[Downloaded free from http://www.ijpmonline.org on Thursday, June 27, 2019, IP: 49.205.38.

190]

CagA and VacA genes of Helicobacter pylori and their

Original Article

clinical relevance
Lavanya Jeyamani, Jayalakshmi Jayarajan1, Venkatakrishnan Leelakrishnan1, Mukundan Swaminathan1
Department of Microbiology, Karpagam Faculty of Medical Sciences and Research, 1Department of Microbiology and
Gastroenterology, PSG Institute of Medical Science and Research, Coimbatore, Tamil Nadu, India

Address for correspondence:

Dr. Lavanya Jeyamani, 197/13, Asiad Colony, 7th Avenue, Annanagar West, Chennai ‑ 600 101, Tamil Nadu, India.
E‑mail: jlavanya152@gmail.com

ABSTRACT Access this article online

Website: www.ijpmonline.org
Context: Helicobacter pylori is associated with the development of a variety PMID: xxxxxxxxx (when available)
of gastroduodenal diseases which varies with ethnicity and the type of strains DOI: 10.4103/IJPM.IJPM_234_17
that infect the population. Aims: This study aims to evaluate the prevalence of Quick Response Code:
H. pylori cagA and vacA genotypes in our region and to determine their relationship
to the severity of the lesions that they cause. Settings and Design: This study
was an observational cross‑sectional study. Subjects and Methods: DNA
was extracted from 165 gastric biopsies from patients evaluated for dyspepsia.
PCR was used to detect cagA and vacA (s1, s2, m1, m2) genes of H. pylori.
Statistical analysis of associations was performed between endoscopy findings
and virulence genes. Statistical Analysis Used: Pearson Chi‑square test and
Fischer’s exact test. Results: The prevalence of H. pylori infection was 37% and
the dominant genotypes was vacA s1 cagA‑positive strain (54.1%) in this study.
The vacAs1 subtype was found in all patients with peptic ulcer disease (PUD). the severity of the gastric lesions produced
The entire normal study group had VacA s2 variant only. This clearly shows that in patients in Coimbatore region (Western
vacA s1 is a significant virulence marker and patients harboring s1 strains are Tamil Nadu, India).
more prone to develop ulcers (P = 0.007). There was a significant association
of cagA with s1 strain rather than s2. Variation in VacA m genotype did not
SUBJECTS AND METHODS
seem to have any association with disease status. There was a statistically
significant association between the presence of cagA gene and PUD rather than
the nonulcer dyspepsia (P = 0.027). Conclusion: The predominant genotype in This observational cross‑sectional study
our population was cagA positive vacA s1, which was found to be significantly was conducted during the period from May
associated with patients with gastric diseases, especially PUD. VacA s1 can 2014 to June 2015 in the Department of
serve as a single best virulence marker of the disease manifestation. Microbiology, after obtaining institutional
Human ethical committee’s approval.
KEY WORDS: CagA, Helicobacter pylori, vacA, virulence factor Gastric biopsy samples were collected from
165 patients with gastroduodenal diseases
by upper gastrointestinal endoscopy, after
INTRODUCTION obtaining their written informed consent
to participate in the study. Patients who
Ever since the discovery of Helicobacter pylori, the scientific facts associated with it have had received antibiotics within the past
undergone a drastic change over a period of time. The role of this bacterium either as a
pathogen or a commensal still remains centered around important factors – lifestyle of This is an open access article distributed
the patient, food habits in the region, and virulence of the strain.[1,2] H. pylori has two under the terms of the Creative Commons
Attribution‑NonCommercial‑ShareAlike 3.0
important cytotoxin – vacA and cagA. VacA is a polymorphic gene showing variance License, which allows others to remix, tweak,
in s and m region – s1/s2 and m1/m2. Among this, s2 is not known to be associated and build upon the work non‑commercially,
with virulence. It is widely studied in the western countries that the presence cagA as long as the author is credited and the new
creations are licensed under the identical terms.
and VacA s1 genes contribute to severe manifestation of H. pylori infection, whereas in
Asian population, studied so far, cagA bore no significance. One exception was Japanese For reprints contact: reprints@medknow.com
population where it was associated with gastric cancer.[2] There is a wide variation in the
prevalence of these virulence factors and their association with clinical manifestations How to cite this article: Jeyamani L,
in different ethnic groups.[3‑8] In this scenario, very few studies have been carried out Jayarajan J, Leelakrishnan V, Swaminathan M.
CagA and VacA genes of Helicobacter pylori and
on virulence factors in Indian population. Hence, the current study was undertaken to their clinical relevance. Indian J Pathol Microbiol
evaluate the prevalence of cagA and vacA genotypes of H. pylori and their relationship to 2018;61:66-9.

66 © 2018 Indian Journal of Pathology and Microbiology | Published by Wolters Kluwer - Medknow
[Downloaded free from http://www.ijpmonline.org on Thursday, June 27, 2019, IP: 49.205.38.190]

Jeyamani, et al.: CagA and VacA genes of H. pylori and their clinical relevance

1 month period and antisecretory drugs within the past 2 weeks Table 1: List of the primers used in the study
before endoscopy were excluded. Endoscopic findings were noted Gene Gene primer sequence (5-3’)* Amplicon Reference
down. One biopsy tissue was obtained aseptically preferably from size (bp)
the site of lesion or gastric antrum. The sample was transported to glmM F‑AAGCTTTTAGGGGTGTTAGGGGTTT 136 [9]
R‑CGCAATGCTTCAATTCTAAATCTTG
the molecular laboratory in sterile freshly prepared 70% ethanol
VacA s1/s2 VAI‑F ATGGAAATACAACAAACACAC 259/286 [10,11]
and stored under –80°C for further processing. DNA extraction VAI‑R CTGCTTGAATGCGCCAAA
was done using QIAmp DNA MINI extraction kit as per the VacA m1/m2 VAG‑F CAATCTGTCCAATCAAGCGAG 567/642 [12,13]
manufacturers’ instruction (QIAGEN, Germany). VAG‑R GCGTCAAAATAATTCCAAGG
Cag A cag5c‑F GTTGATAACGCTGTCGCTTC 350 [10]
The presence of H. pylori in the tissue was identified by cag3c‑R GGGTTGTATGATATTTTCCAT AA
conventional PCR for glmM gene (housekeeping gene). All *Obtained from Sigma Aldrich, Mumbai

the positive samples were further tested for the presence of

cagA and variance of vacA genes by PCR for individual genes.
The respective primers and amplicon sizes are mentioned in
Table 1.[9‑13] A single strain harbors any one of the variants in each
gene, for example, VacA s1/m1, VacA s1/m2, VacA s2/m1, or VacA
s2/m2. All PCRs were performed in AB StepOne‑Thermocycler.
Single reaction mixture (25 μl) contained 4 μl of DNA suspension,
12.5 μL of Mastermix (Sigma‑Aldrich, Mumbai), and 1 μl of
each primer depending on the gene amplified [Sigma‑Aldrich,
Mumbai] (1 μM of each primer for glmM gene or 25 pmol of
each primer for VacA genes or 10pmol of each primer for cagA
gene). The remaining volume was adjusted with PCR grade water.
Positive and negative controls were set up with each batch of tests
run. H. pylori ATCC 700392 (strain 26695) was used as positive
control for glmM, cagA, vacA s1 m1 the genes. Negative controls
were run with PCR grade sterile water in place of template. PCR
condition for glmM gene was denaturation at 95°C for 10 min,
35 cycles of 95°C for 30 s, annealing temperature 60°C for 45 s
and extension at 72°C for 1 min and a final elongation at 72°C
for 5 min.[9] PCR condition for cagA And variants of vacA genes
were denaturation at 94°C for 3 min, 35 cycles of the following
condition –94°C for 1 min, annealing temperature of 55°C for
1 min and extension at 72°C for 1 min, and a final elongation at
72°C for 10 min. [10‑13] The amplified product is visualized by use
of agarose gel electrophoresis. Images of the gel were captured
by gel doc and interpreted.
Statistical analysis was performed using SPSS software (Statistical
Product and Services Solutions, version 17, SPSS Inc., Chicago,
IL, USA) to analyze data. Association between gastric lesions and
genotypes was tested independently using Pearson Chi‑square test
and Fischer’s exact test. All Chi‑square test and Fischer’s exact
test results with P < 0.05 were considered statistically significant.
RESULTS
Among the dyspeptic patients, 107 (65%) were male and 58 (35%)
were female. Figure 1 shows the distribution of cases according
to their endoscopy finding. Out of 165 patients included in this
study, 86% (142) had significant endoscopic findings – gastritis,
gastroduodenitis, peptic ulcer, etc., Out of 165 patients, 61 (37%)
had H. pylori infection confirmed by glmM PCR. On analysis
of virulence genes, cagA positivity was 57.4% in our study.
Table 2 shows the percentage of cagA positivity among different
Indian Journal of Pathology and Microbiology ¦ Volume 61 ¦ Issue 1 ¦ January-March 2018
Table 2: Percentage of CagA positivity among infected cases
Endoscopic findings PCR positive for glmM gene CagA positive (%)
Gastritis 35 16 (45.7)
Gastroduodenitis 6 5 (83.3)
Gastric ulcer 11 10 (90.9)
Duodenal ulcer 3 2 (66.7)
Others 1 0
Carcinoma stomach 0 0
Normal study 5 2 (40)
Total 61 35 (57.4)
PCR: Polymerase chain reaction
pathological conditions. There was a statistically significant
association between the presence of cagA gene and peptic ulcer
disease (PUD) rather than the nonulcer dyspepsia (P = 0.027, odds
ratio was 6 with 95% confidence interval [CI], range 1.19–30.1)
as shown in Table 3. Although cagA positivity was high among
gastric ulcer (90.9%) and gastroduodenitis (83.3%) patients
compared to patients with normal endoscopic findings, statistical
analysis by Fisher’s exact test found no significance (P = 0.642,
odds ratio 2.15 with 95% CI, range 0.33–13.92) attached to the
cagA status and disease manifestation.
Among 61 strains distribution of vacA s and m polymorphs were
as follows – 44 vacA s1 and 17 vacA s2, 31 vacA m1 and 30 vacA
m2. Table 4 shows that all 44 vacA s1 subtype identified were
found only in patients with pathological findings, whereas the s2
subtype was found in both normal as well as diseased patients.
In the light of clinical manifestations, among the 35 patients
who had gastritis s1 m1 and s1 m2 subtypes predominated with
34.3% each. Gastric ulcer and gastroduodenitis patients shared a
similar picture where all the strains were either s1 m1 or s1 m2
subtypes with no vacA s2 subtype. All 3 duodenal ulcer patients
had harbored only vacA s1 m1 subtype. Statistical analysis was
done using Pearson Chi‑square test, and there was a significant
association between the vacA subtypes and the above‑mentioned
endoscopy findings (P = 0.007).
Co‑occurrence of cagA and vacA analysis showed that 33 (75%) of
the 44 vacAs1 isolates were cagA positive, while only 2 (11.8%)
of the 17 vacAs2 isolates were cagA positive.
Among 30 nonulcer dyspepsia patients with vacA s1 subtype,
21 (70%) were cagA positive. Among 14 PUD patients with vacA
67
[Downloaded free from http://www.ijpmonline.org on Thursday, June 27, 2019, IP: 49.205.38.190]
Jeyamani, et al.: CagA and VacA genes of H. pylori and their clinical relevance
Figure 1: Distribution of study population with respect to endoscopic
findings
Table 3: CagA status among peptic ulcer disease and nonulcer
dyspepsia
Disease cagA positive (%) cagA negative (%)
manifestation
NUD 21 (50) 21 (50)
PUD 12 (85) 2 (14.3)
Total 33 23
NUD: Nonulcer dyspepsia; PUD: Peptic ulcer disease
s1 subtype, 12 (85.7%) were cagA positive. Difference in cagA
status had no statistically significant association with the disease
manifestation in vacA s1‑positive patients. Figure 2 shows the
gel doc images of the genes studied.
DISCUSSION
The prevalence of H. pylori infection among this study
population was 37%. Although WHO states that the prevalence
is 70%–90% among Asian population, it is known to vary widely
across our country.[14] H. pylori infection was maximum in
patients with duodenal ulcer (100%) and gastric ulcer (78.6%),
followed by gastroduodenitis (54.5%). H. pylori infection had a
significant association with PUD rather than nonulcer dyspepsia
(P = 0.001, odds ratio 8 with 95% CI, range 2.2–29.8). On contrary
to the studies from Eastern Asia,[15] all the 3 carcinoma stomach
patients included in this study did not have H. pylori in their
gastric mucosa. Only 21.7% of the study group with normal
endoscopic finding had H. pylori in their gastric mucosa and all
of them were vacA s2 strains, clearly showing that vacA s2 strains
are far less virulent than s1 strains.
Studies show that H. pylori‑induced gastroduodenal diseases
varied in severity and manifestations depending on the strain
virulence. In this study, we have analyzed cagA and vacA variant
status of bacteria directly from the tissue biopsy.
Prevalence of vacAs1 variant (72%) was greater compared
to s2 variant (28%). A statistically significant association
68 Indian Journal of Pathology and
Figure 2: Gel-doc images of the genes analyzed in the study
was found between the presence of vacA s1 and disease
Total P (χ2) manifestation (P < 0.01). Nonulcer dyspepsia patients showed a
higher prevalence of vacA s1 compared to s2, and this association
42 0.027
was significant. None of the vacA s1 strains was found in cases
14
56
with normal endoscopic findings. All the strains from duodenal
ulcer cases were vacAs1 m1 type whereas gastric ulcer patients
had 63.6% and 36.4% of s1 m1 and s1 m2, respectively. VacAs1
subtype was found in all patients with PUD.
The entire normal study group had VacA s2 variant only.
Research evidences show that vacA s2 strain is not an efficient
toxin producer. None of the ulcer disease and gastroduodenitis
patients had s2 variants. Twelve vacA s2 strains were found in
patients with gastritis. This could be due to confounding factors
which were not included in this study. This clearly shows that
vacA s1 is a significant virulence marker for development of
ulcers and s2 is a benign marker with a questionable need for
eradication therapy.
On analysis of virulence genes, cagA positivity was 57.4%
in our study. This is in accordance with the global data
(60%–70%). There was a statistically significant association
between presence of cagA gene and PUD rather than the
nonulcer dyspepsia (P = 0.027). Although cagA positivity
was high among patients with gastric ulcer (90.9%) and
gastroduodenitis (83.3%) compared to those with normal
endoscopic findings, statistical analysis by Fisher’s exact test
found no significance (P = 0.642) attached to the cagA status
and disease manifestation.
When the co‑occurrence of cagA and vacA subtypes was studied,
we found that cagA was more often associated with s1 strain
rather than s2. Percentage of vacA s1 cagA positive strain was
54.1 in Coimbatore region. On analysis, this co‑occurrence of
vacA s1 cagA positivity had no influence on the diseases. VacA
m subtype was equally distributed among s1 variants and did
not have any significance.
Microbiology ¦ Volume 61 ¦ Issue 1 ¦ January-March 2018
[Downloaded free from http://www.ijpmonline.org on Thursday, June 27, 2019, IP: 49.205.38.190]

Jeyamani, et al.: CagA and VacA genes of H. pylori and their clinical relevance

Table 4: Correlation between endoscopy findings and vacA subtype

Endoscopy findings VacA s1 m1, n (%) VacA s1 m2, n (%) VacA s2 m1, n (%) VacA s2 m2, n (%) P
Gastritis 12 (34.3) 12 (34.3) 5 (14.3) 6 (17.1) 0.015
Gastroduodenitis 3 (50) 3 (50) 0 0 0.012
Gastric ulcer 7 (63.6) 4 (36.4) 0 0 0.001
Duodenal ulcer 3 (100) 0 0 0 0.018
Others 0 0 0 1 (100) ‑
Carcinoma stomach 0 0 0 0 ‑
Normal study 0 0 1 (20) 4 (80) ‑
Total (%) 25 (41) 19 (31) 6 (9.8) 11 (18.2) 0.007

All infected patients were treated with anti‑H. pylori therapy and
clinically cured. However, long‑term follow‑up of the infected
cases could not be carried out due to shorter time period of the
study.
CONCLUSION
These findings show that the vacA s1/s2 genotype has an
important role in the clinical outcomes. Hence, this genotype
can be used to identify patients who are at a higher risk for
gastroduodenal disease and those who may not require treatment.
Patients infected with the strain carrying vacA s1 genotype should
be checked for eradication status on completion of antibiotic
treatment, to prevent the development of PUD in future.
Acknowledgment
We gratefully acknowledge the financial support offered by
Research committee, PSGIMSR. We are thankful to Head of the
department of Microbiology for his support. We also thank the
patients who have participated in this study.
Financial support and sponsorship
This study was financially supported by PSGIMSR through PSG
Prime Funds.
Conflicts of interest
There are no conflicts of interest.
REFERENCES
1. Alfizah H, Rukman AH, Norazah A, Hamizah R, Ramelah M. Ethnicity
association of Helicobacter pylori virulence genotype and metronidazole
susceptibility. World J Gastroenterol 2013;19:1283‑91.
2. Doosti A, Ghasemi‑Dehkordi P. Helicobacter pylori vac A genotypes
in shahrekordian (Iran) H. pylori‑positive patients. Res J Biol Sci
2009;4:11‑5.
3. Yakoob J, Abid S, Abbas Z, Jafri W, Ahmad Z, Ahmed R, et al.
Distribution of Helicobacter pylori virulence markers in patients with
gastroduodenal diseases in Pakistan. BMC Gastroenterol 2009;9:87.
4. Hussein NR, Mohammadi M, Talebkhan Y, Doraghi M, Letley DP,
Muhammad MK, et al. Differences in virulence markers between
Helicobacter pylori strains from Iraq and those from Iran: Potential
importance of regional differences in H. pylori‑associated disease.
J Clin Microbiol 2008;46:1774‑9.
5. Erdoğdu C, Saribaş Z, Akyön Yilmaz Y. Detection of cagA and vacA
genotypes of Helicobacter pylori isolates from a university hospital in
Ankara region, Turkey. Turk J Med Sci 2014;44:126‑32.
6. Farshad S, Alborzi A, Abbasian A. Association of H. pylori virulence
genes CagA, VacA and UreAB with ulcer and nonulcer diseases in Iranian
population. Pak J Biol Sci 2007;10:1185‑9.
7. Estrada UN, Jimenez AC, Velez Velez LM, Cruz MC, Romero AM,
Hernandez JF, et al. Prevalence of Helicobacter pylori cagA and
vacA genotypes in a population from Northeastern Mexico with
chronic gastritis and intestinal metaplasia. Afr J Microbiol Res
2013;7:1409‑14.
8. Udhayakumar G, Senthilkumar C, Jayanthi V, Devaraj N, Devaraj H.
Helicobacter pylori detection and genotyping in gastric biopsy specimens
from Chennai patients (India). Can J Microbiol 2009;55:126‑32.
9. Refaay HA, Nouh HH. Evaluation of different methods for detection of
Helicobacter pylori infection in dyspeptic patients. Egypt J Med Microbiol
2006;15:751‑62.
10. Chattopadhyay S, Patra R, Ramamurthy T, Chowdhury A, Santra A,
Dhali GK, et al. Multiplex PCR assay for rapid detection and genotyping
of Helicobacter pylori directly from biopsy specimens. J Clin Microbiol
2004;42:2821‑4.
11. Atherton JC, Cao P, Peek RM Jr., Tummuru MK, Blaser MJ, Cover TL,
et al. Mosaicism in vacuolating cytotoxin alleles of Helicobacter pylori.
Association of specific vacA types with cytotoxin production and peptic
ulceration. J Biol Chem 1995;270:17771‑7.
12. Goodwin CS, Armstrong JA, Chivers T. Transfer of Campylobacter
pylori and Campylobacter mustelae to Helicobacter gen. nov. and H. pylori
comb. nov. and Helicobacter mustelae comb. nov. Respectively. Int J Syst
Bacterial 1989;39:397‑405.
13. Atherton JC, Cover TL, Twells RJ, Morales MR, Hawkey CJ, Blaser MJ,
et al. Simple and accurate PCR‑based system for typing vacuolating
cytotoxin alleles of Helicobacter pylori. J Clin Microbiol 1999;37:2979‑82.
14. Hunt RH, Xiao SD, Megraud F, L eon‑Barua R, Bazzoli F,
van der Merwe S, et al. World Gastroenterology Organisation Global
Guidelines Helicobacter pylori in Developing Countries; August, 2010.
Available from: http://www.worldgastroenterology.org/guidelines/
global‑guidelines/helicobacter‑pylori‑in‑developing‑countries/
helicobacter‑pylori‑in‑developing‑countries‑english. [Last accessed
on 2015 May 15].
15. Xue FB, Xu YY, Wan Y, Pan BR, Ren J, Fan DM, et al. Association of
H. pylori infection with gastric carcinoma: A Meta analysis. World J
Gastroenterol 2001;7:801‑4.

Indian Journal of Pathology and Microbiology ¦ Volume 61 ¦ Issue 1 ¦ January-March 2018 69