Biology Book 1 & 2-1 PDF

BOOK 1 MCQS
UNIT NO. (01) D. Turgor Force
7. If the eyepiece of a microscope is marked 10X

1. The branch of biology, which deals with the and the high power objective is marked 44X,
life process, and function of processes is the total magnification is:
known as: A. 100
A. Physiology B. 144
B. Pathology C. 440
C. Histology D. 1044
D. Evolution
8. Which one of the following areas of biological
study could produce evidence to prove
2. Discovered the microscopic creature under conclusively that two organisms belong to
microscope in the red blood cells of malarial the same species?
patient: A. Anatomy
A. Ronald Ross B. Embryology
B. Laveran C. Genetics
C. Grassy D. Physiology
D. A.F.A king
9. _________ is a science of exception:
A. Biology
3. Physical basis of life is: B. Zoology
A. Nucleotide and proteins C. Botany
B. Nucleus D. Pathology
C. Cell
D. Protoplasm 10. The branch of biology, which deals with the
continuous adaptation of living organisms to
their environment, is known as:
4. The life was evolved first: A. Adaptation
A. On earth B. Evolution
B. In water C. Similarity
C. In sky D. Genetics
D. On the hill
11. Palaeobotany is study of:
5. The ________ structure was first proposed by A. Living plants
Robertson: B. Dead plants
A. Cellulo-protein C. Fossil plants
B. Star protein D. Fossil animas
C. Cylo protein
D. Lipo protein 12. The word Biology has been derived from
_________ language.
6. Opening and closing of stomata is controlled A. English
by which of the following taking place in the B. Latin
guard cells? C. Greek
A. Turbidity D. French
B. Turgidity
C. C. Flaccidity
PAGE N0: 1
Website: www.PakSuccessEducation.com Whatsapp:03362851595 Facebook.com/PakSuccessEducation
13. The name malaria is a combination of two 4. Steroids consist of _______ 6-membred
_________ words. carbon rings and one 5-membred carbon
A. Italian ring.
B. Latin A. Four
C. English B. Three
D. French C. Two
D. Five
14. It is currently estimated that the age of the E. Six
earth is about:
A. 1 billion years 5. What occurs when sucrose is broken down
B. 4 billion years to monosaccharides?
C. 1 light year A. reducing sugars and releasing water
D. 100 billion years B. condensation of reducing sugars using
water
15. An educated guess is known as ______. C. hydrolysis, releasing reducing sugars and
A. Hypothesis releasing water
B. Theory D. hydrolysis, releasing reducing sugars and
C. Statement using water
D. Problem
6. The structure of a lipid contains all of the
following EXCEPT:
UNIT NO. (02) A. A carboxyl group
B. A CH2O basic structure
1. If one ribose molecule were bonded to one C. A glycerol molecule
adenine molecule and one Phosphate D. A fatty acid molecule
molecule, we would have a E. An OH group
A. Ribosome
B. Nucleotide 7. Stearin (C57 H10 O6) is an important example
C. Nucleic acid of:
D. ATP A. Carbohydrates
E. ADP B. Proteins
C. Waxes
2. An organic compound in which hydrogen and D. Acylglycerol
oxygen are present in the same ratio as in E. Nucleic Acids
water is
A. Fat 8. The above diagram represents the process
B. Carbohydrate of:
C. Protein A. Hydrolysis
D. Nucleic acid B. Condensation
E. All of the above C. Neutralization
D. Metabolism
3. Deficiency of vitamin A causes
A. Rickets 9. Sugar in stored in the liver as:
B. Osteomalacia A. Starch
C. Delay in coagulation of blood B. Glycogen
D. Night blindness C. Maltose
E. Anemia D. Cellulose
PAGE N0: 2
10. Which of the following is correct: 17. Which of the following organic compounds
A. Glucose + fructose = maltose represents a protein?
B. Glucose + galactose = sucrose A. C12H35COOH
C. Glucose + glucose = maltose B. (C6H10O5) n
D. Glucose + glucose = sucrose C. C708H1130O224N180S4P4
D. C12H22O11
11. Polysaccharides are synthesized in plants by
18. Assuming that only 20 commonest amino
the process of
acids are present in a given organism, how
A. Hydrolysis many different dipeptides might
B. Oxidation theoretically be found in it?
C. Condensation A. 20
D. Glycolysis B. 40
C. 100
12. Which one of the following is not D. 400
immediately essential for protein synthesis?
A. ATF 19. Why do proteins have a buffering effect in
B. Enzyme cells?
A. They are non - polar
C. Glucose
B. They are amphoteric
D. mRNA
C. They contain basic amino acids
D. They are a major component of cell
13. The bond present between carbohydrate surface membranes
units 20. The most abundant component of a living
A. Peptide bond cell is
B. Covalent bond A. Carbohydrates
C. Glycosidic bond B. Proteins
D. Electrostatic bond C. Lipids
D. Water
14. A lipid molecule is composed of glycerol
21. Which of the following are true:
fatty acid in a ratio of:
A. glucose + fructose = maltose
A. 1:1
B. glucose + galactose = sucrose
B. 1:3
C. glucose + glucose = maltose
C. 1:4
D. glucose + glucose = sucrose
D. 1:2
22. Which of the following molecules contain
15. The formula of glyceraldehyde is:
amino acids?
A. C3H6O4
A. Ascorbic acid
B. C3H6O3
B. Cellulose
C. C6H12O6
C. Collagen
D. C6H14O7
D. Glycogen
16. In AMYLOPECTIN the linkage is:
23. The _________ structure was first proposed
A. 1.3
by Robertson:
B. 1.6
A. Cellulo-protein
C. 2.6
B. Star protein
D. 6.6
C. Cyto protein
D. Lipoprotein
PAGE N0: 3
31. The test of reducing sugars can be done by
24. The distinctive characteristic and functional using:
group of fats is: A. Cu+2 ions
A. Ketone B. Cu+ ions
B. Alcohol C. Hg+ ions
C. Peptide D. None of the above
D. Ester
32. Regarding starch molecule which statement
25. Lipids are different types simple lipids is correct?
include, natural fats, and oils and: A. Amylase chain of starch is branched,
A. Waxes amylopectin is not branched
B. Sterols B. Amylopectin chain is branched, amylose is
C. Lipids not branched
D. Cholesterols C. Both chains are branched
D. Both chains are unbranched
26. Cellulose is:
A. Disaccharide 33. Assuming that only 20 commonest amino
B. Pentose Polysaccharide acids are present in a given organism, how
C. Hexane Polysaccharide many different dipeptides might
D. Mucopolysaccharide theoretically be found in it?
A. 20
27. Which of the following is not made up of B. 40
hexose sugar subunits: C. 100
A. Sucrose D. 400
B. Starch E. 10
C. Glycogen
D. Insulin 34. Which of the following has quaternary
structure;
28. How many carbon atoms are found in A. Myoglobin
monosaccharide compound? B. Actin
A. 1 to 5 Carbon atoms C. Tropomyosin
B. 3 to 6 Carbon atoms D. Hemoglobin
C. 5 to 10 Carbon atoms
D. 5 to 15 Carbon atoms 35. In a typical nucleotide the nitrogenous base
is attached to _________ carbon of pentose
29. What is general formula of Carbohydrates? sugar:
A. Cn H2n On A. 6th
B. C2n Hn On B. 5th
C. Cn H2n O2n C. 4th
D. None of these D. 3rd
E. 1st
30. Polysaccharides of two types, storage
polysaccharides and: 36. Lysosomes function in:
A. Structural polysaccharides A. Protein synthesis
B. Amino polysaccharides B. Processing
C. Functional polysaccharides C. Intracellular digestion
D. Cellulosic polysaccharides D. Lipid synthesis
E. Carbohydrate synthesis
PAGE N0: 4
37. Steroids consist of _______ 6-membred Which DNA sequence would be needed to
carbon rings and one 5-membred carbon produce the polypeptide sequence alanine -
ring. arginine - lysine - phenylalanine?
A. Four A. CGT GCT TTC AAA
B. Three B. CGT GCT TTC TTT
C. Two C. CGU GCU UUC AAA
D. Five D. CGU GCU UUC TTT
E. Six E. GCT CGT TTC AAA
38. Which type of protein structure contains the 42. Which of the following process is reverse of
three dimensional structure? condensation?
A. primary A. Hydrolysis
B. secondary B. Dehydration synthesis
C. tertiary C. Polymerization
D. quaternary D. Vaporization
39. Which one of the following combinations of 43. The disease night blindness is caused by
statements is true of saccharides in living deficiency of vitamin:
organisms? A. A
They They form They form B. В
provide storage supporting C. С
energy compounds structures D. D
A. No No Yes
B. No No No 44. Micronutrient in abiotic components is
C. Yes No No A. Carbon
D. Yes Yes No B. Hydrogen
E. Yes Yes Yes C. Potassium
D. Iron
40. The diagram shows a molecule. E. All of the above
H
H | O 45. Ribose and ribulose are the example of
N C C ________ class.
H | OH A. Triose
H C H B. Tetrose
| C. Pentose
H D. Hexose
Which substance might include the above
molecule?
A. Cellulose
UNIT NO. (03)
B. Serine
C. Glucose 1. Which level of protein structure maintains
D. Alanine the helix shape of enzymes?
41. Listed below are some amino acids and their A. primary
corresponding mRNA triplets. B. secondary
amino acid mRNA triplet C. tertiary
phenylalanine UUU D. quaternary
lysine AAG E. both A & B
arginine CGA
alanine GCA 2. An enzyme increases the speed of a reaction:
PAGE N0: 5
A. by adding activation energy requirements B. S. Maximum
B. By lowering activation energy C. Decreased to 50%
requirements D. Reduced to minimum
C. by decreasing the concentration of E. None of the above
products
D. by increasing the concentration of 8. In Acetyl Coenzyme (Acetyl CoA) the
products Coenzyme A, a Sulphur containing
E. all of the above compound is derived from:
A. Vitamin A
3. Holo enzymes consist of: B. Vitamin D
A. Apoenzymes and prosthetic group C. Vitamin B
B. Proenzymes and prosthetic group D. Minerals
C. Coenzymes and prosthetic group E. Proteins
D. Proenzymes and apoenzymes
E. Apoenzymes and co enzymes 9. The location on an enzyme where a
substrate binds is called the
4. The biological catalysts are called: A. Binding site
A. Proteins B. Reaction center
B. Carbohydrates C. Allosteric site
C. Vitamins D. Lock-and-key model
D. Minerals E. Active site
E. Enzymes
10. The function of enzyme is to
5. Hydrogen peroxide is highly toxic substance. A. cause chemical reactions that would not
In the liver it is broken down to hydrogen & otherwise take place
oxygen by an enzyme: B. change the rate of chemical reactions
A. Amylase C. change the direction of reactions
B. Transferase D. raise the activation energy
C. Catalase E. None of the above
D. Lipases
E. Trypsin 11. The specificity of enzymes is due to their:
A. High M.wt
6. Which of the following statements about B. Hydrogen bonding
enzyme kinetics is false? C. pH sensitivity
A. An increase in the substrate concentration D. Surface configuration
(at constant enzyme concentration) leads
to proportional increase in the rate of the 12. If temperature is reduced to near or below
reaction. freezing point enzymes become:
B. Most enzymes operating in the human A. Denatured
body work best at a temperature of 37 °C. B. Dormant
C. An enzyme is generally inactivated rapidly
C. Renatured
by exposure to ultraviolet light.
D. All of these
D. Competitive inhibitors reduce the
productivity of enzymes by blocking the
substrate from entering active site 13. Which of the following is not an enzyme:
E. None of the above A. Polymerase
B. Hydroserae
7. At 0°C, the enzymatic activity is: C. Isomerise
A. Completely stopped D. Enzymate
PAGE N0: 6
14. When a prosthetic group join with enzymes A. holoenzyme
it forms: B. apoenzyme
A. Co-Factor C. coenzyme
B. Co-Enzyme D. zymoenzyme
C. Holoenzyme
D. App enzyme 21. The diagram shows s metabolic pathway.
enzyme 1 enzyme 2 enzyme 3

15. Optimum pH for enzyme pepsin of stomach
is: reactant substance substance end
X Y product
A. 7
B. 3 What would be the effect of adding a small
C. 1.4 amount of a non-competitive inhibitor of
D. 4.5 enzyme 2?
A. Enzyme 2 would be partially denatured.
16. The specificity of enzymes is due to their B. Substance X would increase in
A. High M.wt concentration.
B. Hydrogen bonding C. Substance Y would no longer be formed.
C. pH sensitivity D. The initial reactant would no longer be
D. Surface configuration metabolized.
E. All of the above E. The effect would be negligible.
17. Which of the following factor affect enzyme 22. The gland known as the "gland of
activity? emergency" is the:
A. Temperature A. Pituitary
B. pH B. Adrenal
C. Concentration of substrate C. Thyroid
D. Radiation D. Parathyroid
E. all of the above E. Pancreas
18. At above ________ temperature certain heat 23. The autonomic nervous system controls all
shock proteins are produced in plant body. of the following activities except:
A. 40°C A. Digestion of food
B. 50°C B. Heart beat
C. 30°C C. Contraction of pupil of eye
D. 35°C D. Thought
E. Breathing rate
19. An enzyme increases the speed of a reaction:
A. by adding activation energy requirements 24. The following statements are about
B. by lowering activation energy enzymes:
requirements 1. They are globular proteins.
C. by decreasing the concentration of 2. They can be inhibited by competitive
products inhibitors
D. by increasing the concentration of 3. They are formed in the smooth
products endoplasmic reticulum.
E. all of the above 4. They are only found attached to plasma
membranes in the cell.
20. Some enzymes require the presence of a no Which statements are correct for all
protein molecule to behave catalytically. An enzymes?
enzyme devoid of this molecule is called a (n) A. 1 and 4 only
PAGE N0: 7
B. 2 and 4 only 4. Membrane bound organelles include all of
C. 1 and 2 only the following, EXCEPT:
D. 1, 2, 3 and 4 A. Mitochondria
B. Lysosomes
25. Enzyme carbonic anhydrase in RBCs help in C. Peroxisomes
_________ transportation D. Centriole
A. Oxygen E. Plastids
B. Iron
C. Calcium 5. The rough endoplasmic reticulum differs
D. Carbon dioxide from the smooth endoplasmic reticulum due
to the presence of
UNIT NO. (04) A. Lysosomes
B. Ribosomes
C. Mitochondria
1. The diagram shows a generalized animal cell.
D. Golgi apparatus
Which structure would be involved in the
E. Histones
final secretion of digestive enzymes from this
cell?
6. Red blood cells are:
A. Biconcave cells
B. Non-nucleated circular plate-like cells
C. Irregular cells
D. Nucleated cells
E. Both A and B
7. The cell membrane is made up of:

A. A A. Peptidoglycan
B. В B. Lipids & proteins
C. C C. Carbohydrates
D. D D. Proteins & sugar
E. E E. Cellulose
2. Which of the following is NOT an organelle? 8. The diagram shows a student's drawing of
A. Nucleus stomata.
B. Golgi apparatus
C. Lysosome
D. Chlorophyll
E. Chloroplast
3. Which of the following is a correct

association?
A. Mitochondria transports materials from
the nucleus to the cytoplasm
B. Lysosome: digestive enzymes for Which label is not correct?
intracellular use A. A
C. Endoplasmic reticulum: selective barrier B. B
for the cell C. C
D. Ribosome: electron transport chain D. D
E. E
PAGE N0: 8
9. Lymphocytes function as to: A. Af, Bg, Cj, Di, Eh
A. engulf bacteria B. Ah, Bi, Df, Cg, Ej
B. produce histamine and heparin C. Aj, Bi, Ch, Dg, Ef
C. produce antibodies D. Ah, Bf, Dg, Ci, Ej
D. initiate blood clotting
15. Which of the following statement(s) is/are
10. Which of the following is mismatched? correct regarding a nucleus?
A. Nervous system ... reception, conduction, I. Stores wastes and other Substances
integration, effect II. Contains genetic material
B. Skeletal system ... posture, protection, III. Helps in cellular transport system
locomotion, blood cell production IV. Control center of the cell
C. Epidermis ... support, integration, A. I only
exchange, filtration B. I & II
D. Gastrointestinal system ... absorption, C. II & III
secretion, digestion, egestion D. II & IV
E. III & IV
11. Which of the following is not a function of
the endoplasmic reticulum? 16. Which features do animal cells share with
A. Lipid synthesis plant cells?
B. Poison detoxification Chloropla Cytoplas Nucle Mitochond
C. Protein synthesis st m us ria
D. Aerobic respiration
E. Storage and release of Ca+2 ions A √ √ √ √
B √ x √ x
12. Mitochondria are passed to an animal only C x √ √ √
by: D x x x √
A. Father
B. Sister
17. The approx. width of a cell membrane is:
C. Mother
A. 0.001nm
D. Both A and C
B. 0.10nm
E. None of the above
C. 1.0 nm
D. 10nm
13. The inherited impairment of heamoglobin
production is called:
18. Which of the following is a characteristic of
A. Leukemia
mitochondria?
B. Thrombus formation
C. Thalassemia A. They store proteolytic enzymes
D. Myocardial infraction B. They provide sites for anaerobic
E. Hypertension respiration
14. Which of the following is correctly matched? C. They produce cellular secretions
Detoxification of D. They release energy via Kreb's cycle
A Ribosomes f
alcohol
Formation of astral 19. Which one of the following possesses the
B Lysosomes g
ray most prominent Golgi apparatus?
C Centriole h Protein synthesis A. An islet of Langerhans
Destroyers of foreign B. A retinal rod cell
D Peroxisomes i
particles C. A striated muscle
Converts cholesterol D. A xylem tracheid
E Smooth ER j
into vitamin D in skin
PAGE N0: 9
20. ________ said that protoplasm is the 27. Chloroplast contain substational amount of
physical basis of life. ________ and are capable of programming
A. Robert Brown synthesis of some of their new structural
B. Robert Hook components:
A. Chlorophyll
C. Purkinje
B. DNA
D. Huxley
C. RNA
D. Chlorophyll a
21. In folding’s in the Mitochondrial inner
membrane is called: 28. The % of lipids in protoplasm is about:
A. Cristae A. 2 to 3%
B. Thylakoid B. 2 to 4%
C. Glyoxysome C. 2 to 5%
D. Chromatic network D. 10%
22. The nonliving part of protoplasm is: 29. Leucoplast are:

A. Found in underground parts of the plant
A. Golgi bodies
B. Found in aerial parts of plants
B. Inclusion
C. They have chloroplast
C. Organelles
D. They are found exogenously
D. ER
30. Ribosomes are attached to
23. The movement of cytoplasm is called: A. One another
A. Exocytosis B. ER
B. Endocytosis C. Golgi bodies
C. Pinocytosis D. Centromeres
D. Cyclosis
31. Rough Endoplasmic Reticulum are involved
in:
24. Protein synthesis takes place in ________.
A. Protein synthesis
A. Ribosomes
B. DNA synthesis
B. Mitochondria C. RNA synthesis
C. Mesosomes D. Protein Modification
D. Golgi bodies
32. Many ribosomes attached to Endoplasmic
25. Shrinkage of protoplasm from cell wall under reticulum form?
hypertonic solution is called _______. A. Abnormal Function
A. Plasmolysis B. Polyribosomes
B. Endosmosis C. Intense protein synthesis
D. Cell becomes malignant
C. Protolysis
D. Torsion
33. Mitochondria can be found in:
A. Virus
26. When solid particles are ingested by cell B. Bacteria
through plasma membrane: C. Protozoan
A. Pinocytosis D. Nostos
B. Phagocytosis E. None of the above
C. Endosmosis
D. Exomosis
PAGE N0: 10
34. Outer membrane of mitochondrion and
endoplasmic reticulum are similar in having: Fraction 1 Fraction 2 Fraction 3 Fraction 4
A. Similar structure and constituents’ A. Mitochondria Lysosomes Nuclei Ribosomes
substance B. Lysosome Nuclei Ribosomes Mitochondria
B. The enzyme monoamine oxidase C. Mitochondria Nuclei Lysosomes Ribosomes
C. The enzyme NADH cytochrome reductase D. Nuclei Mitochondria Lysosomes Ribosomes
D. Identical metabolic function
38. Regarding cell ultra-structure:
35. The food reserved CO2 and H2 are stored in: A. Golgi bodies gives rise to lysosomes
A. Plastids B. Rough E.R gives rise to lysosomes
B. Mitochondria C. Microfilaments are responsible for
C. Ribosomes intracellular support
D. Nucleus D. The cell wall is impermeable
36. In plant cell, cell wall and cell plate is the 39. Smooth endoplasmic reticulum
product of: A. is studded with ribosomes h
A. Golgi bodies B. Is responsible for transport of metabolites
B. Mitochondria C. is the site of respiration
C. Endoplasmic reticulum D. Is not found in eukaryotes
D. Plastids
40. Outer membrane of mitochondrion and
37. Some fresh rat’s liver homogenized and the endoplasmic reticulum are similar in having
suspension subjected to differential A. Similar structure and constituent’s
centrifugation. The procedure is shown in substance
the table overleaf. B. The enzyme monoamine oxidase
Treatment Sediment C. The enzyme NADH cytochrome reductase
800g for 10 mins Fraction 1 D. Identical metabolic function
41. The delimiting outer membrane is absent is:

Supernatant A. Mitochondria
B. Nucleol
C. Lysosomes
2000g for 15 mins Fraction 2 D. Plastids
42. The chief role of nucleolus in nucleus

Supernatant concerns:
A. Organization of chromosome
B. Ribosome synthesis
25000g for 15 mins Fraction 3 C. Chromatid separation
D. DNA replication
Supernatant 43. ________ were discovered by Slautter Back.

A. Mitochondria
B. Golgi bodies
105000g for 60 mins Fraction 4 C. Microtubules
(g = gravitational force) D. Glyoxysomes
Which one of the following represents the
order in which the organelles were removed 44. Peroxisomes were discovered by Tolbert, it
from the suspension? plays important role in:
PAGE N0: 11
A. Photosynthesis B. They provide sites for anaerobic
B. Respiration respiration
C. Photorespiration C. They produce cellular secretions
D. Reduction D. They release energy via Krebs cycle
E. They produce glucose
45. Protoplasm was first observed by:
A. Purkinje 52. Which one of the following possesses the
B. Dujardin most prominent Golgi apparatus?
C. Robert Hook A. An islet of Langerhans
D. Von Mohl B. A retinal rod cell
C. A striated muscle
46. Synonyms for Golgi bodies are dictyosome D. A xylem tracheid
and: E. An erythrocyte
A. Dactylosome
B. Chondriosome 53. If centrioles are absent from an animal cell,
C. Lypochondria which process would be inhibited?
D. None A. Cell division
B. Respiration
47. The term mitochondria was given by: C. Excretion
A. Altman D. Locomotion
B. Banda
C. Robert Brown 54. Change in which one of the following would
D. Huxley have the most prominent effect on protein?
A. m-RNA
48. Cell Theory is not followed by: B. Nucleus
A. Bacteria C. Golgi apparatus
B. Virus D. Smooth endoplasmic reticulum
C. Cyano Bacteria
D. All prokaryotes 55. According to _______, protein layers are not
confined to the surface of the membrane but
49. Outer nuclear membrane is continuous with embedded in lipid layers.
which cytoplasmic organelle: A. Lock and key mode
A. Ribosome B. induce fit model
B. Golgi apparatus C. Fluid mosaic model
C. Endoplasmic reticulum D. Lotka Volterra model
D. Mitochondria E. All of the above
50. Which of the following organelles always 56. Proteins float in membrane like ice burg in
contains DNA? sea:
A. Centriole A. Lock and key model
B. Golgı apparatus B. Induce fit model
C. Lysosome C. Fluid mosaic model
D. Mitochondrion D. Lokta voltera model
E. Endoplasmic reticulum E. All of the above
51. Which one of the following is a characteristic 57. ________ constitute more than 50% of dry
of mitochondria? weight of cell.
A. They store proteolytic enzymes A. Proteins
B. Vitamins
PAGE N0: 12
C. Water
D. Salts 62. Which of the following is NOT a difference
that would allow one to distinguish between
58. Primary wall contains ________ of a prokaryotic and a eukaryotic cell?
hemicelluloses. I. Presence or absence of the nucleus
A. 50% II. Presence or absence of the cell wall
B. 30% III. Membrane-bound versus no membrane-
bound organelles
P Q R A. I only
A Carbohydrat carbohydrat Light B. II only
. e storage e synthesis absorption C. III only
D. I and II only
B. carbohydrat Carbohydrat Light E. I, II and III
e synthesis e storage absorption
63. The diagram shows the ultra-structure of a
C. carbohydrat Light Carbohydrat chloroplast as seen in section. What are the
e synthesis absorption e storage functions of P, Q and R?
D Light Carbohydrat carbohydrat

. absorption e storage e synthesis
Light carbohydrat Carbohydrat

E. absorption e synthesis e storage
C. 40% 64. The following are all features of eukaryotic

D. 80% cells:
I. chloroplast
59. Capsid is made up of protein subunits called II. Peroxisome
_______. III. Lysosome
A. Lipids IV. Mitochondrion
B. Proteinomeres V. nucleus
C. Capsomeres Which of these have a double membrane?
D. None A. I, II and IV
B. I, III and v
60. Lysosomes are also called: C. I, IV and V
A. Suicide sacs D. II, III and V
B. Chondriosome E. II, III and IV
C. Storage organelle
D. Dictyosome 65. When a red stain is added to a culture
E. Power house of a cell containing both living and dead cells, only
the dead cells take up the stain.
61. Of the following, which is the incorrectly Which structure (s) prevent (s) the stain
paired one? entering the living cells?
A. Robert Hooke ... cell wall A. cell membrane
B. Schleiden and Schwann … cell theory B. cell wall
C. Robert Brown … nucleus C. cytoplasm
D. Watson and Crick DNA model D. vacuole
E. Virchow... mosaic model of plasma E. all of the above
membrane
PAGE N0: 13
66. The statements are all descriptions of cell A. Golgi apparatus
structures. B. lysosome
1. Surrounded by a single membrane and C. mitochondrion
enclosing a large fluid-filled space D. cell wall
2. Surrounded by a single membrane and E. ribosome
enclosing digestive enzymes
3. Formed by two membranes enclosing a 69. The process of membrane fusion and the
matrix, the inner membrane is folded movement of material out of the cell, is
4. Formed by a membrane that has flattened called:
sacs and tubular structures inter-connected A. Phagocytosis
throughout the cell B. Endocytosis
5. Formed of nucleic acid and protein C. Pinocytosis
Which row shows the typical cell in which D. Exocytosis
these cell structures are found?
Plant cell Animal cell 70. The diagram is taken from an electron micro
A. 1, 3, 4 and 5 2, 3, 4 and 5 graph of a cell, name the organelle labeled B:
B. 1, 2, 3 and 4 1, 2, 3 and 5
C. 2, 4, and 5 1, 4 and 5
D. 3, 4 and 5 only 2, 3 and 5 only
67. The diagram shows some similarities

between Golgi apparatus mitochondria and
suicide sacs.
1 2 3 4 5
A. Nucleus
B. Golgi complex
C. Lysosome
1 2 3 4 5 D. Mitochondrion
golgi membr suicide E. Vacuole
mitoch
A. appara enzymes ane sacs
ondria
tus bound 71. Which of the following nutrients is
Non incorrectly paired with its function in a cell-
golgi suicide
mitoch membr wall?
B. appara enzymes sacs
ondria ane A. Potassium Formation of cell-wall.
tus
bound B. Magnesium Constituent of chlorophyll.
Non C. Nitrogen -Constituent of protein.
suicide golgi
membra enzym mitoch D. Phosphorous Component of nucleic acid.
C. sacs appara
ne es ondria
tus
bound 72. All of the following are correct regarding
membra membr golgi parenchyma tissue EXCEPT:
suicide mitoch
D. ne ane appara A. They are found in the epidermis, pith and
sacs ondria
bound bound tus cortex
B. The whole body of Bryophytes is made up
68. It is the non-living component of cell, it is of these tissues
secreted and maintained by the living C. They are loosely packed with intercellular
portion of cell, and is found only in plants. spaces in leaves
What is this structure?
PAGE N0: 14
D. They are of two types namely fibers and D. I and II only
sclerosis E. I, II and III
73. Which of the following contains enzymes for 6. ________ is commonly known as Almond.
the detoxification of alcohol? A. rosa indica
A. Ribosomes B. pyrus malus
B. Peroxisomes C. pyrus communis
A. С. Glyoxysomes D. prunus amygdalus
C. Lysosomes E. prunus persica
UNIT NO. (05) 7. Which one of the following is not a viral

disease?
A. influenza
1. Diptera refers to a (n): B. hepatitis
A. genus C. AIDS
B. species D. Pneumonia
C. order E. rabies
D. family
E. class 8. Which of the following groups have the most
in common with one another?
2. The mouse is known as Mus musculus. The A. members of the same kingdom
Mus is the B. members of the same genus
A. Phylum C. members of the same phylum
B. Class D. members of the same class
C. Order E. members of the same family
D. Genus
E. Species 9. A viral reproductive cycle that culminates in
death of host cell is known as:
3. All viruses A. Lysogenic cycle
A. Carry DNA B. Lytic cycle
B. Carry RNA C. Kreb's cycle
C. Lack protein D. Glycolysis
D. Cannot reproduce outside of cells E. Electron-transport chain
4. Closely related species are grouped together 10. All of the following diseases are caused by
into _________. viruses EXCEPT:
A. families A. Poliomyelitis
B. orders B. Common cold
C. phyla C. Yellow fever
D. kingdom D. Diphtheria
E. genera E. Encephalitis
5. Arboviruses cause: 11. In plants and animals, Colorado tick fever is

I. Encephalitis caused by:
II. Yellow fever A. Enveloped plus-strand RNA group virus
III. Dengue B. Minus-strand RNA group virus
A. I only C. Double-stranded RNA group virus
B. II and III only D. Small genome DNA group virus
C. I and III only E. Bacteriophages
PAGE N0: 15
D. Transmission from one organism to
12. Which one of the terms below correctly another
describes the relationship between the
skeletal system in the wing of bird, fore-limb 18. Mumps, a viral disease is caused by:
of turtle, fore-leg of horse and arm of man? A. Plus-strand RNA virus
A. Analogous B. Enveloped minus RNA virus
B. Homologous C. non enveloped minus RNA virus
C. Homozygous D. None of the above
D. Monotypic
E. Taxonomic 19. Vermiform appendix in man is example of:
A. Homologous organs
13. The scientific name of the dog is Canis B. Vestigial organs
familiaris and that of the coyote is Canis C. Analogous organs
latans. This indicates that both the dog and D. None of the above
the coyote are members of the
A. Same genus but different species 20. Binomial nomenclature was first time
B. Same species but different genera proposed by ________.
C. Same genus but different classes A. Charles Darwin (1859)
D. Same species but different classes B. Rodolph Virchow (1855)
E. Same class but different genera A. C Louis Pasteur (1862)
C. Carolus Linnaeus (1707)
14. Viruses resemble living things because they: D. Robert brown (1773)
A. Circulate
B. Move 21. The Latin words of the name given to a
C. Reproduce human being, Homo sapiens, include the:
D. Are crystalline A. Genus and family
E. Are able to respond to stimuli in the B. Family and order
environment C. Order and class
D. Genus and class
15. Which of the following is not a bacterial E. Genus and species
disease?
A. Typhoid and T B 22. Chicken pox is caused by:
B. Rabies and Polio A. Hepatitis A virus
C. Diphtheria and Cholera B. Varicella zoster virus
D. Dysentery and Diarrhea C. Influenza virus
D. Human immunodeficiency virus
16. All of the following are symptoms of E. Rabies virus
hepatitis, except:
A. Deficit Immunity 23. The viruses are:
B. Enlargement of liver A. Cellular
C. Fever and fatigue B. Prokaryotes
D. Jaundice C. Non-cellular
D. Eukaryotes
17. The TMV first appeared on the leaves of E. Visible with naked eye
Tobacco plant and was characterized by:
A. Wrinkling of leaves 24. A bacteriophage consists solely of:
B. Yellow patches on lamina surface A. DNA and protein
C. Falling off of the leaves B. RNA and protein
C. RNA only
PAGE N0: 16
D. Protein only D. Conjugation
E. DNA only E. Transformation
25. Rabies is caused by ________. 4. Almost all the prokaryotes belong to the
A. Bacteria kingdom:
B. Rhabdovirus A. Fungi
C. Insect bite B. Plantae
D. Rhinovirus C. Animalia
D. Protista
26. Closely related species are grouped together E. Monera
into _______.
A. families 5. Bacilli bacteria are ________ shaped.
B. orders A. Spherical
C. phyla A. e. Spring
D. kingdom B. Rod
E. genera C. Screw
D. Comma
27. Encircle the miss-match:
A. Colds... Rhino virus 6. The hollow, filamentous appendages which
B. Yellow-fever... Bacteria help in conjugation in bacteria are:
C. Encephalitis... Virus A. Flagella
D. Minus Strand RNA virus... Paramylons B. Cell wall
virus C. Capsule
E. Rabies... Dog bite D. Pilli
E. Storage bodies
7. Which features enable an organism to be

UNIT NO. (06) identified as a prokaryote?
I. cell wall
1. Shape of a coccus is II. Circular DNA
A. Spherical III. Nucleus
B. Rod shaped IV. Ribosomes
C. Helical A. I only
D. Spiral B. II only
E. Elongated C. III only
D. I and IV only
2. The cell wall of most of the bacteria have E. II and IV only
unique macromolecule called ________.
A. cellulose 8. A chain of coccus is seen in a bacteria called:
B. chitin A. Micrococcus
C. fibres B. Diplococcus
D. fats C. Streptococcus
E. peptidoglycan D. Sarcinia
E. Staphylococcus
3. The most common method of bacterial
reproduction is: Questions 9-10
A. Fission A student studied a drop of pond water with
B. Transduction the low power of compound microscope and
C. Endospore
PAGE N0: 17
made the following exact drawing of an D. Spirilli
organism she observed:
15. Some bacteria live on dead organic matter
they are call
A. Parasite
B. Phages
C. Saprophytes
D. Symbionts
9. In which kingdom is the organism classified?

16. Sexual reproduction in bacteria is taken by:
A. Protista
B. Monera A. A, Binary fission
C. Metazoa B. Conidia
D. Animal C. Conjugation
E. Bryophyta D. Zoospore
10. The organism moves by means of: 17. Cyanobacteria is the typical example of:
A. Peristalsis A. Chlorophyceae
B. Pinocytosis B. Greenhaceae
C. Porifera C. Green algae
D. Protozoa
D. Fungi
E. Pseudopodia
11. When the tuft of flagella are present at both 18. Lichen is associated between:
the ends in the structure of bacterial cell, A. Fungus and Algae
then the condition is known as: B. Algae and Bacteria
A. Atrichous C. Bacteria and Fungus
B. Lophotrichous D. Bacteria and Virus
C. Peritrichous
D. Amphitrichous 19. Which structure in bacteria composed of
E. Bitrichous polysaccharides and amino acids that
prevents bacteria from antibiotics and
12. Regarding bacteria: increases its pathogenicity?
A. Cocci are rod- shaped A. Flagella
B. All contain RNA B. Capsule
C. Bacilli are spiral shaped C. Cell Membrane
D. None of these D. Cyto skeleton
13. The complementary mRNA for the DNA 20. Photosynthetic Bacteria use which of the
triplet GAT would read: following instead of H2O?
A. CTA A. H2S
B. CUA B. H2SO4
C. CTG C. C. H2 Gas
D. CTC D. Atomic Hydrogen
14. Rod shaped bacteria are called 21. Which of the following is a bacterial disease:
A. Bacilli A. Leishmaniosis
B. Plasmodia B. Tetanus
C. Cocci
PAGE N0: 18
C. Measles 28. Which of the following structure (s) is/are
D. Polio found in a generalized bacterial cell?
A. flagellum
22. Kingdom Monera includes all of the B. pili
following except C. capsule
A. Viruses D. cell wall
B. Bacteria E. all of the above
C. Fungi
D. Blue - green algae 29. Five steps of the lytic cycle of a T4 phage are
given below:
23. The cell wall of a bacteria is made up of all of 1. The T 4 phage uses its tail to stick to
the following except: specific receptor.
A. Amino acids 2. The cell's metabolic machinery, directed
B. Chitin by phage DNA, produces phage proteins and
C. Polysaccharides nucleotides from the cell's degraded DNA,
D. Cellulose are used to make copies of the phage
genome.
24. Regarding metronomes of bacterial cell 3. The phage then directs production of an
which is correct: enzyme that digest the bacterial cell wall.
A. They are invagination of cell membrane 4. The empty capsid of the phage is left as a
into cytoplasm ghost outside the cell.
B. They are in the form of vesicles, tubules or 5. The sheath of the tail contracts, thrusting
lamellae a hollow core through the wall and
C. They help in respiration membrane of the cell.
D. All of the above Which of the following is the correct
sequence of the cycle?
25. Bacterial pili help in: A. 3 → 5 → 4 → 2 →1
A. Locomotion B. 2 → 4 → 5 → 1→ 3
B. Conjugation C. 5 → 1 → 4 → 2→ 3
C. Phagocytosis D. 1 → 5 → 4 → 2 →3
D. Pinocytosis E. 4 → 5 → 1 → 3 →2
E. Exocytosis
30. Tuberculosis is caused by:
26. ________ bacteria are also called invisible A. bacterium
enemies of man. B. allergy
A. Cocci bacteria C. nicotine
B. Rhizobium Bacteria D. virus
C. Pathogenic Bacteria
D. Bacillus 31. In which of the following phase of bacterial
growth, death rate is more rapid than
27. The cell wall of most of the bacteria have multiplication rate?
unique macromolecule called _______. A. Stationary phase
A. cellulose B. LAG phase
B. chitin C. Decline phase
C. fibers D. LOG phase
D. fats
E. peptidoglycan
PAGE N0: 19
6. Protists are classified separately from plants
UNIT NO. (07) and animals because:
A. They appeared later in evolutionary
history
1. Organisms that are included in the B. Their classification is not clear cut
protoctista are: C. They are harmful to humans
A. slime molds D. Linnaeus did not know of their existence
B. conidia
C. mucor 7. Identify the protist in which photosynthesis
D. spongocoel does not take place:
E. euplectella A. Euglena
B. Ulva
2. Which of the following is not a characteristic C. Slime moulds
of the kingdom Protista? D. Chlorella
A. Members can be photosynthetic. E. None of the above
B. Members can be free living.
C. Some members move via flagella. 8. The causative agent of malaria is:
D. Some members are shaped like rods and A. Plasmodium
termed bacilli. B. Trypanosoma
E. Some members spend part of their life C. Volvox
cycle inside insects. D. Entamoeba histolytica
3. All of the following organisms belong to the 9. Amoeba causes:

kingdom Protista EXCEPT: A. Dysentery
A. Ulva B. Malaria
B. Euglena C. Sleeping sickness
C. Suctoria D. Gangrene
D. Slime mold
E. Common Molds 10. Which of the following statement is true for
Euglena:
4. The number of protist phyla is: A. Autotrophic animal
A. 1 B. Unicellular Algae
B. 3
C. Prokaryotic autotrophy
C. 5
D. D A-cellular animal
D. 7
E. 9
11. In meiosis I crossing over takes place in
5. Which of the following kingdom(s) includes ________ stage.
single-celled organisms? A. Pachytene
I. Monera B. Diplotene
II. Protista C. Ygotene
III. Fungi D. Diakinesis
A. I only
B. II only 12. The eye spot in Euglena is sensitive for:
C. I and III only A. Dark
D. II and III only B. Light
E. I, II, and III
C. Red light
D. Blue light
PAGE N0: 20
13. The number of chromosomes in sporophytic B. Virus
ulva: C. Protozoa
A. 13 D. Bacteria
B. 26
C. 24 21. Which protozoan class is totally parasite?
D. 12 A. Protozoa
B. Plasmodium
C. Ciliate
14. Who discovered protozoan in the red blood
D. Sporozoa
cells of human:
A. Leveran
B. King 22. Animals and plants characters are found in:
C. Ronald Ross A. Euglena
D. Grassi B. Paramecium
C. Bacteria
15. Movement in protozoan specially in D. Virus
sarcodinians is
A. Amoebid 23. In which cycle of plasmodium which of the
B. Euglenoid following does not effected or g changed:
C. Flagellary A. Sporozoa
D. Brachiation B. Merozoites
C. Cryptozoic
16. Plasmodium can be founding the mosquito D. Trapezoids
at:
A. Salivary gland 24. The following is true about Nostos except:
B. CBC A. It is filamentous
C. Stomach B. It contains chlorophyll
D. Both A & B C. It is parasitic
D. Reproduces asexually
17. A green single celled organism in the protista
kingdom: 25. Regarding Ulva:
A. Algae A. The thallus is 3 cell thick
B. Bacteria B. The gametes are biflagellate
C. Euglena C. The gametes are quadriflagellate
D. Amoeba D. Gametes fuse with others from the same
thallus
18. Amoeba is:
A. Acellular 26. Equisetum is commonly called:
B. Prokaryote A. Club mosses
C. Multinucleated B. Horse tails
D. None of the above C. Ferns
D. Mosses
19. Nostos contains following except:
A. Cellulose 27. Hammering used which algae for
B. Ribosomes experiment:
C. Golgi Apparatus A. Acetabularia
D. Chloroplasts B. Chlamydomonas
C. Neurospora
20. Malaria is caused by: D. None of the above
A. Mosquito
PAGE N0: 21
28. The following is true about Nostos except: C. blood
A. It is filamentous D. both A & B
B. It contains chlorophyll
C. It is parasitic 35. Three words are shown below:
D. It reproduces asexually Isomorphic sporophyte
E. It is phagocytic gametophyte
These words can be used in the spaces P, Q,
29. Trypanosoma belongs to class: and R to complete the sentence below.
A. Sarcodina Thallus in Ulva is of two types. The one with
B. Flagellata 26 chromosomes is called ...P... and the
C. Ciliata other with 13 chromosomes is called …Q...
D. Suctoria Morphologically both gametophyte and
E. Sporozoa sporophyte are exactly alike hence called
...R...
30. The amoeboid stage of slime mold is called Gametophyt Sporophyte Isomorphic
_________. e
A. Amoeba A. p Q R
B. Euglena B. Q P R
C. Plasmodium C. R P Q
D. Parasite D. P R Q
31. ________ is one of the common liverworts. 36. During which stage of meiosis do
A. Anthocerotae centromeres divide?
B. Riccia A. prophase I
C. Moss B. metaphase I
D. Marchantia C. prophase II
D. metaphase II
32. All of the following organisms belong to the 37. Pseudopodia are found in:
kingdom Protista EXCEPT: A. Flagellates
A. Ulva B. Rhizopods
B. Euglena C. Ciliophoran
C. Suctoria D. Suctoria
D. Slime mold
E. Common Molds 38. Nostoc filaments are intermixed in
gelatinous mass that form ball like structure
33. Which of the following statements called _______.
concerning nucleolus is correct? A. Chromoplasm
A. It disappears at the time of cell division B. Sarcina
B. There is only one nucleolus in every cell A. С. Kokkos
C. It plays important role in the synthesis of C. Coenobium
ribonucleic acid and ribosomes in
prokaryotic cells 39. Plasmodium belongs to class
D. It helps in destroying worn out organelles A. Flagellate
E. It captures energy for the cell. B. Sarcodina
C. Sporozoa
34. In mosquito, the plasmodium is found in: D. Ciliate
A. salivary glands
B. wings
PAGE N0: 22
UNIT NO. (08) 5. Penicillin is produced by _______.
A. Bacteria
B. Virus
1. Molds and yeast are classified as C. Algae
A. Rhodophytes D. Fungi
B. Bryophytes E. Protozoa
C. Fungi
D. Ciliates 6. Why is yeast used in bread-making?
E. Flagellates A. Aerobic respiration produces alcohol.
B. Aerobic respiration produces carbon
2. Two organisms live in close association with dioxide.
one another. One organism is helped by the C. Anaerobic respiration produces alcohol
association, while the other is neither helped D. Anaerobic respiration produces carbon
nor harmed. Which of the following terms dioxide.
best describes this relationship? E. Both C & D
A. Mutualism
B. Commensalism 7. The scientific name of button mushroom is:
C. Symbiosis A. agaricus campestris
D. Parasitism B. sycopodium phlegmaria
E. Predator prey relationship C. anthoceros fusiformis
D. ginkgo biloba
3. Mushrooms belongs to: E. agaricus bisporus
A. Zygomycota
B. Ascomycota 8. A single mushroom may produce 500, 000
C. Basidiomycota spores _______ at the peak of its production.
D. Deuteromycota A. a minute
E. Yeasts B. an hour
C. a day
4. Using the flow diagram, which organism is a D. a week
fungus? E. a month
9. Chlamydomonas:
composed of cells
A. Is a multicultural alga
yes no B. Has a single flagellum
C. Has no system of water regulation
D. Has a light sensitive structure
has chloroplast A
yes no
10. All of the following are examples of fungi:
A. Yeast
B B. Mushroom
has cell nuclei
yes no C. Moulds
D. Vorticella
C D
11. When hybrids are crossed the genotype of
A. A the offspring is,
B. В A. 1:1
C. C B. 3:1
D. D
C. 1:2:1
D. 4:1
PAGE N0: 23
12. The following may cause mutation 19. Most optimum environment for the growth
A. Malaria of fungus is:
B. Tuberculosis A. Dry
C. Ultra violet rays B. Moist
D. Colchicine’s C. Shady
D. All of the above
13. The blue pigment found only in blue green
20. Which statement about fungi is not true?
algae is: A. They have cellulose
A. Chlorophyll B. They are heterotrophs
B. Xanthophyll C. They have starch
C. Carotses D. They are coenocytic
D. Phycocyanin
21. Basidiomycota reproduce:
14. Lichen is associated between: A. Sexually
A. Fungus and Algae B. Asexually
B. Algae and Bacteria C. Both sexually and asexually
C. Bacteria and Fungus D. None of the above
D. Bacteria and Virus
22. Optimal habitat for fungi is;
A. Dry
15. Neurospora is a fungus which is used to
B. Shady
understand the principle of: C. Moist
A. Reproduction D. Torrential
B. Locomotion
C. Inheritance 23. Fungi do not contain:
D. None of the above A. Cell wall
B. Hyphae
16. Fungi cause many diseases in humans such C. Chlorophyll
D. Mycelium
as ________.
E. Spores
A. Elephantiasis
B. Leishmaniasis 24. Which of the following fungus is utilized in
C. Warts baking Industry?
D. Monalisis A. Mushrooms
B. Yeast
17. Which of the following regarding true fungi C. Bread mold
is correct D. Penicillium
A. They are autotrophs E. Penicillium Neomycin
B. They have chlorophyll
C. Less number of species 25. Fungi whose growth is favored by fire is
D. They have mycelium and hypae called:
A. Pyrophilus
18. Ringworm is caused by: B. Prophilus
A. Round worm C. Philus
B. Fungus D. Prephylus
C. Protozoa
D. None of the above
PAGE N0: 24
26. Genetically isolated unit of population is B. It prevents the flower from being
known as: pollinated.
A. Deme C. It prevents the flower from producing
B. Gene seeds.
C. Biom D. It prevents the development of fruit from
D. Specie ovary.
E. It prevents the flower from pollinating
27. Which of the followings is the fungal itself.
disease?
A. Pneumonia 4. Plants that have true root, stems, and
B. Tinea corporis leaves, as well as flowers and seeds enclosed
C. Taeniasis in fruit are classified as
D. Amebiasis A. Bryophytes
B. Tracheophytes
C. Gymnosperms
UNIT NO. (09) D. Angiosperms
E. Endosperms
1. Vascular Cambium produces:
5. Conifers, such as pine trees, are classified as
A. Primary xylem
A. angiosperm
B. Primary phloem
B. gymnosperm
C. Secondary xylem
C. fern
D. Secondary phloem
D. mosses
E. Both C & D
E. none of the above
2. The scientific name of gumtree is Acacia
Questions 6 - 7 refer to the following
nilotica and that of Katha plant is Acacia
diagram.
catechu. This indicates that both gumtree
and Katha plants are members of the:
A. Same species but different genera
B. Same genus but different classes
C. Same species but different classes
D. Same genus but different species
E. Same class but different genera
3. The diagram shows a flower in longitudinal 6. Which structure contains the female
section. gametophytes?
Before they had developed fully, a plant A. 1
breeder removed the structures labelled X, B. 6
as shown. C. 7
D. 9
E. 12
7. Where do pollen grains develop?

A. 4
B. 5
C. 6
What is the effect of removing these D. 7
structures? E. 8
A. It prevents asexual reproduction.
PAGE N0: 25
8. Plants absorb it in the form of soluble 14. The adaptive characters exhibited by
phosphates. It is present abundantly in bryophytes for their survival on land, include all
growing and storage organs of plants. What except:
is it? A. Heterogamy
A. H2O B. Absorption of CO2
B. CO2 C. Lignin fortified tissues
C. K D. Conservation of water
D. P E. Formation of embryos
E. N
15. All of the following plants belong to
9. Fern has ______ pairs of chromosome. Mimosacea family EXCEPT:
A. 23 A. Acacia nilotica
B. 40 B. Cicer arietinum
C. 500 C. Mimosa pudica
D. 13 D. Prosopis glandulosa
E. 7 E. Acacia catechu
10. The botanical name of touch-me-not is: 16. The floral formula of family fabaceae or pea
A. Acacia nilotica family is:
B. Mimosa pudica
C. Acacia catechu
D. Prosopis glandulosa
E. Albizzia Lebbek
11. Peach trees, apple trees, tomatoes, and

chhui mui are example of A. Ꚛ, O, K (5), C (5) A5, 𝑮(2)
A. gymnosperms
B. bryophytes
C. angiosperms B. +, O, K (5), C1+2+ (2), A(9) +1, 𝑮1
D. chlorophytes
E. rhodophytes
C. +, O, K (5) or 5, C5, A10, 𝑮1
12. The botanical name of "brinjal" is:
A. Solanum melongena
B. Datura alba D. Ꚛ, O, K (5), C5 or (5), Aα or (10), 𝑮1
C. Solanum nigrum
D. Solanum tuberosum E. None of the above
E. Cestrum nocturnum
17. In gymnosperms, after fertilization, the
13. Wheat, Oats, rice & corns belong to the megasporngium gives rise to:
family: A. Fruit
A. Fabaceae B. Seed
B. Poaceae C. New plant
C. Solinaceae D. Thorns
D. Rosaceae E. Leaves
E. Casia
18. The number of chromosomes in fern is:
A. 2 chromosomes
B. 14 chromosomes
PAGE N0: 26
C. 46 chromosomes A. 2
D. 80 chromosomes B. 3
E. 1000 chromosomes C. 7
D. 8
19. Pollen grains in conifers are: E. 9
A. Absent
B. Winged in all species 23. During pollination, pollen is transferred from
C. Contained in sporangium and are never A. 4 to 1
released B. 3 to 2
D. Produced by microspore mitotically and C. 4 to 5
released D. 5 to 4
E. Not winged E. 5 to 9
20. The floral formula of family solanaceae or 24. The formation of haploid cells through
potato family is: meiosis takes place in structures numbered
A. 1 and 5
A. Ꚛ, O, K (5), C (5) A5, 𝑮(2) B. 1 and 6
C. 3 and 4
D. 1, 4, and 8
E. 4, 7, and 9
B. +, O, K (5), C1+2+ (2), A(9) +1, 𝑮1
25. Cryptogams:
A. Are non-flowering plants
C. +, O, K (5) or 5, C5, A10, 𝑮1 B. From seeds + fruits
C. Include conifers + cycads
D. Include algae
D. Ꚛ, O, K (5), C5 or (5), Aα or (10), 𝑮1
26. Which of the following is not a part of seed:
E. None of the above A. Plumule
B. Testa
21. All of the followings are legume families C. Pericarp
except: D. Cotyledon
A. Mimosaceae
B. Fabaceae 27. Most highly developed plants are
C. Poaceae
A. Saprophytes
D. Caesalpiniaceae
B. Angiosperms
C. Bryophytes
Questions 22 – 24 D. Gymnosperms
28. Which one of the following is the major

advantage of using a light microscope
instead of an electron microscope?
A. A superior resolving power
B. Constant depth of focus
C. Observation of living matter
D. Use of very thing sections
29. Dalbergia sisso is botanical name of _______.

22. The fruit develops from
PAGE N0: 27
A. Sesbenia
B. Edible pea 37. Maize Endosperm is:
C. Sweet pea A. Diploid
D. Red wood B. Haploid
C. Triploid
30. Cells which are absent in gymnosperms but D. None
present in angiosperms are _______.
38. Which of the following have an edible seed
A. Vessels
coat?
B. Tracheid’s
A. Guava
C. Collenchyma B. Mango
D. Parenchyma C. Pomegranate
D. Water Melon
31. In catkin inflorescence the flowers are:
A. Motile 39. Most of the fruits belong to Family:
B. Sessile A. Poaeceae
C. Stalked B. Fabaceae
D. Branched C. C. Roseacie
D. Solanacae
32. The primitive vascular plant rhynia is:
A. Pterodophyte 40. The chloroplasts in an Elodea green plant cell
B. Bryophyte move because:
C. Spermatophyte A. They are equipped with cilia
D. Gametophyte B. The have flagella
C. They are carried around by the streaming
33. The botanical name of mustard is protoplasm
A. Brassica oleracea D. They carry on plasmolysis
B. Brassica compestris
C. Brassica napus 41. Which of the following is not an individual
D. Raphanus sativus flower
A. Sun flower
34. Flowering plants which produce seeds within B. Petunia Alba
fruits called: C. Daisy
A. Angiosperms D. Lily
B. Gymnosperms
C. Cryptogams 42. Almond is a:
D. Pteridophytes A. Pome
B. Silique
35. The reproductive structure of ferns is: C. Lomentum
A. Cones D. Drupe
B. Needles
C. Sporophyll 43. Plasmodium is a:
D. Gametophylls A. Parasite
B. Bacteria
36. Solanacea is also called: C. Virus
A. Legume family D. Saprophyte
B. Potato family
C. Night Shade Family 44. Regarding a leaf:
D. b &c both
PAGE N0: 28
A. The leaf-axil is the angle between the 51. Which one is not the group of Gymnosperm?
stipule and stem A. Cycads
B. The leaf apex is the part by which the leaf B. Ginkgo
is attached to the stem C. Gnetae
C. A compound leaf has a divided lamina D. Conifers
D. A compound leaf has terminal buds and E. Musci
nodes
52. The botanical name of gum tree is:
45. In angiosperms fertilization occurs at the A. Acacia nilotica
A. Stigma B. Mimosa pudica
B. Pollen grain C. Acacia catechu
C. Embryo sac D. Prosopis glandulosa
D. Style E. Albizzia Lebbek
46. Botanical name of "Lady of the night" 53. The floral formula of family mimosaceae is:
A. Atropa belladonna
B. Capsicum annum A. Ꚛ, O, K (5), C (5) A5, 𝑮(2)
C. Cestrum nocturnum
D. Pyrus communis
47. An increase in the diameter of an oak tree is

B. +, O, K (5), C1+2+ (2), A(9) +1, 𝑮1
due to:
A. Bark
B. Lenticel
C. +, O, K (5) or 5, C5, A10, 𝑮1
C. Cambium
D. Annual rings
E. Xylem & phloem
D. Ꚛ, O, K (5), C5 or (5), Aα or (10), 𝑮1
48. Which of the following is included in E. None of the above

Bryophytes?
A. Mosses 54. The scientific name of potato is Solanum
B. Club mosses tuberosum and that of brinjal is Solanum
C. Ferns melongena. This indicates that both potato
D. Seed plants and brinjal are members of the
E. Horse tails A. Same species but different genera
B. Same genus but different classes
49. ________ is from pea family. C. Same species but different classes
A. Cassia Fistula D. Same genus but different species
B. Rosa Indica E. Same class but different genera
C. Pisum Sativum
D. Acacia 55. Which of the following is true in angiosperm
life cycle?
50. The botanical name of Imli is: A. Gametophyte are photosynthetic and
A. Cassia fistula partially independent than sporophyte
B. Mimosa pudica B. Sporophytes are totally dependent on
C. Tamarindus indica gametophytes.
D. Datura alba C. Gametophytes are totally dependent on
E. Rosa indica sporophytes.
D. Both gametophytes and sporophytes are
totally dependent on each other
PAGE N0: 29
E. Both gametophytes and sporophytes are 60. The floral formula of family caesalpiniaceae
totally independent of each other or cassia family is:
A. Ꚛ, O, K (5), C (5) A5, 𝑮(2)
56. Antheridia and archegonia are ________
organs in bryophytes.
A. reproductive
B. digestive
B. +, O, K (5), C1+2+ (2), A(9) +1, 𝑮1
C. respiratory
D. none of the above
C. +, O, K (5) or 5, C5, A10, 𝑮1
57. The diagram shows part of a flower after it
has been pollinated.
D. Ꚛ, O, K (5), C5 or (5), Aα or (10), 𝑮1
61. Minerals salts enter a plant largely through

Which row correctly identifies one of the its:
labelled structures? A. root hairs
58. The scientific name of Thorn apple is: Labeled structure Flower part
A. lycopodium phlegmaria A. 1 stigma
B. Anthoceros fusiformis B. 2 pericarp
C. Ginkgo biloba C. 3 radicle
D. datura alba D. 4 seed
E. Agaricus bisporus B. stomata
C. guard cells
59. Which of the following types of cell are D. cell wall
found in the secondary xylem of
angiosperms? 62. All of the followings are the effects of red
A. tracheids, parenchyma, fibers, light on plant, EXCEPT:
collenchyma but no vessels A. Causes epicoty (plumule) hook to unbend
B. vessels, tracheids, parenchyma, B. Induces increase in leaf area
collenchyma but no fibers C. Elongation of internodes is promoted
C. vessels, tracheids, fibres, collenchyma but D. Stimulate flowering in long day plants
no parenchyma E. Phytochrome 660 changes to
D. vessels, tracheids, fibres, parenchyma but phytochrome 730
no collenchyma
E. vessels, fibres, parenchyma, collench but 63. Below the point at which the cotyledons are
no tracheids attached, the embryo axis is called _______.
A. Radicle
B. Epicotyl
C. Hypocotyl
D. Coleoptile
64. Prosopis glandulosa is the botanical name of

_________.
A. Chhui mui
B. Kikar
PAGE N0: 30
C. Bauble 6. Annelida are:
D. Devi A. Acoelomate
B. Pseudo coelomate
65. Pistal is the part of: C. Haemo coelomate
A. Sepal D. Coelomate
B. Petal E. None of the above
C. Stamen
D. Carpel 7. Which statement about the phylum
Echinodermata is false?
A. The phylum includes starfish and sea
UNIT NO. (10) urchins.
B. Echinoderms usually reproduce sexually.
C. The phylum includes crayfish.
1. Which of the following is/are adaptation(s)
D. Echinoderms are heterotrophs.
for parasitic mode of life in Platyhelminthes?
E. Echinoderms are invertebrates.
A. Thick body covers
B. High fertility rate
8. Compound eyes are found in
C. Adhesive organs like suckers
A. Porifera
D. Simplified digestive system
B. Coelenterata
E. All of the above
C. Mollusca
D. Arthropoda
2. Arthropods can be characterized by all of the
E. Annelida
following EXCEPT
A. A hard exoskeleton
9. The segmented worms belong to the phylum
B. A water vascular system
_______.
C. Jointed appendages
A. Annelida
D. Moulting
B. Nematoda
E. Segmented body
C. Porifera
D. Mollusca
3. Ascaris belongs to the phylum
E. Arthropoda
A. Platyhelminthes
B. Annelida
10. _______ are exclusively marine
C. Mollusca
invertebrates.
D. Nematoda
A. Arthropods
E. Arthropoda
B. Echinoderms
C. Protozoans
4. Which of the following is a hermaphrodite?
D. Nematods
A. Ant
E. Platyhelminthes
B. Earthworm
C. Aphid
11. Snail moves with the help of ________.
D. Trout
A. Foot
E. Wasp
B. Cilia
C. Flagella
5. Bat is:
D. Pseudopodia
A. A bird
E. Shell
B. An insect
C. A mammal
12. ________ is a typical protozoan that has
D. A reptile
both animal and plant like characteristics.
E. An amphibian
A. Virus
PAGE N0: 31
B. Euglena
C. Ulva 18. Class of Annelida whose members are
D. Paramecium exclusively marine is?
E. Amoeba A. Polychaeta
B. Oligochaeta
13. A man has the following symptoms during a C. Hirudinaria
Filariasis: D. None of the above
I. excessive inflammation of legs
II. Inflammation of arms & scrotum 19. Pheretima posthuma is biological name for
The disease is caused by _________.
A. A round worm (Ascaris) A. sea anemone
B. A flat worm (Dugesia) B. corals
C. A hook worm (Ancylostoma) C. obelia
D. A thread worm (Wuchereria) D. jelly fish
E. An earth worm E. earthworm
14. The open type circulatory system is present 20. Which pair contains organisms of different
in: chyla?
A. Humans A. moss, liverwort
B. Fishes B. mucor, rhizopus
C. Arthropods C. moss, club moss
D. Cow D. petunia, tobacco
E. None of the above E. star fish, brittle star
15. Which group of organisms has the following 21. 100. Which animal is not an arthropod?
features?
I. three pairs of jointed legs
II. three-part segmented body
III. one pair of antennae
A. arachnids
B. crustaceans
C. insects
D. myriapods
16. Which of the following bird is placed in the

sub class Ratitae?
A. Ostrich
B. Pigeon
C. Crow
D. Parrot
E. Peacock
17. Which of the following have a pupa stage in

their development?
A. Amoeba
B. Insects
C. Hydra
D. Sponges
E. Frogs
PAGE N0: 32
22. Of the following, the animal not included in √ = feature present
the same phylum as snail is the: x = feature absent
A. Pila A. A
A. e. Octopus B. B
B. Prawn C. C
C. Laligo D. D
D. Pearl Oyster
28. Platyhelminthes means:
23. Hydra, Sea anemone & corals occur only as: A. Flat worms
A. Medusa form B. Round worms
B. Spicules C. Segmented worms
C. Polyp form D. None of the above
D. Sycon form
E. None of the above 29. All of the following are mammals EXCEPT
the:
24. The remains of Archaeopteryx indicate that A. Porpoise
birds are most closely related to: B. Shark
A. Flying insects C. Whale
B. Flying mammals D. Walrus
C. Flying fish E. Seal
D. Reptiles
E. Amphibian 30. Molluses have all of the following except:
A. A well-developed nervous system
25. Example of Cnidarians include all except: B. Kidneys
A. Corals C. Nostrils tor respiration
B. Jelly fish D. Circulatory system with a heart
C. Hydra
D. Sponges 31. Crustacea includes all of the following
E. Sea anemone except:
A. Crabs
26. Which group of organisms has the following B. Lobsters
features? C. Oysters
I. three pairs of jointed legs D. Crayfish
II. three-part segmented body
III. one pair of antennae 32. Which of the following Cnidarian lives in
A. arachnids colonies?
B. crustaceans A. Tapeworm
C. insects B. Obelia
D. myriapods C. Jelly fish
D. Sea anemone
27. The table shows some characteristics of four
different vertebrates. 33. Earthworms feed on:
Which vertebrate is a reptile? A. Decaying vegetation
fins legs scales hairs B. Organic matter
A √ x √ x C. Soil
B x √ √ x D. All of the above
C x √ x x
D x √ x √ 34. Function of the "tube feet" in Phylum
Key Echinodermata is
PAGE N0: 33
A. Locomotion D. All of the above
B. Anchoring to hard surface
C. Grabbing the prey 42. Defensive cells of cnidarians are called
D. All of the above _________.
A. Nematocysts
35. Nematode include all of the following except
B. Gonocytes
A. Hookworms
C. Oocytes
B. Guinea worms
D. Gastrocytes
C. Earthworms
D. Ascaris
43. The feathers which help the birds in flying
are:
36. Arthropoda have all of the following except
A. Quill feathers
A. Hard exoskeleton
B. Hair feathers
B. Jointed legs
C. Down feathers
C. Segmentation
D. Plumulae
D. Closed circulation
44. A purely marine phylum:
37. Hydra and corals are classified in A. Mollusca
A. Coelenterate B. Echinodermata
B. Porifera C. Annelids
C. Echinodermata D. Arthropods
D. Mollusca
45. Echinoderms have a brain:
38. Snell is included in the class _________. A. Well-developed
A. Gastropoda B. Rudimentary
C. Absent
B. Bivalvia
D. None oi the above
C. Arachnida
D. Myriapoda 46. Male honey bees are
A. Diploid
39. Ascaris lives in the ________ of man. B. Haploid
A. intestine C. Triploid
B. Liver D. None
C. Blood
D. Bladder 47. Club Mosses belong to the sub-division:
A. Spermopsida
B. Pteropsida
40. Sea star moves with the help of ________.
C. Lycopsida
A. Pseudopodia D. Psilopsida
B. Tube feet
C. Cilia 48. Which one of the following undergoes
D. Flagellum complete metamorphosis?
A. Grasshopper
41. Pike and tout are: B. Butterfly
A. Jawless fishes C. Crab
B. Bony fishes. D. Scorpion
C. Cartilaginous fishes
49. Pokilotherms are the animals:
PAGE N0: 34
A. Whose arteries contract in cold D. Ascaris
temperature
B. Who have lot of stored body fats 56. The egg of a frog shows:
C. Who maintain their body temperature A. an upper pigmented animal pole
constant B. 4 Jelly-like membranes
D. Hibernate during winter C. an animal pole made up of yolk.
D. a size of 1-2 cm
50. In which of the following exoskeleton of
glasslike silica is found: 57. The closest relative of a Lobster is:
A. Mall uses A. Grasshopper
B. Arthropoda B. Squid
C. Diatoms C. Oyster
D. Star Fish D. Sea horse
51. Subcutaneous fat accumulation is essential 58. The life was evolved first:
for; A. On earth
A. Seal B. In sky
B. Shark C. In water
C. Elephant D. On the hill
D. Kangaroo
59. The remains of Archaeopteryx indicate that
52. Although the duck- billed platypus lays eggs, birds are most closely related to:
it is classified as a A. Flying insects
A. Bird B. Flying mammas
B. Reptile C. Flying fish
C. Rodent D. Reptiles
D. Mammal
60. The order monothematic belongs to which
53. A tadpole's tail is broken down during subclass:
metamorphosis into an adult frog. Which A. Sub class Eutheria
organelle increases in number in the cell of B. Metatheria
the tail at this time? C. Prototheria
A. Centriole D. None of the above
B. Lysosomes
C. Golgi apparatus 61. Nematode includes all of the following
D. E.R except
A. Hookworms
54. When warm blooded animals go to cold B. Guinea worms
place: C. Earthworms
A. Their metabolic rate decreases D. Ascaris
B. Their hair erector muscles relax E. Ringworm
C. Their capillaries get constricted
D. The can't breathe 62. Function of the "tube feet" in Phylum
Echinodermata is:
55. Which of the following have no digestive A. Locomotion
canal? B. Anchoring to hard surface
A. Trematodes C. Grabbing the prey
B. Taenia D. All of the above
C. Enterobius E. None of the above
PAGE N0: 35
D. Blood vascular system
63. Mollusks have all of the following except: E. None of the above
A. A well-developed nervous system
B. Kidneys 70. Forming of silkworms is called ________.
C. Nostrils for respiration A. Sericulture
D. Circulatory system with a heart B. Apiculture
C. Horticulture
64. Crustacea includes all of the following D. None
except:
A. Crabs 71. Which one of the following is fish?
B. Lobsters A. Star fish
C. Oysters B. Jelly fish
D. Crayfish C. Cattle fish
D. Sea horse
65. Brain of echinoderm is; E. None of the above
A. Well developed
B. Poorly developed 72. Which vertebrate groups have scaly skin?
C. Rudimentary A. amphibians and fish
D. Absent B. amphibians and mammals
C. fish and mammals
66. _______ is commonly known as Hook worm: D. fish and reptiles
A. Ancylostoma duodenale
B. ascaris lumbricoides 73. Archaeopteryx is a transitional stage
C. Enterobius vermicularis between the members of which one of the
D. Hirudinaria following pairs?
E. Wuchereria A. amphibian bird
B. fish... amphibian
67. An organism appears to be a segmented C. reptile... mammal
worm. Upon observation it is determined D. reptile… bird
that the organism has a closed circulation, a E. mammal... man
mouth and an anus, and does not have an
exoskeleton. The organism most likely 74. Identify the phylum in which the larva is
belongs to the phylum: bilaterally symmetrical but the adult is
A. Mollusca radially symmetrical:
B. Annelida A. Ctenophora
C. Arthropoda B. Coelenterate
D. Chordate C. Echinodermata
D. Sipunculoidea
68. Species of phylum Platyhelminthes are:
A. Round worms 75. Book lungs subseries the function of
B. flatworms respiration in:
C. hookworms A. Scorpion
D. threadworms B. Earthworm
E. Pin worms C. Frog
D. Cockroaches
69. A characteristics features of Echinoderm is: E. Fish
A. Canal system
B. Water vascular system
C. Tracheal system
PAGE N0: 36
76. What is the correct order of arthropod D. ATP is hydrolyzed and NADP reduced
groups, from those with most legs to those E. ATP is phosphorylate and NADP oxidized
with fewest legs?
A. arachnids… crustaceans… insects… 2. The diagram below represents the structure
myriapods of a chloroplast as seen in section.
B. crustaceans… myriapods... insects…
arachnids
C. insects... arachnids... myriapods...
crustaceans
D. myriapods… arachnids… crustaceans…
insects
E. myriapods... crustaceans... arachnids…
Which label, A, B, C, D or E, indicates the site
insects
of the light reaction of photosynthesis?
A. A
77. Class Elasmobranch have an exoskeleton of
A. В. В
A. placoid scales
B. C
B. cycloid scales
C. D
C. ctenoid scales
D. E
D. epidermal scales
3. Which compound captures light energy in
78. Which of the following is exclusively marine
plants?
phylum?
A. O2
A. Mollusca
B. CO2
B. Echinodermata
C. H2O
C. Annelida
D. Chlorophyll
D. Arthropod
79. Molluscs have an l made up of:
4. The Calvin Benson cycle
A. Protein
A. Does not use light directly
B. Silica
B. Occurs in the cytoplasm
C. CaCO3
C. Releases CO2
D. Cuticles
D. Produces ATP
80. Group Deuterostomata includes phylum
A. Chordata
5. Which of the following statements about
B. Annelida
the Kreb's cycle is not true?
C. Arthropoda
A. The Kreb's cycle occurs in the matrix of
D. Echinodermata
the mitochondrion
E. Both A and D
B. The Kreb's cycle is linked to glycolysis by
pyruvate
C. The Kreb's cycle is the single greatest
UNIT NO. (11) direct source of ATP in the cell
D. Citrate is an intermediate in the Kreb's
1. What happens during the light phase of cycle
photosynthesis? E. The Kreb's cycle produces nucleotides
A. ADP is hydrolyzed and NADPH oxidized such as NADH + H+ and
B. ATP is synthesized by F. FADH2
photophosphorylation and NADP reduced
C. ATP is hydrolyzed and NADPH oxidized
PAGE N0: 37
6. Which of the following statements regarding C. Photosynthesis
photosynthesis is NOT true? D. Anaerobic respiration
A. The light cycle occurs only during E. Electron-transport chain
exposure to light.
B. The dark cycle occurs only in the absence 12. Wines and beers are formed due to
of light. ________ process.
C. ATP is produced during the light cycle. A. aerobic respiration
D. During the dark cycle, sugar phosphates B. hydrolysis
are produced. C. hydrogenation
E. Red and blue light are optimal for D. fermentation
photosynthetic function. E. decarboxylation
7. Excess water is forced out in the form of 13. In which of the following life processes is
droplets through: ATP (adenosine triphosphate) produced?
A. Stomata I. Photosynthesis
B. Cuticle II. Aerobic respiration
C. Hydathodes III. Anaerobic respiration
D. Lenticles A. I only
E. All of the above B. II only
C. I and II only
8. Which of the following processes has a net D. II and III only
reaction of: E. I, II and III
Pyruvic acid + 3H2O + 5 carries → 3CO2 + 5
carriers (2H+) 14. Common to the Krebs cycle and glycolysis in
A. Glycolysis eukaryotes is:
B. Fermentation A. Production of FADH2
C. Tricarboxylic Acid Cycle B. Localization in mitochondria
D. Electron Transport Chain C. Occurrence in anaerobic conditions
E. None of the above D. Substrate-level phosphorylation
E. Oxygen utilization
9. The source of oxygen in photosynthesis is:
A. CO2 15. The light reaction of photosynthesis occurs
B. Glucose in the:
C. ATP A. stroma
D. H2O B. thylakoid membranes
E. NADP C. mitochondria
D. nucleus
10. Which of the following is a stage in the light E. ribosomes
independent reactions in photosynthesis
(the Calvin Cycle)? 16. All of the following are needed for
A. Carboxylation of a five-carbon sugar photosynthesis EXCEPT:
B. Photolysis of water A. light
C. Photophosphorylation of ADP B. glucose
D. Release of oxygen C. chlorophyll
E. None of the above D. water
E. carbon dioxide
11. Pyruvic acid is the end product of ________.
A. Kreb's cycle
B. Glycolysis
PAGE N0: 38
17. Limiting regeneration phase of Calvin
Denson Cycle only one molecule of SC 23. Product of anaerobic respiration in animals
(triose-phosphate) is produced, which can: is ________.
I. re-entry the cycle
A. Pyruvic acid
II. be used for starch synthesis within the
B. Lactic acid
chloroplast
III. exported via a phosphate translocator to C. Alcohol
cytosol for sucrose synthesis D. NADPH2
A. I only
B. III only 24. The end product of glycolysis:
C. I and II only A. Citric acid
D. II and III only B. Pyruvic acid
E. I, II and III C. Lactic acid
D. Acetyl CoA
18. The photosynthetic pigments can be
separated by a process called: 25. Chloroplast can be traced in:
A. Photosynthesis A. Roots
B. Respiration B. Stem
C. Paper chromatography C. Leaf
D. Hydrolysis D. None these
E. Bioenergetics
26. Enzymes associated with Krebs cycle are
19. Pyruvic acid is the end product of: found in:
A. Glycolysis A. Outer layer of mitochondrion
B. Krebs cycle B. Inner layer of mitochondrion
C. Oxidation C. Inner membrane space of mitochondrion
D. Electron transport system D. Matrix of mitochondrion
20. The dark reaction of photosynthesis: 27. Xanthophyll is a pigment having:

A. Takes place in the strome of the A. Yellow color
chloroplast. B. Red color
B. Involves the fixing of water C. Green color
C. Causes formation of lactic acid D. Blue color
D. Takes place in the cytoplasm
28. There are different types of chlorophyll like
21. ______ numbers of ATP produce during chlorophyll a, and:
Aerobic Respiration: A. b, c, d and e
A. 32 ATP B. b
C. Xanthophyll
B. 34 ATP
D. Only c
C. 36 ATP
D. 38 ATP 29. Plants convert solar energy into chemical
energy present in the bonds substances
22. Acetyl CoA loses CoA and combines with a 4- namely:
Carbon compound which is: A. NADPH2
A. Oxaloacetic acid B. Nucleotide
B. Citric acid C. ATP
C. Succinic acid D. RNA
D. Malic acid
PAGE N0: 39
30. In light antennae complex _______ is not A. To detoxify pyruvate
found: B. To form lactate which immediately
A. Haemoglobin converted to glycogen
B. Chlorophyll a C. To oxidize the NADH2 facilitating stage 2
C. Chlorophyll b D. To provide NADH2 tor the electron transport
D. Carotenoids chain
31. In which of the following processes ATP is 35. In the dark reaction of photosynthesis,
produced? carbon dioxide first combines with the
l. Photosynthesis phosphoenolpyruvic acid to produce:
I. Aerobic respiration A. Malic acid
Ill. Anaerobic respiration B. Oxaloacetic acid
A. I only C. Phosphoglyceraldehyde
B. ll and Ill only D. Ribulose diphosphate
C. I, II and III
D. II only 36. Concerning Krebs cycle:
A. It converts pyruvate to hydrogen and
32. In aerobic respiration, the final hydrogen water for transfer
acceptor is: B. Acetyl Co-A is a 4 carbon n
A. CO2 C. The cycle produces 2 molecules of ATP
B. H2O D. The cycle uses up to 3 molecules of water
C. ATP per molecule glucose
D. Molecular oxygen
37. The dark reaction of photosynthesis:
33. The reaction CH3COOH → CH3CHO + CO2 is A. Build up molecules of Pyruvate to form
catalyzed by; glucose
A. Decarboxylase B. Release energy
B. Dehydrogenase C. Produces GALP as the first stable
C. Hydrolase intermediate
D. Transferase D. Requires NADH
34. The diagram below summarizes the stages 38. Enzymes associated with krebs cycle are
involved in respiratory metabolism of found in:
mammalian skeletal muscle. A. Outer layer of mitochondrion
Hexoses 1 B. Inner layer of mitochondrion
C. Inner membrane space of mitochondrion
Triose Phosphate D. Matrix of mitochondrion
2
pyruvate Lactate 39. Xanthophyll is a pigment having:
3 A. Yellow color
Acetyl Co A B. Red color
4 C. Green color
Tricarboxylic acid (Krebs) cycle D. Blue color
Electron transport chain 40. There are different types of chlorophyll like
chlorophyll a, and
Stage 3 in the diagram occurs in mammalian A. b, c, d and e
muscles ceils under anaerobic c B. b and B12
Why is stage 3 necessary? C. Xanthophyl
PAGE N0: 40
D. Only "c" D. Stored fats
41. Chloroplast contain grana and storm, grana 47. The main process that occurs in the dark
are formed by _______ while stoma is a reaction in photosynthesis is:
homogenous matrix: A. That water is split
A. Chromosomes B. Light energy is converted into chemical
B. Thylakoid energy
C. Xanthophyl C. That glucose is oxidized
D. Phycocyanin D. That carbon dioxide is fixed
42. The number of ATPs formed during
glycolysis: 48. In paper chromatography xanthophyll will
A. 8 give _______ color:
B. 10 A. Orange
C. 32 B. Grey
D. 6 C. Yellow
D. blue-green
43. Phosphoglycerate formed during E. Yellow-green
photorespiration produces which amino acid
A. Phenylalanine 49. The Calvin Cycle consist of ________ main
B. Serine reactions:
C. Methionine A. З
D. Glycine B. 6
C. 9
44. In which of the following processes ATP is D. 1
produced? E. 16
I. Photosynthesis
II. Aerobic respiration 50. The light dependent reaction of
III. Anaerobic respiration photosynthesis occurs in:
A. I only A. Stroma of chloroplast
B. II and III only B. Guard cells of stomata
C. I, II and III C. Thylakoid membrane of chloroplast
D. II only D. Cytoplasm of leaf cell
E. None of these E. None of the above
45. Which one of the following is a characteristic 51. The end product of Glycolysis is:
of mitochondria? A. Glucose-6-phosphate
F. They store proteolytic enzymes B. Fructose-6-phosphate
G. They provide sites for anaerobic C. Pyruvate
respiration D. 3-Phosphoglycerate
H. They produce cellular secretions E. Phosphoglyceraldehyde
I. They release energy via Krebs cycle
J. They produce glucose 52. Creatine phosphate serves as muscle
reserves of high energy phosphate by
46. Where does the oxygen released during providing ________.
photosynthesis come from? A. Nerve Impulses
A. Water B. ATP's
B. Carbon dioxide C. Calcium ions
C. Stored carbohydrates D. Lactic acid
PAGE N0: 41
D. Carbon dioxide transfer from RuBP to
53. Glucose → 2pyruvic acid + 2H2O glucose
2ADP + 2Pi + 2ATP
2NAD + 4H → 2NADH + 2H+ Rubica
These three reactions collectively constitute 58. RuBP + O2 PGA+ _________.
________. A. Phasphoglycerate
A. Krebs cycle B. Phasphoglycolate
B. Calvin's cycle C. Glycerate
C. Electron transport chain D. Glycolate
D. Light reaction
E. Glycolysis 59. Where do the light-dependent reactions of
photosynthesis occur?
54. In the Krebs cycle, substrate level A. In the guard cells of the stomata
phosphorylation accompanies the formation B. Stroma of chloroplast
of: C. In the thylakoid membrane of chloroplast
A. Citrate D. Cytoplasm of leaf cell
B. Alpha-ketoglutarate
C. Succinate 60. Four tubes were set up under certain
D. Fumarate conditions as shown in the table.
E. Oxaloacetate TUBES CONDITIONS CONTENTS
Oxygen Pyruvate +
1
55. Three word equations are shown: deficiet yeast
P. carbon dioxide + water → glucose oxygen Glucose +
Q. glucose + oxygen → carbon dioxide + 2 Oxygen rich faculative
water aerobes
R. glucose → alcohol + carbon dioxide Glucose + an
What is/are the equation(s) for anaerobic Oxygen rich animal cell
3
respiration in yeast? containing
A. P only mitochondria
B. Q only Pyruvate +
Oxygen
C. R only 4 obligate
deficiet.
D. All of the above aerobes
After incubation, each sample was analysed
56. During the first three steps of glycolysis, to determine the presence of carbon dioxide
glucose is converted to fructose 1, 6 and lactate. In which tubes is lactate most
diphosphate by the rearrangement of the likely to be present?
molecule and addition of two phosphate A. 1 and 2 only
groups. The phosphate group comes from: B. 2, 3, and 4 only
A. Phospholipids of the membrane C. 1 and 4 only
B. ADP D. 1, 2 and 3 only
C. Inorganic phosphate
D. ATP
57. The dark reactions of photosynthesis are

characterized by:
A. Synthesis of ATP, O2 and NADH
B. Utilization of ATP, CO2 and NADPH
C. Electron transfer from NADPH to RuBP
PAGE N0: 42
UNIT NO. (12) C. Light
D. Green pigments (Chlorophyll "a", "b")
E. All of the above
1. Why do some root cells have root hairs?
A. for the maintenance of the temperature 7. Plants prevent excessive water loss from
of the cell sap their aerial parts by a waxy coating called:
B. to increase the surface area of the cells A. Mesoderm
C. to increase the volume of the cell sap B. Lignin
D. to provide a place for cell nuclei C. Cuticle
E. to allow movement of soil particles D. Sporopollenin
E. Cell wall
2. Chemosynthesis is a kind of nutrition
requiring: 8. The important process of holozoic nutrition
A. Inorganic Compounds includes:
B. Organic compounds A. ingestion
C. Any kind of compounds B. Digestion
D. Light C. Assimilation
E. None of the above D. Egestion
E. All of the above
3. Sundew is an example of _______.
A. Autotrophic plant 9. Most _______ are saprophytes that obtain
B. Parasitic plant their food directly from dead organic matter.
C. Saprophytic plant A. Algae
D. Carnivorous plant B. Fungi
E. Extinct plant C. Gymnosperms
D. Angiosperms
4. Nutritional deficiency (vitamin D deficiency) E. None of the above
results in softening of the bones. This
disease in children is called: 10. The nitrates absorbed by the root are
A. Osteoporosis converted into
B. Rickets A. Animal protein
C. Arthritis B. Ammonia
D. Cleft palate C. Amino acids
E. Microcephaly D. Carbohydrates
5. __________ continuously changes the kinds
of plants and animals. 11. Planaria feeds through the:
A. Predation A. Mouth
B. Succession B. Pharynx
C. Symbiosis C. Esophagus
D. Parasitism D. Oral groove
E. Grazing
12. What is the main role of vitamin K in the diet
6. During the process of phototrophic nutrition of humans?
(photosynthesis), the materials used by A. To participate in the formation of visual
phototrophic organisms are: purple
A. CO2 & H2O B. To promote the production of blood
B. Minerals (Nitrogen, Phosphorus, Sulphur clotting factors
& Magnesium etc.) C. To prevent skin disorders
PAGE N0: 43
D. Deposition of Calcium in the bones A. Hydra
E. All of the above. B. Amoeba
C. Paramecium
13. Lacteals of Villi absorb: D. Planaria
A. Amino Acids
B. Glucose 20. Which parasite can’t survive in artificial
C. Hydrochloric Acid medium?
D. Fatty Acids A. Endoparasite
B. Obligate
14. Pepsin and trypsin: C. Ectoparasite
A. Are both secreted with acid digestive D. Facultative
juices
21. Alpha cells of pancreas secrete:
B. Are both secreted by the pancreas
A. Amylase
C. Breakdown protein to amino acids
B. Lipase
D. Are specific enzymes releasing peptide C. Insulin
and polypeptide chain D. Glucagon
15. Vitamins K 22. A person with insufficient iron in his diet

A. is mostly found in green vegetables may become anemic because:
B. deficiency causes Pellagra A. Not enough oxyhemoglobin is formed in
C. promotes production of blood clotting the liver
factors B. Iron is used in building hemoglobin
D. prevent night blindness C. Iron is used in making fibrinogen
D. Iron enhances blood production
16. Where is oxygen produced in plants?
23. Why is Vit B, (thiamine) is important in the
A. A root hair cell human diet?
B. Mesophyll Cell A. It acts as a hormone
C. Leaf epidermal cell B. It acts as antigen
D. Phloem cell C. It acts as a coenzyme
D. It has a structural function
17. Saliva in mouth helps in digestion of
A. Bread 24. The part of the digestive system that doesn't
B. Meat secrete any enzyme is
C. Fat A. Buccal cavity
B. Oesophagus
D. Table salt
C. Stomach
D. Intestine
18. Digestion of cell contents by lysosomes is
termed as _______. 25. Vitamin D deficiency causes:
A. Endocytosis A. Osteomalacia in children
B. Autophagy B. Rickets in adults
C. Immunolysis C. Rickets in children
D. Exocytosis D. All of the above
26. About the stomach:

19. The organism in which both extracellular and
A. Oxyntic cells produce pepsinogen
intracellular digestion takes place is ______. B. Chief cells produce HCL
PAGE N0: 44
C. Goblet cells produce mucus 33. The propulsive movement of the gastro-
D. Villi are present in small numbers intestinal tract (GI tract) is:
A. Peristalsis
27. Cows can digest cellulose through enzyme B. Epiglottis
cellulose produced by: C. Antiperistalsis
A. Intestinal cells D. Anus
B. Gastric cells E. None of the above
C. Cannot digest
D. Bacteria living symbiotically in their Guts 34. Identify the incorrect statement about the
Bathyal zone
28. What is the main role of vitamin K in the diet A. It ranges from surface to depth of about
of humans? 2000 me
A. To participate in the formation of visual B. It consist of pelagic and benthic zone
purple C. It is aphetic
B. To promote the production of blood D. It contains producers that prepare food
clotting factors for consumers
C. To prevent skin disorders E. None of the above
D. Deposition of Calcium in the bones C
E. All of the above 35. The reaction involved in chemotropic
nutrition is:
29. Vitamins are-com ________ compounds; A. 6CO2 + 12H2O →C6H12O6 + 6CO2 + 6H2O
A. Inorganic B. 2H2S + O2 → (CH2O) + H2O + 2S
B. Organic C. NH4 + 3O2 → 2NO2 + 2H2O + 4H+ + energy
C. Both A &B D. CH3.CO.COOH → CH3. CHO + CO2
D. None of them E. 5GAP + 3ATP → 3RuBP + 3ADP + 2Pi
30. In a human alimentary canal, where does 36. The propulsive movement of the gastro-
digestion begin? intestinal tract (GI tract) is
A. Mouth A. Peristalsis
B. Oesophagus B. Epiglottis
C. Stomach C. Antiperistalsis
D. Duodenum D. Anus
31. __________ causes amoebic dysentery in
humans: 37. A psychological condition usually seen in
A. A Pelomyxa palustris girls and young women, with loss of appetite
B. Entamoeba histolytica is:
C. Trichonympha A. Obesity
D. Trypanosoma B. Malnutrition
E. Radiolarian ooze C. Anorexia Nervosa
D. Dyspepsia
32. Ileum is about _______ long. E. Peptic ulcer
A. 3.6 millimeters
B. 3.6 centimeters 38. Parasitic fungi absorbs nutrients directly
C. 3.6 inches from the living host with the help of special
D. 3.6 meters hyphal tips called ________.
E. 3.6 kilometers A. Roots
B. Root hair
C. Rhizoids
PAGE N0: 45
D. Haustoria obligate parasites saprophytes facultative
E. None of the above A. P Q R S
B. Q P S R
39. The diagram shows the four types of human C. R S Q P
tooth. D. S R Q P
UNIT NO. (13)
1. All of the following are functions of the liver

EXCEPT
Which teeth are used for cutting rather than
A. Produce bile
grinding food?
B. Store glycogen
A. 1 and 2
C. Secrete insulin
B. 2 and 3
D. Store vitamins
C. 3 and 4
D. 4 and 1
2. The absorption of oxygen from the
atmosphere into the blood takes place in the
40. The following reaction occurs in the human
A. Pulmonary artery
alimentary canal.
B. Pulmonary vein
enzyme C. Alveoli
starch products D. Trachea
E. Bronchi
What is the enzyme and the product?
ENZYME PRODUCT 3. Pharynx leads air into _______ through
A. acid glucose glottis.
B. alkali energy A. trachea
C. amylase maltose B. bronchus
D. bile amino acid C. alveoli
D. nasal sac
41. Four words are shown below: E. larynx
Facultative obligate saprophytes parasites
4. A bean seed contains all of the following
These words can be used in the spaces P, Q, except
R and S to complete the sentence below. A. A seed coat
Among heterotrophic plants those which B. An epicotyl
depend on living plants and animals for their C. A hypocotyl
nutritional requirements are known as ...P D. A hypha
Parasites which depend for their nutrition E. Cotyledon
entirely on other living organisms are known
as ...Q... or total parasites and those which 5. In the process of inspiration _______ and
depend for these requirements partially on _______ are involved.
other living called ...R... or partial parasites. A. intercostal muscles ... diaphram
On the other hand, the plants which depend B. deltoid muscles ... diaphram
on dead or rotten organic remains of plants C. trapezius ... intercostal muscles
and animals are called ...S.... D. biceps ... triceps
E. none of the above
PAGE N0: 46
6. Respiratory organs in fish are called A. On a humid day, the water potential
________. gradient between the intercellular air
A. Lungs space and the external atmosphere
B. Skin increases to stimulate water loss by
C. Gills evaporation.
D. Tracheal system B. Water arriving at the spongy mesophyll
E. Stomata cells via the symplast pathway must move
by osmosis through the cell surface
7. In the early morning, the water droplets can membrane before evaporation from the
be seen on the tips of grass blades & leaf surface of the cells.
margins of small plants. This is a process C. Water diffuses down the water potential
called: gradient from the saturated air space
A. Adhesion through the guard cells before
B. Guttation evaporating from the surface of the cells
C. Cohesion into the atmosphere.
D. Respiration D. Water moves up the xylem in the apoplast
E. Plasmolysis pathway and can continue on this
pathway by osmosis to reach the spongy
8. Which of the following are considered to be mesophyll cells before evaporating into
the respiratory surfaces of the lungs? the intercellular air space.
A. Pleural membranes
B. Pleural cavity 12. What causes the observed change in skin
C. Bronchioles temperature on exposure to cold air?
D. Alveoli A. less blood flowing just below the skin
B. less blood going to the heart and lungs
9. Which structures are found in a liver cell? C. more blood flowing just below the skin
D. more blood going to the heart and lungs
CELL CELL CHLO LARGE CYT NUCLEU
MEMBRA WAL ROPL VACUOL OPL S
NE L AST E ASM 13. The absorption of oxygen from the
A √ √ x x x x atmosphere into the blood takes place in
B x x √ √ x x the:
C √ x x x √ √ A. Pulmonary artery
D x √ x x x √ B. Pulmonary vein
E x x √ x √ √ C. Alveoli
D. Trachea
10. Which is the correct sequence of E. Bronchi
passageways through which air travels
during inhalation? 14. All of the followings are characteristics
A. Pharynx → trachea → bronchioles features of tuberculosis except:
→bronchi → alveoli A. Cough
B. Pharynx → trachea → lungs → bronchi → B. Pain in chest
alveoli C. Acidity
C. Larynx → pharynx → trachea → bronchi D. Shortness of breath
→ alveoli E. Weight loss
D. Pharynx → larynx → trachea → bronchi →
alveoli 15. During inhalation
A. The diaphragm flattens out, and the ribs
11. Which statement concerning transpiration is are raised
correct?
PAGE N0: 47
B. The diaphragm is raised, and the ribs are D. Wind
lowered
C. The diaphragm flattens out, and the ribs 21. The following are involved with plant
are lowered respiration
D. The diaphragm is raised, and the ribs are A. Stomata
raised
B. Chloroplasts
E. The diaphragm is raised, and the ribs are
C. Auxins
stationary
D. Geotropism
16. Gaseous exchange in Planaria takes place by
means of: 22. During inspiration, the path of air is:
A. Osmosis A. Nostrils - Pharynx-Bronchi - Trachea -
B. Diffusion Lungs
C. Breathing B. Nostrils -Bronchi- Pharynx- Trachea -
D. Active transport Lungs
C. Nostrils - Pharynx - Trachea - Bronchi -
17. Regarding the respiratory system in humans: Lungs
A. The trachea is completely surrounded by D. Nostrils - Pharynx - Lungs Trachea –
rings of cartilage Bronchi
B. The trachea divides into 3 bronchi
C. The vocal cords lie in the larynx 23. During inspiration, the path of air is:
D. The lungs are rigid structures with little A. Nostrils - Pharynx-Bronchi - Trachea -
elasticity Lungs
B. Nostrils -Bronchi- Pharynx- Trachea -
18. The function of oxygen in cellular respiration Lungs
is: C. Nostrils - Pharynx - Trachea - Bronchi -
A. To combine with hydrogen from organic Lungs
molecules to form carbon dioxide D. Nostrils - Pharynx - Lungs Trachea –
B. To combine with Carbon from organic Bronchi
molecules to form carbon dioxide
C. To oxidize ADP to ATP 24. Depletion of ozone layer is due to CFC which
D. To combine with glucose to form carbon release ________.
dioxide A. Cl- atoms
B. CO
19. Which of the following increase the rate of C. F
respiration most efficiently? D. ССl4
A. Lack of oxygen in the alveoli
B. Excess of carbon dioxide in the blood 25. The humidity in air is inversely proportional
C. Excess of carbon dioxide in the lungs to ________ process in plants.
D. Lack of oxygen in the tissues A. Transpiration
B. Respiration
20. Rate of transpiration varies with all the C. Photosynthesis
following except D. None of the above
A. Temperature
B. Decreased number of chloroplasts 26. Centers of cellular respiration in a cell is:
C. Light A. Mitochondrion
B. Cytoplasm
PAGE N0: 48
C. Golgi bodies
D. Ribosome 34. Ciliated epithelial cells in the nasal passages
are useful because they;
27. Which animal uses highly vascularized skin A. Filter dust and bacteria
for respiration? B. Provide the sense of smell
A. Fish C. Reduce the humidity of inhaled air
B. Frog D. Cool incoming air especially in summer
C. Snake
D. Anew borne mammal 35. The best method of determining the relation
of leaf - surface area to transpiration rat
28. In coughing the air is forcibly blown larynx would be to compare the transpiration rates
while in sneezing it is blown through: of:
A. Mouth A. Two identical geranium plant and one
B. Nasal cavities with the leaves removed
C. Both of these B. Two identical geranium plants exposed to
D. None of these different temperature.
C. A normal geranium plant and one whose
29. Earth Worms gaseous exchange occurs stomata have been closed by spreading
through: Vaseline over the lower epidermis of the
A. Lungs leaves.
B. Skin D. Identical geranium plants exposed to
C. Blood different wind velocities
D. Nephridia
30. Guttation is due to: 36. A person who is exercising breathes more
A. High Transpiration rapidly because:
B. Low Relative Humidity A. His lungs use up more energy
C. Negative Root Pressure B. His calorie production goes down
D. Positive root Pressure C. He gives off more CO2 which stimulates
the medulla
31. Which type of respiration is the most D. Glycogen in the muscles is converted to
effective in frog? glucose
A. Coetaneous
B. Lung 37. What is the percentage of Oxygen in a
C. Pulmo-cutaneous sample of exhaled air?
D. Through gills A. 20.96%
B. 16%
32. Which of the following is the most efficient C. 79%
way of respiration in frog: D. 4%
A. Pulmonary
B. Buccopharyngeal 38. In the soil, ammonia is converted to nitrites
C. Both bucco and pharyngeal by a bacterium called:
D. Coetaneous A. Nitrobacteria
B. Nitrosamines
33. If the level of CO2 and H+ ions increase in the C. Azotobacter
body the rate of breathing will: D. Clostridium
A. Increase
B. Decrease 39. The nerve which supplies diaphragm is
C. remains constant called:
D. Unstriated and voluntary A. Vagus nerve
PAGE N0: 49
B. Intercostal nerve D. up and out upwards
C. Diaphragmic nerve
D. Phrenic nerve 46. The adaptive feature (s) which help (s) the
fish to live in water include (s):
40. Which one of the following factors increases A. A tail and an air bladder
residual volume of lungs? B. Unpaired and paired fins
A. Aging C. Streamed lined body
B. Emphysema D. Gills and strong sense of smell
C. None of the above E. All of the above
D. Both of the above
47. The diagram represents the human
41. A person who is exercising breathes more respiratory system.
rapidly because:
A. His lungs use up more energy
B. His calorie production goes down
C. He gives off more CO2 which stimulates
the medulla
D. Glycogen in the muscles is converted to
glucose
E. His blood sugar level goes down
42. In which situation would transpiration be at

a minimum?
A. On a windy day Which structure (s) contain (s) muscles that
B. On a hot day contract when breathing in?
C. On a humid day A. X only
D. During dry season B. X and Y only
C. X and Z only
43. Bacteria in plague converts sugar into acid D. Y and Z only
which causes ________. E. X, Y and Z
A. Cavity
B. Dental Decay 48. The diagram shows a simplified nitrogen
C. Dental caries cycle. During which stage does
D. Gum Boil decomposition start?
44. Pharynx leads air into ______ through

glottis.
A. trachea
B. bronchus
C. alveoli
D. nasal sac
E. larynx
45. Which of the following describes the

movements involved in breathing out?
movements of ribs movements of diaphragm
A. A
A. down and in downwards
B. В
B. down and in upwards
C. C
C. up and out downwards
D. D
PAGE N0: 50
49. What happens to the volume of the thorax
and the air pressure in the lungs during
breathing in?
volume of Air pressure in
thorax lungs
A. decreases increases
B. decreases remains constant
C. increases increases
D. increases remains constant
E. increases decrease A. A=trachea, B=bronchus, C=respiratory
bronchiole, D=alveolar duct, E=alveoli.
50. Which row correctly shows the areas of the B. A=trachea, B=bronchus, C=alveolar duct,
gas exchange system that contain cartilage, D=respiratory bronchiole, E=atrium
ciliated epithelium and goblet cells? C. A=bronchus, B=alveolar duct,
cartilage ciliated goblet cells C=respiratory bronchiole, D=trachea,
epithelium E=alveoli
A. bronchiole, bronchiole, Bronchus, D. A=trachea, B=alveolar duct, C=respiratory
trachea trachea trachea bronchiole, D=bronchus, E=alveoli
alveoli
B. Bronchus, bronchiole, alveoli
trachea Bronchus trachea
UNIT NO. (14)
C. bronchiole, Bronchus, bronchiole,
trachea trachea Bronchus 1. Which of the following is NOT involved in cell
alveoli mediated immunity?
D. Bronchus, Nasal Bronchus, A. Helper T cells
trachea cavity, trachea
B. Cytotoxic T cells
trachea
C. Suppressor T cells
D. Memory T cells
51. The lower two pairs of ribs are _________.
A. True ribs
B. False ribs 2. Destruction of all beta cells in the pancreas
C. Floating ribs would cause:
D. Articulated ribs A. glucagon secretion to stop and a decrease
in blood glucose
52. In the diagram showing the bronchial tree B. glucagon secretion to stop and an
given below, parts have been indicated by increase in blood glucose
alphabets. Choose the answer in which the C. insulin secretion to stop and an increase
alphabets correctly match with the parts
in blood glucose
they indicate.
D. insulin secretion to stop and a decrease in
blood glucose
E. insulin secretion to increase and a
decrease in blood glucose
3. During the action potential:
PAGE N0: 51
A. the polarity of neurolemma first changes A. Cardiac output ... volume of blood
to -65 mv and then restores to +40 mv pumped per minute by the left ventricle
again B. Arterial systole ... contraction of the two
B. the polarity of neurolemma first changes atria
to +40 mv and then restores to -65 mv C. Heart murmur ... defect of heart valves
again D. Diastole ... phase of contraction of cardiac
C. the polarity of neurolemma first changes muscle
to -85 mv and then restores to +30 mv E. Right atrium in diastolic phase ... receives
again deoxygenated blood from vena cava
D. the polarity of neurolemma first changes
to +30 mv and then restores to -85 mv 7. In which form is carbon dioxide mainly
again transported in blood?
E. the polarity of neurolemma first changes A. As carbamino - haemoglobin
to 0 mv and then restores to +40 mv again B. As carbonic acid
C. As hydrogen carbonate
4. What role does pepsin play in digestion? D. In solution
A. It kills the bacteria of stomach
B. It converts soluble milk proteins into 8. The diagram shows a section through a
insoluble proteins kidney and associated blood vessels.
C. It converts starch and glycogen into
maltose
D. It activates the gastric glands to produce
gastric juices
E. It converts proteins into short chain
polypeptides
5. The diagram shows a generalized animal cell.

In which area is there the greatest rate of
Which structure would be involved in the
movement of fluid from the blood through
final secretion of digestive enzymes from this
the walls of blood vessels?
cell?
A. A
B. B
C. C
D. D
E. E
9. Which of the following terms describes the

process by which the plasma membrane
A. A
B. B moves substances inward against a
C. C concentration gradient?
D. D A. Facilitated diffusion
E. E B. Active transport
C. Osmosis
6. Identify the incorrectly matched pair: D. Simple diffusion
E. Autotropism
PAGE N0: 52
10. Pepsin İs a (n) _________, secreted by the D. facilitated diffusion
________.
A. enzyme ... stomach 16. Pancreatic lipase is involved in the digestion
B. hormone ... pancreas of
C. antibody ... gall bladder A. starch
D. pigment ... skin B. protein
E. antigen ... blood C. fat
D. cellulose
11. Bile is stored in E. nucleic acid
A. Liver
B. Pancreas 17. If a plant utilized H2SO4 instead of water, the
C. Duodenum plant would release
D. Gall bladder A. CO2
E. Spleen B. H2O
C. O2
12. The outer protective covering of the heart is D. SO42-
called E. None of the above
A. epicardium
B. mesocardium 18. The hemoglobin of a person with sickle-cell
C. pericardium anemia differs from normal molecules of
D. peritoneum hemoglobin by one:
E. pleura A. monosaccharide, fructose
B. disaccharide, sucrose
13. Which valve action results from an increase C. fatty acid, glutamic acid
in pressure in the ventricles of the heart? D. lipid, oleic acid
A. The closing of all the heart valves E. amino acid, valine
B. The closing of semi-lunar valves
C. The opening of the bicuspid valve 19. The possible causes of atherosclerosis are:
D. The opening of the semi-lunar valves A. Hypertension
E. The opening of the tricuspid valve B. A high serum cholesterol level
C. Family history of arterial disease
14. White blood cells picking up foreign bodies D. Physical inactivity
from the blood stream is an example of: E. All of the above
A. Pinocytosis
B. Exocytosis 20. The utilization of the absorbed food
C. Phagocytosis molecules within the cells to provide energy
D. Osmosis for tissue building is called
E. None of the above A. Digestion
B. Assimilation
15. Which process allows the movement of C. Egestion
molecules that are too large to enter D. Absorption
through a cell surface membrane? E. Ingestion
A. active transport
B. endocytosis
C. exocytosis
PAGE N0: 53
21. Plaque when combines with certain
chemicals in the saliva, it becomes hardened 26. Which cells become memory cells in the
& calcified forming a hard deposit known as: immune response?
A. Molar I. B-lymphocytes
B. Dental caries II. T-lymphocytes
A. c. Calculus III. Phagocytes
C. Gingivitis A. I only
D. Dentine B. II only
C. I and II only
22. A patient is having an epigastric discomfort D. II and III only
following meals, characterized by: E. I, II and III
I. Heart burn
II. Flatulence 27. After starch is ingested, in which order do
III. Nausea & vomiting S (he) is suffering these processes occur?
from a disorder known as: A. absorption → assimilation → digestion
A. Constipation B. absorption → digestion → egestion
B. Piles C. assimilation → digestion → absorption
C. Hemorrhoids D. digestion → absorption → assimilation
D. Dyspepsia E. assimilation → absorption → digestion
E. Food poisoning
28. The diagram show a section through the
23. In type-I diabetes: human heart.
A. Alpha cells are destroyed by the
lymphocytes
B. The beta cells are destroyed by the
lymphocytes
C. Level of insulin is close to or above normal
D. The acid base balance of the body is
maintained
24. Which features enable the aorta to What happens as blood is being pumped out
withstand ventricular systole? of the heart?
A. collagen fibres and elastin fibres Vessel through which
Semi-lunar Valves
B. collagen fibres and smooth muscle blood passes to the lungs
C. elastin fibres and endothelium A. Open 1
D. endothelium and smooth muscle B. Open 2
C. Closed 1
D. Closed 2
25. Which features enable the aorta to
29. The valve present between left auricle and
withstand ventricular systole?
left ventricle is called:
E. collagen fibres and elastin fibres
A. Tricuspid
F. collagen fibres and smooth muscle
B. Bicuspid
G. elastin fibres and endothelium
C. Auriculo-ventricular valve
H. endothelium and smooth muscle
PAGE N0: 54
D. Chordae tendinae D. Avoid walking bare footed
E. Both A and B E. All of the above
34. The stomatal pore will open when the

30. Which of the following choices correctly A. Turgor of the guard cells decreases
illustrates the course that a piece of bread B. Turgor of the guard cells increases
takes though the digestive tract? C. Leaf is kept in the dark
A. Mouth → trachea → esophagus → cardiac D. Amount of CO2 in the guard cells increases
sphincter → stomach → pyloric sphincter E. Atmosphere becomes heavy with water
→ small intestine → large intestine → vapor
rectum → anus 35. In cockroaches, the portion from pre-oral
B. Mouth → pharynx → esophagus → cavity to gizzard is known as _________.
cardiac sphincter → stomach → pyloric A. Proctodaeum
sphincter → small intestine → large B. Mesenteron
intestine → rectum → anus C. Stomodaeum
C. Mouth → pharynx → esophagus → pyloric D. Maxillae
sphincter → stomach → cardiac sphincter E. Mandibles
→ small intestine → large intestine →
rectum → anus 36. The diagram shows some organs of the
D. Mouth → pharynx → esophagus → digestive system.
cardiac sphincter → stomach → pyloric
sphincter → small intestine → large
intestine → anus → rectum
31. An example of partial root parasite is:

A. Loranthus
B. Viscum
C. Cuscuta
D. Sandal wood tree
E. Orobanche
32. Malpighian body is composed of:

A. Bowman's capsule & glomerulus
B. Pyramids & pelvis
C. Pelvis & medulla
D. Hilus & medulla Where is amylase present?
E. Nephron & medulla A. 1, 4 and 5
B. 1, 2 and 3
33. The proper measurements taken to avoid C. 2, 6 and 4
the diseases caused by parasitic worms D. 3, 5 and 4
include:
A. Hygienic living 37. Humoral immunity is carried by a special
B. Careful use of edibles group of cells called:
C. Thorough cooking of meat A. B-cells
PAGE N0: 55
B. Killer cell C. Increased permeability of cells to glucose
C. Helper cell D. Increased cholesterol in blood
D. Null cells
44. Which one of the following possesses the
38. A part of the digestive system that is not in most prominent Golgi apparatus?
contact with food is the: A. An islet of Langerhans
A. Small intestine B. A retinal rod cell
B. Stomach C. A striated muscle
C. Liver D. A xylem tracheid
D. Large intestine
E. Trachea 45. The manufactured food is transported to
various regions by a process called:
39. All of the following protect the body against A. Translocation
the entrance of germs except: B. Transpiration
A. Tears C. Osmosis
B. Mucous membranes D. Diffusion
C. Ciliated cells
D. White blood cells 46. Sugar is stored in the liver as:
E. Red blood cells A. Starch
B. Glycogen
40. Microtubules perform all of the following C. Maltose
except: D. Cellulose
A. A Transport of molecule
B. Movement in cilia and flagella 47. Circulatory system in grass hopper is of
C. Movement of chromosomes A. Hemi open type
D. Protein synthesis B. Open type
C. Close type
D. Hemi close type
41. The heart
48. The uptake of minerals in a plant occurs
A. Pumps blood at a constant rate through
B. Oxygenate blood A. Root hair
C. Is under some amount of voluntary B. Root cap
control C. Coot tip
D. Is stimulated by SA node D. Stomata
E. Guard cells
42. All the following are true about the skin
except, 49. Animal with open circulatory system:
A. It is the largest organ in the body A. Cockroach
B. Frog
B. Vitamin E is synthesized here
C. Snake
C. It performs both secretary and excretory
D. Duck billed platypus
functions
D. Melanin is synthesized here
50. 50% of blood volume is:
A. Plasma
43. Insulin causes; B. Formed elements
A. Increased blood sugar C. Cells
B. Increased calcium deposition in bones D. Both b and c
PAGE N0: 56
C. The blood vessels that contain elastic
51. pH of blood is about: lamina
A. 7.35 D. The blood vessels that contain no valves.
B. 7.00
C. 7.85 58. Which one of the following tissues contains
D. 7.66 cells, which are long, cylindrical have
perforated end walls and some living
52. Ascent of sap is governed by the activity of contents, and cells which are either,
the living cell in the form of pulsatory. This relatively unspecialized, long and thin with
theory is called: dense cytoplasm, or possess lignified walls
A. Physical force theories and no living contents?
B. Passive force theories A. Collenchyma
C. Vital force theories B. Phloem
D. Active force theories C. Parenchyma
D. Xylem
53. Which one of the following plants store
59. Concerning the valves of the heart:
water in their parencymatous cells?
A. The mitral valve is tricuspid
A. Succulent Plants
B. The pulmonary valve closes just after
B. Angiosperms Plants
systole
C. Gymnosperms Plants
C. The semilunar valves guard the
D. Xerophytic Plants
atrioventricular openings
D. The aortic valve opens during diastole
54. Following are the characteristics of arteries
except: 60. Regarding white blood cells
A. They are deep A. The have a regular disc - like shape
B. They don't have valves B. All types have lobed nuclei
C. They have narrow lumen C. The contain granules
D. They are thin walled D. They can be found outside blood vessels
55. Hiroden anti-clotting factor is found in: 61. The heart beat:
A. Leech A. Is initiated in the AVN
B. Earthworm B. Is slowed by the sympathetic nervous
C. Wuchereria system
D. Nereis C. Is slowed by the parasympathetic nervous
system
56. Tissue fluid don't contain: D. Propagated in the atria by Purkinje fibers.
A. WBC
B. Glucose 62. The chemical structure of Insulin was studied
C. Amino acid by:
D. Fibrinogen A. Avery
B. Sanger
57. In examining of tail of a living goldfish with a C. Tantrum
microscope, the capillaries can best be found D. Rutherford
by looking for.
A. The small blood vessels in which there is a 63. The absorption of water and mineral coming
pulsating flow of blood in roots is controlled by
B. The blood vessels in which red blood A. Root hairs
corpuscles pass through in single file. B. Root cambium
PAGE N0: 57
C. Endodermis B. Sanger
D. Spongy Mesophyll C. Tantrum
D. Rutherford
64. The volume of blood in the average adult is: E. Mendel
A. 3 L
B. 4 L 71. Human insulin is a product of:
C. 5 L A. Biotechnology
D. 7 L B. Fermentation
C. Gene sequencing
65. Average diameter of capillaries is D. Genetic Engineering
A. 10 micrometers E. Transcription
B. 10 nanometers
C. 10 millimeters 72. Which one of the following is the major force
D. 10 picometers involved in the ascent of water from the
roots to the leaves of plants?
66. The normal pulse pressure is: A. Root pressure
A. 20 B. Active transport
B. 40 C. Capillary action
C. 30 D. Transpiration pull
D. 35
73. Which of the following does not use its
67. In sickle cell anemia, the amino acid glutamic blood to carry oxygen?
acid of Hb is replaced by ________. A. Man
A. Glycine B. Fish
B. Serine C. Grasshopper
C. Valine D. Frog
D. Aspartic acid
74. The massive accumulation of blood with is a
68. A person with insufficient iron in his diet tissue is called as:
may become anemic because: A. Haemorrhage
A. Not enough oxyhemoglobin is formed in B. Haematoma
the liver C. Hepatoma
B. Iron is used in building hemoglobin D. Haemaccel
C. Iron is used in making fibrinogen E. Haematemesis
D. Iron enhances blood production
E. Iron enhances oxygen uptake 75. Haemoglobin carries more oxygen than
plasma by:
69. The heart beat: A. 50 times
A. Is initiated in the AVN B. 20 times
B. Is slowed by the sympathetic nervous C. 70 times
system D. 100 times
C. Is slowed by the parasympathetic nervous E. 200 times
system 76. The volume of blood which is pumped by the
D. Propagated in the atria by Purkinje fibers left ventricle into the systemic circuit in one
E. Is propagated through chordae tendinous minute is called ________.
A. Cardiac Output
70. The chemical structure of Insulin was studied B. Cardiac Input
by: C. Pulmonary Output
A. Avery D. Pulmonary Input
PAGE N0: 58
A. С. Liver
77. Heart contraction is regulated by ________. C. lungs
A. Pace maker D. spleen
B. Sarcomere
C. Mitochondria 82. The diagram shows how water is lost from a
D. Myosin leaf:
78. Lateral meristem are composed of ________

and phellogen tissues.
A. Phloem water
B. Cambium vapour
C. Xylem
D. Inter Xylem By which process is the water lost?
A. osmosis
79. Which valve action results from an increase B. photosynthesis
in pressure in the ventricles of the heart? C. translocation
A. The closing of all the heart valves D. transpiration
B. The closing of semi-lunar valves E. transcription
C. The opening of the bicuspid valve
D. The opening of the semi-lunar valves 83. Which diagram illustrates the process of
E. The opening of the tricuspid valve active transport?
80. The diagram shows a model to demonstrate
the mass flow hypothesis of translocation.
In a plant, what are the structures w, X, Y

and z and what is the direction of flow of
solution along W?
Direction
Phloem Xylem Roots Leaves of flow
along W
From Z
A. W X Y Z
to Y
From Y
B. W X Z Y
to Z
From Y
C. X W Y Z
to Z
From Z
D. X W Z Y
to Y
81. In the human body, blood circulating from
the gut to the heart passes through the:
A. Aorta
B. kidneys
PAGE N0: 59
84. The table refers to blood vessels in the 87. About 55% of the volume of human blood is:
human body. A. plasma
blood carried B. blood proteins
oxygenated/ C. blood cells
Vessel
from to deoxygenated D. both B & C
all 88. Leukaemia is associated with increased

aorta organs oxygenated number of _______ in blood.
p
except A. Erythrocytes
lungs B. Basophils
C. Eosinophils
pulmonary D. Leucocytes
lungs heart Q
vein
hepatic 89. Pepsin works best at a pH of _________.
aorta R oxygenated
artery A. 1
hepatic alimentary B. 1.1
liver S C. 1.3
portal vein canal
D. 1.4
What are P, Q, R and S? 90. One type of congenital heart defect is called
atrial septal defect (ASD) where the left and
P Q R S
right atria are not completely separated. ASD
left deoxygen deoxygenate usually result right atrium. This will cause
A. Kidney
ventricle ated d increased blood pressure in the right atrium
and decreased blood pressure in the left
left oxygenat deoxygenate
B. liver atrium. Which of the following rows
ventricle ed d
describes the other effects of ASD on blood
right deoxygen pressure and oxygenation?
C. Kidney oxygenated %
ventricle ated blood
blood oxygenation
pressure in
right oxygenat pressure in of
D. liver oxygenated pulmonary
ventricle ed systemic blood in
artery
aorta pulmonary
artery
85. An example of passive acquired immunity is: A decreased increased decreased
A. vaccination against smallpox B decreased increased increased
B. use of polio vaccine C increased decreased decreased
C. passing of certain antibodies to the fetus D increased decreased increased
by the pregnant woman
D. inoculation of antitoxin in case of a 91. The condition due to loss of appetite for
puncture wound food is termed as:
E. both C & D A. Anorexia nervosa
B. Bulimia nervosa
86. Which of the following are found in both C. Colour blindness
arteries and capillaries? D. Retarted growth
A. collagen fibers
B. elastic fibers 92. The diagram shows some of the organs of
C. endothelial cells the human body.
D. smooth muscle cells
PAGE N0: 60
Hence, the digestive system is complete. The
mouth lies at the base of the pre-oral cavity
which is bounded by the mouth parts ...Q...
(Upper lip) ...R... (lower lip), mandibles and
maxillae. The …S… pick up and bring food to
the …Т...for mastication.
Antennae Maxillae Labium Mandibles
Mandibl
Labrum Antennae Maxillae Labium
es
A
P Q R S T
.
B
Q P S R T
.
C
R S Q P T
.
D
S R Q T P
.
In which organs does the digestion of
carbohydrates take place?
A. P and Q 96. The diagram shows the teeth of the lower
B. P and R jaw of a human. Which tooth is an incisor?
C. Q and R
D. Q and S
93. Which of the following are animals with

pointed ends and a tube like digestive track?
A. Annelida
B. Arthropoda
C. Nematode A. A
D. Mollusca B. В
C. С
94. Movement of ions and large molecules with D. D
the help of protein molecules in and out of
cell is called _________. 97. The diagram shows a tree trunk, with a ring
A. Diffusion of bark, which includes the phloem,
B. Facilitated diffusion removed.
C. Passive transport
D. Osmosis
95. Five words are shown below:

Labium Maxillae Labium Ring of bark
Mandibles Antennae removed
These words can be used in the spaces P, Q,
RS and T to complete the sentence below.
Cockroaches are omnivorous and can eat any
kind of organic matter. They search their
food by their ...P.... Their digestive system is The tree will eventually die because this
tubular, having a straight slightly coiled action cuts off the supply of:
digestive tube opening at both the ends. A. Mineral salts to the leaves.
PAGE N0: 61
B. Organic nutrients from the leaves. 101. Which of the following processes occur in
C. Oxygen to the roots. the vascular tissue in leaves and in roots?
D. water to the leaves In leaves In roots
A Sucrose enters
Water passes from
phloem and is
A. phloem to xylem by
98. The table shows the characteristics of the polymerized to
osmosis
blood in one blood vessel in the body. starch
Sucrose enters
oxygen carbon pressure phloem by active Root pressure &
concentration dioxide transport and the transpiration pull
B.
high low high water potential are responsible for
becomes more ascent of sap
negative
Which blood vessel contains blood with Water passes from
these characteristics? Active transport of
phloem to xylem by
A. aorta water into the
osmosis, make the
C. xylem makes the
B. pulmonary artery phloem water
water potential
C. pulmonary vein potential less
more negative
D. vena cava negative
Active transport of
Water passes out of
99. The following reaction occurs in the human salts into the
and phloem and is
gastro-intestinal tract. D. pericycle makes the
lost through
water potential
transpiration
catalyst there high
starch products
What are the catalyst and the product?
Catalyst Product 102. Which method of gaining immunity can be
A. acid glucose described as natural active immunity?
B. alkali energy A. Feeding on colostrum
C. amylase maltose B. Inhaling the chicken pox virus
D. bile amino acid C. Injection with antibodies
D. Through the placenta
100. Atherosclerosis is disease of:
A. Immune system 103. During ventricular systole:
B. Arterial wall A. Oxygenated blood is pumped into the
C. Venal wall aorta and deoxygenated blood is pumped
D. Lungs into the pulmonary vein.
B. Oxygenated blood is pumped into the
pulmonary artery and deoxygenated
blood is pumped into the aorta.
C. Oxygenated blood is pumped into the
aorta and deoxygenated blood is pumped
into the pulmonary artery.
D. Oxygenated blood is pumped into the
pulmonary artery and deoxygenated
blood is pumped into the pulmonary vein.
PAGE N0: 62
BOOK 2 MCQS
C. Vasopressin is secreted by posterior
pituitary gland
UNIT NO. (01) D. Aldosterone increases the reabsorption of
potassium ions in the nephron
1. Blood pressure in the glomerulus is E. Parathormone increases the reabsorption
_________ because diameter of efferent of sodium ions in nephron
arteriole is ________ that of afferent arteriole.
5. An animal cell and a plant cell are placed
A. low ... much less than in distilled water. The animal cell swells and
B. high ... much less than bursts, while the plant cell swells but does not
C. low ... much greater than burst. What accounts for this difference?
D. high ... much greater than A. Animal cells have no cell wall.
E. normal ... is equal to B. Animal cells have no vacuole.
C. Plant cell surface membranes are partially
2. The diagram shows a section through a permeable.
kidney and associated blood vessels. D. Plant cell walls are freely permeable.
6. Which one of the following structures is

present in a human nephron?
A. Urethra
B. Ureter
C. Flame cell
D. Bowman's capsule
E. Malpighian tubule
In which area is there the greatest rate of
movement of fluid from the blood through the
7. Flame cells are the _______ organs in
walls of blood vessels?
planaria.
A. A
A. Reproductive
B. B
B. Respiratory
C. C
C. Digestive
D. D
D. Locomotory
E. E
E. Excretory
3. Ultra-filtration of blood occurs in
8. All of the following are parts of a
A. Bowman's capsule
nephron except:
B. Proximal convoluted tubule
A. Bowman's capsule
C. Distal tubule
B. Proximal convoluted tubule
D. Afferent arteriole
C. Loop of henle
E. Efferent arteriole
D. Glomerulus
E. Glottis
4. Which of the following statement is
correct?
9. Of the following, which one best
A. Aldosterone is secreted by adrenal
describes phenylketonuria?
medulla
A. a vitamin deficiency resulting in abnormal
B. Parathormone is secreted by thyroid
metabolism of proteins
gland
PAGE N0: 63
B. an inherited metabolic disorder resulting A. Stomach
in a lack of an enzyme B. Brain
C. a mineral deficiency resulting in abnormal C. Kidney
bone formation D. Liver
D. an abnormal shape in red blood cells
E. a chronic disease of unknown causes 15. Hemoglobin is:
A. Respiratory pigment
10. The diagram shows a nephron of the B. Excretory pigment
mammalian kidney. Which labeled region is
C. Digestive pigment
mainly responsible for active reabsorption of
D. Storage pigment
blood?
16. The excretory organs in insects are:
A. Flame cell
B. Malpighian tubules
C. Contractile vacuoles
D. Kidneys
17. The kidney does not perform the function of:

A. Regulation of blood pressure
A. A
B. B B. Secretion of bile
C. C C. Regulation of pH
D. D D. Homeostasis
E. E
18. The protoplasm is shrinked in the solution
11. Method in which ultrasonic waves are used of:
to break up calculi is called: A. Normal saline solution
A. Kidney transplant B. Isotonic solution
A. 3. Hemodialysis C. Hypotonic solution
B. Lithotripsy D. Hypertonic solution
C. Peritoneal dialysis
D. Artificial pacemaker 19. Human liver secretes _______.
A. Bile
12. The tube that brings urine from the kidneys
B. Pepsin
to the bladder is the
C. Vit D
A. Urethra
B. Ureter D. Cholecystokinin
C. Uterus
D. Eustachian tube 20. In earthworm the absorptive ridge which
E. Bile duct runs along the dorsal side of intestine is
A. Villi
13. Excretory system of grasshopper consists of: B. Typhlosole
A. Naphridia C. Vessel
B. Flame cells D. None
C. Malpighian tubules
D. Kidneys 21. The pressure which cell contents exert on
cell wall:
14. The major metabolic factory, detoxification A. Turgor pressure
center and storage organ of body is: B. Wall pressure
PAGE N0: 64
C. Suction pressure 29. Sliding filament theory of muscle contraction
D. Osmotic pressure was given by:
A. Rudolf Virchow
22. The internal maintenance in human: B. Sheldon & Schwann
A. Homeostasis C. Huxley
B. Polyploidy D. Robert Brown
C. Excretion
D. Epistaxis 30. The process of Hemodialysis takes about:
A. 1-2 hrs
23. The ability of cell to swell after absorption of B. 24 hrs
H2O: C. 6 -10 hrs
A. Inhibition D. More than 24 hrs
B. Deplasmolysis
C. Guttation 31. What is the connection b/w Renal pelvis &
D. Transpiration urinary bladder?
A. Pyramids of medulla
24. Which of the following is not a requirement B. Renal vessels
for seed germination? C. Ureter
A. Oxygen D. Urethra
B. Water 32. The following are all functions of the liver
C. Abscisic Acid except
D. Temperature A. Detoxification of drugs
B. Excretion of urea
25. The chemical formula of Uric acid is: C. Bile production
A. (NH2)2CO D. Storage of vitamins
B. NH2.CO.NH2
C. C5O3N4H4 33. Turgor movements are:
D. C6O4N2H2 A. Irreversible
B. Reversible
26. Which secretion neutralizes the acidity of C. Unidirectional
urethra? D. all of the above
A. Urine
B. Testosterone 34. Protonephridia:
C. Sperms A. are the excretory organs of earthworms
D. Semens B. are open at both ends
C. is surrounded by blood capillaries
27. Renal vessels leave kidney at: D. are made up of flame-cells bathed in
A. Hypocotyl tissue fluid
B. Hilus
C. Vasa Recta 35. Plasmolysis of ceil occurs in which
D. Pyramids environment:
A. Hypotonic
28. Urine contains urea in a concentration of B. Hypertonic
about: C. Isotonic
A. 95% D. Hypo osmotic
B. 0.3 - 0.7%
C. 2% 36. During hot temperature, for
D. 5% thermoregulation the muscle arrector pili of
skin:
PAGE N0: 65
A. Contracts 43. The urine contains ________ urea.
B. Relaxes A. 1%
C. Neither contract nor relax B. 2%
D. None of the above C. 3%
D. 4%
37. Radiotherapy and chemotherapy is used in;
A. Cancer 44. The diagram shows the human urinary
B. AIDS system.
C. HIV
D. All of them
38. Which of the following is an excretory X

product?
A. Mucus
B. Carbon
C. Farces
D. Sweat
Which substance is not found in the liquid at X in
39. A red blood cell neither swells nor shrivels in a healthy person?
blood plasma. This statement signifies that A. glucose
blood plasma is; B. salt
A. An isotonic solution C. toxins
B. A hypertonic solution D. water
C. A hypotonic solution
D. 95% water 45. The diagram represents two liquids,
separated by a membrane through which
40. Deamination in the liver initially produces: osmosis can occur.
A. ammonia
membrane
B. arginine
C. ornithine
left right
D. urea key
E. uric acid Molecule of water
41. Malpighian tubules are involved in excretion

in: Molecule of
A. Cockroach dissolved substance
B. Earthworm
C. Human
D. Planaria
E. Hydra
What movement of molecules will occur?
42. The disease in which patients passed urine A. Molecules of dissolved substance move
that rapidly turned exposure to air is called: from left to right.
A. Phenylketonuria B. Molecules of dissolved substance move
B. Alkaptonuria from right to left.
C. Sickle cell anaemia C. Overall, water molecules move from left
D. Hemophilia to right.
E. Anuria D. Overall, water molecules move from right
to left.
PAGE N0: 66
E. None of the above As the concentration of glucose solution in the
surrounding solution increases, which of the
46. The site and principle mechanism for the following statements are correct?
passage of glucose into the bloodstream in the I. Net diffusion of water increases.
human kidney is the: II. Glucose molecules reach an equilibrium
A. collecting duct ... by active secretion quicker.
B. distal convoluted tubule ... by passive III. There is less change in the volume of
diffusion surrounding solution
C. glomerulus ... by selective reabsorption IV. Net diffusion of glucose increases.
D. glomerulus ... by ultrafiltration A. I, II, III and IV
blood vessels in the sweat production B. I, II and IV only
surface of skin C. I and III only
A. constrict decreases D. II and III Only
B. constrict increases
C. dilate decreases 50. Which of the following correctly describes
D. dilate increases the thermoregulation in hot temperature?
E. proximal convoluted tubule ... by active
reabsorption 51. In an isotonic solution there would be:
A. No net movement of water
47. Urine formation is the result of: B. Net movement of water into the cell
A. ultra-filtration C. Net movement of water out of the cell
B. reabsorption D. Bursting of the cell
C. tubular secretion
D. all of the above 52. The tendency of a solution to take up water
when separated from pure water by a
48. The condition of a stable internal selectively permeable membrane is called:
environment in an organism is: A. Osmotic pressure
A. coordination B. Turgor potential
B. organization C. Diffusion pressure deficit
C. homeostasis D. Water potential
D. integration 53. The components of feedback mechanism are
A. Receptors, Insulators, Effectors
49. The diagram shows apparatus set up to B. Receptors, Suppressors, Effectors
investigate the effect of changing the C. Receptors, Control Centre, Effectors
concentration of glucose in the surrounding D. Receptors, Depressors, Effectors
solution on the movement of molecules through
a selectively permeable membrane (Visking
tubing) in 15 minutes.
UNIT NO. (02)
Visking tubing 1. The action of the roots of a tree in
growing into a drain pipe is an example of:
A. positive hydrotropism
Surrounding B. negative hydrotropism
solution different 10 % glucose C. positive geotropism
solution D. negative geotropism
concentrations
E. negative phototropism
from 1% to 10%
glucose solution 2. The bones at joints are held together by a
tissue, the
A. Tendons
PAGE N0: 67
B. Connective tissue D. 12 thin filaments
C. Joints E. 14 thin filaments
D. Ligaments 9. What is the correct sequence of the
bones in the arm of a mammal, from the hand to
3. Which of the following statements about the shoulder?
skeletal muscle tissue is true? Hand → shoulder
A. In the muscle fiber, action is the thick A. A. humerus radius scapula
filament. B. The sarcoplasmic reticulum B. B. humerus scapula radius
stores Ca2+ within a muscle cell. C. C. radius humerus scapula
B. In a muscles fiber, myosin is the thin D. D. scapula radius humerus
filament.
C. Contraction of a muscle fiber can occur in 10. Identify the bones in which the connecting
the absence of Ca2+. joints are immovable:
A. Phalanges
4. A muscle that bends a joint is termed as: B. Wrist
A. flexor C. Arm
B. insertion D. Skull bones
C. tonus
D. diastole 11. Which one of the fallowing is not true?
E. extensor A. The joints of elbow & knee are hinge
joints
5. The movement of plants in response to B. The joint cavity is fitted with lubricating
touch stimulus is called: synovial fluid
A. hydrotropism C. Bones of the skull are connected through
B. chemotropism fixed joints
C. geotropism D. Hips & shoulder joints are the example of
D. thigmotropism ball and socket joints
E. Phototropism E. Cells of bones are called osteoblasts
6. The number of muscles in a human body 12. The number of tarsals and metatarsals in
is about: human feet are:
A. 200 A. 14 and 10
B. 300 B. 16 and 10
C. 400 C. 14 and 16
D. 500 D. 28 and 14
E. 600 E. 28 and 16
7. The total number of bones in a human's 13. The diagram shows the bones and muscles of
skeleton is the upper-arm.
A. 207
B. 206
C. 208
D. 205
E. 203
8. Each myosin filament is surrounded by:

A. 4 thin filaments What must happen for the bones in the lower
B. 6 thin filaments arm to move in the direction of the arrow?
C. 8 thin filaments
PAGE N0: 68
A. Muscle X contracts and muscle Y B. Acetyl chlorine
contracts. C. ATPs
B. Muscle X contracts and muscle Y relaxes. D. Calcium ions
C. Muscle X relaxes and muscle Y contracts. E. Lactic acid
D. Muscle X relaxes and muscle Y relaxes.
20. Five hip vertebrae fuse together to make:
14. Select the correct statement: A. coccyx
A. The ankle has seven tarsals B. sacrum
B. Wrist contains nine small carpel bones C. phalanges
C. Fibula is the bone of thigh D. cranium
D. Four metatarsals are present in the sole E. femur
15. Which bones meet at the elbow joint and 21. How many bones are present in the wrist?
what kind of movement do they allow? A. Four bones
Bones Movement B. Six bones
A. humerus and scapula in one plane only C. Eight bones
B. humerus and scapula in three planes D. Ten bones
C. ulna and humerus in one plane only E. Many bones
D. ulna and humerus in three planes
22. Identify the correct statement:
16. When the knee moves back and forth as a A. Protractor and retractor muscles move
person walls, what keeps the surfaces of the leg the arm away from the body and towards
bones from rubbing against each other? the body.
A. The articular cartilage B. Abductor and adductor muscles move the
B. The bone marrow arm in forward and backward direction
C. The periosteum A. С. When biceps contract, elbow opens
D. A sheath of smooth muscle straight
E. Ligaments C. When triceps contract, elbow bends
D. None of the above
17. Obesity, muscle wasting, hypertension and
diabetes are the characteristics of: 23. The correct order of arrangement, in terms
A. Addison's disease of increasing complexity, of the following is
B. Turner's syndrome I. organ
C. Cushing's syndrome II. cell
D. Sickle cell anemia III. tissue
E. Huntington's disease IV. organism
V. system
18. Identify the bones in which the connecting A. II-I-III-IV-V
joints are immovable: B. II-III-IV-I-V
A. Phalanges C. II-III-I-IV-V
B. Wrist D. II-III-IV-V-I
C. Arm E. II-III-I-V-IV
D. Leg
E. Skull bones 24. The contraction of a muscle depends upon
I. Nerve impulse
19. Creatine Phosphate serves as muscle's II. Energy
reserve of high energy phosphate by providing III. Calcium ions
________. A. I only
A. Nerve impulses B. II only
PAGE N0: 69
C. I and III only within the cell membrane are sodium "leak"
D. II & III only channels. These channels would allow sodium to
E. I, II & III A. move out of the cell by simple diffusion
B. move into the cell by simple diffusion
25. Human cells maintain concentration C. move out of the cell by facilitated
gradients across their plasma membranes, such diffusion
that there is a high sodium concentration D. move into the cell by facilitated diffusion
outside the cell and a high potassium E. move into the cell by active transport
concentration inside the cell. Suppose that
within the cell membrane are sodium "leak" 29. Myofibrils:
channels. These channels would allow sodium to A. Are found in smooth muscles
A. move out of the cell by simple diffusion B. Are the smallest fibers that make up a
B. move into the cell by simple diffusion muscle?
C. move out of the cell by facilitated C. Are crossed by transverse Y-Bands
diffusion D. Cannot contract
D. move into the cell by facilitated diffusion
E. move into the cell by active transport
30. Vertebral column is the part of ________
skeleton.
26. The following sequence of events occurs at
the neuromuscular junction. A. Axial
nerve impulse → release of V → end plate B. Appendicular
potential → W produced in muscle fibre → X C. Exoskeleton
released from sarcoplasmic reticulum → D. Hydrostatic
formation of Y → muscle contraction
Which one of the following shows the correct 31. ________ Muscle pulls the limb outward
sequence from V - Y? away from the body.
V W X Y A. Adductor
action B. Protractor
A acetylcholine calcium ions actomyosin
potential
action
C. Abductor
B acetylcholine actomyosin calcium ions D. Extensor
potential
action
C actomyosin acetylcholine calcium ions
potential
32. The dark band in muscle fibers are due to:
action
D calcium ions acetylcholine actomyosin A. Actin
potential
E calcium ions actomyosin acetylcholine

action B. Myosin & Actin
potential
C. Tropomyosin
D. I – band
27. Which bones meet at the elbow joint and
what kind of movement do they allow?
33. Growth of pollen tube towards ovary is an
BONES MOVEMENT
A. Humerus and scapula Sliding example of ______ movement.
B. Humerus and scapula Back and forth A. Phototropic
C. Ulna and humerus Sliding B. Chemotactic
D. Ulna and humerus Back and forth C. Sensory
D. Mechanical
28. Human cells maintain concentration
gradients across their plasma membranes, such 34. Locomotion by pseudopodium is found in:
that there is a high sodium concentration A. Amoeba
outside the cell and a high potassium B. Chlamydomonas
concentration inside the cell. Suppose that C. Ciliates
PAGE N0: 70
D. Euglena A. Unstriated and involuntary
B. Striated and voluntary
35. An automatic, preprogrammed and C. Striated and involuntary
genetically inherited behavior is: D. Unstriated and voluntary
A. Learning
B. Instinctive 43. How many metacarpal bones are present in
C. Parental a lower limb of a human being?
D. Genetical A. 5
B. 7
36. The muscles which rotate the whole or part C. 2
of limb at one of its joint: D. None of these
A. Protractor
B. Retractor 44. Cardiac muscles are:
C. Rotractor A. Involuntary & Untreated
D. Rotator B. Voluntary striated
C. Involuntary & Striated
37. Positive geotropism by the: D. Skeletal muscles
A. Root
B. Stem 45. The example of gliding joints is:
C. Leave A. Ankle & Wrist
D. Flower B. Ribs
C. Vertebrae
38. ________ movement is due to touch D. Ball & Socket joint
response:
A. Thermonastic 46. The intra muscular injection at hip should be
B. Photonastic injected in:
C. Seisnmonastic A. Inner & lower quadrant
D. Thigmotropism B. Outer & upper quadrant
C. Sciatic nerve
39. Which one of the following is voluntary D. Iliac vein
muscle?
A. Biceps 47. Abductor muscular allow the arm to move:
B. Cardiac A. Towards the body
C. C. Stomach B. Away from the body
D. Vessels C. Upwards
D. Downwards
40. Ring Worm is caused by:
A. Bacteria 48. The physiological or functional contact
B. Virus between two neurons is called:
C. C. Neutrophils A. Neuroglia
D. Fungus B. Action potential
C. Synapse
D. RMR
41. Formation of annual ring is the result of the
activity of:
49. All are the bones of axial skeleton except
A. Cork Cambium
A. Scapula
B. Cork Cambium and Vascular cambium
B. Sternum
C. Intercalary meristem
C. Ribs
D. lateral cabium
D. Vertebrae
42. Lacteals requires which muscle to flow:
PAGE N0: 71
50. An increase in the diameter of an oak tree is 56. The causes of cyanosis include:
due to A. deficiency of vitamin C
A. Bark B. varicella zoster virus
B. Lenticel C. degeneration of the cartilage of joints
C. Cambium D. ventricular septum defect
D. Annual rings E. None of the above
51. The lower jaw is supported by a single bone 57. Which of the following bones are present in
called _________: the palm of hand?
A. Maxilla A. Carpals
B. Dentary B. metacarpals
C. Cranium C. Phalanges
D. Clavicle D. Tarsal
E. Radius
52. Secondary growth results from activity of
which meristem 58. Growth movement caused in response to
A. Apical gravitational stimulus is called:
B. Intercalary A. Nutation
C. Lateral B. Geotropism
D. All of the above C. Nastic movement
D. Tropic movement
53. An action potential in a muscle fiber causes E. Turgor movement
the release of Ca++ from:
A. Actin 59. Bones of the skull are joined by:
B. Myosin A. Fixed joints
C. Sarcolemma B. Sliding joints
D. Sarcoplasmic reticulum C. Pivot joints
E. Golgi bodies D. Hinge joints
E. Gliding joints
54. The muscles attached to the bones are:
A. voluntary and smooth 60. The endoskeleton is made up of _______ and
B. Involuntary and smooth ________.
C. Voluntary and striated A. Bones and cartilages
D. Involuntary and striated B. Muscles and Tissues
E. Smooth and striated C. Actin, Myosin
D. None
55. Identify the incorrect statement from the
following: 61. The disease in which bones remain soft and
A. Apical growth increases the length of get deformed is called ________.
stems and roots A. Goiter
B. Xylem is situated on the outer side of the B. Anaemia
cambium ring and the phloem on the C. Rickets
inner side D. Haemophilia
C. Secondary growth increases the diameter
of stems an root 62. The movement in plants is of two types’
D. The cells in elongation phase don't divide ________ and _________.
E. The cells in formative regions are closely A. Autonomic, paratonic
packed together B. Primary, Secondary
PAGE N0: 72
C. Free, Fixed A. Did. fixed joints
D. Parietal, regular D. pivot joints
63. The movement of plants in response to

touch stimulus is called: 68. The diagram shows some of the muscles and
A. hydrotropism bones of the human arm.
B. chemotropism
C. geotropism
D. thigmotropism
E. phototropism
64. The number of muscles in a human body is muscle Y muscle

about:
X
A. 200
B. 300
C. 400
D. 500 elbow
E. 600 joint
When muscle X contracts, what happens to the

65. When a physician elicits the knee-jerk reflex arm and what happens to muscle Y?
by tapping deep tendons in the knee, the normal arm muscle Y
response is for the leer leg to swing forward.
A. bends contracts
When this happens:
B. bends relaxes
A. Muscles in the front of the thigh are
D. straightens relaxes
contracting and muscles in the back of the
C. straightens contracts
thigh are relaxing
B. Muscles in the front of the lower leg are
69. Identify the bones in which the connecting
contracting and muscles in the back of the
joints are freely moveable joints:
lower leg are relaxing
A. Ankle
C. Muscles in the back of the thigh are
B. Wrist
contracting and muscles in the front of
C. Vertebrae
the thigh are relaxing
D. Elbow
D. Muscles in the back of the lower leg are
E. All of the above
contracting and muscles in the front of
the lower leg are relaxing
70. The phytohormones controlling the plant
movement is/are:
A. Auxins
66. How many metacarpals are present in the
B. Gibberellins
hand?
C. Abscisic acid
A. 4
D. Cytokinin
B. 3
E. All of the above
C. 6
D. 5
71. Nutritional deficiency (vitamin D deficiency)
E. 8
results in softening of the bones. This disease is
called:
67. Joints found at the vertebrae are:
A. Rickets
A. gliding joints
B. Cleft palate
B. sliding joints
C. Microcephaly
C. partially moveable joints
D. Down's syndrome
PAGE N0: 73
C. The hormones affect only certain "target"
72. Hinge-joint occurs in: organs
A. elbow D. It is involved in maintaining body
B. wrist homeostasis
C. ankle E. Its organs secrete hormones directly into
D. back bone the bloodstream rather than through
dusts
73. The radius and ulna join at the wrist with the
________ small carpal bones. 3. The hormone progesterone
A. 4 A. Stimulates follicle growth
B. 6 B. Stimulates FSH production
C. 7 C. Is solely responsible for the development
D. 8 of secondary sex characteristics
D. Is produced by the anterior pituitary
74. Which of the following statements describe E. Prepares the uterus for implantation
sliding joints?
I. These joints allow bone to slide over another 4. The structural and functional unit of
bone to make movement in many directions nervous system is
II. Vertebrae are linked by sliding joints A. Neuron
III. These joints don't allow the joining bones to B. Nerve
move C. Receptor
IV. Bones of ankle or wrist are connected by D. Effector
sliding joints E. Axon
A. I only
B. I & II only 5. The concentration of Na ions in the body
C. I & III only fluids is controlled by _______ hormone.
D. I &IV only A. ADH
E. I, II, III & IV B. parathormone
C. aldosterone
D. estrogen
UNIT NO. (03) E. thyroxin
1. When a sensory receptor receives a
threshold stimulus, it will do all of the following 6. The largest gland of the body is:
EXCEPT: A. Pancreas
A. become depolarized B. Liver
B. transduce the stimulus to an action C. Pituitary gland
potential D. Thyroid gland
C. inhibit the spread of the action potential E. Parathyroid gland
to sensory neurons
D. cause the sensory neurons to send action 7. Blinking of eye is an example of:
potentials to the central nervous system A. taxes
E. none of the above B. reflex
C. learning
2. All of the following are true about the D. insight learning
endocrine system EXCEPT E. imprinting
A. It relies on chemical messenger that travel
through the bloodstream 8. Hyperthyroidism is always associated
B. It is a control system that has extremely with
rapid effects on the body A. low blood pressure
PAGE N0: 74
B. severely diminished mental activity B. Anterior pituitary lobe
C. low metabolic rate C. Thalamus
D. low body temperature D. The posterior pituitary lobe
E. increased heart rate E. Medulla oblongata
9. In a reflex arc: 15. The phytohormones controlling the plant

A. the sensory neuron synapses directly with movement are:
the motor neuron A. Auxins
B. sensory and motor neuron can synapse B. Gibberellins
outside of the spinal cord C. Abscisic acid
C. sensory neurons synapse in the brain D. Cytokinin
D. the motor response occurs without E. All of the above
synaptic delay
E. а minimum of three neurons must 16. The region where the impulse moves is
participate called synapse. It consists of:
A. The axon terminals, synaptic cleft & the
10. Which of the following associations of brain dendrite of other neuron
structure and function is false? B. Sensory neuron, motor neuron & axon
A. hypothalamus: appetite C. Myelinated & unmyelinated neurons
B. cerebellum: motor coordination D. Soma & Nissl substance
C. cerebral cortex: higher intellectual E. None of the above
function
D. medulla: basic emotional drives 17. Which of the following pairings is correct?
A. Sensory nerves ... afferent nerve pathway
11. Pick the odd one out: B. Motor nerves ... efferent nerve pathway
A. Aorta C. Motor nerves ... afferent nerve pathway
B. Arteries D. Sensory nerves ... efferent nerve pathway
C. Capillaries E. Both A & B
D. Veins
E. Nephron 18. Which of the following associations between
the hormone and its role is FALSE?
12. _______ are responsible for secondary A. Estrogen-development of secondary
sexual characters in male. sexual characteristics
A. Cortisol B. Progesterone-development and
B. Androgens maintenance of endometrial walls
C. Thyroid glands C. LH-stimulate ovulation
D. Glucagon D. FSH-formation of the ovarian follicles into
E. Aldosterone the corpus luteum
13. The strong contractions of uterus muscles 19. Which part of the central nervous system
are controlled by a hormone called _______. controls the body's water balance?
A. Cortisol A. cerebellum
B. Progesterone B. cerebrum
C. Insulin C. hypothalamus
D. Testosterone D. medulla
E. Oxytocin
20. Adrenal gland is located:
14. The antidiuretic hormone is released from: A. At the side of the kidney
A. Hypothalamus B. On the top of each kidney
PAGE N0: 75
C. On lower side of the liver E. Testosterone
D. At the end of the pancreas
E. Near the gall bladder 25. Based on the peak levels of hormone X, on
what day of the cycle is ovulation most likely to
21. _________ are the cells that separate occur?
neurons from each other and form myelin A. Day 21
sheath. B. Day 14
A. Soma C. Day 12
B. Axon D. Day 25
C. Inter neurons E. Day 28
D. GIial cells
E. Nissl substance 26. The hormone labeled Y in the diagram is:
A. progesterone, secreted by the corpus
22. _______ pairs of cranial nerves and _______ luteum after ovulation has occurred
pairs of spinal nerve constitute peripheral B. progesterone, secreted by the ovary after
Nervous system in man. ovulation has occurred
A. 6 ... 2 C. estrogen, secreted by the corpus luteum
B. 12 ... 24 after ovulation has occurred
C. 24 ... 12 D. estrogen, secreted by the ovary after
D. 31 ... 12 ovulation has occurred
E. 12 ... 31 E. estrogen, secreted by the follicle before
ovulation occurs
23. A nerve cell that receives stimuli from the
outside is known as a (n): 27. The pituitary gland secretes of the following
A. Motor neuron except:
B. Sensory neuron A. Growth hormone
C. Efferent neuron B. Calcitonin
D. Interneuron C. Prolactin
E. Ganglion D. Oxytocin
Questions 24-26 28. Thyroid stimulating hormone levels:

A. Would be raised in a person with
hyperthyroidism
B. Would be low in patients with
hypothyroidism
C. Would be low in patient with
hypothyroidısm
D. Would be unaffected in hypothyroidism
29. Retina contains light sensitive receptor cells

called:
24. The hormone labeled X in the diagram is A. Rods
often used in over -the- counter diagnostic tests B. Cones
to determine when ovulation has occurred. This C. Both rods and cones
hormone is: D. Optic nerves
A. estrogen
B. progesterone 30. Removal of the thyroid gland in an adult
C. FSH would cause an increase in:
D. LH A. BMR
PAGE N0: 76
B. Conversion of glycogen to glucose C. Adrenal gland
C. Excretion of Na+ from the kidney D. Islet of Langerhans
D. Secretion of TSH
38. Under secretion of thyroxine in infants
31. An action potential in a muscle fiber causes causes ________.
the release of calcium ions from A. Cretinism
A. Actin B. Dwarfism
B. Myosin
C. Gigantism
C. Sarcolemma
D. Osteoporosis
D. Sarcoplasmic reticulum
32. The motor nerve cell transmits impulses 39. Rods and cones (photoreceptor cells) are
from present in
A. Iris
A. The effector organ to the spinal cord
B. Pupil
B. Receptor cells to the spinal cord
C. Cornea
C. Receptor cells to the effector organ D. Retina
D. Spinal cord to the effector organ
40. Adrenal glands are found adjacent to:
33. Removal of the thyroid gland in an adult A. Kidney
would cause an increase in, B. Heart
A. Basal metabolic rate C. Lungs
B. Conversion of glycogen to glucose D. Liver
C. Excretion of Na+ from the kidney
D. Secretion of TSH 41. Sensors that receive stimulus:
A. Receptor
34. The active visual receptor of the eye are: B. Neuron
A. Iris & Pupil C. Effector
B. Iris & Lens D. All of the above
C. Rods & Cones
42. Which of the following is not a reflex action?
D. Cornea & Retina
A. Eye blink
B. Knee jerk
35. The natural clock in the human body: C. An animal salivating spontaneously as the
A. Pineal body bell rings without given food
B. Medulla D. Watering of mouth at the sight of food
C. Pons
D. Cerebellum 43. When your hand touches the hot body,
which path is taken by stimulus to withdraw
36. The forebrain is divisible into two your hand?
components: A. Sensory Neurons → Spinal Cord → Brain →
A. Cerebellum and Cerebral hemisphere Muscle.
B. Medulla and Pons B. Sensory Neurons → Spinal Cord → Muscle
C. Telencephalon and Diencephalons C. Sensory Neurons → Brain → Spinal Cord →
D. Telencephalon and Medulla motor Neuron
D. Hot Object → Spinal Cord → Hand
37. Sugar level in blood is maintained by:
44. The phytohormone responsible for Fruit
A. Liver
development, bud sprouting, development of
B. Kidney pollen tube and parthenocarpy is:
PAGE N0: 77
A. Oxin D. Cushing's disease
B. Gibberellin
C. Cytokine 52. Neurons.
D. Thailomycın A. Unipolar types are not found in
invertebrates
45. Forgetfulness, loss of memory and losing B. Pseudo unipolar have 2 cell bodies
track of even the most familiar places are the C. Bipolar have 2 cell bodies
progressive characteristics of which disease: D. Multipolar have multiple Dendron’s
A. Huntington’s Disease
B. Parkison's disease 53. Thirst center is found in the:
C. Alzheimer’s Disease A. Pharynx
D. Caposi's Sarcoma B. Medulla
C. Hypothalamus
46. Which is associated with long term memory. D. Pineal gland
A. Hippocampus
B. Hypothalamus 54. Which of the following are common to all
C. Brain Stem neurons?
D. Pons A. A cell body which contains a nucleus
B. A thick myelin heath
47. Pituitary gland is controlled by which of the C. Presence of nodes of Ranvier
following: D. Several long axons
A. Adrenal Cortex
B. ACTH 55. Which of the following is not true? A rise in
C. Hypothalamus Adrenaline concentration causes:
D. Cytoxan A. The liver to change more glucose to
glycogen
48. The largest part of fore brain is B. Increases the rate of respiration
A. Diencephalons C. The muscles to go tense
B. Corpus callosum D. The heart to beat faster
C. Telencephalon
D. Cerebrum 56. Retina contains color sensitive receptors
called:
49. The physiological or functional contact A. Rods
between two neurons is called: B. Cones
E. Neuroglia C. Both rods and cones
F. Action potential D. Optic nerves
G. Synapse
H. RMR 57. Polar bodies are formed during:
A. Phototropism
50. The automatic nervous system controls: B. Oogenesis
A. Sight C. Spermatogenesis
B. Thinking D. Fertilization
C. Digestion
D. Memory 58. The pairing of homologous chromosomes is
called
51. The disease caused by lack of ADH is A. Meiosis
A. Diabetes Mellitus B. Synapsis
B. Acromegaly C. Spermatogenesis
C. Diabetic Insipidus D. Crossing over
PAGE N0: 78
D. Oxytocin
59. Pancreatic juice is secreted by pancreas
under the stimulation of which hormone 66. Retina contains light sensitive receptor cells
A. Gastrin called
B. Secretin A. Rods
C. Renin B. Cones
D. Insulin C. Both rods and cones
D. Optic nerves
60. The dorsal root of spinal nerve is:
A. Sensory 67. Removal of the thyroid gland in an adult
B. Motor would cause an increase in:
C. Mixed A. BMR
D. None of the above B. Conversion of glycogen to glucose
C. Excretion of Na from the kidney
61. Myxedema in elder is caused by: D. Secretion of TSH
A. Hyperthyroidism
B. Hypothyroidism 68. A typical neuron at rest is more ________
C. Not related to any condition electrically outside.
D. Both a and b A. Positive
B. Negative
62. The automatic nervous system controls: C. Neutral
A. Sight D. None of them
B. Thinking
C. Digestion 69. Goiter is a disease caused by deficiency of;
D. Memory A. Iron
E. Movement B. Calcium
C. Iodine
63. The disease caused by lack of ADH is: D. Chorine
A. Diabetes Mellitus
B. Acromegaly 70. The prolactin hormone responsible for the
C. Diabetic Insipidus activation of mammary glands to start producing
D. Cushing's disease milk is a hormone of:
E. Addison's disease A. Pituitary gland
B. Pancreas
64. Thyroid stimulating hormone levels: C. Thyroid gland C
A. Would be raised in a person with D. Thymus gland
hyperthyroidism E. Adrenal gland
B. Would be low in patients with
hypothyroidism 71. Deficient production of hormones by adrenal
C. Would be high in patient with glands results in:
hypothyroidism A. Cushing's syndrome
D. Would be unaffected in hypothyroidism B. Addison's disease
E. None of the above C. Diabetes Mellitus
D. Goiter
65. The pituitary gland secretes of the following E. Epilepsy
except:
A. Growth hormone 72. The loose connection between two neurons
B. Calcitonin is called ________.
C. Prolactin A. Axon
PAGE N0: 79
B. Dendrite E. II I IV III
C. Synapse
D. Cell Body
78. What are the functions of the inter, motor
and sensory neurons in a reflex response?
73. The plasma membrane of neuron is called
INTER MOTOR SENSORY
________.
NEURON NEURON NEURON
A. Neurilemma to conduct
B. Neurolaena to connect to conduct
impulses
neurons within impulses
C. Neuronite A. the to the effector
from the
receptor
D. Neuromelanin central nervous from the central
to the central
system nervous
nervous system
74. The gas hormone which helps in rapid to conduct
to connect
neurons within to receive the
ripening of fruit is called ________. B.
impulses to the
the stimulus
A. Auxin effector
central nervous
B. Cytokinin system
to conduct
C. Ethene to conduct
impulses from
to connect
D. Abscisic acid impulses from neurons
the
C. the within the
receptor to the
central nervous central
central nervous
75. The concentration of Na ions in the body system
system
nervous system
fluids is controlled by ______ hormone. to conduct to conduct
A. ADH Impulses from impulses from to conduct
the receptor to the impulses
B. parathormone D.
the central receptor to the to the effector
C. aldosterone nervous central nervous
D. estrogen system system
E. thyroxin
79. How many meninges cover the human
76. The region where the impulse moves from brain?
one neuron to another is called ________. A. 5
A. Axon B. 4
B. Dendrites C. 3
C. Synapse D. 2
D. Thalamus E. 1
E. Cerebellum
80. In an experiment, the production of
77. Four events in the transmission of nerve hormone secretin was blocked. As a result,
impulses across synapses are: levels of all of the following enzymes were
I. Depolarization of the presynaptic membrane affected EXCEPT:
II. Propagation of postsynaptic action potential A. trypsin
III. Reabsorption of the transmitter substance B. pepsin
IV. Release of transmitter substance into the C. chymotrypsin
synaptic cleft D. amylase
In which sequence do these events occur? E. lipase
FIRST → LAST 81. The diagram shows a section through the
human brain.
A. I III II IV
B. I IV II III
C. IV I III II
D. IV III I II
PAGE N0: 80
1 83. Which of the following is not secreted by
thyroid gland?
A. thyroxin
B. triiodothyronine
C. calcitonin
D. glucagon
3 2
84. The water content of mammalian blood is
What are some functions of the parts labelled 1,
regulated by antidiuretic hormone (ADH). In
2 and 3?
which part of the nephron does regulation
1 2 3
occur?
heart beat controls
forms visual A. the ascending limb of the loop of Henle
A. and blood digestion
images B. the collecting duct
pressure
perception of heart beat C. the descending limb of the loop of Henle
muscular D. the proximal convoluted tubule
B. pleasure and and blood
coordination
pain pressure
heart beat perception of 85. The diagram shows a motor nerve cell.
muscular
C. and pleasure and Which part of the cell contains a transmitter
coordination
perception pain substance?
heart beat
perception of
controls and
D. pleasure and
digestion blood
pain
pressure
perception
heart beat
muscular of
E. and blood
coordination pleasure
pressure
and pain
82. The following sequence of events occurs at

the neuromuscular junction.
Nerve impulse → release of V → end plate
potential → w produced in muscle fiber → X
released from sarcoplasmic reticulum →
formation of Y → muscle contraction.
Which one of the following shows the correct A. A
sequence from V → Y? B. B
C. C
D. D
V W X Y
acetylcholi action calcium actomyos 86. Which diagram illustrates the distribution of
A
ne potential ions in sodium and potassium ions in a section of a non-
acetylcholi action actomyosi calcium myelinated axon which is at resting potential?
B
ne potential n ions
actomyosi calcium action
C acetylcholine
n ions potential
calcium action acetylcholi actomyos
D
ions potential ne in
calcium acetylcholi action
E actomyosin
ions ne potential
PAGE N0: 81
_ _ _ _ phenylalanine in the blood, which indicates the
hereditary disease phenylketonuria. Pale skin
color is also the indication of sufferers from this
A. K+ high disease.
The following series of reactions occurs in
- - - - normal metabolism.
enzyme 1 enzyme 2 enzyme 3
Na+ high Pheny Other
protein tyrosine
_ _ _ _ lalanin metabolite
s
enzyme 4
B. K- low
melanin
- - - - Which enzyme is lacking in persons with
Na+ low phenylketouria?
_ _ _ _ A. 1
B. 2
C. K+ low C. 3
D. 4
- - - - 89. Match the parts of the human brain listed
K+ low under Column I with the functions given under
_ _ _ _ Column II. Choose the answer which gives the
correct combination of alphabets of the two
D. Na+ high columns.
Column I Column II
(Part of the (Functions)
- - - - Brain)
87. Match the processes listed under Column I A. Cerebral p Relaying
with the hormones given under Column II. hemisphere impulses
Choose the answer which gives the correct
combination of alphabets of the columns. B. Thalamus q Posture and
Column I Column II balance
(Processes) (Hormones) C. Cerebellum r Control of sleep
Production of and wakening
Progesterone D. Medulla s Reflex actions
A. milk from q
mammary gland oblongata
B. Release of milk r Vasopressin t Intelligence
Thickening of memory
C. s Prolactin
endometrium
D. t oxytocin A. A=r, B=q, C=p, D=s
A. A=s, B=q, C=r B. A=r, B=s, C=q, D=t
B. A=s, B=t, C=q C. A=t, B=p, C=q, D=r
C. A=q, B=t, C=s D. A=t, B=q, C=p, D=s
D. A=s, B=r, C=q
88. Newborn babies are screened for the

presence of high levels of the amino acid
PAGE N0: 82
90. Which of the following type and function of 91. Which part of the brain regulates body
the neuron is correct? temperature?
Motor Sensory Inter A. cerebellum
neuron neuron neuron B. cerebrum
C. hypothalamus
Carries D. medulla
sensory
It takes information They are 92. Match the hormones listed under Column I
command of from the found in with the roles given under Column II. Choose the
the control receptor to central answer which gives the correct combination of
A.
center to the nervous the alphabets of the two columns
the effector Other System
Column I Column II
neuron or
(Hormones) (Roles)
directly to
Preparation of
CNS
A. FSH p endometrium for
Carries
implantation
sensory
Female secondary
information It takes They are B. LH q
sexual characters
from the command of found in
Contraction of uterine
receptor to the control central C. progesterone r
B. muscles
the counter to nervous
Development of
Other the effector System D. Estrogen s
corpus luteum
neuron or
E. t Maturation of follicle
directly to
CNS
Carries
A. A=t, B=s, C=p, D=q
sensory
B. A=r, B=t, C=s, D=q
They are It takes information
C. A=t, B=p, C=s, D=q
found in command of from the
D. A=q, B=s, C=p, D=r
central the control receptor to
C.
nervous counter to the
93. Cranium (a part of the skull) forms the brain
System the effector Other
box and consist of ________ bones
neuron or
A. 10
directly to
B. 08
CNS
C. 05
Carries
D. 03
sensory
information They are It takes
94. The diagram shows a neurone.
from the found in command
receptor to central of the
D.
the nervous counter
Other System center to
neuron or the effector
directly to
CNS
PAGE N0: 83
Which of the given structures could be found at B. II and III only
X and Y? C. l and III only
X Y D. I and II only
A brain intestine E. I, II and III
B brain leg
C eye hand 6. Parthenogenesis is a type of
D skin spinal cord reproduction which requires:
A. One parent-female
B. One parent-male
C. Two parents
UNIT NO. (04) D. No parents
1. The female gamete of a flower is formed
in the:
7. A rope like structure, which connects
A. pollen grain
embryo to placenta is called _______.
B. pollen tube
A. Spinal cord
C. stigma
B. Umbilical cord
D. style
C. Optical fiber
E. embryo sac
D. Vocal cord
E. Spindle fiber
2. If the sperm cell of a fruit fly has 4
chromosomes, then the number of
8. The first ever cloned sheep was named as
chromosomes in each body cell is:
________.
A. 2
A. Silly
B. 4
B. Dolly
C. 6
A. С. Jolly
D. 8
C. Honey
E. 16
D. Tommy
3. Which one of the following is not a
9. Which of the following is/are function(s) of
sexually transmitted disease?
semen?
A. Gonorrhea
I. It provides the sperms with food
B. Syphilis
II. It provides the sperms with a medium to
C. Genital herpes
swim in
D. Meningitis
III. It neutralizes the acidity of urethra caused by
E. AIDS
the passage of Urine
A. I only
4. Germ cells give rise to:
B. III only
A. legs
C. I and II only
B. head
D. II and III only
C. eggs and sperms
E. I, II and III
D. hands
E. all body parts
10. The transfer of pollen grains from anther to
stigma is called:
5. Which of the following is an example(s)
A. Fertilization
of cloning?
B. Transpiration
I. Identical twins in humans
C. Pollination
II. Asexual reproduction in plants
D. Diffusion
III. Tumor
A. I only
PAGE N0: 84
11. On which date is a woman most likely to D. Ovary
ovulate if the first day of menstrual loss was 1
February? 17. The mammalian placenta has all of the
A. 5 February following functions except
B. 14 February A. Excretion
A. С. 24 February B. Nutrition
C. 28 February C. Hormone secretion
D. 1 March D. Stock absorptions
12. Which of the following incorrectly pairs the

18. ________ Hormone stimulates mammary
term with its definition?
gland to secrete milk and process of labor.
A. Scrotum-location of the testes
B. Epididymis-site of sperm maturation A. Oxytocin
C. Vas deferens-tube connecting the B. F.S.H
epididymis to the prostate C. L.H
D. Semen-composed of seminal fluid and D. T.S.H.
sperm 19. The menstrual stage lasts for:
E. Urethra-tube for urinary & reproductive A. 1 to 5 days
discharge B. 14 to 16 days
C. 25 to 28 days
13. A type of asexual reproduction in which D. 8 t0 18 days
individual resembles exactly to the egg donor is
called: 20. Fertilization in mammals takes place in
A. Regeneration ______.
B. Budding A. Uterus
C. Parthenogenesis
B. Ovary
D. Cloning
C. Vagina
E. Fission
D. Fallopian tube
14. Fertilized ovum in human is implanted in:
A. Oviduct 21. Some plants form embryo without
B. Uterus fertilization called
C. Placenta A. Apomixis
D. Umbilical Cord B. Epimixis
E. Vagina C. Apomixes
D. Endomixis
15. The sperms produced by seminiferous
tubules are stored in 22. Spores are
A. Vas deferens A. Diploid
B. Urethra B. Haploid
C. Epididymis C. Triploid
D. Bladder D. Cone
E. Sperm duct
23. In vitro fertilization is:
16. The following is a part of the female A. Fertilization of egg outside the body in lab
reproductive tract: B. Fertilization within the female
A. Vas deferens C. Fertilization in water exclusively
B. Cervix D. Giving nutrition to fertilized egg
C. Spermatozoa
PAGE N0: 85
24. The hormone which helps in the contraction B. Regeneration
of uterus at time of birth is: C. Apomixes
A. Prolactin D. Parthenocarpy
B. Oxytocin
C. Gonadotrophin 32. Every statement is true about fraternal twins
D. Antidiuretic hormone except:
A. They can be of different sex
25. The supply line b/w embryo & mother is: B. They are dizygotic
A. Placenta C. They are developed sexually
B. Umbilical cord D. The genotype of each zygote is sense
C. Amnion
D. Chorion 33. About urethra each statement is correct
except:
26. Which of the following disease if not treated A. It is the last part of urinary system
can cause blindness in new born: B. It is the extension of urinary bladder
A. Syphilis C. It is a known as urogenital duct in females
B. AIOS D. Contains prostatic gland at its tip
C. Hepatitis
D. Gonorrhea 34. About menstruation phase: pick the odd one
27. The sperms are stored in: out:
A. Seminiferous tubules A. Onset off bleeding and debris of uterus
B. Vas Deferens through vagina.
C. Epididymis B. Lasts about 5 days
D. b) Testes C. Progesterone secretion stops
D. Blood & myometrium flows out through
28. Conception in human female takes place at: vagina.
A. Uterus
B. Vagina 35. In comparison with the number of gametes
C. Ovary produced from one primary sex cell during
D. Fallopian tube oogenesis, the number of gametes produced
from one primary sex cell during
29. The chemical attractant which directs the spermatogenesis is:
pollen tube to enter the ovary to micropyle is: A. The same
A. Seminal fluid B. 4 times as many
B. Abscisic acid C. Twice as many
C. Auxin D. Half
D. Calcium
36. The development of an egg without
30. Thermos regulation is done by sweat glands fertilization is called
in mammals especially, but some lack glands so A. Oogenesis
they do: B. Parthenogenesis
A. Guttation C. Fertilization
B. Transpiration D. Growth
C. Panting
D. Hydathodes 37. Which of the following in the mammalian
ovary produces Estrogen?
31. The process in which fruit privation takes A. Corpus Luteum
place without the formation of seeds, is called: B. Germinal epithelium
A. Pathogenesis C. Graafian follicle
PAGE N0: 86
D. Connective tissue
44. The Prolactin hormone responsible for
38. How does a paramecium reproduce activation of mammary glands to start producing
sexually? milk is a hormone of:
A. Conjugation A. Pituitary gland
B. Parthenogenesis B. Pancreas
C. Budding C. Thyroid gland
D. Spore formation D. Thymus gland
E. Adrenal gland
39. Correct sequence in the menstrual cycle is:
A. Ovulation, follicle stage, corpus luteum, 45. All of the following are sexually transmitted
menstruation diseases except:
B. Corpus luteum, Ovulation, follicle, A. Syphilis
menstruation B. Gonorrhea
C. Follicle, Ovulation, Corpus luteum, C. Alzheimer's Disease
menstruation D. Genital herpes
D. Fertilization, cleavage, differentiation, E. AIDS
Ovulation, menstruation
46. Amniocentesis is performed between the:
40. Primary spermatocytes have ______ A. 16th and 18th week of gestation
chromosomes: B. 1st and 2nd week of gestation
A. Diploid C. 30th and 32nd week of gestation
B. Triploid D. 37th and 38th week of gestation
C. Haploid E. After the delivery of the baby
D. None of the above 47. Fertilized ovum in human is implanted in
________.
41. Growth of the mucous lining (endometrium) A. Oviduct
of uterus is enhanced by ________. B. Uterus
A. Estrogen C. Placenta
B. Progesterone D. Vagina
C. L.H
D. FSH 48. FSH stimulates the ovary to produce a
hormone of its own, called ________.
42. The ______ of female provides safe and A. Oestrogen
moist place for the development of embryo in B. Progesterone
most animals: C. Androgen
A. Ovary D. LH
B. Vagina
C. Uterus 49. Male and female sea urchins release their
D. Cervix sperm and eggs into the water where
E. Fallopian tube fertilization takes place. How can their
reproduction be described?
43. At the onset of the birth, there is decrease A. asexual reproduction which results in
level of: genetically dissimilar offspring
A. Estrogen B. asexual reproduction which results in
B. Progesterone genetically identical offspring
C. TSH C. sexual reproduction which results in
D. GH genetically dissimilar offspring
E. L.H
PAGE N0: 87
D. sexual reproduction which results in D. Blastulation
genetically identical offspring E. Gastrulation
50. When a fetus is in the uterus, what carries 3. The development of an egg without
oxygen away from the placenta? being fertilized by a sperm is known as:
A. The amniotic fluid A. Metamorphosis
B. The amniotic sac B. Regeneration
C. The lining of the uterus C. Differentiation
D. The umbilical cord D. Parthenogenesis
E. Incubation
51. How does the second meiotic division differ
from mitosis? 4. Gastrulation in a frog's embryo involves
In the second meiotic division: all of the following except:
A. chiasmata form between the chromatids A. Epiboly
of a bivalent. B. Involution
B. each chromosome replicates to form two C. Rotation
chromatids during metaphase D. Invagination
C. the separating chromatids of a pair differ
genetically 5. Mesoderm gives rise to:
D. none of the above A. Lens of the eye
B. Teeth enamel
52. Testes are structures that produce: C. Liver
A. spores D. Heart
B. sperms
C. seeds 6. _______ germinal layer give raise all the
D. ova body muscles:
A. Ectoderm
53. Spirochete bacterium Treponema pallidum B. Endoderm
causes __________. C. Mesoderm
A. Gonorrhea D. Chorion
B. Syphilis
C. Genital herpes 7. The science of aging is called:
D. AIDS A. Ethonology
B. Gerontology
UNIT NO. (05) C. Embryology
D. Genetics
1. What is the correct sequence of events in the
8. The whole tail of tadpole and its gills are
development of the embryo?
lost during metamorphosis the change is:
A. morula → cleavage → blastula → gastrula
A. Progressive
B. cleavage → morula → blastula → gastrula
C. cleavage → gastrula → blastula → morula B. Retrogative
D. blastula → cleavage → gastrula → morula C. Organizational
E. morula → blastula → cleavage → gastrula D. None of the above
2. ________ is the reconstruction of the lost 9. Extremely small amount of yolk are
part of the body. called _______.
A. Growth A. Alecithal
B. Development B. Polylecithal
C. Regeneration C. Oligolecithal
PAGE N0: 88
17. Endoderm gives rise to all of the following
10. Ectoderm give rise to ________. except:
A. Muscular system A. Liver
B. Nervous system B. Lungs
C. Vascular system C. Thyroid
D. Digestive system D. Nervous system
18. Mesoderm gives rise to:

11. Science of aging is called ________.
A. Lens of the eye
A. Paleontology
B. Teeth enamel
B. Entomology C. Liver
C. Gerontology D. Heart
D. Parasitology
19. Cytoplasmic Localization is a consequence of:
12. Seedless fruits which grow without A. Fertilization
fertilization are called _______. B. Cleavage
A. Angiosperms C. Morula
B. Parthenocarpus D. Blastula
C. Ovulatory E. Gastrula
D. Mesangial
20. The process of division of zygote is called
13. According to Hay flick the aging is due to loss _________.
of: A. Cleavage
A. Cell function B. Development
B. Immunity C. Enlargement
C. Stability D. Differentiation
D. A.О.Т
21. Germ cells give rise to:
14. Eggs of amphioxus: A. legs
A. Alecithal B. head
B. Telolecithal C. eggs and sperms
C. Meiolecithal D. hands
D. Mesolecithal E. all body parts
15. When a diploid egg is formed without 22. A bean seed contains all of the following
fertilization except
A. Parthenogenesis A. A seed coat
B. Apomixes B. An epicotyl
C. Facultative apomixes C. A hypocotyl
D. Reverse transcription D. A hypha
E. Cotyledon
16. In chick embryo the space between 2 layers
is: 23. ________ is the reconstruction of the lost
A. Coelom part of the body.
B. Blastocoel A. Growth
C. Primitive Streak B. Development
D. Gastrocoel C. Regeneration
D. Blastulation
E. Gastrulation
PAGE N0: 89
A. Ensures that the same genetic
24. The egg of a chick is laid at which of the characteristics appear in the daughter
following stages? cells as in the parents
A. gastrula B. Ensures that the number of genes in the
B. blastula new chromosomes remains constant
C. cleavage C. Provides opportunities for new genotypes
D. morula to arise
E. neurulation D. Prevents homologous chromosomes from
pairing
25. Scurvy is caused by deficiency of vitamin E. Allows attachment of the chromatids to
_________. the spindle fibers
A. A
A. В 3. Which of the following nitrogenous bases
B. C are found in DNA?
C. D I. Thymine
II. Cytosine
III. Uracil
A. I only
B. II only
C. I and II only
D. I and III only
E. I, II, and III
4. Which is correctly associated?

26. Which of the following is the correct A. RNA: thymine
sequence of missing events in the above given B. DNA: uracil
diagram? C. RNA: replication
A. Cleavage → Fertilization → Organogenesis D. mRNA: picks up amino acids
→ Gastrulation E. RNA: ribose sugars
B. Organogenesis → Gastrulation →
Fertilization → Cleavage 5. In DNA, guanine forms a base pair with
C. Fertilization → Cleavage → Gastrulation ________ while adenine forms a base pair with
→ Organogenesis ________
Gastrulation → Fertilization → Organogenesis → A. thymine ... cytosine
Cleavage B. adenine ... guanine
C. cytosine ... thymine
UNIT NO. (06) D. thymine ... thymine
E. cytosine ... cytosine
1. Which one of the following statements
correctly describes the transcription of DNA? 6. Which of the following is not found in a
A. It produces amino acids molecule of DNA?
B. It results in an increased DNA synthesis A. Adenine
C. It produces messenger RNA B. Deoxyribose
D. It is a semi conservative process C. Phosphorus
E. It occurs at the surface of the ribosome D. Uracil
E. Thymine
2. The formation of chiasmata is an
important feature of meiotic division because it 7. The combination of XXY (47)
chromosomes results in:
PAGE N0: 90
A. Down's Syndrome C. N-bases
B. Turner's Syndrome D. Sugar (ribose)
C. Klinefelter's Syndrome E. None of the above
D. Sickle cell anemia
E. Color blindness 13. The chromosomes with equal arms
resembling the letter 'V' are called:
8. Cells from a bacterial clone were grown A. Telocentric
for many generations on a medium in which all B. Sub-metacentric
the nitrogen compounds contained only the C. Metacentric
isotope nitrogen 15 (15N). Adenine comprised D. Acrocentric
36% of the nitrogen bases present. A sample of E. Autosomes
these bacteria was transferred to a medium in
which the only nitrogen source was 14N and was 14. In mature cells each chromosome consists of
provided with conditions suitable for asexual two thin threads called:
reproduction. What was the percentage of A. Chromatids
guanine in the DNA? B. Centromere
A. 14% C. Karyotype
B. 18% D. Chromomeres
C. 28% E. Kinetochore
D. 36%
E. 64% 15. The diagram shows a process involving DNA.
9. Which of the following is a Female sexual

defect?
A. Microcephaly
B. Polydactyly
C. Turner's syndrome
D. Klinefelter's syndrome
E. Cleft lip and palate
What is the name of the process and the stage in
10. The chromosome number in humans is: the cell cycle at which it occurs?
A. 3 pairs Process Stage
B. 13 pairs A. replication ... interphase
C. 23 pairs B. replication ... prophase
D. 33 pairs C. transcription ... interphase
E. 43 pairs D. transcription ... prophase
E. replication ... telophase
11. In Downs syndrome the 21st pair of
chromosomes: 16. Adenine comprised 36% of the nitrogenous
A. lacks one chromosome bases in the DNA of cells from a bacterial clone.
B. has an extra chromosome attached to it What was the percentage of guanine in the
C. is missing DNA?
D. lacks genes
E. none of the above A. 14%
B. 18%
12. Which one is not the component of C. 28%
nucleotide of DNA? D. 36%
A. H3PO4 E. 64%
B. Sugar (Deoxyribose)
PAGE N0: 91
17. If one ribose molecule was bonded to one D. 23
adenine molecule and one phosphate molecule,
we would have a 23. The results of non - disjunction are:
A. Ribosome A. Down syndrome
B. Nucleotide B. Turner syndrome
C. Nucleic acid C. Klinefelter syndrome
D. ATD D. All of the above
E. ADP
24. The number of chromosomes in man is:
18. Which of the following RNA sequences A. 44
would be transcribed from the DNA sequence B. 48
ATGCCTAGGAC? C. 46
D. 23
A. TACGGATCCTG
B. UAGCGAUCCUG 25. The condition in which there is one extra
C. AUGCCUAGGAC chromosome is:
D. UACGGAUCCUG A. Monosomic
E. GCAUUCGAAGU B. Trisomic
C. Disomic
D. Nullisomic
26. Guanine always pairs with

A. Thymine
B. Adenine
C. Cytosine
D. Uracin
19. The above diagram illustrates:
A. Hemophilia 27. Which of the following replaced by thymine:
B. Phenylketonuria A. Uracil
C. Sickle cell anemia B. Cytokine
D. Down's Syndrome C. Guanine
D. Adenosine
20. The bond between adenine and thymine is:
A. Single bond 28. Centromere at the end of Chromosomes
B. Double bond A. Meta centric
C. Triple bond B. Areocentric
D. Covalent bend C. Sub Meta centric
D. None of above
21. The person with down’s syndrome has:
A. One extra chromosome 29. Number of chromosomes in human cell are:
B. One less chromosome A. 48
B. 46
C. Two extra chromosome
C. 44
D. Two less chromosome
D. 56
22. The total Autosomes in human are:
30. The genotype of a Turner's syndrome patient
A. 44 is
B. 46 A. XXY
C. 22 B. Trisomy 21
PAGE N0: 92
C. XO 38. Y chromosome is ________:
D. OXY A. Rod shaped
B. Hook shaped
31. Which of the following organelles always C. Wire like
contains DNA? D. Coiled shaped
A. Centriole
B. Golgi apparatus 39. The complementary mRNA for the DNA
C. Lysosome triplet GAT would read:
D. Mitochondrion A. CTA
B. CUA
32. How is the Down's syndrome inherited? C. CTG
A. Test cross D. CTC
B. Mutation
C. Sex linkage 40. Which of the following is not caused by
D. Segregation bacteria?
A. Butter going rancid
33. In Turners syndrome the genotype is: hot B. Yogurt formation
A. Male 45 chromosomes C. Athlete’s foot
B. Male 46 chromosomes D. Cheese formation
C. Female 45 chromosomes
D. Female 47 chromosomes 41. Which part of a nucleic acid allows double
strand formation in DNA?
34. Chromatin is to chromosomes as DNA is to: A. Phosphate group
A. Daughter ceils B. Hydroxyl group
B. Mitosis C. Sugar
C. Genes D. Nitrogen base
D. RNA
42. The major sign and symptom of
35. If the sperm ceil of a fruit fly has 4 Microcephaly is;
chromosomes, then the number of A. Sexual defects
chromosomes in each body cell is: B. Excessive number of toss
A. 2 C. Mental retardation
B. 4 D. Small skull in proportion to the normal
C. 8 body size
D. 16 E. Split in upper lip and gap in the roof
mouth
36. In non-disjunction, chromosomes fail to
A. Replicate 43. Highly condensed portions of the chromatin
B. Reduce are called:
C. Separate A. Euchromatin
D. Fertilize B. Hetero chromatin
C. Nucleosome
37. The first indication of DNA action was found D. Super coils
in: E. None of the above
A. Protozoa
B. bacteria 44. In sugar cane number of chromosome is
C. Drosophila __________.
D. algae A. 50
B. 60
PAGE N0: 93
C. 70 E. 44
D. 80
45. Cells from a bacterial clone were grown for QUESTION 49-50
many generations on a medium in which all the
nitrogen compounds contained only the isotope
nitrogen 15 (15 N). Adenine comprised 36% of
the nitrogen bases present. A sample of these
bacteria was transferred to a medium in which
the only nitrogen source was 14 N and was
provided with conditions suitable for asexual
reproduction. What was the percentage of
guanine in the DNA?
A. 14%
B. 18% 49. The first cell to contain the diploid number
A. С. 28% of chromosomes is:
C. 36% A. 2
D. 64% B. 3
C. 4
46. Fern has ________ pairs of chromosome. D. 6
A. 23 E. 9
B. 40
C. 500 50. A female gamete containing the monoploid
D. 13 (haploid) number of chromosomes is:
E. 7 A. 2
B. 3
47. The combination of XXY (47) chromosomes C. 4
results in: D. 5
A. Down's Syndrome E. 8
B. Turner's Syndrome
C. Klinefelter's Syndrome 51. An anti-codon is the sequence of the
D. Sickle cell anemia nitrogenous bases on the:
E. Color blindness A. complementary strand of DNA which
codes for one amino acid
48. The diagram shows a cell of an organism B. complementary strand of mRNA which
formed by reduction division. codes for one amino acid.
C. tRNA molecules where the amino acid is
attached.
D. tRNA molecules where recognizes the
appropriate sequence of bases on the
mRNA
E. tRNA molecules where instructs the
ribosomes to initiate protein synthesis.
What is the diploid number for this organism? 52. A short piece of DNA 30 base pairs long was
A. 10 analyzed to find the number of nucleotide bases
B. 20 in each of the polynucleotide strands. Some of
C. 30 the results are shown below.
D. 40
PAGE N0: 94
D. They carry both morphologically similar
Number of nucleotide members with same set of genes
bases
56. The diploid human chromosome set has:
A C G T
A. 22 pairs of autosomes and 1 pair of sex
Strand 1 12 6
chromosomes
Strand 2 8
B. 22 pairs of autosomes and XY
How many nucleotides containing guanine were
chromosomes
present in strand 1?
C. 22 pairs of autosomes and XX
A. 2
chromosomes
B. 3
D. Haploid somatic cells and diploid germinal
C. 4
cells
D. 6
E. Diploid somatic and germinal cells.
53. Five different amino acids (numbered 1-5
57. Which of the following options give the
below) form the following sequence in part of a
correct sequence (steps) in recombinant DNA
polypeptide chain:
technology?
1-2-3- 4-2- 5- 3
I. Selection of bacteria with desired gene.
Messenger RNA (mRNA) codons which
II. Insertion of rDNA into host cell
correspond to these amino acids are:
III. Preparation of recombinant rDNA molecules.
amino acid 1 UGU
IV. Multiplication and production of numerous
amino acid 2 GAU
copies of host with rDNA in it.
amino acid 3 CAC
A. I → II → III → II
amino acid 4 UAG
B. I → III → IV → II
amino acid 5 AAG
C. III → II → IV → I
Which one of the following DNA base sequences
D. III → IV → II → I
could provide the code for the given section of
E. IV → III → I → II
polypeptide?
A. ACACTTGTGATGCTATTCGTG
B. ACACUAGUGAUGCUAUUCGUG
C. ACACTAGTGATGCTAAACGTG UNIT NO. (07)
D. ACACTAGTGATCCTATTCGTG
E. CACATCUTUCTUATCTTAUTU
54. The biochemical analysis of a sample of DNA

shows that 32% of the nitrogenous bases are
cytosine. What is the total percentage of
adenine and uracil in RNA transcribed from this
DNA?
A. 16% 1. In the above given diagram which is the
B. 18% first cell to undergo mitotic division?
C. 32% A. 3
D. 36% B. 4
C. 5
55. Which of the following statements correctly D. 6
describes homologous chromosomes? E. 8
A. They are formed during meiosis.
B. They are held together by centromeres. 2. The diagram below is of a cell from a
C. They are chromatids of the same gametophyte undergoing division. What is the
chromosome type of division and the stage?
PAGE N0: 95
A. Meiosis; prophase I; 2n = 8
B. Meiosis; metaphase II; n = 8 Which statement describes the chromosomes
C. Mitosis; prophase; n = 8 found in each daughter nucleus immediately
D. Mitosis; early metaphase; 2n = 8 following division of this cell by mitosis?
E. Mitosis; early anaphase; 2n = 8 A. 8 chromosomes, each consisting of 4
chromatids
3. A process that cannot take place in a B. 8 chromosomes, each containing 1
haploid cell is molecule of DNA
A. mitosis C. 12 chromosomes, each consisting of 4
B. meiosis chromatids
C. ATP production D. 16 chromosomes, each containing 1
D. DNA replication nucleus
E. Transcription
7. Meiosis differs from mitosis in that:
4. The cell of a corn plant contains a diploid I. two consecutive cell divisions in one cell take
number of 20 chromosomes. When it divides by place
mitosis, what is the number of chromosomes in II. DNA replicates during Interphase
each of the following resulting cells? III. haploid cells are produced from diploid cells
A. 10 A. I only
B. 15 B. II only
C. 20 C. III only
D. 30 D. I and III
E. 40 E. I, II, and III
5. Which of the following activities occur
during interphase? 8. "Crossing over" takes place in ________
I. DNA duplication stage.
II. RNA synthesis A. Leptotene
III. Volume of the cell roughly doubles B. Zygotene
A. I only C. Diplotene
B. III only D. Pachytene
C. I and II only E. Diakinesis
D. II and III only
E. I, II and III 9. The death of living cells that results from
tissue injury is known as:
6. The diagram shows a cell nucleus in A. Apoptosis
prophase of mitosis. B. Nuclear budding
C. Mitosis
D. Necrosis
E. Meiosis
10. The mitotic stage in which the sister

chromatids physically separate is:
A. Interphase
PAGE N0: 96
B. Prophase A. Mitosis
C. Metaphase B. Meiosis
D. Anaphase C. Amitosis
E. Telophase D. Karyo kinesis
11. Some chemicals, used to stop tumor growth, 16. In mitosis the no. of chromosomes in
work by preventing the DNA double helix from daughter cells
uncoiling and separating. During which stage of A. 2n
the cell cycle would they act? B. n
A. anaphase C. 1/2n
B. interphase D. None of the above
C. metaphase
D. prophase 17. How many mitotic divisions produce 12
E. telophase cells?
A. 3 Divisions
12. The diagram shows a cell of an organism B. 6 Divisions
formed by reduction division. C. 4 Divisions
D. 12 Divisions
18. Reduction division in Meiosis is;

A. Anaphase-II
B. Anaphase-I
C. Diagenesis
D. Diplotene
19. What does not take peace in meiosis?

A. Chromosome multiplied
What is the diploid number for this organism? B. Separation of chromosomes
A. 10 C. Production of hormones
B. 20 D. Production of enzymes
C. 30
D. 40 20. Exchange of genetic material takes place in:
E. 46 A. Meiosis
B. Prophase I
13. Genetic exchange via chiasmata occurs in a C. Diplotene
stage of Meiotic prophase I called: D. Pachytene
A. Leptotene
B. Pachytene 21. Amitosis takes place in:
C. Diplotene A. Germ cells
D. Diakinesis B. Somatic cells
E. Zygotene C. Skin cells
D. Bacterial cells
14. The phenomenon known as crossing-over
occurs during: 22. Nuclei disappear during:
A. Mitosis A. Diakinesis
B. Meiosis B. Diplotene
C. Geographic distribution C. Pachytene
D. Active transport D. Zygotene
15. A division without formation of spindle is:

PAGE N0: 97
23. During which phase of meiosis are chiasmata Which one of the following correctly identifies
formed; each of the phases described?
A. Prophase interp proph metaph anaph teloph
B. Metaphase hase ase ase ase ase
C. Metaphase II A. I II III IV V
D. Telophase II B. I V IV II III
C. V I IV III II
24. Chromatids are monad during which stage of D. II IV I III V
meiosis: E. V IV I II III
A. Anaphase -I
B. Anaphase -II 29. The diagram shows a cell at anaphase 1 of
C. Metaphase- II meiosis.
D. Telophase -I
25. Diplotene is the sub-stage of:

A. Anaphase I
B. Telephone l
C. Prophase l
D. Metaphase l Which diagram shows a normal gamete that
E. All of the above could be produced from this cell?
26. The cell death which mostly occurs during

embryonic development is called _______.
A. Cytosis
B. Necrosis
C. Apoptosis
D. Macrosis
27. The diagrams below show chromosomes in a

cell undergoing mitosis and in a cell undergoing
meiosis. Which of the following names the
stages of division correctly?
Mitosis Meiosis
A. prophase prophase I
B. prophase metaphase I
C. metaphase anaphase I
30. Which of the following sub-stage does not
D. metaphase metaphase II
occur in meiotic prophase I?
A. Leptotene
28. The events shown below occur during
B. zygote ne
different phases of mitosis:
C. Synapsis
I. spiralization of DNA
D. Diplotene
II. hydration of DNA
E. Diakinesis
III. centromeres split
IV. centromeres attach to spindle fibers
V. DNA replicates
PAGE N0: 98
31. Cell X contains 24 chromosomes. It divides
by mitosis to produce cells Y and z. 3. Albinos have a genotype of aa, while all
other members of population are either AA or
cell X Aa. The offspring of a cross between a
heterozygous male and albino female would be
A. 100 % albino
B. 100 % normal
C. 50 % normal, 50 % albino
cell Y cell Z D. 25 % normal, 75 % albino
E. 75 % normal, 25 % albino
How many chromosomes does cell Z contain? 4. A black male mouse (I) is crossed with a
A. 12 black female mouse, and they produce 15 black
B. 24 and 5 white offspring. A different black male
C. 46 mouse (II) is crossed with the same female, and
D. 48 the offspring from the mating are 30 black mice.
Which of the following must be true?
32. Which of the following processes occur by A. The female mouse is homozygous
mitosis? B. Male mouse it is heterozygous
I. cloning of plasma cells C. Two of the mice are heterozygous
II. gamete production D. All the progeny of mouse II are
III. replacing damaged cells homozygous
A. II only E. All three mice are homozygous
B. III only
C. I and III only Questions 5 - 6 refer to the following statement:
D. I, II and III Father Mother
X(normal) / Y(normal) X(hemophilia) / X(normal)
With reference to the parents whose genotypes
are shown above
UNIT NO. (08)
5. _______ % of children is likely to be male.
1. In sickle cell anemia, the abnormal A. 0
hemoglobin differs from normal hemoglobin in: B. 25
A. a single amino acid C. 50
B. the amount of coenzymes D. 75
C. the number of iron atoms E. 100
D. the number of magnesium atoms
E. the number of genes 6. The possibility of a female child with
phenotype: hemophilia is _______ %.
2. A woman with normal colour vision, A. 0
whose father was red green colour blind, B. 25
married a red green colour blind man. What is C. 50
the probability of her first born child being red- D. 75
green colour blind? E. 100
A. 1.0
B. 0.75 7. If the male blood type A marries a female
C. 0.66 with blood type B, which of the following types
D. 0.50 would be impossible for a first generation child?
E. 0.25 A. type B
PAGE N0: 99
B. type A 12. A red-flowered plant crossed with a white-
C. type O flowered plant of the same species, produced F1,
D. type AB plants which all had pink flowers. Self-
E. all types are possible pollination of the F1 plants produced an F2
generation in which 40 plants had red flowers,
8. The process of replacing or 80 had pink flowers and 40 had white flowers.
supplementing the defective allele with a What does this experiment demonstrate?
functional, normal allele is known as ______. A. incomplete dominance
A. allele transplant B. continuous variation
B. physiotherapy C. a dihybrid cross
C. gene therapy D. linkage
D. mutation E. multiple alleles
E. cloning
13. Which one of the following genotype cannot
9. In cats, the genes controlling coat-colour occur amongst the offspring from a mating
are co-dominant (incompletely dominant) and between a person of blood group A and a person
are carried on the X chromosomes. When a of blood group B?
black female was mated with a ginger male the A. AA
resulting litter consisted of black male and B. AB
tortoise-shell female kittens. What phenotypic C. A
ratio would be expected in the F2 generation? D. B
A. 1 black male: 1 ginger male: 2 tortoise- E. O
shell females
B. 1 black male: 1 ginger male: 1 tortoise- 14. In fruit flies, the gene for wing type is
shell female: 1 black female located on an autosomal chromosome. The
C. 2 black males: 1 tortoise-shell female: 1 allele for wild-type wings is dominant over the
ginger female allele for vestigial wings. If a homozygous
D. 1 black male: 1 tortoise-shell female: 1 dominant male fly is crossed with a female with
ginger female: 1 black female vestigial wings, what percentage of their female
E. 2 black males: 1 tortoise-shell female: 1 progeny is expected to have wild-type wings?
black female A. 0 %
B. 25 %
10. Mendel perform his famous experiments of C. 50 %
Heredity on: D. 75 %
A. Maize E. 100 %
B. Bean plants
C. Garden pea 15. The total aggregate of the genes in a
D. Mirabilis plant population is called:
E. Wheat A. Gene variation
B. Gene code
11. A man who is normal for color vision marries C. Gene mutation
a normal heterozygous woman. What is the D. Gene pool
chance of their son being color blind? E. Gene trait
A. 0%
B. 25% 16. If the new born babies get mixed up in a
C. 50% hospital, how could you determine their
D. 75% parentage from the information given below?
E. 100%
Baby I Type O
PAGE N0: 100

Baby II Type B A. Xc Xc
B. Xn Y c
Mrs. Ali Type A C. Xc Y c
Mr. Ali Type AB D. XY
E. Xc Y
Mrs. Ahmad Type A
Mr. Ahmad Type A 21. What are the phenotypes of the parents of a
A. Baby I is the child of Mr. and Mrs. Ahmad colour blind son and non-carrier daughter with
B. Baby I is the child of Mr. and Mrs. Ali normal colour vision?
C. Baby II is the child of Mr. and Mrs. Ahmad Father Mother
D. Both Baby I and Baby II are the children of A. A. carrier normal
Mr. and Mrs. Ali B. B. colour-blind carrier
E. Inadequate Data C. C. colour-blind carrier
D. D. normal carrier
17. The four children of two parents each have a E. E. normal colour-blind
different blood group of the ABO series. What
were the blood groups of the parents? 22. Haemophilla is caused by a sex -linked,
A. A and A recessive allele. Two parents have a Haemopiliac
B. A and B son, a normal son a Haemophiliac daughter.
C. A and O What are the most likely genotype of the
D. B and O parents?
Mother Father
18. In some of Mendel's experiments, three A. A. XH Xh Xh Y
quarters of the offspring showed the dominant B. B. XH Yh XH Y
trait. Which of the following is most likely to be C. C. Xh Xh XH Y
true about the parents? H
D. D. X Y H Xh Y
A. Both were recessive E. None of the above
B. Both were heterozygous
C. Both were dominant 23. When hybrids are crossed, the genotype
D. One was heterozygous; the other, ratio of the offspring is
homozygous dominant A. 1 : 1
E. One was recessive; the other, B. 3 : 1
homozygous dominant C. 1 : 2 : 1
D. 4 : 1
19. A species of rose plants can be purchased as E. 3 : 2 : 1
red, white, or pink flowering plants. Assuming
that large petals is a dominant trait, which is the 24. Cystic fibrosis patients lack a gene that codes
genotype of a plant with pink flowers and large tor a transmembrane carrier of:
petals? [W = white flowers, w = red flowers, L = A. Na+ ions
large petals, l = small petals] B. K+ ions
A. WwLL C. CI- ions
B. WWLL D. Ca2+ ions
C. WWLl E. Mg2+ ions
D. wwLL
E. wwll
20. According to normal genetic prediction a

color-blind girl (Xc Xc) must have had a father
whose genetic makeup was:
PAGE N0: 101

Tahir Maryam A. Allele frequency
B. Genetic drift
C. Gene frequency
D. Allelomorph
30. A man with blood group 'A' marries a

woman with blood group 'B', child can have
A. A and B
B. B and AB
C. A and AB
Jawaria Juhi Saad D. A, B, AB and O
31. In a population 36% people have Blue Eyes";

25. In the pedigree of a family shown above, allele frequency for blue is
brown eyes are indicated as and blue eyes A. 36%
as Jawaria and Juhi are twins. From this B. 40%
chart, it can be determined that: C. 60%
A. Tahir and Mary are homozygous for D. 64%
brown eyes
B. Jawaria and Juhi are identical twins 32. O Group is universal donor because
C. Juhi is heterozygous for blue eyes A. It has both A & B Antigens
D. Juhi is homozygous for blue eyes B. No Antigens
E. Jawaria and Saad are homozygous for C. A antigen
brown D. B antigen
A. Eyes
33. In sickle cell anemia
26. Which of the following is an example of A. Valine is replaced by Glutamic Acid
discontinuous variation: B. Glutamic Acid is replaced by Valine
A. Range of height of pea plants 30-50 cm C. Glutamic Acid is replaced by Adenine
B. Offspring including 2 males and 3 females D. B-chain is replaced by Valine
C. Pea plants grown in darkness are yellow
D. Adult human weight ranges from 50-95 kg 34. Skin color, height and intelligence vary in
different people due to:
27. The possible result of crossing between A. Pleiotropy
heterozygous (T t) and homozygous dwarf (tt) is. B. Epistasis
A. 50% tall and 50% Dwarf C. polygenic inheritance
B. 100% tall D. Crossing over
C. 100% dwarf
D. 75% tall and 25% dwarf 35. When phenotypically tall plant is crossed
with pure dwarf plant what cross is this:
28. The tendency of gene in chromosomes to A. Test
remain together is called: B. Monohybrid
A. Crossing over C. Dihybrid
B. Synapsis D. Multiple cross
C. Terminalization
D. Linkage 36. If a color blind person marries a homozygous
normal female, what are the chances of sons to
be color blind?
29. The proportion of different alleles of a gene
A. 50%
in a population is termed as:
PAGE N0: 102
B. 25% C. AB
C. 100% D. O
D. None of these
43. How do tall pea plants produce short pea
37. A man who is normal for color vision marries plants?
a normal heterozygous woman chance of their A. Mutation
son being color blind is: B. Independent assortment
A. 0% C. Linkage
B. 100% D. Segregation
C. 50%
D. 25% 44. Genetic drift is the change in allele frequency
of small population simply by:
38. The gene pool of a population tends to A. Mutation
remain stable if: B. Natural selection
A. Mating is at random C. Migration
B. There is extreme migration D. Chance
C. There is selected mattings
D. There are frequent mutations 45. The branch of biology, which deals with
heredity and ___________ is known as genetics.
39. For a guinea pig, black coat (B) is dominant A. Crossing over
over white coat (b). If 2 guinea pigs mate and B. Variation
produce 75 offspring with black coats and 25 C. Linkage
white which coats the genotypes of the presents D. Mutation
were most likely:
A. BB x BE 46. In pea plants, all of the following are
B. Bb x BB examples of dominant traits except
C. Bb x Bb A. Round seed
D. Bb x bb B. Yellow seed
C. Tallness
40. If the women carrying the trait for color- D. Yellow pods
blindness marries a color-blind man that are the
chances they will have a color blind son: 47. Drosophila is useful for all of the following
A. 100 reasons except:
B. 75 A. It breeds every 10 days
C. 25 B. It produces many off springs
D. 50 C. It has no linked character
D. It has four pairs of chromosomes
41. Father has dark eyes and the mother has
blue. The possibility of the color of eyes of the 48. In the Himalayan rabbit, low temperatures
offspring: cause the growth of:
A. Blue A. White fur
B. Brown B. Black fur
C. Grey C. White paws
D. Blue or brown D. Black genes
42. The blood type known as a universal donor 49. A change in genes is called a
is: A. Genotype
A. A B. Phenotype
B. B C. Cross-over
PAGE N0: 103

D. Mutation
57. Which process during meiosis causes
50. A test cross is performed: variation?
A. Only with hybrids A. Formation of 4 daughter calls
B. Only with pure types B. Synapsis
C. To determine whether an organism is C. Fertilization of gamete
heterozygous or homozygous dominant D. Formation of haploid gamete
D. Only between recessives
58. The law of Dominance is illustrate in the
51. If two parents who are hybrid for brown garden pea by:
eyes have four children, the eye color of the A. Homozygous tall x heterozygous tall
children may be: B. Heterozygous tall x heterozygous tall
A. all brown C. Homozygous tall x Homozygous tall
B. 3 brown, 1 blue D. Pure short x pure short
C. 2 brown, 2 blue E. Homozygous tall x pure short
D. any of the above combination
59. In the Hardy-Weinberg principle, p2 + 2pq +
52. The hemoglobin of people with sickle-cell q2 = 1, q2 represents the frequency of the:
anemia differs from normal hemoglobin one: A. Homozygous dominant
A. Protein B. Heterozygous dominant
B. Gene C. Heterozygous recessive
C. Amino acid D. Homozygous recessive
D. Monosaccharide E. Blended genes
53. All of the following human traits are Questions 60-62

recessive except: Hemophilia is a disorder in which blood fails to
A. curly hair clot. Saad, a male hemophiliac, marries Sara, a
B. albinism normal woman and together they have four
C. light hair color children, two boys (Ahmed and Ali) and two girls
D. attached ear lobe (Alia and Ayesha). None of the children display
the symptoms of hemophilia. Ahmed, Ali, Alia,
54. Neurospora has been useful in illustrating: and Ayesha all marry normal individual and have
A. b) RNA action children. Hone of Ahmed's or Ali's children, male
B. DNA action or female, display symptoms of hemophilia, but
C. single gene action the sons of Alia and Ayesha display symptoms of
D. test cross hemophilia while the daughters of Alia and
Ayesha do not
55. The normal color of eye is due to:
A. Recessive alleles 60. Which of the following best explains the
B. Dominant alleles reasons that Ahmed, All, Alia, and Ayesha do not
C. Recessive gene display symptoms of hemophilia, even though
D. Dominant gene their father, Saad, is a hemophiliac?
E. Holographic genesis A. Hemophilia is a Y-linked disorder, and
Saad can only pass on his Y chromosome.
56. The gene for eye color is located on; B. Hemophilia is an X-inked disorder, and
A. X chromosomes even though Alia and Ayesha received a
B. Y chromosomes hemophiliac X chromosome from Saad,
C. Both A & B Sara gave them a normal X chromosome.
D. None of them
PAGE N0: 104

C. Hemophilia is a Y-linked disorder, and
therefore cannot be displayed in females. 65. The genotype of normal male in humans is
D. Hemophilia is a Y-linked disorder, and _________ chromosomes.
Ahmed and All must have received and X- A. 44+XX
chromosome from Saad. B. 44+XY
E. Hemophilia is an X-inked disorder, and C. 44+XXY
even though Ahmed and Ali received a D. 44+XO
hemophiliac X chromosome from Saad, E. 44+XXX
gave them a normal X chromosome.
66. In cats, the genes controlling coat-color are
61. If one of Ali's daughters marries a normal co-dominant (incompletely dominant) and are
man, what is the probability that one of their carried on the X chromosomes When a black
children will display symptoms of hemophilia? female was mated with a ginger male the
A. 0% resulting litter consisted of black male and
B. 25% tortoise-shell female kittens. What phenotypic
C. 50% ratio would be expected in the F2 generation?
D. 5% A. 1 black male: 1 ginger male: 2 tortoise-
E. 100% shell females
B. 1 black male: 1 ginger male: 1 tortoise-
62. Which of the following individuals are shell female: 1 Black female
heterozygous for hemophilia? C. 2 black males: 1 tortoise-shell female: 1
A. Saad, Ahmed and Ali ginger female
B. Ahmed, Ali Alia, and Ayesha D. 1 black male: 1 tortoise-shell female: 1
C. Saad and Sara ginger female: 1 black female
D. Alia and Ayesha E. 2 black males: 1 tortoise-shell female: 1
E. Ahmed and Ali black female
63. Erythroblastosis foetalis occurs when: 67. A pure-breeding plant with the dominant
A. Mother is Rh positive and baby is Rh phenotype of character P and the recessive
negative phenotype of character Q was crossed with
B. Mother is Rh negative and baby is Rh another pure-breeding plant with the. Recessive
positive phenotype of character P and the dominant
C. Both mother and baby are Rh negative phenotype of Q. The offspring of this cross were
D. Both mother and baby are Rh positive crossed with a double homozygous recessive for
E. All of the above statements are true P and Q and the following results obtained:
22 were phenotypically dominant for P and
64. In pea plants, the allele for round seeds (R) is recessive for Q.
dominant to the allele for wrinkled seeds (r) and 5 were phenotypically dominant for both P and
the allele for yellow seeds (Y) is dominant to the Q.
allele for green seeds (y). A doubly 4 were phenotypically recessive for both P and
heterozygous, round, yellow-seeded plant is Q.
crossed with a green, wrinkled- seeded plant. 24 were phenotypically recessive for P and
What percentage of the F1 generation are dominant for Q.
recombinants? Which one of the following types of
A. a.0 % inheritance is illustrated by these results?
B. b.25 % A. gene linkage of P and Q
C. c.50 % B. independent segregation of P and Q
D. d.75 % C. Mendelian dihybrid inheritance
E. e.100 % D. multiple alleles
PAGE N0: 105

E. polygenic inheritance 71. The diagram shows the inheritance of
haemophilia in a family.
68. Flower color is controlled by a single pair of
alleles. The allele for red flowers is dominant to
the allele for white flowers. 1 2 3 4
A plant homozygous for red flowers is crossed
with a plant homozygous for white flowers. All
the resulting plants have red flowers (F1
generation). 5 6 7 8
When the F1 generation is crossed with each
other, 18 plants are obtained. 12 plants have
red. 9 10 11
Flowers and 6 have white flowers (F2 Key to phenotypes key to chromosome types
generation) Normal female XH = normal X chromosome
What ratio is expected in the F2 generation and Haemophilia Xh = × chromosome
what ratio has been obtained? female carrying allele
Normal male for haemophilia
Haemophilia male Y = normal Y chromosome
expected ratio red obtained ratio
to white red to white What is the genotype of person 7?
A. 1:1 2:1 A. XH XH
B. 1:1 3:1 B. XH Y
C. 3:1 2:1 C. XH Xh
D. 3:1 3:1 D. Xh Yh
E. Xh Y
69. In birds the male is the homogametic sex. A
male bird showing the recessive trait was mated 72. Red-green colour-blindness is a sex-linked
with a female showing the dominant trait of a recessive trait. A colour-blind man marries a
characteristic governed by a pair of alleles which woman with normal vision, whose father is
are sex linked. What is the probability that the colour-blind. If they have a daughter, what is the
male offspring will show the dominant trait? probability that she will be colour-blind?
A. 0 A. 0
B. 0.25 B. 0.25
C. 0.50 C. 0.50
D. 0.75 D. 0.75
E. 1.00
73. Mendel concluded that each organism has
70. During the formation of an ovum, non- two hereditary factors for each trait, now called:
disjunction of the sex chromosomes occurred. A. chromatids
The ovum was then fertilized by a normal, Y- B. alleles
bearing sperm cell. Which one of the following C. chromosomes
shows the sex chromosome complement of the D. none of the above
resulting zygote?
A. XO 74. Inheritance of acquired characteristics is
B. XY based on:
C. XXY A. Genetic role in reproduction
D. XXXY B. Use and disuse of organ
E. XXYY C. Survival of the fittest
D. Mutations
PAGE N0: 106

thr - pro - glu - glu thr - pro - val -
75. The family tree shows the inheritance of the glu
ability to taste a certain substance. The allele for mRNA codons for these amino acids are
the ability to taste this substance is dominant to glutamine (glu) GAA GAG proline (pro) CCU
the allele for the inability to taste it. CCC
1st generation
threonine (thr) ACU ACC valine (val) GUA
GUG
Daud Maryam
Which transfer RNA molecule is involved in the
formation of this part of the sickle cell
haemoglobin?
2nd generation A. GUG
B. CAU
C. UGC
Pasha Hina D. GAG
3rd generation ???? 78. In the Hardy-Weinberg principle, p2 +2pg +q2

=?
A. 0
B. 1
C. Infinity
D. Any value between 0 to 1
Key
Represents a male ‘taster’ 79. Which statement about dominant and
Represents a male ‘non-taster’ recessive alleles is not correct?
Represents a female ‘taster’ A. A dominant characteristic is seen in the
Represents a female ‘non-taster’ phenotype of a heterozygote.
What percentage of children of Pasha and Hina B. A homozygous genotype may be either
would be 'non tasters'? dominant or recessive
A. 25 % C. Recessive phenotypes always have two
B. 50% recessive alleles.
C. 75% D. The phenotype of a homozygote is always
D. 100% dominant.
76. Two animals are mated. One is homozygous 80. An Rh negative woman is married to an Rh
dominant for one character and homozygous positive man whose father was also Rh negative.
recessive for another. The other animal is What are the chances that their child will be
heterozygous for both characters. How many affected?
phenotypes are expected in the offspring of this A. 25%
cross? B. 50%
A. 1 C. 75%
B. 2 D. 100%
C. 3
D. 4 81. The disease, which is caused by defect in a
single gene or pair of gene is referred to as:
77. Part of the amino acid sequences in normal A. Unifactorial
and sickle cell haemoglobin are shown. B. Multifactorial
normal haemoglobin sickle cell C. Down syndrome
haemoglobin D. Turner syndrome
PAGE N0: 107

82. The diagram shows the inheritance of E. All of the above
haemophilia in a family.
1 2 2. Which type of molecule is the end
product of translation?
A. amino acid
B. mRNA
C. polypeptide
D. tRNA
E. ATP
3 4 5 6
3. _______ is used to seal a DNA restriction
Key fragment.
Unaffected female A. Vector
Unaffected male B. Restriction enzyme
Affected male C. Ligase
If daughter 4 married a normal male, what is the D. Polymerase
probability that their first child would suffer E. Plasmids
from haemophilia?
A. 0 4. Process of transferring bacterium from a
B. 0.125 donor bacterium to a receive bacterium
C. 0.25 A. Conjugation
D. 0.5 B. Transduction
C. Transformation
83. An inter-breeding population of finches D. Regressive Mutation
became separated geographically, forming two
isolated groups. Each group then became 5. Formation of mRNA from DNA is called:
subject to different selective pressures. One A. Translation
group was then introduced into the habitat of B. Transcription
the other. C. Genetics
Which one of the following would determine D. Mutation
whether they now formed two distinct species?
A. They had been separated for more than 6. The photogenic bacteria transfer DNA
three million years. material to another bacteria by:
B. They failed to produce fertile F, hybrids. A. Transduction
C. They showed marked differences in the B. Transformation
shape of their beaks. C. Conjugation
D. Their plumage had become markedly D. Fragmentation
different.
E. Several genes now possessed different 7. Bacteria takes rDNA in the presence of:
base sequences. A. NaOH
B. HCL
UNIT NO. (09) C. Calcium Chloride
D. NaCl
1. The enzyme used to seal the sticky ends
of DNA restriction fragment is: 8. Which enzyme is used to cut DNA into small
A. Ligase pieces?
B. Polymerase A. ONA polymerase
C. Adenosine deaminase B. Vector
D. Trypsin C. Restriction enzyme
PAGE N0: 108

D. DNA Ligase
15. The process of replacing or supplementing
9. Transcription: the defective allele with a functional, normal
A. Requires tRNA to assemble amino acids allele is known as _______.
B. Requires DNA polymerase to assemble A. allele transplant
nucleotides B. physiotherapy
C. Results in the synthesis of a peptide C. gene therapy
D. Requires the nucleotide containing uracil D. mutation
E. cloning
10. The process of transferring coded
information from DNA to messenger RNA is 16. In the commercial manufacture of insulin, a
known as: human gene is inserted into which of these?
A. Translocation A. a chromosome of a human cell
B. Transpiration B. a protein molecule in a yeast cell
C. Transcription C. the DNA of a bacterium
D. Translation D. the nucleic acid in a virus
11. All of the following are examples of genetic 17. The enzyme used to seal the DNA is:
engineering except the: A. Restriction enzymes
A. Production of a synthetic vaccine hepatitis B. Ligase
B by yeast cell C. Polymerase
B. Development of a strain of bacteria to Lipase
break down oil spills
C. Production of human antibodies in UNIT NO. (10)
tobacco plants
D. Development of frog embryo outside 1. Which of the following ideas was not
female body part of Charles Darwin's theory of evolution by
natural selection?
12. Radioactive, short deoxy oligonucleotide A. Organisms produce more offspring than
sequence based on N-terminal amino acid the environment can support
sequence of a protein is called: B. Variation between individuals arises by
A. Gene probe gene mutation
B. Gene clone C. Only those individuals best adapted to the
C. Type II environment survive and reproduce
D. Complementary DNA D. Individuals compete for scarce resources
E. None of the above E. Adaptive variation is inherited
13. The total number of Alleles in a population 2. Which of the following men might have
in one time is called ______. explained the auk's less of the ability to fly with
A. Gene Pool the following hypothesis?
B. Gene Constant "Since the auk stopped using its wings, the
C. Allele Pool wings became smaller and this acquired trait
D. Allele Constant was passed on to the offspring."
A. Darwin
14. The coding part of gene is called _____. B. Mendel
A. Exon C. De Vrles
B. Intron D. Lamarck
C. Interferon E. Morgan
D. Exoferon
PAGE N0: 109

3. Darwin's theory of evolution by natural A. use and disuse of organs
selection incorporated all of the following B. asexual reproduction
EXCEPT C. sexual reproduction
A. hereditary variation D. variations
B. high reproductive potential E. natural selection
C. inheritance of acquired characteristics
D. struggle for existence 9. Which of the following negates Lamarck's
E. different survival Theory?
A. Elongated fore-limbs and neck of giraffe
4. Which of the following statements is B. Custom of Circumcision
FALSE based on Darwin's theory of evolution? C. Evolution of snake
A. Natural selection is the driving force of D. foot of modern horse
evolution. E. Webbed feet of duck
B. Favorable genetic variations become
more and more common in individuals 10. Lamarck Identified evolution as:
throughout their lives. A. Natural selection
C. There is always a tendency of B. Acquired characters
overproduction in a species. C. Disuse / use of organs
D. All individuals of a species are not 100% D. Mutation Theory
alike.
E. None of the above. 11. The theory of inheritance of acquired
characters was proposed by:
5. The weakness in Darwin's theory of how A. Devaries
evolution occurs was his inability to explain the B. Darwin
A. mechanisms that produce variations C. Lamarck
B. reasons for overproduction D. Weisman
C. role played by natural selection 12. All of the following provide evidence for
D. adaptations of living organisms for evolution except:
survival A. eugenics
E. inheritance of acquired characteristics B. heredity
C. fossils
6. Darwin's Theory was based on all of the D. vestigial
following points except:
A. Over reproduction 13. The first scientist to present a theory of
B. Struggle for existence evolution was:
C. Variations and heredity A. Empedocles
D. Survival of the fittest B. Anakaminder
E. Use and disuse of organs C. Lamarck
D. Darwin
7. Coccyx a reduced tail bone in man is the
best example of 14. Most scientists today believe that species
A. Embryology have changed as the result of:
B. Vestigial organs A. use and disuse
C. Homology B. inheritance of character
D. Habitat C. minor variations
E. Deme D. mutation
8. All of the following are factors in the 15. All of the following are factors in the
development of new species EXCEPT: development of new species except
PAGE N0: 110

A. variation IV. Although populations tend to overproduce,
B. asexual reproduction they remain more or less constant in numbers
C. sexual reproduction from generation to generation.
D. both B and C In what sequence should the statements be
placed to support. Darwin's theory of evolution?
16. Identify the incorrect statement about A. I, II, III, IV
Charles Darwin's Theory: B. II, I, III, IV
A. The individuals of species have variations C. III, I, IV, II
among them D. IV, II, I, III
B. There is always a tendency of over
reproduction in a species 20. At what point are two populations
C. Vast gradual changes result in the origin descending from the same ancestral stock
of a new species considered separate species?
D. Favorable variations survive and A. When they can no longer produce viable,
unfavorable will be exterminated fertile offspring
E. Intra specific competition occurs between B. when they look significantly different
different species and inter-specific from each other
competition occurs among the individuals C. When they can interbreed successfully
in a species and produce offspring
D. When their habitats are separated by a
17. Lamarck theory is based on all of the significantly large distance so that they
following points EXCEPT: cannot meet
I. Effects of environments E. Both B & C
II. Use and disuse of organs
II. Natural selection 21. The following observations refer to
IV. Inheritance of acquired character evolution:
A. I only I. Inherited variations which are 'favoured' in
B. II only particular environment are passed on
C. III only II. There is a struggle for existence.
D. IV only III. In time, ‘favoured' inherited variations may
E. I, II, and IV accumulate causing gradual changes in the
organism.
18. Many scientists believe that one of the IV. Although populations tend to overproduce,
following is/are evolutionary origin(s) of they remain more or less constant in numbers
animals, plants and fungi? from generation to generation.
A. Protists In what sequence should the statements be
B. Algae placed to support Darwin's theory of evolution?
C. Bacteria A. I, II, III, IV
D. Protozoans B. II, I, III, IV
C. III, I, IV, II
19. The following observations refer to D. IV, I, II, III
evolution: E. IV, II, I, III
I. Inherited variations which are ‘favoured' in
particular environment are passed on.
II. There is a struggle for existence.
III. In time, ‘favoured' inherited variations may
accumulate causing gradual changes in the
organism.
PAGE N0: 111

UNIT NO. (11) A. Grass hopper
B. Frog
1. Living things that convert nitrogen- C. Sheep
containing molecules into nitrates are: D. Cow
A. Decomposers (e.g. bacteria and fungi) E. Rabbit
B. Producers (e.g. green plants)
C. Primary consumers (e.g. mice) 7. The decomposers of an ecosystem are:
D. Secondary consumers (e.g. snakes) A. Parasites only
E. Tertiary consumers (e.g. hawks) B. Bacteria only
C. Fungi only
2. The best definition of species is D. Bacteria and Fungi
A. A group of organisms that occupy the E. Producers only
same niche
B. A population that works together to 8. The habitat of a population is the:
defend itself from predators A. set of conditions and resources it uses
C. A group of organisms that can mate with B. place where it lives
each other C. geographic area it covers
D. A population that preys on other D. set of interactions it has with other
populations populations
E. A population where all members benefit
from the association in some way 9. What is the ecological definition of the
term community?
3. A bird that feeds on both insects ant A. all the food webs in an ecosystem
berries would be classified as a B. all the individuals of one species in an
I. Primary consumer area
II. Secondary consumer C. all the organisms in an area
III. Tertiary consumer D. the living organisms and their non-living
A. I only environment
B. II only
C. III only 10. Which of the following is the correct
D. I and III only sequence of the levels of organism
E. II and III only A. organism → population → community →
ecosystem → biosphere
4. In the given food chain of grass → B. community → ecosystem → organism →
squirrel → snake → owl, the secondary population → biosphere
consumer would be C. ecosystem → organism → population →
A. grass community → biosphere
B. squirrel D. organism → community → population →
C. snake ecosystem → biosphere
D. owl E. organism → community → ecosystem →
E. microbes of decay population → biosphere
5. Nitrogen cycle is facilitated by _______.
A. Algae 11. Higher altitudes have
B. Fungi A. High temperatures
C. Bacteria B. Less rain
D. Virus C. High atmospheric pressure
E. Earth-quacks D. Increased wind velocity
6. All of the following are primary E. All of the above
consumers except:
PAGE N0: 112
12. In a pyramid of energy, which level Which of the above organisms is a primary
represents the greatest amount of energy? consumer?
A. Producers A. Frog
B. First-order consumers B. Aphid
C. Second-order consumers C. Ladybird beetle
D. Third-order consumers D. Maple tree
E. Decomposers
19. All of the following statements about
13. The plants and animals of an area which live population are true except:
successfully and reproduce particular A. A population is made up of individuals of
surrounding constitute: different species
A. Community B. Populations respond to favorable
B. Population conditions by increasing in number
C. Ecology C. Conditions favorable for one population
D. Biosphere maybe unfavorable for another
D. Individuals of a population interact with
14. The drastic change in climate over a past each other.
century has been illustrated
A. Increase in rainfall 20. In a pyramid of energy, the greatest amount
B. Decrease in rainfall of energy is present in' the level represented by:
C. Colder winter A. Producers
D. Warmer winter B. First-order consumers
C. Second - order consumers
15. An ecosystem is: D. Decomposers
A. Population living together
B. Species living together 21. The expression "Ecological Niche" is defined
C. A community with its nonliving as
components A. A group of individual living together
D. A community with its living & nonliving B. Where an organism lives
components C. e) All the population of a specific area
D. The role that an organism plays in an
16. Different Food Chains interact with each ecosystem
other to form:
A. Food Pyramid 22. Combining the desirable qualities of two
B. Energy Graph different organisms into one is referred to as
C. Food Web A. Inbreeding
D. Energy Pyramid B. Self-breeding
E. Food Chain Complex C. pure-line breeding
D. Hybridization
17. Oxygen reacts with RuBP in the absence of
CO2 to form: 23. Progression from simple to complex forms is
A. PGA summarized in the term:
B. PGA and phosphoglycerate A. Sedimentation
C. Oxalo acetate B. putrefaction
D. ATP C. Evolution
D. catastrophism
18. The following is a food chain:
Maple tree → Aphid → Ladybird beetle 24. An ecosystem in made up of
Frog → Garter snake → Hawk A. Producers
PAGE N0: 113

B. Consumers 31. Which of the following would be most likely
C. Decomposers to occur in an ecosystem?
D. All of these A. As the number of prey decreases, the
number of predators increases
25. A change in the community structure of an B. As the number of predators increases, the
ecosystem over a period of time is called: number of prey increases.
A. Climax C. As the number of prey decreases, the
B. Food chain number of predators decreases
C. Succession D. As the number of prey increases, the
D. Food web number of predators decreases.
E. As the number of predators decreases,
26. The succession ends with a diverse and the number of prey decreases.
relatively stable
A. Community 32. The secondary and tertiary consumers are
B. Biosphere also known as:
C. Ecosystem A. green plants
D. Climax community B. herbivores
C. abiotic factors
27. A disease in living organisms caused by D. decomposers
parasites is called E. carnivores
A. Infection
B. Infestation 33. Consider the following statements about
C. Endosymbiosis biological communities.
D. Commensalism I. Their members share a common gene pool.
II. The community remains stable even though
28. An association between members of some physical aspect of the environment may
different species in which both get benefit from undergo change.
each other is called: III. It consists of all the populations living in a
A. Symbiosis particular area.
B. Parasitism IV. A community interacts with non-living
C. Mutation environment and both function together to form
D. Commensalism ecosystem.
Which two of the above statements are true?
29. Scientific study of soil is called: A. 1 and 2
A. Topography B. 1 and 3
B. Penology C. 2 and 4
C. Geology D. 2 and 3
D. All of the above E. 3 and 4
30. The total amount of _____ reaching the 34. Living things that would be the first to
producers in the ecosystem is called incident experience adverse effects if large amounts of
solar radiation: carbon dioxide were taken out of the biosphere
A. Solar energy are:
B. Radiant energy A. Decomposers (e.g. bacteria and fungi)
C. Heat B. Producers (e.g. green plants)
D. Energy C. Primary consumers (e.g. mice)
E. None of the above D. Secondary consumers (e.g. snakes)
E. Tertiary consumers (e.g. hawks)
PAGE N0: 114

35. The diagram shows a food web. A. Stock the lakes with bigger fish so that
4 5 they can resist the effects of the acid
better
B. Reduce the amount of fossil fuels that are
3 burned
C. Supply plants with excess phosphorus and
2 water
1 D. Supply fungi with excess sugars and amino
acids
producer
E. Only fish when it is sunny
Which organisms occupy the same trophic level? 3. Savannah is an example of _______
A. 3 and 2 ecosystem:
B. 4 and 1 A. marine water
C. 5 and 2 B. fresh water
D. 5 and 4 C. forest
E. 1 and 2 D. tropical grass land
E. desert
36. Which of the following defines an ecological
niche? 4. The sea zone below 2000 meters is
A. the habitat in which an organism finds its called:
food supply A. Euphotic zone
B. the habitat in which an organism finds the B. Bathyal zone
most suitable climate C. Abyssal zone
C. the relationship between an organism and D. Pelagic zone
other species E. Benthic zone
D. the way in which an environment is
exploited by an organism 5. The biome in which an ecologist would
expect to find the coldest year-round
37. Which of the following is not the type(s) of temperature is the:
abiotic component? A. Taiga
A. Climatic factors B. Coniferous
B. Edaphic factors C. Deciduous forest
C. Topographic factors D. Tundra
D. Phytoplankton E. Grassland
UNIT NO. (12) 6. The frozen soil in Tundra is called

________.
1. Which of the following deserts is an A. Ice-soil
example of a cold desert B. Snow soil
A. Sahara desert C. Frigid soil
B. Thar desert D. Perma frost
C. Cholistan desert E. Frosted-soil
D. Gobi desert
E. Thal desert 7. Which of the following is correct
regarding Savannah type of ecosystem?
2. What night be the best strategy to A. The dry season is very long
prevent ecological damage due to acid rain? B. The temperature ranges upto 45°
throughout the year
PAGE N0: 115

C. The subsoil is permanently frozen and is 13. The temperature deciduous forest are
called perma frost characterized by plant
D. The forests are characterized by board A. Maple
leaved plants B. Pine
E. Most common animals are bats, wild cats, C. Fir
wild boars and spiders D. Spruce
8. All of the following statements are true 14. In pond ecosystem the macronutrient
about savannah EXCEPT: include:
A. Dry season is very long and temperature A. Iron
ranges more than 18 °C throughout the B. Manganese
year C. Copper
B. These are tropical grass lands D. Magnesium
C. Rain fall is upto 125 cm per year
D. Fauna includes antelopes, zebras and 15. In which region organic material and shells
giraffes are found:
E. Its plants do not shed off their Ieaves A. Littoral
B. Abyssal
9. ________ biomes are known as bread C. Euphotic
basket of the world. D. Bathyal
A. Coniferous forest
B. Temperate deciduous forests 16. The biome in which most of the Earth's
C. Tundra photosynthesis takes place is:
D. Tropical rain forests A. Oceans
E. Grass land B. Deciduous forests
C. Tropical forests
10. Identify the correctly matched pair relating D. Coniferous forests
to a term and its meaning/function/example:
A. nitrogen cycle ... Rhizopus 17. In Grassland ecosystem the average rainfall
B. denitrifying bacteria ... change protein to is ________:
ammonia A. 30 to 75cm
C. biosphere ... where life exists B. 100 - 125cm
D. lithosphere ... water, air and soil on the C. 20 - 40cm
surface of earth D. 125-150cm
11. _______ mono consists of deeper layer of 18. In which of the following habitats are we
water. most likely to find and animal with no sweat
A. Letic glands, a thick fur and bulky body?
B. Littoral A. Tundra
C. Limnetic B. Grass lands
D. Profundal C. Tropical forest
D. Desert
12. Coniferous forests are found at _______.
19. Which biome contains maples, Oaks, and
A. High altitudes & latitudes
bears?
B. Low altitudes & latitudes A. Tundra
C. High longitudes & latitudes B. Tropical rain forest
D. High altitudes & longitudes C. Temperate grasslands
D. Taiga
PAGE N0: 116

E. Deciduous forest J. polygenic inheritance
20. Identify the incorrect statement about the 24. At the northern hemisphere, a tundra type
Bathyal zone: of growth:
A. It ranges from surface to depth of about A. А. is impossible
2000 meters B. occurs only in winter
B. It consists of pelagic and benthic zones C. lasts only for two to three months
C. It is aphetic D. is in the form of a wide land
D. It contains producers that prepare food E. is in the form of patches of land
for consumers
E. None of the above 25. Which of the following statements is true
about savannah?
21. The producers of pond ecosystem include: A. dry season is very long and temperature
A. Bacteria ranges more than 18°C throughout the
B. Zooplankton year
C. Fungi B. its plants do not shed off their leaves
D. Phytoplankton C. the sub soil is permanently frozen
E. All of the above D. rain fall is upto 200 cm per year
E. evaporation exceeds rainfall
22. Savannah is an example of ________
ecosystem: 26. A pollen tube serves as to:
A. marine water A. produce sperms
B. fresh water B. store food for the developing embryo
C. forest C. transfer sperms from the stigma to the
D. tropical grass land ovary
E. desert D. produce female gametophytes
23. A pure-breeding plant with the dominant 27. Which of the following is the area of least
phenotype of character P and the recessive productivity?
phenotype of character Q was crossed with
another pure-breeding plant with the. Recessive
phenotype of character P and the dominant
phenotype of Q. The offspring of this cross were
crossed with a double homozygous recessive for
P and Q and the following results obtained:
22 were phenotypically dominant for P and
recessive for Q.
5 were phenotypically dominant for both P and A. Intertidal zone
Q. B. Oceanic zone
4 were phenotypically recessive for both P and C. Photic zone
Q. D. Aphotic zone
24 were phenotypically recessive for P and E. Neritic zone
dominant for Q.
Which one of the following types of 28. The continuous decrease in water table and
inheritance is illustrated by these results? favorable changes in substratum makes the
F. gene linkage of P and Q pond suitable for plants, they have much
G. independent segregation of P and Q branched rhizome system. The dense growth of
H. Mendelian dihybrid inheritance plants increases the rate of transpiration, which
I. multiple alleles ultimately exposes the marshy soil. The
PAGE N0: 117
nutrients present in pond due to action of II. deamination
oxygen of air are now oxidized to nitrates and III. nitrification
sulphates. The representative plant species of IV. nitrogen fixation
this stage are Juneus, Cyperus and Carex. The A. I, II and III only
animals of this stage are snails like Anodonta B. I, II and IV only
and Psidium.
The above given lines tell about which of the P Q R S
following stage of hydrosere in a pond? Denitrificat
Nitrogen Decay of
A. Climax stage fixation leaf tissue Ammonificat
ion
A by by ion by
B. Wood land stage by
. Nitrifying saprotroph saprotrophic
C. Sedge meadow stage anaerobic
bacteria ic fungi
D. Reed swamp stage bacteria
fungi
E. Submerged stage Nitrogen
Decomposi
Decompositi
fixation on
Lightening tion using
B by by root
29. The below given are the characteristics of action on nitrogenas
. nitrogen nodule
which of the following ecosystem? soil nitrates e
fixing bacteria
I. I includes tropical grasslands enzyme
bacteria
II. Rainfall is up to 125cm per year. Nitrificati
nitrification Decay of
III. Dry season is very long on using Assimilation
by leaf
IV. Primary consumers include Zebras, giraffes C nitrogena of
anaerobic tissue by
. se Organic
and elephant etc. bacteria
enzyme
saprotroph
nitrogen
V. Euphorbia is an example of its plant life ic fungi
A. Tropical rain forests Nitrogen
reduction Decomposi Decay of
B. Coniferous forests fixation
by tion urea
C. Savannah D by
anaerobic of organic by
. root
D. Tundra bacteria
nodule
nitrogen saprotrophic
bacteria
bacteria
UNIT NO. (13) C. I, III and IV only
D. II, III and IV only
1. The diagram shows a simplified nitrogen
cycle. 3. The first step in nitrogen cycle is:
A. Nitrification
nitrate
B. Ammonification
P
C. Oxidation
R D. Denitrification
legume
ammonia
Q 4. Nitrogen is the ultimate product of:
S A. Fats
nitrogen B. Carbohydrates
nitrogen in C. Proteins
primary consumers D. Organic salts
Which row shows the correct labels for P, Q, R
5. Thick layer of _______ acts like a glass of
and S?
a green house, which allows the entry of
incoming solar radiation, but prevents the
2. Which processes are essential in making
emission of the outgoing heat waves:
nitrogen in dead plant material available to
A. Nitrogen dioxide
growing plants?
B. Sulphur dioxide
I. ammonification
C. Nitrogen
PAGE N0: 118
D. Carbon dioxide
E. Ozone
6. What phenomenon is causing heating up

of the earth's atmosphere?
A. Global warming
B. Pollution
C. Ozone depletion
D. Deforestation
7. Plants absorb it in the form of soluble

phosphates. It is present abundantly in growing
and storage organs of plants. What is it?
A. H2O
B. СО2
C. K
D. P
E. N
8. Nitrogen-cycle is facilitated by ________.
A. Algae
B. Fungi
C. Bacteria
D. Virus
E. Earth-quacks
PAGE N0: 119


Biology Book 1 & 2-1 PDF

Загружено:

Сведения о документе

Оригинальное название

Авторское право

Доступные форматы

Поделиться этим документом

Поделиться или встроить документ

Параметры публикации

Этот документ был вам полезен?

Это неприемлемый материал?

Авторское право:

Доступные форматы

Biology Book 1 & 2-1 PDF

Загружено:

Авторское право:

Доступные форматы

BOOK 1 MCQS

UNIT NO. (01) D. Turgor Force

7. If the eyepiece of a microscope is marked 10X

enzyme 1 enzyme 2 enzyme 3

7. The cell membrane is made up of:

3. Which of the following is a correct

22. The nonliving part of protoplasm is: 29. Leucoplast are:

41. The delimiting outer membrane is absent is:

42. The chief role of nucleolus in nucleus

Supernatant 43. ________ were discovered by Slautter Back.

D Light Carbohydrat carbohydrat

Light carbohydrat Carbohydrat

C. 40% 64. The following are all features of eukaryotic

67. The diagram shows some similarities

UNIT NO. (05) 7. Which one of the following is not a viral

5. Arboviruses cause: 11. In plants and animals, Colorado tick fever is

7. Which features enable an organism to be

9. In which kingdom is the organism classified?

3. All of the following organisms belong to the 9. Amoeba causes:

7. Where do pollen grains develop?

11. Peach trees, apple trees, tomatoes, and

28. Which one of the following is the major

29. Dalbergia sisso is botanical name of _______.

47. An increase in the diameter of an oak tree is

48. Which of the following is included in E. None of the above

61. Minerals salts enter a plant largely through

64. Prosopis glandulosa is the botanical name of

16. Which of the following bird is placed in the

17. Which of the following have a pupa stage in

20. The dark reaction of photosynthesis: 27. Xanthophyll is a pigment having:

57. The dark reactions of photosynthesis are

15. Vitamins K 22. A person with insufficient iron in his diet

26. About the stomach:

UNIT NO. (13)

1. All of the following are functions of the liver

42. In which situation would transpiration be at

44. Pharynx leads air into ______ through

45. Which of the following describes the

3. During the action potential:

5. The diagram shows a generalized animal cell.

9. Which of the following terms describes the

34. The stomatal pore will open when the

31. An example of partial root parasite is:

32. Malpighian body is composed of:

78. Lateral meristem are composed of ________

In a plant, what are the structures w, X, Y

all 88. Leukaemia is associated with increased

93. Which of the following are animals with

95. Five words are shown below:

6. Which one of the following structures is

17. The kidney does not perform the function of:

38. Which of the following is an excretory X

41. Malpighian tubules are involved in excretion

8. Each myosin filament is surrounded by:

E calcium ions actomyosin acetylcholine

63. The movement of plants in response to

64. The number of muscles in a human body is muscle Y muscle

When muscle X contracts, what happens to the

9. In a reflex arc: 15. The phytohormones controlling the plant

Questions 24-26 28. Thyroid stimulating hormone levels:

29. Retina contains light sensitive receptor cells

82. The following sequence of events occurs at

88. Newborn babies are screened for the