Вы находитесь на странице: 1из 34

Accepted Manuscript

Characterization of a new zeaxanthin producing strain of Chlorella saccharo‐


phila isolated from New Zealand marine waters

Dilip Singh, Munish Puri, Serena Wilkins, Anshu S. Mathur, Deepak K. Tuli,
Colin J. Barrow

PII: S0960-8524(13)00925-5
DOI: http://dx.doi.org/10.1016/j.biortech.2013.06.006
Reference: BITE 11922

To appear in: Bioresource Technology

Received Date: 15 April 2013


Revised Date: 31 May 2013
Accepted Date: 3 June 2013

Please cite this article as: Singh, D., Puri, M., Wilkins, S., Mathur, A.S., Tuli, D.K., Barrow, C.J., Characterization
of a new zeaxanthin producing strain of Chlorella saccharophila isolated from New Zealand marine waters,
Bioresource Technology (2013), doi: http://dx.doi.org/10.1016/j.biortech.2013.06.006

This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers
we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and
review of the resulting proof before it is published in its final form. Please note that during the production process
errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

 

Manuscript

Characterization of a new zeaxanthin producing strain of Chlorella saccharophila isolated

from New Zealand marine waters.

Dilip Singha,b, Munish Puria, Serena Wilkinsc, Anshu S. Mathurb, Deepak K. Tulib and Colin J.

Barrowa,*
a
Centre for Chemistry and Biotechnology, Waurn Ponds, Deakin University, Victoria 3217,

Australia.
b
DBT-IOC Centre for Advance Bioenergy Research, Research & Development Centre, Indian

Oil Corporation Limited, Sector-13, Faridabad 121007, India.


c
Marine Biodiversity and Biosecurity, NIWA, Kilbirnie, Wellington, New Zealand

*Corresponding author

Professor Colin J. Barrow, Centre for Chemistry and Biotechnology, Deakin University,

Victoria, Australia.

Tel: +61-3 5227 2325; Fax: +61-3 5227 2170

Email address: colin.barrow@deakin.edu.au



 

Abstract

A fast growing strain of Chlorella saccharophila was isolated from the marine water of New

Zealand and grown in heterotrophic conditions using glucose or glycerol as a carbon source.

Biomass production was found to be higher in culture fed with glucose (2.14±0.08 g L-1) as

compared to glycerol (0.378±0.04 g L-1). Lipid accumulation was similar for both carbon

sources, at approximately 22 % of dry cell weight. However, carotenoid yield was higher with

glycerol (0.406±0.0125 mg g-1) than with glucose (0.21±.0034 mg g-1). Further optimization of

the growth of the isolate gave maximal carotenoid production of 16.39±1.19 mg g-1 total

carotenoid, containing 11.32±0.64 mg g-1 zeaxanthin and 5.07±0.55 mg g-1 β-carotene.

Comparison of various chemical and physical carotenoid extraction methods showed that

ultrasonication was required for maximum extraction yields. The new strain has potential for

biofuel, with carotenoid co-production.

Key words: Carotenoids, RP-HPLC, Ultrasonication, Biofuel, microalgae, nutraceutical, cell


disruption

 

1. Introduction

Carotenoids are an important group of natural pigments. Some carotenoids such as β-carotene,

lutein, zeaxanthin and astaxanthin are well characterized and used commercially in aquaculture,

food and nutritional supplements. Lutein and zeaxanthin play major role in maintaining normal

vision and occur naturally in the retina (Alves-Rodrigues & Shao, 2004). Lutein and zeaxanthin

supplemented diets can potentially reduce the risks of cataract, macular degeneration and

atherosclerosis (Roberts et al., 2009) . The European Food Safety Authority (EFSA) in 2012

recommended a daily intake of zeaxanthin of up to 0.75 mg Kg-1 body weight (EFSA Panel on

Dietetic Products et al., 2012). The market for carotenoids was estimated at nearly $1.2 billion in

2010 and projected to reach $1.4 billion in 2018. The combined market for β-carotene,

zeaxanthin and lutein is estimated to reach $643 million in 2018 (BCC, 2011).

Carotenoids are primarily chemically synthesized, although natural production methods such as

fermentation are also used. Food grade zeaxanthin is primarily extracted from marigold (Tagetes

erecta), but the productivity is low at about 0.3 mg g-1 (Campo et al., 2007). Microalgae such as

chlorella are of interest as an alternative source of carotenoids, including zeaxanthin. Chlorella

zofingiensis, Chlorella protothecoides, Chlorella vulgaris, Scenedesmus almeriensis and

Haematococcus pluvialis have been reported to produce significant amount of various

carotenoids, including β-carotene, lutein, zeaxanthin and astaxanthin (Cordero et al., 2011). The

ability of chlorella to shift between phototrophic, heterotrophic and mixotrophic growth makes it

more flexible for the production of both biofuel and co-products, such as carotenoids. Gupta and

coworkers (2013) have underlined the importance of inexpensive carbon sources such as glycerol

for biofuel production in heterotrophic mode (Gupta et al., 2013). In this paper, we describe the

 

isolation and fermentation of a fast growing strain of Chlorella saccharophila, capable of

utilizing glycerol as carbon source and producing a relatively high amount of zeaxanthin.

Various cell disruption methods were also tested to maximize the extraction of zeaxanthin from

this strain.

2. Materials and methods

2.1. Reagents and chemicals

All chemicals and reagents used in this study were either analytical, High Pressure Liquid

Chromatogrphy (HPLC), or molecular grade. Medium components such as glycerol, D-glucose,

yeast extract, peptone, gelatin hydrolysate (Sigma-Aldrich or Oxiod) and sea salt (Instant Ocean

or Aquarium Systems) were used for cultivation. Hydrochloric acid, sulfuric acid, oxalic acid,

citric acid, acetic acid and sodium bicarbonate (Sigma-Aldrich, USA) were used for membrane

disruption to facilitate carotenoid extraction. The solvents dimethyl sulfoxide (DMSO), hexane,

petroleum ether, acetone (Merck) were used for carotenoid extraction from freeze dried biomass

and it’s profiling by TLC and Reverse Phase-HPLC (RP-HPLC). Methanol, ethyl acetate,

chloroform (HPLC grade, Honeywell & Fischer) were used for HPLC and Liquid

Chromatography Mass Spectrometry (LCMS) analysis of carotenoids. Carotenoid standards such

as astaxanthin, zeaxanthin, canthaxanthin, res/meso-astaxanthin, β-cryptoxanthin, echinenone

(CaroteNature, Switzerland), β-carotene and chlorophyll A (Sigma-Aldrich, Australia) were used

for calibration curve preparation.

2.2. Isolation

 

Coastal water samples were collected from New Zealand during 2008. All samples were dusted

with sterilized pine pollen (Porter & Lingle, 1992) and refrigerated for transport to the

laboratory. Water samples were then incubated at 17ºC for 2 weeks, under a continuous light

regime (5 μmol m-2 s-1). Once microorganisms (i.e. Chlorella) had colonized pine pollen grains,

100μl sub-samples were spread-plated onto nutrient agar plates comprising: agar 13g; glucose

15g; yeast extract 0.5g; peptone 0.5g, gelatin hydrolysate 0.5g, 70% v/v artificial seawater per

liter. Agar also included rifampicin 25 mg L-1, nystatin 10 mg L-1 and streptomycin/penicillin

500 mg L-1, and plates were further incubated at 17ºC. Pure isolates were obtained by single

colony picking and streak plate techniques and axenic colonies inoculated into 20 ml vials with

liquid media (as described above).

2.3. Molecular identification of the isolate

Six day old culture was harvested and rapidly frozen with liquid nitrogen followed by maceration

with a mortar and pestle. DNeasy blood and tissue kit (Qiagen, USA) was used to isolate

genomic DNA from the macerated biomass according to the guideline suggested in the kit

protocol for gram negative bacteria. The coding region of 18S rRNA was partially amplified by

PCR using primer NSI-X, CCAGTAGTCATATGCTTGTC and 18L-X,

ACCTTGTTACGACTTCTCC (Phillips & Fawley, 2000). The PCR reaction was composed of

PCR master mix (Promega, Australia) 12.5 µl, primers (NSI-X, 18L-X) 0.5 µl each, genomic

DNA 1 µl and milliQ water 10.5 µl. PCR program was run for 3 minutes at 98°C (for

denaturation), 30 seconds at 96°C, 30 second at 60°C (for annealing), 1 minute at 72°C for 30

cycles and 5 minutes final extension at 72°C. The PCR product was purified by QiAquick gel

extraction kit (Qiagen, USA) and PCR product along with primers were sent to Macrogen (South

 

Korea) for 18S rDNA sequencing. The resulting rDNA sequence was compared with known 18S

nucleotide sequences of Chlorella in the gene bank database of NCBI by using a basic local

alignment search tool (BLAST). These sequences along with isolate sequence were analyzed by

MEGA 5.1 software and a neighbor-joining (NJ) tree was constructed.

2.4. Biomass production, Growth kinetics, Carotenoid and Fatty Acid Methyl Ester (FAME)

profile

The isolate Chlorella saccharophila used in this study was inoculated in seed medium (pH 6.5)

consisting: glucose 0.5g; yeast extract 0.2g; peptone 0.2 and 50% v/v artificial seawater and

cultured at 20°C for 72 h with shaking at 150 rpm. Isolate was sub cultured each 25 days on

same medium having 1% agar. After 72 h, 5% culture was inoculated into production medium

(pH 6.5) consisting: glycerol or glucose 1g; yeast extract 1g; peptone 0.1g; 50% v/v artificial sea

water and cultured at 20°C for 192 h with shaking at 150 rpm. After 192 h, biomass was

harvested (4000 rpm, 15 min) and freeze dried for 48 h. Freeze dried biomass was stored at -

20°C for further use. Most of centrifuges in this study were done at 4000 rpm for 15 min.

For growth kinetics, 20 ml culture was harvested at the interval of 24 h up to 192 h. OD600nm and

cell dry weight was measured at each 24 h. A calibration curve was prepared between OD and

cell dry weight. For carotenoid kinetics, freeze dried cells were incubated with 0.1 M sodium

bicarbonate (25 mg ml-1) at 40°C for 24 h. Cells were washed twice with water to remove traces

of sodium bicarbonate followed by the addition of acetone (25mg ml-1) and vortexing for 3 min.

The colored extract was harvested and supernatant was stored at -20°C to avoid carotenoid

degradation.

 

Lipid was extracted and quantified from freeze dried biomass every 48 h with the protocol

(Gupta et al., 2012) with some modifications. 10 mg freeze dried biomass was added in 600 µl

solvent (methanol and chloroform in 1:2 ratio) and vortex for 2 min followed by centrifuge at

13000 rpm,15 min, to extract organic soluble material. This process was repeated three times.

The three supernatants were pooled together followed by the addition of 2 ml hexane to extract

lipid from non-lipid components such as pigments and lipoproteins (Bellou & Aggelis, 2012).

The upper layer was collected using a Pasteur pipette and dried under nitrogen. Lipid was

measured gravimetrically. For FAME analysis, 100 µl toluene was added into glass tubes

followed by the addition of 20 µl internal standard (methyl tricosanoate C19:0) and 20 µl

butylated hydroxytoluene (BHT). 200 µl acidic methanol was added to tube and incubated

overnight (10-12 h) at 50°C. 500µl of 5% NaCl was added into tube and FAMEs were extracted

with hexane. FAMEs were washed with 2% Potassium bicarbonate and passed through

anhydrous sodium sulphates to remove water traces. FAMEs were concentrated under a nitrogen

stream and analyzed with gas chromatography-flame ionization detection (GC-FID) system

(Agilent Technologies, 6890N, US), equipped with capillary column (Supelcowax 10, 30 m x

0.25 mm, 0.25 µm thickness). The injector was maintained at 250 °C and a sample volume of 1

µL was injected. Helium was used as the carrier gas and its flow rate was maintained at 1.5 mL

min-1. Fatty acids peaks were identified and quantified with Chemstation chromatography

software (Agilent Technologies, US). Values are presented as mean ± SD of duplicates.

2.5. Chlorophyll extraction and pigment profiling

500 mg of freeze dried biomass was added into 5 ml of 80% aqueous acetone followed by

ultrasonication for 15 min. Coloured supernatant was harvested by centrifuge at 4000 rpm for 15

 

min at 4 °C. 4 ml of petroleum ether was added and kept at 65°C for 2 min. The upper dark layer

was taken out by Pasteur pipette and 6 ml, 60% aqueous methanol was added into it. The upper

layer was suctioned carefully by Pasteur pipette and evaporated under nitrogen. The extract was

dissolved in acetone and absorption spectrum of the extract was analyzed between from 350 nm

to 800 nm. 5 µl of this extract was spotted on TLC plate (10 X 10 cm) and run into solvent

system (petroleum ether 6 ml, hexane 1.6 ml, ethyl acetate 1 ml, acetone 1ml, and methanol 0.4

ml) until the solvent reached upper front. Each band on the TLC plate was scratched and

dissolved in HPLC mobile phase and run in RP-HPLC. Peaks were identified by comparing with

the retention time of standard carotenoids. These peaks (chlorophyll a & b, Zeaxanthin and β-

carotene) were collected and analyzed by LC-MS to check their m/z value (molecular weight).

2.6. HPLC analysis of chlorophyll and carotenoids

HPLC method for chlorophyll and carotenoid analysis was adopted from Armenta et al. (2006)

with some modifications. One ml extract was taken and evaporated under nitrogen gas followed

by addition of 1 ml mobile phase A and syringe filtered (0.45 µm) before for HPLC analysis of

the extracts. 10 µl was injected into an Agilent 1200 Series HPLC system equipped with a

photodiode array detector, 5 µm Luna C18 reversed-phase column, 4.6 mm x 250 mm

(Phenomenex, USA), coupled with security guard column C18, 3.0 mm x 4.0 mm, (Phenomenex,

USA). Chlorophyll and other related extracts were analyzed at 453 nm and 660 nm, near the two

chlorophyll absorption maxima, whereas carotenoids were analyzed at 477 nm. Column was

equilibrated for 10 min with mobile phase A consisting of methanol, ethyl acetate and water

(88:10:2, v/v/v) at a flow rate 0.75 ml min-1. This flow rate was maintained for further 10

minutes. The mobile phase composition was adjusted to mobile phase B consisting of 48:50:2

 

(methanol: ethyl acetate: water, v/v/v/) between 10 and 30 min and the flow rate was adjusted to

1.5 mL min-1. This flow rate was maintained for further 10 min and column was washed with

mobile phase A for 10 min. Standards of the carotenoids astaxanthin, zeaxanthin, canthaxanthin,

res/meso-astaxanthin, β-cryptoxanthin, echinenone and β-carotene were used to prepare

calibration curves for identification and estimation of each carotenoid present in extracts.

2.7. Cell disruption for improved carotenoid extraction

25 mg of freeze dried biomass was added to 1 ml acetone and vortexed for 3 min before

centrifuging at 4000 rpm for 15 minutes. The supernatant was suctioned and this whole process

was repeated two more times. After three extractions the supernatant became colorless, while the

biomass remained colored, indicating incomplete extraction. To improve the extraction

efficiency biomass was treated with either chemical or physical means of cell disruptions. All

extractions were carried out in dark or dim light to avoid photo oxidation of carotenoids.

2.7.1 Chemical cell disruption

The carotenoid extraction method with some modification was adopted from Sedmak et al.

(1990) (Sedmak et al., 1990). 25 ml of freeze dried biomass was suspended in 1 ml of DMSO

(preheated at 55°C) and left undisturbed at 55°C for 60 min followed by centrifugation at 4000

rpm for 15 min at 15°C. The supernatant was taken out and stored in the dark. This cycle was

repeated two times for complete carotenoid extraction from biomass. Ether: water (1:1) was

added to the DMSO extract in 2:1 ratio (solvent system: DMSO), followed by centrifugation at

4000 rpm for 15 min at 15 °C and kept at -20 °C for 10 min. The upper ether layer was

transferred into fresh tube and washed twice with water to remove traces of DMSO. The ether
10 
 

was evaporated under nitrogen stream and an equivalent volume of acetone was added into the

tube and stored at -20°C for further analysis.

Strong inorganic acids such as hydrochloric acid and sulfuric acid or mild organic acids such as

oxalic acid, citric acid, acetic acid, and sodium bicarbonate were used for the treatment of freeze

dried cells before carotenoid extraction with acetone. 25 mg of freeze dried cells were

suspended into 1 ml of 3M acid and kept at 30°C for 40 min. As in the case of sodium carbonate

mediated extraction, cells were suspended into 1ml of 0.1 M sodium bicarbonate and kept at

40°C for 24 h. This cell suspension was washed twice with water to remove traces of acids

followed by the carotenoid extraction with acetone.

2.7.2 Mechanical cell disruption

Carotenoid was extracted by either ultrasonication (50 ultrasonic cycles at 20 kHz for 30 min in

an ice bath) or homogenization (10500 rpm for 30 min in an ice bath), bead beating (0.5 µm size,

25mg biomass per 500 µl beads, 5 min beating (vortexing) and 1 min cooling in ice bath, 6

cycles) or maceration (rapid freezing with liquid N2 followed by maceration with mortar pestle

for 3 min). Carotenoids were identified and quantified by RP-HPLC analysis.

3. Results and Discussion

3.1. Identification of the isolate

Differential interference contrast images of the isolate revealed the maximum cell size between

20-25 µm and presence of dark green pigment like chlorella. Isolated strain was showing

ellipsoidal cell shape having unequal autospores during reproduction, and parietal chloroplasts,
11 
 

which is typical to green algae like chlorella notably Chlorella saccharophila. However,

Darienko and co-workers (2010) has renamed Chlorella saccharophila into Chloroidium

saccharophilum and placed along with other ellipsoidal green algae such as

Chloroidium engadinensis/ Chlorocloster engadinensis (Darienko et al., 2010).

To confirm the identity of the isolate, 18S rDNA sequencing of isolate was carried out and the

resulting rDNA sequence was deposited in NCBI with accession number KC521363. BLAST

analysis showed that 18S rDNA sequence of this isolate was having 97% similarity with

Chlorella saccharophila/ Chloroidium saccharophilum (accession number FM946003). Based

on the evolutionary distance between the different chlorella strains, NJ tree (Figure 1) for this

isolate revealed its close relationship with Chloroidium engadinensis/ Chlorocloster

engadinensis (accession number FM946011), which was according to the findings of Darienko

and co-workers (2010). Boot strap value more than 50 shows the confidence of the branching.

3.2. Effect of carbon source on productivity of Chlorella saccharophila

Glucose and glycerol were both used as carbon sources in the cultivation of the Chlorella

saccharophila isolate. Biomass production was about five fold higher when glucose was used as

the carbon source in place of glycerol (2.14 g L-1 and 0.378 g L-1, respectively) but the lipid

content remained similar in both the cases, at about 22% of the total biomass (Table. 1). Biomass

reported in this work is higher than previous report (Isleten-Hosoglu et al., 2012) on Chlorella

saccharophila, fed with different carbon sources (0.344 g L-1 and 0.248 g L-1 with glucose and

glycerol, respectively). Liang et al. (2009) reported 1.6 g L-1 biomass and 21% lipid content in a
12 
 

C. vulgaris culture with glucose opposite to 0.7 g L-1 biomass and 22% lipid content with

glycerol.

Cellular compositional analysis of the biomass showed a higher content of protein and lower

content of carbohydrate in the glycerol culture (Liang et al., 2009). Similar lipid content reflects

identical regulation of lipid biosynthesis under both the carbon sources (O’Grady & Morgan,

2011). However, low biomass with glycerol shows poor utilization of glycerol in the medium,

compared to glucose. C. vulgaris has been reported to have an efficient hexose transport system

that is induced under glucose conditions whereas glycerol is taken up by the cell through

diffusion (Perez-Garcia et al., 2011). This activated transport system helps to utilize glucose

efficiently resulting in high biomass, as compare to when glycerol is the primary carbon source.

High biomass and lipid content was reported in C. protothecoides culture when O’Gardy and

coworkers (2011) used either glycerol or glucose in the medium (O’Grady & Morgan, 2011).

These contrasting reports suggest different regulation of carbon metabolism in different

Chlorella cultures. Biomass was lower but carotenoid content was higher with glycerol as carbon

source (0.406 mg g-1 with glycerol and 0.21 mg g-1 with glucose) (Table 1).

The total lipid content from our strain of 22%, which is close to the average reported for green

algae (Griffiths & Harrison, 2009), could probably be elevated through further optimization of

the fermentation conditions. Tan and Johns also reported that the lipid content and fatty acid

composition of C. saccharophila in heterotrophic culture can be altered by glucose concentration

and aeration levels. In particular, low glucose concentrations could increase lipid content to

between 36 and 47% of the dry cell weight (Tan & Johns, 1991).
13 
 

Zeaxanthin and β-carotene are the major carotenoid synthesized by our isolate of Chlorella

saccharophila. Minor amounts of other carotenoids, such as violaxanthin or neoxanthin, were

also present in the extract. The higher content of carotenoids and lipids in glycerol supplemented

cultures indicates the possibility of using glycerol or other cheap carbon sources in Chlorella

cultures for the production of biodiesel and carotenoids, although in our strain it would be

necessary to increase the overall biomass levels. Glycerol is an inexpensive carbon source when

compared with glucose or other costly carbon sources, and has been utilized in lipid and pigment

production in cyanobacteria such as Spirulina platensis (Narayan et al., 2005) and omega-3 fatty

acid production in heterotrophic algae such as Schizochytrium limacinum SR21(Chi et al., 2007).

An alternative approach, published recently, was to culture a wastewater chlorophyte

(Kirchneriella sp.) with the aim of low cost production of both carotenoids and biodiesel

(Frampton et al., 2013). Similarly, Chlorella sorokiniana was grown autotrophically on urban

wastewater, with the aim of producing a low cost algal broth for green biorefining processes

(Yen et al., 2013)

3.3. Study of growth kinetics, Carotenoid kinetics and FAME profile

Growth kinetics of Chlorella saccharophila was studied in terms of biomass production,

carotenoid accumulation and fatty acid composition in the cell up to 192 h. It took almost 72 h

(lag phase) for the isolate to acclimatize in the new carbon source. After 72 h, there was sharp

rise in OD600 nm (from 0.212 to 0.666), as well as in cell dry weight (from 0.136 g L-1 to 0.301 g

L-1), up to 120 h marking the onset of the log phase. However, this trend ends after 120 h and
14 
 

growth becomes stagnant during later culture growth, marking the stationary phase (Figure 2).

OD600 nm and Cell dry weight (CDW) can be correlated by the following equation

CDW (g L-1) = 0.415 OD600 nm + 0.023 (R² = 0.9818)

Growth on glycerol remains slow in the starting phase of the culture (Liang et al., 2010), which

remains a significant hurdle in achieving high cell density culture. However, related work

indicates that a fed-batch system can be designed for maximum utilization of glycerol to

overcome this problem (Liang et al., 2009).

Total carotenoid content increased with increasing cell dry weight and maximum carotenoid

content was observed at 192 h (zeaxanthin 7.746 mg g-1 and β-carotene 3.929 mg g-1). Increase

in the carotenoid content was higher in early or late phase of the culture where growth was flat as

compared to log phase of the culture (Figure 2). Zeaxanthin as a percentage of total carotenoid

was higher in early and late phases of the culture, with maximum at 144 h (72.2 %). However, β-

carotene was higher in the log phase of the culture with a maximum at 96 h (37.3 %) (Table2).

This may be explained by variation in oxygen transfer rate modifying the rate of hydroxylation

of β-carotene into xanthophyll (Schmidt et al., 2011). Early and late phases of the culture show

low anabolic activity, with constant oxygen supply. The presence of oxygen enhances the

conversion of β-carotene into zeaxanthin. However, during the log phase most of the oxygen is

consumed by anabolic activities, slowing the conversion of β-carotene into zeaxanthin. There

was no astaxanthin or canthaxanthin observed in this isolate, reflecting an inability to add further

hydroxyl and keto groups to zeaxanthin, in contrast to some other Chlorella species, including

Chlorella zofingiensis (leutin 4 mg g-1, astaxanthin 1.5 mg g-1), or other algae like
15 
 

Haematococcus pluvialis (Del Campo et al., 2004) that produce astaxanthin as a major

carotenoid.

Saturated fatty acids (SFA) constitutes 50 % or more of total fatty acid (TFA) from the lag phase

to the late stationary phase, with maximum SFA (64.56% of TFA) and minimum unsaturated

fatty acid (UFA) (33.44 % of TFA) at 96h (Table 2). Palmitic acid (C16:0), linoleic acid

(C18:2n6c) and linolenic acid (C18:3n3) are the major fatty acids present at each growth phase

(Figure 3). Similar observations were reported by O’Gardy and Morgan (2011) when they

cultured C. protothecoides on glycerol. The level of palmitic acid remained constant with a slight

increase up to 29% of TFA at 192 h. A similar pattern was observed with linoleic and linolenic

acid. However, myristic acid (C14:0), pentadecylic acid (C15:0), and stearic acid (C18:0)

increase up to 96h and then pentadecylic and stearic acid sharply decrease at subsequent stages,

indicating the conversion of stearic acid into linoleic acid via oleic acid. Oleic acid (C18:1n9c)

remained highest at 48h followed by a gradual decrease, probably due to slow conversion into

linoleic acid. C14:0, C16:0 and C18:2n6c, C18:3n3 remain the major fatty acids present in the

late phase of the culture, probably due to conversion of other fatty acids into C18:2n6c and

C18:3n3. The comparable level of C18:2n6c and C18:3n3 in the FAME profile signifies the

feedback control of Δ-15 desaturase activity which is responsible for conversion of C18:2n6c

into C18:3n3.

3.4. Chlorophyll extraction and pigment profiling

Absorption spectrum of the chlorophyll extract shows two absorption maxima, at 453 nm and

662 nm. TLC analysis of this extract reveals the presence of chlorophyll along with other major

carotenoids such as β-carotene, zeaxanthin, and two unknown xanthophylls. RP-HPLC shows β-
16 
 

carotene, chlorophyll a, chlorophyll b, zeaxanthin, and two unidentified xanthophylls that are

probably violaxanthin and neoxanthin. Subsequent LCMS studies confirm these assignments

(Armenta et al., 2006) (Table 3). Different species of chlorella are reported to have different

carotenoid profile. For example, C. protothecoides has astaxanthin, leutin/Zeaxanthin,

canthaxanthin, echinenone and β-carotene (Campenni’ et al., 2013), while C. zofingiensis has

astaxanthin and leutin (Del Campo et al., 2004). Chlorella saccharophila, as used in this study

contains primarily zeaxanthin and β-carotene.

3.5. Chemical cell disruption for carotenoid extraction

Carotenoid extraction is complete once the pellet becomes colorless (Armenta et al., 2006).

However, in practice the supernatant becomes colorless after 3 or 4 extraction cycles, leaving

behind a colored biomass. The total carotenoid yield with direct extraction was found to quite

low (0.406 mg g-1) as compared to more disruptive extraction methods that include

ultrasonication (16.934 mg g-1). Michelon et al. (2012) reported an almost 8-10 fold increase in

total carotenoid yield when the cells were disrupted either by chemical or mechanical means.

Direct extraction does not disrupt the cell wall that prevents efficient carotenoid extraction.

Chemical or mechanical disruption is required for improved extraction yields (Michelon et al.,

2012). Strongly solvating solvents such as DMSO have been used to increase carotenoid

extraction yields. In our case the use of DMSO significantly enhanced carotenoid yields (0.406

mg g-1 in direct extraction method compared to 3.437 mg g-1 with DMSO). Zeaxanthin was the

major carotenoid present in the extract as 92 % of the total carotenoid (Figure 4), when biomass

was suspended in DMSO followed by extraction with ether: water solvent system. The enhanced

ratio of zeaxanthin to β-carotene may be due to incomplete extraction of the less polar carotenoid
17 
 

with DMSO, which is a relatively polar solvent. DMSO may be useful for selective production

of zeaxanthin from this strain. Polar solvents such as methanol and acetone have been used for

selective extraction of canthaxanthin from freeze dried E.coli biomass (Scaife et al., 2012)

Solvent selection varies depending upon the type of biomass and carotenoid types to be

extracted, and should be tested for each new isolate (Cha et al., 2009; Sarada et al., 2006) . Even

after extraction with DMSO, solvents can be used to selectively enrich specific carotenoids from

DMSO. We found that hexane: ethyl acetate extraction from DMSO can enrich β-carotene over

zeaxanthin, partially separating these two carotenoids through selective extraction (data not

shown).

Treatment of the freeze dried cells with acid prior to extraction with acetone resulted in increased

carotenoid yield. However, carotenoid yield was higher in cells treated with organic acids, as

compared to strong acids such as HCl or H2SO4. Figure 4 shows that there is an inverse relation

between acid strength and total carotenoid yield. Total carotenoid extracted from the cells treated

with HCl was 0.873 mg g-1 with 45.7 % zeaxanthin and 54.3 % β-carotene, which was higher

than direct extraction but lower than DMSO assisted extraction. H2SO4 assisted extraction gave a

carotenoid yield of 3.860 mg g-1, with 18.67 % zeaxanthin and 81.32 % β-carotene. β-Carotene

to zeaxanthin ratio was higher when strong acids were used. HCl has been used to disrupt

bacterial cell such as Rhodobacter sphaeroids, yeast cells such as Phaffia rhodozyma and algal

cells like Haematococcus pluvialis to improve carotenoid extraction (Michelon et al., 2012;

Sarada et al., 2006).


18 
 

Researchers have reported an increase in carotenoid yield using HCl, as compared to weaker

organic acids. These reports are contrary to our findings where yield was lower with strong acids

and higher with organic acids, possibly due to HCl induced carotenoid degradation, or the ability

of weaker acids to effectively degrade the cell wall of our C. saccharophila isolate. Maximum

yields were obtained using sodium bicarbonate assisted extraction, with 11.38 mg g-1 carotenoid

(66.59% zeaxanthin and 33.40% β-carotene). Lower yields were obtained with stronger organic

acids, with oxalic acid providing the lowest recovery at 3.526 mg g-1 (37.6 % zeaxanthin and

62.4 % β-carotene). Citric acid resulted in 6.57 mg g-1 total carotenoid, with 54.91 % zeaxanthin

and 45.09 % β-carotene, and acetic acid resulted in 8.94 mg g-1 total carotenoid, with 56.3 %

zeaxanthin and 43.7 % β-carotene. Stronger acids tended to favor extraction of β-carotene over

zeaxanthin, which was extracted more efficiently with mild acids. An almost 30 fold increase in

carotenoid yield was observed using sodium bicarbonate (11.38 mg g-1), versus direct extraction

(0.406 mg g-1).

3.6. Mechanical cell disruption for carotenoid extraction

Application of acid in the extraction process resulted into some carotenoid degradation (HPLC

data not shown). Mechanical means of cell lysis such as ultrasonication, bead beating,

homogenization, or rapid freezing followed by maceration were tested to see if improved

carotenoid yield were observed. To prevent the degradation due to the heat generation,

mechanical cell lysis was performed in an ice bath. Ultrasonication gave the highest carotenoid

yield with 16.394 mg g-1 carotenoid comprising 69 % zeaxanthin and 31 % β-carotene (Fig 4),

almost 40 fold increases over direct extraction. Bead beating and ultrasonication are the two

widely used mechanical mean of cell disruption for oil or carotenoid extraction from yeast or
19 
 

algae (Michelon et al., 2012; Shen et al., 2009). Michelon and coworkers (2012) reported a 5 to 6

fold increase in total carotenoid yield from yeast when they applied ultrasonication or bead

beating. Armenta and coworkers (2006) used ultrasonication to increase carotenoid yields from

freeze dried thraustochytrid biomass (Armenta et al., 2006). Extraction of our strain using bead

beating resulted in 12.122 mg g-1 carotenoid, with 70 % zeaxanthin and 30 % β-carotene, a 30

fold increase in total yield as compared with direct extraction. Rapid freezing with liquid

nitrogen followed by maceration with a mortar and pestle resulted in 9.194 mg g-1 carotenoid,

with 71.5 % zeaxanthin and 28.5 % β-carotene. Homogenization was found to be least effective

mechanical method for carotenoid extraction, giving a carotenoid yield of 2.748 mg g-1, with 75

% zeaxanthin and 25 % β-carotene. All mechanical methods resulted in no observable carotenoid

degradation (HPLC data not shown).

Cordero and coworkers (2011) screened various species of Chlorella and other green algae for

lutein and zeaxanthin production, where they were able to produce up to 0.705 mg g-1 zeaxanthin

and 2.58 mg g-1 lutein (Cordero et al., 2011). In our work we achieved total carotenoid yield of

up to 16.39 mg g-1 with zeaxanthin yield up to 11.32 mg g-1. Microwave assisted extraction or

extraction with super critical fluids such as carbon dioxide are other methods, which are being

used by researchers for lipid or carotenoid extraction from wet/freeze dried biomass (Monks et

al., 2012). Ultrasound/microwave assisted extraction (UMAE) was used by Lianfu et al. (2008)

for lycopene extraction from tomato (Lianfu & Zelong, 2008). A pressurized liquid extraction

method was used by Cha et al. (2009), in comparison with ultrasonication for carotenoid

extraction from C. vulgaris. They reported almost equal carotenoid yield with both the methods

(Cha et al., 2009).


20 
 

4. Conclusion

In this work, a fast growing isolate of Chlorella saccharophila was isolated from the New

Zealand marine environment. This isolate was found to be capable of successfully utilizing

glycerol as carbon source and producing high amount of zeaxanthin, when grown

heterotrophically. The ability of this isolate to utilize glycerol for lipid and carotenoid production

provides potential for biodiesel production, with zeaxanthin and/or β-carotene co-production.

Evaluation of methods to extract carotenoids showed that ultrasonication provided the highest

carotenoid yield. Applying different solvent systems enables differential extraction of zeaxanthin

and β-carotene from biomass from this strain.

Acknowledgments

The authors thank Deakin University and DBT-IOC Centre for Advance Bioenergy Research,

Indian Oil R & D center, India for supporting collaborative research. One of the authors DS

thanks the DIRI program of Deakin University for providing a scholarship to pursue this research

work. Funding for sample collection and isolation was provided under NIWX0502 by the

Foundation for Research, Science and Technology, New Zealand. Special thanks to Dr. Jacqui

Adcock for helping with GC and HPLC data analysis.


21 
 

References

1. Alves-Rodrigues, A., Shao, A. 2004. The science behind lutein. Toxicol. Lett., 150, 57-83.

2. Armenta, R.E., Burja, A., Radianingtyas, H., Barrow, C.J. 2006. Critical assessment of various

techniques for the extraction of carotenoids and co-enzyme Q10 from the thraustochytrid strain

ONC-T18. J. Agric. Food Chem., 54, 9752-9758.

3. BCC, R. 2011. The Global Market for Carotenoids. http://www.marketresearch.com/BCC-

Research-v374/Global-Carotenoids-6558319/, accessed on 30th may 2013).

4. Bellou, S., Aggelis, G. 2012. Biochemical activities in Chlorella sp. and Nannochloropsis salina

during lipid and sugar synthesis in a lab-scale open pond simulating reactor. Biotechnol. J., 164,

318-329.

5. Campenni’, L., Nobre, B.P., Santos, C.A., Oliveira, A.C., Aires-Barros, M.R., Palavra, A.M.F.,

Gouveia, L. 2013. Carotenoid and lipid production by the autotrophic microalga Chlorella

protothecoides under nutritional, salinity, and luminosity stress conditions. Appl. Microbiol.

Biotechnol., 97, 1383-1393.

6. Campo, J., García-González, M., Guerrero, M. 2007. Outdoor cultivation of microalgae for

carotenoid production: current state and perspectives. Appl. Microbiol. Biotechnol., 74, 1163-

1174.

7. Cha, K.H., Lee, H.J., Koo, S.Y., Song, D.G., Lee, D.U., Pan, C.H. 2009. Optimization of

pressurized liquid extraction of carotenoids and chlorophylls from Chlorella vulgaris. J. Agric.

Food Chem., 58, 793-797.

8. Chi, Z., Pyle, D., Wen, Z., Frear, C., Chen, S. 2007. A laboratory study of producing

docosahexaenoic acid from biodiesel-waste glycerol by microalgal fermentation. Process

Biochem, 42, 1537-1545.


22 
 

9. Cordero, B.F., Obraztsova, I., Couso, I., Leon, R., Vargas, M.A., Rodriguez, H. 2011.

Enhancement of lutein production in Chlorella sorokiniana (Chorophyta) by improvement of

culture conditions and random mutagenesis. Mar Drugs, 9, 1607-1624.

10. Darienko, T., Gustavs, L., Mudimu, O., Menendez, C.R., Schumann, R., Karsten, U., Friedl, T.,

Pröschold, T. 2010. Chloroidium, a common terrestrial coccoid green alga previously assigned to

Chlorella (Trebouxiophyceae, Chlorophyta). Eur. J. Phycol., 45, 79-95.

11. Del Campo, J.A., Rodríguez, H., Moreno, J., Vargas, M.Á., Rivas, J., Guerrero, M.G. 2004.

Accumulation of astaxanthin and lutein in Chlorella zofingiensis (Chlorophyta). Appl. Microbiol.

Biotechnol., 64, 848-854.

12. EFSA Panel on Dietetic Products, Nutrition, Allergies. 2012. Statement on the safety of synthetic

zeaxanthin as an ingredient in food supplements. EFSA Journal, 10, 2891-2905.

13. Frampton, D.M.F., Gurney, R.H., Dunstan, G.A., Clementson, L.A., Toifl, M.C., Pollard, C.B.,

Burn, S., Jameson, I.D., Blackburn, S.I. 2013. Evaluation of growth, nutrient utilization and

production of bioproducts by a wastewater-isolated microalga. Bioresour. Technol., 130, 261-

268.

14. Griffiths, M., Harrison, S.L. 2009. Lipid productivity as a key characteristic for choosing algal

species for biodiesel production. Journal of Applied Phycology, 21, 493-507.

15. Gupta, A., Singh, D., Barrow, C.J., Puri, M. 2013. Exploring potential use of Australian

thraustochytrids for the bioconversion of glycerol to omega-3 and carotenoids production.

http://dx.doi.org/10.1016/j.bej.2013.04.028.

16. Gupta, A., Vongsvivut, J., Barrow, C.J., Puri, M. 2012. Molecular identification of marine yeast

and its spectroscopic analysis establishes unsaturated fatty acid accumulation. J. Biosci. Bioeng.,

114, 411-417.

17. Isleten-Hosoglu, M., Gultepe, I., Elibol, M. 2012. Optimization of carbon and nitrogen sources

for biomass and lipid production by Chlorella saccharophila under heterotrophic conditions and
23 
 

development of Nile red fluorescence based method for quantification of its neutral lipid content.

J. Biosci. Bioeng., 61, 11-19.

18. Lianfu, Z., Zelong, L. 2008. Optimization and comparison of ultrasound/microwave assisted

extraction (UMAE) and ultrasonic assisted extraction (UAE) of lycopene from tomatoes. Ultrason

Sonochem, 15, 731-737.

19. Liang, Y., Sarkany, N., Cui, Y. 2009. Biomass and lipid productivities of Chlorella vulgaris

under autotrophic, heterotrophic and mixotrophic growth conditions. Biotechnol. Lett., 31, 1043-

1049.

20. Liang, Y., Sarkany, N., Cui, Y., Blackburn, J.W. 2010. Batch stage study of lipid production from

crude glycerol derived from yellow grease or animal fats through microalgal fermentation.

Bioresour. Technol., 101, 6745-6750.

21. Michelon, M., Matos de Borba, T., Silva Rafael, R., Burkert, C., Medeiros Burkert, J. 2012.

Extraction of carotenoids from Phaffia rhodozyma: A comparison between different techniques of

cell disruption. Food Sci. Biotechnol., 21, 1-8.

22. Monks, L., Tiggamann, L., Mazuti, M., Oliveira, V., Valduga, E. 2012. Assessment of

carotenoids recovery through cell Rupture of Sporidiobolus salmonicolor CBS 2636 using

compressed fluids. Food Bioprocess Technol., 5, 2353-2359.

23. Narayan, M.S., Manoj, G.P., Vatchravelu, K., Bhagyalakshmi, N., Mahadevaswamy, M. 2005.

Utilization of glycerol as carbon source on the growth, pigment and lipid production in Spirulina

platensis. Int J Food Sci Nutr, 56, 521-528.

24. O’Grady, J., Morgan, J. 2011. Heterotrophic growth and lipid production of Chlorella

protothecoides on glycerol. Bioprocess Biosyst Eng, 34, 121-125.

25. Perez-Garcia, O., Escalante, F.M.E., de-Bashan, L.E., Bashan, Y. 2011. Heterotrophic cultures of

microalgae: Metabolism and potential products. Water Res., 45, 11-36.

26. Phillips, K.A., Fawley, M.W. 2000. Diversity of coccoid algae in shallow lakes during winter.

Phycologia, 39, 498-506.


24 
 

27. Porter, D., Lingle, W.L. 1992. Endolithic Thraustochytrid Marine Fungi from Planted Shell

Fragments. Mycologia, 84, 289-299.

28. Roberts, R.L., Green, J., Lewis, B. 2009. Lutein and zeaxanthin in eye and skin health. Clin.

Dermatol., 27, 195-201.

29. Sarada, R., Vidhyavathi, R., Usha, D., Ravishankar, G.A. 2006. An efficient method for

extraction of astaxanthin from green alga Haematococcus pluvialis. J. Agric. Food Chem., 54,

7585-7588.

30. Scaife, M.A., Ma, C.A., Armenta, R.E. 2012. Efficient extraction of canthaxanthin from

Escherichia coli by a 2-step process with organic solvents. Bioresour. Technol., 111, 276-281.

31. Schmidt, I., Schewe, H., Gassel, S., Jin, C., Buckingham, J., Hümbelin, M., Sandmann, G.,

Schrader, J. 2011. Biotechnological production of astaxanthin with Phaffia

rhodozyma/Xanthophyllomyces dendrorhous. Appl. Microbiol. Biotechnol., 89, 555-571.

32. Sedmak, J.J., Weerasinghe, D., Jolly, S. 1990. Extraction and quantitation of astaxanthin from

Phaffia rhodozyma. Biotechnol. Tech., 4, 107-112.

33. Shen, Y., Pei, Z., Yuan, W., Moa, E. 2009. Effect of nitrogen and extraction method on algae

lipid yield. Int. J. Agric. Biol. Eng., 2, 51-57.

34. Tan, C., Johns, M. 1991. Fatty acid production by heterotrophic Chlorella saccharophila.

Hydrobiologia, 215, 13-19.

35. Yen, H.-W., Hu, I.C., Chen, C.-Y., Ho, S.-H., Lee, D.-J., Chang, J.-S. 2013. Microalgae-based

biorefinery – From biofuels to natural products. Bioresource Technology, 135, 166-174.

 
25 
 

Legend to figures and tables

Figure1. Phylogenetic relationship of Chlorella saccharophila GTC with other members of


chlorophyta.

Figure 2. Cell dry weight and carotenoid composition of Chlorella saccharophila GTC over

cultivation period.

Figure 3. Fatty acid composition of Chlorella saccharophila GTC during growth phase.

Figure 4. Effect of different cell disruption methods on Chlorella saccharophila GTC on

carotenoid yield.

List of Tables

Table 1. Effect of glucose and glycerol on biomass, lipid content and carotenoid content in

Chlorella saccharophila GTC culture.

Table 2. Carotenoid and fatty acid compositions of Chlorella saccharophila GTC over

cultivation period.

Table 3. Characterization of TLC bands by RP-HPLC and LC-MS.


1

Table 1. Effect of glucose and glycerol on biomass, lipid content and carotenoid content in
Chlorella saccharophila GTC culture.

Productivity Glucose Glycerol

CDW (g L-1) 2.14±0.08 0.378±0.04

Lipid content (%) 23.8±0.14 22.59±0.10

Carotenoid content (mg g-1) 0.21±0.03 0.40±0.012


2

Table 2. Carotenoid and fatty acid compositions over cultivation period.

Time (Hrs) Carotenoids FA

Zeaxanthin (%) Beta carotene (%) SFA (%) UFA (%)

24 68.28±3.63 31.71±1.56 NM1 NM

48 68.35±3.11 31.64±1.13 48.91±2.16 51.08±2.42

72 63.74±4.43 36.25±3.72 NM NM

96 62.66±12.08 37.33±8.89 64.56±1.39 35.43±3.83

120 64.28±0.63 35.71±0.30 NM NM

144 72.21±1.20 27.78±3.09 51.087±0.90 48.91±0.52

168 69.22±0.56 30.77±4.70 NM NM

192 66.34±0.19 33.65±1.85 53.15±1.44 46.84±0.49

1
NM- Not measured
3

Table 3. Characterization of TLC bands by RP-HPLC and LC-MS.

Band on TLC Pigment present in Retention time on LC-MS

from top extract RP-HPLC (min) m/z value

1 Beta carotene 29.045 537

2 Chlorophyll a 20.946 894

3 Unknown-1 16.206 909

4 Zeaxanthin 7.409 568

5 Unknown-2 5.438 599

6 Unknown-3 5.089 599


1

Figure1.
2

Figure 2.

0.45 12
Beta carotene
0.4 11
Zeaxanthin

Carotenoid content (mg g-1)


10
0.35 CDW 9
CDW (mg L-1)

0.3 8
0.25 7
6
0.2 5
0.15 4
0.1 3
2
0.05 1
0 0
0 24 48 72 96 120 144 168 192
Time (h)
3

Figure 3.

40

35
Fatty acid (% of TFA)

30 C14:0

25 C15:0
C16:0
20
C18:0
15
C18:1n9c
10
C18:2n6c
5
C18:3n3
0
48H 96H 144H 192H
Time (h)
4

Figure 4.1

18
16 Beta carotene
Carotenoid yield (mg g-1)

14 Zeaxanthin
12
10
8
6
4
2
0
1 2 3 4 5 6 7 8 9 10 11 12
Cell disruption methods

1
1-Direct extraction; 2- HCl; 3- DMSO; 4- H2SO4; 5- Oxalic acid; 6- Citric acid; 7- Acetic
acid; 8- Sodium bicarbonate; 9- Sonication; 10- Bead beating; 11- Rapid freezing + Maceration;
12- Homogenization;
 A new strain of Chlorella saccharophila was isolated from New Zealand marine
waters.
 This species can be grown heterotrophically using either glucose or glycerol.
 This species produces both lipid and the carotenoids zeaxanthin and -carotene.
 This species has potential as a biofuel producer.