See discussions, stats, and author profiles for this publication at: https://www.researchgate.

net/publication/317951067

Endemic Dragons of Sumatra's Volcanoes: New Species of Dendragama

(Squamata: Agamidae) and Status of Salea rosaceum Thominot

Article  in  Herpetological Monographs · December 2017

DOI: 10.1655/HERPMONOGRAPHS-D-16-00012

CITATIONS READS

3 420

5 authors, including:

Michael B Harvey Kyle J Shaney

Broward College Universidad Nacional Autónoma de México
72 PUBLICATIONS   907 CITATIONS    23 PUBLICATIONS   251 CITATIONS   

SEE PROFILE SEE PROFILE

Irvan Sidik Nia Kurniawan

Research Center for Biology, Indonesian Institute of Sciences Brawijaya University
16 PUBLICATIONS   37 CITATIONS    55 PUBLICATIONS   175 CITATIONS   

SEE PROFILE SEE PROFILE

Some of the authors of this publication are also working on these related projects:

Systematic of Linnaeus reed snakes View project

Phylogeography and systematics of North American whipsnakes View project

All content following this page was uploaded by Michael B Harvey on 27 June 2017.

The user has requested enhancement of the downloaded file.

Herpetological Monographs, 31, 2017, 69–97
Ó 2017 by The Herpetologists’ League, Inc.

Endemic Dragons of Sumatra’s Volcanoes: New Species of Dendragama (Squamata: Agamidae)

and Status of Salea rosaceum Thominot
MICHAEL B. HARVEY1,5, KYLE SHANEY2, IRVAN SIDIK3, NIA KURNIAWAN4, AND ERIC N. SMITH2
1
Department of Biological Sciences, Broward College, 3501 SW Davie Road, Davie, FL 33314, USA
2
The Amphibian and Reptile Diversity Research Center and Department of Biology, University of Texas at Arlington, 501 S Nedderman Drive, Arlington,
TX 76010, USA
3
Laboratory of Herpetology, Museum Zoologicum Bogoriense, Research Center for Biology, Indonesian Institute of Sciences–LIPI, Jl Raya Jakarta Bogor
km 46, Cibinong, West Java, 16911, Indonesia
4
Department of Biology, Universitas Brawijaya, Jl Veteran, Malang, East Java 65145, Indonesia

ABSTRACT: We discovered new populations of Dendragama at the northern and southern ends of Sumatra. High genetic distances and
concordance of multiple, apparently independent diagnostic characters support our descriptions of these two populations as new species. We
define new characters of the sublabial, tympanic, dorsal crest, and dorsolateral crest scales. The three species of Dendragama undergo remarkable
color change in response to time of day and stress. Females lay 2–4 ovoid eggs, reach sexual maturity at about 60 mm snout–vent length, and likely
produce multiple clutches each year. We remove Salea rosaceum Thominot from the synonymy of Dendragama boulengeri and argue that the
unique holotype of S. rosaceum is a specimen of Pseudocalotes tympanistriga with incorrect locality information.
Key words: Clutch size; Color change; Dendragama australis sp. nov.; Dendragama boulengeri; Dendragama dioidema sp. nov.; Draconinae;
Java; Morphology; ND4; Pseudocalotes cybelidermus; Pseudocalotes guttalineatus; Pseudocalotes tympanistriga; Reproductive cycle; Sexual dimorphism;
Singapore; Sunda Shelf; Systematics

SHORTLY after Doria described the new genus and species
Dendragama boulengeri in 1888, Boulenger (1890) added
Salea rosaceum Thominot to its synonymy and Boettger
(1893) named a second species, Dendragama fruhstorferi,
from Java. The genus contained only these two species until
1954 when Mertens synonymized D. fruhstorferi with
Pseudocalotes tympanistriga Gray, thus rendering the genus
monotypic. Mertens (1954) also considered Dendragama to
be a synonym of Pseudocalotes Fitzinger and relegated
Pseudocalotes to subgeneric status within Calotes Cuvier.
Moody (1980) recognized both Pseudocalotes and Dendra-
gama as valid genera and retained only boulengeri in
Dendragama. Initially, these changes failed to gain accep-
tance (Frost and Etheridge 1989; Ota and Hikida 1989,
1991), but both genera are now widely recognized as distinct
from Calotes (e.g., Welch et al. 1990; Manthey and Schuster
1996; Hallermann and Böhme 2000).
Neither Moody (1980) nor Mertens (1954) discussed
Acanthosaura schneideri Ahl. Ahl (1926) described this
species based on a single specimen from ‘‘Simbolon’’ in the
Batak Highlands of Sumatra. He appreciated this species
similarity to lizards in the genus Pseudocalotes and compared
it to Acanthosaura fruhstorferi Werner (¼ Pseudocalotes
brevipes fide Smith 1935; Mertens 1954). Although Wer-
muth (1967) and Tiedmann et al. (1994) considered A.
schneideri to be a synonym of P. brevipes (Werner),
Manthey and Grossmann (1997) transferred Ahl’s species
to the synonymy of D. boulengeri. Following these changes,
Dendragama remains monotypic, albeit containing three
subjective synonyms: D. boulengeri Doria, Salea rosaceum
Thominot, and Acanthosaura schneideri Ahl.
5
CORRESPONDENCE: e-mail, mharvey@broward.edu
ZooBank.org registration LSID: 99761424-5102-4298-97D3-
E7EB36EAF14D
Dendragama occurs only on Sumatra. Although originally
described from West Sumatra Province, these lizards were
later reported from the Batak highlands of North Sumatra
(Werner 1900; De Rooij 1915) and Kerinci Seblat National
Park in Jambi (Kurniati 2009). The checklist of Teynié et al.
(2010) included these three provinces in the distribution of
this species but also added Aceh without comment.
In 2013, we began a comprehensive survey of reptiles and
amphibians across Sumatra. Preliminary results revealed an
agamid fauna of surprising diversity, exceeding that of
Peninsular Malaysia and Borneo in both numbers of species
and genera (Harvey et al. 2014). Though previously rare in
collections, Dendragama proved to be one of the most
common lizards at high elevations on many mountains visited
during our surveys. At all localities, Dendragama rarely
occurs below 1500 m. We found additional populations of
Dendragama far outside of the known range of the genus,
both to the north in Aceh and south in Bengkulu and South
Sumatra Provinces.
Though the populations of Dendragama appeared similar
at first, we noted several differences suggesting that the
genus contains not one but several species. We take this
opportunity to evaluate our initial impressions.
MATERIALS AND METHODS
Morphological Characters and Fieldwork
Teams of researchers from Broward College (BC), the
Museum Zoologicum Bogoriense (MZB), the Universitas
Brawijaya (UB), and the University of Texas at Arlington
(UTA) conducted surveys mostly along trails and streams
through montane forests, cultivated areas, and areas of
secondary growth during July and August 2015. We
conducted most surveys at night and recorded global
positioning system coordinates using the WGS84 geodetic
system. We photographed specimens in life, euthanized
them with an intracoelomic injection of benzocaine, stored

69
70 Herpetological Monographs 31, 2017
either liver or muscle in 1.5 ml of cell lysis buffer for DNA
extraction, fixed the lizards in 10% buffered formalin, and
transferred them to 70% ethanol for permanent storage at
the MZB and UTA. Before fixing, we weighed each
specimen using an electronic balance. We placed each
specimen on a flat surface next to a ruler and took
photographs of the dorsal, lateral, and ventral sides. We
deposited photos of all specimens at UTA.
We everted hemipenes of most males in the field and
sexed the remaining specimens by a ventrolateral incision on
the right side. To avoid damaging specimens, we assessed
reproductive condition of most females by examining ovaries
and oviducts on the right side only. We estimated the volume
of oviductal eggs using the formula for a prolate spheroid,
(4p/3)a2c, where a is the smallest and c is the largest radius
of the egg. We estimate clutch size based on numbers of
large, yolked ovarian eggs in the same stage of development,
rather than on counts of oviductal eggs, because some
specimens may have laid one or more of their oviductal eggs
before capture.
We compared three populations of Dendragama com-
prising a southern sample from Sumatera Selatan and
Bengkulu Provinces, a central sample including type
specimens of D. boulengeri and recently collected specimens
from the type locality and nearby mountains of Sumatera
Barat Province, and a northern sample entirely from Aceh
Province. We scored each specimen for a suite of meristic,
mensural, and qualitative characters that have proven useful
for diagnosing and describing lizards in the closely related
genus Pseudocalotes (Harvey et al. 2014). During the course
of this study, we identified several new characters, which we
describe herein.
To the nearest 1 mm with a straight ruler, we measured
snout–vent length (SVL, to the anterior lip of the cloaca),
body length (axilla to groin), pectoral width (axilla to axilla),
and length of the tail (from the anterior lip of the cloaca). We
measured Finger III and IV and Toes IV and V by pressing
the digits to a flexible ruler and measuring from the
interdigital skin to the base of the claw. To the nearest 0.1
mm with digital calipers, we measured head length (from the
occiput to the center of the snout), distance from the
anterior border of the auditory meatus to the center of the
snout, head width (at rictus), maximum diameter of the orbit
(bony edge to bony edge; not the ocular aperture as used by
Harvey et al. 2014); we took this measurement along a line
more or less parallel to the ocular aperture because the orbit
is widest along this line), shortest distance from the posterior
border of the orbit to the anterior margin of the auditory
meatus, length of the tympanic membrane or enlarged
tympanic scale (not including one or more small granular
scales that may separate the tympanic scale from the border
of the auditory meatus), width of the snout (between the
upper margins of the nostrils), greatest width and height of
the rostral, length of the shank (from the center of the knee
to the preaxial base of Toe I), height of the longest nuchal
crest scale (a straight-line measure from the anteriormost
edge of the scale to its apex), and height of the longest dorsal
crest scale (using the same technique as for nuchal crest
scales).
For characters that could be scored on either side of the
body (i.e., bilateral characters), such as length of the shank
and counts of labials, we scored meristic characters on the
left side and mensural characters on the right side of each
specimen. When a bilateral character was damaged on one
side, we switched sides.
Most of our meristic characters are self-explanatory;
however, a few characters used in this study require further
comment. As in Pseudocalotes (Harvey et al. 2014), the last
supralabial is lower and more elongate than the supralabials
in front of it. It overlies the rictus and extends posterior to it
along a short rictal fold. The last infralabial is the scale
positioned directly below the center of the last supralabial.
We identified the last canthal as a scale ending directly above
or extending beyond a straight vertical line at the anterior
margin of the orbit. We counted circumorbitals using the
method of Harvey et al. (2014) and transorbitals as the
number of scales in a transverse line between but not
including the last supraciliary scale. Our transorbital count is
identical to the ‘‘Head Scales: HeadStr’’ character defined by
Zug et al. (2006). Counts of subdigital lamellae include all
scales from the interdigital skin to the claw and include the
elongate ungual scale. Ordinarily, several rows of small scales
cover the base of Finger IV, proximal to the transversely
widened lamellar scales. Our counts of subdigital lamellae
include each of these transverse rows of small scales at the
base of the digit. We count number of fourth toe lamellae
within the span of the fifth toe by adpressing the fourth and
fifth toes, noting the position of the base of the claw of the
fifth toe, then counting fourth toe lamellae from the point to
the base of the digit.
Harvey et al. (2014) introduced new terminology used
here for the dorsolateral series of modified scales, pectoral
gap, and the nuchal, posttemporal, posttympanic, and
postrictal modified scales. We refer to a large, modified
scale positioned at the dorsoposterior corner of the orbit as
the ‘‘postciliary scale’’ and the gap between the supraciliaries
and this scale as the ‘‘supraciliary notch.’’ Dendragama has
some additional distinctive characters that require definition
(new terms appear in singular quotes). A row of ‘sublabial
tubercular scales’ appear in front of the postrictal modified
scale and usually resemble this scale in size and shape.
Usually these scales are white or yellow in live specimens
(Figs. 1, 2). When counting sublabial tubercular scales, we
do not include the postrictal scale. These scales have been
noted before; in her description of D. boulengeri, De Rooij
(1915:119) mentions ‘‘below the angle of the mouth and
below the ear two white tubercular scales.’’
Dendragama boulengeri and the northern population
have a continuous white line from behind the ear to behind
the arm. This stripe edges the distinctive black prescapular
blotch in D. boulengeri and overlies a series of enlarged
scales including enlarged, plate-like scales between the
tympanum and eye, the posttympanic modified scale,
‘posttympanic series’, and part of the dorsolateral series of
modified scales. We refer to all the scales in this series as the
‘dorsolateral crest’ (Fig. 3). We noted any modifications in
the dorsolateral crest in the pectoral region. Below the
pectoral gap, the crest may be continuous or its enlarged,
heavily keeled scales may be separated by a wide gap of
small, smooth scales. In some populations, the dorsolateral
and posttympanic series diverge markedly in the pectoral
region.
We struggled to develop both a reliable methodology and
terminology for reporting and quantifying variation in the
 HARVEY
FIG. 1.—Cephalic coloration and morphology of male Dendragama
australis. Brown phase (A; MZB 13776, head length 18.4 mm) and green
phase showing blackening after excessive handling (B; UTA 63420, head
length 17.9); both specimens from Gunung Patah, Sumatera Selatan,
Indonesia. Photos by ENS. A color version of this figure is available online.
vertebral crest. As in a previous study (Harvey et al. 2014),
we divide the vertebral crest into nuchal and dorsal
components separated by the pectoral gap. As in Pseudoca-
lotes (Harvey et al. 2014), paravertebrals frequently interrupt
scales of the dorsal crest and we excluded these scales from
our count (Fig. 4). On the other hand, our counts of scales
within the pectoral gap include all scales whether paraver-
tebral or not. Sometimes, an enlarged scale behind the
nuchal crest may be present and pointing upward rather
than backward. When present, we include such a scale in the
count of scales in the pectoral gap. The nuchal crest count
includes large, pointed scales in the middle of the crest and
ET AL.—NEW DENDRAGAMA 71
FIG. 2.—Cephalic morphology of Dendragama australis (A; MZB 13782,
adult male, head length 21.4 mm) and D. dioidema (B; MZB 13814, adult
male holotype, head length 21.5 mm). The sublabial tubercular scales, scales
of the posttympanic series, and the temporal, posttemporal, and postrictal
modified scales are shaded gray for emphasis.
small triangular to subriangular scales in the anterior portion
of the crest but excludes small triangular scales and
paravertebrals separating the large scales of the crest.
When viewed from the side, the dorsal crest of some
populations has a distinctive, serrated appearance due
primarily to the large, projecting scales being positioned
atop vertebral arches. Frequently, enlarged, nonprojecting
vertebral scales lie immediately before and after the
subtriangular crest scales and may be positioned in the
depression between the vertebral arches. In contrast, other
populations have projecting scales positioned between the
vertebral arches as well. To quantify these differences, we
added a new meristic character, ‘projecting scales of the
dorsal crest’, scored by counting only the projecting
vertebrals and excluding nonprojecting vertebrals (Fig. 4).
Statistical Analysis, Species Concept, and Status of
Synonyms
For meristic characters, we made all pairwise compari-
sons using Tukey’s honest significant difference test when
72 Herpetological Monographs 31, 2017
FIG. 3.—Modified scales of the neck and pectoral region of Dendragama
australis (A; UTA 63431, adult male) and D. dioidema (B; UTA 63449, adult
male). Temporal, posttemporal, and postrictal modified scales, sublabial
tubercular scales, and scales of the dorsolateral crest are shaded gray for
emphasis.
samples satisfied the assumptions of normality and homoge-
neity of variance. We tested the assumption of normality
using the Shapiro-Wilk test and homogeneity of variance
using Levene’s test. For characters where samples violated
these assumptions, we report Bonferroni-corrected Mann–
Whitney U probabilities. Of our mensural characters, we
found head length to be more repeatable and reliable than
other measurements. Moreover, preliminary analyses failed
to find any sexual dimorphism in this character. Conse-
quently, we used head length as a covariate when comparing
species for morphometric characters. We used analysis of
covariance (ANCOVA) to test for differences in relative sizes
of selected mensural characters and an F-test to verify the
assumption of parallel slopes. Because we used ANCOVA for
each of the three possible interspecific comparisons, we
corrected the probability level using the Bonferroni method
(i.e., we multiplied each probability by three). For the
morphometric comparisons, we excluded digital lengths
because these characters violated the assumption of slope
parallelism.
We assess sexual dichromatism qualitatively, and we used
statistical methods to test for sexual dimorphism in selected
meristic and mensural characters. As for interspecific
comparisons, we used ANCOVA for the mensural traits.
We verified that our meristic characters satisfied assump-
tions of homogeneity and normality, and then compared
sexes of each species using a Student’s t-test. We used the
PAST 3.10 statistical software program (Hammer et al. 2001)
for all statistical tests.
We view species as separately evolving metapopulations
and agree with de Quieroz’s (1998) observation that many, if
not all, contemporary species concepts are special cases of
the General Lineage Concept. Operationally, we recognize
allopatric populations as species when we find concordance
(Avise and Ball 1990) of multiple, apparently independent
characters.
We evaluated the status of subjective synonyms of
Dendragama boulengeri by direct comparisons of type
material and additional comparative material of Pseudoca-
lotes (Appendix). Institutional abbreviations are those of
Sabaj (2016).
Molecular Analysis
We extracted genomic DNA from muscle or liver tissue
taken from four specimens of the southern population of
Dendragama, three specimens from the northern popula-
tion, and one specimen from the type locality of Dendraga-
ma boulengeri. We provide GenBank numbers for these
specimens in Table 1.
We sequenced a fragment of the NADH dehydrogenase
subunit 4 (ND4) gene using the forward primer ND4
(CACCTATGACTACCAAAAGCTCATGTAGAAGC) and
reverse primer LEU (CATTACTTTTACTTGGATTTG-
CACCA). The ND4 thermal cycle profile consisted of an
initial denaturation at 948C for 3 min followed by 30 cycles of
denaturation at 948C for 30 s, a 508C annealing phase for 45
s, and a 728C extension for 1 min, followed by a 728C
extension for 7 min, then a holding phase at 48C. We cleaned
the products of amplification using Sera-Mag Speedbeads
(Fisher Scientific, Pittsburgh, PA, USA) following the
procedure outlined by Rohland and Reich (2012).
We aligned all sequences using the Geneious aligner
implemented within Geneious v6.1.8 (Kearse et al. 2012).
We checked all alignments by eye and trimmed them to
equal lengths (592 base pairs) to remove missing data. We
calculated uncorrected pairwise distances using Mega v5.1
(Tamura et al. 2011).
RESULTS
Comparisons among Populations of Dendragama
Morphology.—The combination of a high supratemporal
ridge extending from behind the postciliary scale to the
occiput, one or more subtubercular scales in front of a
postrictal modified scale, 57–94 scales around midbody, and
 HARVEY ET AL.—NEW DENDRAGAMA 73

FIG. 4.—Morphology and method of counting dorsal crest scales (shaded gray). Dorsal and lateral views of section of dorsal crest at midbody from (A)
Dendragama australis (MZB 13782; nine crest scales, all projecting and with crest interrupted by medial contact of single pair of paravertebrals), and (B) D.
boulengeri (UTA 63451; eight crest scales, four of them projecting with crest interrupted by medial contact of four pairs of paravertebrals).

a visible tympanum immediately distinguishes specimens of
Dendragama from all other Draconinae.
Suites of meristic, mensural, and qualitative characters
distinguish the three populations of Dendragama from one
another. Perhaps most obviously, the southern and northern
populations have large gulars and smooth or very feebly
keeled ventrals whereas D. boulengeri has small gulars and
heavily keeled ventrals. The southern population has 3–5
sublabial tubercular scales whereas the other two popula-
tions usually have only one of these in front of the postrictal
modified scale. All populations possess a row of enlarged
scales below the eye. These enlarged scales contact the
supralabials in the northern and southern populations, but a
continuous row of small lorilabials separates the enlarged
scales and supralabials in D. boulengeri.
Facial markings immediately distinguish the southern
population from the other two. Lizards from the south have a
short, white sublabial stripe extending from below the eye to
below or just behind the ear (Fig. 1). The stripe overlaps the
sublabial tubercular and postrictal modified scales; it is
usually continuous and parallels the labial series. In contrast,
specimens from the other two populations have a pair of
oblique white bands extending ventroposteriorly from just
below the rictus and just below the ear. These bands overlap
a sublabial tubercular scale and the postrictal modified scale.
Many specimens from the northern population lack these
bands but have two white, yellow, or yellow green spots in
the same locations as the oblique bands. In dorsal aspect,
Dendragama boulengeri and specimens from the northern
population usually have a continuous white, yellow, or pale
green line from behind the ear to behind the arm, i.e.,
traversing the pectoral gap and overlying the dorsolateral
crest. This stripe interrupts a dark brown or black band on
the neck. In the southern and northern populations, the
band continues for a short distance below the stripe;
however, it lengthens and darkens to form a distinctive,
prescapular blotch in D. boulengeri. Moreover, only in D.
boulengeri a wide white band edges this prescapular blotch
posteriorly. Finally, the northern population has a pale pink
buccal epithelium and a darker pink tongue whereas the
other two populations have yellow to orange buccal epithelia
and tongues.

TABLE 1.—Deposition of sequence data for three species of Dendragama and Pseudocalotes used in the molecular analysis.

Species Museum number Locality GenBank sequence number

D. australis MZB 13781 Gunung Patah, Sumatera Selatan KY576737

D. australis UTA 63424 Gunung Patah, Sumatera Selatan KY576738
D. australis MZB 13783 Gunung Patah, Sumatera Selatan KY576739
D. australis MZB 13784 Gunung Dempo, Sumatera Selatan KY576740
D. australis UTA 63432 Bukit Daun, Bengkulu KY576741
D. boulengeri MZB 13818 Gunung Marapi, Sumatera Barat KY576742
D. dioidema UTA 63442 Kute Baru, Aceh KY576743
D. dioidema MZB 13811 Bukit Sama, Aceh KY576744
D. dioidema MZB 13815 Hutan Timang, Aceh KY576745
P. cybelidermus UTA 60551 Gunung Pesagi, Sumatera Selatan KT180139
P. cybelidermus UTA 60549 Gunung Pesagi, Sumatera Selatan KT180140
P. guttalineatus UTA 60540 Mountain above Ngarip, Sumatera Selatan KT180141
P. guttalineatus UTA 60501 Gunung Pesagi, Sumatera Selatan KT180142
74 Herpetological Monographs 31, 2017

TABLE 2.—Summary statistics of diagnostic qualitative and meristic characters in three populations of Dendragama. In parentheses, mean 6 standard
deviation and sample size appear after ranges. (—) indicates character states not observed.

Characters Southern population: D. australis Dendragama boulengeri Northern population: D. dioidema

Postrostrals 3 (13%, n ¼ 24) — —

4 (29%, n ¼ 24) 4 (5%, n ¼ 20) 4(10%, n ¼ 20)
5 (54%, n ¼ 24) 5 (90%, n ¼ 20) 5(85%, n ¼ 20)
6 (4%, n ¼ 24) 6 (5%, n ¼ 20) 6(5%, n ¼ 20)
Transorbitals 12–18 (16 6 1, n ¼ 24) 16–22 (18 6 2, n ¼ 20) 13–18(16 6 2, n ¼ 20)
Supralabials contacting nasal — 0 (5%, n ¼ 20) 0(5%, n ¼ 20)
1 (37%, n ¼ 24) 1 (90%, n ¼ 20) 1(75%, n ¼ 20)
2 (63%, n ¼ 24) 2 (5%, n ¼ 20) 2(20%, n ¼ 20)
Loreals between last canthal and supralabials 5–8 (6 6 1, n ¼ 24) 6–9 (7 6 1, n ¼ 20) 5–7(6 6 1, n ¼ 20)
Loreals between orbit and nasal 5–7 (6 6 1, n ¼ 24) 5–8 (6 6 1, n ¼ 20) 5–7(6 6 1, n ¼ 20)
Supraciliaries 4 (42%, n ¼ 24) — 4(10%, n ¼ 20)
5 (54%, n ¼ 24) 5 (55%, n ¼ 20) 5(75%, n ¼ 20)
6 (4%, n ¼ 24) 6 (45%, n ¼ 20) 6(15%, n ¼ 20)
Combined canthals and supraciliaries 9 (25%, n ¼ 24) — 9(10%, n ¼ 20)
10 (50%, n ¼ 24) 10 (15%, n ¼ 20) 10(40%, n ¼ 20)
11 (21%, n ¼ 24) 11 (50%, n ¼ 20) 11(50%, n ¼ 20)
12 (4%, n ¼ 24) 12 (35%, n ¼ 20) —
Palpebrals in second row above eye 9–14 (11 6 1, n ¼ 24) 10–14 (12 6 1, n ¼ 20) 9–15 (12 6 1, n ¼ 20)
Enlarged interoculabials contacting supralabials 96% (n ¼ 24) 0% (n ¼ 20) 100% (n ¼ 20)
Sublabial tubercular scales — 0 (10%, n ¼ 20) 0 (5%, n ¼ 20)
— 1 (55%, n ¼ 20) 1 (70%, n ¼ 20)
— 2 (25%, n ¼ 20) 2 (25%, n ¼ 20)
3 (25%, n ¼ 24) 3 (10%, n ¼ 20) —
4 (71%, n ¼ 24) — —
5 (4%, n ¼ 24) — —
Scales separating temporal and posttemporal modified scales 0–6 (4 6 1, n ¼ 16) 1–5 (2 6 1, n ¼ 19) 0–4 (1 6 1, n ¼ 19)
Enlarged scales between orbit and auditory meatus 3 (25%, n ¼ 24) — 3 (15%, n ¼ 20)
4 (54%, n ¼ 24) 4 (30%, n ¼ 20) 4 (70%, n ¼ 20)
5 (21%, n ¼ 24) 5 (65%, n ¼ 20) 5 (15%, n ¼ 20)
— 6 (5%, n ¼ 20) —
Infralabials 7–9 (8 6 1, n ¼ 24) 7–10 (9 6 1, n ¼ 20) 6–9 (8 6 1, n ¼ 20)
Chinshields contacting infralabials — 1 (20%, n ¼ 20) —
2 (4%, n ¼ 24) 2 (15%, n ¼ 20) 2 (5%, n ¼ 20)
3 (13%, n ¼ 24) 3 (25%, n ¼ 20) 3 (50%, n ¼ 20)
4 (58%, n ¼ 24) 4 (35%, n ¼ 20) 4 (40%, n ¼ 20)
5 (25%, n ¼ 24) 5(5%, n ¼ 20) 5 (5%, n ¼ 20)
First pair of chinshields in medial contact behind mental 71% (n ¼ 24) 50% (n ¼ 20) 30% (n ¼ 20)
Gulars 15–30 (22 6 3, n ¼ 24) 30–38 (35 6 2, n ¼ 20) 16–22 (20 6 2, n ¼ 20)
Interrictals 18–28 (22 6 3, n ¼ 24) 32–50 (41 6 5, n ¼ 20) 17–25 (21 6 2, n ¼ 20)
Ventrals Smooth to feebly keeled Heavily keeled Smooth to feebly keeled
44–60 (51 6 4, n ¼ 24) 50–63 (57 6 3, n ¼ 20) 49–63 (55 6 3, n ¼ 20)
Nuchal crest scales 6–12 (8 6 1, n ¼ 24) 4–13 (7 6 2, n ¼ 20) 5–10 (7 6 1, n ¼ 20)
Middorsal scales spanning pectoral gap 2–10 (6 6 2, n ¼ 24) 4–14 (10 6 3, n ¼ 20) 3–12 (9 6 2, n ¼ 20)
Dorsal crest scales 31–47 (38 6 5, n ¼ 24) 22–44 (34 6 5, n ¼ 20) 11–33 (26 6 6, n ¼ 20)
Projecting scales of dorsal crest 19–37 (31 6 4, n ¼ 23) 11–18 (15 6 2, n ¼ 16) 9–19 (14 6 3, n ¼ 20)
Scales around midbody 61–94 (74 6 9, n ¼ 24) 62–84 (73 6 6, n ¼ 19) 57–77 (68 6 5, n ¼ 20)
Fourth toe lamellae within span of fifth toe 2–6 (4 6 1, n ¼ 24) 3–7 (5 6 1, n ¼ 20) 3–6 (5 6 1, n ¼ 20)
Bands on tail 16–19 (17 6 1, n ¼ 20) 12–16 (14 6 1, n ¼ 8) 11–17 (13 6 2, n ¼ 12)
Bands on proximal one-half of tail 8–13 (11 6 1, n ¼ 23) 7–9 (8 6 1, n ¼ 15) 6–10 (7 6 1, n ¼ 17)

In Dendragama boulengeri and the northern population,
the posttympanic and dorsolateral series are straight and
often continuous (Fig. 3). In contrast, the dorsolateral crest
of the southern population has a distinct break at the anterior
border of the scapula. Without magnification, this break may
be visible as a broken line of white scales at the shoulder and,
sometimes, a semilunar white stripe curving around the
scapula. In the southern population, the dorsolateral series
curves downward and the posttympanic series may slightly
curve upward or remain more or less horizontal. A single
enlarged scale may be positioned between these curved
series.
High supratemporal ridges distinguish Dendragama from
other genera of Southeast Asian Draconinae. The supra-
temporal ridges of D. boulengeri have a distinct depression
behind the postciliary scale whereas these ridges extend
smoothly or dip slightly behind the postciliary scale in the
southern population. Moreover, the two ridges extend to the
nuchal crest in the southern population, forming a near-
continuous wall around the parietal area. In contrast, a
longitudinal groove separates the supratemporal ridge from
the terminus of the nuchal crest in D. boulengeri and the
northern population. Though still elevated relative to the
parietal area, the crest ends at a point noticeably lower than
the highest part of the ridge in the southern population.
Unlike the other two populations, Dendragama boulen-
geri has an unusual imbrication pattern on the neck. Scales
below the posttympanic series point anteriorly whereas they
point posteriorly in the northern and southern populations.
This difference is most obvious in the area between the ear
and antehumeral fold.
 HARVEY ET AL.—NEW DENDRAGAMA 75

TABLE 3.—Results of univariate comparisons for selected meristic Although many meristic characters overlap among the
characters among three species of Dendragama. Diagnostic characters populations (Tables 2, 3), the southern population has the
satisfying assumptions of normality and homoscedasticity appear in the
upper portion of the table with Tukey statistics followed by probabilities. highest counts of sublabial tubercles, scales between the
Characters violating these assumptions appear in the lower portion with temporal and postemporal modified scales, dorsal crest
Bonferroni-corrected Mann–Whitney pairwise comparison probabilities. scales (especially evident in counts of projecting dorsals),
For emphasis, significant (P , 0.05) results are indicated with an supralabials contacting the nasal, chinshields contacting the
asterisk*; sample sizes are provided in Table 2.
infralabials, and bands on the tail. This population has the
Tukey’s Q, probability
fewest postrostrals, vertebral scales spanning the pectoral
Characters D. dioidema D. australis
gap, ventrals, and lamellae within the span of the fifth toe.
Compared to the other two populations, the first pair of
Transorbitals chinshields is more-frequently in medial contact in the
D. australis 0.49, 0.9368
D. boulengeri 8.00, 0.0001* 7.51, 0.0001*
southern population. The low count of postrostrals in this
Loreals between last canthal and population appears to be correlated with a relatively narrow
supralabials rostral, snout, and head (Tables 4, 5) in the southern
D. australis 4.61, 0.0053* population. The southern population has the shortest nuchal
D. boulengeri 13.48, 0.0001* 8.88, 0.0001* crest scales and has a longer shank than the northern
Palpebrals in second row above
eye population (Fig. 5).
D. australis 3.54, 0.0496* Dendragama boulengeri has the highest counts of loreals,
D. boulengeri 2.49, 0.1928 1.05, 0.7388 combined canthals and supraciliaries, enlarged scales
Combined canthals and between the orbit and tympanum, infralabials, gulars, and
supraciliaries
D. australis 2.24, 0.2593 interrictals (Tables 2, 3). It has higher counts of transorbitals
D. boulengeri 5.01, 0.0023* 7.252, 0.0001* than the southern population and fewer chinshields contact-
Enlarged scales between orbit and ing the infralabials than the northern population. Dendra-
auditory meatus gama boulengeri has heavily keeled ventrals whereas the
D. australis 0.31, 0.9732
D. boulengeri 5.66, 0.0006* 5.97, 0.0003*
other two populations have smooth or very-feebly keeled
Middorsal scales spanning ventrals.
pectoral gap The northern population has the fewest dorsal crest
D. australis 5.43, 0.0010* scales, fewest scales around midbody (Tables 2, 3), and the
D. boulengeri 2.29, 0.244 7.72, 0.0001* longest tail (Tables 4, 5). Most often, these lizards have a
Dorsal crest scales
D. australis 9.75, 0.0001* single, large sublabial tubercular scale in front of the
D. boulengeri 6.98, 0.0001* 2.78, 0.1305 postrictal modified scale and a gular separates the first pair
Scales around midbody of chinshields behind the mental. Compared to the southern
D. australis 4.31, 0.0095* population, the northern population has more palpebrals in
D. boulengeri 4.06, 0.0154* 0.25, 0.9832
Ventrals
the second row above the eye.
D. australis 4.63, 0.0051* Several characteristics of the ear serve to distinguish the
D. boulengeri 2.49, 0.1907 7.12, 0.0001* three populations. The auditory meatus is positioned furthest
Fourth toe lamellae within span back on the head in Dendragama boulengeri and closest to
of fifth toe the eye in the southern population. Consequently, the
D. australis 4.99, 0.0024*
D. boulengeri 0.96, 0.7765 4.03, 0.0164* southern population has the narrowest space separating the
orbital border from the border of the meatus. The
Bonferroni corrected differences among populations are even starker when the
Mann–Whitney probabilities
two methods for measuring head length are compared: the
Postrostrals ratio of head length and distance from the meatus to the tip
D. australis 0.0281* of the snout barely overlaps between the southern popula-
D. boulengeri 0.6716 0.0111*
Supraciliaries
tion and the other two (Table 5). The ear is partially hidden
D. australis 0.0456* in the southern population and in D. boulengeri. The
D. boulengeri 0.0676 0.0002* southern population has a thickened, enlarged tympanic
Infralabials scale covering most of the meatus but separated from the
D. australis 0.8555 border of the meatus by one or two (usually two) curved
D. boulengeri 0.0020* 0.0008*
Chinshields contacting infralabials rows of small granular scales. In contrast, the northern
D. australis 0.0161* population has a thin tympanic membrane covering the
D. boulengeri 0.6392 0.0031* meatus and almost always extending to its border (one out of
Gulars 20 specimens has a single curved row of small granular scales
D. australis 0.2627
D. boulengeri 0.0000* 0.0000* separating the tympanic membrane from the border of the
Projecting Dorsals meatus). Dendragama boulengeri has an intermediate
D. australis 0.0000* condition with slightly thickened keratinized layers over
D. boulengeri 1 0.0000* the membrane and one or two (usually one) rows of small
Nuchal crest scales
D. australis 0.0577
scales separating the membrane from the border. Interest-
D. boulengeri 1 0.119 ingly, some specimens of both the southern population and
Caudal bands on proximal tail D. boulengeri have a narrow black ring of pigment overlying
D. australis 0.0000* the border of the meatus. Measurements of the tympanic
D. boulengeri 0.1148 0.0000* scale reflect these differences among the populations: the
76 Herpetological Monographs 31, 2017

(899.5 6 65.4, n ¼ 18)

TABLE 4.—Diagnostic morphometric characters of three species of

(101.5 6 2.0, n ¼ 19)

(67.7 6 2.6, n ¼ 20)
(25.6 6 1.0, n ¼ 20)
(16.0 6 1.2, n ¼ 20)

(13.4 6 1.6, n ¼ 20)

(12.8 6 1.8, n ¼ 19)
(89.4 6 7.7, n ¼ 20)
Dendragama based on analysis of covariance using head-length as a

(25.5 6 1.3, n ¼20)

covariate. For emphasis, significant (P . 0.05) results are indicated with an

Northern population: D. dioidema

asterisk*; samples sizes are provided in Table 5.

TABLE 5.—Relative sizes of diagnostic mensural characters in three populations of Dendragama. In parentheses, mean 6 standard deviation and sample size appear after ranges.
F, Bonferonni-corrected P

Dendragama Dendragama
Characters dioidema australis

Auditory meatus to tip of snout

98.2–107.3
62.7–71.9%
23.6–27.2%
13.4–18.1%
23.1–29.0%
10.6–16.0%
10.9–16.3%
68.9–104.4%
767.0–1050.1%
D. australis 64.04, 0.0000*
D. boulengeri 6.90, 0.0377* 88.77, 0.0000*
Head width
D. australis 31.24, 0.0000*
D. boulengeri 1.24, 0.8181 49.71, 0.0000*
Snout width
D. australis 6.53, 0.0433*
D. boulengeri 0.69, 0.4111 2.05, 0.1598
Rostral width
D. australis 64.06, 0.0000*

(801.6 6 38.3, n ¼ 20)

(103.2 6 3.1, n ¼ 20)
D. boulengeri 2.57, 0.3513 41.76, 0.0000*

(69.7 6 2.6, n ¼ 20)

(25.4 6 1.1, n ¼ 19)
(15.3 6 1.3, n ¼ 20)
(27.8 6 2.0, n ¼ 20)
(10.1 6 1.8, n ¼ 20)
(11.6 6 2.2, n ¼ 20)
(91.6 6 5.4, n ¼ 20)
Distance from orbit to auditory meatus
D. australis 7.57, 0.0264*
D. boulengeri 24.2, 0.0001* 76.66, 0.0000*
Length of tympanum

D. boulengeri
D. australis 148.2, 0.0000*
D. boulengeri 32.88, 0.0000* 22.36, 0.0001*
Height of nuchal crest scale
D. australis 14.42, 0.0015*

702.8–859.7%
98.4–110.4

81.4–100.6%
63.5–73.4%
22.7–27.0%
14.1–18.3%
23.7–32.3%
7.4–14.3%
7.6–16.6%
D. boulengeri 2.01, 0.4941 8.78, 0.0151*
Length of shank
D. australis 17.30, 0.0005*
D. boulengeri 1.09, 0.9108 3.31, 0.2282
Length of tail
D. australis 15.41, 0.0011*
D. boulengeri 35.98, 0.0000* 0.26, 1

(799.0 6 56.8, n ¼ 23)

tympanic scale is smallest in the southern population, (95.9 6 2.2, n ¼ 20)
(62.2 6 2.4, n ¼ 24)
(24.4 6 1.4, n ¼ 24)
(12.7 6 1.2, n ¼ 24)
(24.2 6 1.3, n ¼ 24)

(10.3 6 1.9, n ¼ 24)

(94.0 6 6.2, n ¼ 24)
(8.2 6 0.9, n ¼ 24)
largest in the northern population, and intermediate in size
Southern population: D. australis

in D. boulengeri (Fig. 5; Tables 4, 5).

When comparing the three populations, we did not find
differences in numbers of circumorbitals, dorsals directed
upward, manual and pedal subdigital lamellae, or bands on
the body (P . 0.05). The southern population has more
56.6–68.3%
21.4–27.1%
10.1–15.3%
20.9–25.8%

6.5–13.5%
6.3–9.7%

665.9–895.7%
82.9–106.3%
91.0–98.6

nuchal crest scales than does the northern population;

however, the higher counts are just barely nonsignificant if
5% is considered the acceptable frequency of a Type I
error (Table 3).
In summary, concordance of multiple, apparently
independent diagnostic characters indicates that the three
allopatric populations of Dendragama represent distinct
species.
Distance from orbit to auditory meatus/head length

Genetic distances.—Within populations of Dendraga-

ma, the ND4 gene has diverged by 0.0–3.4% (based on p
Length of enlarged tympanic scale/head length

uncorrected genetic distances); however, among popula-

Auditory meatus to tip of snout/head length

tions it has diverged by 6.0–12.1% (Table 6). Of the three

Height of nuchal crest scale/head length

populations considered in this study, the northern popu-

lation is the most divergent; its ND4 gene has diverged by
10.7–11.7% from the southern population and 10.7–12.1%
Length of shank/head length

from D. boulengeri. In contrast, ND4 sequences of the

Rostral width/ head length

Length of tail/head length

southern population have only diverged by 6.0–6.4% from

Snout width/head length
Head width/head length

D. boulengeri. Although the populations of Dendragama

are allopatric from one another, we note that divergence of
the northern population is greater than that seen between
the sympatric species Pseudocalotes cybelidermus and P.
guttalineatus (9.7%; Table 6). Finally, we note that
Characters

divergences between species pairs of Dendragama and

Pseudocalotes range from 18.3–19.9%.
 HARVEY ET AL.—NEW DENDRAGAMA 77

As for the morphological characters, high levels of genetic

FIG. 5.—Regression lines and scatter plots of two diagnostic morpho-
metric characters of Dendragama.
divergence in the ND4 gene support recognition of three
species of Dendragama.
Systematics
Dendragama australis sp. nov.
Holotype.—An adult male (MZB 13786, field tag ENS
18398; Fig. 6) from trail up Gunung Dempo above Kampung
Empat, Kabupaten Pagaralam, Provinsi Sumatera Selatan,
Indonesia, 4.037448S, 103.145268E, 1953 m, collected by
M.B. Harvey, P. Thammachoti, and G. Pradana on 10 July
2015.
Paratypes (37).—Seven males (MZB 13776, 13778,
13782, 13783; UTA 63420, 63421, 63423), four females
(MZB 13777, 13779, 13781, UTA 63424), and four unsexed
specimens (MZB 13780, UTA 63418, 63419, 63422) from
Gunung Patah near Desa Segamit, Kabupaten Muara Enim,
Provinsi Sumatera Selatan, Indonesia, 4.21–4.238S, 103.41–
103.428E, 1742–2142 m, collected on 12 July 2015 by E.
Wostl, G. Sarker, G. Pradana, and F. Alhadi. Three males
(MZB 13784, UTA 63427, 63428), two females (MZB 13785,
13787), and six unsexed specimens (MZB 13788, UTA
63425, 63426, 63429–63431) from Gunung Dempo above
Kampung Empat, Kabupaten Pagaralam, Provinsi Sumatera
Selatan, Indonesia, 4.048S, 103.14–103.178E, 1764–2111 m,
collected on 8, 10, 14, and 15 July 2015 by M. Harvey, E.
Wostl, U. Smart, G. Sarker, P. Thammachoti, G. Pradana
and F. Alhadi. Three males (MZB 13789, 13790, UTA
63433) and one unsexed specimen (UTA 63432) from Bukit
Daun, above desa Air Nipas, Rimbo Pengadang, Kabupaten
Rejang Lebong, Provinsi Bengkulu, Indonesia, 3.368S,
102.388E, 1646–1728 m, collected on 21 July 2015 by E.
Wostl, G. Sarker and F. Akhsani. Five males (MZB 13791–
13793; UTA 63434, 63435), one female (UTA 63436), and
one unsexed specimen (UTA 63437) from Air Duku, Selupu
Rejang, trail up Gunung Kambing from police academy near
road to Gunung Kaba, Kabupaten Rejang Lebong, Provinsi
Bengkulu, Indonesia, 3.39–3.408S, 102.63–102.648E, 1516–
1748 m, collected on 22 July 2015 by E. Smith, E. Wostl, G.
Sarker and G. Pradana.
Diagnosis.—The following combination of characters
distinguishes Dendragama australis from its congeners: (1)
enlarged scales below eye broadly contacting supralabials;
(2) enlarged tympanic scale relatively small (6–10% of head
length) and set relatively close to eye (orbit–meatus 21–36%
of head length); (3) sublabial tubercular scales 3–5, usually 4,
in front of postrictal modified scale; (4) gulars large, 15–30;
(5) dorsal crest of 19–37 projecting scales, serrate and
continuous along back without obvious gaps; (6) dorsolateral
crest broken: posttympanic series of enlarged, modified
scales straight or curving upward, dorsolateral series curving

TABLE 6.—Uncorrected pairwise genetic distances, p, for ND4 sequences between populations of Dendragama and Pseudocalotes.

Southern population: D. australis (n ¼ 5) D. boulengeri (n ¼ 1) Northern population: D. dioidema (n ¼ 3) P. cybelidermus (n ¼ 2) P. guttalineatus (n ¼ 2)

D. australis 0.0–1.0% 6.0–6.4% 10.7–11.7% 18.5–18.7% 18.3–19.3%

D. boulengeri — 10.7–12.1% 19.9% 19.7–19.9%
D. dioidema 0.0–3.4% 18.7–19.3% 18.1–18.7%
P. cybelidermus 0.0% 9.7%
P. guttalineatus 0.4%
78 Herpetological Monographs 31, 2017

FIG. 6.—Coloration of the male holotype of Dendragama australis (A and C; MZB 13786, SVL 62 mm) and a male paratype (B and D; UTA 63421, SVL 72
mm). In the bottom row, specimens exhibit darkening due to excessive handling. Photos by ENS. A color version of this figure is available online.

downward; (7) scales around midbody 61–94; (8) scales of
lower flanks heterogenous; (9) ventrals smooth or very feebly
keeled, 44–60 from preaxial border of arm to vent; (10) sharp
white stripe or line of broken white spots on sublabials from
level of eye to below or behind ear; (11) brown band on
neck, but large black prescapular blotch absent; (12)
proximal half of tail with 8–13 dark brown or green bands;
(13) buccal epithelium and tongue yellow or orange.
Description.—Characteristics of the holotype appear in
brackets after other male specimens. Males reaching 257
mm (SVL 77 mm) [155, 62] and females reaching 254 mm
(SVL 78 mm) in total length; smallest juveniles in our sample
77 mm total length;. SVL 285–35.1% (30.7 6 1.6, n ¼ 24)
[28.6%] and tail 64.9–71.5% (69.3 6 1.6, n ¼ 24) [71.4%] of
total length; tail 1.852–2.5073 (2.263 6 0.160, n ¼ 24)
[2.5003] as long as SVL; distance from axilla to groin
accounting for 39.3–56.5% (47.7 6 4.1, n ¼ 18) [46.8%] of
SVL in males and 47.5–50.0% (49.0 6 1.0, n ¼ 6) of SVL in
females; head 56.6–68.3% (62.2 6 2.4, n ¼ 24) [61.3%] as
wide as long, accounting for 26.0–32.1% (28.5 6 1.3, n ¼ 24)
[29.5%] of SVL; snout subacuminate in dorsal view and in
profile, sloping upward at about 408 to horizontal (Fig. 2);
dorsal head scales weakly imbricate (some juxtaposed),
keeled (occasionally almost smooth); rostral visible from
above, 41.0–64.5% (52.2 6 5.7, n ¼ 24) [50.6%] as wide as
internarial distance, its height 18.3–37.8% (29.8 6 5.5, n ¼
24) [34.1%] of its width, broadly contacting first supralabials
and three (13%), four (29%), five (54%), or six (4%) small
postrostrals (n ¼ 24) [four]; postrostral series separating
nasal from rostral 88% (n ¼ 24) of the time; infrequently,
nasal contacting rostral (4%, n ¼ 24) or separated from
rostral by two scales (8%, n ¼ 24); noticeably enlarged scales
usually (88%, n ¼ 24) forming inverted Y on snout or
consisting of a row of enlarged azygous scales between
nostril (22%); single scales forming each arm of Y, positioned
just anterior to orbital border and separated from base of Y
by small scales; keels on scales of base of Y oriented
longitudinally, those of arms oriented transversely; scales of
frontal region about as large as medial supraoculars, much
smaller than scales of circumorbital series; parietal region
 HARVEY ET AL.—NEW
depressed, flanked by high supratemporal ridge covered in
enlarged, knobbed scales; supratemporal ridge without
distinct depression behind postciliary scale, though area
may be slightly depressed in some specimens; interparietal
usually (96%, n ¼ 24) present, diamond-shaped, keeled,
much larger than scales flanking it; parietal eye usually not
visible, rarely evident as lightly pigmented blotch in center of
interparietal; area in front of nuchal crest raised, same height
as supratemporal ridges.
One (38%, n ¼ 24) or two (62%) supranasal scales
separating postrostral series from first canthal; circumorbital
scales 8–13 (11 6 1, n ¼ 24) [10], distinctly enlarged,
roughly pentagonal to octagonal, extending between canthal
series and postciliary scale; transorbitals 12–18 (16 6 1, n ¼
24) [17]; canthals four (13%, n ¼ 24), five (33%), or six (54%)
[six]; supraciliaries four (42%, n ¼ 24), five (54%), or six (4%)
[five]; all but last supraciliary with posterior edges imbricat-
ing onto medial side of next scale back; anterior edge of last
supraciliary overlapping medial side of scale in front of it;
supraciliary notch present but poorly developed; last
supraciliary contacting postciliary scale (58%, n ¼ 24) or
separated from it by one (38%) or two (4%) small scales;
postciliary scale enlarged, subpyramidal, single, positioned at
dorsoposterior corner of orbit, posteriorly abutting enlarged
scale of supratemporal ridge; scales of temporal region
smooth to feebly keeled, angulate and juxtaposed (occasional
specimens such as MZB 13792 have one or two enlarged
temporals with heavy keels interspersed among the rest, but
usually the temporal modified scale is the only heavily keeled
scale in this region); temporal modified scale larger than
adjacent temporals, subpyramidal with low but obvious
projecting apex; enlarged posttemporal modified scales
similar to adjacent dorsals except for its heavier keel and
enlarged size; posttemporal modified scale absent (33%, n ¼
24) or single (59%), rarely doubled (4%) or tripled (4%)
[single]; when present, posttemporal modified scales sepa-
rated from temporal modified scale by 0–6 (4 6 1, n ¼ 16)
[4] small scales.
Nasal large, oval to trapezoidal, its dorsal border
contributing to canthus; nasal contacting supralabial 1
(37%, n ¼ 24) or both 1 and 2 (63%) [1 only]; nostril large,
oval, directed laterally, its upper margin reaching canthus;
loreal region slightly concave; scales of loreal region smooth,
5–8 (6 6 1, n ¼ 24) [7] scales in vertical row between last
canthal and supralabials, 5–7 (6 6 1, n ¼ 24) [6] scales in
horizontal row from anterior border of orbit to nasal; orbit
31.2–38.8% (35.4 6 2.0, n ¼ 24) [37.7%] of head length;
palpebrals granular; second row of palpebrals above eye
containing 9–14 (11 6 1, n ¼ 24) [11] scales between ocular
angles, central 1–4 of these largest and more-heavily keeled;
fusion of palpebrals in first and second rows frequent in this
species; large subocular scale row broadly contacting supra-
labials and not separated from supralabials by row of small
lorilabials (100%, n ¼ 24); horizontal row of three (25%, n ¼
24), four (54%), or five (21%) [three] enlarged, angulate
scales between orbit and anterior margin of auditory meatus;
tympanum with large central scale separated from anterior
border of meatus by one (38%, n ¼ 24) or two (62%) curved
rows of small granular scales; length of large tympanic scale
18.0–26.7% (23.5 6 2.7, n ¼ 24) [24.6%] of diameter of orbit
and 6.3–9.7% (8.3 6 0.9, n ¼ 24) [9.2] of head length;
distance from border of auditory meatus to orbit 20.9–25.8%
DENDRAGAMA 79
(24.2 6 1.3, n ¼ 24) of head length; scales surrounding
meatus small, granular; posttympanic modified scale sub-
pyramidal; posttympanic series of enlarged, heavily keeled
scales on neck.
Supralabials smooth, 6–9 (8 6 1, n ¼ 24) [6]; rictal fold
short, bordered dorsally by portion of last supralabial and
dorsally and ventrally by one or two elongate scales behind
labial series; infralabials smooth, 7–9 (8 6 1, n ¼ 24) [7]; first
two (4%, n ¼ 24), three (13%), four (58%), or five (25%)
[five] chinshields contacting infralabials, thereafter sublabial
scales separating enlarged chinshields from infralabials; first
pair of chinshields in medial contact (71%, n ¼ 24) [in
contact] or separated medially by one (21%) or two (8%)
gulars; gulars smooth, 15–30 (22 6 3, n ¼ 24) [21] from
mental (or point of medial contact between first pair of
chinshields) to preaxial margin of arm, arrayed as 18–28 (22
6 3, n ¼ 24) [22] interrictal scales between last right and left
infralabials; gular pouch moderately developed, longitudinal;
scales in center of gular pouch same size as gulars lateral to
it; 3–5 enlarged, sublabial tubercular scales in longitudinal
row in front of postrictal modified scale; postrictal modified
scale subpyramidal, usually largest of the four modified
scales on the neck.
Nuchal crest consisting of 6–12 (8 6 1, n ¼ 24) [7] large,
triangular scales mostly separated from one another by
paravertebrals and smaller heavily keeled or small projecting
vertebrals; longest nuchal crest scales 6.5–13.5% (10.3 61.9,
n ¼ 24) [7.1%] as long as head and 68.2–204.6% (126.0 6
31.0, n ¼ 24) [76.9%] as long as enlarged tympanic scale;
fleshy flap supporting scales of nuchal crest; flap curving to
its highest point short distance behind occiput and best
developed in adult males; dorsal crest prominent, though
only weakly projecting on posterior body, extending onto
base of tail in males and usually in females, consisting of
transversely narrow scales with heavy keels and projecting
tips; 31–47 (38 6 5, n ¼ 24) [46] vertebrals in dorsal crest to
posterior border of thigh, 19–37 (31 6 4, n ¼ 23) [32] of
them projecting; paravertebrals separating dorsal crest scales
posteriorly, but most crest scales in contact with one another
anteriorly; no obvious gaps in crest between vertebral arches;
largest scales of dorsal crest 50.0–99.2% (67.4 6 11.9, n ¼
24) [99.2%] as long as largest nuchal crest scales; scales of
dorsal crest separated from nuchal crest by pectoral gap of
2–10 (6 6 2, n ¼ 24) [4] small dorsals (in occasional
specimens one or more of the vertebrals in the gap may
project slightly and therefore resemble the crest scales);
paravertebral series same size as adjacent dorsals.
Dorsal smaller than ventrals; on neck, dorsals pointing
upward and backward above posttympanic series, pointing
downward and backward below series; at midbody, upper
17–29 (21 6 3, n ¼ 18) [21] rows of dorsals pointing upward
and backward, scale row below them pointing backward, and
lower scales pointing backward and downward; dorsolateral
crest with distinct break: at level of scapula, posttympanic
series straight or curving upward slightly and dorsolateral
series curving downward, often as short series of enlarged
scales edging anterodorsal border of scapula (downward
curve of dorsolateral series occasionally consisting of single
enlarged scale oriented downward and anterior along with
similarly oriented small dorsal scales); dorsolateral series of
7–14 widely spaced, heavily keeled scales between limbs
(count excluding enlarged scales curving downward around
80 Herpetological Monographs 31, 2017
scapula); gaps between scales of dorsolateral series progres-
sively lengthening posteriorly: first pair of scales in series
separated from one another by 0–2 small dorsals and
separated from dorsal crest by 7–11 dorsals; last pair of
scales in series separated from one another by 5–12 dorsals
and separated from dorsal crest by 5–7 dorsals; scales of
lower flanks heterogenous, larger, heavily keeled scales
interspersed among much smaller smooth or feebly keeled
scales; scales around midbody 61–94 (74 6 9, n ¼ 24) [72];
ventrals smooth to feebly keeled, without sharp transition
from scales on flanks, 44–60 (51 6 4, n ¼ 24) from preaxial
edge of arm to vent; throughout most of length of tail,
subcaudals slightly longer than dorsal caudals; enlarged,
slightly projecting scales of dorsal crest extending for short
distance onto base of tail.
Scales of brachium, antebrachium, thigh, and shank
imbricate, keeled; two scales along postaxial border of
antebrachium modified: enlarged with projecting mucrons
and white keels more promininent than keels on adjacent
scales; 4–11 (7 6 2, n ¼ 24) [7] similar enlarged scales with
white, pointed, blade-like keels arrayed along postaxial
margin of dorsal thigh; on distal thigh, keels of modified
thigh scales oriented more postaxially than adjacent scales;
palmar scales small, keeled, mucronate, uniform; palmar
subdigital lamellae multicarinate at base of fingers, bicari-
nate distally, 23–30 (27 6 2, n ¼ 24) [28] under Finger IV
(count includes 1–5 lamellae at base of Finger IV that are
divided into small scales similar to those in center of palm);
terminal phalanges of fingers lacking unicarinate lamellae;
Finger III usually slightly shorter than Finger IV (Finger III
69.6–104.5% [96.1 6 6.9, n ¼ 20; 97.2%] as long as Finger
IV); Finger IV 68.8–82.6% (74.3 6 3.1, n ¼ 24) [72.0%] as
long as Toe IV; plantar scales heavily keeled, mucronate,
imbricate, those proximal to Toe IV noticeably larger than
others; pedal subdigital lamellae bicarinate and mostly entire
except under Toe IV where lamellae under the proximal
phalangeal articulation longitudinally divided into pairs of
unicarinate scales (lamellae proximal to this articulation are
also divided about 40% of the time. Some specimens have
more extensive division of the lamellae under Toe IV. For
example, in MZB 13790, lamellae under Toe IV are only
entire under the last phalanx, so that only the last 9 out of 31
lamellae are entire); preaxial keels much more developed
than postaxial keels at base of Toe III and some postaxial
keels absent entirely; lamellae 27–33 (30 6 2, n ¼ 24) [33]
under Toe IV; single subdigital and single supradigital
ungual lamellae contacting one another on all fingers and
toes; ungual lamellae much longer than other subdigital
lamellae; supradigital scales proximal to supradigital ungual
lamellae 3–5, usually 4; in relative length, Finger III ¼ IV .
II . V . I and Toe IV . III . V . II . I; Toe V 60.0–71.0
(65.0 6 3.0, n ¼ 24) [65.3%] as long as Toe IV; when
adpressed, 2–6 (4 6 1, n ¼ 24) [6] lamellae under Toe IV
within span of fifth toe; leg moderate in length relative to
other draconines; shank 23.9–31.3% (26.8 6 1.8, n ¼ 24)
[28.2] of SVL.
Scale organs lenticular, single, and positioned subtermi-
nally, usually just below mucrons on body, more numerous
and also concentrated on keels on head; bristled sense
organs (Ananjeva et al. 1991) present, position, number, and
distribution not assessed because stratum corneum missing
from most scales of body); callous glands, pigmented
generation glands (sensu Maderson and Chiu 1970; Harvey
et al. 2012), and femoral and precloacal pores absent.
Measurements of holotype (in mm): SVL 62, length of tail
155, length of body 29, pectoral width 9.2, length of head
from occiput to rostral 18.3, length of head from anterior
border of auditory meatus to rostral 17.0, width of head 11.2,
length of orbit 6.8; distance from orbit to tympanum 4.3,
length of enlarged tympanic scale 1.7, height of largest scale
of nuchal crest 1.3, height of largest scale of dorsal crest 1.3,
width of snout 4.4, width of rostral 2.2; height of rostral 0.8,
length of shank 17.5, length of Finger IV 10.8; length of
Finger III 10.5; length of Toe IV 15.0; length of Toe V 9.8.
Coloration and color change.—(Based on field notes of
MBH and photos of the type series). In life, Dendragama
australis may be brown or green, with or without darker
bands on the body, tail, and limbs. Moreover, within a short
period of time, individuals can change from green to brown
and from nearly immaculate to banded. They can darken
almost to black (Fig. 6). When banded, one band crosses the
neck and 4–6 cross the body. Bands on the body are
narrower than the pale interspaces; at midflank, bands fuse
and divide into a net-like pattern of anastomosing lines.
Dendragama australis has 16–19 (17 6 1, n ¼ 20) caudal
bands, 8–13 (11 6 1, n ¼ 23) of them on the proximal one
half of the tail. Proximally, caudal bands are narrower than
the interspaces, and the tail is the same color as the body.
Distally, the bands are much longer than the interspaces and
the entire tail is darker, grading to brown or charcoal.
Frequently, scales of the dorsolateral crest are a lighter
shade of green than surrounding scales and may appear as a
light green line interrupting the band on the neck. In field
notes, MBH noted that a line of green scales ‘‘appear to edge
the scapula,’’ referring to the downward curve in the
dorsolateral series of UTA 63418. Similar to Sumatran
Pseudocalotes (Harvey et al. 2014), the flanks blacken when
specimens are euthanized, but blackening of the flanks
mostly occurs anteriorly rather than along the whole flank as
in P. cybelidermus and P. guttalineatus.
After collecting specimens on Gunung Patah, E. Wostl
reported that sleeping Dendragama australis at that locality
had a paired series of paravertebral blotches (these blotches
were incorporated into bands during the day) and ‘‘strikingly
bright lemon yellow gular regions’’ (E. Wostl, personal
communications). When MBH first encountered UTA 63426
sleeping along a trail on Gunung Dempo, the dorsum and
sides of the head and body were nearly immaculate green
and the underside light green This specimen changed to
brown in the collecting bag, then green with bands the next
morning. During handling, the head transitioned to charcoal
gray with sharply contrasting green canthals, supraciliaries,
and supralabials. The infralabials were mostly charcoal with
some green flecking anteriorly and abruptly uniform green
from the level of the eye to the rictus. The anterior two thirds
of the chin were charcoal gray but underwent an abrupt
transition to an almost black gular band from the level of the
eye to the pectoral girdle. This band extended onto the sides
of the body between the rictus and arm, forming a collar. We
observed similar black gular collars in other males, but most
males showed no trace of a collar. Dendragama australis has
black skin between the gular scales. In green specimens the
gulars may be yellow or green, but they are burnt orange to
red in brown males (Fig. 1). During photo sessions, gulars of
 HARVEY ET AL.—NEW DENDRAGAMA 81

males invariably darkened to almost black but changed back

to light green or yellow-green after the same specimen was
euthanized.
Most specimens have a distinctive white sublabial stripe
extending from below the eye to behind the ear. We never
saw this white stripe vanish when species were changing
other aspects of their coloration and pattern. Darkening of
the head and, especially, the gular region accentuates this
stripe in stressed specimens. The stripe overlaps the
sublabial tubercular scales and postrictal modified scale. In
specimens without a solid stripe, these modified scales are
still white, thus forming a broken line of white spots.
The ground coloration of the venter is yellow-green,
yellow, or cream and usually appears dirty due to scattered
brown flecking or scattered individual reddish-brown scales.
Most specimens have a pair of ventrolateral reddish-brown
to charcoal bands narrowly and irregularly edged dorsally in
white. An irregular midventral stripe or mark of the same
color may be present. Several gravid females have red bellies
(Fig 7). In the field, MBH took notes for two of these
females. The belly of UTA 63424 was mostly red with
scattered dirty yellow botches whereas the center of the belly
was mostly yellow in MZB 13779 and red pigment was
concentrated laterally. Both specimens also had brown to
charcoal ventrolateral bands and the red pigment was
restricted to the area medial to the bands.
The postaxial thigh and antebrachium are dark brown to
black, and this dark color sharply contrasts with white keels
of modified scales of the limbs. The palmar surface may have
extensive patches of black pigment or be more or less
immaculate brown; the plantar surface is black banded.
The throat, buccal epithelium (including skin lateral to
teeth), and tongue are uniform yellow or orange. Dendra-
gama australis has a tan, gold, or bronze iris with black
reticulum and a pale gold ciliary ring. The parietal
peritoneum of the abdomen is uniformly black pigmented.
Etymology.—The new name is a Latin adjective meaning
southern. Dendragama australis occurs farther south than
any of its congeners.
Distribution and natural history.—Dendragama aus-
tralis occurs in microsympatry with Lophocalotes. We found
both genera along trails through primary forest on Gunung FIG. 7.—Ventral coloration and pattern of gravid female Dendragama
australis (A; MZB 13779, SVL 69 mm; B, MZB 13777, SVL 67 mm). Photos
Dempo, G. Patah, G. Kambing, and Bukit Daun (Fig. 8). by ENS. A color version of this figure is available online.
Without any careful study of habitat segregation, our
impression is that Lophocalotes sleeps higher in the
understory than does Dendragama. We did not encounter gravid females is likely to be a social signal, but additional
the new species in edge habitats on these mountains, where research is required to determine its function. In unrelated
it appears to be replaced ecologically by Pseudocalotes iguanians, bright coloration in females indicates receptivity
cybelidermus and P. guttalineatus. Interestingly, we did not or nonreceptivity to males (Cooper and Greenberg 1992)
encounter D. australis on G. Kaba, even though the other and may be involved in competition for suitable oviposition
three agamids were present in large numbers on this sites (Yedlin and Ferguson 1973). In the Australian agamid
mountain. Ctenophorus maculosus, changes in female coloration are
Locally, people refer to these lizards as ‘‘bunglon.’’ This linked to steroid levels and male rejection behavior (Jessop
common name appears to have originated in Java and is et al. 2009); maximal female brightness predicts last date of
rather generic. It is used to refer to most medium-size to
oviposition in the congener C. ornatus (LeBas and Marshall
large draconines, including sympatric Lophocalotes and
2000).
Pseudocalotes.
We did not find sexual dimorphism in relative height of We assessed reproductive condition of nine females. Two
the nuchal scales; in relative length of the head, body, tail, or specimens (59.0 and 61.5 mm SVL) had five and seven
shank; in relative head width; or in counts of the dorsal crest cream-colored ova in the right ovary, with the largest ovum
scales, projecting dorsal crest scales, scales around midbody, 1.6–2.2 mm in diameter. Both specimens had convoluted
or ventrals (P . 0.05). The red ventral pigment observed in oviducts. The smaller specimen with five developing eggs in
82 Herpetological Monographs 31, 2017

FIG. 9.—Dorsal and lateral views of adult male lectotype (MSNG 29936,
SVL 64 mm) of Dendragama boulengeri Doria. Photos by MBH. A color
version of this figure is available online.

FIG. 8.—Distribution of three species of Dendragama on Sumatra,

Indonesia.

the right ovary did not have a distended cloaca whereas the
larger specimen did.
The remaining females (67–78 mm SVL) contained large,
yolked ovarian eggs, oviductal eggs, or both; all had
distended cloacae and convoluted oviducts. In each ovary,
two eggs appear to mature cyclically and continuously. In
this sample, three specimens had oviductal eggs and, in a
single ovary, two large, yolked ova (4.0–5.6 mm in diameter),
two cream-colored ova about half as large (1.7–2.1 mm in
diameter), and four or five smaller ova. Ovaries of two
specimens with oviductal eggs lacked large, yolked ova and
contained pairs of cream colored to pale yellow ova 2.2–2.8
mm in diameter. Three specimens had single oviductal eggs
and two specimens had two oviductal eggs. However, one of
these specimens had a greatly distended cloaca and almost
certainly had laid one of its eggs. The remaining egg was the
largest in our sample (8.0 3 19.9 mm; 669 mm3 in volume)
and extended for more than half of the distance from the
axila to the groin (35.4 mm). In Dendragama australis,
developing oviductal eggs are ovoid with their smaller
diameter about half as large as their longest diameter,
13.1–19.9 mm long, 5.6–8.2 mm wide, and 218.9–669.1 mm3
in volume.
Based on these observations, we conclude that Dendra-
gama australis normally has a clutch size of four and reaches
sexual maturity around 60 mm SVL. The abdominal cavity of
females is not large enough to accommodate more than four
eggs at a time. Presence of eggs in pairs and in up to four
developmental stages strongly suggests that female D.
australis produce multiple clutches per year.
Dendragama boulengeri Doria
FIG. 10.—Dorsal, lateral, and ventral views of the head of the male
D. [endragama] Boulengeri Doria 1888:649, Plate 8. lectotype (MSNG 29936, head length 19.7 mm) of Dendragama boulengeri.
Lectotype male (MSNG 29936, Figs. 9, 10, examined in Photos by MBH. A color version of this figure is available online.
 HARVEY ET AL.—NEW
this study, designated by Capocaccia 1961) from ‘‘monte
Singalang (Sumatra occidentale) ad un’ altezza di metri
circa 2800’’ [traced to Gunung Singgalang, Kabupaten
Agam, Sumatera Barat, Indonesia, 0.388S, 100.368E].
Dendragama boulengeri Doria: Boulenger 1890:78; Barbour
1912:183; De Rooij 1915:118 (in part); Werner 1915:100;
Capocaccia 1961:90; Moody 1980:298; Moody 1983:210;
Welch et al. 1990:40; Welch 1994:39; Manthey and
Schuster 1996:76 (in part); Manthey and Grossmann
1997:167; Manthey 2008:102 (in part, ‘‘RA01205-4’’ only);
Das 2010:183 (in part); Teynié et al. 2010:34 (in part);
Denzer et al. 2015:132.
Calotes boulengeri (Doria): Mertens 1954:186 [in subgenus
Pseudocalotes of Calotes Cuvier]; Wermuth 1967:34;
Brygoo 1988:9.
Referred specimens.—We examined five paralectotypes
of Dendragama boulengeri Doria including three males
(BMNH 1946.8.13.15; ZMB 10155, 54503) and two females
(MNHN 1889-27; ZMB 54502). To this species we refer one
additional male (UTA 63451) and one additional female
(MZB 13806) from the type locality (above desa Beringin)
0.3752–0.37538S, 100.3638E, 1376–1473 m and six males
(MZB 13822, 13824, 13825; UTA 63463, 63466, 63469),
seven females (MZB 13819–13821, 13823, 13826; UTA
63465, 63467), and seven unsexed specimens (MZB 13817,
13818, 13824; UTA 63461, 63462, 63464, 63468) from Aie
Angek, Sepuluh Koto, Gunung Marapi, Kabupaten Tanah
Datar, Provinsi Sumatera Barat, 0.3958S, 100.4258E, 1526–
1553 m.
Diagnosis.—The following combination of characters
distinguishes Dendragama boulengeri from its congeners:
(1) enlarged scales below eye separated from supralabials by
continuous row of small lorilabials; (2) enlarged tympanic
scale intermediate in size (7–14% of head length) and set far
back on head (orbit–meatus 24–32% of head length); (3)
sublabial tubercular scales 0–3, usually 1, in front of
postrictal modified scale; (4) gulars small, 30–38; (5) dorsal
crest of 11–18 projecting scales, serrate with obvious gaps
between enlarged projecting scales; (6) dorsolateral crest of
more or less continuous posttympanic and dorsolateral
series; (7) scales around midbody 62–84; (8) scales of lower
flanks heterogenous in size, smooth to feebly keeled; (9)
ventrals heavily keeled, 50–63; (10) no white sublabial stripe
extending from below eye to level of ear, however 1–3 white
spots usually present in this region; (11) most specimens with
prominent black prescapular blotch edged posteriorly in
white; (12) proximal half of tail with 7–9 dark brown or green
bands; (13) buccal epithelium and tongue yellow or orange.
Description.—Characteristics of the lectotype appear in
brackets after other male specimens. Males reaching 265
mm (SVL 79 mm) [216 mm, SVL 64 mm] and females
reaching 223 mm (SVL 73 mm) in total length; smallest
juveniles in our sample 90.5 mm total length (SVL 30.5 mm);
SVL 27.7–32.7% (30.7 6 1.2, n ¼ 20) [29.6%] and tail 67.3–
72.3% (69.3 6 1.2, n ¼ 20) [70.4%] of total length; tail
2.055–2.6053 (2.261 6 0.127, n ¼ 20) [2.3753] as long as
SVL; distance from axilla to groin accounting for 46.1–53.9%
(48.3 6 2.3, n ¼ 11) [40.2%] of SVL in males and 41.2–
48.2% (44.8 6 2.3, n ¼ 9) of SVL in females; head 63.5–
73.4% (68.7 6 2.6, n ¼ 20) [66.4%] as wide as long,
accounting for 25.9–32.9% (28.2 6 1.7, n ¼ 20) [30.7%] of
SVL; snout subacuminate in dorsal view and in profile,
DENDRAGAMA 83
sloping upward at about 408 to horizontal (Fig. 10); dorsal
head scales weakly imbricate or juxtaposed; rostral visible
from above, 53.9–69.6% (60.7 6 5.0, n ¼ 19) as wide as
internarial distance, its height 19.4–38.1% (29.2 6 5.6, n ¼
16) [23.3%] of its width, broadly contacting first supralabials
and four (5%), five (90%), or six (5%) small postrostrals (n ¼
20) [five]; postrostral series separating nasal from rostral
100% (n ¼ 20) of the time; noticeably enlarged scales
forming inverted Y (100%, n ¼ 17); single scales forming
each arm of Y, positioned just anterior to orbital border and
separated from base of Y by small scales; keels on scales of
base of Y oriented longitudinally, those of arms oriented
transversely; scales of frontal region about as large as medial
supraoculars, much smaller than scales of circumorbital
series; parietal region depressed, flanked by high supra-
temporal ridge covered in enlarged, knobbed scales; distinct
depression in supratemporal ridge behind postciliary scale;
interparietal usually present (73% n ¼ 15) [absent], roughly
diamond-shaped, keeled, larger than scales flanking it;
parietal eye usually not visible, rarely evident as lightly
pigmented blotch in center of interparietal; area in front of
nuchal crest raised, but noticeably lower than supratemporal
ridges; anterior terminus of nuchal crest separated from
supratemporal ridge by longitudinal groove.
One (63%, n ¼ 16) or two (37%) supranasal scales
separating postrostral series from first canthal; circumorbital
scales 10–13 (11 6 1, n ¼ 16) [12], distinctly enlarged,
roughly pentagonal to octagonal, extending between canthal
series and postciliary scale; transorbitals 16–22 (18 6 2, n ¼
20) [22]; canthals five (35%, n ¼ 20), six (55%), or seven
(10%) [six]; supraciliaries five (55%, n ¼ 20) or six (45%)
[six]; all but last supraciliary with posterior edges imbricating
onto medial side of next scale back; anterior edge of last
supraciliary overlapping medial side of scale in front of it;
supraciliary notch present; last supraciliary separated from
postciliary scale by one (56%, n ¼ 16), two (38%), or three
(6%) [one] small scales; postciliary scale enlarged, subpyr-
amidal, single, positioned at dorsoposterior corner of orbit;
scales of temporal region angulate, heterogenous in size,
juxtaposed to weakly imbricating; largest scales of temporal
region heavily keeled, some resembling temporal modified
scale; small scales of temporal region smooth; temporal
modified scale enlarged and heavily keeled, with low,
projecting point off-center on keel; posttemporal modified
scale enlarged, heavily keeled to pyramidal and, usually,
somewhat angulate; posttemporal modified scale usually
single (80%, n ¼ 20), rarely doubled (15%) or absent (5%)
[doubled]; several scales resembling posttemporal modified
scale on neck just behind skull, mostly separated from one
another by small granular scales; when present, posttemporal
modified scales separated from temporal modified scale by
1–5 (2 6 1, n ¼ 19) [1] small scales.
Nasal large, oval to trapezoidal, its dorsal border
contributing to canthus; nasal contacting Supralabial 1
(90%, n ¼ 20), rarely contacting both 1 and 2 (5%) or
separated from supralabials by row of lorilabials (5%)
[contacting Supralabial 1]; nostril large, oval, directed
laterally, its upper margin reaching canthus; loreal region
slightly concave; scales of loreal region mostly smooth (some
large loreals feebly keeled in some specimens), 6–9 (7 6 1, n
¼ 20) [8] scales in vertical row between last canthal and
supralabials, 5–8 (6 6 1, n ¼ 20) [7] scales in horizontal row
84 Herpetological Monographs 31, 2017
from anterior border of orbit to nasal; orbit 33.4–42.5% (36.7
6 2.2, n ¼ 20) [37.5%] of head length; palpebrals granular;
second row of palpebrals above eye containing 10–14 (12 6
1, n ¼ 20) [12] scales between ocular angles, central 1–4 of
these largest and more-heavily keeled; continuous row of
small lorilabials separating enlarged scales below eye from
supralabials (i.e., 3 interoculabials, 100%, n ¼ 20); horizontal
row of four (30%, n ¼ 20), five (65%), or six (5%) [five]
enlarged, angulate scales between orbit and anterior margin
of auditory meatus; tympanum with large central scale
reaching anterior border of meatus (50%, n ¼ 20, ‘‘reaching
anterior border’’ includes some specimens with narrow strip
of flexible skin devoid of scales between enlarged tympanic
scale and bony border of meatus) or separated from it by one
(44%) or two (6%) [one] curved rows of small granular
scales; length of large tympanic scale 18.1–40.1% (27.7 6
5.3, n ¼ 20) [29.0%] of diameter of orbit and 7.4–14.3%
(10.1 6 1.8, n ¼ 20) [10.9%] of head length; distance from
border of auditory meatus to orbit 23.7–32.3% (27.8 6 2.0, n
¼ 20) [28.6%] of head length; scales surrounding meatus
small, granular; posttympanic modified scale subpyramidal,
usually with one small granular scale separating it from
similar but larger and more attenuate subpyramidal scale of
posttympanic series (variations on this pattern include
occasional specimens lacking the posttympanic modified
scale, lacking the second attenuate scale, or without small
granular scales separating these scales so that the post-
tympanic modified scale appears doubled or tripled);
posttympanic series usually consisting of enlarged scales
arrayed longitudinally in white stripe edging prescapular
blotch (however, these scales are usually separated from the
two subpyramidal posttympanic scales by a wide gap of small
granular scales on the anterior neck).
Supralabials smooth, 7–10 (9 6 1, n ¼ 20) [9]; rictal fold
short, bordered dorsally by portion of last supralabial and
dorsally and ventrally by one or two elongate scales behind
labial series; infralabials smooth, 7–10 (9 6 1, n ¼ 20) [7];
first one (20%, n ¼ 20), two (15%), three (25%), four (35%),
or five (5%) [three] chinshields contacting infralabials,
thereafter, sublabial scales separating enlarged chinshields
from infralabials; first pair of chinshields in medial contact
(50%, n ¼ 20) or separated medially by one (50%)
[separated] gular; gulars keeled, 30–38 (35 6 2, n ¼ 20)
[34] from mental (or point of medial contact between first
pair of chinshields) to preaxial margin of arm, arrayed as 32–
50 (41 6 5, n ¼ 20) [45] interrictal scales between last right
and left infralabials; gular pouch moderately developed,
longitudinal; scales in center of gular pouch same size as
gulars lateral to it; zero (10%, n ¼ 20), one (55%), two (25%),
or three (10%) [two] enlarged, sublabial tubercular scales in
longitudinal row in front of postrictal modified scale;
postrictal modified scale subpyramidal to spinose, with apex
pointing downward and backward, usually largest of the four
modified scales on the neck.
Nuchal crest consisting of 4–13 (7 6 2, n ¼ 20) [9] large,
triangular to elongate and curved scales mostly separated
from one another by gaps filled with paravertebrals and small
vertebrals about same size as paravertebrals or (in some
specimens) projecting and subtriangular scales much smaller
than crest scales; longest nuchal crest scales 7.6–16.6% (11.6
6 2.2, n ¼ 20) [10.5%] as long as head and 69.7–185.8%
(116.2 6 24.1, n ¼ 20) [96.3%] as long as enlarged tympanic
scale; fleshy ridge supporting scales of nuchal crest; fleshy
ridge of more or less uniform height, best developed in adult
males; dorsal crest prominent, with obvious gaps between
vertebral arches, extending onto base of tail in males and
some females (projecting scales stopping in front of pelvic
girdle in some females); enlarged, triangular to curved
projecting scales of crest positioned atop vertebral arches,
typically with one heavily keeled scale in front and one
behind each projecting crest scale; between arches, afore-
mentioned keeled vertebrals contacting one another or
separated by paravertebrals in slightly depressed area
between vertebral arches (medial paravertebral contact
more common posteriorly); 22–44 (34 6 5, n ¼ 20) [29]
vertebrals in dorsal crest to posterior border of thigh, 11–18
(15 6 2, n ¼ 20) [14] of them projecting; largest scales of
dorsal crest 41.5–94.2% (68.8 6 14.1, n ¼ 20) [73.3%] as
long as largest nuchal crest scales; scales of dorsal crest
separated from nuchal crest by pectoral gap of 4–14 (10 6 3,
n ¼ 20) [10] small dorsals (in occasional specimens, one or
more of the vertebrals in the gap may project slightly and
therefore resemble the crest scales); paravertebral series
same size as adjacent dorsals.
Dorsals smaller than ventrals; imbrication patterns on
neck complex: dorsals pointing upward and backward above
posttympanic series, those below antehumeral fold pointing
downward and anteriorly, those between antehumeral fold
and posttympanic series pointing anteriorly; at midbody,
upper 14–23 (20 6 3, n ¼ 19) [20] rows of dorsals pointing
upward and backward, scale row below them pointing
backward, and lower scales pointing backward and down-
ward; dorsolateral crest more or less continuous across
pectoral gap (1–5 small scales separate first scale of
dorsolateral series from enlarged scales of posttympanic
series; 56% of 16 specimens) or substantial gap of 7–13 small
scales separating posttympanic and dorsolateral series (44%
of 16 specimens); dorsolateral series of 7–14 heavily keeled
scales between limbs; scales of dorsolateral series greatly
enlarged, about twice as large as largest scales on lower
flanks (slightly below the dorsolateral series most specimens
have a second series of heavily keeled scales of the same size
and shape; scales in this second series are generally
positioned below gaps of the dorsolateral series); scales of
dorsolateral series separated from one another by 0–8 small
dorsals; first scale of series separated from dorsal crest by 5–
7 dorsals and last separated from crest by four or five dorsals;
scales of lower flanks heterogenous, larger, heavily keeled
scales interspersed among smaller, feebly keeled scales
(becoming heavily keeled approaching venter); scales around
midbody 62–84 (73 6 6, n ¼ 19) [75]; ventrals heavily
keeled, without sharp transition from scales on flanks, 50–63
(57 6 3, n ¼ 20) [60] from preaxial edge of arm to vent;
throughout most of length of tail, subcaudals and dorsal
caudals about same size; enlarged, slightly projecting scales
of dorsal crest extending for short distance onto base of tail.
Scales of brachium, antebrachium, thigh, and shank
imbricate, keeled; antebrachium lacking obviously modified
scales on postaxial margin like those in Dendragama
australis; 4–8 (5 6 1, n ¼ 16) [5] enlarged scales arrayed
along postaxial margin of dorsal thigh with keels heavier and
oriented differently (usually more postaxially, but modified
scale closest to knee oriented more preaxially) than adjacent
scales; palmar scales small, keeled, mucronate, uniform;
 HARVEY
FIG. 11.—Adult male specimen of Dendragama boulengeri (UTA 19161, SVL 71 mm) from the type locality: Gunung Singgalang, Sumatera Barat,
Indonesia. Photos by ENS. A color version of this figure is available online.
palmar subdigital lamellae multicarinate at base of fingers,
bicarinate distally, 23–29 (26 6 2, n ¼ 20) [25] under Finger
IV (count includes 1–5 lamellae at base of Finger IV that are
divided into small scales similar to those in center of palm);
terminal phalanges of fingers lacking unicarinate lamellae;
Finger III usually slightly shorter than Finger IV (Finger III
86.7–100.0% [95.8 6 4.9, n ¼ 18; 91.7%] as long as Finger
IV); Finger IV 61.5–75.0% (71.0 6 3.2, n ¼ 20) [75.0%] as
long as Toe IV; plantar scales heavily keeled, mucronate,
imbricate, those proximal to Toe IV noticeably larger than
others; pedal subdigital lamellae bicarinate and mostly entire
except under Toe IV where lamellae under the proximal
phalangeal articulation longitudinally divided into pairs of
unicarinate scales; preaxial keels much more developed than
postaxial keels at base of Toe III and some postaxial keels
absent entirely; lamellae under Toe IV 24–35 (29 6 2, n ¼
20) [29], usually (69%, n ¼ 16) unicarinate to point just distal
to proximal phalangeal articulation or with 1–2 bicarinate
scales proximal to articulation (31%). (In some specimens
longitudinal division of the lamellae produces the unicarinate
condition whereas apparent loss of the postaxial keel
produces the unicarinate condition in others. In specimens
with bicarinate lamellae proximal to the articulation, the
postaxial and preaxial keels are positioned very close to one
another) [some bicarinate]; single subdigital and single
supradigital ungual lamellae contacting one another on all
fingers and toes; ungual lamellae much longer than other
subdigital lamellae; supradigital scales proximal to supra-
digital ungual lamellae 3–5, usually 4; in relative length,
Finger III ¼ IV . II . V . I and Toe IV . III . V . II .
I; Toe V 60.0–70.4 (65.5 6 2.9, n ¼ 20) [61.3%] as long as
Toe IV; when adpressed, 3–7 (5 6 1, n ¼ 20) [4] lamellae
under Toe IV within span of fifth toe; leg moderate in length
relative to other draconines; shank 23.7–30.0% (25.8 6 1.3,
n ¼ 20) [30.0%] of SVL..
Scale organs lenticular, single, and positioned subtermi-
nally, usually just below mucrons on body, more numerous
and also concentrated on keels on head; bristled sense
organs present, position, number, and distribution not
assessed because stratum corneum missing from most scales
of body); callous glands, pigmented generation glands (sensu
ET AL.—NEW DENDRAGAMA 85
Maderson and Chiu 1970; Harvey et al. 2012), and femoral
and precloacal pores absent.
Measurements of lectotype (in mm): SVL 64, length of tail
152, length of body 25.7, pectoral width 9.2, length of head
from occiput to rostral 19.7, length of head from anterior
border of auditory meatus to rostral 21.0, width of head 13.1,
length of orbit 7.4; distance from orbit to tympanum 5.6,
length of enlarged tympanic scale 2.1, height of largest scale
of nuchal crest 2.1, height of largest scale of dorsal crest 1.5,
width of rostral 3.6; height of rostral 0.8, length of shank
19.2, length of Finger IV 12; length of Finger III 11; length
of Toe IV 16; length of Toe V 9.8.
Coloration and color change.—In life, Dendragama
boulengeri is brown or green with dark green, brown, or
black transverse bands. Adult males have rather striking
facial markings (Fig. 11), including a distinctive white ring
around the eye (covering the first and part of the second row
of palpebrals sharply contrasting with mostly charcoal eyelids
[palpebrals counted from the ocular angle]). Broken lines
(one palpebral thick) of cream to white palpebrals radiate
out from the eye. A pair of distinctive white bands extend
obliquely downward and backward from just in front of and
just behind the corner of the mouth. The first of these bands
includes one of the sublabial tubercles and is about 3–5
scales wide; it begins on the third or second row of sublabials
below the infralabials and extends onto the gulars. The
second band begins behind the rictal fold and extends to the
postrictal modified scale, which is also white. The second
band is 2–3 scales wide and separated from the first by one
or two rows of green to brown scales. Most scales on the
dorsal surface of the head have narrow black edging. Some of
the larger azygous scales forming an inverted Y on the snout
may be paler than adjacent scales. The temporal, post-
temporal, posttympanic, and postrictal scales are all white
and some other enlarged, heavily keeled scales of the
temporal region may also be white whereas surrounding
scales are green or brown.
On the neck, males have mostly white nuchal crest scales
and a large black blotch in front of the scapula. A narrow
white stripe overlaps the posttympanic series, edges the
blotch dorsally, and separates the blotch from a single black
86 Herpetological Monographs 31, 2017
to dark brown transverse band crossing the pectoral gap. The
white stripe merges with a wide white band that borders the
prescapular blotch posteriorly. This white band overlaps two
or three rows of scales at its narrowest point below and
behind the prescapular blotch and 5–7 scales dorsally, where
it bridges the gap between the posttympanic and dorsolateral
series.
During photo sessions, we noticed that individual
specimens change both their color and pattern, apparently
darkening in response to stress. During one photo session,
MZB 13806 first blackened while retaining light yellow areas
between black bands, then lost any trace of green or yellow
pigment to become entirely brown and black. Dendragama
boulengeri has one dark brown to black band on the neck, 4–
6 bands on the body, and 12–16 (14 6 1, n ¼ 8) on the tail,
of which 7–9 (8 6 1, n ¼ 15) bands are present on the
proximal one half of the tail. Distally, the tail darkens in
color, preventing a total count of caudal bands in many
specimens. Four dark brown to black bands cross the
brachium, antebrachium, thigh, and shank. The hands and
feet are also banded dorsally. Soles of the feet are banded
cream and charcoal. On the body, transverse bands usually
cross the vertebrals and stop at the enlarged scales of the
dorsolateral series. Below the dorsolateral series, the flanks
usually have a net-like reticulum of anastomosing dark
brown or black lines. However, specimens can change to a
heavily banded condition where the net-like pattern vanishes
and bands extend from the dorsolateral series to the venter.
On the body, scales of the dorsolateral series are the same
color as surrounding scales.
The venter may be immaculate white to cream, or it may
appear dirty due to varying amounts of diffuse brown or
black pigmentation. Photos of a live female (MZB 13823)
show brown lines radiating across the gular region and a
complex brown and cream reticulum under the limbs.
At this time, we cannot determine if this species exhibits
sexual dichromatism. Both males and females have the
white-edged, black prescapular blotch; however, a few
specimens of both sexes lack this blotch.
Dendragama boulengeri has a dark brown iris, white to
pale yellow ciliary ring, a yellow to orange buccal epithelium
and tongue, and black parietal peritoneum.
Etymology.—This species’s name is a patronym for
George Albert Boulenger.
Distribution and natural history.—Beccari collected
the type series on Gunung Singgalang in sympatry with
Lophocalotes ludekingii (Doria 1888). Manthey (2008)
published a recent photograph of the type locality.
Female Dendragama boulengeri have relatively longer
bodies than do males (F9,11 ¼ 7.12, P ¼ 0.02). We did not
find sexual dimorphism in relative height of the nuchal
scales, head length, head width, length of the shank, length
of the tail, dorsal crest counts, projecting dorsal counts,
scales around midbody, or ventrals (P . 0.05). Nonetheless,
the dorsal crest of females usually lacks projecting scales on
the last one quarter of the body whereas these scales extend
to the base of the tail in males.
In our sample from Gunung Marapi, two subadult
females, 40 and 45 mm SVL, had not reached sexual
maturity. Their ovaries contained 3 and 4 small white
developing ova, the largest 0.52 mm and 0.85 mm,
respectively. Neither had convoluted oviducts or distended
cloacas, suggesting that they had not reached sexual
maturity. All females over 60 mm (six specimens, 60.0–68.5
mm SVL) were sexually mature. In five of these, the right
ovary contained one (80% of specimens) or two (20%) large,
yolked ova, 3.4–7.2 mm in diameter and seven or eight white
developing ova smaller than 1.8 mm in diameter. The sixth
specimen contained a 6.0 3 12.7 mm (235.1 mm3 in volume)
ovoid oviductal egg in the right oviduct. By looking through
the mesenteries, we were able to count two large, yolked
ovarian eggs on the left side of one of the specimens with a
single advanced egg in the right ovary. All six gravid females
had convoluted oviducts and distended cloacas.
Relative to the size of the abdominal cavity, the oviductal
egg is very large and accounts for almost half of the distance
from the axilla to the groin. There is not enough space for
more than two eggs to develop in a single oviduct. Based on
these observations, we conclude that Dendragama boulen-
geri likely produces multiple clutches each year and lays 2–4
eggs.
Remarks.—Based on X-ray plates and examination of
external anatomy, Moody (1980) included Dendragama
boulengeri in his phylogenetic matrix, and interested readers
may consult this source for additional morphological data not
mentioned in our description. Recently, Denzer et al. (2015:
their Fig. 2) illustrated the skull of D. boulengeri and
compared it to the skull of Malayodracon robinsonii
(Boulenger).
Although Acanthosaura schneideri Ahl (1926) is currently
considered to be a junior synonym of Dendragama
boulengeri (Denzer et al. 1997; Manthey and Grossmann
1997), we consider this name to be valid and we will
redescribe it in a subsequent paper. From the synonymy, we
exclude several references to D. boulengeri because they
actually refer to one of the other species of Dendragama.
Werner (1900) based his description on one specimen from
‘‘Rája-Berge’’ and several from ‘‘Fusse des Vulkans Si
Nabung’’ (¼ Gunung Sinabung near Berastagi, Sumatera
Utara). Schenkle (1901) also reported this species from
‘‘Vulkan Si-Nabung.’’ Specimens from Gunung Sinabung are
D. schneideri (KS and MBH, unpublished data). De Rooij’s
(1915) description appears to be based on both D. boulengeri
and D. schneideri because she included data from specimens
collected on Gunung Sinabung and from ‘‘Si Rambé near
Lake Toba, 1200 M.’’ Kurniati (2009) reported D. boulengeri
from Gunung Tujuh, Jambi; however, the taxonomic status
of this population requires further investigation (KS and
MBH, unpublished data). Accordingly, we exclude Werner’s
and Kurniati’s publications from the synonymy of D.
boulengeri.
Das (2010) reports Dendragama boulengeri from ‘‘Binjai,
nr Medan, Pis-Pis, Batakland and Gunung Singalang.’’
Dendragama boulengeri only occurs at the last locality
whereas Pis-Pis and Batakland refer to specimens of D.
schneideri. Neither species ever occurred at the lowland site
Binjai (Sumatera Utara, 3.60018N, 98.48548E, 28 m eleva-
tion). Specimens with Binjai as their locality were most likely
collected in the nearby Batak Highlands. Collectors such as
Ludwig Martin who resided in Binjai shipped several
herpetological specimens to European museums in the late
1800s (Harvey et al. 2016).
Manthey (2008) published a photo by Mistar Kamsi of a
female Dendragama from ‘‘near Lubuk Selasih, West
 HARVEY ET AL.—NEW
Sumatra, Indonesia.’’ As for many localities in Sumatra, the
name Lubuk Selasih has changed over time. We suspect that
the specimen came from Gunung Talang, a mountain above
city of Lubuk Selasih, Kecamatan Gunung Talang, Kabu-
paten Solok, Sumatera Barat, 0.96838S, 100.60178E, eleva-
tion approximately 1200 m. A locality in the Falling Rain
Gazetteer misspelled as ‘‘Lubuksulasih’’ also likely refers to
this same region based on its coordinates 0.96678S,
100.60288E, 1276 m (Falling Rain Genomics Inc. 2015),
and the current name was spelled Loeboeksoelasih during
the Dutch era (Anonymous 1923). Although we have not
examined specimens from this locality, we tentatively refer
this population to D. boulengeri based on its proximity to the
type locality. Other photos in Manthey’s (2008) publication
illustrate either D. schneideri or the undescribed species
from Kerinci.
Dendragama dioidema sp. nov.
Holotype.—An adult male (MZB 13814, collector’s tag
ENS 19450; Fig. 12) from Bukit Sama, Kampung Telege
Atu, Kebayakan, Kabupaten Aceh Tengah, Provinsi Aceh,
Indonesia, 4.665128N, 96.809378E, 1567 m, collected 5
August 2015 by I. Sidik, I. Fonna, and P. Thammachoti.
Paratypes (42).—Three males (MZB 13794; UTA 63448,
63449), six females (MZB 13804, 13805; UTA 63438, 63440,
63441, 63446), and 15 unsexed specimens (MZB 13795–
13803; UTA 63439, 63442–63445, 63447) from Kute Baru,
Linge, along road from Takengon to Isaq, Kabupaten Aceh
Tengah, Provinsi Aceh, Indonesia, 4.528758N, 96.853168E,
1827 m, collected on 5 August 2015 by E. Wostl, I. Fonna
and M. Ikhsan; one unsexed specimen (UTA 63450) from
foot of Berni Terlong, near Desa Rambune, Kabupaten
Bener Meriah, Provinsi Aceh, Indonesia, 4.76488N,
96.801968E, 1471 m, collected on 7 August 2015 by G.C.
Sarker, I. Sidik, I. Fonna and M. Ikhsan; four male (MZB
13807, 13808, 13810; UTA 63452) and two unsexed
specimens (MZB 13809; UTA 63453) from Beutong Ule,
high point on Meulaboh-Takengon road, Kabupaten Nagan
Raya, Provinsi Aceh, Indonesia, 4.383678N, 96.516338E,
1950 m, collected on 5 August 2015 by E. Wostl, E.N. Smith,
G.C. Sarker and P. Thammachoti; one male (MZB 13811),
three females (UTA 63456–63458), and three unsexed
specimens (MZB 13812, 13813; UTA 63455) from Bukit
Sama, Kampung Telege Atu, Kebayakan, Kabupaten Aceh
Tengah, Provinsi Aceh, Indonesia, 4.66512–4.665838N,
96.80627–96.809378E, collected 5 August 2015 by I. Sidik,
I. Fonna, and P. Thammachoti; one male (UTA 63460), one
female (MZB 13815), and two unsexed specimens (MZB
13816; UTA 63459) from Hutan Timang Gajah, Gunung
Burni Telong, Kabupaten Bener Meriah, Provinsi Aceh,
Indonesia, 4.77122–4.771428N, 96.80907–96.810178E,
1875–1957 m, collected on 7 August 2015 by E. Wostl, P.
Thammachoti, A.M. Khadafi, and I. Fonna.
Diagnosis.—The following combination of characters
distinguishes Dendragama dioidema from its congeners: (1)
enlarged scales below eye broadly contacting supralabials;
(2) tympanum relatively large (11–16% of head length) and
close to eye (orbit–meatus 23–29% of head length); (3)
sublabial tubercular scales 0–2, usually 1, in front of
postrictal modified scale; (4) gulars large, 16–22; (5) dorsal
crest of 9–19 projecting scales, serrate with obvious gaps
DENDRAGAMA 87
FIG. 12.—Holotype of Dendragama dioidema (MZB 13814, SVL 73 mm)
from Bukit Sama, Aceh, Indonesia, 4.665128N, 96.809378E, 1567 m. Photo
by ENS. A color version of this figure is available online.
between enlarged projecting scales; (6) dorsolateral crest of
more or less continuous posttympanic and dorsolateral
series; (7) scales around midbody 57–77; (8) scales of lower
flanks heterogenous in size, smooth to feebly keeled; (9)
ventrals smooth or very feebly keeled, 49–63; (10) no white
sublabial stripe; however, one or two white or pale yellow
spots (corresponding to sublabial tubercular scale and
postrictal modified scales) usually present in area below
rictus and ear; (11) no distinctive prescapular blotch edged
posteriorly in white; band crossing neck interrupted by
narrow white or yellow line; (12) proximal half of tail with 6–
10 dark brown or green bands; (13) buccal epithelium
cream, tongue pink to red.
Description.—Characteristics of the holotype appear in
brackets after other male specimens. Males reaching 258
mm (SVL 73 mm) [246 mm, SVL 73 mm] and females
reaching 259 mm (SVL 74 mm) in total length; smallest
juveniles in our sample 93 mm total length; SVL 25.9–32.3%
(29.0 6 1.3, n ¼ 19) [29.7%] and tail 67.7–74.1% (71.0 6
1.3, n ¼ 19) [70.3%] of total length; tail 2.100–2.8683 (2.449
6 0.152, n ¼ 19) [2.3703] as long as SVL; distance from
axilla to groin accounting for 45.0–48.0% (46.6 6 1.1)
[46.6%] of SVL in males and 44.9–53.6% (49.5 6 2.7) of
SVL in females; head 62.7–71.9% (67.7 6 2.6, n ¼ 20)
[67.4%] as wide as long, accounting for 25.8–30.7% (27.4 6
1.2, n ¼ 20) [29.5%] of SVL; snout subacuminate in dorsal
view and in profile, sloping upward at about 258 to horizontal
(Fig. 2, 13); dorsal head scales weakly imbricate or
juxtaposed; rostral visible from above, 53.3–73.1% (62.7 6
4.9, n ¼ 20) [69.6%] as wide as internarial distance, its height
17.2–34.4% (28.5 6 4.4, n ¼ 20) [26.9%] of its width,
broadly contacting first supralabials and four (10%), five
(85%), or six (5%) small postrostrals (n ¼ 20) [five]; single
postrostral usually separating nasal from rostral 95% (n ¼ 20)
or two small scales separating nasal from rostral (5%);
noticeably enlarged scales forming inverted Y (100%, n ¼
20); single scales forming each arm of Y, positioned just
anterior to orbital border and separated from base of Y by
small scales; keels on scales of base of Y oriented
longitudinally, those of arms oriented transversely; scales of
frontal region about as large as medial supraoculars, much
88 Herpetological Monographs 31, 2017
FIG. 13.—Coloration and morphology of the heads of adult male (A; holotype, MZB 13814, head length 21.5 mm) and female (B; UTA 63438, head length
19.4 mm) Dendragama dioidema from Aceh, Indonesia. Photos by ENS. A color version of this figure is available online.
smaller than scales of circumorbital series; parietal region
depressed, flanked by high supratemporal ridge covered in
enlarged, knobbed scales; distinct depression in supra-
temporal ridge behind postciliary scale; interparietal present
(65% n ¼ 20) or absent (35%) [absent], roughly diamond-
shaped, keeled, larger than scales flanking it; parietal eye
often visible as lightly pigmented blotch in center of
interparietal; area in front of nuchal crest raised, but
noticeably lower than supratemporal ridges; anterior termi-
nus of nuchal crest separated from supratemporal ridge by
longitudinal groove.
One (20%, n ¼ 20), two (65%), or three (15%) [two]
supranasal scales separating postrostral series from first
canthal; circumorbital scales 10–13 (11 6 1, n ¼ 20) [10],
distinctly enlarged, roughly pentagonal to octagonal, extend-
ing between canthal series and postciliary scale; transorbitals
13–18 (16 6 2, n ¼ 20) [15]; canthals five (65%, n ¼ 20) or
six (45%) [five]; supraciliaries four (10%, n ¼ 20), five (75%)
or six (15%) [five]; all but last supraciliary with posterior
edges imbricating onto medial side of next scale back;
anterior edge of last supraciliary overlapping medial side of
scale in front of it; supraciliary notch present; last
supraciliary separated from postciliary scale by one (95%, n
¼ 20) or two (5%), [one] small scales; postciliary scale
enlarged, subpyramidal, single, positioned at dorsoposterior
corner of orbit; scales of temporal region angulate,
heterogenous in size, juxtaposed to weakly imbricating;
largest scales of temporal region keeled; small scales of
temporal region smooth; temporal modified scale enlarged,
pyramidal to swollen with heavy keel but always distictive;
enlarged posttemporal modified scale enlarged, heavily
keeled to pyramidal; posttemporal modified scale usually
single (65%, n ¼ 20), infrequently doubled (25%), tripled
(5%), or absent (5%) [absent]; when present, posttemporal
modified scales separated from temporal modified scale by
0–4 (1 6 1, n ¼ 19) small scales.
Nasal large, oval to trapezoidal, its dorsal border
contributing to canthus; nasal contacting Supralabial 1
(75%, n ¼ 20), both 1 and 2 (20%), or separated from
supralabials by row of lorilabials (5%) [contacting Supralabial
1]; nostril large, oval, directed laterally, its upper margin
reaching canthus; loreal region slightly concave; scales of
loreal region mostly smooth (some large loreals feebly keeled
in some specimens), 5–7 (6 6 1, n ¼ 20) [5] scales in vertical
row between last canthal and supralabials, 5–7 (6 6 1, n ¼
20) [5] scales in horizontal row from anterior border of orbit
to nasal; orbit 33.7–39.1% (36.6 6 1.6, n ¼ 20) [34.4%] of
head length; palpebrals granular; second row of palpebrals
above eye containing 9–15 (12 6 1, n ¼ 20) [13] scales
between ocular angles, central 1–4 of these largest and more-
heavily keeled; enlarged row of scales below eye contacting
supralabials (two interoculabials, 100%, n ¼ 20); horizontal
row of three (15%, n ¼ 20), four (70%), five (15%) [four]
enlarged, angulate scales between orbit and anterior margin
of auditory meatus; auditory meatus covered by thin
tympanumic membrane reaching anterior border of meatus
(85%, n ¼ 20; in some specimens, a few small granular scales
in a single row are on the tympanic skin, but the enlarged
tympanic scale projects through one or more gaps in this row
to reach the border of the meatus) or separated from border
of meatus by one complete curved row of small granular
scales (15%) [reaching border]; length of tympanic mem-
brane 27.2–46.0% (36.6 6 5.0, n ¼ 20) [41.5%] of diameter
of orbit and 10.6–16.0% (13.4 6 1.6, n ¼ 20) [14.3%] of
head length; distance from border of auditory meatus to
orbit 23.1–29.0% (25.5 6 1.3, n ¼ 20) [26.0%] of head
length; scales surrounding meatus small, granular; posttym-
panic modified scale undifferentiated, enlarged and heavily
keeled, or slightly swollen and pyramidal, separated by one
to three scales from larger and more attenuate subpyramidal
scale of posttympanic series (a short gap in the dorsolateral
crest of 1–5 small scales follows this attenuate scale in most
[86%, n ¼ 15] specimens).
 HARVEY ET AL.—NEW
Supralabials smooth, 6–10 (8 6 1, n ¼ 20) [8]; rictal fold
short, bordered dorsally by portion of last supralabial and
dorsally and ventrally by one or two elongate scales behind
labial series; infralabials smooth, 6–9 (8 6 1, n ¼ 20) [8]; first
two (5%, n ¼ 20), three (50%), four (40%), or five (5%)
[four] chinshields contacting infralabials, thereafter sublabial
scales separating enlarged chinshields from infralabials; first
pair of chinshields in medial contact (30%, n ¼ 20) or
separated medially by one (70%) gular [in contact]; gulars
smooth and relatively large, 16–22 (20 6 2, n ¼ 20) [18]
from mental (or point of medial contact between first pair of
chinshields) to preaxial margin of arm, arrayed as 17–25 (21
6 2, n ¼ 20) [20] interrictal scales between last right and left
infralabials; gular pouch moderately developed, longitudinal;
scales in center of gular pouch same size as gulars lateral to
it; zero (5%, n ¼ 20), one (70%), or two (25%) enlarged,
sublabial tubercular scales in longitudinal row in front of
postrictal modified scale; postrictal modified scale enlarged,
heavily keeled to swollen and subpyramidal with apex
pointing downward and backward, usually largest of the
four modified scales on the neck but somewhat smaller than
sublabial tubercular scale below rictus (UTA 63460 is
exceptional in lacking a postrictal modified scale on both
sides, 5%, n ¼ 20).
Nuchal crest consisting of 5–10 (7 6 1, n ¼ 20) [7] large,
triangular to elongate scales mostly separated from one
another by gaps filled with paravertebrals, small vertebrals
about same size as paravertebrals or (in some specimens)
projecting, and subtriangular scales much smaller than crest
scales; longest nuchal crest scales 10.9–16.3% (12.8 6 1.8, n
¼ 20) [11.5%] as long as head and 68.7–123.2% (96.3 6
15.4, n ¼ 20) [80.5%] as long as enlarged tympanic scale;
low, fleshy ridge supporting scales of nuchal crest in large
specimens; dorsal crest low, extending from pectoral gap to
base of tail of males and some females (crest not
distinguishable from paravertebrals by posterior one third
of body in some females), consisting of heavily keeled scales
with distally attenuate tips projecting upward and backward;
dorsal crest scales about same length as flanking paraverte-
brals (ignoring the extension contributed by attenuate tips of
projecting dorsals); first few projecting scales of dorsal crest
contacting one another, but remaining dorsal crest scales
separated by gaps of 2–3 paravertebrals or heavily keeled but
not projecting vertebrals (or both); 11–33 (26 6 6, n ¼ 20)
[25] vertebrals in dorsal crest to posterior border of thigh, 9–
19 (14 6 3, n ¼ 20) [17] of the dorsal crest scales projecting;
largest scales of dorsal crest 37.3–71.8% (54.4 6 9.9, n ¼ 18)
[70.0%] as long as largest nuchal crest scales; scales of dorsal
crest separated from nuchal crest by pectoral gap of 3–12 (9
6 2, n ¼ 20) [8] small dorsals; paravertebral series same size
as adjacent dorsals.
Dorsals smaller than ventrals; on neck, dorsals pointing
upward and backward above lower border of tympanum,
pointing downward and backward below this point; no scales
on neck pointing anteriorly and scales not undergoing
reorientation of imbrication pattern at antehumeral fold; at
midbody, upper 16–23 (19 6 2, n ¼ 20) [23] rows of dorsals
pointing upward and backward, scale row below them
pointing backward, and lower scales pointing backward and
downward; prominent posttympanic series of enlarged scales
extending longitudinally to cross pectoral gap, continuous
with dorsolateral series or last scale of posttympanic series
DENDRAGAMA 89
separated from dorsolateral series by 1–3 small scales
dorsolateral crest more or less continuous across pectoral
gap; dorsolateral series of enlarged and heavily keeled scales
evident on anterior half of body, but scales of series not or
poorly differentiated from adjacent dorsals in 50% (n ¼ 20)
of specimens; dorsolateral series consisting of 11–18 (14 6 3;
we did not attempt to count the scales in specimens with
poorly differentiated series on the posterior body) enlarged
scales between limbs, separated from one another by gaps of
3–6 scales and frequently grouped in short lines of 2–4
enlarged scales contacting one another; in some specimens,
all scales of dorsolateral series more-heavily keeled than
adjacent dorsals, only anterior scales of series more-heavily
keeled in other specimens (unlike D. boulengeri, this species
lacks a second series of enlarged scales below the
dorsolateral series); first scale of series separated from dorsal
crest by 5–9 dorsals and last separated from crest by 3–5
dorsals; dorsals keeled adjacent to vertebral crest, feebly
keeled to smooth on lower flanks; scales of lower flanks
heterogenous, larger scales interspersed among smaller
scales; however, larger scales smooth or feebly keeled like
adjacent small scales; scales around midbody 57–77 (68 6 5,
n ¼ 20) [71]; ventrals smooth to very feebly keeled without
sharp transition to scales on flank, 49–63 (55 6 3, n ¼ 20)
[53] from preaxial edge of arm to vent; subcaudals and dorsal
caudals about same size; enlarged, slightly projecting scales
of dorsal crest extending for short distance onto base of tail.
Scales of brachium, antebrachium, thigh, and shank
imbricate, keeled; two (sometimes only one) enlarged scales
with white, heavy keels positioned on dorsal postaxial margin
of antebrachium, separated from one another by one or two
scales; 4–7 (5 6 1, n ¼ 20) [6] enlarged scales arrayed along
postaxial margin of dorsal thigh with keels heavier and
oriented differently than adjacent scales; palmar scales small,
keeled, mucronate, uniform; palmar subdigital lamellae
multicarinate at base of fingers, bicarinate distally, 22–33
(27 6 3, n ¼ 20) [27] under Finger IV (count includes 1–5
lamellae at base of Finger IV that are divided into small
scales similar to those in center of palm); terminal phalanges
of fingers lacking unicarinate lamellae; Finger III about as
long as Finger IV (Finger III 92.8–105.0% [97.9 6 3.5, n ¼
15; 91.7%] as long as Finger IV); Finger IV 63.3–81.7% (72.8
6 4.3, n ¼ 20) [75.0%] as long as Toe IV; plantar scales
heavily keeled, mucronate, imbricate, those proximal to Toe
IV noticeably larger than others; pedal subdigital lamellae
bicarinate and mostly entire except under Toe IV where
lamellae under the proximal phalangeal articulation usually
longitudinally divided into pairs of unicarinate scales;
preaxial keels much more developed than postaxial keels at
base of Toe III and some postaxial keels absent entirely,
pointed but not greatly attenuate into serrated fringe;
lamellae under Toe IV 26–35 (29 6 2, n ¼ 20) [27],
frequently (60%, n ¼ 20) unicarinate to point just distal to
proximal phalangeal articulation or with some or all scales
bicarinate proximal to articulation (40%) [divided]; single
subdigital and single supradigital ungual lamellae contacting
one another on all fingers and toes; ungual lamellae much
longer than other subdigital lamellae; supradigital scales
proximal to supradigital ungual lamellae 3–5, usually 4; in
relative length, Finger III ¼ IV . II . V . I and Toe IV .
III . V . II . I; Toe V 59.4–71.0 (65.3 6 2.5, n ¼ 20)
[59.4%] as long as Toe IV; when adpressed, 3–6 (5 6 1, n ¼
90 Herpetological Monographs 31, 2017

19) [5] lamellae under Toe IV within span of fifth toe; leg
moderate in length relative to other draconines; shank 20.5–
27.0% (24.4 6 1.7, n ¼ 20) [24.3%] of SVL.
Scale organs lenticular, single, and positioned subtermi-
nally, usually just below mucrons on body, more numerous
and also concentrated on keels on head; bristled sense
organs present, position, number, and distribution not
assessed because stratum corneum missing from most scales
of body); callous glands, pigmented generation glands (sensu
Maderson and Chiu 1970; Harvey et al. 2012), and femoral
and precloacal pores absent.
Measurements of holotype (in mm): SVL 73, length of tail
173, length of body 34, pectoral width 11.1, length of head
from occiput to rostral 21.5, length of head from anterior
border of auditory meatus to rostral 22.0, width of head 14.5,
length of orbit 7.4; distance from orbit to tympanum 5.6,
length of enlarged tympanic scale 3.1, height of largest scale
of nuchal crest 2.5, height of largest scale of dorsal crest 1.7,
width of rostral 3.6; height of rostral 1.0, length of shank
17.7, length of Finger IV 12; length of Toe IV 16; length of
Toe V 9.5.
Coloration and color change.—In life, Dendragama
dioidema is usually green or brown and, as for congeners,
this species can darken both its pattern and hue. Dorsal head
scales are extensively edged in dark brown or black whereas
sides of the head are mostly green or light brown. Irregular
bands of black pigment radiate out from the eye but are
interrupted by an immaculate green or light brown ring of
palpebrals edging the eye. Most specimens have a pair of
white or yellow bands below and behind the corner of the
mouth: one extending downward and backward from the
posterior infralabials or rictus to cover the large sublabial
tubercular scale and another with the same orientation
extending from the lower border of the auditory meatus to FIG. 14.—Ventral coloration and pattern of adult male (A; MZB 13794,
cover the postrictal modified scale. In some specimens, the SVL 72 mm) and female (B; 13812, SVL 66 mm) Dendragama dioidema
from Aceh, Indonesia. Photos by ENS. A color version of this figure is
bands are absent, but the sublabial tubercular scale and available online.
postrictal modified scale are nonetheless immaculate yellow
or white.
Dendrogama dioidema has transversely banded limbs, both sexes. Ventrally the legs and feet are white with
one transverse brown to black band crossing the pectoral charcoal bands, and this pattern extends onto the postaxial
gap, four or five [four] on the body, and 11–17 (13 6 1, n ¼ thigh and tail just above the vent.
12) [13] on the tail (6–10, 7 6 1, n ¼ 17 [8] on the proximal Dendragama dioidema has a tan to bronze iris with a
one half of the tail). Scales of the posttympanic series and much lighter ciliary ring. Its buccal epithelium is cream and
first few scales of the dorsolateral series are white or yellow tongue pink to red. The parietal peritoneum is black and
and form a prominent stripe interrupting the band crossing flanks of some specimens darkened when we euthanized
the neck. However, this species lacks a large prescapular them.
blotch edged posteriorly in white. On the body, bands Etymology.—The new name dioidema is a masculine
terminate just after crossing the dorsolateral series. A noun in apposition derived from the Greek prefix di,
complex pattern of narrow, anastomosing brown to black meaning two, and noun oidema, meaning protuberance.
lines replaces the bands on the lower flanks. Bands encircle The name refers to the pair of distinctive tubercular scales
the tail; they are narrower than the interspaces proximally positioned slightly below and behind the rictus in this
but progressively lengthen toward the tip. Distally, bands species. Unlike some congeners, Dendragama dioidema
cannot be counted in many specimens due to darkening of usually has a single, large sublabial tubercular scale
both the bands and interspaces. Modified, heavily keeled positioned in front of the postrictal modified scale.
scales on the postaxial borders of the thigh and antebrachium Distribution and natural history.—Dendragama dio-
have white or yellow keels or are entirely white or yellow. idema is known from a relatively small area above 1400 m in
Males in our samples have white ventral bodies and gular the highlands of central Aceh (Fig. 8). We found this species
regions whereas the same areas are light green in females at five localities between 4.38–4.778N and 96.52–96.858E,
(Fig. 14). Gravid females in our collection (e.g., UTA 63438 sleeping in low vegetation of montane forest between 1471–
and MZB 13811) both have white bands extending along the 1950 m elevation.
ventrolateral edge of their otherwise green bellies. Skin Female Dendragama dioidema have relatively longer
between the gulars is blue, purplish-blue, or bluish-gray in bodies than do males (F10,10 ¼ 6.74, P ¼ 0.02; Fig. 15).
 HARVEY
FIG. 15.—Regression of body length on head length illustrating sexual
dimorphism in Dendragama dioidema.
The dorsal crests of females usually lack attenuate scales on
the posterior one third of the body. Lower counts of
projecting dorsals (t10,10 ¼ 4.57, P ¼ 0.0002) and dorsal crest
scales (t10,10 ¼ 1.19, P ¼ 0.0752) in females also reflect this
sexual dimorphism. An exception is UTA 63458: in its dorsal
crest, attenuate scales extend to the level of the posterior lip
of the cloaca and are more numerous than in other females.
We did not find sexual dimorphism in relative height of the
nuchal scales, head length, head width, length of the shank,
length of the tail, scales around midbody, or ventrals (P .
0.05).
We examined the reproductive system in 10 females. The
smallest of these specimens (59 mm SVL) had convoluted
though not distended oviducts, a slightly distended cloaca,
and only five cream-colored developing eggs in its ovaries
(the largest ovum is 1.2 mm in diameter). The other nine
specimens (62–74 mm SVL) had 10–15 (n ¼ 6; not counted
in three specimens to avoid excessive damage) eggs in their
ovaries. One of these nine specimens contained two ovoid
oviductal eggs and one contained a single egg. Oviductal eggs
were 6.1 3 12.5 mm (246.2 mm3 in volume) and 7.5 3 13.9
mm (402.9 mm3). Ovaries in seven of the nine mature
females contained large, spherical, yolked eggs (4.4–7.7 mm
in diameter). These yolked ova were most often paired (six
specimens, 86%). The right ovary of MZB 13812 contained a
single, large, yolked egg, 7.7 mm in diameter. Specimen
UTA 63457 appears to have oviposited shortly before
capture based on its greatly distended right oviduct and
cloaca. The ovary of this specimen contained two yellowish
eggs, each 2.7 mm in diameter. The ovary of the specimen
with a single oviductal egg contained four subequal cream-
colored ova, the largest 2.4 mm in diameter.
ET AL.—NEW DENDRAGAMA 91
Based on these observations, we conclude that Dendra-
gama dioidema has a clutch size of 2–4 ovoid eggs, with four
eggs being more frequent. Female D. dioidema appear to
reach sexual maturity at about 60 mm SVL. One specimen
simultaneously had large, yolked ovarian eggs and oviductal
eggs, suggesting that this species is capable of producing
multiple clutches in a single year. Nonetheless, most
specimens had either advanced ovarian eggs or oviductal
eggs but not both.
Status of Salea rosaceum Thominot
Thominot (1889:24) described Salea rosaceum based on a
small male agamid reportedly from ‘‘Syngapoore.’’ Bou-
lenger (1890) examined the type and added it to the
synonymy of Dendragama boulengeri. Smith (1930) could
not locate the type, but Guibé (1954) indicated that the
specimen was still present in the MNHN. The last revisor to
comment on the type was Brygoo (1988), who retained the
specimen in the synonymy of D. boulengeri. Recent
catalogues of Draconinae (Wermuth 1967; Welch et al.
1990; Welch 1994) followed Boulenger’s synonymy. Salea
rosaceum appears in the synonymy of D. boulengeri
prepared by Uetz and Hallermann in Uetz and Hošek
(2015). However, these authors incorrectly attribute the
name to Guibé (1954) rather than to Thominot.
While visiting the MNHN, Harvey examined the holotype
of Salea rosaceum and consulted the original catalogue
entries. Boulenger (1890) misidentified this specimen as
Dendragama boulengeri. The specimen cannot be assigned
to Dendragama because it has 43 scale rows around midbody
and lacks sublabial tubercular scales, postrictal modified
scales, and high supratemporal ridges. Instead, the specimen
bears the diagnostic characters of Pseudocalotes (Haller-
mann and Böhme 2000; Mahony 2010; Harvey et al. 2014)
and most-closely resembles P. tympanistriga and P. rham-
manotus.
The holotype of Salea rosaceum cannot be assigned to
Pseudocalotes rhammanotus because the holotype of S.
rosaceum has homogenous and feebly keeled scales on the
lower flanks (vs. heterogenous with some enlarged, more-
heavily keeled scales interspersed among smaller, feebly
keeled scales in both species), a pattern of irregular black
lines on the neck and body (lines absent), and five lamellae
under Toe IV within the span of the fifth toe (vs. two in P.
rhammanotus). The holotype of S. rosaceum (Fig. 16, 17)
most-closely resembles Pseudocalotes tympanistriga, and we
compare it to a sample of 16 P. tympanistriga in Table 7.
Sequences of the ND4 gene have diverged by 7.4–7.6%
between northern and southern populations of P. tympanis-
triga. Accordingly, we report data for the northern and
southern populations separately in Table 7. We did not
combine data from either population with data for the
holotype of P. tympanistriga because of this specimen’s
imprecise locality information.
When compared for a suite of 49 meristic and mensural
characters (Table 7), only slight differences between
Pseudocalotes tympanistriga and the holotype of Salea
rosaceum emerge. The holotype has six scales bridging the
pectoral gap whereas P. tympanistriga has 0–5 scales; it has
43 scales around midbody versus 46–60 and it has 21 dorsal
crest scales versus 25–32.
92 Herpetological Monographs 31, 2017

FIG. 16.—Dorsal, lateral, and ventral aspects of the holotype of Salea

rosaceum (male, SVL 79 mm, MNHN 6806). Photos by MBH. A color
version of this figure is available online.

Are these differences substantial enough to suspect that

two species are at hand? We do not have a good estimate of
the population range for these characters because our
sample sizes of P. tympanistriga are relatively small.
However, it is reasonable to assume that the population
ranges will have a similar magnitude to those in Dendragama
because this genus is closely related to Pseudocalotes. The
range for scales bridging the pectoral gap is eight in D.
australis (n ¼ 24), nine in D. boulengeri (n ¼ 20), and five in
D. dioidema (n ¼ 20); thus, an actual range of 0–8 in P.
tympanistriga should not come as a surprise. Similarly, these
same three species of Dendragama have ranges of 16, 22,
and 22 for dorsal crest scale counts and, 33, 22, and 20 for
scales around midbody. To generate conservative estimates
of the population range of P. tympanistriga, we select the
maximum observed ranges of midbody scales in Dendraga-
ma and then generate new ranges around the sample means
for our 16 P. tympanistriga. Applying this procedure, we
obtain hypothetical population ranges of 42–64 (using the
mean of the entire sample of 16 P. tympanistriga and
maximum range of the three species of Dendragama) and
11–43 for dorsal crest scales. The midbody and dorsal crest
counts of S. rosaceum fall within these hypothetical ranges. If
variation in these characters is at least as great in P.
tympanistriga as it is in Dendragama, the low counts in S.
rosaceum do not constitute compelling evidence that it is a
valid species.
In their Table 3, Grismer et al. (2016) summarized
diagnostic characters of all currently described species of
Pseudocalotes. We found a few errors in the entries for P.
tympanistriga. Nonetheless, when each character in this
table is scored for the holotype of Salea rosaceum, the
specimen agrees with P. tympanistriga. Grismer et al. (2016)
apparently meant ‘‘scale between a postrostral and nasal’’
rather than ‘‘scale between rostral and nasal.’’ Harvey et al.
FIG. 17.—Dorsal, lateral, and ventral morphology of the head of the
holotype of Salea rosaceum (male, head length 19.6 mm, MNHN 6806). A
knot in the anterior gular region is attached to a glass float designed to
suspend the specimen head-first in its jar. Photos by MBH. A color version
of this figure is available online.
(2014) discussed variation in this character and referred to it
as a ‘‘scale intercalated between postrostral and nasal’’ in
their Table 1. One scale (a postrostral) almost always
separates the nasal from the rostral in Pseudocalotes, and
the holotype of S. rosaceaum has this common character
state. A scale intercalated between the postrostral and nasal
occurs at low frequencies in, at least, the southern
population of P. tympanistriga. Thus, the table of Grismer
et al. (2016) should be amended to read ‘‘No/Yes’’ for this
character. In addition, Grismer et al. (2016) characterize P.
tympanistriga as lacking both keeled flank scales and an
interparietal. Scales on the lower flanks of S. rosaceum and P.
tympanistriga are keeled, although feebly so. Like other
Sumatran and Javan congeners, P. tympanistriga has a
dorsolateral series of 4–8 enlarged, heavily keeled scales on
the upper flanks. Like most specimens from the southern
population of P. tympanistriga, the holotype of Salea
rosaceum has an interparietal. In this specimen, the
interparietal is relatively small and poorly differentiated,
 HARVEY ET AL.—NEW DENDRAGAMA 93

TABLE 7.—Comparisons of the holotype of Salea rosaceum Thominot to Pseudocalotes tympanistriga Gray. †Characters differ between holotype of S.
rosaceum and specimens of P. tympanistriga. (—) indicates character state not observed.

Pseudocalotes tympanistriga
Salea rosaceum
Characters holotype Northern population (n ¼ 5) Southern population (n ¼ 10) Holotype

Postrostrals 5 4–7 4–6 Damage

Transorbitals 15 14–19 (17 6 2) 13–18 (16 6 2) 18
Interparietal Present Absent (100%) Present (70%) —
Absent (30%)
Supranasals 2/1 1 (80%) 1 (40%) —
2 (20%) 2 (60%)
Canthals 6/6 5–7 4–7 5/6
Supraciliaries 5/7 6–8 5–7 6/damage
Canthals þ Supraciliaries 11/13 11–14 (13 6 1) 9–13 (12 6 1) 11/damage
Small scales between last supraciliary and postciliary scale 1/1 1–3 1–4 —
Scales separating rostral from nasal 1/1 1 (100%) 1 (90%) Damage/1
2 (10%)
Supralabials contacting nasal 1–2/1–2 1 (20%) 1 (70%) 1–2/1–2
1–2 (80%) 1–2 (30%)
Loreals between last canthal and supralabials 7/5 4–6 (5 6 1) 5–7 (6 6 1) 4/4
Loreals between orbit and nasal 8/6 6–7 (7 6 5) 5–8 (7 6 1) 5/5
Postnasal-suborbital scales (sensu Grismer et al. 2016) 10/11 10–11 10–13 —
Palpebrals in second row above eye 13/11 11–15 (12 6 1) 10–15 (12 6 2) 12/12
Interoculabials 2/2 2 (100%) 2 (90%) 2/2
3 (10%)
Scales separating temporal and posttemporal modified scales 2/3 1–2 1–3 2/3
Number of posttemporal modified scales 1/2 1 (100%) 1 (90%) 1/1
2 (10%)
Enlarged scales between orbit and auditory meatus 4/4 3–4 3–5 5/4
Supralabials 9/9 9–11 9–11 9/9
Infralabials 8/9 9–11 9–10 10/10
Count of chinshields (sensu Grismer et al. 2016) 6/6 5–7 6–8 —
Chinshields contacting infralabials 3/3 2–5 1–4 3/3
Gulars separating first pair of chinshields 1 0 (0%) 0 (10%) 1
1 (40%) 1 (90%)
2 (60%)
Gulars 35 30–40 (35 6 4) 33–41 (36 6 3) 32
Nuchal crest scales 8 7–10 (9 6 1) 6–11 (9 6 1) —
Middorsal scales spanning pectoral gap† 6 1–5 (3 6 2) 0–5 (3 6 2) —
Dorsal crest scales† 21 25–28 (26 6 1) 25–32 (27 6 3) —
Rows of dorsals directed upward and backward at midbody 3 3 (100%) 3 (100%) 3
Scales around midbody† 43 50–60 (53 6 4) 46–60 (54 6 4) 51
Ventrals 63 56–73 (65 6 7 52–63 (59 6 4) 62
Lamellae under Finger IV 24/24 22–26 (24 6 1) 20–26 (23 6 2) 24/24
Lamellae under Toe IV 29/31 26–32 (28 6 3) 25–31 (28 6 2) 29/30
Fourth toe lamellae within span of fifth toe 5/6 5–8 (6 6 1, n ¼ 4) 5–7 (6 6 1) 6/damage
Maximum SVL 79 mm 81 mm 80 mm 67 mm
Body length/SVL 46.8% 45.9–49.1% (47.1 6 1.3) 43.7–53.3% (49.0 6 2.7) 52.2%
Head length/SVL 24.8% 23.5–24.8% (24.2 6 0.4) 23.4–26.8% (24.6 6 1.1) 26.0%
Auditory meatus to tip of snout/head length 106.4% 104.3–109.5% (107.2 6 2.1) 102.2–106.6% (104.4 6 1.4) 105.4%
Head width/head length 61.4% 54.0–72.4% (65.1 6 7.0) 59.8–66.8% (63.6 6 1.9) 65.2%
Length of orbit/head length 35.6% 35.6–36.8% (36.4 6 0.4) 33.8–39.1% (37.0 6 1.7) —
Distance from orbit to auditory meatus/head length 24.4% 22.7–26.0% (24.2 6 1.3) 22.6–25.6% (24.2 6 0.8) 25.0%
Length of tympanum/head length 11.7% 11.6–14.7% (12.9 6 1.2) 11.8–14.8% (13.4 6 0.9) 14.8%
Length of nuchal crest scale/length of tympanum 83.8% 57.4–87.9% (71.9 6 11.1) 51.6–77.1% (60.7 6 8.3) 61.8%
Width of snout/head length 23.3% 23.4–26.9% (25.2 6 1.3) 20.5–25.7% (23.7 6 1.5) 25.4%
Rostral width/head length 14.8% 13.5–15.2% (14.4 6 0.8, n ¼ 4) 9.6–16.5% (13.8 6 2.3) Damaged
Rostral height/width 39.0% 26.1–40.5% (34.4 6 6.3, n ¼ 4) 26.0–50.5% (36.4 6 6.9) Damaged
Length of shank/SVL 18.9% 18.1–21.1% (19.3 6 1.3) 17.5–21.3% (19.3 6 1.2) 19.7%
Length of Finger IV/ head length 45.9% 40.4–51.4% (45.6 6 4.6, n ¼ 4) 42.4–52.1% (46.5 6 3.2) 48.7%
Length of Finger IV/length of Toe IV 70.3% 68.2–77.6% (73.4 6 4.0, n ¼ 4) 65.6–74.6% (70.6 6 2.9) 69.1%
Length of Toe IV/length of Toe V 66.4% 67.3–75.0% (71.8 6 3.2, n ¼ 4) 63.0–80.0% (69.5 6 5.3) 66.7%

55.2% as wide as long, and has a round, swollen area
containing a visible parietal eye in the posterior half of the
scale. Earlier, Harvey et al. (2014) reported that P.
tympanistriga lacks an interparietal; however, they had not
yet collected samples of the southern population and had
only examined the five specimens from the northern
population. When present, interparietals in the southern
population of P. tympanistriga are 30.3–55.2% (42.9 6 8.4, n
¼ 7) as wide as long.
Other than color pattern, we have not identified
morphological differences between the northern and south-
ern populations of Pseudocalotes tympanistriga. The holo-
type of Salea rosaceum has a color pattern like lizards from
the northern population. When described by Thominot, the
specimen was still green. After at least 139 yr in preservative,
94 Herpetological Monographs 31, 2017
the specimen has faded to dull blue with black markings. It
has a black postciliary scale contrasting with blue scales of
the circumorbital series and other adjacent scales. About six
palpebral rows above the eye and two below are brown; flat,
thin scales of the opaque window in the lower eyelid are
charcoal; remaining palpebrals are light blue with some
scattered black scales not forming radiating lines. A black
postocular band includes the row of enlarged orbito-
tympanic scales and two rows below them. This postocular
band is diffuse due to some blue or partially blue scales in
the center of the band. Four irregular lineate markings, 1–4
scales high, extend backward and downward between the
tympanum and scapula. Similar irregular lineate markings
also extend along the flanks, contributing to a complex dorsal
pattern that includes entirely blue and entirely black scales
as well as scales that are half blue and half black or blue with
black edges. Diffuse bands composed of black-edged blue
scales cross the limbs and number 1/1 on the brachium, 3/3
on the antebrachium, 4/4 on the thighs, and 3/3 on the
shank. The hand and foot are also diffusely banded. On the
tail, diffuse bands formed by black-edged scales are much
longer than interspaces and lengthen distally. The ventral
surfaces are mostly immaculate light blue and the gular
pouch completely lacks any black pigment.
Animal dealers such as M. Deyrolles did not always keep
careful records, and this fact is borne out by the vague
locality data accompanying all three specimens in the
shipment from Singapore. The MNHN received the
holotype of Salea rosaceum on 27 January 1877. In addition
to the holotype (originally assigned the Number MNHN
1877-24 and the methodological catalogue Number 2006a),
the shipment contained a snake of the genus Calamaria
(MNHN 1877-26) and an unidentified skink (MNHN 1877-
25). Locality entries for all three specimens are brief.
Without any more-precise locality information, the catalogue
lists Singapore for the holotype and Java for the snake and
skink. We suspect that the holotype’s locality is incorrect and
that all three specimens were actually collected on Java.
Nonetheless, a species of Pseudocalotes could occur on
Singapore. Members of this genus occur on each of the three
large adjacent landmasses surrounding Singapore: Borneo
(Inger and Stuebing 1994), Peninsular Malaysia (Grismer et
al. 2016), and Sumatra (Harvey et al. 2014). Singapore has
several low hills, with Bukit Timah being the highest at only
164 m. Although most species of Pseudocalotes occur above
800 m, at least one insular species, P. andamanensis, occurs
near sea level (Harikrishnan and Vasudevan 2013).
In conclusion, we find no compelling morphological
differences between the holotype of Salea rosaceum and
specimens of Pseudocalotes tympanistriga. We have little
confidence in the vague locality data sent by a collector to
the MNHN in 1877 and conclude that the specimen was
most likely collected on Java along with other specimens in
the same shipment. Accordingly, we refer Salea rosaceum
Thominot to the synonymy of Pseudocalotes tympanistriga
Gray ‘new synonymy.’ The possibility remains that S.
rosaceum is a rare insular endemic on Singapore, but we
consider this possibility to be remote. If a population of
Pseudocalotes is discovered on Singapore or one of its
adjacent islands in the future, our rather detailed description
of the holotype of S. rosaceum will facilitate comparisons.
DISCUSSION
In this study, we were fortunate to have large series. With
increased statistical power relative to recent descriptions of
species in the closely related genus Pseudocalotes (Harvey et
al. 2014; Grismer et al. 2016), we were able to more
completely explore the usefulness and variability of several
characters widely used in systematics of Draconinae. Our data
reveal that some widely used diagnostic characters, such as
number of canthals, are more variable than originally thought
and should be interpreted with caution when diagnosing rare
species. Most species of Pseudocalotes have a single row of
enlarged lorilabials below the eye, and Mahony (2010) argued
that this character distinguishes Pseudocalotes from other
Draconinae. However, both new species of Dendragama and
P. brevipes (Harvey et al. 2014) lack it.
On the other hand, some neglected characters deserve a
second look, and new characters from our study should be
considered when diagnosing new Draconinae. New charac-
ters described herein include those of the sublabial,
tympanic, dorsal crest, and dorsolateral crest scales. Again,
we stress the importance of buccal coloration. In Dendra-
gama we found the same dichotomy already described for
Sumatran Pseudocalotes (Harvey et al. 2014). Like P.
cybelidermus and P. guttalineatus, D. australis and D.
boulengeri have bright yellow to orange buccal epithelia
whereas, like species of the P. tympanistriga Group, D.
dioidema has a pale pink epithelium.
Our analysis revealed a surprising number of diagnostic
morphometric characters. However, we would have failed to
identify some of these if our sample sizes had not been so
large. Some authors measure head length from the occiput to
the tip of the snout whereas others measure head length
from the tympanum. These two methods give similar results
when compared across draconine genera. Nonetheless,
researchers should not assume that they are redundant
measurements. Position of the auditory meatus varies among
the three species of Dendragama; the tympanum–snout
measurement captures this variation whereas the occiput–
snout measurement does not.
Finally, a better understanding of character variation
informed our study of the holotype of Salea rosaceum. This
specimen presented a difficult problem because its supposed
provenance and morphology suggested that it could be a
rare, though valid, species. One might conclude that S.
rosaceum is valid because the specimen’s scale counts at
midbody, in the dorsal crest, and within the pectoral gap all
lie outside known ranges of P. tympanistriga. We argue that
such a conclusion would be a mistake. Based on variation in
Dendragama, we conservatively estimated hypothetical
ranges of each of these characters in P. tympanistriga and
showed that the counts for S. rosaceum fall within these
hypothetical ranges. Furthermore, we provide several
reasons to believe that the specimen was collected on Java
rather than on Singapore.
Lizards of the genus Dendragama are restricted to
mountains of Sumatra’s Barisan Range. This formation
extends for about 1700 km along the western side of the
island. Peaks average 2000–2500 m in elevation with some
volcanoes exceeding 3800 m. Several different historical
events likely shaped the contemporary distribution of
Dendragama. Glaciation cycles of the Pleistocene likely
 HARVEY ET AL.—NEW
brought some populations into contact following dramatic
shifts in vegetation composition (Morley 2000) and elevation
(Broeker 1996). These frequent, recent events may explain
why populations on the mountains of Bengkulu (e.g., Gunung
Daun) and Sumatera Selatan (Gunung Dempo and Patah)
show little genetic divergence, even though inhospitable
lowland areas currently isolate these populations. On the
other hand, violent and frequent volcanic activity (Umbgrove
1949; Verstappen 1973) likely isolated some populations of
Dendragama for longer periods of time, leading to speciation.
Some speciation events leading to the current diversity of
Dendragama and other Sumatran agamids may date to the
Miocene when Sumatra was largely inundated and reduced
to a chain of volcanic islands (Hall 1998).
Inger and Voris (2001) view inundation during the
Miocene and volcanic activity as forces that reduced anuran
and snake diversity on Sumatra by increasing extinction
rates. Observing that many Mentawai mammals have their
closest relatives on Borneo or Java rather than Sumatra,
Wilting et al. (2012) propose higher extinction rates on
Sumatra, again invoking volcanic events such as the Toba
supervolcanic eruption. Perhaps because of our previous
experience with Neotropical herpetofaunas, these hypothe-
ses strike us as counterintuitive. We view these vicariant
events as forces that would increase speciation by interrupt-
ing gene flow and generating topographic diversity. In the
neotropics, amphibian and reptile diversity is highest on
volcanically active mountain ranges such as the Andes.
On the Sunda Shelf, agamids reach their highest diversity
on Sumatra. Description of Dendragama australis and D.
dioidema brings the number of Sumatran agamid species to
37 in 13 genera. These counts exceed those of Peninsular
Malaysia (8 genera, 35 species), Borneo (10 genera, 32
species), and Java (5 genera, 13 species; Uetz and Hošek
2015; Grismer et al. 2016) and will increase further as our
ongoing revisions of Sumatran agamids proceed. These
discordant patterns of species diversity—high in agamids and
low in snakes—call for an explanation. Perhaps volcanism has
simply affected these groups differently: reducing diversity
in one and increasing diversity in the other. Untangling the
sundry historical effects of glacial cycles, volcanism, and
marine incursions on Sumatra’s reptiles will be a challenge
for future students of Sunda Shelf biogeography.
Acknowledgments.—We are grateful to the Ministry of Research and
Technology of the Republic of Indonesia (RISTEK) for coordinating and
granting research permission. S. Wahyono (RISTEK) provided valuable
assistance throughout the permit approval process. We are grateful to past
and present representatives of LIPI at the Museum Zoologicum Bogoriense
for facilitating in-house study of specimens and export and field research
permits, namely Boeadi, M. Amir, R. Ubaidillah, R.M. Marwoto, and H.
Sutrisno.. Both RISTEK and LIPI reviewed and approved our fieldwork in
Indonesia and provided export permits for specimens to the United States
for study and deposition at UTA A. Hamidy and W. Tri Laksono kindly
provided laboratory assistance at MZB, and N. Widodo and Mr. Marwoto
from the Faculty of Mathematicas and Natural Sciences of Universitas
Brawijaya (UB) kindly provided logistical support. Dr. E. Harnelly and Dr.
Suwarno (Biology Department, Syiah Kuala University [SKU], Banda Aceh,
Indonesia) kindly provided logistical support to our team while in Aceh. For
their hard work under often difficult field conditions, we thank members of
the summer 2015 expedition to Sumatra: M. Ikshan and I. Fonna (SKU), A.
Hamidy, Farid, Syaripudin, W. Tri Laksono, and G. Pradana (MZB), F.
Alhadi and A.M. Kadafi (UB), and G.C. Sarker, U. Smart, P. Thammachoti,
and E. Wostl (UTA). For kindly hosting MBH’s visits to their institutions, we
thank G. Doria and M. Petri (MSNG), E. Dondorp (RMNH), C. Spencer
and J. McGuire (MVZ), J. Streicher and P. Campbell (BMNH), J. Vindum
(CAS), A. Ohler, M. Cugnet, and J. Courtois (MNHN), and F. Tillack and
DENDRAGAMA 95
M.O. Rödel (ZMB). For loan of specimens used in this research we thank A.
Resetar and H.K. Voris (FMNH), D. Kizirian (AMNH), C. Spencer and J.
McGuire (MVZ), and J. Vindum (CAS). C. Franklin (UTA) kindly
catalogued and mailed specimens to MBH. All specimens were collected,
euthanized, and preserved following guidelines detailed in the American
Society of Ichthyologists and Herpetologists pamphlet: Guidelines for Use of
Live Amphibians and Reptiles in Field and Laboratory Research, 2nd
edition, available at http://www.asih.org/publications. A National Science
Foundation grant (DEB-1146324) to ENS and MBH funded this research.
LITERATURE CITED
Ahl, E. 1926. Neue Eidechsen und Amphibien. Zoolgischer Anzeiger
67:186–192.
Ananjeva, N.B., M.E. Dilmuchamedov, and T.N. Matveyeva. 1991. The skin
organs of some iguanian lizards. Journal of Herpetology 25:186–199.
Anonymous. 1923. Lijst van De Voornaamste Aardrijkskundige Namen in
Den Nederlandsch-Indischen Archipel, 2nd edition. Landsdrukkerij-
Weltevreden, Indonesia.
Avise, J.C., and R.M. Ball, Jr. 1990. Principles of genealogical concordance
in species concepts and biological taxonomy. Oxford Survey in
Evolutionary Biology 7:45–67.
Barbour, T. 1912. A contribution to the zoogeography of the East Indian
islands. Memoirs of the Museum of Comparative Zoology 44:1–203 þ 8
plates.
Boettger, O. 1893. Neue Reptilien und Batrachier aus West-Java.
Zoologischer Anzeiger 16:334–340.
Boulenger, G.A. 1890. First report on additions to the lizard collection in the
British Museum (Natural History). Proceedings of the Zoological Society
of London 1890:77–86.
Broeker, W. 1996. Glacial climate in the tropics. Science 272:1902–1904.
Brygoo, É. 1988. Les types d’Agamidés reptiles, sauriens du Muséum
National d’Histoire Naturelle. Catalogue critique. Bulletin du Museum
National d’Histoire Naturelle 10:1–56.
Capocaccia, L. 1961. Catalogo del tipi di reptili del Museo Civico di Storia
Naturale di Genova. Annali del Museo Civico di Storia Naturale Giacomo
Doria 72:86–111.
Cooper, W.E., Jr., and N. Greenberg. 1992. Reptilian coloration and
behavior. Pp. 298–422 in Biology of the Reptilia, vol. 18: Physiology,
Hormones, Brain and Behavior (C. Gans and D. Crews, eds.). Chicago
University Press, USA.
Das, I. 2010. A Field Guide to the Reptiles of South-East Asia. New Holland
Ltd., UK.
de Queiroz, K. 1998. The general lineage concept of species, species criteria,
and the process of speciation: A conceptual unification and terminological
recommendations. Pp. 57–75 in Endless Forms: Species and Speciation
(D.J. Howard and S.H. Berlocher, eds.). Oxford University Press, USA.
De Rooij, N. 1915. The Reptiles of the Indo-Australian Archipelago. I.
Lacertilia, Chelonia, Emydosauria. E.J. Brill, The Netherlands.
Denzer, W., R. Günther, and U. Manthey. 1997. Kommentierter Type-
nkatalog der Agamen (Reptilia: Squamata: Agamidae) des Museums für
Naturkunde der Humboldt-Universität zu Berlin (ehemals Zoologisches
Museum Berlin). Mitteilungen aus dem Zoologischen Museum in Berlin
73:309–332.
Denzer, W., U. Manthey, K. Mahlow, and W. Böhme. 2015. The systematic
status of Gonocepahlus robinsonii Boulenger, 1908 (Squamata: Agami-
dae: Draconinae). Zootaxa 4039:129–144.
Doria, G. 1888. Nota erpetologiche. I. Alcuni nuovi sauri raccolti in Sumatra
dal Dr. O. Beccari. Annali del Museo Civico di Storia Naturale Giacomo
Doria 26:646–652, Plate 8.
Falling Rain Genomics Inc. 2015. Global Gazetteer, Version 2.3. Available at
http://www.fallingrain.com. Archived by WebCite at http://www.
webcitation.org/6lTwxjIy2 on 22 October 2016.
Frost, D.R., and R. Etheridge. 1989. A phylogenetic analysis and taxonomy
of iguanian lizards (Reptilia: Squamata). The University of Kansas
Museum of Natural History Miscellaneous Publications 81:1–65.
Grismer, L.L., E.S.H. Quah, P.L. Wood, Jr., . . ., A.J. Cobos. 2016. Dragons
in the mist: Three new species of Pseudocalotes Fitzinger (Squamata:
Agamidae) from the sky island archipelago of Peninsular Malaysia.
Zootaxa 4136:461–490. DOI: http://doi.org/10.11646/zootaxa.4136.3.3
Guibé, J. 1954. Catalogue des Types de Lezards du Muséum National
d’Histoire Naturelle. Bayeux, France.
Hall, R. 1998. The plate tectonics of Cenozoic SE Asia and the distribution
of land and sea. Pp. 99–131 in Biogeography and Geological Evolution of
SE Asia (R. Hall and J.D. Holloway, eds.). Backhuys, The Netherlands.
Hallermann, J., and W. Böhme. 2000. A review of the genus Pseudocalotes
96 Herpetological Monographs 31, 2017
(Squamata: Agamidae), with description of a new species from West
Malaysia. Amphibia-Reptilia 21:193–210. DOI: http://dx.doi.org/10.1163/
156853800507372
Hammer, Ø., D.A.T. Harper, and P.D. Ryan. 2001. PAST: Paleontological
statistics software package for education and data analysis. Palaeontologia
Electronica 4:1–9.
Harikrishnan, S., and K. Vasudevan. 2013. Rediscovery of Calotes
andamanensis Boulenger, 1891, and assessment of its generic allocation
(Squamata: Sauria: Agamidae). Herpetozoa 26:3–13.
Harvey, M.B., G.N. Ugueto, and R.L. Gutberlet, Jr. 2012. Review of teiid
morphology with a revised taxonomy and phylogeny of the Teiidae
(Lepidosauria: Squamata). Zootaxa 3459:1–156.
Harvey, M.B., A. Hamidy, N. Kurniawan, K. Shaney, and E.N. Smith. 2014.
Three new species of Pseudocalotes (Squamata: Agamidae) from
southern Sumatra, Indonesia. Zootaxa 3841:211–238. DOI: http://dx.
doi.org/10.11646/zootaxa.3841.2.3
Harvey, M.B., K.A. O’Connell, E. Wostl, A. Riyanto, N. Kurniawan, E.N.
Smith, and L.L. Grismer. 2016. Redescription Cyrtodactylus lateralis
(Werner) (Squamata:Gekkonidae) and phylogeny of the prehensile-tailed
Cyrtodactylus. Zootaxa 4107:517–540. DOI: http://doi.org/10.11646/
zootaxa.4107.4.3
Inger, R.F., and R.B. Stuebing. 1994. First record of the lizard genus
Pseudocalotes (Lacertidae: Agamidae) in Borneo, with description of a
new species. Raffles Bulletin of Zoology 42:961–965.
Inger, R.F., and H.K. Voris. 2001. The biogeographical relations of the frogs
and snakes of Sundaland. Journal of Biogeography 28:863–891.
Jessop, T.S., R. Chan, and D. Stuart-Fox. 2009. Sex steroid correlates of
female-specific colouration behavior and reproductive state in Lake Eyre
dragon lizards, Ctenophorus maculosus. Journal of Comparative Physi-
ology A 195:619–630. DOI: http://dx.doi.org/ 10.1007/s00359-009-0437-4
Kearse, M., R. Moir, A. Wilson, . . ., A. Drummond. 2012. Geneious Basic:
An integrated and extendable desktop software platform for the
organization and analysis of sequence data. Bioinformatics 28:1647–
1649. DOI: http://dx.doi.org/10.1093/bioinformatics/bts199
Kurniati, H. 2009. Herpetofauna diversity in Kerinci Seblat National Park,
Sumatra, Indonesia. Zoo Indonesia, Jurnal Fauna Tropika 18:45–68.
LeBas, N.R., and N.J. Marshall. 2000. The role of colour in signaling and
male choice in the agamid lizard Ctenophorus ornatus. Proceedings of
the Royal Society B 267:445–452. DOI: https://doi.org/10.1098/rspb.
2000.1020
Maderson, P.F.A., and K.W. Chui. 1970. Epidermal glands in gekkonid
lizards: Evolution and phylogeny. Herpetologica 26:233–238.
Mahony, S. 2010. Systematic and taxonomic reevaluation of four little known
Asian agamid species, Calotes kingdonwardi Smith, 1935, Japalura
kaulbacki Smith, 1937, Salea kakhienensis Anderson, 1879 and the
monotypic genus Mictopholis Smith, 1935 (Reptilia: Agamidae). Zootaxa
2514:1–23.
Manthey, U. 2008. Terralog, vol. 7a. Agamid Lizards of Southern Asia:
Draconinae 1. Edition Chimaira, Germany.
Manthey, U., and W. Grossmann. 1997. Amphibien & Reptilien
Südostasiens. Natur und Tier Verlag, Germany.
Manthey, U., and N. Schuster. 1996. Agamid Lizards. T.F.H. Publications,
USA.
Mertens, R. 1954. Über die javanische Eidechse Dendragama fruhstorferi
und die Gattung Dendragama. Senckenbergiana 34:185–186.
Moody, S.M. 1980. Phylogenetic and Historical Biogeographical Relation-
ships of the Genera in the Family Agamidae (Reptilia: Lacertilia). Ph.D.
dissertation, The University of Michigan, USA.
Moody, S.M. 1983. The rectus abdominis muscle complex of the Lacertilia:
Terminology, homology, and assumed presence in primitive iguanian
lizards. Pp. 195–212 in Advances in Herpetology and Evolutionary
Biology: Essays in Honor of Ernest E. Williams (A.G.J. Rhodin and K.
Miyata, eds.). Museum of Comparative Zoology, USA.
Morley, R.J. 2000. Origin and Evolution of Tropical Rain Forests. John
Wiley & Sons, USA.
Ota, H., and T. Hikida. 1989. Karyotypes of three species of the genus Draco
(Agamidae: Lacertilia) from Sabah, Malaysia. Japanese Journal of
Herpetology 13:1–6.
Ota, H., and T. Hikida. 1991. Taxonomic review of the lizards of the genus
Calotes Cuvier, 1817 (Agamidae, Squamata) from Sabah Malaysia.
Tropical Zoology 4:179–192.
Rohland, N., and D. Reich. 2012. Cost-effective, high throughput DNA
sequencing libraries for multiplex target capture. Genome Research
22:939–946.
Sabaj, M.H. 2016. Standard Symbolic Codes for Institutional Resource
Collections in Herpetology and Ichthyology: An Online Reference,
Version 6.5 (16 August 2016). American Society of Ichthyologists and
Herpetologists, USA. Available at http://www.asih.org/. Archived by
WebCite at http://www.webcitation.org/6lkBdh0EO on 3 November
2016.
Schenkel, E. 1901. Achter Nachtrag zum Katalog der herpetologischen
Sammlung des Basler Museums. Verhandlungen der Naturforschenden
Gesellschaft in Basel 13:142–199.
Smith, M.A. 1930. The Reptilia and Amphibia of the Malay Peninsula from
the Isthmus of Kra to Singapore including the adjacent islands. Bulletin
of the Raffles Museum 3:1–149.
Smith, M.A. 1935. The Fauna of British India, Including Ceylon and Burma.
Reptilia and Amphibia, vol. II: Sauria. Taylor and Francis, UK.
Tamura, K., D. Peterson, N. Peterson, G. Stecher, M. Nei, and S. Kumar.
2011. MEGA5: Molecular evolutionary genetics analysis using maximum
likelihood, evolutionary distance, and maximum parsimony methods.
Molecular Biology and Evolution 28:2731–2739. DOI: http://dx.doi.org/
10.1093/molbev/msr121
Teynié, A., P. David, and A. Ohler. 2010. Notes on a collection of
amphibians and reptiles from Western Sumatra (Indonesia), with the
description of a new species of the genus Bufo. Zootaxa 2416:1–43.
Tiedemann, F., M. Häupl, and H. Grillitsch. 1994. Katalog der Typen der
Herpetologischen Sammlung nach dem Stand vom 1. Jänner 1994. Teil
II: Reptilia. Kataloge Bd. Der wissenschaftlichen Sammlungen des
Naturhistorischen Museum in Wien, Vertebrata Bd. 10, Heft 4.
Selbstverlag, Naturhistorisches Museum Wien, Austria.
Thominot, M.A. 1889. Observations sur quelques reptiles et batraciens de la
collectión du Muséum d’Histoire naturelle de Paris. Bulletin de la Société
philomathique de Paris 8:21–30.
Uetz, P., and J. Hošek. 2015. The Reptile Database. Available at http://www.
reptile-database.org. Archived by WebCite at http://www.webcitation.
org/6lTwlns5p on 22 October 2016.
Umbgrove, J.H.F. 1949. Structural History of the East Indies. Cambridge
University Press, UK.
Verstappen, H.T. 1973. A Geomorphological Reconnaissance of Sumatra
and Adjacent Islands (Indonesia). International Institute for Aerial
Survey and Earth Sciences, The Netherlands.
Welch, K.R.G. 1994. Lizards of the World. A Checklist. 5. Agamidae,
Chamaeleonidae, Cordylidae and Gerrhosauridae. R & A Research
Information Limited KCM Books, UK.
Welch, K.R.G., P.S. Cooke, and A.S. Wright. 1990. Lizards of the Orient: A
Checklist. Robert E. Krieger Publishing Company, USA.
Wermuth, H. 1967. Liste der rezenten Amphibien und Reptilien. Agamidae.
Das Tierreich, Lief. 86:i–xiv, 1–127.
Werner, F. 1900. Reptilien und Batrachier aus Sumatra. Zoologische
Jahrbücher. Abteilung für Systematik, Geographie und Biologie der
Tiere. Jena 13:479–508.
Werner, F. 1915. Reptilia und Amphibia für 1915 (und zum Teil auch für
1914). Archiv für Naturgeschichte. Abteilung B 81:67–107.
Wilting, A., R. Sollmann, E. Meijaard, K.M. Helgen, and J. Fickel. 2012.
Mentawai’s endemic, relictual fauna: Is it evidence for Pleistocene
extinctions on Sumatra? Journal of Biogeography 2012:1–13.
Yedlin, I.N., and G.W. Ferguson. 1973. Variation in aggressiveness of free-
living male and female collard lizards, Crotaphytus collaris. Herpetolog-
ica 29:268–275.
Zug, G.R., H.H.K. Brown, J.A. Schulte, II, and J.V. Vindum. 2006.
Systematics of the garden lizards, Calotes versicolor group (Reptilia,
Squamata, Agamidae), in Myanmar: Central dry zone populations.
Proceedings of the California Academy of Sciences 57:35–68.
ZooBank.org registration LSID: 99761424-5102-4298-97D3-
E7EB36EAF14D
Published on 29 May 2017
Guest Editor: Bryan Stuart
APPENDIX
Additional Specimens Examined
Dendragama schneideri (1).—INDONESIA: SUMATERA BARAT: Gunung
Simbolon (ZMB 15664, holotype).
Pseudocalotes sp. (1).—INDONESIA: SUMATERA BARAT: forest west of
 HARVEY ET AL.—NEW
the mountain crest next to the road from Tapan to Sungai Penuh, 2.042948S,
101.311298E (MZB 9813).
Pseudocalotes brevipes (10).—LAO PDR: XE KONG: Kaleum District, Xe
Sap National Biodiversity Conservation Area, near 1680410 0 0 N, 10685845 0 0 E,
1200–1300 m (FMNH 258703). VIETNAM: VINH PHU: Tam Dao, Vinh Yen
District (MVZ 224103–224106; 226486, 226487, 226489, 226490, 226494).
Pseudocalotes cybelidermus (15).—INDONESIA: LAMPUNG: Montane
forest above Ngarip, 5.288S, 104.568E, 1376–1521 m (MZB 9766, 9769,
9800, UTA 60537–60539, 60552–6055 paratypes). SUMATERA SELATAN:
Montane forest at Maura Dua, Remanan Jaya, Gunung Pesagi (locally
known as Masagi), 4.918S, 104.138E, 1474–1643 m (MZB 9767 holotype;
MZB 9650, 9760, 9799, UTA 60549–60551 paratypes).
Pseudocalotes dringi (2).—MALAYSIA: PAHANG: ‘‘Gunung Tahan, 6500–
7200 ft (1981–2194 m) elevation’’ (BMNH 1906.2.28.10 holotype).
TERENGGANU: ‘‘Summit Ridge, 4000 ft (1219 m) elevation, Gunung Lawit,
Terengganu, W-Malaysia’’ (BMNH 1974.4929 paratype).
Pseudocalotes flavigula (2).—MALAYSIA: PAHANG: ‘‘Gunnong Brin-
chang,’’ Cameron Highlands, 1524–1829 m (FMNH 143903); ‘‘Cameron
Highlands between 5,000 and 6,000 feet’’ (BMNH 1946.8.11.14 holotype).
Pseudocalotes floweri (2).—CAMBODIA: KOH KONG: ‘‘Cardamom
Highlands Plateau. 0349359 Easting, 1325813 Northing, 1200 m’’ (FMNH
270127). THAILAND: No other data (FMNH 114514), ‘‘Chantaboon’’ ¼
Chantaburin (BMNH 1946.8.11.25 lectotype).
Pseudocalotes guttalineatus (16).—INDONESIA: LAMPUNG: Montane
forest above Ngarip, 5.288S, 104.568E, 1341–1521 m (MZB 9796 holotype;
MZB 9652, 9765, 9792–9795, 9801, UTA 60536, 60540–60543, 60554
paratypes). SUMATERA SELATAN: Maura Dua, Remanan Jaya, Gunung Pesagi
(localy known as Masagi), 4.918S, 104.138E, 1574–1643 m (UTA 60500–
60501, paratypes).
Pseudocalotes kakhienensis (6).—CHINA: YUNAN: Nujiang Prefecture,
small village S of Gongshan, 27842 0 13.7016 0 0 N, 98842 0 10.1982 0 0 E, ca 1451 m
(CAS 214907, 214940, 214949), Fugong County, Shiwuli, 27809 0 22.5 0 0 N,
98847 0 57.4 0 0 E (CAS 234454–234455), Gongshan County, vicinity of village S
of Gongshan, 27842 0 13.1 0 0 N, 98842 0 10.6 0 0 E, 1437 m (CAS 242105).
View publication stats
DENDRAGAMA 97
Pseudocalotes kingdonwardi (11): BURMA.—‘‘Adung Valley, 7000 ft,
Burma-Tibet border’’ (BMNH 1946.8.11.17 holotype). CHINA: YUNAN:
Nujiang Prefecture, Gongshan County; road between Kongdang and Bapo
in Dulong Valley, 27849 0 33.9 0 0 N, 98819 0 31.7 0 0 E, 1478 m (CAS 241965), ca 5
km N (by Dulong River) of Kongdang (CAS 241992, 241994, 241997),
Dulong Valley, E of Kongdang (CAS 242015), Dulong Valley, 2 km N of
Kongdang, W side of Dulong River (CAS 242020), Dulong Valley, road from
Bapo N toward Kongdang, 27845 0 29.9 0 0 N, 98820 0 52.8 0 0 E, 1357 m (CAS
242628), Dulong Valley, Kongdang, 27850 0 28.4 0 0 N, 98819 0 45.4 0 0 E, 1450 m
(CAS 242653), Dulong Valley, Kongdang, 27852 0 07.7 0 0 N, 98820 0 09.4 0 0 E,
1451 m (CAS 242674), Dulong Valley, Kongdang, 27851 0 44.0 0 0 N,
98820 0 04.3 0 0 E (CAS 242675), Dulong Valley, Kongdang, 27852 0 07.2 0 0 N,
98820 0 09.8 0 0 E, 1450 m (CAS 242676).
Pseudocalotes microlepis (3).—LAO PDR: ‘‘Phong Saly’’ (FMNH 14499).
VIETNAM: BAC THAI: Ba Be Lake National Park, cave area, ca. 1.5 km E of
guest house, 22824 0 1 0 0 N, 105837 0 54 0 0 E (AMNH 147071). THAILAND:
‘‘Plapoo Tenasserim’’ (BMNH 1946.8.11.21).
Pseudocalotes poilani (2): LAO PDR: CHAMPASAK: Pakxong District, Dong
Hua Sao National Biodiversity Conservation Area, near Ban Nongluang
Village, near 1580470 0 0 N, 10681203 0 0 E, 1100 m (FMNH 258704), Pakxong
District, Dong Hua Sao National Biodiversity Conservation Area, Bolaven
Plateau, near 1580355 0 0 N, 10681303 0 0 E, 1200 m (FMNH 258710).
Pseudocalotes rhammanotus (1).—INDONESIA: LAMPUNG: montane
forest along the ridge of a mountain south of Danau Ranau (¼ Lake
Ranau), 4.93948S, 103.852928E, 1237 m (MZB 10804, holotype).
Pseudocalotes tympanistriga (16).—INDONESIA: JAWA BARAT: Cibodas
Botanical Garden, 6.741818S, 107.00618E (UTA 60544–60548); Gunung
Tilu, 7.156018S, 107.523098E, 1389–1647 m (UTA 63094–63096); road from
S coast of Java to Gunung Patuha, 7.247168S, 107.356968E, 1156 m (UTA R
63097); road from S coast of Java to Gunung Patuha, 7.247118S,
107.357228E, 1183 m (UTA R 63098–63099); Gunung Puntang. Gibbon
Research Center, 7.118288S, 107.604938E, 1393–1468 m (UTA 63100–
63101); Gunung Waringin, 7.156038S, 107.496478E, 1583–1607 m (UTA
63102–63103). NO OTHER DATA: ‘‘Java’’ (ZMB 689 holotype).