching levels over 2 g/L [15]. PG fruit contains also a small
production of mediators (cytokines, growth factors, adhesion amount of free ellagic acid (EA), and it has been estimated to
molecules, etc.), which facilitate and amplify cell interactions be around 15 mg/L in fresh arils [15].
and inflammation [10]. ETs are quite stable under the physiological conditions of
Epithelial cells, in response to a proinflammatory stim- the stomach. The acid conditions (HCl, pH 1.8–2.0) and the
ulus, that is, TNF𝛼 and bacteria, release several cytokines gastric enzymes do not hydrolyse the native ETs to ellagic
and induce the expression of NF-𝜅B related genes such as acid, and no degradation of ETs has been observed. The
cyclooxygenase-2 (COX-2), inducible nitric oxide synthase stomach seems to be a location for the absorption of free
(iNOS) and metalloprotease-9 (MMP-9) [11]. The integrity EA, but ETs are not absorbed [16]. PG ETs release EA in
of the epithelial barrier is reduced thus favouring pathogen the gut, and this compound is poorly absorbed in the small
infections. NF-𝜅B is highly involved in the control of the intestine; conversely, EA is largely metabolized by human
transcription of the inflammatory mediators. gut microflora in the intestinal lumen into urolithins, such
Anti-inflammatory properties of PG and its major com- as urolithins A and B, and urolithin-8-methyl ether [17,
ponents have been widely described in the literature (for 18]. These metabolites reach relevant plasma concentrations
a review, see [12]). For example, cold pressed PG seed oil (3–5 𝜇M) after PG juice consumption [19]. The absorbed
has been shown to possess anti-inflammatory activity since metabolites are conjugated with glucuronic acid and/or
it inhibited in vitro both cyclooxygenase and lipoxygenase methylated to give ether derivatives [16].
enzymes. In addition, the acetone extract of whole PG fruit In addition to ETs, PG fruit is an important source of ANs
inhibited phosphorylation of several cytokines released by as well; these include the 3-glucosides and 3,5-diglucosides
of delphinidin, cyanidin, and pelargonidin [15, 20]. The total 3.2. Animal Studies
amount of ANs in PG fruit is higher in fresh arils than in
the frozen ones (306 versus 172 mg/L, resp.), and in single- Ethanol-Induced Gastritis. Ethanol-induced ulcers are the
strength commercial juice than in commercial juice from result of a direct effect of ethanol on gastric mucosa, mostly
concentrate (387 versus 162 mg/L, resp.) [15]. due to its capacity to induce necrosis of superficial gastric
The pH of the stomach (1-2) ensures that ANs are epithelial cells and erosion [28]. An in vivo study showed
maintained as the flavylium cation, which is the most stable that PG fruit rind methanolic extract showed a significant
form of ANs. The stability of ANs under the gastric conditions reduction in the ulcer index (UI) in ethanol-induced gastritis
has been confirmed by in vitro studies [20, 21]. Conversely, in rats; the extract, when tested at 250 mg/kg and 500 mg/kg,
the neutral pH of the small and large intestines makes ANs inhibited UI by 21% and 63%, respectively, whereas the
much less stable, and these molecules are converted into reference compound ranitidine (50 mg/kg) showed 51% inhi-
a variety of metabolites [22]. Several studies reported that bition. Rats treated with 500 mg/kg of PG extract were also
exposure of different ANs to gut microflora resulted in rapid protected from intraluminal bleeding [29]. In another study,
deglycosylation and demethylation to the corresponding the hydroalcoholic extract (methanol : water 80 : 20) from
aglycones. The aglycones were unstable at neutral pH and dried flowers of PG significantly reduced the UI (−87.5%
rapidly degraded to their corresponding phenolic acids and at 980 mg/kg), whereas the half dose (490 mg/kg) and
aldehydes through cleavage of the C-ring. Similar results omeprazole (20 mg/kg) exhibited 65% and 49.6% inhibition,
were obtained after incubation of free and acylated ANs with respectively [30].
human faecal microbiota [23, 24]. It has been proposed that Some biochemical parameters, such as superoxide dis-
the decrease of anthocyanin concentration after pancreatin mutase (SOD), catalase, tissue lipid peroxidation, and glu-
bile salt digestion (as a simulation of small intestine digestion) tathione peroxidase (GSH-PX), were reduced in animals
could be partially explained by the transformation of the treated with acetylsalicylic acid and returned at the basal
flavylium cation to the chalcone at the neutral pH [20]; levels in animals that received the fruit rind methanolic
however these hypotheses need to be confirmed by in vivo extract [29]. PG tannins significantly inhibited ethanol-
studies. induced mucosal injury in a dose-dependent manner, and the
effect was ascribed to the decrease of lipid peroxidation as
well as NO levels and to the modulation of both SOD and
3. Effect of Pomegranate in GSH-PX in gastric mucosa [31].
Gastric Inflammation Gharzouli et al. demonstrated that aqueous extract of
PG peel (AEP) shows a gastroprotective effect in rats
There are no clinical studies in the literature investigating the
with ethanol-induced gastric lesions [32]. The simultaneous
beneficial effect of PG in the stomach. The anti-inflammatory
administration of ethanol and AEP significantly decreased
activity of PG at gastric level has been evaluated mainly by
gastric lesions and UI (from −53.7% to −76.9%).
in vivo studies, and few in vitro studies deal with the anti-H.
Among the pure compounds, Beserra et al. demonstrated
pylori activity of PG extracts and individual compounds. For
that the oral pretreatment with EA (3, 10, and 30 mg/kg)
a better comprehension of the effects of PG in modulating
significantly reduced gastric injury by 59, 79, and 70%, respec-
gastric inflammation, in the following paragraph the in vivo
tively, whereas the inhibitory effect by ranitidine (50 mg/kg)
studies have been organized according to the inflammatory
was −83% [33].
challenge applied to induce gastritis in animal models.
Nonprotein sulfhydryls (NP-SH) are antioxidant com-
pounds involved in the maintenance of gastric integrity. They
3.1. In Vitro Studies. A small number of studies report control the cascade of inflammatory cytokines and promote
that PG is able to treat H. pylori infection. Methanol peel detoxification and excretion of ROS produced mainly by
extract of PG exhibited a remarkable anti-H. pylori activity noxious agents and stress. Pretreatment with EA (3 and
in vitro, as shown by the size of inhibition zone in the disk 10 mg/kg) significantly increased the NP-SH content in rats
diffusion method, which was comparable to the reference thus suggesting a protective role of EA against ethanol-
compound metronidazole (MIC 8 𝜇g/mL) [25]. In another induced gastritis [33].
study the methanolic extract of PG fruit rind exhibited high TNF-𝛼 released by monocytes/macrophages plays a key
activity against H. pylori strains (39 mm inhibition zone role in initiating the cascade of other proinflammatory
for 100 𝜇g disc−1 ) in comparison with other plant extracts cytokines, including IL-1𝛽, IL-6, and IFN-𝛾, which are impor-
[26]; in particular eight among nine PG cultivars showed tant biomarkers in gastric inflammation. Rats subjected to
high activity against this bacterium (mean of inhibition zone ethanol-induced ulcer after treatment with EA (10 mg/kg)
diameter ranging from 16 to 40 mm at 50 𝜇g disc−1 ). Strong showed levels of TNF𝛼 significantly lower than the ethanol-
anti-H. pylori activity of PG ethanolic extract from pericarp treated group (11.1 ± 1.1 versus 6.2 ± 1.0 pg/mL, resp.) [33].
has been also documented, and the highest zone of inhibition NO is considered to be one of the most important
(16.5 mm) was found at 2.5 mg disc−1 [27]. defensive endogenous agents in the gastric mucosa. Pre-
Indeed, further studies with PG extracts alone and com- treatment with inhibitors of NO synthase such as L-NAME
bined with drugs commonly used for H. pylori eradication has been demonstrated to worsen the ethanol-induced ulcer.
should be carried out before considering PG as effective Rats pretreated with L-NAME increased the severity of
antimicrobial agent. the gastric lesions induced by ethanol, whereas treatments
with L-arginine, in the absence or in the presence of EA, [33]. In another study, treatment with EA or omeprazole for
significantly attenuated the deleterious effect of L-NAME 3 days significantly upregulated the mucosal PGE2 level by
(−22% and −19.6%, resp.). When EA was coadministrated 2.0- and 1.6-folds, with respect to the untreated group [36]. In
with L-arginine, the gastroprotective effect was found 2-fold the same study, indomethacin-administered mice increased
higher (−39%) with respect to EA alone [33]. mucosal myeloperoxidase (MPO) activity on the third day.
Treatment with EA (7 mg/kg once daily for 3 days, orally)
NSAIDs-Induced Gastritis. Nonsteroidal anti-inflammatory and omeprazole significantly reduced MPO activity by 77.9%
drugs (NSAIDs), such as acetylsalicylic acid, indomethacin, and 68,1%, respectively. Ulceration significantly depleted the
and ibuprofen, are commonly used as analgesics in many expression of gastric COX-1. In this study, COX-2 expression
acute and chronic inflammatory conditions. Acetylsali- was not significantly modified by indomethacin treatment;
cylic acid interferes with gastric protective mechanisms, conversely, EA significantly increased COX-1 and COX-2
such as mucus and bicarbonate secretion, surface epithe- expression in the ulcerated group [36].
lial hydrophobicity, and mucosal blood flow. Acetylsalicylic The same study investigated the effect of EA on indo-
acid mainly interferes with the biosynthesis of cytopro- methacin-induced cytokines release in the gastric mucosa.
tective prostaglandins through the inhibition of cyclooxy- Indomethacin administration increased the release of several
genase (COX); this effect results in an over production cytokines, including TNF-𝛼 (1.8-fold), IL-1𝛽 (1.9-fold), and
of leukotrienes and other products of the 5-lipoxygenase decreased IL-4 (2.3-fold), IL-10 (1.2-fold), VEGF (1.7-fold),
pathway. EGF (1.6-fold), and HGF (1.5-fold), whereas IL-6 secretion
PG hydroalcoholic extract (methanol 70%) from pow- was not affected. EA (7 mg/kg) significantly reduced the
dered rind showed a significant UI reduction in rats treated proinflammatory cytokines (TNF-𝛼, IL-1𝛽, and IL-6) release
with 400 mg/kg acetylsalicylic acid. The inhibitory effect by 1.9-, 1.5-, and 1.6-folds, respectively; a significant increase
showed by PG extract, at 250 and 500 mg/kg, was −22.4% and was seen for the anti-inflammatory cytokines IL-4 and IL-
−74.2%, respectively, whereas ranitidine (50 mg/kg) showed 10 levels and growth factors (VEGF, EGF, and HGF) levels.
44.7% inhibition [29]. In another study, the hydroalcoholic When EA was administrated to the animals, it was able to
extract (methanol : water 80 : 20) obtained from powdered decrease TNF𝛼, IL-1𝛽, and IL-6 release, and an increase of IL-
flowers of PG, when tested at 980 mg/kg and 490 mg/kg, 4 and IL-10 was observed. When EA was given following COX
inhibited ulceration by 83.9% and 73.8%, respectively, thus inhibitor pretreatment (celecoxib, NS398), the protective
suggesting that PG flowers contain compounds with a dose- effect was partially missed [36].
dependent gastric protective effect [30].
Prostaglandins produced by COX-1, mainly PGI2 and Acetic Acid-Induced Gastritis. No studies dealing with the
PGE2 , are essential for gastric mucosa protection. The effect of PG extracts on acetic acid-induced gastritis are
ulcerogenic effect of NSAIDs seems to be related to the present in the literature, whereas some studies on the
inhibition of endogenous prostaglandin synthesis, although pure compound EA occur. Treatment with EA (3, 10, and
it has also been established that indomethacin modifies 30 mg/kg) for 14 days did not reduce the ulcerated area
other protective mechanisms of the gastric mucosa, including caused by application of acetic acid, but showed a sig-
gastric secretion and the permeability of the gastric mucosal nificant reduction in the ulcer thickness (−21,3%, −25,6%,
barrier [34]. Indomethacin is known to increase leukotriene and −26,2%, resp.) in comparison to the vehicle group.
C4 and reduces PGE2 levels. Enhancement of leukotriene Cimetidine significantly reduced the ulcerated area and the
synthesis results in damaging effects, which may induce thickness of the ulcer by 33.4% [33].
mucosal vasoconstriction, and enhances NSAIDs-induced In acetic acid ulcer model the plasma levels of TNF𝛼
injury [35]. were significantly lower in animals treated with EA at the
Hydroalcoholic (methanol : water 80 : 20) extract from dose of 3 mg/kg with respect to the control group (8.8 versus
powdered flowers of PG (980 mg/kg) showed significant pre- 19.3 pg/mL, resp.) [33]. IL-4 is an anti-inflammatory cytokine
vention of gastric lesions in indomethacin-treated rats, higher able to exacerbate, if excessively released, the inflammatory
inhibition of ulceration (83.9%), and reduced gastric acid injury in the stomach. It has been demonstrated that ulcera-
secretion in comparison with omeprazole 20 mg/kg (69.5%). tion drastically increased the plasma levels of IL-4 by 6-fold,
Although pure compounds were not tested during this study, and co-administration with EA significantly suppressed the
the authors suggest that the anti-ulcerogenic activity of the increase by 65.0%, 60.6%, and 44.2% at 3 mg/kg, 10 mg/kg,
extract may be due to the presence of saponins, tannins, and and 30 mg/kg, respectively [33]. In a similar fashion, ulcer-
flavonoids [30]. ation increased the plasma levels of IL-6 by 12.5-fold as
The treatment with EA (3, 10, and 30 mg/kg) significantly compared to the control group, and EA significantly inhibited
decreased UI by 82, 74, and 77%, respectively, whereas the IL-6 levels by 75%, 73%, and 48% at 3 mg/kg, 10 mg/kg, and
inhibitory effect, after treatment with cimetidine (100 mg/kg), 30 mg/kg, respectively. The same trend was observed for IFN-
was 88% [33]. Leukotriene B4 (LTB4 ) contributes to the 𝛾. Acetic acid ulceration significantly increased the levels of
NSAID gastric injury by promoting intense chemotaxis of IFN-𝛾 by 7.2-fold, as compared to the control group. Pre-
the neutrophils and leukocyte adherence to the vascular treatment with the three concentrations of EA significantly
endothelium. Plasma levels of LTB4 were also reduced with inhibited the IFN-𝛾-induced gastritis by 83.8%, 63%, and
the treatment of EA (3, 10, and 30 mg/kg), but levels of 54%. IL-1𝛽, IL-10, and VEGF levels were undetectable on the
prostaglandin E2 (PGE2 ) in gastric mucosa were not affected 14th day of ulcer induction in this model of gastritis [33].
Pylorus-Ligated Gastritis. The hydroalcoholic (methanol : review, see [12]). However only few papers reported the effect
water 80 : 20) extract of PG flowers demonstrated significant on intestinal inflammation, and, surprisingly, no clinical
reduction in volume of gastric acid secretion and total acidity studies are present in this regard. In the following paragraph,
of gastric juice in rats with pylorus-ligated gastritis, whereas the in vitro and in vivo anti-inflammatory effect of Punica
pH of gastric juice increased. Administration of the extract granatum L. extracts and individual compounds at the intesti-
(980 mg/kg) was found to reduce the volume of gastric nal level will be reviewed and discussed.
acid up to 40.0% as compared to the control group; the
reduction of the gastric volume (−24.4%) was present also 4.1. In Vitro Studies
when the extract was given at the lower dose (490 mg/kg)
[30]. In another study, PG tannins significantly increased the PG Juice and Peel/Husk Extract. The anti-inflammatory effect
secretion of adherent mucus and free mucus, but did not of PG on an in vitro intestinal model was firstly described
affect the free acidity, total acidity, gastric juice volume, and in 2006 in a study investigating the molecular mechanisms
gastrin pepsin activity induced by pylorus ligation [31]. underlying its antitumoral properties [40]. It was demon-
PG hydroalcoholic extracts (ethanol 50%) from peel strated that pretreatment of a colon cancer cell line with
(100 mg/kg), rind (500 mg/kg), and seed (500 mg/kg) signif- commercial PG juice (6–50 𝜇g/mL), total pomegranate tan-
icantly decreased the mucosal injury at the 6th day of treat- nins (TPT, 30–200 𝜇g/mL), and punicalagin (25–200 𝜇g/mL)
ment, showing the antiulcer effect [37]. In the same study, EA inhibited AKT activity, NF-𝜅B activation, and COX-2 expres-
reduced gastric acid secretion to 65–70% in pylorus-ligated sion induced by TNF𝛼 [40]. PG juice showed the highest
rats after intraperitoneal administration at 5 and 10 mg/kg, activity on these parameters with respect to TPT and the
although the effect was not statistically significant. On the pure component, indicating that more than a single bioactive
contrary, acidity was significantly reduced by EA (5 mg/kg) compound contributes to the biological activity exerted by
treatment [38]. the extract. Using a different cellular model (human intestinal
Caco-2 cells), Romier-Crouzet et al. demonstrated that the
Gastric Ischemia/Reperfusion. Gastric ischemia induced for
pretreatment with a polyphenolic aqueous extract from PG
20 minutes by bleeding from the carotid artery produced
peels (PomH) reduced many inflammatory mediators [41].
a marked reduction of gastric mucosal blood flow (GMBF)
The extract, at the concentration of 50 𝜇M (expressed as
up to 40–50% of basal values. The GMBF then increased
total phenols), significantly inhibited the secretion of the
over basal values during 15 minutes reperfusion, reaching
chemokine IL-8 and the production of NO upon stimu-
a maximum of 140–160% before gradually returning to the
lation by IL-1𝛽 or a mixture of proinflammatory stimuli.
basal levels. Rats treated with EA (6 mg/mL) or SOD (15000
It also exhibited an inhibitory effect on the secretion of
unit/kg/hr) did not show any differences in GMBF with
PGE2 by COX-1 as well as COX-2 in response to IL-1𝛽
respect to the control group [39].
stimulation [41]. Authors explained this anti-inflammatory
Reduction of hemorrhagic lesions following gastric
activity with the inhibition of NF-𝜅B activation and ERK-1/2
ischemia/reperfusion significantly started at 3 mg/mL of
phosphorylation; both systems are implicated in IL-8, NO,
EA. The increased levels of lipid peroxidation induced by
and PGE2 expression [41]. The same group demonstrated
ischemia/reperfusion was significantly inhibited when ani-
that pretreatment with PG husk extract (PomH, 100 𝜇g/mL)
mals were pretreated with either EA (6 mg/mL) or SOD
and its pure ellagitannin punicalagin (50 𝜇M) could modify
(15000 unit/kg/hr), the inhibition being 78.3% and 82.6%,
transcription levels of the genes encoding for IL-6 and MCP-
respectively [39].
1 in differentiated Caco-2 cells treated with a mixture of
In another study, topical application of NH4 OH (60 mM)
proinflammatory stimuli (IL-1𝛽, TNF-𝛼, IFN-𝛾, and LPS)
produced a persistent reduction of gastric potential difference
[42]. No effect was seen in the absence of proinflammatory
in the stomach made ischemic by bleeding and resulted
conditions and on IL-8 expression, while PomH as well
in hemorragic damage 1 hr later. The development of gas-
as punicalagin decreased the secretion of IL-8, IL-6, and
tric lesions induced by NH4 OH plus ischemia was dose-
MCP-1 [42]. A direct interaction between punicalagin and
dependently inhibited by preexposure of the mucosa to
cytokines was also demonstrated, thus suggesting that PomH
EA (1–6 mg/mL), and a significant effect was observed at
ETs could interact with the proinflammatory cytokines in the
concentrations above 3 mg/mL [30].
gut lumen, decreasing the intercellular communication and
Stress-Induced Gastritis. No studies investigating the effect limiting the local and systemic inflammation [42].
of PG extracts against stress-induced gastritis have been
published so far. Murakami et al. report that EA significantly PG Metabolites and Urolithins. Phenolic compounds con-
inhibited the occurrence of stress-induced gastric lesions at tained in PG extracts are of particular importance during
5 mg/kg [38], whereas the effect of the other pure compounds, intestinal inflammation. In fact, it was demonstrated that only
including ETs and ANs, was not investigated. a very small percentage of polyphenols ingested with diet
are absorbed in the small intestine, while the majority of
4. Effect of Pomegranate in them remain in the gut lumen, where they counteract and are
Intestinal Inflammation metabolized by gut microbiota. In this regard, it was shown
that, after a digestion in vitro, ANs, phenolic compounds, and
Anti-inflammatory properties of PG and its major compo- vitamin C present in PG juice diminish their solubility, com-
nents have been widely described in the literature (for a promising the amount of compounds that can be absorbed
by intestinal cells and their bioavailability [20]. However, this and LPS) on secretion and mRNA expression of different
permanence of phenolic compounds ingested with PG in the inflammatory biomarkers (IL-6, IL-8, MCP-1, and IL-10).
intestinal lumen enhances the interactions with gut micro- EA decreased only MCP-1 and IL-8 secretion, but the effect
biota. Many scientific evidence points out the importance of was not statistically significant, and no effect on the mRNA
human gut microbiota toward health improvement and the levels of these cytokines was observed [48]. Nevertheless,
genesis of various diseases. In fact beneficial bacteria species, in the same study, EA downregulated the transcription of
as Bifidobacterium and Lactobacillus, constitute an important some genes involved in intestinal inflammation, as STAT-3, a
barrier against the overgrowth of external and internal transcription factor responsible for the persistent activation
pathogenic strains, whose prevalence causes chronic and of NF-𝜅B [48]. In another study, EA, urolithins A and B,
acute bowel diseases and has been associated with aging and and a mixture of them, at a concentration achievable in the
cancer [43]. For this reason, the modulation of gut microbiota intestinal lumen after PG consumption (10 𝜇M for EA and
by dietary supplements and food intake is of key importance 40 𝜇M for urolithins), inhibited the growth of Caco-2 cancer
to the maintenance of physiological balance. In this regard, a cells, deactivating the ERK-signalling pathway [49]. Opposite
commercial PG dietary supplement derived from extraction results were obtained in human normal colon fibroblast cell
of residual material from juice production (PomX) and puni- line CCD18-Co treated with IL-1𝛽, as a proinflammatory
calagin demonstrated a selective toxicity toward intestinal stimulus, and with different concentrations (1–10 𝜇M) of EA
pathogenic bacteria as compared to probiotic bacteria [44]. In and urolithins A or B since neither urolithins nor EA was able
particular, PomX, as well as punicalagin and EA, significantly to decrease the phosphorylation of p-ERK1/2 [50]. Myofi-
inhibited Clostridium and Staphylococcus aureus growth. broblasts in the colon mucosa play an important role in the
Punicalagin showed an inhibitory effect also against the intestinal inflammatory response even by releasing PGE2 . In
growth of Escherichia coli and Pseudomonas aeruginosa (IC50 the same study it was shown that urolithin A decreased PGE2
9.2 and 3.2 𝜇M, resp.). Probiotic lactobacilli were unaffected production, downregulating COX-2 and mPGES-1 expres-
by PG components, while the positive effect on bifidobacteria sions but not their enzymatic activity. Reduction of PGE2
was species-specific [44]. Possible explanations of the mecha- production by urolithins could be explained by the inhibition
nisms underlying the antimicrobial effect against pathogenic of NF-𝜅B activation and p38 MAPK pathway [50]. No
bacteria have been hypothesized: (i) tannins could create anti-inflammatory effects were seen with EA [50]. Authors
stable complexes with proteins or with physiological metal hypothesized that the anti-flogistic activity demonstrated by
ions essential for bacteria survival; (ii) polyphenols might urolithins might be due to a receptor-mediated effect, because
decrease the pH of intestinal environment, favouring the no metabolites were found in cell media or intracellular
growth of probiotic instead of pathogenic bacteria [44]. The extracts after incubation of cells with urolithins A, B or
long permanence (up to 56 hrs in the colon before excretion EA [50]. Using the same cellular model of human colon
[45]) of PG ellagitannins and the interaction with gut micro- fibroblasts treated with IL-1𝛽 or TNF-𝛼 as proinflammatory
biota lead to the formation of many metabolites, that could stimuli and urolithins A (40 𝜇M), B (5 𝜇M) or EA (1 𝜇M), it
explicate different biological activities at this level. Through was demonstrated that all these metabolites inhibit two criti-
in vitro batch-culture fermentation system the effect of PomX cal processes of inflammatory response: fibroblast migration
extract and punicalagin on the growth of gut bacteria and the and monocyte adhesion. A mixture of urolithins A, B and
production of active metabolites was investigated. PomX, but EA completely abolished IL-1𝛽 induction by PGE2 , and this
not punicalagin, significantly enhanced the growth of total activity was mainly due to urolithin A [51], in agreement with
bacteria, as well as beneficial bifidobacteria and lactobacilli, another previous study [50]. The effect was not maintained
being the effect in contrast with previous results [46]. The when TNF𝛼 was used as a stimulus, thus indicating that
extract also increased the production of short chain fatty PG metabolites could explain their action by a challenge-
acids, acetate, butyrate, and propionate [46], compounds dependent pathway [51]. PAI-1 is another molecule deeply
that are related to inhibition of preneoplastic proliferation associated with inflammatory status of the intestinal mucosa,
and acceleration of conversion of cholesterol into bile acids whose expression is highly induced by IL-1𝛽 and TNF𝛼 and
[43]. As concerns the metabolism of PG ellagitannins, while is strictly related to fibroblast migration. The metabolites
punicalagin was not detected in the fermentation media at mixture and urolithin A downregulated PAI-1 expression and
any collection time, after 10 hrs of incubation with PomX exerted also a preventive effect inhibiting some factors of
there was a pick of ellagic acid (EA) that disappeared when the PDGF family, known to be involved in cell migration
dibenzopyranones urolithins A, C, and D appeared [46]. [51]. During inflammation, the presence of cytokines such
Urolithin B was not detected in small intestine, suggesting as IL-1𝛽 and TNF-𝛼 induces the expression of chemokines,
that ETs metabolism occurs in the colon as well, and the for- in particular IL-8, and adhesion molecules (e.g., ICAM-1
mation of this compound is the last step of ETs metabolism. and VCAM-1) in colonic subepithelial myofibroblasts, thus
Both urolithins C and D as well as urolithin A demon- favouring monocyte infiltration and adhesion. The mixture
strated a high antioxidant activity in vitro (IC50 0.16, 0.33, of metabolites reduced monocyte migration inhibiting IL-8
and 13.6 𝜇M, resp. for urolithin C, D, and A) [47], but what secretion induced by TNF𝛼 and ICAM-1 and VCAM-1 levels
are the effects of PG metabolites on intestinal inflammation? after stimulation with IL-1𝛽 [51].
In the first study, the antiphlogistic effects of EA (50 𝜇M)
were evaluated in Caco-2 differentiated cells treated with a 4.2. Animal Studies. There are two main standardized meth-
mixture of proinflammatory stimuli (IL-1𝛽, TNF-𝛼, IFN-𝛾, ods to produce an experimental animal model of IBD: (i) oral
administration of dextran sulphate sodium (DSS) in drinking an aqueous extract from PG peel (200–800 mg/kg) relieved
water; (ii) intracolonic administration of trinitrobenzene diarrheic and ulcerative symptoms, decreasing MPO activity,
sulfonic acid (TNBS). The use of DSS method mimics the lipid peroxidation, IL-1𝛽, and TNF-𝛼 [57].
development of UC, while symptoms manifested after TNBS In another study, the PG peel extract (PPE) demonstrated
treatment present the clinical and morphological features of also to downregulate the expression of inflammatory genes
CD. (COX-2, IL-6, and IL-1𝛽) in colonic and adipose tissues from
In a rat model of DSS-induced UC, oral administration obese mice fed with a high-fat diet [58]. The same extract
of EA using colonic delivering microsphere (containing 1– possessed also a prebiotic effect, modulating gut microbiota
10 mg/kg of EA) significantly reduced the severity of colonic toward bifidobacteria [58], which are bacteria showing high
lesions and the shortness of colonic length. This activity anti-flogistic activity in the intestinal tract [59]. Moreover, it
could be accounted by the antioxidative action of EA, as was demonstrated in vitro that gut bacteria could contribute
demonstrated by the decreased myeloperoxidase (MPO) to the anti-inflammatory effects of PG extracts through
activity and lipid peroxidation in the colonic mucosa of their capacity to metabolize polyphenols to bioavailable and
animals treated with EA microspheres [52]. These results biological active urolithins [50]. To assess whether anti-
were confirmed in another study, which showed that a flogistic properties seen with PPE were due to ETs content or
PG hydroalcoholic extract (100–200 mg/kg) from flowers as to their microbiota-derived urolithins, a rat model of DSS-
well as the ellagic acid-rich fraction attenuated DSS-induced induced colitis was fed with PG peel extract (250 mg/kg)
UC in mice, reducing colonic MPO activity and oxidative or urolithin A (15 mg/kg) for 25 days before administration
markers [53]. In addition to the antioxidant effect, another of DSS. In rats fed with PPE and urolithins A, the number
mechanism proposed for the anti-ulcerative properties of of bifidobacteria and lactobacilli increased, and the effect
EA was the stabilization of mast cells. Mast cells play an was maintained after DSS administration only in urolithin
important role in phlogistic processes by releasing many A-fed group. Both PPE and urolithin A increased also the
proinflammatory factors, as histamine. DSS administration count of Clostridium probiotic strains and maintained it after
in mice was also associated with an increase in histamine colitis induction, preventing the colonization and invasion of
content in colonic tissue, indicating mast cell degranulation. colonic tissue by pathogenic enterobacteria [60]. Treatment
Hydroalcoholic extract of PG (methanol : water 3 : 1) and its with PPE and urolithin A exerted the same anti-inflammatory
ellagic acid-rich fraction significantly attenuated the DSS- effects, downregulating PGE2 production as well as iNOS
induced increase in the histamine level, suggesting a capacity induction and NO levels; however, in the case of PPE, these
to stabilize mast cells degranulation [53]. The molecular properties seemed not to be enough to protect the colonic
mechanisms underlying the anti-inflammatory activity of architecture [60]. Another interesting aspect is the evaluation
EA in the gut were clarified in a study devoted to the of metabolic fate of PPE after microbiota metabolism. In
effect of this polyphenol on colon carcinogenesis [54]: EA fact PG metabolism in rats with colitis was shown to be
(60 mg/kg), administered per os for 30 weeks in a rat model different from those without colon inflammation: the phe-
of colon cancer, reduced inflammatory status decreasing the nolic profile of faeces of PPE-fed rats showed the presence
expression and the production of COX-2, iNOS, IL-6, and of ellagic acid and even punicalagin contained in PPE and
TNF-𝛼 through the inhibition of NF-𝜅B system [54]. The traces of urolithin A, while only urolithins were found in
same mechanism was confirmed in two studies analysing the faeces of healthy PPE-fed rats [60]. The low metabolism
anti-flogistic effect of EA in TNBS-induced colitis in rats: (i) exerted by gut microbiota in an inflammation context is
in the first it was demonstrated that administration of EA an important consideration studying the effects of phenolic
(10-20 mg/kg) by gavage before and after induction of acute compounds. In fact, as previously demonstrated, in the pres-
colitis diminished the severity and extension of the intestinal ence of an inflammatory status they can reach, without any
injuries and inhibited MPO activity, in agreement with previ- metabolic transformation, the intestinal lumen and directly
ous studies [52, 53]. It was also shown that treatment with EA exert their anti-inflammatory activity. In conclusion, the anti-
was able to reduce the neutrophilic infiltration and to increase inflammatory properties shown by PG in the IBD model
the production of mucus in globet cells. All these anti- could be explained by a synergic activity of urolithins, the
inflammatory effects might be explained by the reduction of main active compound responsible for PG anti-inflammatory
the expression of COX-2 and iNOS, through the inhibition effects in healthy subjects, with ETs and EA; however, the
of NF-𝜅B-mediated transcriptional activation and preventing increase in prebiotic bacteria by both PPE and urolithin A
p38, JNK and ERK-1/2 MAPKs phosphorilation [55]; (ii) the or both these hypotheses taken together cannot be excluded
second study analysed EA effect in a model of chronic colitis. [60].
Chronic oral administration of a commercial PG fruit extract Pomegranate seed oil (PSO) is predominantly composed
(250–500 mg/kg) with or without the enrichment with EA of triglycerides containing unsaturated fatty acids, as con-
(10 mg/kg) was able to reduce inflammatory symptoms and jugated linolenic acids, oleic acid, linolenic acid, palmitic
histological injuries, diminishing MPO activity, TNF-𝛼 pro- acid, and stearic acid. The major conjugated linolenic acid
duction, and reducing COX-2 and iNOS expression through in PSO (representing 60 to 80% of total fatty acids) is
the inhibition of MAPKs and NF-𝜅B, but not PPAR-𝛾- punicic acid (PuA). Increasing evidence suggested that fatty
signalling pathways [56]. acids with conjugated double bonds, such as PuA, exert
In a rat model of UC induced by 2,4-dinitrochloroben- beneficial effects in inflammation and some types of cancer
zene (DNCB) and acetic acid, intragastric administration of [61, 62]. Different in vivo studies assessed the effects of
PG seed oil and PuA on intestinal inflammation. Oral (IC50 12.5 𝜇g/mL), a molecule involved in the diarrhoeal
administration of PuA (800 𝜇g/mL) or PG seed oil (2%) effect induced by castor oil. Retardation of intestinal transit
before TNBS injection in a colitis rat model ameliorated demonstrated by PG crude extract might be explained with
ulceration status and tissue damage, limiting neutrophil acti- an increased absorption of water and electrolyte, resulting in
vation and lipid peroxidation [63]. Molecular mechanisms a diminished number of wet faeces [67].
underlying these anti-inflammatory effects were clarified by
in vitro studies on human neutrophils. PuA (10 𝜇M) exerted a
strong anti-oxidant activity, inhibiting TNF-𝛼-induced ROS 5. Conclusions
and NADPH oxidase production by neutrophils, through
the inhibition of p47phox phosphorilation and p38 MAPK Few in vitro studies have been performed with PG peel
activation [63]. Treatment with PuA prevented also TNF- extracts to evaluate anti-H. pylori activity. These extracts
𝛼 and bacterial fMLP-induced neutrophil degranulation, are able to reduce significantly the growth of this pathogen,
resulting in reduced MPO release and lower tissue injuries which is considered the aetiological agent mainly responsible
[63]. In another study it was demonstrated that pretreatment for human gastritis.
with PuA (45–80 mg/die) to an IL-10−/− IBD mice model In vivo studies performed on the whole fruit or juice, peel,
ameliorated clinical symptoms, while it was not able to exert and flowers demonstrate high antiulcer effect in a variety of
any effect if administered after IBD development [64]. PuA animal models. EA was found to be the main component
upregulated colonic PPAR-𝛿 activation and suppressed TNF- responsible for this effect, although other individual ETs,
𝛼 and MCP-1 expressions. Since effects of PuA disappeared which have not yet been studied, could contribute to the
in IL-10 and PPAR-𝛾 or -𝛿 double-knock-out mice, it was biological activity of the mixture. With the exception of EA,
hypothesized that the pure compound exerted its action the effect of the pure compounds at the gastric level was not
through PPAR-𝛾 and -𝛿 pathways [64]. This conclusion was investigated; this should be carefully considered for the future
in agreement with previous results demonstrating that PPARs studies, since these molecules appear to be unmodified at the
represent important targets of dietary lipids, mediating the gastric level. Conversely, the positive effect of EA has been
maintenance of intestinal homeostasis. Moreover, PPAR-𝛾 widely demonstrated, and the effect is corroborated by other
expression results also in therapeutic benefits in the DSS studies performed on other plants: ethanolic extract from
colitis model [65], producing the same effects seen with PuA. Ficus glomerata fruit (FGE) contained 0.36% w/w of EA and
PSO was shown to be effective also in a model of necrotizing showed significant dose-dependent anti-ulcerogenic effect
enterocolitis (NEC). This disease is the major cause of mor- in different models of induced gastritis (pylorus ligation,
bidity and mortality in premature infants and is characterized ethanol, and cold stress) [69]; moreover, the hydroalcoholic
by a dysregulation of inflammatory cytokines in the intestinal extract of Anogeissus latifolia (50% alcohol) containing 0.25%
mucosa and an impaired production of mucins (as Muc2) w/w of EA has been shown to possess gastroprotective activity
and trefoil factors (Tff) by lamina propria. Treatment with [70] due to the presence of EA. In addition, methanol stem
PSO (1.5% w/w) of a neonatal model of NEC rats reduced the bark extract of Lafoensia pacari containing 23.4% of EA
incidence and severity of necrotizing colitis, protecting the showed gastroprotective and ulcer-healing effects in animal
epithelial barrier and preserving the intestinal integrity [66]. models strictly associated to the presence of great amounts
PSO decreased IL-6, IL-8, IL-23, IL-12, and TNF-𝛼 mRNA of EA in the extract [71], and an improvement of the gastric
levels as well and downregulated the inflammatory response symptoms in patients with H. pylori gastritis was observed
in the developing intestinal mucosa [66]. [72]. The mechanism of action by which EA shows antiulcer
activity is partially attributed to the inhibitory effect on the
Antidiarrhoeal Effects. Diarrhoea is one of the major symp- gastric H+ , K+ -ATPase, in addition to the anti-H. pylori
toms of IBDs, mainly caused by inflammation and an activity [38].
increased intestinal transit leading to a reduction in water Unfortunately, no clinical studies coping with the anti-
and electrolytes absorption. Two studies described the in vivo inflammatory activity of PG at the gastric level have been
antidiarrhoeal effect of PG. Intraperitoneal injection of an found, thus suggesting that the effect of the extracts and
aqueous extract of PG peels (100–400 mg/kg) as well as orally individual compounds in this area need to be elucidated. In
administration of a crude methanolic extract from PG rind particular, it is necessary to draw clinical trials considering
(200–400 mg/kg) diminished diarrhoea induced by castor oil the effects of PG extracts in patients with H. pylori-induced
administration in a rat model [67, 68]. PG aqueous extract gastritis, alone or in combination with antibiotics.
reduced in a dose-dependent way intestinal weight and Different preparations of PG, including extracts from
motility, inhibiting also the spontaneous and acetylcholine- peels, flowers, and seeds, in addition to the juice, show a
induced ileum contractions. Hypothesis formulated for this significant anti-inflammatory activity in the gut. From all
antidiarrhoeal activity included (i) an increase of reabsorp- the studies taken into consideration in the present paper,
tion of water and NaCl, reducing intestinal motility and (ii) some conclusions can be drawn. First of all, the pure
a decrease of cytosolic calcium, either by inhibiting Ca2+ compounds occurring in PG fruits seem to act through
influx or Ca2+ release from intracellular stores, resulting in different pathways. Oil derived from PG seeds and its major
relaxation of rat ileal smooth muscle [68]. On the other hand, component PuA could inhibit the expression of proinflam-
PG methanolic extract exerted a potent antioxidant activity matory cytokines (such as IL-6, IL-8, IL-23, IL-12, and
(IC50 11.7 𝜇g/mL) and significantly scavenged nitric oxide TNF-𝛼) through the modulation of PPAR-𝛾 and -𝛿. This is
not true for PG peel extracts, as well as their components the onset of malaria,” Malaria Journal, vol. 9, no. 1, article 208,
punicalagins and EA, since they do not show any effect on 2010.
PPAR signalling; conversely, the main effect is due to the [4] S. D. Johanningsmeier and G. K. Harris, “Pomegranate as a
inhibition of the expression and secretion of several inflam- functional food and nutraceutical source,” Annual Review of
matory mediators (i.e., IL-6, IL-8, MCP-1, iNOS, COX-2, Food Science Technology, vol. 2, pp. 181–201, 2011.
and PGE2 ). The inhibitory effect is ascribed to the inhibition [5] A. Faria and C. Conceição, “The bioactivity of pomegranate:
of the NF-𝜅B pathway and involves the MAPKs system as impact on health and disease,” Critical Reviews in Food Science
well. This effect was confirmed both in vitro and in vivo and Nutrition, vol. 51, no. 7, pp. 626–634, 2011.
for the extracts and the pure compound punicalagin, while [6] J. E. Crabtree, P. Peichl, J. I. Wyatt, U. Stachl, and I. J. D. Lindley,
contradictory results were found for EA, since it seems to “Gastric interleukin-8 and IgA IL-8 autoantibodies in Heli-
be effective only in studies performed in vivo. This might cobacter pylori infection,” Scandinavian Journal of Immunology,
be explained considering the metabolic fate of PG phenolic vol. 37, no. 1, pp. 65–70, 1993.
compounds. In fact, different studies demonstrate a strong [7] J. E. Crabtree, Z. Xiang, I. J. D. Lindley, D. S. Tompkins, R.
interaction between gut microbiota and PG polyphenols Rappuoli, and A. Covacci, “Induction of interleukin-8 secretion
from gastric epithelial cells by a cagA negative isogenic mutant
(i.e., EA) that are metabolized by intestinal microflora to
of Helicobacter pylori,” Journal of Clinical Pathology, vol. 48, no.
urolithins. These metabolites themselves could modulate gut 10, pp. 967–969, 1995.
microbiota, enhancing the growth of beneficial strains in
[8] K. Yasumoto, S. I. Okamoto, N. Mukaida, S. Murakami, M. Mai,
spite of pathogenic ones. Among urolithins, urolithins A
and K. Matsushima, “Tumor necrosis factor 𝛼 and interferon
has been shown to possess a significant anti-inflammatory 𝛾 synergistically induce interleukin 8 production in a human
activity both in vitro and in vivo, thus suggesting that this gastric cancer cell line through acting concurrently on AP-1 and
compound, and not its precursor EA, could be the main NF-kB-like binding sites of the interleukin 8 gene,” Journal of
responsible for the anti-inflammatory properties observed Biological Chemistry, vol. 267, no. 31, pp. 22506–22511, 1992.
with PG extracts in the gut. However it has been also [9] R. Caruso, D. Fina, I. Peluso et al., “IL-21 is highly produced
showed that the inflammatory status alters the composition of in Helicobacter pylori-infected gastric mucosa and promotes
intestinal microbiota, changing its metabolic capacity and the gelatinases synthesis,” Journal of Immunology, vol. 178, no. 9, pp.
bioavailability of phenolic compounds [60]. This statement is 5957–5965, 2007.
corroborated by observation that, after consumption of PG [10] B. Romier, Y. J. Schneider, Y. Larondelle, and A. During,
extract, the phenolic profile of faeces obtained from healthy “Dietary polyphenols can modulate the intestinal inflammatory
and DSS-fed rats is deeply changed: in normal conditions response,” Nutrition Reviews, vol. 67, no. 7, pp. 363–378, 2009.
EA and punicalagin are completely metabolized to urolithins [11] R. Al-Ashy, I. Chakroun, M. E. El-Sabban, and F. R. Homaidan,
A, whereas in inflammatory conditions they can be found “The role of NF-𝜅B in mediating the anti-inflammatory effects
unmodified in the colon [60]. This suggests that biological of IL-10 in intestinal epithelial cells,” Cytokine, vol. 36, no. 1-2,
effects of urolithins, and consequently PG, could be strictly pp. 1–8, 2006.
related to the composition of individual microbiota and to [12] E. P. Lansky and R. A. Newman, “Punica granatum
the intestinal inflammatory status. For this reason, although (pomegranate) and its potential for prevention and treatment
the studies reported herein seem to recommend PG con- of inflammation and cancer,” Journal of Ethnopharmacology,
sumption to prevent or treat gastrointestinal inflammation, vol. 109, no. 2, pp. 177–206, 2007.
future clinical studies on anti-inflammatory activity at the [13] F. Afaq, V. M. Adhami, and H. Mukhtar, “Photochemopre-
gastrointestinal tract are necessary to clarify the beneficial vention of ultraviolet B signaling and photocarcinogenesis,”
Mutation Research, vol. 571, no. 1-2, pp. 153–173, 2005.
effects of PG for human health.
[14] D. Heber, “Pomegranate ellagitannins,” in Herbal Medicine:
Biomolecular and Clinical Aspects, I. F. F. Benzie and S. Wachtel-
Acknowledgments Galor, Eds., CRC Press, Boca Raton, Fla, USA, 2nd edition, 2011.
[15] M. I. Gil, F. A. Tomas-Barberan, B. Hess-Pierce, D. M. Holcroft,
The fellowship of E. Colombo is partially funded by FSE, and A. A. Kader, “Antioxidant activity of pomegranate juice
Regione Lombardia. The authors thank Ms. Elda Desiderio and its relationship with phenolic composition and processing,”
Pinto for excellent administrative management. Journal of Agricultural and Food Chemistry, vol. 48, no. 10, pp.
4581–4589, 2000.
[16] S. Quideau, Chemistry and Biology of Ellagitannins, World
References Scientific, Singapore, 2009.
[17] N. P. Seeram, R. Lee, and D. Heber, “Bioavailability of ellagic
[1] J. Jurenka, “Therapeutic applications of pomegranate (Punica
acid in human plasma after consumption of ellagitannins from
granatum L.): a review,” Alternative Medicine Review, vol. 13, no.
pomegranate (Punica granatum L.) juice,” Clinica Chimica Acta,
2, pp. 128–144, 2008.
vol. 348, no. 1-2, pp. 63–68, 2004.
[2] M. Dell’Agli, G. V. Galli, Y. Corbett et al., “Antiplasmodial [18] N. P. Seeram, Y. Zhang, R. McKeever et al., “Pomegranate juice
activity of Punica granatum L. fruit rind,” Journal of Ethnophar- and extracts provide similar levels of plasma and urinary ellag-
macology, vol. 125, no. 2, pp. 279–285, 2009. itannin metabolites in human subjects,” Journal of Medicinal
[3] M. Dell’Agli, G. V. Galli, M. Bulgari et al., “Ellagitannins of Food, vol. 11, no. 2, pp. 390–394, 2008.
the fruit rind of pomegranate (Punica granatum) antagonize in [19] B. Cerdá, J. C. Espı́n, S. Parra, P. Martı́nez, and F. A. Tomás-
vitro the host inflammatory response mechanisms involved in Barberán, “The potent in vitro antioxidant ellagitannins from
pomegranate juice are metabolised into bioavailable but poor [35] C. J. Hawkey, “Prostaglandins: mucosal protection and peptic
antioxidant hydroxy-6H-dibenzopyran-6-one derivatives by ulceration,” Methods and Findings in Experimental and Clinical
the colonic microflora of healthy humans,” European Journal of Pharmacology, vol. 11, no. 1, pp. 45–51, 1989.
Nutrition, vol. 43, no. 4, pp. 205–220, 2004. [36] A. Chatterjee, S. Chatterjee, and S. Das, “Ellagic acid facilitates
[20] A. Pérez-Vicente, A. Gil-Izquierdo, and C. Garcı́a-Viguera, indomethacin-induced gastric ulcer healing via COX-2 up-
“In vitro gastrointestinal digestion study of pomegranate juice regulation,” Acta Biochimica et Biophysica Sinica, vol. 44, no. 7,
phenolic compounds, anthocyanins, and vitamin C,” Journal of pp. 565–576, 2012.
Agricultural and Food Chemistry, vol. 50, no. 8, pp. 2308–2312, [37] R. Gautam and S. C. Sharma, “Anti-ulcer activity of Punica
2002. granatum L. in diabetic rats,” International Journal of Pharmacy
[21] G. J. McDougall, S. Fyffe, P. Dobson, and D. Stewart, “Antho- and Pharmaceutical Sciences, vol. 4, no. 3, pp. 451–461, 2012.
cyanins from red wine—their stability under simulated gas- [38] S. Murakami, Y. Isobe, H. Kijima, H. Nagai, M. Muramatu,
trointestinal digestion,” Phytochemistry, vol. 66, no. 21, pp. and S. Otomo, “Inhibition of gastric H+,K+-ATPase and acid
2540–2548, 2005. secretion by ellagic acid,” Planta Medica, vol. 57, no. 4, pp. 305–
[22] T. K. McGhie and M. C. Walton, “The bioavailability and 308, 1991.
absorption of anthocyanins: towards a better understanding,” [39] T. Iino, K. Tashima, M. Umeda et al., “Effect of ellagic acid
Molecular Nutrition and Food Research, vol. 51, no. 6, pp. 702– on gastric damage induced in ischemic rat stomachs following
713, 2007. ammonia or reperfusion,” Life Sciences, vol. 70, no. 10, pp. 1139–
[23] A. M. Aura, P. Martin-Lopez, K. A. O’Leary et al., “In vitro 1150, 2002.
metabolism of anthocyanins by human gut microflora,” Euro- [40] L. S. Adams, N. P. Seeram, B. B. Aggarwal, Y. Takada, D. Sand,
pean Journal of Nutrition, vol. 44, no. 3, pp. 133–142, 2005. and D. Heber, “Pomegranate juice, total pomegranate ellagitan-
[24] J. Fleschhut, F. Kratzer, G. Rechkemmer, and S. E. Kulling, “Sta- nins, and punicalagin suppress inflammatory cell signaling in
bility and biotransformation of various dietary anthocyanins in colon cancer cells,” Journal of Agricultural and Food Chemistry,
vitro,” European Journal of Nutrition, vol. 45, no. 1, pp. 7–18, vol. 54, no. 3, pp. 980–985, 2006.
2006. [41] B. Romier-Crouzet, J. van de Walle, A. During et al., “Inhibition
[25] P. Saniee, M. Hajimahmoodi, P. Foroumadi et al., “Antibacterial of inflammatory mediators by polyphenolic plant extracts in
activity of plant extracts against H. pylori,” Helicobacter, vol. 14, human intestinal Caco-2 cells,” Food and Chemical Toxicology,
pp. 393–394, 2009. vol. 47, no. 6, pp. 1221–1230, 2009.
[26] M. Hajimahmoodi, M. Shams-Ardakani, P. Saniee et al., “In [42] S. Hollebeeck, J. Winand, M. F. Herent et al., “Anti-
vitro antibacterial activity of some Iranian medicinal plant inflammatory effects of pomegranate (Punica granatum
extracts against Helicobacter pylori,” Natural Product Research, L.) husk ellagitannins in Caco-2 cells, an in vitro model of
vol. 25, no. 11, pp. 1059–1066, 2011. human intestine,” Food & Function, vol. 3, no. 8, pp. 875–885,
[27] S. P. Voravuthikunchai and H. Mitchell, “Inhibitory and 2012.
killing activities of medicinal plants against multiple antibiotic- [43] R. A. Rastall, G. R. Gibson, H. S. Gill et al., “Modulation
resistant Helicobacter pylori,” Journal of Health Science, vol. 54, of the microbial ecology of the human colon by probiotics,
no. 1, pp. 81–88, 2008. prebiotics and synbiotics to enhance human health: an overview
[28] P. J. Oates and J. P. Hakkinen, “Studies on the mechanism of of enabling science and potential applications,” FEMS Microbi-
ethanol-induced gastric damage in rats,” Gastroenterology, vol. ology Ecology, vol. 52, no. 2, pp. 145–152, 2005.
94, no. 1, pp. 10–21, 1988. [44] D. Bialonska, S. G. Kasimsetty, K. K. Schrader, and D. Ferreira,
[29] K. B. Ajaikumar, M. Asheef, B. H. Babu, and J. Padikkala, “The “The effect of pomegranate (Punica granatum l.) byproducts
inhibition of gastric mucosal injury by Punica granatum L. and ellagitannins on the growth of human gut bacteria,” Journal
(pomegranate) methanolic extract,” Journal of Ethnopharmacol- of Agricultural and Food Chemistry, vol. 57, no. 18, pp. 8344–
ogy, vol. 96, no. 1-2, pp. 171–176, 2005. 8349, 2009.
[30] M. S. Alam, M. A. Alam, S. Ahmad, A. K. Najmi, M. Asif, [45] N. P. Seeram, S. M. Henning, Y. Zhang, M. Suchard, Z. Li, and D.
and T. Jahangir, “Protective effects of Punica granatum in Heber, “Pomegranate juice ellagitannin metabolites are present
experimentally-induced gastric ulcers,” Toxicology Mechanisms in human plasma and some persist in urine for up to 48 hours,”
and Methods, vol. 20, no. 9, pp. 572–578, 2010. Journal of Nutrition, vol. 136, no. 10, pp. 2481–2485, 2006.
[31] S. Lai, Q. Zhou, Y. Zhang, J. Shang, and T. Yu, “Effects [46] D. Bialonska, P. Ramnani, S. G. Kasimsetty, K. R. Muntha, G.
of Pomegranate tannins on experimental gastric damages,” R. Gibson, and D. Ferreira, “The influence of pomegranate by-
Zhongguo Zhongyao Zazhi, vol. 34, no. 10, pp. 1290–1294, 2009. product and punicalagins on selected groups of human intesti-
[32] K. Gharzouli, S. Khennouf, S. Amira, and A. Gharzouli, “Effects nal microbiota,” International Journal of Food Microbiology, vol.
of aqueous extracts from Quercus ilex L. root bark, Punica 140, no. 2-3, pp. 175–182, 2010.
granatum L. fruit peel and Artemisia herba-alba Asso leaves on [47] B. Dobroslawa, S. G. Kasimsetty, S. I. Khan, and F. Daneel,
ethanol-induced gastric damage in rats,” Phytotherapy Research, “Urolithins, intestinal microbial metabolites of pomegranate ∼
vol. 13, no. 1, pp. 42–45, 1999. ellagitannins, exhibit potent antioxidant activity in a cell-based
[33] A. M. S. E. S. Beserra, P. I. Calegari, M. D. C. Souza et assay,” Journal of Agricultural and Food Chemistry, vol. 57, no.
al., “Gastroprotective and ulcer-healing mechanisms of ellagic 21, pp. 10181–10186, 2009.
acid in experimental rats,” Journal of Agricultural and Food [48] T. Sergent, N. Piront, J. Meurice, O. Toussaint, and Y. J. Schnei-
Chemistry, vol. 59, no. 13, pp. 6957–6965, 2011. der, “Anti-inflammatory effects of dietary phenolic compounds
[34] S. Fiorucci, E. Antonelli, and A. Morelli, “Mechanism of non- in an in vitro model of inflamed human intestinal epithelium,”
steroidal anti-inflammatory drug-gastropathy,” Digestive and Chemico-Biological Interactions, vol. 188, no. 3, pp. 659–667,
Liver Disease, vol. 33, supplement 2, pp. S35–S43, 2001. 2010.
[49] A. González-Sarrı́as, J. C. Espı́n, F. A. Tomás-Barberán, and [63] T. Boussetta, H. Raad, P. Lettéron et al., “Punicic acid a
M. T. Garcı́a-Conesa, “Gene expression, cell cycle arrest and conjugated linolenic acid inhibits TNF𝛼-induced neutrophil
MAPK signalling regulation in Caco-2 cells exposed to ellagic hyperactivation and protects from experimental colon inflam-
acid and its metabolites, urolithins,” Molecular Nutrition and mation in rats,” PLoS ONE, vol. 4, no. 7, Article ID e6458, 2009.
Food Research, vol. 53, no. 6, pp. 686–698, 2009. [64] J. Bassaganya-Riera, M. DiGuardo, M. Climent et al., “Acti-
[50] A. González-Sarrı́as, M. Larrosa, F. A. Toms-Barberán, P. vation of PPAR𝛾 and 𝛿 by dietary punicic acid ameliorates
Dolara, and J. C. Espı́n, “NF-𝜅B-dependent anti-inflammatory intestinal inflammation in mice,” British Journal of Nutrition,
activity of urolithins, gut microbiota ellagic acid-derived vol. 106, no. 6, pp. 878–886, 2011.
metabolites, in human colonic fibroblasts,” British Journal of [65] K. Katayama, K. Wada, A. Nakajima et al., “A novel PPAR𝛾 gene
Nutrition, vol. 104, no. 4, pp. 503–512, 2010. therapy to control inflammation associated with inflammatory
[51] J. A. Gimenez-Bastida, M. Larrosa, A. Gonzalez-Sarrias et bowel disease in a murine model,” Gastroenterology, vol. 124, no.
al., “Intestinal ellagitannin metabolites ameliorate cytokine- 5, pp. 1315–1324, 2003.
induced inflammation and associated molecular markers in [66] C. F. Coursodon-Boyiddle, C. L. Snarrenberg, C. K. Adkins-
human colon fibroblasts,” Journal of Agricultural and Food Rieck et al., “Pomegranate seed oil reduces intestinal damage
Chemistry, vol. 60, no. 36, pp. 8866–8876, 2012. in a rat model of necrotizing enterocolitis,” American Journal of
[52] Y. Ogawa, K. Kanatsu, T. Iino et al., “Protection against dextran Physiology, vol. 303, no. 6, pp. G744–G751, 2012.
sulfate sodium-induced colitis by microspheres of ellagic acid [67] R. Hasan, M. Hossain, R. Akter et al., “Antioxidant, antidiar-
in rats,” Life Sciences, vol. 71, no. 7, pp. 827–839, 2002. rhoeal and cytotoxic properties of Punica granatum Linn.,”
[53] K. Singh, A. S. Jaggi, and N. Singh, “Exploring the ameliorative Latin American Journal of Pharmacy, vol. 28, no. 5, pp. 783–788,
potential of Punica granatum in dextran sulfate sodium induced 2009.
ulcerative colitis in mice,” Phytotherapy Research, vol. 23, no. 11, [68] E. Y. Qnais, A. S. Elokda, Y. Y. A. Ghalyun, and F. A. Abdulla,
pp. 1565–1574, 2009. “Antidiarrheal activity of the aqueous extract of Punica grana-
[54] S. Umesalma and G. Sudhandiran, “Differential inhibitory tum (pomegranate) peels,” Pharmaceutical Biology, vol. 45, no.
effects of the polyphenol ellagic acid on inflammatory 9, pp. 715–720, 2007.
mediators NF-𝜅B, iNOS, COX-2, TNF-𝛼, and IL-6 in 1,2- [69] C. V. Rao, A. R. Verma, M. Vijayakumar, and S. Rastogi,
dimethylhydrazine-induced rat colon carcinogenesis,” Basic “Gastroprotective effect of standardized extract of Ficus glom-
and Clinical Pharmacology and Toxicology, vol. 107, no. 2, pp. erata fruit on experimental gastric ulcers in rats,” Journal of
650–655, 2010. Ethnopharmacology, vol. 115, no. 2, pp. 323–326, 2008.
[55] M. A. Rosillo, M. Sanchez-Hidalgo, A. Cárdeno, and C. A. de la [70] R. Govindarajan, M. Vijayakumar, M. Singh et al., “Antiulcer
Lastra, “Protective effect of ellagic acid, a natural polyphenolic and antimicrobial activity of Anogeissus latifolia,” Journal of
compound, in a murine model of Crohn’s disease,” Biochemical Ethnopharmacology, vol. 106, no. 1, pp. 57–61, 2006.
Pharmacology, vol. 82, no. 7, pp. 737–745, 2011.
[71] P. Tamashiro-Filho, B. Sikiru Olaitan, D. A. Tavares de Almeida
[56] M. A. Rosillo, M. Sanchez-Hidalgo, A. Cardeno et al., “Dietary et al., “Evaluation of antiulcer activity and mechanism of action
supplementation of an ellagic acid-enriched pomegranate of methanol stem bark extract of Lafoensia pacari A. St.-Hil.
extract attenuates chronic colonic inflammation in rats,” Phar- (Lytraceae) in experimental animals,” Journal of Ethnopharma-
macological Research, vol. 66, no. 3, pp. 235–242, 2012. cology, vol. 144, no. 3, pp. 497–505, 2012.
[57] J. Lian, W. Ding, J. X. Sun, and X. M. Lü, “Experimental study
[72] V. Da Mota Menezes, Á. N. Atallah, A. J. Lapa, and W. R.
of aqueous extract of Pericarpium granati for treating ulcerative
Catapani, “Assessing the therapeutic use of Lafoensia pacari St.
colitis of rats,” Pharmaceutical Care and Research, vol. 9, no. 2,
Hil. extract (Mangava-Brava) in the eradication of Helicobacter
pp. 107–110, 2009.
pylori: double-blind randomized clinical trial,” Helicobacter, vol.
[58] A. M. Neyrinck, V. F. van Hee, L. B. Bindels et al., “Polyphenol- 11, no. 3, pp. 188–195, 2006.
rich extract of pomegranate peel alleviates tissue inflammation
and hypercholesterolaemia in high-fat diet-induced obese mice:
potential implication of the gut microbiota,” British Journal of
Nutrition, vol. 7, pp. 1–8, 2012.
[59] E. V. Khokhlova, V. V. Smeianov, B. A. Efimov et al., “Anti-
inflammatory properties of intestinal Bifidobacterium strains
isolated from healthy infants,” Microbiology and Immunology,
vol. 56, no. 1, pp. 27–39, 2012.
[60] M. Larrosa, A. González-Sarrı́as, M. J. Yáñez-Gascón et al.,
“Anti-inflammatory properties of a pomegranate extract and
its metabolite urolithin-A in a colitis rat model and the effect
of colon inflammation on phenolic metabolism,” Journal of
Nutritional Biochemistry, vol. 21, no. 8, pp. 717–725, 2010.
[61] K. Nagao and T. Yanagita, “Conjugated fatty acids in food and
their health benefits,” Journal of Bioscience and Bioengineering,
vol. 100, no. 2, pp. 152–157, 2005.
[62] D. M. Hwang, J. K. Kundu, J. W. Shin, J. C. Lee, H. J. Lee, and Y.
J. Surh, “cis-9,trans-11-Conjugated linoleic acid down-regulates
phorbol ester-induced NF-𝜅B activation and subsequent COX-
2 expression in hairless mouse skin by targeting I𝜅B kinase and
PI3K-Akt,” Carcinogenesis, vol. 28, no. 2, pp. 363–371, 2007.
doi:10.1155/2012/382763
Review Article
Pomegranate Protection against Cardiovascular Diseases
Michael Aviram and Mira Rosenblat

The Lipid Research Laboratory, Technion Faculty of Medicine, The Rappaport Family Institute for Research in
the Medical Sciences and Rambam Medical Center, Haifa 31096, Israel
Correspondence should be addressed to Michael Aviram, aviram@tx.technion.ac.il
Received 10 July 2012; Accepted 10 October 2012
Copyright © 2012 M. Aviram and M. Rosenblat. This is an open access article distributed under the Creative Commons
properly cited.
The current paper summarizes the antioxidative and antiatherogenic effects of pomegranate polyphenols on serum lipoproteins
and on arterial macrophages (two major components of the atherosclerotic lesion), using both in vitro and in vivo humans and mice
models. Pomegranate juice and its by-products substantially reduced macrophage cholesterol and oxidized lipids accumulation,
and foam cell formation (the hallmark of early atherogenesis), leading to attenuation of atherosclerosis development, and its
consequent cardiovascular events.
1. Polyphenolic Flavonoids and of atherosclerosis in animals [10]. Reduced development of

Cardiovascular Diseases atherosclerotic lesion areas in the atherosclerotic apolipopro-
tein E-deficient (E0 ) mice was demonstrated following
Polyphenolic flavonoids compose the largest and the most consumption of red wine [11, 12] licorice root extract [13,
studied group of plant phenolics. Over 4000 different 14], grape powder [15], or ginger extract [16].
flavonoids have been identified to date. Flavonoids are
grouped into anthocyanins and anthoxanthins. Antho-
cyanins are glycosides of anthocyanidin, and they are the 2. Pomegranate Juice (PJ) Polyphenols
most important group of water-soluble plant pigments, Inhibit the Development of
responsible for the red, blue, and purple colors of flowers Atherosclerotic Lesion
and fruits. Anthoxanthins are colorless or colored white-
to-yellow, and include flavonols, flavanols, flavones, flavans, The pomegranate tree, which is said to have flourished in the
and isoflavones. Flavonoids are powerful antioxidants, and Garden of Eden, has been extensively used as a folk medicine
their activity is related to their chemical structure [1, in many cultures [17, 18]. Edible parts of pomegranate fruits
2]. Plant flavonoids can act as potent inhibitors of low- (about 50% of total fruit weight) comprise 80% juice and
density lipoprotein (LDL) oxidation [3, 4] or of macrophage 20% seeds. Fresh juice contains 85% moisture, 10% total
oxidation [5]. Dietary consumption of flavonoids was shown sugars, 1.5% pectin, ascorbic acid, and polyphenols.
to be inversely related to morbidity and mortality from Content of soluble polyphenols in PJ varies within
coronary heart disease (CHD) [6]. Moreover, an inverse the limits of 0.2%–1.0%, depending on the variety, and
association between flavonoid intake and subsequent occur- includes mainly anthocyanins (such as cyanidin-3-glycoside,
rence of ischemic heart disease, or cerebrovascular disease cyanidin-3, 3-diglycoside, and delphindin-3-glucoside) and
was shown [7, 8]. Reduced morbidity and mortality from anthoxanthins (such as catechins, ellagic tannins, and gallic
cardiovascular diseases, in spite of high intake of saturated and ellagic acids) [19, 20]. Ellagic acid and hydrolysable
fat among French, the so-called French paradox [9], has ellagitannins are both implicated in protection against
been attributed to the regular intake of red wine in the diet. atherogenesis, along with their potent antioxidant capacity.
Dietary consumption of flavonoid-rich nutrients, as well as Punicalagin is the major ellagitannin in PJ, and this com-
pure flavonoids, was shown to attenuate the progression pound is responsible for the high antioxidant activity of this
juice. As a major source for polyphenolics, PJ was shown of atherosclerosis. Thus, PJ exhibits preventive, as well as
to be a very potent antioxidant against LDL oxidation and, therapeutic effects against atherosclerosis.
in parallel, to inhibit atherosclerosis development in mice
and in humans [21–23]. In vivo studies were conducted
first in order to evaluate whether the active antioxidant 2.2. Studies in Humans. Measurements of the arterial stiff-
components of PJ are absorbed. Recent studies examined the ness of the common carotid arteries in 73 patients with
bioavailability and metabolism of punicalagin in the rat as at least one cardiovascular risk factor that consumed PJ
an animal model [24, 25]. Two groups of rats were studied. (Wonderful variety, 240 mL/day for one year) showed trends
One group was fed with standard rat diet (n = 5), and to increased elasticity in the PJ-treated group versus the
the second one with the same diet plus 6% punicalagin placebo-treated group (who received beverage of similar
(n = 5). The daily intake of punicalagin ranged from 0.6– caloric content, flavor and color, unpublished data). The
1.2 g. Glucuronides of methyl ether derivatives of ellagic acid effect of a daily consumption of PJ for 3 months on myocar-
and punicalagin were detected in plasma. 6H-Dibenzo [b, d] dial perfusion in 45 patients who had CHD was also studied.
pyran-6-one derivatives were also observed in the plasma, Patients were randomly assigned into one of two groups: a PJ
especially during the last few weeks of the study. In urine, group (240 mL/day) or a placebo group. The experimental
the main metabolites observed were the 6H-dibenzo [b, d] and control groups showed similar levels of stress-induced
pyran-6-one derivatives, and were present as aglycones or as ischemia at baseline. After 3 months however, the extent
glucuronides. It was concluded that since only 3%–6% of the of stress-induced ischemia decreased in the pomegranate
ingested punicalagin was detected as such or as metabolites group, but increased in the control group. This benefit was
in urine and feces, the majority of this ellagitannin has to observed without changes in cardiac medications, blood
be converted to undetectable metabolites or accumulated in sugar, hemoglobin A1c, body weight, or blood pressure,
nonanalysed tissues. Only traces of punicalagin metabolites in either group [31]. We next investigated the effects of
were detected in liver or kidney. In humans, following con- PJ consumption by patients with carotid artery stenosis
sumption of PJ (180 mL) containing 25 mg of ellagic acid and (CAS) on carotid lesion size, in association with changes in
318 mg of hydrolysable ellagitannins (as punicalagin), ellagic oxidative stress [32]. Ten patients were supplemented with
acid was detected in human plasma 1 hour after ingestion PJ for up to one year, and nine CAS patients that did not
at a maximum concentration of 32 ng/mL, and by 4 hours consume PJ served as a control group. Blood samples were
it was completely eliminated [26]. Thus, active components collected before treatment and after 3, 6, 9, and 12 months
of PJ are indeed absorbed, and subsequently affect biological of PJ consumption. Patients’ carotid intima-media thickness
processes which are related to atherogenesis protection. (CIMT) was compared between the PJ group and the control
Upon analyzing the influence of the physiological conditions group. While in the control group (no PJ) CIMT increased
in the stomach and small intestine on pomegranate bioactive by 10% after 1 year, PJ consumption resulted in a significant
compounds bioavailability using an in vitro availability CIMT reduction, by up to 35%. Analysis of the mean CIMT
method, it was demonstrated that pomegranate phenolic (of the left and right common carotid arteries) before and
compounds are available during digestion in a high amount during PJ consumption revealed a gradual reduction of 13%,
(29%). Nevertheless, due to pH, anthocyanins are largely 22%, 26%, and 35%, as observed after 3, 6, 9, and 12
transformed into nonred forms or degraded [27]. months of PJ consumption, respectively, in comparison to
baseline values (“0 time”, Figure 1(c)). On examination of the
internal carotid arteries, flow velocities were calculated at the
2.1. Studies in Atherosclerotic Mice. PJ supplementation stenotic sites, and expressed by peak systolic velocity (PSV)
to the atherosclerotic E0 mice reduced the size of their and end diastolic velocity (EDV). The ultrasound outcome
atherosclerotic lesion and the number of foam cells in their data were the change over time in maximal IMT, which was
lesion [28], in comparison to control placebo-treated E0 measured in the same preselected carotid artery segments.
mice that were supplemented with water. We also analyzed Twelve months of PJ consumption, resulted in PSV reduction
the therapeutic potency of PJ by its administration to E0 by 12% and 28% in the left and the right carotid arteries,
mice with already advanced atherosclerosis. Atherosclerotic respectively. Mean carotid EDV of both left and right carotid
E0 mice at 4 months of age, were supplemented for 2 arteries gradually decreased, by 16%, 20%, 31%, and 44%,
months with 31 μL of PJ (equivalent to 0.875 μmoles of total after 3, 6, 9, and 12 months of PJ consumption, respectively.
polyphenols/mouse/day, which is equivalent to about one A randomized, double-blind trial assessed the influence
glass-8Oz/human/day), and were compared to age-matched of PJ consumption on anterior and posterior CIMT progres-
placebo-treated mice. PJ supplementation to 4-month-old sion rates in subjects at moderate risk for coronary heart
E0 mice was still able to inhibit the progression of the disease. Subjects were men (45 to 74 years old) and women
disease, as it reduced the mice atherosclerotic lesion size (55 to 74 years old) with one or more major CHD risk factors
by 17%, in comparison to atherosclerotic lesion of the age- and baseline posterior wall CIMT of 0.7 to 2.0 mm, without
matched placebo-treated mice (Figures 1(a) and 1(b)) [29]. any significant stenosis. Participants consumed 240 mL/day
These results were further confirmed by de Nigris et al of PJ (n = 146), or a control beverage (n = 143) for up to 18
[30], who demonstrated that oral administration of PJ to months. No significant difference in overall CIMT progres-
hypercholesterolemic LDL-receptor deficient mice at various sion rate was observed between PJ and control treatments.
stages of the disease reduced significantly the progression In exploratory analyses however, in subjects in the most
A B
50 μm 50 μm
Placebo (6 months) PJ (6 months)

(a) (b)
1.5 ∗
∗
∗
(mm)
∗
1
0.5
0 3 6 9 12
Time after PJ consumption (months)
(c) Carotid IMT
Figure 1: Pomegranate juice (PJ) consumption attenuates atherosclerotic lesion development in the atherosclerotic apolipoprotein E-
deficient (E0 ) mice (a)-(b), or in patients with carotid artery stenosis (CAS, c). Twenty E0 mice, 4-month-old, with advanced atherosclerosis,
or 10 patients with severe CAS were supplemented with PJ concentrate (12.5 μL/mouse/day or 50 mL/day, resp.) for 9 weeks or for 1 year,
respectively. Photomicrographs of typical foam cells from 6 months old E0 mice administered a placebo (a) or PJ (b) are presented. Effect
of PJ consumption on human common carotid artery intima media thickness (IMT, c) is shown. ∗ P < 0.01 (mean ± SEM, after PJ versus
before PJ consumption).
adverse tertiles for baseline serum lipid peroxides, triglyc- of free radicals scavenging capacities of various juices
erides (TGs), high-density lipoprotein (HDL) cholesterol, revealed that PJ was the most potent one, whereas orange
TGs/HDL cholesterol, total cholesterol/HDL cholesterol, and juice, grapefruit juice, and peach juice demonstrated very
apolipoprotein-B100, those in the PJ group had significantly low free radicals scavenging capacities (Figure 2(b)). The
less anterior wall and/or composite CIMT progression versus antioxidant potency of commonly consumed polyphenol-
control subjects. These results suggest that in subjects at rich beverages in the USA was also compared [34]. Total
moderate CHD risk, PJ consumption had no significant polyphenol content in these beverages was evaluated by
effect on overall CIMT progression rate but slowed CIMT gallic acid equivalents determination. This study applied five
progression in subjects with increased oxidative stress and tests of antioxidant potency: (1) trolox equivalent antioxi-
disturbances in the TG-rich lipoprotein/HDL axis [33]. dant capacity (TEAC), (2) total oxygen radical absorbance
capacity (ORAC), (3) free radical scavenging capacity by
3. Antioxidative Properties of PJ 2, 2-diphenyl-1-picrylhydrazyl (DPPH), (4) ferric reducing
antioxidant power (FRAP), and (5) inhibition of LDL
3.1. Antioxidative Capacity of PJ in Comparison to other Juices. oxidation. The beverages included several different brands as
PJ was shown to possess an antioxidant activity that was follows: apple juice, acai juice, black cherry juice, blueberry
three times higher than the antioxidant activity of green tea juice, cranberry juice, Concord grape juice, orange juice,
[19]. The antioxidant activity was higher in juice extracted red wines, iced tea beverages (black tea, green tea, white
from whole pomegranate than that of juice obtained from tea), and the major PJ available in the U.S. market. An
arils only, suggesting that the processing extracts some of the overall antioxidant potency composite index was calculated
hydrolyzable tannins present in the fruit rind into the juice. by assigning each test equal weight. PJ had the greatest
We have demonstrated that PJ contains a higher concen- antioxidant potency composite index among the beverages
tration of total polyphenols (5 mmol/L) in comparison to tested, and was at least 20% greater than any of the other
other fruit juices (orange, grapefruit, grape, cranberry, pear, beverages tested. Antioxidant potency, ability to inhibit LDL
pineapple, apple, and peach juices which contain only 1.3– oxidation, and total polyphenol content were consistent in
4 mmol/L of total polyphenols, Figure 2(a)). Determination classifying the antioxidant capacity of the polyphenol-rich
120
6
OD reduction (%)
90
(mmol/L)
4
60
2 30
0 0
Peach juice
Pear juice
Red plum juice
Kiwi juice
Orange juice
Red plum juice
Kiwi juice
Orange juice
Pomegranate juice (PJ)
Grape juice
Cranberry juice
Grapefruit juice
Apple juice
Pineapple juice
Pomegranate juice (PJ)
Apple juice
Pineapple juice
Peach juice
Grape juice
Cranberry juice
Grapefruit juice
Pear juice
(a) Total Polyphenols (b) Free Radical Scavenging Capacity
Figure 2: Fruit juices total polyphenols concentration and free radical scavenging capacities. Total polyphenol concentration of various
juices was determined using quercetin as a standard (a). Free radical scavenging capacity was analyzed by the DPPH assay and is given as %
of absorbance reduction by 1 μL/mL of juice after 5 minutes of incubation. Results are given as mean ± S.D of three different experiments.
beverages in the following order: PJ > red wine > Concord cyanidin-3-0-β-glucopyranodise, and cyanidin-3, 5-di-0-β-
grape juice > blueberry juice > black cherry juice, acai juice, glucopyranoside inhibited copper ion-induced LDL oxida-
cranberry juice > orange juice, iced tea beverages, apple juice. tion in a dose-dependent manner. Upon comparing the
Although in vitro antioxidant potency does not prove in vivo effects of ellagic acid to gallic acid, gallic acid was more
biological activity, there was a consistent clinical evidence of potent inhibitor of LDL oxidation (IC50 of 2.1 μg/mL for
antioxidant potency for the most potent beverage antioxi- gallic acid, versus 16 μg/mL for ellagic acid). Similarly,
dants with PJ and red wine being most potent. Furthermore, the anthocyanins delphinidin-3-0-β-glucopyranoside and
we have recently compared the antioxidative properties cyanidin-3-0-β-glucopyranodise were more potent antiox-
of 35 beverages, and found that 100% Wonderful-variety idants against LDL oxidation than ellagic acid, with IC50
pomegranate and 100% black currant juices were both, the of 3.0, 2.0, and 16 μg/mL, respectively. When comparing
most potent antioxidants in vitro and in vivo, as they inhib- the antioxidative properties of the specific PJ anthocyanins,
ited copper ion-induced LDL oxidation by up to 94% and pelargonidin-3-0-β-glucopyranoside and cyanidin-3, 5-di-0-
AAPH-induced serum lipid peroxidation by up to 38% [35]. β-glucopyranoside were less potent than delphinidin-3-0-β-
The most potent antioxidant activity of PJ could be glucopyranoside or cyanidin-3-0-β-glucopyranodise (IC50 of
related to its high polyphenolic flavonoid content, as well 13 μg/mL versus 2-3 μg/mL). A similar pattern was noted
as, to the specific type of potent polyphenols present in PJ for the free radical scavenging capabilities of the above PJ
(specific hydrolyzable tannins). fractions.
3.2. Contribution of PJ Constituents to Its Antioxidative 4. PJ Consumption Reduces Serum

Properties. Several polyphenolic fractions were isolated from Oxidative Stress
PJ, including gallic acid, ellagic acid, tannins, total PJ
anthocyanins, and specific anthocyanins, such as cyanidin-3- 4.1. Serum Lipid Peroxidation. Human plasma obtained
0-β-glucopyranoside, cyanidin-3,5-di-0-β-glucopyranoside, from healthy subjects after 2 weeks of PJ consumption
delphinidin-3-0-β-glucopyranoside, and pelargenin-3-0-β- (50 mL PJ concentrate/day, equivalent to 1.5 mmol total
glucopyranoside. The total anthocyanin and tannin frac- polyphenols) demonstrated a small but significant (P < 0.01)
tions exhibited a dose-dependent antioxidative effect against 16% decreased susceptibility to free radical-induced lipid
copper ion-induced LDL oxidation. In the AAPH-induced peroxidation, in comparison to plasma obtained prior to PJ
LDL oxidation process, both fractions exhibited weaker consumption, as measured by lipid peroxides formation, or
antioxidative properties in comparison to the copper ion- by total antioxidant status (TAS) in serum. To determine
induced LDL oxidation. These results suggest that the antho- the effect of increasing or decreasing the dosages of PJ on
cyanins and tannins possess in addition to their free radical plasma lipid peroxidation, and to analyze PJ capability to
scavenging capabilities, also transition metal ion chelation maintain its effect after termination of juice consumption,
properties. The tannin fraction was more potent than the three subjects were further studied. Supplementation of
anthocyanin fraction in inhibiting LDL oxidation, and the 20 mL of PJ concentrate/day for one week resulted in a
IC50 of the tannins was half that of the anthocyanins. Both PJ, significant decrease of 11% in plasma lipid peroxidation,
ellagic and gallic acids and the anthocyanins delphinidin-3- compared to plasma obtained prior to PJ consumption.
0-β-glucopyranoside, pelargonidin-3-0-β-glucopyranoside, Supplementation of 50 mL PJ concentrate/day for one more
week exhibited a further 21% decrease in plasma lipid per- HDL oxidation from 37 ± 2 minutes to 45 ± 6 minutes before
oxidation. However, a further increase in the supplemented and 2 weeks after PJ consumption, respectively.
PJ to 80 mL of PJ concentrate/day for an additional one PJ consumption by patients with CAS resulted in a
week did not further inhibit plasma susceptibility to lipid significant reduction in the basal level of LDL-associated
peroxidation. Gradual decreasing of the PJ dosage in these lipid peroxides by 43%, 89%, 86%, and 90% after 3, 6, 9, and
3 subjects down to 40 mL/day for one week, and then to 12 months of PJ consumption, respectively, and in parallel,
20 mL/day for additional two weeks, did not significantly it increased the resistance of LDL to copper ion-induced
affect plasma lipid peroxidation, which remained low in oxidation [32]. This was demonstrated by reduced formation
comparison to the levels obtained after supplementation of of lipid peroxides in LDL during its incubation with copper-
80 mL of PJ concentrate/day. Two weeks after cessation of PJ ions (by 40%, 49%, 57%, and 59% after 3, 6, 9, and 12
supplementation, the reduced rate of plasma susceptibility to months of PJ consumption, respectively, Figure 3(c)). PJ con-
lipid peroxidation was sustained. After a further 4 weeks with sumption also decreased the propensity of LDL derived from
no PJ consumption, plasma lipid peroxidation returned to E0 mice to copper ion-induced oxidation (Figure 3(d)). In
the higher values obtained before PJ consumption. E0 mice that consumed 6.25 μL/mouse/d or 12.5 μL/mouse/d
The effect of PJ consumption by patients with CAS of PJ concentrate for a period of 3.5 months, LDL oxidation
on their serum oxidative state was also measured [32]. A by copper ions was delayed by 100 minutes and by 120
significant (P < 0.01) reduction in the concentration of minutes, respectively, in comparison to LDL obtained before
antibodies against Ox-LDL by 24% and 19% was observed juice administration. Determination of the extent of LDL
after 1 and 3 months of PJ consumption, respectively, (from oxidation by the lipid peroxides assay revealed a significant
2070 ± 61 EU/mL before treatment to 1563 ± 69 and 1670 ± inhibition after PJ consumption (Figure 3(d)). Furthermore,
52 EU/mL after 1 and 3 months of PJ consumption, resp.). the progressive increase with age in the susceptibility of the
TAS in serum from these patients was substantially increased mice LDL to oxidation was significantly attenuated by PJ
by 2.3 fold (from 0.95 ± 0.12 nmol/L at baseline, up to consumption, in a dose-dependent manner [28].
2.20 ± 0.25 nmol/L after 12 months of PJ consumption).
These results indicate that PJ administration to patients
with CAS substantially reduced their serum oxidative status 4.3. Serum Paraoxonase 1 (PON1). The increased resistance
and could thus inhibit plasma lipid peroxidation. The of LDL and of HDL to oxidation after PJ administration
susceptibility of the patient’s serum to free radical-induced to healthy subjects or to patients with CAS could have
oxidation decreased after 12 months of PJ consumption by also resulted from increased serum HDL-associated paraox-
62% (Figure 3(a)). The effect of PJ consumption on serum onase1 (PON1) activity. Indeed, a significant 18% increase in
oxidative state was recently measured also in patients with serum PON1 activity was monitored in healthy subjects after
noninsulin dependent type 2 diabetes mellitus. Consump- PJ consumption for a period of 2 weeks [28]. In CAS patients,
tion of 50 mL of PJ per day for a period of 3 months serum PON1 arylesterase activity significantly increased by
resulted in a significant reduction in serum lipid peroxides 11%, 42%, 49%, and 83% after 3, 6, 9, and 12 months of
and TBARS levels by 56% and 28%, respectively [36]. PJ consumption, respectively [32], and in patients with type
PJ consumption exhibited antioxidative effects also when 2 diabetes mellitus it significantly increased by 12% after
administered to E0 mice [28]. The basal oxidative state, PJ consumption for 3 months [36]. In another study from
measured as lipid peroxides in serum of control E0 mice our group, we analyzed thirty patients with type 2 diabetes
(that did not consume PJ), increased gradually during aging mellitus. Ten male patients and 10 female patients received
from 260 nmol/mL of serum at 6 weeks of age, to 309 concentrated Wonderful variety of PJ (WPJ, 50 mL/day for
and 535 nmol/mL of serum after 9 and 14 weeks of age, 4 weeks), while another group of 10 male patients received
respectively. Following PJ consumption, the extent of serum pomegranate by-product extract (WPOMxl, 5 mL/day for
lipid peroxidation by the free radical AAPH was markedly 6 weeks) [37]. There were no significant effects of WPJ
reduced, as compared to that observed in serum from or WPOMxl consumption on fasting blood glucose or
the placebo mice, and this effect was PJ concentration- hemoglobin A1c levels. After 4 weeks of WPJ consumption
dependent (Figure 3(b)). Similarly, serum TAS was higher in by male patients, basal serum oxidative stress was signifi-
E0 mice that consumed PJ, in comparison to control mice, cantly decreased by 35%, whereas serum concentration of
and this effect was again juice concentration-dependent [28]. sulfhydryl (SH) groups (antioxidant marker) was signifi-
cantly increased by 25%. In male patients that consumed
WPOMxl and in female patients that consumed PJ, a similar
4.2. Serum LDL and HDL Oxidation. Consumption of PJ for pattern was observed, though to a lesser extent.
1 and 2 weeks by healthy volunteers increased the resistance The effect of consuming the polyphenol-richest bever-
of their LDL to copper ions-induced oxidation, as shown by ages (Wonderful-variety pomegranate juice, black currant
a prolongation of the lag time required for the initiation of juice, Concord grape juice, acai juice blend, and red wine)
LDL oxidation, by 29% and 43%, in comparison to LDL by healthy subjects was further analyzed in vivo for a short
obtained prior to juice consumption [28]. Similarly, the term (after 2 hours, and after 1 week of consumption) [35].
resistance of their HDL to copper ion-induced oxidation also Consumption of these antioxidant rich beverages (especially
gradually increased after PJ consumption, as shown by a Wonderful-variety pomegranate juice and black currant
prolongation in the lag time required for the initiation of juice) increased serum SH groups level already after 2 hours,
CAS patients E◦ mice
600
2000
Placebo
(nmol lipid peroxides/mL)

(nmol lipid peroxides/mL)
500
PJ (6.25 μL/mouse/d)
1500
400 PJ (12.5 μL/mouse/d)
#
1000
∗
300
500 #
200
0 0
Before PJ After PJ 6 9 12 15 18
(a) AAPH-induced Serum Lipid Peroxidation (b) AAPH-induced Serum Lipid Peroxidation
Mice age (weeks)
(nmol lipid peroxides/mg LDL protein)
1600 300
(nmol lipid peroxides/mg LDL protein)

250
1200
∗ ∗ 200
#
800 ∗
∗
150
400 100
50
0
0 3 6 9 12 0
Placebo PJ
Time of PJ consumption (months)
(c) Copper ion-induced LDL Oxidation (d) Copper ion-induced LDL Oxidation
Figure 3: Pomegranate juice (PJ) consumption reduces serum or LDL oxidation in patients with carotid artery stenosis (CAS) and in
the atherosclerotic E0 mice. Effect of PJ supplementation to CAS patients (for 1 year) or to E0 mice (for up to 14 weeks) on (a and b) the
susceptibility of serum to radical-induced lipid peroxidation, and on (c and d) copper ion-induced LDL oxidation is shown. ∗ P < 0.01 (mean
± SD, after PJ versus before PJ consumption in humans) and # P < 0.01 (mean ± SD, PJ (12.5 μL/mouse/day) versus placebo in mice).
and more so, after 1 week (Figure 4(a)). After 1 week investigated the effects of PJ and POMxl consumption on
of consumption, black currant juice or Wonderful-variety PON1 association with HDL in diabetic patients [37]. HDL-
pomegranate juice significantly increased serum SH groups associated PON1 arylesterase, paraoxonase, and lactonase
concentration by 11% or 8%, respectively (Figure 4(a)). In activities increased significantly after PJ consumption, by 34–
contrast, consumption of the other beverages for 2 hours 45%, as compared to the baseline levels. In male patients that
or for one week had no statistically significant effect on consumed POMxl, and in female patients that consumed
serum SH groups’ concentration (Figure 4(a)). We next PJ, a similar pattern was observed, although to a lesser
analyzed the effects of selected polyphenols-rich beverages extent. PON1 protein binding to HDL was significantly
consumption by healthy subjects (2 hours or 1 week con- increased by 32% following PJ consumption (Figure 5(a)),
sumption) on serum PON1 catalytic activity (Figure 4(b)) while the level of PON1 in the lipoprotein deficient serum
[35]. Two hours after consumption of the selected beverages, (LPDS) decreased by 62% (Figure 5(a)), suggesting that PJ
serum PON1 lactonase activity was not significantly affected consumption resulted in increased free PON1 binding to
(Figure 4(b)). However, after 1 week of consumption, black the HDL. A similar trend of increased PON1 protein asso-
currant juice significantly increased serum PON1 activities ciation with HDL was observed in males following POMxl
by 20%, and Wonderful-variety PJ significantly increased it consumption, as after 4 weeks of POMxl consumption,
by 5% (Figure 4(b)). HDL-bound PON1 protein increased by 17%, as compared
Association of PON1 with HDL stabilizes the enzyme. to baseline values (Figure 5(b)). The above results were
In diabetic patients, PON1 dissociates from HDL and, confirmed also in in vitro study where serum from diabetic
as a consequence, it is less biologically active. We thus patients was incubated with PJ or with punicalagin, or with
16 ∗
∗
∗ ∗ 14
(Units/mL)
300
(μmol/L)
12
10
200
8
6
100
After 2 h
After 2 h
After 2 h
After 2 h
After 2 h
After 1 week
After 1 week
After 1 week
After 1 week
After 1 week
0 0 0 0 0
After 2 h
After 1 week
0
After 2 h
After 2 h
After 2 h
After 2 h
After 1 week
After 1 week
After 1 week
After 1 week
0 0 0 0
Acai Grape juice Currant juice PJ Red wine

Acai Grape juice Currant juice PJ Red wine
(a) Serum SH Groups (b) Serum PON1 Lactonase Activity
Figure 4: Pomegranate juice (PJ) or black currant juice consumption by healthy subjects, for a short term, decreases serum oxidative stress
and increases PON1 activity. Six healthy subjects consumed 250 mL/day of pomegranate juice (PJ, POM Wonderful), black currant juice
(Knudsen), Red Wine (Mondavi), Grape Juice (Lakewood), or Acai Juice (Naked) for up to one week, followed by one week of washout.
Blood samples were collected before and after 2 hours or one week of beverages consumption. (a) Serum SH groups’ concentration. (b)
Serum paraoxonase 1 (PON1) lactonase activity (towards dihydrocoumarin) were determined. The individual results, as well as, the mean
± SD for each treatment at the different time points are shown. ∗ P < 0.01 versus time 0.
×102 ×103
300 18
densitometric analysis
densitometric analysis
(peak volume (a.u.))

(peak volume (a.u.))
PON1 protein
PON1 protein
225 ∗ ∗
12
150
6
75 ∗
0
0 4 0 4 0 4
HDL
HDL LPDS
Time on PJ (weeks) Time on POMxl (weeks)
(a) (b)
Figure 5: Pomegranate juice (PJ) or whole pomegranate fruit extract (POMxl) increase PON1 binding to HDL. Twenty patients with type
2 diabetes mellitus participated in the study. Ten male patients received concentrated PJ (50 mL/day for 4 weeks) while another group of 10
male patients received POMxl (5 mL/day for 6 weeks). (a) Blood samples were collected from both groups before (0 time) and 4 weeks after
PJ consumption, or (b) 4 weeks after POMxl consumption. The HDL or LPDS fractions were isolated from the blood samples of 4 patients
by density gradient ultracentrifugation. The HDL fractions (25 μg protein) or LPDS fractions (20 μL) were loaded on 10% acrylamide gel,
and PON1 protein bands were visualized using mouse anti-human PON1 antibody. PON1 bands and densitometric analysis of the PON1
bands are shown. This is a representative experiment out of four. ∗ P < 0.01 versus time 0.
no addition (control) for 2 hours at 37◦ C. Then, HDL was We thus conclude that PJ, as well as, POMxl consumption
isolated from the serum by ultracentrifugation, and Western by diabetic patients contributes to PON1 stabilization, by
blot analysis was performed. After serum incubation with PJ increasing its association with HDL, and therefore, enhanc-
(18 μg GAE/mL) or with punicalagin, the protein content ing PON1 catalytic activities. The ratio between HDL-
of HDL-bound PON1 significantly increased by 36% and associated PON1 and free PON1 gradually decreased as the
by 14%, respectively, as compared to control serum. Upon extent of HDL oxidation increased. The antioxidants vitamin
increasing the concentration of PJ or punicalagin up to 36 μg E or PJ inhibited the oxidation-mediated redistribution of
GAE/mL, HDL-bound PON1 protein further increased, and PON1 in serum. Indeed, PJ or its purified major polyphenols
it was 62% or 83% higher than that observed in control punicalagin, gallic acid, or ellagic acid, all increased PON1
serum (no PJ), respectively [37]. binding also to HDL. Furthermore, PON1 associated more
efficiently with HDLs isolated from diabetic patients after (Figure 7(b)), contained less lipid peroxides, in comparison
PJ consumption versus patient HDLs isolated prior to PJ to carotid lesion from patients that did not consume PJ,
consumption [38]. or to MPM from the placebo-treated E0 mice, respectively
Similarly to the results obtained in humans, a significant [28, 32]. Incubation of the human carotid lesion or of E0
43% increase in serum PON1 activity was also observed in MPM with LDL (100 μg of protein/mL) for 18 hours under
E0 mice after PJ consumption for a period of 2 months, oxidative stress (in the presence of copper ions) revealed that
in comparison to serum PON1 activity observed in the PJ consumption resulted in 43% and 82% reduced capacity
placebo-treated mice [29]. The increase in serum PON1 of the lesion or the macrophages to oxidize LDL, respectively.
activity may be a direct effect of PJ, as well as an effect The mechanism responsible for this effect was associated
secondary to PJ-mediated reduction in lipid peroxides, as it with inhibition of the translocation to the macrophage
was previously demonstrated that paraoxonase is inactivated plasma membrane of the NADPH oxidase cytosolic factor p-
by oxidized lipids [39], and its activity is preserved by 47, and hence, inhibition of NADPH oxidase activation and
antioxidants, such as PJ, red wine, or the licorice root- of superoxide anion release from the macrophages.
derived isoflavan glabridin. The above increment in PON1 Similarly to the in vivo studies, preincubation of J774A.1
catalytic activities could have resulted also from PJ-induced macrophages with increasing concentrations of PJ dose-
increment in liver PON1 expression. Indeed, PON1 protein dependently reduced macrophage oxidative stress, as mea-
and mRNA expression, as well as PON1 gene promoter sured by total peroxides level (Figure 7(c)). Recently, we
activation, were significantly increased in hepatocytes cell have demonstrated that unique complex sugars and/or
line (HuH7) following incubation with PJ or its major phenolics in PJ also contribute to PJ-induced reduction of
polyphenols punicalagin, or gallic acid (GA), and this macrophage oxidative stress [46]. Increasing concentrations
effect was dose-dependent (Figure 6(a)) [40]. This effect of the PJ sugar fractions resulted in a dose-dependent
of PJ polyphenols was mediated, at least in part, via the decrement in J774A.1 macrophage cell line peroxide levels,
transcription factor PPARγ, as addition of PJ polyphenols to up to 72%, compared to control cells. On the contrary,
HuH7 cells in the presence of the PPARgamma antagonist incubation of the cells with white grape juice sugar fraction
GW9662, significantly decreased the stimulatory effect of PJ at the same concentration resulted in a dose-dependent
polyphenols on PON1 expression (Figure 6(b)) [40]. increment in peroxide levels up to 37%. On the molecular
In accordance with the above increased PON1 mRNA basis, PJ-induced reduction in macrophage oxidative stress
expression, PJ, punicalagin, and GA increased the hepato- could result from the effect of PJ on the transcription
cytes-secreted PON1 activity (in the presence of HDL from of redox sensitive genes. The activation of the oxidative
PON1KO mice) by 2.7 and 1.9 fold, respectively, compared stress responsive transcription factor, Nuclear Factor kappa-
to control untreated cells (Figure 6(c)). Functionally, the B (NFκ-B), has been linked with a variety of inflammatory
secreted PON1 exhibited biological activity, as it protected diseases, including atherosclerosis. Extensive research in the
LDL from copper ion-induced oxidation (Figure 6(d)) [40]. last few years, reviewed by Aggarwal and Shishodia [47], has
shown that the pathway that activates NFκ-B can be inhibited
5. PJ Reduces Macrophage Atherogenicity by phytochemicals, including those present in pomegranate,
thus providing a beneficial effect against atherosclerosis
Oxidative stress has been implicated in the pathogenesis development. It was demonstrated that pomegranate wine
of atherosclerosis [41, 42], leading to the oxidation of (PJ fermented with yeast and dealcoholized) inhibits oxi-
lipids, not only in LDL, but also in arterial macrophages dation of endothelial cells induced by TNF-α, and acts
[43, 44]. We have previously shown that “lipid-peroxidized as a potent inhibitor of NFκ-B activation in these cells
macrophages” exhibit atherogenic characteristics, including [48]. Pomegranate fermented juice and pomegranate cold
increased ability to oxidize LDL and to take up oxidized LDL pressed seed oil flavonoids were also shown to inhibit
(Ox-LDL) [45]. eicosanoid enzyme activity [49]. Flavonoids extracted from
We thus studied the effect of dietary consumption of pomegranate cold pressed seed oil showed 31–44% inhibi-
PJ by E0 mice on macrophage atherogenicity, including tion of sheep cyclooxygenase and 69–81% inhibition of soy-
macrophage lipid peroxidation and subsequently macro- bean lipoxygenase. Flavonoids extracted from pomegranate
phage activities related to foam cell formation, such as fermented juice also showed 21–30% inhibition of soybean
cell-mediated oxidation of LDL and cellular uptake of lipoxygenase. Recently, it was demonstrated that PJ decreased
lipoproteins. the activation of the redox-sensitive genes ELK-1 and p-
JUN and increased eNOS expression in cultured endothelial
5.1. Macrophage Oxidative Stress. We have demonstrated cells which were exposed to shear stress, as well as in
that human monocyte derived macrophages (HMDM) atherosclerotic-prone areas of hypercholesterolemic mice
isolated from patients with type 2 diabetes mellitus after [30].
consumption of PJ for 3 months, as well as, the carotid PJ-mediated reduction in the transcription of several key
lesion derived after endarterectomy from CAS patients that redox enzymes, including cyclooxygenase, lipoxygenase, and
consumed PJ (Figure 7(a)), and also mouse peritoneal NO synthase could be the result of intracellular oxidation
macrophages (MPM) isolated from E0 mice after consump- suppression. Through this mechanism, as well as via the sup-
tion of PJ concentrate (12.5 μL/mouse/day, equivalent to pression of lipoxygenase-catalyzed leukotriene formation, PJ
0.35 μmoles of total polyphenols) for a period of 3.5 months
∗ 1000
800
(% over control untreated cells)
(% over control untreated cells)

PON1/β-actin mRNA ratio
PON1/β-actin mRNA ratio

800
∗ ∗
600 ∗
∗ ∗ 600
400 ∗
400
200
200
0 0
Control PJ Punicalagin Gallic acid Ellagic acid Control PJ Punicalagin Gallic acid
17.5 μg GAE/mL −GW9662

35 μg GAE/mL +GW9662 (PPARγ antagonist)
70 μg GAE/mL
(a) (b)
Copper ion-induced LDL oxidation

Secreted PON1 arylesterase activity
(nmol MDA/mg LDL protein)

∗
60
(units/mg cell protein)
2
∗ 40
Control-CM
∗
1 20
Gallic acid-CM
0 0
Control PJ Punicalagin Gallic acid Ellagic acid 0 10 20 30 40 50
Conditioned medium (CM) concentration ( μL)
(c) (d)
Figure 6: Pomegranate Juice (PJ) polyphenols upregulated paraoxonase 1 (PON1) expression in hepatocytes, via PPARγ, resulting in the
secretion of biologically active PON1. (a) PON1 mRNA expression in human hepatoma cell line (HuH7) that were incubated with increasing
concentrations (17–70 μg of gallic acid equivalents (GAE)/mL) of PJ, or its polyphenols: punicalagin, gallic, or ellagic acids, for 24 hours at
37◦ C. (b) PON1 mRNA expression in HuH7 cells, untreated (Control) or treated with pomegranate or its major polyphenols, in the absence
or presence of the PPARγ antagonist GW9662 (50 μmol/L). (c) Secreted PON1 arylesterase activity was measured in the medium from
control cells, or from pomegranate polyphenols-treated cells in the presence of HDL from PON1 knockout (KO) mice. (d) LDL was oxidized
by copper ions in presence of conditioned medium from untreated (Control-CM) and from gallic acid treated cells (Gallic acid-CM). Results
are expressed as mean ± SD of three different experiments. ∗ P < 0.01 versus control.
may act also as an anti-inflammatory agent, in addition to its PJ (0–50 μmol/L of total polyphenols) dose-dependently
major role as antioxidant. increased PON2 mRNA (Figure 8(a)), protein expression,
and lactonase activity (Figure 8(b)) and reduced macrophage
oxidative stress. These effects could be attributed to the
5.2. Macrophage Paraoxonase 2 (PON2). Whereas PON1 is PJ unique polyphenols, punicalagin, and gallic acid. PJ
expressed mainly in the liver and is present in the circulation, polyphenol-induced upregulation of PON2 was inhibited by
PON2 is expressed in most tissues, including macrophages, 40% upon using the PPARγ antagonist GW9662. Accord-
but it is not present in the circulation [50, 51]. PON2, like ingly, the PPARγ ligand, rosiglitazone, dose-dependently
PON1 however, was shown to protect against atherosclerosis stimulated macrophage PON2 expression by up to 80%.
development [52]. This effect could be attributed to PON2- Inhibition of AP-1 activation (with SP600125) attenuated PJ-
induced reduction in macrophage oxidative stress [50, 51, induced upregulation of PON2 by 40%. Similarly, incubation
53], as well as, in triglyceride accumulation [53, 54]. We of macrophages with PJ polyphenols in the presence of
next questioned the association between PJ polyphenolics, GW9662 or SP600125 significantly reduced their capacity to
macrophage oxidative stress, and cellular PON2 expression, protect macrophages against oxidative stress [55]. We thus
in relation to the activation of specific PON2 transcrip- conclude that the antioxidative characteristics of PJ unique
tion factors [55]. Incubation of J774A.1 macrophages with phenolics punicalagin and gallic acid could be related, at
CAS patients (in vivo) E◦ mice (in vivo)

80
250
(nmol/mg lesion protein)
(nmol/mg cell protein)

200 60
150 ∗
40
∗
100 ∗
20
50
0 0
0 3 12 Placebo PJ
Time of PJ consumption (months)
(a) Carotid Lesion Lipid Peroxides (b) Macrophage Lipid Peroxides
J774A.1 macrophages (in vitro)
300
Mean fluorescence intensity (a.u.)
250
200
#
#
150
100
50
0
0 12 25 50 75
PJ concentration (μmol/L)
(c) Macrophage Total Peroxides
Figure 7: Pomegranate juice (PJ) reduces oxidative stress in carotid artery stenosis (CAS) patients’ lesion, and in macrophages. Effect of PJ
consumption by CAS patients on lipid peroxides content in human carotid lesions (a), and the effect of PJ consumption by E0 mice on lipid
peroxides content in their mouse peritoneal macrophages (b). J774A.1 macrophage cell line was incubated with increasing concentrations
of PJ for 20 hours at 37◦ C, followed by cellular oxidative stress analysis measured as DCFH oxidation (c).∗ P < 0.01 (mean±SD versus 0 time
in humans, and PJ versus placebo in the mice study), # P < 0.01 cell incubation with PJ versus control cells (without PJ).
least in part, to their stimulatory effect on macrophage PON2 5.3. Macrophage Cholesterol Metabolism. Macrophage cho-
expression, a phenomenon which was shown to be associated lesterol accumulation and foam cell formation are the
with activation of the transcription factors PAPRγ and AP- hallmark of early atherogenesis. Cholesterol accumulation
1.We next analyzed the role of PON2 in the antiatherogenic in macrophages can result from impaired balance between
properties of PJ. Consumption of PJ by C57BL/6 mice external and internal cholesterol sources. LDL, which under-
(Figure 8(c)), or by PON1KO mice significantly upregulated goes oxidative modification, is an important external source
PON2 expression in MPM [56]. Unlike the inhibitory effects for macrophage accumulated cholesterol.
of PJ consumption in C576BL/6 MPM or in PON1KO Ox-LDL is taken up by macrophages at enhanced rate via
MPM on macrophage oxidative stress (as measured by scavenger receptors [57, 58], which, unlike the LDL receptor,
the cells’ ability to oxidize LDL), in PON2KO mice, PJ are not down regulated by intracellular cholesterol content
consumption had a nonsignificant effect, on LDL oxidation [59], and therefore lead to accumulation of cholesterol in the
rate by the cells (Figure 8(d)). These results indicate that cells. Macrophage cholesterol from internal sources origins
PJ-induced reduction in macrophage oxidative stress is from cholesterol biosynthesis. The enzyme 3-hydroxy-3
mediated mostly by PJ-induced macrophage PON2 (but not methylglutaryl coenzyme A (HMGCoA) reductase catalyzes
PON1) overexpression. the rate limiting step in cholesterol biosynthetic pathway
In vitro In vitro
(PON2/GAPDH mRNA)
0.3 ∗
∗ ∗
PON2 lactonase activity

PON2 expression
10

∗ 0.2
0.1
0 0
0 10 50 0 10 50
PJ concentration (μmol/L) PJ concentration (μmol/L)
(a) J774A.1 Macrophages (b) J774A.1 Macrophages
In vivo In vivo
Cell-mediated LDL oxidation 400
(nmol MDA/mg LDL protein
2
(PON2/GAPDH mRNA)
#
PON2 expression
/mg cell protein)
300
#
#
200
1
100
0
C57BL/6
PON1KO mice + PJ
C57BL/6
PON2KO mice + PJ
PON1KO mice
C57BL/6 mice
PON2KO mice
C57BL/6 mice + PJ
mice mice + PJ
(c) MPM (d) MPM
Figure 8: Pomegranate juice (PJ) upregulates macrophage paraoxonase 2 (PON2) expression and reduces macrophage oxidative stress. (a)
and (b) In vitro studies. J774A.1 macrophages were incubated with increasing concentrations (0–50 μmol polyphenols/L) of PJ for 20 hours.
Then, PON2 mRNA expression (a), as well as PON2 lactonase activity towards dihydrocoumarin (b) were determined. (c) and (d) In vivo
studies. C57BL/6 mice, as well as PON1knockout (KO) mice, or PON2KO mice, consumed PJ (200 μg of gallic acid equivalents/mouse/day)
for 1 month, and the mice peritoneal macrophages (MPM) were harvested. MPM PON2 mRNA expression (c) and the cells’ ability to oxidize
LDL in the presence of copper ions were measured (d). ∗ P < 0.01 (incubation in vitro with PJ versus without PJ), # P < 0.01 (after PJ versus
before PJ consumption).
[60], and it is subjected to a negative feedback regulation by measured as cellular lipoprotein binding, cell-association,
the cellular cholesterol content. In addition to cellular uptake and degradation, by MPM derived from E0 mice that
of lipoproteins and to cholesterol biosynthesis, macrophage consumed 12.5 μL of PJ concentrate/mouse/day for a period
cholesterol accumulation can also result from a decreased of 2 months, was significantly reduced, by 16%, 22%, and
efflux of cholesterol from the cells [61]. 15%, respectively, in comparison to Ox-LDL binding, cell-
Since PJ was shown to inhibit macrophage foam cell association, and degradation obtained by MPM from control
formation and the development of atherosclerotic lesions, E0 mice. Similarly, PJ consumption by patients with type 2
we analyzed the effect of PJ consumption on cellular diabetes mellitus significantly decreased the extent of Ox-
processes that lead to macrophage cholesterol accumulation. LDL cellular uptake by their HMDM (by 36%) [36]. Cellular
We have demonstrated that the cellular uptake of Ox-LDL, cholesterol esterification rate (another atherogenic property
of macrophages) in MPM isolated from PJ-treated mice We conclude that PJ protects the macrophages against
was found to be 80% lower compared with age-matched, oxidative stress by increasing PON2 expression, suppress-
placebo-treated mice. Finally, PJ treatment significantly ing Ox-LDL uptake by macrophages, inhibiting cellular
increased, by 39%, cholesterol efflux from macrophages cholesterol and triglyceride biosynthesis, or stimulation of
compared with the cholesterol efflux rate from MPM HDL-mediated cholesterol efflux from the cells. All these
harvested from the placebo-treated mice. Taken together, all effects could lead to attenuation in cellular cholesterol and
these antiatherogenic effects lead to reduced accumulation of triglyceride accumulation, and foam cell formation.
cholesterol in macrophages.
In vitro studies clearly show that PJ exhibit direct
antiatherogenic effects on macrophages. Preincubation of 6. Antiatherogenic Effects of Pomegranate
J774A.1 macrophages with PJ resulted in a significant By-Products
(P < 0.01) reduction in Ox-LDL degradation by 40% [62].
On the contrary, PJ had no effect on macrophage degra- Pomegranate extract prepared from the whole fruit contains
dation of native LDL and also not on macrophage choles- an approximately 20-fold increased antioxidant activity in
terol efflux. Macrophage cholesterol biosynthesis however, comparison to the level in the pomegranate aril juice [67].
was inhibited by 50% after cell incubation with PJ. This The antioxidant level in the pomegranate whole extractis
inhibition, unlike statin action, was not mediated by an effect directly correlated with the content of hydrolyzable tannins
on HMGCoA reductase along the cholesterol biosynthetic (in which punicalagin is predominant), while no such
pathway. correlation was found for the level of anthocyanins [67].
A product of total pomegranate tannins (TPT) contain-
5.4. Macrophage Triglyceride Metabolism. Triglycerides are ing 85% punicalagin, 1.3% ellagic acid, and a small amount
an independent risk factor for atherosclerosis [63]. Macro- of ellagic acid glycosides was purified from the pomegranate
phage foam cells isolated from atherosclerotic lesions contain husk extract prepared by Dr. Navindra P. Seeram from the
not only cholesteryl esters and unesterified cholesterol, but laboratory of Dr. David Heber at UCLA, USA [68]. On a
also substantial amount of triglycerides [64]. Triglyceride similar polyphenol weight basis (10 μg/mL), TPT was more
accumulation in macrophages increases oxidative stress and potent than vitamin E or PJ when analyzed as a free radical
cellular necrosis, thus further contributing to foam cell scavenger. TPT reduces the absorbance in the DPPH solution
formation [65]. The effect of PJ on macrophage triglyc- by 75% in comparison to 62% and 48% reduction obtained
eride metabolism was recently studied [66]. Upon incuba- by a similar total polyphenol content of PJ or by vitamin E,
tion of J774A.1 macrophages with PJ (0–50 μM), a dose- respectively. LDL oxidation induced either by copper ions
dependently decrease (by up to 30%) in cellular triglyceride or AAPH, was dose-dependently inhibited by TPT, with an
content (Figure 9(a)), and in triglyceride biosynthesis rate IC50 of 2.1 and 1.4 μg/mL, respectively. Macrophage oxidative
(Figure 9(b)) were observed. Similarly, punicalagin, the status was also substantially decreased by 50% on using
major PJ polyphenol, inhibited MPM triglyceride biosyn- 80 μmol/mL of TPT polyphenols. At a similar concentration,
thesis rate by 40%. Triglyceride hydrolytic rate however punicalagin was found to be even more potent than TPT in
was not significantly affected by PJ or punicalagin. The all the above assays.
activity of diacylglycerol acyltransferase 1 (DGAT1, the The antioxidative properties of pomegranate polyphenol
rate limiting enzyme in triglycerides biosynthesis) was extract powder, as well as of pomegranate fiber powder were
significantly inhibited, (by ∼50%), in J774A.1 macrophages also analyzed. The pomegranate fiber powder polyphenol
that were treated with 50 μM of PJ or with punicalagin, concentration was 8-fold lower, as compared to the polyphe-
with no significant effect on DGAT1 mRNA or protein nols in the pomegranate extract powder (200 ± 6 nmol/mg
expression. Both PJ and punicalagin increased (by ∼1.7 fold) versus 1580 ± 138 nmol/mg, resp.). The pomegranate extract
MPM PON2 mRNA expression, and PON2 was previously was significantly more potent than the fiber powder in both
shown to inhibit DGAT1 activity [53]. Addition of PJ scavenging of free radicals and in reducing macrophage
or punicalagin (50 μmol/L) to microsomes from PON2KO oxidative stress.
MPM still resulted in a significant reduction in DGAT1 The effects of a pomegranate liquid by-product (PBP,
activity, by ∼50%, suggesting a direct, non-PON2-mediated which includes the whole pomegranate fruit left over after
effect of PJ on macrophage triglycerides [66]. Similarly to juice preparation), on atherosclerosis development in E0
the in vitro study, we have recently demonstrated that PJ mice were studied [69]. Consumption of PBP (17 or 51.5 mg
consumption by C57BL/6 mice, by PON1KO mice, or by gallic acid equivalents/kg/day) by the mice resulted in a
PON2KO mice resulted in a significant reduction in MPM significant reduction in atherosclerotic lesion size by up to
triglyceride content by 17%, 16%, and 23%, respectively 57% (Figure 10(a)). PBP consumption significantly reduced
(Figure 9(c)), and this effect was associated with a significant the extent of Ox-LDL uptake by the mice MPM by up
reduction in macrophage triglyceride biosynthesis rate by to 19% (Figure 10(b)). Furthermore, MPM lipid peroxide
27%, 28%, or 22%, respectively (Figure 9(d)) [56]. content decreased by up to 42% (Figure 10(c)), after PBP
This study demonstrates that PJ beneficial effects on consumption, in association with increment in PON2 lac-
macrophage triglyceride metabolism are direct effect of tonase activity by up to 50% (Figure 10(d)), as compared to
PJ, which are not mediated via PJ-induced stimulation of MPM from the placebo mice. Similar results were observed
macrophage PON2. also in vitro. Treatment of J774A.1 macrophages with PBP
In vitro ×102 In vitro
Macrophage triglyceride biosynthesis rate

Macrophage triglyceride mass
150
6
(cpm/mg cell protein)

(μg/mg cell protein)
∗
∗ ∗
∗
100
4
0.5 5
0 0
0 10 20 30 40 50 0 10 20 30 40 50
PJ concentration (μmol/L) PJ concentration (μmol/L)
(a) J774A.1 (b) J774A.1
In vivo In vivo
×103
Macrophage triglyceride biosynthesis rate

60
Macrophage triglyceride mass
30 # #
(cpm/mg cell protein)
(μg/mg cell protein)
40
20
# #
# 20
10
#
0 0
C57BL/6 mice + PJ
PON2KO mice + PJ
PON1KO mice
PON1KO mice + PJ
PON2KO mice
C57BL/6 mice
C57BL/6 mice + PJ
C57BL/6 mice
PON1KO mice + PJ
PON2KO mice
PON2KO mice + PJ
PON1KO mice
(c) MPM (d) MPM
Figure 9: Pomegranate juice (PJ) protects macrophages from triglyceride accumulation: in vitro and in vivo studies. (a) and (b) In vitro
studies: J774A.1 macrophages were incubated with increasing concentrations (0–50 μmol polyphenols/L) of PJ, for 20 hours. Cellular
triglyceride content (a) and macrophage triglyceride biosynthesis rate (b) were determined. (c) and (d) In vivo studies: C57BL/6 mice,
as well as PON1knockout (KO) mice, or PON2KO mice, consumed PJ (200 μg of gallic acid equivalents (GAE)/mouse/day) for 1 month, and
the mice peritoneal macrophages (MPM) were then harvested. Cellular triglyceride content (c) and macrophage triglyceride biosynthesis
rate (d) were determined. ∗ P < 0.01 (incubation in vitro with PJ versus without PJ), # P < 0.01 (after PJ versus before PJ consumption).
(10 μmol/L or 50 μmol/L of total polyphenols), significantly than POMarils+seeds polyphenols in reducing oxidative
decreased both cellular total peroxide content and Ox-LDL stress. The amount of total peroxides in MPM from the mice
uptake. We thus conclude that PBP significantly attenuates that consumed POMarils+seeds, or POMxp was decreased
atherosclerosis development by its antioxidant properties. by 14% or by 24%, respectively, as compared to MPM
Next, we performed ex vivo and in vitro studies, in from placebo-treated mice (Figure 11(a)). Furthermore, the
which we compared the antiatherogenic properties of whole amount of superoxide anion released from MPM derived
pomegranate fruit powder by- product (POMxp) to those from E0 mice that consumed POMxp or POMarils+seeds
of pomegranate by-product POMarils+seeds powder. Per was lower by 39% or by 14%, respectively, as compared to
mg powder, the POMxp contained 90-fold higher concen- placebo MPM. This effect was associated with inhibition of
trations of polyphenols than the POMarils+seeds. Admin- MPM-mediated LDL oxidation by 18% or 31%, respectively
istration of 10 mg total polyphenols/kg/d of POMxp or of (Figure 11(b)).
POMarils+seeds aqueous extract to E0 mice for 2 months, The extent of Ox-LDL uptake by MPM from mice that
demonstrated that POMxp polyphenols are more potent consumed POMxp, but not by MPM from the mice that
500

40000
(μm2 )
∗ ∗
450
∗
20000
400 ∗
100
0 0
Placebo
Placebo
+ PBP(51.5 mg GAE/kg/day)
+PBP(17 mg GAE/kg/day)
+PBP(51.5 mg GAE/kg/day)
(a) Lesion Size (b) Macrophage Ox-LDL Uptake
100
∗
(nmol/mg cell protein)
0.2 ∗
∗
∗
50
0.1
0 0
Placebo
Placebo
(c) Macrophage Lipid Peroxides (d) Macrophage PON2 Lactonase Activity
Figure 10: Pomegranate by-product (PBP) consumption by E0 mice attenuates atherosclerotic lesion development, in association with
reduction in Ox-LDL uptake, and in macrophage oxidative stress, and on elevation in cellular paraoxonase 2 (PON2) activity. E0 mice
consumed PBP (17 or 51.5 mg gallic acid equivalents (GAE)/kg/day) for 3 months. Control mice received only water (placebo). At the end
of the study, the mice aortas, as well as, the mice peritoneal macrophages were harvested. (a) Atherosclerotic lesion size determination. (b)
The extent of Ox-LDL (25 μg of protein/mL, labeled with FITC) uptake by the mice macrophages was determined using flow cytometry. (c)
Macrophage lipid peroxides level. (d) Macrophage PON2 lactonase activity towards dihydrocoumarin. Results are expressed as mean ± S.D
of three different determinations. ∗ P < 0.01 versus Placebo.
200 600
(nmol MDA/mg LDL protein/

∗ 500
mg cell protein)
∗
150
∗ 400 ∗
300
100
20 100
50
0 0
(10 mg total polyphenols

Placebo
Placebo

POM arils+seeds
POM arils+seeds
POMxp
POMxp
/kg/d)
/kg/d)
/kg/d)
/kg/d)
(a) Macrophage Total Peroxides (b) Macrophage-Mediated LDL Oxidation
160
16
∗
140 12
Efflux (%)
∗ ∗
120 8
40 4
20
0 0

Placebo

Placebo
POM arils+seeds
POM arils+seeds
POMxp
POMxp
/kg/d)
/kg/d)
/kg/d)
/kg/d)
(c) Macrophage Ox-LDL Uptake (d) HDL- Mediated Cholesterol Efflux
Figure 11: Increased in vivo antiatherogenic properties of whole pomegranate powder by-product (POMxp) versus pomegranate arils+seeds
by-product (POM arils+seeds): studies in peritoneal macrophages from the atherosclerotic E0 mice. E0 mice (6 weeks old) consumed for 2
months 10 mg total polyphenols/kg/day of POMxp (dissolved in water), or of POM arils+seeds. Control mice received only water (placebo).
At the end of the study, the mice peritoneal macrophages (MPM) were harvested. (a) Macrophage total peroxides content was determined by
the DCFH assay. (b) The cells were incubated with LDL (100 μg protein/mL) in the presence of copper ions, and the extent of LDL oxidation
was measured by the TBARS assay. (c) The extent of Ox-LDL (25 μg of protein/mL, labeled with FITC) uptake by the mice macrophages was
determined using flow cytometry. (d) The mice macrophages were prelabeled with [3 H]-cholesterol for 1 hour. Then, the cells were washed,
and further incubated for 3 hours at 37◦ C without or with HDL (100 μg of protein/mL). The extent of HDL-mediated cholesterol efflux was
determined. Results are given as mean ± S.D of three different determinations. ∗ P < 0.01 versus placebo.
consumed POMarils+seeds, was significantly reduced by that the polyphenols in POMxp are more potent than the
13%, as compared to Ox-LDL uptake by the placebo MPM polyphenols in the by-product prepared from the arils+seeds
(Figure 11(c)). Furthermore, consumption of POMxp or in attenuation of macrophage cholesterol accumulation and
of POMarils+seeds by the E0 mice significantly stimulated foam cell formation. Similar results were observed in vitro
HDL-mediated cholesterol efflux from the mice MPM by upon adding POMxp or POMarils+seeds (10 mg gallic acid
74% and by 31%, respectively, (Figure 11(d)), indicating equivalents/mL) to J774A.1 macrophages, with 53% or

20000 100
∗
∗
(μm2 )
∗
∗
∗
10000 50
∗
0 0
Placebo
+PJ
+POMxp
+POMarils
+POMflower
+POMflower
Placebo
+PJ
+POMxp
+POMarils
(a) Lesion Size (b) Macrophage Total Peroxides
16
∗
∗
350
∗
12
∗ Efflux (%) ∗
300 8
20 1
0 0
+POMflower
+POMflower
Placebo
+PJ
+POMxp
+POMarils
+PJ
+POMxp
+POMarils
Placebo
(c) Macrophage Ox-LDL Uptake (d) HDL- Mediated Cholesterol Efflux
Figure 12: The effect of pomegranate extracts consumption by E0 mice on atherosclerotic lesion development and on the mice peritoneal
macrophages atherogenicity. Fifty male E0 mice (6 weeks old) were divided into five groups of 10 mice each. The placebo group received only
water. The other four groups received in their drinking water 200 μg gallic acid equivalents (GAE)/mouse/day of: PJ, POMxp, POMarils, or
POMflower for a 3-month period. At the end of pomegranate extracts consumption, the mice peritoneal macrophages (MPM), as well as
the mice aortas were harvested. (a) Atherosclerotic lesion size in the mice aortas. (b) Macrophage total peroxides content was determined
by the DCFH assay. (c) The extent of Ox-LDL (25 μg of protein/mL, labeled with FITC) uptake by the mice macrophages was determined
using flow cytometry. (d) The mice macrophages were prelabeled with [3 H]-cholesterol for 1 hour. Then, the cells were washed and further
incubated for 3 hours at 37◦ C without or with HDL (100 μg of protein/mL). The extent of HDL-mediated cholesterol efflux was determined.
Results are given as mean ± S.D of three different determinations. ∗ P < 0.01 versus Placebo.
27% reduction in Ox-LDL uptake by the cells, respectively. the lesion size by only 6% (Figure 12(a)). POMflower
Upon adding 41 μg of gallic acid equivalents/mL of POMxp consumption reduced serum lipids and glucose levels by 18–
or POMarils+seeds to the cells, HDL-mediated cholesterol 25%. PJ, POMxp, POMflower, or POMarils consumption
efflux was significantly stimulated by 147% and by 52%, by the E0 mice resulted in a significant decrement by
respectively. 53, 35, 27, or 13%, respectively, in MPM total peroxides
We next analyzed the antiatherogenic properties of the content (Figure 12(b)) and significantly increased cellular
pomegranate fruit various parts including: peels (POMxp), PON2 activity, as compared to placebo-treated mice. The
arils (POMarils), and flowers (POMflower), in comparison cellular uptake rates of Ox-LDL by E0 MPM (Figure 12(c))
to the whole pomegranate juice (PJ) [70]. After consump- were significantly reduced following the consumption of
tion of PJ, POMxp, or POMflower by the atherosclerotic PJ (by 15%), or POMxp (by 10%). PJ and to a lesser
E0 mice (200 μg of GAE/mouse/day, for 3 months), the extent POMarils consumption significantly stimulated HDL-
atherosclerotic lesion area was significantly decreased by mediated cholesterol efflux from MPM by 69% or by 28%,
44, 39, or by as much as 70%, respectively, as compared respectively (Figure 12(d)), whereas POMxp or POMflower
to lesion area observed in the placebo-treated group (Fig- consumption had no significant effect. We thus conclude that
ure 12(a)). POMarils consumption however, attenuated attenuation of atherosclerosis development by some of the
l HDL
ro
Macrophage le ste PON1
LDL 7 (−) ho fflux
oxidized C e
Free radicals Oxidases 5 (+)
Native LDL
(NADPH-Ox) UC
(ROS/RNS)
Antioxidants CE
1 (−) 6 (+) PON2
(GSH)
8 (−)
4 (−) Cholesterol TG UC 10
biosynthesis ( −)
CE
Cholesterol 9 (−) Triglyceride UC
influx biosynthesis CE
Ox-LDL TG
UC
3 (−) SR-CD36
CE CE
Oxidized LDL
Atherosclerotic lesion
HDL (macrophage foam cell)
2 (+) PON1
TG
“LDL”
Figure 13: Major pathways by which pomegranate polyphenols inhibit macrophage foam cell formation and atherosclerosis development.
Pomegranate polyphenols are the most potent antioxidants, and they directly inhibit LDL oxidation (#1). Pomegranate increases
paraoxonase1 (PON1) liver expression and serum activity, thereby increasing hydrolysis of already formed lipid peroxides in oxidized
LDL (Ox-LDL) (#2). Pomegranate polyphenols protect macrophages from cholesterol accumulation by several mechanisms: decrement
in cholesterol influx, by inhibition of Ox-LDL uptake via the cells scavenger receptor CD36 (#3), or by inhibition of cholesterol biosynthesis
rate (#4), or by stimulation of HDL-mediated cholesterol efflux from macrophages (#5). PJ polyphenols upregulate macrophage paraoxonase
2 (PON2) expression (#6), leading to reduction in macrophage oxidative stress (#7), and inhibition of reactive oxygen species (ROS),
or reactive nitrogen species (RNS) production and release from the cells, which can lead to inhibition of LDL oxidation by the cells
(#8). Pomegranate polyphenols also inhibit macrophage triglyceride (TG) biosynthesis rate (#9), thus reducing also TG accumulation in
macrophages. Altogether, these antiatherogenic effects of PJ attenuate macrophage conversion into foam cells, and the development of
atherosclerotic lesion (#10). CE, cholesterol ester; UC, unesterified cholesterol; TG, triglycerides, SR, scavenger receptor, (+), stimulation;
(−), inhibition.
pomegranate extracts and in particular POMflower could be PJ was shown to attenuate the accumulation of choles-
related to their combined beneficial effects on macrophage terol in macrophages due to: (a) inhibition of cellular choles-
atherogenic properties. terol biosynthesis, (b) inhibition of cellular Ox-LDL uptake,
and (c) stimulation of HDL-mediated cholesterol efflux from
macrophages. Furthermore, PJ also protects macrophages
7. Perspectives and Future Directions from triglyceride accumulation. Like PJ, pomegranate by-
products were similarly shown (both ex vivo and in vitro)
Our current view on the major pathways by which to reduce macrophage oxidative stress and to attenuate
pomegranate polyphenols and pomegranate by-products macrophage cholesterol accumulation and atherosclerotic
reduce macrophage foam cell formation and the develop- lesion development.
ment of advanced atherosclerosis is summarized in Figure 13. All these antioxidative and antiatherogenic effects of
Pomegranate fruit polyphenols (either in PJ or in the pomegranate polyphenols were clearly demonstrated in vitro,
pomegranate by-products) protect against lipid peroxidation as well as in vivo in humans and in the atherosclerotic
in serum, by direct interaction of pomegranate polyphenols apolipoprotein E-deficient mice. Dietary supplementation of
with LDL, or indirect by increasing serum PON1 stabil- PJ rich in polyphenols to patients with severe carotid artery
ity (HDL-association) and its catalytic activities, resulting stenosis or to atherosclerotic mice resulted in a significant
in the hydrolysis of serum lipid peroxides. Moreover, PJ inhibition in the development of the atherosclerotic lesions,
has a remarkable effect on macrophage atherogenicity. and this may be attributed to the protection of lipids in
Pomegranate polyphenols were shown to reduce macrophage arterial wall as well as in serum LDL against oxidation.
oxidative stress, secondary to pomegranate polyphenols- The preferred pomegranate product in terms of biological
induced upregulation of macrophage PON2. PON2 inhibits potency and consequent health benefits is the pomegranate
the formation and release of reactive oxygen species (ROS) juice (PJ) from the whole fruit. Since combination of
and reactive nitrogen species (RNS) in macrophages, thus antioxidants, as exist in PJ can provide a wider range of free
preventing macrophage oxidation and the oxidation of LDL radicals scavenging capacities than an individual antioxidant,
by the cells. clinical and nutritional studies in humans should be directed
towards the use of combinations of several types of dietary [3] B. Fuhrman and M. Aviram, “Flavonoids protect LDL from
antioxidants, including combinations of flavonoids together oxidation and attenuate atherosclerosis,” Current Opinion in
with other nutritional antioxidants, such as vitamin E and Lipidology, vol. 12, no. 1, pp. 41–48, 2001.
carotenoids. It is also important to use reliable biological [4] B. Fuhrman and M. Aviram, “Polyphenols and flavonoids
markers of oxidative stress and to identify populations protect LDL against atherogenic modifications,” in Handbook
of Antioxidants Biochemical, Nutritional and Clinical Aspects,
suitable for antioxidant treatment, as antioxidants treatment
E. Cadenas and L. Packer, Eds., vol. 16, p. 303, Marcel Dekker,
may be beneficial only in subjects which are under oxidative
NY, USA, 2nd edition, 2001.
stress. [5] M. Rosenblat, P. Belinky, J. Vaya et al., “Macrophage enrich-
ment with the isoflavan glabridin inhibits NADPH oxidase-
induced cell-mediated oxidation of low density lipoprotein.
Abbreviations A possible role for protein kinase C,” Journal of Biological
PJ: Pomegranate juice Chemistry, vol. 274, no. 20, pp. 13790–13799, 1999.
LDL: Low density lipoprotein [6] M. G. L. Hertog, D. Kromhout, C. Aravanis et al., “Flavonoid
HDL: High density lipoprotein intake and long-term risk of coronary heart disease and cancer
in the seven countries study,” Archives of Internal Medicine, vol.
PON1: Paraoxonase 1
155, no. 4, pp. 381–386, 1995.
PON2: Paraoxonase 2 [7] P. Knekt, J. Kumpulainen, R. Järvinen et al., “Flavonoid intake
CHD: Coronary heart disease and risk of chronic diseases,” American Journal of Clinical
CAS: Carotid artery stenosis Nutrition, vol. 76, no. 3, pp. 560–568, 2002.
E0 : Apolipoprotein E deficient [8] P. Knekt, R. Järvinen, A. Reunanen, and J. Maatela, “Flavonoid
CIMT: Carotid intima media thickness intake and coronary mortality in Finland: a cohort study,”
PSV: Peak systolic velocity British Medical Journal, vol. 312, no. 7029, pp. 478–481, 1996.
EDV: End diastolic velocity [9] S. Renaud and M. De Lorgeril, “Wine, alcohol, platelets, and
TEAC: Trolox equivalent antioxidant capacity the French paradox for coronary heart disease,” Lancet, vol.
ORAC: Oxygen radical absorbance capacity 339, no. 8808, pp. 1523–1526, 1992.
DPPH: 2,2-Diphenyl-1-picrylhydrazyl [10] M. Aviram, “Antioxidants in restenosis and atherosclerosis,”
Current Interventional Cardiology Reports, vol. 1, p. 66, 1999.
FRAP: Ferric reducing antioxidant power
[11] T. Hayek, B. Fuhrman, J. Vaya et al., “Reduced progression of
AAPH: 2.2 -Azobis, 2-amidinopropane atherosclerosis in apolipoprotein E-deficient mice following
hydrochloride consumption of red wine, or its polyphenols quercetin or
TAS: Total antioxidant status catechin, is associated with reduced susceptibility of LDL to
SH: Sulfhydryl oxidation and aggregation,” Arteriosclerosis, Thrombosis, and
LPDS: Lipoprotein deficient serum Vascular Biology, vol. 17, no. 11, pp. 2744–2752, 1997.
GAE: Gallic acid equivalents [12] M. Aviram and B. Fuhrman, “Wine flavonoids, LDL choles-
GA: Gallic acid terol oxidation and atherosclerosis,” in Wine: A Scientific
PON1KO: PON1 Knockout explorAtion, M. Sandler and R. M. Pinder, Eds., p. 140, Taylor
Ox-LDL: Oxidized LDL and Francis, London, UK, 2003.
MPM: Mouse peritoneal macrophages [13] B. Fuhrman, S. Buch, J. Vaya et al., “Licorice extract and its
NFκ-B: Nuclear factor kappa-B major polyphenol glabridin protect low-density lipoprotein
against lipid peroxidation: In vitro and ex vivo studies in
HMGCoA-3: Hydroxy-3-methylglutaryl coenzyme A
humans and in atherosclerotic apolipoprotein E-deficient
HMDM: Human monocytes derived mice,” American Journal of Clinical Nutrition, vol. 66, no. 2,
macrophages pp. 267–275, 1997.
DGAT1: Diacylglycerol acyltransferase 1 [14] M. Aviram, J. Vaya, and B. Fuhrman, “Licorice root flavonoid
TPT: Total pomegranate tannins antioxidants reduce LDL oxidation and attenuate cardiovascu-
PBP: Pomegranate liquid by-product lar diseases,” in Herbal Medicines: Molecular Basis of Biological
POMxp: Pomegranate fruit powder by-product Activity and Health, L. Packer, B. Halliwel, and C. N. Ong, Eds.,
RNS: Reactive nitrogen species chapter 27, p. 595, Marcel Dekker, NY, USA, 2004.
ROS: Reactive oxygen species [15] B. Fuhrman, N. Volkova, R. Coleman, and M. Aviram, “Grape
TBARS: Thiobarbituric acid reactive substances powder polyphenols attenuate atherosclerosis development in
DCFH- 2 , 7 : Dichlorofluorescin diacetate. apolipoprotein E deficient (E0 ) mice and reduce macrophage
atherogenicity,” Journal of Nutrition, vol. 135, no. 4, pp. 722–
728, 2005.
References [16] B. Fuhrman, M. Rosenblat, T. Hayek, R. Coleman, and M.
Aviram, “Ginger extract consumption reduces plasma choles-
[1] C. A. Rice-Evans, N. J. Miller, P. G. Bolwell, P. M. Bramley, terol, inhibits LDL oxidation and attenuates development of
and J. B. Pridham, “The relative antioxidant activities of plant- atherosclerosis in atherosclerotic, apolipoprotein E-deficient
derived polyphenolic flavonoids,” Free Radical Research, vol. mice,” Journal of Nutrition, vol. 130, no. 5, pp. 1124–1131,
22, no. 4, pp. 375–383, 1995. 2000.
[2] S. A. B. E. Van Acker, D. J. Van Den Berg, M. N. J. L. Tromp et [17] P. Langley, “Why a pomegranate?” British Medical Journal, vol.
al., “Structural aspects of antioxidant activity of flavonoids,” 321, no. 7269, pp. 1153–1154, 2000.
Free Radical Biology and Medicine, vol. 20, no. 3, pp. 331–342, [18] M. Aviram, “Polypyhenols from pomegranate juice, red wine
1996. and licorice root protect against lipids peroxidation and
attenuate cardiovascular diseases,” in Polyphenols, S. Martens, Sciences of the United States of America, vol. 102, no. 13, pp.
D. Treutter, and G. Forkmann, Eds., Proceedings of the 20th 4896–4901, 2005.
International Conference on Polyphenols, p. 158, Freising- [31] M. D. Sumner, M. Elliott-Eller, G. Weidner et al., “Effects
Weihenstephan, Germany, 2002. of pomegranate juice consumption on myocardial perfusion
[19] M. I. Gil, F. A. Tomas-Barberan, B. Hess-Pierce, D. M. Hol- in patients with coronary heart disease,” American Journal of
croft, and A. A. Kader, “Antioxidant activity of pomegranate Cardiology, vol. 96, no. 6, pp. 810–814, 2005.
juice and its relationship with phenolic composition and [32] M. Aviram, M. Rosenblat, D. Gaitini et al., “Pomegranate
processing,” Journal of Agricultural and Food Chemistry, vol. juice consumption for 3 years by patients with carotid artery
48, no. 10, pp. 4581–4589, 2000. stenosis reduces common carotid intima-media thickness,
[20] C. Ben Nasr, N. Ayed, and M. Metche, “Quantitative deter- blood pressure and LDL oxidation,” Clinical Nutrition, vol. 23,
mination of the polyphenolic content of pomegranate peel,” no. 3, pp. 423–433, 2004.
Zeitschrift fur Lebensmittel -Untersuchung und -Forschung, vol. [33] M. H. Davidson, K. C. Maki, M. R. Dicklin et al., “Effects of
203, no. 4, pp. 374–378, 1996. consumption of pomegranate juice on carotid intima-media
[21] M. Aviram, “Pomegranate juice as a major source for thickness in men and women at moderate risk for coronary
polyphenolic flavonoids and it is most potent antioxidant heart disease,” American Journal of Cardiology, vol. 104, no. 7,
against LDL oxidation and atherosclerosis,” in Proceedings of pp. 936–942, 2009.
the 11th Biennal Meeting of the Society for Free Radical Research [34] N. P. Seeram, M. Aviram, Y. Zhang et al., “Comparison of
International, Monduzzi, Ed., p. 523, MEDIMOND Inc, Paris, antioxidant potency of commonly consumed polyphenol-rich
France, July 2002. beverages in the United States,” Journal of Agricultural and
[22] M. Aviram, M. Aviram, B. Fuhrman, M. Rosenblat et Food Chemistry, vol. 56, no. 4, pp. 1415–1422, 2008.
al., “Pomegranate juice polyphenols decreases oxidative [35] M. Rosenblat, N. Volkova, J. Attias, R. Mahamid, and
stress, low-density lipoprotein atherogenic modifications and M. Aviram, “Consumption of polyphenolic-rich beverages
atherosclerosis,” Free Radical Research, vol. 36, supplement 1, (mostly pomegranate and black currant juices) by healthy
pp. 72–73, 2002. subjects for a short term increased serum antioxidant status,
[23] M. Aviram, L. Dornfeld, M. Kaplan et al., “Pomegranate and the serum’s ability to attenuate macrophage cholesterol
juice flavonoids inhibit low-density lipoprotein oxidation and accumulation,” Food and Function, vol. 1, no. 1, pp. 99–109,
cardiovascular diseases: studies in atherosclerotic mice and in 2010.
humans,” Drugs under Experimental and Clinical Research, vol. [36] M. Rosenblat, T. Hayek, and M. Aviram, “Anti-oxidative effects
28, no. 2-3, pp. 49–62, 2002. of pomegranate juice (PJ) consumption by diabetic patients
[24] B. Cerdá, R. Llorach, J. J. Cerón, J. C. Espı́n, and F. A. Tomás- on serum and on macrophages,” Atherosclerosis, vol. 187, no.
Barberán, “Evaluation of the bioavailability and metabolism 2, pp. 363–371, 2006.
in the rat of punicalagin, an antioxidant polyphenol from [37] W. Rock, M. Rosenblat, R. Miller-Lotan, A. P. Levy, M.
pomegranate juice,” European Journal of Nutrition, vol. 42, no. Elias, and M. Aviram, “Consumption of Wonderful variety
1, pp. 18–28, 2003. pomegranate juice and extract by diabetic patients increases
[25] B. Cerdá, J. J. Cerón, F. A. Tomás-Barberán, and J. C. paraoxonase 1 association with high-density lipoprotein and
Espı́n, “Repeated oral administration of high doses of the stimulates its catalytic activities,” Journal of Agricultural and
pomegranate ellagitannin punicalagin to rats for 37 days is not Food Chemistry, vol. 56, no. 18, pp. 8704–8713, 2008.
toxic,” Journal of Agricultural and Food Chemistry, vol. 51, no. [38] B. Fuhrman, N. Volkova, and M. Aviram, “Pomegranate juice
11, pp. 3493–3501, 2003. polyphenols increase recombinant paraoxonase-1 binding to
[26] N. P. Seeram, R. Lee, and D. Heber, “Bioavailability of ellagic high-density lipoprotein: studies in vitro and in diabetic
acid in human plasma after consumption of ellagitannins from patients,” Nutrition, vol. 26, no. 4, pp. 359–366, 2010.
pomegranate (Punica granatum L.) juice,” Clinica Chimica [39] M. Aviram, M. Rosenblat, S. Billecke et al., “Human serum
Acta, vol. 348, no. 1-2, pp. 63–68, 2004. paraoxonase (PON 1) is inactivated by oxidized low density
[27] A. Pérez-Vicente, A. Gil-Izquierdo, and C. Garcı́a-Viguera, lipoprotein and preserved by antioxidants,” Free Radical
“In vitro gastrointestinal digestion study of pomegranate juice Biology and Medicine, vol. 26, no. 7-8, pp. 892–904, 1999.
phenolic compounds, anthocyanins, and vitamin C,” Journal [40] J. Khateeb, A. Gantman, A. J. Kreitenberg, M. Aviram, and B.
of Agricultural and Food Chemistry, vol. 50, no. 8, pp. 2308– Fuhrman, “Paraoxonase 1 (PON1) expression in hepatocytes
2312, 2002. is upregulated by pomegranate polyphenols: a role for PPAR-γ
[28] M. Aviram, L. Dornfeld, M. Rosenblat et al., “Pomegranate pathway,” Atherosclerosis, vol. 208, no. 1, pp. 119–125, 2010.
juice consumption reduces oxidative stress, atherogenic mod- [41] M. Aviram, “Review of human studies on oxidative damage
ifications to LDL, and platelet aggregation: studies in humans and antioxidant protection related to cardiovascular diseases,”
and in atherosclerotic apolipoprotein E-deficient mice,” Amer- Free Radical Research, vol. 33, pp. S85–S97, 2000.
ican Journal of Clinical Nutrition, vol. 71, no. 5, pp. 1062–1076,
[42] J. A. Berliner, M. Navab, A. M. Fogelman et al., “Atherosclero-
2000.
sis: basic mechanisms: oxidation, inflammation, and genetics,”
[29] M. Kaplan, T. Hayek, A. Raz et al., “Pomegranate juice
Circulation, vol. 91, no. 9, pp. 2488–2496, 1995.
supplementation to atherosclerotic mice reduces macrophage
lipid peroxidation, cellular cholesterol accumulation and [43] B. Fuhrman, J. Oiknine, and M. Aviram, “Iron induces
development of atherosclerosis,” Journal of Nutrition, vol. 131, lipid peroxidation in cultured macrophages, increases their
no. 8, pp. 2082–2089, 2001. ability to oxidatively modify LDL, and affects their secretory
[30] F. De Nigris, S. Williams-Ignarro, L. O. Lerman et al., properties,” Atherosclerosis, vol. 111, no. 1, pp. 65–78, 1994.
“Beneficial effects of pomegranate juice on oxidation-sensitive [44] B. Fuhrman, O. Judith, S. Keidar, L. Ben-Yaish, M. Kaplan,
genes and endothelial nitric oxide synthase activity at sites of and M. Aviram, “Increased uptake of LDL by oxidized
perturbed shear stress,” Proceedings of the National Academy of macrophages is the result of an initial enhanced LDL receptor
activity and of a further progressive oxidation of LDL,” Free [58] D. Steinberg, “Low density lipoprotein oxidation and its
Radical Biology and Medicine, vol. 23, no. 1, pp. 34–46, 1997. pathobiological significance,” Journal of Biological Chemistry,
[45] B. Fuhrman, N. Volkova, and M. Aviram, “Oxidative stress vol. 272, no. 34, pp. 20963–20966, 1997.
increases the expression of the CD36 scavenger receptor and [59] J. L. Goldstein and M. S. Brown, “Regulation of the meval-
the cellular uptake of oxidized low-density lipoprotein in onate pathway,” Nature, vol. 343, no. 6257, pp. 425–430, 1990.
macrophages from atherosclerotic mice: protective role of [60] M. S. Brown and J. L. Goldstein, “A receptor-mediated
antioxidants and of paraoxonase,” Atherosclerosis, vol. 161, no. pathway for cholesterol homeostasis,” Science, vol. 232, no.
2, pp. 307–316, 2002. 4746, pp. 34–47, 1986.
[61] M. Krieger, “The best of cholesterols, the worst of cholesterols:
[46] O. Rozenberg, A. Howell, and M. Aviram, “Pomegranate juice
a tale of two receptors,” Proceedings of the National Academy
sugar fraction reduces macrophage oxidative state, whereas
of Sciences of the United States of America, vol. 95, no. 8, pp.
white grape juice sugar fraction increases it,” Atherosclerosis,
4077–4080, 1998.
vol. 188, no. 1, pp. 68–76, 2006.
[62] B. Fuhrman, N. Volkova, and M. Aviram, “Pomegranate juice
[47] B. B. Aggarwal and S. Shishodia, “Suppression of the nuclear inhibits oxidized LDL uptake and cholesterol biosynthesis in
factor-κB activation pathway by spice-derived phytochemicals: macrophages,” Journal of Nutritional Biochemistry, vol. 16, no.
reasoning for seasoning,” Annals of the New York Academy of 9, pp. 570–576, 2005.
Sciences, vol. 1030, pp. 434–441, 2004. [63] P. Cullen, “Evidence that triglycerides are an independent
[48] S. Y. Schubert, I. Neeman, and N. Resnick, “A novel mecha- coronary heart disease risk factor,” American Journal of
nism for the inhibition of NF-kappaB activation in vascular Cardiology, vol. 86, no. 9, pp. 943–949, 2000.
endothelial cells by natural antioxidants.,” The FASEB Journal, [64] B. Lundberg, “Chemical composition and physical state of
vol. 16, no. 14, pp. 1931–1933, 2002. lipid deposits in atherosclerosis,” Atherosclerosis, vol. 56, no.
[49] S. Y. Schubert, E. P. Lansky, and I. Neeman, “Antioxidant and 1, pp. 93–110, 1985.
eicosanoid enzyme inhibition properties of pomegranate seed [65] A. Aronis, Z. Madar, and O. Tirosh, “Mechanism underlying
oil and fermented juice flavonoids,” Journal of Ethnopharma- oxidative stress-mediated lipotoxicity: Exposure of J774.2
cology, vol. 66, no. 1, pp. 11–17, 1999. macrophages to triacylglycerols facilitates mitochondrial reac-
[50] C. J. Ng, D. J. Wadleigh, A. Gangopadhyay et al., “Paraox- tive oxygen species production and cellular necrosis,” Free
onase 2 is aubiquitously expressed protein with antioxidant Radical Biology and Medicine, vol. 38, no. 9, pp. 1221–1230,
properties and is capable of preventing cell-mediated oxidative 2005.
modification of low density lipoprotein,” Journal of Biological [66] M. Rosenblat and M. Aviram, “Pomegranate juice protects
Chemistry, vol. 276, no. 48, pp. 44444–44449, 2001. macrophages from triglyceride accumulation: inhibitory effect
[51] M. Rosenblat, D. Draganov, C. E. Watson, C. L. Bisgaier, B. on DGAT1 activity and on triglyceride biosynthesis,” Annals of
N. La Du, and M. Aviram, “Mouse macrophage paraoxonase 2 Nutrition and Metabolism, vol. 58, no. 1, pp. 1–9, 2011.
activity is increased whereas cellular paraoxonase 3 activity is [67] R. Tzulker, I. Glazer, I. Bar-Ilan, D. Holland, M. Aviram,
and R. Amir, “Antioxidant activity, polyphenol content, and
decreased under oxidative stress,” Arteriosclerosis, Thrombosis,
and Vascular Biology, vol. 23, no. 3, pp. 468–474, 2003. related compounds in different fruit juices and homogenates
[52] C. J. Ng, N. Bourquard, V. Grijalva et al., “Paraoxonase-2 prepared from 29 different pomegranate accessions,” Journal
deficiency aggravates atherosclerosis in mice despite lower of Agricultural and Food Chemistry, vol. 55, no. 23, pp. 9559–
apolipoprotein-B-containing lipoproteins: anti-atherogenic 9570, 2007.
role for paraoxonase-2,” Journal of Biological Chemistry, vol. [68] N. Seeram, R. Lee, M. Hardy, and D. Heber, “Rapid large
281, no. 40, pp. 29491–29500, 2006. scale purification of ellagitannins from pomegranate husk, a
[53] M. Rosenblat, R. Coleman, S. T. Reddy, and M. Aviram, by-product of the commercial juice industry,” Separation and
“Paraoxonase 2 attenuates macrophage triglyceride accumula- Purification Technology, vol. 41, no. 1, pp. 49–55, 2005.
tion via inhibition of diacylglycerol acyltransferase 1,” Journal [69] M. Rosenblat, N. Volkova, R. Coleman, and M. Aviram,
of Lipid Research, vol. 50, no. 5, pp. 870–879, 2009. “Pomegranate byproduct administration to apolipoprotein E-
[54] E. Meilin, M. Aviram, and T. Hayek, “Paraoxonase 2 (PON2) deficient mice attenuates atherosclerosis development as a
decreases high glucose-induced macrophage triglycerides result of decreased macrophage oxidative stress and reduced
cellular uptake of oxidized low-density lipoprotein,” Journal of
(TG) accumulation, via inhibition of NADPH-oxidase and
DGAT1 activity: studies in PON2-deficient mice,” Atheroscle- Agricultural and Food Chemistry, vol. 54, no. 5, pp. 1928–1935,
rosis, vol. 208, no. 2, pp. 390–395, 2010. 2006.
[55] M. Shiner, B. Fuhrman, and M. Aviram, “Macrophage paraox- [70] M. Aviram, N. Volkova, R. Coleman et al., “Pomegranate
onase 2 (PON2) expression is up-regulated by pomegranate phenolics from the peels, arils, and flowers are antiathero-
juice phenolic anti-oxidants via PPARγ and AP-1 pathway genic: studies in vivo in atherosclerotic apolipoprotein E-
activation,” Atherosclerosis, vol. 195, no. 2, pp. 313–321, 2007. deficient (E0 ) mice and in vitro in cultured macrophages and
lipoproteins,” Journal of Agricultural and Food Chemistry, vol.
[56] M. Rosenblat, N. Volkova, and M. Aviram, “Pomegranate
56, no. 3, pp. 1148–1157, 2008.
juice (PJ) consumption antioxidative properties on mouse
macrophages, but not PJ beneficial effects on macrophage
cholesterol and triglyceride metabolism, are mediated via PJ-
induced stimulation of macrophage PON2,” Atherosclerosis,
vol. 212, no. 1, pp. 86–92, 2010.
[57] M. Aviram, “Interaction of oxidized low density lipoprotein
with macrophages in atherosclerosis, and the antiatherogenic-
ity of antioxidants,” European Journal of Clinical Chemistry and
Clinical Biochemistry, vol. 34, no. 8, pp. 599–608, 1996.

Granada

Загружено:

Сведения о документе

Авторское право

Доступные форматы

Поделиться этим документом

Поделиться или встроить документ

Параметры публикации

Этот документ был вам полезен?

Это неприемлемый материал?

Авторское право:

Доступные форматы

Granada

Загружено:

Авторское право:

Доступные форматы

Evidence-Based Complementary and Alternative Medicine

Pomegranate: Its Health and

Pomegranate: Its Health and

Guest Editors: Ari M. Mackler, David Heber,

A Review on Antihyperglycemic and Antihepatoprotective Activity of Eco-Friendly Punica granatum

Preventive and Prophylactic Mechanisms of Action of Pomegranate Bioactive Constituents,

Pomegranate Juice Metabolites, Ellagic Acid and Urolithin A, Synergistically Inhibit

Pomegranate Bioactive Constituents Suppress Cell Proliferation and Induce Apoptosis in an

A Review on the Anti-Inflammatory Activity of Pomegranate in the Gastrointestinal Tract,

Ari M. Mackler,1 David Heber,2 and Edwin L. Cooper3

Correspondence should be addressed to Edwin L. Cooper; ecam@roll.com

Received 9 September 2013; Accepted 9 September 2013

the 𝛽-Catenin Signaling Pathway. From a clinical perspective,

Susan A. Ropacki,1 Sapna M. Patel,2 and Richard E. Hartman2

Correspondence should be addressed to Richard E. Hartman; behavioralneuroscience@gmail.com

Received 28 December 2012; Revised 18 July 2013; Accepted 5 August 2013

Academic Editor: Ari M. Mackler

1. Introduction potentially neurotoxic protein linked to Alzheimer’s disease

All Pomegranate Placebo Signif.

Average performance by domain Working Immediate Delayed Retention

reduces systolic blood pressure,” Atherosclerosis, vol. 158, no. 1,

Susan Y. Bookheimer,1,2 Brian A. Renner,1,2 Arne Ekstrom,1,2 Zhaoping Li,1,2 Susanne M.

Correspondence should be addressed to Susan Y. Bookheimer; sbook@ucla.edu

Received 17 March 2013; Accepted 14 May 2013

Academic Editor: Edwin L. Cooper

1. Introduction [7]. Epidemiological studies have suggested a link between

Plasma TEAC change (day 4 to day 28)

80 Consistent long-term retrieval 100 Buschke total recall score

MNI coordinates (mm)

x = −28 x = −12 x=2

Verbal fMRI- Spatial fMRI-

[57] B. R. Bitner, D. C. Marcano, J. M. Berlin et al., “Antioxidant

Fatemeh Forouzanfar,1,2 Amir Afkhami Goli,2 Elham Asadpour,1

Correspondence should be addressed to Hamid Reza Sadeghnia; sadeghniahr@mums.ac.ir

Received 2 December 2012; Revised 1 May 2013; Accepted 4 June 2013

Academic Editor: Edwin L. Cooper

1. Introduction deprivation (SGD) neuronal damage which could character-

∗∗∗ ∗∗∗ ∗∗∗ ∗∗∗ ∗∗∗

Tail DNA (%)

damage, suggesting its antiapoptogenic properties. But fur-

Sushil Kumar Middha,1 Talambedu Usha,2 and Veena Pande1

Correspondence should be addressed to Veena Pande; veena kumaun@yahoo.co.in

Received 28 December 2012; Revised 25 March 2013; Accepted 25 April 2013

Academic Editor: Edwin L. Cooper

1. Introduction containing sacs packed with a fleshy, juicy, red or whitish

Ultraviolet Infant brain

Figure 1: Principal therapeutic effects of pomegranate peel.

Table 3: Active constituents and their biological activity of Punica peel.

Compound Bioactivity Reference

Luteolin Epicatechin (EC) Epigallocatechin (EGC) Epicatechin-3-gallate (ECG)

Table 4: Amount of EA in different varieties of peel [33].

S. no Variety Thickness Antioxidant activity Amount of ellagic acid

Table 5: Overview of antioxidant pomegranate studies.

Assays Effect Reference

Nature of peel Statistically

the impairment in insulin action in the conversion of glucose Conflict of Interest

Nils Kroeger,1,2 A. S. Belldegrun,1 and A. J. Pantuck1

Correspondence should be addressed to A. J. Pantuck; apantuck@mednet.ucla.edu

Received 23 May 2013; Accepted 23 May 2013

The authors’ names were incorrectly listed as Kroeger N.,

Juan Carlos Espín, Mar Larrosa, María Teresa García-Conesa,

Correspondence should be addressed to Francisco Tomás-Barberán; fatomas@cebas.csic.es

Received 4 January 2013; Revised 15 April 2013; Accepted 17 April 2013

Academic Editor: David Heber