6 International Conference Proceedings

All Rights reserved.
No part of this publication may be reproduced or

transmitted in any form or by any means, electronic or mechanical, including
photocopying, recording, or any information storage and retrieval system,
without permission in writing from GAMU GmbH, Institut für Pilzforschung,
Krefeld, Germany
II
Contents
List of Contributors VIII
Foreword XIII
Preface XIV
KEYNOTE LECTUR
1. Mushrooms, Cause and Cure 1
L.J.L.D VAN GRIENSVEN
Part I PHYSIOLOGY AND BIOCHEMISTRY
Reactive Oxygen Species and the Strategy of Antioxidant Defence in

Mushrooms 8
JEAN-MICHEL SAVOIE
Recognition and Degradation of Insoluble Crystalline Cellulose by

Polyporus arcularius 21
TADANORI AIMI, YUKA OHNISHI, MITSUTOSHI NAGASE,

TSUYOSHI ICHIYANAGI & YUTAKA KITAMOTO
Antimicrobial Activities of Four Wild Mushroom Species Collected

from Turkey 31
FATIH KALYONCU & MUSTAFA OSKAY
Degradation of Endosulfan by Pleurotus spp 36
GABRIELA M. MENDOZA, JOSÉ E. SANCHEZ, MARIA G. NIETO &

ACUNDO J. MÁRQUEZ-ROCHA
Part II CULTIVATION TECHNOLOGY
Double Cropping Agaricus bisporus by Re-supplementing and Re-casing

Compost 48
DANIEL J. ROYSE
III
Progress of Lentinula edodes Research in China 54
QI TAN
Mushroom Compost Production – A Review of Industry Quality

Assurance Frameworks in Ireland 61
MAIREAD KILPATRICK, H. S. SHEKHAR SHARMA & GARY
LYONS
Effect of Aerobic Fermentation Substrate on Pleurotus ostreatus

Production and Resistance to Trichoderma viride 74
GERARDO MATA & FLOR E. TORRES-HERNÁNDEZ
Yield and Mushroom Solids of Agaricus bisporus as Influenced by

Moisture Content of Substrates 83
DELPHINA P. MAMIRO AND DANIEL J. ROYSE
Cultivation Technique using Plastic Container and Selection the

Superior Strain of Monkey Mushroom (Hericium erinaceus) 91
UNG YANG, KYUNG-JU JUNG, DUCK-SOO CHOI, BONG-YUN OH,
JOUNG-KEON KIM, TAE-JUNG KIM & KI-CHUL CHUNG
Part III GENETICS AND BREEDING
Mushroom Breeding: Hurdles and Challenges 96
ANTON S.M. SONNENBERG, JOHAN J.P. BAARS & RICK W.

KERRIGAN
Molecular Genetics of the Mating System in the Bipolar Mushroom,

Pholiota nameko 104
RUIRONG YI, MUKAIYAMA HIROYUKI, TAKASHI TACHIKAWA

& TADANORI AIMI
Outcrossing via the Buller phenomenon in a substrate simultaneously

inoculated with spores and mycelium of Agaricus bisporus creates
variability for agronomic traits. 113
PHILIPPE CALLAC, MICHELINE IMBERNON & JEAN-MICHEL

SAVOIE
IV
Part IV INTEGRATED PEST MANAGEMENT
Challenges Facing Mushroom Disease Control in the 21st Century 120
H. M. GROGAN
Spotting and Discoloration of the Cultivated Mushroom, Agaricus

bisporus: Some Issues to Consider 128
D. L. RINKER, J. DANO, D. SIVANESAN, C. DOBBIN, H.

MATHANI, G. ALM, J. CLINE & A. CASTLE
Agaricus bisporus Infection by Verticillium fungicola and Incidence

on Host Tissues Colonisation and Genes Expression 139
M. L. LARGETEAU, C. LATAPY, P. BROCA & J.-M. SAVOIE
Immunological Detection of dsRNAs in Wild Agaricus Species and

in Virus-infected Cultivated Champignon 148
ANDRÁS GEÖSEL, KRISZTIÁN HALÁSZ, JÓZSEF SZARVAS,

CSABA HAJDÚ, NELLI VIRÁGH & NOÉMI LUKÁCS.
Control of Yellow Rot on Reishi Mushroom (Ganoderma lucidum

Karsten) Using a Shelf Cultivation and Modified Vinyl Cover Method 155
H.J. KANG, J.T. HWANG, J.G. NOH, J.S. CHOI, W.B. CHANG, I.G.
SONG & K.B. MIN
Biological Control Against Trichoderma Species in Agaricus
Cultivation 158
JÚLIA GYŐRFI & ANDRÁS GEÖSEL
Part V NUTRITIONAL & MEDICINAL ASPECTS

Factors Affecting Ergothioneine Content in Button Mushrooms 165
ROBERT BEELMAN & HYUN-JU LEE
Mycotherapy - Treatment with Medicinal Mushrooms 171

SUSANNE EHLERS
V
Part VI SAFETY, QUALITY CONTROL AND REGULATIONAL
ASPECTS
Molecular Modelling and Modification of Mushroom Senescence

and Quality-loss 181
K. S. BURTON, A. MEAD, M. P. CHALLEN, B. HERMAN, J. GREEN,

B. PHILLIPS & D. C. EASTWOOD
Safety, Quality Control and Regulational Aspects Relating to

Mushroom Nutriceuticals 188
S. T. CHANG & J. A. BUSWELL
Part VII MUSHROOM RESOURCE DEVELOPMENT
Commercial Cultivation of Lyophyllum shimeji 197

K. YAMANAKA
Organic Button Mushroom (Agaricus bisporus) Production, Quality
Produce and Pesticide Residue Analysis 203
B. L. DHAR, O. P. AHLAWAT, R. K. SHARMA, J. K. DUBEY, S. K.

PATYAL & MEENA THAKUR
Organic Production of Oyster Mushroom in India 212
YOGENDRA MAHTO & R. N. VERMA
Part VIII ENVIRONMENTAL IMPLICATIONS AND APPLICATIONS
Olive Mill Waste as a Substrate for the Cultivation of Pleurotus spp

Mushrooms 220
C. SOLER-RIVAS, M. I. G. D. FERREIRA POLONIA, JOSÉ
CARDOSO DUARTE, H. J. WICHERS & D. LEVANON
Alternative Uses of Spent Mushroom Compost 231
PETER OEI, HUI ZENG, JIANHUA LIAO, JIANQING DAI, MEIYUAN

CHEN & YI CHENG.
VI
Oyster Mushroom Pleurotus ostreatus (Jacq.) P.Kumm. –
Its Cultivation and Utilization in Slovak Forestry 246
M. PAVLIK, M. HRASKO & A. PAVLIKOVA
Biotechnology to Grow Edible and Medicinal Mushrooms on Vine and

Winery Wastes 255
M. PETRE & A. TEODORESCU
Part IX MYCORRHIZAL MUSHROOMS AND MYCORRHIZATION
Problems and Perspectives in the Production of Tuber Infected Plants 263
ALESSANDRA ZAMBONELLI, MIRCO IOTTI & FEDERICA

PIATTONI
Mycorrhizal Research Applied to Experiences in Plantations of

Mycorrhizal Mushrooms, Especially in Central Europe 272
ZOLTÁN BRATEK
Occurrence of Ectomycorrhizal Mushrooms in Disturbed

Forest Stands 287
M. PAVLIK
Part X ECONOMICS AND MARKETING
The Development of Polish Mushroom Exports 298

TOMASZ SMOLEŃSKI
INDEX 305
VII
LIST OF CONTRIBUTORS
Number in parentheses indicates the page on which the authors’ contributions begin.
O. P. AHLAWAT (203) National Research Centre for Mushroom, Chambaghat, Solan -

172213 (H.P), India.
TADANORI AIMI (21, 104) Faculty of Agriculture, Tottori University, Koyama-cho
Minami 4-101, Tottori-shi, Tottori 680-8553, Japan.
G. ALM (128) University of Guelph, 4890 Victoria Avenue, P.O. Box 7000, Vineland
Station, ON, Canada L0R 2E0.
JOHAN J.P. BAARS (96) Department of Plant Breeding, Wageningen University and
Research Centre, The Netherlands.
ROBERT BEELMAN (165) Department of Food Science, The Pennsylvania State
University, University Park, PA 16802, USA.
ZOLTÁN BRATEK (272) Eötvös University, Department of Plant Physiology and
Molecular Plant Biology, H-1117 Budapest, Pázmány Péter sétány 1/C, Hungary.
P. BROCA (139) INRA, UPR 1264, Mycologie et Sécurité des Aliments, BP 81, F-33883
Villenave d’Ornon, France.
K. S. BURTON (181) Warwick HRI, University of Warwick, Wellesbourne, Warwick
CV35 9EF, UK.
J. A. BUSWELL (188) Institute of Edible Fungi, Shanghai Academy of Agricultural
Sciences, Shanghai 201106, P.R. China.
PHILIPPE CALLAC (113) INRA, UR1264, Mycologie et Sécurité des Aliments, BP
81, F-33883 Villenave d’Ornon, France.
JOSÉ CARDOSO DUARTE (220) Instituto Nacional de Engenharia e Tecnologia
Industrial - INETI. Departamento de Biotecnologia, Unidade de Monitorizacão e
Ecotoxicidade. Edifício F. Estrada do Paço do Lumiar, 22, 1649-038 Lisboa. Portugal.
A. CASTLE (128) Brock University, 500 Glenridge Avenue, St Catharines, ON, Canada
L2S 3A1.
M. P. CHALLEN (181)Warwick HRI, University of Warwick, Wellesbourne, Warwick
CV35 9EF, UK.
S. T. CHANG (188) Centre for International Services to Mushroom Biotechnology,
Department of Biology, The Chinese University of Hong Kong, Hong Kong SAR, China.
W. B. CHANG (155) Agricultural Environment Division, Chungcheongbuk-do
Agricultural Research and Extension Services, Cheongwon 363-880, Korea.
MEIYUAN CHEN (231) Fujian Mushroom R&D Station, Fuzhou, Fujian 350005, P.R.China.
YI CHENG (231) Fujian Mushroom R&D Station, Fuzhou, Fujian 350005, P.R.China.
DUCK-SOO CHOI (91) Crop Research Division, Jeonnam Agriculture Research and
Extension Service, Naju 520-715, Korea
J.S. CHOI (155) Agricultural Environment Division, Chungcheongbuk-do Agricultural
Research and Extension Services, Cheongwon 363-880, Korea.
KI-CHUL CHUNG (91) School of Biological Sciences and Technology, Chonnam
National University, Gwangju, 500-757, Korea
J. CLINE (128) University of Guelph, 4890 Victoria Avenue, P.O. Box 7000, Vineland
VIII
JIANQING DAI (231) Fujian Mushroom R&D Station, Fuzhou, Fujian 350005, P.R.China.
J. DANO (128) University of Guelph, 4890 Victoria Avenue, P.O. Box 7000, Vineland
B. L. DHAR (203) Division of Plant Pathology, Indian Agricultural Research Institute,
New Delhi-110012, India,
C. DOBBIN (128) University of Guelph, 4890 Victoria Avenue, P.O. Box 7000, Vineland
J. K. DUBEY (203) Department of Entomology & Apiculture, University of Horticuture &
Forestry, Nauni, Solan, HP, India.
D. C. EASTWOOD (181) Warwick HRI, University of Warwick, Wellesbourne,
Warwick CV35 9EF, UK.
SUSANNE EHLERS (171) Weidenstrasse 4, 85368 Wang, Germany
M. I. G. D. FERREIRA POLONIA (220) Wageningen University and Research
Centre, Bornsesteeg 59. 6708 PD. Wageningen. The Netherlands; and Escola Superior
Agrária de Santarém - ESAS. Sector de Engenharia Agro-Alimentar. Quinta do Galinheiro, S.
Pedro. 2000-014 Santarém. Portugal.
ANDRÁS GEÖSEL (148, 158) Department of Vegetable and Mushroom Growing,
Faculty of Horticultural Science, Corvinus University of Budapest, Budapest, Hungary.
J. GREEN (181)Warwick HRI, University of Warwick, Wellesbourne, Warwick CV35
9EF, UK
H. M. GROGAN (120) Teagasc, Kinsealy Research Centre, Malahide Road, Dublin 17,
Ireland.
JÚLIA GYŐRFI (158) Department of Vegetable and Mushroom Growing, Faculty of
Horticultural Science, Corvinus University of Budapest, Budapest, Hungary.
CSABA HAJDÚ (148) Department of Plant Physiology and Plant Biochemistry, Faculty
of Horticultural Science, Corvinus University of Budapest, Budapest, Hungary.
KRISZTIÁN HALÁSZ (148) Department of Plant Physiology and Plant Biochemistry,
B. HERMAN (181) Warwick HRI, University of Warwick, Wellesbourne, Warwick
CV35 9EF, UK.
MUKAIYAMA HIROYUKI (104) Faculty of Agriculture, Tottori University,
Koyama-cho Minami 4-101, Tottori-shi, Tottori 680-8553, Japan.
M. HRASKO (246) Forests of the Slovak Republic State Enterprise, Forest Enterprise
Krupina, Saská 9, 96321 Krupina, Slovak Republic.
J.T. HWANG (155) Agricultural Environment Division, Chungcheongbuk-do Agricultural
TSUYOSHI ICHIYANAGI (21) Faculty of Agriculture, Tottori University, Koyama-
cho Minami 4-101, Tottori-shi, Tottori 680-8553, Japan.
MICHELINE IMBERNON (113) INRA, UR1264, Mycologie et Sécurité des
Aliments, BP 81, F-33883 Villenave d’Ornon, France.
MIRCO IOTTI (263) Dipartimento di Protezione e Valorizzazione Agroalimentare, via
Fanin 46, I-40127 Bologna, Italy.
KYUNG-JU JUNG (91) Crop Research Division, Jeonnam Agriculture Research and
FATIH KALYONCU (31) Celal Bayar University, Faculty of Science & Arts,
Department of Biology, Muradiye, Manisa, Turkey
H. J. KANG (155) Agricultural Environment Division, Chungcheongbuk-do Agricultural
IX
RICK W. KERRIGAN (96) Sylvan Research, Kittanning, USA.
MAIREAD KILPATRICK (61)Applied Plant Science and Biometrics Division, Agri-
Food and Biosciences Institute, Manor House, Loughgall, Co Armagh, BT60 8JB, UK.
JOUNG-KEON KIM (91) Crop Research Division, Jeonnam Agriculture Research and
TAE-JUNG KIM (91) Crop Research Division, Jeonnam Agriculture Research and
YUTAKA KITAMOTO (21) Asano Life Science Laboratory, Asano Industry Co. Ltd.,
3-20-6, Tamahara, Tamano, Okayama 706-0014, Japan.
M. L. LARGETEAU (139) INRA, UPR 1264, Mycologie et Sécurité des Aliments, BP
81, F-33883 Villenave d’Ornon, France.
C. LATAPY (139) INRA, UPR 1264, Mycologie et Sécurité des Aliments, BP 81, F-33883
Villenave d’Ornon, France.
HYUN-JU LEE (165) Department of Food Science, The Pennsylvania State University,
University Park, PA 16802, USA.
D. LEVANON (220) Migal-Galilee Technological Center P.O. Box 831, Kiryat-Shmona
11-016. Israel.
JIANHUA LIAO (231) Fujian Mushroom R&D Station, Fuzhou, Fujian 350005, P.R.China.
NOÉMI LUKÁCS (148) Department of Plant Physiology and Plant Biochemistry,
GARY LYONS (61) Applied Plant Science and Biometrics Division, Agri-Food and
Biosciences Institute, Newforge Lane, Belfast, BT9 5PX, UK.
YOGENDRA MAHTO (212) Ramakrishna Mission Vivekananda University, Faculty
Centre, IRTD,Morabadi, Ranchi-834008, Jharkhand, India.
DELPHINA P. MAMIRO (83) Department of Plant Pathology, Mushroom Research
Center, The Pennsylvania State, University Park, PA 16802, USA.
ACUNDO J. MÁRQUEZ-ROCHA (36) Centro de Investigación Científica y de
Educación Superior de Ensenada, Km. 107, Carr. Tijuana-Ensenada, Ensenada, Baja
California, México.
GERARDO MATA (74) Instituto de Ecología, Apdo. Postal 63 Xalapa, Veracruz,
México.
H. MATHANI (128) University of Guelph, 4890 Victoria Avenue, P.O. Box 7000,
Vineland Station, ON, Canada L0R 2E0.
A. MEAD (181) Warwick HRI, University of Warwick, Wellesbourne, Warwick CV35
9EF, UK.
GABRIELA M. MENDOZA (36) Facultad de Biotecnología, UNACH. Carr. Puerto
Madero Km. 1.5, Tapachula, Chiapas, México.
K.B. MIN (155) Agricultural Environment Division, Chungcheongbuk-do Agricultural
MITSUTOSHI NAGASE (21) Shimane Institute for industrial Technology, Hokuryo-
cho 1, Matsue-shi, Shimane 690-0816, Japan.
MARIA G. NIETO (36) El Colegio de la Frontera Sur, Apartado Postal 36, Tapachula,
Chiapas, México.
J. G. NOH (155) Agricultural Environment Division, Chungcheongbuk-do Agricultural
PETER OEI (231) ECO Consult Foundation, Tiel, The Netherlands
BONG-YUN OH (91) Crop Research Division, Jeonnam Agriculture Research and
X
YUKA OHNISHI (21) Faculty of Agriculture, Tottori University, Koyama-cho
Minami 4-101, Tottori-shi, Tottori 680-8553, Japan.
MUSTAFA OSKAY (31) Celal Bayar University, Faculty of Science & Arts,
Department of Biology, Muradiye, Manisa, Turkey.
S. K. PATYAL (203) Department of Entomology & Apiculture, University of Horticuture
& Forestry, Nauni, Solan, HP, India.
M. PAVLIK (246, 287) Technical University in Zvolen, T.G.Masaryka 20, Zvolen 96053,
Slovak Republic.
A. PAVLIKOVA (246) Matej Bel University in Banska Bystrica, Ružová 13, 97411
Banská Bystrica, Slovak Republic.
M. PETRE (255) Faculty of Sciences, University of Pitesti, 1 Targul din Vale Street, Pitesti
110040, Arges County, Romania.
B. PHILLIPS (181) Department of Engineering, Coventry University, Coventry CV1 5FB,
UK.
FEDERICA PIATTONI (263) Dipartimento di Protezione e Valorizzazione
Agroalimentare, via Fanin 46, I-40127 Bologna, Italy.
D. L. RINKER (128) University of Guelph, 4890 Victoria Avenue, P.O. Box 7000,
DANIEL J. ROYSE (48, 83) Department of Plant Pathology, The Pennsylvania State
University, University Park, PA 16802, USA.
JOSÉ E. SANCHEZ (36) El Colegio de la Frontera Sur, Apartado Postal 36, Tapachula,
Chiapas, México.
JEAN-MICHEL SAVOIE (8, 113, 139) INRA, UR1264, Mycologie et Sécurité des
Aliments, BP 81, F-33883 Villenave d’Ornon, France.
H. S. SHEKHAR SHARMA (61) Applied Plant Science and Biometrics Division2,
Agri-Food and Biosciences Institute, Newforge Lane, Belfast, BT9 5PX, and School of
Biological Sciences, Queen’s University Belfast, Newforge Lane, Belfast BT9 5PX, UK.
R. K. SHARMA (203) Division of Plant Pathology, Indian Agricultural Research
Institute, New Delhi-110012, India,
D. SIVANESAN (128) University of Guelph, 4890 Victoria Avenue, P.O. Box 7000,
TOMASZ SMOLEŃSKI (298) Institute of Agricultural and Food Economics,
Swietokrzyska 20, 00-002 Warsaw, Poland.
C. SOLER-RIVAS (220) Wageningen University and Research Centre, Bornsesteeg 59.
6708 PD. Wageningen. The Netherlands; and Universidad Autonoma de Madrid, Unit of
Food Science and Technology, Ctra. de Colmenar km. 15. 28049 Madrid. Spain.
I. G. SONG (155) Agricultural Environment Division, Chungcheongbuk-do Agricultural
ANTON S. M. SONNENBERG (96) Department of Plant Breeding, Wageningen
University and Research Centre, The Netherlands.
JÓZSEF SZARVAS (148) Quality Champignons Ltd., Pf. 8., 3394 Kerecsend, Hungary
TAKASHI TACHIKAWA (104) Faculty of Agriculture, Tottori University, Koyama-
cho Minami 4-101, Tottori-shi, Tottori 680-8553, Japan.
QI TAN (54) Institute of Edible Fungi, Shanghai Academy of Agricultural Sciences,
Shanghai 201106, P.R. China.
A. TEODORESCU (255) Faculty of Sciences, University of Pitesti, 1 Targul din Vale
Street, Pitesti 110040, Arges County, Romania.
XI
MEENA THAKUR (203) Department of Entomology & Apiculture, University of
Horticuture & Forestry, Nauni, Solan, HP, India.
FLOR E. TORRES-HERNÁNDEZ (74) Instituto de Ecología, Apdo. Postal 63
Xalapa, Veracruz, México.
L.J.L.D. VAN GRIENSVEN (1) Plant Research International, Wageningen University
and Research, Wageningen, The Netherlands.
R. N. VERMA (212) Ramakrishna Mission Vivekananda University, Faculty Centre,
IRTD, Morabadi, Ranchi-834008, Jharkhand, India.
NELLI VIRÁGH (148) Department of Plant Physiology and Plant Biochemistry, Faculty
of Horticultural Science, Corvinus University of Budapest, Budapest, Hungary.
H. J. WICHERS (220) Wageningen University and Research Centre, Bornsesteeg 59.
6708 PD. Wageningen. The Netherlands.
K. YAMANAKA (197) Kyoto Mycological Institute, Misasagi, Yamashina, Kyoto, 607-
8406, Japan.
UNG YANG (91) School of Biological Sciences and Technology, Chonnam National
University, Gwangju, 500-757, Korea
RUIRONG YI (104) The United Graduate School of Agricultural Sciences, Tottori
University, 4-101 Koyama-cho Minami, Tottori-shi, Tottori 680-8553, Japan.
ALESSANDRA ZAMBONELLI (263) Dipartimento di Protezione e Valorizzazione
Agroalimentare, via Fanin 46, I-40127 Bologna, Italy.
HUI ZENG (231) Fujian Mushroom R&D Station, Fuzhou, Fujian 350005, P.R.China.
XII
Foreword
On behalf of the World Society for Mushroom Biology and Mushroom Products
(WSMBMP), I am delighted to welcome you to the 6th International Conference. The
Conference offers a diverse range of both basic and applied aspects that cover a wide variety
of topics. Scientists, growers, suppliers and merchandisers alike should find something of
interest in this extensive program.
Special thanks go to Dr. Jan Lelley, conference chair, and our colleagues on the Organizing
and Scientific Program Committees for their prodigious efforts in helping to develop,
organize, and carry out a meeting of this magnitude. The keynote and plenary lectures
promise to give us pause for thought on how we might move the industry forward.
We owe a special debt of gratitude to the presenters who have graciously agreed to share their
research findings and their experiences with the mushroom community. It is innovation that
drives growth and development in the mushroom industry, and we must work together to
harness the power of science and technology. This is truly a cooperative effort so your
participation in all aspects of the Conference is needed and anticipated. Thank you in advance
for your comments, involvement and expertise.
The WSMBMP gratefully acknowledges the generous support of the sponsors of the
Conference. Without their financial assistance, this conference would not be possible at such
a reasonable cost to participants. I am sure our sponsors would welcome a hearty “thank you”
at some time during the Conference.
It is fitting that this conference be held in Bonn, a city with a 2000-year history and located in
the picturesque Rhine River Valley. Bonn has developed into a hub of international
cooperation and that is the purpose of this meeting. We hope you enjoy the Conference and
the City of Bonn!
Professor Daniel J. Royse

President, World Society for Mushroom Biology and Mushroom Products
XIII
Preface
Dear Colleagues,
It is my pleasure to welcome you to the 6th International Conference on Mushroom Biology

and Mushroom Products in Bonn.
The enormous progress in developing mushroom biology and mushroom products world-wide
has continued during the last thee years, since the previous meeting took place. Therefore our
Conference will serve everyone involved in mushroom research, cultivation, mushroom trade
and also in developing equipment and machinery to reach the final information level in this
field.
From the submitted contributions we have successfully put together an interesting oral lecture
and poster programme. Moreover we have gained excellent scientists for the keynote and
plenary lectures. Additionally three workshops have been organised with coordinators and
panellists who are eminent representatives in their own research field. This all goes to
promise us a successful conference.
I would like to use the opportunity to express my gratitude to the sponsors of the Conference.
Without their generous support we would not be able to set up this event.
I wish you all a warm welcome to Bonn, a very successful meeting and an enjoyable stay in
Germany.
Sincerely yours
Professor Jan I. Lelley
Chairman of the Organising Committee
XIV
Proceedings of the 6th International Conference on Mushroom Biology and Mushroom Products, 2008
Mushrooms: Cause and Cure
Leo van Griensven

Plant Research International, Wageningen University and Research, Wageningen, The
Netherlands. Email: leo.vangriensven@wur.nl
Key Words: Mushroom cultivation; Nutritional attributes; Medicinal aspects;

Bioremediation;
Introduction
Since times immemorial, mushrooms have been used for hallucinogenic and for
medical application, for human consumption and for commercial exploitation. The first
records of mushroom use are of African, i.e.Yoruba, origin and depict the hallucinogenic
effects of mushrooms. They go back to the Paleolithic period and were produced 7000 – 9000
years ago (Samorini, 1992). In the desire for immortality and power, Psilocybe spp and
Amanita muscaria were used in many cultures, e.g. in Egypt before the 11th Dynasty (Berlant,
2005), in Siberian and Tibetan shamanism and possibly in Buddhism, in the Veda and in
Celtic myths (Hajicek-Doberstein, 1995). Even today, the practice of shamanism is widely
spread throughout the world; Psilocybe is widely used by several indigenous Mesoamerican
peoples, particularly the Mazatecs of Oaxaca (Guzman, 1984; Stamets, 2000). In the
Netherlands the recreational use of “paddos” has recently become forbidden.
Although it was claimed that the ancient Egyptians used A. muscaria to relieve pain
(Puharich, 1959 cf Berlant, 2005), it was originally in China that mushrooms such as species
of Ganoderma, Phellinus, Cordyceps. and many others were applied in daily medical practice.
The famous Shen Nong herbal which describes the use of herbal preparations for a range of
diseases was published at the end of the Han Dynasty (225 AD) and was based on 3000 years
of experience.
The consumption of mushrooms was common throughout the ages, both as a
collectable free food from nature as well as a gourmet food as is the case with Amanita
caesarea, Morchella conica and truffles. In spite of their delicacy, reports (Buller, 1914)
concerning early mushroom consumption mention that wealthy Romans and Greeks insisted
on preparing mushrooms themselves. This peculiar behaviour was presumably caused by the
fear of being poisoned. Interestingly, it has been made clear by meta-analysis that the death of
the Roman emperor Claudius was rather a consequence of his “good life” than of poisoning
by mushrooms. Claudius died at the age of 62 of severe cerebro-vascular disease, a condition
that was not uncommon among well-fed Romans of the higher social classes (Marmion,
2002).
Cultivation of edible mushrooms started around 700 years ago in China with the
cultivation of Shii-take (Lentinula edodes) on inoculated wood logs. Wang (1987) referred to
the cultivation description of Wang Zeng that dates from 1313 AD. Shii-take and the rice
straw mushroom (Volvariella volvacea) were both reported to be cultivated 300 years ago in
China and Japan. In Europe, the first description of the cultivation of the button mushroom.
Agaricus bisporus, was by the French botanist Tournefort (1707). During the 18th century,
mushroom cultivation spread all over Europe after it was discovered that mushrooms could be
grown on flat cultivation beds consisting of mixtures of weathered horse manure. It took
another 100 years before pure cultures were made and compost spawn was developed
(Kligman, 1950). In 1927, the first white strain of A. bisporus was made after Lambert (1929)
had observed this mutant in a culture of the brown wild-type “Agaricus brunnescens”. The
American scientist, Bob Miller, described a system for the cross-breeding of A. bisporus in
1971, but it took until 1981 before the first cross-bred A. bisporus strains were developed by
1
German-born Gerda Fritsche (1983) at Horst in The Netherlands. These strains, combining
high productivity and good quality, were highly reliable in their cultivation behaviour and
now form the basis of all commercial white mushroom strains in the world. Since then,
nothing has changed in the world of Agaricus breeding. A non-sporulating variant of
Pleurotus was bred by Baars et al. (2004), possibly saving thousands of workers from
“mushroom worker’s lung” (Cox et al. 1988).
Food and jobs; jobs and food
The growth of the mushroom industry began when cultivation went from outdoors to
caves with a stable climate, and later into the “Pennsylvania doubles” indoor system that
consisted of large racks containing up to 12 beds positioned above each other and divided
over two floors. This arrangement formed the basis of the Dutch mushroom farm system that
is constructed of standardized metal beds in fully acclimatized rooms, a very efficient and
very expensive design that has since been introduced in all parts of the world where it is
affordable. Indoor composting and two-phase cultivation, also designed in the eighties
(Gerrits, 1988), have created a complete system of incomparably efficient mushroom
cultivation, that allowed for high productivity of a valued industrial product in Western
countries. In 2005, world production of industrially produced white button mushrooms had an
estimated value of approximately three million tonnes (USDA, 2004).
At the same time, a whole range of other mushrooms were produced elsewhere in the
world in completely different ways. Shii-take, Oyster mushrooms (Pleurotus spp), (V.
volvacea) and many others are grown on substrates ranging from wood logs and wetted non-
fermented straw to complicated sterilized mixtures of various organic and inorganic materials.
These substrates can either be industrially produced or made on a small scale at the farm.
These cultivation systems are easily adaptable to local circumstances, can be built without
enormous capital investment, produce a valued edible product for local trade and have created
hundreds of thousands of jobs in Asia, South and Middle America and Africa. World wide
production of Oyster mushrooms and Shii-take especially is now double that of industrial A.
bisporus and is still on the rise. In China, enormous quantities of non-industrial A. bisporus,
Pleurotus spp, L. edodes and V. volvacea are produced by hundreds of thousands small
farmers. Total mushroom production in China in 2003 exceeded 10 million metric tonnes
(Chang, 2006).
The growth of mushroom cultivation will continue in Asia, South and Middle
American and Africa because it creates jobs without the necessity for large investments, uses
inexpensive basic materials and produces a readily sellable food product for the local market
that fits present day health concepts. In the Western world, the health aspects, i.e. low calorie,
high antioxidant and high ergosterol content leading to Vitamin D2 synthesis upon exposure
to sunlight, and the “cradle to cradle” idea of environmentally friendly politicians, will guide
the industry into further development. Future prospects appear bright!
Health Food
Apart from their aromatic and taste properties, mushrooms are appreciated as a
vegetarian and as a health food. They are low in calories and in fat, and supply sufficient
protein and essential amino acids (Mattila et al. 2002). They are also a good source of
phytosterols, especially ergosterol. Consumption of phytosterols can contribute to the
lowering of LDL cholesterol in the plasma. Also, ergosterol is a precursor of Vitamin D2 and
can readily be converted into Vitamin D2 by exposing the mushroom to low wavelength UV
light (Jasinghe & Perera, 2006). As many people have insufficient Vitamin D supply in their
diet, mushrooms, being easily and cheaply available, could form a good source of natural
2
Vitamin D. This holds especially for the elderly and for vegetarians. Also consumption of
mushroom phytosterols could decrease LDL cholesterol and overproduction of triglycerides.
Further, mushrooms can be used as vehicles for supplying selenium to our diet (Beelman &
Royse, 2006).
Another aspect of present day health concepts is the concept that antioxidants can
prevent malignant disease and aging effects. Overexposure to free radicals generates DNA
breaks and induces cancer, autoimmune disease and ageing. Mushrooms such as A. bisporus,
L. edodes, Pleurotus spp and Grifola frondosa have been found to contain considerable
amounts of antioxidant compounds, i.e. ergothioneine and polyphenols, that can counteract
the damaging effects of free radicals (Dubost et al. 2007). Furthermore, mushrooms can be
enriched with selenium, and provide a major part of the recommended dietary intake of this
element. Apart from having specific effects in suppressing in vitro carcinogenesis (Spolar et
al. 1999) , Se enrichment increases immunoreactivity, Se has a key role in antioxidation
(Wintergerst et al. 2007).
Considering the above, mushrooms can truly be named “health food”. However,
surprisingly little evidence has been collected that proves its presumed effects beyond any
doubt. No clinical studies concerning effects of mushroom derived health foods in humans
could be found in the scientific literature.
Medicines
Mushrooms such as Agaricus brasiliensis, Cordyceps sinensis, Coriolus versicolor,

Ganoderma lucidum, L. edodes, Phellinus linteus, and many others have traditionally been
used for the prevention and cure of a range of diseases including atherosclerosis, cancer,
chronic hepatitis, and autoimmune diseases such as diabetes type I. The preventive and
therapeutic effects of these mushrooms and their components have been well documented in
mouse and rat model systems, and in cancer cell lines (Wasser et al. 2002, Zaidman et al.
2005). Many studies have led to important knowledge of the effects of mushroom extracts and
of their modes of action. These involve immunomodulatory effects in various forms, e.g. pro-
inflammatory activity or adjuvant effects, and also apoptosis, mostly with the involvement of
chemokines, produced by the cells of the immune system, as mediators.
Mushroom extracts contain several biologically or medicinally active components: i.e.
glucans, phenolic compounds and proteins. A vast amount of evidence has been collected
supporting a role for β-glucans from several mushroom species in suppressing the growth of
transplantable tumors in rats and mice (Wasser et al. 2002), although with different degrees of
effectiveness. Many of the preparations also exhibit high antioxidant activity and, at the same
time, surprisingly showing prooxidative effects (Song & van Griensven, in press). They
generate reactive oxygen species (ROS) inside cells (Song et al. 2008) leading to the
destruction of invading pathogens and to apoptosis or autophagous death of cancer cells. A
major drawback of studies on the effects of mushroom extracts on disease is that all have been
carried out using inbred rodent strains. Therefore, they are of only limited value in terms of
the treatment of disease in (outbred) humans. Although there are many successful case
reports, only a few matched double-blind tests have been carried out in humans. Most of these
have yielded inconsistent results. However, a large Japanese meta analysis involving eight
trials and over 8000 gastric cancer patients has clearly shown that postoperative
immunochemotherapy applying mushroom extracts led to significant advantages in survival
over chemotherapy alone (Oba et al. 2007; Abascal & Yarnell, 2007). Chemotherapy-related
side effects and subjective well-being were improved by mushroom extracts in both rats
(Wang et al. 2005) and humans (Hu et al. 2005; Ahn et al. 2004).
Apart from the effects on malignant disease, several observations have been made
concerning immunomodulation and decreases in infections (Lull et al. 2005) and suppression
3
of symptoms of autoimmune disease. Several studies have shown that mushroom extracts can
partially cure rats of STZ-induced diabetes type I and also rheumatoid arthritis; interesting
results have also been obtained in studies involving experimental multiple sclerosis and in
lupus erythematodes (this lecture). However, most of the studies were carried out in rodents
and, again, no matched double-blind tests have been described. For the further development
of mushroom derived medicines, the requirements of Western world pharmacology, i.e. the
lack of available statistically positive results of matched double-blind assays in humans, have
caused a clear deadlock. I consider this unacceptable; Western legislation blocks the
development of new natural medicines that are greatly needed to stop the increase of
degenerative diseases in future generations of people who will live longer than ever before in
the history of mankind. Temporal-spatial studies in which individual patients over the whole
world are followed sequentially under standardized treatments with standardized newly-
developed medicines (including those from mushrooms) could provide a statistically relevant
alternative for double-blind testing. This will allow a more ethical approach to human
experimentation and, at the same time, result in the more rapid development of new
medicines.
Bioremediation
After it had become clear in the early 1980s that chlorinated aromatics are very
recalcitrant and highly toxic (Peyton, 1984), a programme was initiated to stop further use and
to clean contaminated water and soil. It was soon discovered that fungal laccases and
peroxidases could play an important role in the bioremediation of phenolic wastewaters
(Davis & Burns, 1990). The white rot fungus Trametes versicolor was effective in solutions
but the enzymes were easily inactivated (Atlow et al. 1984). The remedy was to use the
phenol-degrading enzymes bound to a carrier (Ryan et al. 2007) such as the spent compost
remaining after the cultivation of mushrooms like Pleurotus pulmonarius (Law et al. 2003)
and P. ostreatus (Polcaro et al. 2008), or even A. bisporus mushroom tissue (Kameda et al.
2006). The spent mushroom compost of Agaricus macrosporus is a good adsorbent for the
heavy metals Cu2+, Cd2+, Pb2+, Hg2+ and Zn2+, which allows for removal of those metals from
aqueous solutions (Melgar et al. 2007). The same was found for Cr2+ using L. edodes spent
substrate (Chen et al. 2006). Removal of odorous gaseous compounds from the exhaust air of
mushroom compost plants has become common practice since the work of Derikx et al.
(1991) who found that mushroom compost can be used as a biosorbent for those compounds.
The same method and material was later successfully applied by Shojasadati & Elyasi (1999)
for the removal of highly toxic hydrogen sulfide from the air of industrial processes.
A more difficult process is the degradation of aromatics in the soil, mostly due to the
lack of oxygen and formation of hydrophobic anisole compounds. However,
pentachlorophenol (PCP) could be removed from contaminated soils that contained up to 1
gram of PCP per kg by mixing and incubating with wood chips that had been inoculated with
Phanerochaete sp. (Ford et al. 2007). More recently, Polcaro et al. (2008) reported analogous
results for the removal of creosote from soils. These small scale laboratory experiments,
although promising, should be repeated on large-scale before the technique can be used in the
real world.
Based on the above, proposals will be made for the further development and use of
mushrooms and derived products, and to strengthen the position of the mushroom industry.
References
Abascal K, Yarnell E. 2007. A Turkey tail polysaccharide as an

immunochemotherapy agent in cancer. Altern. Compl. Ther., 13, 178-182.
4
Ahn WS, Kim DJ, Chae CT, Lee JM et al. 2004. Natural killer cell activity and
quality of life were improved by consumption of a mushroom extract, Agaricus blazei
Murill Kyowa, in gynecological cancer patients undergoing chemotherapy. Int. J.
Gynaecol. Cancer, 14, 589-594.
Atlow SC, Bonadonna-Aparo L, Klibanov AM. 1984. Dephenolization of industrial
wastewater catalyzed by polyphenol oxidase. Biotechnol. Bioeng., 26, 599-603.
Baars JJP, Hendrickx PH, Sonnenberg ASM. 2004. Prototype of a sporeless oyster
mushroom. Mushr. Sci., 16, 139-147.
Beelman RB, Royse DJ. 2006. Selenium enrichment of Pleurotus cornucopiae (Paulet)
Roland and Grifola frondosa (Dicks.:Fr.) S.F. Gray mushrooms. Int. J. Med. Mushr.,
8, 77-84.
Berlant SR. 2005. The enthnomycological origin of Egyptian crowns and the esoteric
underpinnings of Egyptian religion. J. Ethnopharmacol., 102, 275-288.
Chang ST. 2006. Development of the culinary-medicinal mushrooms industry in
China: past, present and future. Int. J. Med. Mushr., 8, 1-17.
Chen GQ, Zeng GM, Tu X. Niu CG, Huang GH, Jiang W. 2006. Application of a by-
product of Lentinus edodes to the bioremediation of chromate contaminated water. J.
Hazard Mat., B135, 249-255.
Cox A, Folgering HTM, van Griensven LJLD. 1988. Extrinsic allergic alveolitis
caused by spores of the oyster mushroom Pleurotus ostreatus. Eur. Respir. J.,
1, 466-468.
Davis S, Burns RG. 1990. Decolorization of phenolic effluents by soluble and
immobilized phenol oxidases. Appl. Microbiol. Biotechnol., 32, 721-726.
Derikx PJL, Simons FHM, Op den Camp, HJM, van der Drift C, van Griensven LJLD,
Vogels GD. 1991. Evolution of volatile sulfur compounds during laboratory scale
incubations and indoor preparation of compost used as a substrate in mushroom
cultivation. Appl. Environ. Microbiol. 57, 563-567.
Dubost NJ, Ou B, Beelman RB. 2007. Quantification of polyphenols and
ergothioneine in cultivated mushrooms and correlation to total antioxidant capacity.
Food Chem., 105, 727-735.
Ford CI, Walter M, Northcott GL, Hong JD, Cameron KC, Trower T. 2007. Fungal
inoculum properties: extracellular enzyme expression and pentachlorophenol removal
in highly contaminated field soils. J. Environ. Qual., 36, 1599-1608.
Fritsche G. 1988. Breeding Agaricus bisporus at the Mushroom Experimental Station
at Horst. Mushr. J., 122, 49-53.
Gerrits JPG. 1988. Nutrition and compost. pp 29-72. In: LJLD van Griensven Ed. The
cultivation of mushrooms. Darlington Mushroom Laboratories, Rustington U.K.
Guzman G. 1984. El uso de los hongos en Mesoamérica. Ciencia y Desarollo, 59, 17-27.
Hajicek-Dobberstein S. 1995. Soma siddhas and alchemical enlightenment:
psychedelic mushrooms in Buddhist tradition. J. Ethnopharmacol., 48, 99-118.
Hu Z, Chen X, Yang X, Gao Y, Zhou S. 2005. Water-soluble polysaccharides of
Ganoderma lucidum (W.Curt.:Fr.) P. Karst. (Aphyllophoromycetideae) alleviate the
dose-limiting toxicities of irinotecan (CPT-11). Int. J. Med. Mushr., 8, 321-327.
Jasinge VJ, Perera CO. 2006. Ultraviolet irradiation: the generator of vitamin D2 in
edible mushrooms. Food Chem., 95, 638-643.
Kligman AM.1943. Some cultural and genetic problems in the cultivation of the
mushroom, Agaricus campestris Fr. Am. J. Bot., 30, 745-763.
Lambert EB. 1929. The production of normal sporophores in monospore cultures of A.
campestris. Mycologia, 21, 333-335.
5
Law WM, Lau WN, Lo KL, Wai LM, Chiu SW. 2003. Removal of biocide pentachlorophenol
in water system by the spent mushroom compost of Pleurotus pulmonarius.
Chemosphere, 52, 1531-1537.
Lull C, Wichers HJ, Savelkoul HFJ. 2005. Anti-inflammatory and immunomodulating
properties of fungal metabolites. Mediators Inflamm., 2, 63-80.
Marmion VJ, Wiedemann TEJ. 2002. The death of Claudius. J. Royal Soc. Med., 95,
260-261.
Mattila P, Salo-Väänänen P, Könkö K, Aro H, Jalava T. 2002. Basic composition and
amino acid contents of mushrooms cultivated in Finland. J. Agric. Food Chem., 50,
6419-6422.
Melgar MJ, Alonso J, Garcia MA. 2007. Removal of toxic metals from aqueous
solutions by fungal biomass of Agaricus macrosporus. Science Total Environ., 385,
12-19.
Miller RE. 1971. Evidence of sexuality in the cultivated mushroom Agaricus bisporus.
Mycologia, 63, 630-634.
Oba K, Termukai S, Kobayashi M, Matsui T, Kodera M, Skamoto J. 2007. Efficacy
of adjuvant immunochemotherapy with polysaccharide K for patients with curative
resections of gastric cancer. Cancer Immunol. Immunother., 56, 905-911.
Peyton TO. 1984. Biological disposal of hazardous waste. Enzyme Microb. Technol.,
6, 146-154.
Polcaro CM, Brancaleoni E, Donati E, Frattoni M, Galli E, Migliore L, Rapanà P.
2008. Fungal bioremediation of creosote-treated wood: a laboratory scale study on
creosote components degradation by Pleurotus ostreatus mycelium. Bull. Environ.
Contam. Toxicol., 81, 180-184.
Ryan D, Leukes W, Burton S. 2007. Improving the bioremediation of phenolic
wastewaters by Trametes versicolor. Bioresource Technol., 98, 579-587.
Samorini G. 1992. The oldest representations of hallucinogenic mushrooms in the
world (Sahara Desert, 9000-7000 B.P.). Integration, 2/3, 69-78.
Song W, van Griensven LJLD. 2008. Pro-oxidative and anti-oxidative properties of
medicinal mushroom extracts. Submitted for publication.
Song W, Helsper JPFG, van Griensven LJLD. 2008. Phenolic compounds present in
medicinal mushroom extracts generate reactive oxygen species in human cells
in vitro. Intern. J. Med. Mushr. 10, 1-15.
Sjojaosadati SA, Elyasi S. 1999. Removal of hydrogen sulfide by the compost
biofilter with sludge of leather industry. Resources Conservation Recycling, 27, 139-
144.
Spolar MR, Schaffer EM, Beelman RB, Milner JA. 1999. Selenium-enriched
Agaricus bisporus mushrooms suppress 7, 12-dimethylbenz[a]anthracene
bioactivation in mammary tissue. Cancer Lett., 138, 145-150.
Stamets P. 2000. Growing Gourmet and Medicinal Mushrooms. 576 pp. Ten Speed
Press. Berkely, Toronto.
Tournefort M. 1707. Observations sur la naissance et sur la culture des champignons.
Memoires de l’Academie Royale, Paris., 58-66.
Wang YC. 1987. Mycology in ancient China. The Mycologist, 21, 59-61.
Wang CZ, Basila D, Aung HH, Mehendale SR, Chang WT, McEntee E, Guan XF, Yuan CS.
2005. Effects of Ganoderma lucidum extract on chemotherapy-induced nausea and
vomiting in a rat model. Am. J. Chin. Med., 33, 807-815.
Wasser SP. 2002. Medicinal mushrooms as a source of antitumor and
immunomodulating polysaccharides. Appl. Microbiol. Biotechnol., 60, 258-274.
Wintergerst ES, Maggini S, Hornig DH. 2007. Contribution of selected vitamins and
trace elements to immune function. Ann. Nutr. Metab. 51, 301-323.
6
Zaidman BZ, Yassin M, Mahajna J, Wasser SP. 2005. Medicinal mushroom
modulators of molecular targets as cancer therapeutics. Appl. Microbiol. Biotechnol.,
67, 453-468.
7
Proceedings of the 6th International Conferemce on Mushroom Biology and Mushroom Products, 2008
Reactive Oxygen Species and the Strategy of Antioxidant Defence in

Mushrooms
Jean-Michel Savoie
INRA, UR1264, Mycologie et Sécurité des Aliments, BP 81, F-33883 Villenave d’Ornon,
France. E-mail: savoie@bordeaux.inra.fr
Abstract
Oxidative stress leading to an increased presence of free radicals and reactive oxygen
species (ROS) plays an important role in human degenerative diseases associated with ageing,
and diets rich in antioxidants are expected to help human body to reduce oxidative damage.
Mushrooms are potential attractive sources of antioxidant and there have been recent
investigations on the antioxidant properties of extracts from various cultivated and wild edible
species. Although research focused mainly on the composition and putative therapeutic
effects of mushrooms, little information is available about ROS generation and the strategy of
antioxidant defence in mushrooms. In addition to the well established damaging effects of
ROS on DNA, proteins, lipids and other cell components, there is increasing evidence
supporting that ROS play important physiological roles in yeasts and fungi. The level of ROS
in the cell regulates the growth and differentiation of the fungal organism, and the adaptation
of fungi to oxidative stress is tightly connected with the redox-dependant changes in the
activities of antioxidant components. As in plant and animal that are both capable of an
oxidative burst in response to pathogen recognition and ROS production associated with
defence response, mushrooms respond to biotic interferences by accumulation of H2O2 or
quinones and death of either the competitor or the fungi itself. The questions of the
involvement of ROS regulation in Basidiomycete development and defence systems have to
be addressed to increase our knowledge on edible mushrooms. This review discusses progress
on ROS generation and the strategy of antioxidant defence in A. bisporus with emphasis on
new research ways.
Key Words: Reactive oxygen species; Antioxidants; Free-radical scavenging activity;

Agaricus bisporus
Introduction
An increased intake of fruits and vegetables is largely recommended to limit the

occurrences of human degenerative diseases associated with ageing. Oxidative stress leading
to an increased presence of free radicals and reactive oxygen species (ROS) plays an
important role in these diseases and diets rich in antioxidants are expected to help human
body to reduce oxidative damage. Mushrooms are potential attractive sources of antioxidant,
and there have been recent but numerous investigations on the antioxidant properties of
extracts from various cultivated and wild edible species (Choi et al. 2004; Czapski, 2004;
Dubost et al. 2007b; Elmastas et al. 2007; Huang et al. 2006; Lee & Juang, 2004; Lee et al.
2007; Mau et al. 2002, 2004; Savoie et al. 2008). Antioxidant and free radical scavenging
activities of natural products are the results of chemical reactions associated with the presence
of some compounds and enzymes. The primary function of antioxidant properties is to
prevent cell damage induced by ROS. The reducing power present might contribute to the
elimination of H2O2 and other ROS in the mushroom cells.
Although research focused mainly on the composition and putative therapeutic effects of
mushrooms, little information is available about ROS generation and the strategy of
8
ROS on DNA, proteins, lipids and other cell component, there is increasing evidence
supporting that ROS play important physiological roles in yeasts and fungi (Aguirre et al.
2005). The level of ROS in the cell regulates the growth and differentiation of the fungal
organism, and the adaptation of fungi to oxidative stress is tightly connected with the redox-
dependant changes in the activities of antioxidant components (Belozerskaya & Gessler,
2007). The most studied species for these questions about the involvement of ROS regulation
in fungal development are: Saccharomyces cerevisiae, Aspergillus nidulans, Dictyostellium
discoideum, Neurospora crassa, Podospora anserina, Sclerotium rolfsii, Ustilago maydis.
Mushrooms are absent in this list.
Plant and animal cells are both capable of an oxidative burst in response to pathogen
recognition and the ROS production is associated with defence response. Hyphal interference
was identified as a reaction characterized by accumulation of H2O2 and death of either the
competitor or the fungi itself. For instance, Coprinopsis cinerea is endowed with such a
defence system able to recognize self vs non-self and involving superoxide (Silar, 2005).
The button mushroom, Agaricus bisporus (J.E. Lange) Imbach, is the premier cultivated
edible mushroom and is consumed throughout the world. Recent evidence suggests that A.
bisporus mushroom also contains high levels of substances of possible medicinal importance
such as tyrosinase, aromatase inhibitors and immunomodulating and antitumor
polysaccharides (Beelman et al. 2003). Ergosterol, vitamin D2 content, and antioxidant
activity are also proposed as interesting components for the development of A. bisporus as a
nutraceutical for tomorrow (Gopalakrishnan et al. 2005; Lelley & Vetter, 2005). Although
research focused on antioxidant properties of various specialty mushrooms, little information
was available about A. bisporus antioxidant properties. Since the last five years, increasing
interest was paid on A. bisporus as a source of antioxidants (Czapski, 2004; Dubost et al.
2007b; Lee & Jang, 2004; Ramirez-Anguiano et al. 2007; Savoie et al. 2008; Tsai et al.
2008). One objective in our research group is to investigate the involvement of ROS
regulation in A. bisporus development and defence systems. This paper discusses progress on
knowledge on ROS generation and the strategy of antioxidant defence in A. bisporus.
ROS generation
Both Eucaryotes and Procaryotes generate ROS as by-products of their metabolism,

mainly through aerobic respiration. The O2 molecule is stable and generation of ROS is the
consequence of O2 involvement in oxidation of organic substrates leading to the formation of
radicals or peroxides as well as O2 activation or excitation by external factors. ROS are
oxygen in its excited singlet (1O2), superoxide anion radical (O2-.), peroxide radical (HO2-.)
and peroxide ion (HO2-), hydroxyl radical (HO.) and hydroxyl ion (HO-), hydrogen peroxide
(H2O2). During respiration, 2 to 5% of the O2 used by mitochondria is incompletely reduced
and forms O2-.. In S. cerevisiae, Georgiou et al. (2005) measured superoxide rates between 5
and 10 nM min-1 inside cells. It is assumed that this O2-. is readily converted to H2O2 both
spontaneously and with the involvement of mitochondrial superoxide dismutases (SOD).
Formation rate of H2O2 in mycelium of S. rolfsii was estimated to be 4 ± 0.5 nmol min-1 g-1
dry biomass (Sidery & Georgiou, 2000). In animal cells the rate of mitochondrial ROS
production can be modulated and might be involved in cell signalling and development
(Severin & Hyman, 2002). O2-. is also generated as an intermediate product in reactions of
autooxidation of thiols, flavins, quinones and catecholamines, and in reactions involving
enzymes (xanthine oxidase, microsomal monooxygenases, lipoxygenase, NADPH oxidases).
Extracellular oxidative systems also produce ROS and are important for fungi.
9
Roles of ROS
In addition to their generation as by products of the metabolism, ROS are synthesised by
specific enzymes and have roles in fungal cells and for interaction with their environment.
Changes in ROS levels during cell differentiation and development

On the one hand, ROS cause cell damage and, on the other, induce differentiation of
fungi. ROS production is a universal signalling system among multicellular organisms. The
diffusible nature of superoxide and H2O2 makes them ideal second messengers for signalling
within the cell and intercellular signalling for H2O2 which can traverse the cell membrane
(Takemoto et al. 2007). In fungi, H2O2 as a signal molecule is involved in various processes,
such as the change in growth rate, differentiation, and proliferation. Visible light, changes in
pH of the medium, temperature, osmosity, oxygen partial pressure, as well as concentrations
of substrates, drying, mechanical damages and other external factors influencing microbial
growth and development, induce generation of oxygen radicals within the fungal cell
(Belozerskaya & Gessler, 2007). These factors are those on which we are acting in order to
induce the fruiting of A. bisporus and other mushrooms. The switch between developmental
phases occurs through an unstable hyperoxidant state determined by an increase in the cell
ROS in fungi, similarly to other organisms. It is probable that ROS generation is necessary at
a transitory state for fruiting induction.
We measured H2O2 concentrations in freeze-dried cultivation substrates, mycelium and
fruiting bodies as estimation of ROS level, with various A. bisporus strains. Correlations were
observed between the active mycelial biomass and H2O2 concentrations in compost (Savoie et
al. 2000, 2007). In sporocarps of A. bisporus, we detected H2O2 with the highest concentration
residing in the gill tissues (Savoie et al. 2004). The level in vegetative mycelium was
significantly lower than the amounts associated with the cap. These data are in agreement
with a role of ROS in cell differentiation and fruiting body development.
On the other hand, extracellular oxidative enzymes thought to be involved in lignin
depolymerization include an array of oxidases and peroxidases. These enzymes are
responsible for generating highly reactive and non-specific free radicals that affect lignin and
contribute to the adaptation to the biotic and abiotic environment. H2O2 concentration,
measured in freeze dried composts after a heat treatment inhibiting phenol oxidases, increased
during the vegetative growth for all the strains of A. bisporus and reached maximal values
during the fruiting stages (Savoie et al. 2007), which was in agreement with the hypothesis of
significant role of ROS generation for compost degradation and nutrient intake by A.
bisporus.
Changes in ROS levels during host-pathogen interactions or interspecific interactions

In plant-pathogenic fungi interactions, the apparent paradox whereby active oxygen
species contributes both to pathogen virulence and host resistance strengthens the specificity
of the interaction that can vary with the fungi and plants and the important role of oxidative
processes in these interactions. Oxidative processes with production of active oxygen species
are also factors in host–pathogen interactions when the host is a mushroom. They have been
implicated in the offensive/defensive strategies employed by fungi during interactions of their
vegetative mycelia. There are evidences that some filamentous fungi accumulate large
amounts of peroxide when challenged, a phenomenon strikingly similar to an oxidative burst
(Silar, 2005). Otherwise hydrogen peroxide can have an antifungal action at very low
concentrations (10-7 to 10-12 M depending on the fungus) by suppression of early stages of
fungus development (Aver'yanov et al. 2007). Continuous enzymatic H2O2 generation was
proposed as a strategy to control the germination of Trichoderma spores and prevent its
growth during Pleurotus ostreatus cultivation on wheat straw (Jansen et al. 2000). Production
10
of H2O2 in its cultivation substrate (Savoie et al. 2007) could contribute to the protection of A.
bisporus against Trichoderma aggressivum and other antagonists.
Verticillium fungicola is a major fungal pathogen of A. bisporus and the causal agent of
the disease commonly known as dry bubble. By comparing strains in a progeny for their H2O2
concentrations in healthy sporocarps, and in bubbles, we observed significant differences
between the strains that were correlated with their level of susceptibility to the pathogen
(Savoie & Largeteau, 2004). The higher H2O2 concentrations measured in the less susceptible
strains contributed probably to a pre-formed resistance. These measurements were performed
on freeze dried samples and H2O2 was quantified after an extraction at 80 °C for 40 min.
Under such conditions, H2O2 concentrations were an evaluation of a potential of ROS
production, or pro-oxidant activity. This strengthens the concept of the impact of oxidative
processes in the systems leading to the resistance of A. bisporus to V. fungicola. Oxidative
processes are implicated in the defensive strategy employed by A. bisporus during interaction
with a fungal pathogen that affects its differentiation and induces the formation of malformed
sporocarps.
Synthesis of ROS by diverse enzymes

Along with the intracellular generation of ROS directly due to the respiration, there are
intracellular and extracellular enzymes that produce ROS in fungal cells and are involved in
the development regulation and interferences with other organisms in their environment.
Extracellular oxidative enzymes thought to be involved in lignin depolymerization include an
array of oxidases and peroxidases. One can expects from the analysis of the A. bisporus
genome to observe, as in other basidiomycetes, the occurrence of large and complex families
of structurally related genes including cytochrome P450s, peroxidases, glycoside hydrolases,
proteases, cupper radical oxidases and multicopper oxidases (Hoegger et al. 2006; Kersten &
Cullen, 2007; Kilaru, 2006; Nakamura & Go, 2005). Some examples are proposed here.
NADP oxidases (NOX)

NOX are a family of heme-containing transmembrane proteins. Their basic function is
transport of electrons across the membrane from a cytosolic electron donor to an electron
acceptor in the extracellular space. NADPH serves as electron donor and oxygen as electron
acceptor. The overall result is the production of ROS. NOX enzymes are widely distributed in
different kingdoms of life and the basic NOX structure emerged before the divergence of life
into fungi, plants and animals (Bedard
et al. 2007). Fungi express only ancestral-type isoforms consisting of 6 transmembrane
domains (containing two asymmetrical hemes) and a long cytoplasmic C-terminal (containing
the FAD and NADPH binding sites). Four groups of NOX homologues are found: three
appear to be superoxide generators (NOXA, B, C), while ferric reductases are involved in
reduction of metal ions (Bedard et al. 2007).
Within fungi, there is an interesting correlation between the presence of NOX genes and
the capability to develop fruiting bodies, which are multicellular structures (Aguirre et al.
2005). The involvement of the superoxide generating fungal NOX in development processes,
was observed for NOXA from A. nidulans that was essential for sexual development (Lara-
Ortiz et al. 2003) and PaNOX1 mutants of P. anserina that failed to produce an oxidative
burst of peroxide and superoxide normally seen around the fruiting bodies of wild-type fungi
and failed to develop aerial hyphae or female organs (Malagnac et al. 2004). Within the
Basidiomyceta, NOX genes are absent from the genomes of Cryptococcus neoformens and U.
maydis, but 3 NOX genes are identified in genomes of Puccina graminis and two saprophytic
mushrooms: C. cinerea and Phanerochaete chrysosporium (Takemoto et al. 2007).
NOX are also responsible for the ROS production associated with defence response of
some fungi (Silar, 2005). During hyphal interference, the accumulation of superoxide in the
11
ascomycete P. anserina requires a NOX and a MAP kinase cascade that is also involved in
fruiting body formation. Peroxide is likely involved in signalling rather than playing a direct
toxic role (Silar, 2005). The processes of sexual reproduction, host defence and cell
degeneration in P. anserina are all interconnected (Takemoto et al. 2007).
Specific NADPH oxidases are probably active in A. bisporus for synthesis of ROS and
can serve both defence and differentiation signalling roles. NADPH oxidase activity
increasing during the mushroom postharvest has been measured in A. bisporus (Hammond,
1978). Attention should be paid on this group of enzymes and its biological function.
Xanthine oxidase
Xanthine oxidases and xanthine deshydrogenase are molibdopterins-containing
flavoproteins that catalyse the oxidation of hypoxanthine to xanthine and oxidation of
xanthine to uric acid and generate hydrogen peroxide. Xanthine is derived from purine
degradation. Xanthine deshydrogenase genes are present in A. nidulans and N. crassa but
absent in other yeasts that are although able to utilize purine by a pathway not involving a
molybdo-enzyme Xan A (Cultrone et al. 2005). This enzyme is a α-ketoglutarate- and Fe(II)-
dependant dioxygenase which homologues are present in both ascomycetes and
basidiomycetes, but no homologues were outside the fungal kingdom (Cultrone et al. 2005).
Two homologues of XanA were found in the genome of C. cinerea, one of them quite
divergent from all other fungal enzymes. Are there homologues of XanA in A. bisporus?
Cytochrome P450
Cytochrome P450 (CYP) enzymes are a group of proteins involved in the oxidative
metabolism of a large numbers of compounds. The most common reaction catalysed by CYP
is a monooxygenase reaction, e.g. insertion of one atom of oxygen into an organic substrate
while the other oxygen atom is reduced to water. They can contribute to a transient production
of superoxide radicals. In A. bisporus, different cytochrome P450 genes are associated with
the early stages of sporophore development (de Groot et al. 1997; Ospina-Giraldo et al.
2000), and with senescence after harvest (Eastwood et al. 2001).
Oxalate oxidation
Extracellular H2O2 may be generated by the oxidation of organic acid such as glyoxylate
and oxalate. In A. bisporus, oxalate crystals are frequently present on the surface of vegetative
hyphae. The mycelial cord is the first well-organized tissue of the fruiting mycelium. The
hyphae of the cord are held together through a semi-fluid medium, the extracellular matrix,
which involves a type of cell death different from cell necrosis. This primary matrix
production leads to the formation of minute cord tissues in which oxalate crystals are no
longer present (Umar & Van Griensven, 1998). Fructification is inhibited by soluble oxalate
(Verbeke & Overstyns, 1991). Oxalate is present in fruiting bodies, but the levels of soluble
and insoluble oxalates of all the mushrooms analysed were low compared to other common
oxalate-containing vegetables (59 to 104 mg/g DM) and the cultivated mushrooms contained
mainly insoluble oxalate (Savage et al. 2002). A concomitant degradation of oxalate and H2O2
generation might be implicated in mushroom differentiation.
With a view to the degradation of oxalic acid, genes for enzymes such as oxalate oxidase
and oxalate decarboxylase are of interest. Oxalate decarboxylases break down oxalate to
generate formate and carbon dioxide. Oxalate decarboxylase activity was measured in liquid
culture medium and mycelium of A. bisporus. Enzyme activity in the mycelium peaked at
two-weekly intervals after primary growth phase and into secondary metabolism (Kathiara et
al. 2000). This could contribute to the decrease in calcium oxalate crystals during cord
formation. Oxalate decarboxylase was also detected in the fruiting body up to the cup stage of
development (Kathiara et al. 2000). Oxalate oxidase catalyses the oxygen-dependent
12
oxidation of oxalate to CO2 and hydrogen peroxide. No mention of oxalate oxidase produced
by A. bisporus was found in the literature, but it is possible to find oxalate oxidase genes in
the sequenced genomes of some basidiomycetes. For instance in C. cinereus genome
annotation, one can found a sequence of 715 bp similar to oxalate oxidase [Ceriporiopsis
subvermispora] with an E value of 1e-27. In C. subvermispora, oxalate oxidase was observed
in peroxisome-like structures, multivesicular bodies and membranous vesicles, suggesting
oxalate oxidase might be transported to the periplasmic space. Once in that location, oxalate
oxidase could provide the extracellular medium with at least trace amount of hydrogen
peroxide (Aguilar et al. 1999). It would be interesting to detect the presence of oxalate
oxidase genes and enzyme activities that could contribute to the extracellular generation of
ROS by A. bisporus.
Manganese peroxidase (MnP) oxidizes Mn2+ to Mn3+, using H2O2 as oxidant, but MnP of
C. subvermispora can also oxidize oxalate and glyoxylate to form H2O2 and thus, in the
presence of these organic acids, MnP is independent of added H2O2 (Urzúa et al. 1998). The
presence of one, possibly two, MnPs in A. bisporus was proposed by Bonnen et al. (1994).
Factors affecting production of MnP in A. bisporus are unknown. A. bisporus cultures with
wheat and rye bran favoured MnP production over those with straw, which is the usual
substrate in A. bisporus production (Lankinen et al. 2005). Lignin degradation in compost
takes place during A. bisporus vegetative growth and correlates with laccase and MnP
activities (Bonnen et al. 1994). Contrary to other basidiomycetes, Mn had no effect on MnP
production by A. bisporus (Lankinen et al. 2005). We observed a positive correlation between
MnP activity and H2O2 concentration in compost of A. bisporus during the fruiting stage
(Savoie et al. 2007). No MnP activity was detected in fruiting bodies of A. bisporus, although
some MnP activity was measurable in necrotic tissues due to the infection by V. fungicola
(Juarez del Carmen, 2003). In addition, higher H2O2 concentrations were measured in bubbles
than in healthy cap tissues (Savoie & Largeteau, 2004). However a basal level of mnp1 gene
transcription was observed in both healthy and necrotic samples of fruiting bodies and no
significant difference was revealed by a Q-PCR analysis (Largeteau, 2007). Further
investigations are needed.
Laccases catalyse the reduction of oxygen to water accompanied by the oxidation of a
substrate, typically a p-dihydroxy phenol or another phenolic compound. Laccase is produced
in copious amounts by A. bisporus; its activity appears to be developmentally regulated. The
specific activity of both laccase and MnP increases through the pinning stage and then
decreases with fruiting body maturation (Bonnen et al. 1994). It was proposed that laccase
and MnP can co-operate. In the presence of Mn2+ and oxalate, laccase produces Mn3+-oxalate.
The latter initialises a set of follow-up reactions leading to H2O2 formation, which may initiate
or support peroxidase reactions ( Schlosser & Höfer, 2002). This cooperation could be
effective both in compost and in fruiting bodies of A. bisporus. The relation between MnP and
laccase activities and H2O2 concentration in compost and affected fruiting bodies has to be
highlighted.
Tyrosinases
To date, information regarding the physiological role of tyrosinase in fungi is limited, and
also the biochemical information related to kinetic characterization and the relationship
between various isoforms needs further elucidation (Seo et al. 2003). It is well known that
when compartimentation is broken, tyrosinase oxidizes phenolic compounds localized in
mushroom tissues to quinones, followed by coupling reactions or by oxidation of protein
functional groups by the quinones which are powerful electrophilic agents. Production of
phenolics and quinoid compounds by tyrosinase can lead to production of ROS responsible
for mutagenicity of mushroom extract (Papaparaskeva-Petrides et al. 1993), but it also can
lead to an increase of the antioxidant activity in a water extracts due to quinone reaction with
13
other phenolic compounds yielding radical scavenging degradation products (Ramírez-
Angiano et al. 2007) . Besides, tyrosinase could be inactivated as the result of irreversible
reaction between a product of the enzyme-catalysed reaction and the active site of the enzyme
(Rescigo et al. 1997). Hydrogen peroxide inactivates mushroom tyrosinase in a biphasic
manner. Enzyme inactivation is dependent on H2O2-concentration and independent of pH, and
inhibition is faster under anaerobic conditions than under aerobic ones (Andrawis & Kahn,
1985). Quinones also tend to polymerize yielding melanins. In fungi, the role of melanin is
correlated with differentiation of reproductive organs and spore formation, virulence of
pathogenic fungi, and tissue protection after injury. The two first steps in the pathway are the
hydroxylation of monophenol to o-diphenol (monophenolase or cresolase activity) and the
oxidation of diphenol to o-quinone (diphenolase or catecholase activity), both using molecular
oxygen followed by a series of non-enzymatic steps resulting in the formation of melanin (see
Seo et al. 2003).
ROS generation versus ROS elimination
ROS are generated during normal cellular metabolism, mainly by the mitochondrial
respiratory chain, or by H2O2-generating reactions catalysed by oxidases. Antioxidant defence
mechanisms maintain ROS at a basal, non-harmful level to repair cellular damage. Growth
and differentiated states are stable conditions in which low levels of ROS are maintained by a
balance between ROS generation and elimination. A switch between these two states occurs
when a transient increase in ROS level, beyond the cellular capability to neutralize them, is
produced. This response is transient because increased ROS levels result in higher expression
of the enzymes that decompose them, as it was observed with different eukaryotic
microorganisms (Aguirre, 2005). Endogenous and exogenous ROS do probably not cause the
same cellular effects. Studies on response to exogenous ROS in microbial eukaryotes
identified H2O2-sensing pathways involving the expression of numerous genes needed to
content with this and other types of stress. It is probable that several of these also are
conserved in filamentous fungi (Aguirre, 2005). In some experiments where superoxide
scavengers were added or where enzymes eliminating superoxides were over-expressed, cell
differentiation and fruiting were prevented. The balance between ROS generation and ROS
elimination should be also involved in early stages of fruiting initiation in A. bisporus. That
has been used in cultivation technique with increases in oxygen content as one component of
the factors inducing the production of fruiting bodies, but a finer regulation could be obtained
by acting directly on the systems regulating the balance.
Extensive free radical generation occurs in A. bisporus tissues when they are physically
damaged in a simulation of the mastication process. This is presumably largely the
consequence of reactions between cellular contents when compartimentation is broken down.
Thus, the reactions which occur on mastication are analogous to the mushroom defence
reactions that are initiated in response to physical damage by a parasite or infection by an
incompatible pathogen (Pirker et al. 2004). Such radical generation will, therefore, result in a
reduction in the levels of free radical scavengers/antioxidants relative to those in the
undamaged tissue prior to mastication. But contrary to many of the herbs, in Agaricus
mushrooms, free radicals produced in presence of O2 are stabilized to a steady state situation,
in which the rate of their formation and decomposition are stabilized. The mushrooms contain
compounds that are effective radical scavengers (Pirker et al. 2004), giving to A. bisporus a
high level of antioxidant defence.
Reaction of an organic molecule with a free radical generally leads to the generation of a
new free radical species, and hence the reactions of many antioxidants might be expected to
proceed via free radical pathways. Antioxidant defence in fungi comprises both enzymes
(superoxide dismutase, catalase, heme-containing and thiol peroxidases) and antioxidants
14
(glutathione, ascorbate, pigments, phenolic compounds, proline), (Belozerskaya & Gessler,
2007).
Free radical scavenging activity and antioxidants
The primary function of antioxidant properties is to prevent cell damage induced by

reactive oxygen species (ROS). Under normal conditions, ROS are cleared from the cell by
action of superoxide dismutase which catalyses the conversion of O2-. to H2O2; H2O2 is then
decomposed in the presence of catalase. In addition, glutathione peroxidase catalyses the
peroxidation of reduced glutathione. Reduced glutathione is generated by glutathione
reductase.
Superoxide dismutase and catalase

Superoxide dismutase (SOD) and catalase are the main antioxidant enzymes which
catalyse the reaction with primary ROS (1O2, O2-, H2O2). These enzymes display a high
specificity toward ROS, have distinct intracellular localization, and contain metals in their
active centres as catalysts. They contribute to the modulation of mitochondrial ROS involved
in cell signalling and development. SOD catalyses the reaction of superoxide radicals with
protons to produce hydrogen peroxide which is highly reactive and potentially damaging. A.
bisporus possesses an iron/manganese-type SOD gene which is up-regulated following
harvest (Eastwood et al. 2001). Transcript levels were shown to be very low immediately
after harvest and increased slightly between 3 and 15 hours before a larger increase in
expression (Henderson et al. 2005). At harvest, transcript levels were significant in stipe and
gill tissues but very low in cap tissue. In an attempt to quantify SOD activity in water extracts
from A. bisporus mushrooms by the inhibition of NBT reduction by O2-. generated by light
oxidation of riboflavin, we obtained inversely 40 to 50 % increase in NBT reduction. This
was probably due to the high NBT reduction activity of the gills that gave an increase of 185
% whereas no significant variation in NBT reduction was observed in the stipe and cap tissues
(Savoie et al. 2008). The absence of measurable SOD activity is in agreement with the low
level of transcription at harvest (Henderson et al. 2005) but also could be due to the
interference of the reducing power present in the water extracts during the assay. With
extracts from mycelium during the vegetative phase, native polyacrylamide gel
electrophoresis and staining for SOD revealed several SOD isoenzymes. Two of them were
apparently included in a peroxisome containing also other superoxide anion generating
enzymes (Besson et al. 1996, unpublished). The product of SOD catalysis, H2O2, is also
potentially highly reactive and damaging. However, the activity of the hydrogen peroxide-
scavenging enzyme, catalase, is high in the mushroom sporophore (Eastwood et al. 2001).
The higher activity is located in the gills and the level of activities may vary with the strains
(Savoie et al. 2008). The strong induction of SOD and catalase in response to enhanced levels
of ROS might play an important role in the defence against oxidative stress in A. bisporus
fruiting bodies as in other aerobic organisms. Consequently, measurement of these enzyme
activities or levels of gene expression are ways to estimate the oxidative stress during
developmental processes or interspecific interactions.
Glutathione peroxidase and glutathione reductase

Glutathione peroxidases dissociate H2O2 and organic peroxides as well as catalyse the
reduction of oxidised cysteine residues in proteins, including proteins involved in ROS signal
transduction, with the corresponding changes in their conformations. Glutathione, a tripeptide,
is the most widespread low-molecular-weight thiol compound in the eukaryotic cells. It plays
an important antioxidant role in the cell, decreasing the ROS level. The NADPH dependent
glutathione reductase maintains a high level of glutathione reduction. In water extracts of A.
15
bisporus mushrooms, glutathione peroxidase activities were dramatically higher than
glutathione reductase and no difference was observed between three strains (Savoie et al.
2008). Glutathione peroxidase activity was apparently not limiting for free radical processing,
but it was dependent on the generation of reduced glutathione by glutathione reductases.
Glutathione reductase activity was lower in stipes than in caps (Savoie et al. 2008). The
concentration of reduced glutathione (GSH) under normal physiological conditions is 10- to
100-fold higher than the concentration of its oxidized form; due to this, the protein thiols in
the cytoplasm are present mainly as reduced state (Le Moan et al. 2006). GSH acts as a thiol
redox buffer. The redox-sensitive groups in the cysteine residues of proteins are protected
against an irreversible oxidation with the increase of ROS by the formation of mixed
disulfides with glutathione. This process is frequently accompanied by a reversible inhibition
of protein activities, which is removed when the cell redox status is restored (Le Moan et al.
2006). Various studies highlight the pivotal role of cysteine oxidation and disulfide bond
formation in many aspects of cell function during oxidative stress. For instance, the heat stress
chaperone HSP70 family has been shown to form intermolecular and mixed disulfides with
other cytoplasmic proteins, but how these redox modifications influence protein function is
not yet known (Cumming et al. 2004). HspA is a gene of HPS70 identified in A. bisporus
primordia (Ospina-Giraldo et al. 2000) and its transcription is affected during the
development stages and by the contamination with V. fungicola. (Largeteau et al.,
unpublished). These enzymes, through their action on cell redox potential, might be involved
in fruiting body differentiation and defence. Variations in their activities might also be
markers of the antioxidant defence and its regulation during both mushroom development and
inter-specific interactions.
Antioxidants
Mushrooms contain a variety of secondary metabolites, including various phenolic
compounds, having the ability to act as multifunctional antioxidants: reducing agents,
hydrogen donating antioxidants, singlet oxygen quenchers (Rice-Evans et al. 1996). With
various mushrooms, good correlations are often observed between antioxidant capacity and
total phenolic compounds. Mushroom alcoholic extracts are effective as good scavengers of
superoxide and free radicals (Choi et al. 2004; Czapski 2004; Dubost et al. 2007b; Elmastas et
al. 2007; Huang et al. 2006; Lee & Jang 2004; Lee et al. 2007; Mau et al. 2002, 2004; Savoie
et al. 2008).
Several works report that A. bisporus have high antioxidant potential relative to other
mushrooms and total phenols appear as major antioxidant components (Dubost et al. 2007b;
Ramírez-Anguiano et al. 2007; Savoie et al. 2008; Tsai et al. 2008). Ethanolic extracts from
fruiting bodies of A. bisporus harvested at different stages of maturity showed effective
antioxidant properties and antioxidant activities determined by the conjugated diene method.
Fruiting bodies harvested at stages 1, 4, and 5 were more effective than those at stages 2 and
3. However the reducing power and scavenging activity were not significantly different
between the development stages (Tsai et al. 2008). In another work with methanolic extracts,
the free radical scavenging activity and reducing power of the gills were always higher than
that of the stipes and caps (Savoie et al. 2008). Higher concentrations of H2O2 had also been
measured in gills than in other tissues in some strains of A. bisporus (Savoie et al. 2004). This
mushroom is characterized by pigmented gills in which redox reactions are important, and
under normal conditions, pro-oxidants and antioxidants equilibrate each other in order to
maintain high activities without cell damage. This antioxidant property might have benefits
for mushroom development. Identification and quantification of specific active compounds
could help to understand the role of antioxidants in A. bisporus fruiting bodies. Ergothioneine
is one specific antioxidant identified and quantified in A. bisporus (Dubost et al. 2007b) and
several observations indicated that it may be a stress metabolite acting as an antioxidant
16
within the mushroom to prevent damage from free radicals produced during environmental or
biological stress (Dubost et al. 2007a).
Conclusion
Oxidative stress, which arises from an imbalance between pro-oxidants and antioxidants
in mushroom cells, is caused by reactive oxygen species, in the form of superoxide, hydrogen
peroxide, hydroxyl radical, and singlet oxygen, that is byproduct of normal metabolism and
attacks biological molecules, leading to cell or tissue injury. These ROS react against
enzymes, the phospholipid membrane, receptors, and nucleic acids. But transitory increases in
ROS levels appear to be correlated with cell differentiation or defence against parasites in
mushrooms as in other eukaryotic microorganisms. Modification of the intracellular redox
potential during oxidative stress regulates some transcription factors and consequently the
expression of various genes is modulated. In addition, extracellular ROS generation may
occur and ROS might act as signal molecules inducing adaptive reaction to biotic and abiotic
environmental factors. It is difficult to directly identify ROS in any biological sample due to
their very short half-lives. A common approach is to add radical scavengers that undergo
characteristic preferential reactions with ROS over an extended period and then measure the
accumulation of the diagnostic products in the culture, but that is difficult to do when
studying fruiting initiation and mushroom differentiation. We have experimented with
measurements of hydrogen peroxide concentrations in freeze-dried samples after extractions
at 80 °C for 40 min. This method proved to be efficient for identifying variations in pro-
oxidant activities both in vegetative mycelium in compost and in fruiting bodies (Savoie et al.
2000, 2004, 2007; Savoie & Largeteau, 2004). Another approach is the measurement of ROS
generating and antioxidant enzyme activities or of the transcription level of the associated
genes. Some of these enzymes have already been detected in A. bisporus and other
mushrooms. Numerous questions remain to be answered about the regulatory networks
consisting of ROS generators and specific targets, and about the way the mushrooms protect
themselves against ROS damage. Progress in this area will probably have consequences on
the selection of mushroom strains more resistant to environmental variation and will
contribute to a better management of the production of fruiting bodies.
References
Aguilar C, Urzúa U, Koenig C, Vicuña R. 1999. Oxalate oxidase from Ceriporiopsis

subvermispora: biochemical and cytochemical studies. Arch. Biochem. Biophys., 366,
275-282.
Aguirre J, Ríos-Momberg M, Hewitt D, Hansberg W. 2005. Reactive oxygen species
and development in microbial eukaryotes. Trends Microbiol., 13, 111-118.
Andrawis A, Kahn V. 1985. Inactivation of mushroom tyrosinase by hydrogen
peroxide. Phytochemistry, 24, 397-405.
Aver'yanov AA, Lapikova VP, Pasechnik TD, Kuznetsov VV, Baker CJ. 2007.
Suppression of early stages of fungus development by hydrogen peroxide at low
concentrations. Plant Pathol. J., 6, 242-247.
Bedard K, Lardy B, Krause K-H. 2007. NOX family NADPH oxidases: not just in
mammals. Biochimie, 89, 1107-112.
Beelman RB, Royse DJ, Chikthimmah N. 2003. Bioactive components in button
mushroom Agaricus bisporus (J. Lge) Imbach (Agaricomycetideae) of nutritional,
medicinal or biological importance. Int. J. Med. Mushr., 5, 321-337.
Belozerskaya TA, Gessler NN. 2007. Reactive oxygen species and the strategy of
antioxidant defence in fungi: a review. Appl. Biochem. Microbiol., 43, 506-515.
17
Bonnen AM, Anton LH, Orth AB. 1994. Lignin-degrading enzymes of the
commercial button mushroom, Agaricus bisporus. Appl. Environ. Microbiol., 60,
960–965.
Choi YM, Ku JB, Chang HB, Lee J. 2005. Antioxidant activities and total phenolics
of ethanol extracts from several edible mushrooms produced in Korea. Food Sci.
Biotechnol., 14, 700-703.
Cultrone A, Scazzochio C, Rochet M, Montero-Moŕan G, Drevet C, Fernández-
Martín R. 2005. Convergent evolution of hydroxylation mechanisms in the fungal
kingdom: molybdenum cofactor-independent hydroxylation of xanthine via α-
ketoglutarate-dependent dioxygenase. Molecular Microbiol., 57, 276-290.
Cumming RC, Andon NL, Haynes PA, Park M, Fischer WH, Schubert D. 2004.
Protein disulfide bond formation in the cytoplasm during oxidative stress. J. Biol.
Chem., 279, 21749-21758.
Czapski J. 2004. Antioxidant activity and phenolic content in some strains of
mushrooms (Agaricus bisporus). Veg. Crops Res. Bull., 62, 165-173.
Dubost NJ, Beelman RB, Royse DJ. 2007a. Influence of selected cultural factors and
postharvest storage on ergothioneine content of common button mushroom Agaricus
bisporus (J. Lge) Imbach (Agaricomcetideae). Int. J. Med. Mushr. 9, 163-176.
Dubost NJ, Ou B, Beelman RB. 2007b. Quantification of polyphenols and
ergothioneine in cultivated mushrooms and correlation to total antioxidant capacity.
Food Chem., 105, 727-735.
Eastwood DC, Kingsnorth CSK, Jones H, Burton KS. 2001 Genes with increased
transcript levels following harvest of the sporophore of Agaricus bisporus have multiple
physiological roles. Mycol. Res., 105, 1223–1230.
Elmastas M, Isaldak O, Turkekul I, Temur N. 2007. Determination of antioxidant
activity and antioxidant compounds in wild edible mushrooms. J. Food Comp. Anal.,
20, 337-344.
Georgiou CD , Papapostolou I, Patsoukis N, Tsegenidis T, Sideris T. 2005. An
ultrasensitive fluorescent assay for the in vivo quantification of superoxide radical
in organisms. Anal. Biochem., 347, 144-151.
Gopalakrishnan C, Pawar RS, Bhutani KK. 2005. Development of Agaricus bisporus
as a nutraceutical of tomorrow. Acta Hort. (ISHS), 680, 45-47.
de Groot PWJ, Schaap PJ, van Griensven LJLD, Visser J. 1997. Isolation of
developmentally regulated genes from the edible mushroom Agaricus bisporus.
Microbiology, 143, 1993-2001.
Hammond JBW. 1978. Carbohydrate catabolism in harvested mushrooms.
Phytochemistry, 17, 1717-1719.
Henderson J, Eastwood D, Bains N, Burton K. 2005. Superoxide dismutase – mushroom
under stress. Acta Edulis Fungi 12 Supplement, 61-65.
Hoegger PJ, Kilaru S, James TY, Thacker JR, Kües U. 2006. Phylogenetic
comparison and classification of laccase and related multicopper oxidase protein
sequences. FEBS J. 273, 2308-2326.
Huang SJ, Tsai SY, Mau JL. 2006. Antioxidant properties of methanolic extracts from
Agrocybe cylindracea. LWT - Food Sci. Technol., 39, 378-386.
Jansen M, Field JA, van Griensven LJLD. 2000. Control of Trichoderma with glucose
oxidase. In: LJLD Van Griensven (Ed). Science and Cultivation of Edible Fungi.
A.A. Balkema, Rotterdam, pp 675-678.
Juarez del Carmen S. 2003. Diversity of pathogenic fungus, Verticillium fungicola
and interactions with its host, the cultivated mushroom, Agaricus bisporus.
PhD Thesis, University Pau et Pays de l'Adour.
18
Kathiara M, Wood DA, Evans CS. 2000. Detection and partial characterization of
oxalate decarboxylase from Agaricus bisporus. Mycol. Res., 104, 345-350.
Kersten P, Cullen D. 2007. Extracellular oxidative systems of the lignin-degrading
basidiomycete Phanerochaete chrysosporium. Fungal Genet. Biol. 44, 77-87.
Kilaru S, Hoegger PJ, Kües U. 2006. The laccase multi-gene family in Coprinopsis
cinerea has seventeen different members that divide into two distinct subfamilies.
Current Genet. 50, 45-60.
Lankinen P, Hilden K, Aro N, Salkinoja-Salonen M, Hatakka A. 2005. Manganese
peroxidase of Agaricus bisporus: grain bran-promoted production and gene
characterization. Appl. Microbiol. Biotechnol., 66, 401-407.
Lara-Ortiz T, Riveros-Rosas R, Aguirre J. 2003. Reactive oxygen species generated
by microbial NADPH oxidase NoxA regulate sexual development in Aspergillus
nidulans. Mol. Microbiol. 50, 1241-1255.
Largeteau M. 2007. Dry bubble disease of the button mushroom Agaricus bisporus,
variability of the pathogen, Verticillium fungicola, morphological and transcriptional
variations in the host. PhD Thesis, University Pau et Pays de l'Adour,
Lee EJ, Jang HD. 2004. Antioxidant activity and protective effect of five edible
mushrooms on oxidative DNA damage. Food Sci, Biotechnol., 13, 443-449.
Lee YL, Huang GH, Liang ZC, Mau JL. 2007 Antioxidant properties of three extracts
from Pleurotus citrinopileatus. LWT Food Sci Technol., 40, 823-833.
Lelley JI, Vetter J. 2005. The possible role of mushrooms in maintaining good health
and preventing diseases. Acta Edulis Fungi, 12 Suppl: 412-419.
Le Moan N, Clément G, La Maout S, Tacnet F, Toledano MB. 2006. The
Saccharomyces cerevisiae proteome of oxidized protein thiols. Contrasted functions for
the thioredoxin and glutathione pathways. J Biol Chem., 281, 10420-10430.
Malagnac F, Lalucque H, Lapere G, Silar P. 2004. Two NADPH oxidase isoforms are
required for sexual reproduction and ascospore germination in the filamentous fungus
Podospora anserina. Fungal Genet Biol., 41, 982-997.
Mau JL, Lin HC, Song SF. 2002. Antioxidant properties of several specialty
mushrooms. Food Res Int., 35, 519-526.
Mau JL, Chang CN, Huang SJ, Chen CC. 2004. Antioxidant properties of methanolic
extracts from Grifola frondosa, Morchella esculenta and Termitomyces albuminosus
mycelia. Food Chem., 87, 111-118.
Nakamura K, Go N. 2005. Function and molecular evolution of multicopper blue
proteins. Cell Mol Life Sci., 62, 2055-2066.
Ospina-Giraldo MD, Collopy PD, Romaine CP, Royse DJ. 2000. Classification of
sequences expressed during the primordial and basidiome stages of the cultivated
mushroom Agaricus bisporus. Fungal Genet Biol., 29, 81-94.
Papaparaskeva-Petrides C, Ioannides C, Walker R. 1993. Contribution of phenolic
and quinoid structures in the mutagenicity of the extracts from the edible mushroom
Agaricus bisporus. Food Chem Toxicol., 31, 561-567.
Pirker KF, Reichenauer TG, Goodman BA, Stolze K. 2004. Identification of oxidative
processes during simulated mastication of uncooked foods using electron paramagnetic
resonance spectroscopy. Analytica Chemica Acta, 520, 69-77.
Ramírez-Anguiano AC, Santoyo S, Reglero G, Soler-Rivas C. 2007. Radical
scavenging activities, endogenous oxidative enzymes and total phenols in edible
mushrooms commonly consumed in Europe. J Sci Food Agric., 87, 2272-2278.
Rescigo A, Sollai F, Sanjust E, Rinaldi AC, Curreli N, Rinaldi A. 1997. Diafiltration
in the presence of ascorbate in the purification of mushroom tyrosinase.
Phytochemistry, 46, 21-22.
19
Rice-Evans C, Miller NJ, Papanga G. (1996) Structure-antioxidant activity
relationships of flavonoids and phenolic acids. Free Radical Biol Med., 20, 933-956.
Savage GP, Nilzen V, Osterberg K, Vanhanen L. 2002. Soluble and insoluble oxalate
content of mushrooms, Int J Food Sci Nut., 53, 293-296.
Savoie J-M, Besson M, Caluori J. 2000. Detection of hydrogen peroxide in cultures of
the edible mushroom, Agaricus bisporus. In: LJLD Van Griensven (Ed.) Science and
Cultivation of Edible Fungi. A.A. Balkema, Rotterdam, pp 55-62.
Savoie J-M, Largeteau ML. 2004. Hydrogen peroxide concentrations detected in
Agaricus bisporus sporocarps and relation with their susceptibility to the pathogen
Verticillium fungicola. FEMS Microbiol Lett., 237, 311-315.
Savoie J-M, Juarez del Carmen S, Billette C, Largeteau ML. 2004. Oxidative
processes in Agaricus bisporus dry bubbles. In: Romaine CP, Keil CD, Rinker DL and
Royse DJ. (Eds.) Science and Cultivation of Edible and Medicinal Fungi. Pennsylvania
State University, University Park, PA, USA, pp. 527-535.
Savoie J-M, Salmones D, Mata G. 2007. Hydrogen peroxide concentration measured
in cultivation substrates during growth and fruiting of mushrooms, Agaricus bisporus and
Pleurotus spp. J Sci Food Agric., 87, 1337-1344.
Savoie JM, Minvielle N, Largeteau M. 2008. Radical scavenging properties of
extracts from the white button mushroom Agaricus bisporus. J Agric Food Chem.,
88, 970-975.
Schlosser D, Höfer C. 2002. Laccase-catalyzed oxidation of Mn2+ in the presence of
natural Mn3+ chelators as a novel source of extracellular H2O2 production and its impact
on manganese peroxidase. Appl Environ Microbiol., 68, 3514–3521.
Seo S-Y, Sharma VK, Sharma N. 2003. Mushroom tyrosinase: recent prospects.
J. Agric Food Chem., 51, 2837-2853.
Severin FF, Hyman AA. 2002. Pheromone induced programmed cell death in
Saccharomyces cerevisiae. Curr Biol., 12, R233-R235.
Sidery M, Georgiou CD. 2000. Differentiation and hydrogen peroxide production on
Sclerotium rolfsii are induced by the oxidizing growth factors, light and iron. Mycologia,
92, 1033-1042.
Silar P. 2005. Peroxide accumulation and cell death in filamentous fungi induced by
contact with a contestant. Mycol Res., 109, 137-149.
Takemoto D, Tanaka A, Scott B. 2007. NADPH oxidases in fungi: Diverse roles of
reactive oxygen species in fungal cellular differentiation. Fungal Genet Biol., 44,
1065-1076.
Tsai SY, Wu TP, Huang SJ, Mau JL. 2008. Antioxidant properties of ethanolic
extracts from culinary-medicinal button mushroom Agaricus bisporus (J. Lange)
Imbach (Agaricomycetideae) harvested at different stages of maturity. Int J Med
Mushr., 10, 127-137.
Umar MH, Van Griensven LJLD. 1998. The role of morphogenetic cell death in the
histogenesis of the mycelial cord of Agaricus bisporus and in the development of
macrofungi. Mycol Res., 102, 719-735.
Urzúa U, Kersten PJ, Vicuña R. 1998. Kinetics of Mn3+-oxalate formation and decay
in reaction catalyzed by manganese peroxidase of Ceriporiopsis subvermispora. Arch
Biochem Biophys., 360, 215-222.
Verbeke MN, Overstyns A. 1991. Interrelationships between activated charcoal,
carbon dioxide, oxalate and iron chemistry for fructification of Agaricus
bisporus. In: Maher MJ (Ed.) Mushroom Science XIII. Volume 2. Proc 13th Intl
Congress on the Science and Cultivation of Edible Fungi. Dublin, Irish Republic,
1-6 September, 1991, pp 737-746.
20
Recognition and Degradation of Insoluble Crystalline Cellulose by

Polyporus arcularius
Tadanori Aimi1, Yuka Ohnishi1, Mitsutoshi Nagase2, Tsuyoshi Ichiyanagi1 and Yutaka
Kitamoto3
1
Faculty of Agriculture, Tottori University, Koyama-cho Minami 4-101, Tottori-shi, Tottori
680-8553, Japan; 2Shimane Institute for industrial Technology, Hokuryo-cho 1, Matsue-shi,
Shimane 690-0816, Japan; 3Asano Life Science Laboratory, Asano Industry Co. Ltd., 3-20-6,
Tamahara, Tamano, Okayama 706-0014, Japan. Email: taimi@muses.tottori-u.ac.jp
Abstract
The genomic and cDNA clones encoding an endoglucanase (cel4), and two
cellobiohydrolases (cel1 and cel2) of Polyporus arcularius were sequenced and characterized.
The predicted amino acid sequence of Cel1 Cel2, Cel3a and Cel4 are similar to glycosyl
hydrolases belonging to families 7, 6 12 and 5, respectively. Expression of the all the cellulase
genes (cel1 cel2, cel3a and cel4) were induced by Avicel (microcrystalline cellulose) and
cellopentaose but repressed by glucose, cellobiose, cellotriose, and cellotetraose. There was a
low level of transcription of both genes regardless of the carbon source. These results suggest
that P. arcularius cells constitutively express a very low level of cellulase that can degrade
insoluble crystalline cellulose and that the transcription of cellulases in the cells is induced by
products such as cellooligosaccharides produced by these endoglucanases. From our findings,
we propose a possible mechanism for the recognition and degradation of insoluble crystalline
cellulose by fungal cells.
Key Words: Polyporus arcularius; Cellulases; Cellulase gene expression; Real-time PCR;
Enzyme induction
Introduction
Cellulose, which is a polymer of glucose units linked by β-1,4-glycosidic bonds, is

the most abundant carbohydrate in the biosphere. Cellulose is produced at an estimated rate of
4×107 tons per year. Cellulose is the most promising large-scale, renewable carbon source for
long-term solutions to energy, chemical, and food resource problems (Wood & Ingram,
1992). The most useful technology for utilizing cellulose is its biological conversion to
alcohol via cellooligosaccharides; however, depolymerization of cellulose into
cellooligosaccharides with commercial enzymes remains expensive (Henrissat & Davies,
1997). Thus, identification of a new microbial cellulase has been needed for some time.
Cellulose depolymerization is mediated by endoglucanases, which randomly cleave
the internal β-1,4-glucosidic links, and cellobiohydrolases, which act on the free ends of
cellulose polymer chains. Cellulases belong to the large group of glycosyl hydrolases, of
which there are several families according to amino acid sequence similarities. Over the years,
the number of glycosyl hydrolase families has grown steadily, and currently there are 82
known families (Henrissat & Davies, 1997). The filamentous fungus, Trichoderma reesei,
produces at least two types of cellobiohydrolase (CBHI and CBHII), four types of
endoglucanase (EGL1, EGL2, EGL3, and EGL5), and a β-glucosidase (Teeri et al. 1987;
Ilmén et al. 1997; Jia et al. 1999). The genes encoding CBHI and CBHII, which belong to
glycosyl hydrolase families 7 and 6, respectively, have been cloned from the basidiomycetous
mushrooms, Volvariella volvacea (cbhI and cbhII), Lentinula edodes (cel7A and cel6B), and
Agaricus bisporus (cel2 and cel3). Transcriptional regulation of the CBHI and CBHII genes
in these mushrooms was also previously described. Transcripts of cel2 and cel3 from A.
21
bisporus, cbhI and cbhII from V. volvacea, and cel7A and cel6B from L. edodes are strongly
induced when the mycelia are grown in a medium containing crystalline cellulose, and they
are not expressed in a medium containing glucose (Chow et al. 1994; Yague et al. 1994,
1997; Lee et al. 2001), but how insoluble substrates such as crystalline cellulose are
recognized by these fungal cells is not clear.
The polypore mushroom, Polyporus arcularius, is a wood decomposing
basidiomycete that produces at least three types (I, II, and IIIa) of carboxymethyl cellulase
(CMCase) when the medium contains crystalline cellulose as the sole carbon source (Ishihara
et al. 2005a). The genomic and complementary deoxyribonucleic acid (cDNA) clones
encoding the family 12 endoglucanase (CMCase IIIa) gene (cel3A) of P. arcularius have been
sequenced, and Cel3A has been expressed as an active enzyme in Escherichia coli (Ishihara et
al. 2005b). To determine the role and function of each type of cellulase in the degradation of
crystalline cellulose by basidiomycetous mushrooms, the structure of all of the cellulase genes
should be investigated, but the nucleotide sequences of the CBHI and CBHII genes in P.
arcularius have not yet been reported.
In this study, we describe the characterization of the genomic DNA and cDNA
sequences of the cel1 cel2, cel3a and cel4 genes from P. arcularius (Ishihara et al. 2005b;
Ohnishi et al. 2007a; 2007b). We also analyzed their expression in a medium containing
crystalline cellulose, cellooligosaccharides, and glucose by quantitative reverse transcriptase
polymerase chain reaction (RTPCR). The findings of these studies should help clarify how
insoluble substrates such as crystalline cellulose are recognized by mushroom cells.
Materials and methods
Strains and plasmids

Monokaryotic strain P. arcularius 69B-8, which is single basidiospore isolate from
the fruiting body of dikaryotic strain P. arcularius 69B, was used in this study.
RNA preparation
To prepare total ribonucleic acid (RNA) from P. arcularius 69B-8, the mycelium
was grown on potato dextrose agar at 25 °C for 7 d, after which the mycelium along with ten
square agar blocks (5×5 mm) were transferred to 50 ml of GP medium (20 g/l glucose, 2 g/l
peptone, 0.1 g/l yeast extract, 1 g/l KH2PO4, 0.3 g/l MgSO4·7H2O, and 0.1 g/l CaCl2·2H2O,
pH 5.6) in a Sakaguchi flask and grown at 25 °C for 7 d. The mycelia from four Sakaguchi
flasks were harvested by centrifugation at 3,000 × g for 10 min and washed three times with
sterilized distilled water. The washed mycelium was suspended in 25 ml of cellulase-
producing medium (3 g/l carbon source, 2 g/l peptone, 0.1 g/l yeast extract, 1 g/l KH2PO4, 0.5
g/l MgSO4·7H2O, and 0.1 g/l CaCl2·2H2O, pH 5.8; Enokibara et al. 1992) and homogenized
with a Marusan Homoblender HG2 (Sakura Seisakusho, Tokyo, Japan). Avicel
(microcrystalline cellulose), glucose (C1), cellobiose (C2), cellotriose (C3), cellotetraose
(C4), and cellopentaose (C5) were used as carbon sources. The medium containing the
homogenized mycelium was added to 175 ml of fresh liquid cellulase-producing medium in a
Sakaguchi flask and incubated at 25 °C for 4 d. The mycelium was harvested by filtration,
frozen in liquid nitrogen, and ground in a mortar and pestle to a fine powder. RNA was
extracted form frozen mycelia using a RNeasy Plant Mini Kit (Qiagen, Tokyo, Japan)
according to the manufacturer’s instructions and with additional on-column DNase digestion
using an RNase-Free DNase Set (Qiagen). RNA purity and integrity were checked by visual
inspection after separation of 1 μg of total RNA on a 6.7% formaldehyde/ 1% agarose gel.
22
Real-time RT-PCR
The synthesis of cDNA and quantitative real-time PCR analysis were carried out
using a PrimeScript™ RT Reagent Kit (Perfect Real Time; Takara Bio). The cDNA was
synthesized from 300 ng of total RNA in a 20 μl reaction with oligo (deoxythymidine) and
random hexamers as primers according to the manufacturer’s instructions. The synthesized
cDNA was stored at −20 °C until use. Quantification of gene expression was determined
relative to a standard curve for each target gene included in each RT-PCR experiment. The
template for the gene specific standard curves was generated via PCR using 1 ng of plasmid
DNA carrying the full-length cDNA of cellulase genes, 0.4 μM of each PCR primer (Table 1),
1 × Ex Taq buffer, 0.2 mM of each dNTP, and 2.5 U of Ex Taq polymerase. PCR was carried
out with a denaturation at 94 °C for 2 min, followed by 30 cycles of 94 °C for 30 s, 60 °C for
30 s, and 68 °C for 1.5 min, and a final extension at 72 °C for 10 min. The samples were then
kept at 4 °C. For quantification of housekeeping gene expression, β-actin (act1) cDNA was
amplified with primers Act-Bs4R-Temp (5′- GAGGCGCAACGATCTTGAC-3′) and Act-Bs-
4F-Temp (5′-TGCCCTCGAGAAGAGCTAC-3′) using the Takara RNA PCR (AMV) version
3.0 kit (Takara Bio) according to the manufacturer’s instructions. The amplified fragments
were used as a template to produce the standard curve. Standard curves were generated for
each gene (cel1, cel2, cel3a cel4 and act1) by purification and ten-fold serial dilution of the
respective amplicons.
Table 1. Primers used for real-time PCR
Primer Sequence Amplified cDNA
Actin Bs-4F 5’-GTAACGAGCGGTTCCGTGCT-3’

β-actin (act1) cDNA
Actin Bs-4R 5’-CGCAACGATCTTGACCTTCA-3’
CBH1TF 5’-TGGGACGACTCGCTTTG-3’ cel1
CBH1TR1 5’-GAGGACGTTGGCCTCG-3’ (CBH I)
CBHTF 5’-CGGCTGGTCTGGTGCT-3’ cel2
CBHTR 5’-AGGAAGGGCGTGACGC-3’ (CBH II)
CMCTF 5’-ACGGCAAGTACATCGG-3’ cel1
CMCTR 5’-TGGGTTCCCGAGTTGT-3’ (CBH I)
CMC3TF 5’-GAGTTCAGCTCTCCGCC-3’ cel3A
CMC3TR 5’-TGCACATACTGCGAAGC-3’ (CMCase IIIa)
Real-time PCR was carried out by using the kit (Takara) with 0.2 μM of forward and
reverse primers (Table 1) and a variable amount of cDNA synthesis mixture in a final reaction
volume of 10 μl. Thermocycling was carried out using a LineGene Real-Time Thermal Cycler
(BioFlux, Tokyo, Japan), with an initial incubation for 1 min at 95 °C, followed by 40 cycles
of 95 °C for 5 s and 64 °C for 30 s. Fluorescence data were acquired during the elongation
step in each cycle. Each run was completed with a melting curve analysis to confirm the
specificity of amplification and the absence of primer dimers. The amplification of genomic
DNA was prevented by designing primers for exon–exon junctions and by DNase treatment
of extracted RNA. The concentration of each gene was calculated by comparison with a
standard curve and with the assistance of LineGene software (BioFlux). Relative gene
expression was expressed as a ratio of the target gene (cel1, cel2, cel3a and cel4)
concentration to the housekeeping gene (act1) concentration, and values reported represent
the mean gene expression from at least two separate PCR experiments using the same
preparation of RNA.
23
Analysis of cellooligosaccharide content in culture filtrate using high-performance ion
chromatography
Twenty-five microliters of each culture filtrate was analyzed on a DX-500 high-
performance ion chromatography system (Dionex, Sunnyvale, CA), which included a metal
free quaternary gradient pump, an eluent degassing module, a microinjection valve, a post
column reagent delivery module, and a solvent-compatible pulsed amperometric detector
equipped with an electrochemical cell containing a gold working electrode and an Ag/AgCl
reference electrode (Dionex). Cellooligosaccharides were separated on a Dionex CarboPac
PAl anion exchange column (4 × 250 mm) fitted with a CarboPac PA guard column (Dionex)
at a flow rate of 1.0 ml/min. Cellooligosaccharides were eluted with a linear gradient of 0 to
0.5 M sodium acetate in 100 mM NaOH. Chromatographic data were integrated and analyzed
using PeakNet version 5.11 software (Dionex).
Results
DNA sequencing and computer analysis of nucleotide and protein sequences

Nucleotide sequences of cel1, cel2, cel3a and cel4 from P. arcularius have been
submitted to the DNA Data Bank of Japan/European Molecular Biology Laboratory/GenBank
database under accession numbers AB298322, AB298323, AB187524 and AB298324,
respectively. The coding region, from ATG to the stop codon, is 1,377 bp in cel1, 1,356 bp in
cel2, 1329 bp in cel3A and 1251 bp in cel4, and encodes proteins of 458, 454, 243 and 417
amino acids, respectively (Table 2). Genomic Southern hybridization was performed using
genomic DNA from P. arcularius monokaryon 69B-8 digested with three restriction
endonucleases in each blot and using probes generated from amplified DNA fragments
corresponding to partial cellulase clones. The Southern blots showed a single band for each
digest, indicating that four P. arcularius cellulase genes are single-copy genes in the haploid
genome (Ishihara et al. 2005b; Ohnishi et al. 2007a; 2007b).
Characterization of protein sequence of Cel1 and Cel2

We examined the predicted protein sorting signals in the four cellulases. The
program PSORTII (http://psort.nibb.ac.jp; Nakai & Kanehisa, 1992) predicted that the
cellulases are extracellular proteins and that the first 18-20 amino acids of each form an N-
terminal signal sequence (see Figs. 1 and 2). After removal of the signal peptide, the
molecular masses of the putative mature proteins are predicted to be 46,973 Da
Table 2. Cellulase cDNAs from Polyporus arcularius identified in this study.
Amino acid Molecular Signal Glycosyl Reference

Cellulase genes ORF
residues mass peptide hydrolase
(enzyme name) (bp)
(a.a.) (kDa) (a.a.) family
cel1
1377 458 48.9 18 7
(CBH I) Ohnishi et al.
Exo
cel2 2007a
1356 454 47.4 20 6
(CBH II)
cel3A
(CMCase 732 243 26 18 12
Ohnishi et al.
End IIIa)
2007b
cel4
1251 417 44 19 5
(EG II)
24
(Cel1), 45,312 Da (Cel2), 24,270 Da (Cel3a) and 42,135 Da (Cel4). We next analyzed the
protein sequences of the four cellulases using MOTIF (http://motif.genome.jp/). This program
predicted that Cel1 Cel2, Cel3a and Cel4 contain nine glycosyl hydrolase family 7 signature
sequences, six glycosyl hydrolase family 6 signature sequences, six consensus boxes in fungal
family 12 glycosyl hydrolases and one glycosyl hydrolase family 5 signature sequence,
respectively (Table 2; Henrissat & Bairoch, 1993).
Figure 1. Relative gene expression of the cellulase genes and concentration of

cellopentaose during cultivation in medium containing Avicel as the sole carbon source.
(Figure modified from Ohnishi et al. 2007a, b).
Figure 2. Relative gene expression of cellulase genes and concentration of cellopentaose

during cultivation in medium containing cellooligosaccharides as the sole carbon source.
(Figure modified from Ohnishi et al. 2007a, b). C2, cellobiose; C3, cellotriose; C4,
cellotetraose; C5, cellopentaose.
25
Constitutive expression of the four cellulase genes in P. arcularius cells
Initially, we examined the effect of the carbon source on the expression of the four
cellulases. The relative expression revels are shown in Table 3. The highest levels of
expression were observed when Avicel was used as the sole carbon source. Moreover, there
was minimal transcription of the four cellulase gene when glucose or cellobiose was used as
the carbon source or when there was no carbon source. Minimal transcription was also
observed using a combination of Avicel and either glucose or cellobiose.
Recognition of insoluble crystalline cellulose in P. arcularius

To investigate how insoluble crystalline cellulose is recognized by P. arcularius
cells, we examined the time course of the four cellulase expression in the medium containing
cellooligosaccharides (Figure 1). The transcription of the four cellulase genes increased
starting one day after the mycelium was transferred to the cellulose-producing medium. The
maximum amounts of the transcripts were detected after two days. At least 24 h was required
for P. arcularius cells to induce the transcription of the cellulases in response to insoluble
crystalline cellulose. These results indicate that P. arcularius cells may constitutively produce
a very low level of endoglucanases that can degrade insoluble crystalline cellulose, after
which the reaction products such as cellooligosaccharides (Ishihara et al. 2005a, b; Ohnishi et
al. 2007b) induce transcription of the cellulases. To examine the validity of this hypothesis,
we assessed the effect of cellooligosaccharides (cellobiose, cellotriose, cellotetraose, and
cellopentaose) on cellulase expression. We found the cellulases expression was induced when
cellopentaose was the sole carbon source. Cellobiose, cellotriose, and cellotetraose did not
affect the transcription of celllulases. Therefore, a chain of more than five glucose molecules
might be required for the induction of endoglucanases in P. arcularius cells. When mycelia
were transferred to the medium containing cellopentaose, the levels of the four cellulase
transcripts increased after 6 h, and the maximum levels were detected after 12 h (Figure 2).
This induction of transcription of cellulase genes by cellopentaose was more rapid than the
induction by Avicel as the sole carbon source.
Table 3. Effect of carbon source on the relative expression levels of cellulase genes in
Polyporus arcularius.
Carbon source cel1 cel2 cel3A cel4

(CBHI) (CBH II) (CMCase3a) (EGIII)
2% Glucose 1.0 1.0 1.0 1.0
2% Glucose + 0.3% Avicel 0.8 0.8 1.1 2.2
2% Cellobiose 2.4 3.6 1.1 6.7
2% Cellobiose + 0.3% Avicel 1.5 1.9 1.0 4.1
None 5.1 4.1 1.3 1.4
0.3% Avicel 151.1 2,185.2 107.4 194.2
The maximum expression levels are shown. (Table modified from Ohnishi et al. 2007a, b).
The culture period was from 0 to 4 days, after which the cells were transferred to a medium
containing various carbon sources.
Discussion
Our results indicated that the expression of the cellulase gene can be induced by
Avicel and repressed by glucose and cellobiose. Similar findings were reported for the
expression of cellobiohydrolases such as cel1 of Irpex lacteus (Hamada et al. 1999), cbhI and
cbhII of V. volvacea (Jia et al. 1999), cel3 of A. bisporus (Chow et al. 1994), and cel7A and
26
cel6B of L. edodes (Lee et al. 2001). Although the transcripts for cellobiohydrolase genes of
other basidiomycetous mushrooms were not detected in the glucose-containing medium, there
was low-level transcription of the cellulase genes in P. arcularius cells regardless of the
carbon source. Moreover, it is possible that in other basidiomycetous mushrooms,
transcription of cellulase genes may occur at levels that are below the detection limit of the
procedure. P. arcularius cells may constitutively produce a very low level of endoglucanases
that can degrade insoluble crystalline cellulose, after which the reaction products such as
cellooligosaccharides (Ishihara et al. 2005a, b) induce transcription of the cellulase genes.
Similarly, Mach & Zeilinger (2003) have also suggested that fungi constitutively produce low
levels of cellulase than can convert cellulose into cellooligosaccharides that induce the
expression endoglucanases.
From our results, it is indicated that water-soluble cellopentaose can mediate the
induction of the cellulase genes by Avicel. To investigate this possibility, we grew
Figure 3. Concentration of cellopentaose during cultivation in medium containing Avicel

as the sole carbon source.
(Figure modified from Ohnishi et al. 2007a, b)
mycelia in a medium containing Avicel as the sole carbon source and measured the
concentration of cellopentaose over time (Figure 3). The maximum concentration of
cellopentaose was detected after 12 h. The induction of the cellulase gene transcription
occurred after another 12 h. These results strongly supported our model for how insoluble
crystalline cellulose is recognized. The fungus produces low constitutive cellulase levels
under all culture conditions, and the cellulase produce water-soluble cellooligosaccharides
larger than cellopentaose. The cellooligosaccharides were recognized by fungal cells (Mach &
Zeilinger, 2003). Moreover, we previously identified three endoglucanases (CMCases I, II,
and IIIa) from a culture filtrate of P. arcularius, and we detected CMCase IIIa activity after
the addition of cellobiose, but there was much less activity when the mycelia were grown in
the presence of cellooligosaccharides containing more than two glucoside units. Therefore,
these endoglucanses may produce cellooligosaccharides that in turn can be recognized by P.
arcularius cells.
In summary, we have identified a possible mechanism for the recognition and
degradation of insoluble crystalline cellulose by fungal cells (Figure 4), and that for the
repression of cellulase gene expression and enzyme inhibition (Fig. 5). To further explore this
mechanism, it will be necessary to identify the receptors for water-soluble
cellooligosaccharides such as cellopentaose and the signal transduction pathway controlling
cellulase gene transcription.
27
Figure 4. A possible mechanism for the recognition and degradation of insoluble
crystalline cellulose by fungal cells.
Figure 5. A possible mechanism for the repression of cellulase gene expression and
enzyme inhibition.
28
References
Chow CM, Yague E, Raguz S, Wood DA, Thurston CF. 1994. The cel3 gene of
Agaricus bisporus codes for a modular cellulase and is transcriptionally regulated by the
carbon source. Appl. Environ. Microbiol., 60, 2779-2785.
Enokibara S, Mori N, Kitamoto Y. 1992. Purification and some properties of a carboxymethyl
cellulase from Favolus arcularius. J. Ferment. Bioeng., 73, 230–232.
Hamada N, Okumura R, Fuse N, Kodaira R, Shimosaka M, Kanda T, Okazaki M. 1999.
Isolation and transcriptional analysis of a cellulase gene (cel1) from the basidiomycete
Irpex lacteus. J. Biosci. Bioeng., 87, 97-102.
Henrissat B, Bairoch A. 1993. New families in the classification of glycosyl hydrolases based
on amino acid sequence similarities. Biochem. J., 293, 781-788.
Henrissat B, Davies G. 1997. Structural and sequence-based classification of glycoside
hydrolases. Curr. Opin. Struct. Biol., 7, 637-644.
Ilmén M, Saloheimo A, Onnela ML, Penttila ME. 1997. Regulation of cellulase gene
expression in the filamentous fungus Trichoderma reesei. Appl. Environ. Microbiol., 63,
1298-1306.
Ishihara H, Imamura K, Kita M, Aimi T, Kitamoto Y. 2005a. Enhancement of the viscometric
endocellulase activity of Polyporus arcularius CMCase IIIa by cellobiose and
cellooligosaccharides. Mycoscience, 46, 148-153.
Ishihara H, Aimi T, Takahashi T, Kitamoto Y. 2005b. Heterologous expression and
characterization of the endocellulase encoding gene cel3A from the basidiomycete
Polyporus arcularius. Mycoscience, 46, 154-161.
Jia J, Dyer PS, Buswell JA, Peberdy JF. 1999. Cloning of the cbhI and cbhII genes involved
in cellulose utilisation by the straw mushroom Volvariella volvacea. Mol. Gen. Genet.,
261, 985-993.
Lee CC, Wong DW, Robertson GH. 2001. Cloning and characterization of two cellulase
genes from Lentinula edodes. FEMS Microbiol. Lett., 205, 355-360.
Mach RL, Zeilinger S. 2003. Regulation of gene expression in industrial fungi: Trichoderma.
Appl. Microbiol. Biotechnol., 60, 515–522.
Nakai K, Kanehisa M. 1992. A knowledge base for predicting protein localization sites in
eukaryotic cells. Genomics, 14, 897–911.
Ohnishi Y, Nagase M, Ichiyanagi T, Kitamoto Y, Aimi, T. 2007a. Transcriptional regulation
of two endoglucanase encoding genes (cel3A and cel4) from the wood-degrading
basidiomycete Polyporus arcularius. FEMS Microbiol. Lett., 274, 218–225.
Ohnishi Y, Nagase M, Ichiyanagi T, Kitamoto Y, Aimi T. 2007b. Transcriptional regulation
of two cellobiohydrolase encoding genes (cel1 and cel2) from the wood-degrading
basidiomycete Polyporus arcularius. Appl. Microbiol. Biotech., 76, 1069–1078.
Teeri TT, Lehtovaara P, Kauppinen S, Salovuori I, Knowles J. 1987. Homologous domains
in Trichoderma reesei cellulolytic enzymes: gene sequence and expression of
cellobiohydrolase II. Gene, 51, 43-52.
Wood BE, Ingram LO. 1992. Ethanol production from cellobiose, amorphous cellulose, and
crystalline cellulose by recombinant Klebsiella oxytoca containing chromosomally
integrated Zymomonas mobilis genes for ethanol production and plasmids expressing
thermostable cellulase genes from Clostridium thermocellum. Appl. Environ. Microbiol.,
58, 2103–2110.
Yague E, Mehak-Zunic M, Morgan L, Wood DA, Thurston CF. 1997. Expression of CEL2
and CEL4, two proteins from Agaricus bisporus with similarity to fungal
cellobiohydrolase I and beta-mannanase, respectively, is regulated by the carbon source.
29
Yague E, Wood DA, Thurston CF. 1994. Regulation of transcription of the cel1 gene in
Agaricus bisporus. Mol. Microbiol., 12, 41-47.
30
Antimicrobial Activities of Four Wild Mushroom Species Collected from

Turkey
Fatih Kalyoncu and Mustafa Oskay

Celal Bayar University, Faculty of Science & Arts, Department of Biology, Muradiye,
Manisa, Turkey Email: fatih.kalyoncu@bayar.edu.tr
Abstract
Four wild mushrooms, namely Meripilus giganteus, Armillaria mellea, Clitocybe

geotropa and Sparassis crispa, collected from the southwest of Turkey, were tested for their
antimicrobial activities by using the agar well diffusion method. Ethanol and chloroform
extracts from the fruit bodies of these mushrooms were assayed against 10 microorganisms.
The test antibiotics, penicillin G, novobiocin, nalidixic acid, ampicillin, erythromycin,
imipenem, chloramphenicol, vancomycin and nystatin were used for comparison. This
research has shown that four wild mushrooms revealed antimicrobial activities against some
Gram (+) and Gram (-) bacteria, and Candida albicans.
Keywords: Meripilus giganteus; Armillaria mellea; Clitocybe geotropa; Sparassis crispa;

Antimicrobial activity; Turkey
Introduction
Macrofungi have long been used as a valuable food source and as traditional
medicines around the world, especially in Japan and China. A number of medicinal
mushrooms, such as Ganoderma lucidium, Tremella fuciformis and Lentinula edodes, are
deemed to belong to the highest class of medicines (Wasser & Weis, 1999). Furthermore,
screening programs aimed at the discovery of new bioactive metabolites from macrofungi
have been performed (Rosa et al. 2003; Dulger et al. 2002, 2004).
In research, extracts of more than 75% of the polypore mushroom species surveyed showed
antimicrobial activity and 45% of 204 mushroom species inhibited the growth of a wide
variety of microorganisms (Suay et al. 2000).
This experimental study is part of a program focusing on screening of wild edible
mushrooms collected from the southwest region of Turkey. The antimicrobial activities of
ethanol and chloroform extracts of four wild mushrooms are reported here for the first time.
Materials and Methods
Fungi
Meripilus giganteus (Pers.) P. Karst, Armillaria mellea (Vahl) P. Kumm., Clitocybe
geotropa (Bull.) Quel. and Sparassis crispa (Wulfen) Fr. were collected from the wild during
field trips between 2006 and 2007, from the southwest of Turkey. The morphological and
ecological characteristics of the collected macrofungi were recorded and photographed in
their natural habitats. The specimens were identified according to macroscopic and
microscopic features and the related literature (Watling, 1973; Moser, 1983).
Preparation of macrofungi extracts

The dried and powdered fruit bodies of macrofungi were reduced to a coarse powder.
Each sample (20 g) was extracted with 100 ml of ethanol and chloroform at room
31
temperature, with stirring, for 4 d. The extraction solvent was evaporated to dryness. Sample
solutions were prepared by dissolving the extracts in extraction solvents.
Microbial test organisms

Test microorganisms included the following bacteria: Staphylococcus aureus ATCC
6538P, Escherichia coli, Sarcina lutea ATCC 9341NA, Bacillus cereus ATCC 7064, Bacillus
subtilis ATCC 6633, Salmonella typhimurium CCM 5445, Proteus vulgaris ATCC 6897,
Enterococcus faecalis ATCC 29212, Enterobacter cloacae ATCC 13047D and the yeast,
Candida albicans ATCC 10231. Bacterial cultures were grown in Mueller-Hinton broth
(Oxoid) at 37 oC for 24 h and the yeast was incubated in glucose yeast extract broth at 30 oC
for 48 h. All the microorganisms were obtained from the Department of Biology, Ege
University, Izmir, Turkey.
Assay for antimicrobial activity

The assay was conducted as described by Perez et al. (1990) with slight modification
according to the present experimental conditions. Briefly, 50 µl inoculum (containing
approximately 108 bacteria per ml and 107 yeast per ml) were added to 25 ml melted Mueller-
Hinton agar (MHA) and potato dextrose agar (PDA) medium cooled to 50 °C. This was then
poured into 90 mm diameter sterile Petri dishes, and maintained for 1 h at room temperature.
Small wells (6 mm) were cut in the agar plate using a cork borer; 60 µl of extract
concentration with a negative control (EtOH 96° and chloroform, 60 µl) were loaded in the
wells. The dishes were pre-incubated at 4 °C for 2 h to allow uniform diffusion into the agar.
After pre-incubation, for bacteria, the plates were incubated aerobically at 37 °C for 24 h, and
28 °C for 48 h for yeast. The antimicrobial activity was evaluated by measuring the inhibition
zone diameter observed. In addition, commercial antibiotics [penicillin G (10 i.u.), nalidixic
acid (30 µg), novobiocin (30 µg), ampicillin (10 µg), imipenem (10 µg), erythromycin (15
µg), vancomycin (30 µg), chloramphenicol (30 µg) and nystatin (10 µg)] were used as
positive controls to determine the sensitivity of the strains. These studies were performed in
triplicate.
Statistical Analysis
The mean values were statistically analyzed with the MINITAB Release 13.20
program by the general one-way (unstacked) analysis of variance (ANOVA) to find out the
most effective extracts and the most sensitive test organisms. Similarity (%) of
microorganisms in relation to their susceptibility to the mushroom extracts was analyzed by
the multivariate cluster analysis according to the data obtained from well diffusion assay.
Results and Discussion
Table 1 show the antimicrobial activities of the extracts obtained from A. mellea, C.
geotropa, M. giganteus and S. crispa. As clearly seen from Table 1, with an inhibition zone of
20 and 19 mm, the ethanol extracts of A. mellea and C. geotropa presented significant
antibacterial activity against B. subtilis and B. cereus, respectively. The ethanol extracts of A.
mellea and M. giganteus showed antiyeast activity against C. albicans, 19 and 20 mm
respectively. Also, the ethanol extract of S. crispa has antiyeast activity, with a inhibition
zone 17 mm. The ethanol extract of A. mellea was found to be active against S. lutea and P.
vulgaris, 17 and 16 mm, respectively. Similarly, the ethanol extract of C. geotropa has
antibacterial activity against P. vulgaris (16 mm).
32
Table 1. Antimicrobial activity of four wild mushrooms against bacteria and C. albicans
Test Microorganismsa
Macrofungi Dose SA EC SL BC BS STYP PV EF ECLO CA

( mg/well )
CHR 12 0* 0b 0 0 0 0 0 0 0 2
Armillaria mellea ETH 12 10 10 17 13 20± 12 16 10 10 19
CHR 8 0 0 0 0 0 0 0 0 0 0
Clitocybe geotropa ETH 6 14 8 10 19 12 14 16 10 10 13
CHR 12 0 0 0 10± 0 0 0 14± 0 10±
Meripilus giganteus ETH 5 13 10 8 11 0 14 12 10 14± 20
CHR 8 0 12± 0 0 0 0 0 0 0 10±
Sparassis crispa ETH 15 11 8 10± 14 10± 12 16± 8 12± 17
CHR 0 0 0 0 0 0 0 0 0 0
NCc ETH 9 8± 10± 11 10± 9 10 8 8 9

a
Microorganisms: SA - Staphylococcus aureus; EC - Escherichia coli; SL - Sarcina lutea; BC - Bacillus cereus;
BS - Bacillus subtilis; STYP - Salmonella typhimurium; PV - Proteus vulgaris; EF - Enterococcus faecalis;
ECLO - Enterobacter cloacae; CA - Candida albicans. bInhibition zone diameter in mm, including well diameter
(6 mm); * mean values, n = 3; 0 - no inhibitory activity (equal to well diameter); ± partially inhibition.
c
NC - negative control, CHR – Chloroform; ETH – Ethanol 96%, 60 µl.
In a previous study, ethanol was observed as the best solvent for extracting
antimicrobial substances from Lycoperdon pusilum and L. giganteum (Jonathan & Fasidi,
2003). Similarly, our results showed that ethanol was a better solvent for extracting than
chloroform. Suay et al. (2000) reported that the methanol extract of C. nebularis
(Tricholomataceae) was active against S. aureus (<15 mm) and B. subtilis (>15 mm). In the
same study, simple hot-water extracts of Lepista nuda
Table 2. Inhibitory activity of selected antibiotics against test bacteria and C. albicans
Standard antibiotics
Tested microorganisms* NAa NV AMP P ERY IPM VA CLH NYS
S. aureus ATCC 6538P 20b 32 15 R 24 20 34 12 20 ND
E. coli 26 6R 6R 6R 12± R 30 6R 26 ND
S. lutea ATCC 9341NA 10R 28 26 20 R 26 40 15 30 ND
B. cereus ATCC 7064 28 25 6R 10 R 26 36 15 28 ND
B. subtilis ATCC 6633 32 13 R 10 R 8± R 15 34 6R 30 ND
S. typhimurium CCM 5445 6R 40 6R 6R 28 30 28 40 ND
33
Table 2. continued from page 33
P. vulgaris ATCC 6897 12 R 26 10± R 10± R 20 22 22 15 ND
E. faecalis ATCC 29212 30 28 16 24 30 40 16 30 ND
E. cloacae ATCC 13047D 12± R 22 15 12 R 15 R 30 16 26 ND
C. albicans ATCC 10231 ND ND 6 6 6 ND 6 ND 22
*Bacteria tested in MHA medium, yeast in PDA. aNA - Nalidixic acid (30 µg/disc); NV - Novobiocin (30
µg/disc); AMP - Ampicillin (10 µg/disc); P - Penicillin G (10 i.u./disc); ERY - Erythromycin (15 µg/disc); IPM
- Imipenem (10 µg/disc); VA - Vancomycin (30 µg/disc); CHL - Chloramphenicol (30 µg/disc); NYS - Nystatin
(10 µg/disc). bDiameter of inhibition zone in mm, including disc diameter (6 mm); RResistant; ± partially
inhibition; 6 - no activity; ND – not dermined.
Growth Inhibition (mm)

20
10
0
ECLO
EC
BC
STYP
CA
SL
EF
SA
BS
PV
Microorganisms
Figure 1. Mean values of microorganisms in relation to their susceptibility to the

mushroom extracts.
*Means are indicated by solid circles. See Table 1 for abbreviations of test microorganisms.
(Tricholomataceae) were found to be active against C. albicans. However, this study

observed activity against C. albicans from the ethanol extracts of all mushrooms.
Sensitivity of test strains was, in decreasing order: C. albicans > B. cereus > P.
vulgaris > E. faecalis > S. typhimurium > S. aureus > E. coli > Enterobacter cloacae >
Sarcina lutea > B. subtilis (Fig. 1). Figure 2 summarizes the similarity of microorganisms in
relation to their susceptibility to the mushroom extracts.
These results confirm that bioactive components of any macrofungi may differ in their
solubility depending on the extractive solvents. Although further investigations are clearly
necessary to clarify and identify the bioactive constituents we believe that our results
presented herein may be a contribution for other researchers, who would carry out further
studies on the antimicrobial activity of macrofungi.
34
Similarity
0,00
33,33
66,67
100,00
SA STYP ECLO PV SL BS EC BC EF CA
Microorganisms
Figure 2. Similarity (%) of microorganisms in relation to their susceptibility to the
mushroom extracts. * See Table 2 for abbreviations of test microorganisms.
(Tricholomataceae) were found to be active against C. albicans. However, this study

observed activity against C. albicans from the ethanol extracts of all mushrooms.
Sensitivity of test strains was, in decreasing order: C. albicans > B. cereus > P.
vulgaris > E. faecalis > S. typhimurium > S. aureus > E. coli > Enterobacter cloacae >
Sarcina lutea > B. subtilis (Fig. 1). Figure 2 summarizes the similarity of microorganisms in
relation to their susceptibility to the mushroom extracts.
These results confirm that bioactive components of any macrofungi may differ in their
solubility depending on the extractive solvents. Although further investigations are clearly
necessary to clarify and identify the bioactive constituents we believe that our results
presented herein may be a contribution for other researchers, who would carry out further
studies on the antimicrobial activity of macrofungi.
References
Dulger B, Gonuz A, Gucin F. 2004. Antimicrobial activity of the macrofungus

Cantharellus cibarius. Pakistan J. Biol. Sci., 7, 1535-1539.
Dulger B, Yilmaz F, Gucin F. 2002. Antimicrobial activity of some Lactarius species.
Pharmaceut. Biol., 40, 304-306.
Jonathan SG, Fasidi IO. 2003. Antimicrobial activities of two Nigerian edible
macrofungi, Lycoperdon pusilum and L. giganteum. African J. Biomed. Res., 6, 85-90.
Moser M. 1983. Keys to Agarics and Boleti. Gustav Fischer, London.
Perez C, Pauli M, Bazerque P. 1990. An antibiotic assay by the agar-well diffusion
method. Acta Biologica et Medica Experimentalis, 15, 113–115.
Rosa LH., Machado K.M.G., Jacob C.C., Capelari M., Rosa C.A. and Zani C.L. 2003.
Screening of Brazilian basidiomycetes for antimicrobial activity. Memorıas
Do Instıtuto Oswaldo Cruz, 98, 967-974.
Suay I, Arenal F, Asenio F. 2000. Screening of basidiomycetes for antimicrobial
activities. Antonie van Leeuwenhoek, 78, 129-139.
Wasser SP, Weis AL. 1999. Medicinal properties of substances occurring in higher
Basidiomycetes mushrooms: current perspectives. Int. J. Med. Mushr. 1, 31-62.
Watling R. 1973. Identification of the larger fungi. Hulton Educational Publication
Ltd. Buckinghamshire, UK.
35
Degradation of Endosulfan by Pleurotus spp

Gabriela M. Mendoza1, José E. Sanchez2, Maria G. Nieto2 and Facundo J. Márquez-
Rocha3
1
Facultad de Biotecnología, UNACH. Carr. Puerto Madero Km. 1.5, Tapachula, Chiapas,
México; 2El Colegio de la Frontera Sur, Apartado Postal 36, Tapachula, Chiapas, México;
3
Centro de Investigación Científica y de Educación Superior de Ensenada, Km. 107, Carr.
Tijuana-Ensenada, Ensenada, Baja California, México.
Email: esanchez@ecosur.mx
Key Words: Pleurotus spp; Pleurotus pulmonarius Endosulfan; Biodegradation; High

nitrogen medium
Introduction
Endosulfan [6,7,8,9,10,10-hexachloro-1,5,5a,6,9,9a-hexahydro-6,9-methano-2,4,3-
benzodioxathiepin-3-oxide], is a chlorinated hydrocarbon, broad-spectrum insecticide/
acaricide registered for use on a variety of field, fruit, and vegetable crops. This pesticide is
highly toxic to humans and animals (EPA, 2006). Because it is persistent and easily dispersed,
it has been found in sediment, surface waters, the air, and foods (Gunther & Jeppson, 1975;
Matsumura, 1980; Kullman & Matsumura, 1996; Hernandez-Romero et al. 2004). The
endosulfan molecule is very stable and its degradation in the environment is slow; however,
it has been confirmed that some strains of Pleurotus spp, among other fungi and bacteria are
able to degrade it (Escobar et al. 2002; Sutherland et al. 2000; Shetty et al. 2000; Siddique et
al. 2003; Hernandez et al. 2006; Weir et al. 2006).
The ability of the genus Pleurotus to grow on lignocellulosic residues relates to its
own complex enzymatic system. The strains belonging to this genus have been shown to be
capable of degrading complex molecules such as cellulose, lignin, and chitin, and, recently,
xenobiotics such as polycyclic aromatic hydrocarbons (PAHs) (Bezalel et al. 1996, 1997;
Schutzendubel et al. 1999; Martens et al. 1999; Marquez-Rocha et al. 2000). Industrial dyes
can also be biodegraded by Pleurotus spp (Rodriguez et al. 1999; Yesilada et al. 2003) .
The genus Pleurotus is diverse (Vilgalys et al. 1996) and has the interesting ability to
biodegrade various substances (Cohen et al. 2002). These mushrooms as well as their spent
substrate may be useful for bioremediation, but their properties have not been adequately
investigated. The objective of this study was to select a species from 80 Pleurotus spp
mushrooms which could efficiently degrade the insecticide endosulfan, a registered
insecticide widely used in Mexico (INSP, 2005) .
Material and Methods
Organisms
The 80 strains of Pleurotus spp (Table 1) were obtained from the mycological
collection of ECOSUR-Tapachula, Chiapas, Mex.
Reagents
Endosulfan 35 % (Thiodan, Agrevo); acetonitrile and petroleum ether (HPLC
grade) were purchased from Bayer; high purity standards of endosulfan (= 66.3 % and
=33.5%) and endosulfan sulfate (97.7 %) (Pestanal) were obtained from Sigma-Aldrich.
36
Solid medium cultures
Three solid medium cultures were used. The propagation culture medium consisted of
the following in g/l: agar (Bioxon) 16.0, peptone casein (Bioxon) 5.0, dextrose 1.0, and yeast
extract (BBL) 2.5. Medium A consisted of the following, (in g/l): agar 16.0, peptone casein
5.0, and dextrose 1.0. Medium B consisted of the following: (in g/l): agar 16.0 and peptone
casein 5.0. Medium C (g/l): agar 16.0, peptone casein 5.0, and 100 mg/l of endosulfan
(thiodan 35 %).
Liquid medium cultures
The basal medium contained the following (in g/l): KH2PO4 1.0, MgSO4 0.5, KCl 0.5,
dextrose 1.0, and 1 ml of mineral solution. The mineral solution contained (in mg/l):
B4O7Na2.10H2O 100, ZnSO4.7H2O 70, FeSO4.7H2O 50, CuSO4.5H2O 10, and MnSO4.4H2O
10. The High-Nitrogen Medium (HNM) consisted of 1.584 g of L-asparagine (24 mM) in 1
liter of basal medium. The Low-Nitrogen Medium (LNM) consisted of 0.158 g of L-
asparagine (2.4 mM) in 1 liter of basal medium. All media were adjusted to pH 6.0. For the
inoculum, 60 ml of medium was placed in a 250-ml Erlenmeyer flask. For endosulfan
biodegradation assays, 35 ml of medium was placed in a 125-ml Erlenmeyer flask.
Evaluation of growth in solid medium in the presence of endosulfan

The radial extension rate (RER) of eight groups of 9 to 11 strains of Pleurotus spp.
(Table 2) were evaluated on solid media. Mycelial plugs (55 mm diam.), grown for 5 d on
propagation medium, were used as the inoculum for assays. The mycelia were inoculated on
to petri dishes (90 x 15 mm) containing Medium A, B or C, three replicates each. The plates
were incubated at 24±1 °C in darkness for 11 d. RER analysis was done for each group,
selecting the one or two strains in each with the highest RER in Medium C. A second trial
was carried out with 10 selected strains, resulting in the selection of the three strains with the
highest RER in Medium C.
Effect of endosulfan and nitrogen concentration on the growth of Pleurotus

Twenty (5.5 mm dia.) mycelial plugs, grown on propagation medium for 10 days,
were inoculated into 60 ml of LNM in a 250-ml Erlenmeyer flasks, at 24±1 °C, and then
agitated at 150 rpm in darkness for 7 d. At the end of 7 d, the mycelial plugs were aseptically
removed. The rest of the culture was centrifuged 5 min. at 3,000 rpm at 10 °C in a Model J2-
21 Beckman centrifuge. The supernatant was discharged, yielding a concentrate of
approximately 50 ml, which was homogenized in a blender for 30 s at the lowest speed. One
ml of the homogenized suspension was inoculated into 35 ml of HNM or LNM, and then
placed in a 125-ml Erlenmeyer flask. Cultures were then incubated at 24± 1°C, in darkness at
150 rpm for 11 d. Seventy two hours after inoculation, 1 ml of an endosulfan solution was
added, for a final concentration of 82.9 mg/l in both media and in their respective controls.
Under these culture conditions, the biomass of the three strains was determined. One of these
strains was selected to evaluate the biodegradation of endosulfan in HNM and LNM.
Residual α- and β-endosulfan, endosulfan sulfate and pH were measured.
Sampling of liquid medium

Three flasks of each strain, with and without endosulfan, were harvested randomly
after 0, 3, 5, 7, 9 and 11 d cultivation. Biomass was collected by filtration and the supernatant
used to measure endosulfan. The endosulfan concentration in the control was measured at the
end of the experiment.
Growth evaluation
Radial extension rate (RER) was determined as follows: 48 h after inoculation, and
every 24 h for 10 d, the radius of the mycelium in each colony was measured using a vernier
37
and a stereo-microscope. The radius was graphed over time and the slope, defined as RER,
was calculated using the following equation RER = (X2-X1) / (t2-t1) = cm/d
Biomass
Biomass was collected by filtration on Whatman No. 6 filter paper, previously dry-
weighted. The filters with the biomass were then dried at 84±1 °C for 24 h and weighed. The
change in weight was expressed in g/l. The specific growth rate (μ) was determined using the
equation:
μ = 1/x dx
dt
Endosulfan determination
Extraction and measurement of endosulfan were performed according to Hernandez et
al. (2006). A Clarus Model 500 Perkin Elmer gas chromatograph, coupled to an Ni63 electron
capture detector and a SPB-5 column (15 m x 0.20 mm ID, 0.20 μ film -Supelco) were used.
Operating temperatures were as follows: The initial oven temperature was 150 °C, and was
increased at a rate of 12 °C/min to 320 °C. Injector and detector temperatures were 250 and
320 °C, respectively. Retention times obtained from the samples were compared with
standard retention times for α- and β-endosulfan, and endosulfan sulfate. The linear
regression calibration curve derived from standard solutions (from 0.001 to 10 mg/l) showed a
correlation coefficient of R2 = 0.999.
Design and statistical analysis

A random design with three replicates was employed to evaluate mycelial growth in
the solid medium,. The effect of endosulfan on growth was evaluated by a bifactorial design
in blocks, in which the Factor 1 was the nitrogen concentration in the culture medium (HNM
or LNM), and Factor 2 was the presence or absence of endosulfan. Blocks were grouped in
days with three replicates in each block. An analysis of variance and means separation was
performed according to Tukey’s test (α=0.05) using the statistical program Stat Soft (version
6).
Results
Growth in the presence of endosulfan.

The radial extension rates (RER) of the 80 Pleurotus spp strains grown in three
different media (A, B, and C) are shown in Table 3. In Medium A, the RER values ranged
from 0.24 to 0.85 cm/d for strains ECS-01120 (Group 7) and ECS-0102 (Group 1),
respectively. Statistical analyses showed significant differences among the strains in each
group (G1: p=2.7x10-12, G2: p=1.3x10-10, G3: p=1.4x10-9, G4: p=7.7x10-13, G5:
p=5.2x10-10, G6: p=9.2x10-12, G7: p=4.9x10-11, and G8: p=1.1x10-16) and classified the
strains in each group, in three (G1) to seven (G6 and G7) subgroups. The RER in Medium B
had values between a low of 0.11 cm/d for ECS-0123 (Group 1) and a high of 0.64 cm/d for
ECS-0141 (Group 2). Statistical analyses of strains in Medium C showed differences among
strains in each group (G1: p=1.2x10-7, G2: p=9.9x10-14, G3: p=2.0x10-12, G4: p=1.0x10-10,
G5: p=1.5x10-9, G6: p=5.2x10-10, G7: p=2.4x10-4, and G8: p=8.8x10-16). The RER in
Medium C,
38
Table 1. Strain, code number and origin of the 80 Pleurotus strains used in this study
No. Strain Code No. Origin No. Strain Code No. Origin
1 P. djamor ECS-0102 Chiapas, 41 P. djamor ECS- Chiapas. Mex

2 P. djamor ECS-0103 Chiapas, 42 P. djamor ECS- Chiapas, Mex
4 P. djamor ECS-0105 Chiapas,Mex 44 P. djamor ECS- Chiapas, Mex
5 P. ostreatus ECS-0106 Guatemala 45 P. djamor ECS- Chiapas; Mex
6 P. ostreatus ECS-0107 Guatemala 46 P. djamor ECS- Chiapas, Mex
7 P. ostreatus ECS-0108 Guatemala 47 P. djamor ECS- Chiapas, Mex
8 P. sp ECS-0109 Chiapas, 48 P. djamor ECS- Chiapas, Mex
9 P.pulmonarius ECS-0110 Veracruz 49 P. djamor ECS- Chiapas, Mex
10 P. ostreatus ECS-0111 México City. 50 P. djamor ECS- Chiapas, Mex
11 P. ostreatus ECS-0112 México City 51 P. ostreatus ECS- Puebla, Mex
12 P. ostreatus ECS-0113 México City 52 P. pulmonarius ECS- Jalisco, Mex
13 P. ostreatus ECS-0114 México City 53 P. ostreatus ECS- México City
14 P. ostreatus ECS-0115 México City 54 P. ostreatus ECS- Unknown
15 P. cystidiosus ECS-0116 Guatemala 55 P. ostreatus ECS- Unknown
16 P. ostreatus ECS-0117 México City 56 P. ostreatus ECS- Morelos, Mex
17 P.comucopiae ECS-0118 France 57 P. djamor ECS- Morelos, Mex
18 P.comucopiae ECS-0119 France 58 P. ostreatus ECS- Chiapas, Mex
19 P. ostreatus ECS-0120 Germany 59 P. ostreatus ECS- Chiapas, Mex
21 P. djamor ECS-0122 Chiapas, 61 P. djamor ECS- Morelos, Mex
22 P. djamor ECS-0123 Chiapas, 62 P. pulmonarius ECS- Morelos, Mex
23 P. djamor ECS-0124 Chiapas, 63 P. sp ECS- Morelos, Mex
24 P. djamor ECS-0125 Chiapas, 64 P. ostreatus ECS- Morelos, Mex
27 P. djamor ECS-0128 Chiapas, 67 P. sp ECS- Nuevo León,
28 P. djamor ECS-0129 Chiapas, 68 P. ostreatus ECS- Japan
29 P. djamor ECS-0130 Chiapas, 69 P. pulmonarius ECS- USA
30 P. djamor ECS-0131 Chiapas, 70 P.citrinopileatus ECS- USA
31 P. djamor ECS-0132 Chiapas, 71 P. cystidiosus ECS- Georgia, USA
32 P. djamor ECS-0133 Chiapas, 72 P. ostreatus ECS- France
33 P. djamor ECS-0134 Chiapas, 73 P. pulmonarius ECS- Maurice Island
34 P. djamor ECS-0135 Chiapas, 74 P. ostreatus ECS- Veracruz, Mex
35 P. djamor ECS-0136 Chiapas, 75 P. djamor ECS- Pennsylvania,
36 P. djamor ECS-0137 Chiapas, 76 P. eryngii ECS- Pennsylvania,
37 P. djamor ECS-0138 Chiapas, 77 P. ostreatus ECS- Pennsylvania,
40 P. djamor ECS-0141 Chiapas, 80 P. tuber-regium ECS- Pennsylvania,
‘ECS’ refers to the mycological collection of El Colegio de la Frontera Sur (ECOSUR).
which contained endosulfan, exhibited the lowest values among the media tested and had
RER values between 0.11 for ECS-0116 (Group 8) to 0.38 cm/d for ECS-0156 (Group 5).
Statistical analysis indicated significant differences among strains in each group (G1:
p=1.4x10-4, G2: p=3.3x10-6, G3: p=8.2 x10-7, G4: p=1.2x10-14, G5: p=1.8x10-11, G6:
p=6.4x10-6, G7: p=1.9x10-9, and G8: p=3.9x10-7). The ten strains selected for the next trial
are marked with an asterisk in Table 3.
39
Table 2. The eight statistical groups formed from the 80 Pleurotus spp. strains.
Group Pleurotus spp strains (all prefaced ‘ECS’)

1 0102 0104 0121 0123 0126 0132 0138 0144 0149
2 0103 0105 0129 0130 0131 0133 0134 0135 0139 0141
3 0127 0140 0142 0143 0145 0146 0148 0150 0151 0152
4 0109 0122 0124 0125 0128 0136 0137 0147 0154
5 0112 0114 0115 0117 0118 0120 0153 0156 0158 0159
6 0113 0157 0169 0170 0171 0172 0173 0185 0186 0190
7 0106 0166 0167 0168 0184 0191 01119 01120 01121 01122 01123
8 0107 0110 0111 0116 0119 0177 0187 0188 0189 01124 01154
Table 4 shows the RER after a new growth trial in Mediums A, B and C for the ten
strains selected in Table 3. The highest RER’s in Medium A were 0.71, 0.73, 0.74, and 0.75
cm/d, for strains ECS-0140, 0184, 0104, and 0128, respectively. In Medium B the strains
with highest RER were ECS-0140, 0128, 0184, 0115, and 0185, with values between 0.50 to
0.53 cm/d. Strains ECS-0185, 0190, and 0184 had RER’s of 0.35, 0.34, and 0.33 cm/d,
respectively in Medium C. Statistical analyses showed significant differences among strains
in each medium: A (p=2.3x10-10), B (p=1.27x10-8), and C (p=7.73x10-6). The strains with
the highest RER obtained in Medium C were chosen (ECS-0184, 0185, and 0190) to test the
effect of endosulfan on the growth in LNM.
Growth of selected strains in LNM.

Figure 1 shows the growth of ECS-0184, 0185, and 0190 in LNM with and without
endosulfan. In the absence of endosulfan, the net biomass produced and the specific growth
rate (μ) was highest in Pleurotus sp ECS-0184 (0.99 g/l, 0.081 d-1); followed by P.
pulmonarius ECS-0190 - (0.89 g/l and 0.071 d-1), and Pleurotus sp ECS-0185 - (0.287 g/l
and 0.021 d-1). Statistical analysis showed significant differences among strains (p=2.6x10-
15). In the presence of endosulfan, the net biomass produced and the specific growth rate (μ)
was highest for P. pulmonarius ECS-0190 (0.61 g/l and 0.045 d-1), followed by Pleurotus sp
ECS-0184 - (0.522 g/l and 0.038 d-1), and P. ostreatus ECS-0185 - (0.23 g/l and 0.016 d-1).
Statistical analysis showed significant differences in the presence of endosulfan (p=6.9x10-4).
The growth of ECS-0184 and 0190 reached maximum on day 11, while ECS-0185 grew
slowly until the seventh day.
40
Table 3. Radial extension rate (cm/day) of 80 Pleurotus spp. strains on agar
Strain Medium A Medium B Medium C Strain Medium A Medium B Medium C

Group 1 Group 2
ECS-0102 0.85a 0.49ab 0.30a ECS-0141 0.81a 0.64a 0.28ab
ECS-0138 0.80a 0.60a 0.26ab ECS-0129 0.78a 0.44c 0.27ab
ECS-0132 0.76ab 0.47abc 0.25abc ECS-0103 0.77ab 0.27e 0.26abc
ECS-0126 0.75ab 0.50ab 0.28ab ECS-0134 0.70abc 0.61ab 0.30a
*ECS- 0.69b 0.33cd 0.33a ECS-0130 0.69bc 0.30e 0.23bcd
ECS-0123 0.49c 0.11d 0.18c *ECS- 0.60cd 0.40cd 0.30a
ECS-0144 0.45c 0.32cd 0.21bc ECS-0139 0.53de 0.53b 0.29a
ECS-0149 0.44c 0.30d 0.27ab ECS-0135 0.53de 0.32de 0.22bcd
ECS-0121 0.43c 0.42bcd 0.28ab ECS-0133 0.46ef 0.56ab 0.21cd
C.V. 5.46 13.75 10.17 ECS-0131 0.41f 0.25e 0.19d
P 2.7E-12 1.2E-7 1.4E-4 C.V. 6.3 6.3 8.1
P 1.3E-10 9.9E-14 3.3E-6
Group 3 Group 4
*ECS- 0.82a 0.63a 0.31a
ECS-0148 0.68b 0.48b 0.21b *ECS- 0.76a 0.56a 0.33ª
ECS-0127 0.67bc 0.43bc 0.24b ECS-0136 0.70ab 0.48a 0.30ª
ECS-0142 0.66bc 0.33de 0.21b ECS-0137 0.67b 0.56a 0.30ª
ECS-0145 0.66bc 0.48b 0.23b ECS-0122 0.58c 0.32b 0.25b
ECS-0152 0.64bcd 0.38cd 0.21b ECS-0124 0.54c 0.29bc 0.18c
ECS-0143 0.58cde 0.26ef 0.23b ECS-0125 0.43d 0.29bc 0.21c
ECS-0146 0.56de 0.22f 0.16c ECS-0109 0.41d 0.33b 0.13d
ECS-0150 0.52ef 0.34de 0.19bc ECS-0147 0.37d 0.27bc 0.15d
ECS-0151 0.45f 0.32de 0.21bc ECS-0154 0.29e 0.23c 0.13d
C.V. 5.1 7.1 8.3 C.V. 5.68 8.42 5.07
P 1.4E-9 2.0E-12 8.2E-7 P 7.7E-13 1.0E-10 1.2E-14
Group 5 Group 6
ECS-0117 0.66a 0.50a 0.29bc ECS-0173 0.66a 0.49b 0.32abcd
ECS-0114 0.63ab 0.38bc 0.30bc ECS-0157 0.64ab 0.44bc 0.34ab
ECS-0158 0.63ab 0.43ab 0.27bc *ECS- 0.60bc 0.36de 0.36a
ECS-0112 0.59b 0.36bc 0.28bc ECS-0186 0.57cd 0.34de 0.33abc
ECS-0120 0.59b 0.41b 0.21d *ECS- 0.55de 0.58a 0.36a
*ECS- 0.56b 0.44ab 0.38a ECS-0170 0.54def 0.30de 0.30bcd
*ECS- 0.56b 0.38bc 0.38a ECS-0172 0.50fg 0.28e 0.27d
ECS-0153 0.56b 0.33c 0.32b ECS-0113 0.50fg 0.33de 0.28cd
ECS-0159 0.47c 0.32c 0.27c ECS-0171 0.47g 0.37cd 0.29bcd
ECS-0118 0.36d 0.20d 0.18d ECS-0169 0.47g 0.35de 0.28cd
C.V. 4.7 7.0 5.5 C.V. 2.9 7.39 5.69
P 5.2E-10 1.5E-9 1.8E-11 P 9.2E-12 5.2E-10 6.4E-6
Group 7 Group 8
*ECS- 0.71a 0.57ab 0.32a ECS-0107 0.67ª 0.42ª 0.27ab
ECS-0106 0.69a 0.46abc 0.24bcd ECS-0189 0.62ab 0.43ª 0.22bcd
ECS-0166 0.65ab 0.46abc 0.29ab ECS-0110 0.57bc 0.32c 0.27ab
ECS-0191 0.61bc 0.35abc 0.30ab ECS-0111 0.53cd 0.35bc 0.24abc
ECS-0167 0.58c 0.60a 0.29ab *ECS- 0.49d 0.37b 0.32a
ECS- 0.55cd 0.44abc 0.25abc ECS-0187 0.39e 0.17g 0.17cdef
ECS- 0.50de 0.32bc 0.24bcd ECS- 0.34ed 0.27d 0.18bcdef
ECS- 0.46e 0.28c 0.17de ECS-0119 0.32edf 0.18fg 0.21bcde
ECS-0168 0.31f 0.27c 0.20cde ECS-0188 0.29df 0.25de 0.12ef
ECS- 0.30fg 0.24c 0.13e ECS-0116 0.27df 0.22ef 0.11f
ECS- 0.24g 0.26c 0.13e ECS- 0.25f 0.26de 0.15def
C.V. 4.54 23.25 10.16 C.V. 5.69 5.39 15.24
P 4.9E-11 2.4E-4 1.9E-9 P 1.1E-16 8.8E-16 3.9E-7
Media A (peptone + glucose), B (peptone) and C (peptone + endosulfan). Incubation 25 ºC,11

d. * Strains selected. CV: Coefficient of variation , P: Probability at α=0.05
41
Growth and biodegradation of endosulfan by Pleurotus pulmonarius ECS-0190 in HNM and
LNM.
Figure 2 displays the growth of P. pulmonarius ECS-0190 in HNM and LNM. pH
values and endosulfan concentrations during growth in Erlenmeyer flasks with agitation are
indicated. The pHof the medium were significantly different in LNM and HNM in the
presence of endosulfan (p=2.17x10-9). The final pH was also affected significantly by the
addition of supplemental nitrogen (p=7.91x10-12).
ECS-0184 ECS-0185
1.0 1.0
Biomass (g/l)
0.8 0.8
Biomass (g/l)
0.6 0.6
0.4 0.4
0.2 0.2
0.0
0.0
0 3 5 7 9 11 0 3 5 7 9 11
Time (days) Time (days)
ECS-0190
Biomass (g/l)
1.0
0.8
0.6
0.4
0.2
0.0
0 3 5 7 9 11
Time (days)
Figure 1. Growth over time of three Pleurotus strains in Low Nitrogen Medium (LNM)
at 25°C and 150 rpm.
Symbols: Solid squares indicate growth in the absence of endosulfan. Solid triangles indicate
growth in the presence of endosulfan
Biomass
The growth of P. pulmonarius biomass over time in HNM and LNM, with and without
endosulfan is shown in Figure 2. In HNM without endosulfan, the μ value was 0.021 d-1, and
with endosulfan it was 0.018 d-1. No significant statistical difference was observed. In LNM,
the μ value was 0.073 d-1 and 0.056 d-1 in the absence and presence of endosulfan,
respectively. The difference in biomass as affected by endosulfan in HNM was 0.031, and in
LNM it was 0.192 g/l. The difference (LNM - HNM) due to nitrogen concentration was 0.583
g/l and for LNM (+endosulfan) – HNM (+endosulfan), the difference was 0.482 g/l. Statistical
analysis determined significant differences due to the presence of endosulfan (p=1.7x10-7)
and nitrogen concentration in the medium (p=3.1x10-19).
Endosulfan concentration.
P. pulmonarius degraded endosulfan both in high-nitrogen medium (HNM) and low-
nitrogen medium (LNM) (Figure 2). The initial concentration in both media was 82.28 mg/l
(α-endosulfan=53.99 mg/l; β-endosulfan=28.19 mg/l). The initial endosulfan concentration in
42
controls dropped 22% (63.84 mg/l: α-endosulfan=41.68 mg/l and β-endosulfan=22.16 mg/l),
due to the physical and chemical experimental conditions (pH, temperature).
Discussion
The degradation of endosulfan by strains of the genus Pleurotus has been reported
previously by Escobar et al. (2002) and by Hernández et al. (2006). In this study, we tested
the abilty of 80 strains of this genus to grow on solid medium in presence of endosulfan, and
studied the degradation of the insecticide by one of the fastest-growing strains identified.
a) b)
1.0 6.0 1.0 6.0
0.8 5.8 0.8 5.8

Biomass (g/l)
Biomass (g/l)
0.6 5.6 pH 0.6 5.6
pH
0.4 5.4 0.4 5.4
0.2 5.2 0.2 5.2
0.0 5.0 0.0 5.0

0 3 5 7 9 11 0 3 5 7 9 11
a) EI E II ES b) EI E II ES
100 1.5 100 1.5

Endosulfan (mg/l)
Endosulfan (mg/l)
E. sulfate (mg/l)
E. sulfate (mg/l)
80 1.2 80 1.2
60 0.9 60 0.9
40 0.6 40 0.6
20 0.3 20 0.3
0 0.0 0 0
0 3 5 7 9 11 C 0 3 5 7 9 11 C
Figure 2. Growth of Pleurotus pulmonarius ECS-0190 in (a) high-nitrogen medium

(HNM) and (b) low-nitrogen medium (LNM) at 25°C and 150 rpm.
Solid squares indicate growth in the absence of endosulfan. Solid triangles indicate growth in
the presence of endosulfan. E I= α-endosulfan; E II= β-endosulfan; ES= endosulfan sulfate.
Our results showed that all the strains tested were able to grow in presence of 100
ppm endosulfan, although at this concentration the insecticide’s inhibitory effect on growth
varied with the strain. All strains grew in Medium B, which did not contain glucose,
suggesting that Pleurotus might be able to use peptone as a carbon source, although the
growth in this medium was comparatively slower than the growth with glucose. In Medium
A, 59 % of the strains covered completely the agar plate surface between the sixth and eighth
day of incubation. In Medium B, 56 % of strains covered the petri dishes between eighth and
eleventh day of incubation. These results are comparable to those obtained by Singh et al.
(2000) who cultivated P. pulmonarius on wheat extract, malt extract, and Sabouraud agar, and
observed 90 mm agar plates
43
Table 4. Radial extension rate (RER) of the selected strains from
Table 3 on agar.
Strain Medium A Medium B Medium C

ECS-0128 0.75a 0.51ab 0.30abc
ECS-0104 0.74a 0.46cd 0.27c
ECS-0184** 0.73a 0.50abc 0.33ab
ECS-0140 0.71ab 0.53a 0.28c
ECS-0105 0.64bc 0.36e 0.30bc
ECS-0156 0.62c 0.48bcd 0.29bc
ECS-0190** 0.60c 0.49abcd 0.34a
ECS-0115 0.58cd 0.50abc 0.30bc
ECS-0185** 0.50d 0.50abc 0.35a
ECS-0177 0.50d 0.45d 0.26c
C.V. 3.76 5.68 4.61
P 2.3E-10 1.2E-8 7.7E-6
Media A (peptone + glucose), B (peptone) and C (peptone + endosulfan).

Incubation temperature: 25ºC, 11 days. **Strains selected after statistical
analysis.
covered by the fungus in 4.8, 6.4, and 11.5 days, respectively). Medium C (peptone +
endosulfan) was less favorable for growth: only 28 strains grew between 6 and 8 cm in 11
days of incubation. The growth rate was 3 to 57 % less for almost all strains in comparison
with Medium B. Strain ECS-0123 (Group 1) grew faster in Medium C (0.18 cm/d) than in
Medium B (0.11 cm/d). The difference is statistically significant at α=0.5 (p=2.47x10-6).
However, this strain grew poorly in all three media. ECS-0123 was the most endosulfan-
tolerant strain. Its growth was not inhibited by endosulfan; in fact, its growth seemed to be
stimulated in its presence. ECS-0123 can be used in future studies.
The three strains selected from the tests in solid media produced more biomass in
liquid culture without endosulfan, than with endosulfan. This fact confirmed the insecticide’s
inhibitory effect on growth: ECS-0184 showed 47.3 % growth inhibition, and ECS-0185 and
ECS-0190 were inhibited 20.2 % and 31.5% respectively.
ECS-0185 grew at a lower RER than the other two strains in liquid medium, both with
and without endosulfan. ECS-0184 and ECS-0190 did not show any statistical growth
difference in the medium without endosulfan, but ECS-0190 was clearly less inhibited by the
insecticide. For this reason, this strain was selected to study the removal of endosulfan during
growth. It has been reported that endosulfan limits P. ostreatus (ECS-0152) growth under
limited-nitrogen medium conditions (2.4mM and 10 g/l of glucose): Growth was 3.43 g/l
biomass in the medium without endosulfan versus 1.27 with endosulfan (Escobar et al. 2002).
Limiting nitrogen may induce enzyme excretion, particularly enzymes such laccases,
manganese peroxidase and veratryl alcohol oxidase (Palmieri et al. 1997).
A change in the culture’s pH was observed. This was probably due to the nutrient
source and the intrinsic metabolism of the mushroom (El-Kattan et al. 1990). These authors
observed a decrease in pH with ammonium as the nitrogen source. Moore-Landecker (1996)
suggested that the decrease in pH during mushroom cultivation was due to the formation and
accumulation of organic acids during metabolism. In other studies Sanchez & Martin (1994)
demonstrated an increase in pH from 5.5 to 8.0 during the cultivation of P. ostreatus on
coffee-wastewater.
44
The decrease in the C/N ratio with the addition of L-asparagine (1.584 g/l, 24 mM
nitrogen) partially inhibited the growth of P. pulmonarius ECS-0190. The biomass produced
by this fungus in HNM was 0.314 g/l, and in LNM, it was 0.897 g/l. The difference amounted
to a 65% reduction, with the addition of L-asparagine and a decreased C/N ratio, from 15:1
(LNM) to 1.5:1 (HNM). The ratio C/N in HNM was lower than the one reported by Khanna &
Garcha (1985).They estimated that the C/N ratio in Pleurotus species should be between 4:1
and 30:1, and the maximum biomass production can be obtained between 12:1 to 16:1.
Sanchez & Royse (2002), said that a ratio of 40:1 is optimal for growth in liquid medium.
Escobar et al. (2002) reported a ratio of 140:1, with a limited nitrogen medium producing
higher biomass concentration (3.43 g/l) than in a medium with a ratio of 14:1 (2.16 g/l).
In HNM, endosulfan inhibited growth 10%; in LNM it produced a 22 % inhibition.
Similar results were obtained by Escobar et al. (2002). P. ostreatus ECS-0152 was added to a
high-nitrogen medium in the presence of endosulfan (2 g/l glucose and 24 mM nitrogen), and
an inhibition of 41% was observed. When the same concentration was added to low-nitrogen
medium (10 g/l glucose and 2.4 mM nitrogen) 63% inhibition resulted.
Several other reports suggest that pesticides actually contribute (along with energy and
carbon) to the growth of P. pulmonarius (Matsumura, 1980), Polycyclic aromatic
hydrocarbons also seem to serve as a carbon source. Biomass increases as these compounds
are degraded by the fungus (Upadhyay & Fritshe, 1997; Pickard, 1999). Awasthi et al. (1997)
reported a substantial biomass increase (from 0.1 to 0.45 optical density), in a bacterial culture
due to the biodegradation of endosulfan.
The removal of endosulfan in HNM by P. pulmonarius was noted at day 2 after the
addition of insecticide (α-endosulfan=7.81 mg/l; 81% and β-endosulfan=13.52 mg/l; 39%).
Degradation resulted in a concentration of α-endosulfan of 1.257 mg/l (96.98 % reduction)
and β-endosulfan 1.413 mg/l (93.62% reduction) eight days after the addition of endosulfan.
1.057 mg/l of the metabolite endosulfan sulfate was also detected at day 8 after insecticide
addition. The biodegradation of endosulfan by P. pulmonarius cultured in LNM produced a
residual pesticide concentration of 0.12 mg/l (α-endosulfan, 99.7%) and 0.05 mg/l (β-
endosulfan, 99.7%). In LNM, 1.43 mg/l of endosulfan sulfate were produced. Statistical
analysis showed significant differences between α (p=3.8x10-5) and β (p=3.7x10-4) isomers,
but endosulfan sulfate did not show a significant difference. These data are similar to those
reported by Escobar et al. (2002) and Kullman & Matsumura (1996). In both those studies,
endosulfan degradation was higher in low-nitrogen medium (for P. ostreatus, 98.9%, and for
P. chrysosporium, 90%). In white rot fungi, endosulfan sulfate has been reported as the main
metabolite formed following oxidative degradation, due to extra-cellular enzyme activity.
(Kullman & Matsumura, 1996; Navarro et al. 2000), The presence of this metabolite, along
with the fact that endosulfan is not accumulated in P. pulmonarius ECS-0190 (Hernández et
al. 2006) suggests that this insecticide is degraded by the fungus.
Conclusions
The results in this study confirm that Pleurotus spp can tolerate high concentrations of
endosulfan. All strains of Pleurotus grew in the presence of this insecticide. P. pulmonarius
ECS-0190 has the ability to degrade it, and this capability is enhanced when the fungus grows
in a low-nitrogen medium.
Acknowledgements
The project was supported by the National Council of Science and Technology
(CONACYT), Grant 34199B. The technical support of Dr. R. Bello, Antonio Santiesteban,
Lilia Moreno, René Andrade and Gerardo Hernandez is gratefully acknowledged. The authors
thank the Instituto Tecnólogico de Tapachula , and Javier Valle Mora for his help with the
statistic analysis.
45
References
Awasthi N, Manicham N, Kumar A 1997. Biodegradation of endosulfan by a bacterial co-

culture. Environ. Contamin. Toxicol., 59, 928-934.
Bezalel L, Hadar Y, Cerniglia CE. 1996a. Mineralization of polycyclic aromatic hydrocarbons
by the white rot fungus Pleurotus ostreatus. Appl. Environ. Microbiol., 62, 292-295.
Bezalel L, Hadar Y, Fu PP, Freeman JP, Cerniglia CE. 1996b. Initial oxidation products in the
metabolism of pyrene, anthracene, fluorene, and dibenzothiophene by the white rot fungus
Pleurotus ostreatus. Appl. Environ. Microbiol., 62, 2554-2559.
Cohen R, Persky L, Hadar Y. 2002. Biotechnological applications and potential of wood-
degrading mushrooms of the genus Pleurotus. Appl. Microbiol. Biotechnol. 58, 582-594.
EPA. 2006. Pesticide Registration. Endosulfan. USA Environmental Protection Agency.
http://www.epa.gov/pesticides/reregistration/endosulfan/ February 16, 2006.
Escobar VM, Nieto MG, Sánchez JE, Cruz L. 2002. Effect of endosulfan on mycelial growth
of Pleurotus ostreatus and Auricularia fuscosuccinea in liquid culture. In: Sánchez JE,
Huerta G, Montiel E. (Eds). Proc. 4th Intl. Conf. Mushroom Biology and Mushroom
Products. Universidad Autónoma del Estado de México, Cuernavaca, México. pp399-408.
Gunther FA, Jeppson LR. 1975. Insecticidas modernos y la producción mundial de alimentos.
pp. 165. 4th Edition. C.E.C.S.A. México D.F.
Hernández-Rodríguez D, Sánchez JE, Nieto MG, Márquez-Rocha FJ. 2006. Degradation of
endosulfan during substrate preparation and cultivation of Pleurotus pulmonarius. World
J. Microbiol. Biotechnol. 22, 753-760.
Hernández-Romero AH, Tovilla-Hernández C, Malo EA, Bello-Mendoza R. 2004. Water
quality and presence of pesticides in a tropical coastal wetland in southern Mexico.
Marine Pollut. Bull., 48, 1130-1141.
INSP. 2005. Instituto Nacional de Salud Pública. El campo mexicano. Una bomba de tiempo
tóxica. http://www.insp.mx/2005/noticias/noticia020605_3.htm March 29, 2006.
Khanna P, Garcha HS. 1985. Physiological studies on Pleurotus spp. II. Carbon utilization.
Mushroom J. Tropics, 6, 9-14.
Kullman SW, Matsumura F. 1996. Metabolic pathways utilized by Phanerochaete
chrysosporium for degradation of the cyclodiene pesticide endosulfan. Appl. Environ.
Microbiol., 62, 593-600.
Márquez-Rocha FJ, Hernández-Rodríguez VZ, Vázquez-Duhalt R. 2000. Biodegradation of
soil-adsorbed polycyclic aromatic hydrocarbons by the white rot fungus Pleurotus
ostreatus. Biotechnol. Lett., 22, 469-472.
Martens R, Wolter M, Bahadir M, Zadrazil F. 1999. Mineralization of C-labelled higly-
condensed polycyclic aromatic hidrocarbons in soils by Pleurotus sp. Florida. Soil Biol.
Biochem., 31, 1893-1899.
Matsumura F. 1980. Toxicology of insecticides. pp63-64, 205. 3rd Edition. Plenum Press.
New York.
Moore-Landecker E. 1996. Fundamentals of fungi. Prentice-Hall. New Jersey, USA. pp290-
302.
Navarro S., Barba A, Segura JC, Oliva J. 2000. Disappearance of endosulfan residues from
seawater and sediment under laboratory conditions. Pest Management Sci., 56, 849-854.
Palmieri G, Giardina P, Bianco C, Scaloni A, Capasso A, Sannia G. 1997. A novel white
laccase from Pleurotus ostreatus. J. Biol. Chem., 272, 31301-30307.
Pickard MA, Vandertol H, Roman R, Vazquez-Duhalt R. 1999. High production of
ligninolytic enzymes from white rot fungi in cereal bran liquid medium. Can. J.
Microbiol. 45, 627-631.
Rodriguez E, Pickard MA, Vázquez-Duhalt R. 1999. Industrial dye decolorization by laccases
from ligninolytic fungi. Curr. Microbiol., 38, 27-32.
46
Sánchez JE, Royse DJ. 2002. La biología y el cultivo de Pleurotus spp. pp19, 61-62.
ECOSUR-UTEHA. Editorial Limusa, México.
Sánchez JE, Martín AM. 1994. Pleurotus production in coffee bean wash water. In
Developments in food engineering. Part 2, pp1017-1019. Ed. Yano T, Matsuno R,
Nakamura N. Chapman and Hall. Toronto.
Schûtzendûbel A, Majcherczyk A, Johannes C, Hüttermann A. 1999. Degradation of fluorene,
anthracene, phenanthrene, fluoranthene and pyrene lacks connection to the production of
extracellular enzymes by Pleurotus ostreatus and Bjerkandera adusta. Int. Biodeterior.
Biodegradation, 43, 93-100.
Shetty PK, Mitra JNB, Murthy K, Namitha KK, Savita N, Raghu K. 2000. Biodegradation of
cyclodiene insecticide endosulfan by Mucor thermo-hyalospora MTCC 1384. Curr. Sci.,
79, 1381–1383.
Siddique T, Okeke BC, Arshad M, Frankenberguer WT. 2003. Enrichment and isolation of
endosulfan-degrading microorganism. J. Environ. Quality, 32, 47–54.
Singh SK, Upadhyay RC, Verma, RN. 2000. Physico-chemical preferences for efficient
mycelial colonization in edible mushrooms. Mush. Res., 9, 85-89.
Sutherland TD, Horne I, Lacey JM, Harcourt RL, Russell RJ, Oakeshott JO. 2000.
Enrichment of an endosulfan-degrading mixed bacterial culture. Appl. Environ.
Microbiol. 66, 2822–2828.
Upadhyay RC, Fritsche W. 1997. Ligninolytic enzymes of Pleurotus species. Adv. Mushr.
Biol. Production, 281-290.
Vilgalys R, Moncalvo JM, Liou S, Volovsek M. 1996. Recent advances in molecular
systematics of the genus Pleurotus. In: Royse DJ (Ed). Proc. 2nd Intl. Conf. Mushroom
Biology and Mushroom Products. Pennsylvania State University, University Park, PA,
USA. pp91-101.
Weir K, Sutherland TD, Horne I, Russel RJ, Oakeshott JG. 2006. A single monooxygenase,
Ese, is involved in the metabolism of the organochlorides endosulfan and endosulfate in
an Arthrobacter sp. Appl. Environ. Microbiol. 72, 3524-3530.
Yesilada O, Asma D, Cing S. 2003. Decolorization of textile dyes by fungal pellets. Process
Biochem. 38, 933-938.
47
Double Cropping Agaricus bisporus by Re-supplementing and Re-casing

Compost
Daniel J. Royse
Department of Plant Pathology, The Pennsylvania State University, University Park, PA
16802, USA. Email: djr4@psu.edu
Abstract
Four mushroom crops were grown to assess the effect of supplementing first or second
break “spent” mushroom compost (MC) on mushroom yield. Mushrooms were produced for
one or two breaks at the Mushroom Test Demonstration Facility, the casing layer was
removed and the fragmented MC was non-supplemented or re-supplemented with hydrolyzed
protein, crystalline or feed grade amino acids, or commercial supplements and then re-cased
for a second crop at the Mushroom Research Center. Crops 1 and 2 were designed to examine
the effect of re-supplementing second-break MC with SoyPlus®, a commercial delayed
release nutrient. Crops 3 and 4 evaluated the effects of non-supplementing or supplementing
first-break MC with commercial delayed-release nutrients, hydrolyzed protein or amino acids.
For Crops 1 & 2, BEs (two breaks) ranged from 46% on non-supplemented MC in Crop 1 to
60% on SoyPlus®-supplemented MC in Crop 2. For comparison, SoyPlus®-supplemented
Phase II compost BEs (two breaks) ranged from 58% in Crop 1 to 66% in Crop 2. For Crops
3 & 4, mean (combined Crops 3 & 4) BEs ranged from a low of 72% on non-supplemented
MC to a high of 101% on MC supplemented with crystalline L-isoleucine or Pro Fam H200
FG (a hydrolyzed soy isolate). Overall double crop yields were higher when first-break MC
was supplemented compared to second-break MC. Re-supplementing and re-casing MC
offers an opportunity for growers to obtain additional mushroom production from the same
compost. As materials costs rise, double cropping would potentially increase revenues while
reducing costs associated with compost preparation and disposal. Growers using a multi-zone
system, i.e., bulk Phase II compost preparation and bulk spawn run (Phase III), would be in
the best position to fully exploit double cropping. The multi-zone system reduces time of
exposure of the compost to pests and diseases because both Phase II and Phase III tunnels are
equipped with filters that prevent competitors from reaching the compost.
Key Words: Agaricus bisporus; Double cropping; Compost re-supplementation; Re-casing;

Increased yields
Introduction
The production of the common cultivated mushroom, Agaricus bisporus is a

multibillion dollar industry worldwide. This mushroom is produced on a composted mixture
of various raw materials including wheat straw, cottonseed hulls, hay, corncobs, bark, grain
distiller’s waste, oilseed meals and gypsum. During the crop cycle, mushrooms are harvested
in a rhythmic pattern of breaks or flushes that occurs at ca. 7-day intervals. After two flushes,
production declines rapidly and a grower must decide to terminate the crop and start anew or
face a dwindling harvest of mushrooms from each successive flush. Such a decision is
dependent upon the economics of production including the expected yield/flush, cost of
materials, labor, energy, utilities, depreciation and time. Ever increasing costs for mushroom
production is a major concern for growers because the price they receive for their product has
not kept pace with the cost of production. The preparation of compost is the single greatest
cost of production (Van Roestel, 1988; Wuest, 1983) so considerable effort has been made to
reduce outlays and increase potential productivity of the compost.
48
Mushroom production declines with each successive break due to diminishing
available nutrients (Sinden & Schisler, 1962; Schisler & Sinden, 1962), the build up of pest
populations (Fordyce, 1970), or to growth-inhibiting metabolites that accumulate in the
compost (Giovannozzi et al. 1978; Schisler, 1990). Removal of the casing layer and re-
supplementing the “spent” mushroom compost (MC) with cottonseed meal after second break
(Schisler, 1964) or with delayed release nutrients, amino acids or hydrolyzed protein after
first, second, or third break can increase yields by up to 40% depending on when the
supplements are added (Royse et al. 2008; Royse & Sanchez, 2008). Injections of liquidized
casein hydrolysates into compost after first break also is known to increase subsequent
mushroom yields (San Antonio, 1966).
Relatively recent developments in the mushroom industry, including broad adoption of
bulk Phase II and Phase III compost, fungicide treatment of spawn and supplement and
improved pest management and sanitation, would appear to offer growers an opportunity to
commercially exploit re-supplementing and re-casing MC for the production of a second crop
of mushrooms. The purpose of this paper is to review previous work and update our research
efforts to increase double crop yields and BE of A. bisporus on MC.
Two cropping trials (Crops 1, 2) were conducted to evaluate the effects of non-
supplementing or supplementing second break MC with a commercial delayed release
nutrient. Two additional trials (Crops 3 and 4) were used to evaluate the effects of non-
supplementing or supplementing first break MC with commercial delayed-release nutrients,
hydrolyzed protein or amino acids. All four crops involved production of mushrooms for one
or two breaks at the Mushroom Test Demonstration Facility (MTDF), removal of the casing
then transport of the de-cased MC to the Mushroom Research Center for re-supplementation
and re-casing. Crops 1 and 2 were designed to examine the effect of re-supplementing the
MC with SoyPlus®, a commercial delayed release nutrient. Crops 3 and 4 were used to
evaluate three hydrolyzed proteins, three commercial delayed release nutrients, one amino
blend, and one or more amino acids.
Mushroom production at the MTDF for the first two breaks

Phase I and Phase II compost for mushroom production was prepared as described by
Royse et al. (2008). The finished Phase II compost was supplemented with SoyPlus®, a
delayed release nutrient, at 4% of the dry wt at time of spawning with Sylvan 140 spawn (a
white U1-type hybrid).
Following a 16-day spawn run, a fiberglass screen was placed over the compost prior
to casing to ease removal of the casing overlay after mushroom harvest. Following harvest of
second break for Crops 1 and 2 or first break for Crops 3 and 4, the casing was removed and
the MC was transported (ca. 100 m) to the MRC for fragmentation, re-supplementation and
re-casing.
Mushroom production at the MRC

Mushrooms were produced on re-supplemented and re-cased MC at the MRC for
Crops 1 and 2 in plastic bins (56 cm x 44 cm x 24 cm) filled with 22.7 kg of MC at the time
of casing. For Crops 3 and 4, mushrooms were produced in plastic bins (17 cm x 22 cm x 28
cm) filled with 3.64 kg of MC at the time of re-casing. Supplements were thoroughly mixed
into the MC at the specified rate and the MC then was cased with a 4-cm layer of sphagnum
peat moss and limestone at ca 80% moisture. Casing inoculum was added to the moistened
casing (1 kg/m2) prior to application to the MC (Royse et al. 2008; Royse & Sanchez, 2008).
49
Experimental design and analysis
Experimental designs and analyses were conducted as described by Royse et al.
(2008) and Royse and Sanchez (2008).
Results
Double crop mushroom yields for two crops are shown in Table 1. Yields for two
breaks at the MTDF for Crops 1 and 2 were 19.9 kg/m2 and 19.7 kg/m2, respectively. BEs at
the MTDF ranged from a low of 57.5% in Crop 1 to a high of 65.9% for Crop 2. At the
MRC, mushroom yields ranged from a low of 12.6 kg/m2 on non-supplemented MC in Crop 1
to a high of 19.5 kg/m2 on MC supplemented with 3.7% SoyPlus. BEs ranged from a low of
45.9% on non-supplemented MC in Crop 1 to a high of 59.8% on MC supplemented with
SoyPlus®. Overall yields and BEs were higher in Crop 2 compared to Crop 1.
Mushroom yields for Crops 3 and 4 as affected by the addition of various supplements
to first break MC are shown in Table 2. Overall yields were higher in Crop 4 compared to
Crop 3 (29.0 kg/m2 vs. 26.2 kg/m2 respectively). Mean yields ranged from a high of 29.7
kg/m2 on MC supplemented with 3.6% (dry wt) L-isoleucine (ile) to a low of 20.4 kg/m2 on
non-supplemented MC (45.1% difference). All supplements significantly stimulated yield
compared to the non-supplemented control. Pro Fam H200 FG appeared to be the most
consistent in stimulating yield from crop to crop (yield difference of 0.15 kg/m2 between Crop
3 and 4).
The effect of adding individual amino acids to first break MC on mushroom yield is
shown in Figure 1. Significant yield increases were noted for leu and L-lysine SO4 (lys)
compared to the non-supplemented control. On the other hand, L-arginine (arg) DL-
methionine (met) and L-tyrosine (tyr) significantly reduced mushroom yield when added to
first break MC. Mushroom yield was 54% higher on MC supplemented with ile compared to
the non-supplemented control.
Discussion
The addition of 3.7% SoyPlus® to second break MC significantly increased

mushroom yield by 20.2% and 30.7% (mean 25.5%) compared to the non-supplemented
control MC in Crops 1 and 2, respectively. Biological efficiencies for 2 breaks averaged
56.5% for second break MC supplemented with 3.7% SoyPlus® compared to 61.7% BE for
Phase II compost supplemented with 4% SoyPlus®.
Table 1. Yield and BE (%) of mushroom (Agaricus bisporus) production on

supplemented Phase II and “spent” mushroom compost (MC)
Crop MTDF MRC Combine Combine
No. Flush No. Total BE Supple Flush No. (yield Total BE d MTDF d MTDF
(yield kg/m2) yield (%) ment1,2 kg/m2)3 yield (%) & MRC & MRC
1 2 (kg/m2) (g/bin) 1 2 (kg/m2)3 yield BE (%)
(kg/m2)
1 11.25 8.66 19.91 57.5 None 5.92b 6.70a 12.62b 45.9 32.53 103.4
11.25 8.66 19.91 57.5 272 7.44a 7.73a 15.17a 53.1 35.08 110.6
2 10.94 8.79 19.73 65.9 None 8.59b 6.35b 14.94b 47.3 34.67 113.2
10.94 8.79 19.73 65.9 272 11.67a 7.86a 19.53a 59.8 39.26 125.7
Mushrooms first were produced on Phase II compost supplemented at time of spawning with
SoyPlus® (3% dry wt) at the Mushroom Test Demonstration Facility (MTDF) for 2 breaks. The
50
casing then was removed and the MC was fragmented and non-supplemented or supplemented with
272 g (3.7% compost dry wt) per bin SoyPlus® and re-cased at the Mushroom Research Center
(MRC) for a second crop of mushrooms. 1 Supplement added at time of MC fragmentation and casing
at the MRC. 2 3.7% of oven dry compost wt. 3 Yields followed by the same letter within the same
column, flush and crop are not significantly different according to Tukey’s Honestly Significant
Difference, P = 0.05.
Table 2. Effect of various supplements added to first break compost1 on mushroom

yield and biological efficiency at the Mushroom Research Center for two crops (Crop 3,
4).
Supplement2 Yield (kg/m2)3,4 Mean BE5 (%) Mean BE

Crop 3 Crop 4 yield Crop 3 Crop 4 (%)
(kg/m2) Crops 3
Crops 3 & &4
4
L-isoleucine 28.26 ab 31.03 a 29.65 96.1 105.5 100.8
Pro Fam H200 FG (soy 29.55 a 29.70 a 29.63 100.5 101.0 100.8
isolate)
HLA-198 (hydrolyzed whey) 27.37 ab 31.30 a 29.34 93.1 105.8 99.5
Remo’s 28.28 ab 29.97 a 29.13 96.2 101.9 99.1
Amino blend (type BC-2) 27.53 ab 29.81 a 28.67 93.6 101.4 97.5
Remo’s (autoclaved) 27.07 b 29.35 a 28.21 92.1 99.8 96.0
Fermenten® 26.59 bc 29.38 a 27.99 90.4 99.9 95.2
Soypeptone (experimental 26.17 bc 28.63 a 27.40 89.0 97.4 93.2
M-061121)
Lambert T6 23.24 d 28.68 a 25.96 79.1 97.5 88.3
None 18.32 e 22.56 b 20.44 64.1 78.9 71.5
Average 26.24 29.04 27.64 89.4 98.9 94.1
Treatments were sorted in descending order by mean yield. 1Mushrooms were harvested for 1 break at
the Mushroom Test Demonstration Facility prior to re-supplementing and re-casing for a second crop
at the Mushroom Research Center. 2Supplements added at 36 g/kg compost (oven dry wt). 3Yield from
three breaks. 4Means followed by the same letter are not significantly different according to Tukey’s
Honestly Significant Difference, P = 0.05. 5Biological efficiency defined as ratio of fresh mushroom
weight to dry compost weight expressed as a percentage.
Both ile and Pro Fam H200 FG gave identical mean BEs (100.8%, three breaks) for
two crops (Crops 3, 4) on first break MC. BE for first break MC for Crops 3 and 4 at the
MTDF were 32.5% and 34.9% (mean 33.7%), respectively. Thus, overall double crop BEs
were substantially higher for Crops 3 and 4 (mean 134.5%) on supplemented (3.6% ile) MC
compared to Crops 1 and 2 (mean 118.2%) on supplemented (3.7% SoyPlus®) MC. Both the
type of supplement and the use of first break MC may have contributed to this difference.
Our previous work indicated that using first break MC results in higher overall double crop
yields compared to using second or third break MC (Royse et al. 2008).
Supplementation of first break MC with either lys or ile resulted in increased
mushrooms yields. Since L-lysine SO4 is only 50.7% lys, further increases in mushroom
yield may be possible if the concentration of L-lysine SO4 was doubled. L-lysine SO4 is a
feed grade amino acid that is routinely added to ruminant and swine feed. At current prices of
about $2/kg for L-lysine SO4 and about $30/kg for ile, it might be worthwhile exploring the
use of these amino acids, especially lys, as additives to Remo’s or other commercial
supplements. The current prices may limit their singular use in compost to stimulate
51
mushroom yield, but the use of these amino acids as additives to commercial supplements
would substantially lower the economic threshold of their use.
35
30
25
20
15
10
0
e
4
ne
ne
e
in
in
SO
on
ni
ci
os
on
eu
gi
ne
r
hi
Ty
Ar
ol
et
si
L-
L-
Is
Ly
M
L-
L-
L-
D
Amino Acid
Figure 1. Effect of amino acid addition (36 g/kg dry wt) to first break
compost (MC) on second-crop mushroom yield (3 breaks) at the
Mushroom Research Center (MRC)
Mushrooms were harvested for one break at the Mushroom Test Demonstration
Facility, the casing was removed, and the MC was fragmented prior to re-
supplementing and re-casing for a second crop at the MRC (Crop 4)
Re-supplementing and re-casing MC offers an opportunity for growers to obtain

additional mushroom production from the same compost. As materials costs continue to rise,
double cropping would potentially increase revenues while reducing costs associated with
compost preparation and disposal. Growers using a multi-zone system, i.e., bulk Phase II
compost preparation and bulk spawn run (Phase III), would be in the best position to fully
exploit double cropping. The multi-zone system reduces time of exposure of the compost to
pests and diseases because both Phase II and Phase III tunnels are equipped with filtered air
that prevents competitors from reaching the compost.
Double cropping is currently only practiced routinely on a research scale where a
higher degree of cleanliness generally is present compared to commercial farms. Thus,
growers attempting to practice re-supplementing and re-casing MC for a second crop may be
at increased risk for exposure to pest problems. Growers will need to carefully assess this
increased contamination risk prior to attempting to practice double cropping on their farm.
Acknowledgements
The technical assistance of Tom Rhodes, Doug Keith, Henry Shawley and John
Pecchia is gratefully acknowledged.
52
References
Fordyce C. 1970. Relative numbers of certain microbial groups present in compost used for
mushroom (Agaricus bisporus) propagation. Appl. Microbiol. 20, 196-199.
Giovannozzi Sermanni G, Basile G, Luna M. 1978. Biochemical changes occurring in the
compost during growth and reproduction of Pleurotus ostreatus and Agaricus
bisporus. Mushroom Sci., 10, 37-53.
Royse DJ, Sanchez JE, Beelman RB, Davidson J. 2008. Re-supplementing and re-casing
mushroom (Agaricus bisporus) compost for a second crop. World J. Microbiol.
Royse DJ, Sanchez JE. 2008. Supplementation of first break mushroom compost with
hydrolyzed protein, commercial supplements and crystalline amino acids. World J.
Microbiol. Biotechnol. 24:(in press) (published online 21 November 2007)
San Antonio JP. 1966. Effects of injection of nutrient solutions into compost on the yield of
mushrooms (Agaricus bisporus). Proc. Amer. Hort. Soc., 89, 415-422.
Schisler LC. 1964. Nutrient supplementation of compost during the mushroom growth
cycle. Mushroom Growers Association Bulletin, 179, 503-541.
Schisler LC, Sinden JW. 1962. Nutrient supplementation of mushroom compost at spawning.
Mushroom Sci. 5, 150-164.
Schisler LC. 1990. Why mushroom production declines with each successive break, and the
production of a second crop of Agaricus mushrooms on “spent” compost. Appl. Agric.
Res., 5, 44-47.
Sinden JW, Schisler LC. 1962. Nutrient supplementation of mushroom compost at casing.
Mushroom Sci., 5, 267-280.
Van Roestel AJJ. 1988. Costs and returns. pp447-483, In: Van Griensven, LJLD (Ed) The
cultivation of mushrooms. Mushroom Experimental Station, Horst, The Netherlands.
Wuest PJ. 1983. Resources need to farm the “champignon”. Mycologia, 75, 341-350.
53
Progress of Lentinula edodes Research in China

Qi Tan and Chunyan Song
Institute of Edible Fungi, Shanghai Academy of Agricultural Sciences, Shanghai 201106,
P.R. China. Email: syj0@saas.sh.cn
Key Words: Lentinula edodes; Germplasm resources; Strain identification; Breeding,

Pharmacological activity
Introduction
The edible/medicinal mushroom, Lentinula edodes (Xiang-gu in Chinese), is

cultivated and consumed in many countries worldwide. In terms of total annual output, it
currently ranks second, behind Agaricus bisporus, among all the mushrooms grown on an
industrial scale. China is the major producer and exporter of Xiang-gu, and the mushroom
continues to play an increasingly important role in the economic and social development
of the country. This is due in large part to the many scientific breakthroughs and
production improvements relating to Xiang-gu achieved in recent years by mushroom
biologists and growers in China and elsewhere. Of almost 1000 articles on Xiang-gu listed
in the CAB (Commonwealth Agricultural Bureaux) database, 15%, 19%, 11% and 25%,
respectively related to the cultivation, physiology, molecular biology/breeding and
pharmacology of this mushroom. 38％, 20% and 9% of these articles were authored by
researchers from Japan, China and South Korea respectively (scholars from the United
States and Germany accounted for 13% and 9%, respectively), thereby demonstrating that
most research activity on L. edodes is concentrated in Asia. This paper describes the latest
advances in Xiang-gu research and development in China over a wide range of areas
including germplasm resources, strain identification, breeding and breeding technologies,
and pharmacological activity.
Germplasm Resources
Researchers at Huazhong Agricultural University located in Wuhan, Hubei Province,

have conducted extensive studies on the wild L. edodes germplasm resources in China.
Lin et al. (2003) analyzed the mating type factors present in 94 monokaryons derived from
53 wild strains of L. edodes collected from 14 Chinese provinces of China. Sixty-six
different A factors and 72 different B factors were identified from the samples, and the
specific factors of both the A and B incompatibility series occurred in equal frequency. It
was estimated that 121 distinct A factors and 151 distinct B factors existed among natural
populations of L. edodes in China, indicating a very high degree of genetic diversity in the
fungal germplasm resource. Sun & Lin (2003) used RAPD (Random Amplified
Polymorphic DNA) analysis to assess the level of DNA polymorphism among 53 wild
strains of L. edodes collected from 14 provinces distributed throughout eight floristic
regions of China. Amplification using 10 random primers revealed a total of 147 RAPD
bands, 94% of which were found to be polymorphic. The variation in RAPD band patterns
54
and DNA similarity among the strains confirmed the strong genetic diversity among the
natural L. edodes germplasm resource of China.
In view of the shortage of Asian Lentinula strains in reported phylogenetic studies
involving ITS (internal transcribed spacer) fragments of nuclear ribosome DNA, Xu et al.
(2005) sequenced ITS regions of rDNA extracted from 60 wild strains of L. edodes
collected from 15 different provinces of China. A phylogenetic evaluation was carried out
based on the 60 Chinese and 48 reported sequences using Collybia isolates as the outgroup,
and the phylogenetic status of the Asian strains within the entire Lentinula population was
reappraised. Altogether, five Asia-Australasia rDNA lineages were identified, and only
strains from China and Papua New Guinea were distributed among two of each of these
five lineages. Papua New Guinea strains were distributed among island lineage IV and
island-continental lineage II, while Chinese strains were distributed among island lineage I
and continental lineage V. Furthermore, China has much broader range of L. edodes
distribution than Papua New Guinea. Therefore, China is the most important region for
genetic diversity in L. edodes as far as the eastern hemisphere is concerned.
Researchers at the Institute of Edible Fungi, Shanghai Academy of Agricultural
Sciences, studied DNA polymorphism among 31 commercial cultivars of L. edodes using
RAPD (Song et al. 2005), ISSR (InterSimple Sequence Repeat) (Qin, 2005) and AFLP
(Amplified Fragment Length Polymorphism) (Zhuo et al. 2006) methodology. Data
revealed that RAPD was useful for analyzing genetic differences in larger samples, or
among strains with no clear genetic background, although it was less effective in
demonstrating polymorphism compared with AFLP and ISSR markers. Genotypes of
different strains were readily distinguishable by DNA fingerprints produced using AFLP,
which represents a rapid and effective technique for monitoring the quality, and for
providing a scientific basis for standardizing production management, of cultivated L.
edodes strains. These studies laid the foundation of a genetic database able to provide
molecular evidence of genetic relationships between L. edodes strains, and for the
selection and breeding of eminent cultivars.
Strain Identification
With the expansion of Xiang-gu production, accurate strain identification has become
even more crucial, both for L. edodes strain improvement through the implementation of
breeding programmes and the adoption of new germplasm resources, and for industrial
application. Several approaches are currently adopted for strain identification including
morphological characterization, antagonism tests, isozyme patterns, and the use of various
molecular markers.
Tan (1998) recommended a new convenient and reliable method for identifying L.
edodes strains based on mating type gene analysis involving the use of protoplast
monokaryons and mating tests. A subsequent study using single spore cultures to analyze
the mating type genes of 15 artificial-log-cultivated L. edodes strains from Fujian Province
revealed the presence of only 5 A and 5 B mating type factors among the test sample (Xie
et al. 2004). According to data from incompatibility tests, the 15 strains could be separated
55
into six groups based on mating type. Relationships among the strains were analyzed by
reference to breeding backgrounds and RAPD analysis data, and demonstrated that mating
type could play an important role in strain identification.
Researchers at the Fujian Edible Fungi Strains Station analyzed 15 L. edodes strains,
cultivated on artificial logs and registered in Fujian Province, by RAPD using 50 random
primers (Fu et al. 2002). All 15 strains were effectively identified using polymorphic DNA
fragments amplified by the S42 molecular marker. Subsequently, four RAPD markers
linked to four L. edodes strains were successfully converted into more specific and stable
SCAR markers (Song et al. 2005). When these four strain-specific SCAR markers were
tested using 164 L. edodes strains collected from all over China, their feasibility and
reliability for rapid strain identification was validated.
Based on results of studies so far, we can conclude that it is difficult to distinguish
strains using a single method, even in cases where differences existed between the various
strains of L. edodes. It is necessary to adopt an integrated approach using a range of
procedures, to establish comprehensive databases, and to develop a rapid and precise
strain-diagnostic system for this mushroom. Currently, researchers at the Institute Edible
Fungi in Shanghai have developed 20 strain-specific markers for Lentinula spp using
AFLP, RAPD, ISSR, SCAR and other modern molecular biological techniques. Fourteen
of the 20 strains are commercial cultivars of L. edodes (Shenxiang 93, 54, 241, 241-4, 135,
507, 9015, Qingke20, 7402, Cr02, L03, 44, 54, Minfeng No.1), three are wild strains of L.
edodes (43, 47, 50) and three are as yet unidentified Lentinula species (Baopi 0820, Baopi
0821 and Hupi 0827). According to the records, Baopi 0820 and Baopi 0821 are L.
lepideus strains, and Hupi 0827 is L. tigrinus).
Breeding and Breeding Technologies
Industrial-scale production of L. edodes in China began in the early 1980s, developed

rapidly in the 1990s, and has been expanding rapidly ever since. The use of good
commercial strains has played a decisive role in the development of the L. edodes industry.
Both conventional and more modern methods have been used to generate strains that
produce high yields of high quality mushrooms, exhibit a strong resistance to disease, are
adaptable to different climates and cultivation regimes, or for some other special purpose.
Conventional procedures include mutation, cross- breeding and domesticated breeding,
whereas protoplast technology and molecular breeding techniques have been adopted only
more recently. Since China is the largest producer and consumer of L. edodes, much
ground-breaking breeding work has been undertaken in the country. Tan et al. (2000)
divided the process of L. edodes breeding in China into four phases: the initial phase, the
spawn-introduction phase, the single-spore cross-breeding phase and the protoplast
cross-breeding phase. For nearly 20 years, cultivation on artificial logs has been widely
used in China, and a large amount of breeding work centered on this mode of cultivation
has been carried out. In the early 1980s, single spore cross-breeding played an important
role in L. edodes strain improvement. Single spores were collected from fruit bodies and
two monokaryons of different genotype and ecotype were mated using the symmetrical
hybrid method. The hybrid offspring would be examined for desirable characters such as a
56
faster mycelium growth rate, adaptability, and high yields of good quality fruit bodies, and
strains selected from these offspring on the basis of required attributes. Cultivars Cr02,
Cr04 and Cr66 were bred using the spore crossing method. The “Hybrid 26” cultivar was
bred in the same way using 19 wild spore monokaryons as crossing material (Kang et al.
1994). All these strains are still the main L. edodes varieties used in substituted cultivation.
The fourth stage in L. edodes breeding development was based on protoplast
technology. Pan et al. (1989, 1992, 1993) optimized the conditions for L. edodes
protoplast preparation and regeneration, and used L. edodes and L. tigrinus for interspecies
protoplast fusion experiments. Pan et al. (1993) found that the appearance of monokaryon
protoplasts was a general phenomenon during the release and regeneration of protoplasts
from mycelia of L. edodes. Parental characteristics such as colony morphology, mycelial
growth rate and auxotrophy were maintained in the monokaryon protoplasts. However,
protoplast and spore monokaryons differed genetically in that the former produced asexual
progeny without meiosis, whereas meiosis was involved in the generation of sexual
progeny from the latter.
In other protoplast research, Suxiang (a cultivated strain) and a wild strain (No. 70)
were selected as parental strains based on genetic differences detected using the RAPD
technique (Tan, 1999). Monokaryons, with different mating factors as genetic markers,
were prepared by protoplast technology and cross-bred. Shengxiang No. 8, a new
recombinant high-yielding and adaptable strain was selected out by the symmetrical
genome shuffling method. The high quality strains, JW1 and JW3, were also bred from
protoplast monokaryons using the same technology (Gan et al. 2006). Asymmetrical
genome shuffling, also called mono-di crossing, is a breeding method that has been used
to improve certain known cultivated strains possessing desirable characteristics (Tan,
2001). A protoplast monokaryon serves as the acceptor and a dikaryon strain with the
desired characteristic(s) as the donor. Using asymmetrical genome shuffling technology, L.
edodes Shengxiang No. 10 was selected following protoplast fusion between a
monokaryon acceptor from “hybrid 26” and a dikaryon donor derived from Suxiang.
Subsequent cultivation revealed that Shengxiang No.10 had retained the desired quality of
high flexibility from “hybrid 26” and acquired the high yield feature of Suxiang. Although
the technique is limited in scope in terms of the traits that can be augmented, asymmetrical
genome shuffling is a new way to improve existing cultivated strains, especially some fine
cultivars.
Pharmacological Activity
L. edodes is also a well-known medicinal fungus that contains numerous bioactive

components including polysaccharides, nucleotides, vitamins, proteins, amino acids and
minerals (Dong et al. 2005). Polysaccharides from L. edodes have been widely studied
both in China and elsewhere, and are reported to exhibit a wide range of biological effects
including immunostimulation, anti-tumor, antiviral, hypoglycemic, hypolipidaemic,
anti-ageing, anti-mutation and hepatoprotective activities. The anti-tumor activity of the
polysaccharides is due to activation of the host immune system rather than direct
57
tumoricidal effects, and involves enhancement of the phagocytic ability of macrophages,
activation of T cells to secrete cytokines, and improved antigen cells to dendritic cells.
More recent reports demonstrating that sulfonated derivatives of L. edodes
polysaccharides exhibit anti-HIV activity represents a new direction in the study of these
fungal components.
In the 1960s, Japanese researchers extracted, isolated and purified a series of
polysaccharides from L. edodes and demonstrated their immunostimulatory and
anti-tumor effects. One of these polysaccharides, named lentinan (mol. wt ~4.8 × 105 Da),
was developed in the 1980s as a drug for immunoenhancement, and the treatment of
chronic hepatitis and tumors. In the 1990s, lentinan was used in clinical trials in China and
shown to have good curative effects. Modern research has shown that lentinan functions as
an immuno-regulator, and has various properties including anti-viral, anti-tumor (Guo,
2007) and antioxidant (Yao et al. 2004) activity.
Most recent studies have focused on the extraction and purification of polysaccharides
from L. edodes, and on the search for novel pharmacological effects. Polysaccharide that
had been extracted from L. edodes with hot water under alkaline conditions was treated
with CAS, trypsin and dialysed. Activated carbon was then used to remove protein and,
after precipitation with a mixture of organic solvents, the polysaccharide was collected
and freeze-dried (Guo et al. 2007). This protocol was effective in removing contaminating
material such as protein, pectin and nucleic acid. Decolorization of lentinan preparations
was investigated using six types of macroporous adsorption resins and two kinds of
ion-exchange resins (Xie & Zhou, 2007). Most effective decolourization was achieved
with the macroporous adsorption resin, DA201-C, at pH 4-6, 40 OC and a flow rate of
3BV/h.
Concluding remarks
In summary, although there have been extensive developments in the cultivation and
breeding of L. edodes, research in China and elsewhere has attached greater importance to
the genetics of this mushroom. However, further in-depth and systematic research is
required to resolve present-day problems facing the L. edodes industry. The future for
further development and exploitation of L. edodes is bright.
References
Chen MJ, He DM, Wang ZY, Pan YJ, Tan Q. 1999. Breeding of Lentinula edodes，
through protoplasted monokaryon technique Acta Horticulturae Sinica, 26, 271-272.
Dong XY, Ning AH, Cao J，Huang M. 2005. On progress of the research on
Lentinula edodes (Berk) Sing. and the pharmacological effect. J. Dalian Univ., 26,
63-68.
Fu RZ, Xie FQ, Xie BG, Huang ZL. 2002. Molecular identification of 15 Lentinula
edodes strains cultivated with artificial synthetic compost. Acta Edulis Fungi, 9, 5-8.
Gan BC, Tang JR, Peng WH, Guo Y, Xie LY, Xiao ZQ. 2006. Study on the breeding
58
of JW strains from protoplast monokaryon cross in Lentinula edodes. Southwest
China J. Agric. Sci., 19, 494-497.
Guo ZJ. 2007. Summarization on the application of lentinan in anti-tumor. Guiding
Journal of TCM, 13, 78-80.
Guo YT, Zeng ZP, Li H, Long HY. 2007. Study on removal of protein from
lentinan. Appl. Chem. Ind., 36, 328-329.
Kang YA, Lian MZ, Zhong YJ. 1994. Studies on selection of Lentinula edodes
“Hybrid 26”. Acta Edulis Fungi, 1, 1-6.
Lin FC, Wang ZW, Sun Y, Cai YJ. 2003. Analysis of the mating type factors in
natural population of Lentinula edodes in China. Mycosystema, 22, 235-240.
Lin N, Zhong YG, Wang SQ, Liu CJ. 2007. Review on advancement of
polysaccharide from Lentinula edodes. Food Res. Devel., 28, 174-176.
Pan YJ, Chen MJ, Wang ZY. 1989. Separation and incubation of protoplasts in Lentinula
edodes. Acta Agriculture Shanghai, 5, 25-30.
Pan YJ, Chen MJ, Wang ZY, Gong SP, Zhen HG. 1992. Interspecies protoplast fusion
of Lentinula edodes and Lentinula tigrinus. Acta Agriculture Shanghai, 8, 9-12.
Pan YJ, Liao HQ, Zhang ST. 1993. A study on monokaryotization by protoplasting of
heterokaryotic mushrooms. Acta Agricultural Shanghai, 1993,9(2): 1-5.
Qin LH. 2005. Study on the construction of strain-specific molecular markers in
Lentinula edodes. Doctoral Thesis, Nanjing Agricultural University.
Song CY, Tan Q, Chen MJ, Pan YJ. 2005. Identification of cultivated strains of
Lentinula edodes by SCAR markers. Mycosystema, 24, 132-138.
Sun Y, Lin FC. 2003. Analysis of genetic diversity in natural germplasm of Lentinula
edodes in China using RAPD technique. Mycosystema, 22, 387-393.
Tan Q. 2001. Mechanism discussing on molecule biology and application of
symmetrical and asymmetrical genome shuffling to breeding of Lentinula
edodes. Doctoral Thesis, Nanjing Agricultural University.
Tan Q, Pan YJ, Huang WY. 2000. The development process of Lentinula edodes
breeding in China. Acta Edulis Fungi, 7, 48-52.
Tan Q, Pan YJ, Chen MJ, Wang ZY, He DM, Feng ZY, Yan PL, Guo Q, Ling XF,
Zhan CX. 1998. New identification method of Lentinula edodes strain using mating
type gene as main marker. Acta Edulis Fungi, 5, 6-11.
Tan Q, Pan YJ, Wang ZY, He DM, Chen MJ. 1999. Breeding of Lentinula edodes through
protoplasted monokaryon technique. Acta Horticulturae Sinica, 26, 271-272.
Xie FQ, Xie BG, Yi H, Fu RZ, Lin YC, Huang ZL, Zhang HZ. 2004. Determination of
mating types of Lentinula edodes and its application in strain identification of main
cultivating strains in Fujian Province. J. Fujian Agric. For. Univ. (Natural Science
Edition), 33, 521-526.
Xie HQ, Zhou CS. 2007. Study on de-colorization technology of lentinan. Ion
Exchange and Adsorption, 23, 158-165.
Xu XF, Li AZ, Cheng SM, Lin FX, Lin FC. 2005. Reappraisal of phylogenetic status and
genetic diversity analysis of Asian population of Lentinula edodes. Progress in Natural
Science, 15, 1204-1210.
Yang JM. 2006. Progress of the research on lentinan. Anhui Agri. Sci.Bull., 12, 55-56.
59
Yao L, Wang J, Zhao HT. 2004. Development of research on biologic activity of
lentinan. China Beet and Sugar, 3, 27-30.
Zhuo Y, Tan Q, Chen MJ, Cao H, Jia YN, PanYJ. 2006. AFLP analysis of genetic
diversity in main cultivated strains of Lentinula edodes. Mycosystema, 25, 203-210.
60
Mushroom Compost Production – A Review of Industry Quality Assurance

Frameworks in Ireland
Mairead Kilpatrick1, H. S. Shekhar Sharma 2,3and Gary Lyons2

Applied Plant Science and Biometrics Division1, Agri-Food and Biosciences Institute, Manor
House, Loughgall, Co Armagh, BT60 8JB, Applied Plant Science and Biometrics Division2,
Agri-Food and Biosciences Institute, Newforge Lane, Belfast, BT9 5PX, and School of
Biological Sciences3, Queen’s University Belfast, Newforge Lane, Belfast BT9 5PX, UK. E-
mail: s.sharma@qub.ac.uk
Abstract
Irish composters have established a reputation for excellent substrate quality

manufactured to Best Available Techniques (BAT) for the control of emissions to air from
composting installations. The majority implement compost production methods that follow
the principles of Hazard Analysis Critical Control Points (HACCP). The industry frameworks
reported in this paper are based on Irish and UK legislation and policy documents, European
Union directives, academic studies and discussions with industry members from the Republic
of Ireland and Northern Ireland. Quality assurance (QA) protocols may need further practical
development with the aid of workshops, research and interviews with small groups of high
performing industry members. The results can then be used to inform government policies
along with dissemination of the key findings to all members. This effort should be followed
up by discussions with industry to ensure that the best practice will be widely recognized,
accepted and can be readily applied by others. This collaborative “whole supply chain
process” approach should generate a higher degree of industry ownership. Intervention steps
for implementing QA directives at each stage of production need to be planned and organised.
Major factors influencing the industry have been considered and discussed to provide a way
forward.
Key Words: Mushroom compost; European policies and directives & industry review;
Quality assurance protocols; Sustainable food production; Environmental protection
Introduction
In the past two decades, the mushroom industry in Ireland has grown rapidly with a
farm-gate value worth € 124 m with exports of the order of € 95 m in 2005 (Anon., 2005a). A
recent report has highlighted contributions of this sector to the economic prosperity of rural
communities and in 2004 more than 4500 workers are directly involved across the full
production and supply chain. At the same time, the sector in N Ireland was worth £25 million
per annum, employing more than 600 workers (Anon., 2005a).
Previous reviews of the horticulture sector (O’Maolain, 2000; Anon., 2004a) concluded
that the mushroom industry has been facing harsh economic and environmental problems
caused by competition in the UK export market, environmental issues on odour emissions
from compost production and a lack of policies on the disposal of spent mushroom compost
and waste plastic packaging. A recent review (Anon., 2005a) on the cross border horticulture
industry was based on economic, demographic, production and market profiles of all crops. It
highlighted market strengths and weaknesses of major crop production and emphasised that
the mushroom sector requires cooperative ventures or producer groups in order to maintain a
competitive production volume and the necessary marketing network. Other recent reviews of
the industry in Northern Ireland, British Columbia, Canada and Australia have reiterated that
61
strategic plans need to be in place to advance this sector (Anon., 2004a; Anon, 2005b, c;
McEvilly, 2006).
In view of the current emphasis on “Sustainable Production of Food” in Europe, Ireland
and the UK, this sector should be highlighted and put forward as an example of sustainable
production for utilizing waste materials to produce substrates for growing mushroom.
However, there are deficiencies in the production steps and supply chain that need further
improvements to enhance the impact of the sector to the highest standard of sustainability.
The current report is aimed at reviewing government policies, industry and academic reports
on aspects relating to environment, quality assurance and code of practice for substrate
production to evaluate current issues and discuss future requirements for advancing the sector.
Policies and Directives
All composting and growing facilities must conform to relevant guidelines on health &
safety, environment protection, waste disposal, food safety regulations and other relevant
policies introduced by the two governments. From these overarching local, national and
international polices and legislation, very specific, detailed standards and guidelines on all
key areas have been developed. Participants in Quality Assurance programmes are inspected
and certified against these. Organisations based in Belfast and Dublin are responsible for
maintaining health and safety at work place. Their roles are to ensure that risks to people's
health and safety from work activity are properly controlled.
a. The Health and Safety Executive for Northern Ireland (HSENI), a Non- Departmental
Public Body with Crown status, was established by an Order in Council amending the
Health and Safety at Work (Northern Ireland) Order 1978.
b. The Health and Safety Authority is the national body in Ireland with responsibility for
securing health and safety at work. It is a state-sponsored body, operating under the
Safety, Health and Welfare at Work Act, 2005.
In addition the manufacturing and production activities of the supply chain must operate
in accordance with European Union directives. Some examples of policies and directives are
listed:
• Guide to the Health and safety at work order (NI), 1978, Northern Ireland.
o Management of Health and Safety at work regulations (MHSWR).
o Control of substances hazardous to health (COSHH) regulations.
o Noise at work regulations
o Electricity at work regulations
o Fire Services order
o Safety representatives and safety committees regulations (SRSC regulations)
o Reporting of injuries, disease and dangerous occurrence (RIDDOR)
o Health safety (first aid) regulations
o Health and safety information for employees regulations
o Health and safety (signs and signals) regulations
o Risk assessment
• Part III of the Environmental Protection Act 1990 contains the main legislation relating to
statutory nuisance in England, Wales and Scotland and is enforced by the local
authorities. The Public Health (Ireland) Act 1878, (as amended), contains the main
legislation relating to statutory nuisances in Northern Ireland. Under Part III of The
62
Pollution Control and Local Government (Northern Ireland) Order 1978, district councils
have powers to deal with noise nuisance.
• Environment (NI) order, 2002; pollution prevention and control regulations (NI) 2003;
industrial pollution control (NI) order 1997; IPO (prescribed processes and substances)
regulations, 1998, Northern Ireland.
• The Waste Electrical and Electronic Equipment (WEEE) Directive was adopted by the
EU in 2003. It aims to reduce the amount of WEEE being disposed in landfills by
promoting separate collection, treatment and recycling. It will affect businesses that have
WEEE to dispose of and the public who will have more opportunities to reuse, recycle
and recover these products.
• Directives on Dangerous Substances: The dangerous substances directive (76/464/EEC)

and its ‘daughter’ Directives control discharges to water that are liable to contain
Dangerous Substances.
• The Habitats Directive: The Directive requires member states to designate sites based on
species and habitats in the Directive’s annexes, and existing designations from the Birds
Directive. Once agreed by the European Commission, these sites become part of a
European network, Natura 2000.
• EC Directive on controlling nitrates from agricultural sources: The Nitrate Directive

requires member states to designate, as Nitrate Vulnerable Zones, surface or underground
waters that are or could be high in nitrate from agricultural sources.
• River water quality: River Quality Objectives (RQOs) were agreed by Government as
targets for all rivers in England and Wales when the water industry was privatised in
1989. The targets specify the water quality needed in rivers if we are to be able to rely on
them for water supplies, recreation and conservation.
• EC Directive on Surface Water Abstraction: Surface water abstracted for public water
supply has to comply with standards related to the quality of the water and the number of
people that the abstraction supplies.
• Waste Management Act, 1996, Ireland.
• The Litter Act 1982, Local Government (Water Pollution) Act 1977; Dumping at Sea Act
1951; the Local Government (Planning and Development) Acts 1963 and 1976, the
Sanitary Services Code, Ireland.
• Regulations and Orders Made Under the Safety, Health and Welfare At Work Act, 2005.
• During 1999 legislation in Northern Ireland (by Order in Council) and the Republic (by
Act of the Oireachtas) gave effect to the agreement signed in Dublin on 8 March 1999
(formally entitled Agreement between the Government of the United Kingdom of Great
Britain and Northern Ireland and the Government of Ireland Establishing
Implementation Bodies). The March agreement established six bodies "under and in
furtherance of Article 2 of the British-Irish Agreement [of 10 April 1998]", including "an
implementation body for food safety, to be known as The Food Safety Promotion Board.
63
• Food Safety Authority of Ireland Act, 1998 (Amendment of First and Second Schedules)
(No. 1) Order, 2000, Dublin, Published by the Stationery Office S.I. No. 184 of 2000.
• Food safety regulation (EC 882/2004) of the European Parliament and of the Council of
29 April 2004 on official controls performed to ensure the verification of compliance
with feed and food law, animal health and animal welfare rules.
Compost Production Protocol
Solid state fermentation is the biological decomposition of organic matter rich in

cellulose and nitrogen under controlled conditions brought about by the growth of micro-
organisms (Flegg et al. 1987). Good quality mushroom compost is an essential component of
the production of high-grade mushrooms (Agaricus bisporus). Substrate productivity is
largely determined by the quality of raw materials and the degree of control at Phase I, II and
III stages. An example of the phases of production including duration at each stage is listed in
Figure 1 (Sharma Anon., 2004a).
Recently, a detailed review of protocols on substrate production in Ireland has been
reported by Sharma et al. (2005). The raw materials used and the production steps have been
described to highlight information required for generating standard operating protocols for
QA, HACCP, environmental protection, waste disposal, health and safety.
Raw Materials
An important economic strength of the industry is that substrates are made from
agricultural residues - lignocellulosics and nitrogen rich litter from the broiler industry. The
quality of raw materials should be suitable for use in the production of mushrooms for human
consumption according to current best practice and the delivery of materials onto the
production yards must be from readily identifiable sources. A list of currently approved
suppliers with all contact details must be retained on site. In addition, a data sheet on the
materials delivered by the suppliers should be retained on the production unit as a reference
point (Anon., 2004a, b). Storage of raw materials must comply with all relevant health &
safety regulations. All raw materials should be analysed regularly for all key components and
micro-organisms as part of a quality assurance (QA) guideline and risk assessment protocol
for food safety. Certificate of tests/analyses should be obtained from an accredited or
approved laboratory.
Straw
Cereal straw usually forms the bulk of raw materials but alternatives including hay and
rape straw can be used according to availability. Wheat straw used by the industry is imported
from various counties in England and Ireland. Generally, fresh straw, either round or
rectangular bales, is dry and uniform. However new-year (i.e. freshly harvested) straw can be
very difficult to wet due to an outer waxy layer. Consequently, quality of straw used in the
production must be maintained by blending old and new-year straws throughout the year and
due care must be taken in the recipe formulation. Since, straw quality can be different
depending on the production area, cultivar and crop management protocols used (unpublished
data), and the delivery of straw onto compost production units must be from readily
identifiable sources. However, the supplier may not be able to provide all background
information listed above.
64
Goody water lagoon &
Pre-wet straw mechanically braised
OR
Pre-wet Bales dunked in goody water pit
Straw blended with Mechanical blending line

poultry litter & OR
gypsum Mixed by mechanical loader
Rough stack 4-12 d & turned every 2-3 d
Fill into aerated 3-5 d

bunker
Phase I
Moved to second
3-4 d
bunker and
adjusted for
moisture
Formed into windrows for 8 d
Final Phase I stage (turned every 2 d).
Emptied & left in yard overnight
l
Pasteurised &
Phase II conditioned in PII 6-8 d
tunnels
Bulk spawn run in

14-17 d
Phase III PIII tunnels
Figure 1: Material flow chart of mushroom compost in Ireland showing, pre-wet,

phase I, II and III stages of production.
65
Horse manure
Various lignocellulosic materials, such as cereal straw, wood savings and hemp waste
are used for horse bedding in stables. Consequently, the proportions of cellulose, moisture and
excrement/urine content can vary considerably both within an individual load and among
separate deliveries.
Nitrogen source (poultry manure)

Main source of nitrogen is poultry manure which contains excrement, urine and bedding
materials, such as wood chips, straw, peat and paper.
Gypsum
Hydrated calcium sulphate is a proprietary product produced by a several manufacturers
most commonly from agricultural origins. However, gypsum may also arise as a by-product
of industrial processes, for example, in Ireland from the glass crystal industry. In 2003,
problems with significantly higher levels of lead were quantified with the latter and it’s use
discontinued (personal communication).
Water
Recycled or “goody” water is applied at the early stages of production from secure
storage facilities on the production unit. However, washing and disinfection of cement floor
and machinery after pasteurisation of composted materials should be from a clean supply.
Waste water containing chemical residues from washings must be separated from the pipe-
work and collection points for recycled water used for wetting straw.
Mushroom Spawn and Additives

The supplier should provide detailed information on handling, storage, use of spawn
material or supplements and they must ensure that the goods do not represent a hazard to
health. In addition product specification and safety data sheets must be supplied for each
additive/supplement and retained on site.
Phase I
The first phase comprises dunking of straw bales in tanks or wetting using recycled
water and blending of raw materials e.g. wheat straw, poultry manure and gypsum, followed
by composting of the materials as a rough pile. Gypsum is added along with the chicken
manure to reduce substrate greasiness leading to improvements in aeration during blending.
This stage can last for 1-2 weeks before the substrate is transferred to aerated bunkers or
windrows to enhance control of the fermentation process (Sharma et al. 2005). At this stage,
nitrogen rich supplements, such as heat-
treated soya-bean meal can be added to improve nitrogen content of the substrate. Windrow
compost is turned regularly to ensure homogeneous breakdown of the substrate and to control
aeration and overheating in the compost core. Phase I can last for 4 weeks (Figure 1).
Phase II
The composting process is completed in bulk tunnels equipped with plenum chambers
which allows air to be passed through the substrate. The compost temperature is maintained at
58oC for 8-9 hours to kill organisms potentially harmful to mushroom mycelium. This stage is
followed by a conditioning period by reducing temperature to 45oC for 4 days to enhance
activity of thermophilic micro-organisms, leading to the fixation of excess ammonia as
microbial protein (Sharma et. al. 2005). Accurate records of temperature, air movements, fan
speeds and gas composition during phase II must be maintained to allow implementation of
66
quality assurance protocols. The tunnels and segregated area for substrate spawning must be
covered to prevent airborne contamination with organisms e.g. insects and microorganisms.
At the end of phase II, the substrate temperature must be reduced below 25oC and ammonia
level less than 0.1% of dry matter (Anon., 1995). The spawned compost is placed in bags or
compressed into plastic wrapped blocks (20–22 kg) ready for delivery to growers. The
substrate must be capable of supporting mycelium growth and be free of mushroom pests,
pathogens and human enteric pathogens.
Phase III
Spawn-run of inoculated bags, blocks or loose compost can be carried out in growing
tunnels at 25oC for duration of 14 – 19 days. Alternatively bulk phase III tunnels can be used
for spawn running the compost. However, care should be taken to maintain the optimum
compost temperature at 25oC as a potential environmental control method against
Trichoderma aggressivum. Current best practice indicates that a duration of 14 days at 25oC
and CO2 level of 2.5 to 4.5 % (Sharma et al. 2005). The design, protocols for monitoring and
control of aeration in phase III chambers are similar to phase II chamber described above.
Strict guidelines for environmental monitoring of the bulk tunnels and spawning/packaging
area must be carried out, as contamination of the substrate with weed mould or a pathogen can
destroy the entire load in tunnels.
Packaging and Distribution
The phase III substrate must be emptied from the tunnels in a segregated area to prevent
contamination during bagging or blocking with mushroom pests and pathogens. Compost can
be supplied as small loads or bulk delivery in sealed containers of defined weight and care
must be taken to prevent contamination during transportation. The delivery vehicle must be
cleaned and disinfected on a regular basis using proprietary chemicals. If several growers are
supplied on a trip, the driver should hose down the vehicle including the body panels, chassis,
tyres and mounted forklifts prior to entry onto growing units. All necessary documentation on
the substrate including QA results and labelling of the bags or pallets must be provided to the
customer/grower (Anon., 2004 a, b).
Food safety, quality assurance and HACCP
The industry in Ireland implemented HACCP principles for mushroom crop production
back in the 1990’s by incorporating detailed risk analysis assessed and prepared by trained
experts into good manufacturing practices (GMP) for production units under the Bord Glas
Quality Programme (Neary, 2001) and the Northern Ireland Mushroom Horticultural Auditing
and Certification Programme (Anon., 1998). Subsequently, the Euro-Retailer group (EUREP)
was established in 1997 and EUREPGAP® is now the recognised framework for Good
Agricultural Practice (GAP) on farms that defines essential elements of the development of
best practice for the global production of Horticultural produce. Acceptable to leading retail
groups worldwide, EUREPGAP® supports the principles of HACCP (Hazard Analysis and
Critical Control Point) (Barrow, 2000) and has now been broadly adopted as standard practice
by the mushroom production industry in Ireland. Further, the most recognised UK QA
programme is Assured Produce Standard (APS) independently audited and certified by CMI
(Checkmate International); in addition, many of the leading UK supermarkets – Tesco,
Sainsbury, Asda and others require annual certification under “in house” QA systems, e.g.
Tescos Natures Choice. Other studies on the implementation of HACCP for mushroom
industry have been reported from North America and India (Anon., 2000; Anon., 2007).
67
The ultimate application of HACCP is to yield the desired results of improving the safety
of the consumption of fresh mushroom produce. Health and Safety, and Food Safety
legislation and European directives are previously listed in Section 2. Since fresh mushrooms
are produced as ready to eat raw, food safety legislations apply. Producers must demonstrate
their commitment to five core principles:
(a) Maintaining consumer confidence in food quality and safety
(b) Minimising the detrimental impact on the environment, whilst conserving nature and
wildlife
(c) Reducing the use of crop protection products
(d) Improving the efficiency of natural resource use; and
(e) Ensuring a responsible attitude towards worker health and safety.
The key to maintaining good hygiene standard is primarily to avoid contamination of

compost, casing and mushrooms with any organisms that would pose a hazard to human
health; further to prevent contamination of pasteurised substrate with pests or disease causing
organisms, and to stop any potential hazard to the personnel working in the compost yard or
mushroom growing units (Anon., 2006b).
In 2001 contamination of mushrooms with Salmonella enterica serovar kedougou was
reported (Doran et al. 2005), when produce originating in Ireland, failed routine microbial
screening. However, no associated cases of human infection were detected. Rapidly traced
back to post production contamination of waste lime from the sugar beet industry used in
casing, the incident resulted in the immediate ban on the use of waste lime. More
significantly, it triggered a whole Industry review and the compilation and adoption of a
voluntary Code of Practice for Casing Manufacturers (Anon., 2004d). Importantly, with this
incident, came two major realisations: (i) ALL inputs and ingredients that form part of the
mushroom production process must be of a sufficient high standard to contribute to the
production of a quality mushroom fit for human consumption and (ii) ALL elements of the
supply chain – raw material suppliers, composters, casing manufacturers, spawn suppliers,
growers, marketing companies, retailers etc are inherently dependant on each other. Whole
process quality assurance cannot be put into practice unless the principles and agreed
standards are accepted and implemented by the entire supply chain (Anon., 2004b).
The code of practice for the production of mushroom casing was developed (Anon.,
2004d). Implemented as a 3-staged process, stage 1 focusing on the quality assurance of food
safety aspects aimed at ensuring the prevention of contamination of casing with Salmonella
and other pathogens; this has been adopted as an industry minimum. Stage 2 relates to the QA
of casing product quality and performance; with Stage 3 proposed as a combined advanced
higher Industry standard incorporating all previous aspects with additional elements of
environmental protection and waste management. In a similar vein, Stage 1 of a Compost
Code of Practice for the Industry was implemented in 2004 with additional stages now under
development (Anon, 2004b).
Examples of key directives for whole process QA are listed below:
Mushroom Crop Production

The current standard includes one annual self audit and independent external
inspection as a minimum requirement, not least to include generic areas such as: Cropping
practices; Quality & hygiene standards in relation to personnel & premises; Packhouse and
cool chain facilities; Crop protection products usage and storage; Record keeping and
maintaining appropriate documentation; Implementation of environmentally friendly
practices. At farm level, this will include numerous daily documented records. For example:
cold store temperatures; picking knife use and return; crop protection product application;
68
weighing scale calibration; filter replacement; cleaning records; staff canteen cleaning
records; first aid treatment; farm visitors, equipment preventative maintenance schedules etc.
Compost and Casing Substrate Production

Annual audits are again required under the voluntary Code of Practices for Mushroom
Casing and Compost Production (Anon., 2004b & Anon., 2004d) and the Environmental
Protection Agency (EPA) Waste Management licensing scheme in the south. Inspections
cover similar generic areas as outlined above with additional specific requirements including:
storage of all materials undertaken to minimise the risk of physical, chemical or
microbiological contamination; certified microbiological screening for Phase I, Phase II and
casing products; batch based production with records on formulation, process conditions,
turning schedules, additives, temperatures, analyses etc retained; full traceability throughout
each stage of the production process so that an audit trail can be conducted if required.
Sampling and Analysis

QA programmes specify minimum EU standards for both sampling plans and
analytical methods. For example, only UKAS accredited laboratories (ISO 17025:1999) may
be used for annual routine water analysis, mushroom pesticide residue testing and casing
batch microbiological screening prior to positive release. Further, fully documented action
plans for product recall procedures and notifications must be in place should results exceed
specified standards.
Training
Adequate education and extension programme on HACCP, must to be undertaken and
training programmes organised (Anon., 2000). All units within the supply chain must comply
with national health and safety legislations and the workers need to be fully informed and
trained as part of an implementation plan which must be displayed as a Safety Statement. This
may include training in: safe tractor driving; use of forklifts; vehicle management; farm safety
policy; manual handling principles; accident and emergency instruction; First aid instruction;
spray operator safety; Fire extinguisher use; Risk and COSHH assessment; basic food
hygiene; harvesting procedures; pest & disease identification; chemical store keepers etc.
The implementation steps need to be reviewed and approved by the QA staff members
in the supply chain, who are responsible for maintaining records of all QA activities including
the updating of data sheets on a regular basis. All tasks relating to HACCP must be recorded,
documented and retained in file for inspection for a minimum period of 5 years.
Environmental Protection
The environmental impacts of the industry are easily identifiable, as various elements are
similar to other rural based horticultural industry, food processing, wholesale, distribution and
retail activities. However there are practical problems to overcome, such as the need to ensure
that all sectors involved in the industry understand the relationships among enterprises and the
natural environment, community expectations, regulatory systems and market needs (Quinn,
2004). Major factors relating to environment protection are quality of run-off water, air
quality in the adjoining areas and environmental management of the surrounding areas.
Relevant legislations are listed in Section 2 (Anon., 2004a, b; Anon., 2006a). This aspect
relates mainly with composting facilities, although quality of run-off water and waste disposal
are important factors for producer groups, where intensive growing of mushrooms can
generate large volumes of waste-water and solid waste.
69
Run-off water quality
All compost production units are required to have drainage linked to catchment tanks to
avoid contamination of storm drains that are linked to natural waterways. The run-off water is
usually screened prior to reaching the large capacity holding tank, which is usually aerated to
reduce anaerobic conditions.
Air Quality
The monitoring of air quality in and around a compost yard is an important part of
controlling offensive odour. The key factor responsible for generating malodour is anaerobic
fermentation at the phase I stage but the use of aerated bunkers and regular turning can
virtually eliminate poor air quality problems. In addition, careful planning of formulation,
batch size and production logistics can also reduce all factors that can cause air quality
problems. Specific recommendations are set out in Best Available Techniques (BATs) for the
control of emissions to air from composting installations and include: premix poultry litter
with gypsum prior to addition to straw; limiting size of individual compost batches; bale
wetting by immersion; later poultry addition through split applications etc (Anon, 2006a)
Countryside Management
Since production facilities are usually sited in rural areas, conservation of biodiversity
in the countryside must form a core part of the environmental management plan. This plan
should be aimed at effective management of water, wildlife and natural habitats.
Waste Disposal
Irish and Northern Irish legislations and EU directives relating to waste disposal
are listed in Section 2. The introduction of Waste Management Act of Ireland (1996) marked
for the first time an attempt to develop a comprehensive national framework for waste
management strategies and an excellent review on the public attitude and politics of waste
management was published by Davies (2003). The handling and disposal of waste (solid or
liquid) generated at each stage of the supply chain must comply with EU waste management
legislations and municipal bylaws. All activities must be documented and retained for
inspection. Compost yard managers must seek prior approval for disposal of solid waste in an
approved landfill site. The industry also uses large quantities of plastic for packaging
compost, and mushrooms, and an increasing proportion of this waste is recycled through
approved outlets as part of the routine QA protocols. Future recycling plans and targets must
be put in place to reduce environmental impact of the industry.
Discussion
During the past 4-5 years, the Irish exporters to the UK market have been facing severe
pressure from Dutch and Polish suppliers, leading to strong downward price pressures to
maintain market share (Anon., 2004a). With costs of production also on the increase due to
higher labour charges, composters and growers are caught in a price squeeze with profit
margins being eroded (Anon. 2004a). In response to the market forces, the industry through-
out Ireland has been consolidating - closing unprofitable compost production units, increasing
farm size and merging producer (grower) groups to enhance economies of scale, and adopting
food safety and environmental regulations.
The Irish industry members and academic researchers are aware of the benefits of
introducing QA protocols, but these could not be implemented without a government policy
directive. In the past, these policy issues were not fully developed because the problems faced
by the industry had not been raised at the highest level. After a number of initial discussions
70
between industry and governments ministers, the Mushroom Task Force (MTF) was set up in
2003 to formulate a time bound action plan for addressing key issues. The Department of
Agriculture & Food in Maynooth, Ireland spearheaded the overarching review, resulting in
the publication of the MTF report (Anon. 2004a). Industry stakeholder meetings organised in
Northern Ireland to examine like problems faced by the sector, culminated in a
comprehensive Development Plan issued by the Mushroom Industry Association of Northern
Ireland (MIANI), (Anon., 2003; Anon., 2005a).
The current Code of Practice for Mushroom Compost Production (CPMCP) will require
further refinements by introducing detailed action plan on QA, HACCP and environmental
protection using BAT. However, it must be recognised that this is a major undertaking for the
industry and will require education, training and equipment to implement the
recommendations; all at a time when the Industry can least afford to introduce costly or
ineffective measures. This may be reflected in the current reluctance in the industry to
implement key elements of CPMCP. In addition, QA objectives listed in the CPMCP need to
be expanded with the aid of workshop findings, research and development and interviews
with small groups of high performing industry members, based on relevant practical
experience. The results from these activities can be used to inform government policy makers
and should be disseminated to all members. This activity should be followed by discussions to
ensure that the best practice will be widely recognized, accepted and can be readily applied by
others. This collaborative “whole supply chain process” approach will generate a higher
degree of industry ownership. Intervention steps for implementing QA directives at each stage
of production need to be planned and organised.
The excellent reports on the mushroom industry recommended key actions on the
following: supply arrangements and price transparency, cost reduction, promotion and
marketing, co-operation and co-ordination, training and advisory, research and the
environment (Anon., 2003; Anon., 2004a; Anon 2005a). Some of the recommendations
including QA protocols (Anon., 2004a) may require further re-evaluation to develop linkages
with financial aid packages for the composters and producer groups, and unless this is
delivered in a highly targeted fashion, the objectives of the MTF may not be achieved as
planned.
The core action of the industry should focus on two key areas:
o Reduction of production cost is vital as the Dutch and Polish suppliers enjoy 10-48% cost
advantage. In the long term unit cost will determine the UK market sector (Anon., 2005a).
o The presentation and marketing of mushroom need to be improved and managed carefully
in consultation with retailers to enhance wider public acceptance. A clear marketing
strategy and awareness from producer to retailers should provide additional opportunities
to exploit (Anon., 2005a)
The implementation of a comprehensive traceability system from raw materials to

compost and mushrooms is necessary for complying with current and future legislations and
EU directives. The industry will require further auditing to maintain the system, the
maintenance and recording of data sheets on materials and the documentation of all activities
relating to all stages of production. This objective is an ambitious target and substantial
support from the two governments and European Union will be needed to implement the
action plans (Anon., 2004a).
Currently, the European Union and funding agencies (e.g. Invest NI, InterTrade Ireland
and Industrial Development Agency, Ireland) in Belfast, Newry and Dublin are providing
specialised funds (Anon., 2005a) for capital expenditure, to train and improve skill base of
71
staff members employed by composters, producer and marketing groups. These initiatives
should yield significant increase in the technology and knowledge base of the enterprises and
workers in the supply chain. The general consensus of opinion, is that while the mushroom
sector in the north and south of border will survive the current changes forced on by geo-
political, financial and cultural factors (Anon., 2006b), the future size of the industry will be
determined by the actions undertaken by the industry leaders and responsible government
Departments.
References
Anon. 1995. Mushroom Compost Code of Practice. Ulster Farmers’ Union, 1-16.
Anon. 1998. Northern Ireland Mushrooms Horticultural Auditing & Certification Programme
Quality Manual. Quality Assurance Branch, Department Of Agriculture for Northern
Ireland, 1-65
Anon. 2000. Application of hazard analysis and critical point for improvement of quality of
processed foods. Indian Council of Medical research Bulletin, 30, 5, 1-4.
Anon. 2003. Mushroom Industry Association of Northern Ireland (MIANI) Development
Plan, June – November 2003, 1–24.
Anon. 2004a. Report of Mushroom Task Force, Department of Agriculture & Food, Crop
Production & Safety Division, Maynooth Business Campus, Maynooth, Ireland, 1-42.
Anon. 2004b. Code of Practice for Mushroom Compost Production in Ireland, Bord Glas,
(Horticulture Council) Ireland, 1-21.
Anon. 2004c. A Review of the All Ireland Horticultural Industry – InterTradeIreland, 1–50.
Anon. 2004d. Code of Practice for Mushroom Casing in Ireland. Stage 1 (of 3), Bord Glas,
MIANI and Department of Agriculture and Rural Development, 1–34, ISBN: 1 85527 720
4
Anon. 2005a. Cross Border Horticultural Development Project Report, Changes and
opportunities for the horticultural sector, International Fund for Ireland, Irish Exporters
Association, Dublin, 1-134.
Anon. 2005b. Industry Stake Holder Meeting, Monday 24 October 2005, FSANI, 10A
Clarendon Road, Belfast, 1-9.
Anon. 2005c. British Columbia Cultivated Mushroom Initiative, Five Year Strategic Plan
2006-2010, British Columbia Mushroom Industry, Canada, 1-23.
Anon. 2006a. Mushroom Substrate Manufacturing Processes, Process Guidance note, NIPG
6/30 (V 2), Department of Environment for Northern Ireland, 1-26.
Anon. 2006b. Harvesting justice, Mushroom Workers call for change. Mushroom Workers
Support Group, Migrants Rights Centre Ireland, November 2006, 1-25.
Anon. 2007. Penn State University, Food Safety for mushroom Growers and Packers,
http://foodsafety.cas.psu.edu/mush/foodsafety.htm (accessed Jan 6 2008).
Barrow J. 2000. HACCP in Practice. Chartered Institute of Environmental Health, 1–34,
ISBN 1 902423 00 4.
Davies A. 2003. Waste wars – public attitudes and the politics of place in waste management
studies. Irish Geography, 36, 77-92.
Doran G, Sheridan F, DeLappe N, O’Hare C, Anderson W, Corbett-Feeney G, Cormican M.
2005. Salmonella enterica serovar Kedougou contamination of commercially grown
mushrooms. Diagnostic Microbiol. Infectious Dis., 51, 73-76.
Flegg PB, Spencer DM, Wood DA. 1985. The Biology and Technology of the Cultivated
Mushroom. John Wiley & Sons, Chichester, England, 347pp.
McEvilly G. 2006. Strategic Plan Appendices, Horticultural Australia Limited Supply Chain,
2005-2010, 1-20.
72
Neary M. 2001. A Quality Assured Mushroom Industry. Refining Management for a
Sustainable Future, 3rd All Ireland Mushroom Conference and Trade Show, Hillgrove
Hotel, Monaghan, pp72-77
O’Maolain C. 2000. North-South Co-operation on Agriculture and Food, including forestry
and rural development – A mapping study, Centre for Cross Border Studies, Ireland, 1-
30.
Sharma HSS, Kilpatrick M, Lyons G. 2005. Monitoring mushroom compost quality during
production and cropping. Acta Edulis Fungi, 18 (Suppl.) pp221- 235,
Quinn N. 2004. The olive industry – an environmental management systems framework. A
report for the Rural Industries Research and Development Corporation, Publication no
04/057, 1-59.
73
Effect of Aerobic Fermentation Substrate on Pleurotus ostreatus Production

and Resistance to Trichoderma viride
Gerardo Mata and Flor E. Torres-Hernández

Instituto de Ecología, Apdo. Postal 63 Xalapa, Veracruz, México.
Email: gerardo.mata@inecol.edu.mx
Abstract
The culture of Pleurotus spp on fermented substrates takes place on a commercial

scale providing good yields and a low contamination rate by antagonistic molds. This research
aims to obtain a suitable substrate for Pleurotus ostreatus culture through aerobic
fermentation of barley straw with added coffee pulp (CP) or peat moss (PM). The effect of
different periods of substrate fermentation (0, 3, 7 and 14 days) on the production of fruit
bodies, and resistance of P. ostreatus to the presence of Trichoderma viride were studied.
After fermentation, the substrate was pasteurized with steam for 6 h at 65 °C and the
biological efficiency of two P. ostreatus strains was evaluated. Growth inhibition of P.
ostreatus confronted with T. viride was also evaluated in vitro using pasteurized or sterilized
substrate. The results showed higher biological efficiency between 3 and 7 days of
fermentation. It was noted that the substrate fermentation limits the growth of T. viride
antagonist, especially when the fermentation period lasts for 7 or 14 days.
Key Words: Pleurotus ostreatus; Trichoderma viride; Substrate fermentation; Substrate

selectivity; Inhibition of mold growth;
Introduction
Substrate selectivity in Pleurotus spp. culture is obtained through thermal treatments

such as pasteurization (Guzmán et al. 1993; Muez Ororbia & Pardo Núñez, 2001). Substrate
treatment is, undoubtedly, one of the significant stages to achieve successful culture. This
stage of culture was achieved using different methods, depending on the cultivator’s technical
and economical possibilities. A favored thermal treatment system for small-scale Pleurotus
spp. culture has always been to submerge the substrate in hot water. This method produces a
substrate that is easily contaminated by molds of the Trichoderma genus, and requires a great
amount of water. Conversely, on a commercial scale the substrate is put through a short
fermentation process, before a steam-based thermal treatment, which favors fungal
competitiveness and reduces the total culture cycle time. The fermentation process produces
thermo-tolerant microflora with the ability to resist thermal treatment (generally at 65 ºC) and
inhibit mold growth, thus offering advantages to Pleurotus mycelium growth on the substrate
(Velázquez-Cedeño et al. 2006). Preparation of the culture substrate must be carefully
scrutinized, in order to avoid problems that might affect the fungus’ quality and productivity.
Trichoderma species may cause serious problems in commercial production of Pleurotus spp.
(Vijay & Sohi, 1989; Pandey & Tewari, 1990). The presence of Trichoderma spp. generates
an overproduction of laccase enzymes in P. ostreatus mycelium; such enzymes have several
functions, including a defense response against mold-produced metabolites (Savoie & Mata,
2003; Velazquez-Cedeño et al. 2007). Laccase overproduction may also result from adding
phenolic substance-rich compounds to the culture substrate. The ability to degrade such
compounds offers advantages for the Pleurotus mycelium to colonize the substrate. The goal
of this research was to obtain an adequate substrate for the culture of P. ostreatus through
aerobic fermentation of barley straw with added coffee pulp or peat moss, and to evaluate
resistance to Trichoderma viride.
74
Fungal Strains
Two strains of Pleurotus ostreatus (Jacq.:Fr.) Kumm were studied; one donated by
Hong Kong University (IE-38) and the other (IE-238) bred at our institute. A strain of T.
viride (IE-637) was also studied and isolated in Mexico from shiitake cultures on coffee pulp.
Strains were kept in Petri dishes, using malt extract agar (MEA = 1% malt extract and 1.5%
agar). All strains are maintained at the Instituto de Ecología A.C.
Substrate Preparation and Sowing

Barley straw (Hordeum vulgare L.) was used as the culture substrate. The straw was
cut into approximately 2-inch pieces using an electric slicer, submerged in water for 2 hours
and drained for 1.5 hours. Once hydrated, 1% CaCO3 was added, based on the straw dry
weight. Two treatments were prepared: 1) addition of dry coffee pulp powder (10 % w/w)
(CP); and 2) addition of peat moss powder (10 % w/w) (PM). The substrate was homogenized
by placing ~300 kg (wet wt.) of each treatment in a 1 m x 2m x 1 m metal grid container and
allowing it to ferment for 14 d. Substrate humidity was maintained at 70-75% and determined
by the difference between the wet and dry weight of the substrate. The substrate was stirred
and mixed daily to facilitate a homogeneous fermentation.
Samples of the substrate were taken after 0, 3, 7 and 14 d fermentation, designated T0,
T3, T7 and T14, respectively. Substrate pH, and the minimum and maximum temperatures,
were recorded on a daily basis. The fermented substrate was placed in metallic baskets and
filled into the pasteurization tunnel where it was pasteurized for 6 h with a constant steam
flow at 65 ºC.
After cooling, 2 kg aliquots of substrate were transferred to plastic bags to which 5%
of P. ostreatus spawn was added. The spawn was prepared with sorghum seeds (Sorghum
vulgare Pers.) according to the formula reported by Ortiz & Mata (2003). Spawn was hand-
added to attain uniform distribution. Twelve bags were prepared for each strain of each
treatment and each fermentation period. Each bag received eight 2 cm diameter perforations,
uniformly spaced, in order to allow the fungus to breathe. Seeded samples were dark-
incubated at 24 ºC for 25-30 days until the appearance of primordia. Afterwards, the samples
were stored under fruiting conditions at 28 ºC, with a relative humidity of 75-80%, ventilation
and 12 h of daylight. The biological efficiency (BE) of the samples was evaluated from the
percentage of fresh fruit bodies obtained from the substrate on a dry weight basis (Guzmán et
al. 1993).
P. ostreatus vs T. viride
To evaluate the resistance of P. ostreatus strains to T. viride, both antagonists were
confronted in vitro on the fermented, previously pasteurized substrates. Using a sterile
environment, 10 g of pasteurized straw was placed on Petri dishes on which both antagonists
were inoculated. A P. ostreatus spawn grain (aged 15 d) and a 0.7 cm dia. fragment of MEA
with 2 day-old T. viride mycelia were placed at opposite ends of the Petri dish. Surface
mycelial growth of both antagonists was recorded, and the total area calculated according to
the method developed by Peralta González et al. (2006). To better establish the effects of the
substrate microflora on P. ostreatus resistance, samples were prepared where, after
pasteurization, the substrate was sterilized by autoclaving for 1 h at 121 °C. Each treatment
(CP and PM) included a control of both P. ostreatus strains with 5 repetitions, and the total
growth area of each was recorded after 8 d incubation at 27 °C. Two confrontation conditions
were studied: 1) same-day confrontation, i.e. simultaneous inoculation of both antagonists on
the Petri dish; and 2) inoculation after 4 d growth for P. ostreatus strains. In both cases, 10
repetitions were performed for each condition. Growth areas were evaluated 8 d after
75
inoculation of the P. ostreatus strains. P. ostreatus resistance was expressed as the percentage
of inhibition caused by the presence of T. viride in relation to mycelium growth on the
control. This was calculated using the following formula (Pandey & Tewari, 1990):
Inhibition percentage (PI)
PI = I1 – I2 x 100
Where:
I1 = mycelial growth area of P. ostreatus (control)
I2 = mycelial growth area of P. ostreatus (confrontation)
Analysis of Substrate Fiber Content

Variations in the cellulose, hemicellulose and lignin composition of the substrate
produced by fermentation, as well as by P. ostreatus growth, were determined by the method
of Van Soest (1982). Only CP treatment samples were analysed during the whole
fermentation process (0, 3, 7 and 14 d) after pasteurization. Substrate composition was also
analyzed after P. ostreatus incubation (INC) and production (PROD) periods.
Statistical Analysis
Biological Efficiency results for P. ostreatus were subjected to analysis of variance,
and differences between averages established with Tukey’s multiple range analysis (α=
0.05%).
Results
Substrate temperature and pH increased notably during the first three days of
fermentation. The highest temperature was recorded with the CP treatment T3; however,
differences with the PM treatment were minimal. From T7 onwards, temperatures were higher
in PM treatments (Figure 1). The pH of the control substrate was 6.1, increasing to 7.9 at T0
by addition of supplements. In the case of T3 fermentation samples, the pH values of the CP
and PM treatments were 9.0 and 8.5, respectively. By the end of the fermentation, at T14, the
pH values were 9.2 and 8.3, respectively (Figure 2). Despite the high pH of the fermented
substrates, the mycelium of both P. ostreatus strains grew adequately, achieving a sensibly
lower substrate pH after incubation and at the end of the production (Table 1).
The samples were incubated for 30 days. Strain IE-38 formed fruiting primordia very
quickly; however, strain IE-238 required a major temperature shock (24 h at 5 °C) to achieve
primordia formation. The BE obtained in the control substrate was lower in the case of both
strains compared with values obtained in treatments CP and PM. Furthermore, in the control
treatment, neither strain showed significant BE differences (Table 2). Both P. ostreatus strains
experienced their highest BE values in the CP treatment (excepting T0); strain IE-38 showed
a significantly higher BE at T3 and T14, while strain IE -38 was higher at T3. Only in the PM
treatment did the IE-238 strain show significant differences compared to the BE of the control
treatment.
76
80
CP maximum temperature
70 CP minimum temperature
PM maximum temperature
60
Temperature °C PM minimum temperature
50
40
30
20
10
0
0 1 2 3 4 5 6 7 8 9 10 11 12 13 14
Days
Figure 1. Highest and lowest substrate temperatures during the 14-day fermentation
period
Arrows represent days when the samples were taken.
Table 1. Variation in substrate pH during fermentation (14 days) and at the end of the
incubation (INC) and production (PROD) cycles
Treatment Strain Day Fermentation INC PROD

Control IE-38 T0 6.61 ND 5.48
IE-238 T0 6.61 ND 5.56
CP IE-38 T0 7.54 ND 5.92
T3 9.04 5.27 5.77
T7 8.85 5.33 4.97
T14 9.15 5.40 5
IE-238 T0 7.54 ND 4.76
T3 9.04 5.54 5.13
T7 8.85 4.95 5.23
T14 9.15 5.33 5.63
PM IE-38 T0 7.39 ND 5.3
T3 8.48 4.85 5.71
T7 8.34 5.14 4.79
T14 8.32 4.95 4.39
IE-238 T0 7.39 ND 5.14
T3 8.48 5.03 5.16
T7 8.34 4.67 5.3
T14 8.32 4.98 5.02
CP = treatment with added coffee pulp; PM = treatment with added peat moss
ND: Not determined
77
Table 2. Biological Efficiency values of P. ostreatus strains in a fermented substrate
Treatment Strain Day BE I II

Control IE-38 T0 38.2 a A
IE-238 T0 39.8 a A
CP IE-38 T0 55.9 a AB
IE-38 T3 101.6 bc CD
IE-38 T7 70.5 ab ABC
IE-38 T14 129.4 c D
IE-238 T0 30.4 a A
IE-238 T3 113.6 b D
IE-238 T7 91.2 b BCD
IE-238 T14 103.79 b CD
PM IE-38 T0 71.9 a B
IE-38 T3 54.1 a AB
IE-38 T7 58.8 a AB
IE-38 T14 46.8 a AB
IE-238 T0 59.6 bc AB
IE-238 T3 61.5 c AB
IE-238 T7 36.9 ab A
IE-238 T14 29.42 a A
Values after 14 d. CP = treatment with added coffee pulp; PM = treatment with added peat
moss. Different letters in column I indicate significant differences between each strain
subjected to separate treatments compared with the corresponding control.
Different letters in column II indicate significant differences between both strains subjected to
the same treatment compared with the corresponding control.
9.5
CP PM
9
pH
8.5
7.5
0 1 2 3 4 5 6 7 8 9 10 11 12 13 14
Days
Figure 2. Variations in substrate pH during 14 d fermentation period
In confrontations between P. ostreatus and T. viride strains in the control substrate, it

was observed that growth inhibition appeared only on the sterile substrate, and the most
affected strain was IE-238, with 22.6% inhibition. In supplemented substrates, the PM
treatment showed the highest inhibition at T7 Strain IE-238 exhibited 38.9% inhibition and
strain IE-38 33.6% inhibition, both of them in pasteurized substrate. In the CP treatment, the
78
highest inhibition rate of 38.7% was seen with strain IE-38 at T7 in the pasteurized substrate.
Some high inhibition rates were also seen at T14, 17.9% with strain IE-38 in sterile CP
substrate, and 19.0% with strain IE-238 in pasteurized PM substrate (Table 3).
Table 3. Inhibition of P. ostreatus growth in confrontations with T. viride on barley

straw fermented for 14 days
Day
Treatment Strain Confrontation T0 T3 T7 T14
P S P S P S P S
Control IE-38 same day - 8.5
after 4 days - 9.3
IE-238 same day - 22.6
after 4 days - 15.8
CP IE-38 same day 4.9 - 8.4 3.0 1.7 3.0 3.6 13.7
after 4 days 1.2 2.7 - 7.0 38.7 - 5.6 17.9
IE-238 same day - - 7.0 2.8 - - 0.9 -
after 4 days - - 3.2 12.5 9.4 3.1 - -
PM IE-38 same day - 3.6 - 0.1 - 3.4 - -
after 4 days - 3.5 - - 33.6 1.6 - -
IE-238 same day - - - 0.1 17.8 9.5 19.0 -
after 4 days 0.4 - 9.0 - 38.9 4.6 - -
Values expressed as percentages. CP = treatment with added coffee pulp;
PM = treatment with added peat moss; P = pasteurized substrate; S = sterile substrate
- = no inhibition.
The composition of the CP substrate was considerably modified during the

fermentation process (Figure 3). Between T0 and T14, 40% and 30% of the cellulose and
hemicellulose respectively were degraded, while no lignin degradation was detected. During
the incubation and production stages, substrate degradation by P. ostreatus growth at T0
reached levels of 70% (cellulose), 60% (hemicellulose) and 12% (lignin). At T14, substrate
degradation levels reached a maximum level of 80% (cellulose), 75% (hemicellulose) and
50% (lignin) when compared to the non-fermented substrate.
Discussion
Aerobic fermentation of the substrate produces changes in its composition and

structure, which modify the antagonistic relationship developed between strains of Pleurotus
and Trichoderma. The presence of bacterial communities allow Pleurotus development while
they hinder Trichoderma growth (Velázquez Cedeño et al. 2004, 2008). The addition of
supplements such as coffee pulp and peat moss increases the difficulty for T. viride
colonization, since they contain phenolic compounds that obstruct mold growth, while P.
ostreatus strains can produce oxidative enzymes that grant them competitive advantages for
quick substrate colonization (Savoie & Mata, 2003).
The temperature achieved by the substrate during fermentation may help decrease the
content of soluble sugars (Stölzer & Grabbe, 1991) due to metabolism by thermophilic
bacteria that developed during the fermentation process and survive pasteurization (Velázquez
Cedeño et al. 2006). Recently, it has been shown that one of the main agents responsible for
inhibiting the growth of Trichoderma spp is Paenibacillus polymyxa, a bacterium that may
play an important part in the competitive interactions between P. ostreatus and some rapid-
growth molds (Velázquez Cedeño et al. 2008).
79
90.0
Celullose Hemicelullose Lignine
80.0
70.0
60.0
P ercentage
50.0
40.0
30.0
20.0
10.0
0.0
Incubation
Incubation
Incubation
Incubation
Control
P roduc tion
P roduc tion
P roduc tion
P roduc tion
Ferm entation
Ferm entation
Ferm entation
Ferm entation
T0 T3 T7 T14
Figure 3. Changes in the composition of coffee pulp (CP)-supplemented substrate during

14-day fermentation by P. ostreatus, strain IE 38.
Reduction of cellulose and hemicellulose levels, and an increase in pH value, during

substrate fermentation appear to be the key elements in the eventual production of a selective
substrate. These two polysaccharides are also degraded by P. ostreatus mycelium during the
incubation stage, and lessen considerably during the production of fruiting bodies. On the
other hand, lignin is not degraded during fermentation, and its decrease is linked to P.
ostreatus growth.
P. ostreatus growth inhibition appears to be affected the most when confrontations
with T. virirde are performed on the same day of inoculation for both antagonists. The
previous growth of P. ostreatus favors its ability to defend itself, but results from this study
suggest that, at T7, P. ostreatus may be strongly inhibited even in a pasteurized substrate.
The BE obtained in this study is similar to that recorded by other authors (Castañeda
de León & Leal Lara, 2007; Salmones, 2005; Salmones et al. 1997; Velázquez Cedeño, 2000;
Velázquez Cedeño et al. 2008; Villa et al. 1999). The addition of supplements to the substrate
may help to increase the production of fruiting bodies. However, substrate fermentation and
pasteurization at temperatures near 65 °C favour obtaining a selective substrate. Accrued
results indicate that the addition of coffee pulp and the 3-7 day fermentation of the substrate
with a pasteurization treatment at 65 °C for at least 6 hours, facilitates obtaining a selective
substrate for the culture of P. ostreatus.
Acknowledgements
The authors wish to thank the Instituto de Ecología, AC, for providing the necessary
facilities to conduct this research, as well as the Consejo Nacional de Ciencia y Tecnología
80
(CONACYT), for funding it. Thanks to Rosalía Pérez and Dulce Ma. Murrieta for their
technical support, and Dulce Salmones and Rigoberto Gaitán for their research development
suggestions and comments.
References
Catañeda de León VT, Leal-Lara H. 2007. Factores que influyen en la producción de

sustratos selectivos para el cultivo de Pleurotus ostreatus. In: Sánchez Vázquez, J.E.,
D. Martínez Carrera, G. Mata, H. Leal Lara (eds.), El cultivo de setas
Pleurotus spp. en México. ECOSUR, Tapachula, Mexico. pp81-90.
Guzmán G, Mata G, Salmones D, Soto C, Guzmán Dávalos L. 1993. El cultivo de los
hongos comestibles. Con especial atención a especies tropicales y subtropicales en
esquilmos y residuos agro-industriales. IPN, Mexico, D.F., 245pp.
Muez-Orobia MA, Pardo-Núñez J. 2001. La preparación del sustrato. In:
Sánchez, J.E., D.J. Royse (eds.), La biología y el cultivo de Pleurotus spp. ECOSUR-
UTHEA, Mexico, D.F., 290 pp.
Ortiz Morales, A, Mata G. 2003. Sobre la factibilidad de mejoramiento del inóculo de
Pleurotus ostreatus y P. pulmonarius para su cultivo en paja de trigo. VIII Congreso
Nacional de Micología, Toluca, Mexico.
Pandey M, Tewari RP. 1990. Antagonism of Pleurotus sajor-caju by some weed
fungi. Mush. J. Tropics, 10, 52-58.
Peralta González F, Mata G, Murrieta DM. 2006. Efecto de la fermentación aerobia
de la paja de cebada en la producción de Pleurotus ostreatus. IX Congreso Nacional
de Micología, Ensenada, Mexico.
Salmones D. 2005. Actividad de enzimas lignocelulolíticas en cultivos de Pleurotus
spp. en pulpa de café y la relación con su capacidad productiva y defensiva. PhD.
Thesis, Instituto Tecnológico de Veracruz, Mexico.
Salmones D, Gaitán-Hernández R, Pérez R, Guzmán G. 1997. Estudios sobre el
género Pleurotus, VIII. Interacción entre crecimiento micelial y productividad.
Revista Iberoamericana de Micología, 14, 173-176.
Savoie JM, Mata G. 2003. Trichoderma harzianum metabolities pre-adapt
mushrooms to Trichoderma aggressivum antagonism. Mycologia, 95, 191-199.
Stölzler S, Grabbe K. 1991. Mechanisms of substrate selectivity in the cultivation of
edible fungi. Mush. Sci., 13, 141-146.
Van Soest PJ. 1982. Nutritional ecology of the ruminant: ruminant metabolism,
nutritional strategies, the cellulolytic fermentation and chemistry of forages and plant
fibers. OZB Books Inc., Oregon. pp81-84.
Velázquez-Cedeño M., 2000. Evaluación de la producción de 2 especies de Pleurotus
(Fungi: basidiomycetes), cultivadas en pulpa de café y detección de las celulasas y
lacasas durante el ciclo de cultivo. Bachelor Thesis, Facultad de Biología, Universidad
Veracruzana, Mexico.
Velázquez-Cedeño MA, Farnet AM, Ferré E, Savoie JM. 2004. Variations of
lignocellulosic activities in dual cultures of Pleurotus ostreatus and Trichoderma
longibrachiatum on unsterilized wheat straw. Mycologia, 96, 712-719.
Velázquez Cedeño M, Mata G, Farnet AM, Savoie JM. 2006. Estudio preliminar de la
microflora bacteriana termotolerante de la pulpa de café y la paja de trigo con
potencial de inhibición contra Trichoderma viride en el cultivo de Pleurotus spp.
Revista Mexicana de Micología, 22, 33-39.
81
Velázquez Cedeño M, Farnet AM, Billette C, Mata G, Savoie JM. 2007. Interspecific
interactions with Trichoderma longibrachiatum induce Pleurotus ostreatus defence
reactions based on the production of laccase isozymes. Biotechnol. Lett., 29, 1583-
1590.
Velázquez Cedeño M, Farnet AM, Mata G, Savoie JM. 2008. Role of Bacillus spp. in
antagonism between Pleurotus ostreatus and Trichoderma harzianum in heat-treated
wheat-straw substrates. Bioresource Technol., In press.
Vijay B, Sohi HS. 1989. Fungal competitors of Pleurotus sajor-caju (Fr.) Sing.
Mush.J.Tropics, 9, 29-35.
Villa-Cruz V, Huerta-Palacios G, Sánchez-Velázquez JE. 1999. Solid fermentation of
a corn cob-coffe pulp mixture for the cultivation of Pleurotus ostreatus. Micología
Neotropical Aplicada, 12, 67-74.
82
Yield and Mushroom Solids of Agaricus bisporus as Influenced by Moisture

Content of Substrates
Delphina P. Mamiro and Daniel J. Royse

Department of Plant Pathology, Mushroom Research Center, The Pennsylvania State,
University Park, PA 16802, USA Email: delphimamiro@yahoo.com
Abstract
Yield, biological efficiency (BE), basidioma size, and mushroom solids were
determined from mushrooms harvested from non-composted substrate (NCS) and a 1:1
mixture of NCS and spent mushroom compost (SMC) at three moisture contents (55%, 60%,
and 65%). Substrate type and moisture content significantly influenced yield, BE, and
mushroom solids. Moisture content also significantly influenced basidioma size. Mushroom
yield (14.5 kg/m2) was highest on a 1:1 mixture of NCS and SMC at 55% moisture, whereas
BE (60.5%) was highest from Phase II compost (control). The largest mushrooms (23.8
g/mushroom) and highest mushroom solids (9.9%) were obtained from NCS at a moisture
content of 60%. Optimum substrate moisture contents for yield and BE varied depending on
substrate type.
Key Words: Agaricus bisporus; Substrate moisture content; Non-composted substrate;

Biological efficiency; Spent mushroom compost
Introduction
The ongoing concern for odor reduction has focused the need to develop a substrate
for mushroom production that does not emit offensive odors. In addition, SMC, a medium
that remains from the mushroom production process, is sometimes considered
environmentally unfriendly, undesirable and represents a solid waste disposal problem for
mushroom growers (Duns et al. 2004). Production of A. bisporus using NCS and/or SMC has
been demonstrated previously (Till, 1962; Fleg & Randle, 1968; San Antonio, 1971; Murphy,
1972; Mee, 1978; Schisler, 1990; Sánchez & Royse, 2001; Sánchez et al. 2002; Bechara et al.
2005; 2006a, b). However, the influence of substrate moisture contents on mushroom yield,
BE, size and mushroom solids content has not been examined.
A. bisporus (Lange) Imbach basidiomata contain more than 90% water (Carey &
O’Connor, 1991). The basidiomata receive 54-83% of their water from the substrate and 17-
46% from the casing depending on the depth and water potential of the casing (Kalberer,
1990). Too low or too high moisture availability in the substrate at spawning may negatively
affect the yield of the crop (Gerrits, 1971; Kalberer, 1991; Carey & O’Connor, 1991). Low
compost moisture (<61.6%) content is associated with few visible mycelial strands whereas
compost with higher moisture content is associated with dense and thick mycelial growth
(Schroeder & Schisler, 1981). Gerrits (1971) suggested that optimum moisture content of
compost was 63-68% at spawning. Phase II compost moisture content below 61.6% may limit
mycelial growth and limit mushroom yield (Schroeder & Schisler, 1981). Schroeder and
Schisler (1981) observed that a compost moisture content of 65% gave optimum yield while
compost moisture did not influence mushroom size.
For the production of brown A. bisporus on non-composted substrate (NCS), a
moisture content of 48-55% was used by Sánchez and Royse (2001). These levels may seem
low when compared to the moisture contents of 63% to 68% typically found in Phase II
compost. However, they are in the range of mushroom spawn that may be cased and directly
used to produce mushrooms (Bechara et al. 2005, 2006a, b; San Antonio, 1971). Optimal
83
moisture content for mushroom production and quality may depend on the type of substrate
being used. For example, Phase II compost is substantially different from NCS, so the
optimum moisture content for maximum yields may not be comparable. It is not known if
substrate moisture contents higher than 55% for NCS may lead to higher yields and
mushroom size. Therefore, the main goal of our experiments was to determine the effect of
substrate moisture content for two formulations on A. bisporus yield, BE, mushroom size,
solids content and mycelial growth.
Methods
Substrate
Ingredients used for NCS, adopted from Sánchez and Royse (2001), included oak
sawdust (28% oven dry wt), millet (29%), rye (8%), peat (8%), ground alfalfa (4%), ground
soybean (4%), wheat bran (9%), and CaCO3 (10%).
Spent mushroom substrate, obtained from the Mushroom Test Demonstration Facility
(MTDF) at the Pennsylvania State University, was post-crop pasteurized with steam at 60 oC
for 24-48 h to kill pests or pathogens that might interfere with subsequent cropping trials.
Pasteurized SMC, including the casing layer, was mixed, removed from the production
facility, bagged in plastic bags (94 cm x 75 cm), and stored at 2 oC until used.
Phase II compost was obtained from the MTDF with a moisture content of
approximately 68%. The compost was used as received and no attempt was made to adjust its
moisture content.
Spawn
A brown strain (Sylvan SB-65, Sylvan Spawn Laboratories, Kittanning, PA) of A.
bisporus (Portobello) was selected since it is commercially produced and is becoming
increasingly popular with consumers in the United States. The spawn used was commercial
casing inoculum (CI) that consisted of a mixture of peat, wheat bran and vermiculite. Casing
inoculum was used as spawn because it contains many fine particles that may serve as
additional points of inoculum.
Mushroom cropping trials

A moisture content of each substrate component was obtained by using a drying oven.
Four samples, (100 g each) from substrate components were collected after thorough mixing.
Samples were placed in the oven for 24 h at 60 oC. Moisture contents were as follows: red oak
sawdust (31%), millet (10%), rye (10%), peat moss (41%), alfalfa meal (10%), soybean meal
(10%), wheat bran (10%), CaCO3 (0%), SMC (67%), and Phase II compost (68%).
The substrate moisture contents were adjusted to 55%, 60%, and 65% by
determination of dry ingredient weights and then adding the appropriate amount of water. The
substrate mixtures were placed into plastic bags with very high porosity filters (Unicorn Bags,
Garland, TX), autoclaved at (121 oC for 3 h), cooled, and aseptically spawned with 30 g
spawn per 2.5 kg moist substrate (1.2%, w/w). After mixing the spawn with the substrate, the
bagged substrates were transferred to the Mushroom Research Center for spawn run at 18±1
o
C for 18-21 days. The bags were opened and the fully colonized substrate was fragmented
and placed in 6.1 L plastic tubs (29.5 cm x 15.75 cm x 8.75 cm, with a surface area of 0.0465
m2). Neutralized peat (2.5 cm) was overlaid on the substrate surface as casing. Case hold
lasted for 18-21 days at 18±1 oC; during this period, water was applied daily or as needed
until the casing layer was saturated. Relative humidity in the production room was maintained
at 90-95%.
The experimental design was a factorial with a variance (Kuehl, 2000). The cropping
experiment was the 2 x 3 factorial with the addition of fresh Phase II compost as a control and
84
was replicated 12 times except the control which was replicated eight times. The experiment
contained two substrates (NCS and 1:1 NCS/SMC) and three substrate moisture contents
(55%, 60%, and 65%) in a completely randomized design.
Harvesting and determination of yield

Mushrooms were harvested, counted, and weighed daily when the pilei were open and
the lamellae were exposed. At the end of the second flush, yield and BE were determined and
average mushroom size calculated as (fresh mushroom weight)/(number of mushrooms
harvested). Biological efficiency was determined as the ratio of (g fresh mushrooms
harvested)/(g dry substrate weight) and expressed as a percentage. Yield was expressed as
kg/m2. Mushrooms for solids content determination were randomly sampled from each
treatment from the mushroom cropping trials. Mushrooms were sliced into fourths or eighths
depending on the initial size of each mushroom. Each sample (100 g) was placed in a paper
bag and oven dried at 99 oC for 48 h. Ten replicates per treatment were used and solids
contents were recorded as percentage weight of oven-dry mushrooms.
Mycelial growth
The experiment was designed to examine the effect of substrate moisture content on
vegetative mycelial growth. Phase II compost was included in the experiment as a control.
The NCS and NCS/SMC were tested at moisture contents of 55%, 60%, and 65%, whereas
Phase II compost had a moisture content of 68% (oven dry wt). The NCS and NCS/SMC were
placed in plastic bags containing very high porosity filter patches and autoclaved at 121 oC for
90 min. The substrates were cooled overnight and 5 g CI (brown strain) (Sylvan SB-65) was
placed in the bottom of sterile 130 mm long x 35 mm diameter glass tubes. Sterile substrates
(100-120 g) were added until the tubes were full. Inoculated substrates (12 tubes per
treatment) were incubated at 25 oC for 18 days. Mycelial growth was measured at 3-day
intervals.
Statistical analysis
Data from the mushroom cropping experiment were subjected to two analyses of
variance (ANOVA). The first analysis considered the 2 x 3 factorial design alone, and was
performed using the general linear model (GLM) (SAS, 2001). The second analysis utilized
one-way ANOVA with each treatment combination and the control as one of the levels, for a
total of seven treatments. Treatment means were separated using Fisher’s least significant
difference (LSD) test at p<0.05. The treatment combinations were further subjected to
pairwise comparisons with Phase II compost (control) according to Dunnett’s test (Zar, 1999;
Kuehl, 2000) since Dunnett specifically addresses making pair-wise comparisons between a
control group (Phase II compost in our case) and each of the other conditions, such as
substrate-moisture content treatments (Kuehl, 2000).
A linear regression of mycelial growth (mm) versus time (days) for each treatment
(MINITAB, 2004) was carried out to obtain mycelial growth rate. Slope means were
separated according to Fisher’s LSD test at p<0.05.
Results
Mushroom yield and BE

Significant sources of variation in the ANOVA included yield and BE for substrates
and substrate moisture contents (Table 1). For the NCS/SMC mixture, mushroom yields
tended to decrease as moisture content increased (Table 2). For NCS, the opposite trend was
observed, i.e. as substrate moisture increased, yield increased. For BE, however, no
differences were observed for the NCS/SMC mixture. However, BE was higher for the NCS
85
containing 65% moisture. Biological efficiency was higher on Phase II compost (60.5%), but
was not significantly different from the other treatments except for NCS at 60% moisture
(42.0%). No mushrooms were obtained from NCS at 55% moisture.
Table 1. Probabilities greater than F from analysis of variance for two factors and their
interactions tested for yield, biological efficiency (BE) and size of Agaricus bisporus for
two crops grown at the Mushroom Research Center
Probability > Fb
Sourcea df Yield BEc Size Solids

Substrate (SB) 1 <0.0001 <0.0001 0.1013 <0.0001
Moisture content (MC) 2 0.0012 <0.0001 0.0306 <0.0001
SB x MC 2 <0.0001 <0.0001 0.1127 0.4884
a
Error df 66, coefficient of variation, 33.95, 34.58, 29.71 and 7.52 for yield, BE, size and
solid contents respectively.
b
Values of less than 0.05 were considered significant according to Fisher’s LSD.
c
%BE = (g fresh mushrooms/g dry substrate) x 100
Mushroom size
A significant source of variation was found for mushroom size due to substrate
moisture content (Table 1). Mushroom sizes ranged from 14.6 g/mushroom (NCS/SMC @
55%) to 23.8 g/mushroom (NCS @ 60%) (Table 2). Mushrooms harvested from NCS/SMC
tended to increase in size as moisture content increased. However, differences within the
NCS/SMC were not significant. Conversely, mushrooms produced on NCS tended to decrease
in size as moisture content increased, reflecting an increase in total number of mushrooms
harvested (data not shown). The largest mushrooms (23.8 g/mushroom) were obtained from
NCS.
Mycelial growth rates

Mycelial growth rate on Phase II compost was more than twice that of any of the other
substrates (Table 3). In general, mycelial growth on the NCS/SMC substrate was faster than
on NCS alone. The NCS/SMC mixture containing a moisture content of 60% resulted in the
most rapid mycelial growth rate (2.35 mm/day) (Table 3), while sparse mycelial growth was
observed on NCS at 55% moisture. The slowest growth rate (1.61 mm/day) was observed on
NCS with a substrate moisture content of 65%.
Table 2. Influence of substrate moisture content on yield (kg/m2), percentage biological

efficiency (% BE), size (g/mushroom) and mushroom solids content (%) of Agaricus
bisporus grown on spent mushroom substrate (SMC), non-composted substrate (NCS)
and mixtures of NCS/SMC
Substrate Dry wt Moisture Yield BE Size Solids

(kg) content (%) (kg/m2)abc (%)cd (g)bc (%)ce
NCS/SMC 1.125 55 14.5a 59.1a 14.6b 7.6c
1.000 60 12.7ab 58.3a 18.8ab 7.6c
0.875 65 10.7bc 56.4a 19.0ab 6.6d
NCS 1.125 55 ---f --- --- ---
1.000 60 9.1c 42.0b 23.8a 9.9a
0.875 65 10.3c 54.4a 18.3ab 8.7b
Phase II 0.800 68 10.5bc 60.5a 16.0b 8.2b
compost
86
Table 2 continued from page 86
a
Yield = fresh mushrooms harvested when pilei were open (lamellae visible) per 2.5 kg
substrate (w.w.).
b
Values are means of 12 replicates except for Phase II compost (control) which had eight
replicates.
c
Means within a column followed by the same letter are not significantly different (p<0.05)
according to Fisher’s LSD. Values are means of 10 replicates.
d
% BE = ratio of fresh mushrooms harvested/dry substrate wt expressed as a percentage.
e
Values are means of 10 replicates.
f
Treatment did not produce mushrooms.
Table 3. Influence of substrate moisture content on linear mycelial growth rate of a

brown (Sylvan SB-65) strain of Agaricus bisporus grown on spent mushroom substrate
(SMC) and non-composted substrate (NCS)
Substrate Moisture content Mycelial growth

(%) (mm/day)ab
1:1 NCS/SMC 55 2.06cd
60 2.35b
65 2.09c
NCS 55 1.85d
60 1.93cd
65 1.61e
Phase II compost 68 5.89a
a
Means within a column followed by the same letter are not significantly different
(p<0.05) according to Fisher’s LSD.
b
Values are means of 12 replicates.
Discussion
The reasons for the differential yield and size response to different substrates and
moisture contents remain unexplained. However, these responses may be related to the
physical nature of the substrate, to gas exchange or to water availability within the substrate.
Ohga (1990) demonstrated that the vegetative growth rate of Lentinula edodes (shiitake)
mycelium was different at the surface compared to the interior of substrate prepared with
various woodchip particle sizes. As particle size decreased, the radial mycelial extension rate
increased whereas mycelial biomass decreased. Ohga (1990) suggested that oxygen depletion
was the cause of reduced mycelial biomass development in substrates containing smaller
particle size. Donoghue and Dennison (1995, 1996) demonstrated that O2 and CO2 levels in
the airspace above the inoculated substrate were correlated with subsequent mushroom yields.
Royse and Sánchez-Vazquez (2001) found that shiitake yields from substrates prepared with
wood chips smaller than 0.85 mm were lower by about 15% compared to large chips (>0.85
mm). We did not measure the size of the woodchips used in our experiments, so it is not
possible to compare our profile with others. However, it is known that particle size
distribution for commercial sawdust may vary as much as 300% within a sieve size (Royse &
Sànchez-Vazquez, 2001). In their work with composted sawdust as a medium for A. bisporus,
Block and Rao (1960) used oak sawdust with 91% of the particle sizes >0.85 mm. They
suggested that smaller particle sizes may lead to insufficient aeration during composting and
production. Additional work would be required to elucidate the effect of particle size
distribution on yield and size of A. bisporus produced on NCS.
87
No mushrooms were obtained from NCS at 55% moisture due to poor mycelial
growth. Bechara et al. (2005) observed a similar outcome, i.e., large variation in mushroom
yield due to inadequate moisture (58% in cased) grain spawn. The desired moisture level of
Phase II compost is 65-68% (Schroeder & Schisler, 1981). Bechara et al. (2005) were able to
increase yield dramatically by placing a layer of water-saturated Perlite® below the cased
grain spawn.
Our work is the first report on how moisture content of NCS and a mixture of
NCS/SMC influenced mushroom size. As moisture content increased from 55% to 65% in
NCS/SMC substrate, mushroom size increased from 14.6 g/mushrooms to 19.0 g/mushroom,
but this increase was not significant. Mamiro et al. (2007) and Mamiro and Royse (2008)
observed mushroom sizes between 17 g and 31 g for NCS/SMC when the substrate moisture
content was 65%. Also, mushroom size increased 5.5 g/mushroom when the moisture content
of NCS decreased from 65% to 60%. The reason for an increase in mushroom size as
substrate moisture content decreased may be due to the number of mushrooms forming on the
casing. A higher number of mushrooms were produced when the NCS moisture content
decreased from 65% to 60% (data not shown). It is known that the number of mushrooms
maturing on the casing is indirectly related to the overall size of the mushrooms (Sinden &
Schisler, 1962).
We observed a negative correlation between substrate moisture and mushroom solids
content, i.e., greater solids content were obtained from drier substrates of both types. This
supported the report by Gormely (1969) who observed an increase in dry mushroom weight as
compost moisture content decreased from 80% to 66%. However, our findings were different
from those of Schroeder and Schisler (1981) who found that mushrooms from drier compost
had lower percent dry weights than mushrooms from higher compost moisture treatments.
Mycelial growth of A. bisporus on both NCS and mixtures of NCS/SMC contained in
test tubes appeared to have a common growth pattern. Mycelial growth increased as moisture
content increased from 55% to 60%. However, there was a decrease in mycelial growth as
substrate moisture content was increased from 60% to 65% in both substrates. Gerrits (1971)
observed less mycelial growth in compost with moisture contents greater than 72%. He
observed thin mycelial growth from very dry (<60%) Phase II compost at spawning. Both
NCS and NCS/SMC at a moisture content of 65% had the slowest mycelial growth rate. On
the driest (55%) NCS, mycelial growth was sparse. This was similar to the observations of
Schroeder and Schisler (1981) who observed that on dry (61.6%) substrate, mycelial growth
was visibly less whereas growth on the higher moisture compost was dense, numerous and
thick.
We have shown that the optimum moisture contents for yield and BE for NCS/SMC
and NCS were 55% and 65%, respectively. However, the optimum moisture contents for
mushroom size for NCS/SMC and NCS were 65% and 60%, respectively. Gerrits (1971)
suggested that the optimum moisture content of compost at spawning is in the range of 63 to
68%. In the future, higher levels of moisture content such as 70% and 74% should be
evaluated for NCS and NCS/SMC. In addition, the effect of casing moisture on yield and size
of mushrooms grown on NCS and NCS/SMC should be examined. The work of Schroeder
and Schisler (1981) demonstrated the importance of the interaction of substrate moisture and
casing moisture on yield and mushroom size. It is not known if a similar pattern would be
observed for the NCS and NCS/SMC treatments.
Acknowledgements
The authors thank the Ford Foundation IFP Program for financial support to Delphina
P. Mamiro during her Ph.D. thesis work at PSU. We also thank Tom Rhodes, Doug Keith,
88
Henry Shawley and Vija Wilkinson from the Mushroom Research Center, PSU for technical
assistance.
References
Bechara MA, Heinemann P, Walker PN, Romaine CP. 2005. Cultivation of Agaricus bisporus
on a mixture of cereal grain spawn and delayed-release nutrient supplement. Mush.
News, 53, 6-10.
Bechara MA, Heinemann P, Walker PN, Romaine CP. 2006a. Evaluating non-composted
grain substrates for the production of Agaricus bisporus and Agaricus blazei
mushrooms. ASABE Paper No. 067089. St. Joseph, Mich.: ASABE.
Bechara MA, Heinemann P, Walker PN, Romaine CP. 2006b. Non-composted grain-based
substrates for mushroom production (Agaricus bisporus). Trans. ASABE 49, 819-824.
Block SS, Rao SN. 1960. Sawdust compost for mushroom growing. Mush. Sci., 5, 134-142.
Carey AT, O’Connor TP. 1991. Influence of husbandry factors on the quality of fresh
mushrooms (Agaricus bisporus). Mush. Sci., 13, 673-682.
Donoghue JD, Denison WC. 1995. Shiitake cultivation: gas phase during incubation
influences productivity. Mycologia, 87, 239-244.
Donoghue JD, Denison WC. 1996. Commercial production of shiitake (Lentinula edodes)
using whole-log chip of Quercus, Lithocarpus, and Acer. pp265-275. In: Royse, D.J.
(Ed.), Proc. 2nd Intl. Conf. Mushroom Biology and Mushroom Products, 9-12 June,
University Park, PA.
Duns GJ, Rinker DL, King L, Ripley BD, Alm G. 2004. Comparisons of odor emissions from
mushroom substrate prepared by traditional windrow and forced aeration composting
methods using organoleptic and analytical chemical methods of odor assessment.
Mush. News, 52, 6-24.
Flegg PB, Randle PE. 1968. Re-use of mushroom bed compost. M.G.A. Bull., 223, 363-378.
Gerrits JPG. 1971. The influence of water in mushroom compost. Mush. Sci., 8, 43-57.
Gormely TR. 1969. Texture studies on mushrooms. J. Food Technol., 4, 161-169.
Kalberer PP. 1990. Water relations of the mushroom culture (Agaricus bisporus): study of a
single break. Scientia Hort., 41, 277-283.
Kalberer PP. 1991. Water relations of the mushroom culture Agaricus bisporus: Influence on
the crop yield and on the dry matter content of the fruit bodies. Mush. Sci., 13, 269-
274.
Kuehl RO. 2000. Design of Experiments: Statistical Principles of Research Design and
Analysis. 2nd Ed. Duxbury Press. 666pp.
Mamiro DP, Royse DJ. 2008. The influence of spawn type and strain on yield, size, and
mushroom solids content of Agaricus bisporus produced on non-composted and spent
mushroom compost. Bioresource Technol., 99, 3205-3212.
Mamiro DP, Royse DJ, Beelman RB. 2007. Yield, size, and mushroom solids content of
Agaricus bisporus produced on non-composted substrate and spent mushroom
compost. World J. Microbiol. Biotechnol., 23, 1289-1296.
Mee HM. 1978. Mushroom composting. US. Patent No. 4,127,964.
MINITAB® Statistics, 2004. MINITAB Release 14 for Windows, USA.
Murphy WS. 1972. Development of a mushroom production medium without Phase I
composting. Mush. News, 20, 4-22.
Ohga S. 1990. Growth rate of mycelium of shiitake, Lentinula edodes, in relation to water
potential of medium. J. Fac. Agric. Kyushu Univ., 34, 413-420.
Royse DJ. Sánchez-Vazquez JE. 2001. Influence of substrate wood-chip particle size on
shiitake (Lentinula edodes) yield. Bioresource Technol., 76, 229-233.
89
San Antonio JP. 1971. A laboratory method to obtain fruit from cased grain spawn of the
cultivated mushroom, Agaricus bisporus. Mycologia, 63, 17-21.
Sánchez JE. Royse DJ. 2001. Adapting substrate formulas used for shiitake for production of
brown Agaricus bisporus. Bioresource Technol., 77, 65-69.
Sánchez, JE. Royse DJ. Hernández G. 2002. Development of non-composted substrate for
production of Agaricus bisporus. pp265-270. In: Sánchez, JE, Huerta G, Montiel E,
(Eds.) Proc. 4th Intl. Conf. Mushroom Biology and Mushroom Products, 20-22
February. Universidad Autónoma del Estado de México, Cuernavaca, México.
SAS. 2001. Statistical Analysis System, SAS Institute Inc., Cary, NC, USA.
Schisler LC. 1990. Why mushroom production declines with each successive break, and, the
production of a second crop of Agaricus mushrooms on “spent” compost. App. Agric.
Res., 5, 44-47.
Sinden JW, Schisler LC. 1962. Nutrient supplementation of mushroom compost at casing.
Mush. Sci., 5, 267-280.
Schroeder GM, Schisler LC. 1981. Influence of compost and casing moisture on size, yield
and dry weight of mushrooms. Mush. Sci., 11, 495-509.
Till, O. 1962. Champignonkultur auf sterilisiertem Nährsubstrat und die Wiederverwendung
von abgetragenem Kompost. Mush. Sci., 5, 127-133.
Zar, J.H. 1999. Biostatistical Analysis, 4th edition, Prentice Hall, New Jersey. Pp 217.
90
Cultivation Technique using Plastic Container and Selection the Superior

Strain of Monkey Mushroom (Hericium erinaceus)
Ung Yang1, Kyung-Ju Jung2, Duck-Soo Choi2, Bong-Yun Oh2, Joung-Keon Kim2, Tae-
Jung Kim1, and Ki-Chul Chung1
1
School of Biological Sciences and Technology, Chonnam National University, Gwangju,
500-757, Korea; 2Crop Research Division, Jeonnam Agriculture Research and Extension
Service, Naju 520-715, Korea. Email: chungkc@jnu.ac.kr
Abstract
These experiments were conducted to find a superior strain of monkey mushroom (Hericium
erinaceus), culture conditions for liquid inoculum, and the optimum media composition for culture
using plastic containers. In general, the optimum medium for culturing monkey mushroom strains
was Hamada medium and, among five strains tested, the most energetic strain was MKACC51875.
When culturing the liquid inoculum, the optimum medium pH and temperature for growth of most
hyphae were pH 4.0 and 22.5 OC, respectively. The cultivation period was delayed as the amount of
nutrition was increased, but the fruit body yield was increased. When cultivated at low temperature,
the yield per container increased and the quality of the fruit bodies was good. In conclusion, when
taking into account the cultivation period, and fruit body quality and yield, the best medium
composition for cultivating the monkey mushroom (MKACC51875) was oak sawdust 80% +
nutrition source 20%. Under these conditions, the yield per container was 140.6 g.
Key Words: Hericium erinaceus; Cultivation; Plastic container; Strain selection; Substrate
optimization
Objectives
The objectives of this study were to:

a. Find a superior strain of the monkey mushroom (H. erinaceus),
b. Optimize the culture conditions for liquid inoculum preparation,
c. Optimize the medium composition for cultivation using plastic containers.
Selection the superior strain and optimum media for culture of monkey mushroom
Test mushroom : five strains of monkey mushroom (Hericium erinaceus)
Media : PDA, MCM, Hamada, BGM (Barley germ media), CDA, YM
Nutritional sources and mixing ratio: rice bran (10, 20, 30%), wheat bran (10, 20, 30%)
Optimal culture conditions (pH, temperature) for the preparation of monkey mushroom
liquid inoculum
Culture method: 1,000 ml volume of bottle culture, air supplying system,
Test strain: MKACC51875
Test conditions: liquid medium pH (pH 4, 5, 6, 7, 8), culture temperature (20, 22.5, 25, 27.5,
30 OC)
Optimal medium composition for cultivation of monkey mushroom using plastic containers
Main materials: oak sawdust, willow sawdust
Nutritional source: rice bran, wheat bran, sugar cane
Nutritional mixing ratio: rice bran 50% + wheat bran 30% + sugar cane 20%
91
Media formation ratio:
oak sawdust (OS) 85% + nutritional source (NS) 15%,
OS 80% + NS 20%,
OS 75% + NS 25%,
OS 70% + NS 30%,
oak + willow sawdust (OWS) 85% + NS 15%,
OWS 80% + NS 20%,
OWS 75% + NS 25%,
OWS 70% + NS 30%
Results
Table 1. Mycelia growth (cm) of monkey mushroom strains on different media
Strain No. PDA MCM Hamada BGM CDA YM

MKACC51864 2.3 3.2 7.2 3.0 5.8 1.3
MKACC51865 6.7 5.4 6.6 6.3 4.3 4.2
MKACC51866 7.1 8.0 7.1 8.3 5.5 5.5
MKACC51869 4.3 4.1 6.6 6.3 6.1 6.3
MKACC51875 8.2 8.3 8.5 7.5 5.6 7.3
Culture temperature: 23 OC; culture period: 8 d
Table 2. Mycelia growth (cm) of different monkey mushroom strains on oak sawdust
supplemented with different amounts of nutritional source
Rice bran (%) Wheat bran (%)

Strain No.
10 20 30 10 20 30
MKACC51864 5.7 5.75 4.9 4.6 5.65 5.3
MKACC51865 5.0 6.0 4.15 4.25 6.2 5.1
MKACC51866 4.0 6.45 5.6 5.0 7.1 5.9
MKACC51869 5.05 6.45 4.7 5.1 6.05 6.25
MKACC51875 5.25 5.65 5.5 4.7 6.55 5.75
Culture temperature: 23 OC; culture period: 8 d
Table 3. Cultivation period of the monkey mushroom and fruit body characteristics when
cultivated in plastic containers (1,100cc)
Yield
Culture Periods Fruit body size (mm) Pin length
Strain No. (g/1,100cc)
(days) (mm)
Wide Length
MKACC51864 25 85 67 1.3 59.3
MKACC51865 32 60 48 1.5 32.4
MKACC51866 18 61 56 2.7 42.0
MKACC51869 15 62 71 2.9 81.4
MKACC51875 15 73 43 4.2 92.8
92
Figure 1. Growing area and fruit bodies of the superiority monkey mushroom
strain (MKACC51875)
Figure 2. Mycelium production by the superiority monkey mushroom strain

(MKACC51875) grown in liquid media adjusted to different pH values and incubated
at different culture temperatures
(Left plate: temperature, right: pH)
Table 4. Mycelium biomass production and pH changes after culture of monkey

mushroom (MKACC51875) liquid inoculum at different temperatures
Culture temp (OC) 20.0 22.5 25.0 27.5 30.0

Dry hyphal weight (g/l) 1.14 2.05 1.97 1.39 1.31
Standard deviation 0.17 0.07 0.09 0.11 0.20
pH change
3.41 3.40 3.52 3.69 3.78
(Initial pH: 4.0)
93
Table 5. (H. erinaceus MKACC51875: culture periods, fruit body size and yield at different
growing temperatures and media formulations
Fruit body size and yield at different growing temperature (mm, g)

Media formation (%) Culture
15 OC 18 OC 21 OC
period
Nutrition (days) Wide
Main material Length Yield Wide Length Yield Wide Length Yield
source
Oak sawdust 85 15 15 100.3 55.9 93.8 114.5 63.0 78.6 109.5 55.6 71.9
Oak sawdust 80 20 16 124.6 65.7 140.6 132.8 72.2 112.2 123.4 69.9 104.3
Oak sawdust 75 25 17 129.6 76.2 146.9 132.2 79.4 116.9 123.1 72.9 108.8
Oak sawdust 70 30 18 124.3 83.2 150.0 145.5 90.6 126.8 127.6 72.8 109.5
Oak+willow sawdust 85 15 15 98.8 60.5 115.6 113.8 63.4 86.6 92.9 57.9 76.6
Table 6. Changes in the physical and chemical characteristics of monkey mushroom media
following sterilization, and after culture and harvest
Media formation (%) pH (1:5) EC (dS/m) T-N

After After After
Nutrition After After After After After After
Main material steril steril steril
source culture harvest culture harvest culture harvest
-ization -ization -ization
Oak sawdust 85 15 5.46 4.74 4.25 1.61 2.08 1.95 0.73 0.84 0.75
Oak sawdust 80 20 5.52 4.87 4.52 1.74 2.46 2.31 0.87 0.99 0.93
Oak sawdust 75 25 5.51 4.99 4.64 1.91 2.92 2.40 0.92 1.14 0.97
Oak sawdust 70 30 5.55 5.12 4.73 2.23 3.32 2.72 1.07 1.10 1.08
Oak+willow sawdust 85 15 5.49 4.73 4.25 1.69 2.35 1.93 0.78 0.86 0.66
Table 7. Changes in the physical and chemical characteristics of monkey mushroom media
following sterilization, and after culture and harvest
Media formation T-C C/N

Nutrition After After After After After After
Main material
source sterilization culture harvest sterilization culture harvest
Oak sawdust 85 15 76.7 93.3 93.3 105 111 124
Oak sawdust 80 20 90.0 90.0 93.3 103 91 100
Oak sawdust 75 25 93.3 90.0 80.0 101 79 82
Oak sawdust 70 35 96.7 90.0 91.3 93 82 85
Oak+willow sawdust 85 15 96.7 93.4 86.6 124 109 131
94
Conclusions
These experiments were conducted to find the superior strain of monkey mushroom,
optimum culture conditions for the preparation of liquid inoculom, and the optimum medium
composition for cultivation using plastic containers.
In general, the optimum medium for culturing the monkey mushroom (H. erinaceus) strains
was Hamada medium and among the five strains tested, the most energetic strain was
MKACC51875. Mycelia growth of these strains did not different according to the kind of
nutritional source, but the optimum mixing amount was 20% to sawdust volume. Among the
five test strains, the culture period of MKACC51875 strain was the shortest (15 days), and the
yield per container was the highest (92.8 g). Therefore, MKACC51875 was selected as the
most superior strain. When culturing the liquid inoculum, the optimum medium pH and
temperature for growth of most hyphae were pH 4.0 and 22.5 OC, respectively. Under these
conditions, dry fungal biomass reached 2.05 g/l. For large-scale production of monkey
mushroom, we tested different sawdust media ratios. The cultivation period was delayed as
the amount of nutrition was increased, but the fruit body yield was increased. When cultivated
at low temperature, the yield per container increased and the quality of the fruit bodies was
good.
In conclusion, when taking into account the cultivation period, and fruit body quality and
yield,
the best medium composition for cultivating the monkey mushroom (MKACC51875)
was oak sawdust 80% + nutrition source 20%. Under these conditions, the yield per container
was 140.6 g.
95
Mushroom Breeding: Hurdles and Challenges

Anton S.M. Sonnenberg1, Johan J.P. Baars1 and Rick W. Kerrigan2
1
Department of Plant Breeding, Wageningen University and Research Centre, The
Netherlands; 2Sylvan Research, Kittanning, USA. Email: anton.sonnenberg@wur.nl
Key Words: Mushroom breeding; Agaricus bisporus; Genetic base; Chromosome length
polymorphism; Strain protection
Introduction
Breeding of mushrooms is a young applied science compared to plant or animal

breeding. Only recently, large breeding programs comparable to plant breeding projects were
set up for the button mushroom, Agaricus bisporus. These programs revealed that there are a
number of hurdles in mushroom breeding of which some were not fully anticipated. First of
all, one has to conclude that the genetic base of all present day hybrids is very narrow. As a
result, all strains have similar sensitivity to diseases and new diseases will affect all strains. In
addition, all strains occasionally show similar abnormalities that might be caused by strain
instabilities. The variation in characters between the present-day hybrids is minor. One thus
needs wild, none related, strains as a donor line for the introduction of new traits into
commercial acceptor lines. The wild isolates, however, are mostly inferior in quality and/or
yield. Repeated back-crossing is needed with a commercial acceptor line in order to restore
quality. It appeared, however, that in these so called introgression breeding programs the
restoration of quality is hampered by a so-called linkage drag. This is the additional wild
genome linked to the trait of interest that is hauled along when selecting in each generation
for the desired trait. The main reason for this linkage drag is the low recombination frequency
in the button mushroom.
Additional phenomena that might interfere with the restoration of quality in the
commercial acceptor line are the common chromosome length polymorphism and
translocations that occur during meiosis in several basidiomycetes, including the button
mushroom. This hampers the restoration of the acceptor genome in backcrosses and might
thus interfere with restoration of quality.
Last but not least is the difficulty to protect new varieties that result from breeding
programs. Although there is breeders right or plant patent right in most countries for
mushrooms, it is still difficult to protect strains. The ease with which copies are made, the
restricted legal tools that can be used and the costs that have to be made to prosecute
infringers, makes investment in mushroom breeding programs unattractive. This is one of the
reasons that breeding programs on the same scientific and magnitude levels as plant breeding
programs are rare for mushrooms.
This article elaborates on these hurdles in breeding the button mushroom but will also
point to some chances that are available to tackle these problems. Issues discussed will
certainly also apply to a large extent to other mushroom species.
Life cycle and recombination in meiosis
In order to understand the problems and challenges for breeders of button mushrooms
we will shortly describe the different types of life cycles found in A. bisporus. All commercial
strains and most wild isolates have a so-called secondary homothallic life cycle. Most basidia
produce two spores and the four post meiotic nuclei are distributed to these spores in such a
way that each spore receives two non-sister nuclei (Evans, 1959). Since these nuclei have
opposite mating type, each spore will produce fertile heterokaryotic mycelium upon
96
germination. Only a small portion of the basidia (1.3%) produce 4 spores each receiving one
post-meiotic nucleus and will form infertile homokaryotic mycelium. In breeding programs,
these homokaryons are selected from different strains and used to make hybrids and produce a
next generation.
Callac and Kerrigan have described a tetrasporic variety of A. bisporus from the
Sonoran desert of California (Callac et al. 1993). Most of the basidia of this variety produce 4
spores that are haploid, and mating between compatible homokaryons leads to fertile
heterokaryotic mycelia. This variety displays mainly a heterothallic life cycle. At last, a rare
tetrasporic variety of A. bisporus has been found recently that has a true homothallic life cycle
(Callac et al. 2003). Each spore has one haploid nucleus and can produce fruit bodies. All
three varieties found are completely interfertile. The different varieties are designated as A.
bisporus var. bisporus (secondary homothallic), A. bisporus var. eurotetrasporus (true
homothallic) and A. bisporus var. burnetti (heterothallic).
The heterothallic trait (mainly 4-spored basidia with homokaryotic spores) is dominant
in crosses between 2-spored and 4-spored varieties. The MAT gene and the main determinant
for the basidial spore number (bsn) are located on chromosome I (Imbernon et al. 1996).
Genetic maps of this chromosome of the secondarily homothallic and heterothallic varieties
show a high degree of synteny (Callac et al. 1997), indicating the close relationship between
these varieties.
As stated before, all commercial lines of the button mushroom and most wild isolates
have a secondarily homothallic life cycle. Only a low percentage of the spores are
homokaryotic (haploid). These spores originate from rare 4-spored basidia. Genetic analysis
has shown that recombination occurs (Summerbell et al. 1989; Kerrigan et al. 1993) but at a
low frequency. In a previous breeding program, we also observed low recombination
frequencies, i.e. 1 to 2 recombination events per individual per generation (Sonnenberg,
unpublished). There is, however, a normal independent segregation of homologue
chromosomes. Analysis of marker segregation in heterokaryotic single spore isolates (derived
from 2-spored basidia) shows that many loci are heteroallelic. This indicates that most spores
receive a pair of non-sister nuclei. The typical life cycle is thus directed to the preservation of
heterozygosity in its offspring and might prevent accumulation of deleterious alleles. Contrary
to the ‘bisporus’ variety, the ‘burnettii’ variety has predominantly 4 spores per basidium and
there are indications that this variety shows a higher recombination frequency. This
reproductive system thus seems to be directed to outbreeding.
In hybrids between bisporic and tetrasporic varieties, maps are extended due to higher
recombination frequencies (Sonnenberg et al. 1996; Callac et al. 1997). Callac et al. (1997)
found in 52 single spore isolates from a bisporic variety no recombination between markers
on chromosome I. In a cross between bisporic and burnettii varieties, 23% of the offspring
were found to be recombinant for markers on chromosome I. In our breeding program we also
see an increase in recombination in hybrids between bisporic and burnettii varieties compared
to strains of the bisporic varieties. The average recombination frequency is between 4 and 5
recombination events per individual per generation. This is not a high number and there is a
considerable variation between the numbers of events from individual to individual (from 0 to
14). The increased recombination frequency in hybrids between the bisporic and tetrasporic
varieties compared to the bisporic variety indicates that the tetrasporic variety has a higher
recombination frequency than the bisporic variety. However, no data on marker segregation
from tetrasporic offspring are available.
Mazhieka et al. (2006) have studied the meiotic process in the heterothallic and
secondarily homothallic varieties of A. bisporus. They have used a previously developed
method of microspreading of basidial nuclei to study meiotic prophase I (Mazheika et al.
2003). The EM observations show a large variation in morphologies in chromosome pairing
in bisporic and tetrasporic varieties. Clear, vague or absence of axial elements (AE) and
97
synaptonemal complexes (SC) are observed. Distinct AEs and SCs (normal and abnormal) are
only seen to some extent in open fruit bodies (disrupted veil). This indicates that at least the
first wave of meioses might lead to formation of spores with no or abnormal meiosis. More
interesting are the observed differences in nuclear morphology between bisporic and
tetrasporic varieties. Whereas the bisporic variety shows predominantly abnormal axial
structures and less SCs, in the tetrasporic variety mostly distinct and normal AEs and SCs are
seen. It is likely that AEs and SCs play a role in the establishment of contact between
homologous chromosomes and thus form a prerequisite for recombination. It might well be
possible that the abnormal morphology of meiosis in the bisporic variety is related to the low
recombination frequency of this variety compared to the tetrasporic variety. It is not known if
the BSN allele controlling the number of spores per basidium (bi- or tetrasporic) is linked to
recombination frequency.
An interesting observation made by Mazhieka is the presumable arrest of meiosis
during the first wave of spore production and a more normal meiosis in mature mushrooms
with disrupted velum. We have previously generated limited genetic maps of different spore
prints of the commercial line Horst U1. In this bisporic variety a large difference was seen in
length of maps based on different spore prints (Sonnenberg, unpublished). Unfortunately, no
details are known from these experiments as to when spores were collected or in what flush. It
is well possible that this variation in recombination is due to the difference in developmental
stage of the mushrooms taken to collect spores. Spores from mature mushrooms might thus
show more recombination and be more beneficial to a breeding program.
The interfertility and dominant characteristics of the 4-spored trait offer the
opportunity to discover genes involved in processes that are characteristic for each life cycle,
i.e. the number of spores per basidium and recombination frequencies. The genome of a
homokaryon of a bisporic and a tetrasporic variety will be sequenced by JGI in California and
the sequences will be available in 2009. This certainly will help in identifying genes involved
in life cycle specificity. From a breeders point of view it is important that the 4-spored trait
and higher recombination frequencies can be introduced in breeding stocks of this
economically important edible mushroom. Especially a low recombination frequency is one
of the hurdles in breeding programs. The introduction of a new trait is usually done by so-
called introgression breeding. This is a hybridization between a receptor commercial strain
and a wild donor strain, followed by backcrosses with the commercial line and simultaneous
selection in each generation for the trait of interest. The outcome is introgression of the target
gene(s) into the recipient line. The target gene(s) are usually flanked by additional wild
genome and when these flanking regions are unintentionally introduced in a strain, this is
called linkage drag from the donor. The amount of linkage drag is dependent on the frequency
of crossover events around the target gene, number of backcrosses, and the ease of selection
against genes with negative side effects. The present breeding programs show that especially
the low recombination frequency in A. bisporus leads to considerable linkage drag. The
additionally introduced wild genome will certainly have a negative influence on the quality of
the end product. Fundamental research on this topic is thus important and a PhD student will
start soon in the department of Plant Breeding of Wageningen University and Research
Centre, the group where mushroom research is carried out now. This PhD student will study
recombination frequencies in both types of life cycles and the variation in recombination
between “early” and “late” spores. In addition, other factors influencing recombination will be
examined. This research might lead to the detection of the genetic determinants involved in
the type of life cycle and the frequency of recombination in meiosis. This certainly will
contribute to more efficient breeding programs and less linkage drag.
98
Narrow genetic base
In the early 1980s, Dr. Gerda Fritsche produced the first hybrids for the button
mushroom by hybridizing traditional strains (Fritsche, 1986). One of these hybrids, Horst U1,
soon became dominant on the spawn market. Within one year, additional hybrids appeared on
the market and genotyping showed that these were either copies or directly derived from the
first hybrids produced by Fritsche. The low genetic variation still exists and, as a
consequence, all strains are sensitive to the same diseases and will all be sensitive to new
diseases. All hybrids also occasionally show the same abnormalities, such as stroma, open
veil and clusters (Figure 1). There are indications that stroma and clusters correlate with
spawn batches and are likely related to strain instabilities. Open veil seems also to be a stress
related symptom. Previous work done in cooperation with the University of Toronto indicated
that some deviations are associated with chromosomal abnormalities (Horgen et al. 1996).
A B C
Figure 1. Abnormalities that are occasionally seen in crops of the

button mushroom A. bisporus.
Photo A: Stroma, a strong vegetative growth often accompanied by
abnomal mushrooms and a reduced yield. Photo B: Different extents of
open veil, a underdeveloped or absence of lamellae. This phenomenon also
is often accompanied by a reduced yield. Photo C: Clusters and
malformation. Here several mushrooms arise from one tissue and are
attached to each other at the base (cluster) or on top of each other
Research done so far has not delivered a method to trace instability on mycelium level
(mother cultures), nor a method to maintain strains in such a way that degeneration is
prevented. Spawn companies and laboratories are just using their experience to maintain
strains to their best knowledge. Screening of spawn batches on a limited scale in test crops
prevents disasters on a large scale but can not prevent occasional degenerations. Little to
nothing is known of the fundamental processes or triggers that cause degeneration. Recent
breeding products of the Plant Breeding Department of Wageningen UR also encountered
abnormalities (open veil in a new brown hybrid and stroma in the sporeless oyster
mushroom). This phenomenon hampers the introduction of new strains on the market. A start
has been made now at the Plant Breeding Department of Wageningen UR to study the genetic
inheritance of these abnormalities in order to find out if genetic changes are involved in this
phenomenon. In this study it will be of help that the genome of the button mushroom and the
oyster mushroom will be sequenced by JGI. This will deliver all gene sequences of both
species and allows the design of micro-arrays (genes spotted on DNA-chips) and a quick
screening of expression of all genes. That certainly will reveal what genes are expressed
differently in cultures that show abnormalities. This knowledge might be used to screen
cultures in an early stage against abnormalities and be used in breeding programs to select
stable strains.
99
The narrow genetic base of the present-day hybrids is also reflected by the minor
variations in characters. Thus, one needs wild, unrelated, strains for the introduction of new
traits. These wild isolates, however, are mostly inferior in quality and/or yield. Repeated back
crosses are needed with a commercial line in order to restore quality. As stated in the previous
paragraph, low recombination frequencies in the button mushroom lead to considerable
linkage drag and hampers the restoration of quality. For most crops in plant breeding
programs, advanced breeding stocks are available. These are lines that vary in genetic base
and differ in one or a number of traits. They have in common agronomic values that are not
far from commercial standards. Interbreeding of such lines leads to new combinations of traits
without the loss of important traits as quality and yield. Such advanced breeding stocks are
not available for mushroom breeders, especially not for the button mushrooms, and it is
difficult to find funding for this. The Dutch government has acknowledged that the
Netherlands has a prominent position in breeding research and the production of breeding
stocks for several crops, i.e. flower bulbs, tomatoes and potatoes. It has recently decided to
support this in order to maintain this knowledge and is co-funding programs on these areas.
The Plant Breeding Department in Wageningen has now also applied for a project to generate
knowledge and breeding stock for button mushrooms on the quality issue of discoloration of
mushrooms by mechanical damage. This knowledge will be used to breed strains less
sensitive to bruising and thus more suited for mechanical harvesting systems. Several
companies representing the whole production chain are involved and support this project.
When successful, such a project may have a positive effect and lead to the generation of
advanced breeding stock for other traits and, hopefully, also other mushroom species.
Chromosome length polymorphism
A phenomenon that is relevant to mushroom breeding is chromosome length

polymorphism (CLP). The size of fungal genomes allows separation of intact chromosomes
by pulse field gel electrophoresis (Mills & McClusky, 1990). This technique has shown that
strains within a species have a considerable variation in chromosome length (reviewed by
Zolan, 1995). This has been observed also in mushroom producing species (Kerrigan et al.
1993; Sonnenberg et al. 1996; Larraya et al. 1999; Kim et al. 2000). The origin of the length
differences is not known and it is assumed that homologues of strains which show CLP have
more than one heterologous region. A source for the generation of CLP in sexual reproducing
fungi is meiosis. It has been observed that strains with CLP generate offspring with new
chromosome lengths. This is due to the recombination between homologous chromosomes of
different length resulting in a chromosome with a new, often intermediate, length. Differences
can also be generated by reciprocal translocations. In the button mushroom, translocation also
was seen (Figure 2). All these chromosomal changes might have a phenotypic effect. It is also
clear that repeated backcrosses in the introgression breeding programs of the button
mushroom might result in a strain that not only has changes in the region where the target
gene(s) is (are) located but also in other regions where no changes were meant to be. In
Coprinopsis cinerea it has been shown that in repeated backcrosses sometimes a recombined
chromosome selected for its new trait could not be restored to the original length (Zolan et al.
1994). This was explained by assuming that the novel-sized chromosome, once generated, has
common sequences with only part of the homologue of the recipient strain thus restricting
recombination to certain regions. This might also have an effect on the quality of the breeding
products. Variation in chromosome length might also be caused by the “dispensable”
sequences which may be present, absent or duplicated (Zolan, 1995). A definition of the
dispensability is, however, often based on the viability of spore germination and vegetative
growth. Variation in these sequences might well influence characters that are important for
mushroom formation.
100
A B C
Pre-meiotic Post-m eiotic Pre-m eiotic Post-meiotic
nuclei nuclei nuclei nuclei
H91/14
H91/31
H91/14
H91/31
H39
H97
H97
H39
Figure 2. Panel A: Chromosomes of A. bisporus homokaryons H39 and H97

separated by pulsed field electrophoresis (CHEF). The homokaryons are the
constituent parental line of the commercial hybrid Horst U1. Marker segregation
analysis of the offspring of Horst U1 revealed the homologous chromosomes of both
lines and these are indicated to the right of the gel. Panel B and C represent a
schematic drawing of chromosomes of a hybridization experiment. Each ellipse
represents one chromosome or a double chromosome (indicated as a gray ellipse). In
each panel, the first two lanes represent the pre-meiotic lines, i.e. the homokaryons
H39 and H97, and the second two lanes represent two homokaryons isolated from one
fertile heterokaryotic single spore isolate from Horst U1 and thus represent two post-
meiotic products. The blot in panel A was hybridized with an Eco-RI restriction
It is difficult to say how breeding programs can anticipate this phenomenon. A

possible approach is to generate sufficient advanced breeding stock, thus creating a broader
platform that can be use to introduce new traits and thus enhance the chance to restore most
agronomic traits to such an extent that commercially acceptable strains can be produced.
Strain protection
Most countries have signed the UPOV treaty (International Union for the Protection of
New Varieties of Plants) and have legislation on breeders right for plants. For almost all of
these countries it is also possible to protect new mushroom varieties. In practice, however, it
appears to be difficult to protect mushroom strains. This is reflected by the fact that, for a
number of species, not only for the button mushroom, many strains are sold with different
names that show no or hardly any genotypic and phenotypic differences. It is very easy to
make tissue cultures of mushrooms and use these to produce spawn under a different name.
Until now, only phenotypic characters can be used in legal disputes to prove that a strain was
copied. These rules were made for plants. Mushrooms, however, often have less phenotypic
characters than plants. In addition, these characters are influenced by environmental factors,
which makes the assessment difficult. An additional drawback to protecting strains are the
costs that have to be made to prosecute infringers. Since the market for mushrooms is
considerably smaller than for plants, it is not always certain if the costs made to prosecute will
exceed the benefits. This makes investments in mushroom breeding programs not very
attractive. It is illustrative that on the website of the CPVO (the European Breeders Right
Organization; http://www.cpvo.eu.int/) only three mushroom strains are mentioned and one
101
application is pending. This is one of the reasons why breeding programs on scientific and
magnitude levels of plants are rare for mushrooms.
With plants, it is now allowed to use genetic information such as genetic fingerprints,
as additional support but never as main proof. These tools will certainly help in protecting
mushroom strains too but that is not certain because no precedent is known. An additional
genetic tool that could be used to protect strains is CLP. New CLP are generated in each new
generation but a karyotype is stable in mitosis (Zolan, 1995). This can thus be used to prove if
a strain is a vegetative copy. At last, sequencing of whole genomes of the size of fungi will
soon become fast and cheap. That will certainly give the ultimate proof if strains are identical
or not.
Concluding remarks
The annual world production of edible mushrooms is very small compared to plants.
Nevertheless, there is a steady increase in production. Edible mushroom are more and more
subject to studies on nutritional value and bioactive compounds. If these studies lead to a
good scientific underpinning of claims that are now made, mushrooms do have a potential to
become a more prominent crop. An efficient production system and products adapted to the
demands of consumers are then needed to fulfill the needs of the market. Breeding has to play
an important role in this process because it can use the available genetic resources to adapt
strains to these demands. As stated in the previous paragraphs, there are a number of hurdles
to be taken before mushroom breeding will be on a level comparable to plant and animal
breeding. A substantial genetically and phenotypically varied advanced breeding stock should
be generated as a source for breeding programs. Fundamental research should be done on
meiotic behavior, i.e. recombination, of the different varieties in button mushrooms and also
in other species. This knowledge can be used to tackle problems such as linkage drag. Last
but not least, infringements on breeders right of mushroom varieties should be prosecuted and
thus generate jurisdiction that will make the protection for new strains easier and less costly.
This will hopefully, in addition to the market potential, lead to larger investments in
mushroom breeding.
References
Callac P, Billette C, Imbernon M, Kerrigan RW. 1993. Morphological, genetic and infertility
analyses reveal a novel, tetrasporic variety of Agaricus bisporus from the Sonoran dessert
of California. Mycologia, 85, 835-851.
Callac P, Desmerger C, Kerrigan R, Imbernon M. 1997. Conservation of genetic linkage with
map expansion in distantly related crosses of Agaricus bisporus. FEMS Microbiol. Lett.,
146, 235-240.
Callac P, Jacobe´ de Haut I, Imbernon M, Guinberteau J, Desmerger C, Theochari I. 2003. A
novel homothallic variety of Agaricus bisporus comprises rare tetrasporic isolates from
Europe. Mycologia, 95, 222–231.
Evans HJ. 1959. Nuclear behaviour in the cultivated mushroom. Chromosoma, 10, 115-135.
Fritsche G. 1986. Breeding mushrooms. Mushroom J., 157, 4-17
Horgen PA, Carvalho D, Sonnenberg ASM. 1996. Chromosomal abnormalities associated
with strain degeneration in the cultivated mushroom, Agaricus bisporus. Fungal Gen. Biol.,
20, 229-241.
Imbernon M, Callac P, Gasqui P, Kerrigan R, Velcko T. 1996. BSN, the primary determinant
of basidial spore number and reproductive mode in Agaricus bisporus, maps to
chromosome I. Mycologia, 88, 749-761.
102
Kerrigan R, Imbernon M, Callac P, Billette C, Olivier J-M. 1994. The heterothallic life cycle
of Agaricus bisporus var. burnettii and the inheritance of its tetrasporic trait. Exp. Mycol.,
18, 193-210.
Kerrigan RW, Royer JC, Baller LM, Kohli Y, Horgen PA, Anderson JB. 1993. Meiotic
behavior and linkage relationships in the secondarily homothallic fungus Agaricus
bisporus. Genetics 133, 225-236.
Kim D, Tamai Y, Azuma T, Harada A, Ando A, Sakuma Y. 2000. Analysis of the
electrophoretic karyotype of Flammulina velutipes. J. Wood Sci. 46, 466-469.
Larraya LM, Pérez G, Peñas MM, Baars JP, Mikosch TSP, Pisabarro AG, Ramírez L. 1999.
Molecular karyotype of the white rot fungus Pleurotus ostreatus. Appl. Environ.
Microbiol., 65, 3413–3417.
Mazheika I, Kolomiets O. 2003. A method for preparation of synaptonemal complexes of
meiotic chromosomes from basidial protoplasts of the white button mushroom Agaricus
bisporus (Lange) Imbach. Russian J. Genet., 39, 283–287.
Mazheika I, Kolomiets O, Dyakov Y, Bogdanov Y. 2006. Abnormal meiosis in bisporic
strains of white button mushroom Agaricus bisporus (Lange) Imbach. Russian J. Genet.,
42, 279–285.
Mills D, McCluskey K. 1990. Electrophoretic karyotypes of fungi: the new cytology. Mol.
Plant-Microbe Interact. 3, 351–357.
Sonnenberg A, de Groot P, Schaap P, Baars J, Visser J, van Griensven L. 1996. Isolation of
expressed sequence tags of Agaricus bisporus and their assignment to chromosomes. Appl.
Environ. Microbiol., 62, 4542–4547.
Summerbell R, Castle A, Horgen P, Anderson J. 1989. Inheritance of restriction fragment
length polymorphism in Agaricus brunnescens. Genetics, 123, 293-300.
Zolan ME, Heyler NK, Stassen NY. 1994. Inheritance of chromosome-length polymorphisms
in Coprinus cinereus. Genetics, 137, 87-94.
Zolan ME. 1995.Chromosome length polymorphism in fungi. Microbiol. Rev., 59,
689-698.
103
Molecular Genetics of the Mating System in the Bipolar Mushroom,

Pholiota nameko
Ruirong Yi1, Mukaiyama Hiroyuki2, Takashi Tachikawa2 and Tadanori Aimi2

1
The United Graduate School of Agricultural Sciences, Tottori University, 4-101
Koyama-cho Minami, Tottori-shi, Tottori 680-8553, Japan; 2Faculty of Agriculture,
Tottori University, Koyama-cho Minami 4-101, Tottori-shi, Tottori 680-8553, Japan.
Email: taimi@muses.tottori-u.ac.jp
Abstract
We investigated the genetic structure around hox1 and rcb1 in the Pholiota
nameko, and discovered a second homeodomain protein gene (hox2) upstream of hox1.
Meanwhile, two pheromone receptor genes (rcb2 and rcb3) and two putative
pheromone genes (phb1 and phb2) were discovered around rcb1. The cloned genes
were introduced into P. nameko protoplasts using a DNA mediated transformation
system. The P. nameko strain with the introduced hox1 gene produced many
pseudo-clamp like structures. Although it is well known that the mating system in P.
nameko is bipolar, the function of homeodomain protein in P. nameko is similar to
those of the homeodomain proteins in the tetrapolar mushrooms Coprinopsis cinerea
and Schizophillum commune. Therefore, it is possible that clamp formations may not be
regulated only by the homeodomain protein, but also by the pheromone and pheromone
receptor proteins. In this study, relationships between clamp cell formation and
compatibility in the bipolar mushroom will be discussed.
Key Words: Pholiota nameko; Bipolar mating system; Clamp cell formation
Homeodomain protein; Pheromone receptor gene
Introduction
Incompatibility factors of basidiomycetous mushrooms are constituted by one

or two sets of multiple allelomorphic genes called bipolar and tetrapolar incompatibility
factors, respectively (Whitehouse, 1949). Mushrooms such as Coprinopsis cinerea
(Casselton & Kües, 1994; Hiscock et al. 1996), Flammulina velutipes (Ashan-Aberg,
1960), and Schizophyllum commune (Frankel & Ellingboe, 1977) were demonstrated to
carry tetrapolar incompatibility factors. In the tetrapolar mushrooms, both A and B
factors are constructed of two subunits, α and β, that are located on different
chromosomes (Day, 1960; Frankel & Ellingboe, 1977).
Both the loci (A and B factors) regulate formation of a dikaryon through a
sequence of events. First, the compatibility at B factor promotes migration of fertilizing
nuclei from each mate into the other. Compatibility at A factor then promotes a one to
one pairing of invading nuclei with host nuclei in hyphal tip cells. An outgrowth called
a hook cell forms from the side of the tip cell and the nuclei divide synchronously.
Septa form to separate the four daughter nuclei: paired nuclei of opposite types in the
new apical cell, a single nucleus in the hook-cell, and a single nucleus in the new
subapical cell. Compatibility at B factor instigates fusion of the hook cell with the
subapical cell to form a ‘clamp connection’ and releases the hook cell’s nucleus into the
subapical cell, resulting in a dikaryotic subapical cell. The nuclei are always distributed
such that each dikaryotic cell receives nuclei derived from each of the original mates
(Raper, 1983; 1966; Fowler et al. 2004).
104
Recently, the composition of the A incompatibility factor gene in the bipolar
mushroom, P. nameko, has been reported (Aimi et al. 2005). The gene for the
homeodomain protein (hox1) in the bipolar mushroom, P. nameko, which is a putative
homologue of A mating type genes in the tetrapolar basidiomycete, C. cinerea, was
sequenced and characterized. The gene for the pheromone receptor (rcb1) in P. nameko,
which is a putative homologue of the B mating type genes in C. cinerea, was also
sequenced and characterized. Restriction fragment length polymorphism (RFLP) and
linkage analyses indicated that both genes are present as a single locus on different
chromosomes. Moreover, in P. nameko, the hox1 gene was mapped to the A mating
type locus in linkage group I. However, rcb1 was not linked to the A mating type locus
and was mapped to the other linkage group. These results strongly suggest that hox1
regulates with incompatibility in the bipolar mushroom, and that rcb1 may not affect
the mating function in P. nameko. A similar phenomenon was reported in the bipolar
mushroom, Coprinellus disseminatus (James et al. 2006). Only the transcription factor
genes segregate with mating type, discounting the hypothesis of genetic linkage
between the A and B mating-type loci as the causal origin of bipolar mating behavior.
The mating-type locus of C. disseminatus is similar to the A mating-type locus of the
model species C. cinerea and encodes two tightly linked pairs of homeodomain
transcription factor genes. When transformed into C. cinerea, the C. disseminatus A and
B homologs elicited sexual reactions like native mating type genes. Although mating
type in C. disseminatus is controlled by only the transcription factor genes, cellular
functions appear to be conserved for both groups of genes. Therefore James et al.
(2006) suggested loss of mating-type-specific pheromone receptor function in the
mushroom, C. disseminatus.
However, little is known about which genes are controlled by the homeodomain
transcription factor protein. Moreover, it is not clear whether or not clamp cell
formation is controlled by only the homeodomain proteins. From these questions, we
analyzed genomic structure of the P. nameko A mating type locus and its flanking
region, and the homeodomain protein genes were introduced into P. nameko cells using
a newly developed DNA mediated transformation system in order to investigate the
function of the homeodomain protein genes. In this study, relationships between clamp
cell formation and function of the homeodomain protein gene in bipolar mushroom will
be discussed.
Fungal strains used in this study

Auxotrophic monokaryons of Pholiota nameko, NGW12-163 (A3，Arg4) and
NGW19-6 (A4，pdx1), were used in this study.
Genomic walking
Genomic walking around A4-hox1 from NGW19-6 strain (Aimi et al. 2005)
was carried out using cassette amplification by PCR with seven specific primer sets.
These primer sets were designed based on the partial nucleotide sequences of amplified
DNA fragments obtained from each of the PCRs. Template DNAs for cassette PCR
were prepared with a Takara LA PCRTM In Vitro Cloning Kit (Takara Bio Co., Shiga,
Japan) according to the manufacturer's instructions.
Amplification of full-length cDNA by RT-PCR was performed using a
SuperScript™ One-Step High Fidelity kit (Invitrogen, Tokyo, Japan).
105
DNA sequencing and computer analysis of nucleotide and protein sequences
DNA sequencing was carried out in an ABI PRISM™ 3100 Genetic Analyzer
(Applied Biosystems, Tokyo, Japan) using the chain-termination procedure with a
BigDye Terminator™ Cycle Sequencing version 3.1 kit (Applied Biosystems)
according to the manufacturer’s instructions. Nucleotide and protein sequence data
were analyzed using Genetyx-SV/RC Version 8 (Software Development, Tokyo, Japan).
Identification of genes in the chromosomal regions around A4-hox1 of NGW19-6 gene
was accomplished using the software Eukaryotic GeneMark hmm
( http://exon.gatech.edu/GeneMark/eukhmm.cgi),
Caenorhabditis elegans ES-3.0 models (Lomsadze et al. 2005) and BLASTX database
searching (Altschul et al. 1997) of the EMBL (European Molecular Biology
Laboratory)-EBI (European Bioinformatics Institute) database (URL:
http://www.ebi.ac.uk/blast2/) to find open reading frames (ORFs) with significant
matches to known genes. We chose a P value <10-10 as the threshold value for
homologue assignment. The nucleotide sequences of A mating type locus and its
flanking regions from NGW19-6 and NGW12-163 strain have been deposited in DDBJ
under the Accession nos. AB435542 and AB435543, respectively.
Transformation method
DNA mediated transformation was carried out essentially according to the
method described by Binniger et al. (1987) and Honda et al. (2000). To collect P.
nameko oidia, NGW16-9 strain was inoculated on a MYG plate (2% glucose, 0.5%
yeast extract, 0.5% malt extract, pH 5.6) and incubated at 25 OC for 2 weeks. Five agar
blocks (2 mm × 2 mm) from the plate were inoculated into a 100 ml Erlenmeyer flask
containing 10 ml MYG liquid medium at 25 OC for 2 weeks without shaking. The
harvested oidia were inoculated into 100 ml MYG liquid medium in a Sakaguchi flask
and incubated at 25 OC for 18-24 h with shaking. The germinated oidia was suspended
in 3 ml MM buffer containing 2% lywallzyme (Guangdong Institute of Microbiology,
China), and was incubated at 30 OC for 3 h without shaking except for gently shaking at
30 min intervals to release protoplasts into suspension. The protoplasts (about 5 × 106)
were suspended in 50 µl MMC buffer (0.55 M mannitol, 50 mM maleic acid, 50 mM
CaCl2, pH 5.5), and 20 µg plasmid (pCbxr or pHygr) and 12.5 µl PEG buffer (25%
PEG4000, 10 mM pH 7.5 Tris-HCl, 25 mM CaCl2) was added. The mixture was placed
in ice for 10 min and then 500 µl PEG buffer was added. After keeping at room
temperature for 5 min, 1 ml MMC buffer and 1 ml SMYM medium (1% sucrose, 1%
malt extraction, 0.4% yeast extraction, and 0.55 M mannitol, pH 5.6) were added.
Subsequently, protoplasts were allowed to regenerate at 25 OC for 18~24 h, then mixed
with 3 ml SMYM medium containing 0.7% agar and selection drug (carboxin
concentration was set at three levels, 0.5 µg/ml, 1.0 µg/ml, 2.0 µg/ml; hygromycin B at
four levels, 150 µg/ml, 200 µg/ml, 300 µg/ml, 400 µg/ml). The mixture was poured
onto a SMYM agar medium (contain 1.5% agar) supplemented with selection drug. The
plate was incubated at 25 OC for 5~7 days. Colonies were sub-cultured individually
onto fresh MYG plates containing 2 µg/ml carboxin or 200 µg/ml hygromycin B
according to the differently transformed plasmid. In every case, a control without the
joining plasmid was set for every drug concentration.
The co-transformation method is the same as the transformation except for addition
of amplified DNA fragments cording hox1 or hox2 gene with the drug resistant
plasmid.
106
Results and discussion
Structure of the A mating-type region in P. nameko NGW19-6 strain

In order to reveal genomic structure around A4-hox1, which is one of the
components of the A mating type locus in P. nameko NGW19-6 strain, a total of 39,882
bp of the nucleotide sequence around A4-hox1 was amplified and determined. The gene
map of this region is shown in Figure 1, and the position and characterization of these
genes is given in Table 1. Fifteen genes with significant similarity to proteins in the
EMBL database
Figure 1. Comparisons of the genomic structure of the bipolar mushroom A

mating-type locus and its flanking region among various species.
Homeodomain protein genes are shown as black boxes ( ). Diagonal stripes ( )

indicate gene sequences that are conserved among the bipolar mushrooms P. nameko
and Coprinellus disseminatus (James et al. 2006) and the tetrapolar mushroom
Pleurotus djamor (James et al. 2004b). Gray shading ( ) indicates gene sequences that
are conserved between the bipolar mushrooms P. nameko and C. disseminatus. A
stippled pattern ( ) indicates gene sequences that are conserved between P. nameko
and the tetrapolar mushroom P. djamor. White boxes ( ) indicate genes that are not
conserved between the three mushroom species. Arrows indicate the putative direction
of transcription. The figure showing the genomic structure of the C. disseminatus A
mating-type locus was modified from James et al. (2006).
(P<10-10) were identified in this region. At 284 bp upstream of A4-hox1,
another homeodomain protein gene (A4-hox2) was found in which the direction of
transcription was opposite to the A4-hox1 gene. This location of the pair of
homeodomain protein genes displayed strong similarity to the two classes of mushroom
A mating-type homeodomain genes in the tetrapolar mushrooms, C. cinerea, S.
commune (Casselton & Olesnicky, 1998) and Pleurotus djamor (James et al. 2004b),
and the bipolar mushroom, C. disseminatus (James et al. 2006). The single pair of
homeodomain genes represents the only genes in this region with similarity to known
mating-type genes in other fungi such as Ustilago maydis and P. djamor, and it is
suggests that this single pair of homeodomain protein genes (A4-hox1 and A4-hox2)
107
actually functions in mating-type determination (Aimi et al. 2005).
Table 1. Gene homologues identified in the Pholiota nameko A mating type locus
and its flanking region.
Gene P-value Position Homologue Possible function Reference

methylmalonate-semiald
Putative methylmalonate - ehyde
-81 semialdehyde dehydrogenase, dehydrogenase
mmsd 1.78 × 10 1734-4309 Loftus et al. 2005
[Cryptococcus neoformans] (acylating)
(AAW45534) activity, oxidoreductase
activity
Low molecular weight
phosphotyrosine protein
lmwpp Mondesert et al.
3.80 × 10-12 4945-4213 phosphatase dephosphorylation
p 1995
[Schizosaccharomyces pombe]
(P41893)
Hypothetical protein
hp1 3.54 × 10-27 8875-10852 Prenylcysteine lyase Loftus et al. 2005
[C. neoformans] (Q5K9H3)
Ammonium transporter
ammonium transporter
amtp 1.56 × 10-94 13,022-11,037 [Hebeloma cylindrosporum] Javelle et al .2001
activity
(AAK82417)
Beta-flanking protein
β-fg 1.63 × 10-19 13,677-14,656 [C. disseminatus] unknown
(AAZ14920)
James et al. 2006
Homeodomain A mating-type
-18 transcription factor
hox2 5.29 × 10 17,032-15,187 protein [C. disseminatus]
activity
(AAZ20167)
Homeodomain A mating-type
transcription factor Aimi et al. 2005;
hox1 3.56 × 10-21 17,316-19,420 protein [C. disseminatus]
activity James et al. 2006
(AAZ20163)
hydrolase activity,
Mitochondrial intermediate mitochondrial
mip 0 22,201-19,725 peptidase [C. disseminatus] intermediate peptidase
(AAO61501) activity,
zinc ion binding
Hypothetical protein UP11 James et al. 2006
up11 2.61 × 10-51 24,740-23,254 [C. disseminatus] unknown
(AAZ14914)
Hypothetical protein UP10
up10 2.42 × 10-16 25675-25120 [C. disseminatus] unknown
(AAZ14913)
Hypothetical protein UPA2
up2 3.38 × 10-53 25,876-27,253 unknown James et al. 2004b
[P. djamor ] (AAS46739)
Hypothetical protein UP8
up8 3.56 × 10-21 27,610-29,701 [C. disseminatus] unknown
(AAZ14911) James et al. 2006
-11 secE/sec61-γ [C. protein translocase
sec61 1.79 × 10 33,868-33,459
disseminatus] (AAZ14910) activity
Hypothetical protein PDUPA1
up1 6.10 × 10-28 34,093-36,288 unknown
[P. djamor] (AAS46735)
glycine dehydrogenase
Glycine dehydrogenase James et al. 2006
(decarboxylating)
glydh 0 39,882-36,001 [C. disseminatus]
activity,
(AAZ14908)
lyase activity
P value indicates the probability of the match being due to chance in EMBL similarity searches. Under homologue,
the species from which the lowest P value hit was obtained is given in brackets, followed by the
DDBJ/EMBL/GenBank accession number in parentheses.
Other genes with known function in this region are mitochondrial intermediate
peptidase gene (mip) that is conserved in the A mating type region (James et al. 2004a),
methylmalonate-semialdehyde dehydrogenase gene (mmsd) (Loftus et al. 2005), low
108
molecular weight phosphotyrosine protein phosphatase gene (lmwppp) (Mondesert et al.
1994), ammonium transporter protein gene (amtp) (Javelle et al. 2002), and glycine
dehydrogenase (glydh) (James et al, 2006). Although another nine genes encoded
hypothetical proteins, the functions of which are unknown, surprisingly eight
homologue genes of the bipolar mushroom, C. disseminatus present at the A mating
type region, were discovered around A4-hox1 and A4-hox2 of P. nameko. Moreover, the
gene order from β-fg to glydh, including homeodomain protein genes, and the direction
of transcription bear significant resemblance (Figure 1). Similarity of the location of the
genes around A mating type locus among bipolar mushroom, P. nameko, tetrapolar
mushroom, C. cinerea and S. commune, and secondarily homothallic mushroom, C.
bilanatus was previously described (Kües et al. 2001; Aimi et al. 2005). However, in
the literature, the location of only three kinds of genes such as homeodomain protein
genes, adenine synthesis gene and p-aminobenzoic acid synthetase genes were on more
than 20 cM chromosomal region. Therefore, the similarity of the gene location among
morphologically and taxonomically different species is a very important finding for
understanding the evolution of the bipolar mushroom genome, although the two
mushroom species belong to different taxonomic families; P. nameko belongs to
Strophariaceae; C. disseminatus belongs to Psathyrellaceae.
The pCbxr and pHygr transformation

In the pCbxr transformation, the transformation efficiency of three carboxin
concentrations was not the same. Among the three concentrations, the carboxin
1.0µg/ml was higher than the other two (Table 2). Transformant colonies grew
relatively slower on regeneration plates containing 2.0 µg/ml carboxin compared with
the plates containing 0.5 µg/ml or 1.0 µg/ml carboxin.
Table 2. Transformation efficiency of P. nameko wild type strain NGW19-6 using

pHygr (Hygromycin) and pCbxr (carboxin)
Hygromycin B Carboxin
(transformants per µg DNA) (transformants per µg
Protoplast DNA)
number
150 200 300 400 0.5 1.0 2.0
µg/ml µg/ml µg/ml µg/ml µg/ml µg/ml µg/ml
Exp. 1 4.12×106 86.9 73.8 54.4 34.2 44.5 69.5 46.1
Exp. 2 4.45×106 153.4 133.6 60.6 41.2 95.8 125.3 79.0
Exp. 3 4.03×106 126.9 105.9 69.9 27.0 49.9 71.7 40.6
In the pHygr transformation, along with the increasing of hygromycin

concentration, the transformation efficiency decreased (Table 2). In the regeneration
plates containing 400 µg/ml hygromycin, the transformants were sparse and small. The
calculation number of the pHygr transformant colonies three days and a week after the
109
Table 3. Co-transformation of P. nameko wild type strain NGW19-6
Transformation experiment
pCbxr+A3-hox1 pHygr+A3-hox1 pCbxr+A3-hox2 pHygr+A3-hox2
Number of protoplasts 5×106 5×106 4.5×106 4.5×106

Number of total
146 34 111 147
transformants picked up
Number of co-transformants
7 2 16 8
observed clamp cells
Co-transformantion
4.8% 5.9% 14.4% 5.44%
efficiency
appearance of colonies was different. More than half of the colonies that appeared after
three days did not grow any larger and, after transfer to MYG plates containing 200
µg/ml hygromycin, they failed to grow. These colonies may have no pHygr plasmid
inserted in the genome and express temporarily with the rudimental plasmid in the cell.
In all three transformation experiments, no growth of controls was detected on plates
containing the three carboxin concentrations and four hygromycin concentrations.
Co-transformation
The co-transformation efficiency (number of co-transformant colonies as a
percentage of the total transformants) using either the pCbxr or pHygr transformation
methods varied between approximately 5~15% (Table 3). The co-transformants
exhibited different a mycelial appearance compared with other transformants.
Microscopical observation revealed that the co-transformants showed mainly
pseudo-clamp like structures, suggesting that introduction of only one gene such as
hox1 or hox2 may not be enough for the formation of clamps.
References
Aimi T, Yoshida R, Ishikawa M, Bao D, Kitamoto Y. 2005. Identification and linkage

mapping of the genes for the putative homeodomain protein (hox1) and the
putative pheromone receptor protein homologue (rcb1) in a bipolar basidiomycete,
Pholiota nameko. Curr. Genet., 48, 184-194.
Altschul SF, Madden TL, Schäffer AA, Zhang J, Zhang Z, Miller W, Lipman DJ. 1997.
Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs. Nucleic Acids Res., 25, 3389-3402.
Ashan-Aberg K (1960) Studies on dedicaryotization mycelia and of F1 variation in
Collybia velutipes. Svensk Bot. Tidskr., 54, 311-328.
Binninger DM, Skrzynia C, Pukkila PJ, Casselton LA. 1987. DNA-mediated
transformation of the basidiomycete Coprinus cinereus. EMBO J. 6, 835-840.
Casselton LA, Kües U. 1994. The multiallelic mating type genes of Hymenomycetes.
In: Esser K, Lanmke PA (eds) The Mycota, vol 1. Growth, differentiation and
sexuality. Springer, Berlin Heidelberg New York, pp 307-321.
Casselton LA, Olesnicky NS. 1998. Molecular genetics of mating recognition in
basidiomycete fungi. Microbiol. Mol. Biol. Rev., 62, 55-70.
Day PR. 1960. The structure of the A mating type locus in Coprinus lagopus. Genetics
45, 641-650.
110
Fowler TJ, Mitton MF, Rees EI, Raper C. 2004. Crossing the boundary between the B
alpha and B beta mating-type loci in Schizophyllum commune. Fungal Genet. Biol.,
41, 89-101.
Frankel C, Ellingboe AH. 1977. Sexual incompatibility factors and somatic
recombination in Schizophyllum commune. Genetics 85, 427-438.
Hiscock SJ, Kües U, Dickinson HG. Molecular mechanisms of self-incompatibility in
flowering plants and fungi—different means to the same end. Trends Cell Biol., 6,
421-428.
Honda Y, Matsuyama T, Irie T, Watanabe T, Kuwahara M. 2000. Carboxin resistance
transformation of the homobasidiomycete fungus Pleurotus ostreatus. Curr. Genet.
37, 209-212.
James TY, Kües U, Rehner SA, Vilgalys R. 2004a. Evolution of the gene encoding
mitochondrial intermediate peptidase and its cosegregation with the A mating-type
locus of mushroom fungi. Fungal Genet. Biol., 41, 381-390.
James TY, Liou SR, Vilgalys R. 2004b. The genetic structure and diversity of the A and
B mating-type genes from the tropical oyster mushroom, Pleurotus djamor.
Fungal Genet. Biol., 41, 813-825.
James TY, Srivilai P, Kües U, Vilgalys R. 2006. Evolution of the bipolar mating system
of the mushroom Coprinellus disseminatus from its tetrapolar ancestors involves
loss of mating-type-specific pheromone receptor function. Genetics, 172,
1877-1891.
Javelle A, Rodriguez-Pastrana B, Jacob C, Botton B, Brun A, Andre B, Marini A,
Chalot M
2002. Molecular characterization of two ammonium transporters from the
ectomycorrhizal fungus Hebeloma cylindrosporum FEBS Lett., 505, 393-398.
Kües U, James TY, Vilgalys R, Challen MP. 2001. The chromosomal region containing
pab-1, mip, and the A mating type locus of the secondarily homothallic
homobasidiomycete Coprinus bilanatus. Curr. Genet., 39, 16–2.
Loftus BJ, Fung E, Roncaglia P, Rowley D, Amedeo P, Bruno D, Vamathevan J,
Miranda M, Anderson IJ, Fraser JA, Allen JE, Bosdet IE, Brent MR, Chiu R,
Doering TL, Donlin MJ, D'Souza CA, Fox DS, Grinberg V, Fu J, Fukushima M,
Haas BJ, Huang JC,
Janbon G, Jones SJ, Koo HL, Krzywinski MI, Kwon-Chung JK, Lengeler KB,
Maiti R, Marra MA, Marra RE, Mathewson CA, Mitchell TG, Pertea M, Riggs FR,
Salzberg SL, Schein JE, Shvartsbeyn A, Shin H, Shumway M, Specht CA, Suh BB,
Tenney A, Utterback TR, Wickes BL, Wortman JR, Wye NH, Kronstad JW, Lodge
JK, Heitman J, Davis RW, Fraser CM, Hyman RW. 2005. The genome of the
basidiomycetous yeast
and human pathogen Cryptococcus neoformans. Science 307, 1321-1324.
Lomsadze A, Ter-Hovhannisyan V, Chernoff Y, Borodovsky M. 2005. Gene
identification in novel eukaryotic genomes by self-training algorithm. Nucleic
Acids Res., 33, 6494-6506.
Mondesert O, Moreno S, Russell P. 1994. Low molecular weight protein-tyrosine
phosphatases are highly conserved between fission yeast and man. J. Biol.
Chem.,269, 27996-27999.
Raper JR. 1966. Genetics of sexuality in higher fungi. The Ronald Press, New York, pp
1-283.
Raper CA. 1983. Controls for development and differentiation of the dikaryon in
basidiomycetes. In: Bennet JW, Ciegler A (Eds) Secondary metabolism and
differentiation in fungi, vol. 15, pp 195–236.
111
Whithhouse HLK. 1949. Multiple allelomorph heterothallism in the fungi. New Phytol.,
48, 212–244.
112
Outcrossing via the Buller Phenomenon in a Substrate Simultaneously

Inoculated with Spores and Mycelium of Agaricus bisporus Creates
Variability for Agronomic Traits.
Philippe Callac, Micheline Imbernon, Jean-Michel Savoie
INRA, UR1264, Mycologie et Sécurité des Aliments, BP 81, F-33883 Villenave d’Ornon,
France. E-mail: savoie@bordeaux.inra.fr, callac@bordeaux.inra.fr
Abstract
A novel outcrossing method proceeding through the Buller phenomenon was evaluated
for its efficiency in creating a useful variability in agronomics traits and being considered of
value in the early generations of selection. Hybrids were obtained by outcrossing via the
Buller phenomenon of S608-2 homokaryon (white hybrid) with spores of a single spore print
of a C9 sporocarp (brown strain). Forty fruiting bodies resulting from the Buller phenomenon
were collected. Spawn was obtained from each collected hybrid and culture trials were
performed under conventional conditions or with artificial contamination by the pathogen
Verticillium fungicola. Forty-two percent of the hybrids came from the non-cultivatable mat-x
homokaryon of C9. This group of hybrids was not significantly different to the group
inheriting the mat-1 homokaryon for the yield, mean mass and cap colour, but it was
significantly less susceptible to the pathogen. The dispersion of the data for the susceptibility
to the pathogen was compared with those observed in a sample of wild strains and in a sample
of hybrids obtained by conventional crossings. The variability created by outcrossing for this
trait is significant and could be used to select interesting strains.
Key Words: Agaricus bisporus; Outcrossing; Buller phenomenon; Agronomic traits;

Verticillium fungicola
Introduction
In Agaricus bisporus var. bisporus most of the basidiospores are heterokaryotic

(predominant pseudohomothallic life cycle). Heterothallic basidiospores are homokaryotic (n)
and generally give rise to self-sterile homokaryotic mycelia. Plasmogamy between two
sexually compatible homokaryons restores a fertile heterokaryon. Pseudohomothallic
basidiospores are heterokaryons (n + n) and contain two non-sister post-meiotic nuclei with
different mating type alleles. Mycelia growing from these spores are sexually fertile. In wild
strains of A. bisporus var. bisporus, only 1.3% of the basidia, on average, are tetrasporic
(Callac et al. 1996) and produce homokaryotic basidiospores. From this, the outcrossing
classical method (confrontation of homokaryons in vitro) is hampered by the difficulty to
recover homokaryotic strains. However, it was recently shown that numerous hybrid
sporocarps are easily produced in vivo by simultaneously inoculating a standard compost of
culture with a homokaryon from one parent and the spores from a second parent (Callac et al.
2006). When a homokaryon is cultivated on compost like a commercial heterokaryotic
cultivar (Figure 1), it cannot form sporocarps by itself and requires genetic information from
the spores of a second parent to do so; on the other hand, mycelia derived from the
heterokaryotic spores of the second parent can fructify by themselves. In this case, it was
indirectly shown that crosses occurred between the heterokarotic spores (or mycelia issued
from them) and the inoculated homokaryon (Buller phenomenon). Outcrossing via the Buller
phenomenon in a substrate simultaneously inoculated with spores and mycelium of A.
bisporus is a promising outcrossing method that could be used in commercial breeding
programs, and in genetic studies.
113
Homokaryons recovered from some A. bisporus strains always have the same mating
type allele, whether they are obtained from spores or from protoplasts, suggesting that they
carry a recessive deleterious or lethal allele at a locus linked to MAT. This characteristic was
used to determine whether outcrossing proceeds through the Buller phenomenon or through
heterothallism (Callac et al. 2006). Nuclei that cannot support independent homokaryotic
growth could easily survive in a heterokaryon as long as their partner carried an allele that
complemented their lethal or deleterious allele(s). With outcrossing occurring mainly via the
Buller phenomenon, lethal or deleterious alleles can be transmitted through multiple
outcrossed generations. But this process allows also preserving and transmitting putative
beneficial alleles from these nuclei.
One objective in the present study was to determine if the novel outcrossing method
proceeding through the Buller phenomenon could create a useful variability in agronomics
traits for being considered of value in the early generations of selection. The second objective
was to show that interesting phenotypes can be recovered from nuclei that cannot support
independent growth thanks to in situ outcrossing via the Buller phenomenon.
Fructification Sporulation A. bisporus is amphithallic:

in the suspension of spores
PARENT A Grain (about one billion) most of
strain Bs 518 them (about 94%) are
spawn
(cultivar C9) heterokaryotic (n+n)
1 sporeprint Suspension of spores
PARENT B Homokaryon Spores and homokaryon

strain Bs 548 protoplasts were simultaneously Compost tray
Bs 548-2
(white hybrid inoculated in the compost
cultivar S608)
Grain spawn of 4 culture trays
Isolation (tissue
culture) of 41
hybrids (AxB)
Figure 1. Schematic representation of the experimental design including in vivo

outcrossing, collection of the hybrids, and cultural assays for determination of their
agronomical traits.
Parental strains and their mating type genotypes

Homokaryotic mycelium (S608-2 = Bs548-2) from S608 was confronted with spores
from C9 (Bs518), (Figure 1). Both of the parental strains, S608 and C9, are bisporic cultivars,
but they produce sporocarps with white and brown caps, respectively. S608 (Somycel,
114
Langeais, France) is a classic “white hybrid” that is genetically very similar to cultivar U1
(Mushroom Research Unit, Horst, The Netherlands). Homokaryon S608-2 was derived from
S608 by protoplasting and is genetically very similar to the U1-2 homokaryon and carries the
Mat-2 (mating type) allele. C9 (Le Lion, Saumur, France), the heterokaryotic parent of the
spores, is a well-known traditional “brown” cultivar. All the homokaryons derived from C9
carry the Mat-1 allele, consequently the mating type genotype of C9 is partially undetermined
(Mat-1/x).
Forty-five hybrids (H) obtained by conventional crossing between homokaryons similar
to U1-7 carrying the Mat-7 allele and homokaryons of A. bisporus var burnettii (Callac et al.
1997) were used as control of the level of variability for the susceptibility to V. fungicola.
Another sample of 33 wild strains from various geographical origins (collection CGAB,
INEA, France) was also used.
Outcrossing to produce hybrids

Hybrids were obtained by outcrossing via the Buller phenomenon of Bs608-2
homocaryon with spores of a single sporeprint of a C9 sporocarp as described in Callac et al.
(2006). Forty-one fruiting bodies were collected before caps opened and transfers were made
from each fruiting body in Petri dishes on compost agar medium (Figure 1). The outcrossing
origin of each isolate was checked with molecular markers (Callac et al. 2006). Outcrossing
heterokaryons resulting from the Buller phenomenon were distinguished by the alleles
inherited from the C9 parent at the PR6 locus. PR6 is a molecular marker derived from
restriction fragment length polymorphism marker P1N150 and is tightly linked to MAT on
chromosome 1 (Callac et al. 1997; Kerrigan et al. 1993). In C9, the allele PR6-1 is linked to
Mat-x, and PR6-2 is linked to Mat-1. The genotype of S608-2 is PR6-1.
Evaluation of the hybrids in cultures

Rye grain spawn cultures of each hybrid were prepared under sterile conditions like for
commercial spawn (Elliot, 1995). A. bisporus hybrids were cultivated on commercial compost
spawned at the rate of 0.8% in 0.1 m² crates containing 8 kg of compost. Three trays were
spawned with each hybrid. The incubation was performed at 24 °C for 13 d before a
conventional casing layer was overlaid on the compost. Nine days after casing, the trays were
separated in two groups, each placed in separated rooms, both with the temperature regulated
at 16 °C and air humidity at 89%. A conidial suspension of V. fungicola var. fungicola was
sprayed on the top of the casing layer of one group of trays 11 days after casing at a rate of
106 conidia m-2. Mushrooms were harvested for 4 weeks and the weights of healthy or
affected mushrooms were recorded for each tray (Juarez et al. 2002). One tray of each hybrid
was used in this group. The second group containing two trays per hybrid was cultivated
under standard conditions without inoculation of pathogen (Figure 1). Mushrooms were
harvested for 4 weeks, their weight and number were recorded and cap colour was measured
on five sporocarps from the first flush with a Minolta chromameter (CR221, 3 mm),
immediately after harvest. The yield was expressed as kg of fresh mushroom per m² of
compost and the mean weight of mushrooms was calculated (= weight / number, as g /
mushroom) (Rodier et al. 2000).
In another trial, wild strains were cultivated as above but only with inoculation of the
pathogen and one tray per strain. The 15 hybrids H were cultivated in a third trial with
inoculation of the pathogen and 3 trays per hybrid.
Statistical analyses
Descriptive statistics, analyses of variance and mean comparisons were performed with
SYSTAT software (SPSS Inc.)
115
Ten of the 41 hybrids were not used in data analyses because of no or abnormal fruiting
during the cultivation test in presence of V. fungicola. In the resulting sample of 31 hybrids,
13 had the PR6-1/1 genotype and resulted from crossings of the nucleus of S608-2 and the
nucleus of C9 carrying Mat-x that can not be obtained as homocaryon (Callac et al. 2006).
The 18 others had the PR6-1/2 genotype and resulted from crossings of the nucleus of S608-2
and the nucleus of C9 carrying Mat-1. Despite this bimodal distribution of the hybrids, the
distribution of the points on Figures 2 and 3 indicated that there was no observable
discrimination between the groups for yield, mean mass and cap colour. For the susceptibility
to the pathogen there was a trend of lower values of percentiles of diseased mushroom in the
groups with PR6-1/1 genotype, even if some highly susceptible hybrids were found in this
group.
25
20
.
15
yield (kg/m²)
10
0
5 10 15 20 25 30 35 40
mean weight of mushrooms (g)
Figure 2. Distribution of the A. bisporus hybrids resulting from outcrossing for their
yield and calibre estimated as the mean weight.
Squares = genotype PR6-1/1, rings = genotype PR6-1/2, white triangle = parent A C9, black
triangle = parent B S608.
This distribution is shown by the descriptive statistics (Table 1). The median is the value
above which half of the data fall. Medians and means are close in the two genotypes for the
agronomical traits except for susceptibility. 75 % of the data of PR6-1/1 genotype are lower
than the median value of PR6-1/2 genotype and 9/13 (69 %) are lower than the lower hinge.
None of the means between the two genotypes are significantly different except for
susceptibility where the difference is significant at P<0.05. These data indicate a link between
the genotype and the susceptibility to V. fungicola, with some possible recombination. In the
present case, the level of susceptibility transmitted by the non cultivable Mat-x nuclei of the
parent C9 is favourable.
116
95
90
85
.
80
weightness (L) 75
70
65
60
55
50
0 20 40 60 80 100
% deseased mushroom
Figure 3. Distribution of the A. bisporus hybrids resulting from outcrossing for their cap
color and susceptibility to V. fungicola.
Squares = genotype PR6-1/1, rings = genotype PR6-1/2, white triangle = parent A C9, black
triangle = parent B S608.
Table 1. Descriptive statistics of the agronomical traits measured on the group of

hybrids having a different genotype at the marker PR6.
Genotype Variable Stem and Leaf Plots

Lower Median Upper Mean Standard
hinge hinge error
PR6-1/1 % diseased 4.3 5.5 15.8 14.4 5.2
PR6-1/2 13.7 16.0 37.4 28.0 5.3
PR6-1/1 Yield (kg/m²) 13.4 15.9 16.8 14.4 1.2
PR6-1/2 12.5 16.1 17.2 15.3 0.8
PR6-1/1 Mean weight (g) 14.2 14.5 18.0 15.8 1.0
PR6-1/2 12.6 14.7 15.5 15.4 1.4
PR6-1/1 L (%) 66.8 69.1 71.7 69.4 1.0
PR6-1/2 65.2 69.0 70.6 68.9 0.9
One of the interesting features of the proposed new outcrossing method for hybridisation
and selection is that production of numerous homokaryons is not necessary. Nuclei that
cannot support independent homokaryotic growth could easily survive in a heterokaryon as
long as their partner carried an allele that complemented their lethal or deleterious allele(s).
However, they can bear other interesting alleles that could not be selected and used in
conventional breeding methods.
The dispersion of the data for the susceptibility to the pathogen was compared with
those observed in a sample of wild strains and in a sample of hybrids obtained by
conventional crossings. Only the Kurtosis coefficient of the outcrossing sample is considered
as significant because Kurtosis/ Standard error Kurtosis is higher than 2 (Table 2). This
indicates that the variable has longer tails than those for a normal distribution, due to the
existence of a significant difference between the two genotypes. The coefficient of variation
of the outcrossing sample is also the higher. The high level of variability in the hybrids
117
obtained by outcrossing is the result of the genetic variability of the spores in the sporeprint
from the parent C9.
Table 2. Comparison of the variability in susceptibility to V. fungicola in three groups pf

A. bisporus strains having three origins: hybrids from outcrossing, wild strains, hybrids
obtained by conventional method.
Origin of the A. bisporus strains

Outcrossing Wild strains Hybrids H
No. of cases 31 33 45
Median 14.3 21.0 30.7
Mean 22.3 28.9 40.3
95 % CI upper 30.3 38.0 46.5
95 % CI lower 14.3 19.8 34.0
Coefficient of variation 0.98 0.89 0.53
Kurtosis 2.4 - 0.18 - 0.52
SE Kurtosis 0.82 0.80 0.68
These data stress that the variability created by outcrossing through the Buller
phenomenon by simultaneously inoculating spores and the grain spawn of a homokaryon into
a culture substrate, is significant for some traits and could be used to select interesting strains
in the early generations of selection.
Acknowledgments
We are grateful to Christiane Coldefy, Patrick Castant and Thierry Gibard for their
excellent technical assistance in cultivation of mushrooms and production of V. fungicola
inoculum.
References
Callac P, Imbernon M, Kerrigan RW, Olivier JM. 1996. The two life cycles of Agaricus
bisporus, pp57–66. In: Royse DJ. (Ed.), Proc. 2nd Intl. Conf. Mushroom Biology and
Mushroom Products. The Pennsylvania State University, University Park, PA, USA.
Callac P, Desmerger C, Kerrigan RW, Imbernon M. 1997. Conservation of genetic linkage
with map expansion in distantly related crosses of Agaricus bisporus. FEMS Microbiol.
Lett., 146, 235–240.
Callac P, Spataro C, Caille A, Imbernon M. 2006. Evidence for outcrossing via the Buller
phenomenon in a substrate simultaneously inoculated with spores and mycelium
of Agaricus bisporus. Appl. Environ. Microbiol., 72, 2366-2372.
Elliott TJ. 1985. Spawn-making and spawns, pp131–139. In: Flegg PB, Spencer DM, Wood
DA (Eds), The biology and technology of the cultivated mushroom. John Wiley & Sons,
Chichester, United Kingdom.
Juarez del Carmen S, Largeteau-Mamoun ML, Rousseau T, Regnault-Roger C, Savoie JM.
2002. Genetic and physiological variation in isolates of Verticillium fungicola causing dry
bubble disease of the cultivated button mushroom, Agaricus bisporus. Mycol. Res., 106,
1163-1170.
Kerrigan RW, Royer JC, Baller LM, Kohli Y, Horgen PA, Anderson JB. 1993. Meiotic
behavior and linkage relationships in the secondarily homothallic fungus Agaricus bisporus.
Genetics, 133, 225–236.
118
Rodier A, Devesse C, Rousseau T, Védie R, Imbernon M, Olivier JM. 2000. Breeding brown
hybrids of button mushroom (Agaricus bisporus) from a factorial cross. Mush. Sci. XV,
289-298.
119
Proceedings of the 6th International Conference on Mushroom Biology and Mushroom Prodicts, 2008
Challenges Facing Mushroom Disease Control in the 21st Century

H.M. Grogan
Teagasc, Kinsealy Research Centre, Malahide Road, Dublin 17, Ireland.
Email: Helen.grogan@teagasc.ie
Abstract
Disease outbreaks can severely reduce the yield and productivity of commercial
mushroom production. Many mushroom pathogens are resistant to benzimidazole fungicides
or are increasingly tolerant to prochloraz. New pathogens have emerged at regular intervals
over the years such as Trichoderma aggressivum, Cladobotryum mycophilum Type 2 and
Mushroom Virus X (MVX). The number of approved pesticide products has been
significantly reduced in Europe and it is expensive to generate the data required to register
potential new products for small users such as the mushroom industry. This combination of
circumstances makes controlling disease outbreaks more challenging. Disease control will
increasingly depend on effective disease hygiene measures being in place. Knowledge of
disease epidemiology of specific pathogens will provide growers with insight into how they
are transmitted and spread within and between crops. Collaboration between the research
groups at an international level is a way forward.
Key Words: Mushroom diseases; Trichoderma aggressivum; Cladobotryum mycophilum

Type 2; Mushroom Virus X; Disease control
Introduction
The mushroom industry in Europe has undergone much change in the past 10 to 15
years. In Britain and France production has decreased by approximately 50%, in the
Netherlands and Ireland it has decreased by about 20% while in Poland it has increased by
100%. In 2006, Poland become the second largest producer of mushrooms in Europe (216,000
tonnes) after The Netherlands (225,000 tonnes) (Grogan, 2008). This changing pattern of
production across Europe has resulted in large reductions in grower numbers in many
countries. Small inefficient farms have closed, and those farms continuing in production have
had to increase output and efficiency.
Throughout Europe the industry is consolidating into larger, more productive farms
with increased mechanisation and centralised management and, within this framework, it is
essential that a clear disease management strategy is in place to maximise efficiency. Failure
to treat disease outbreaks in the early stages can be very costly as untreated areas of disease
produce the spores and propagules that will spread the disease throughout the rest of the crop
and the farm. Serious outbreaks of disease reduce marketable yield, incur additional costs for
disease control chemicals, as well as additional labour to identify and treat disease and to
apply chemicals. Ongoing pesticide reviews in Europe have resulted in many chemicals being
no longer approved for use. In addition, there is increased demand from consumers and
supermarket retailers for reduced pesticide use so that growers will increasingly have to
depend on disease prevention and containment measures to control outbreaks rather than
resorting to chemicals. Thus, a major challenge for mushroom growers in the 21st Century is
disease control with few or no chemicals. Other challenges include fungicide resistance
among pathogen populations, managing existing available pesticides and the emergence of
new pathogens. The mushroom research community in Europe is also facing a reduction in
both numbers and funding and will be less able to respond to emerging problems.
120
Collaborative projects between research groups around the world, on topics of universal
interest such as pest and disease control, are seen as the way forward.
Fungicide Resistance
Over the years, mushroom pathogens such as Verticillium fungicola, Cladobotryum

mycophilum and now Trichoderma aggressivum have developed resistance to the
benzimidazole fungicides (Fletcher & Yarham, 1976; Grogan & Gaze, 2000; Romaine et al,
2005). Resistance to benzimidazoles usually requires only a single mutation in a single gene
and this has occurred with relative ease for a large number of pathogens, particularly those
with many life cycles in a year like Verticillium and Trichoderma. However, other pathogens,
such as Mycogone perniciosa, have remained sensitive. In Europe. the benzimidazole
fungicide carbendazim is now withdrawn for use on mushrooms leaving no benzimidazoles
approved for controlling sensitive pathogens such as Mycogone.
In many countries, the fungicide prochloraz is the only effective chemical to control V.
fungicola. In countries where prochloraz is used, Verticillium populations tend to become
more tolerant to the active ingredient but this tolerance has not been associated with any
major loss of control (Grogan et al. 2000; Gea et al., 2005). Elsewhere in agriculture,
prochloraz has remained an effective fungicide against a broad range of fungal pathogens
despite many years of use and records of increased tolerance in fungal populations similar to
that seen in Verticillium.
However, significantly increased levels of prochloraz resistance have been detected in
some populations of the cereal eyespot pathogen in France and New Zealand (Dyer et al.
2000). Whether or not prochloraz remains effective for Verticillium control will depend on
whether resistance is determined by mutation in a single major gene or requires mutations in
many genes. The gradual directional shifts in sensitivity to prochloraz that are reported are
believed to indicate that resistance is under the control of many genes. However, there is
evidence to suggest that this polygenic resistance is conferred by a single major gene along
with additional minor genes. This complex control mechanism is probably the reason why
there is no widespread loss of field performance by prochloraz to date despite shifts in
sensitivity. Sexual reproduction within fungal populations can markedly increase the level of
resistance in the progeny and increase the likelihood of reduced efficacy. However, as the
sexual state of Verticillium has not been encountered so far, the risk of increased resistance
due to sexual recombination is reduced.
Fungicide Persistence
Reduced efficacy of fungicides can occur for reasons other than resistance. Benomyl
and carbendazim are both known to be susceptible to microbial degradation in soils
previously exposed to them (Fletcher et al, 1980; Yarden et al. 1990) and this can lead to
reduced control of pathogens which are still sensitive to these fungicides. Biodegradation of
pesticides is an environmentally desirable trait so that toxic chemicals do not accumulate in
the environment such as was the case with DDT. But there has to be a balance between the
time frame within which the chemical is effective against the target pathogen and the ultimate
degradation of the chemical to non-toxic components.
The current widespread practice of buying in ready made “pristine” casing mixes that
have never been treated with fungicides, rather than preparing casing mixes from scratch on
the farm from stored stocks of ingredients, will reduce the opportunity for fungicide
degrading microbial populations to develop. It is a good idea not to mix old and new batches
of casing as old batches that have been stored on the farm can pick up the microbes that
flourish in casing elsewhere on the farm. If fungicides are generally used on the farm then
121
some casing microbes may have acquired the ability to degrade those fungicides and may be
present in the background microbial population on the farm.
Recent research has shown that prochloraz too can be degraded by microbes present in
prochloraz-treated casing (Papadopulos, 2006). When the fungicide is applied to casing under
laboratory conditions, the concentration of prochloraz remains reasonably high with
approximately 50% of what was applied being still present by day 40 (Figure 1-A).
However, under normal growing conditions on a mushroom unit, there was a rapid
decline in the concentration of the active ingredient with less than 15% remaining by day 45
(Figure 1-B). This is likely to lead to reduced efficacy late in the crop cycle but further work
is required to determine if this is the case.
A. Laboratory scale B. Mushroom unit

25 240
mg Prochloraz kg-1
20 g Sporgon 100 m-2

180
15
120
10
60
5
0 0
0 10 20 30 40 50 0 10 20 30 40 50
Days after casing Days after casing
Figure 1. Recovery of prochloraz from mushroom casing treated with Sporgon

(46% a.i.) under (A) laboratory scale conditions and (B) on a mushroom unit
following two applications of prochloraz.
Laboratory scale plots received 15 mg prochloraz per kg casing and mushroom unit plots
received 120 g Sporgon per 100 m2 on day 3 and day 21 (From Papadopulos, 2006).
The fact that, under laboratory conditions, fresh casing treated with prochloraz
retained more prochloraz compared to similar casing treated with prochloraz on a mushroom
unit indicated that the casing itself was not necessarily the source of the prochloraz degrading
microbes. Further research by Papadopulos (2006) indicated that 14C-labelled prochloraz was
degraded much more rapidly in the presence of residual liquid from a fungicide spray tank
compared with fresh casing indicating that the source of prochloraz-degrading microbes in
casing may be the tank used to apply the chemical (Figure 2).
This result would suggest that it is important to clean and disinfect spray tanks, pumps
and hoses between fungicide applications, particularly if the spray tank is not used for other
operations such as watering or applying other products. However, a survey of fungicide spray
tanks indicated that prochloraz degrading populations were still detected in tanks used for
applying sodium hypochlorite (Sites 2 and 4, Figure 3), despite the fact that it has bactericidal
activity.
As prochloraz remains one of the few chemicals available to control fungal diseases of
mushrooms it is important that we maximise its efficacy through good farm management
practices. This is all the more important if more aggressive strains of Verticillium emerge.
122
3500
LSD = 906 Fungicide spray tank liquid
3000
CO2 (Counts per minute)
2500 3rd flush casing, prochloraz

treated
2000
3rd flush casing, untreated
1500
Fresh Casing
1000
14
500 Control
0
0 7 14 21 28 35 42
Time (days)
Figure 2. 14CO2 evolution from respirometer units containing 14C labelled prochloraz
and inoculated with different substrates containing micro-organisms (Adapted from
Papadopoulos, 2006).
Emerging New Pathogens
Mushroom pathogens have evolved alongside mushrooms, originally in the wild, and
have successfully migrated to wherever mushrooms are cultivated commercially. Fungal
pathogens such as Verticillium, Mycogone, Cobweb and Trichoderma are known since the
early days of commercial production (Kligman, 1950). Compost-related pathogens and weed
moulds have also found a niche in commercial mushroom compost such as Truffle, Olive
green mould and Plaster moulds. With improvements in technology, hygiene and grower
understanding of diseases and how they spread, many of these diseases, particularly compost
related ones, are no longer problematical. However, nature is a dynamic force and, as
mushroom compost improves and mushroom growing becomes more hygienic and precisely
controlled, new pathogens have emerged that have overcome some of the obstacles in their
way or become adapted to new conditions such as more productive compost, bulk handling
of vulnerable Phase 3 compost or wetter growing conditions. A key question is often “where
did the new pathogen come from?” but this question is often difficult to answer. “New”
pathogens may be present at low levels within the existing pathogen population or they may
be a recently mutated form that confers an advantage, such as fungicide resistance. Table 1
lists a number of new pathogens or new strains of existing pathogens which have been
reported since 1950.
La France virus disease was probably the first major new pathogen which affected
mushroom cultivation, impacting severely on the mushroom industry in the USA and UK in
the 1960’s. Epidemiological research indicated that it was predominately spread by spores
from infected mushrooms and also by infected mycelium carried over from one crop to the
next (Schisler et al. 1967). Control was achieved by preventing the spread of spores by
filtration and not growing flat mushrooms and by cooking out crops at the end of the cycle.
123
70 Site 1
60 Site 2
Site 3
50 Site 4
C-CO2 Bq
40 Site 5
Site 6
30 Site 7
14
20 Site 8
Site 9
10 Site 10
0 control
0 7 14 21 28
Days
14
Figure 3. CO2 evolution from respirometer units containing 14C labelled
prochloraz and inoculated with 1 ml of liquid taken from fungicide spray tanks
at 10 different mushroom farm locations (Adapted from Papadopoulos, 2006).
Table 1. Some new mushroom pathogens or pathogen strains reported since 1950.
Pathogen First reported Reference

La France Virus 1948 USA Sinden & Hauser (1950)
Pythium artotrogus 1960 USA Fergus et al. (1963)
Pythium oligandrum 1986 UK Fletcher et al. (1990)
Trichoderma aggressivum var 1984 Ireland Morris et al. (1995)
europaeum
Trichoderma aggressivum var 1990 Canada Rinker & Alm (2000)
aggressivum
Cladobotryum mycophilum Type II 1992 Ireland McKay et al. (1999)
Mushroom Virus X 1996 UK Gaze et al. (2000)
Although Trichoderma species such as T. koningii and T. viride were long associated
with mushroom cultivation, their impact on production was relatively minor. In the mid-
1980’s and 1990’s, Trichoderma aggressivum emerged as an aggressive compost mould that
decimated mushroom production if it got into freshly spawned Phase II compost. It had a
higher temperature optimum than other Trichoderma spp. and grew rapidly on the
carbohydrates in the grain supporting the mushroom spawn. Once T. aggressivum
encountered mushroom cultivation facilities, it found a niche ideally suited to its
characteristics: it is a successful fungus producing enzymes capable of growing on
carbohydrate-rich substrates with a fast growth rate and temperature optimum close to that of
Agaricus. Poor hygiene at Phase 2 emptying and/or spawning either through ineffective
disinfection of equipment or through the ingress of contaminated air into spawning halls is the
likely route of entry into a crop or Phase 3 tunnel. Initially, benzimidazole fungicides applied
to the spawn gave good control of the problem but in the USA resistance has now emerged
leaving improved hygiene as the only option to control this pathogen (Romaine et al. 2005).
Fungicide resistance appears to have been the trigger for the emergence of another
new pathogen in the 1990s. Up until then, Cladobotryum dendroides was an occasional
124
pathogen of crops, usually late in the cycle, but in the 1990’s serious cobweb epidemics
started to occur, first in Europe then later, further afield in Australia and USA. Close
examination of the organisms associated with the epidemics revealed that C. dendroides was
not the major cause but a fungicide-resistant strain of C. mycophilum (McKay et al. 1999).
Although benzimidazole-sensitive C. mycophilum was also occasionally recorded from
diseased crops, the bulk of the problems were associated with benzimidazole-resistant
isolates. These appeared to differ in many respects to the normal C. mycophilum in having a
faster growth rate, more profuse and earlier sporulation, no distinct odour and spores which
were regularly two , three and four-celled rather than the two celled spores characteristic of C.
mycophilum (Adie, 2000; Grogan & Gaze, 2000). The widespread use of benzimidazole
fungicides to control cobweb and other diseases would have facilitated the emergence of a
resistant strain. The shift at this time to using wetter casings, made from freshly harvested
deep-dug peats, would have provided an ideal moist environment for cobweb spores to
germinate. Epidemiological research indicated that the disease was spread very rapidly
through mushroom houses when sporulating areas of disease were disturbed by watering or
when applying salt to kill it. Control can be achieved however by carefully covering diseased
areas with damp paper towel prior to salting so as to prevent spores from entering the air
stream (Adie et al. 2006).
Mushroom Virus X (MVX) is an enigmatic disease which emerged in the late 1990’s
causing crop delay, pinning disruption, poor quality and occasionally brown or off-coloured
mushrooms. The symptoms were consistently associated with a variable number of viral
dsRNAs (Gaze et al. 2000). It is proving difficult and time consuming to characterise the
exact aetiology of MVX-associated cropping problems; however the symptoms are
transmitted in conjunction with MVX dsRNAs (Grogan et al. 2005). MVX is unlike La
France virus in that La France is most problematical when virus infected spores or mycelium
infect the crop at spawning and is less problematical if infection takes place later. In contrast,
epidemiological research indicates that MVX infected mycelium can cause severe effects
when minute quantities of infected mycelium are introduced at either spawning or casing.
Further experiments indicate that the expression of the brown mushroom symptom most often
occurs when infection takes place within a narrow window of opportunity. Early infection of a
crop often produces no brown mushroom symptoms whereas infection of a crop at casing
time produces the brown symptomatic mushrooms more consistently. This suggests a
complex interaction between the infective agent (dsRNAs?) and the actively differentiating
tissue within the mushroom cap. The absence of symptomatic mushrooms in an “infected”
crop means that ultimate control of the problem may be compromised as growers will be
unaware that there is a potential problem on the farm. MVX was brought under control in
Britain through improvements in farm hygiene aimed at preventing the contamination of
crops with potentially infected spores and mycelial debris at spawning or casing. In Ireland,
however, the brown mushroom symptom still persists and the transient nature of its
expression indicates that there is still a reservoir of infective material within the industry.
Recent research from France (Largeteau & Savoie, 2008) indicates that some
Verticillium fungicola var. fungicola isolates in Europe are more aggressive than others.
However V. fungicola var aleophilum from USA appears to be more aggressive than
European isolates (Largeteau et al. 2004). A V. fungicola isolate identified in Mexico in 2002
appears to be var. fungicola, like European isolates, and the authors raise the question about
the possibility of it having been introduced into Mexico on machinery originating in Europe.
The spread of pathogens from one continent to another through imported goods and
machinery is not new but as international trade increases, it increases the risk of unwanted
introductions of pathogens. Recently, a highly aggressive Verticillium isolate has been
isolated in Australia that does not appear to be controlled by prochloraz (A. Clift, pers.
comm.). It remains to be seen if more aggressive Verticillium isolates become more
125
widespread in the mushroom growing world. In the absence of an effective fungicide to
control an aggressive Verticillium strain, more care will be needed in identifying initial
outbreaks of the disease and dealing with them quickly before any watering is done.
Verticillium spores are readily dispersed in water and are spread by water splash onto the
surrounding casing, structures and growing room floors. Contaminated floor debris will
become integrated into the dust fraction on the farm and will be liable to spread further by
wind and air movements. Power washing dirty areas near casing storage areas or when casing
is in operation will facilitate the spread of contaminated debris in the fine mist generated by
power washing. Thus, water use needs to be critically evaluated when severe outbreaks of
Verticillium occur.
Conclusions
As the mushroom industry is faced with having fewer chemicals to control disease
outbreaks, and with new and evolving pathogens emerging, growers will be increasingly
reliant on rapid identification and containment of disease outbreaks as the first line of defence.
Epidemiological research produced by mushroom scientists around the world will be
invaluable as a source of information on the best way specific pathogens are spread and
transmitted around a farm. Ultimately, excellent hygiene standards (disinfection, cook-out,
foot-dips, door-seals, filters, fly-control) will be required across the board, every day, every
crop, to prevent a build-up of pathogen propagules around the farm. New chemicals will be
few and far between, given the rigorous costs and requirements for registering new products
and the increasing consumer- and retailer-driven demands for reduced pesticide use.
Biological control products are likely to be more acceptable but may not be as effective as
traditional chemicals. Collaborative research projects between the major mushroom producing
countries may be a way forward to identify and register any products that appear to offer
some benefit. The recently formed International Mushroom Diagnostic group aims to share
knowledge on mushroom disease diagnostics and this group is an excellent forum to progress
international collaborative projects and to disseminate knowledge.
References.
Adie BAT. 2000. The biology and epidemiology of Cobweb disease pathogen (Cladobotryum
spp. infecting the cultivated mushroom (Agaricus bisporus). Ph.D. Thesis, Imperial
College, University of London, UK.
Adie BAT, Grogan H, Archer S, Mills P. 2006. Temporal and spatial dispersal of
Cladobotryum conidia in the controlled environment of a mushroom growing room. Appl.
Environ. Microbiol., 72, 7212-7217.
Dyer PS, Hansen J, Delaney A, Lucas JA. 2000. Genetic control of resistance to the sterol
14a-demethylase inhibitor fungicide prochloraz in the cereal eyespot pathogen Tapesia
yallundae. Appl. Environ. Microbiol., 66, 4599-4604.
Fergus CL, Sinden JW, Schisler LC, Sigel EM. 1963. Possible detrimental effect of Pythium
artotrogos on the cultivated mushroom. Phytopathology, 53, 1360-1362.
Fletcher JT, Yarham DJ. 1976. The incidence of benomyl tolerance in Verticillium fungicola,
Mycogone perniciosa and Hypomyces rosellus in mushroom crops. Ann. Appl. Biol., 84,
343-353.
Fletcher JT, Connolly G, Mountfield EI, Jacobs L. 1980. The disappearance of benomyl from
mushroom casing. Ann. Appl. Biol., 95, 73-82.
Fletcher JT, Smewin BJ, O’Brien A. 1990. Pythium oligandrum associated with a cropping
disorder of Agaricus bisporus. Plant Pathology, 39, 603-605.
126
Gaze RH, Calvo-Bado L, Challen MP, Adie BAT, Romaine CP. 2000. A new virus disease of
Agaricus bisporus? Mush. Sci. XV, 701-705.
Gea FJ, Navarro MJ, Tello JC. 2005. Reduced sensitivity of the mushroom pathogen
Verticillium fungicola to prochloraz-manganese in vitro. Mycol. Res., 109, 741-745.
Grogan HM. 2008. Changes and challenges for the Irish mushroom industry. Mushroom
Business, 28, 22-23.
Grogan HM, Gaze RH. 2000. Fungicide resistance among Cladobotryum spp. – causal agents
of cobweb disease of the edible mushroom Agaricus bisporus. Mycol. Res., 104, 357-364.
Grogan HM, Keeling C, Jukes AA. 2000. In vivo response of the mushroom pathogen
Verticillium fungicola (dry bubble) to prochloraz-manganese. Proceedings Brighton Crop
Protection Conference - Pests and Diseases 2000, pp273-278.
Grogan HM, Gaze RH, Holcroft S. 2005. Viral dsRNAs in Agaricus bisporus: Transmission,
symptom expression and control. Acta Edulis Fungi, 12, 363-367.
Kligman AM. 1950. Handbook of Mushroom Culture. 2nd Edition. J.B. Swayne, Publisher,
Kennet Square, PA, USA.
Largeteau M, Mata G, Savoie JM. 2004. Verticillium fungicola v fungicola affects Agaricus
bisporus cultivation in Mexico. FEMS Microbiol. Lett., 236, 191-196.
Largeteau M, Savoie JM. 2008. Effect of the fungal pathogen Verticillium fungicola on
fruiting initiation of its host, Agaricus bisporus. Mycol. Res., 112, In press.
McKay GJ, Egan D, Morris E, Scott C, Brown AE. 1999. Genetic and morphological
characterization of Cladobotryum species causing Cobweb disease of mushrooms. Appl.
Environ. Microbiol., 65, 606-610.
Morris E, Doyle O, Clancy KJ. 1995. A profile of Trichoderma species. Mushroom compost
production. Mush. Sci. XVI, 611-618.
Papadopoulos G. 2006. The fate of prochloraz in mushroom casing. Ph.D. Thesis, University
of Reading, UK.
Rinker DL, Alm G. 2000. Management of green mould disease in Canada. Mush. Sci. XV,
617-623.
Romaine CP, Royse DJ, Schlagnhaufer. 2005. Superpathogenic Trichoderma resistant to
TopsinM found in Pennsylvania and Delaware. Mush. News, 53, 6-9.
Schisler LC, Sinden JW, Sigel EM. 1967. Etiology, symptomology and epidemiology of a
virus disease of cultivated mushrooms. Phytopathology, 57, 519-526.
Sinden JW, Hauser E. 1950. Report on two new mushroom diseases. Mush. Sci. I, 96-100.
Yarden O, Salomon R, Katan J, Aharonson N. 1990. Involvement of fungi and bacteria in
enhanced and nonenhanhanced biodegradation of carbendazim and other benzimidazole
compounds in soil. Can. J. Microbiol., 36, 15-23.
127
Spotting and Discoloration of the Cultivated Mushroom, Agaricus bisporus:

Some Issues to Consider
D.L. Rinker1, J. Dano2, D. Sivanesan2, C. Dobbin2, H. Mathani2, G. Alm1, J. Cline1, and

A. Castle3
1
University of Guelph, 4890 Victoria Avenue, P.O. Box 7000, Vineland Station, ON, Canada
L0R 2E0; 2Former student; 3Brock University, 500 Glenridge Avenue, St Catharines, ON,
Canada L2S 3A1. DRinker@UoGuelph.ca
Abstract
Mushroom producers strive to achieve perfectly looking mushrooms for fresh market.
However, diseases and horticultural anomalies can dramatically affect pre- and post-harvest
mushroom quality. Species, biotype and concentration - all affect disease symptom
expression. Among four Trichoderma species (T. atroviride, harzianum, koningii and viride)
inoculated on mushrooms at difference concentrations, symptom development was earlier and
most severe for T. harzianum and least severe for T. koningii. The majority of symptoms
occurred after harvest (four days after inoculation). In a survey of bacterial blotch on
mushroom farms, there were at least five genetic groups that caused blotch symptoms on
mushrooms. Symptoms caused by Pseudomonas isolates varied from dark brown, brown and
yellow. The desirable casing pH is neutral, adjusted with lime. Reducing the amount of lime
in the ‘normal’ 1:1ratio (wt:wt) of lime to peat in the casing mix increased the incidence of
blotch and decreased the ‘whiteness’ of the mushroom.
Key Words: Agaricus bisporus; Spotting and discoloration; Trichoderma spp; Bacterial
blotch; Pseudomonas
Introduction
Mushroom consumers are discriminating as to the quality of the product they

purchase. They desire mushrooms free of soil, if a white mushroom very white and gills
unexposed, a firm texture and unblemished (Eastwood & Burton, 2002). The mushroom
producer attempts to provide its customers with the perfectly looking mushroom. Mushrooms
can often during the cultivation process become spotted by diseases that include wet bubble
(Mycogone perniciosa, M. rosea), dry bubble (Verticillium fungicola), cob web
(Cladobotryum dendroides), Aphanochadium cap spotting (Aphanochadium abum, A.
aranearum var sinense, A. dimorphum), Hormiactis cap spot (Hormiactis alba), Gliocladium
diseases (Gliocladium virens, G. deliquescens) or Trichoderma diseases (Trichoderma
aggressivum, T. koningii, T. viride, T. atroviride, T. harzianum, T. pseudokoningii) or
bacterial blotch (Pseudomonas tolaasii, P. gingeri) (Fletcher & Gaze, 2008).
This paper is a synopsis of some of our research on spotting diseases caused by
Trichoderma and Pseudomonas species on the cultivated mushroom, Agaricus bisporus.
Methods
Trichoderma species causing cap spotting

Four species of Trichoderma were inoculated onto mushrooms in order to ascertain
symptom expression, time to symptom development, and influence of concentration on both.
There were two sets of experiments: one with Trichoderma atroviride and the other set with
T. harzianum, T. koningii and T. viride.
128
Preparation of inoculum
Four Trichoderma species (T. atroviride, harzianum, koningii and viride; University
of Guelph culture no.1550, 2876, 2906 and 2662, respectively) were cultured on malt agar for
12 to 14 d. Spores were harvested by flooding each plate with 6 mL of Tween 80 solution
(750 µL in 500 mL distilled water), scraping the agar surface with a glass rod and filtering it
through cheese cloth.
An aliquot of the each stock solution was diluted with the Tween solution to make a
th
200 dilution spore suspension. The number of spores in the dilution mixture was determined
with a haemacytometer. The spore suspension was adjusted to contain the desired spore
concentration in 5 µL, the concentration volume applied to the mushroom cap. The spore
concentration in each solution was confirmed using serial dilutions.
Trichoderma atroviride
Off-white hybrid mushrooms (0.5-1 cm diam.) from a mushroom crop at the
Mushroom Research Facility (University of Guelph-Vineland Campus, Vineland Station,
Ontario) were inoculated in the centre of the pileus with 5 µL of Tween 80-spore suspension.
The surface (0.25 m2) of each of three trays was divided into quarters. Ten mushrooms were
inoculated in situ with 0 (Tween solution), approximately 10, 1000 or 10000 spores of T.
atroviride in each quarter. Both first and second break mushrooms were inoculated in this
manner. Trays used for first break were not used for second break.
The inoculated trays were arranged in a randomized complete block design (RCBD).
The quarters were randomized on each tray and the mushrooms randomized within each
quarter. Healthy mushrooms were removed from each tray daily. The entire experiment was
repeated.
Mushrooms were evaluated daily in situ by noting if there was pitting (depression) or
brown discoloration. Three days after inoculation, these ten mushrooms were harvested. The
stipe was cut close to the pileus, and the pileus was placed surface up into a small plastic tray
which was covered with plastic wrap (first break) or an inverted plastic tray (second break).
The mushrooms were then stored in the same room (18 OC) where the crop was being
harvested and they were observed daily for the next three days.
Trichoderma harzianum, T. koningii and T. viride

Mushrooms were inoculated in a manner similar to T. atroviride. The surface of each
of twelve trays was divided into three sections, one for each Trichoderma species, T. koningii,
T. harzianum or T. viride. One tray was used for one concentration. Ten randomly chosen
mushrooms in each section were inoculated in situ with approximately, 10, 100 or 1000
spores of one of the Trichoderma species. Mushrooms used as controls (Tween solution only)
were randomly selected across each section. Each concentration-Trichoderma species was
replicated four times. The experiment was conducted for both breaks 1 and 2; and the
experiment was repeated. Trays used for first break were not used for second break.
The treatments were arranged in a factorial experiment as a split-plot design.
Concentration was the whole plot effect and Trichoderma species were the subplot effect. The
whole plot design was a randomized complete block design of four blocks (each block
consisting of three trays) with each tray divided into three sections to accommodate three
species at one inoculation concentration. Mushrooms were evaluated as per T. atroviride.
Pseudomonas biovars causing cap spotting

Blemished mushrooms were collected from six provinces in Canada. From these
mushrooms 170 isolates were tested for pathogenicity by the Wong and Preece (1979)
mushroom rapid pitting test on freshly harvested mushrooms. Biochemically, a selection of
eighty-three isolates were identified to species using a procedure adapted from Sorensen et al.
(1992). Digested protein samples (Sorensen et al. 1992) were separated using sodium dodecyl
129
sulphate polyacrylamide gel electrophoresis (SDS-PAGE) (Sivanesan, 2003). A dendrogram
was developed through fragment length polymorphism (AFLP) analysis and neighbor joining
analysis on fifty isolates identified as Pseudomonas species.
A problematic Pseudomonas strain (isolate 57) from a mushroom farm was inoculated
onto 150 (50 per break) mushroom pilei at 101, 103, 105, 107 or 109 cfu three days before
harvest. Post-harvest the mushrooms were maintained at 8 OC. In addition, the same isolate
57 was compared on the same pilei to ATCC type culture collections numbers (P. tolaasii
ATCC 33618 and ATCC 51309; P. ‘reactans’ ATCC 14340 and 51314) using 30 mushrooms
for each comparison at three concentrations (101, 103 and 105 cfu) under the same protocols as
the initial experiment. In both experiments, each rate was replicated three times in RCBD
(Dobbin, 2001).
Lime in casing and influence on mushroom spotting

Mushroom casing material in Canada may be a mixture of dry, bagged sphagnum peat
moss and agricultural lime (CaCO3), mixed in a ratio of 1:1 (by weight of commercial
product) (Rinker, 1993). The proportion of lime to sphagnum peat moss was altered to
provide ratios of 0, 0.125, 0.25, 0.50, 1 and 2 to 1 (wt:wt). The same amount of water was
added to each blend of lime and peat. Each rate was replicated six times in a RCBD. Three
replicates were used for yield and colorimetric analysis and for the remaining three replicates
the casing material was removed periodically through the case-run and cropping periods for
pH and moisture determinations on day-0 (day of casing ), day-3 (except pH), -6, -14, -21, -27
and -35.
At the peak of first, second and third breaks, the mushroom surface colour (CIE 1976
(L*, a*, b*) color space), was recorded from the pileus of 20 mushrooms per experimental
unit, using a tri-stimulus colorimeter (Minolta CR-300, Minolta Corp., Toronto, Ontario). The
instrument used C illuminant, a 11 mm viewing aperture and was calibrated using a near-
white calibration plate (No. 2153303, L*=97.5, a*=-0.02, b*=1.72, Minolta Corp.). After data
acquisition, hue angle (h°) and Chroma C*, an index somewhat analogous to color
saturation or intensity (Hunter, 1942; Little, 1975), was calculated according to methods
published by McGuire (1992). Hue angle (h°), which represents the colour hue (amount
of blue, green, red, yellow components) was calculated from the arctangent of b*/a*.
Fisher’s protected analysis of variance using PROC GLM (SAS, SAS Institute, Inc.,
Cary, NC) was conducted on the measured and calculated parameters. Mean separation was
performed using Least Significant Difference at the p=0.05.
Trichoderma species causing cap spotting

All four Trichoderma species caused spotting on the mushroom pilei. Mushrooms
infected with Trichoderma atroviride developed dark brown and sunken spots; T. harzianum,
a brown cast over the entire mushroom surface; T. koningii, spotting and a light brown cast;
and T. viride, a freckle-like appearance over the mushroom cap surface. Fletcher & Gaze
(2008) further illustrate that symptom expression varies with the species.
The higher the concentration the sooner the symptoms developed. For example, T.
atroviride spotting developed with 24 hours when 10000 spores were applied (Mithani, 1999).
At concentrations of 1000, spotting did not develop until the day-3 (day of harvest) for any of
the four species. At concentrations of 10 or 100, symptoms were generally visible by day-4
with all species (Table 1).
Time to development, severity and appearance varied with break. Symptoms were
sooner to develop on second break mushrooms and/or were more severe (Table 1).
Trichoderma koningii dramatically illustrates the different response between breaks. In first
break for both experiments, there were little to no spotting symptoms for 10 or 100 spores.
130
However, second break symptoms were visible on day-4 and became quite severe by day-6
(Table 1). In contrast, Trichoderma harzianum had the most striking difference in appearance
Table 1. Percentage spotting response over six days on the pileus of

Agaricus bisporus to different concentrations of Trichoderma species.
Trichoderma atroviride
Break Concentration day1 day2 day3 day4 day5 day 6
1 10 0 0 0 0 0 0.088
1 1000 0 0 0 0.032 0.453 0.733
1 10000* 0.129 0.143 0.227 0.687 0.886 0.864
2 10 0 0 0 0.09 0.281 0.236
2 1000 0 0 0.059 0.292 0.548 0.435
2 10000 0.016 0.281 0.677 0.796 0.776 0.588
Trichoderma harzianum
1 10 0 0 0 30 75 95
1 100 0 0 0 43.75 93.75 96.25
1 1000 0 0 15 82.5 95 95
2 10 0 0 1.25 52.5 81.25 86.25
2 100 0 0 33.75 82.5 93.75 88.75
2 1000 0 0 56.25 93.75 96.25 96.25
Trichoderma koningii
1 10 0 0 0 0 1.25 1.25
1 100 0 0 0 0 0 8.75
1 1000 0 0 0 8.75 16.25 42.5
2 10 0 0 0 15 31.25 72.5
2 100 0 0 0 16.25 55 78.75
2 1000 0 0 25 55 75 76.25
Trichoderma viride
1 10 0 0 0 0 10 33.75
1 100 0 0 0 11.25 60 78.75
1 1000 0 0 0 43.75 80 92.5
2 10 0 0 0 2.5 73.75 86.25
2 100 0 0 0 60 87.5 88.75
2 1000 0 0 0 95 93.75 97.5
Disease propagules were applied in 5 µL of water to a single location three days before harvest. After
harvest, mushrooms were stored in same room as cultivated. Values are means of repeated
experiments.
*
Concentrations were higher for T. atroviride only.
between breaks. At 1000 spores on day-3 first break disease symptoms had a light brown/tan
mottle appearance. Twenty-four hours later there was ‘cobweb’ hairy appearance across the
entire cap surface and by day-6 the cobweb appearance was replaced with a corrugated
puckered appearance. However, second break mushrooms had a lighter tan/creamy colour
with no ‘cobweb’ development (Dano, 2000). The mushroom percentage dry weights were
slightly higher by 1.2 to 1.5% for first break mushrooms (data not shown).
Time to development and severity varied with species. Generally, T. koningii was the
slowest to develop symptoms followed by T. viride, T. atroviride and T. harzianum (Table 1).
Of the three (T. harzianum, koningii and viride) grown on culture in the same room as the
experiment, T. koningii spores germinated more slowly (in about 54 hours) compared to the
131
other two that germinated in about 48 hours. The most severely infected cap surface in terms
of surface area was T. harzianum, followed by T. viride and then T. koningii.
Pseudomonas biovars causing cap spotting

Seventy percent of the 170 isolates evaluated produced yellow, brown or dark brown
symptoms. A subset (83) of those isolates causing visible blotch and no visible blotch using
the mushroom rapid pitting test were classified biochemically. Fifty-two percent of the subset
was Pseudomonas fluorescens, according to Sorenson et al. (1992) (Table 2). Among these P.
fluorescens, 47% were biovar III, 33% biovar V, 2% biovar II and 2% biovar I. Sixteen
percent were only identified to P. fluorescens. Among any P. fluorescens 79% caused blotch
on mushrooms. Of the remaining subset isolates, yet not fitting into the Sorenson et al. (1992)
groupings, 50% caused blotch symptoms.
Table 2. Biochemical and SDS-PAGE analysis of bacteria from blotched mushrooms

collected across Canada
Identification (Species/Genus) Biovar Blotch Non-blotch Total
Pseudomonas fluorescens III 13 7 20

Group A peptide profile V 14 0 14
(presence of <14, 16,18 & 45 kDa) II 1 0 1
I 1 0 1
- 5 2 7
Subtotal P. fluorescens 34 9 43
Pseudomonas sp. - 11 5 16
P.syringae - 0 1 1
Subtotal Pseudomonas 45 15 60
Unknown - 9 12 23
Total # isolates 54 28 83
Representatives from the non-Pseudomonas blotch causing group, identified from the
SDS-PAGE analysis, were identified by the Laboratory Services Division of the University of
Guelph using fatty acid analysis. Two new species were tentatively identified as Serratia
liquefaciens and Cedecea devisae. Furthermore, using this technique the type culture
collection (ATCC 33618; P. tolaasii) was identified only as fluorescens. Additionally, one
isolate identified as P. fluorescens biovar III was designated P. putida biotype A by fatty acid
analysis (Table 3).
Table 3. Microbial identification results using fatty acid analysis
Isolate Identification used in the thesis Fatty acid analysis SIa

P.tolaasii (ATCC33618) P.fluorescens V P. fluorescens 0.881
h12 P.fluorescens III P.putida biotype A 0.905
adbbpM4x Pseudomonas sp. P.fluorescens 0.889
PEI7 Group B peptide profile Serratia liquefaciens 0.681
A13 Group B peptide profile Cedecea devisae 0.397
A7 Group B peptide profile Cedecea devisae 0.622
Fatty acid analyses were carried out at the University of Guelph. Group B peptide profile
corresponds to SDS-PAGE of proteinase K digested cell soluble protein profiles lacking the
16 kDa peptide. aSI (Similarity index) of 0.6-1.0 is an excellent match; SI value between 0.3-
132
0.6 is match that is very likely to be accurate and SI less than 0.3 is not found in the database
but related. SI value of less than 0.1 indicates that there is some similarity of the fatty acid
composition to the matched species but an alternative method should be used for
identification of that organism.
A dendogram including information on 46 isolate, 35 which caused blotch and 11
which did not, along with four ATCC strains and outgroup strain, h4yel, is presented in
Figure 1. At least five major groups are indicated by branch points B, J, K, I and E, along with
minor groupings given as groups, L, M, N, O, F and G.
Several points are noteworthy. First, non-pathogenic isolates are interspersed with
blotch causing strains. This pattern is suggestive of relatively frequent loss of pathogenicity.
Second, the four ATCC strains formed a distinct cluster from the other isolates. This result
indicates that there may be much more diversity of blotch causing organisms than initially
thought. It should be of interest to mushroom growers and researchers alike to determine if
current control measures for bacterial blotch are effective against all of these groups.
Isolate 57 was isolated from a mushroom farm that had repeated product returns from
its customers. However, no visible symptoms were present in the production room. This
isolate was identified as P. fluorescens V, (Sivanesan, 2003) according to Sorensen et al.
(1992) and according to AFLP analysis was distinctive from the ATCC type cultures. Pre-
harvest symptoms (days 1 to 3) developed at concentrations greater than 105 cfu but no
symptoms appeared within the first three days after inoculation at 101, 103 and 105 cfu. At 101
cfu symptoms appeared in six or seven days after harvest (nine or ten days after inoculation);
103 cfu, 7 days after harvest; and 105 cfu, one day after harvest. Of the total 450 mushrooms
inoculated with 105 cfu or less only 36% demonstrated any post-harvest symptoms.
Side-by-side comparison between isolate 57 and ATCC type cultures demonstrated
that isolate 57 was pathogenic at concentrations lower than the ATCC type cultures by
producing post-harvest symptoms at 101 and 103. ATCC P. ‘reactans’ produced no
symptoms; whereas, ATCC P. tolaasii produced post-harvest symptoms at 105 cfu.
Differences among bacteria causing blotch disease symptoms have been reported
additionally by Wells et al. (1996) in the USA and Godfrey et al. (2001) in New Zealand.
There is considerable diversity among the organisms responsible for the ‘same’ blotch-like
symptom recognized by growers. Although the symptoms may be similar, expression occurs
at lower concentrations than the classical blotch, concluding that the management may not be
the same.
Lime in casing and influence on mushroom spotting

Moisture
The moisture level of each casing type remained fairly stable over the 35 days of case
run and crop production. The calculated moisture of the casing was inversely ranked to the
amount of lime present in the peat moss (Table 4). However, the differences in moisture
between the lime rates are a function of the increased amount of lime and not due to a
difference in true moisture levels since all casings were given the same amount of moisture at
the beginning and throughout the experiment.
The pH values for any lime addition ranged between 7 and 8 and remained fairly close to the
initial value for the entire crop duration of 35 days (Table 4).
Spottings
Mushrooms were heavily spotted in treatments with 0.50 or less than the
recommended lime rate (RML) (Table 5). Isolations of the spots on those casings with less
than RML revealed that the isolations were bacteria, mostly fluorescent with no fungi present.
However, in the 0-lime treatment the majority of the isolations were caused by fungi in the
genus Trichoderma.
Decreasing the amount of lime in the casing significantly increased the percentage of
bacterial spotted mushrooms (Table 5). On casing with 0.125 of RLM 87% of the mushrooms
133
were spotted with bacteria. An increase in the rate only to 0.25 significantly lowered the
evidence of spots to about 26%. Although there was a slight decrease in spotting with 0.50, it
was not significant. Increasing the rate to the recommended (1:1) or doubling it, further
significantly lowered incidence of spotting to between 8 and 10%.
Figure 1. Dendogram of bacterial isolates.

(White, no blotch; black = dark brown blotch; light grey, yellow blotch; between light grey
and black, brown blotch)
134
Table 4. Moisture and pH of peat moss and lime casing mixture over 35 days of case
run and crop production.
Days after casing

Fraction of lime to 1
0 3 6 14 21 27 35
part peat moss
pH
0 3.6 . 4.09 4.11 4.3 4.31 4.53
0.125 7.04 . 7.55 7.08 7.13 7.06 7.06
0.25 7.29 . 7.63 7.51 7.4 7.3 7.42
0.50 7.4 . 7.77 7.66 7.48 7.47 7.37
1 7.5 . 7.76 7.8 7.76 7.49 7.71
2 7.57 . 7.79 7.87 7.91 7.57 7.83
Percent moisture
0 85.80 87.73 87.17 88.83 88.10 87.40 85.83
0.125 83.90 86.27 85.53 86.17 82.30 82.37 81.23
0.25 81.90 82.60 82.57 84.53 80.97 79.90 78.73
0.50 76.80 78.07 78.03 78.87 74.13 74.90 72.07
1 69.50 70.40 71.70 70.00 66.50 64.13 62.00
2 58.10 59.13 59.67 59.50 53.03 57.60 53.80
Table 5. Mean fraction of total Agarcius bisporus mushrooms with any spotting or total
mushroom yield (kg/m2) as a function of various fractions of lime (CaCO3) added to the
peat moss casing as a proportion of the peat moss.
LIME Mean fraction of mushrooms with spots Total yield (spotted and non-spotted)
0 0.73093by 12.031c
0.125 0.86661a 30.954b
0.25 0.25868c 31.601b
0.5 0.21346c 34.714a
1 0.07953d 33.266ab
2 0.09741d 34.576a
y
Means with the same letter in the same column are not significantly different at P=0.05 according to
Fisher’s LSD.
Yield
Mushrooms were harvested for 17 days. Total mushroom yield, including spotted
mushrooms decreased with decreased amount of lime. With no lime the total yield was about
1/3 of the greatest yield and significantly less than any lime treatment. There was no
significant difference in mushroom yield for rates 0.50, 1 and 2. However, rates 0.50 and 2
were significantly higher than 0.125 or 0.25. There was no significant difference in rates
0.125, 0.25 or 1 (Table 5).
135
Colour
Significant treatment differences in the L* colour component was detected in
mushrooms harvested after the first and third break (Table 6). [The L* value indicates
lightness of color, ranging from complete darkness (L = 0) to pure white light (L= 100).]
Mushrooms receiving the recommended lime rate (RLM) were similar in colour to those
receiving the 2x RLM, but whiter than the mushrooms grown in the 0.125, 0.25 or 0.50 RLM
compost. During the second break, a similar trend was observed, but it was not statistically
significant at p=0.05. Mushrooms harvested during the third break where less white from
Table 6. Effect of rate of lime added to sphagnum peat moss casing on mushroom
colour.
Hue
Rate of lime (% Chroma angle
of recommended) L* a b (C*) (Ho)
First Break
0 - - - - -
0.125 90.15 ab 0.10 6.79 6.80 89.33 b
0.25 89.92 b -0.07 6.83 6.84 90.71 a
0.50 89.45 a 0.13 6.65 6.66 89.09 b
1 90.78 b -0.06 6.72 6.74 90.70 a
2 90.64 ab 0.06 6.82 6.83 89.60 ab
Significancez *** ns ns ns *
LSD (p≤0.05) 0.56 0.17 0.23 0.24 1.38
P value <0.001 0.052 0.261 0.284 0.038
Second Break
0 89.13 aby -0.44 c 7.09 7.10 93.60 a
0.125 88.72 b -0.29 a 7.38 7.39 92.53 bc
0.25 89.14 ab -0.40 bc 7.21 7.22 93.24 ab
0.50 89.25 a -0.37 abc 7.14 7.16 93.07 abc
1 89.20 a -0.32 ab 7.07 7.08 92.66 bc
2 89.40 a -0.29 a 7.11 7.13 92.33 c
Significancez ns * ns ns *
LSD (p≤0.05) 0.42 0.10 0.24 0.24 0.76
P value 0.053 0.019 0.106 0.102 0.011
Third Break
0 89.66 a -0.26 a 9.13 a 9.15 a 91.80 c
0.125 85.88 c -0.35 ab 8.52 b 8.53 b 92.29 bc
0.25 87.50 b -0.44 c 8.53 b 8.54 b 93.02 a
0.50 87.26 b -0.46 c 8.28 bc 8.30 bc 93.20 a
1 88.02 b -0.38 bc 7.97 c 7.98 c 92.75 ab
2 87.47 b -0.33 ab 8.03 c 8.04 c 92.38 bc
Significancez *** *** *** *** ***
LSD (p≤0.05) 0.79 0.09 0.24 0.24 0.78
P value <0.001 <0.001 <0.001 <0.001 <0.001
y
Means with the same letter are not significantly different at P=0.05 according to Fisher’s
LSD.
z
Indicates non significant and significant differences at P≤0.05, P≤0.01, and P≤0.1
respectively.
plots receiving the 0.125 RLM followed by the 0.25 to 2 RLM. Treatment differences in
white colour of mushrooms during the third break were greater than the first or second break.
136
Chroma (C*; saturation or vividness of color) and hue angle (h°; the basic tint of color)
are derived from a and b and were calculated as described by McGuire (1992). For useful
interpretation, h° should remain positive between 0° and 360° of the color wheel. As such, a
h° of 0° is red-purple, 90° is yellow, 180° is bluish-green, and 270° is blue (McGuire, 1992).
Treatment differences in C* were observed during the third break only while treatment
differences in the hue angle were observed during all three breaks. In general, higher rates of
lime decreased the colour saturation (C*) during the third break, giving the mushrooms a
duller colour. Treatment effects on hue angle were statistically significant but inconsistent
amongst treatment, likely because of the low colour a* and B* values (data not presented).
During the first break, mushrooms from the 0.25, 1 and 2 RLM had the greatest hue angles.
However, these differences can be considered biologically minor (LSD= 1.4 degrees in Hue at
p=0.05) and likely has little influence on mushroom quality (Table 6).
Conclusion
Mushroom discoloration and the type of blemish are a function of species and
variations within the species. Inoculation studies with Trichoderma and Pseudomonas
indicate that mushrooms may be harvested and shipped before symptoms develop on the
farm. The percentage of mushrooms with blemishes in the market place will be higher than
those recognized at the time of harvest. And although the symptoms may be similar,
expression occurs at lower concentrations, concluding that the management may not be the
same within the species. The proportion of neutralizing agent, too, may influence both the
quality and the amount of bacterial blotch.
Acknowledgments
We thank the Canadian Mushroom Growers' Association and the Agricultural

Adaptation Council Safety Net Research and Development Fund for financial support. And
we are grateful to Money’s Mushroom Farm, Greenwood Mushroom Farm and Sylvan Spawn
Company for supplying materials.
References
Castle A, Sivanesan D, Dobbin C, Rinker DL. 2004. Causal agents of bacterial blotch
on cultivated Agaricus bisporus in Canada. Mush. Sci., XVI, 441-448.
Dano J. 2000. Symptom expression of Trichoderma viridae, T. koningii and T.
harzianum biotype Th1 on sporophore development of Agaricus bisporus. BSc
Honour’s Thesis, Brock University, St Catharines, Ontario, Canada.
Dobbins C. 2001. An unusual postharvest spotting disease of the commercial
mushroom, Agaricus bisporus, caused by a novel pathogen of Pseudomonas tolaasii.
MSc Thesis, Brock University, St Catharines, Ontario, Canada.
Eastwood D, Burton K. 2002. Mushrooms – a matter of choice and spoiling oneself.
Microbiology Today 29(February), 18-19.
Fletcher J, Gaze R. 2008. Mushrooms Pest and Disease Control. Manson Publishing,
London, 192pp.
Godfrey SAC, Harrow SA, Marshall JW, Klena JD. 2001. Characterization by 16 S
rRNA sequence analysis of Pseudomonas causing blotch disease of cultivated
Agaricus bisporus. Appl. Environ. Microbiol., 67, 4316-4323.
Hunter RS. 1942. Phtoelectric tristimulus colorimetery with three filters. NBS Circ. C
249, U.S. Dept. Commerce, Washington, DC.
Little AC. 1975. Off on a tangent. J. Food Sci., 40, 410-411.
McGuire R. 1992. Reporting of objective color measurements. HortScience, 27, 1254-1255.
137
Mithani HA. 1999. Symptom expression of Trichoderma atroviridae on sporophore
development in Agaricus bisporus. BSc Honour’s Thesis, Brock University, St
Catharines, Ontario, Canada.
Rinker DL. 1993. Commercial mushroom production. OMAFA Publication 350,
Guelph, Ontario, Canada, 41pp.
Sivanesan D. 2003. Diversity among bacteria causing blotch disease on the
commercial mushroom, Agaricus bisporus. MSc Thesis, Brock University, St.
Catharines, Ontario, Canada.
Sorensen J, Skouv J, Jorgensen A, Nybroe O. 1992. Rapid identification of
environmental isolates of Pseudomonas aeruginosa, P. fluorescens and P. putida by
SDS-PAGE analysis of whole-cell protein patterns. FEMS Microbiol. Ecol., 101, 41-
50.
Wells JM, Sapers GM, Fett WF, Butterfield JE, Jones JB, Bouzar H, Miller FC. 1996.
Postharvest discoloration of the cultivated mushroom Agaricus bisporus caused by
Pseudomonas tolaasii, P. ‘reactans’, and P. ‘gingeri’. Phytopathology, 86, 1098-
1104.
Wong WC, Preece TF. 1979. Identification of Pseudomonas tolaasii: the white line in
agar and mushroom tissue block rapid pitting tests. J. Appl. Bact., 47, 401-407.
138
Agaricus bisporus Infection by Verticillium fungicola and Incidence on Host

Tissues Colonisation and Genes Expression
M.L. Largeteau, C. Latapy, P. Broca and J.-M. Savoie

INRA, UPR 1264, Mycologie et Sécurité des Aliments, BP 81, F-33883 Villenave d’Ornon,
France. Email: largeteau@bordeaux.inra.fr
Abstract
The button mushroom, Agaricus bisporus (Lange) Imbach is sensitive to various

diseases, especially to dry bubble caused by Verticillium fungicola. The fungal pathogen
developed increasing resistance to the available pesticides. A reduction in the registered
fungicides to manage the disease has prompted a need to understand the interaction between
A. bisporus and V. fungicola with the aim to breed for resistance. The disease is responsible
for various symptoms on its host: bubbles (undifferentiated spherical masses), bent and/or
split stipes (blowout) and spotty caps. Quantification of V. fungicola was applied to tolerant
and sensitive mushroom strains to detect a correlation between tissue infection level and
resistance level, taking into account tissues discolouration. The second objective of this work
was to assess the effect of infection on the disruption in gene transcription in bubbles. A
general approach using RT-UP PCR gave an overview on the incidence of infection on gene
expression and showed that bubble is closer to cap tissue (without gills) than to
undifferentiated healthy pinhead for the overall transcription. The regulation of genes directly
or indirectly related to morphogenesis was markedly affected by infection whereas that of the
other genes seemed not or poorly modified.
Key words: Discolouration, DNA quantification, Fungal pathogen, Agaricus bisporus; Real-
time PCR.
Introduction
Dry bubble disease of A. bisporus is responsible for large losses to the mushroom
industry. The fungal pathogen, V. fungicola, affects the morphogenesis of the host. The major
symptom consists in the development of an undifferentiated, non-necrotic spherical mass,
named bubble, in place of the sporophore. The pathogen is unable to attack vegetative
mycelium (Calonje et al. 2000) because a lectin specific to A. bisporus fruit body is involved
in the recognition system (Bernardo et al. 2004). Infection occurs at the very early stage of the
fruit body (pinhead stage), (Largeteau et al. 2007), and host and pathogen hyphae coexist in
diseased tissues (North & Wuest, 1993; Dragt et al. 1995, 1996; Calonje et al. 1997), but the
ratio of host to pathogen is poorly documented. We detected a wide range of tissues
colonisation in bubbles of the cultivar Amycel 2100 and reported that browning was not an
efficient mechanism to contain the pathogen (Largeteau et al. 2007). The aim of this work
was first to complete these studies and to investigate relationships between the level of
infection and the susceptibility of A. bisporus, then to have an overview on the incidence of
infection on genes expression in bubbles.
Agaricus bisporus strains and crops

Two cropping experiments were conducted at INRA (Institut National de la Recherche
Agronomique) facilities. Experiment A performed with the cultivar 2100 (Amycel, France)
was described by Largeteau et al. (2007). Experiment B consisted of the cultivar 2100 and the
139
wild strains Bs085A, Bs175, Bs419B, Bs431C, and Bs437 (Collection of A. bisporus
germplasm (CGAB), INRA, Bordeaux). For each experiment, the same batch of compost was
used for the non-infected and infected crops, both placed in separate climatic chambers but
under the same regulation. Infection by V. fungicola var. fungicola (isolate VCTC, 106 conidia
m-2) was performed as described by Savoie & Largeteau (2004).
Verticillium fungicola
To obtain the mycelium used for RNA and DNA extractions, V. fungicola VCTC was
cultivated for 21 d in Cristomalt® (Difal, Seysses, France) liquid medium. The fungal
biomass was recovered by filtration, the inoculum plugs were removed, the mycelium was
washed with sterile water, immediately deep-frozen into liquid nitrogen and stored at -80 °C.
Samples
Healthy and diseased materials were harvested at random, and immediately placed on
ice. Healthy samples collected on non-infected trays consisted in fruit bodies at stage pinhead
(PH, 2 mm high, undifferentiated tissues), and sporophore (SP, stage 3 according to
Hammond & Nichols, 1976). Bubbles collected on infected crops were cut by the middle, and
separated in three groups according to the visual colour of the tissues: white bubbles (Bw),
bubbles with homogeneous (Bb) and heterogeneous (Bwb) discolouration. Samples were
peeled on ice, gills of sporophores were removed, and tissues of bubbles heterogeneous in
discolouration sampled separately. Tissues samples were immediately frozen in liquid
nitrogen and stored at -80 °C.
Measurement of tissue colour

Tissue colour of bubbles was measured using the parameter L (0 for black to 100 for
white) given by a Minolta chromameter® CR221 (Minolta Camera Co., Japan), (Sapers et al.
1994; Moquet et al. 1997; Soler-Rivas et al. 2000). Data were reported as means of three
measurements per sample.
Quantification of host and pathogen DNA

Frozen samples were lyophilized and DNA was extracted with the Amersham™
Nucleon™ Phytopure™ RPN 8510 Kit (Amersham Int. plc, England) according to the
manufacturer’s procedure. Real-time PCR absolute quantification was used to assess both
total DNA and A. bisporus DNA quantities in samples of experiment A as described by
Largeteau et al. (2007). The quantity (ng) of A. bisporus DNA was expressed per 100 ng of
total DNA. Eight white bubbles (Bw), 10 brown bubbles (Bb) and 9 bubbles with
heterogeneous discolouration were analysed. For experiment B, samples consisted of 23 white
bubbles (Bw), 8 from tolerant strains, and 15 from susceptible strains. Total DNA was
quantified with a ND 1000 spectrophotometer (NanoDrop Technology, Inc., Wilmington, DE,
USA) and V. fungicola DNA by real-time PCR absolute quantification with primers IF3L (5’-
CTTCTACCGTATTGGTGTCTGGA-3’) and IF4R (5’- CACTGTTGGGAAGCTCCAAT-
3’) designed to specifically amplify a 164 bp region in the eIF4 gene of the pathogen.
Amplifications were performed with the LightCycler 2.0 Instrument (Roche Diagnostics,
Germany). The amplification mixture consisted of 4 µl of FastStart DNA MasterPLUS SYBR
Green I MIX (Roche Diagnostics, Germany), 500 nM of both forward and reverse primer and
5 µl of DNA in a final volume of 20 µl. After 10 min activation of the hot-start Taq DNA
polymerase at 95 °C, 35 cycles of 95 °C for 15 s, 58 °C for 20 s and 72 °C for 15 s were
performed. Data were acquired at 72 °C. A melt curve was run at the end of the 35 cycles to
check for a unique PCR reaction product. The similar efficiency of primers IF3L/IF4R (E =
1.98 ± 0.011) to amplify DNA of V. fungicola and bubbles was previously verified.
140
RNA extraction and RT-UP PCR
The frozen material (experiment A) was ground in liquid nitrogen, and total RNA was
extracted with the QIAshredder® kit and the RNeasy® mini kit (Qiagen, Germany) according
to the manufacturer’s procedure. Residual DNA was removed using the RNase-Free DNase
Set (Qiagen). RT-UP PCR were performed with pools of RNA extracted from 40 healthy
pinheads (PH), tissues of 5 sporophores without gills (SP), 5 white bubbles (Bw), 4 brown
bubbles (Bb), and two cultures of V. fungicola (Vf). After incubation of 200 ng RNA at 65 °C
for 10 min, a reaction mixture containing 1x M-MLV RT buffer (Invitrogen), 10 mM
DTT (Invitrogen), 1 µM universal primer (UP, Table 1), 0.1 mM each of dNTP (Amersham),
24 U ribonuclease inhibitor (RNasin®, Promega) and 200 U M-MLV reverse transcriptase
(Invitrogen) was added to a total volume of 25 µl. ADNc segments were synthesized by
incubation for 1 h at 37 °C followed by enzyme inactivation at 70 °C for 5 min. A reaction
mixture containing 1x Taq polymerase buffer (Promega), 0.2 mM each of dNTP (Amersham),
1 µM each of primer and 2 U Taq polymerase (Promega) in a total volume of 25 µl was added
and PCR amplification was performed in a thermal cycler (Eppendorf) programmed for 40
cycles of 1 min at 94 °C, 1 min at 50 °C and 2 min at 72 °C. The absence of DNA in RNA
samples was checked using negative controls obtained from RT without reverse transcriptase.
Table 1. Sequences of universal primers used for the RT-UP PCR

Primer Sequence (5’-3’)1
Au CTACCCCCAACAAAGGAAATG
Ru GGCAAGTCACAGAACCTCATC
B1 GCGATCATGGATGAAAAGAACA
UpII TATGTCAACGAAGCGTAGTTTTAT
Mr AGCGGATAACAATTTCACACAGGA
G TACGGTGGCGGAGCGCAGCA
D GTAAAACGACGGCCAGTACCAAG
A-1 AATCTAGAGCTCCTCCTC
A-2 AATCTAGAGCTCCAGCAG
A-4 AATCTAGAGCTCTCCAGC
A-5 AATCTAGAGCTCCCTCCA
B-1 CTTGTACGCGTGTGCGAC
B-2 CCTACACGCGTATACTCC
B-3 CATACACGCGTATACTCG
B-4 ACGCACACGCACAGAGAG
B-5 CACACGCACACGGAAGA
C-2 CGTGTATACATACGTAAC
C-4 CCACACGCGCACACGGGA
C-5 CCGCACGCGCACGCAAGG
1
See Leung et al. (2000); Sawada & Iwata (2002)
Universal primers used are described in Table 2. Amplification products were
visualized on 2% type D-5 agarose gels (Euromedex, France) in presence of 0.004% ethidium
bromide. For each of the 25 combinations of primers, the amplification profiles obtained for
healthy pinheads, sporophores, bubbles and V. fungicola were recorded with the Perfect-
Image V6.1 program (Clara Vision, France) and compared for the presence and absence of
bands.
141
Mushroom strains were compared for the intensity of discolouratiopn and the
percentages of V. fungicola DNA in bubbles by the Cramér-von Mises nonparametric test
(Sprent, 1989). Two populations differ by the test when the calculated T value exceeds 0.461
at p = 0.05 and 0.743 at p = 0.01. The box-plot representation (Chambers et al. 1983) was
used to show the distribution of the data. The box extends from quartile 25 (Q1) to quartile 75
(Q3). The horizontal line segment inside the box corresponds to the median (m). The higher
and lower fractions are represented by line segments extending from the top and bottom of the
box. Extra lines above and below the box show data found outside of the distribution (values
< [Q1-1.5(Q3-Q1)] and > [Q3+1.5(Q3-Q1)].
Analysis of bubble discolouration

A characteristic of A. bisporus is to produce sporophores that develop quasi
simultaneously during successive flushes. In contrast, a continuous production of bubbles was
observed after crops infection by V. fungicola. Bubbles variable in size, weight and colour
coexisted on the same days on the same trays.
90
80
Tissue colour (L)
70 Legend
min
60
Q3
50
m
Q1
max
40
30
0
Bb Bwb
Figure 1. Distribution of the intensity of discolouration (L value) in tissues of bubbles

homogeneous (Bb) and heterogeneous (Bwb) in discolouration.
See complement of legend in Material and Methods.
From previous investigations carried on with A. bisporus 2100 (Largeteau et al. 2007),
tissues of bubbles showing no visual discolouration were as white as tissues of healthy
sporophores (L = 90), and bubbles with homogeneous or heterogeneous discolouration
exhibited a wide range of L values. The distribution of tissue colour given by the L value was
similar for bubbles homogeneous and heterogeneous in discolouration (Figure 1). The T value
of 0.105 obtained by the Cramér - von Mises nonparametric test confirmed that both groups
of bubbles did not differ for the intensity of discolouration. No explanation could be given for
the origin of both types of discolouration, but we questioned the possibility of multiple points
of infection for bubbles with heterogeneous discolouration.
The percentage of host DNA in bubbles with homogeneous brown tissues increased
significantly with the time course after inoculation (Figure 2). A negative and similar
correlation was found between the percentage of host DNA and discolouration for
homogeneous (white or brown) and heterogeneous bubbles (Figure 3), but the DNA
142
percentage was not correlated to the weight of the bubble (r = 0.04, df = 16) showing that V.
fungicola was involved in bubble formation but did not regulate its growth. Based on the
present experiments and previous ones (unpublished results, and Juarez del Carmen, 2003),
neither the rate and time of infection, nor the colonisation of host tissues by V. fungicola but
the unregulation of the morphogenesis related to the presence of the pathogen could explain
the heterogeneity in bubble development.
Figure 2. Variations in the percentages of host DNA in brown bubbles (Bb) in relation to
the time course after infection.
120
Host DNA (% total DNA)
80
40
r = 0,736 **
0
15 20 25 30 35 40 45
Time course after inoculation (days)
Figure 3. Relationships between host DNA and discolouration for bubbles with
homogeneous and heterogeneous tissue colour.
Bw Bb Bwb
120
Host DNA (% total DNA)
100 r = 0,819 **
80
60
40
20
0
100 80 60 40 20
Discolouration (L value)
Bw: white bubbles; Bb: bubbles with homogeneous brown tissues; Bwb: bubbles with tissues
heterogeneous in colour.
Relationship between susceptibility and colonisation by V. fungicola

The wild strains Bs 85A, Bs 419B and Bs 431C produced 4.3, 5.3 and 19.0% of
diseased mushrooms, respectively and were considered to be tolerant to V. fungicola. The two
other wild strains, Bs 175 and Bs 437B, and the cultivar 2100 were estimated as susceptible,
with a production of 40.2, 40.5 and 48.9 % of diseased mushrooms, respectively. The
classification of the wild strains for susceptibility to V. fungicola confirmed previous
observations (unpublished results).
White bubbles exhibited percentages of V. fungicola ranging from 1.0 to 13.5 with an
extreme value of 53.3 outside of the distribution for tolerant strains, and ranging from 2.2 to
19.6 with an extreme value of 41.0 for susceptible strains (Figure 4). The Cramér–von Mises
nonparametric test applied to the data gave the calculated T value of 0.2038, showing that
tolerant and susceptible strains did not differ at p = 0.05 for the colonisation of white bubbles
143
tissues by the pathogen. But visual observations of longitudinal cuts of bubbles harvested at
random revealed that tissue discolouration varied with the level of susceptibility of the
mushroom strain. Tolerant strains produced mainly brown bubbles whereas a wide range of
tissue colour was observed for bubbles of susceptible strains. With sensitive strains, it was
previously observed that intensive discolouration was related to high infection level
(Largeteau et al. 2007). In tolerant strains, this intensive decoloration might also be the result
of a response of the host involving an unstable hyperoxidant state determined by an increase
in the cell reactive oxygen species overpassing the antioxidant defence capacity. By
comparing strains in a progeny for their H2O2 concentrations in healthy sporocarps and in
bubbles, we observed significant differences between the strains that were negatively
correlated with their level of susceptibility to the pathogen (Savoie & Largeteau, 2004). This
strengthens the concept of the impact of oxidative processes in the systems leading to the
resistance of A. bisporus to V. fungicola.
55
Verticillium fungicola DNA (% total DNA)
50
45
40
20
15
10
0
Tolerant Susceptible
Figure 4. Distribution of the percentages of Verticillium fungicola DNA detected in white

bubbles of tolerant and susceptible strains.
Tolerant strains: Bs 85A, Bs 419B and Bs 431C; susceptible strains: Bs 175, Bs 437B, and the
cultivar 2100.
Overview of the effect of infection on gene expression

The profiles of white bubbles exhibited various types of bands defined according to
whether the transcript was representative of the pinhead stage (type A), the sporophore stage
(type B), A. bisporus irrespective of the morphogenesis stage (type C), fungi whatever the
species and morphogenesis stage (type D), and V. fungicola (type E) (Figure 5).
Whatever the primers, all the bands observed on the profiles of white bubbles were
present on the corresponding profiles of either healthy mushrooms (pinheads and/or
sporophores) or V. fungicola, and consequently no gene specifically expressed as a
consequence of infection was detected. The stage of development of the diseased samples
(bubble) might explain this result, as it is well known that the regulation of genes involved in
infection processes can occur very early after host-pathogen recognition which is the pinhead
stage. But our purpose was to assess the whole disturbance of gene expression in bubbles. All
the bands of type D, common to pinheads, sporophores, and V. fungicola, i.e. not
characteristic of morphogenesis but of fungal hyphae, were detected in bubbles showing that
infection did not or poorly affected the development of aggregated hyphae of A. bisporus.
144
Mr / Au Mr / Mr Mr / B1
PH SP Bw Vf PH SP Bw Vf PH SP Bw Vf
E
D
B A
Figure 5. Example of RT- UP PCR profiles for pinheads (PH), sporophores (SP), white
bubble (Bw) and mycelium of Verticillium fungicola (Vf).
Profiles obtained with primer Mr (RT) and Au, Mr or B1 (PCR).

Bands characteristic of the pinhead stage (A), the sporophore stage (B), A. bisporus irrespective of the
morphogenesis stage (type C), fungi (type D), and V. fungicola (type E).
Analysis of the 25 profiles of white bubbles showed that a low percentage of bands
belong to types A and E, and a very high percentage to types B and C (Table 2), but 17.65%
of bands characteristic of the sporophore stage (tissues without gills) were absent on the
profiles of white bubbles meaning the silencing or the strong down-regulation of some genes.
In the latter possibility, the PCR technique used might be not efficient enough to detect very
low transcription. Such genes might be involved in the first stages of mushroom
differentiation, and their identification (or EST) would open access to the mechanisms related
to the induction of bubbles, and the identification of the genes associated to the
morphogenesis of sporophores. Similarly, the same interest had to be paid to bands
characteristic of the pinhead stage, representative of the undifferentiated stage, present on the
profiles of white bubbles.
Table 2. Presence/absence of the various types of bands on the white bubble profiles.
Absence Presence
Type of
Numbe Percentages1 Numbers Percentages1
band
rs
A 10 76.92% 3 23.08%
B 3 17.65% 14 82.35%
C 10 6.80% 137 93.20%
D 0 0% 67 100%
E 111 90.98% 11 9.02%
1
Within a type, values as percent of the total numbers of bands detected on profiles of the
corresponding type, i.e. PH for A; SP for B; PH and SP for C; PH, SP and Vf for D; Vf for E.
When each type of bands was expressed as percent of the total numbers of bands on
the profile, 64.7% of the bands of white bubbles corresponded to genomic regions specific of
A. bisporus (types A + B +C) and 4.6% to V. fungicola. These percentages appeared in
145
connection with previous results (Largeteau et al. 2007) estimating the host DNA as 95-98%
of the total DNA in the white bubbles of A. bisporus 2100 used for this experiment.
The profiles of brown bubbles differed from those of white bubbles by the presence/
absence of bands and by marked variations in the intensity of some bands (Figure 6). Such
high variations in band intensity were not observed for white bubbles, and might be related to
browning and senescence.
A1 / A5 B1 / C2
PH SP Bw Bb Vf PH SP Bw Bb Vf
Figure 6. Example of comparison of RT- UP PCR profiles for white (Bw) and brown
(Bb) bubbles.
A1/A5 and B1/C2 represent RT primer/PCR primer.
The arrows point bands with marked variability in intensity between the Bw and Bb profiles.
Conclusion
The pathogen is not involved in the biomass production in bubbles, and infection does
not or poorly affects the development of aggregated hyphae of A. bisporus. However,
silencing or strong down-regulation of some gene involved in the initiation of mushroom
differentiation might be responsible for the production of dry bubbles. The tolerance of A.
bisporus strains is first the result of limitation of initial infection, and then of higher
unspecific defence reactions in infected tissues. Further investigations on the interspecific
interaction V. fungicola - A. bisporus might focus on both these mechanisms, for instance by
studying expression of target genes.
References
Bernardo D, Perez Cabo A, Novaes-Ledieu M, Garcia Mendoza C. 2004. Verticillium disease

or ‘dry bubble’ of cultivated mushrooms: the Agaricus bisporus lectin recognizes and
binds the Verticillium fungicola cell wall glucogalactomannan. Can. J. Microbiol., 50,
729-735.
Calonje M, Garcia Mendoza C, Galan B, Novaes-Ledieu M. 1997. Enzymic activity of the
mycoparasite Verticillium fungicola on Agaricus bisporus fruit body cell wall.
Calonje M, Garcia Mendoza C, Perez Cabo A, Bernardo D, Novaes-Ledieu M. 2000.
Interaction between the mycoparasite Verticillium fungicola and the vegetative
mycelial phase of Agaricus bisporus. Mycol. Res., 104, 988-992.
146
Chambers JW, Cleveland WS, Kleiner B, Tukey PA. 1983. Graphical methods for data
analysis. Wadsworth and Brooks/Cole Publishing Co., Pacific Grove, CA, USA.
Dragt JW, Geels FP, Rutjens AJ, van Griensven LJLD. 1995. Resistance in wild types of
Agaricus bisporus to the mycoparasite Verticillium fungicola var. fungicola. Mush.
Sci., 14, 679-683.
Dragt JW, Geels FP, de Bruijn C, van Griensven LJLD. 1996. Intracellular infection of the
cultivated mushroom Agaricus bisporus by the mycoparasite Verticillium fungicola
var. fungicola. Mycol. Res., 100, 1082-1086.
Juarez del Carmen S. 2003. Diversité d’un champignon patthogène, Verticillium fungicola, et
interactions avec son hôte, le champignon cultivé, Agaricus bisporus. Ph.D Thesis,
university of Pau and Pays de l’Adour, 137pp.
Largeteau ML, Regnault-Roger C, Savoie JM. 2007. Verticillium disease of Agaricus
bisporus: Variations in host contribution to the total fungal DNA in relation to
symptom heterogeneity. Eur. J. Plant Pathol., 118, 155-164.
Leung GSW, Zhang M, Xie WJ, Kwan HS. 2000. Identification by RNA fingerprinting of
genes differentially expressed during the development of the basidiomycete Lentinula
edodes. Mol. Gen. Gene., 262, 977-990.
Moquet F, Ramos Guedes-Lafargue M, Védie R, Mamoun M, Olivier JM. 1997. Optimum
measure of cap color in Agaricus bisporus wild and cultivated strains. J. Food Sci., 62,
1054-1056.
North LH, Wuest PJ. 1993. The infection process and symptom expression of Verticillium
disease of Agaricus bisporus. Can. J. Plant Pathol., 15, 74-80.
Sapers GM, Miller RL, Miller FC, Cooke PH, Choi SW. 1994. Enzymatic browning control
in minimally processed mushrooms. J. Food Sci., 59, 1042-1047.
Savoie JM, Largeteau ML. 2004. Hydrogen peroxide concentrations detected in Agaricus
bisporus sporocarps and relation with their susceptibility to the pathogen Verticillium
fungicola. FEMS Microbiol. Lett., 237, 311-315.
Sawada K, Iwata M. 2002. Isolation of blast fungal cerebroside elicitor-responsive genes in
rice plants. J. Gen. Plant Pathol., 68, 128-133.
Sprent P. 1989. Applied nonparametric statistical methods. Chapman and Hall, London.
Soler-Rivas C, Arpin N, Olivier JM, Wichers HJ. 2000. Discoloration and tyrosinase activity
in Agaricus bisporus fruit body infected with various pathogens. Mycol. Res., 104,
351-356.
147
Immunological Detection of dsRNAs in Wild Agaricus Species and in Virus-

infected Cultivated Champignon
András Geösel1, Krisztián Halász2, József Szarvas3, Csaba Hajdú3, Nelli Virágh2 and
Noémi Lukács2.
1
Department of Vegetable and Mushroom Growing, and 2Department of Plant Physiology and
Plant Biochemistry, Faculty of Horticultural Science, Corvinus University of Budapest,
Budapest, Hungary; 3Quality Champignons Ltd. Demjén, Hungary,
Email: andras.geosel@uni-corvinus.hu
Abstract
Since champignons are susceptible to a large number of pests and infectious agents, it
is important to have reliable methods for pathogen detection. At present, Mushroom Virus X
(MVX) is the major virus causing losses. The unequivocal detection of virus diseases is
problematic because the symptoms are often similar to those caused by errors in cultivation.
The detection of MVX-infection presents an extreme challenge because, until now, it has not
been possible to identify which one of the 23 double-stranded RNA (dsRNA) species,
occurring in variable number and size in MVX diseased mushrooms, is causally connected
with disease development. The aim of our experiments was to develop a sensitive, simple and
reliable immunological method to detect all dsRNAs present in fungal nucleic acid extracts.
We tested samples of MVX-infected cultivated Agaricus bisporus, and more than 50 wild
Agaricus specimens from different species and from different areas of Hungary by dsRNA-
immunoblotting. In MVX diseased reference samples, as well as in some “suspicious”
samples, we were able to detect dsRNAs not present in healthy mushrooms. In several of the
wild Agaricus species, dsRNAs of different sizes were found.
Key Words: Agaricus spp.; Wild strains; Mushroom Virus X; dsRNAs; Immunological
detection
Introduction
Champignon (A. bisporus) production accounts for a dominant portion of the

Hungarian vegetable sector. One of the major risks of champignon production world-wide is
the infection by viruses. Earlier, the La France Isometric Virus (LIV) caused significant yield
losses. At present, Mushroom Virus X (MVX) is the major virus, which can be dangerous
during the cropping period. As described by several authors, the MVX disease can induce
many different symptoms including elongated stems, misshapen and small caps, brown
colouring, dramatic loss of yield and delayed flushes (Gaze et al. 2000; Grogan et al. 2003;
Adie et al. 2004). Such symptoms, however, can also be caused by errors in cropping
technology or through poor hygienic conditions. Therefore, it is not possible to identify the
presence of the MVX virus on the basis of symptoms (Rao et al. 2007). Several methods to
control and limit virus spread have been suggested in the literature (Fletcher & Gaze, 2008),
but their efficient application should be based upon reliable virus detection which is still
problematic.
The basic difficulty arises from the fact that a total of 26 different dsRNA have been
found in different MVX-diseased mushroom samples, and it is not known which of these are
causally involved in disease development. It has not even been unequivocally clarified
whether one or more viruses are involved. What is certain is that at least three of the 26
dsRNA species are routinely detectable in healthy fruit bodies as well. The remaining 23
dsRNA seem to be linked to MVX symptoms but occur in different amounts and in different
148
patterns in the samples (Adie et al. 2004). To our knowledge, all 23 dsRNA bands have never
been detected together in one sample. Some of the dsRNA-species seem to be sequentially
related (Rao et al. 2007), but since only a few partial sequences are available, final
conclusions about the relatedness or function of the individual species cannot be drawn.
Given this state of our present knowledge, no polymerase chain reaction (PCR) based
methods can be developed for specific and highly sensitive detection of MVX. Presently, in
most cases, MVX detection is based upon the purification of dsRNA by CF11 column
chromatography and identification of dsRNA-bands after agarose gel electrophoresis (Gaze et
al. 2000; Grogan et al. 2003).
The aim of our experiments was to introduce dsRNA-immunoblotting as a sensitive,
simple and reliable immunological method to detect all dsRNA present in fungal nucleic acid
extracts. Using this procedure, dsRNAs are detected in total nucleic acids without purification
by dsRNA-specific monoclonal antibodies (Schönborn, 1991). These antibodies specifically
recognize dsRNA independent of its nucleotide composition and sequence, and do not cross-
react with short double-strand helices present in single-stranded RNAs. The method has been
successfully used to detect infection caused by many different viruses in plants with a
sensitivity of 40-60 pg/50 μg total nucleic acid/lane (Lukács, 1994).
Source of tissue
Healthy and suspicious cultivated mushrooms were collected from commercial sites,
and MVX references samples obtained from the reference collection of A. Sonnenberg,
Wageningen, the Netherlands. Wild Agaricus species were collected from different regions in
Hungary. Samples were lyophilized and stored at -20 °C until testing. We usually started with
a 2 g fresh sample.
Total nucleic acid extraction

Lyophilized and powdered fruiting bodies were used for the sample preparation,
because otherwise the high water content and the presence of secondary metabolites in the
mushroom lowered the yield and the purity of the extract. Nucleic acid extraction was carried
out by applying different CTAB (cetyltrimethyl ammonium bromide) concentrations as
described previously (Góes-Neto et al. 2005; Pearson et al. 2006). Chloroform-isoamyl
alcohol (24:1) solution was used for removing proteins.
Gel electrophoresis
To detect dsRNS, unfractionated nucleic acid samples were separated by gel
electrophoresis in non-denaturing 5% (w/v) polyacrylamide-1xTBE (89 mM Tris-HCl, 89
mM boric acid and 2,5 mM EDTA) gels. It is essential to use polyacrylamide gels because,
after agarose gel electrophoresis, the sensitivity of immunodetection is reduced by about 100-
fold.
dsRNA detection
dsRNAs in crude nucleic acid extracts were detected on immunoblots as described by
Lukács (1994). A dsRNA-specific monoclonal antibody, J2, was used as primary antibody.
dsRNA-immunoblotting was successfully introduced to detect dsRNA from

unfractionated nucleic acid extracts of champignon directly, without chromatographic
purification of dsRNA. Using symptomless mushrooms or MVX-infected reference samples,
149
we found that the same dsRNA can be detected by the immunoblotting procedure in the same
way as after dsRNA-purification by CF11 chromatography and agarose gel electrophoresis
(Figure 1). Both methods have their limitations. While a relatively large sample is needed for
the CF11-procedure, 2 g fresh sample is sufficient to carry out all the necessary
immunoblotting analysis. On the other hand, immunoblotting needs to be proceeded by
polyacrylamide gel electrophoresis, which does not allow exact determination of molecular
weights for dsRNA longer than 4kb. Therefore, we recommend dsRNA-immunoblotting
when only small samples are available and just dsRNA species additional to those in the
healthy control need to be identified, while the chromatographic procedure is needed when
differences in the size of very long dsRNAs need to be determined.
Figure 1. DsRNA patterns of symptomless fruiting bodies on immunoblot, and purified

on CF11, separated on agarose.
dsRNA present in symptomless fruiting bodies of cultivated A. bisporus dsRNA were
detected by immunoblotting (a) or by CF11 chromatography followed by electrophoresis in
1% agarose gel (b). For immunoblotting, 3-5 μg of total nucleic acid extracts was loaded on to
a non-denaturing 5% polyacrylamide-1xTBE gel. After electrophoretic separation of nucleic
acids, dsRNA species present in the samples were detected by dsRNA-immunoblotting.
Independently of the method used, essentially the same dsRNA bands were observed. In
addition to the two major dsRNA bands a minor 1.9 kbp segment was also detected by
immunoblotting in sample “A”. The molecular weight was estimated by using the 100 bp and
1 kbp DNA ladder from Fermentas.
Since it has been described in the literature that dsRNA can also occur in apparently
healthy, symptomless samples (Gaze et al. 2000), we first analysed the dsRNA pattern of
different champignon strains cultivated in Hungary. It is a special characteristic of the
Hungarian mushroom industry that, in addition to the most frequently used European A15
(Sylvan Inc.) strain, several other strains are in use. The samples were collected from
commercial growers and from local markets. As shown in Figure 1, in accordance with the
literature (Adie et al. 2004), we found that a dsRNA of 2.4 kbp was present in most extracts
of symptomless sporophores of cultivated A. bisporus. In most samples, a band >5.2 kbp was
also seen. The correct length of this dsRNA cannot be estimated on the immunoblot because
of the non-linear resolution of the 5% polyacrylamide gel is in this region, but it presumably
corresponds to the other, 9.4 kbp dsRNA-species described in healthy A. bisporus (Adie et al.
2004). In sample “A”, additional dsRNA of unknown origin can be seen, indicating that the
150
dsRNA pattern may be strain-dependent. It is noteworthy that, with respect to the dsRNA
pattern of healthy A. bisporus hybrids, a new hybrid produced in Hungary seems not to
contain any dsRNA (not shown in the figure). In addition to the two dsRNA bands present in
the healthy control (Eg), a prominent 4.1 kbp dsRNA is present in both MVX reference
samples and in the “suspicious” samples A and B. In ‘B’ other dsRNA species between 1.3-
2.6 kbp can also be clearly seen. In sample ‘C’ only very weak dsRNA bands, not detected in
the MVX reference sample, can be observed.
Figure 2. Immunoblot of dsRNA-species in healthy (Eg), diseased (MVX Son, MVX

0201) and ‘suspicious’ (A, B, C) samples.
In each case, 30-50 μg of total nucleic acid was electrophoresed in 5% polyacrylamide-
1xTBE gel. After electrophoretic separation of the nucleic acids, dsRNA species were
detected by dsRNA-immunoblotting.
Detection of MVX-disease is presently based on comparison of dsRNA-pattern of

healthy and diseased samples. We analyzed MVX infected reference samples (from the
reference collection of A. Sonnenberg, Wageningen, the Netherlands) and some “suspicious”
samples showing symptoms. In these reference samples, a 4.1 kbp dsRNA, not present in the
extract of healthy sporophores was detected, but no other dsRNA species were found by
immunoblotting or by CF11 chromatography (Figure 2). The 4.1 kbp dsRNA was present at a
relatively high concentration, and was also visible in two of the “suspicious” samples (A and
B in Figure 2) collected from mushroom growers. In sample B, dsRNA species of 1.3-2.6
kbp, neither present in healthy nor in MVX-diseased reference samples, were also observed.
These bands may potentially represent additional MVX-associated dsRNA. In sample C, only
weak bands can be seen. These, however, were not visible in the MVX reference sample.
Taken together, these results indicate that dsRNA-immunoblotting is sensitive enough to be
151
used for MVX detection in unfractionated nucleic acid extracts, and we are planning to verify
the general applicability of the method further by testing additional and more complex MVX
reference samples.
Figure 3. dsRNA patterns in wild Agaricus species.

dsRNAs are also present in wild Agaricus species collected from natural habitats. The
presence of dsRNA was investigated in 50-60 μg crude nucleic acid extract as in Figure 2.
Many of the samples shown in Figure 3 contain dsRNA species, but the size and the pattern of
dsRNA is quite different among the samples. Rice Dwarf Virus (RDV) genomic dsRNA was
used as a marker.
We also investigated whether dsRNA potentially indicating the presence of a virus
occur in different wild Agaricus species in nature and whether the dsRNA patterns show any
relatedness to LIV- or MVX-infected cultivated mushroom samples. The occurrence of
dsRNA species in wild Agaricus species was investigated in 56 samples of 25 species from
different habitats in Hungary (Table 1). We found that dsRNAs, which might be of viral
origin are present in 16 samples (A. bitorquis, A. vaporarius (2), A. bisporus, A. campestris
(2), A. maskae (2), A. romagnesii (2), A. xanthoderma, A. pilatianus, A. meleagris, A.
sylvicola, A. squamuliferus and A. gennadii (Figure 3). At least in one case, A. vaporarius, we
observed differences in the dsRNA pattern of the two independent samples. In earlier
experiments in our laboratory, we found that in LIV-infected samples, all 9 dsRNA can be
consequently detected by immunoblotting. Since such a pattern was not found in any of the
samples, LIV is most probably not present in wild Agaricus species in Hungary. Because of
the complex dsRNA pattern occurring in association with the MVX disease, we can neither
confirm nor exclude any identity between MVX-associated dsRNA and those of the wild
Agaricus species.
152
Table 1. Agaricus species collected from different habitats in Hungary for dsRNA-
analysis.
Species Number of samples

Agaricus arvensis 2
A. bisporus 2
A. bitorquis 4
A. campestris 2
A. deylii 2
A. gennadii 2
A. haemorrhoidarius 1
A. iodosmus 1
A. lanipes 1
A. lutosus 1
A. macrocarpus 1
A. maskae 2
A. meleagris 3
A. pampeanus 1
A. phaeolepidotus 4
A. pilatianus 6
A. pilatianus var. magnus 1
A. porphyrizon 2
A. romagnesii 4
A. semotus 2
A. squamuliferus 3
A. sylvaticus 1
A. sylvicola 1
A. vaporarius 2
A. xanthoderma 5
Samples were collected in 2006, 2007 and 2008.
The presence of dsRNA in Agaricus sporophores appeared to be dependent on the

habitat rather than the species. Thirty-nine per cent of the samples collected from meadows or
agricultural fields contained dsRNA, while only 15 % of the woodland habitats were positive.
The results indicate that dsRNA, i.e. potential viruses, do occur in wild Agaricus species.
Therefore, it is highly advisable to carry out a careful analysis of dsRNA-patterns before new
wild samples are introduced as hybridization partners or new candidates for cultivation.
Acknowledgements
The authors thank co-workers in the Department of Plant Physiology and Plant
Biochemistry for valuable discussions. This research was supported by GVOP -3.3.3-05/1.-
2005-05-0106/3.0
References
Adie B, Choi I, Soares A, Holcroft S, Eastwood DC, Mead A, Grogan HM, Kerrigan
RW, Challen M, Mills PR. 2004. MVX disease and double-stranded RNA elements in
Agaricus bisporus. In: Mushroom Science XVI Science and Cultivation of Edible and
153
Medicinal Fungi, Romaine, CP, Keil, CB, Rinker, DL and Royse, DJ (Eds), Penn
State, University Park, PA, USA, pp411–420.
Fletcher JT, Gaze RH. 2008. Mushroom Pest and Disease Control. Academic Press,
Boston, pp112-123.
Gaze RH, Calvo-Bado L, Challen MP, Adie B, Romaine CP. (2000) A new virus
disease of Agaricus bisporus? In: Science and Cultivation of Edible Fungi, Van
Griensven LJLD (Ed.), Rotterdam, Netherlands, Vol 2, pp701-705.
Góes-Neto A, Loguercio-Leite C, Guerrero RT. 2005. DNA extraction from frozen
field-collected and dehydrated herbarium fungal basidiomata: performance of SDS
and CTAB-based methods. Biotemas, 18, 2, 19-32.
Grogan HM, Adie BAT, Gaze RH, Challen MP, Mills PR. 2003. Double-stranded
RNA elements associated with the MVX disease of Agaricus bisporus. Mycol. Res.,
107, 147-154.
Lukács N. 1994. Detection of virus infection in plants and differentiation between
coexisting viruses by monoclonal antibodies to double-stranded RNA. J. Virol.
Methods, 47, 255-272.
Pearson GA, Lago-Leston A, Valente M, Serrão EA. 2006. Simple and rapid RNA
extraction from lyophilized tissue of brown algae and seagrasses. Eur. J. Phycology,
41, 97-104.
Rao JR, Nelson DWA, McClean S. 2007. The enigma of double-stranded RNA
(dsRNA) associated with Mushroom Virus X (MVX). Curr. Iss. Mol. Biol., 9, 103-
122.
Schönborn J, Oberstrass J, Breyel E, Tittgen J, Schumacher J, Lukacs N. 1991.
Monoclonal antibodies to double-stranded RNA as probes of RNA structure in crude
nucleic acid extracts. Nucl. Acids Res. 19, 2993-3000.
154
Control of Yellow Rot on Reishi Mushroom (Ganoderma lucidum Karsten)

Using a Shelf Cultivation and Modified Vinyl Cover Method
H.J. Kang, J.T. Hwang, J.G. Noh, J.S. Choi, W.B. Chang, I.G. Song and K.B. Min
Agricultural Environment Division, Chungcheongbuk-do Agricultural Research and
Extension Services, Cheongwon 363-880, Korea. E-mail: khjrda@cb21.net
Abstract
Yellow rot on Reishi mushroom (Ganoderma lucidum) is caused by an ascomycetous

fungus Xylogone sphaerospora. A culture method, the vinyl cover method (VCM), has been
used to control the disease in commercial mushroom farms. In order to improve the control
efficacy, we used the 3-floor cultivation shelf and VCM, in which whole film at the top of the
wood logs was removed in the commercial farm before fruit body formation. In the first year
of cultivation, none of the logs were infected with the pathogen. In the second year, almost all
of the logs (>97%) were infected with the pathogen, which implies that the spores of the
pathogen may be transmitted in the air. To reduce exposure to air-borne inoculum, only the
polyethylene film near the primordium was removed. In that treatment, 40% of the logs were
infected until the second-year harvest.
Key Words: Ganoderma lucidum; Yellow rot; Xylogone sphaerospora; Vinyl cover
cultivation method; Disease control
Introduction
Reishi mushroom ( Ganoderma lucidum P. Karsten) is a medicinal mushroom. It has

long been thought to have various pharmacological functions. Recent intensive studies on this
mushroom have discovered many medicinal effects such as antifibrotic, immunomodulating,
and free-radical scavenging activities. In Korea, it has been cultivated in greenhouses since
the mid-1980's as an important cash crop. Yellow rot, a fungal disease of the mushroom, is
caused by an ascomycetous fungus. The causal pathogen has been previously reported as
Xylogone sphaerospora (anamorph Sporendonema purpurascens) or Arthrographis cuboidea
(Lee et al. 1996; Oh et al. 1998). Choi et al. (1998) selected effective fungicides to control the
disease. A cultural method, the vinyl cover method (VCM), in which a wood log is wrapped
in a bag made of two layers of polyethylene film and sterilized before spawning, was
developed by Oh et al. (1996) to control the disease by preventing soil inoculum. However,
the control methods were not so effective in the commercial farm and severe yield losses have
occurred in the mushroom farm in which the disease has occurred. The purpose of this study
is to develop a cultivation method using a cultivation shelf for the control of yellow rot on G.
lucidum.
Oak wood logs colonized with the mycelia of G. lcudum were placed on each floor.
Three cultivation shelves per house were installed. In the first year of cultivation, yellow rot
was examined by observing the bottom of the fruiting body after harvesting. Formation of
ascocarps and discoloration in wood logs were also examined for nine wood logs. In the
second year, yellow rot was examined twice before formation of primordia and after
formation of pilei. The cultivation shelf was constructed according to the following
specifications: height 1300, length 1750, width 390 mm. Each floor of the 3-floor cultivation
shelf was 50, 90, and 130 cm apart from the soil surface, respectively. This experiment was
155
carried out in the two distant locations (Boeun and Danyang) where severe outbreaks of
yellow rot had occurred.
In the first year of cultivation, yellow rot was not observed in any wood logs in either
of the two different cultivation areas. In contrast, in the second year of the cultivation, yellow
rot occurred severely. In the Boeun area (Table 1), 75 to 84.2% of wood logs showed yellow
rot symptoms. Out of 95 wood logs treated, 44 (46.3%) showed typical symptoms such as
greenish yellow discoloration and abundant tiny black ascomata in the interior of the wood
logs sectioned longitudinally. Disease incidence was not significantly different among the
floors. This result implies that yellow rot is disseminated through the air.
Table 1. Occurrence of yellow rot in shelf cultivation using VCM in Boeun area during
the second year of cultivation
Location of wood logs 1st floor 2nd floor 3rd floor

Diseased wood logs (%) 75 84.2 81.8
Number of wood logs cultivated 24 38 33
Number of diseased wood logs 18 32 27
Yellow rot occurred also in the shelf cultivation in the Danyang area (Table 2). In the
Danyang area, 70.6 to 81.5 percent of wood logs were infected with the yellow rot pathogen.
Out of 95 wood logs cultivated, fifty one (53.6%) showed typical greenish yellow
discoloration in the log interior. On the third floor, slightly lower disease incidence was
observed than on the first floor, but they were not significantly different. These results
indicate that yellow rot might be disseminated through the air.
Table 2. Occurrence of yellow rot in shelf cultivation using VCM in the Danyang
area during the second year of cultivation
Location of wood logs 1st floor 2nd floor 3rd floor

Diseased wood logs (%) 81.5 79.4 70.6
Number of wood logs cultivated 27 34 34
Number of diseased wood logs 22 27 24
In order to reduce the surface area exposed to the air-borne inoculum, only small parts
(2 x 2 cm) of the polyethylene film on the growing primordia were removed. When the
mushroom was grown on the cultivation shelf in the first year, yellow rot symptoms were
observed neither in VCM nor modified VCM. Sixty percent of the wood logs showed yellow
rot symptoms when cultivated in the soil by VCM. The highest disease incidence (85%) was
observed with the short wood log method, in which logs were buried in the soil infested with
yellow rot pathogen. In the second year, 97% of the wood logs were infected with the yellow
rot pathogen in VCM. However, in the modified VCM, the disease incidence was only 40%
(Table 3).
156
Table 3. Reduction of yellow rot on G. lucidum using shelf-cultivation and modified vinyl
cover method
Improved short wood method Short wood

Cultivation
(vinyl cover method, VCM) method
Location of wood log On the shelf On the soil In the soil
Removal of Buried in
Partial removal Removal of the
the whole soil after
of vinyl cover on whole vinyl
Removal of vinyl cover vinyl cover removal of
the primordia cover on the top
on the top of whole vinyl
(2×2cm) of wood logs
wood logs cover
Diseased wood logs (%)
0 0 60 85
in the first year
Diseased wood logs (%)
97 40 100 100
in the second year
Diameter of pileus (cm) 9.2×5.1 11.1×6.0 6.5×4.2 15.0×6.0
Length of stipe (cm) 4.6 4.5 6.1 7.5
Yield (dry weight,
12.0 48.7 1.5 3.5
g/wood log)
Yield (kg/m2) 0.2 0.8 0.03 0.06
The quality of the mushroom was lower when cultivated on shelves; the length of the
stipe became shorter and the pileus became thicker than when cultivated in the soil. Although
the mushroom quality decreased slightly, the modified VCM enables Reishi mushroom
growers to cultivate the mushroom using continually the cultivation house contaminated with
yellow rot pathogen. This cultivation method will reduce production costs, and the mushroom
growers can cultivate the mushroom in the same place without moving the cultivation house
to another distant place.
References
Choi GJ, Lee JK, Woo SH, Cho GY. 1998. Selection of effective fungicides against
Xylogne sphaerospora, a fungal pathogen of cultivated mushroom, Ganoderma
lucidum. Korean J. Plant Pathol., 15, 491-495.
Lee JK, Choi GJ, Cho KY, Oh SJ, Park JS. 1996. Xylogone sphaerospora, a new
fungal pathogen of cultivated Ganoderma lucidum. Kor. J. Mycol., 24, 246-254.
Oh SJ, Chun CS, Lee JK, Kim HK. 1998. Occurrence and identification of the fungus
causing yellow rot on Ganoderma lucidum. Kor. J. Mycol., 26, 31-38.
Oh SJ. 1996. Incidence of yellow rot disease on Ganoderma lucidum Karst:
Identification, epidemiology and control. Master’s Thesis. Gyeongsang National
University.
157
Biological Control Against Trichoderma Species in Agaricus Cultivation

Júlia Győrfi and András Geösel
Department of Vegetable and Mushroom Growing, Faculty of Horticultural Science,
Corvinus University of Budapest, Budapest, Hungary. Email:gomba@uni-corvinus.hu
Various species of Trichoderma are pathogens, the occurrence of which are ever more
frequent in mushroom production causing very significant harm both in national and world
production. Possibilities of their control are limited and, apart from preventive control, there
are only few possibilities in the technology of production to prevent them from doing harm. A
few years ago, intensive research activity began in Hungary for the survey and
characterisation of the Trichoderma species occurring in Hungary, as well as for the
development of biocontrol products to control them. Under laboratory conditions, three
bacterial strains were successfully isolated which in vitro were inhibitory to the growth of
various Trichoderma species. In our experiment, we studied the in vivo effect of these
antagonists under conditions of small scale mushroom production. According to our results,
the individual bacteria are in fact inhibitory to the growth of harmful Trichoderma species and
can also have yield stability enhancing and yield increasing effects.
Key words: Trichoderma species; Green mould disease; Antagonistic bacteria; Agaricus
bisporus; Biological control
Introduction
The disease called green mould (Trichoderma) has long been known in mushroom
production (Geml et al. 2000) causing damage of different dimensions. The major enemy of
world mushroom production was Trichoderma harzianum. In 1980, Domsch et al. (1980)
published a study and analysis indicating T. harzianum to be the most widespread among the
Trichoderma species occurring all over the world. It can be found under every climate but it is
most typically found in the temperate climate zone. Its occurrence in Hungary was first
reported by Vajna (1984) but not in mushroom production.
T. harzianum appeared in Ireland for the first time in 1985 (Rinker & Alm, 2000)
causing considerable damage to Irish mushroom production that same year. In 1987, it spread
over to England and Scotland, and its harmful effects have been reported in the United States,
Canada and even Australia. It caused damage costing several million Euros to mushroom
production in the Netherlands (Geels, 1997). It appeared particularly following the
introduction of 3rd phase compost (Grogan et al. 2000). From these years on, the elaboration
of its control, the study of the pathogen and the development of an efficient monitoring
system were undertaken with great intensity at various institutes of mushroom research.
There are several known strains (races) of this species. Currently, strain Th2 in Europe
and strain Th4 in North America are considered to be the greatest threat to mushroom
production. The damage caused by this species extend in several directions: it parasitizes the
mycelium of the button mushroom poisoning the latter with its toxins and also, since it grows
faster than the button mushroom, it depletes the available nutrients before the mushroom
culture can access them. While the optimal temperature ranges between 22 and 26°C for most
Trichoderma secies, the strains of T. harzianum seem to prefer higher temperatures.
Consequently, the mould field can grow more than 1 mm in one hour at 27°C. The speed of
spreading is even higher in composts having temperatures of 28-30°C. Its identification is
made difficult by the fact that the so-called vegetative growth phase takes much more time in
the case of this species compared to others. At the same time, the parasite needs light of
certain intensity in order to be able to develop green spores. Its spread is greatly facilitated,
158
either inside the mushroom factory or from one grower to the other, by air currents, flies,
spider mites, personnel or by any tools or implements that are used, and even by picking
boxes. Its incapacity to gain ground in evenly colonized composts has also been demonstrated
experimentally.
A few years ago, very significant yield losses were caused to Hungary’s button
mushroom production by different Trichoderma species (Hatvani et al. 2006; Hatvani et al.
2007). The symptoms of the disease can appear in the compost, in the casing soil or on the
fruiting bodies. By the naked eye, it is impossible to distinguish the vegetative mycelium of
Trichoderma from that of the button mushroom as they are very similar (Oei, 2003). Damage
is only indicated by the green sporulating Trichoderma specks appearing on fruiting
substrates. As these moulds develop billions of spores, they are difficult to keep under control
and the only solution is farm hygiene (Rinker et al. 2000). It was common practice for a long
time to sprinkle salt over the green mould specks or to irrigate them with a benomyl
containing solution (Ch. Fundazol 50 WP). In certain cases, the whole of the casing material
infected with green mould was removed and a new casing was applied. Though the expected
yield level was not achieved, the end amount of picked mushrooms was acceptable, even if
with a delay of more than two weeks (Györfi, 2002). A research project started in 2004
selected antagonistic compost-tolerating biofungicidal microbial strains that in vitro were able
to inhibit the growth of the harmful Trichoderma strains. These former strains came from
bacterium strains belonging to the genera Pseudomonas, Bacillus and Streptomyces
(Manczinger, personal communication).
The objective of the present series of experiments was to determine if the bacterium
strains selected were able to provide protection against Trichoderma infections under the
growing conditions common in the practice of button mushroom cultivation. Therefore, the
compost treated by the bacteria was subjected to a provocative infection with Trichoderma
and then observations were carried out on the appearance of the parasite, its effect on yields
and fruit body quality, as well as on accumulated yields over time.
Cultivation substrate
The cultivation substrate was 2nd phase spawned button mushroom compost which
was purchased from a compost factory. From the bags containing 16-18 kg compost, 2 kg was
measured into each polyethylene bag in accordance with the number of the treatments and
repetitions. Each treatment contained 3 bags and the experiment was carried out in 3
repetitions. The variety used for spawning was E25 and the moisture content of the compost
was 65%.
Bacterial antagonists
The bacterial antagonists used in the experiment were three different Bacillus sp,
designated E, F and C6. The antagonistic influence of the bacteria on Trichoderma had
previously been demonstrated by in vitro experiments, and they were then identified to
species level using detailed genetic tests (Manczinger, personal communication). The bacteria
were cultured in a liquid medium (0.2% glucose and 0.2% yeast extract) following their
inoculation from a solid substrate. The suspension was incubated with shaking (150 rpm) at
31°C. Bacterial counts were determined spectrophotometrically (Cecil CE1020), where 1 unit
of absorbance corresponded to 108 cells/ml. The suspension was diluted such that 2 x 1010
bacteria were applied to each bag in 20 ml suspension. According to our earlier findings, this
bacterial load was inhibitory to the growth of Trichoderma without having any significant
effect on button mushroom mycelium. The introduction of the bacteria was carried out using
an injection needle and syringe, piercing each bag five times in a design arranged
159
proportionally in space. Inoculation with the antagonists was carried out on the day following
transfer of the bags into the growing room.
Trichoderma species
The pathogens used in the experiment were: Trichoderma agressivum f. europeum
(CBSc),Trichoderma agressivum f. europeum (Hungarian isolate, B1), and Trichoderma
agressivum f. aggressivum (CBSa). The Trichoderma strains were identified based on detailed
genetic and cytological tests at the Department of Microbiology, University of Szeged (Antal
et al. 2005; Hatvani et al. 2005). Propagation of the strains was carried out on a substrate
containing 20 g/l malt extract and 20 g/l fibrous agar at 30 °C. Spores from sporulating strains
were gathered in laminar boxes and then stored in water in a refrigerator until application.
Spore counts were determined spectrophotometrically and 20 ml spore suspension containing
2 x 106 spores was applied to each bag (103 spores/ml compost) on the 7th day after transfer of
the bags to the growing room.
Treatments
A total of 16 different treatments were carried out within the framework of the
experiments: Control: normal growing conditions; E, F, C6: treatments containing only the
suspension of the given bacterium; B1, CBSa, CBSe: bags treated only with the spore
suspension of the given Trichoderma strain; growing blocks treated with the combination of
the antagonists and the Trichoderma species: E+CBSa, E+CBSe, E+B1, F+CBSa, F+CBSe,
F+B1, C6+CBSa, C6+CBSe and C6+B1.
Spawn run
The spawn run was relatively slow to start; therefore, the mouths of the bags were
folded back. The air temperature was maintained between 25 and 28°C. The temperature of
the compost was ~25°C for 8 days and then started to rise. Bags were rolled down on the 9th
day after transfer to the growing room and, in order to prevent the surface from becoming dry,
were covered with newspaper and the paper was watered. By the 14th day after the bags were
transferred, the mycelium had spread over the top of the compost, and casing was carried out
using a thickness of 2 cm. Each treatment had an even colonization. On the 14th day after
inoculation with the Trichoderma spores, no symptoms suggesting infection were observed.
Fruiting was then induced by the gradual and slow cooling down of the growing room. Within
two days, the air and compost temperature was decreased to 22°C, and the relative humidity
was maintained at a constant 80-85%. From the placement of the casing, the surface of the
bags was watered in accordance with the needs of the culture. In order to avoid the spread of
infection from one bag to another, each experimental bag was irrigated individually using low
pressure spraying.
Results
The first fruiting bodies were harvested on the 30th day following placement of the
bags in the growing room. Treatment F-B1 was remarkable in that fruiting commenced earlier
than in controls. A total of two flushes were harvested over the fruiting period which lasted
exactly 15 days. For each treatment, yields were measured and recorded individually at each
picking. When the pattern of accumulated yields over time was considered, there was no
significant difference from the schedule generally practised with button mushroom
cultivation, except that the two fruiting flushes were not sharply separated from each other
and the second flush was more protracted than normal. In the case of the control treatments
and with the three antagonists, the 1st flush was picked over a period of 4 days. The greatest
amounts of fruit bodies were harvested on the 2nd and 3rd days.
160
Figure 1 shows the harvested yields from the individual treatments expressed per 100
kg button mushroom compost. Lowest yields were produced by the combinations E-B1 and
C6-B1. The three antagonists, when considered individually, gave almost the same yields as
the control, and the antagonists designated as F and C6 produced equal or somewhat greater
yields than the control suggesting that these two antagonists were not inhibitory to button
mushroom mycelium growth. Antagonist E by itself has some yield diminishing effect, this
harmful characteristic disappears in the case of two of the three Trichoderma strains (Figure
1). Antagonist E combined with T. aggressivum f. aggressivum or T. aggressivum f. europeum
Figure 1. Respective yields from the different treatments expressed per 100 kg compost
30,0 28,3
24,9 25,2
24,2
25,0 23,1
22,6
21,8 21,9 21,9 22,0 21,6
20,6 20,8
20,0 19,0
15,0
9,9
10,0 8,9
5,0
0,0
C6+B1
C6+CBSa
E+B1
F+B1
C6+CBSe
E+CBSa
F+CBSa
C6
B1
E+CBSe
F+CBSe
E
CBSa
F
CBSe
Control
produced yields that were superior to the untreated control, while it produced a huge drop in
yield in combination with Trichoderma B1 (Figure 1). Although this bacterium by itself
causes a decrease in yields, in the presence of the two Trichoderma strains it can improve
yield stability and increase yield levels. In addition to Trichoderma, red pepper spider mites
were also present in the treatment E+B1 in the 2nd flush, and only very few primordia
occurred (Figure 2).
Extremely high yields were produced in the case of combinations of antagonist F with
T. aggressivum f. europeum (Figure 1). Although the effect of the antagonist was weaker
against T. aggressivum f. aggressivum (CBSa), the results were promising against strains
CBSe and B1. Healthy fruiting bodies produced in the middle of the 1st flush with the
combination F+CBSe are shown in Figure 3.
161
Red pepper
spider mites
a
Figure 2. Part of the 2nd flush from treatment E+B1 showing red pepper spider mites
Almost identical mushroom yields to the control were produced in the case of
antagonist C6 combinations with both T. aggressivum f. aggressivum and T. aggressivum f.
europium, while only low quantities of fruit bodies were produced with antagonist C6
together with Trichoderma B1 (Figure 1). This bacterial strain does not provide sufficient
protection against this isolate during button mushroom production.
Conclusions
Based on our experiments, it can be concluded that the among the antagonist
bacterium strains considered as biocontrol candidates, strains E and F were efficient in the
control of Trichoderma species under in vivo production conditions.
Although the bacterial strains when applied by themselves cause a decrease in average
yields, in cases of green mould infections this harmful effect diminishes and the bacteria
enhance both the yield and yield stability. The yield of first-class button mushrooms was
increased in most of the combinations between antagonistic bacteria and Trichoderma strains.
Unfortunately, a markedly synergetic effect was observed in combinations C6+B1 and E+B1,
i.e. instead of diminishing, the bacteria increased the appearance of the symptoms. Therefore,
these two bacterial strains are completely unsuitable for the biological control of the isolate of
Trichoderma aggressivum f. europeum. Further investigations are needed to decide what are
the suitable doses and combinations of the bacteria for the development of a biocontrol
product. It would also be advisable to study which phase (e.g. compost preparation, spawning,
colonisation, induction of fruiting) is the most appropriate for bacterial application.
162
Figure 3. Healthy fruiting bodies from the middle of the 1st flush from treatment
F+CBSe
Acknowledgements
This research was supported by the National Research and Technology Office, Grant
NKTH 4/033-04.
References
Antal Z, Hatvani L, Kredics L, Szekeres A, Manczinger L, Vágvölgyi C, Nagy E.

2005. Polymorphism of mitochondrial DNA among Trichoderma strains obtained
from mushroom farms. Acta Microbiol. Immunol. Hungarica, 52, 54-55.
Domsch KH, Gams W, Anderson TH. 1980. Compendium of Soil Fungi. Vol.1.,
Academic Press, London. pp794-809.
Geels FP. 1997. Rondetafel-bijeenkomst over Trichoderma. Champignoncultuur, pp
41-43.
Geml J, Hajdú CS, Szarvas J. 2000. Zöldpenészek a gombatermesztésben. Magyar
Gombahíradó, MGOSZ, VIII. évf. 27, 8-9.
163
Grogan HM, Scruby A, Harvey L. 2000. Moulds in spawn-run compost and their
effect on mushroom production. Mushr. Sci. XV. Vol. 2. A.A. Balkema, Rotterdam,
Brookfield, pp609-615.
Győrfi J. 2002. Zöldpenészek, Trichoderma fajok. Magyar Gomba. 18, 28-29.
Hatvani L, Antal Z, Manczinger L, Druzhinina IS, Kubicek CP, Szekeres A,
Vágvölgyi C, Nagy E, Kredics L. 2006. Monitoring the occurrence of Trichoderma
species during compost production and cultivation of Agaricus bisporus in Hungary.
Acta Microbiol. Immunol. Hungarica, 53, 272.
Hatvani L, Antal Z, Manczinger L, Szekeres A, Druzhinina IS, Kubicek CP,
Nagy E, Vágvölgyi C, Kredics L. 2007. Green mold diseases of Agaricus and
Pleurotus spp. are caused by related but phylogenetically different Trichoderma
species. Phytopathology, 97, 532-537.
Hatvani L, Kredics L, Szekeres A, Antal Z, Nagy E, Manczinger L, Vágvölgyi C.
2005. Genetic diversity of Trichoderma strains and occurrence of T. aggressivum in
Hungarian mushroom compost and substrate samples. Acta Microbiol. Immunol.
Hungarica 52, 55.
Oei P. 2003. Mushroom cultivation. Backhuys Publishers, Leiden, The Netherlands.
pp378-379.
Rinker DL, Alm G. 2000. Management of green mould disease in Canada.
Mush. Sci., XV. Vol.2. A.A. Balkema, Rotterdam, Brookfield, pp617-623.
Vajna L. 1984. Trichoderma fajok és alkalmazásuk a növényi gombabetegségek elleni
védekezésben. Növényvédelem XX. pp193-201.
164
Factors Affecting Ergothioneine Content in Button Mushrooms

Robert Beelman and Hyun-Ju Lee,
Department of Food Science, The Pennsylvania State University, University Park, PA 16802,
USA. Email: rbb6@psu.edu
Abstract
L-Ergothioneine (ERGO) is a naturally-occurring 2-thio-imidazole amino acid

biosynthesized primarily by fungi and a few bacteria. ERGO is a potent antioxidant and
cellular protector. A preliminary survey indicated that Agaricus bisporus strains contained
significantly lower levels of ERGO than Lentinula edodes, Pleurotus ostreatus, Pleurotus
eryngii and Grifola frondosa. Brown strains of A. bisporus were found to contain higher
levels of ERGO than the more commonly consumed white strains. Hence, studies were
conducted to determine if ERGO content in the button mushroom could be increased to higher
levels. Studies indicated that ERGO concentration in mushrooms appeared to be increased by
several stress factors, such as the use of dry substrate, breaking the mycelium in the substrate
at casing and harvesting mushrooms from the later flushes of its crop cycle. This research has
demonstrated that button mushrooms grown in dry compost and obtained from the end of the
third flush contained ERGO levels of 2.1 and 1.8 mg/g d.w. for brown and white strains,
respectively. These data indicated that button mushrooms can potentially contain ERGO
levels about 5-10 times higher than previously observed or as high as those found previously
in specialty mushrooms. It was also determined that ERGO levels declined with levels of
maturity at harvest such that buttons contained higher levels of ERGO compared to open
mushrooms. ERGO levels were similar in cap and stipe tissue but were lower in gill tissue in
mushrooms harvested at full maturity. A storage experiment revealed that ERGO levels in
freeze-dried portabella powder declined steadily over time in storage. ERGO concentrations
were reduced by 40 and 42 percent after 8 weeks at 4 OC and 23 OC, respectively.
Key Words: Agaricus bisporus; L-Ergothioneine; Antioxidant; Stress factors; Radical

scavenger
Introduction
Cultivated mushrooms are a rich source of several antioxidants and other bioactive
components (Dubost et al. 2007b). They are an excellent natural source of a potent
antioxidant, produced primarily by fungi, called ergothioenine. Ergothioneine (ERGO) is a
naturally-occurring 2-thio-imidazole amino acid (Figure 1) biosynthesized only by fungi and
mycobacteria (Melville, 1958). ERGO is a potent antioxidant and cellular protector that has
been shown to aggressively scavenge singlet oxygen, peroxyl and hydroxyl radicals. It was
recently discovered that mammals produce a genetically-coded ERGO transporter
(Grüdemann et al. 2005) that carries ERGO to the red blood cells. ERGO presumably gets
into the human food chain through plants that take it up from soil, where it is produced by
fungi, and from meat obtained from animals that absorb if from grazing grasses or plant-based
feeds.
Research by Dubost et al. (2006) demonstrated that ERGO is concentrated in
mushrooms in the range of 0.2-2.1 mg/g, d.w. These levels make mushrooms the best source
of ERGO in the human diet, since they provide significantly more ERGO than chicken livers,
previously believed to be the best sources of ERGO (Ey et al. 2007). Recently, interest in the
165
CO2-
N NH N(CH3)3
+
SH
Figure 1. Structure of L-ergothioneine (ERGO)
nutritional and medical implications of bioactive compouns of mushroom, such as ERGO, has
increased greatly (Clemens & Dubost, 2007). One recent study (Deiana et al. 2004)
demonstrated that pure ERGO administrated to rats protected against liver and kidney damage
due to lipid peroxidation and also reduced consumption of endogenous glutathione and α-
tocopherol. The authors suggested that consumption of mushrooms would be the preferred
dietary source of ERGO. Another study showed that ERGO inhibited TNF-α-mediated HIV-1
LTR activation. Thus, it could be of benefit in controlling chronic immunodeficiency diseases
(Xiao et al. 2006). Grigat et al. (2007) suggested that “supplementation of ERGO to correct a
dietary deficit could provide a new therapeutic strategy for chronic inflammatory diseases.”
Previous research (Dubost et al. 2006) demonstrated that the button mushroom (A.
bisporus) contained significantly lower levels of ERGO than L. edodes, P. ostreatus, P.
eryngii and G. frondosa. Brown strains of A. bisporus were found to contain higher levels of
ERGO than the more commonly consumed white strains. Subsequent studies (Dubost et al.
2007a) were conducted to determine the influence of selected cultural practices that affect
ERGO content in white button mushroom. For example, addition of histidine (a precursor of
ERGO biosynthesis) increased ERGO levels especially in the later flushes of the crop cycle.
ERGO also increased when mycelial growth in the substrate was increased, and by several
stress factors, such as use of dry substrate. Hence, this study was initiated to evaluate the
potential for determining other factors that could possibly increase ERGO levels in button
mushrooms.
Materials and methods
Preparation of samples for ERGO analysis

Based on knowledge obtained from previous research that ERGO may be a stress
metabolite, it was decided to evaluate ERGO levels in button mushrooms harvested from the
last day of the third flush of crops grown in dry compost. Mushrooms of all stages of maturity
were represented which allowed for evaluating ERGO content as affected by maturity of the
mushrooms at harvest.
Mushrooms (brown strain of A. bisporus) were obtained from Crop No. 3502 grown at
the MTDF on dry compost (67% moisture at spawning). Mushrooms were separated into
different stages of maturity, freeze-dried, and ERGO levels were determined. A similar
experiment was conducted with a white strain of A. bisporus obtained from the last pick of the
third flush of a crop at Modern Mushroom Farm, Inc. The different stages of maturity are
shown in Table 1.
166
Table 1. The five stages in the development of harvested mushrooms
Stage Description
1 Veil intact (tight)
2 Veil partially broken
3 Veil completely broken
4 Veil open, gills well exposed
5 Veil open, gill surface flat
Methods employed to determine ERGO levels in mushrooms were similar to those

used by Dubost et al. (2006). Harvested fruit bodies were transferred immediately from the
growing facilities to the laboratory. Mushrooms were then separated into different states of
maturity. In some cases, open mushrooms were dissected into various tissues as described by
Miklus & Beelman (1996). The mushrooms were cleaned, sliced, then freeze dried (Model 15
SRC-X), ground to a fine powder, and sieved through a size 16 mesh screen. The mushroom
powder was collected in sterile sample bags (Fisher Scientific, Pittsburgh, PA) and stored in
desiccators over CaSO4. One gram of freeze-dried mushroom powder was dispersed in 20 ml
of cold ethanolic extraction medium (10 mM DTT, 100 mM betaine, and 100 mM MMI in
70% ethanol) and mixed. A 0.1% ethanol solution (4 ml) of SDS was added and gently mixed.
Centrifugation (Allegra 6R; Beckman Coulter, Fullerton, CA) was completed, with 1.0 ml of
the supernatant evaporated with a Speedvac concentrator (AES 2000, Savant, NY). The
residue was then resuspended in 0.5 ml of water (adjusted to pH 7.3) and micro-centrifuged
(Eppendorf 5415D, Brinkmann, NY). The supernatant was filtered through a 0.45 μm filter
(Nalgene) prior to High-Performance Liquid Chromatography (HPLC) (Model 1050, HP).
Further details of the extraction procedure are outlined by Dubost et al. (2006). The method
used to quantify ERGO in the mushroom is described in detail by Dubost et al. (2006).
Analysis was conducted using an HPLC (1050 system, HP) with separation carried out on two
Econosphere C18 columns (Alltech). An isocratic mobile phase of 50 mM sodium phosphate
in water with 3% acetonitrile and 0.1% triethylamine adjusted to pH 7.3 was used at a flow
rate of 0.8 ml/min. A DAD detector (HP) set at a wavelength of 254 nm was employed.
Results and discussion
The results of the first experiment (Figure 2) demonstrated that high levels of ERGO
were present in mushrooms harvested on the last day of the third flush of the crop cycle and
grown on dry compost. ERGO levels of 2.1 and 1.8 mg/g, d.w. were observed in the brown
and white strains, respectively, in mushrooms harvested at the tight button stage (stage 1) of
maturity. ERGO levels were reduced steadily in mushrooms harvested at more mature stages
(#2-5). These data indicated that button mushrooms can produce high levels of ERGO,
comparable to those reported previously in specialty mushrooms (Dubost et al. 2006). This
study also demonstrated that a brown strain accumulated higher levels of ERGO compared to
a white strain, and those harvested as tight buttons (criminis) contained more ERGO than
open mushrooms (portabellas). These mushrooms were grown on compost with lower than
normal moisture (67% compared to normal level of 72%). These results give additional
support to the theory that ERGO is a stress metabolite. Previous research in our laboratory
(Beelman & Simmons, 1996) demonstrated that tyrosinase, a stress metabolite, also increased
in the later breaks of mushrooms and when grown on dry compost.
167
3.0
Stage 1
2.5 Stage 2
ERGO concentration (mg/g, d.w.)
Stage 3
Stage 4
Stage 5
2.0
1.5
1.0
0.5
0.0
Brown White
Figure 2. ERGO concentration in brown and white strains of A. bisporus

mushrooms harvested at different stages of maturity.
The data presented in Figure 3 illustrates ERGO concentrations in different tissues of

white and brown strains of button mushrooms harvested at full maturity. The data indicate
that cap and stipe tissues contained higher ERGO levels compared to gill tissue. This
observation appears to conflict with the report of Ey et al. (2007) who found that Boletus
edulis and P. ostreatus contained much higher levels of ERGO than button mushrooms. They
speculated that this difference was likely due to the possibility that ERGO is synthesized by
fungal spores and not the mycelium. However, our work reported in Figure 3, demonstrated
that gill tissue contained less ERGO than cap or stipe despite containing more spores.
In most of the experiments conducted for this report, ERGO analyses were conducted
on freeze-dried mushroom powder within a week after preparation. However, in same cases,
the powders were stored for extended periods of time for evaluation and indications of
declining ERGO concentrations over storage were observed. Hence, the experiment with data
illustrated in Figure 4 was conducted. These data clearly indicated that ERGO levels declined
significantly (41-42%) over an 8-week storage period. However, the rate of decline appeared
not to be influenced by storage temperature within the range of 4-23oC. This relative
instability of ERGO in freeze-dried mushroom powder indicates the need to evaluate the
nature of this decline and the ramifications that it may have on the nutritional/medicinal value
of ERGO in cultivated mushroom. This will be a focus of some future studies in our
laboratory.
Conclusions
This study clearly demonstrates that common button mushrooms can produce large
quantities of ergothioneine (ERGO) when grown under conditions that can beconsidered to
induce stress to the crop. In this case, the stress conditions were drier than normal compost
and harvesting on the last day of the third flush. This study also demonstrated that mushrooms
harvested at an immature stage of maturity (tight button stage) contained more ERGO than
those harvested at the same time but at a more mature stage. These findings do indicate the
168
possibility to manipulate cropping procedures to enhance ERGO levels in button mushrooms
to levels of 5- to 10-times greater than previously observed (Dubost et al. 2006). However,
future studies are needed to determine if this can be accomplished in a commercially practical
manner.
3.0
Whole
2.5 Cap
ERGO concentration (mg/g, d.w.)
Gill
Stipe
2.0
1.5
1.0
0.5
0.0
Brown White
Figure 3. ERGO concentration in button mushrooms harvested fully mature (stage 5)

and dissected into cap, gill and stipe tissues.
1.2
Storage at 23C
1.0 Storage at 4C
ERGO (mg/g, d.w.)
0.8
0.6
0.4
0.2
0.0
0 2 4 6 8
Week
Figure 4. Decline in ERGO concentrations in open (stage 5) mushroom powders made

from fully-mature (stage 5) brown mushrooms following storage at 23 OC and 4 OC.
169
References
Beelman RB, Simons SS. 1996. Influence of selected cultural factors on relative
tyrosinase activity in cultivated mushrooms. p. 543-551. In: Mushroom Biology
and Mushroom Products, Royse D.J. (Eds.). The Pennsylvania State University
Press, USA.
Clemens R. Dubost J. 2007. The mushrooming health benefits of fungi. Food
Technol., 8, 17.
Deiana M, Rosa A, Casu V, Piga R, Dessi MA, Aruoma OI. 2004. L-Ergothioneine
modulates oxidative damage in the kidney and liver of rats in vivo: studies upon the
profile of polyunsaturated fatty acids. Clin. Nut., 23, 183-193.
Dubost NJ, Beelman R, Peterson D, Royse D. 2006. Identification and quantification of
ergothioenine in cultivated mushrooms using liquid chromatography-mass
spectroscopy. Intl. J. Med. Mushr., 8, 215-222.
Dubost NJ, Beelman RB, Royse DJ. 2007a. Influence of selected cultural factors and
postharvest storage on ergothioneine content of common button mushroom Agaricus
bisporus (J. Lge) Imbach (Agaricomycetideae). Intl J. Med. Mushr., 9, 163-176.
Dubost NJ, Qu B, Beelman RB. 2007b. Quantification of polyphenols and ergothioneine
in cultivated mushrooms and correlation to total antioxidant capacity. Food Chem.
105, 727-735.
Ey J, Schömig E, Taubert D. 2007. Dietary sources and antioxidant effects of
ergothioneine. J. Agric. Food Chem., 55, 6466-6474.
Grigat S, Harlfinger S, Pal S, Striebinger R, Golz S, Geert A, Lazar A, Schömig E,
Gründemann D. 2007. Probing the substrate specificity of the ergothioenine
transporter with methimazole, hercyneine, and organic cations. Biochem. Pharmacol.,
74, 309.
Gründemann D, Harlfinger S, Golz S, Gerrts A, Berkels R, Jung N, Rubbert A, Schömig
E. 2005. Discovery of the erghothioneine transporter. Proc. Natl. Acad. Sci., 102,
5256-5261.
Melville DB. 1958. L-Ergothioenine. Vitamins and Hormones 17, 155-204.
Miklus MB, Beelman RB. 1996. CaCl2 treated irrigation water applied to mushroom
crops (Agaricus bisporus) increases Ca concentration and improves postharvest
quality and shelf life. Mycologia, 88, 403-409.
Xiao L, Zhao L, Li T, Hartle DK, Aruma OI, Taylor EW. 2006. Activity of the dietary
antioxidant ergothioneine in a virus gene-based assay for inhibitors of HIV
transcription. BioFactors, 27, 157-165.
170
Mycotherapy − Treatment with Medicinal Mushrooms

Susanne Ehlers
Weidenstrasse 4, 85368 Wang, Germany. Email: dr-ehlers@fairlife.org
Abstract
Mushrooms belong to the oldest natural remedies of mankind. In Asia their application
in medicine have been used for thousand of years but in the last years in Europe there has
been also an enormous increasing interest in their application for preventive and curative
purposes. Medicinal mushrooms have already a strong scientifically based potential in
immunotherapy, for example, as an alternative cancer treatment to complement or even to
substitute chemotherapy or radiotherapy. A detailed overview of the following eight most
important medicinal mushrooms (Ling Zhi/Reishi, Shiitake, Cordyceps, Maitake, Hericium,
Coprinus, Auricularia, and Polyporus) will be provided and their traditional application area
will be outlined. Having regards to the available analysis results of the respective ingredients,
it will go into nutritional and pharmacological meaning of each medicinal mushroom. The
results of the latest research and studies concerning the application of individual medicinal
mushrooms in numerous diseases and disturbances will be compiled and evaluated with
regard to the consequences for the practical and therapeutical action. The centre of interest
will be the experiences in the treatment of diabetes, hypertension, lipid metabolic disorder,
overweight, allergies, psychosomatic disorder as well as the possibility of immune system
stabilisation and the combat of various cancers. In this lecture, will be discussed some
methods of cultivation, harvesting and processing of medicinal mushrooms into the
corresponding products. The correct application of medicinal mushrooms products will be
explained in detail and the answers to questions about dosage, mixtures, administration forms
and accompanying symptoms will play also an important role. The lecture will conclude with
the incorporation of mycotherapy in other naturopathic treatments.
Key Words: Medicinal mushrooms; Mycotherapy; Lentinula edodes; Ganoderma ludicum;

Naturopathic treatments
Introduction
My name is Dr. Susanne Ehlers. After my high school diploma, I completed a garden
apprenticeship (Horticulture) and afterwards I studied Horticulture Science at the Humboldt
University in Berlin.
At this time, my interest was already focused on the nutrition- physiological meaning
of secondary plants and mushrooms substances.The title of my thesis at the Technical
University of Munich was: “Investigations on the cultivation and pharmacological meaning of
the Chinese medicinal and edible mushroom Hericium erinaceus”. I gave several lectures and
authored a book. In 2004, I was co-founder of The Incorporated Society of Medicinal
Mushrooms, later renamed to The Incorporated Society of Medicinal Mushrooms Science
e.V. We advised numerous people on the telephone and via e-mail relating to mushroom
applications. I work now at an international level together with the Fairlife group
(www.fairlife.org). I visit original areas of cultivation and I continue advising people about
medicinal mushrooms and train alternative practitioners. The knowledge regarding the
production, application and combination of mycotherapy with other naturopathic therapies is
constantly growing.
171
Mushrooms have their own kingdom; they are fundamentally different from plants and
animals. They produce chitin like insects in their cell wall, bio vital substances, like in no
other plant. Mushrooms are heterotrophic like human beings. Medicinal mushrooms are
macrofungi and they are applied for healing purposes. They have illustrious names like
“Divine mushroom of immortality”– Reishi, and they were offered to the imperator as a
tribute. Nowadays, some species can be cultivated so that more and more people can benefit
from their applications. Mushrooms have an incredible preventing and healing potential!
The main effect of medicinal mushrooms is detoxification, they are the strongest
known immune modulators and they act as catalysers, in which trace elements boost the
enzyme creation. Their antiviral, antifungal, antibacterial, tumour inhibitory, antiallergic,
analgesic and antioxidative effects have already been analysed and confirmed. Medicinal
mushrooms act as adaptogens, they cause no dependence and they are known as Biological
Response Modifiers (intelligent, regulative). Fundamental are the benefits without side-
effects. The active principle is the homeostasis process, the maintenance of the internal
environment within tolerable limits.
The application of mushrooms in human health has a long tradition and gradually the
immune stimulation and cholesterol-lowering effects are also confirmed by science. It was
also demonstrated that some mushrooms have secondary nutrients which stimulate the
productions of T-lymphocytes, Nk-cells (natural killer cells), interferon, interleucin and
macrophages (scavenger cells). T-Lymphocytes are also called T-helper-cells. They form an
“army defense” against undesired intruders in our organism.
Mushrooms are not only tasty, they are also very healthy due to the favourable
composition of their nutrients. Numerous minerals and vitamins belong to these nutrients,
especially the B-group. The B-vitamins are rarely found in other vegetables. Mushrooms are
rich in dietary fibre, which we normally find in low quantities in our food and are rich in trace
elements, fundamental to our lives, but only in tiny quantities; not to mention the other
essential amino acids, the building blocks of proteins. It is important that all these nutrients
are bioavailable, which mean these nutrients can be absorbed and used by the body. And all of
this by a very low mushrooms energy value, low calories, such as in salad or vegetables.
Energy in a compact way!
Some of the benefits include the decrease of the cholesterol level, thus preventing
arteriosclerosis, and weight reduction. Other healing effects are known and partially
documented through clinical studies in diseases such as gastritis, hepatitis, arthritis, allergies,
oedemas and others. Mushrooms like Maitake, Shiitake, Hericium and Reishi are already
applied successfully in the alternative cancer therapy, because their specific polysaccharide
complexes stimulate the immune system of the human organism.
The concept of Mycotherapy (analogous: healing treatment with mushrooms and
substances of mushrooms) was only characterized in 1974. At that time, the first congress
about the healing effect of mushrooms took place. In Tokyo, scientists met at the
“International Mycological Association” and, for the first time, they exchange experiences
regarding this subject. Thus, traditional knowledge and the first results of scientific research
also reached Europe. Since then the flood of information about mushrooms, which have the
ability to heal, never stopped.
Important mushrooms and their effects
Shiitake
Shiitake (Lentinula edodes) is considered the king of mushrooms and is, after the
champignon, the most consumed mushroom in the world. Shiitake is a white rot fungus,
which lives only in dead wood, among others in oaks, beech and chestnuts. In China and
Japan it is known for 200 years as a delicacy and excellent remedy. Since the beginning of the
172
1970s, Shiitake gained popularity in North America and in Germany. It smells like garlic and
is very spicy when dried. A doctor of the Ming-Dynasty wrote: “This mushroom is an agent
for the preservation of health, heals colds and stimulates the bloodstream.”
An analysis concerning the ingredients/nutrients showed that 100 g dried mushroom
contained 0.4 mg thiamin, 0.8 mg riboflavin and 12 mg niacin. In addition, the mushroom
contains ergosterol and eritadenin. It is rich in calcium and phosphorus, as well as in iron and
zinc.
Polysaccharides could be isolated from the fruiting body and also from the mycelium
of the Shiitake mushroom. A polysaccharide, lentinan, activates the immune response and
retards tumour growth. It also enhances insulin production. In Japan, lentinan is already
allowed as a medicament in the treatment of stomach cancer.
It is believed that Shiitake is especially effective in the cancer of the digestive system
including liver and pancreas as well as lung- and ovarian cancer. It boosts the immune system
and has antiviral, liver protection and cholesterol reducing characteristics. Japanese results of
research from the 1960s and 1970s, showed that Shiitake mushroom could be applied
effectively in migraine, bad blood circulation, smoker’s leg, stroke, (articular) gout,
rheumatism, chronic fatigue syndrome, cirrhosis, hepatitis B, gastric ulcer, diabetes, allergies,
autoimmune diseases and tumours. Regulative and healing effects could be seen on high
blood pressure, arthritis, tumour diseases of the digestive system and the liver, cold and low
immunity.
Case report: I am self-employed for 30 years now… got a bypass operation and as result my
heartaches increased…consumed a lot of medicaments like Beta Blocker, nitro products and
diuretics…it is a year now since I start taking Shittake mushroom in capsules: the pains
disappeared, the blood pressure is normal. I stopped taking the medication and I feel great
again!
Reishi – Ling Zhi

Reishi (Ganoderma ludicum) is also called “lingzhi” because of its appearance. In the
Chinese and Japanese traditional medicine Reishi is highly regarded as a remedy for more
than 4000 years (!). The extraordinary mushroom, equipped with numerous properties, is only
cultivated for healing purposes. Exceptionally, it does not belong to the edible mushrooms,
because of its pulp which is extremely hard and not delicious. In Europe, we can also find
Reishi in alluvial forests, in common hornbeam forests and in dry and warm oak forests.
The knowledge about the benefits of Reishi also comes from China. Above all it is
rumoured to be a cancer remedy. Besides pharmacological effects, mental effects were also
attributed to this mushroom. Reishi is seen as a symbol of luck, long life and even
immortality. That is the reason why it is reproduced in a lot of drawings, carpets as well as in
porcelain from China. Reishi is called “Ling Zhi” in China. Ling Zhi means “spiritual plant”,
respectively “plant of immortality”. “Zhi” is also interpreted as a divine medical plant. In
China’s most famous book about the natural history from the year 1578, it is said that the
regular ingestion of “Ling Zhi” leads to weight reduction and increases life expectancy.
Reishi has a very positive effect in the following diseases: nervous debility, breathlessness,
insomnia, chronic hepatitis, renal pelvis inflammation, high serum cholesterol level, high
blood pressure, cardiopathy, deficit of white blood cells, cold, bronchitis, asthma, stomach
and duodenal diseases.
Anti-allergic effects are also known. There are especially two types of substances in
Reishi which are understood as being very active. One of them is the polysaccharides, whose
effects in tumour retarding and immune system stabilization were demonstrated. The other
group is made up of triterpenes, a specific group of hydrocarbons, to which also belong the
high active ganoderic, ganolucid and lucidemic acids. According to presented cognitions, they
173
prevent liver insufficiency, reduce high blood pressure and inhibit cholesterol synthesis and
histamine release influencing the development of allergies and asthma.
Sterines, lactones, alkaloids, polysaccharides and over 150 different triterpenes have
been found in considerable quantities in Reishi. Also important are the minerals and trace
elements such as calcium, zinc, manganese, iron, copper and germanium. A wide range of
applications of this healing mushroom are known, due to the above mentioned positive effects
in numerous diseases. The fruiting body powder is effective in asthma, chronic bronchitis and
it can protect the liver. The white blood cells as well as the platelet production are increased.
Reishi has a calming effect and is applied during convalescence. Furthermore, Reishi can
decrease the blood lipids and can help heartache and cardiac insufficiency. Reishi is also
applied in fatigue, cough, insomnia, indigestion and cardiac arrhythmia manifestations. Reishi
can successfully be used in problems such as chronic trachea inflammation (tracheitis),
bronchial asthma, leucopoenia (a reduction in the number of white blood cells in the blood),
and narrowed coronary blood vessels. Experiences and examinations showed that Reishi
calms the nervous system and can therefore help in insomnia. The speed at which you fall
asleep as well as the sleep duration was improved. The ganoderic acid, the oleic acid and
cyclooctasulphur block the histamine distribution and can so prevent the allergic reaction of
Type I and IV. Reishi is also helpful in food sensibility and neurodermatitis. Further
investigations have shown that Reishi has special producing functions in nicotine abuse. The
disease symptoms caused by smoking could be reduced in 25%. Due to the better oxygen
absorption of the blood by the administration of Reishi, the chances of survival of someone
who suffers from the mountain sickness increased extremely.
An enhancement of the blood circulation in the brain and of the myocardial muscle
has been detected in examations, which means that Reishi can be applied in brain activity and
cardiac insufficiency. One of the main causes of cardiac insufficiency is the absence of bio
vital substances (vitamins, amino acids, enzymes and minerals) in the heart muscle cells,
which are responsible for the pump function and therefore responsible for an excellent blood
circulation. Reishi contains especially these important bioenergetics substances for the heart
muscle. Reishi also showed effects in cardiovascular diseases, hepatitis, allergies, overweight,
insomnia, exhaustion, in the cancer therapy (stomach, liver, lung, skin, brain, and kidney) and
in tinnitus when ingested by people.
Case report: Mr. K suffered for more than ten years from a peptic ulcer, which caused him
disturbances day and night. In a short time his state worsened so drastically, that he couldn’t
sleep some nights because of the pains. Friends told him to use Reishi, which is applied in the
traditional Chinese medicine. Before Mr. K had tried several other medicaments, but he
noticed no pain relief. He could not eat, and the constant pain was a torture to his body and
soul. Mr. K was very sceptical when they told him to take the mushroom. According to his
patient file he was in a critical condition. As he finds out that Reishi does not have any
adverse side-effects and that it would also help in other complaints, he decides to take it. Mr
K. tells: “After only one week the complaints disappeared and my appetite returned. I also
looked much healthier. After taking Reishi for five weeks, it seemed unbelievable that I had
suffered so long in pain! The doctor confirmed the complete cure.”
Hericium
Hericium (Hericium erinaceus) is also called Lion’s Mane Mushroom or Bearded
Tooth Mushroom. The mushroom grows on red hard wood like elm, oak and beech as well as
on Japanese walnuts. Hericium belongs to the white rot mushrooms, which destroy the wood.
If it is air-dried and applied medicinally it is named “Houtou” (monkey head mushroom). This
is the exact translation of the Chinese characters, because there are monkeys in China, which
are so hairy that you cannot see their faces. Hericium is an excellent edible mushroom, very
174
widespread and appreciated in China and Japan. After all, it contains 32 different flavouring
agents. In China, it was offered formerly to the imperator instead of a tribute of gold.
Hericium has a plurality of bio vital substances. Important for the human alimentation are also
a multiplicity of trace elements and all eight essential amino acids. Concerning the elements
such as zinc, iron, selenium and germanium we can speak about a natural power package with
low calories.
A set of substances, which belong to different substance classes, were isolated from
Hericium such as special fatty acids, phenols (hericenone, hericene) as well as Vitamin D
(ergosterol), lectins and antimicrobial active substances. In the minerals was found a
correspondence with the values of other edible mushrooms. Apart from high potassium values
(254 mg) and phosphate values (109 mg), were also detected low sodium values (8 mg) in 100
g fresh substance. Therefore, we can evaluate the relation between sodium and potassium as
being very beneficial.
The medicinal benefits are especially positive in stomach disturbances and in the
cancer therapy. Furthermore Hericium is used in ulcers and inflammations as well as in
agitation. Researches have shown that the mushroom can be successfully applied in
stomach ulcers, stomach cancer and duodenal ulcer as well as in oesophagus cancer and
polypeptides, which allow the immune system to detect cancer cells and to kill the
malignant cells with the increased formation of T-lymphocytes (T-helper-cells) and
macrophage (scavenger cells) such as other complicated immunological effective
mechanisms. In a study with patients, who suffered from gastritis, 82% showed an
improvement relative to the symptoms and to the clinical values and on 58% was
diagnosed a complete decrease of the inflammation. The gastric mucosa was restored
again. Japanese scientists found other interesting substances in Hericium such as
erinacine, which stimulates the Nerve Growth Factor (NGF). This can be useful in the
treatment of nerve diseases like Alzheimer. The active antibacterial substances can
explain the anti-inflammatory effects of Hericium as described in the literature. From
major importance is also the referred brightening mood effect caused by this mushroom.
Agitation and sleep disorders can be improved through the consumption of pressed
mushroom juice, because it balances our nerves. Positive patient experiences were
achieved in gastritis, inflammations, stomach ulcer and oesophagus mucosa, reflux,
cancer, anxiety and depression, menopause discomfort, overweight and in
accompaniment of chemotherapy (appetite, hair loss) agitated legs and insomnia.
Case report: My weight was not only a beauty problem. The tiredness that I felt during the
day and the aversion to all movements, as well as high blood pressure were very difficult for
me. I took Hericium and Polyporus and also Cordyceps and after a month I was feeling
better. Now, after 6 months, I am free of all agony, I enjoy standing up and enjoy looking at
my body with 10 Kg less. My blood pressure decreased to the normal values of 120 to 85 and
I am surprised about my vitality.
Against the disturbances and inflammations caused by Morbus Crohn, Mr. S. took the
Hericium mushroom. After 2 or 3 days he could notice an improvement of his condition and is
now very satisfied.
Umbrella polypore
The Umbrella polypore (Polyporus umbellatus) grows from June to October, on
withered beech and maple trees roots. It can also be found in German forests. Its sclerotium,
called zhuling, is a crude drug commonly used for urological disorders in Chinese medicine.
In this mushroom were found egosterin, α-hydroxytetracosan acid, biotin as well as
polysaccharides and polypeptides. In the dried substance of the fruiting body was found 7.9%
crude protein, with 45.6% of fibre, 0.5% carbohydrate and 6.6% minerals. In the minerals
175
were found considerable quantities of calcium, potassium, iron, and a little sodium and as
trace elements, manganese, copper and zinc. Trace elements are much more important for our
nutrition than assumed until now. Manganese is, for example, important in the growth control,
in the function various enzymes, for the nerves and for healthy bones. Copper is responsible
for the creation of red blood cells, for the numerous enzymes properties and for the bone
growth. A sufficient supply of zinc causes the release of insulin and vitamin A, and is
necessary for the reproduction and healing of wounds.
The main field of application of sclerotia from the Umbrella polypore is in
dehydration – it acts as a diuretic. In the traditional Chinese medicine is mentioned that
Umbrella polypore improves the structure of the skin, relaxes the muscular tissue, opens the
pores of the sweat glands and eases urination during the pregnancy.
Umbrella polypore also helps in oedemas, diarrhoea and icterus. Tests of the modern
medicine confirm the data/information and experiences of the old China. There was an
increase of water-, sodium- and chloride excretion by administering Umbrella polypore and
the effects were as potent as conventional medicaments. Therefore, the important difference is
that by administering medicaments always occurs a high potassium excretion, which appears
to be prejudicial because potassium apprehends important functions in the organism.
Potassium is important for the function of the muscles and nerves in the organism; it regulates
the fluid balance and maintains the acid-base equilibrium in the organism. Sclerotium extracts
of the Umbrella polypore have also tumour-inhibiting effects due to the production restraint of
deoxyribonucleic acid in the tumour cells; according to this their genetic information material
is no more produced. The side-effects of the chemotherapy are also reduced. In clinical tests,
healing promotional effects were diagnosed in lung cancer and leukaemia. According to a
treatment study, 86% of the patients responded positively to the treatment with Umbrella
polypore. Patients reported positive effects relative to oedemas, decrease of blood lipids,
reduction of the secondary blood pressure values, skin disorders, lymph stimulation,
overweight, haemorrhoids and cancer.
Shaggy mane
You probably know this mushroom because it grows solitary, scattered, or clustered
on lawns, in pastures, or along roadsides in the summertime. Shaggy mane (Coprinus
comatus) is one of the distinctive ``inky-cap'' mushrooms whose gills and flesh darken and
dissolve into an inky-black mess. The fruiting body of Coprinus has 8-13% of dry substance.
This dry substance consists of 22-38% crude protein. In the protein were detected 20 free
amino acids, among these, the eight essential amino acids. 100 g dry substance contains,
among others, 930 mg potassium, 74 mg magnesium, 2 mg iron, 27 mg calcium, 1 mg
manganese, 3 mg zinc, 1 mg copper, 74 mg vitamin C, 39 mg niacin, 3 mg riboflavin and 1
mg thiamine.
In the far eastern popular medicine, the ingestion of Coprinus is recommended for the
promotion of digestion and for the treatment of haemorrhoids. Chinese scientists
demonstrated in experiments a 100% inhibition regarding the growing of sarcoma (a cancer of
connective or supportive tissue) and a 90% inhibition of the so called Erlich´s carcinoma due
to Coprinus. Very interesting is also the blood sugar lowering effect caused by Coprinus.
Coprinus can be applied in diabetes I and II, arteriosclerosis, digestion disturbances,
haemorrhoids, sarcomas and inflammations.
Case report: Mrs. H suffers from diabetes. Only with 3 Coprinus capsules she has solved her
diabetes problem. She eats normally again and does not need to think about her diabetes
every time she eats.
176
Maitake
Maitake (Grifola frondosa) is called actually “Dancing Mushroom” but it is also
translated as “Henn of the woods”. This is probably because of its growth habit. This
mushroom was so precious and rare, that its reference/source was concealed. But since the
beginning of the 1980s, this mushroom, which grows especially in East Asia, North America
and Europe, is also cultivated on sawdust. Maitake can be found in the bottom of oaks and
sweet chestnut. The fruiting body, which has a considerable height of 50 cm and also a
considerable weight (can reach up to 15 kg) looks like a leafier bush and is composed of
numerous grey-brown huts.
For hundreds of years, the Japanese people have appreciated the benefits of Maitake.
There is not much information about the single substances, but the value of ergosterol and the
pre-stage of Vitamin D are remarkable. In 100 g of fresh mushroom are 50-150 international
units, vitamin D promotes the calcium absorption and helps to prevent osteoporosis and
rachitis. In experiments, it was proved that the use of alcoholic extracts from maitake
mushroom has antihypertensive effects and the use of an aqueous extract decreases the
cholesterol. This mushroom can also be used as a liver protecting agent. Maitake decreases
the blood sugar by diabetes II. A special meaning has the substance mixture of Maitake, a
protein-bound polysaccharide, which acts as an immune modulator. Until now, the
polysaccharides found in healing mushrooms have more success in the combat against cancer
diseases. It is especially efficient when combined with Vitamin C and it does not disintegrate
in the gastrointestinal tract.
Prof Nanba carries out researches for more than 30 years now in Japan about breast
cancer and Maitake extract. In experiments was already demonstrated that this polysaccharide
can stop the growth of cancer cells. This occurs due to the stimulation of microphages and T-
lymphocytes. A destruction of T-lymphocytes through the HIV-virus, for example, is avoided.
In the near future more tests will be conducted relative to these effects. Maitake can also be
applied in chemotherapy to help reduce the strong side-effects. Patients’ positive experiences
are available in cancer (breast, pancreas, skin, lung and prostate), diabetes, AIDs,
osteoporosis, arteriosclerosis and irritable colon.
Case report: After an intestinal operation to remove a rectal carcinoma and a posterior
removal of a liver carcinoma Mrs. H took Maitake and Shiitake extracts for the improvement
of her well-being and to fight other cancer cells in chemotherapy. She is very satisfied and
will take these mushrooms and the ABM also during the next radiation. Her general condition
is very good. She has no restrictions caused by the chemotherapy, allows herself calmness
and ascribes the good well-being to the mushrooms, which shows up in the blood values.
Jew´s ear
A legend tells that on the tree where Judas hanged himself grew an ear shaped fungus.
That is the reason why, nowadays, these little unimpressive fruiting bodies of the “Auricularia
polytrichna” have this name. There are four species, which are known for a long time now,
and that have an impressive medicinal effect.
The mushrooms are 3-10 cm broad, red-brown, ear-shaped and have a gelatinous
consistence. They can be found all year round and have no special taste. In dried mushrooms
scientists found 14.4% protein, 1.2% lipids and 65.4% carbohydrates, 4.2% fibres as well as
5.4% mineral components. In the minerals there is 35% of potassium, 18% calcium, but only
6% sodium. Further important minerals are magnesium (6.6%), phosphorus (7.9%) and
silicon (9.7%).
The Jew’s ear is very rich in secondary nutrients. Through a series of tests the Jew’s
ear proved to have inflammatory inhibiting effects. Especially by inflamed mucosa one could
177
see an improvement. Furthermore, the Jew’s ear inhibits blood clotting, decreases the whole
cholesterol and the lipid values of the blood, stimulates the immune system, catches free
radicals and inhibits the formation of connective or supportive tissue cancer (Sarcoma 180).
The bloodstream is improved. Thrombosis and other vein closures can be avoided when Jew’s
ear is used and therefore there is a big possibility of preventing heart attack or apoplexy. This
mushroom can also be very effective in the peripheral arterial disease (PAD), which causes a
lot of pain in the legs due to poor blood circulation. There are a lot of advantages as opposed
to normal medicaments. Through the substances of the Jew’s ear, some collagen components
in the veins are not attacked as apposed to some anticoagulant. So the danger of inner
bleeding through veins bursting is avoided. With Auricularia, stents are coated, in order not to
close so fast again. The Jew’s ear shows effects in coagulation disorders, thrombosis, and
heart attack prevention, enhancing the libido, arteriosclerosis and tinnitus.
Case report: For more than 10 years now, Mr K. takes dried Auricularia and Shiitake and
last year he additionally started to take Hericium, ABM in tablet form, Shitake and other fresh
mushrooms. He complements with Reishi extract. He is 52 years old and wants to prevent
cancer and other coronary diseases. He also suggests the ingestion of mushroom powder with
honey (50g powder by 500g honey). His blood levels and blood pressure are normal (blood
pressure 70/ 110-130 mm Hg). He feels extremely well. He describes: My breathing is lighter,
I am not tired anymore. I attribute the lighter breathing to Reishi. I reduced my weight a little
bit by taking a lot of mushrooms. My heart rate got considerably lower.
Caterpillar Fungus (Cordyceps sinensis)

Cordyceps is a power-mushroom that strengths body and soul. It grows uncommonly
as a parasite on a caterpillar in the highlands of Tibet. It is collected extensively only for
medicinal healing purposes (it is the principal source of income of farmers) and until now he
can only be cultivated as a mycelium.
It is a strong antibiotic, it stops for example the growing of Clostridium spp. without
destructing the bifido bacteria and lacto bugs (healthy microorganisms). The liver metabolism
is stimulated and the LDL and the VLDL cholesterol are reduced. Immune stimulating, anti-
tumour as well as antibacterial characteristics are attributed to cordycepin, ophicordin and
galactomannan. The activity of the natural killer cells is increased, the macrophages are
stimulated and the whole immune system excited.
Through bile stasis, conditional liver fibrosis can be avoided. Cordyceps is successfully
applied by athletes, who report about their improved performance, increased persistency and
reduction of the regeneration time. Chinese runners won sensational world records and after
asking them about their secret they answered: a strong exercise plan and Cordyceps.
In traditional Chinese medicine, Cordyceps properties are reported: strengthening of
lungs, kidneys and improvement of Qi and Yang. It calms emotions and eliminates mucus and
bleeding. It is expected to act blood-building and moving and strengthens especially the
sexual energy. It is also applied very successfully against fatigue, cancer, rheumatism,
respiratory disease, inflammations, insomnia, concentration disorders and irregular
menstruation. Cordyceps enhances the oxygen supply of the blood. Patients reported about
libido increasing; it is applied for the regeneration after and during the chemotherapy. It is
also used in anxiety, depression, agitation, insomnia, tinnitus, detoxication, rheumatism and
other inflammatory processes, painful menstruation, overweight, bronchitis, asthma, fat
metabolism disorder, AIDs, stress and chronic fatigue syndrome.
Case report: Mr. F takes Shiitake, Rheishi and Cordyceps. Thanks to them he can sleep
serenely and he is more resistant to stress situations. He suffered a heavy metals poisoning
178
(mercury, plumb and copper) which attacked his immune system. With these three mushrooms
he builds up the body’s resistance.
Uses of mushrooms
Medicinal mushrooms are available as a dietary supplement, in mushroom powder or

mushroom extract. The powder, fine-ground cultivated mushroom, is available in capsules a
500 mg. A good therapeutic experience was reached with 2 to 5 g (4 to 10 capsules)
mushroom powder daily, depending if the complaints are just a few or if it is a disease. A
medicinal effect occurs almost after a few days. A regular daily use is absolute necessary for
continuous therapeutic effect especially by diabetes. As dependence does not occur it is
absolutely harmless and you can take it as long as you want. It also makes sense to take them
over several weeks for other indications. There are existing tables, gained as a result of a year-
long work, with dosage recommendations. However they should be applied individually.
Usually the mushroom administration should occur slowly. The medicinal mushrooms
are taken during or before the meals. One can take them with tea, soups, etc. In order to select
the right medicinal mushroom you should consult a specialist. There is also the possibility of
testing, for example, bio tensor, kinesiology, forecast procedures, bio resonance. Important is
the harmlessness of the products, modern analysis procedures and strong boundary values in
Germany allow quality control.
Certificates should exist in order to distinguish the reliable from the dubious supplier. The
production should be documented and traceable.
The following harmless reactions can occur as possible accompanying symptoms:
- flatulence, that decreases when the organism adapts itself to the mushroom proteins
(hard to digest);
- increased urination, changing of colour and smell;
- increased and smooth stool, changing of smell,
- increased sweating, changing of the sweating smell.
Some studies show that when taking simultaneously Vitamin C, the effect of the medicinal
mushrooms improves. So it is recommended to take, in moderate quantities, this Vitamin
simultaneously with mushrooms.
Additionally to Mycotherapy one can try vascular training (e.g. Kneipp), homeopathy,
correction of bad posture (osteopathy), spiritual work, yoga, cold/heat, sauna, detoxication,
deacidification, intestinal clean up, phytotherapy, e.g. Nopal, as well as liver activation (milk
thistle), boosting of the biliary flow (artichoke juice), orthomolecular medicine (e.g. Vitamin
C), a dietary change, elimination of parasitic influence (electro smog, mobile phone,
environmental pollution), dietary supplement: anti-oxidants, garlic, zinc…as needed!,
sufficient drinking ( unbound material, boiled water) and daily exercise outside. Mycotherapy
is an old and at the same time young and very promising therapy form.
For centuries now, the Chinese people used mushrooms in their complementary
medicine especially to strengthen the immune system, to prevent and heal heart- and
metabolism diseases, to regulate the blood pressure and blood sugar, to strengthen the liver, to
detoxicate, to treat allergies, to reduce overweight and to improve vitality. Nowadays
numerous alternative practitioners and doctors profit from this knowledge. There are always
more and more people interested in alternative medicine in order to reduce the medicaments
and to value the side-effect free mushrooms. The medicinal mushrooms can be combined with
orthomolecular medicine, herbal medicine, scientific medicine, meditation techniques, bio
resonance and they act integrally.
Medicinal mushrooms contain numerous bio active substances and essential trace
elements, minerals, fibres, amino acids and vitamins. The nutrition- physiological meaning of
mushrooms is outstanding. Still, nobody can eat fresh mushrooms twice a day. Gentle dried
179
mushroom powder, extracts and tablets offer some advantages that should not be
underestimated: they can be preserved, they are available (the healing mushrooms are fresh –
except Shiitake – does not exist or is rare to find in the market), they are easier to dose and
essential for the mycotherapeutic purposes – they can be taken regularly. The extracts also
offer a strong concentration of effective components. One can also prepare fresh mushroom
meals and obtain the same healthy effects as the therapy with capsules or tablets.
The good experiences made in the last years in Germany with mushrooms contributed
to the increased use and appreciation of mushrooms in the scientific medicine due to the
exceptional mushrooms characteristics in the naturopathy - in the beginning with a lot of
scepticism. Hundreds of natural oriented doctors and naturopaths already adopted mushrooms
with healing properties for preventive and curative purposes. The wide base of the acquired
knowledge and the pharmacological and clinical studies show that healing mushrooms are not
an old or new miracle cure, but can contribute, due to their exceptional characteristics, to our
health and to our recovery. Mushrooms with healing properties are needed, because, despite
of enormous advances in medicine, more and more chronic diseases accompany our lives.
High blood pressure, metabolism disorders and diabetes II are increasing worldwide. The
number of people, in Germany, who suffer from diabetes increased threefold in the last 50
years. Experts assume that 7 million citizens of the Federal Republic of Germany are affected.
Most of us do not even know that their blood sugar level is constantly high. Therefore the risk
of bad following diseases increases – and in the same way the life expectancy decreases
drastically.
Science has already accomplished awesome achievements in the diabetes research.
But the regular administration of medication is connected partially with considerably negative
side-effects. There have been made positive experiences with different types of mushrooms in
the treatment of metabolism disturbances, high blood pressure as well as in sugar diseases and
their sequels – without any adverse effects! Success creates trust and so, in the following
years, with the increase of diseases, the demand of mushrooms with healing properties will
surely increase.
In the following years the use of medicinal mushrooms will especially increase in the
combat of more and more diagnosed tumour diseases. There are high expectations regarding
mushrooms as they are used solely in the immune therapy or as an accompanying agent in the
radiation or chemotherapy. There are also some new hopes concerning the treatment of HIV-
infections. And also in another way the application of mushrooms showed first successes: The
burden to our body is everyday stronger with environment toxicity. Therefore, in the
following years, the medicinal mushrooms will have a much more important meaning in the
detoxication procedures than till now.
180
Molecular Modelling and Modification of Mushroom Senescence and

Quality-loss
K. S. Burton1, A. Mead1, M. P. Challen1, B. Herman1, J. Green1, B. Phillips2, and D. C.

Eastwood1
1
Warwick HRI, University of Warwick, Wellesbourne, Warwick CV35 9EF, UK;
2
Department of Engineering, Coventry University, Coventry CV1 5FB, UK.
Email: Kerry.Burton@warwick.ac.uk
Key Words: Agaricus bisporus; Mushroom senescence; Molecular modelling; Mushroom

quality; Bruisometer
Introduction
The Agaricus bisporus mushroom has a high worldwide value of €4 bn. This high
value is partially dependent that the quality of mushroom, grown and harvested, is maintained
at the point of harvest and after harvest until consumption. Mushrooms can lose quality during
growth due to poor crop management, pinning and diseases, and also during and after harvest
because of mishandling, the post-harvest environment and again diseases. A range of
approaches and scientific investigations have examined the causes of quality-loss during
growth and after harvest.
This paper aims to briefly review research on mushroom quality with a particular
emphasis on recent advances on molecular post-harvest research.
What is Mushroom Quality
The quality of any product or concept is a subjective or personal issue. This is

especially true for foods. We can, however, derive some common themes from consumer
surveys which judge the important characteristics of mushroom quality are based on colour,
texture, maturity and flavour. Mushrooms should be uniformly white and free from signs of
brown discolouration or contaminating peat, pests or spores. Preferably the gills should be
pink, or light brown but not the dark brown to black colour which indicates old age and
possible texture loss. Texture should be firm. Mushrooms are sold at different stages of
maturity (buttons, closed cups, open cups, flats). Within any grade, the mushrooms should be
of regular round shape and uniform size. Flavour is the most subjective quality characteristic.
High quality mushrooms should be tasty and pleasurable to eat. This is partially due to the
‘umami’ or meaty flavours and partially the volatiles component of ‘mushroom alcohol’, 1-
octen-3-ol.
Pre-harvest Factors Affecting Mushroom Quality
Mushroom quality is determined by both genetic and environmental influences and the
interaction between them (GXE). The breeding of hybrid mushroom strains (between smooth
white and off-white varieties) has resulted in strains with improved quality characteristics,
denser and whiter. The use of high density linkage genetic maps and the forthcoming genome
sequence of A. bisporus (http://www2.warwick.ac.uk/fac/sci/whri/research/agaricusgenome/)
due to be released in 2008 will enable more focussed and precise breeding which will deliver
further improvements in genetically-determined quality. Other exciting recent advances and
technologies, which are having a major impact on our capabilities, understanding and
hypotheses, are the development and the wider use of genetic transformation of A. bisporus
and the use of high-throughput technologies such as micro-arrays.
181
A number of studies have tried to identify causal links between agronomy and
mushroom quality. Recent work at Warwick HRI has examined how bruising can be
influenced by agronomy and growing environment. It was evident from examining bruising
that a direct impact of a force onto a mushroom surface does not stimulate that much
browning. The bruising most damaging to mushroom colour is a ‘slip-shear’ which is the
same as fingers sliding over the surface with some downwards pressure (for instance during
picking). A “bruisometer” device was designed and built by Dr Bryan Phillips of Coventry
University. When the bruisometer was applied to investigate the agronomic influences on
mushroom bruising, it was found that the greatest influences are room humidity, amount of
watering added to the casing, the duration of Phase I composting of straw and the use of
calcium chloride (Burton & Noble, 2004; Burton, 2004)
Biochemical and Chemical Changes in the Mushroom Post-harvest
In order to understand the physiology of the mushroom post-harvest, studies began by

analysing first the chemical compositional changes in the mushroom after harvest, then the
biochemical changes and now the changes in gene expression. This progression of analytical
techniques has used the best techniques available at the time of performing the research and
has resulted in a detailed understanding of some of the physiology.
After the mushroom has been harvested, its respiration increases even though it is
nutritionally isolated (Hammond & Nichols, 1976). The fruit body adapts its metabolism to
this new status to ensure that gill growth and spore production continue. Mannitol and
fructose are used as respiratory substrates and their levels fall 8- and 9-fold respectively while
urea levels increase 8-fold (Hammond& Nichols, 1975; Tseng and Mau, 1999; Hammond,
1979). Mannitol can represent up to 30% of the dry weight of a mushroom fruit body at the
time of harvest and probably acts as a osmoticum driving cell expansion. Its degradation,
catalysed by mannitol dehydrogenase, is partially regulated by the NADPH/NADP ratio
which in turn is controlled by the flux through the Pentose Phosphate Pathway (Morton et al.
1985; Hammond, 1985).
Amino acid levels increase in the mushroom post-harvest, and the compositional
changes have been described to account for the changes in mushroom flavour e.g. increase in
‘umami’ or meaty flavours principally from glutamate and aspartate, and also sweet (alanine,
glycine, serine and threonine) and bitter components (arginine, histidine, isoleucine, leucine,
methionine, phenylalanine and theonine), (Tseng & Mau, 1999).
However, these changes are not uniform in the fruit body. All tissues undergo growth
and physical expansion. However, only the gill tissues increase in dry weight after harvest at
the expense of cap and stipe tissues which decline in dry weight (Hammond & Nichols,
1975). Braaksma et al. (1998) have described the differences in expansion growth and cell
division growth between the tissues. There is consistent evidence that first the stipe tissue,
followed then by the cap tissue, undergoes a form of senescence to act as a source of nutrients
for the developing gills and spores.
Post-harvest biochemical studies have focussed on proteases, tyrosinase and nitrogen
metabolism. Polymers such as protein and glucan decline in level while chitin levels increase
(Hammond, 1979; Burton et al. 1997). Protein levels fall in the mushroom from the time of
harvest which is largely the result of a 38-fold increase in serine proteinases activity starting
24 hours after harvest which is due to the synthesis of new enzyme (Burton et al. 1997). It is
assumed the initial decline (in the first 24 h) is due to the high protein turn-over rate (Burton
et al. 1997). Tyrosinase is the polyphenol oxidase responsible for tissue browning in the skin
of the mushroom. Several studies have found that tyrosinase activity does not change in the
mushroom skin after harvest. However, tyrosinase is present as an inactive or latent enzyme
which can be activated by proteinases after harvest (Burton et al. 1993; Espin et al. 1999).
182
Tyrosinase activation is one explanation of post-harvest tissue browning in the mushroom, a
further and additional explanation is the breakdown of intracellular membranes (by post-
harvest degradation or mechanical damage) which allows the phenolic substrates and enzymes
to mix and react. The molecular physiology of nitrogen metabolism is discussed below.
Molecular Physiology of Post-harvest Quality Loss
A number of genes have been previously identified which are up-regulated in the
fruitbody of A. bisporus after harvest (Kingsnorth et al. 2001; Eastwood et al. 2001). Serine
proteinase gene has been cloned, characterised and sequenced. It is strongly up-regulated
post-harvest and the transcript is found almost entirely in the stipe tissue (Kingsnorth et al.
2001). A study of screening cDNA libraries has revealed a further 19 genes up-regulated in
the mushroom after harvest (Eastwood et al. 2001). The diverse functions of these genes
reveal that several different physiological processes are occurring in the mushroom after
harvest. Table 1 shows these genes together with serine proteinase and other post-harvest
genes.
Table 1. Physiological roles and biochemical functions of genes up-regulated in the

Agaricus bisporus mushroom after harvest
Physiological Roles Biochemical Functions

Polymer degradation Serine proteinase I
Serine proteinase II
Leucine aminopeptidase
Glucuronyl hydrolase
Lipo-protein with putative chitinase
activity
Stress Tolerance Superoxide dismutase
Metallothionein
Cytochrome P450 Cytochrome P450 I
Cytochrome P450 II
Carbon & Nitrogen Metabolism Argininosuccinate lyase
Argininosuccinate synthase
Ornithine aminotransferase
Cell Wall Synthesis β (1-6) glucan synthase
Unknown roles Cruciform DNA binding protein
Riboflavin aldehyde forming enzyme
See references: Eastwood et al. 2001; Kingsnorth et al. 2001; Wagemaker et al.
2007a, 2007b.
Two stress tolerance genes, superoxide dismutase and metallothionein, show that the
mushroom is under a stress physiology. The increase in superoxide dismutase transcript levels
is rapid starting 12-15 hours after harvest, (largely in the stipe and cap tissues), and then
declines to pre-harvest levels 36 hours later (Henderson et al. 2004). In addition to serine
proteinase, other polymer-degrading genes up-regulated post-harvest include leucine amino-
peptidase, a putative chitinase and glucuronyl hydrolase. The glucuronyl hydrolase is
expressed at significant levels at approximately 0.17% of transcripts (Eastwood et al. 2001).
Interestingly, a gene involved in polymer synthesis, β-(1-6)-glucan synthase is also up-
regulated and is probably associated with synthesis of glucan side branches of the cell wall.
Two genes coding for cytochrome P450 (which has a large range of physiological roles) were
also found to be up-regulated. Two post-harvest genes have known probable biochemical
183
functions; however, their physiological roles are not fully understood. These are cruciform
DNA binding protein and riboflavin aldehyde-forming enzyme. The cruciform DNA binding
protein may be involved in gene regulation but it is not meiotic events as it is expressed at a
low level in the gill tissue (Eastwood et al. 2001). Riboflavin aldehyde-forming enzyme gene
has been characterised (Sreenivasaprasad et al. 2006) and a homologue has also been
identified in the shiitake mushroom, Lentinula edodes (Hiranto et al. 2004; Suizu et al. 2008).
Modelling Gene Expression Profiles
More recent work on Agaricus has focussed on nitrogen metabolism post-harvest and
modelling the post-harvest gene expression profiles.
The gene expression profiles of five of the post-harvest genes were determined using
quantitative reverse transcriptase PCR (qRT-PCR). To determine whether statistical
modelling can identify similar profile shapes, the five genes were chosen to be functionally
distinct and therefore not likely to have common regulatory patterns (Eastwood et al. 2008a).
This profiling examined the gene expression levels in the first 24 hours after harvest when the
increase in levels is largely due to transcription and also for 5 days post-harvest where there is
an initial increase followed by a plateau or decline to an asymptote. Non-linear regression
modelling techniques were successfully applied to the post-harvest genes in both cases.
Split-line or ‘broken stick’ regression (where two linear lines were fitted to the data,
the first line having a slope of zero) was applied to the 24 h profile and was able to determine
the time of up-regulation with greater precision i.e. to determine primary from secondary
events. Using this model and previously obtained data, we now know that the first genes to be
up-regulated are argininosuccinate lyase, argininosuccinate synthase and cruciform DNA-
binding protein (0-6 h post-harvest), followed by glucan synthase (9 h), cytochrome P450
(13.5), superoxide dismutase (15 h), glucuronyl hydrolase (16.5 h) and riboflavin aldehyde-
forming enzyme and serine proteinase (~24 h).
The 5-day profiles were modelled using a critical exponential curve which describes
an initial increasing process followed by a plateau or decrease to an asymptote. This curve
form is therefore biologically orientated to describe transcription followed by transcript turn-
over. Three distinct regulatory patterns were identified. Cruciform DNA binding protein and
cytochrome P450 had similar shaped curves even though there were large differences (three
orders of magnitude) in transcript magnitudes, and similarly glucuronyl hydrolase and
riboflavin aldehyde-forming enzyme also had similar profile shapes. The data were fitted to
the critical exponential curve resulting in a reduction in data “noise” and the production of
parameters which enabled comparison of curve shape. These common expression profiles
observed for functionally distinct genes using critical exponential modelling may indicate
common regulatory mechanisms. This methodology has also been applied to publically
available micro-array data from E. coli and Rattus norvegicus.
Post-harvest Nitrogen Metabolism
Urea accumulates in the fruit body tissues post-harvest driven by observed changes in
the transcript levels of nitrogen metabolism genes: increases in argininosuccinate lyase,
argininosuccinate synthetase, serine proteinase, and ornithine aminotransferase, and a
decrease in urease transcript levels (Burton et al. 1997; Wagemaker et al. 2006; Wagemaker
et al., 2007a; Wagemaker et al. 2007b). The role of urea is probably as an alternative
osmoticum to mannitol for cell and tissue expansion. Urea is only 20% carbon and is one third
the molecular weight of mannitol, and therefore is an efficient osmoticum so carbon to be
channelled for respiration. As argininosuccinate lyase is one of the first genes to show an
increase in transcript levels (within 3 hours after harvest), it was chosen as a candidate for
184
gene silencing studies. A vector was constructed consisting of a gus A 325 bp fragment and
argininosuccinate lyase sequences in ‘sense’ and ‘antisense’ orientations, to form a
1.00E+02
R ela tiv e ex p res s io n (1 8 S )
1.00E+00 A15 control

hygR control
1.00E-02 ASL 3
ASL 14
1.00E-04 ASL 33
1.00E-06
Day 2
Figure 1. Transcript levels of argininosuccinate lyase in three RNAi transformants

(ASL3, 14 & 33) relative to 18S.
Comparison with the two controls (A15 & A15 transformed with the hygromycin resistance gene)
reveals ASL3 and ASL33 have significantly lower asl transcript levels. Note: data are expressed on a
logarithmic scale.
self-complementary hairpin transcript. The hairpin vector was transformed into A. bisporus
and transformants were selected by hygromycin resistance, PCR and RT-PCR. Two
transformants were grown to produce fruit bodies, and the argininosuccinate transcript levels
were measured to be 99.9% and 93.1% reduction compared with the non-transformed control,
using quantitative RT-PCR (Eastwood et al. 2008b). However, no significant differences were
observed in urea levels of the transformants compared with the controls, possibly indicating
alternative pathways for urea formation e.g. purine degradation.
RNAi has been successfully demonstrated in A. bisporus and therefore opens the way
for new advances in mushroom breeding technology by enabling hypothesis testing of key
genes which can influence agronomic characteristics such as quality. In addition, micro-array
technology is being used at the University of Warwick to identify the mechanism of
mushroom pinning (initiation) and browning caused by Mushroom Virus X.
References
Braasma A, van Doorn AA, Kieft AC, van Aelst AC. 1998. Morphometric analysis of ageing
mushrooms (Agaricus bisporus) during postharvest development. Postharvest Biol
Technol., 13, 71-79.
Burton KS, Love ME, Smith JF. 1993. Biochemical changes associated with mushroom
quality in Agaricus spp. Enzyme Microbial Technol., 15, 736-741.
Burton KS, Partis MD, Wood DA, Thurston CF. 1997. Accumulation of serine proteinase in
senescent sporophores of the cultivated mushroom, Agaricus bisporus. Mycol Res., 101,
146-152.
185
Burton KS, Noble R. 2004. Optimising mushroom quality. Factsheet 15/04, Horticultural
Development Council, East Malling, UK.
Burton KS. 2004. Cultural factors affecting mushroom quality – cause and control of
browning. Mush Sci., 16, 397-402.
Eastwood DC, Kingsnorth CS, Jones HE, Burton KS. 2001. Genes with increased transcript
levels following harvest of the sporophore of Agaricus bisporus have multiple physiological
roles. Mycol Res., 103, 1223-1230.
Eastwood DC, Mead A, Sergeant MS, Burton KS. 2008a. Statistical modelling of transcript
profiles of differentially regulated genes. BMC Molecular Biology, (In press).
Eastwood DC, Challen MP, Zhang C, Jenkins H, Henderson J, Burton KS. 2008b. Hairpin
mediated down-regulation of the urea cycle enzyme argininosuccinate lyase in Agaricus
bisporus. Mycol Res., 112, 708-716.
Espin JC, Van Leeuwen J, Wichers HJ. 1999. Kinetic study of the activation process of a
latent mushroom (Agaricus bisporus) tyrosinase by serine proteases. J Agric Food Chem.,
47, 3509-3517.
Hammond JBW, Nichols R. 1975. Changes in respiration and soluble carbohydrates
during the post-harvest storage of mushrooms (Agaricus bisporus). J Sci Food Agric., 26,
835-842.
Hammond JBW, Nichols R. 1976. Carbohydrate metabolism in Agaricus bisporus: Changes
in soluble carbohydrates during growth of mycelium and sporophore. J Gen Microbiol., 93,
309-320.
Hammond JBW. 1979. Changes in composition of harvested mushrooms (Agaricus
bisporus). Phytochemistry, 18, 415-418.
Hammond JBW. 1985. Glucose-6-phoshate dehydrogenase from Agaricus bisporus:
purification and properties. J Gen Microbiol., 131, 321-328.
Henderson J, Eastwood DC, Bains N, Burton KS. 2004. Superoxide dismutase-
mushrooms under stress. Mush Sci., 16, 67-73.
Hiranto T, Sato T, Enei H. 2004. Isolation of genes specifically expressed in the
fruitbody of the edible basidiomycete, Lentinula edodes. Biosci Biotechnol Biochem., 68,
468-472.
Kingsnorth CS, Eastwood DC, Burton KS. 2001. Cloning and postharvest expression
of serine proteinase in the cultivated mushroom Agaricus bisporus. Fungal Gen Biol., 32,
135-144.
Morton N, Dickerson AH, Hammond JBW. 1985. Mannitol metabolism in Agaricus
bisporus: purification and properties of mannitol dehydrogenase. J Gen Microbiol., 131,
2885-2890.
Sreenivasaprasad S, Eastwood DC, Browning N, Lewis SMJ, Burton KS. 2006.
Differential expression of a putative riboflavin-aldehyde forming enzyme (raf) gene during
development and post-harvest storage and in different tissue of the sporophore in Agaricus
bisporus. Appl Microbial Cell Physiol., 70, 470-476.
Suizu T, Zhou G-L, Oowatari Y, Kawamukai M. 2008. Analysis of expressed
sequence tags (ESTs) from Lentinula edodes. Appl Microbiol Biotechnol., 79:461–470
Tseng Y-H, Mau J-L. 1999. Contents of sugars, free amino acids and free 5’ nucleotides in
mushrooms, Agaricus bisporus, during post-harvest storage. J Sci Food Agric., 79, 1519-
1523.
Wagemaker MJM, Eastwood DC, Van Der Drift C, Jetten MSM, Burton KS, Van Griensven
LJLD, Op Den Camp HJM. 2006. Expression of the urease gene of Agaricus bisporus: A
tool for studying fruit body formation and post-harvest development. Appl Microbial
186
Wagemaker MJM, Eastwood DC, Van Der Drift C, Jetten MSM, Burton KS, Van Griensven
LJLD, Op Den Camp HJM. 2007a. Argininosuccinate synthase and argininosuccinate lyase:
two ornithine cycle enzymes from Agaricus bisporus. Mycol Res., 111, 493-502.
Wagemaker MJM, Eastwood DC, Wellagen J, Van Der Drift C, Jetten MSM, Burton KS, Van
Griensven LJLD, Op Den Camp HJM. 2007b. The role of ornithine aminotransferase in
fruiting body formation of the mushroom, Agaricus bisporus. Mycol Res., 111, 909-918.
187
Safety, Quality Control and Regulational Aspects Relating to

Mushroom Nutriceuticals
S. T. Chang1 and J. A. Buswell2

1
Centre for International Services to Mushroom Biotechnology, Department of
Biology, The Chinese University of Hong Kong, Hong Kong SAR, China; 2Institute
of Edible Fungi, Shanghai Academy of Agricultural Sciences, Shanghai 201106,
China.
Email: jabuswell2003@yahoo.co.uk
Key Words: Mushroom nutriceuticals, Dietary supplements; Quality control,

Standardized protocols; Consumer acceptability
Introduction
Mushrooms are devoid of chlorophyll-containing tissues, rendering them

incapable of photosynthetic food production. They grow and produce new biomass by
relying on organic matter synthesized by green plants, most of which is in the form of
forestry and agricultural waste residues. Unlike photosynthetic organisms, mushrooms
produce a battery of extracellular enzymes to degrade the complex major
macromolecular components (cellulose, hemicellulose, lignin) of the growth substrate.
Mushrooms use mainly cellulose and hemicellulose to provide soluble nutrients which
are then absorbed and assimilated for vegetative growth and fruit body formation.
However, since the cellulose and hemicellulose in the plant cell wall is normally in
the form of lignin-carbohydrate complexes (LCCs), lignin-degrading enzymes are
also synthesized in addition to cellulases and hemicellulases in order to gain access to
new areas of embedded polysaccharide. This demonstrates a strong biodegradative
capability, and an impressive capacity for absorbing from the surroundings all the raw
materials, organic and inorganic, required for biosynthesis. Unfortunately, this
absorption capability is potentially of major negative significance for mushrooms and
mushroom products.
Environmental pollution is now a global problem which affects all aspects of
human welfare including the air, water, food and ultimately our health. Consequently,
growth substrates and other components of the mushroom growth environment (air,
water) may contain harmful compounds that are also taken up and accumulated by the
mushrooms. Moreover, there may further possibilities for contamination by
environmental pollutants during the transportation and processing (e.g. drying,
canning) of fresh fruit bodies, and at different stages involved in the manufacture of
mushroom-derived products. When this occurs, the quality of mushrooms and their
products is diminished, and there may be serious consequences for human life and
health. In this article, we consider the issues affecting the quality and safety of
mushrooms and derived products, and some basic regulations that should apply where
mushrooms and their derivatives are cultivated and manufactured.
Market Value of Mushroom Nutriceuticals

For the purpose of this article, “mushroom nutriceuticals” (Chang & Buswell,
1996) are defined as ‘refined/partially defined/unrefined mushroom preparations
derived from fruiting bodies, fungal mycelium or the spent culture fluid following
mycelium growth in submerged culture that possess nutritional and/or medicinal
188
properties and which are consumed in the form of capsules or tablets as a dietary
supplement’.
Although there are no recently published data relating to the total world
market value of mushroom nutriceuticals, it is useful to review a number of earlier
estimates that have been published in different sources. The market value of
medicinal mushrooms was estimated in 1991 to be US$1.2 billion (Chang, 1993),
US$3.6 billion in 1994 (Chang, 1996) and US$6.0 billion in 1999 (Wasser et al.
2000). Three of the first mushroom ‘nutriceuticals’ were the β-glucans, krestin,
lentinan and schizophyllan extracted from Coriolus versicolor, Lentinula (Lentinus)
edodes and Schizophyllum commune, respectively (Reshetnikov et al. 2001). Krestin
(PSK) was reported to be the top-selling anti-cancer drug in Japan during 1987 with
annual sales of US$358 million (Chang, 1993), while the 1995 market value of G.
lucidum and various products derived from this medicinal mushroom was reported to
be US$1,628.4 million (Chang & Buswell, 1999). Before 1995, 99% of all sales of
medicinal mushrooms and their derivatives were concluded in Asia and Europe, with
<0.1% in North America. However, in recent years, both North and South American
demands have been increasing between 20% and 40% annually depending upon the
species. More than ten new companies were established recently in Brazil to promote
the sale of different dietary supplements derived from Agaricus blazei (A.
brasiliensis). In the year 2000 in China, the major producer and consumer of
medicinal mushrooms, more than 100 research units/institutes were engaged on
research and development of medicinal mushrooms. Some 30-40 varieties of
mushroom products for use as nutriceuticals/herbal medicines were manufactured in
more than 200 factories. Furthermore, about 700 mushroom-based health food
products, including more than 90 brands of G. lucidum products, were registered and
marketed (Lin, 2000). Based on previous data, the current world market value of
mushroom nutriceuticals is estimated at US$14 billion.
Sources and Manufacture of Medicinal Mushroom Products
Chang & Miles (2004) reported that about 77% of all medicinal mushroom
products are derived from fruiting bodies, which have either been cultivated
commercially or collected from the wild. Only about 21% of all products were
reportedly based on extracts from mycelia and approximately 2% were derived from
culture filtrates. However, mycelial- and culture broth-based products are already
assuming greater importance due to demands for increased quality control and for
year-round production. The processes involved in submerged mycelial culture can
easily be standardized under controlled conditions, and purification and other
downstream processing of active components such as polysaccharides released into
the culture medium, usually involve relatively simple procedures.
Several types of medicinal mushroom products are currently available on the
market, with no systematic scientific verification of which is the preferred method of
production. These include:
(1) whole fruiting bodies ground into powder and then processed into capsule
or tablet form;
(2) dried and pulverised mycelium harvested from submerged liquid cultures
grown in fermentation tanks;
(3) dried and pulverised combined preparations consisting of substrate, fungal
189
mycelium and mushroom primordia from a semi-solid medium following
inoculation with fungal mycelium, and incubation until the appearance of
primordia;
(4) hot water extracts of mycelium harvested from submerged liquid cultures
grown in fermentation tanks which have been evaporated to dryness and
made into capsule or tablet form;
(5) hot water and/or alcohol extracts of fruiting bodies (for extraction of the
polysaccharide and triterpene components) which have been evaporated to
dryness and made into capsules or tablets either separately or integrated
together in designated proportions;
(6) extracts of fruiting bodies, converted to powdered form, obtained by
supercritical fluid CO2 extraction technology (contain a large spectrum of
substances due to the low temperature during processing);
(7) pure spore powder in capsular form - this method has been promoted
vigorously in recent years but the medicinal benefits of this method remain
controversial;
(8) extract powder from fruiting bodies mixed with an equal portion of
mycelium
extract powder of the same species.
(9) binary, triplet, or more complex products consisting of mixtures of
different
mushrooms (e.g. Ganoderma/Lentinula; Ganoderma/Agaricus
brasiliensis,
Grifola frondosa/Pleurotus spp/Flammulina velutipes), and even other
medicinal herbs ( e.g. Spirulina powder, flower pollen grains).
(10) treated and ground fruiting body powder, in equal proportions, in a capsule
Enhanced Understanding of the Nature of Mushroom Nutriceuticals
Past empirical observations relating to the health-promoting effects of

mushrooms were often based on the consumption of the intact mushroom or crude
potions (e.g. mushroom teas) prepared from the fruit body. More recently, the
effectiveness of mushroom nutriceuticals has been confirmed repeatedly by laboratory
experiments using in vitro or animal model systems. However, there is a need in
virtually all cases to confirm their efficacy in ethically-conducted and carefully
controlled human trials. Furthermore, exactly how most of these products work is still
a matter of conjecture. One approach to understanding the beneficial effects of
mushrooms has been to isolate and determine the bioactivity of individual
components. The active principle, for example lentinan, is then sold in refined or
purified form. Such an approach is certainly valid if the objective is to focus on a
single mushroom-derived substance for the treatment of a specific disease condition.
However, the overwhelming majority of mushroom-based nutriceutical products
currently available are not single compounds but combinations of several individual
components that together contribute to the overall medicinal effects of the product.
Thus, the medicinal effects afforded by Ganoderma products may be attributable to
several quite different types of compound present in the mushroom: e.g.
polysaccharides, lectins, triterpenoids and fungal immunomodulatory proteins
(Wachtel-Galor et al. 2004). These compounds, and possibly others yet to be
identified, appear to act in concert in contributing to the documented anticancer,
antitumour, antiviral, antibacterial and immunomodulating properties of this
190
mushroom (Chang & Buswell, 2003). Therefore, it is important that the future
development of mushroom nutriceuticals should not be focused solely on the isolation
and bioactivity of individual mushroom components, otherwise synergistic effects
will be overlooked. In certain cases, it may be more desirable to consider the total
medicinal effect(s) of mushroom “extracts” and then to ascertain the contributions
made to the overall activity by individual components. The consistency of the
“extracts”, both in terms of overall chemical composition and in the actual levels of
active components between different batches, could be standardized on the basis of
one or two of the main active constituents. This is essential for ensuring some degree
of uniformity in prescribed dosages. Thus, while the minimum dosage of an active
component required to bring about the desired therapeutic effect is often known for
similar products; e.g. hypericin in extracts of St. John's Wort, this is generally not the
case where mushroom extracts are concerned. This is an area where scientific
validation can increase knowledge of the products itself as well as contribute to
quality control of the products (see below).
Introduction of a Labelling System for Mushroom Nutriceuticals
During the last two decades, more than 200 substances have been isolated
from the fruiting bodies, spores, cultivated mycelium and spent culture broths of
medicinal mushrooms, with some established knowledge of their chemical and
physical structures. However, many medicinal mushroom products on the market do
not list the main ingredients on the product labels. Of 40 mushroom products
examined in shops/companies, only two (both Ganoderma products) had labelling
that revealed the product was standardized to contain polysaccharides (12.5%) and
triterpenes (4.5%) (S.T. Chang, unpublished). More commonly, labels on the
containers claim only that each capsule contains, for example, only pure natural
lingzhi (Ganoderma lucidum) or a mixture of lingzhi and maitake (Grifola frondosa).
The labelling may also claim that the product contains no preservatives, artificial
colouring or flavouring, and that it was manufactured on licensed premises. No
nutritional information is provided and no other ingredients are listed. Although some
companies have provided one of us (STC) with validation reports relating to the
polysaccharide content, as well as HPLC and HPTLC validation profiles, of powdered
Ganoderma fruiting bodies and mycelium, these companies do not disclose the test
data on the bottle/packaging containing their products.
Mushroom nutriceuticals are mostly upgraded products which are intermediate
between regular food and registered drugs. While they do not qualify for the
restrictions imposed on prescription drugs (indeed ‘nutriceuticals’ should be clearly
distinguished from drugs, mainly because of their distinctive natural properties and
intended use by consumers), they should at least be subject to the same government
regulations applicable to simple food products. They should be properly regulated by
the appropriate authority, and should be similarly labelled as food products both in
terms of the main ingredients and nutritional data. Although most medicinal
mushroom products are compound products containing several bioactive ingredients,
selected major active components and nutritional data should be indicated. The need
for disclosure is even more acute when we consider the diversity of products on the
market, and is exemplified by the data shown in Table 1. These demonstrate the
considerable variation in the two major active components (triterpenes and
polysaccharide) of eleven randomly selected samples of lingzhi products (commercial
products of eleven different companies). Such variations can arise for several reasons
191
including differences in the species/strains of mushroom used and to different
extraction/production methods. In the case of these products, triterpene content ranged
from undetectable to 7.8%, and polysaccharide content varied from 1.1% to 15.8%.
The polysaccharide content of some lingzhi products available on the Hong Kong
market also showed huge variation, ranging from 0.06% to 29.7%. All these products
claimed various beneficial attributes without providing the consumer with any basic
quality control data such as that shown in Table 1. Disclosure requirements will serve
as a natural monitoring device to ensure consistency between different batches of
product and constant quality from one batch to another. They will also promote
greater product integrity, thereby enhancing consumer confidence in the mushroom
nutriceuticals market.
Table 1. Comparison of triterpene and polysaccharide contents of 11 commercial

lingzhi products currently available on the market.
Nature of product Triterpenes (%) Polysaccharide (%)

A (fruiting body extract ) 1.36 4.48
B (fruiting body extract ) 2.36 5.32
C (fruiting body extract) 1.88 15.70
D (fruiting body extract) 1.06 10.97
E (fruiting body extract) 0.44 7.51
F (fruiting body extract) 1.78 6.18
G (fruiting body extract) 1.44 13.30
H (fruiting body extract) 0.50 15.80
I (fruiting body extract) 7.82 7.66
J (fruiting body powder) 0.46 1.10
K (mycelium powder Undetectable 12.78
Note: These data were obtained in one laboratory using the same equipment and
method for each sample. This experiment was conducted in confidence under the
direction of one of the authors (STC).
Current Regulations Relating to Mushroom Nutriceuticals
An in-depth coverage of the various regulations that currently apply to the

marketing of mushroom nutriceuticals is outside the scope of this article. Suffice to
say that the huge global expansion that has recently taken place in the nutraceutical
and functional food industries has created major challenges, one of which is the
considerable variation in the regulations applicable to the different countries active in
the marketplace. Another is the borderline position occupied by mushroom
nutriceuticals between food and medicine. The reader is directed to a recent
publication (Bagchi, 2008) that examines the regulatory hurdles facing foods and
dietary supplements in general, and which provides coverage of regulations from
South America, Canada, the European Union, Australia, New Zealand, Africa, Japan,
Korea, China, India and Southeast Asia as well as the United States.
192
A Proposed Protocol for Obtaining Quality Mushroom Products
There is no question that medicinal mushroom-based products can serve as

superior dietary supplements or “nutriceuticals”. The problem is the wide product
diversity and the present lack of standard protocols for guaranteeing reproducible,
high quality merchandise. Consequently, a number of these products have no
enduring public credibility, and there is a serious need for improved quality control,
bolstered by scientific validation, in order to maintain and increase consumer
confidence, protect public health, and to meet current and future standards set by the
regulatory authorities. The following five “G” guidelines have been proposed for
adoption as a basis for the manufacture of quality mushroom products from
mushroom fruiting bodies (Miles and Chang 1997, Chang 2006). Although these
guidelines may be considered too simplistic and/or unrealistic in terms of practical
adoption, they are offered as a starting point for future reference.
GLP (Good Laboratory Practice): The source and nature of the mushroom
strain must be clearly documented, and it should be properly maintained and
preserved without contamination or degeneration. Mushrooms from many different
genera are used in nutriceutical manufacture and often reported under a common
name with little or no regard to strain/variety or, in some cases, even to species. The
validity of comparing data obtained by different laboratories using the same
mushroom species is often questionable due to genetic diversity that often exists
among different strains of that species.
GAP (Good Agricultural Practice): Adherence to recommended standard

practices is clearly more difficult to monitor in cases where the mushroom feedstock
is collected from the wild. However, in such cases, it should still be possible to
introduce a system of random testing of different batches of mushrooms prior to
processing. This should be given high priority in view of the propensity of
mushrooms to accumulate heavy metals, radionucleides and other potentially harmful
contaminants from the growth environment. In the case of commercially cultivated
fruit bodies, growth and harvesting conditions must be strictly defined: the growth
substrate and, where relevant, ancillary material (e.g. casing) should be free of heavy
metals, the levels of various ingredients specified and maintained, the physical growth
parameters (e.g. temperature regimes, relative humidity, illumination) stipulated, and
good sanitary growth conditions should prevail (e.g. free from contaminated water
and polluted air, microbial contamination, insect infestation). Not only are such
practices important for the quality and safety of the product, they often affect the yield
of the desired bioactive component. For example, log-grown shiitake (L. edodes)
contained more high-molecular weight polysaccharides (HMWP) than sawdust-grown
mushrooms and, among the log-grown shiitake, both mushroom strain and tree
species influenced HMWP content (Brauer et al. 2001).
GMP (Good Manufacturing Practice): Effective, contamination-free

downstream processing protocols and parameters (e.g. pre-treatments prior to
comminution, comminution methods, extraction temperatures, extraction times,
solvents, etc) should be developed, standardized and constantly monitored. Although
most mushroom nutriceuticals are heterogeneous in nature, levels of the main active
constituents of a particular product should, as far as the nature of that product allows,
be determined and disclosed in order to guarantee quality, authenticity and dosage
193
formulation. For example, the quality of some Ganoderma products could be based on
the content of the major triterpenoid and/or polysaccharide components as determined
by high-pressure liquid chromatography. In the longer term, certified testing centres
should be established in order to provide product validation/information to
manufacturers, retailers and consumers.
GPP (Good Post-formulation Practice): Appropriate chemical and

microbiological analyses should be undertaken to ensure that all types and levels of
chemical (e.g. heavy metals) and microbiological contamination respectively fall
within safe limits. Optimum storage conditions and stability data relating to the major
active ingredients of all marketed products should be determined in order to determine
rates of inactivation/deterioration over time (shelf life) and to establish appropriate
‘sell-by dates’.
Noteworthy in this context is the exoglucanase-mediated degradation of lentinan
reported during the storage of L. edodes fruiting bodies (Minato et al., 1999).
GCP (Good Clinical Practice): High quality clinical trials, including double-
blind studies, should be conducted over the longer term to confirm claims of product
bioactivity, and to facilitate product formulation and the determination of an
appropriate dosage level for an effective health-promoting outcome.
Concluding Remarks
There is growing experimentally-based evidence to suggest that dietary

supplements based on bioactive compounds extracted from mushrooms (mushroom
nutriceuticals) increase resistance to disease and, in some cases, causes regression of a
diseased state. Disease prevention is particularly desirable, not only in having positive
financial and social impacts but also in maintaining/improving the quality of life and
human dignity. In many cases, these products appear to enhance the host immune
response that is often weakened through exposure to increased stress levels caused by
present day high-pressure work demands. They have extraordinary low toxicity, even
at high doses, are apparently lacking in various side effects that frequently accompany
the use of synthetic drugs and, since mushrooms have a long tradition as a food source,
mushroom feedstocks are categorised as ‘generally considered safe’.
Increasing interest in mushroom nutriceuticals is likely to continue worldwide
in view of the challenges and opportunities they represent, and their economic value
may ultimately surpass that of mushrooms currently produced for food. However,
consumers nowadays are more demanding and better informed, and apply their
knowledge when choosing a particular product. Therefore, it is crucial that mushroom
products be of high, reproducible quality and free from potentially harmful substances
in order to earn the enduring public credibility essential for future market expansion.
Widely accepted procedures relating to feedstock production, downstream processing,
product safety and stability, and product efficacy need to be developed and
continually improved. Introduction of a registration system for mushroom
nutriceuticals based on information obtained using these procedures would achieve
the highest level of quality assurance, and provide reputable manufacturers with an
effective marketing strategy while helping to eliminate less reliable
manufacturers/traders. Moreover, accurate disclosure of this information to the
consumer will create an automatic monitoring system, and contribute enormously to
the overall integrity of the mushroom nutriceutical industry.
194
References
Bagchi D. 2008. Nutraceutical and functional food regulations in the United States
and around the world. Academic Press, New York, 462pp.
Brauer D, Kimmons T, Phillips M. 2002. Effects of management on the yield and

high-molecular-weight polysaccharide content of shiitake (Lentinula edodes)
mushrooms. J. Agric. Food Chem., 50, 5333-5337.
Chang ST. 1993. Mushroom biology: the impact on mushroom production and
mushroom products. In: Chang ST, Buswell JA, Chui SW. (Eds), Mushroom
Biology and Mushroom Products, Chinese University Press, Hong Kong,
pp.3-20.
Chang ST. 2006. The need for scientific validation of culinary-medicinal mushroom
products. Int. J. Med. Mushr. 8, 187-195.
Chang ST, Buswell JA. 1996. Mushroom nutriceuticals. World J. Microbiol.

Chang ST, Buswell JA. 1999. Ganoderma lucidum (Curt.:Fr) P.Karst.

(Aphyllophoromycetideae) - a mushrooming medicinal mushroom. Int. J. Med.
Mushr. 1, 139-146.
Chang ST, Buswell JA. 2003. Mushrooms – a prominent source of nutriceuticals for
the 21st Century. Curr. Topics Neutraceutical Res. 1, 257-280.
Chang ST, Miles PG. 2004. Mushrooms: Cultivation, nutritional value, medicinal
effects, and environmental impact. CRC Press, Boca Raton and London,
451pp.
Lin SC. 2000. Medicinal fungi of China - production and products development.
Chinese Agricultural Press, Beijing, China.
Miles PG, Chang ST. 1997. Mushroom biology: Concise basics and current
developments. World Scientific, Singapore and London, 194pp.
Minato K, Mizuno M, Terai H, Tsuchida H. 1999. Autolysis of lentinan, an antitumor

polysaccharide, during storage of Lentinus edodes, shiitake mushroom. J.
Agric. Food Chem., 47, 1530-1532.
Reshetnikov SV, Wasser SP, Tan KK. 2001. Higher Basidiomycota as a source of
antitumor and immunostimulating polysaccharides. Int. J. Med. Mushr. 3, 361-
394.
Wachtel-Galor S, Benzie IFF, Tomlinson B, Buswell JA. 2004. Lingzhi (Ganoderma

lucidum): Molecular aspects of health effects. In: Herbal Medicines. Packer L,
Halliwell B, Ong CN, (Eds). Marcel Dekker Inc., New York, pp.179-228.
195
Wasser SP, Nevo E, Sokolov D, Reshetnikov S, Timor-Tismenetsky M. 2000. Dietary
supplements from medicinal mushrooms: Diversity of types and variety of
regulations. Int. J. Med. Mushr. 2, 1-19.
196
Commercial Cultivation of Lyophyllum shimeji
K. Yamanaka
Kyoto Mycological Institute, Misasagi, Yamashina, Kyoto, 607-8406, Japan
E-mail: katsujiy@viola.ocn.ne.jp
Abstract
Lyophyllum shimeji (“Hon-shimeji” in Japanese) is an ectomycorrhizal fungus that

grows in association with Japanese red pine and/or oak trees. The fungus has been prized as
the most delicious and the next most expensive mushroom to Matsutake (Tricholoma
matsutake) in Japan. L. shimeji has been successfully cultivated experimentally in pure culture
using selected strains that were capable of growing saprobically. However, the productivity
was not good for commercial cultivation because of using limited wild strains and inadequate
substrate. Large amounts of costly materials such as barley grains have been used in
experimental cultivation. Yamasa Corporation has cultivated the fungus commercially using
high-quality and high-yield strains by hybridization breeding. Moreover, optimum and
inexpensive substrate for the commercial cultivation of L. shimeji has been newly developed.
L. shimeji is cultivated in facilities provided with automatic cultivation machines using
polypropylene bottles although the scale of production is currently small.
Key words: Lyophyllum shimeji; Ectomycorrhizal fungus; Commercial cultivation; Bottle

culture; Liquid spawn
Introduction
Lyophyllum shimeji (Kawam.) Hongo is a member of the family Tricholomataceae.

This species has been an ectomycorrhizal fungus in Japan although the species of genus
Lyophyllum Karsten have been considered saprophytic fungi in Europe. The general name
“Shimeji” has been widely used to describe some of the best Japanese gourmet mushrooms
and has been assigned to about twenty mushroom species. However L. shimeji has been called
“Hon-shimeji (Hon means true in Japanese, true-Shimeji)” in Japan because the fungus is the
richest flavored mushroom among mushrooms with the general name Shimeji. A Japanese
proverb states “for fragrance, Matsutake (Tricholoma matsutake); for flavor, Shimeji (Hon-
shimeji)”, or “Matsutake is noted for its aroma and Shimeji is noted for its taste”.
Nevertheless, the wild fruiting of L. shimeji has become more rare year after year, and the
provision for market of the fruit bodies collected from the wild has decreased sharply.
This mycorrhizal fungus has been regarded as a species that is difficult to cultivate
artificially in pure culture. However, some selected wild strains of the fungus have the ability
to form primordia in pure culture using rye medium without the host plant (Ohta, 1994a).
Moreover, Ohta (1994b) and Yoshida & Fujimoto (1994) succeeded in the experimental
artificial cultivation of L. shimeji in bottles and bags, respectively. Thereafter, Ohta (1998)
has improved the substrate materials, bottle types and casing materials to cultivate
commercially. However, the cost of barley grain for substrate was too expensive and the yield
was lower. In 2004, Takara Bio Inc., and Yamasa Corporation (a soy sauce manufacturing
company) developed new commercial cultivation methods for L. shimeji. Only forty tons of L.
shimeji are sold in the market as the most exclusive cultivated mushroom.
The purpose of this paper is to review the progress from basic research and the
experimental cultivation to the commercial production of L. shimeji by the two companies.
197
Biological characteristics of L. shimeji
Description
Pileus 2-8 cm across, hemispherical when young, later convex with an incurved
margin, eventually plane, surface smooth, slightly lubricous, dark gray when young, later
gray-brown to light gray. Flesh white, thick. Lamellae white to slightly cream, small
depressed or slightly decurrent. Stipe 3-8 cm, white, usually ventricose when young, later
cylindric. Spores globose, smooth, 4-6 μm.
Figure 1. Wild fruit bodies of Lyophyllum shimeji
Distribution
Widely in Japan and China.
Natural habitats
Mainly in Quercus serrata and Pinus densiflora forests, ectomycorrhized with these
tree species, usually clustered, crowded, or in fairy rings, more rare solitary.
Ecological characteristics
This fungus forms the mat of fungal mycelial colony (Shiro in Japanese) in the soil at
the fruiting location. The fairy rings enlarge outwards 30 to 50 cm a year Fujita et al. 1982)
Yamanaka (1990) used electron microscopy to examine the Hartig net between cortical cells
and mantle layer formed on the surface of ectomycorrhizas of P. densiflora colonized by L.
shimeji.
Mycelial characteristics
Vegetative hyphae have clamp connections. The fungus has gelatinous, fine hyphae,
i.e. 0.7-2.0 μm in diameter, 0.20-0.26 μm in cell wall thickness Yamanaka & Chie, 1998).
The average optimum temperature for mycelial growth of L. shimeji on a medium consisting
of rye grains was 24.9 OC (Ohga, 1994a).
Chemical components of the flavor

The mushroom flavor is predominantly the result of the presence of monosodium
glutamate, further improved by the addition of minor amounts of nucleotides, such as 5’-
guanidine monophosphate (5’-GMP) and adenosine monophosphate (AMP). The content of
5’-GMP in broth after boiling of L. shimeji fruit bodies is the highest in major edible
mushrooms, and the content is about 1.4 times the levels in Lentinula edodes and Pleurotus
ostreatus. Such a high content of 5’-GMP in the broth of L. shimeji is the reason why this
fungus has been prized as the most delicious mushroom.
198
Fruit body formation capability
Ohta (1994a) reported that three strains among 45 wild strains of L. shimeji had the ability
to form primordia on rye grain medium. Yoshida & Fujimoto (1994) reported fruit body
formation in all of 26 experimental wild strains using a medium composed of a mixture of
peat moss and soluble starch. We recognized that all of the wild strains collected from the
whole of Japan formed fruit bodies using a newly developed substrate although the yield and
the morphology of the fruit bodies were different among the strains tested. Moreover, we
could form fruit bodies in Chinese strains of L. shimeji.
Starch utilization
Some ectomycorrhizal fungi have the ability to utilize polysaccharides such as starch.
Ohta (1997) reported that L. shimeji grew rapidly on both starch and amylose medium. He
mentioned that the quantity of sufficient starch used as a carbon source was able to supply the
factor that allows successful fruit body formation without raising the osmotic pressure of the
medium. The ability of starch utilization of L. shimeji is effective for screening strains that
form fruit bodies under artificial cultivation. Amylase and glucoamylase in fruit body-forming
strains of L. shimeji show higher activity level than those of the fruit body non-forming strains
(Terashita et al. 2000). Kusuda et al. (1994) found that extracellular glucoamylase was a
dominant hydrolytic enzyme produced in the barley medium during vegetative mycelial
growth of L. shimeji and they purified the extracellular glucoamylase from the fungal
medium. It is considered that two types of extracellular amylases, glucoamylase and the endo-
type amylase (alpha-amylase), are associated with nutritional decomposition of barley starch
composing of 25% amylose and 75 % amylopectin (Terashita et al. 2000; Kusuda et al.,
2004).
Cultivation methods
Available strains
Ohta (1994b, 1998) recommends the wild strain SF-Ls6 as having high productivity
and high quality. However, this strain readily forms warty structures on the surface of the cap.
Warts on the cap surface notably decrease the quality and market value of the mushroom.
Yoshida & Fujimoto (1984) have used only wild strains to form fruit bodies. These wild
strains in experimental cultivation were low yield and low quality to cultivate L. shimeji
commercially. Wild strains vary in their morphology and in the color of the mushrooms at
maturity. It is supposed that Takara Bio Inc., also use wild strains for the commercial
cultivation in sophisticated and automated facilities. Fruit bodies produced by Takara have a
darker colored cap and the gill compared with general wild strains of this fungus. Yamasa
Corporation has produced fruit bodies commercially using new high quality and high yielding
strains developed by mating between excellent wild strains. The fruit bodies are extremely
similar morphologically to those of wild strains.
Substrate
Ohta (1994b) found that a mixture of barley grain and beech sawdust supplemented
with synthetic nutrients was the best substrate to form fruit bodies in bottle cultures of L.
shimeji. Table 1 shows the culture conditions for the production of this fungus devised by
Ohta (1998b). Yoshida & Fujimoto (1994) used a solid medium for fruit body formation,
adding 750 ml of liquid medium (consisitng of: soluble starch 100 g, D-glucose 25 g, pectin 1
g, yeast extract 3 g, KH2PO4 0.5 g, MgSO4 0.5 g, thiamine-HCl 1 mg, CaCO3 5 g, charcoal
powder 5 g, water 860 ml) to 120 g of peat moss.
Barley grains are suitable material as a starch source for the substrate to produce L.
shimeji fruit bodies. The cost of barley grain medium is immensely expensive for commercial
199
cultivation. In addition, barley grain media results in a non- porous condition in the substrate
and retards mycelial colonization because of the swelling and the viscosity of barley grains
after autoclaving. Therefore, Takara uses a substrate based on hardwood sawdust
supplemented with corn grits and/or corn meal. At Yamasa, the basal medium for L. shimeji
production is composed mainly of a hardwood/softwood sawdust mixture, corn meal and
barley grain.
Table 1. Substrate for L. shimeji cultivation (from Ohta, 1998b)
Barley grain 875 g (dry wt.), hardwood sawdust 542 g (dry wt.). Moisture content of the
substrate: 70% on a wet weight basis.
Synthetic medium: Citric acid, 0.5 g; KH2PO4, 0.1 g; MgSO4, 0.2 g; acetylacetone, 0.05 ml;
FeCl3, 50 mg; ZnSO4, 1.0 mg; MnSO4, 0.03 mg; CuSO4, 1.5 mg; CoSO4, 0.3 mg; NiSO4, 0.1
mg; HEPES, 7 g; distilled water, 1,000 ml; pH 5.4.
Synthetic medium (1,000 ml) is added to the barley grain/hardwood sawdust and, after
mixing, the pH was adjusted to 5.4 with 1 M HCl.
_____________________________________________________________________
Cultivation bottle and filling

Ohta (1998b) has shown that the fruit bodies was largely harvested in the cultivation
using 400 ml of barley/hardwood sawdust substrate contained in 800 ml polypropylene bottles
with a large opening. However, such half-filling of the substrate into the bottle is
inappropriate and uneconomic for commercial cultivation because bottles cannot be half-filled
with substrate using automatic filling machines. Moreover, the cropping of the fruit bodies
fruiting inside the bottle is very difficult. Takara fills the substrate into 1,100 ml bottles with
the opening of 82 mm in diameter, and then mechanically drills five holes into the substrate to
inoculate with liquid spawn. Yamasa uses 800 ml polypropylene bottles with an opening of 75
mm in diameter, which are filled mechanically with substrate, and which will contain
approximately 640 g of substrate per bottle.
Utilization of liquid spawn

Solid spawn produced on a sawdust substrate has been used in experimental
cultivation. Takara has used liquid spawn for commercial production of L. shimeji. We also
confirmed that liquid spawn inoculation enhanced faster colonization of the substrate by
fungal mycelia and resulted in high fruit body yields of good quality in the commercial
cultivation of L. shimeji.
Spawn run
In the cultivation of L. shimeji using 800 ml bottles filled with 400 ml of substrate
(Ohta, 1998b), the inoculated bottles are placed in an incubation room at 20-23 OC and 60-
70% relative humidity for spawn running. Forty to fifty days after inoculation, mycelia have
fully colonized the substrate. According to Yoshida & Fujimoto (1994), 870 g of a substrate
composed of peat moss/liquid medium containined in a polypropylene bag was incubated at
23 OC and 70-80 % RH for 90 days after inoculation. In the commercial production of L.
shimei at Takara, 1,100 ml polypropylene bottles containing the substrate are initially
incubated at 21 OC for 40 days and then for 70 days additionally after the inoculation. In
commercial cultivation at Yamasa, inoculated bottles of 800 ml size are placed in an
incubation room at 23 OC and 65-70 % RH for 80-85 days.
200
Casing and casing materials
According to Ohta’s cultivation manual (1998b), the surface of the substrate was
covered with autoclaved peat moss as casing material and the substrate was incubated for an
additional 5-7 days after casing. The casing material, consisting of 20 liter peat moss, 100 g
CaCO3 and 10 liter water, was adjusted to pH 5.0-5.4 before autoclaving. However, peat moss
is totally inadequate as a casing material for the commercial cultivation of L. shimeji because
peat moss falls between the branches of fruit body clusters and soils the white stipes.
Consumers must then wash the mushroom with water. Takara initiates primordia formation by
Kinkaki (in Japanese, raking off the surface of substrate to stimulate fruiting) without the need
for casing. Yamasa uses Kanuma-soil (porous, lightweight granular soil) as the casing
medium. The substrate covered with casing layer is additionally incubated at 20-23 OC for 10-
14 days.
Primordium formation (Medashi in Japanese)

After Kinkaki, or the complementary incubation for approximate 10 to 14 days
subsequent to casing, the bottles are placed in a pinning room at 15-16 OC, 80-90 % RH and
600-1,000 ppm CO2 concentration to stimulate primordium formation (Ohta, 1998b). Light
illumination (500-600 lux) in the daytime is required for the induction of primordium
formation. Primordia are formed on the surface of the substrate (Takara), or the surface of the
casing layer (Yamasa), 10 to 14 days after transfer of the bottles to the pinning room.
Growing
After 25 to 35 days, when the primordia appear on the surface of either the substrate or
the casing layer, the primordia develop into mature fruit bodies ready for harvest. The
cultivation cycles from inoculation to harvest in the commercial production of L. shimeji are
approximate 130 days at Takara and 90-100 days at Yamasa.
Harvesting
Crop yields using the technique of Ohta (1998b) are in the range of 53 to 69 g per 800
ml bottle containing 400 ml of barley/sawdust substrate. Fruit body yields are lower under
commercial cultivation conditions. On the other hand, it is estimated that fruit body yields of
120 to 150 g per 1,100 ml bottle with the large opening are harvested at the Takara
commercial cultivation facility. At Yamasa, yields are in the range of 110 to 160 g per 800 ml
bottle with the large opening. Commercial production yields of L. shimeji are considerably
lower compared with yields obtained through the commercial cultivation of Flammulina
velutipes and Hypsizygus marmoreus.
Figure 2. Bottle culture of a hybrid strain of Lyophyllum shimeji (courtesy of Yamasa

Corporation)
201
In near future, new strains of L. shimeji having improved cultivation characteristics,
e.g. high productivity, high quality and a short cultivation cycle, should be developed by
breeding for desired fruit body features.
The price of wild L. shimeji fruit bodies in season can range from US$110 to US$200
per kilogram in the retail market. The retail price of cultivated L. shimeji fruit bodies ranges
from US$30 to US$80 per kilogram.
Outlook
As previously mentioned, growers and companies producing L. shimeji should

improve the substrate, casing materials and cultivation methods for the commercial
production of this mushroom. Utilization of cheap materials for the growth substrate, effective
substrate formulations, and shorter term cultivation periods are important to reduce
production costs and to provide for stable cultivation of this fungus. Overly expensive prices
for this cultivated edible mushroom are not acceptable to consumers although its taste and
texture are immensely agreeable. The breeding of excellent hybrid strains with desirable
features is strongly expected and will lead to a more solid consumption of L. shimeji.
References
Fujita H, Itoh T, Kobayashi F, Ogawa M. 1982. Ecological studies of Lyophyllum shimeji in

Pinus densiflora forest. Trans Mycol Soc Japan, 23, 391-403. (in Japanese)
Kusuda M, Ueda M, Konishi Y, Matsuzawa K, Shirasaka N, Nakazawa M, Miyatake
K, Terashita T. 2004. Characterization of extracellular glucoamylase from the
ectomycorrhizal mushroom Lyophyllum shimemi. Mycoscience, 45, 383-389.
Ohta, A. 1994a. Some cultural characteristics of mycelia of a mycorrhizal fungus, Lyophyllum
shimeji. Mycoscience, 35, 83-87.
Ohta A. 1994b. Production of fruit-bodies of a mycorrhizal fungus, Lyophyllum shimeji, in
pure culture. Mycoscience, 35, 147-151.
Ohta A. 1997. Ability of ectomycorrhizal fungi to utilize starch and related substrates.
Mycoscience. 38, 403-408.
Ohta A. 1998a. Culture conditions for commercial production of Lyophyllum shimeji. Trans
Mycol Soc Japan 39, 13-20. (in Japanese)
Ohta A. 1998b. Shiga Prefectural Forest Center Cultivation Manual for Lyophyllum shimemi.
6pp. (in Japanese)
Terashita T, Kitao T, Nagai M, Yoshikawa K, Sakai T. 2000. Amylase production during the
vegetative mycelial growth of Lyophyllum shimeji. Mush Sci Biotechnol., 8, 61-69. (in
Japanese)
Yamanaka K. 1990. Ecological characteristics of Lyophyllum shimeji. Bull. Nara Forestry
Experimental Station, 20, 1-11. (in Japanese)
Yamanaka K, Chie O. 1998. Nutritional requirement for mycelial growth in Lyophyllum
shimeji and Lyophyllum fumosum. Mush Sci Biotechnol., 6, 159-165. (in Japanese)
Yoshida H, Fujimoto S. 1994. A trial cultivation of Lyophyllum shimeji on solid media. Trans
Mycol Soc Japan, 35, 192-195. (in Japanese)
202
Organic Button Mushroom (Agaricus bisporus) Production, Quality

Produce and Pesticide Residue Analysis,
BL Dhar1*; OP Ahlawat2; R. K. Sharma1 ; JK Dubey3, SK Patyal3 & Meena Thakur3

1
Division of Plant Pathology, Indian Agricultural Research Institute, New Delhi-110012,
India; 2National Research Centre for Mushroom, Chambaghat, Solan -172213 (H.P), India;
3
Department of Entomology & Apiculture, University of Horticuture & Forestry, Nauni,
Solan, HP, India. Email: dhar_bl@hotmail.com
Abstract
The organic button mushroom cultivation project was started at this Centre in 2001-
02. So far, 10 trials have been conducted under this project at the Centre. The basic work
centered on compost preparation without the use of fertilizers/chemicals, with the aim of
elimination of pesticides detected from the base material from the substrate through high-
temperature prolonged aerobic fermentation of the compost during Phase-I, for catabolism of
the pesticides to harmless by-products. With improved/prolonged high temperature
fermentation in phase-I, most of the pesticide residues detected from base materials in earlier
trials were eliminated from the substrate. With standardization of the cultivation technology,
higher mushroom yields of 18-20 kg/100 kg compost in 4-6 weeks of cropping were obtained,
with improved quality of fruit body. The base materials used for crop raising were cereal
straws, poultry manure, decomposed farm yard manure/spent mushroom substrate/coir pith,
wheat bran, cotton seed cake and brewer’s grain. The composting schedule followed was pre-
wetting: day 6, day 4, day 2; phase-I in bunker/ricks 0, 3, 6, 9, 11, 13, 15 (fill); phase-II in
bulk pasteurization chamber following a normal schedule of pasteurization at 57-59 OC and
conditioning at 48-53 OC. Sylvan A-15 strain of Agaricus bisporus was used in the study.
Spawn running was accomplished in 12-14 days; case run in 7 days and the first flush
appeared on average 16-17 days after casing application. The crop was raised in environment
controlled cropping rooms at 15-17 OC, 80-85%, RH and CO2 concentration of around 800-
1000 ppm. No pesticides were used during the cultivation trials. Hanging of oil coated
polythene sheet with a yellow lamp for fly trapping was successfully used to trap flying
insects. Use of common salt to isolate and destroy the stray diseased fruit bodies on the crop
bed was successfully done to keep the diseases under check as and when detected. The
pesticide residue analysis was done for about 40 different pesticides or their
isomers/analogues/catabolic by-products commonly used on agri-crops and poultry. The
important amongst these were hexachloro-cyclohexane (HCH) and all its isomers, DDT and
different analogues, endosulphan and different isomers, ethylene bis-dithiocarbamates,
carbendazim and chloropyriphos. All organic chlorines, synthetic pyrethroids and
organophosphorus pesticides were assayed on a gas chromatograph model HP 5890-A,
Series-II using Electron Capture Detector (ECD) and Nitrogen Phosphorus Detector (NPD) by
following the method given by Kadenczki et al. (1992). Ethylene bis-dithiocarbamate
fungicides were detected by second derivative UV spectroscopic method of Dubey & Stan
(1998). Carbendazim (MBC) fungicides were detected by the Nath et al. (1993) method. The
quality of the fruit body was assessed on measurable parameters like fruit body length/weight,
pileus dia/thickness, pileus-stipe ratio, toughness of fruit body, dry weight and the N-content.
Almost all the quality characteristics showed superiority when compared to mushrooms raised
non-organically. One on-farm-trial was conducted on progressive mushroom farm near the
Centre with good results. Organic Food Production Laws of the US Govt (1990) were
followed in the project.
203
Key Words: Agaricus bisporus; Organic cultivation; Pesticide degradation; High temperature
fermentation; Pesticide residue analysis
Introduction
Organic agriculture is what man learnt from pedegree from time immemorial, right
from the stone age to the beginning of the 20th century. Field crops were grown on soils
enriched with animal manures/ecyclable agro-wastes to sustain life on earth. It is only in
recent times towards beginning of the 20th century, with advancement in chemistry, that use of
chemical fertilizers and pesticides were resorted to for increased crop productivity and
protection against pests. This resulted in the accumulation of chemicals/pesticides in the
soil/water body below, over a long period of time showing its ill effects by way of increase in
human diseases/sufferings through use of agricultural produce raised on these pesticide loaded
soils and by use of pesticide contaminated water for irrigation. Generation of information and
data on pesticide residue accumulation in foods/vegetables/fruits/poultry and other agro-
products has brought to light the pathway through which these pesticides have gained entry
into human body. Data on pesticide presence in human blood was made available by WHO-
UN about higher percentage of DDT/BHC/other commonly used pesticides in the blood of
people from developing countries like India, Pakistan and some other countries. This put
pressure on the human mind to look for alternative pathways whereby these pesticides do not
find their way into food products that ultimately end up in the human body, which led to the
concept of "organic agriculture production", whereby use of fertilizers/pesticides is restricted
that were earlier introduced by man for obtaining increased crop yields, meaning thereby to
reverse the process of fertilization/pesticide application from outside.
Cultivated edible mushrooms are grown on substrates produced from agro-
byproducts/agro-wastes like cereal straws, animal manures, legume seed cakes and other such
N-rich supplements. These agro-products when harvested from soils containing pesticides
showed their residues in grain as well as straw, which ultimately result in the entry of
pesticide residues into mushroom fruit body. One method of organic mushroom cultivation is,
therefore, by exclusion of these residues from mushroom substrates by use of agro-based
materials grown on soils without pesticides residues/or on land kept fallow for five years in
order to rid the land of pesticide residues. The second alternative method for organic button
mushroom cultivation is by process of elimination/catabolization of pesticide residues from
compost that gain entry into substrate through composting ingredients, by improved method
of high temperature fermentation during Phase-I of composting or by selective use of
thermophilic microflora from the compost for catabolization of pesticide residues into
harmless byproducts/compounds.
Since obtaining organically produced base materials for substrate preparation for
button mushroom cultivation is very difficult in developing countries like India, it is the
second option that was applied for organic button mushroom cultivation in the present study.
Mushrooms are a food crop recognized by FAO-UN for human nutrition, especially for their
higher content of quality proteins, vitamins and minerals, when compared to other vegetables.
Mushroom cultivation has additional advantage as it is cultivated on agro-wastes which
require recycling in nature, hence is an environmentally friendly process. Moreover, there is
minimum land use involved in mushroom cultivation and this can easily be adopted in
places/countries with scarce land availability. Unproductive land, not fit for cultivation, can
be utilized for building infrastructure for indoor mushroom cultivation.
The first country to come out with Organic Food Production Laws was the USA
Department of Agriculture as part of the 1990 Farm Bill (Mushroom News, 1990). Similar
environmental guidelines for mushroom producers have been issued by Ministry of
Agriculture, Food and Fisheries, Government of British Columbia, Canada to advise
204
mushroom growers regarding the use of various raw materials during mushroom growing to
eliminate/reduce its impact on air, soil and water pollutants. The guidelines for organic food
production have also been evolved by various other international agencies like International
Federation for Organic Agricultural Movement (IFOAM), European Union and Codex
Standards. In India, the responsibility of promotion of Organic Agriculture has been given to
Agricultural Processed Food Development Authority (APEDA), Govt. of India, Ministry of
Commerce for preparing the national standards for organic agriculture and evolve certification
standards for certification of various organic crops in the country.
Tea in the north-eastern region in India is grown organically by some planters under
certification of Swiss Organic Agency (Bangalore based). Ginger is produced organically by
farmers in the state of Manipur (N. Eastern India) and marketed in Europe. Cotton is now
produced organically in India for export with good prospects. The project on organic
cultivation of the button mushroom Agaricus bisporus, was started at National Research
Centre for Mushroom, ICAR, Solan in 2001-02 and, so far, ten well laid out replicated trials
have been conducted using a minimum of two tons of compost in each trial for cropping,
leading to standardization of improvised composting technique whereby most of the
pesticides, detected from composting ingredients at the start, were successfully eliminated
from the substrate to produce pesticide free button mushrooms. The data was generated on
mushroom yield, fruit body quality and pesticide residue analysis, which is presented in this
paper.
Compost for the trials was prepared using agro-byproducts like cereal straws as base
material and animal manure/oil seed cakes/wheat bran/brewers grain as composting nitrogen
supplements. The standard formulation used for compost making was:
Wheat straw 1000 kg
Poultry manure 800 kg
Brewer's grain (wet) 400 kg
Wheat bran 250 kg
Cotton seed cake 60 kg
Gypsum 35 kg
Water 3500-4000 l
N at start 1.57%
N at spawning 2.3%
------------------------------------------------------------------------------------------------
From Sharma et al. (2003) - thermogravimetric method for estimation of carbon, nitrogen dry
matter, dry matter, ash, pH, minerals, lignin of various composting materials in India.
Compost was prepared following the method outlined by Sinden & Hauser (1950, 53) with
improvised application during phase-I. The composting schedule followed was:
Phase-I :
Pre-wetting: Days 6, 4, 2
Outdoor composting: 0, 3, 6, 9, 11, 13, 15 (fill for phase-II)
Phase-II :
5-6 days inside the bulk chamber until elimination of ammonia
The outdoor fermentation during phase-I was improvised and prolonged to 5-6
turnings given after 2-3 days intervals depending upon the temperature development in the
composting materials. This was necessary to facilitate maximum ammonia production during
phase-I as there is slow release of N from organic matter as compared to fertilizers. This also
resulted in increased exposure of the composting materials to high temperature fermentation
205
process for catabolization of pesticide residues present. The compost stack temperatures of
70-75 OC were attained before each turning during Phase-I until maximum ammonia
production was achieved. The composting material was filled for Phase-II on day 15/16 for
pasteurization /conditioning. Steam was injected immediately after equivalization of
temperatures of plenum/ compost/air above. The pasteurization was done at air temperature of
57-59 °C for 8 hours, followed by conditioning with introduction of 25% fresh air/and
temperatures of 48-53°C (both bed & air). This lasted for 4-5 days until no ammonia was
detected from the tunnel air (below 3 ppm dragger tube/ammonia sensor in the bulk chamber).
The compost was cooled and then spawned at 0.5% of spawning rate, using A. bisporus strain
A-15 (Sylvan).
Spawn running was accomplished in 14-16 days on average in all the trials with room
environment simulated to a temperature of 24 °C (23 °C air, 24 °C bed), RH of 95% and
carbon dioxide concentration above 10,000 ppm. The trial was conducted in polypropylene
bags of 150 gauge (24" x 21") holding 10 kg compost at spawning.
Casing materials used were mixture of spent mushroom substrate, coir pith, FYM
alone and in combination (50:50 V/v) after steam pasteurization at 65-70°C for 8 hours.
Uniform layer of 3-4 cm thick casing layer was applied on top of fully spawn run compost,
using wooden buttons/iron rings. The casing was immediately watered to make it moist for
quick mycelium impregnation. The case run was done under similar conditions as described
for spawn run, which took 7-8 days.
The venting was done after mycelium colonized the casing, when the temperature was
lowered simultaneously to 15-17 °C (15 °C air, 17 °C bed). Pinheads appeared 28-30 days
post spawning, with first flush harvested after 34-35 days post spawning. Fresh tap water was
used for water spraying of beds. No chemicals/ pesticides were used at any stage of the crop
cycle. Mushroom yield was recorded for a period of 4-6 weeks of cropping.
Samples were drawn from all composting ingredients, compost after Phase-I and
Phase-II, casing materials, water, spawn and fruit body and sent to the residue analysis
laboratory at the University of Horticulture and Forestry, Nauni, Solan for pesticide residue
analysis (collaborators in the project). The pesticide residue analysis was carried out for about
32 different pesticides or their isomers/analogues/catabolic by-products commonly used on
agricultural crops and poultry. The important amongst these were HCH (4 isomers), DDT and
its analogue, alpha-endosulfan, endosulfan sulphate, ethylene bis-dithiocarbamate,
carbendazim, malathion, chlorophyriphos and deltramethrin. All organochlorines, synthetic
pyrethroids and organophosphorous pesticides were assayed on gas chromatograph (model
HP 5890 A - series II and model mpdel Agilent 6890 N) using electron capture detector
(ECD) and nitrogen phosphorus detector (NPD) by following the method described by
Kadenczki et al. (1992). Parameters of gas chromatograph were: oven temperature 160 °C for
2 min hold time and then final temperature 260 °C at 3.5 °C per minute for 43 minutes,
injection port temperature 260 °C, ECD temperature 300 °C and NPD temperature 350 °C.
Ethylene bis-dithiocarbanate fungicides were detected by second derivative UV spectroscopic
method described by Dubey & Stan (1998). Carbendazim (MBC) fungicides were detected by
the method described by Nath et al. (1993).
Nitrogen analysis was done by microkjeldal method in autoanalyser. Quality
characteristics (measurable) of the fruitbody were recorded from the first harvest. The
measurable quality characteristics determined were the whole mushroom length/ weight,
pileus diameter/thickness/weight, stipe diameter/length/weight, pileus-stipe ratio (w/w),
whiteness, dry weight, N-content, toughness (cavity size) and others. No pesticides/chemicals
were used at any stage in the cultivation cycle. The data were subjected to statistical analysis,
wherever necessary, for interpretation of results. Organic laws of the US Government (1990)
were followed in these experiments in absence of such laws in India.
206
Three major findings, i.e. mushroom yield, fruit body quality and pesticide residue
analysis, will be discussed in this paper and results interpreted based on these findings.
Mushroom yield
The quantity of compost obtained from one ton base material (straw) on an average
was higher, 3.5 tons of compost, possibly due to use of voluminous agro-by-products/wastes
for nitrogen enrichment during compost making which has greater bulk when compared to
chemical fertilizers. Mushroom yields were recorded for a period of 4-6 weeks, but some
trials had to be terminated earlier due to problem of pests/diseases. Some of the quality
characteristics of compost having direct bearing on mushroom yield/quality are presented in
Table 1.
The nitrogen dry matter in Indian wheat straw as determined by the thermogravimetric
method (Sharma et al. 2003) was in the range of 0.34 to 0.38% as compared to N-dry matter
of 0.44 to 0.68% in Northern Ireland (NI) wheat straw. Nitrogen content determined in other
composting ingredients/compost from India by these workers was 1.81% in poultry manure,
1.28% in Phase-I compost and 1.58% in Phase-II compost. In comparison NI poultry manure
contained 3.1-5.1% nitrogen, Phase-I composts 1.20% nitrogen and Phase-II composts 2.58%
nitrogen. The ash content was four times higher in Indian poultry manure as compared to NI
poultry manure, possibly due to a high content of sand mixed with poultry manure. The
composting formulation had to be redrawn accordingly to balance the C:N ratio in the
composting material. Cropping details and yield data recorded in all the trials is given in
Table 2
Mushroom yields varying from 3 kg to 20 kg per 100 kg compost were obtained in
different trials conducted over a period of 5 years at the Centre (Table 2). In earlier trials, low
yields were harvested due to pest problems at various stages of the cropping cycle and the
experiment had to be terminated prematurely. However, in trials 7 and 8, good mushroom
yields of 18 and 20 kg from 100 kg compost were harvested in 4 and 6 weeks of cropping,
respectively. The bulk of the crop yield was harvest in first 3 weeks of cropping. Good quality
button mushrooms were harvested in these trials, with fruit body white in colour, excellent in
texture, hard and closed buttons. Average individual fruit body weight recorded was 14 g in
organically grown button mushrooms.
Mushroom quality
Organically produced button mushrooms looked like any other button mushroom with
excellent taste and flavour, as generally found in button mushrooms (Figure 1). The quality
characteristics (measurable) of organic button mushrooms were found to be superior to
traditionally grown mushrooms. Organically grown mushrooms showed a slightly higher
value of nitrogen (proteins) as compared to mushroom grown non-organically (Table 3).
The whole mushroom length and weight of organically grown button mushrooms were
superior to mushrooms grown non-organically. The pileus diameter, thickness and weight
were also superior as compared to mushrooms grown non-organically. These are the primary
parameters that make up the physical characteristics of a fruit body followed by superior
pileus-stipe ratio. The higher the pileus weight/dia w/thickness, the better the mushroom. The
cavity size determines the toughness, which was found superior to normally grown
mushrooms. However, there was no difference in the whiteness of the mushroom as measured
by reflectance meter. The dry weight was higher in non-organically grown mushrooms, but N-
content was higher in organically grown mushroom. This aspect is under further investigation
in greater detail.
207
Table 1. Compost quality characteristics
Trial Compost Compost Compost Compost Compost Compost Phase-I
No. colour pH moisture 'N' ( %) odour quantity/ in
(%) ton base bunker/
material ricks
(B/R)
1* Light dark 8.0 66 2.2 sweet smell 3.29 B
brown
2* Light dark 8.2 67 2.3 sweet smell 3.20 B
brown
3 Deep dark 7.8 64 2.25 sweet smell 4.20 R
brown
4 Dark brown 7.8 67 2.31 sweet smell 3.60 R
9 Dark brown 7.9 66 -- -- 3.80 R
*In Trials No. 1 & 2, normalcomposting schedule of 3 turnings during Phase I was adopted
Figure 1. Organic crop of button mushroom (Quality) at NRCM Sloan (2006)
208
Table 2. Cropping details and mushroom yields
Trial Spawn Spawn Spawn Case Days to Yield Av. Ind. Yield
No. strain rate run (d) run (d) harvest (kg/100 kg fruit CD
% (post compost) body wt
casing) (g)
1 S-11 0.5 14 7 6.4 22.5 ND --
(NH)
2 S-11 0.5 14 7 19.4 13.0 10.25 --
(NH)
3 A-15 0.5 14 7 17 15.0 14.71 --
(HS)
4 A-15 0.5 14 7 16 3.0 10.80 --
(HS)
5 A-15 0.5 14 7 17 8.00 14.00 --
(HS)
6 A-15 0.5 14 7 17 6.0 12.35 --
(HS)
7 A-15 0.5 14 7 16 18.0 14.00 1.979
(HS)
8 A-15 0.5 14 7 17 20.0 14.50 0.771
(HS)
9 A-15 0.5 14* -- -- -- -- --
(HS)
10 A-15 0.5 14 7 19 10.13 14.00 --
(HS)
* Chaetomium growth found in abundance/anaerobic condition during Phase-II
NH: non hybrid; HS: hybrid Sylvan
Table 3. Measurable quality characteristics* recorded from first harvest

(organic/non-organic - strain A-15)
S.N Treatment Fruit Fruit Pileus Pileus Pileus Stipe Stipe dia
body body wt dia thickness wt (g) length (mm)
length (g) (mm) (mm) (mm)
(mm)
1 Organic 36.6 14.7 34.6 11.8 11.6 24.7 13.7
SE (±) 1.47 0.90 0.98 0.32 0.77 1.48 0.42
2 Non 26.3 10.5 30.7 10.8 8.1 15.6 14.1
organic
SE (±) 0.98 0.76 0.94 0.31 0.63 1.01 0.51
S.N Treatment Stipe Pit stipe Cavity Whiteness Dry wt N content

wt (g) ratio (w/w) (toughness) *** (g) (% DW)
**
1 Organic 3.1 3.7:1 1.7 73.4 9.0 28
SE (±) 0.23 0.16:0 0.16 1.06 -- --
2 Non-organic 2.5 3.2 1.2 74.0 9.2 18
SE (±) 0.18 0.21:0 0.08 1.38 -- --
*The above data is mean of 20 measurements (S No.1) and 16 measurements (S No. 2)

**Ascending order, 1-5 scale ***Measured with reflectance meter
209
Pesticide residue analysis
Pesticides detected from raw materials, Phase I/Phase II composts /supplements,
casing materials, water, spawn, fruit bodies have been reported in details in an earlier
publication (Dhar et al. 2004). Pesticides such as α-HCH, α-endosulfan, p,p-DDT were
detected from wheat straw in earlier trials. Similarly pesticides like α-HCH, β-HCH, γ-HCH,
δ-HCH, α-endosulfan, β-endosulfan, o,p-DDT, p,p-DDT, o,p-DDD, p,p-DDD, p,p-DDE,
chloropyriphos methyl and chloropyriphos were detected from composting ingredients like
poultry manure, cotton seek cake and casing materials/irrigation water. Most of these
travelled to Phase-I composts, and a few also to Phase-II composts. Some of the pesticides
like γ-HCH, α-endosulfan and chloropyriphos were also detected from fruit bodies. This was
in initial trials before improvised composting techniques were standardized. After use of
improvised composting techniques, most of the pesticides were not detected from compost
Phase-II/fruitbody. Some of the pesticides like EDBC and carbendazim detected from wheat
straw, spawn, cotton seed cake and Phase-II composts did not find their way into mushrooms
(Annual Report, NRCM, 2003-04) . The residues that entered the cropping cycle at various
stages during composting were not detected from the fruit body.
Conclusion
The organic mushroom cultivation poses many challenges on yield front, and
mushroom yield has to be compromised for quality. By following the second alternative of
elimination of pesticides and their derivatives during improvised composting, the authors
were successful in raising a crop of button mushrooms organically at NRCM, Solan without
the use of chemicals/pesticides at any stage of crop cycle. Mushroom yield of 18-20 kg/100
kg compost in 4-6 weeks of cropping was obtained after standardization of the improvised
composting technology. The cost of production was higher by 15-20 per cent, mainly due to
cost of composting ingredients which were all agro-byproducts, and the mushroom yield ws
lower due to pests and diseases which appeared after completion of 3rd week of cropping. By
end of 3rd week of cropping, the bulk of the mushroom yield was harvested.
The substrate/casing were steam pasteurized, with pest control confined to use of
sticky-oil traps for trapping flying insects and use of common salt for disease
exclusion/control. No chemicals/pesticides were used for pest control. The crop was raised
in cropping rooms with complete climate controls (Figure 2).
Figure 2. Organic crop of button mushroom (Production facility) at NRCM Solan

(2006)
210
Acknowledgement
The authors are thankful to the Indian Council of Agricultural Research and the Vice
Chancellor, University of Horticulture and Forestry, Solan, for providing facilities for the
research described in this presentation.
References
Anon., 2004. Annual Report 2003-04, National Research Centre for Mushroom,
ICAR, Solan, Himachal Pradesh, India, pp33-34.
Dhar BL, Ahlawat OP, Nath A, Dubey JK. 2004. Organic mushroom production
through improved substrate fermentation process and cultural practices. Mush. Sci.,
16, 289-296.
Dubey JK, Stan HJ. 1998. Second-derivative UV-spectroscopic determination of
dithiocarbamate residues as methyl xanthate in apple and Lanbs’s lettuce. J. Food
Sci. Technol., 35, 482-485.
Kadenczki L, Arpad Z, Gadri I, Arpad A, Gyroft L, Gabriela R, Winfried E. 1992.
Column extraction of residues of several pesticides from fruits and vegetables : a
simple multiresidue method. JAOAC, 75, 53-61.
Nath A, Patyal SK, Dubey JK. 1993. A new protocol for rapid sample preparation for
spectrophotometric estimation of carbendazim residues in apple, tomato and
mushroom. J. Food Sci. Technol., 30, 239-240.
National programme for organic production. 2001. Promotion of Organic Agriculture
by APEDA (India). APEDA Website, www.apeda.com
Sharma D, Awasthi MD, Tewari RP. 1996. Entry of hexachlorohexane residue in
mushroom from substrate. Mush. Res., 5, 109-112.
Sharma HSS, Lyons G, Vijay B. 2003. Quality assessments of Indian mushroom
compost. In: Current Vistas in Mushroom Biology and Production (Upadhyay RC,
Singh SK, Rai RD, eds), NRCM Publication, 289pp.
Sinden JW, Hauser E. 1950. The short method of mushroom composting. Mush. Sci.,
1, 52-59.
Sinden JW, Hauser E. 1953. The nature of the composting process and its relation to
short composting. Mush. Sci., 2, 123-131.
USDA. 1990. Revised proposal announced for national organic programme. Mush.
News, 48, 10-17.
211
Organic Production of Oyster Mushroom in India
Yogendra Mahto and R.N.Verma

Ramakrishna Mission Vivekananda University, Faculty Centre, IRTD,
Morabadi, Ranchi-834008, Jharkhand, India. Email: rnverma_1940 @yahoo.com
Abstract
Oyster mushrooms in India are commonly produced on cereal straw pasteurized in

water containing effective doses of carbendazim and formaldehyde, leading to production of
mushrooms containing some residual toxicity. Hot water treatment as an alternative method of
pasteurization has not been adopted by most growers due to high fuel cost involved in the
practice. In the present study, a Neem Oil formulation containing 0.15% azadirachtin (1500
ppm), has been used to pasteurize chopped paddy straw as the substrate for growing oyster
mushroom organically. Results obtained from both in vitro and in vivo studies on the effect of
low concentrations of Neem Oil on growth and yields of Pleurotus flabellatus (Berk and
Broome) Sacc. are reported. Neem Oil at 150, 15 and 1.5 ppm concentrations had no adverse
effects on mycelial growth of P. flabellatus and a common laboratory contaminant
Aspergillus niger, but considerably restricted the growth of a common mushroom parasite,
Trichoderma viride, for more than one week. Results from an in vivo study on P. flabellatus
indicated that Neem Oil at 0.15 and 0.015 ppm concentrations supported good mycelia
growth, enhanced pinhead numbers and gave considerably higher mushroom yields than the
chemically treated control beds and those soaked in plain water only, except that it extended
the period of the spawn run by 2-3 days.
Key Words: Pleurotus flabellatus; Organic cultivation; Neem oil; Azadirachtin; Trichoderma
viride
Introduction
India produces a large quantity of cereal straw from crops including rice, wheat, ragi,
besides other farm residues like cotton straw, sunflower straw, jute residues, coir pith and
industrial wastes like sugarcane bagasse, tea leaf waste, coffee pulp, oil-seed cakes and rubber
wastes. Most of these agro-industrial wastes have been tried successfully as substrates for
growing different species of oyster mushroom in India and abroad (Jandaik & Kapoor, 1974;
Bano et al. 1978; Silanikove & Levanon, 1986; Mathew et al. 1991; Upadhyay et al. 1996).
The wide adaptability of edible Pleurotus species and the subtropical to tropical weather
conditions obtaining in most parts of India have motivated the Indian farmers from across the
country to adopt its rather simpler and cheaper cultivation technology and grow this
mushroom both for internal consumption and export purposes so as to augment their income.
However, the most widely adopted technique for its cultivation on farm wastes is based on
chemical pasteurization of the substrates in order to eradicate and prevent the
incidence/infestation of the beds by competitor moulds, pathogens and insects (Vijay & Sohi,
1987). For chemical pasteurization, a systemic fungicide, viz. carbendazim and a germicide,
formaline, are used in effective doses in aqueous solution to soak the straw for 18 h before
using it as the substrate for growing oyster mushroom. Alternatively, pasteurization can also
be done quite effectively by hot water- or steam-treatment (Upadhyay et al. 2002) but these
methods are cost-prohibitive and hence their adoption is very limited.
The mushrooms produced on chemically pasteurized substrates obviously carry some
residual toxicity and hence are not considered eco-friendly and safe food for health conscious
consumers both within and outside India, and they also fetch lower prices on the market.
212
Therefore, an attempt has been made to produce a good crop of oyster mushrooms without the
use of chemical fungicide/germicide, as well as the costly method of hot water/steam
treatment, by using a potent biopesticide, viz. a Neem-Oil formulation for pasteurization of
the substrate. Neem (Azadirachta indica) has been identified as a very potent source of
biopesticides effective against a host of insects, and its leaves and oil are traditionally used in
Indian households as effective and safe germicides. The authors conducted both in vitro and
in vivo experiments on the growth and cultivation of P. flabellatus on Neem oil-treated
growth media /substrate, and the results obtained so far are reported here. Efficacy of Neem
oil on fungi in general, and those related to mushroom crop in particular, have not received
the attention of mycologists. Hence, growth dynamics of two common fungal species, viz.
Trichoderma viride, a destructive mycoparasite of mushroom fungi, and Aspergillus niger a
very common laboratory contaminant, on Neem-oil treated culture medium were also studied
and the findings are reported here.
The study was conducted in the Mushroom Laboratory and on the Krishi-Vigyan
Kendra (KVK) farm, Ramakrishna Mission, Morabadi, Ranchi under a project for partial
fulfillment by the senior author (RNV) of the requirements for a postgraduate diploma in the
Agro-Based Biotechnology course of the R.K. Mission, Vivekananda University, Morabadi,
Ranchi, Jharkhand. For conducting the study, a pure culture of P. flabellatus (Berk.&
Broome) Sacc. was obtained from the KVK culture bank and maintained on Potato Dextrose
Agar (PDA) medium .
Various dilutions of a Neem-oil based biopesticide, “Vanguard”, containing 1500ppm
Azadirachtin was used in both for in vitro and in vivo experiments. The in vitro studies on P.
flabellatus and two common fungi, A. niger and T. viride, were conducted by the poisoned
food technique by adding 1 ml of serial dilutions (150, 15 and 1.5ppm) of azadirachtin to
Petri plates containing molten PDA medium which was allowed to solidify before inoculating
the respective test fungus.
For in vivo experiments on P. flabellatus, wheat grains + 2% CaCO3 medium for
spawn preparation and chopped paddy straw as substrate were used. Standard laboratory and
cultivation practices were followed to raise the crop of oyster mushrooms under seasonal
conditions. The biopesticide azadirachtin was used at 0.15, and 0.015ppm concentrations for
substrate pasteurization by soaking in each dilution at 2 kg dry straw per bed for 18 h. The
soaked straw from each treatment was filled in layers into polythene tubes (45 x 60cm) after
draining and drying the excess water from the straw. Spawning was carried out at each layer
so as to complete spawning of a bed with 150 g of spawn. Both ends of the tube were securely
tied, and a few small holes were punched on all sides, before keeping them in a dark, warm
place for incubation. The polythene tubes were slowly removed after the spawn run was
complete, and the beds were kept in the growing room with optimum temperature, humidity
and light, with provisions for ventilation, to initiate fruiting.
Results
Results obtained from the four experiments conducted, viz. three in vitro studies, one
each on A. niger, T. viride and P. flabellatus, and one in vivo cultivation trial on P. flabellatus
on treated paddy straw, are detailed below.
Effect of Neem Oil on Radial Growth of T. viride

Data obtained from the in vitro study on the effect of Neem oil on the growth of T.
viride are given in Table 1. Dilutions D1 (150ppm) and D2 (15ppm) of Neem oil effectively
retarded the growth of T. viride for upto 8 days of incubation as compared to untreated
213
controls. Furthermore, no bacterial contamination were observed until day 12 in both the D1
and D2 plates, even though by that time, T. viride almost covered the D2 plate. However, on
plates containing higher dilutions i.e. D3 (1.5ppm) and D4 (0.15ppm), growth of T. viride was
almost equal to that of untreated controls. At these dilutions, the plates exhibited varying
degrees of bacterial contamination after 8 days incubation.
Effect of Neem Oil on Radial Growth of A. niger

Neem oil treatments D1 (150ppm) and D2 (15ppm) only mildly retarded the growth of
the mould until the 8th day, and the D3 (1.5ppm) and D4 (0.15ppm) dilutions were even less
inhibitory, compared to controls (Table 2). On day 12, the effects of Neem oil were nullified
at all four dilutions, and the mould attained growth almost equal to the controls. Bacterial
contamination in both treated and untreated plates exhibited the same pattern as in the T.
viride plates (Table 1).
Table 1. Effect of Neem oil on the growth of T. viride and A. niger
Mean Radial Growth (cm) Bacterial Contamination

Dilution of
azadirachtin T. viride A. niger T. viride A. niger
Day 8 Day 12 Day 8 Day 12 Day 8 Day 12 Day 8 Day 12
D1 (150ppm) 1.3 2.4 2.6 4.4* - - - -
D2 (15ppm) 1.75 4.0 2.4 4.2 - - - -
D3 (1.5ppm) 4.0 4.5* 3.0 4.0 +++ +++ +++ +++
D4 (0.15ppm) 4.2 4.2 2.75 4.5* + + ++ +++
Control
4.5* 4.5* 3.4 4.5* + + ++ ++
(untreated)
+++ = High; ++ = Moderate, + = Low; - = Absent; * = Full growth.
Effect of Neem Oil on the Growth of P. flabellatus

The highest Neem oil treatments (D1, 150ppm and D2, 15ppm) only mildly retarded
the growth of P. flabellatus at 10 days (Table 2). However, no inhibitory effects on the
growth of P. flabellatus were recorded after 10 days at the lower concentrations tested, or
after 20 days in samples containing all four concentrations of Neem oil, compared to
untreated controls (Table 2). Bacterial contamination followed a similar pattern and was
absent throughout the 20-day experimental period in samples containing the two highest
Neem oil concentrations (Table 2).
Effect of Neem Oil Pasteurization of Paddy Straw on Spawn Run and Fruit Body Yield of P.
flabellatus
Both Neem oil treatments, T1 (0.15ppm) and T2 (0.015ppm), slightly slightly
increased the time required for full spawn run and pinhead initiation compared to controls C1
and C2. However, both treatments considerably increased the number of pinheads and the
mean weight of the sporophores at first harvest. The pinhead number increased by 29% and
131% over C1 and C2 respectively at the 1st harvest. At the 2nd harvest, however, only T1
could increase the number of pinheads and mean weight of sporophores over both the
controls; while T2 could only exceed the value of the mean weight of sporophores of both the
controls. At the 3rd harvest, C1 marginally exceeded the pinhead numbers of both the
214
treatments, but the mean sporophore weight remained the same for C1, T1 and T2; while no
3rd harvest was possible from C2 due to infestation/contamination.
Table 2. Effect of Neem oil on the growth of P. flabellatus
Dilution of Mean Radial Bacterial

Azadirachtin Growth (cm) Contamination
Day 10 Day 20 Day 10 Day 20
D1 (150ppm) 3.4 4.5* - -
D2 (15ppm) 3.5 4.5* - -
D3 (1.5ppm) 3.7 4.5* + +
D4 (0.15ppm) 3.7 4.5* ++ ++
Control (untreated) 3.7 4.5* ++ +++
+++ = High; ++ = Moderate,+ = Low; - = Absent; * = Full growth.
Table 3. Effect of Neem oil pasteurization of paddy straw on spawn run and fruit body
yield of P. flabellatus
Azadirachtin Days to 1st 2nd 3rd Total

concentration Harvest Harvest Harvest yield
(ppm)
Full Pinhead Pinhead Pinhead Pinhead Mean
spawn formation No./Mean No./Mean No./Mean wt. (g)
run wt. (g) wt. (g) wt. (g)
(T-1) 0.15 17 22.5 93/425 155/250 71.5/100 775
(T-2) 0.015 15.5 20 63/300 125/250 65/100 650
C1 14 16 38.5/175 132.5/225 76/100 500
C2 14 16 38/170 100/150 NIL 320

C1 = Control with bavistin and formaline; C2 = Plain water control
Both treatments resulted in considerable increases in yield compared with the two
controls, with T1 giving the highest yield exceeding C1 by 55%. On the other hand, a 30%
yield increase over C1 was recorded for the T2 treatment. The yield increase from T1 and T2
over C2 were, however, much higher, viz. 142% and 97% respectively (Table 3).
Organoleptic Test of Mushrooms

Oyster mushrooms produced on Neem oil pasteurized straw appeared quite healthy
and attractive (Figure 1). However, to assess their acceptability, organoleptic tests on the
mushrooms were performed with the help of 12 random volunteers, who recorded their
response in respect of various parameters including aroma, taste and insects. While all the
volunteers rated the aroma as pleasant, 50% rated the taste as excellent. Only two reported the
occurrence of a few adult mushroom flies in their samples although flies in numbers were
215
visible in harvests from control beds, possibly due to prevalent warm weather conditions
during the experiment.
Figure 1. First flush Pleurotus flabellatus grown on paddy straw pasteurised

with 0.15ppm Neem oil
Discussion and Conclusions
Cultivation of the oyster mushroom is of recent origin as compared to Black Ear

(Auricularia spp) and Shiitake (Lentinula edodes) mushrooms, which are known to have been
cultivated in 600 A.D. and 1100 A.D, respectively. Oyster mushrooms were first successfully
cultivated in Germany by Falck in 1917 on tree stumps and wooden logs. Block et al. (1958)
grew Pleurotus ostreatus on sawdust of Eucalyptus and pine. Cultivation on straw was first
reported by Bano & Srivastava (1962). Zadrazil (1974, 1978) standardized an industrial
process of continuous production of substrate for cultivation of oyster mushrooms. At the
National Research Centre for Mushroom (then called NCMRT), Solan, India, a chemical
pasteurization based technique for oyster mushroom cultivation was standardized (Vijay &
Sohi, 1987), which has been widely adopted in India. However, there appears to be no report
of organic production of oyster mushrooms so far. A literature review also reveals that,
although Neem oil based formulations have been widely tested as a bioinsecticide, they have
seldom received the attention of the mycologists/plant pathologists. Of course, Neem oil cake,
besides some other oil-seed cakes and a few other botanicals have been tested against some
mushroom competitors/pathogens. Sohi & Grewal (1987) reported that incorporation of
Tagetes erecta residues inhibited the growth of T. viride, Penicillium oxalicum and
Gliocladium deliquence. Neem cake was found effective against some mushroom weed fungi
(Grewal & Grewal, 1988), while Adenocalyma allica and Hyphus suvalence were found to
control the cobweb causing fungus Cladobotryum dendroides (Singh & Rai, 1997). T. viride,
a myco-parasite causes green mould disease of the white button mushroom (Agaricus
bisporus) inflicting appreciable yield loss to the crop (Sharma, 1994). Also, it damages the
oyster mushroom beds and contaminates spawn bags to a great extent. The findings of this
study have shown that the biopesticide azadirachtin at 150 and 15 ppm concentrations could
retard the growth of T. viride by 71% and 61% respectively until the 8th day, and by 46% and
11% until the 12th day of incubation, which obviously will be quite helpful during the spawn
216
run of the crop raised on straw pasteurized by the biopesticide. There was no effect of the
biopesticide at all concentrations tested on A. niger during the study, but A. niger is not a
known competitor of the oyster mushroom.
1st harvest
800 2nd harvest

700 3rd harvest
600 Total
Weight (g)
500
400
300
200
100
0
0,15 0,015 C1 C2
Neem oil concentration (ppm)
Figure 2. Yields of P. flabellatus from Neem oil pasteurized paddy straw
Mycelial growth of oyster mushroom was also found unaffected by azadirachtin at all
concentrations tested during the in vitro or in vivo studies (Table 2), which supports its use for
pasteurizing the substrate for mushroom cultivation. Although the effect of Neem oil
formulation on the growth of Pleurotus spp has not been studied earlier, Neem cake has been
used as a supplement and it is reported to exert beneficial effect on mycelial growth and
fruiting of Pleurotus spp by several workers (Krishmoorthy & Narsimhan, 1994; Hazarika,
1998; Srivastava & Singh, 1999). All these reports support the findings of this investigation
and strengthen the concept of using this biopesticide for growing oyster mushroom. In fact,
the in vivo experiment on growing of P flabellatus on azadirachtin (0.15 and 0.015 ppm)
pasteurized straw conducted during the investigation gave 55% and 30% higher yields,
respectively over control 1, i.e. over the most prevalent cultivation practice using carbendazim
and formaline for pasteurizing the straw. Besides higher yields, the Neem oil treatment
produced healthy and tasty mushrooms with a pleasant aroma and good acceptability. Earlier,
Neem oil for pasteurization or even as amendment /supplement has not been used, but several
reports on the use of Neem cake suggest that at 2-4% level, Neem cake powder as amendment
enhanced spawn run and reduced the number of days for pinhead formation (Geetha &
Sivaprakasam, 1994) and in the case of Pleurotus citrinopileatus (Fr.) Singer and P. sajor
caju, Krishmoorthy & Narsimhan (1994) recorded 48.7% and 75% yield increases,
respectively over controls. Srivastava & Singh (1999) obtained the maximum yield from 5%
Neem cake-supplemented beds over controls in the case of P. citrinopileatus.
The only report on the use of Neem oil formulations in oyster mushrooms has come
from Bhat et al. (1998), who used 0.15% Rakshak and 0.03% Neemark as a spray at spawning
217
and after full spawn run, but for insect management only. Besides getting the former, as
effective as endosulfan (0.15%) and superior to Bacillus thuringiensis and Neemark in insect
management, they found the two Neem formulations viz. Rakshak and Neemark, gave 42%
and 28% higher yields, respectively over controls. The yield increase recorded in the present
investigation were much higher, which might be due to the control of competing moulds,
pathogens, bacteria and insects right from the day of spawning, as well as the growth-
stimulating effect of azadirachtin. It may therefore be concluded that Neem oil (azadirachtin)
in recommended doses (0.15 and 0.015 ppm) could be used to pasteurize paddy straw as a
substrate for growing oyster mushroom in enhanced quantity and of better quality, due to the
fact that such products would be free from residual toxicity and might possibly contain
azadirachtin - a medicinal limonoid known to be present in Neem oil – one of the most potent
biopesticide available to us.
Acknowledgements
The senior author (RNV) expresses his gratitude to the Honorable Vice Chancellor,
the Administrative Head, Dean and faculty members of the RK Mission Vivekananda
University for their kind help and guidance during the completion of this project.
References
Bano Z, Srivastava HC. 1962. Studies on the cultivation o Pleurotus spp on paddy straw.
Food Sci., 12, 363-365.
Bano Z, Rajarthnam S, Nagarajan N. 1978. Some aspects of the cultivation of
Pleurotus flabellatus in India. Mush. Sci. 10, 597-608.
Bhat MN, Kumar S, Singh AK, Chandra S, Shylesha AN. 1998. Neem-formulation in
management of insect infestation in cultivation of the oyster mushroom in Meghalaya.
Mush. Res. 7, 51-52.
Block SS, Tsao G, Han LH. 1958. Production of mushroom from sawdust. J. Agric. Food.
Chem., 6, 923-927.
Falck R. 1917. Uber die walkulter des Austernpilzes (Agaricus ostreatus) auf
Laubhelzstubben. Z Forest-Sagdwes., 49, 159-65.
Geetha D, Sivaprakasam K. 1994. Effect of different substrates and amendments on
cultivation of oyster mushroom. Mush. Res., 3, 52-53.
Hazarika DK. 1998. Effect of substrates and supplements on yield of oyster mushroom. Mush.
Res. 7, 47-48.
Jandaik CL. Kapoor JN. 1974. Studies on the cultivation of Pleurotus sajor-caju (Fr.) Singer.
Mush. Sci. IX, 667-672.
Krishnamoorthy AS, Narsimhan V. 1994. Influence of organic supplement on yield and
protein content of oyster mushroom. Mush. Res., 3, 54.
Mathew J, Kothandarman R, Thresiamma KJ. 1991. Cultivation of oyster mushroom on
rubber processing factory waste - a possible solid waste utilization method. Indian
Mushrooms. Proc. National Symposium on Mushroom. Thiruvananthapuram pp97-99.
Sharma SR. 1994. Diseases of mushroom and their management. NCMRT, Solan. Tech
Bulletin No., 43 pp
Silanikove N, Levanon D. 1986. Cotton straw: composition, variability and effect of
anaerobic preservation. Biomass, 9, 101-112.
Singh AK, Rai B. 1997. Utilization of sugarcane trash (dried leaves) for production of oyster
mushroom Pleurotus florida. Mush. Res., 4, 35-38.
Srivastava DK, Singh SP. 1999. Effect of supplements in paddy straw on yield of Pleurotus
citrinopileatus (Fr.) Mush. Res., 8, 47-48.
218
Upadhyay RC, Vijay B, Verma RN. 1996. Use of industrial tea leaf waste for cultivation of
oyster mushroom. In: Mushroom Biology and Mushroom Products, (Royse D. ed).
Pennsylvania State University, University Park, pp423-428.
Upadhyay RC, Vijay B, Verma RN. 2002. Cultivation of oyster mushroom. In: Recent
Advances in the Cultivation Technology of Edible Mushrooms (Verma RN, Vijay B, Eds.
) NRCM, Solan, India, pp209-219.
Vijay B, Sohi HS. 1987. Cultivation of oyster mushroom Pleurotus sajor-caju (Fr.) Singer on
chemically sterilized wheat straw. Mush. J. Tropics, 7, 67-75.
Zadrazil F. 1974. The ecological and industrial production of Pleurotus ostreatus, P. florida,
P. cornucopiae and P. eryngii. Mush. Sci. IX, 621-52.
Zadrazil F. 1978. Cultivation of Pleurotus. In: The Biology and Cultivation of Edible
Mushrooms (Chang ST, Hayes WA, Eds.). Academic Press, New York p52.
219
Olive Mill Waste as a Substrate for the Cultivation of Pleurotus spp

Mushrooms
C. Soler-Rivas,a, b, M. I.G. D. Ferreira Polonia,a, c, José Cardoso Duarted, H. J. Wichersa

and D. Levanone
a
Wageningen University and Research Centre, Bornsesteeg 59. 6708 PD. Wageningen. The
Netherlands; bUniversidad Autonoma de Madrid, Unit of Food Science and Technology, Ctra.
de Colmenar km. 15. 28049 Madrid. Spain; cEscola Superior Agrária de Santarém - ESAS.
Sector de Engenharia Agro-Alimentar. Quinta do Galinheiro, S. Pedro. 2000-014 Santarém.
Portugal; dInstituto Nacional de Engenharia e Tecnologia Industrial - INETI. Departamento de
Biotecnologia, Unidade de Monitorizacão e Ecotoxicidade. Edifício F. Estrada do Paço do
Lumiar, 22, 1649-038 Lisboa. Portugal; eMigal-Galilee Technological Center P.O. Box 831,
Kiryat-Shmona 11-016. Israel. E-mail: danl@migal.org.il
Abstract
Olive mill waste (OMW) is the main waste material of modern industrial production
of olive oil. The addition of up to 30% OMW to cereal grains used for the production of
Pleurotus inocula (spawn) for mushroom cultivation, had no negative impact on spawn
quality. Slight increases in mushroom yields, with no harm to their quality, was demonstrated,
when 50% OMW were added to wheat straw for Pleurotus spp cultivation. Exocellular
activity of the ligninolytic enzymes laccase and peroxidase was higher in the OMW
supplemented pure cultures, spawn and straw substrates of Pleurotus spp. Total peroxidase
activity (TP) was higher than laccase activity in the wheat straw/OMW substrate. TP activity
in liquid culture correlated with OMW content in the medium. These findings indicate that
there is an option to use OMW as supplement for Pleurotus substrates.
Key Words: Pleurotus spp; Olive mill waste; Ligninolytic enzymes; Laccase; Peroxidase
Introduction
Olive mill wastewater and the solid olive mill waste (OMW) are the residues of the
industrial extraction process of olive oil. The waste-waters, that are characterised by a high
chemical oxygen demand (COD) and the presence of toxic phenolics, pollute soil and surface
water resources. Environmental legislation, imposed in most olive oil producing countries,
enforces their proper treatment. Therefore, in modern olive mills, an effort is made to
minimise olive residues from entering the wastewater by converting these into solid waste,
while bigger amounts of OMW are generated and its humidity content increases (Barranco et
al. 2001). The characteristics of OMW are determined by the extraction system used to
generate olive oil. It contains 27-58% humidity and 7.5-8.5% oil (of dry matter). It is
comprised of the residues of the olive peel, pulp and seeds, and its nitrogen content is close to
1% (of dry matter). OMW is considered, in most cases, as a problematic organic waste.
Utilisation is not simple, since its high water content interferes with the extraction of
remaining oil, and its chemical composition (phenolic compounds) minimise other potential
uses such as animal feed.
Pleurotus spp are white rot fungi grown on lignocellulose containing substrates
including sawdust, cereal straw, cotton stalks and other plant residues (Cohen et al. 2002).
The use of white rot fungi, including Pleurotus spp, to treat the olive oil industry wastes, was
studied mainly due to their lignocellulolytic enzymatic systems, capable of biodegrading
complex phenol containing compounds, structurally similar to lignin (Fountoulakis et al.
2002). The ligninolytic system of Pleurotus spp contain mainly three groups of enzymes:
220
laccase, peroxidase (MnP and VP) and H2O2 generating enzymes (Cohen et al. 2002).
Pleurotus spp demonstrated ability to biodegrade recalcitrant xenobiotic organic compounds
(including pesticides) due to their enzymatic constitution (Novotny et al. 2004).
In the present study, the use of Pleurotus spp in utilisation of OMW was tested. The
activity of the enzymes laccase and peroxidase (MnP and VP) was followed in OMW
containing substrates.
Biological material
Fungal strains
Mushroom strains, used in this study, were Pleurotus ostreatus 2191, 2204, 2171 and
Pleurotus pulmonarius 2204 from Mycelia (Gent, Belgium), and Pleurotus ostreatus K15
and Pleurotus pulmonarius P17 from FungiSem S.A. (Autol, Spain). Pleurotus ostreatus
1111 was obtained from the Fungal Technology Research Group of Dr. Jose Duarte at INETI
(Lisbon, Portugal). Other commercial Pleurotus strains were purchased at the local
supermarket as control for the quality parameters.
Plant material
Wheat straw for mushroom cultivation was purchased at Hoge Born (Wageningen, The
Netherlands). Wheat grains used to prepare spawn were supplied by Koopmans Meel BV
(Leeuwarden, The Netherlands).
Olive mill waste (OMW)
Olive mill waste (OMW) obtained from Fatima olive mill (Portugal) made by a two-
phase centrifugation system and was stored at –250C until used. Part of the OMW was freeze
dried (lyophilised) for specific experiments. Part of the freeze-dried OMW was irradiated with
γ-rays by a 60cobalt source, with an average dose of 5 kGy. The irradiation was performed at
Isotron Netherlands BV (Ede, the Netherlands) OMW irradiated under these conditions will
be indicated as iOMW.
Cultivation of mushroom mycelium

Mother cultures (inocula prepared for further sub-culture).
Mother cultures were prepared using as inocula mycelium obtained from the original strains.
Control mother cultures were grown on Petri plates containing two different media:
(a) DMEP agar (dextrose 2%, malt extract 2% and bactopeptone 1%). Inoculations were
carried out using 5 mm diameter mycelial plugs. Mother plates were then incubated at 30
O
C for 7 days and stored at 4 OC until further use for sub-cultivation.
(b) MMP agar (malt extract 1%, mycological peptone 1%). Inoculation, incubation and
maintenance were performed as for DMEP mother plates.
Other mother cultures were prepared using as media MMP supplemented with OMW.
These plates were used for subcultivation on substrates containing the same concentration of
OMW and used as inoculums of “adapted mycelium”, a mycelium which has been adapted to
grow in media containing the mentioned wastes.
Adapted inoculums were prepared in plates containing DMEP supplemented with 10%
OMW. When Pleurotus mycelia reached the edge of the petri plate, a plug was taken from
the mycelium edge and used as inoculums for DMP supplemented with 200% OMW. From
this plate the 30% OMW containing plates were inoculated. Petri plates were incubated at
300C during 7 days.
Cultivation of mycelium on semi-solid MMP media
Semi-solid MMP was used as control medium. To study the growth of the fungi in the
presence of different concentrations of OMW and iOMW, plates supplemented with different
concentration of waste (5, 15 and 30% (w/w)) were prepared. Sterilised cellophane circles
221
were placed at the top of the semi-solid media. Plates were inoculated by placing a 5 mm plug
of agar from the mother culture in the centre of the plate. Plates were inoculated at 25 OC for
9 days.
Cultivation of Pleurotus mycelium on liquid media
Liquid MMP media, 25 ml, supplemented with the same quantities of OMW and iOMW
as described for semi-solid media, were placed in 100 ml Erlenmeyer flasks and inoculated
with non-adapted inocula. A piece of agar (5 mm) from the mother culture of each Pleurotus
strain was placed in each Erlenmeyer. Erlenmeyer flasks were incubated in triplicate for each
strain and media and placed at 25 OC, in darkness without shaking, for 9 days.
Cultivation of Pleurotus mycelium on cereal grains for spawn preparation
a. Laboratory procedure:
Petri plates containing a thin layer of semi-solid MMP media were inoculated with
mycelium of Pleurotus strain and placed at 25 OC, in darkness, for 5 days. When the
mycelium covered about 2/3 of Petri plate diameter, several cereal grains with or without
OMW supplement (~20 g) were placed on the top of the medium. Cereal grains were
supplemented with 5, 15 and 30% of OMW or iOMW, using as control wheat grains without
waste. All substrates were sterilised in an autoclave at 121 OC for 30 minutes. iOMW was
added after sterilisation of the cereal grains. Plates were placed at 25 OC in darkness. Spawn
was ready to inoculate bags after 9 days.
b. Industrial procedure:
Rye grains were cooked during 30 min and left to drain for 10 min. Grains with waste
were prepared by mixing 130 g of cooked rye, 20 g of OMW and 6% (w/w) of calcium
carbonate/calcium sulphate (1:3). This mixture (150 g) was placed in small autoclave bags (13
x 7 cm2) and sterilised by autoclaving at 121 OC for 30 min. The controls were prepared with
cereals grains without OMW. Cooked rye was mixed with 6% (w/w) of calcium
carbonate/calcium sulphate (1:3). This mixture (150g) was treated by the same procedure.
Each bag was inoculated with 10% (w/w) of spawn produced as described above, and placed
at 25 OC in darkness. One bag each week during four weeks was taken as a sample for
determination of exocellular ligninolytic activity of the fungal enzymes during the time of
growth.
Cultivation of Pleurotus mycelium in straw bags
Specific substrate mixtures were prepared as follows: wheat straw was chopped (2-5
cm) and left soaking up in tap water overnight. Excess water was drained by sieving for 20
min. The soaked straw was the mixed and homogenised with 25%, 50%, 60%, 70%, 80%
90% and 100% of OMW in dry weight proportions of straw and OMW. Wheat straw with no
addition of OMW was used as control. Homogenised substrates (300 g) were placed in bags
(15 x 25 x 3 cm3) and sterilised in an autoclave for 30 min at 121 OC. The prepared substrates
were inoculated with 10% (w/w) of fully colonised spawn (prepared with the laboratory
procedure) from the selected strains, and incubated in dark at 25 OC for 15 days. When the
substrates were fully colonised, fructification was induced by changing temperature from 25
O
C to 16 OC and 85% RH, adding a day/night light cycle and setting the CO2 concentration to
550 ppm. Two holes (approx. 2 cm dia.) were made in one side of each bag. After 3-27 days
(depending on substrate and strain) pinheads were visible. The first and second flushes of
mushrooms were harvested for further experiments. Mushroom yields were recorded as
biological efficiency (BE). BE is calculated as the fresh weight of the mushrooms in % of the
dry substrate weight. Triplicates were made for each Pleurotus strain and for each type of
substrate.
222
Mycelial Growth Measurements
Mycelial growth on Petri plates

Growth rates of triplicates were estimated by daily measuring colony diameters. Two
perpendicular diameters in each plate were measured. If necessary, mycelial growth was
measured twice a day at the same time, until mycelia reached the edge of the plates. Four
plates were used in this case for each fungal strain and semi-solid substrate. Growth rate in
both cases was later expressed as mm day-1 using the slope of the linear growth phase of the
fungi.
Biomass
Mycelial growth of Pleurotus strains was also quantified by weighing the mycelia. After
9 days incubation, all plates were fully-grown and mycelia were scratched from the
cellophane-containing plates with a scalpel, and weighed. Mycelia were frozen, freeze-dried
and weighed again to calculate the dry weight. Water content was calculated from the
difference between fresh and dry weight.
Mycelial growth on liquid media

Mycelia were separated from the broth by filtration using cheesecloth and Whatman no. 1
paper (previously dried at 105 OC for 2 h). Extracts were centrifuged at 6000 rpm, 15 min at 2
O
C (Sigma Laborzentrifugen 2K15). Pellets, corresponding to biomass, were dried for 24 h at
105OC and weighed.
Enzymatic activities
Extraction of exocellular enzymes on liquid media
Mycelia were separated from the growth broth as described above. The remaining medium
was centrifuged at 600 rpm, 15 min. at 20C (Sigma Laborzentrifuge 2K15). Supernatants were
frozen and stored at –300C until further use for analysis of exocellular enzymes.
Extraction of exocellular enzymes from spawn samples
Spawn prepared as described above from different developmental stages was lyophilised,
transferred to liquid nitrogen and milled (Moulinex, Masterchef 20) for 1 min at maximum
velocity. The powder was placed at –25 OC until further use. Later, 2 g of each type of spawn
was mixed with 8 or 5 ml buffer depending on the experiment (corresponding to each type of
enzymatic determination) for 30 min. These mixtures were centrifuged at 5000 rpm for 10
min (Sigma Laborzentrifuge 3-10). Each supernatant (1 ml) was later centrifuged again at
14000 rpm for 5 min (Hemle Z200 M/H) and supernatants were used as enzyme source.
Extraction of exocellular enzymes from straw samples
Colonised straw substrate with or without OMW or iOMW supplementation were collected
and freeze-dried without fruit bodies. Samples were treated as described for spawn. Each
sample (2 g) was mixed with 10 ml buffer (corresponding to each type of enzymatic
determination) for 30 minutes. These mixtures were treated as described for spawn samples.
Extraction of endocellular enzymes
Endocellular enzymes produced by the fungi were evaluated in mycelium prepared as
described above lyophilised and ground with liquid nitrogen. Obtained powder (10 mg) was
mixed with 1 ml of the buffer used in each enzymatic determination. Suspension was stirred
in a Vortex for 10 minutes and centrifuged at 14000 rpm for 5 min (Harlem Z200 m/H). The
supernatants were used as sample for enzymatic determination.
Laccase
Laccase (EC 1.10.3.2) activity was assayed by the oxidation of 0.05μM σ-tolidine (Sigma) in
0.1M acetic acid buffer, pH 5.0. Changes in absorption at 630 nm were measured.
223
Peroxidases
Total peroxidase (TP) activity was assayed by the oxidation of 0.07 mM 3-
dimethylaminobenzoic acid (DMAB, Aldrich) and 0.99 mM 3-methyl-2-benzothiazolonone
hydrazone hydrochloride (MBTH, Fluka) in succinic-lactic acid (Sigma) buffer at pH 4.5 in
the presence of 0.05 mM H2O2 (Sigma) and MnSO4. Mn-independent peroxidase (VP) (EC
1.11.1.7) was assayed in the absence of MnSO4 and Mn-dependent peroxidase (MnP) (EC
1.11.1.13) was calculated from the difference.
Enzymatic activity of both enzymes was calculated as μkatal g-1 for solid medium or μ
katal ml-1 for liquid medium.
Results
Growth of Pleurotus spp on OMW-containing media

Mycelial growth on OMW containing media
All strains increased their growth rate on OMW supplemented media compared with
MMP without the waste. OMW supplement (5%) brought the highest growth rates for all
tested Pleurotus strains. Growth rates started to decline when 30% OMW was supplemented
(Figure 1, averaged for all strains).
10
9
Colony diameter (cm)
8
7
6
5
4
3
2
1
0
1 3 5 7 9
days
A B C
Fig 1. Growth of Pleurotus mycellium on MMP medium (A), supplemented with 5%

OMW (B) and 30% OMW (C)
Highest growth rates on iOMW supplemented substrates were with those containing
15% for most of the evaluated strains. Almost all Pleurotus strains (with the exception of P.
pulmonarius P17) could grow faster on media with 30% iOMW than with 30% OMW.
Measurements of fresh and dry mycelia weight indicated that Pleurotus grown on 15%
OMW produced the largest biomass compared with the biomass produced in the control or
iOMW, with exceptions of P. ostreatus 2204 and P. pulmonarius 2204. Similar results were
obtained for fresh and dry weight. Therefore, OMW or iOMW did not influence in the
humidity content of mushroom mycelium.
Endocellular enzyme activity
When OMW was present in the growth media, laccase activity inside the mycelia was
lower than the activity observed when grown on control media. TP activity in the mycelium
decreased (for most of the strains) when increased concentrations of OMW were added to the
growth media.
224
Exocellular enzyme activity
The highest activity detected in the growth media was of laccase, and this activity
increased for four of the strains with concentration of OMW or iOMW in the cultivation
medium. Others, such as P. ostreatus K15, did not show any significant differences,
compared to the control. Activity of the exocellular total peroxidases increased concomitantly
with OMW and iOMW supplementation for all strains.
Average TP activity values for all strains are presented in Figure 2. A positive linear
correlation was found between supplemented concentrations and TP activity. The correlation
coefficients (r2) values for these linear regressions were over 0.9 for all strains.
1.6
1.4
1.2
TP activity
1
0.8
0.6
0.4
0.2
0
0 5 15 30
Concentration %
OMW iOMW
Fig 2. Total peroxidase activity (μ-katal ml-1) in liquid growth medium with different
concentrations of OMW and iOMW
MnP activity was higher than VP in all the strains, and more strongly induced, with an
increase of the OMW or iOMW concentration in the cultivation medium.
Influence of OMW on spawn production

The spawn prepared on cereal grains supplemented with 5%, 15% and 30% OMW or
iOMW was fully grown with Pleurotus mycelium after 9 incubation days. There was no
visible difference between this spawn and the control (unsupplemented) grain spawn. This
spawn from the OMW supplemented grains was used to inoculate OMW-supplemented straw
in the mushroom cultivation experiment.
The kinetics of laccase, TP, MnP and VP activity were followed during 28 incubation
days on rye grains and rye grains supplemented with OMW. All the Pleurotus strains were
able to colonise the two types of cereal substrate. In both
substrates, maximum laccase activity (on average for all strains) was recorded 21 days after
inoculation. Laccase levels recorded during 28 days of incubation were higher on substrate
with OMW compared with controls (Figure 3). TP levels were much lower than laccase for all
strains. Highest TP levels were again reached with both OMW and unsupplemented spawns
after 28 incubation days. During 21 days incubation, the activity was higher in the
unsupplemented spawn. TP activity in both substrates was mainly attributable to VP.
225
Mushroom growth on straw containing OMW
Enzymatic activity
Laccase was the oxidase activity detected first in the substrate. Highest laccase levels
in all strains were recorded between 10-15 days after spawning in both substrates. In
substrates containing 50% OMW, laccase activity was higher compared to substrates without
OMW (Figure 4, average of 7 strains).
0.6
0.5
laccase activity
0.4
0.3
0.2
0.1
0
0 7 14 21 28
days
A B
Fig 3. Laccase activity (μ-katal g-1 substrate) in spawn without (A) and
with (B) 30% OMW
Peroxidase activities were higher in these substrates than laccase activities. This tendency is
opposite to that found when the fungi were grown on pure MMP media and on cereal grains
spawn. TP activity was only detected later than laccase, and values increased to a peak after
15 and 20 days incubation for substrates made without and with OMW, respectively. On
OMW containing substrates, higher levels of TP activity were observed during longer periods
than on unsupplemented substrate (Figure 5, average for all strains). In all the Pleurotus
strains TP activity peaked before the appearance of fruit body initials. Peroxidase activity was
mainly MnP rather than VP; i.e. opposite to the results from spawn samples. VP activity was
very low during the incubation period, peaking at the same time as MnP.
Mushroom yields
Mushroom yields were assessed according to three main criteria: timing, yield
quantity and yield quality.
Timing
The incubation time between the first and second flushes was slightly shorter on
substrates supplemented with 25% and 50% OMW (average for all strains) compared with the
control. Higher contents of OMW delayed the onset of both flushes.
226
0.035
0.03
laccase activity
0.025
0.02
0.015
0.01
0.005
0
5 10 15 20 25 30 35 40 45 50 55 60
days
A B
Fig 4. Laccase activity (μ-katal g-1 substrate) in straw without (A) and
with (B) 50% OMW
0.04
0.035
0.03
TP activity
0.025
0.02
0.015
0.01
0.005
0
5 10 15 20 25 30 35 40 45 50 55 60
days
A B
Fig 5. TP activity (μ-katal g-1 substrate) in straw without (A) and with (B)
50% OMW
Yield quantity
Slightly higher yields were achieved with substrates supplemented with 25% and 50%
OMW (Figure 6, averaged for the 7 strains) compared with the control. Higher concentrations
of OMW caused a sharp decrease in yield.
Yield quality
Quality was assessed mainly by measuring the colour and firmness of the mushroom
fruit bodies. Mushroom quality was not negatively affected on substrates supplemented with
up to 50% OMW. For some of the test strains, additional (more than 50%) OMW
supplementation led to a deterioration in mushroom quality. The addition of OMW to the
227
growth medium of Pleurotus had no effect on the total phenol content of the mushrooms
produced by the test strains.
90
80
70
60
50
BE
40
30
20
10
0
0 25 50 60 70 80 90 100
% O M W
Fig 6. Effect of OMW supplementation to wheat straw (0- 100% of dry wt) on
mushroom yield calculated as biological efficiency (BE)
Discussion
The present study deals with the possible use of olive mill waste (OMW) as an
supplement to substrates for the cultivation of Pleurotus spp. The recent change in olive oil
production technology has led to the release of increased amounts of OMW and has therefore
created the need to develop methods for the safe and commercially viable utilisation of this
material. Former studies on the use of Pleurotus spp for utilisation of olive industry wastes
were mostly undertaken before these recent developments in the industry. These studies dealt
with olive press cake (solid waste) and olive wastewater (Flouri et al. 1996; Martirani et al.
1996; Zervakis et al. 1996). The modern industry today releases mainly one type of waste,
olive mill waste (OMW), that includes a higher water content than the former solid waste, and
part of the soluble pollutants (mainly phenolic compounds) from the liquid waste (Barranco et
al. 2001). The present study deals with possible utilisation of OMW, a challenge nowadays to
the olive oil industry.
Growth of the fungal mycelium on pure (MMP) medium containing OMW was faster
than that on unsupplemented medium. There was also a slight increase in mycelium biomass
on the OMW-supplemented medium. These results encouraged us to study the addition of
OMW to actual substrates used for Pleurotus cultivation. The addition for up to 30% OMW to
cereal grains, used for the preparation of inocula for Pleurotus mushroom cultivation (spawn)
was tested. The spawn produced on OMW supplemented grains was of the same quality as the
spawn made on unsupplemented grains. Wheat straw substrates used for Pleurotus mushroom
cultivation were supplemented with increasing concentrations of OMW (up to 90%). It was
demonstrated that highest mushroom yields, without a decrease in mushroom quality, were
achieved on substrates with maximally 50% OMW supplementation. These results indicate
the possibility of using OMW supplements to commercial substrates for the cultivation of
Pleurotus mushrooms. The possible mixing of lignocellulose wastes with wheat straw
substrate for Pleurotus cultivation was studied earlier. The addition of 50% cotton wastes to
wheat straw substrate for Pleurotus spp cultivation enhanced fungal growth and mushroom
yields (Silanikov et al. 1988). Cotton contains higher lignin concentrations than wheat straw,
and other phenolic fractions (Silanikov & Levanon, 1986, 1987).
The addition of cotton residues to the growth medium of Pleurotus pulmonarius
caused enhanced ligninolytic enzyme activity (Masphy & Levanon, 1992). In the present
study, the exocellular ligninolytic activity of Pleurotus was studied on a range of substrates
228
including MMP, cereal grains and wheat straw. Enhanced activity was found for most strains,
on these substrates. The total activity of peroxidase (TP) was the dominant ligninolytic
activity (more than laccase) on wheat straw-based substrates. When TP activity was measured
on MMP medium, it correlated directly with OMW supplements concentrations, with high
correlation coefficients. Laccase and TP activity in OMW supplemented wheat straw
decreased just before initial development of the fruit bodies. This phenomenon was recently
reported for Lentinula edodes (Wichers et al. 2005). The enhanced exocellular ligninolytic
activity was probably induced by the presence of phenolic compounds in OMW, as
demonstrated in previous reports for Pleurotus spp (Masaphy & Levanon 1992; Masaphy et
al. 1998; Cohen et al. 2002). Enhanced ligninolytic activity led to faster growth and earlier
fruit body development with higher yields.
The results of the present study indicate that there is an option for the use of OMW as
a supplement for Pleurotus substrates. There was no advantage in using γ-irradiation for
OMW substrate sterilisation over conventional autoclaving. Therefore, the conventional
methods used for Pleurotus cultivation can be used for OMW supplemented substrates. The
rate of OMW supplement should be studied specifically for each cultivated strain, and each
source of straw.
References
Barranco D, Fernandez-Escobar R, Rallo L. 2001. El cultivo del olivo. 4th Edition.

Barranco D, Fernandez-Escobar R, Rallo L (eds). Ediciones Mundi-Prenza,
Junita de Andalucia, Consejeria de Agricultura y Pesca, Madrid, Spain. (in Spanish)
Cohen R, Perski L, Hadar Y. 2002. Biotechnological applications and potential of
wood-degradation mushrooms of the genus Pleurotus. Appl. Microbiol. Biotechnol.
58, 582-594.
Flouri F, Sotirchos D, Ioannidou S, Balis C. 1996. Decolorization of oil mill liquid
waste by chemical and biological means. Int. Biodeter. Biodegr., 38, 189-192.
Fountoulakis MS, Dokianakis SN, Kornaros ME, Aggelis GG, Lyberatos G. 2002.
Removal of phenolics in olive mill wastewater using the whit-rot fungus Pleurotus
ostreatus. Water Res., 36, 4735-4744.
Martirani L, Giardina P, Marzullo L, Sannia G. 1996. Reduction of phenol content
and toxicity in olive oil mill waste waters with the ligninolytic fungus Pleurotus
ostreatus. Water Res., 30, 1914-1918.
Masaphy S, Levanon D. 1992 The effect of lignocellulose on lignocellulolytic activity
of Pleurotus pulmonarius in submerged culture. Appl. Microbiol. Biotechnol. 36, 828-
832.
Masaphy S, Krinfeld B, Levanon D. 1998. Induction of linoleic acid-supported
benzopyrene hydroxylase activity by manganese in white rot fungus Pleurotus
pulmonarius. Chemosphere, 36, 2933-2940.
Novotny C, Svobodova K, Erbanova P, Cajthaml T, Kasinath A, Lang E, Sasek V.
2004. Ligninolytic fungi in bioremediation: extracellular enzyme production and
degradation rate. Soil Biol. Biochem. 36, 1545-1551.
Silanikove N, Levanon D. 1986. Cotton straw: Composition variability and effect of
anaerobic preservation. Biomass, 9, 101-112.
Silanikove N, Levanon D. 1987. Interrelationships between acidic and alkali
treatments of cotton and wheat straw and fibre chemical properties. J. Sci. Food.
Agric., 38, 117-124.
Silanikove N, Danai O, Levanon D. 1988. Composted cotton straw silage as a
substrate for Pleurotus spp cultivation. Biol. Wastes, 25, 229-226.
229
Wichers HJ, Soler-Rivas C, Levanon D. 2005. Exocellular enzymatic activity and
yields of Shiitake (Lentinula edodes). Process Biochem., Submitted for publication.
Zervakis G, Yiatras P, Balis C. 1996. Edible mushrooms from olive oil mill wastes.
Int. Biodeter. Biodegr., 38, 237-243.
230
Alternative Uses of Spent Mushroom Compost

Peter Oei1, Hui Zeng 2, Jianhua Liao2, Jianqing Dai2, Meiyuan Chen2 and Yi Cheng2.
1
ECO Consult Foundation, Tiel, The Netherlands, Visiting Professor Fujian Agricultural and
Forestry University, Fuzhou, P.R. China; 2Fujian Mushroom R&D Station, Fuzhou, Fujian
350005, P.R.China. Email: poei@antenna.nl
Abstract
The Productschap Tuinbouw (Horticulture Council) commissioned this study to find

alternative ways to use spent mushroom compost (SMC) because the costs of disposal have risen
lately, due to a change in legislation. The SMC is now regarded as animal manure, which is
limited in its application as soil conditioner. The study described not only uses of SMC from
Agaricus, but also SMC from other mushroom species. The different options were then
considered for application in The Netherlands. The most promising application is to develop a
biorefinery process, which makes optimal use of composition of the SMC. The proposed
research direction is to analyse the casing soil and the underlying compost for their specific
properties and to find applications for both materials. Value can be added by separating these
two materials and researching new ways for commercially viable applications. One feasible
solution may be to decrease the salt concentration and use the champost as a substrate for potted
plants. Another option is to extract valuable components and market these separately, e.g.
specific plant hormones or proteins.
Key Words: Spent mushroom compost; Champost; Casing soil; Biorefinery; ECO Consult
Foundation
Introduction
The Dutch mushroom sector has recently been confronted with new legislation
concerning spent mushroom compost, or champost as it is called in The Netherlands. The sector
has to spend several million Euros each year to transport the champost to areas where it can be
applied to the soil. ECO Consult Foundation proposed the Agaricus-growers to investigate which
alternative uses champost has in other countries in cooperation with the Fujian Mushroom
Research and Development Station in Fuzhou. The Productschap Tuinbouw funded the desk
research.
China is the biggest producer of mushrooms in the world. In 2005, it produced 11.6
million tons of fresh mushrooms, about 75% of the world’s total production. The production
value was 4.8 billion euro (Huang, 2006). More than 4 million tons of mushroom cultivation
residue were re-used (Li, 2003). The Chinese call it mushroom bran or mushroom residue, even
mushroom soil, Europeans call it spent mushroom compost (SMC), and the Americans call it
spent mushroom substrate (SMS).
What is SMC, or SMS? SMC is made from agricultural materials, such as wheat-straw horse
manure, hay, poultry manure, cottonseed meal, cocoa shells and gypsum. Mushroom production
takes place in specialized, climate controlled rooms and lasts for approximately 70 days before
new compost is required. When new compost is needed in modern Agaricus cultivation, the
SMC remaining from the old compost is usually steam pasteurized to reduce hygiene problems
for the next mushroom crop and then removed from the growing rooms. SMS can be used for the
other agricultural crops and products since it is ideal soil enrichment with important nutrients.
SMS is a bulky waste product of the mushroom industry and produced abundantly.
Depending on the different cultivated mushroom species, the respective SMS types have
different contents because they were made from different substrate ingredients and the substrate
231
preparation method and type of cultivated mushroom have different impacts. The straw
mushroom (Volvariella) for example degrades mainly cellulose and leaves the lignin almost
intact, whereas white rot fungi from genera like Pleurotus and Lentinula are able to degrade the
lignin complex.
China produces more than 4 million tons of SMC annually. The traditional method was
discarding or burning. As burning generates only 10% of the energy value (because of the high
moisture content), it is a waste of a biological resource. Discarding can bring about the pollution
of environment for its abundant organic nutrients and/or the plastic. In contrast to Holland, spent
mushroom compost (SMC) is not considered a waste in China. A vegetable grower will often
spend RMB100 (about Euro 10) to buy one ton SMC from the mushroom farm. Therefore,
people in China have developed several methods to utilize this “expensive” SMC.
This article introduces these different methods and may serve as inspiration when
developing products from SMC in The Netherlands. Most of the applications below were
scientific experiments, in some cases the method has been put into practice on a larger scale.
Feeding SMC to Earthworms, Insects, etc. to Produce Protein for Fish and Chicken, or
Directly to Domestic Animals
Edible fungi secrete many kinds of extracellular enzymes that have strong capacities for
decomposing cellulose, hemicelluloses and lignin, and can therefore optimize the ratio of
ingredients in an animal feed. SMS from mushroom cultivation contains about 14% protein and
an abundance of vitamins and microelements such as Fe, Ca, Zn and Mg. Mycelia remaining in
the SMS also contain essential amino acids which are absent from common feeds, so that the
nutritional value is equal to wheat bran or corn flour. Therefore, SMS represents a cheap and
nutritious feed that can replace crude feeds such as grain and bran.
Based on collecting and screening the microorganisms for preparing fermented feedstuff,
Tian Juan performed a study on fermented feedstuff production by solid fermentation of
Pleurotus ostreatus SMC. The results showed that after solid fermentation by microorganisms,
not only the crude protein of SMC increased (up to 16.34%), but it was enriched in vitamins,
amino acids, cellulases and living spores, which made the fermented SMC a good feedstuff for
animals such as beef cattle, rabbits and pigs. The solid fermentation technology for SMC was
simple and feasible, and could be popularized in mushroom production area (Tian, 2000). Li
Zhixiang also studied the solid fermentation of P. ostreatus SMC by adding several kinds of
yeasts, and analyzed the fermented SMC. It was shown that the fermented SMC of different
substrates all contained more than 20% of crude protein, and could be developed as functional
feedstuff for fowls and domestic animals (Li & Cai, 2003).
In Zhuo Shaoming’s study, shiitake SMC, cow manure, banana stems and their various
combinations were used as food materials to raise earthworms. Table 1 shows the 7 treatments (3
repeats each) and their characters. Raw material for each repeat (5 kg wet weight) was added
with Em microorganism mixture (which was sold on the market and contained dozens of kinds
of microorganisms) and fermented for 7 days. After 2 h of ventilation, the fermented substrate
was fed to 50 matured earthworms. The earthworms were harvested and counted after 70 days of
breeding. As a result, a total of 1388 earthworms were produced in the treatment sample feed
with SMC, the highest number among all the treatments. The earthworms reproduction rate was
the highest when the pH value was 7.0 and the water content was 60-65% (Zheng et al. 2006;
Zhuo, 2003).
It was also reported that all kinds of SMC could be used as feedstuff for raising
earthworms. The SMC is rich in mycelia and part-decomposed cellulose, and what you should do
is to add a certain proportion of soil and adjust the C/N ratio. The technology was simple and
commonly used (http://www.bd.heagri.gov.cn/baod/detail.jsp?id=15838&typeid=5)
232
Hu et al. (1999) carried out a preliminary study of using eelworm to transfer P. ostreatus
SMC as feedstuff. The result showed that Bursaphelenchus mucronolus could reduce the crude
fiber of SMC by 42.2%, and increase the crude protein by 80.1%. Using the mixed feedstuff
prepared from the transferred SMC to feed rabbits, each rabbit increased weight by 0.52 kg every
month.
Table 1. Worm yields from different treatment of shiitake SMC combinations
Component & proportion

Water pH before
of the substrate (%) Av. pH Av. worm
Treatment Content C/N content fermenta-
Cow Banana postharvest yield
SMC (%) tion
manure stems
A 100 / / Granule of ~0.5cm diameter 25:1 60-70 6.0 6.5 799
B / 100 / 20cm*5cm*0.5cm 21:1 60-70 7.0 9.0 46
C / / 100 Granule of ~0.3cm diameter 25:1 60-70 6.0 7.0 1388
D 50 50 / Granule mixture of A+B 23:1 60-70 6.5 7.7 297
E 20 80 / Granule mixture of A+B 21:1 60-70 6.5 8.5 65
F / 50 50 Granule mixture of B+C 23:1 60-70 6.5 7.8 104
G / 80 20 Granule mixture of B+C 21:1 60-70 6.5 8.5 67
Dong et al. (2002) reported that if 60% of diet of Karacul sheep was replaced by P.
ostreatus SMC (mainly from cottonseed shell), the average daily gain difference of the Karacul
sheep was not outstanding (P > 0.05) compared to replacing 45% of the complete diet. However,
the cost per kilogram feed was 0.11Yuan (0.011Euro) lower than the reference group, 11.4%
cheaper. The economical evaluation is striking.
Li et al. (2005) reported feeding different percentages (20%, 25%, 30%) of waste
material from L. edodes and P. ostreatus (WMLE) and normal diet to non-pregnant sows,
pregnant sows and suckling sows. He studied their reproductive performance. Results showed
that living piglet number, average weight of new born piglets, and lactation ability of sows all
improved. Among trial groups, the group with 30% WMLE was the best, and this group also
brought the most significant effect on piglet weight during 0~21 days and 21~35 days. Trials
showed that the rate of piglet mortality and diarrhea decreased. The result showed that WMLE
feed contributed to grain-saving, and efficient and safe pig production.
It is also reported that utilizing the mixed feedstuff from straw SMC of P. ostreatus and
P. sajor-caju to feed pigs had the same effect of feeding corn, and decrease the cost. To feed pigs
using the mixed feedstuff containing one third SMC, each pig increased weight by more than
780g daily, saved foodstuff by 40% and reduced costs by 50%. Adding SMC to the feedstuff
involves an adaptation period of about one week, increasing the percentage of SMC gradually
from 10% to 30%. It is widely used in some pig production (Anon. 2006).
Lei et al. (2000) used 5% and 10% P. ostreatus SMC to replace the same quantity of
mixed feed to feed dairy cattle. The results showed that milk production (P＞0.05) and the
economic efficiency of treatment groups were higher than the control group by 3%~6.1%.
In Bao et al. (2001), cell wall constituents (CWC) of the waste material from fungal
culture (WMFC) by different treatments were assayed for studying the effect of different
treatments (chemical, microbial, and a combination of chemical and microbial) on improvement
of the feeding value of WMFC. Four hybrid yellow cattle fitted with rumen canellas were
selected to study degradability of organism material (OM) of WMFC prepared by the above
different treatments using the method of rumen by 4 ×4 Latin square design. The results were as
follows:
(1) Three components of WMFC, neutral detergent fiber (NDF), acid detergent fiber (ADF) and
acid detergent lignin (ADL), decreased by the chemical treatment. The effect of the NaOH
treatment was the best, in all chemical treatments NDF, ADF and ADL decreased by 5.71-
9.92%, 7.43-13.36% and 10.55-20.47%, respectively.
233
(2) Three kinds of white rot fungi, (Y4, Y5 and Y8) decreased NDF, ADF, CEL, HC and ADL
of waste material from L. edodes (WMLE) significantly and, among these treatments, the
effect of Y8 was the best, The effect of combination treatment (NaOH and microbial) on the
improvement of the CWC was better than that of single chemical or microbial treatment.
(3) The effective degradability of OM of WMLE by the three kinds of chemical treatment
(NaOH, urea and urea + NaOH ) increased by 19.60%, 13.16% and 21.02%, respectively (p
< 0.05). The effects of Y4, Y5 and Y8 were best in microbial treatments, their effective
degradability of OM of WMLE increased by 31.65%, (p < 0.05) , 47.69% (p < 0.01) and
55.82% (p<0.01), respectively. The effects of Y5 and Y8 were better than those of Y4. The
effect of combination treatment of NaOH and microbial was better than that of single
chemical or microbial treatment on improvement of CWC of WMLE and CWC (Bao et al.
2001).
It is reported that SMC (we think it was woody ear mushroom, Auricularia) was also a
kind of fish feedstuff with rich nutrients. The preparation method for complex fish feedstuff is:
dry and comminute the SMC, and mixed with barley powder at a proportion of 3:7. The
experiment showed that using the complex fish feedstuff, fish production increased 35.91%, and
reduced feed cost by 23.7% compared with that of feeding barley powder only
(http://www.agronet.com.cn/Tech/Detail.aspx?T_ID=892). No reports were found how SMC
from Agaricus could be used as feed.
Fermentation with Other Additives
The goal is to produce organic fertilizer with a high N source for plants, which is called
top fertilizer and can be sold at a relatively high price. At present, the main raw materials for
most potting soils are natural peat moss or forest humus. Producing nutritive soil for flowers
using SMC of A. bisporus and crop straws avoids the environment pollution by organic residue.
Liang & He (2002) performed the trial of preparing potting soil using organic residue, and the
results showed that the potting soil could be prepared by using organic residues (leaves, straws,
SMC and livestock manure) and soil, slag, perlite and other materials. The key technique for
potting soil production was: organic residues (SMC 500 kg, urea 5 kg, corn straw (5-10cm) 500
kg, calcium superphosphate 10 kg, sheep manure 500 kg, K2SO4 1 kg and a certain volume of
water) were first fermented to produce humus (about 30 days totally, with turning every 7-10
days), and then the potting soil was prepared according to its index requirements (pH = 5.5-7,
unit weight <1 g/cm3, organic matter ≥8%, NH4+ - N≥ 150 mg/kg, Olson - P≥ 30 mg/kg, NH4Ac
- K≥ 300 mg/kg) and the physical characteristics.
Utilization of solid wastes like spent compost to produce horticultural substrate has
become an environmental friendly measure to fully-utilize the natural resources. In this study,
the spent compost of Flammulina velutipes was tested as raw material to produce horticultural
substrate. SMC (1 m3) was added 0.5 kg urea, 3 kg (dry wt) sesame residue, 3 kg chicken manure
and 0.2 kg commercially marketed microorganisms reagent (containing azotobacteria, and
phosphorus or potassium degrading microorganisms) as supplemental materials. The composted
spent compost should be mixed with vermiculite at 6:4 in volume. The mixture was shown to be
a good horticultural substrate as it improved yields in cucumber and net melon cultivation
experiments, at a lower cost (Li et al. 2006)
Three continuous rotations of non-heads Chinese cabbage pot experiments were
conducted with the application of different mixtures of P. ostreatus SMC and microbiological
agents in a glass greenhouse to study the influence of microbial manures on non-heads Chinese
cabbage growth and yield by measuring plant height, root length, and number of leaves during
different plant stages. The results indicated that the microbial manures promoted non-heads
Chinese cabbage growth and increased yields. Treatment 1 (Streptomyces sp. + Bacillus
megatherium + SMC) had the best effects among all the treatments (Zhu, 2006).
234
Pepper pot experiments were conducted together with the application of different
microorganisms and P. ostreatus SMC in a glass greenhouse to study the influences of microbial
manures (microorganisms + residue of mushroom medium) on pepper yield，nutrient uptake
and soil nutrients by measuring the yield of peppers, and by determining changes of soil alkaline
hydrolysis N, available P, available K content and total N, P and K contents of pepper plants
after harvesting．The results indicated that microbial manures increased pepper yield and were
conducive to improved soil fertility and total N, P and K contents of pepper plants. Treatment 3
(Streptomyces sp. + Bacillus megatherium + SMC) had the best effects among all the microbial
treatments (Zhu, 2005).
The following experiment was to study the effect of waste mushroom compost mixed
with livestock manure, soybean cake and chemical fertilizer on soil response, yield and quality of
tomato. The C/N ratio of the compost materials at the start of the fermentation was 30, the
moisture content ca. 60%, and the piles were 1.5 x 1.5 x 1 m. The piles were turned every 10
days, mixed with chicken and cattle manures, castor oil extract, soybean cake and chemical
fertilizer. Sixty days after piling up, the C/N ratio was reduced to the maturation index of about
20. The compost was applied to the field before transplanting. The results of a tomato field trial
indicated that the chicken manure plot had the highest yield of fall crop of 5,054 kg/0.1 ha,
which was 30.8% higher than the control plot. The yield in the treatment of mushroom compost
mixed with 5% compound fertilizer was 4,959 kg/0.1 ha, which was 28.4% higher than the
control plot, followed by the soybean cake plot at 4,886 kg/0.1 ha. Result of spring crop of
tomato indicated that the chicken manure plot had the highest fruit yield (4558 kg/0.1 ha),
followed by the castor oil extract, soybean cake and compound fertilizer plots, which were 12.5 -
14.3% higher than the control plot. The yield of the control plot was 3773 kg/0.1 ha. The low
yield of control plot is due to fact that the waste compost had low nutrition after growing
mushroom and was contaminated with miscellaneous fungi. The effect of recycled waste
mushroom compost on the sugar content of tomato fruit in the fall crop ranged from 4.94-5.25,
and from 4.89-5.25 in the spring crop. Application of compost resulted in no difference in the pH
and EC value of soil reaction, but the content of organic matter, potassium, calcium and
magnesium increased, while the phosphorous content declined. In general, the recycled
mushroom compost increased the soil fertility, and enhanced the yield and quality of tomato
fruit. It is therefore recommended for the production of vegetable crops (Lin & Chuen, 1993).
Mixed with Other Manure to Produce Biogas for Heating or Cooking
SMS (from mushrooms other than Agaricus) is an ideal material for producing marsh gas.
There are many nutrient substances in SMS that provide the basis for the long-term propagation
of methane-producing bacteria, and using SMS as a starting material to produce marsh gas
shortens the fermentation time. Furthermore, since SMS is readily broken up into smaller pieces,
there is less time and workload involved in the preparation and reloading of feedstock material.
The technology for utilizing several kinds of SMC from bed or bag cultivation of A.
bisporus, L. edodes or Auricularia auricula to produce biogas was popularized in Sanzhi County
in 2001 (Zhou, 2002). Based on the detection results, this technology had a faster rate and a
higher heat value of producing biogas compared with those utilizing straws and sawdust, and
3~5 kg SMC could produce 6~10m3 of biogas, which was enough for the daily use of a family of
3-5 persons. Now, the dried SMC is hot sold in Sanzhi County, with a price of more than 10
Yuan per 50 kg.
Fleming (2006) studied the feasibility of anaerobic digestion to further process SMS. In
the fermentation trial, the temperatures were in 40 to 60 OC range within 1 day, while the outside
weather temperature was close to 0 OC the entire time. The compost was left for 150 days but
most activity took place in the first month. In the anaerobic digestion, the SMS loading rate of
235
6.7 kg/day produced 355 L/day methane with a methane concentration of 49.3%. The methane
yield was 53.0 L/kg, which was much lower than the 288-562 L/kg range for livestock manure.
In the two reports above, using SMC to produce marsh gas had a higher yield than when
straw and sawdust were used, but a much lower yield than when using livestock manure, which
resulted in different conclusions regarding SMC in terms of efficiency for producing marsh gas.
Whether the SMC is a good source for biogas depends on the raw materials which are used to
produce it.
The methane from SMS can used as a fuel and also for storing foods and fruits. The
residue from the methane ponds can be used to nurse rice seedlings, and the pond liquid can be
employed to immerse seeds prior to planting, or as a pig feed additive. Utilization of SMS for
marsh gas production can form part of a crop recycling strategy-edible fungi – marsh gas-organic
fertilizer, feed stuff-biomass. Such a system is an effective ecological-agricultural model.
It is said that the Japanese developed a technology to produce ethanol from sawdust by
fermenting the SMC, and that the Americans developed the technology to ferment button
mushroom SMC, but the details have been found. In China, there are no related reports or
publications.
Bottom fertilizer: SMC Used Drectly for Planting Vegetables, Fruit, etc.
SMC can have a number of beneficial effects when added to soils. Because it contains
significant amounts of essential plant nutrients, it can supply these to the crop and thus replace
inorganic fertilizers. Trials have shown that it is an excellent source of P, K and trace elements
but, in some cases, needs supplementation with nitrogen for the best results.
Because SMC has a high organic matter content, it can have important benefits in improving the
physical structure of the soil. Soils in continuous tillage systems can have reduced organic matter
content with a poor structure that makes the soil difficult to work and impedes drainage. This is
probably most likely in intensive horticultural or tillage systems where, in the past, farmyard
manure was traditionally used. Use of SMC will increase the activity of soil microorganisms and
earthworms, help develop a good crumb structure, improve soil porosity and make it easier to
work.
Table 2. Changes in mass from start to completion of study
Channel 1 Channel 2 Channel 3

Mass (kg) Mass (kg) Mass (kg)
Start (Day 0) 24,223 24,223 24,223
Finish (Day 150) 13,175 9313 11,788
Final (% of initial value) 54 38 49
Channel 1 - no turning; Channel 2 - turned monthly; Channel 3 - turned weekly
Table 3. Chemical characteristics of fresh SMS vs compost
SMS Ch1 Ch2 Ch3

N 0.95 0.84 0.81 0.85
P 0.49 0.59 0.54 0.58
K 0.81 0.74 0.85 0.89
EC 5.6 6.2 6.5 6.4
Values at Day 56；N, P and K values expressed as a percentage "As is";
EC - mS/cm.
236
He (2001) reported that A. bisporus SMC used as paddy field bottom fertilizer with a
usage of 1-4 tons per 660 m2 would increase the organic matter, provide P and K, and improve
rice production. Trial results showed that, when the SMC fertilization was 1-2 tons per 660 m2,
the organic matter and nutrient concentrations were stable. When the SMC fertilization was 4
tons per 660 m2, compared with the basic soil, the organic matter increased 2.1 g/kg, with an
amplitude of 5.2%. The effective P increased by 9.2 mg/kg with an amplitude of 67.2%, and the
effective K increased by 19.2 mg/kg with an amplitude of 24.0%. In a summer trial, rice
production in the field fertilized with SMC increased by 19~68 kg/660m2 with an amplitude of
5.3~19.0% compared with the control which was not fertilized. The corresponding values in an
autumn trial were 22~45 kg/660m2 and 5.3~10.9%.
Wang (2006) prepared a complex organic fertilizer with treated SMC and some inorganic
N, P and K, and used it in a trial in a rice paddy field. The results showed that the SMC complex
organic fertilizer could stabilize the number of effective spikes and increase the ratio of mature
spikes. Compared with the controls of fertilizing normally and using common complex fertilizer,
the effective spikes of the SMC treatment increased 9.3% and 2.7% respectively, and the rate of
mature spikes increased 16.66% and 15.17%, respectively. The main reason for the SMC
complex organic fertilizer improving the rice yield significantly should be that the complex
fertilizer promoted physical growth, improved economic characteristics, and increased the
numbers of effective spikes and grains.
According to a study by Xiao et al. (2005), fertilizing SMC (mainly from sawdust and
cotton-seed shell) to an orange garden improved the soil quality, and increased the pH value,
organic matter, hydrolyzed nitrogen, available P, K, Zn and Mn, exchangeable Mg and Ca, as
well as water-soluble boron. This technology was developed in Sanming City in 2001, and the
orange quality, yield and good-quality orange rate all clearly improved. Nowadays, this
technology has been popularized in the city.
Wang et al. (2006) reported that adding A. bisporus SMC to flower and vegetable substrates
resulted in regular seedlings, green and thick leaves, and strong plants. The flower number of
rhododendron and rose increased by 15.82-30.77% per batch, the florescence extended 1.3-2.5
days, and the disease incidence decreased 3.20-8.70%. Furthermore, the fruit number of tomato
and capsicum increased by 36~20.00%, the single yield improved 7.48~19.86%, and the disease
incidence decreased by 5.57~7.72%. Seedlings of green cauliflower and cabbage were
7.59~10.89% higher, the number of total leaves increased by 2.20~7.80%, the disease incidence
decreased by 4.69~7.81%, and seedling production increased by 7.5~14.5%.
Soil Improvement
For poor soils, SMC is cheaper and more effective than artificial fertilisers. SMC can be
decomposed to humus material exhibiting good ventilation and water-retaining capacity. It can
thus improve soil aeration and prevent soil hardening. SMC is also rich in organic matter and
many kinds of mineral nutrients that not only offset any soil deficiency but also enhance soil
fertility and output per unit area. As a fertilizer, SMC has a low C:N ratio (equal to or less than
20:1) since it contains a lot of hyphal protein, and because most of the cellulose and lignin
components have been decomposed. Therefore, direct application of SMC on farms can prevent
nitrogen deficiency. After three mushroom flushes, the spent substrate from the cultivation bag
can be used as a slightly acid fertilizer for application to alkaline soils to provide nutrients and
improve soil quality.
In a study by Chen (1995), petunia, impatiens, cosmos and other annual flowers have
been cultivated in the campus of National Chung Hsing University from October to the following
spring. In order to protect the turf grass of the campus, SMC was used as a cover medium to the
soil of petunia and other flowers by non-tillage. Due to the higher electrical conductivity (E.C.)
of SMC, the small plug seedlings cannot be planted in the SMC directly; if they are more than 3
237
inches however, the negative effect of the E.C diminishes. The results showed that SMC has
great potential to grow annual plants. In order to protect the environment, the SMC and other
abandoned mushroom compost in the local area should be recycled as cultivated medium for
sustainable horticulture.
Lin (2002) reported to transfer SMC of straw or cotton-seed shell to a kind of regulator to
adjust the soil nutrient and improve the soil quality, and realize the reasonable reuse of SMC.
The soil regulator he produced contained 43.94% of organic matter, as well as organic chlorine,
P, K and trace elements. After fermentation and maturation in soil, the regulator would improve
soil structure, enhance soil ventilation, eliminate soil hardening, and increase soil temperature,
resulting in suitable soil environment for crop and vegetable growing. Now this product is
popularized in local vegetable fields.
Substrate for Potted Plants to Replace Peat Moss.
Wang (2003) reported that complex substrates prepared with perlite and SMC of A.
bisporus with a volume ratio of 2:1 or 1:2 had good physical and chemical indexes including
proportion, water holding, pH value and EC value. Lettuce seedlings bred by the complex
substrate had a good quality with more and larger leaves, taller plant, stronger stalk, more side
roots and higher biological production. Based on the experimental results, it can be popularized
in soil less cultivation of vegetables. Using SMC as a component of substrate for potted plants
without soil, the pH is high and remains high. EC is initially high. It increases as nutrients are
released during composting, and the salts can be easily leached from SMC during 6 weeks of
composting if the crop is salt sensitive. (See section on Use of SMC as a Casing Material below
for details on how to decrease the high salt content of SMC.) Water holding capacity slightly
increased during composting. Biological activity reduced after 6 weeks of composting. Both
Solvita and radish seed test showed that the compost is mature after 6 weeks. Plants will grow in
many types of SMC, but best plant growth requires knowing the SMC (Holcomb, 2006).
In the study of Fang (2005), the complex substrates with main content of SMC of P.
ostreatus etc. and assistant materials of organic and chemical fertilizer were tested for the effect
on the growth and production of potato seedlings, and the result showed that the SMC substrate
have obvious advantages in potato seedling production. It would be a perfect substrate,
substituting vermiculite and peat moss.
Hormone Production for Increasing Yields of Cucumbers, Melons and Other Plants
In Japan, a kind of liquid plant hormone has been made by diluting SMC extract, but
which kind of SMC was not identified. The preparation was used on cucumber, tomato, eggplant,
haricot bean and soybean to promote growth and increase production. Soybean sprayed with the
hormone liquid had stronger stems and leaves, stronger resistance to diseases, and up to 2.6-fold
higher production. The technology for producing plant hormone involved mixing 1 kg of SMC
with 5 L water, adjusted to a pH value range of 4.5～5.5, and incubating for 4-5 hours at 40-
50℃ in a sealed plastic container. The SMC mixture was filtrated through gauze and then with a
film filter, and the extract containing plant hormone was collected. After 300-500-fold dilution, it
was sprayed twice a week over the plant leaves (Zheng et al. 2006; Liu, 1997). It was said that
the similar plant hormone in a form of liquid also was produced in China using SMC, but the
related publication was not found.
Biocontrol of Diseases
Huang et al. (2000) tested ten agricultural wastes for their suitability as substrates for the
growth of cabbage seedlings. Spent forest mushroom (L. edodes) compost (SFMC) and spent
238
golden mushroom (Flammulina velutipes) compost (SGMC) were found to be more suitable than
raw spent forest mushroom growth medium (RFM), raw spent golden mushroom growth
medium (RGM), rice hull, carbonized rice hull, peanut husk, coconut fiber, bagasse meal or
cotton waste. The optimum composting period for SFMC and SGMC was 10 and 6 weeks,
respectively. A new medium (SSC-06) was formulated using SFMC, carbonized rice hull,
shrimp and crab shell meal, blood waste, and lime. The SSC-06 medium was suitable for growth
of cabbage seedlings and was suppressive to Rhizoctonia solani AG-4. The suppressive effect of
20-day old SSC-06 medium on colonization of cabbage seeds by R. solani AG-4 was reduced
after it was steamed in 100 °C hot air for 15-30 min. However, the inhibitory effect was restored
to the steamed SSC-06 medium by inoculation with Trichoderma harzianum isolate TH-05 at a
concentration of 105 cfu/g dry medium. After the medium was steamed for 5, 10, 15, 25 or 30
min, no fungal colonies were recovered, but the colony-forming units of the bacterial population
were maintained at >106/g dry medium. The potential for SSC-06 as a container medium for
commercial nursery industries was discussed.
Yang et al. (2002b) reported that waste mushroom material can be used in the culture of
Trichoderma spores which reached 248 x 106/g after 6 days by adding wheat bran, bean dregs
and inorganic nutrition. This kind of Trichoderma was isolated from soil, and had some certain
inhibitory effects on several plant pathogens.
Davis (2006) showed that blending SMS with landscape mulch suppressed artillery fungi.
These fungi produce spores which they shoot against walls, which thus become stained. The
landscape industry could purchase and blend mushroom compost into landscape mulch, and
thereby solve the artillery fungi problem and offer a market for unwanted mushroom compost.
SMS (40%) suppressed artillery fungi, and the recommendation was 50% SMS + 50% mulch.
Cultivation of Other Mushrooms with SMS
Edible fungi use up approximately 70% of the available nutrients in the growth substrate
and, if an appropriate amount of fresh substrate is added to the spent residue after harvesting, the
latter can be used again for further mushroom cultivation. Straw mushroom used little nutrient
from straw, so we can add some beef manure to ferment again to cultivate Coprinus mushroom
in good yield (Zeng, 1993).
In some provinces like Zhejiang, some growers cultivated the straw mushroom
Volvariella with SMC from the button mushroom, and the technology were commonly used in
the mushroom farms (Fan & Lu, 2005), while in Fujian, many farmers use spent mushroom
compost from straw mushroom to grow the Agaricus mushroom. Therefore, they can save on the
cost of straw and beef manure as these are becoming too expensive. The price of rice straw was
over 60 Euro per ton last season in the south of Fujian.
Use as a Component of Casing Material
SMS can also be used as casing material. The maximum water-retaining capacity of
casing soil is the main factor to influence the yield and quality of A. bisporus. The garden soil
which is widely used in China restricted improvements in yield because its maximum capacity is
only 20%-30%. The maximum water-retaining capacity of peat is much higher (80%-90%) but it
is rare in China. It is so expensive that the Chinese farmer can not afford it. By adding waste
compost which have been fermented in non-air conditions to garden soil, the maximum water-
retaining capacity was increased to 51%, and the mushroom yield was increased by 13.6%
(Wang et al. 2004).
The result of this experiment showed that addition of SMC to peat positively affected the
mushroom dry matter and protein content compared to controls. Although a complete
replacement for peat coincides with a reduction of yield, partial substitution of peat by SMC
could be very beneficial especially for those countries where peat is not readily available.
239
Malard company, the largest mushroom producer in Iran (produces 3,000 tons of
mushroom annually) has made a special effort over the years to master the production of casing
from SMC. Currently, 70-80% of SMC is blended with 20-30% imported peat to improve both
water holding capacity and structure. This mixture produces some of the firmest and heaviest
mushrooms. Better quality mushrooms, with less bacterial blotch, cobweb, dry and wet bubble,
were observed throughout the period of cropping compared with normal local peat and black
peat (Riahi, 2006). As casing material, the salinity of SMC is too high. Leaching is one of the
possible options that will reduce salinity of SMC. According to Riahi (2006), the leaching yard is
2500m2 in area with a capacity of 450m3.The SMC was spread evenly over the specially
designed and constructed pads. The dimension of each concrete platform was 25 * 3 meters. The
SMC was sprayed with a sprinkler system.
Pollution control
Spent mushroom compost (SMC) is a bulky waste by-product of the mushroom industry
and produced abundantly. The SMC of Pleurotus pulmonarius immobilized laccase (0.88
mmoles min(-1) g(-1)) and manganese peroxidase (0.58 mmoles min(-1) g(-1)) of which the
optimal temperatures were 45 and 75 OC, respectively. In laboratory tests, complete degradative
removal of individual naphthalene, phenanthrene, benzopyrene and benzoperylene (200 mg PAH
kg (-1) sandy-loam soil) by 5% SMC was obtained in two days under continuous shaking at 80
O
C. The SMC-treated PAH samples had significantly reduced or removed their toxicities as
revealed by the Microtox bioassay. These results were confirmed by gas chromatography-mass
spectrometry analysis on the breakdown products. A phthalic derivative which is reported as a
degradative product of PAHs by ozonation or ligninolysis was also detected in the SMC-treated
samples. The results demonstrate the potential in employing SMC in ex situ bioremediation (Lau
et al. 2003).
Table 4. Determination of EC and amount of water used at different stages of leaching
Electrical conductivity (mS/m) Water used/m3

Days
Repl1 Repl2 Repl3 Repl4 Repl1 Repl2 Repl3 Repl4
0 6.0 5.5 7.0 7.1 36 26 27 14
2 4.0 5.2 4.0 6.0 26 34 26 34
4 3.3 4.0 3.5 3.7 17 63 51 108
6 3.2 3.6 3.2 2.8 31 59 32 106
8 3.1 3.1 2.8 2.5 41 48 58 104
10 3.0 2.9 2.4 2.3 36 42 85 96
12 2.9 2.8 2.1 2.2 39 62 76 102
14 2.5 2.6 2.1 2.0 47 49 49 98
16 2.3 2.5 2.0 1.7 38 57 39 82
18 2.0 2.4 1.9 1.6 43 75 27 53
20 1.9 2.0 1.8 .... 38 58 55 ....
22 2.0 1.8 1.8 .... 35 27 37 ....
24 2.1 .... .... .... 8.0 .... 21 ....
Total 470 600 583 832
240
The electrical conductivity of 2 year-old SMC was decreased from 7.1-5.5 to 2.1-1.6 (mS/cm)
after 18-24 days of leaching. During this period 470-832 m3 of water was used for leaching of
350-400 m3 of SMC.
Table 5. Chemical properties of SMC at different stages of leaching
Cations Anions
Samples Ca Mg Na K Cl SO4 HCO3
Day (0) 46 25 50 145 102 36 9.9
Day (10) 25 11.7 36 105 73 65 8.3
Day (15) 20 10 7.8 15.7 8.8 39 4.8
Day (20) 11.9 3.8 5.7 9.4 4.4 36 3.5
In the Chinese patent, CN200510031204.2, the method of utilization of SMC to eliminate

chromium from industry waste water was introduced. L. edodes SMC was used as a biosorbent
for adsorbing cadmium, lead and chromium from solutions under batch conditions for the first
time. Titration of the biomass revealed that it contain at least three types of functional groups.
The fourier transform infrared spectrometry showed that the carboxyl, phosphoryl, phenolic
group were the main groups. The simulated values of pKh and molar quantity were 5.00 and 0.44
mmol/g, 7.32 and 1.38 mmol/g, 10.45 and 1.44 mmol/g, respectively. The biosorption ability
increased with pH in acid condition (Chen et al. 2005). The mechanism and function of sorption
of Pb2+ in waters by L. edodes SMC was studied (Tu et al. 2006). The carboxyl, phosphoryl and
phenolic groups in the SMC were the main functional groups. They caused a quicker sorption
speed, after 30-50 min the equilibrium was reached, the actual sorption process was relatively
identical with the pseudo-second-order Lagergren model. When the pH values were 4.09-6.00,
the sorption efficiency was relatively high. When Pb+ concentrations were 20, 50 and 100mg/L,
the best use amounts of absorbent were 1,2,5g/L respectively. The greatest sorption amount was
714.29mg/g, when Langmiur isothermal sorption equation was used to estimated sorption.
Summary
As feedstuff or fodder additive, SMC can replace a part of feedstuff and other nutritional
elements. Ma et al. (2006) discussed the nutritional value, production technology, utilization and
development prospect of several kinds of SMC. It was a fact that the nutritional value of some
SMC is about equal to that of feedstuffs like wheat. It can be used as a new feed resource for
animals to reduce feed cost. Meanwhile its utilization is of significance to protect the
environment.
The fungal communities in mushroom composting phase II were assessed using a
combination of PCR amplification and sequencing of 18S rDNA from fungal isolates and
“nested” PCR-TGGE analysis on the basis of DNA directly extracted from compost samples.
The diversity of cultivated fungi isolated from compost samples was low. A total of 11 isolates
were clustered to only two different species. One species, Chaetomium elatum, was identified
within 10 isolates, and the other, with high similarity belonged to Penicillium expansum. The
fungal flora associated with mushroom compost was then monitored with “nested” PCR-TGGE.
The patterns obtained revealed the more complex existence of fungal communities from the
original compost samples compared to those enriched with food waste and cow slurry (Yang et
al. 2002).
Yan et al. (2005) recommended that the sawdust SMC of A. auricula and Pholiota
nameko could be newly fermented by adding fresh materials and used for the cultivation of P.
ostreatus, L. edodes, P. citrinopileatus and C. comatus etc. Cultivating different mushrooms
needs different extra materials because of the low C/N ratio. The straw SMC could also be newly
241
fermented for cultivating other mushrooms, or used as organic fertilizer, or used as animal
feedstuff. Because the straw SMC contained about 20% crude fibre, it’s suitable for herbivore;
however its proportion is limited for pig or chicken.
To keep the suitable development of edible mushroom industry, it is necessary to
decrease the dependency on straw and forest resource and develop special production
technologies of edible mushrooms. In order to bring edible fungi industry into a bionomic
economy system and countryside circle–economy, the SMC should be used as a feedstuff for
poultry and fish, and to process soil organic fertilizer utilizing the residues of edible fungi (Bian,
2006).
The use of agricultural biomass as a resource material to cultivate edible fungi provides
humankind with a high protein food material, and simultaneously reduces environmental
pollution caused as a result of burning and otherwise disposing of wastes generated from crop
production. By creating multi-functional SMS, the practice has important and practical
implications for the recycling of agriculture biomass, and achieves economical, ecological and
societal unification.
Recommendations for the Dutch Situation
The different options were considered for use in Holland with the following conclusions:
1. the direct use of SMC from Agaricus as feed for cattle seems unlikely, as it contains
little digestible fibres and is officially labelled as animal manure; it may be possible
to capture valuable ingredients like proteins
2. burning is unprobable as it has a high ash content and contains much water, which
will reduce the amount of useful energy to be harvested; furthermore the regulations
make burning not a probable option.
3. use as a soil fertilizer is the current practice and benchmark for cost comparison.
4. fermentation for natural biogas of untreated Agaricus SMC is commercially not
feasible, as the energy content is even lower than that of other animal manures.
5. use as soil conditioner is (like 4 above) the current practice,
6. as potting soil for potted plants seams feasible if a solution can be found for the high
salt concentrations
7. technically the SMC could be reused for other mushrooms, but given the limited
amounts of other cultivated mushrooms the market potential is small.
8. extraction of plant hormones may be an option, further research is needed to identify
valuable compounds
9. biopesticides seem technically easy to prepare from the SMC, but the market seems
limited;
10. as a source for casing soil: the treatment seems more expensive than buying fresh
peat.
11. soil sanitation is not a continuous process in Holland, possibly water cleaning
facilities could use SMC, but it is not expected that a large amount of SMC can find
alternative use this way.
A double cascade approach for local situations, which considers both biorefinery and energy
aspects (Oei & Braber, 2007), leads to the following recommendations:
First of all, the casing soil should be removed from the compost. This could either be done with
separate nettings or with a kind of mechanical scraper when the cells are emptied. Then the
moisture should be pressed out of the compost and the moisture should be analysed for its
salinity and other components. Possibly proteins and valuable plant hormones like humic acids
can be harvested from the moisture. An efficient process for pressing the moisture out of the
champost has to be developed, with respect to energy and treatment costs and the remaining
242
moisture content in the champost itself. The champost should be analysed for salinity and could
serve as a replacement for peat for potted plants.
If the moisture content can be brought back to ca. 20-30% the champost could also be used to
fuel a bio energy installation. Ideally, the high temperature heat will be used for a process first
and then secondly for a lower valued function, like heating rooms (cascading).
References
Anonymous. 2006. Feeding pig with SMC. Modern Agriculture, 6, 21.

Bao RH, Liu QH, Yao L, Liang XW. 2001. Ruminal degradability of organic material and
cell wall constituent of waste material from fungal culture by different treatments in nylon
bags for cattle. J. Fujian Agric. For. Univ. (Natural Science Edition), No. 4.
Bian YB. 2006. Effect of straw resource status on the development of edible fungi industry
in China. Edible Fungi of China, 1, 5-7.
Chen HJ. 1995. Utilizing spent mushroom compost on the campus planting.
http://etds.ncl.edu.tw/theabs/english_site/detail_result_eng.jsp
Chen GQ, Zeng GM, Tu X, Huang GH, Chen YN. 2005. A novel biosorbent:
characterization of the spent mushroom compost and its application for removal of heavy
metals. J. Environ. Sci., 17, 756-760.
Chinese patent No. CN200510031204.2.
Chen YJ, Ma YP, Gao YY, Lu YJ, Zhang JW, Zhang YD. 2005. Effect of WMLE
feed on reproduction performance of sows. Acta Agriculturae Boreali-Occidentalis Sinica,
14, 115-120.
Davis DD, Kuhns LJ, Harpster TL. 2006. Use of mushroom compost to suppress
artillery fungi. Second SMS symposium, Philadelphia, USA.
Dong ZG, Hu JW, Li LR, Gong MF, Miao XQ. 2002. The study on effect of waste
substrate of mushroom of cottonseed shell feeding Karacul sheep. Grass-feeding Livestock,
1, 38-39.
Fan GQ, Lu XF. 2005. Key techniques of using spent mushroom compost to cultivate
Volvariella volvacea continuously. Edible Fungi of China, 2, 29-30.
Fang GN. 2005. Test of micro-potato culturing based on mushroom debris. Inner
Mongolia Agric. Sci. Technol. 6, 44-45.
Fleming R. 2006. Feasibility of processing spent mushroom substrate to recover
additional value. Second SMS Symposium, Philadelphia,USA.
He GX. 2001. Soil amendment by the addition of waste solution from mushroom
culture. Journal of Soil, 32, 1.
Riahi H. 2006. Leached SMC as a component and replacement for peat in casing soil
and increasing dry matter in mushrooms. Second SMS Symposium, Philadelphia, USA.
Hu HY, Mo MH, Zhang L. 1999. The primary research on transforming the oyster
spent substrate to feedstuff with eelworm. Guizhou Agricultural Science, 27, 19-21.
Huang W. 2006. Report on market of edible fungi in the autumn-spring of China.
pp44-46.
Huang JW, Huang HC. 2000. A formulated container medium suppressive to
Rhizoctonia damping-off of cabbage. Bot. Bull. Acad. Sin., 41, 49-56.
Holcomb JE. 2006. SMS as a component of soilless potting mixes - Does the SMS
make a difference? Second SMS Symposium, Philadelphia, USA.
Lau KL, Tsang YY, Chiu SW. 2003. Use of spent mushroom compost to
bioremediate PAH-contaminated samples. Chemosphere, 52, 1539-1546.
Lei XQ, Xu YS, Xu B, Zhang DX. 2000. Study the effect of using mushroom bran in
dairy cattle production. China Dairy Cattle, 3, 15-16.
243
Li HB. 2005. Effect of WMLE feed on reproduction performance of sows, Acta
Agriculturae Boreali-Occidentalis Sinica, 14, 115-120.
Li QS, Pu CX, Zhang YL. 2006. Physical and chemical characteristics and applied
Effects of composted spent mushroom as horticultural substrate. Soils and Fertilizers
Sciences China, 5, 56-58.
Li XM. 2003. Development and utilization of residues of edible fungi. J. Henan Agric.
Sci., 5, 40-42.
Li ZX, Cai YM. 2003. The study on using fermentable spent mushroom compost
make animal feed. China Animal Husbandry Veterinary Medicine, 5.
Liang Z, He SL. 2002. Productive technique and effects of flowers and plants
nutritive soil which product by waste materials of mushroom production and crops straw.
Xinjiang Agric. Sci., 2, 101-102.
Lin SL. 2002. Utilization of refuse from mushroom bed for manufacture of soil
conditioner. Phosphate and Compound Fertilizer, 17, 3.
Lin TC, Chuen SH. 1993. Utilization of waste mushroom compost for tomato
production. Taizhong Agricultural Develop Station Research Compiles. 40, 44.
Liu ZF. 1997. Edible fungus residue can be used to produce plant hormones. Edible
Fungi of China, 16, 19.
Ma SF, Jun H, Diao ZM, Wu BF. 2006. Study on nutrition value of the cultural
residue of edible fungi and utilization way. Qinghai Prataculture, 15, 36-40.
Mi QS, Wang SK, Song JH. 2005. Study on the comprehensive utilization of edible
fungus waste material. Chin. Agric. Sci. Bull., 21, 284-287.
Oei P, Braber K. 2007. Een kas voor elke wijk, Innovatie Netwerk reports.
Tian J. 2000. The essential of technique for feeding domestic animal with SMC. J.
Henan Agric. Sci., 9, 31-32.
Tu X, Zeng GM, Chen GQ, Huang GH. 2006. Sorption of Pb2+ in waters by culture
medium waste of mushroom. China Environ. Sci., 26 (Suppl.), 45-47.
Wang FG. 2003. The application of SMC on the breeding of vegetable without soil.
J. Changjiang Vegetables, 2, 45-46.
Wang MQ. 2006. Effects of using edible-fungus-residue as fertilizer on rice yield.
China Rice, 2, 44-45.
Wang YJ, Chen RX, Lu DQ, Zhang PJ, Gu BQ. 2006. Recycle experiment on flower
and vegetable with spent mushroom substrate. Edible Fungi, 1, 45-46.
Wang ZQ, Guo Q, Lin XF, Yu JQ. 2004. Study on improving maximum moisture
capacity of casing soil by adding waste compost in garden soil. Edible Fungi of China, 5, 15-
17.
Xiao SG, Liu YG, Wang WM, Luo YS, Weng CF, Huang ZY. 2005. Test of soil
amendment of orange garden with spent mushroom substrate. Edible Fungi, 6, 48.
Yan BS, Ma F, Zhang YX, Meng XY. 2005. Reuse of the edible fungi residues and
the related environmental friendly processing technology. Forest By-product and Speciality
in China, 4, 27.
Yang H, Hang XM, Li DT, Edwards C. 2002a. Analysis of fungi in mushroom
compost using PCR and TGGE of ribosomal DNA. J. Shanghai Jiaotong Univ., E-7, 119-
122.
Yang XR, Wang Y, Zhao GZ, Yang YJ. 2002b. Utilizing wasted material of
mushroom to ferment Trichoderma. Tianjing Agric. Sci., 8 (Suppl.), 36-38.
Zeng H. 1993. Cultivation of Coprinus comatus on spent straw mushroom compost.,
Edible Fungi of Zhejiang, 2, 13.
Zhang JH, Wu Y, Zhang ZB, Ao CJ. 2000. Analysis on nutrient contents of
cultivation waste of edible mushroom. Inner Mongolia Agric. Sci. Technol., 6, 14-16.
244
Zheng LY, Huang XQ, Peng WH. 2006. Utilization of spent mushroom substrate.,
Acta Edulis Fungi, 13, 76-77.
Zhou SL. 2002. Production of biogas with SMC. Edible Fungi, 1, 6.
Zhu XP. 2005. The influences of microbial fertilizers on nutrients uptake of pepper
and changes of soil nutrient. China Agric. Journal, 21, 281-283.
Zhu XP. 2006. The effect of mushroom residue and microbiological agents mixture
on the growth and yield of non-heads Chinese cabbage. J. Hebei Scientific and Technological
Normal Univ., 2, 7-11.
Zhuo SM. 2003. Earthworm raising with agricultural wastes and their combinations.
Chinese J. Tropical Agric., 23, 26-28.
245
Oyster Mushroom Pleurotus ostreatus (Jacq.) P.Kumm. – Its Cultivation

and Utilization in Slovak Forestry
M Pavlik,1 M Hrasko2 and A Pavlikova3

1
Technical University in Zvolen, T.G.Masaryka 20, Zvolen 96053, Slovak Republic, Email:
mrtnpavlik@yahoo.com; 2Forests of the Slovak Republic State Enterprise, Forest Enterprise
Krupina, Saská 9, 96321 Krupina, Slovak Republic,
Email: hrasko@lesy.sk; 3Matej Bel University in Banska Bystrica, Ružová 13, 97411 Banská
Bystrica, Slovak Republic. Email: apavlikova@pdf.umb.sk
Abstract
The primary role of wood destroying fungi is to decompose wood, to humify it and to
restore it into an organic matter cycle. A primary interest for forestry practice is to transform
waste wood in forest stands for useful organic matter in a relatively short time. It is, for
instance, the biodegradation of tree stumps after windstorms or cutting of full-grown trees.
Their natural decomposition is relatively lengthy and it takes several decades. Decomposition
of stumps artificially infected by Pleurotus ostreatus was from three- up to eight-times faster
in comparison with natural conditions. Presented examples were tested under conditions of
Slovak deciduous forests. The result of oyster mushroom activity could be a faster
decomposed wood-waste, faster input of organic matter into the forest soil, and also the tasty
fruit bodies for healthful nourishment.
Key Words: Pleurotus ostreatus; Cultivation; Forestry management; Wood decomposition;

Cycling of organic matter
Introduction
There are very good conditions for existence of varied forest communities in the
Slovak Republic, thanks to the position of the country in the middle of Europe and the typical
continental climate of a moderate zone. Forest cover percentage of the Slovak territory, tree
species composition and the silvicultural systems applied are the essentials of high
biodiversity and relative stability of forest ecosystems. Fungi are an intrinsic part and the
critical component of their existence and also their restoration. Great diversity of their species
and their various ecological functions in nature are the basis of stability of forest
communities. Permanently greater attention has been paid recently to their participation in
forest development, silviculture, tending of stands, forest regeneration and protection.
Nowadays, fungi are neither only destroyers of wood from the viewpoint of foresters, nor a
deadly danger or a delicacy for common mushroom pickers and consumers. The more we
know about them, the more possibilities of their practical and positive utilization we uncover.
The possibilities of fungi utilization in forest management depend on their various
lifestyles. Parasitic fungi are regarded as harmful, but their ability to eliminate weak and non-
perspective trees from the forest stand is very useful. Fungi are the natural selectors of the
strongest and most perspective trees and they appoint a time for restoration of exhausted
forest stands. Saprophytic fungi are the decomposers of dead plants and animal bodies. They
are the main recyclers in nature, and soil formation is the principal result of their activity.
Mycorrhizal fungi and mycorrhizal symbiosis are the essential components of healthy and
stable production forests. Active and fully functional mycorrhizal symbiosis provides
protection and nutrition for forest trees, and raises their ability to resist harmful agents.
The oyster mushroom is a common saprophytic fungus in Slovak forests. From the
viewpoint of forestry, Pleurotus ostreatus is a saprophytic fungus speeding up wood
246
decomposition. This ability could be used for biodegradation of waste wood not serviceable in
forest management or wood technology. This ability is possible to use for speeding up wood
decomposition in more extreme conditions, mainly the rocky and steep sites, where the wood
is not processed and it serves for soil enrichment of poor sites. It is the basis for soil formation
as well. Very important is the ability of the oyster mushroom to filter pollutants from the soil,
and to strengthen unstable and eroded sites. The correct utilization of fungal abilities and
properties leads to improving growing conditions for forest trees, strengthening the stability of
forest stands, as well as increasing benefits and yields from the forest management.
Forest Conditions
According to results of the National Inventory and Monitoring of Forests in the Slovak
Republic, forests cover 2,174,000 hectares, i.e. 44.3% of the Slovak territory. Broadleaved
tree species representation is 60.8% and the most represented is beech (35.2%). Coniferous
trees share 39.2% and the representation of spruce is 28.1%. Production forests, aimed at
wood production, cover 71% of the forest stands area. Protection forests cover 17.2% and
they are aimed at preservation and improvement of ecological functions, mostly soil and
water preservation. The welfare services, i.e. spa and therapeutic, recreational, soil-protection,
hunting and research- educational functions, are the priority of the especially intended forests
(11.2%).
The aim of the forest manager is to cultivate a healthy, stable and high-quality forest
and simultaneously the effective utilization of products obtained from it. Wood mass is the
most important source of income for the Slovak forest management. Therefore, efforts aimed
at the most effective evaluation of the wood mass are the primary interest of forest managers
and forest owners. Some of the activities within the practical forest management do not bring
economical profit because of low wood quality and high financial costs involved in
harvesting.
The main source of income for forestry is logging and selling the wood. Optimal
methods of management are often disturbed not only by activity of the harmful factors but
also by a frequent occurrence of disasters, mainly in the form of gale disasters, snow damage,
and mass outbreaks of bark-beetle and honey mushroom. Salvage-logged volume has not
fallen below 40% for a long time, and from 1970 until 2000, increased from 14.5% to 49.2%,
although in 2001 and 2002 it decreased to 39.5% and 35.1%, respectively (Pavlik & Pavlik
2003). During the last 5 years salvage-logged volume did not fall below 40% with a maximal
volume in 2005 (65.9%). Salvage-felling timber is usually injured, from low quality and
damaged stands that are usually situated at the extreme, non-accessible localities. The
technology of wood processing is usually very strenuous and expensive there, and processing
costs exceed the potential income.
Wood processing from tending and regeneration felling seems to be non-effective and
potentially leads to soil erosion, especially when the wood is of an inferior quality and forest
stands are situated on extremely steep slopes, or sites that are rocky with a lack of soil. It is
more useful to leave a part of that wood in forest stands as a substratum for soil formation, a
barrier against erosion, and a place for a water retention.
Areas exposed to a long-term emission pressure are often extremely polluted, and trees
lacking mycorrhizal symbioses are unhealthy and dying. Furthermore, decomposition of dead
wood is minimal because wood-destroying fungi are also lacking. Their activity is inevitable
for soil restoration and for reconstruction of injured forest stands on the whole. Dead parts of
trees and dying trees are slowly decomposed by activity of climatic factors as well as
microorganisms.
247
It is not possible to utilize the stumps left in forest stands after cutting trees. They are
slowly decomposed for several years or decades and they are frequently an obstacle to forest
restoration. Stumps left in forest stands after poplar cutting are an obstacle to soil preparation
for new reforestation in the lowland areas of the eastern and western Slovakia. Extraction of
stumps is not the best way because of deterioration and disposal of quality soil and their
destruction is also very laborious and expensive.
There are a lot of wood pieces left at the work area during wood processing, and
primary and secondary conversion. This wood waste is not possible to process by any suitable
and economically advantageous method. It is gathered at the margin of the work area and
usually represents a hindrance. There is a problem to remove or to decompose it.
The decomposing activity of wood destroying fungi can be used in all the
aforementioned examples. Selection of suitable species depends on a specific situation
according to tree species, quality or quantity of waste wood and the local conditions.
Fungi
Wood-destroying fungi are an important physiologic-ecological group. They are
essentially connected to wood and decompose it by their activities in nature. They also cause
great damage to living trees, processed wood and wood constructions. However, they are a
non-replaceable component of the forest ecosystem due to their support of the optimal
nutrient cycle in nature by decomposition of wood-waste.
From the economic point of view, it is possible to consider the activity of fungi as both
beneficial and injurious. The injurious activities are moderated by defensive reactions on the
part of the tree, products of its metabolism, antagonistic organisms and also unsuitable
physical conditions in the wood of the invaded tree. The beneficial activities are grounded in
the decomposition of plant wastes. The gradual identification and application of relationships
between wood destroying fungi and biotic influences of the environment leads to an extension
of the possibilities to realize the useful characteristics of wood destroying fungi, and to reduce
their harmful activity.
Pleurotus is a common genus in Slovak forests. The most well-known species is P.
ostreatus (Jacq.) P.Kumm., but the common ones are also Pleurotus cornucopiae (Paulet)
Rolland., Pleurotus carpaticus Pilat, Pleurotus pulmonarius (Fr.) Quél. and Pleurotus
eryngyii (DC.) Quél. in the southern part of Slovakia. Growing of P. ostreatus does not have a
long tradition in Slovakia. The great expansion of oyster mushroom growing started in the
1970s and was carried out on various kinds of wood fractions and various waste biological
substrates from agricultural production. The second part of the 1980s was the boom of oyster
mushroom growing, but nearly all mushroom producing facilities disappeared in the 1990s.
Since the beginning of the 21st Century, interest in the oyster mushroom and its cultivation
has returned.
Growing of oyster mushrooms has limitations in terms of speed of production and the
continual production of fruit bodies. However, it could be a perspective fungus for growing
under forest management conditions. A lot of woody waste material arises at the forestry
production and it is not possible to use them effectively. Thin branches, broken pieces of
trunks and tree stumps are left in a forest stand after cutting, and they are the source of
organic matter in the soil. This process of decomposition is very slow and those wooden
pieces are often a barrier for further forest growth. From the viewpoint of forestry, the oyster
mushroom is a saprophytic fungus speeding up the wood decomposition. This ability could be
used for biodegradation of waste wood that is not possible to use in forest management or
wood technology. The result of oyster mushroom activity could be a faster decomposed
wood-waste, faster input of organic matter to the forest soil, and also the tasty fruit bodies for
healthful nourishment.
248
Results
Possibilities for practical utilization of the oyster mushroom in Slovak forest

management are extensive and the results of its utilization are also well-known. During
research in the 1800s, the oyster mushroom growing and fruit bodies production was observed
on blocks from various tree species (Pavlik, 2005). One wild and one hybrid strain of the
oyster mushroom decomposed during five years the wood blocks right in a forest stand.
The prime aim of our experiment was to verify the possibilities of wood
decomposition of various deciduous trees by oyster mushroom activity under the natural
conditions of a forest stand. Selected tree species are commonly widespread in forest stands of
central Europe. Wood decomposition by the oyster mushroom was observed on five tree
species – beech (Fagus sylvatica), aspen (Populus tremula), birch (Betula pubescens),
hornbeam (Carpinus betulus), and alder (Alnus glutinosa)
The most highly represented is beech which is the most economically important. The blocks
were prepared from recently cut logs of all the selected tree species and the old logs of beech
wood were used in the form with two fungal strains and the form with damaged bark and also
the free standing blocks. The important part of research was to test aggression and
productivity of two production fungal strains.
Oyster mushroom growth was observed during a five-year period under conditions of
a deciduous forest stand. Therefore, external growing conditions were identical for all blocks
and strains at the experimental plot. The differences in mushroom growth, quantity and rate of
fructification, the rate of wood decomposition, and the resistance against influences of
external environment depended firstly on attributes of tree species and the oyster mushroom
production strains. When mushroom production on beech blocks was compared, the best
growth was found on fresh beech wood infected by the wild strain, and the poorest one on old
blocks with injured bark and fully exposed above the ground, infected by the hybrid strain.
Although fruit body production is not the most important outcome for the practical
utilization of oyster mushroom activity in forestry, it is a very significant sign of successful
mushroom growth inside the wood. However, fruit bodies are suitable for utilization in food
industry, pharmacy, medicine and so on. Therefore, evaluation of the most suitable conditions
for maximal fruit body production is very useful. From this point of view, quantitative
comparison of fruit body production on wood of various trees is quite interesting.
The best conditions for fruit body production were found with fresh beech infected by
the wild strain. Relatively high production was recorded on the fresh beech with the hybrid
strain, and old beech and aspen infected with the wild strain. A slightly lower production was
observed on aspen, old beech, hornbeam and birch with the hybrid strain. Old beech blocks
with injured bark and fully exposed stumps infected by the hybrid strain produced markedly
lower amounts of fruit bodies and the production on alder wood was the lowest among all the
samples tested (Table 1).
Mushrooms strains vary in their ability to convert substrate materials into mushrooms
as measured by a simple formula known as the “Biological Efficiency (B.E.) Formula”. This
formula states that one pound of fresh mushrooms grown from one pound of dry substrate is
100 % biological efficiency (Stamets, 2000). The results of evaluation of these characteristics
are very similar to results of fruit body production. The highest average value (21.47%) was
found on wood of the fresh beech with the wild strain. Relatively high values were recorded
on fresh beech with the hybrid strain, and old beech and aspen infected with the wild strain.
Slightly lower efficiencies were observed with fresh aspen, old beech, fresh hornbeam and
birch infected with the hybrid strain. Almost 50% efficiency was achieved with the most
productive fresh beech block (Table 1).
249
Table 1. Characteristics of research material, fruit body yields and Biological Efficiency
values
Section Tree State Strain Total weight of Biological

No. species of stump Blocks Fruit bodies Efficiency (B.E)
(kg) (kg) (%)
1 beech fresh hybrid 144.9 15.4 15.08
2 beech fresh natural 124 18.64 21.31
3 beech old hybrid 108 .8 9.22 10.08
4 beech old natural 112.5 14.45 14.79
5 beech injured bark hybrid 117.7 4.9 5.09
6 beech free placed hybrid 98 4.73 5.89
7 aspen fresh hybrid 141 9.27 13.16
8 aspen fresh natural 170.6 12.67 14.84
9 birch fresh hybrid 162.5 7.1 8.74
10 hornbeam fresh hybrid 135,6 8.51 8.97
11 alder fresh hybrid 110.5 1. 44 2.60
When the quantity of fruit body production within the whole period is compared, it is
evident that the main production was in the third and the fourth year (30.5 and 30.3% of the
total production, respectively). Markedly lower production occurred in the second (19.0%)
and fifth years (12.3%) (Table 2).
The requirement to solve the processing of waste dendromass by ecological, near to
nature methods, as well as new information on the abilities and properties of the oyster
mushroom, were the main reasons for the establishment of new research plots in 2004.
Research methodology was elaborated with regard to requirements of forest management and
conditions in forestry practice, regarding the possibilities for practical application of a forest
stand under natural conditions.
Table 2. Annual production of fruit bodies and Biological Efficiency values
Section 1st B.E. 2nd B.E. 3rd B.E. 4th B.E. 5th B.E. Total B.E.
No. year (%) year (%) year (%) year (%) year (%) (kg) (%)
1 0.76 0.75 2.05 2.02 6.08 5.99 5.3 5.23 1.11 1.09 15.4 15.08
2 1.74 2.00 3.24 3.73 4.09 4.71 6.25 7.20 3.19 3.67 18.64 21.31
3 0.47 0.51 1.95 2.11 2.14 2.32 1.83 1.98 2.93 3.16 9.22 10.08
4 1.99 2.08 2.68 2.80 3.78 3.95 4.75 4.97 0.95 0.99 14.45 14.79
5 0.84 0.84 1.76 1.76 0.79 0.79 1.14 1.14 0.56 0.56 4.79 5.09
6 0.9 1.08 1.29 1.55 1.12 1.34 0.97 1.16 0.63 0.76 4.73 5.89
7 0 0 0.89 1.26 4.54 6.44 3.73 5.30 0.11 0.16 9.27 13.16
8 0.54 0.64 3.01 3.52 3.45 4.04 4.54 5.32 1.13 1.32 12.67 14.84
9 0.57 0.70 1.27 1.56 2.63 3.24 2.63 3.24 0 0 7.1 8.74
10 0.58 0 .61 1.57 1.65 2.87 3.02 11.05 1.11 2.44 2.57 8.51 8.97
11 0 0 0.49 0.88 0.95 1.72 0 0 0 0 1.44 2.60
Total 8.39 20.2 32.44 32.19 13.05 106.22
Average 0.84 2.08 3.43 3.33 1.03 10.96
250
Models of the Waste Dendromass Fractions and Possibilities for Their Exploitation Based on
the Activities of the Oyster Mushroom
The research was undertaken by the Department of Forest Protection and Game
Management at the Forestry Faculty of the Technical University in Zvolen and the research
plots were established under natural conditions of forest stands at the University Forest
Enterprise of the Technical University in Zvolen, the Forest Enterprise Krupina within the
Forests of the Slovak Republic, State Enterprise, Banska Bystrica and at the Military Forests
and Estates, State Enterprise, Pliesovce.
The research was aimed at waste dendromass of broadleaved trees of various
dimensions according to their presence in forestry practice. Stumps left in a forest stand after
tree cutting are the typical model of unexploited dendromass in forestry. Stumps shared more
than 17% of the deadwood in Slovak forests. Even though their total volume is about 7 cubic
metres per hectare on average, their actual volume is much bigger especially in calamitous
and clear cutting stands. They form a very important source of biomass, but its release is very
slow. The actual research was aimed at decomposition of these stumps by an activity of the
oyster mushroom. The fungus was inoculated into snicks in beech and hornbeam stumps
under various stand conditions - in penumbra of a mature forest and in an open area. The first
fruit bodies were observed in November on stumps inoculated in May or June, and
fructification was registered on approximately 20% of the stumps. Fruit bodies were growing
mostly individually from the margins of the snicks, and their occurrence was evidence of
mushroom activity and fungal growth within the stumps. The yield of fruit bodies was clearly
higher in the second and the third year. They were growing also in clusters on more than 60%
of the stumps. Not only fruit body formation will be observed in the next years. The degree of
decomposition of inoculated and non-inoculated stumps will be compared in the same stand,
and the influence of artificial inoculation of stumps on the surrounding forest trees will be
evaluated.
Thin wood material is an important component of the deadwood volume in forest
stands, and it comprises about 23% from the total volume on average. “Smallwood” is mainly
a dendromass left in forests after cutting from tree branches with a thickness up to 7 cm, and it
is the most important source of nutrients for the forest soil. Removing of the thin dendromass
leads to soil deterioration with a negative effect on existing and future forest. The model for
utilizing the oyster mushroom is oriented to decomposition of the thinnest and smallest wood
fractions created in the process of processing and manipulation with wood – sawdust, chips,
small fragments of wood and thin branches. This waste dendromass accumulates often at the
timber yard or sawmill and is usually an obstacle for the working process.
In this case, decomposition was tested in patches, where the oyster mushroom in the form of
grain spawn and saw spawn was inoculated between layers of wood waste. Various
techniques of substrate arrangement, inoculation, watering and protection against sun were
tested in the patches. Patches were installed directly at the forest stand in penumbra of the
mature forest and in open spaces. Intensive overgrowing, dendromass decomposition and fruit
body production depend significantly on suitable shadowing and watering of the patches
according to actual climate conditions during all of the years.
Wood material with a diameter over 7 cm - “thick wood” - is the greatest source of
deadwood in a forest stand with a total share of about 45%. It consists mainly of short and
long fragments of branches and whole trunks laying and decomposing on the ground. The
thinner part of that dendromass, with a diameter up to 20 cm, is suitable for decomposing by
the wood destroying species Lentinula edodes. Successful attempts to decompose 1-metre
long logs of beech, hornbeam or oak by the production of lot of quality fruit bodies could be a
model for other forestry subjects. The soaking of logs in fresh water for about 24 hours every
3 months is a very important condition for fruit body production. Thicker pieces of 50-cm
long wood blocks were inoculated with the oyster mushroom. At the beginning of the
251
research, mainly blocks of beech and aspen, but also oak, hornbeam and black locust, were
inoculated over the cut surface and possibly into the snicks at the side of the wood block. A
new method of intensive inoculation using a special applicator – the “mushroom funnel” –
was developed later. According to this method, inoculum is pressed into longitudinal, 2-3 cm
deep, snicks at the side of wood block, and subsequently is painted with a protective latex
coating. Inoculation is practically without loss of grain spawn, latex painting is relatively
cheap and application is very easy, without no undesirable effects on mushroom growing. The
inoculated blocks were wrapped in plastic cling film and placed in the shade for
approximately 3 months. The blocks were unwrapped after the first rainy and foggy days.
They were placed in the soil and covered up to the one third of their height. In the eventuality
of their location in an open area, it is necessary to protect them against direct sunlight. No
other maintenance or protection of the woody blocks was undertaken, and they were exposed
to activity of the oyster mushroom and the other wood destroying mushrooms, or various
biotic and abiotic factors. Evaluation of oyster mushroom activity and the effectiveness of
growth within the wood blocks were based on fruit body production. Because of different
dimensions of woody blocks and a need to compare results, an evaluation was also based on
Biological Efficiency values (B.E.).
The results for the most frequently used tree species – beech and aspen – during four years are
presented in Table 3.
Discussion
The noticeable differences in speed and intensity of mushroom growth in the present
study were compared with results of compatible research carried out in the 1980s.
Overgrowth and fruit body production was more rapid in the first and the second year, the B.E
maximal values were seen with the beech blocks in the third year and in aspen blocks in the
second year. Rapid onset of fructification in the first year and its rapid decrease in the fourth
year are differences associated with the present research. What are the reasons for these
differences?
Table 3. Proportion of fruit body weight to dry weight of stump (B.E.)
Woody species Year

1st 2nd 3rd 4th Total
beech 4.41 7.13 8.72 1.12 21.38
aspen 3.88 6.38 4.65 0.56 15.47
Maximal values of B.E. on one stump
beech 35.19 23.98 18.53 3.12 43.24
aspen 22.03 16.67 15.81 5.32 30.45
Maximum fruit body production achieved on one stump (kg)
beech 3.85 5.20 1.66 0.45 5.93
aspen 1.80 2.38 2.30 0.66 4.43
Qualitative parameters and attributes of beech and aspen wood are approximately the
same. Climatic conditions were not the same, but average values were similar because of very
similar site conditions. Inocula were created with different strains of the oyster mushroom, but
the differences in production of hybrid and wild strains were only in a fruiting period during a
year. Hybrid strains were able to produce fruit bodies already at the beginning of the spring
and at the beginning of September. Fructification of the wild strain was limited by the
temperature decrease at the beginning of October and usually finished in December. Intensity
252
of inoculation is probably the main reason for growing speed. The older system of inoculation
was very simple: inoculum was poured on to the cut surface of the wood block; the next block
was placed on top and, after inoculum was poured on the top block, the next block was put up.
The system of inoculation was not very laborious, but the mycelium growth was not as
intensive as with the new inoculation method using the “mushroom funnel”. Intensive
inoculation is a pre-requisite for intensive mycelial growth and rapid wood decomposition.
Application of the protective latex layer over the snicks had a very positive impact on
successful inoculation and rapid mycelial growth. Its positive function is mainly in inoculum
protection against wet loosing, against ants and other insects, but also against the other wood
destroying fungi. Mycelium of the oyster mushroom overgrows wood during several months
and, when the latex layer falls away, the oyster mushroom has already occupied a great part of
the wood block. The higher production of fruit bodies, the more rapid completion of
fructification and the more rapid decomposition of wood are expected during actual research.
That is very important because of the aims of research – effective and rapid decomposition of
the waste wood under the forest conditions.
The primary role of wood destroying fungi is to decompose wood, to humify it and to
restore it into the organic matter cycle. Effort to utilize those abilities rapidly increased when
the techniques of artificial infection by spawn of some wood destroying fungi were
developed. For forestry practice, it was a primary interest to transform waste wood in forest
stands into useful organic matter in a relatively short time. It is, for instance, the
biodegradation of tree stumps after windstorms or cutting of full-grown trees.
Experiments in Slovakia were oriented to practical utilization of the oyster mushroom
for decomposition of waste wood. Researchers and foresters from the Forestry Faculty of the
Technical University in Zvolen observed the speed, intensity and other aspects of mushroom
growth under common forest conditions. A very important part of this experiment was the
possibility of a negative influence on the surrounding growing trees by application of the
oyster mushroom spawn to stumps in a forest stand (Ginterova, 1985). Although the oyster
mushroom is commonly growing on dying trees and is thought to be primarily a saprophyte, it
behaves as a facultative parasite at the earliest opportunity (Stamets, 2000). Those qualms
were not realized during ten years of experiments that confirmed the hypothesis about the
possibility of faster decomposition of artificially infected stumps. Decomposition of stumps
was from three to eight times faster in comparison with natural conditions (Kodrik, 1979).
The simplest and the least dangerous is growing of the oyster mushroom on wooden
stumps. It commonly grows on the wood of poplar, beech, birch, willow, hornbeam, lime,
alder, apple, walnut, pear, plum and other species. The next method for oyster mushroom
growing in forestry practice is the decomposition of wood in soil reclamation of a deciduous
forest. Thin broken branches are placed into a half-metre drain and, after infection by the
oyster mushroom strain, are covered with a thin soil layer. Within a few years, the mushroom
is growing and producing fruit bodies depending on external, especially climatic conditions.
Forest soil is enriched by new organic matter after the substrate is completely decomposed.
The aim of research in the 1970s and 1980s was to evaluate one possible application,
and to compare a suitability of various common deciduous trees and two production strains
under the normal conditions of a forest stand. It is possible to compare the results obtained
with those reported of Ginterová et al. (1976) and Kodrík (1979). The methodology of their
research was similar and their results also confirmed the suitability of utilizing oyster
mushroom strains for faster decomposition of deciduous wood. Waste beech wood, the
presence of which sometimes causes problems in forestry practice, is very successfully
decomposed by the application of the oyster mushroom although the biological efficiency is
not very high and fruit body production is limited only to the autumn months.
Aspen and poplar woods are also very well decomposed by the oyster mushroom
activity with relatively high production of fruit bodies. It was confirmed by the results
253
presented, and also by actual research, that 95% of stumps infected in spring produced fruit
bodies in November of the first year. Stamets (2000) reported that, on average, more than one
pound of mushrooms per year was harvested from inoculated poplar stumps for more than
three years. Of the 200 poplar stumps, ranging in size from 6 to12 inches, which were
inoculated in the spring, all produced by the fall of the following year. As expected,
hardwoods of greater density, such as oak, took longer to produce but sustained yields for a
longer period.
The results presented here confirmed a manifold increase in the rate of waste wood
decomposition by oyster mushroom activity. The possibility of successful application,
perennial growing and fruit body production of the oyster mushroom under natural, not sterile
conditions was also confirmed. That is very important because of the aims of research –
effective and rapid decomposition of the waste wood under the forestry conditions. Coherent
methods for practical utilization of the activities and products of wood destroying fungal,
especially of the oyster mushroom, have great prospects, not only in forestry and not only in
Slovakia.
Acknowledgement
The authors thank the Slovak Grant Agency for Science VEGA for a financial support
(Research grant No. 1/4397/07)
References
Ginterová A, Janotková O, Valovič K. 1976. Oyster mushroom – growing and

processing. VU LIKO, Bratislava. (in Slovak)
Ginterová A. 1985. Growing of mushrooms. Príroda, Bratislava. (in Slovak)
Kodrík J. 1979. Preliminary knowledge about the oyster mushroom growing on wood
stumps in forest stand. Acta Facultatis Forestalis, XXI, 117-126. Zvolen. (in Slovak )
Pavlík M, Pavlík Š. 2003. Gale disasters in Slovakia: consequences and management
implications. In: Ruck B, Kottmeier C, Mattheck C, Wilhelm G. (eds), Wind Effects
on Trees. Proc. Intl. Conf., University of Karlsruhe, pp199-206.
Pavlik M. 2005. Growing of Pleurotus ostreatus on woods of various deciduous trees.
Acta Edulis Fungi, 12 (Suppl.), 306-312.
Stamets P. 2000. Growing Gourmet and Medicinal Mushrooms. Ten Speed Press,
Berkeley, California, 574pp.
254
Biotechnology to Grow Edible and Medicinal Mushrooms on Vine and

Winery Wastes
M. Petre and A. Teodorescu
Faculty of Sciences, University of Pitesti, 1 Targul din Vale Street, Pitesti 110040, Arges
County, Romania. Email: marian_petre_ro@yahoo.com
Abstract
The main aim of this research work was to find out the best way of recycling the vine
and winery wastes by using them as a substrate to grow edible and medicinal mushrooms in
order to extend the food chain in vineyard ecosystems. According to this purpose, three fungal
species from Basidiomycetes, namely Ganoderma lucidum (Reishi), Lentinus edodes
(Shiitake) and Pleurotus ostreatus (Oyster Mushroom) have been used to determine the effect
of lignocellulosic vine and winery wastes used as culture composts on the production of
mycelia and fruit bodies that could be processed and marketed as useful products such as food
and drugs. The experiments were achieved by growing these fungal species in special culture
rooms, where all the culture parameters were kept at optimal levels, in order to get the highest
production of fruit bodies. During the experiments, the effects of culture compost composition
(carbon, nitrogen and mineral sources) as well as other physical and chemical factors
(including temperature, inoculum size, CO2 and O2 concentration, air humidity, watering,
light intensity and incubation time) on mycelial net formation and, especially, on fruit body
induction were investigated.
Key words: Biotechnology, Biorecycling, Edible and medicinal mushrooms, Vine and winery
wastes; Mushroom cultivation
Introduction
Most of the wastes produced all over the world arise from industrial, agricultural and
domestic activities. These wastes represent the final stage of the technical and economical life
of products (Verstraete & Top, 1992). As a matter of fact, agricultural works as well as
industrial activities related to vine crops processing have generally been matched by a huge
formation of wide range of waste products (Beguin & Aubert, 1994; Wainwright, 1992).
Many of these lignocellulosic wastes cause serious environmental pollution effects if they are
allowed to accumulate in the vineyards or, much worse, to be burned on the soil. So far, the
basis of most studies on lignocellulose-degrading fungi has been economic rather than
ecological, with emphasis on the applied aspects of lignin and cellulose decomposition,
including biodegradation and bioconversion (Carlile & Watkinson, 1996; Smith, 1998).
In this respect, the main aim of this work was to find out the best way of recycling the vine
wastes by using them as a substrate for growing edible and medicinal mushrooms in order to
extend the food chain in vineyard ecosystems (Moser, 1994).
Fungal species and culture media

According to the main purpose of this work, three fungal species from
Basidiomycetes, namely Ganoderma lucidum (Reishi), Lentinus edodes (Shiitake) and
Pleurotus ostreatus (Oyster Mushroom) were used as pure cultures in experiments. The stock
cultures were maintained on malt extract agar (MEA) slants. Slants were incubated at 25° C
for 5-7 d and then stored at 4° C. The fungal cultures were grown in 250-ml flasks containing
255
100 ml of MEA medium (20% malt extract, 2% yeast extract, 20% agar) at 23 °C on rotary
shaker incubators at 110 rev min -1 for 5-7 d.
Preparation of liquid fungal inoculum

The fungal cultures for experiments were prepared by inoculating 100 ml of culture
medium with 3-5% (v/v) of the seed culture and then cultivated at 23-25°C in rotary shake
flasks of 250 ml. The experiments were conducted under the following conditions:
temperature, 25 °C; agitation speed, 90-120 rev min -1, initial pH, 4.5-5.5. The seed culture
was transferred to the fungal culture medium and cultivated for 7-12 d (Petre et al. 2005a;
Glazebrook et al. 1992).
Incubation of mushroom cultures

The experiments of this research work were achieved by growing all these fungal
species in special culture rooms, where all the culture parameters were kept at optimal levels
in order to get the highest production of fruit bodies. During the experiments, the effects of
culture compost composition (carbon, nitrogen and mineral sources) as well as other physical
and chemical factors (including temperature, inoculum size and volume and incubation time)
on mycelial net formation and especially, on fruit body induction were investigated (Petre &
Petre, 2006).
All the culture composts for mushroom growing were inoculated using 5-7 day-old liquid
inoculum, and a volume size ranging between 3-7% (v/w). During 18-20 d after this
inoculation, all the fungal cultures had developed a significant biomass on the culture
substrata made of vine wastes.
The optimal temperatures for incubation and mycelia growth were maintained between 23-25
°C. The whole period of mushroom growing from inoculation to fruit body formation lasted
between 30-60 days, depending on each fungal species used in experiments (Petre et al.
2007).
Preparation of mushroom culture composts

After this stage of inoculum preparation, the seed cultures were cultivated on special
culture media prepared from lignocellulosic wastes resulted from vine cuttings that were used
as substrates for mushroom development (Petre et al. 2005b). These lignocellulosic materials
were mechanically pre-treated to breakdown the lignin and cellulose structures in order to be
more susceptible to the enzyme actions (Leahy & Colwell, 1990). All these pre-treated
lignocellulosic wastes were disinfected by steam sterilization at 120 OC for 60 min. The final
composition of culture composts was improved by adding the following ingredients: 30-40%
winery wastes as pommace (grape skins and seeds), 20-30% vine wastes as vine stem
cuttings, 15-20% grain seeds (wheat, rye, rice), in the ratio 2:1:1, 0.7-0.9% chalk, 0.3-0.5%
gypsum, each kind of culture medium composition depending on the fungal species used to be
grown. Control samples for each variant of culture composts used for the experimental
growing of all these fungal species consisted of wood chops of oak and wheat straw that were
kept in water three days before the experiments and then disinfected using steam sterilization.
Preparation of mushroom spawn

Grape pommace (3000 g) and 1500 g of vine cuttings were mixed with cleaned and
ground rye grain, 640 g of chalk, 50 g of gypsum and 3550 ml of water, in order to obtain the
growth substratum for mushroom spawn. The ingredients were mixed and sterilized at 121 °C
for 20 min and allowed to cooled until the mixture was below 35 °C. The spawn mixture wass
inoculated with 100-200 ml of liquid fungal inoculum. The materials were mixed for 10 min
to ensure complete homogeneity. Sterile polyethylene bags, containing a microporus filtration
strip, were filled with the product and incubated at 25 °C until the spawn was fully colonized.
256
At this point, the spawn may be used to inoculate the mushroom growth substrate or,
alternatively, it may be stored for up to 6 months at 4 °C before use (Chahal & Hachey,
1990).
The registered data revealed that lignocellulosic vine wastes has to be used as
substrates for mushroom growing only after some mechanical pre-treatments that could
breakdown the whole lignocellulose structure in order to be more susceptible to the fungal
enzyme action (Petre, 2002). The chemical composition of vine and winery wastes was
determined and all results are shown in Table 1.
Table 1. The main chemical composition of grape pommace and vine stem cuttings
_____________________________________________________________________
Waste type Water Sugars Cellulose Total nitrogen Protein
(g%) (g%) (g%) (g%)
(g%) _____________________________________________________________________
Grape 83.5-85.3 15.7-23.5 3.5- 6.4 0.1-0.3 1.4-1.7
pommace
_____________________________________________________________________
Vine stem 3.5-5.3 1.2-1.5 73.8-80.5 0.3-0.5 0.2-0.3
cuttings
_____________________________________________________________________
Dry weights were determined after dehydration in a drying chamber and weighing
using an analytical balance (Lamar et al. 1992). Total reduced sugars were analysed by the
Peterson protocol, and the residual cellulose was determined by the method of direct
weighings. Total nitrogen was determined using the Kjeldahl method, and protein was
determined following the protocol of Kubicek (1993).
According to the above mentioned results, it can be seen that grape pommace has a
different composition to that of vine stem cuttings and, for this reason, these two waste types
must be precisely weighed, mixed and supplemented with nitrogen in order to be used as
appropriate culture composts for mushroom growth.
Effect of carbon source on the mycelia growth of pure cultures

In order to find a suitable carbon source for mycelia growth, and consequently for
fungal biomass synthesis, pure cultures of P. ostreatus, L. edodes and G. viride were
cultivated on different nutritive culture media containing various carbon sources. Each carbon
source was added to the basal medium at a concentration level of 1.5% (w/v) for 7-12 d
(Raaska, 1990). When the cells were grown in the maltose medium, the Fungal biomass
production was highest when maltose served as the carbon source (Table 2). What is very
important to note is that maltose has a significant effect upon the increasing of mycelia
growth and fungal biomass synthesis (Petre, 2002). The experiments were carried out for 12
days at 25 °C with the initial pH 5.5. Data are the means ±S.D. of triple determinations.
Effect of nitrogen source on the mycelia growth of pure cultures

To investigate the effect of nitrogen sources on mycelia growth and fungal biomass
production, the pure cultures of these two fungal species were cultivated in media containing
various nitrogen sources, where each nitrogen source was added to the basal medium at a
concentration of 10 g/l. Among five nitrogen sources examined, rice bran was the most
efficient for mycelia growth and fungal biomass production (Table 3). The experiments were
257
carried out for 12 days at 25 °C with the initial pH 5.5. Data are the means ± S.D. of triple
determinations.
Table 2. Effect of carbon sources on mycelia growth of G. lucidum, L. edodes and P.

ostreatus
_____________________________________________________________________
Carbon source Fresh fungal biomass Final pH
(1.5% w/v) weight (g/l)
G. lucidum L. edodes P. ostreatus G. l L. e P. o
_____________________________________________________________________
Glucose 27±0.14 41±0.05 43±0.03 5.5 5.3 5.1
Maltose 27±0.10 45±0.12 49±0.05 5.8 5.4 5.3
Sucrose 25±0.23 35±0.03 37±0.09 5.1 5.1 5.7
Xylose 26±0.07 38±0.07 35±0.07 5.3 5.5 5.9
Table 3. Effect of nitrogen source on mycelial growth of G. lucidum, L. edodes and P.

ostreatus
____________________________________________________________________
Nitrogen source Fresh fungal biomass Final pH (1%,
w/v) weight (g/l)
_____________________________________________________________________
Rice bran 37±0.10 57±0.05 73±0.23 5.5 5.5 5.1
Malt extract 36±0.12 55±0.03 69±0.20 5.3 5.2 5.7
Peptone 35±0.03 41±0.12 57±0.15 4.6 4.9 5.3
Tryptone 36±0.15 38±0.07 55±0.17 5.1 5.3 5.9
Yeast extract 37±0.21 30±0.01 61±0.14 4.3 5.1 5.1
_____________________________________________________________________
At the same time, malt extract was one of the better nitrogen sources for a high mycelia
growth. Peptone, tryptone and yeast extract are also known as efficient nitrogen sources for
fungal biomass production by using the pure cultures of such fungal species (Chang & Hayes,
1978). In comparison with organic nitrogen sources, inorganic nitrogen sources gave rise to
relatively lower mycelia growth and fungal biomass production (Bae et al. 2000).
Effect of mineral source on mycelia growth of pure cultures

The influence of various minerals on fungal biomass production was examined at a
standard concentration of 5 mg. Among the various mineral sources examined, K2HPO4
yielded good mycelia growth as well as fungal biomass production and, for this reason, it was
recognized as a favourable mineral source (Table 4).
The experiments were carried out for 6 days at 25°C with the initial pH 5.5. Data are
the means ± S.D. of triple determinations. Similar observations were made by Stamets (1993)
during experiments concerning other mushroom fermentations. K2HPO4 could improve
productivity through its buffering action, and essential phosphates were favourable for
mycelia growth in submerged as well as in surface mushroom cultures.
Effect of initial pH and temperature on fruit body formation

In order to study the effects of initial pH correlated with the incubation temperature
upon fruit body formation, G. lucidum, P. ostreatus and L. edodes were cultivated on
substrates made of vineyard wastes at different initial pH values (4.5 – 6.0).
258
Table 4. Effect of mineral sources on mycelia growth of G. lucidum, L. edodes and P.
ostreatus
_____________________________________________________________________
Mineral Fresh fungal biomass Final pH
source (5 mg) weight (g/l)
_____________________________________________________________________
KH2PO4 37±0.15 45±0.07 53±0.12 5.5 5.3 5.9
K2HPO4 45±0.07 57±0.05 59±0.07 5.1 5.1 5.7
MgSO4·5H2O 35±0.25 55±0.09 63±0.28 5.6 5.4 6.1
_____________________________________________________________________
The optimal pH and temperature levels for fungal fruit body production were 5.0-5.5
and 21-23 °C (Table 5). The experiments were carried out between 30-60 days at 25 °C. Data
are the means ± S.D. of triple determinations. To find the optimal incubation temperature for
mycelia growth, these fungal species were cultivated at different temperatures ranging from
20-25°C, and, finally, the optimum of temperature was found at 23°C, being correlated with
the appropriate pH level 5.5, as shown in Table 5.
Table 5. Effect of initial pH and temperature on fruit body formation of G. lucidum, L.

edodes and P. ostreatus
_____________________________________________________________________
Initial pH Initial temp. Final weight of fresh fruit body
O
( C) (g/kg substratum)
G. lucidum L. edodes P. ostreatus
_____________________________________________________________________
4.5 18 175±0.23 191±0.10 180±0.02
5.0 21 193±0.15 203±0.05 297±0.14
5.5 23 198±0.10 195±0.15 351±0.23
6.0 26 181±0.12 179±0.12 280±0.03
6.5 29 173±0.09 105±0.23 257±0.15
Effect of inoculum age and inoculum volume on fruit body formation

Among several fungal physiological properties, the age and volume of mycelia
inoculum may play an important role in fungal hyphae development as well as in fruit body
formation (Petre, 2002). To examine the effect of inoculum age and inoculum volume,
mushroom species G. lucidum, P. ostreatus and L. edodes were grown on substrates made of
vineyard wastes during different time periods between 30 and 60 days, varying the inoculum
volume (5-7% v/w).
As shown in Tables 6 and 7, an inoculum age of 120 h as well as an inoculum volume
of 6.0% (v/w) have beneficial effects on the fungal biomass production. All the experiments
were carried out at 25 °C and initial pH 5.5, and data are the means ± S.D. of triple
determinations.
The period of mushroom growing from inoculation to fruit body formation lasted
between 30-50 days, depending on the fungal species used in experiments. From all these
fungal species tested in our experiments, P. ostreatus was registered as the fastest growing
mushroom culture (25-30 days), then L. edodes (35-45 days) and finally G. lucidum (40-50
days). As control samples for each variant of culture composts used for the experimental
growing of all these fungal species, we used wood chops of oak and wheat straw that were
kept in water three days before the experiments and then disinfected by steam sterilization.
259
Table 6. Effect of inoculum age on fruit body formation of G. lucidum, L. edodes and P.
ostreatus
_____________________________________________________________________
Inoculum age Final weight of fresh fruit body
(h) (g /kg substratum)
_____________________________________________________________________
264 123±0.14 128±0.05 135±0.23
240 141±0.10 150±0.28 157±0.17
216 154±0.12 195±0.90 193±0.15
192 155±0.23 221±0.25 215±0.05
168 169±0.37 235±0.78 241±0.07
144 210±0.20 248±0.03 259±0.12
120 230±0.15 253±0.05 264±0.21
96 215±0.09 230±0.15 253±0.10
72 183±0.05 205±0.23 210±0.05
_____________________________________________________________________
Due to their high content of carbohydrates and nitrogen, the variants of culture
composts supplemented with wheat grains at the ratio 1:10 and rice grains at the ratio 1:5 as
well as the water content of 60% were optimal for the fruit body production of P. ostreatus
and, respectively, L. edodes. So far, lignocellulose biodegradation made by mushroom species
of the genus Ganoderma has been little studied, mostly because of their slow growth,
difficulty in culturing, as well as little apparent biotechnological potential. In spite of these
facts, some strains of G. lucidum were grown in our experiments on culture substrates made
of vine wastes and rye grains at the ratio 1:7 and a water content of 50%. Higher ratios of rye
grains might lead to an increase of total dry weight of fruit body, but also could induce the
formation of antler branches and smaller fruit bodies than those of the control samples. The
results that were achieved by using propylene bag cultures revealed that the composition of
the culture substrate had significant effects on the fruit body production as well as on
characteristic shape of the fruit bodies. The final fruit body mushroom production ranged
between 15-20 kg relative to 100 kg of compost depending on the specific strains of the three
fungal test species.
Table 7. Effect of inoculum volume on fruit body formation by G. lucidum, L. edodes and
P. ostreatus
_____________________________________________________________________
Inoculum volume Final weight of fresh fruit body
(v/w) (g /kg substratum)
____________________________________________________________________
7.0 234±0.12 215±0.20 220±0.05
6.5 245±0.15 248±0.23 251±0.20
6.0 253±0.15 257±0.07 280±0.15
5.5 243±0.12 235±0.03 247±0.07
5.0 255±0.23 215±0.15 235±0.03
_____________________________________________________________________
260
Conclusions
1. From all these fungal species tested in our experiments, P. ostreatus was registered
as the fastest mushroom culture (25-30 d), then L. edodes (35-45 days) and finally,
Ganoderma lucidum as the longest mushroom culture (40-50 days).
2. Data revealed that fungal biomass production was highest when the test strains were
grown on maltose medium.
3. Of five nitrogen sources examined, rice bran was the most efficient for mycelial
growth and fungal biomass production
4. Among the various mineral sources examined, K2HPO4 yielded good mycelia
growth as well as fungal biomass production.
5. An inoculum age of 120 h and an inoculum volume of 6.0% (v/w) were beneficial
for fungal biomass production, and optimal pH and temperature values for fungal fruit body
production were pH5.0-5.5 and 21-23° C, respectively.
6. Final fruit body mushroom production ranged between 15-20 kg per 100 kg of
compost depending on the specific strains of the three tested fungal species.
Acknowledgements
This work was supported by the Romanian Ministry of Education and Research through the
research and development project no. 4661, within the frame-work of the Biotech Program
References
Bae JT, Sinha J, Park JP, Song CH, Yun JW. 2000. Optimization of submerged
culture conditions for exo-biopolymer production by Paecilomyces japonica. J.
Microbiol. Biotechnol., 10, 482-487
Beguin P, Aubert JP. 1994. The biological degradation of cellulose. FEMS Microbiol.
Rev., 13, 25-58.
Carlile MJ, Watkinson SC. 1996. Fungi and biotechnology. In: Carlile MJ, Watkinson
SC. (Eds), The Fungi. Academic Press, London.
Chahal DS. 1994. Biological disposal of lignocellulosic wastes and alleviation of their
toxic effluents. In: Chaudry GR. (ed.), Biological degradation and bioremediation of
toxic chemicals. Chapman & Hall, London.
Chahal DS, Hachey JM. 1990. Use of hemicellulose and cellulose system and
degradation of lignin by Pleurotus sajor-caju grown on corn stalks. Am. Chem. Soc.
Symp., 433, 304-310.
Chang ST, Hayes WA. 1978. The biology and cultivation of edible mushrooms.
Academic Press, New York.
Glazebrook MA, Vining LC, White RL. 1992. Growth morphology of Streptomyces
akiyoshiensis in submerged culture: influence of pH, inoculum, and nutrients.
Can. J. Microbiol. 38: 98-103.
Kubicek CP, Messner R, Guber F, Mach RL. 1993. The Trichoderma cellulase
regulatory puzzle: From the interior life of a secretory fungus. Enzyme Microbiol.
Technol., 15, 90-98.
Lamar RT, Glaser JA, Kirk TK. 1992. White rot fungi in the treatment of hazardous
chemicals and wastes. In: Leatham GF. (ed.), Frontiers in industrial mycology.
Chapman & Hall, New York, pp127-143.
Leahy JG, ColwellRR. 1990. Microbial degradation of hydrocarbons in the
environment. Microbial Rev., 54, 305 – 315
261
Moser A. 1994. Sustainable biotechnology development: from high-tech to eco-tech.
Acta Biotechnol., 12, 2-6.
Petre M. 2002. Biotechnology for microbial degradation and conversion of plant
constituents. Didactica si Pedagogica, Bucharest.
Petre M, Bejan C, Visoiu E, Tita I, Olteanu A. 2007. Mycotechnology for optimal
recycling of winery and vine wastes. Intl. J. Med. Mushr., 9, 241-244.
Petre M, Petre V. 2006. Environmental biotechnology to produce edible mushrooms
by recycling the winery and vineyard wastes. J. Environ. Protection Ecol., (in press)
Petre M, Peng M-X, Mao L-X. 2005a. The influence of culture conditions on fungal
pellets formation by submerged fermentation of Cordyceps sinensis
(Paecilomyces hepiali) – Cs 4. Acta Edulis Fungi, 12 (Suppl.), 345-353.
Petre M, Teodorescu A, Dicu G. 2005b. The growing effect of vineyard and winery
wastes on the production of mycelia and fruit bodies of edible and medicinal fungi.
Intl. J. Med. Mushr., 7, 444-446.
Raaska L. 1990. Production of Lentinus edodes mycelia in liquid media: Improvement
of mycelial growth by medium modification. Mushroom J. Tropics, 8, 93-98.
Ropars M, Marchal R, Pourquie J, Vandercasteele JP. 1992. Large scale enzymatic
hydrolysis of agricultural lignocellulosic biomass. Biores. Technol., 42, 197-203.
Smith JE. 1998. Biotechnology. Cambridge University Press, Cambridge.
Stamets P. 1993. Growing gourmet and medicinal mushrooms. Ten Speed Press,
Berkeley, Toronto, pp390-400.
Verstraete W, Top E. 1992. Holistic environmental biotechnology. Cambridge
University Press, Cambridge.
Wainwright M. 1992. An introduction to fungal biotechnology. Wiley-Chichester.
262
Problems and Perspectives in the Production of Tuber Infected Plants

Alessandra Zambonelli, Mirco Iotti and Federica Piattoni
Dipartimento di Protezione e Valorizzazione Agroalimentare, via Fanin 46, I-40127 Bologna,
Italy. Email: zambonel@agrsci.unibo.it
Abstract
The first important step in truffle cultivation is the production of Tuber infected plants.
For this purpose, three forms of inoculum can be used: spores, infected roots or pure cultures.
It is the last of these which shows the most promise because it provides the opportunity for
selecting fungal strains with ideal infections, affinity for the host plant and adaption to the
ecological conditions, thereby optimising truffle production. Our initial experimental results
confirm that strains can vary in infectivity and host specificity. However, before this
information can be applied commercially it will be necessary to standardise the inoculation
technique, perfect the preparation of the inoculum and select the most suitable medium for
growing the cultures. In the future, it should also be possible to select beneficial fungi and
bacteria that can promote ectomycorrhizal development and fruit body formation.
Key words: Inoculation methods, Tuber mycelia, Truffle; Tuber melanosporum; Tuber
borchii
Introduction
Truffles are ascomyceteous hypogeous fungi belonging to the order of Pezizales

(Trappe, 1979; Percurdani et al.1999). They live in ectomycorrhizal association with the roots
of broad-leaved trees such as oak, linden and hazel and, less commonly, with coniferous trees
(Hall et al. 2007) in temperate forests of the northern hemisphere. There are about 200 species
of truffles grouped together in different genera, but commercially the most important is Tuber,
which includes Tuber magnatum Pico (the Italian white truffle), Tuber melanosporum Vittad.
(the Perigord black truffle or Norcia and Spoleto black truffle), Tuber aestivum Vittad. (the
Burgundy truffle) and Tuber borchii Vittad. (bianchetto). These truffles command very high
prices. For example, in 2007, a year characterised by poor harvests, the prized Italian white
truffle (T. magnatum) commanded 4500-6750 €/Kg
(http://www.albatartufi.com/pagine/18/La-borsa-del-Tartufo.html)
and T. melanosporum 700 to 1000 €/Kg (2007-2008 season). The Bianchetto truffle, a very
good species but generally modestly priced, sold for 300-400 €/K
(http://www.comune.acqualagna.ps.it/index.php?id=10741).
Because truffles are obligate ectomycorrhizal fungi, they cannot be cultivated without
the host plant which supplies the fungal mycelium with the photosynthates necessary to grow
and produce the fruiting body primordia. Attempts to cultivate truffles began in the early
1800s (Hall et al. 2007) but it was not until the discovery of ectomycorrhizal associations by
Frank in 1885 that a scientific understanding of how truffles were being cultivated was
established.
Modern methods of cultivating truffle require first the production of mycorrhizal
plants in semi-sterile or totally sterile conditions. The infected plants are then transplanted in
areas where soils and climate are suitable both for the growth of the plant and of the fungus
(Zambonelli & Di Munno, 1992). The inocula used to produce ectomycorrhizal plants are
spores, infected roots and mycelia which are hereafter summarised.
263
Spore inoculation methods
The first report concerning the attempt to use sporal inoculum to produce truffles dates
back to 1807: in a letter of Giovio to Canonico Giacomo Sacchetti states to have inoculated
seedlings with pieces of truffles in the field (Bruni, 1891). This simple method was optimised
by Italian and French researchers who scientifically showed the ability of the mycelium
deriving from spores to infect seedlings of host plants under controlled conditions (Fontana,
1967; Palenzona, 1969; Chevalier & Grente, 1978; Bencivenga 1982).
The spore inoculation technique is still the most commonly used method for producing
Tuber infected plants because of its simplicity. Sporal inoculum is obtained from fresh or
preserved ascocarps and used to inoculate sterile seedlings or cuttings of suitable host plants
(Zambonelli, 1990). This method can be successfully applied for most of the prized Tuber
species such as T. melanosporum, T. aestivum and T. borchii but not for T. magnatum because
of the difficult germination of its spores (Zambonelli, 1985; Gregori, 2002). The biggest
problem involved in this inoculation method is that operators may accidentally incorporate
less valuable species of truffle which can establish on host plants, when large quantities of
fruit bodies are used to prepare inocula. These less valuable truffles are often more infective
and, consequently, they can contaminate entire batches of plants (Pirazzi, 1994; Ferrara &
Palenzona, 2001). In this context, T. borchii, and T. maculatum can contaminate T.
magnatum inocula while T. brumale or T. indicum can ruin T. melanosporum inocula
(Tibiletti & Zambonelli, 2000). Moreover, as the mycorrhizae of these contaminants are very
difficult to identify by morphological methods, they can escape detection during quality
control prior to outplanting (Zambonelli et al. 1993, 1995, 1997, 1999). Indeed, if plants
infected with the wrong species are planted in a natural truffière, they can also contaminate
the natural producing plants, thereby causing great ecological damage. Nowadays, there is
increasing alarm about the introduction of T. indicum in Italian and French black truffle areas
by plantation of contaminated plants, with the risk to compete with and eventually replace T.
melanosporum.
Infected roots as inoculum

Alternative techniques for producing infected plants consist in the inoculation of non-
mycorrhizal seedlings with excised infected roots (Chevalier & Grente, 1973), or in putting
the roots of an infected plant in contact with sterile seedlings in a bask (mother plant
technique) (Zuccherelli, 1990). This technique exploits the ability of the mycelium to develop
from already infected roots to non-infected ones, thus spreading the mycorrhizal infection.
This inoculation method has been used extensively in the production of plants infected with T.
magnatum, which are difficult to obtain using the spore inoculation method. However, this
method requires the use of well-infected mother plants initially obtained using sporal
inoculation techniques with the consequent risk of contamination. The greatest risk with the
mother plant technique is that very competitive ectomycorrhizal fungi can be missed by the
grower and thus, becoming rapidly dominant on the root system, can finally contaminate
whole batches of plants. This is particularly the case of contaminating fungi such as Pulvinula
convexella (P Karst.) Pfister (=Pulvinula constellatio) and Sphaerosporella brunnea (Alb. &
Schwein.) Svrček & Kubička, which are common greenhouse contaminants, as well as
contaminating species also of Tuber. These fungi are difficult to distinguish, by means of
morphological methods, from the desired Tuber infections (Amicucci et al. 2000, 2001).
264
Mycelial inoculation methods
The production of infected plants by mycelial inoculation is extensively used only for
forestry purposes (Garbaye, 1991). The advantage of this inoculation method is there is no
risk of introducing contaminants with the inoculum. The method consists in isolating the
mycelium, cultivating it on a suitable medium in order to obtain the mycelial inoculum in
pure culture and using the bulked up mycelia to inoculate the medium where seedlings or
cuttings are grown.
The first attempts to isolate and cultivate Tuber mycelia in pure culture were carried
out 40 years ago (Fontana, 1968, 1971; Fontana & Palenzona, 1969; Chevalier, 1973;
Chevalier et al., 1973; Chevalier & Desmas, 1975) with the aim of avoiding the problems
associated to the production of infected plantlets using sporal or mother plant techniques.
However, due the difficulties in obtaining and maintaining Tuber mycelia in pure culture
(Iotti et al. 2002) this technique, for the moment, has no practical application; Tuber
mycelium was used extensively for producing infected plants only in the in vitro Tuber
borchii-Tilia platyphyllos model (Sisti et al. 1998), for research purposes (Giomaro et al.
2005). Only recently, after the assessment of a suitable medium for Tuber development in
pure culture, we began to develop techniques to obtain infected plants in greenhouse
conditions. We obtained the complete development of T. rufum and T. melanosporum
mycorrhizae (Zambonelli & Iotti, 2006) and, in some experiments, we also reached a very
high percentage of ectomycorrhizal infection (Zambonelli et al. 2005).
In the work reported here we tested the ability of different strains of T. borchii and T.
melanosporum to colonise the root system of three different host species, under controlled
conditions, by means of the mycelium inoculation technique.
Fungal inoculum
Pure cultures of 3 strains of T. borchii (Tbo2352, Tb98, Tbo2364) and T.
melanosporum (Tme4, Tme1, Tme3) were grown in flasks (20 flasks/strain) containing 40 ml
of modified Woody Plant Medium (mWPM), in the dark, at 22 °C (Iotti et al. 2005). Each
flask was inoculated with two plugs (∅: 0.7 cm) taken from the rim of 50-day old cultures
grown on agarised mWPM and half-strength Potato Dextrose Agar (20 g/l) (hsPDA) for T.
melanosporum and T. borchii, respectively.
On day 50, mycelia were transferred from flasks into tubes containing 20 ml of fresh mWPM
and homogenised at 12000 rpm/5 min by means of DIAX 900 homogenizer (Heidolph,
Schwabach, Germany). The mycelial suspensions obtained were added to 200 ml of sterile
peat moss and vermiculite (1:9 v/v) imbibed with 60 ml of mWPM and then incubated for 50
days at 22 °C in the dark. Finally, fungal inoculum of each strain was prepared using the
procedures described by Molina (1980).
Host plants
In Autumn 2006, seeds of Corylus avellana L., Castanea sativa Mill. and Quercus
robur L. were collected in central Italy from single plants. They were subjected to surface
sterilisation in a sodium hypochlorite solution (1%) for 5 min and stratified in sterile sand at 4
°C. One month before inoculation, seeds were washed with sterile water and put into 50 x 30
cm germination tanks containing 15 cm of peat/sand (1:1 v/v) and placed in a greenhouse at
23 °C. Before transplantation, each seedling was trimmed to stimulate root branching and
only 2-3 top leaves were left.
265
Inoculation procedure
Fungal inoculum was mixed (1:4) with a sterile substrate mixture (sand 30%, vulcanite
30%, vermiculite 40%, marble powder 15 g/l) to fill plastic pots (height: 14.5 cm; top ∅:12.5
cm; bottom ∅: 14 cm) where 3 seedlings (one for each host species) were transplanted. A 2
cm depth layer of Lightweight Expanded Clay Aggregate (LECA, ∅: 1-2 cm) was distributed
on the top and on the bottom of each pot to prevent cross-contamination with spores of
contaminant fungal species and to improve drainage. The experimental design was based on 5
replicates/strain and non-inoculated controls. For T. borchii and T. melanosporum, a further
set of 5 pots each, was prepared by means of the sporal inocula technique (after Zambonelli &
Branzanti, 1990) using 30 g of mature ascomata (6 g/pot) collected 1-2 months before
inoculation and stored at 4 °C in sterile sand.
Growth conditions and ectomycorrhizal analyses

Plants were kept in a growth room in a light:dark 12:12 h photoperiod, under cool
white fluorescent lamps (3500 lux), at 23 °C during the day and 20 °C during the night with
50-70% relative humidity. Each pot was irrigated weekly with 200 ml of desalted water.
Ectomycorrhiza formation was checked every month excising some roots from the inoculated
plants with tweezers without unpotting them.
Plantlets of T. borchii and T. melanosporum were harvested 3 and 6 months after
inoculation, respectively, in order to check the ectomycorrhizal colonisation rate. After gently
washing the whole root with tap water, 4 fine roots, 3-5 cm length, were sampled from each
seedling (one from the top, two from the middle and one from the bottom of the root) and
observed under a dissecting microscope (20 X). The degree of plant infection was calculated
considering the number of tips colonised by T. borchii over the non-colonised ones counted in
the sampled roots.
One-way analysis of variance was performed using Statgraphics Plus (1996). The data
expressed as percentages were transformed in arcsen before applying the analysis of variance.
Means of treatments were compared using Student Newman’s Keul Test.
Results
T. borchii infection
The first ectomycorrhiza formation was observed only one month after inoculation.
After three months, significant differences in the percentage of mycorrhization were observed
only for the Tb98 strain in oaks, where only 25.4% of the root tips became infected, whereas
the other two strains reached 70% of ectomycorrhizal infection and the spore inoculum 65.5%
(Table 1). Conversely, the other host plants did not show significant differences in the degree
of mycorrhization among the different strains and spore inoculation. Generally, seedlings
infected with strains Tbo2352 and Tbo2364 showed a rate of colonisation similar to that
obtained by means of the sporal inoculum, regardless of the host plant. Q. robur was the most
receptive species to Tbo2352 and Tbo2364 colonisation, whereas Tb98 was more infective on
C. sativa.
T. melanosporum infection
The first ectomycorrhiza formation was observed only 3 months after inoculation.
After 6 months, significant differences in the percentage of mycorrhization were observed
exclusively between seedlings inoculated with spores and those inoculated with mycelial
strains: the former showed mean values ranging from 46% to 61.5% for oak and hazel,
266
respectively, whereas the latter showed that only hazel plantlets inoculated with Tme3 strain
did not differ statistically from those inoculated with spores (Table 2).
Table 1 – A comparison of mycorrhizal infection on three host plants produced by three

T. borchii strains and sporal inoculation
T. borchii colonized tips (%)

Host Plants
T. borchii strains T. borchii
Tb98 Tbo2364 Tbo2352 sporal inocula
Quercus robur 25.4 a 72.0 b 73.0 b 65.5 b
Castanea sativa 31.5 a 48.3 a 41.2 a 58.0 a
Corylus avellana 13.4 a 59.3 a 41.5 a 42.6 a
Each value is the mean of 20 measurements from 5 replicates.
Different letters on the same row indicate significant differences (P < 0.05) (Student Newman
Keul’s Test).
Table 2. A comparison of mycorrhizal infection on three host plants produced by three

T. melanosporum strains and sporal inoculation
T. melanosporum colonized tips (%)

Host Plant
T. melanosporum strain T. melanosporum
Tme1 Tme3 Tme4 sporal inocula
Quercus robur 10.5 a 27.3 a 23.4 a 46.0 b
Castanea sativa 15.0 a 25.3 a 20.3 a 61.5 b
Corylus avellana 15.5 a 50.8 b 23.5 a 58.8 b
Each value is the mean of 20 measurements from 5 replicates.
Different letters on the same row indicate significant differences (P < 0.05) (Student Newman
Keul’s Test).
Discussion
Our results confirmed that it is possible to obtain infected plants using pure mycelial
cultures of Tuber species only three months after inoculation (Zambonelli & Iotti, 2006).
For the two T. borchii strains, the percentages of ectomycorrhizal infection were
similar to those obtained by spore inoculation in all host plants and only Tme3 on C. avellana
formed similar numbers of mycorrhizal root tips to those produced by sporal inocula.
The low degree of mycorrhization obtained with T. melanosporum mycelia was
probably because less than half the amount of T. melanosporum mycelium was used to
inoculate each plant than for T. borchii (data not shown). This was because T. melanosporum
cultures grow slower in vitro than T. borchii cultures (Iotti et al. 2002).
The strain Tme4 used in our work also gave better results in a previous experiment
(Zambonelli et al. 2005) when we obtained 70% of ectomycorrhizal infection. This result
strongly suggests the importance of standardizing the inoculum conditions and selecting the
ideal conditions for mycelial growth on the potting substrate.
The results obtained showed that genetic differences between Tuber strains can result
in different levels of infection and different affinities to the host plant. For example, T. borchii
strains Tbo2364 and Tbo2352 gave the highest ectomycorrizal infection on Q. robur, whereas
strain Tb98 had more affinity with C. sativa. Differences between different T. borchii strains
in colonisation effectiveness of micropropagated Tilia platyphyllos plantlets have also been
reported by Giomaro et al. (2001).
267
One of the most important advantages of the mycelial inoculation method is the
possibilty to reduce seedling production costs, avoiding the necessity of using fruit bodies.
Moreover, it opens up the possibility of selecting genetically the optimum fungal strains for
infectivity, affinity for host plant, ecological conditions, thus optimising truffle production.
However, before commercial application, it will be necessary to verify the possibility of the
isolated mycelia to produce fruiting bodies in field experiments, considering the recent
advances on truffle biology (Palocci et al., 2006). Thus, we are also perfecting a method for
inoculating a seedling contemporaneously with several strains, in order to have the possibility
of using in the future, strains of different mating types for the inoculation. Further research
will also need to standardise the methods used to prepare the inoculum, the medium for
raising the seedlings and the greenhouse conditions.
In future, when perfecting the production of Tuber infected plants, we also need to
take into consideration the possibility to inoculate selectively the soil with other
microorganisms (other fungi and bacteria) which could directly or indirectly affect
ectomycorrhizal development and fruit body formation (Hall et al. 2003). The discovery that
the bacterium Staphylococcus pasteuri, found on the roots of vitroplants of Populus alba,
inhibited the growth of T. borchii but not Hebeloma radicosum (Figure 1), another
ectomycorrhizal fungus, showed that an organism
Figure 1. Selective inhibition of the bacterium Staphylococcus pasteuri (b)

inoculated at the middle of the Petri dish
Note the strong inhibition versus T. borchii (a) but not versus the mycelium of
Hebeloma radicosum (c).
apparently unrelated to either symbiotic partner might influence the composition of the
ectomycorrhizal fungi in soil (Barbieri et al. 2005a). These and other interactions
between Tuber and associated organisms could be one of the reasons underlying the fact that
ectomycorrhizal fungi are found only in certain areas. Moreover, by means of molecular
techniques, we were recently able to increase our taxonomic knowledge on Tuber-associated
bacteria of T. borchii and T. magnatum fruiting bodies, showing that Rhizobi-like bacteria are
constantly associated to T. borchii and T. magnatum ascomata (Barbieri et al. 2005b; Barbieri
et al. 2007). The function of these bacteria is still unclear but their may play an important role
in fruit bodies formation and maturation.
Preliminary trials on Rhizobi-like bacteria isolated from Tuber ascomata and mycelia
of T. borchii showed that they do not interfere in the in vitro T. borchii development when
agar medium is used. The same strains inoculated in the potting medium of plants previously
infected with T. borchii were detected in the T.borchii ectomycorrhizal mantle with specific
PCR, six months after inoculation (unpublished data). Research is in progress to detect their
effect on mycorrhizal formation under controlled conditions.
268
References
Amicucci A, Guidi C, Zambonelli A, Potenza L, Stocchi V. 2000. Multiplex PCR for

the identification of white Tuber species. FEMS Microbiol. Lett., 189, 265-269.
Amicucci A, Zambonelli A, Guidi C, Stocchi V. 2001. Morphological and molecular
characterization of Pulvinula constellatio ectomycorrhizae. FEMS Microbiol. Lett.,
194, 121-125.
Barbieri E, Gioacchini AM, Zambonelli A, Bertini L, Stocchi V. 2005a.
Determination of microbial VOCs from Staphylococcus pasteuri against Tuber borchii
using SPME and gas chromatography/ion trap mass spectrometry. Rapid Commun.
Mass Spectrometry, 19, 3411–3415.
Barbieri E, Bertini L, Rossi I, Ceccaroli P, Saltarelli R. Guidi C, Zambonelli A,
Stocchi V. 2005b. New evidence for bacterial diversity in the ascocarp of the
ectomycorrhizal fungus Tuber borchii Vittad. FEMS Microbiol. Lett., 247, 23-25.
Barbieri E, Guidi C, Bertaux J, Frey-Klett P, Garbaye J, Ceccaroli P, Saltarelli R,
Zambonelli A, Stocchi V. 2007. Occurrence and diversity of bacterial communities in
Tuber magnatum during truffle maturation. Environ. Microbiol., 9, 2234-2246.
Bencivenga M. 1982. Alcune metodiche di micorrizazione di piante forestali con il
tartufo nero pregiato di Norcia o di Spoleto (Tuber melanosporum Vitt.).
L’informatore Agrario, 38, 21154–21163.
Bruni F. 1891. Tartufi. Hoepli, Milano.
Chevalier G. 1973. Synthèse axénique des mycorhizes de Tuber brumale Vitt. a partir
de cultures pures du champignon. Ann. Phytopathologie, 2, 163–182.
Chevalier G, Grente J. 1973. Propagation de la mycorhization par la truffe à partir de
racines excisées et de plantes inséminateurs. Ann. Phytopathologie 5, 317–318.
Chevalier G, Grente J. 1978. Application pratique de la symbiose
ectomycorhizienne: Production a grande échelle de plantes mycorhizes par la truffe
(Tuber melanosporum Vitt.). Mush. Sci., 10, 483–505.
Chevalier G, Desmas C. 1975. Synthèse axénique des mycorhizes de Tuber
melanosporum, T. uncinatum et T. rufum sur Pinus sylvestris a partir de cultures pures
du champignon. Ann. Phytopathologie, 7, 338.
Chevalier G, Grente J, Pollaksek A. 1973. Obtention de mycorhizes de différents
Tuber par synthèse à partir de spores en conditions gnotoxéniques et à partir de
cultures pures du mycélium an conditions axéniques et gnotoxéniques. Ann.
Phytopathologie, 5, 107-108.
Ferrara AM, Palenzona M. 2001. Impiego di marcatori biochimici per
l’identificazione di sporofori, miceli, e micorrize di T. indicum Cooke e
Massee. In: Proc. 5th Intl. Congress on the Science and Cultivation of Truffles. Aix-
en-Provence, France, 3-6 March 1999, FFT, Paris. pp76-77.
Fontana A. 1967. Sintesi micorrizica tra Pinus strobus e Tuber maculatum. Giornale
Botanico Italiano, 101, 298–299.
Fontana A. 1968. Miceli di funghi ipogei in coltura pura. In: Atti del I° Congresso
Internazionale sul tartufo. Spoleto, Italy, 24-25 May 1968. pp127-133.
Fontana A. 1971. Il micelio di Tuber melanosporum Vitt. in coltura pura. Allionia, 17,
19-23.
Fontana A, Palenzona M. 1969. Sintesi micorrizica di Tuber albidum in coltura pura
con Pinus strobus e pioppo euroamericano. Allionia, 15, 99–104.
Garbaye J. 1991. Utilisation des mycorhizes en sylviculture. In: Les mycorhizes des
arbres et plantes cultivées (Strullu DG. ed.). Lavoisier, Paris. pp197-248.
269
Giomaro G. Sisti D. Zambonelli A. 2005. Cultivation of edible ectomycorrhizal fungi
by in vitro mycorrhizal synthesis. In: In Vitro Cultivation of Mycorrhizas (Declerck S.
Strullu D.-G. Fortin JA. eds.). Springer, Berlin. pp253–270.
Giomaro G, Zambonelli A, Sisti D, Benedetti PA, Stocchi V. 2001. Sintesi
micorrizica di Tilia platyphyllos Scop. con cinque cloni di Tuber borchii Vittad. In:
Proc. 5th Intl. Congress on the Science and Cultivation of Truffles. Aix-en-Provence,
France, 3-6 March 1999. FFT, Paris. pp304-306.
Gregori G. 2002. Problems and expectations with the cultivation of Tuber magnatum.
In: Edible Mycorrhizal Mushrooms and Their Cultivation: Proc. 2nd Intl. Conf. Edible
Mycorrhizal Mushrooms (Hall I.R. Wang Y. Danell E. Zambonelli A. eds.).
Christchurch, New Zealand, 3–5 July 2001, CD-ROM. Christchurch, New Zealand
Institute for Crop and Food Research Limited.
Guidi G, Zeppa S, Annibalini G, Pierleoni R, Guescini M, Bufalini M, Zambonelli A. Stocchi
V. 2006. The isoprenoid pathway in the ectomycorrhizal fungus Tuber
borchii Vittad.: cloning and characterisation of the tbhmgr, tbfpps and tbsqs genes.
Curr. Genet. 50, 393–404.
Hall I, Brown G, Zambonelli A. 2007. Taming the Truffle. The History, Lore, and
Science of the Ultimate Mushroom. Timber Press, Portland, Oregon.
Hall IR, Wang Y, Amicucci A. 2003. Cultivation of edible ectomycorrhizal
mushrooms. Trends Biotechnol. 21, 433-438.
Iotti M, Amicucci A, Stocchi V, Zambonelli A. 2002. Morphological and molecular
characterization of mycelia of some Tuber species in pure culture. New Phytologist
155, 499-505.
Iotti M, Barbieri E, Stocchi V, Zambonelli A. 2005. Morphological and molecular
characterisation of mycelia of ectomycorrhizal fungi in pure culture. Fungal Diversity
19, 51-68.
Molina R. 1980. Ectomycorrhizal inoculation of containerized western conifer
seedlings. USDA Forest Service. Research. Note PNW-357.
Palenzona M. 1969. Sintesi micorrizica tra Tuber aestivum Vitt., Tuber brumale Vitt.,
Tuber melanosporum Vitt. e semenzali di Corylus avellana L. Allionia 15, 121–131.
Paolocci F, Rubini A, Riccioni C, Arcioni S. 2006. Re-evaluation of the life cycle of
Tuber magnatum. Appl. Environ. Microbiol., 72, 2390–2393.
Percurdani R, Trevisi A, Zambonelli A, Ottonello S. 1999. Molecular phylogeny of
truffles (Pezizales:Terfeziaceae, Tuberaceae) derived from nuclear rDNA sequence
analysis. Mol. Phylogenet. Evol. 13, 169-180.
Pirazzi R. 1994. Competizione tra T. magnatum Pico e T. albidum Pico nella
micorrizazione di Corylus avellana L. Giornale Botanico Italiano, 128, 400.
Sisti D, Giomaro G, Zambonelli A, Rossi I, Ceccaroli P, Citterio B, Benedetti PA.
1998. In vitro mycorrhizal synthesis of micropropagated Tilia platyphyllos Scop.
plantles with Tuber borchii Vittad. mycelium in pure culture. Acta Horticulturae, 457,
379-387.
Tibiletti E, Zambonelli A. 2000. I tartufi della provincia di Forlì-Cesena, Patron,
Bologna.
Trappe JM. 1979. The orders, families, and genera of hypogeous ascomycotina
(truffles and their relatives) Mycotaxon, 9, 297-340.
Zambonelli A. 1985. Fattori che influenzano la micorrizazione di essenze forestali
con Tuber magnatum. I contributo. Micologia Italiana, 5, 5-14.
Zambonelli A. 1990. Confronto fra diversi metodi di conservazione dell'inoculo di
Tuber spp. Micologia Italiana, 3, 23-29.
270
Zambonelli A, Branzanti MB. 1990. Competizione fra T. albidum e alcuni
basidiomiceti nella formazione di ectomicorrize su semenzali di Pinus pinea. Proc.
2nd Intl. Congress on truffle. Spoleto, Italy, 24-27 November 1988. pp247-255.
Zambonelli A, Di Munno R. 1992. Indagine sulla possibilità di diffusione dei
rimboschimenti con specie tartufigene: aspetti tecnico-colturali ed economici.
Ministero dell’Agricoltura e delle Foreste, Roma.
Zambonelli A. Iotti M. 2006. The pure culture of Tuber mycelia and their use in the
cultivation of the truffles. In: Actes du primier Symposium sur les Champignons
hypogés du Bassin Méditerranéen (Kabar L. ed.). Rabat, Morocco, 6-8 April 2004.
pp244-255.
Zambonelli A, Iotti M. Amicucci A. Pisi A. 1999. Caratterizzazione
anatomo-morfologica delle micorrize di Tuber maculatum Vittad. su Ostrya
carpinifolia Scop. Micologia Italaliana, 3, 29-35.
Zambonelli A. Iotti M. Bonuso E. Hall IR. 2005. The production of truffle infected
plants using mycelial isolates. Abstracts 4th Workshop Internacional sobre
Hongos Micorrícicos Comestibles. Murcia, Spain, 28 Nov - 2 Dec, 2005. p 124.
Zambonelli A, Pisi A, Tibiletti A. 1997. Caratterizzazione anatomo-morfologica delle
micorrize di. Tuber indicum Cooke & Masee su Pinus pinea L. e Quercus cerris L.
Micologia Italiana, 1, 29-36.
Zambonelli A, Salomoni S, Pisi A. 1993. Caratterizzazione anatomo-morfologica e
micromorfologica delle micorrize di Tuber spp. su Quercus pubescens Willd.
Zambonelli A, Salomoni S, Pisi A. 1995. Caratterizzazione anatomo-morfologica e
micromorfologica delle micorrize di Tuber borchii Vitt., Tuber aestivum Vitt., Tuber
mesentericum Vitt., Tuber brumale Vitt. Tuber melanosporum Vitt. su Pinus pinea. L.
Zuccherelli G. 1990. Moltiplicazione in vitro di cinque varietà di nocciolo e loro
micorrizazione con Tuber melanosporum. L’Informatore Agrario, 66, 51-55.
271
Mycorrhizal Research Applied to Experiences in Plantations of

Mycorrhizal Mushrooms, Especially in Central Europe
Zoltán Bratek
Eötvös University, Department of Plant Physiology and Molecular Plant Biology
H-1117 Budapest, Pázmány Péter sétány 1/C, Hungary. Email: drbratek@emsze.hu
Abstract
Experiments aimed at cultivating several valuable mycorrhizal mushrooms
have been carried out worldwide and, nowadays in some countries, it has become a
practice to establish plantations of black truffles: T. melanosporum and T. uncinatum.
It is an urgent task to avoid non-productive truffle plantations and to obtain higher
average harvest yields. To solve these problems, knowledge relating to the ecology of
natural truffieres should be applied. Last decade, in Central Europe, research on
truffle plantations was initiated. Special local climatic and pedological characters
made it necessary to apply information relating to the ecology of explored natural
truffieres to local plantations Phenologic and mycorrhizal research activity on
plantations provides knowledge about the relationship with host plants, soils,
pedology-climate, as well as the biology and life cycles of truffles. It is important to
integrate these two research trends, as we have attempted to do in this paper, in order
to make plantations more successful.
Key Words: Truffle plantation; Natural truffières; Tuber melanosporum; Tuber
uncinatum; Mycorrhization
Introduction
By the end of 1800s, it had been demonstrated that numerous mushrooms,
among them valuable culinary mushrooms, live in association with mycorrhiza-
forming higher plants. In the last century, it was already possible to produce
artificially large amounts of mycorrhized seedlings. At the same time, for the 21st
century, the persistent task that remained was to achieve stable guaranteed production
in the plantations set up with the abovementioned mycorrhized seedlings. To do this,
researchers needed to integrate results from several scientific areas since, in addition
to knowledge of mycorrhizal mushrooms and the host plants, it is necessary to
understand and follow all the effects and subsequent changes in the soil environment,
as well as in the general ecological environment. Our knowledge in these areas is only
just beginning to develop. Although the acquisition of such data has increased the
prospects for cultivating mycorrhizal mushrooms in plantations, in practical terms,
successful technologies exist only for Tuber melanosporum and Tuber uncinatum (=
T. aestivum). In Europe, plantations have been established for these two species on
more than 2000 ha yearly (Fédération Française des Trufficulteurs, 2005). Cultivated
plantations of T. melanosporum have been considerably successful, and have
compensated in large part for reduced gathering from natural truffières (Chevalier,
2007); in France, 90% of T. melanosporum production comes from cultivated
plantations. However, fructification and production in these plantations remains less
than desired (Hall et al. 2008). According to Sourzat (2001), success is guaranteed by
protecting trees and by ensuring that the mushroom colonies are grown in a
favourable environment analogous to that of natural truffières. In order to achieve this
objective, it is necessary to understand the basic ecology of spontaneous truffières as
this is the only way of imitating the conditions existing in the best natural truffières in
272
a plantation system. However, ecological knowledge obtained by French, Italian and
Spanish truffle researchers is applicable only to a limited extent in Central Europe
since the climate is more continental, and because of the different soil types that exist
there. Presumably, as a result of these differences, unique truffle biotypes have
developed which are adapted to the prevailing environmental conditions.
The purpose of this paper is to provide an insight into the research carried out
on Central European burgundy truffle plantations, using examples taken from
Hungary and the Carpathian-Pannonic region, based on descriptions of natural
truffières of valuable Tuber species.
Natural Geographical Characteristics of Hungary

Hungary is a basin of slow (rather horizontal) water streams in the Carpathian
Basin. On a European scale, the level of forestation is not too high (19%). Three
climatic effects intermingle over Hungarian territory: in most parts of the country, the
determining climate is dry and continental but, more recently, has been more sub-
mediterranean and softly atlantic. Average annual temperatures vary between 8.8 and
11.5 °C. On average, temperatures begin to fall below zero between October 5-31,
and are at or below freezing for an average of 90-130 days thereafter. Generally, the
soil becomes frozen one month after the onset of freezing temperatures and thaws one
month prior to the onset of warmer temperatures. The average annual precipitation in
the central part of the Hungarian Lowland is less than 500 mm but exceeds 800 mm in
the western areas near the Hungarian border. Hungarian territory is variable from a
pedological standpoint; the most important soil types are brown forest soils,
chernozoms, prairies soils and sandy soils (soils poor in humus).
Methods of Establishing and Maintaining Truffle Plantations

After the fall of the communist regime, the political system in Hungary was
transformed and opportunities opened up for establishing truffle plantations. Initial
attempts to create plantations were aimed at cultivating T. aestivum and T.
melanosporum, although the latter species does not grow in natural truffières in our
region. Information on cultivation technology relating to these two species was
already known from Hungarian translations of foreign publications. Most plantations
owners applied previously existing methods to produce mycorrhizal seedlings in order
to reduce costs. For example, they scattered acorns on the truffle sites, and attached
fungal spores by soaking in a homogeneous clay material mixed with the spore
suspension. The biggest Hungarian plantation (12 hectares) was established using this
method. Others chose to import seedlings from France. When selecting plantation
sites, and deciding on irrigation systems, plantation owners explored several options,
most of which were unsuitable. However, based on research at three Hungarian
universities, major progress has been made recently in cultivating truffle-inoculated
trees in containers.
Mycorrhizal, Phenologic and Ecological Investigations of Truffle Orchards

Detailed research investigations have been carried out on some dozens of
Hungarian truffle plantations. Investigating every tree in the plantations required
phenologic measurements connected with plant height as well as defining stem-base
diameters and phytosanity states. In order to define phytoindication of plants, we also
made botanical descriptions. Detailed plantation mapping based on GPS
273
measurements was carried out using the ArcView program, and comprehensive data
obtained on seedlings and on shadowing plants. These data have been included in an
Excel database that is compatible with the ArcView database. Investigation of
mycorrhizas was based on sampling and bonitation methods proposed by Gérard
Chevalier (pers. com.) and Ficher & Colinas (1996). These investigations have been
completed together with detailed pedological research relating to soil stratification
and to the chemical and physical properties of soils.
Prior to the creation of a network of experimental plantations under an INRA
(French Institute for Agronomic Research)-ELTE (Eötvös University, Budapest)
cooperation program, visits were made to almost 30 selected locations, and soil
samples were tested in the laboratory. Nine plantation sites were finally chosen and
establishment started immediately. No limestone had to be added since calcium
carbonate levels proved suitable in every case (more than 4.36%). Between 2004 and
2007, almost 3000 seedlings, prepared by the firm Robin under an INRA
mycorrhization licence, were implanted. All the host plants (Quercus spp, Pinus
nigra, Coryllus avellana and Carpinus betulus) except one (a Hungarian oak acorn)
originated from France, and we have used Tuber aestivum (T. uncinatum) inocula
from France, Italy, Spain, Sweden and Hungary. These were placed in a network (2.5
x 4), most of them situated in an east-west orientation, in some cases blocked
according to the origins of the truffles used for inoculum. The investigation was
extended to include a further three plantations established with seedlings from France
consisting of a T. melanosporum plantation in Keszthely set up in 2000 in
cooperation between Pannonic University and Pierre Sourzat, and two experimental
plantations (one consisting of T. uncinatum and the other of T. melanosporum) set up
in Jászszentandrás in 2002 with seedlings from seedling orchards of the Beaucamp
family.
Investigations of Natural Truffières

Truffles were placed into a herbarium after gathering, and cenological
descriptions and pedological data have been placed in a continually expanding digital
database (Merényi et al. 2008). Since 1992, we have accumulated coenological
descriptions obtained from numerous hypogeous mushroom habitats including 169 T.
aestivum habitats and 19 Mattirolomyces terfezioides habitats. These have been
described using the combined estimating method of Braun-Blanquet in 10 x 10 m
quadrants around truffle nests. Relative ecological indicator values as defined by
Borhidi (1993), whose system follows Ellenberg’s phytoindication system used in
Central Europe, have been attached to the plant coenological tables. Syntaxonomic
ranking of each plant society has been undertaken based on the coenological data
following Borhidi (2003), Soó (1981) and Simon (2000) or, in the case of Trans-
sylvanian ones, following Donita et al. (1992). In order to compare the effects of
habitats, data have been grouped together as follows: consideration of all species, only
arboreal, only herbs, and arboreal + herbs together, applying analysis of presence-
absence and Euklid-distance. SYN-TAX (Podani, 2001) was used for coordination.
Results
Experimental plantations
In August 2006, samples taken by Chevalier from all plantations and the
mycorrhizal controls confirmed the preservation of T. aestivum mycorrhizas (M.
Chevalier, per. comm.). In 2007, in order to study the state of mycorrhization in
274
detail, we began collecting and examining mycorrhizas on the oldest (i.e. plantations
three years old or more of the INRA-ELTE cooperation). In each case, these involved
French mushrooms on French host plants. An average mycorrhizal frequency above
50% was recorded on two of the plantations, but was below 50% on plantations with
an inland springtime inundation (Table 1). Mycorrhization data relating to the four
tree species differed significantly three years after planting in almost every case in
spite of using identical plant material and mushroom inoculum, reflecting the
importance of preliminary site selection.
Table 1. State of mycorrhization of T. aestivum (=T. uncinatum) and T.

melanosporum plantations examined in 2007.
Locality Tree species (no. of Year of Mycorrhization % Contamination

samples examined planting Average Min-max % Identified species
(deviation)
T. aestivum
Fiad Carpinus betulus (6) 2004 78.2 (6.7) 68.7-88.6 0
Fiad Corylus avellana (8) 2004 69.4 (7.9) 58.1-82.2 0
Rhizopogon cf.
Fiad Pinus nigra (9) 2004 93.5 (9.4) 71.2-100 1.8 roseolus
Fiad Quercus spp. (13) 2004 28.2 (20.3) 2.9-58.7 0
Jászszentandrás C. avellana (4) 2002 51.8 (10.7) 41.0-66.7 0
Scleroderma cf.
Jászszentandrás P. nigra (8) 2002 50.6 (29.9) 0-82.3 10.7 bovista
Jászszentandrás Quercus spp. (8) 2002 10.6 (15.3) 0-43.5 19.4 S. cf. bovista
Szilvásvárad C. betulus (8) 2004 37.1 (36.2) 1.6-90.7 0
Szilvásvárad C. avellana (8) 2004 30.0 (24.1) 2.9-68.4 0
Szilvásvárad P. nigra (8) 2004 8.2 (22.6) 0-64.2 27.5 R. cf. roseolus
Szilvásvárad Quercus petraea (9) 2004 12.6 (19.2) 0-59.8 0
Gyúró C. betulus (6) 2004 70.1 (13.1) 51.4-89.8 0
Gyúró C. avellana (8) 2004 49.1 (19.3) 28.3-85.0 0
Gyúró P. nigra (5) 2004 36.8 (23.6) 10.0-71.1 4.5 R. cf. roseolus
Gyúró Quercus petraea (10) 2004 51.8 (20.1) 19.3-86.4 0
Keszthely C. avellana (8) 2002 70.2 (30.1) 0-91.1 11.2
Tuber cf.
Keszthely C. avellana (8) 2000 56.0 (40.7) 0-92.6 33.4 mesentericum
Keszthely Quercus spp. (8) 2000 33.4 (33.2) 0-89.4 20.0 T. cf. mesentericum
Keszthely Quercus robur (4) 2000 53.5 (29.6) 10,8-79.0 0.9 T. cf. mesentericum
Keszthely Fagus sylvatica (4) 2000 41.3 (46.8) 0-88.9 32.7
Keszthely C. avellana (9) 2000 51.6 (33.7) 0-82.9 25.1
T. melanosporum
Jászszentandrás C. avellana (8) 2002 19.0 (17.5) 0-47.3 0.7
Jászszentandrás Corylus colurna (8) 2002 70.9 (14.3) 40.9-86.1 0
Jászszentandrás Quercus spp. (8) 2002 34.2 (25.8) 2.0-70.6 0
Quercus pubescens
Keszthely (8) 2000 27.8 (38.5) 0-78.6 27.5 Scleroderma sp., etc.
Data represent values obtained from an average of 8 samples (tree roots). Plantation
age varied between 3-7 years. Detected contaminants and identified taxons are also
presented.
275
When mycorrhization level and phenologic data were considered together,
different host plants proved more suitable on a site-by-site basis (Table 2).
Contamination (interestingly, mostly by Rhizopogon roseolus) was characteristic only
in the case of black pine (Table 1).
Table 2. Phenologic data of the plants of different age in T. aestivum (=T.

uncinatum) plantations and T. melanosporum plantations examined in 2007
Locality Tree species (no. of Year of Height (cm) Stem base (mm)
samples examined) planting Average Min- Average Min- max
(deviation) max (deviation)
T. aestivum
Fiad Carpinus betulus (6) 2004 46.8 (17.6) 32-81 12.5 (2.6) 10-17
Corylus avellana
Fiad (13) 2004 65.5 (22.3) 32-106 17.1 (5.0) 10-25
Fiad Pinus nigra (9) 2004 107.9 (23.6) 73-139 30.6 (4.8) 21-36
Fiad Quercus spp. (20) 2004 21.1 (10.0) 6-46 8.7 (2.9) 3-18
Jászszentandrás C. avellana (5) 2002 34.6 (12.5) 15-48 5.0 (3.0) 2-10
Jászszentandrás P. nigra (17) 2002 104.9 (37.1) 16-157 27.8 (9.5) 8-41
Jászszentandrás Quercus spp. (24) 2002 114.5 (76.8) 35-265 18.0 (12.3) 4-45
Szilvásvárad C. betulus (19) 2004 59.0 (28.5) 5-94 9.7 (3.2) 3-18
Szilvásvárad C. avellana (79) 2004 63.8 (29.1) 5-122 11.4 (4.4) 1-22
Szilvásvárad P. nigra (9) 2004 57.2 (12.5) 42-75 14.4 (4.2) 8-21
Szilvásvárad Quercus petraea (9) 2004 55.4 (18.4) 34-91 9.1 (3.0) 3-14
Gyúró C. betulus (6) 2004 68.5 (11.4) 55-83 12.7 (2.3) 10-15
Gyúró C. avellana (13) 2004 72.7 (34.4) 24-136 10.6 (4.8) 1-18
Gyúró P. nigra (5) 2004 68.6 (20.8) 41-95 16.0 (6.9) 8-25
Gyúró Q. petraea (41) 2004 47.0 (14.9) 11-76 7.4 (2.9) 3-14
Keszthely I C. avellana (15) 2002 128.5 (40.8) 22-205 18.4 (6.5) 4-31
Keszthely I C. avellana (15) 2000 256.3 (52.7) 157-360 33.3 (10.6) 6-45
Keszthely I Quercus spp. (25) 2000 152.1 (56.4) 25-230 37.7 (12.8) 7-55
Keszthely II Quercus robur (5) 2000 127.8 (60.7) 52-220 24.4 (13.0) 13-46
116-
Keszthely II Fagus sylvatica (4) 2000 179.5 (59.8) 240 25.3 (4.6) 21-31
Keszthely II C. avellana (9) 2000 212.9 (93.6) 113-380 27.1 (9.9) 12-38
T. melanosporum
Jászszentandrás C. avellana (10) 2002 155.9 (52.3) 87-230 22.8 (10.9) 9-40
Corylus colurna
Jászszentandrás (26) 2002 210.4 (70.7) 57-320 31.0 (12.7) 9-60
Jászszentandrás Quercus spp. (19) 2002 186.2 (82.9) 67-350 27.6 (14.6) 12-56
Quercus pubescens 21-
Keszthely III (25) 2000 248.0 (99.5) 86-450 57.7 (21.5) 107
Regression analysis showed that P. nigra stem height and stem base diameter
increased with increasing mycorrhization (Figure 1). This also held true for the stem
base diasmeter of more bushy C. avellana and Carpinus betulus species (F-probe,
p<0,05). This early vitalizing effect of T. aestivum was confirmed by another of our
investigations carried out on a one-year-old plantation of Quercus petraea seedlings
in the Bakony region. Measurements carried out on alternatively planted mycorrhized
and non-mycorrhized plants revealed that the height of mycorrhized plants was 21.8
276
160 160
140 140
y = 0,5876x + 50,053
2
120 R = 0,4868 120
100 100
Stem
Height base
(cm) 80 80 dia.
(mm)
60 60
y = 0,195x + 11,327
2
40 R = 0,6135 40
20 20
0 0
0 10 20 30 40 50 60 70 80 90 100 110
Mycorrhization (%)
height dia. of stem base linear (height) linear (dia. of stem base)
Figure 1. Vitalizing effect of Tuber aestivum mycorrhizas on Pinus nigra

Phenologic data relating to mycorrhization of P. nigra trees in three-year old
plantations established in Hungary under INRA-ELTE cooperation.
(± 9.2) cm (n=223) compared with 16.7 (± 6) cm (n=223) for non-mycorrhized plants.

Stem base diameters were 5.5 (± 2.1) cm and 4.2 (± 1.5) cm in the case of
mycorrhized and non-mycorrhized plants, respectively, clearly indicating that the
former were significantly more developed (paired t-probes: p<0.001). Statistical
analysis showed that the vitalizing effect of T. aestivum also occurred in the case of
plants in older plantations. Examples included plants in a 6-year-old C. avellana
plantation in Keszthely, in C. avellana and Quercus sp. plantations in
Jászszentandrás, as well as in 8-year-old Q. cerris, Q. robur, Fagus sylvatica and C.
avellana plantations in Keszthely. Substantially lower values, in most cases <30%
mycorrhizal frequency, were recorded in other plantations established with seedling
material without containers (Bratek, 2007). Mycorrhizal controls effected on all three
T. melanosporum plantations in Hungary confirmed mycorrhizal preservation. We
detected a very high average mycorrhizal frequency (>70%) on Corylus colurna
seedlings in one of the plantations with light, consistent, sandy soils. Regression
analysis of phenological data proved that, in the case of all three host plants in T.
melanosporum plantations in Jászszentandrás, height and stem base diameter were
dependent upon the rate of mycorrhization (F-probe, p<0.05), confirming the
vitalizing effect of T. melanosporum. This effect was not apparent in the case of 2-
year-old Quercus pubescens inoculated with T. melanosporum (at Keszthely),
presumably due, in part, to the high level of contaminating species. Interestingly, in
one plantation (Jászszentandrás), the mycorrhization rate and phenological
characteristics of oak and nut seedlings mycorrhized with T. melanosporum was
significantly higher compared with those mycorrhized with T. aestivum originating
277
from the same seedling orchard (F. Beaucamp) indicating, at this site at least, the
better vitalizing capacity of T. melanosporum. Similar results were obtained when T.
aestivum mycorrhized oaks planted in 2000 on the first and second sectors of the
plantation in Keszthely were compared with T. melanosporum mycorrhized Q.
pubescens seedlings also planted in 2000 at the same locations (t-probe, p<0.001).
However, the origin of the plant material in this case was quite different. Considering
the unusually mild winters in recent years, and the excellent mycorrhization and
vitalizing capacity described above, it is not unreasonable to expect that Hungarian
plantations will produce Perigord truffles.
Distribution and Ecology of Valuable Truffle Species

Burgundy or Summer Truffle (Tuber aestivum Vitt. /T. uncinatum Chatin)
Pedological and botanical aspects of some T. aestivum habitats in the
Carpathian Basin, together with their distribution, were reported by Bratek & Halász
(in Chevalier et al. 2005) and by Bratek (2007). When examining soils in T. aestivum
habitats, it was possible only to determine the physical type of the soil. On the basis
of this more easily assigned soil characteristic, 94 soil samples were separated into the
following types: 66/heavy clay, 19/clay, 7/clay-silty, and 2/silty. In terms of pH, soils
were slightly alkaline, neutral or slightly acid with an average pH value of 7.17
(±0.34). Soil pH data agreed with the soil reaction as indicated by the soil flora.
Humus values varied between 2.76 and 10.8%. Low (5-8%) or trace (0.1-5%)
carbonate values were characteristic of most soils. Phosphate levels varied widely,
exceeding 36mg/100g in 36% of the samples tested. The majority (91%) of samples
fell into the category of very high potassium levels (>36mg/100g).
Comparison of the flora of T. aestivum habitats (sites) and coordination using
SYN-TAX 2000 distinguished three well-separated groups in relation to woody plants.
Group I included habitats with a dominance of Carpinus betulus, Group II included
habitats with a dominance of Quercus robur, while Group III included habitats with a
dominance of Quercus cerris. In case of T. aestivum, the 169 habitats described
belong to 23 associations. The majority of these (66, 39.1% of the total) were
definable as mountainous Carici pilosae-Carpinetum associations. Nineteen sites
(11.2% of total) belonged to Acer campestri-Quercetum, and other sites
constituting >5% of the total were Quercetum petraeae-cerris, Quercetum petraeae-
cerris, and Melampyro bihariensi-Carpinetum associations.
Italian White Truffle (Tuber magnatum Pico)

This species grows sporadically in Hungary which, judging by the small
quantity of small sized fruiting bodies found, may be the northern limit of its
distribution. The gathering season extends from the end of September to the
beginning of December although the main season is normally said to be over by the
end of October. The habitats of this species are situated in the southern part of the
country, mostly in gallery forests of the Danube and Drava flood plain, where a
Mediterranean climate prevails. The 11 truffières investigated were separable into the
following associations: Circaeo-Carpinetum (5), Knautio drymeiae-Ulmetum (4),
Carici pilosae-Carpinetum (1) and Carpecio abrotanoidis-Carpinetum (1). Among
these, seven belonged to the Carpinion betuli association group and four to the Alnion
incanae (hardwood gallery forests) group. All of them can be assigned to the Fagetalia
sylvaticae order, and to the Querco-Fagetea class (European broad-leaved forests). In
some of the well-known habitats, the soils are slightly alkaline with high humus levels
and varying CaCO3 content.
278
Smooth Black Truffle (Tuber macrosporum Vitt.)
For the most part, habitats of this species in Hungary are found in waterstream
valleys and river banks, mostly in areas that are temporarily flood affected. Of the 45
habitats investigated, 23 belonged to the Melampyro bihariensi-Carpinetum
association, six to the Carici pilosae-Carpinetum association, and five to the Carici
brizoidis-Quercetum association. Attempts are underway in Hungary to develop the
cultivation technology for this truffle; the species could play an important role in the
forestation of flood basins. The fructification season in Hungary lasts from September
to February. Soils required by this species are characterized mainly by high clay
content, neutral pH, little or no calcite content and high humus levels. This mushroom
is highly appreciated by consumers due to its outstanding organoleptic properties.
Winter truffle (Tuber brumale Vitt.)

This species is characteristic of forests of the Hungarian Plain and the shaded
valleys of hilly and mountain areas. Of 105 investigated habitats, 50 belonged to
Carici pilosae-Carpinetum, 15 to Circaeo-Carpinetum, 13 to Aceri campestri-
Quercetum roboris, and nine to Melampyro bihariensi-Carpinetum associations. Clay
soils with high humus levels and little or no calcite content, as well as soils of around
neutral pH, meet best the requirements of this species. Similarly to T. aestivum, this
species requires relatively defined growth conditions but is slightly more tolerant with
regard to pH (Bratek et al. 2001). The fruiting season in Hungary lasts from October
to March, and it is highly appreciated due to its very fine aroma. It as not been highly
commercialized due to the small fruit body size.
Discussion
Rezső Bokor, working in Hungary, was among the first researchers worldwide
to produce mycorrhiza using a pure fungal culture (Bokor, 1954). In 1970, the INRA
laboratories at Clermont-Ferrand in France produced seedlings mycorrhized with
truffles, and the first T. melanosporum fruit bodies appeared in 1977 on four-year
experimental Corylus colurna seedlings. Two years later, seedlings inoculated with T.
uncinatum and T. mesentericum also began to fructify on a plantation in Meuse
County. Chevalier (2007) proposed a practice for the optimal use of mycorrhized
seedlings throughout Europe: intensive previous control of potential habitats, with
subsequent selection later, based on climatic and microclimatic properties, as well as
on physical, chemical-analitic and biotic features of the soils; preparation of plants
mycorrhized with truffles using, where possible, host trees and local truffles best
adapted to the habitat; implantation of seedlings after mycorrhization control. Initially,
priority should be given to creating conditions favorable for preservation and
mycorrhization, and then to create conditions favorable for fructification.
Dry conditions lasting for more than three weeks betwen May and September
adversely affected T. aestivum production (Beaucamp, 2001; Urban & Mader, 2003).
Beaucamp suggested that extreme precipitation during springtime had a negative
effect, while Urban & Mader (2003), after analyzing a comprehensive database for
twenty years were unable to confirm this effect in habitats having soils with suitable
water capacity in lowland parts of Austria. However, they identified a two-year
production cycle caused by endogenous factors. The burgundy truffle harvest could be
predicted from the amount of precipitation falling on these habitats during the winter
semester since this quantity was important relative to the summer half-year, filling up
the soil water stocks and (like snow) protecting the soil from freezing.
279
Due to damage caused by freezing weather, seedlings from France raised on
Hungarian plantations died at a markedly high rate in spite of heavy pruning. Oak
seedlings especially were very sensitive to frosts that often occurred in Hungary in
late spring. Native oaks have foliage outgrowth only in May. Macku (1957) also
reported very serious frost damage in a T. melanosporum plantation with seedlings
from France which has been established in 1913 in Moravian Karst.
More extreme meteorological conditions in the future, including higher
temperatures and drier summers, more unequal precipitation distribution and colder
winters (Bratek, 2008), will impact on truffle cultivation (Chevalier, 2007; Chevalier
& Wehrlen, 2008). These changes will initiate species wandering: T.
melanosporumorll move northwards where appropriate soils should be available
(Chevalier, 2007). This wandering phenomenon has already been detected on
Hungarian territory in the case of T. magnatum which has more specific soils
requirements (Bratek, 2008). The genetic variability of the aforementioned species
appears to weak, so climate change might even reduce their distribution. Presumably
there is no danger of this in the case of T. uncinatum (T. aestivum) which is
genetically the most variable and distributed all over Europe. These future changes
raise many problems. First, we should mention irrigation (the supply of water
requirements) at appropriate periods, taking into account climatic and pedological
data of the habitats. Soil covering is also a useful technique to avoid drying and
freezing. It is acceptable to apply host plants which tolerate drier conditions. Oak
species such as Quercus ilex and Q. pubescens are very sensitive to frost. In the case
of the burgundy truffle, some pine species (e.g. Pinus nigra, Cedrus atlantica) that
also tolerate alkaline soils yield much greater harvests in dry years compared to trees
with higher water requirements (Chevalier, 2007).
In the case of Gotland Island (Sweden), habitats can be separated into groups
only according to Quercus robur and C. avellana, the two dominating arboreal plants
(Wedén & Danell, 2007). Most plants associations in the Carpathian-Pannonic region
in which T. aestivum occurred belonged to the mesophilic, leafy forest (Querco-
Fagetea) syntaxonomic class, although this mushroom also occured in plant
associations belonging to the class of submediterranean and subcontinental
xerothermal forests (Quercetea pubescentis). As a result of species wandering caused
by climate change involving Hungary, xerothermal forests will probably occupy more
and more territory in the future while, at the same time, mesophilic forest limits will
extend to northern parts of the country. Therefore, this mushroom will presumably
find favorable growth conditions in Hungary for a long period. In France, in
accordance with the Carpathian-Pannonic region, T. uncinatum can frequently be
encountered within Carpinion betuli (sub-Atlantic and medio- European oak or oak-
hornbeam forests) associations; French habitats are often secundary and quite
different physionomically. Habitats with meso-xerophilic vegetation are less common.
Secundary mesophilic bushy forest associations, forest edge associations and, less
frequently, neighbouring grassy areas, often supply truffle sites (Chevalier et al.
2005). No additional basic coenological information relating to this species is
available from other countries.
For T. melanosporum, a light, airy soil is important. Seedlings mycorrhized
with T. melanosporum planted in too heavy clay soils do not generate fruit bodies,
while T. brumale or T. uncinatum fruit bodies may be produced unexceptedly. The
presence of calcium carbonate can compensate for clay levels that are too high
(Chevalier, 2007). Soils of spontaneous (wild growing) truffières are often poor in
phosphorus and sometimes even potassium. If a truffière is located in an area of rich
280
soil, yields are often low. There appears to be a correlation between rapid tree growth
due to the productive soil and small fruit body size (Chevalier, 2007). The presence of
lime, or more precisely the calcium content, is important for T. melanosporum.
Contrary to Ricard (2003), Ca2+ content cannot predict the truffle potential of the soil.
Chevalier (2007) reported that the optimum calcium content for truffle production
varies according to the physical features (types) of the soil: the more heavy the soil,
the more calcium is required, while less calcium is required for more lighter (more
sandy) soils. The importance of Ca is also evidenced by the fact that truffles grow on
previously acidic soils following calcification. This has been reported in New Zealand
(Hall & Zambonelli, 2005), in the United States (Garland, 2001), and also in France
where Limousin truffles grew on soils developed with mica with an initial pH value of
5.0 (Chevalier, 2003). T. melanosporum has a much higher requirement for Ca than T.
uncinatum (Chevalier, 2007). Otherwise, Burgundy truffles grow in all European
countries.
Carpathian-Pannonic ecotypes of T. uncinatum adapted better to soils
containing less lime compared to Lorrain or Burgundy ecotypes, which practically
never occurred in soils with low lime levels. Carpathian-Pannonic ecotypes were also
reported to adapt better to more compact, clay soils than the Gotland ecotype which is
well adapted to silty-sandy soils and to a fresher climate (Wedén & Danell, 2007).
However, there are large areas of sandy forests in Hungary yet this mushroom seldom
occurs in these forests. This fact appears to refute the statement of Wedén & Danell
(2007) that the burgundy truffle has a wide soil texture tolerance and that differences
in sites where this truffle is found simply reflect regional geology.
Along with much earlier authors (De Bosredon, 1887; Pradel, 1914), Callot et
al. 2001 emphasized the role of the undersoil for truffle production, and drew
attention to the importance of cracked subsoils since they allowed the roots of host
trees to penetrate more deeply in order to seek water and nutrients.
It was observed very early on that, in many cases, the truffle species appearing
on inoculated plants was different from that used in the initial inoculation (Chevalier,
1983). In terms of mycorrhizal competition, the most effective species against T.
melanosporum are T. brumale, T. uncinatum and T. mesentericum. It has long been
recognised that the mycorrhizal state of earlier flora and the flora of the surroundings
are important in determining the nature of these competitive states (whether or not
these flora are AM- or EKM-formers) (Chevalier, 1983), as well as the relationship
between competitive species and root growth rhythm (Chevalier et al. 1982; Chevalier
1983). Nowadays, it is possible to undertake a preliminary competitor analysis by
identifying the mycelium of potentially competitive species in the soil using DNA-
based techniques. This is especially important when renovating older truffières.
According to Chevalier (2001), three generations of seedlings have been
produced in France in large quantities: the first generation (l973-l983) comprised
seedlings grown in decontaminated soil of truffières, and in traditional containers; the
second (1983-1993) was grown in Melfert-containers, and on artificial substrates; the
third (from 1993 to the present) is the generation of seedlings grown in roots “anti-
bun” barred containers with artificial substrate. Nowadays, high quality seedlings are
produced by firms using the INRA licence (Agri-Truffe Association, Pepinières
Robin) and 100% of the seedlings are mycorrhized (Chevalier, 2007). Fructification
of seedlings mycorrhized using the INRA procedure was reported in the US in the
early ’80s, in 2005 in Sweden, and in 2007 in Morocco. Mycorrhization of clones
(plant material obtained by vegetative propagation) was first effected in 1978 using
oak clones originating from root offsprings and later with micro-propagated plants
281
(Boutekrabt et al. 1990; Guinberteau et al. 1990). Research in this area has since
slowed due to a lack of resources (Chevalier, 2001, 2007). Chevalier (2007) reported
positive results from Pepinières Robin involving 15 experimental parcels of Quercus
pubescens clones. Vegetative development of these clones was superior compared
with traditional seedlings, and the “brulés” appear earlier and were produced in
significantly greater numbers. Clones also offer excellent test material for research
aimed at distinguishing those factors (host plant, truffle, soil) affecting production.
Oaks, especially green oaks (Quercus ilex), currently play an important role in
the cultivation of T. melanosporum. Green oaks begin fructifying when just three and
a half years old, and fructification is more balanced and less disposed to
contamination. Tilia species and C. colurna are also used. Quercus species, C.
avellana and Carpinus betulus are the determining species for T. uncinatum
cultivation. After repeated summer dry periods, Pinus nigra austriaca and Cedrus
atlantica are used more and more frequently. Species that are seldom applied,
although they ensure good production, are C colurna, Ostrya carpinifolia and Fagus
sylvatica.
Since the beginning of the last century, a continual decrease in truffle
production was observed in this area, due initially to agricultural mechanization since
tractors made the soils more compact (Chevalier, 2007). Old trufflers cultivated only
truffle-productive terrains with appropriate means, and thereby obtained excellent
results (Pradel et al. 2007). Truffle behaviour is symbiotic at the beginning of the life-
cycle but later becomes saprobiontic. In the symbiotic phase, the mushroom
stimulates the growth of the young seedlings by initially assisting the plant to take up
mineral nutrients, and by increasing resistance to lime (biocalcinogenic effect).
Mycorrhized seedlings may be up to three times taller than non-mycorrhized
(Chevalier, 2007). In the saprobiontic phase, truffles take up nutrients from older or
dead parts of the root system especially from tannins (see Pargney, in Pradel et al,
2008); truffles are not produced when these root elements disappear. This explains
why trees standing alone and with widening smooth roots continually produce
truffles, whereas the truffle harvest from plantations significantly diminishes or
disappears when the brulés meet. Therefore, it is important to develop cultivation
techniques that allow regeneration of the root system. Preventing development of tree
roots (by furrowing a groove at the front of root systems, or by planting grass) may
also be advantageous because roots that grow too rapidly may become contaminated
with other mushrooms (Chevalier et al. 1982). According to Sourzat (2002), the
velocity of mycorrhization is 20-30 cm yearly, but mycorrhization may also be
delayed due to faster root growth. He introduced several new concepts including
truffle virulence which, in his view is the brulé. A correlation exists between the
development of trees and brulés, and truffle production. Sourzat considers in detail the
concept of coexistent mushrooms, with those “successive” mushrooms which precede
or follow the truffles. Relationships between mushrooms are complicated; some may
be synergic, others antagonistic or indifferent. On the truffière stage, truffles are only
one of the “actors”, and not the most energetic (Chevalier, 2007). Truffières are
complicated and delicate ecosystems and, therefore, it is essential to pay more
attention to the ecology of the cultivation process. Intensive cultivation methods or
sylviculture solutions can result in failures. For example, although the intensive
Pallier method rapidly ensures good production, it exposes large areas to
contaminating species and should be removed from cultivation practices. The purpose
of Tanguy’s method is to cultivate truffles on calcicole grasses, with no intervention
before the truffles fructify, and has the advantage of limiting the incidence of
282
“contaminating” species However, a major disadvantage is that fructification occurs
only after 10-12 years. The J.A.A.D method (Pradel et al. 2007) involves
differentiated cultivation in productive and non-productive zones. One cultivates the
zone before fructifying, while cultivation is carried out manually in the productive
zone. This method realised excellent results the Marches area (Ascoli Piceno region)
of Italy. Experimentation is underway to develop machines capable of substituting
manual labour with the “bigo” (two-toothed fork) in productive zones. If necessary,
well-aerated soils are ensured by with adding sand, gravel (fine mixture) and lime.
This so-called integrated model (using traditional and valuable new approaches to
cultivation) has proved very popular and promising in Italy (Gregori, 2008).
In addition to Hungary, established Central-European truffle orchards in
Austria and Slovenia should be mentioned. However, the majority of these are not
experimental plantations or, if they are, only preliminary results have been reported so
far (Urban & Pla, 2007; Grebenc et al. 2007). In establishing additional truffle
orchards, the priority may be to imitate samples of natural habitats about which there
is sound information acquired through earlier research activity carried out in the
countries of the region concerned. At the same time, cooperation at an international
level in the field of applied and basic research is very necessary in order to integrate
research teams into European/international research programmes. This has already
occurred in the case of several research institutes, universities and firms from our
region which have joined CRETT (Consortium en Réseau Européen Truffe et
Trufficulture). After the regime changes that have taken place in several countries of
our region, mainly small and medium size farmers began cultivating agricultural land
in place of the big enterprise systems seen in socialist agriculture. In these countries,
people also became interested in opportunities for alternative land use including
truffle cultivation. Extension of truffle orchards all over the region can play a part in
promoting areas which are economically and socially underdeveloped, and will allow
the formation of landscapes that are harmonious with nature. At the same time, it
ensures the possibility of utilizing low productivity fields.
As for the near future, the two big challenges facing truffle production in
Central-Europe are to stop further despoiling of natural habitats, and to integrate
truffle cultivation into the overall agriculture of our region.
Acknowledgements
My thanks to Mr. Zoltán Illyés, Mr. Béla Drescher and Mrs. Dr. Sára Brandt for data
analysis, Professors Tibor Simon and János Podani for their kind cooperation in
evaluating the floral data, and Drs Lajos Bacsi and István Kamoncza for translating
the manuscript into English. This work was supported by a project under the Ányos
Jedlik Programme entitled MIKOQUAL.
References
Beaucamp B. 1999. Etude des correlations entre la productio de truffes (T. uncinatum
Chatin) et les précipitations dans trois truffières naturelles de Bourgogne.
Actes du Ve Congrès International, Science et Culture de la Truffe et des
autres Champignons Hypoges Comestibles. 4 au 6 Mars 1999, Aix-en-
Provence, France, Federation Française des Trufficulteurs pp.188-190.
Bokor R. 1954. A mykorrhiza-gombákkal történő talajoltások új agrotechnikai
eljárása. (New agrotechnic procedure for soils inoculation with mycorrhizal
mushroom.) Erdészeti Kutatások, Budapest, vol. 11. p. 27-45.
283
Borhidi A. 1993. Social behaviour types of the Hungarian flora, its naturalness and
relative ecological indicator values. JATE 1993, Pécs, pp.1-93.
Borhidi A. 2003. Magyarország növénytársulásai (Plants associations in Hungary),
Akadémiai Kiadó, Budapest.
Boutekrabt A, Chevalier G, Pargney JC, Dexheimer J. 1990. Mycorhization par Tuber
melanosporum de vitroplants de Quercus robur et pubescens. Agronomie, 2,
127-132.
Bratek Z, Király I, Láng F. 1992. R-spectra of some hypogeous mushrooms.
Micologia e Vegetazione Mediterranea, 7, 95-102.
Bratek Z, Jakucs E, Bóka K, Szedlay G. 1996. Mycorrhizae between black-locust
(Robinia pseudoacacia) and Terfezia terfezioides. Mycorrhiza, 6, 271-274.
Bratek Z, Rudnóy S, Parádi I. 1998a. Artificial mycorrhizal infection of black locust
(Robinia pseudoacacia) by Terfezia terfezioides under greenhouse conditions.
2nd Intl. Conf. Mycorrhizae. July 5-10, Uppsala (Sweden), Abstract p.33.
Bratek Z, Rudnóy S, Parádi I, Láng F. 1998b. Natural habitats and preliminary
studies on cultivation of Terfezia terfezioides. 6th Intl. Mycological Congress
Jerusalem (Israel), August 23-28, Abstract p.161.
Bratek Z, Bagi I, Parádi I, Vikor J. 2001. Differentiation among truffle species based
on habitat preferences. Actes du Ve Congrès International, Science et Culture
de la Truffe et des autres Champignons Hypoges Comestibles. 4 au 6 mars
1999, Aix-en-Provence, France, Federation Française des Trufficulteurs
pp.4.193-195.
Bratek Z, Halász K. 2005. A Tuber aestivum Kárpát-medencei termőhelyei. (Tuber
aestivum habitats in Carpathian Basin) In: Chevalier G., H. Frochot, Bratek Z.
(szerk.): Az európai fekete szarvasgomba (Burgundi szarvasgomba – Tuber
uncinatum Chatin) (The European black truffle /Burgundy truffle – Tuber
uncinatum Chatin), Első Magyar Szarvasgombász Egyesület, Budapest,
pp.228-238.
Bratek Z. 2007. Truffes et plantations à vocation truffière en Hongrie. In Actes du
colloque. La culture de la truffe dans le monde. Brive-la Gaillarde, France - 2
Février, pp.95-109.
Bratek Z. 2008. Les effets du changement climatique sur les champignons hypogés,
sur le genre Tuber en Hongrie. In Actes du colloque. La culture de la truffe
dans le monde. Menerbes, France - 2 (In press)
Callot G, Daignieres Y, Fernandez D, Raymond M, Salducci X. 2001. Incidences du
sol sur la production de truffes noired de Périgord (Tuber melanosporum).
Actes du Ve Congrès International, Science et Culture de la Truffe et des
autres Champignons Hypoges Comestibles. 4 au 6 mars 1999, Aix-en-
Provence, France, Federation Française des Trufficulteurs, pp.257-258.
Chevalier G. 1983. Production de truffes à partir de plants mycorhizés selon le
procédé I.N.R.A.: premiers résultats. Bulletin F.N.P.T., 6, 33-50.
Chevalier G, Giraud M, Bardet MC. 1982. Interactions entre les mycorhizes de Tuber
melanosporum et celles d'autres champignons ectomycorhiziens en sols
favorables à la truffe. In: Les mycorhizes, partie intégrante de la plante:
biologie et perspectives d'utilisation. Gianinazzi S et Gianinazzi-Pearson V
(Eds). Les colloques de l'I.N.R.A., 13, 313-321
Chevalier G. 2001. Du congrès de Spoleto à celui d’Aix-en-Provence: les avancées en
matière de recherches sur la truffe et la trufficulture en France. Actes du Ve
Congrès International, Science et Culture de la Truffe et des autres
284
Champignons Hypoges Comestibles. 4 au 6 mars 1999, Aix-en-Provence,
France, Federation Française des Trufficulteurs, pp.11-15.
Chevalier G. 2001. Des truffes dans le limousin! Le trufficulteur français. 43, 9.
Chevalier G, Frochot H, Bratek Z. 2005. (szerk.), Az európai fekete szarvasgomba
(Burgundi szarvasgomba – Tuber uncinatum Chatin) (The European black
truffle /Burgundy truffle – Tuber uncinatum Chatin), Első Magyar
Szarvasgombász Egyesület, Budapest, pp.1-266.
Chevalier G. 2007. La trufficulture en France vers une nouvelle méthode de culture.
In: Actes du colloque. La culture de la truffe dans le monde. Brive-la
Gaillarde, France, 2 Février. pp.59-77.
Chevalier G. Wehrlen L. 2008. Comment lutter contre les effets du réchauffement
climatique sur la truffe? In: Actes du colloque. La culture de la truffe dans le
monde. Menerbes, France – 2. (In press).
De Bosredon A. 1887. Manuel de Trufficulteur, Laporte, Périgueux, 237pp.
Donita N, Ivan D, Coldea Gh, Sanda V, Popescu A, Chifu T, Pauca-Comanescu M,
Mititelu D, Boscaiu N. 1992. Vegetatia Romaniei, Technica Agricola,
Bucuresti.
Ficher C, Colinas C. 1996. Methodology for certification of Quercus ilex seedlings
inoculated with Tuber melanosporum for commercial application. 1st Intl.
Conf. Mycorrhizae. Berkeley, USA.
Fédération Française des Trufficulteurs. 2005. L’impact socio-économique de la
trufficulture sur le développement local. FFT, Paris, pp. 1-40.
Garland C. 2001. Growing T. melanosporum under adverse acid soil conditions in the
United States of America. Actes du Ve Congrès International, Science et
Culture de la Truffe et des autres Champignons Hypoges Comestibles. 4 au 6
mars 1999, Aix-en-Provence, France, Federation Française des Trufficulteurs,
p.393.
Grebenc T, Martin MP, Piltaver A, Ratosa I. 2007. Research and cultivation of
truffles in Slovenia – current status. In: Actes du colloque. La culture de la
truffe dans le monde. Brive-la Gaillarde, France - 2 Février, pp.183-191.
Gregori G. 2008. Trufficulture en Italie: expériences, problèmes et solutions
possibles. In: Actes du colloque. La culture de la truffe dans le monde.
Ménerbes, France - 2 (In press).
Guinberteau J, Salesses G, Olivier JM, Poitou N. 1990. Mycorhization de vitroplants
de noisetiers clonés. CR. IIème Congrès intern. sur la truffe , Spoleto, 24-27
novembre 1988, pp205-210.
Hall IR, Zambonelli A. 2005. Cultivation of truffles on acidic soils. IV. International
Workshop Edible Mycorrhrizal Mushrooms. Murcia. Spain. 28. Nov. - 2. Dec,
Abstracts, p69.
Hall IR, Brown GT, Zambonelli A. 2008. Taming the truffle. The history, lore, and
science of the ultimate mushroom. Timber Press, Portland, OR, USA, 304pp.
Macku J. 1957. Tuberikultura v CSR. Ceská Mykol. Praha, 11, 138-145.
Merényi Z, Pintér Z, Orczán ÁK, Illyés Z. 2008. A kárpát-medence földalatti
gombafajainak biogeográfiai és ökológiai kutatása számítógépes adatbázisok
létrehozásával és integrálásával. (Biogeographical and ecological research of
hypogeous mushrooms in Carpathian Basin by establishing and integrating
computational database.) Mikologiai Közlemények Clusiana (In press).
Pradel L, 1914. Manuel de trufficulture. Guide pratique. Ed. J.B. Baillière, Paris, 154
pp.
285
Pradel L, Dessolas H, Chevalier G, Pargney JC. 2007. Nouveau manuel de
trufficulture. Ed. mise en page/ H. Dessolas, Périgueux, 316pp.
Ricard JM. 2003. La truffe. Guide technique de trufficulture. Ed. C.T.I.F.L., Paris,
268pp.
Simon T. (2000): Magyarország edényes flóra határozója. (Determination book on
vesicular flora in Hungary) – Nemzeti Tankönyvkiadó, Budapest.
Soó R. 1981. Magyar flóra és vegetáció rendszertani-növényföldrajzi kézikönyve VI.
(Taxonomic and biogeographical handbook of the Hungarian flora and
vegetation.) – Akadémiai Kiadó, Budapest.
Sourzat P. 2001. Evolutions techniques et écologiques de la trufficulture en France
et plus particulièrement dans le département du Lot. Actes du Ve Congrès
International, Science et Culture de la Truffe et des autres Champignons
Hypoges Comestibles. 4 au 6 mars 1999, Aix-en-Provence, France, Federation
Française des Trufficulteurs, pp2.55-56.
Sourzat P. 2002. Guide pratique de trufficulture, 4ème éd., L.E.P.A. Cahors-le-
Montat.
Podani J. 2001. SYN-TAX 2000. Computer programs for data analysis in ecology
and systematics. User’s manual. Budapest. Scientia.
Ricard JM. 2003. La truffe. Guide technique de trufficulture. Ed. C.T.I.F.L. Paris
268pp.
Urban A, Mader A. 2003. Über Trüffelvorkommen (Tuber aestivum) im südlichen
Niederöstereich: Einfluss des Niederschlags auf die Fundmenge. Austrian J.
Mycology, 12, 193-204.
Urban A, Pla T. 2007. Truffles and truffle cultivation in Austria. In Actes du
colloque. La culture de la truffe dans le monde. Brive-la Gaillarde, France - 2
Février 2007. pp19-34.
Wedén C, Danell E. 2007. Truffle cultivation in Sweden. In Actes du colloque. La
culture de la truffe dans le monde. Brive-la Gaillarde, France - 2 Février 2007.
pp193-207.
286
Occurrence of Ectomycorrhizal Mushrooms in Disturbed Forest Stands
M. Pavlik
Technical University of Zvolen, T.G.Masaryka 20, Zvolen 96053, Slovak Republic. Email:
mrtnpavlik@yahoo.com
Abstract
The occurrence of ectomycorrhizal, saprophytic and parasitic fungi is a natural

requirement for the existence of a forest, and the percentage of fungi species from these
ecological groups depends on the forest status, its health, age and growing conditions. Forest
stands disturbed by various injurious agents (air pollution, wind, snow, insects, drought, or
clear cutting) are weakened, and the spectrum of fungal species is greatly modified. This
research is oriented towards investigating the changes in the spectrum of macromycetes,
especially to the share of ectomycorrhizal mushrooms, under conditions of disturbed forest
stands, and is aimed at the most widespread tree species in Slovakia, the beech. Preliminary
results show a significant decline of ectomycorrhizal fungi species in disturbed forest areas.
Key Words: Ectomycorrhizal mushroom; Disturbed forest stand; Forest management; Forest
ecosystem; Biocycling
Introduction
Fungi are a natural and non-replaceable component of nature and their place and role
in forest stands depend on their various lifestyles. The rapid decrease in the health status and
stability of Slovak forests is connected with changes in the spectrum of macromycetes within
these forests. All the damage to forest stands caused by biotic or abiotic factors is attended by
changes in fungi species composition. Otherwise, changes in the proportion of mycorrhizal,
saprophytic and parasitic fungi species lead to changes in the health status, resistance and
stability of forest stands. Parasitic fungi are regarded as harmful, but their ability to eliminate
weak and non-perspective trees from the forest stand is very useful. Fungi are the natural
selectors of the strongest and the most perspective trees, and they appoint a time for the
restoration of exhausted forest stands. Saprophytic fungi are the decomposers of dead plants
and animal bodies. They are the main recyclers in nature, and soil formation is the principal
result of their activity. Mycorrhizal fungi and mycorrhizal symbiosis are the essential
components of healthy and stable production forests. Active and fully functional mycorrhizal
symbioses provide protection and nutrition for forest trees, and increase their ability to resist
harmful agents.
The relatively frequent occurrence of calamitous situations in our forest stands during
recent years, leading to the appearance of great deforested areas, have been caused by wind
and snow, as well as insects. Their restoration, connected with the quality and stable forest
stand formation is very important, but also very difficult. However, the negative effects of
industrial pollution on forests is one of the most important problems affecting forest
management and the environment overall. The injurious affects are enhanced also by global
climate changes, especially by the long-term moisture deficit in association with the high
temperature. The negative course of environment conditions has unfavourably affected the
health of deciduous trees, especially during recent decades, due to an insufficient tolerance to
emission pressure. Increasing damage to beech is very unpleasant because of the high
percentage of these trees in Slovak forests, and its importance overall.
Results obtained by investigation of mycoflora in ecosystems under various level of
anthropogenic pressure are very important because of the study of changes in fungi
287
association, changes in the health condition, degree of damage and perspective of those
ecosystems. The study of fungi species and the quantity of fruit bodies is very important for
assessing the condition of forest stands and the qualitative evaluation of the internal changes.
There are many factors influencing the number of fruit bodies and species of the mycorrhizal,
saprophytic and parasitic mushrooms. Temperature, soil and air humidity are the most
important natural factors. Their optimal values vary in the case of every species. Apart from
the aforementioned natural factors, there are a number of others influencing mushroom
growth, and the impact of human activity or the emission pressure factor has been the most
important during recent decades. The aim of this research was to investigate the influence of
natural and anthropogenic factors on the quality and quantity of macromycetes in a beech
forest stand.
The main goal of the research was to determine the relationship between rapidly
worsening growth conditions and changes in the composition of fungi species, in particular
ectomycorrhizal fungi. Research plots were stabilized in the forest stands under very similar
growing conditions (forest type, tree species, stand density, forest age, exposition, and slope).
Differences were only in the emission pressure and the unexpected deforestation of
comparable stands. The influence of emission pressure was observed at two localities (Žiar
nad Hronom and Rožňava) and the effect of unexpected deforestation was observed at two
stands nearby České Brezovo village.
Compared stands – I:
The forest stand mostly affected by emissions is situated nearby the town of Žiar nad
Hronom (stand A). The locality is directly influenced by an aluminium producing enterprise
and also by the town’s heating plant. The aluminium producing enterprise has been emitting
dust, tar, HF, SO2, NOx, CO, HCl and NH3 to the surrounding environment for more than 50
years. Amounts of emitted pollution have decreased, especially during the last 10-15 years,
but the multiyear imission pressure to land and forests is indisputable.
A relatively clear forest stand, outside the polluted area, is situated nearby the village
of Kalinka (stand B). This locality is not directly affected by pollution from any emission
source, although the influence of outlying sources cannot be excluded. Research plots were
stabilized in the beech forest stand and the growing conditions, characterized mainly by the
identical forest type, were practically identical. The main tree species was beech, with about
90% in all stands. The percentage of other species (oak, hornbeam, birch, spruce and pine)
was much lower, and they are not presented at research plots. Exposition of the plots in
Kalinka and Ziar nad Hronom was approximately identical (east or north-east respectively),
the same gradient ratio of both slope (30%) and age of trees (80 and 85 years, respectively).
Compared stands - II:

The second locality under emission pressure was located nearby the town of Rožňava
(stand C), where ironstone, silver and cupriferous ore has been mined for a long time.
Processing of mined siderite has been done in 62 roasting and two rotary furnaces since the
beginning of the 1900´s. Both in the past and present, existing purge reservoirs, after drying
up, became the sources of dust falling on surrounding forest stands. The mine surroundings
were mainly polluted by powdery substances, arsenic, antimony and mercury, but also by
oxides of sulphur, arsenic, antimony and chlorine. The roasting furnaces were closed in 1976,
but the ore was mined and processed up until 1993.
A similar locality, characterized by similar growing conditions in forest stands, but
away from the direct emission pressure is situated in nearby Betliar village (stand D). The age
288
of both beech forest stands is 95 years, the gradient ratio is 40-50 %, and exposition is
northeast and north, respectively. The main tree species is beech with about 80% in all stands.
The percentage of the other species (oak, hornbeam and lime tree) was much lower, and they
are not presented in research plots.
Compared stands III and IV:

The effect of unexpected deforestation of comparable stands on the spectrum of
macromycetes was observed at the research plots located close to Ceske Brezovo village,
nearby Poltar town. An unexpected deforestation was caused by a windstorm in 2000 and
subsequently by rime in 2001. Due to the great extent of the disaster, afforestation was
started only in 2004. Research plots were stabilized in relatively non-damaged forest stands
95 and 55 years old, respectively, and on the deforested areas nearby those forest stands.
Beech is the main tree species, while spruce and oak occur to a lesser extent in the older forest
stand (stand E). Exposition of stands is to the east and the gradient ratio is 50%.
The compared stand (stand F) is overgrown by various species of weed, tall grasses
and shrubbery (Rubus idaeus, Sambucus nigra, Calamagrostis sp, Urtica dioica). The original
forest stand was created mainly by beech and less so by spruce, before the deforestation of the
stand. The natural revitalization by beech and maple is supplemented by beech and spruce.
The younger forest stand (stand G) is 55 years old, oriented to the southeast with a
gradient ratio about 40%. It is created mostly by beech, spruce and maple, and to a lesser
extent by aspen, oak, hornbean, birch and cherry.
The compared severed damaged stand (stand H) is oriented to the south-east and the
gradient ratio is about 60%. It is overgrown by various weeds, shrubs and tall grasses (Rubus
idaeus, Rubus fruticosus, Calamagrostis sp., Senecio nemorensis and Sambucus nigra). The
original forest was formed by beech and less so by oak. The natural revitalization of the
damaged stand is created by beech and maple.
Each compared stand consisted of 10 research plots, 15 by 15 metres. They were
situated in the characteristic part of the forest stand, minimally 20 metres from each other.
Except beech, no other tree species are on the plots.
The number of fruit bodies of every fungi species was registered during the growing
season. Subsequently, the percentage of the mycorrhizal, saprophytic and parasitic species
was determined and the results expressed the degree of negative changes on a forest stand
under the given conditions.
The aim of the research was to evaluate the influence of emission pressure and the
effect of unexpected deforestation on the growth of mycorrhizal mushrooms and on the
changes to the spectrum of macromycetes species. At the same time, the presence of
mushrooms was recorded under the normal growing conditions of the forest stands, and at the
growing conditions radically changed by the activity of harmful factors. A complete review of
the recorded fungi species at all localities is presented in Table 1.
A very important indicator of anthropogenic pressure on a forest stand is the
proportion of ectomycorrhizal mushroom species (Sm) of the total number of species (St)
recorded at the same locality (Gulden et al. 1992). This proportion, the mycorrhizal
percentage” (Im = 100. Sm / St ), reached a maximal level at the relatively clear locality
Kalinka. Its value was nearly double in comparison with a stand in Ziar nad Hronom. The
assumption relating to the decreasing number of ectomycorrhizal mushroom species in the
polluted forest stand was positively confirmed. Similar results were reached in the compared
289
Table 1 Number of fungal species recorded in different forest stands
Type M TS WS P Total M%
Compared stands
I. A 33 26 26 4 89 37,1
B 34 6 7 3 50 68
II. C 26 19 18 4 66 39,4
D 34 21 17 3 75 45,3
III. E 21 4 11 1 37 56,8
F 2 5 20 7 34 5,9
IV. G 20 2 14 4 40 50
H 2 4 21 6 33 6,1
A - Žiar nad Hronom - polluted forest stand; B - Kalinka - clear forest stand; C - Rožňava - polluted
forest stand; D - Betliar - clear forest stand; E - České Brezovo - older forest stand; F - České
Brezovo - deforested area after older forest; G - České Brezovo - younger forest stand; H - České
Brezovo - deforested area after younger forest. M - mycorrhizal species; TS - terrestrial saprophytic
species; WS - wood saprophytic species; P - parasitic species; M % - mycorrhizal percentage
stands II, although differences in the mycorrhizal percentage were not as marked as in the
compared stands I.
A noticeable decrease in the number of ectomycorrhizal species was recorded in the
stands where unexpected deforestation had occurred because of windstorm or rime. Open,
non-protected forest stands are not optimal for the growth of ectomycorrhizal mushrooms, but
there is a lot of deadwood for colonisation by the saprophytic ones. However, the rapid and
radical changes in the composition of fungal species over 3-4 years are also very interesting
and important.
In conclusion of this part, it is necessary to remind ourselves of an important fact,
which is that presence of ectomycorrhizal mushroom species and functionality of the
ectomycorrhizal symbiosis is not necessarily connected with a production of fruit bodies. A
complete list of the recorded species is given in Table 2.
Table 2 Survey of identified fungus species at all stands
Compared stands I. II. III. IV.

Locality A B C D E F G H
Species Type
Agaricus haemorrhoidarius Schulzer * TS
Agaricus sanguifluus Paulet * TS
Agaricus silvaticus Schaeff. * TS
Aleuria aurantia (Pers.) Fuchel * TS
Amanita citrina (Schaeff.) Pers. * * * * M
gemmata ( Fr. ) Bertillon * * M
muscaria ( L. ) Pers. * * * M
phalloides ( Fr. )Link * * * * * * * M
rubescens Pers. * * * * M
290
Table 2 (continued)
vaginata ( Bull. )Lam. * M

Armillaria mellea (Vahl ) P.Kumm. * * * * * P
Bjerkandera adusta (Wild.) P.Karst. * * * * * * WS
Boletellus pruinatus Klofac et Krisal * * M
Boletus aestivalis Paulet * * * M
luridus Schaeff. * M
Bovista plumbea Pers. * * M
Calvatia excipuliformis ( Scop.) Perdeck * TS
Cantharellus cibarius Fr. * * * * * M
Chalciporus piperatus (Bull.) Bataille * M
Chondrostereum purpureum (Pers.) Pouzar * WS
Clavulina cristata (Holmsk.) Pers. * M
Clitocybe cerrusata (Fr.) P.Kumm. * * TS
flaccida (Sowerby) P.Kumm. * TS
geotropa (Lam. et DC. ) Quél. * * TS
gibba (Pers.) P.Kumm. * * TS
nebularis Batsch) P.Kumm. * * * TS
odora (Bull. )P.Kumm. * * * TS
phyllophila (Fr. )P.Kumm. * * * TS
Clitopilus prunulus (Scop.) P.Kumm. * M
Coccomyces coronatus (Schumach.) De Not. * * WS
Collybia asema ( Fr. ) P.Kumm. * TS
dryophila (Bull.) P.Kumm. * * * TS
Coprinus atramentarius (Bull.) Fr. * * * * * TS
disseminatus (Pers.) Gray * WS
micaceus (Bull.) Fr. * * * TS
xanthotrix Romagn. * TS
Cortinarius cinnabarinus Fr. * * M
salor Fr. * * M
torvus (Bull.) Fr. * M
Craterellus cornucopioides (L. ) Pers. * * * * M
Creolophus cirrhatus (Pers.) P. Karst. * * WS
Crepidotus applanatus (Pers.) P.Kumm. * WS
variabilis (Pers.) P.Kumm. * WS

Species Type
Daedalea quercina (L.) Fr. * * WS
Daedaleopsis confragosa (Bolton)
J.Schrot * P
Diatrype distiformis (Hoffm.) Fr. * * * * * * * * WS
Exidia glandulosa (Bull.) Fr. * * * WS
Fistulina hepatica (Schaeff.) With. * P
Fomes fomentarius ( L.) J.Kickx f. * * * * * * * P
Fomitopsis pinicola (Sw.) P.Karst. * * * WS
Fuligo septica (L.) Wigg. * * WS
Ganoderma lipsiense (Batsch)
G.F.Atk. * * * WS
Geastrum rufescens Pers. * M
Gymnopilus junonius (Fr.) P. D. Orton * WS
Gymnopus peronatus (Bolton) Antonín
et al. * TS
291
Table 2 (continued)
Gyroporus castaneus (Bull.) Quél. * M

Hebeloma crustuliniforme (Bull.)
Quél. * * * M
sinapizans (Paulet ) Gillet * * M
Heterobasidion annosus (Fr.) Bref. * P
Hohenbuehelia atrocaerulea (Fr.)
Singer * * WS
Hydnum repandum L . * * * M
rufescens Fr. * * * M
Hygrophorus eburneus (Bull.) Fr. * * * * M
penarius Fr. * M
Hymenochaete rubiginosa
(J.Dichs.)Lév. * WS
Hypoxylon fragiforme (Pers.)J. Kickx
f. * * * WS
Hypholoma fasciculare ( Huds. )
P.Kumm. * * * * WS
sublateritium ( Schaeff. ) Quél. * * * * WS
Inocybe geophylla ( Fr. ) P.Kumm. * M
rimosa ( Bull. ) P.Kumm. * * M
Laccaria amethystina ( Huds. ) Cooke * * * * * * M
laccata (Scop.)Cooke * * * * M
Lactarius blennius (Fr.) Fr. * * * M
fluens Boud. * * M
piperatus ( L.) Gray * * * M
pyrogalus (Bull.)Fr. * M
serifluus (DC.)Fr. * M
subdulcis (Bull.) Gray * * M
vellereus (Fr.)Fr. * * * * * M
volemus (Fr.) Fr. * * M
Laetiporus sulphureus (Bull.) Murrill * P
Leccinum crocipodium (Letell.)
Watling * * M
rufum (Schff.) Kreisel * M

Species Type
Lenzites betulina (L.) Fr. * * WS
Lepiota clypeolaria (Bull. P.Kumm. * * TS
Lepista nuda (Bull.) Cooke * * * TS
Lycogala epidendrum (L.) Fr. * * WS
Lycoperdon echinatum Pers. * * TS
perlatum Pers. * * * * * * * TS
pyriforme Schaeff. * * * * * * * WS
Macrolepiota procera (Scop.) Sing. * * * * TS
rachodes (Vittad.) Singer * TS
Marasmius alliaceus (Jacq.) Fr. * * * TS
bulliardii Quél. * * TS
epiphyllus (Pers.) Fr. * WS
rotula (Scop.) Fr. * * * WS
wynnei Berk. et Broome * TS
292
Table 2 (continued)
Melanoleuca melaleuca (Pers.) Murrill * WS

Micromphale brasicolens (Romagn.)
P.D.Orton * TS
Mycena alcalina (Fr.) P.Kumm. * TS
capillaris (Schumach.) P.Kumm. * TS
crocata (Schrad.) P.Kumm. * TS
epipterygia (Scop.)Gray * TS
galericulata (Scop.) S.F.Gray * * TS
pelianthina (Fr.) Quél. * TS
polygramma (Bull.) S.F.Gray * * * * TS
pura (Pers.) P.Kumm. * * * TS
sanguinolenta (Alb.et Schwein.) * TS
Nectria Fries * * * * * P
Oligoporus caesius (Schrad.) Gilb.et
Ryvarden * WS
Otidea onotica (Pers.) Fuckel * TS
leporina (Batsch Fuckel * TS
Oudemansiella radicata (Relhan )
Singer * * * TS
Paxillus involutus (Batch )Fr. * * M
Peziza badia Pers. * * TS
repanda Pers. * TS
Phaeolus schweinitzii (Fr.) Pat. * * * P
Phallus impudicus L. * M
Phellinus igniarius (L.) Quél. * * P
Pholiota mutabilis (Schaeff.) P.Kumm. * * * WS
Piptoporus betulinus (Bull.) P. Karst * * P
Pleurotus cornucopiae (Paulet)
Rolland * WS
ostreatus (Jacq.) P.Kumm. * WS
Pluteus atricapillus (Batsch) Fayod * * * * WS
Polyporus umbelatus ( Pers.)Fr. * WS
varius (Pers.) Fr. * * * WS
Psathyrella candoleana (Fr.) Maire * * WS
piluliformis (Bull.) P.D.Orton * WS

Species Type
spadiceogrisea (Schaeff.) Maire * M
Psilocybe spadicea (Schaeff.) Sing. * WS
Pycnoporus cinnabarinus (Jacq.)
P.Karst * WS
Ramaria aurea ( Schaeff.) Quél. * * M
botrytis (Pers.) Ricken * M
flava (Schaeff.) Quél. * M
formosa (Pers.) Quél. * M
fumigata (Peck) Corner * M
palida (Schaeff.) Ricken * * M
stricta (Pers.) Quél. * * * TS
Resupinatus applicatus (Batsch.) Gray * * WS
Rhytisma acerinum (Pers.) Fr. * WS
Russula albonigra (Krombh.) Fr. * M
293
Table 2 (continued)
alutacea (Pers.) Fr. * M

brevipes Peck * M
cyanoxantha (Schaeff.) Fr. * * * * * * M
fellea ( Fr. )Fr. * * * * * M
foetens ( Pres. )Fr. * * * * * M
heterophylla (Fr.) Fr. * M
Russula laurocerasii Melzer * * M
lepida Fr. * * M
luteotacta Rea * M
mairei Singer * * * * M
nigricans (Bull.) Fr. * * * * M
ochroleuca (Pers.) Fr. * M
puellaris Fr. * M
rigida Velen. * M
virescens (Schaeff.) Fr. * * M
xerampelina (Schaeff.) Fr. * * M
Schizophyllum commune Fr. * * * * * * * * WS
Scleroderma citrinum Pers. * * * M
Stereum hirsutum (Wild.) Gray * * * * * * * WS
rugosum (Pers.) Fr. * * * * * * WS
sanguinolentum (Alb. et
Schwein) Fr. * WS
Strobilomyces strobilaceus (Scop.
Berk. * M
Stropharia aeruginosa (Curt.) Quél. * * * WS
Trametes gibbosa (Pers.) Fr. * * WS
hirsuta (Wulfen) Pilát * * * * * * WS
multicolor (Schaeff.) Julich * * WS
versicolor (L.) Pilát * * * * * * * WS
Tremella mesenterica Retz. * WS
Tricholoma fulvum (Bull.) Sacc. * M
saponaceum (Fr.) P.Kumm. * * M
sciodes (Pers.) Mart. * * M
sulphureum (Bull.) P.Kumm. * * M

Species Type
virgatum (Fr.) P.Kumm. * M
Ustulina deusta (Hoffm.) Link * * * * P
Xerocomus ferrugineus (Schaeff.) Bon * M
chrysenteron (Bull.) Quél. * * * * * * M
subtomentosus (L.) Quél. * M
Xylaria hypoxylon (L.) Grev. * WS
polymorpha (Pers.) Grev. * * * * WS
A - Žiar nad Hronom - polluted forest stand; B - Kalinka - clear forest stand; C - Rožňava - polluted
forest stand; D - Betliar - clear forest stand; E - České Brezovo - older forest stand; F - České
Brezovo - deforested area after older forest; G - České Brezovo - younger forest stand; H - České
Brezovo - deforested area after younger forest. M - mycorrhizal species; TS - terrestrial
saprophytic species; WS - wood saprophytic species; P - parasitic species.
294
Since the forest stand characteristics are very similar at all the localities and stands, it
is also possible to evaluate the most represented fungal species, and to generalize in terms of
their sensitivity to changed, especially to worsened growing conditions, in a forest stand.
Among a total of 180 recorded fungi species, 76 were ectomycorrhizal species. The genus
Russula had the highest representation with 17 recorded species. The genus Lactarius was
represented by 7 species, the genera Amanita and Ramaria by 6 species each, and the genus
Tricholoma by 5 species.
From a total 93 saprophytic species, 43 were terrestrial and 50 wood saprophytes. The
genus Mycena (9 species) was most highly represented, the genus Clitocybe was represented
by 7 species, and the genus Trametes by 5 species. Parasitic fungi were represented by 12
species and the most frequently occurring species, Fomes fomentarius (L.) J. Kickx.f.,
Armillaria mellea (Vahl.) P.Kumm. and the genus Nectria Fries were recorded at nearly all
the localities. Saprophytic species of the genera Mycena, Psathyrella, Xylaria, Otidea, Peziza,
and also ectomycorrhizal mushrooms of the genus Inocybe, were abundantly represented,
especially in the polluted stands. Species of the most represented genus, Russula, and also
ectomycorrhizal fungi from the genera Amanita and Laccaria, were present at both polluted
and relatively clear localities. One of the most represented species, Laccaria laccata (Scop.)
Cooke, was mostly present only at the polluted stands. The saprophytic species, Diatrype
distiformis (Hoffm.) Fr. and Schizophyllum commune Fr., the parasitic Fomes fomentarius
(L.) J. Kickx.f., and the ectomycorrhizal species Amanita phalloides (Fr.) Link., were
recorded at all stands and under all growth conditions.
Quantitative data concerning the presence of mushroom species are effectively utilised
for biomonitoring of changes in forest ecosystems exposed to emission influence, or to
another unsuitable impacts to the ecosystem (Fellner, 1985; Agerer, 1988; Høiland, 1988;
Janitor, 1997; Pavlik, 1999; Pavlik et al. 2005; Bauer, 2006; Rabas, 2006; Pavlik et al. 2007).
They are utilised also for syntaxonomic evaluation of fungi associations (Fellner, 1987).
However, according to other authors (Kalaames & Kollon, 1971), quantitative studies of
populations of ectomycorrhizal mushrooms provides only partial information about their
activity in an ecosystem. Neither is the presence of fruit bodies unequivocal tangible evidence
of functional symbioses on nearby roots, nor is the extent of a ectomycorrhiza necessarily
positively correlated with its functioning. It is necessary to differentiate between presence and
functioning of ectomycorrhiza (Perry et al. 1989; Repáč, 2000).
According to data from research carried out in central Europe, strong roots and
ectomycorrhizal symbioses are not developing at all well in polluted stands, or their activity is
significantly lower compared with non-polluted stands. A study of the total mycofloral
composition of forest stands polluted by emissions conducted concurrently, revealed critical
decreases in the number of common ectomycorrhizal fungal species as a result of emission
pressure to the forest stands (Příhoda, 1987; Kodrík, 1992; Kodrík, 1997). These observations
correspond with results from the polluted beech stand near Ziar nad Hronom. Similar
conclusions were drawn by other authors (Schlechte, 1987; Fellner, 1987). According to their
findings, a decrease in the occurrence of ectomycorrhizal fruit bodies could be accounted for
by the cumulative effect of pollutants in forest stands.
In addition, data published by other authors confirm our conclusions. Agerer (1988)
and Høiland (1988) noticed changes in the spectrum of ectomycorrhizal mushroom species,
and also a reduction in fruit body number in forest stands artificially acidified and subjected
to liming. A lower number of ectomycorrhizal species is a significant symptom of emission
pressure, since only more resistant species are able to survive extreme conditions (Fellner,
1985; Schlechte, 1987). According to classical mycocoenological studies, soil quality,
especially the level of acidity, is a main factor affecting the spectrum of terrestrial
macromycetes in forest stands (Haas, 1933; Thoen, 1970, 1971; Darimont, 1973).
Ectomycorrhizal mushrooms are very sensitive to changes in the chemical composition of the
295
soil, and to the health condition of a tree symbiont, especially to the concentration of chemical
elements inside its conductive tissues. Increased concentration of aluminium in trees
adversely affects their ectomycorrhizal fungal symbionts (Entry et al. 1987).
Beech, the most widespread tree species in Slovakia, was regarded as a relatively non-
endangered species, with a good health status and good static stability. Determination of the
causes of beech devitalisation is essential to finding ways of stabilizing and reversing this
process. One of the most serious causes is emission pressure and subsequent decline of the
ectomycorrhizal symbioses in forest stands. Since ectomycorrhizas are indisputably important
for the growth and vitality of forest trees, together with the ability of mycoflora to promptly
and by various means to react to environmental changes, it is very important to obtain as
much information as possible on the mycoflora of beech forest stands. The results presented
here are part of the knowledge complex on beech forests, and the changes and evolution they
undergo due to continuous anthropogenic pressure. The collection of information concerning
the spectrum of macromycetes, especially ectomycorrhizal species, and how they adapt to
emission pressure, is very important for the active protection and revitalisation of injured
forest stands.
Acknowledgement
The author thanks the Slovak Grant Agency for Science (VEGA) for financial support
(Research Grant No. 1/4397/07).
References
Agerer R. 1988. Impact of artificial acid rain and liming on fruitbody production of
ectomycorrhizal fungi. Abstr. 2nd Eur. Symp. Mycorrhizae, August 14-21, Prague,
Czechoslovakia, pp3-4.
Bauer K. 2006. Monitoring výskytu fytopatogénnych organizmov na kalamitných
plochách. Diplomová práca. Technická univerzita vo Zvolene, 50 ss.
Darimont F. 1973. Recherches mycologiques dans les forest de Haute Belgique.
Essay sur les fondements de la sociologie des champignons supérieurs. Inst. R. Sci.
Nat. Belg. Mém. 170, 1-220.
Entry JA, Cromack Jr K, Stafford SG, Castellano MA. 1987. The effect of pH and
aluminium concentration on ectomycorrhizal formation in Abies balsamea. Can. J.
For. Res., 17, 865-871.
Fellner R. 1985. Ektomykorrhizní houby klimaxových lesních společenstev při horní
hranici lesa v imisních oblastech Krkonoš (mykocenologická studie). Kand. dizert .
práce. Ústav aplik.ekol. a ekotech. VŠZ, Kostelec n.Č.l.
Fellner R. 1987. Monitorování změn v druhové diverzitě mykorrhizních hub na
imisně různě exponovaných stanovištích. Ekologie mykorrhiz a mykorrhizních
hub.5.-7.10.1987, Špindlerův Mlýn - Svatý Petr, pp93-103.
Gulden G, Høiland K, Bendiksen K, Brandrund TE, Foss BE, Jenssen HB, Laber D.
1992. Macromycetes and air pollution. Biblioteca Mycologia, band 144.
Haas H. 1933. Die bodenbewhonenden Grosspilze in den Waldfoermationene einiger
Gebiete von Wurttemberg. - Beih. Bot. Zentralbl. 50, 35-132.
Høiland K. 1988. Changes in the mycoflora in sample plots treated with artificially
acidified "rain" in South Norway. Abstr. 2nd Eur. Symp. Mycorrhizae, August 14-20,
Prague, Czechoslovakia, p48.
Janitor A. 1997. The environmental factors and their influence on the mycoflora of
forest ecosystems. In: Les-Drevo-Životné Prostredie ´97. Int. Sci. Conf., Technical
University of Zvolen, pp344-346.
296
Kalamees K, Kollon A. 1971. On the biological productivity of Agaricales in
forest ecosystems. Estonian Contrib. IBP, Tartu, 1971/3, pp29-46.
Kodrík M. 1992. Výskum podzemnej biomasy smreka v imisne zaťažených lesných
ekosystémoch na LZ Čadca. Lesnictví-Forestry, 38, 9-10, 751-758.
Kodrík M. 1997. Výskum podzemnej biomasy smrečín v BR Poľana so zameraním
na jemné korienky. In: Midriak R. (ed.), Biosférické rezervácie na Slovensku,
Technická univerzita vo Zvolene, pp133-136.
Pavlik M. 1999. Mycoflora of the polluted beech stand. In: Jankovsky L, Krejcir R,
Antonin V. (eds.), Houby a les. Brno, pp209-214.
Pavlík M, Pavlík Š, Mihaliková M. 2005. Vývoj zdravotného stavu drevín v NPR
Hrončecký grúň od roku 1991. In: Sláviková D. (ed.), Biosférická rezervácia Poľana
po 15 rokoch. Zborník referátov z konferencie. Zvolen, Vydavateľstvo Technickej
Univerzity vo Zvolene, ISBN80-228-1510-1.
Pavlik M, Pavlik Š, Galko J. Zdravotný stav drevín vybraných častí NPR Hrončecký
grúň. In: Ochrana lesa 2007, zborník vedeckých a odborných prác z medzinárodnej
konferencie : Zvolen, 6.9.2007. Kodrík M, Hlaváč P (eds.), Zvolen: Technická
Univerzita vo Zvolene, 2007, ISBN 978-80-228-1788-2, pp105-112.
Perry D, Margolis H, Hoquette C, Molina R, Trappe JM. 1989. Ectomycorrhizal
mediation of competition between coniferous tree species. New Phytol., 112, 501-511.
Příhoda A. 1987. Mykorrhizy v narušených biocenozach.Ekologie mykorrhiz a
mykorrhizních hub. 5-7.10.1987, Špindlerův Mlýn - Svatý Petr pp9-25.
Rabas J. 2006. Porovnanie mykoflóry rôzne imisne zaťažených lesných porastov.
Diplomová práca. Technická Univerzita vo Zvolene, 41pp.
Repáč I. 2000. Funkcie a ochranné účinky ektomykoríz. In: Hlaváč P, Reinprecht L,
Gáper J. (eds.), Drevoznehodnocujúce huby 2000. 2,.med zinárodné sympózium.
Zvolen. Sielnica, pp43-50.
Schlechte G. 1987. Ecological studies on mycorrhiza-forming fungi of forest stands
exposed to different levels of air pollution. Ekologie mykorrhiz a mykorrhizních hub.
5.-7.10.1987, Špindlerův Mlýn - Svatý Petr, pp82-92.
Thoen D. 1970. Étude mycosociologique de quelques associations forestiéres des
districts picardo-brabançon, mosan et ardennais de Belgique. Bull. Rech. Agron.
Gembloux N.S., 5, 310-326.
Thoen D. 1971. Étude mycosociologique de quelques associations forestiéres des
districts picardo-brabançon, mosan et ardennais de Belgique. Bull. Rech. Agron.
Gembloux N.S., 6, 215-242.
297
The Development of Polish Mushroom Exports

Tomasz Smoleński
Institute of Agricultural and Food Economics, Swietokrzyska 20, 00-002 Warsaw, Poland.
Email: smolenski@ierigz.waw.pl
Key Words: Polish mushroom production; Agaricus bisporus; Pleurotus spp; Mushroom
export; SWOT analysis
The development of Polish mushroom producers during the last decade was
determined by external, hence international, factors like the enlargement of the European
Union (EU) and the development of global markets. The important role played by Polish
mushroom producers in the European market was supported by the territorial expansion of the
EU, which had a positive impact on trade between Poland and the rest of the EU. However,
additional macro-economic factors, including interest rate instability and the volatility of the
foreign exchange rates, are still affecting Polish companies, particularly those with a strong
presence in foreign markets. Most noteworthy among the many attributes of the Polish
mushroom producers is their ability to adapt to new market rules, and to maintain a strong
position based on previous experience and a long tradition of producing excellent mushrooms.
The production of mushrooms in Poland has a long-standing heritage dating back to
the 19th Century. As the sector under consideration, Polish mushroom producers have not only
survived but have succeeded in adapting to the extremely volatile and harsh EU market rules
(i.e. initially the market of EU-15, later EU-25, and now the present EU-27). What is a very
exceptional in the case of Polish mushroom producers is the completely different path they
have taken in order to adapt to the rules and conditions of the European integrated economy
compared to Polish producers of agri-commodities in other sectors, i.e. other vegetables, or
agricultural products. This is why it is sometimes said that Polish mushroom producers have
followed an easier path to position themselves on the European market.
According to Zentrale Markt und Preisberichtstelle GmbH (ZMP), the German
organisation for market information and analysis, Polish mushrooms, especially champignon
(Agaricus bisporus) and boczniaki (Pleurotus), are the only products which are still present
on German wholesale markets.
The most important stage in the Polish mushroom producers’ development dates back
to 2001 when trade in Polish mushrooms was liberalized and the duties on fresh and
processed Polish mushrooms exported to EU countries were eliminated. In keeping with the
ideas of the American economist, Michael E. Porter, research on the competitiveness of
particular national markets for champignons was addressed not only in terms of basic
conventional factors such as the cost of production and prices, but foremost in terms of other
factors including the quality of the technical and Information and Communications
Technology infrastructure (ITC) infrastructure, accessibility to the markets and to the new
consumers, and geographical conditions affecting the climate. Such SWOT analysis of the
main world mushroom producers was recently ordered by the Rabobank and addressed to the
Landbouw Economisch Instituut (Agricultural Economics Research Institute; LEI-DLO).
Porter’s theory was based on external positive factors, described as opportunities,
affecting a particular producer. Such opportunities that support and positively affect the
market position of mushroom producers in Poland include a suitable geographical location
(the close proximity of big markets with very strong demand like Germany and Russia),
accessibility of a cheap labour force, and low production costs. The strengths, according to
Porter, are dependent upon the producers and are the effects of their decisions within the
company. These include a relatively high level of technological infrastructure on the farms, a
high level of the price competitiveness, and the excellent quality and taste of Polish
mushrooms, approved by international consumers, which are the result of an enduring Polish
298
mushroom industry and a long established presence in Western European markets. Continuing
with this SWOT analysis of Polish mushroom production, it is necessary to consider the
threats, i.e. potentially negative external factors outside the control of the producers. These
include a lack of capital, difficulties in accessing low-interest rate credits for further
investment in technology and modern processing of mushrooms, highly volatile foreign
exchange rates, and an appreciating Polish currency (the złoty). All of these factors have a
negative impact on the exporting mushroom industry. Furthermore, producers from the
Netherlands, France, China and Ireland are improving their own positions in order to compete
more effectively with Polish producers on the global market. There are also internal factors,
which Porter called weaknesses, affecting mushroom producers in Poland. Weaknesses are
dependent upon the producers, and could be better managed by Polish producers. Such
weaknesses include a low level of concentration of mushroom producers in Poland,
domination of the sector by small producers, a low level of organization and cooperation
between producers who are not well integrated for the purpose of efficient marketing.
Polish exports of fresh fruit and vegetables have been increasing for last years.
Champignons constitute a very special exported vegetable, because within the exports of
Polish fruit and vegetables, the increase of exports of champignons (in terms of value) is the
most rapidly growing since Poland entered the EU. The priority of champignons within Polish
exported vegetables is indicated by the fact that champignons dominate the Polish vegetables
exports, and the value of champignons exports is higher than the value of vegetable exports
other than champignons. The comparison of the export of processed champignons to the
export of fresh champignons shows that fresh products are the true winners and fresh
champignons exports are growing more rapidly than processed champignons. From the point
of view of Polish exporters of fresh mushrooms, this business is of higher profitability than
the exports of different vegetables or fruits, and it might explain the higher interest in Poland
in keeping both: production of fresh mushrooms and their export. The reasons for these
incredibly high profits are quite simple – the price of fresh mushroom is much higher than the
production cost and the chances for good margins are quite good. Therefore, this sector of
production might be less dependent on the other links of food chain, while the vegetable
sector is more highly dependent and highly vulnerable to other links of the food chain
contrary to the food semi-processing links of the food chain, which generally speaking are
very dependent on the final processing companies. The implication of these good profits on
fresh mushroom production in Poland is that the Chinese processed mushrooms exports are
not competitive, and the French processed mushrooms are not so competitive.
Of course, not only the entrance of Poland to the EU positively affected the Polish
fresh mushrooms exporting industry, but also the situation of EU-15 mushrooms producers
and exporters, which is under recession. Such a situation created excellent opportunities for
the further development of the Polish fresh mushrooms exporting industry. Some EU
countries, particularly France and the Netherlands are explaining the success of Polish
mushrooms on the EU market by the strong and expansive development of mushrooms
production in Poland. For instance, according to the Agra-net, about 10% of supplies to the
French market are from Poland and this situation has wide implication for French producers,
as the profitability of fresh mushrooms production business has became lower. Trends of
decreasing output of fresh champignons in the EU-15 have been observed for last years,
similarly to other horticulture business sectors. The best example is the Netherlands, where
not only the fresh mushrooms production business is characterised by the decreasing return on
assets (ROA), but also other horticulture businesses. The return on investment (ROI) of
producing fresh mushrooms in the Netherlands has decreased from 91% in 2003 to 82% in
2006 according to the Dutch Landbouw Economisch Instituut, and the profitability of
producing fresh mushrooms has been decreasing for the last years.
299
The analysis of costs of production indicates that, within the prices of production
factors, the substrate and labour force are of increasing shares in total costs because the
process of production has been under intensification over the last years due to higher number
of production cycles within one year. Meantime, the mushrooms production industry has the
higher capital endowment than the labour force endowment. The development of Dutch
mushrooms production is under transition based on increasing the scale of production and
intensification of production, and small farms going out of business because of the scale
increasing trends. Such detailed observation confirms the overall trends in other sectors of
horticulture.
The rapidly increasing economic performance of the fresh mushrooms producers in
Poland is under the risk of failure of the previous investments focused on increasing the
quality of production processes due to the capital intensification of mushroom farms, but the
opportunity cost of such investments is rapidly increasing because of the increasing interest
rate in Poland. Such a situation results in decreasing return on investment (ROI) of the
mushroom industry in Poland. The production of fresh mushrooms for export is a strategic
sector of Polish national horticulture products along with frozen berries, sour-cherries, apple
juice concentrate and onions.
Polish exports of champignons are dominated by fresh mushrooms which represent a
70% share in terms of quantity. The remaining champignons exported from Poland are canned
mushrooms, mushrooms preserved in brine, and frozen mushrooms. The value of exported
champignons between 2004 and 2007 increased by almost 40%, from US$133.6 million in
2004 to US$183.1 million in 2007. In terms of the quantity of fresh champignons, exports
increased by ca 46%, from: 84,600 tonnes in 2004 compared to 124,000 in 2007. Over the
same period, the value of fresh exports increased by over 100% in US$ terms, i.e. from
US$120.9 million to US$244.5 million. The increase in the quantity of exports is affected by
a decrease in the price of exported mushrooms due to the very strong and still appreciating
Polish zloty in terms of US dollar and the euro. International trade partners for Polish
exporters are located throughout the EU, with Germany and the Netherlands foremost.
Together, these two countries import ca 40% of fresh and processed champignons from
Poland. Following the strong appreciation of the Polish zloty, new trends have been observed
among the international trading partners of Polish champignon exporters. In terms of overall
market share, exports of Polish fresh champignons are decreasing to Germany and to the
Netherlands. After entrance to the EU, the Polish fresh mushroom export performance has
been strengthening in the EU-12 countries and in Commonwealth of Independent States
(CIS).
Summing up the previous experiences of the Polish mushroom producers show that
this industry was strongly positioned in the EU and marginally positioned in the non-EU
countries markets but, for the time being, Polish producers understand all of the differences
between the rules which governs those two external markets. The reason is only one - the
huge differences between the EU and non-EU markets within the perspective of the exported
Polish mushrooms. The previous experiences with the EU market will not be applicable to the
future developments of the EU market. Therefore, there is no reasonable argument of the
brilliant projections for Polish exporters. Presently our producers know that the excellent
foreign European career of the Polish products like semi-processed and canned mushrooms,
and preserved mushrooms, is under the risk of projected changes in the EU-external trade
policy. For the time being, the observed low import quotas on semi-processed and processed
mushrooms have limited the access to the European market by the Chinese products quite
effectively and Polish producers did not cope with such competitors on the EU market.
However, it is a well-known fact that the EU is forced to liberalize its trade of agricultural
products within the WTO, and therefore the EU market is not going to be resistant to the
global market developments anymore. The present structure of the Polish exports is to be
300
changed as presently Polish mushrooms are strongly placed in the EU market. One of the
reasons for such a situation is that this market is under regulations preferring the EU-
mushrooms and eliminating the non-EU mushrooms. On the eve of the liberalisation of the
EU market of processed mushrooms. the competition will be stronger and similar to the
present situation in the non-EU market of semi-processed and processed mushrooms. Here,
the Polish mushroom products are weakly positioned because the share of exports to the
Eastern European markets within the structure of exports of Polish mushroom products has
been decreasing for last years. The reason for such a weaken performance of Polish fresh
mushrooms in the CIS markets is institutional due to restrictions introduced by Russia in
2005, which strongly decreased the supply of the Polish fresh mushrooms to the CIS markets.
Polish statistical data indicate that, apart from the restrictions the exports to Russia totalled at
11.000 of fresh mushrooms in 2007. Comparing this period to the time without restrictions,
the exports were very low, for instance in the year 2005 – 22000 tonnes, in the year 2004 –
23500 tonnes. The Russian institutional regulation of fresh mushrooms imports has been
transformed since July 1st, 2008. The Russian authorities have regulated not only the
information on the origin and kind, and expiration date of the mushrooms, but also additional
information on fresh mushrooms on safety certificate and detailed information on the content
of pesticides, nitrites and nitrates. The Russian requirements for the content of the above-
mentioned chemicals in the fresh mushrooms are incredibly restrictive in comparison to the
EU requirements and the scale of difference is equal to several dozen. The certification of
fresh mushrooms is very expensive and therefore such regulation cannot positively affect
Polish fresh mushrooms exports. However, the implications of long lasting process of
certification of fresh mushrooms might completely destroy the export opportunities.
Turning back to the point of global perspective, it is enough to say that the Chinese
products are the true winners of the competition on the CIS market. Moreover, as the global
provider of preserved mushrooms, China is in an especially good position to meet the
increasing demand for mushrooms, but not only mushrooms, in the CIS because of the
excellent but unique opportunity to barter. Such a barter system operates the following way:
the Chinese agricultural commodity in exchange for the Russian energy. The mechanism of
global imbalances, driven by the outstanding energy security needs, are affecting the
international trade of food. However, the great problem of the Chinese is the growing demand
for energy, and this is forcing China to attend international agreements on the exchange of
food for energy cooperation.
The new dimension of the global macroeconomic developments is going to dominate
the future developments of Polish mushrooms producers. The only fact that is predictable now
is that the Polish producers of mushrooms will be much more sensitive to the global
macroeconomic developments, which are not optimistic for any of the developed economies,
especially for the whole EU economy. According to the last IMF World Economy Outlook,
the projections of rising energy and commodities process have boosted inflationary pressure
and have cut the projections for the Chinese GDP growth from 12% to 10% in 2008/2009.
The consequences of this global instability is accelerating the barter transactions of food into
energy, because the adjustments in the foreign exchange rates are expensively lagged, and
there is an economic sense in avoiding pricing in money and going into assessment of the
value in barter exchange relations. Governments intensively seek new suppliers of energy as
the future of energy-importing countries strongly depends on this factor. But at the same time,
governments are forced to slip away from money as the interest rates, as the price for money
is growing up. In the nearest future, the demand for energy and demand for food will be
strongly positively correlated.
From the point of view of the Polish mushroom products on the future global market,
it is challenging that the Chinese products are promoted due to the bilateral agreements and
the Chinese presence within the WTO, therefore it is risky to assess the results of realising the
301
import quotas on processed mushroom products in the EU, but it is possible to predict the
stronger competition. Such a competition will result in weakening the position of Polish
mushrooms on the EU market and will negatively affect the Polish mushrooms exports.
During this time, the supplies of Chinese mushrooms will be stronger because of the anti-
dumping American trade policy. Such surpluses will be sent to the newly opened EU market,
and the traditionally opened for Chinese products, Russian market. Such global developments
will most probably show that the interests of EU producers of mushroom products will be
quite similar, not competing because the losers will be placed not only in Poland, but also in
Belgium, the Netherlands, where mushrooms are being produced. The perspective of national
differences will be evident also because the winners of the liberalisation of trade policy of
processed mushrooms will be placed in the EU importing countries like Germany, Finland,
Sweden, Austria and Italy. The concluding remark is that the EU-external trade policy
improves the power of competition on the EU markets and the pros and cons of this process
will be regionally oriented.
Additionally, the influence of the anti-inflationary policy mechanism introduced by
the ECB in the euro-area is aimed at increasing the interest rate and improving the power
parity of euro, so the EU is strongly focused on the external providers of food products and
energy. Therefore, the euro-area economic policy will strongly promote cheap food providers,
as the energy will be more expensive due to the limited number of energy providers creating a
monopoly on the energy market. It is not easy to be optimistic about the future of the Polish
mushrooms exporting industry as Poland is still outside of the euro-area and still far away
from the ERM2, because without chances to stabilise highly volatile and strongly increasing
foreign exchange rate of the Polish national currency. Not only Polish products are becoming
more expensive, but also the Polish economy is strongly connected with the global economy
and also affected by the increasing prices of both: food and energy. Such additional,
nationally-determined obstacle like strong currency is killing our export industry not only of
mushrooms. 1
Summing up the discussion on the future developments of the very strongly exporting
Polish mushroom industry, such discussion shall be focused on maintaining its positions in
both those different external areas: the EU and non-EU, particularly CIS markets. As far as
the EU market is considered, the excellent career of the Polish processed mushrooms is under
the risk of future developments driven by the projected changes of the EU-external trade
policy and the projected national, hence macroeconomic developments resulting in improving
the exchange rate of the Polish currency.
Generally speaking, due to the trade liberalisation of the EU, most probably in the
nearest future, the exports of Polish fresh mushrooms to the EU will continue to grow as the
fresh mushroom is a very specific product of a very short shelf life. The sensitiveness of
mushrooms is because fresh mushroom cannot be stored in the conditions of volatile
temperature and a volatile humidity during the long-term transport. Additionally, our main
competitors from the Netherlands, are going into the trade services and logistics instead of the
mushrooms production. Therefore the competition on the market of fresh mushrooms will not
be so hard for products from Poland supposing that the Polish macroeconomic conditions of
exchange and interest rates, labour market developments would be stable. The external threats
might cause not so optimistic performance of the Polish exporters of mushrooms in the future.
From the point of view of the Polish exporters of semi-processed and processed mushrooms,
the future of those products on the EU market is under the shadow. The worse scenario is for
the competition on the market of processed and semi-processed mushrooms, where the shelf
life of products is longer and the products might be traded on the long distances and therefore
the products from China might be introduced to the EU market then. The harder competition
1
This point was prepared by B. Chamot, the Specialist Economist from the Economics of Food Industry
Departament, IAFE, Warsaw
302
will be focused on prices, which will be not competitive in the case of Polish products
because of higher costs of production in Poland (labour force costs, energy, scale of
production) and nationally-determined factor, namely the very strong Polish zloty, which does
not support the Polish exports.
The export of fresh mushrooms create the special need for the best logistics in order to
eliminate losses. The share of Polish markets in the European market might be higher because
of the lack of interest of well organised trading networks still promoting the regional EU
producers. The greatest challenge for the Polish fresh mushrooms is to gain access to those
well organised multinational trade retail companies, which constitute ca 60% of the overall
retail trade of fresh mushrooms in the Scandinavian countries and ca 80% in the Netherlands
and Germany. Access to retail trade networks could be very profitable for Polish producers as
it might hedge the stable and predictable long lasting orders and creates the opportunity to
compete with the biggest European exporting companies from Netherlands. Polish products
are still not branded and not identified as Polish products, and it should also be improved in
the near future as consumers could then identify the product with its origin. The German
market should be taken into consideration by the fresh mushrooms producers in a detailed
way due to the fact that this is a very big open market and is still strongly importing
mushrooms. The case of strong competition between Polish and Dutch exporters, where the
Dutch products totalled at 20,000-30,000 tonnes per year. Germany is the most important
importing fresh mushrooms country and creates the demand for 50% of Polish fresh
mushrooms sold abroad. The position of Germany is becoming stronger also due to the EU
enlargement in 2004 and Russian restrictions on the Polish fresh mushrooms. Since then, the
impact of German importers on Polish fresh mushrooms industry is a quasi-monopson.
According to Polish statistics provided by the Polish Ministry of Agriculture, the export of
Polish fresh mushrooms to Germany totalled 26,000 tonnes in 2007 and meantime the exports
of fresh mushrooms from the Netherlands to Germany totalled at the lower than Polish
numbers, levels (updated detailed statistics are not available). The past performance of Dutch
fresh mushrooms on German market was highest in the years 2000-2001 and then it totalled at
higher than 30,000 tonnes and has since decreased to 26,000 tonnes in the years 2002-2005.
This situation results in the 90% of shares of Polish and Dutch fresh mushrooms in the whole
imports of fresh mushrooms to Germany.
Taking into consideration the experience of EU market in details, where Polish fresh,
semi- and processed products like onions, frozen strawberries, and concentrated apple juice
are strongly positioned, the concluding remark for the Polish mushrooms is that the future
scenario depends on the power of EU manufacturers who search for cheaper suppliers of
mushrooms and who search for reliable suppliers of good quality products. Therefore, the
expansion of Chinese products will be concentrated on the processed mushrooms and the
Chinese competitive advantage will be based on the low-costs of processing mushrooms and
improving its higher added value at the lower cost. Therefore, the competition alongside the
food chain will be concentrated at delivering the higher added value at the lower price.
What are the Polish mushroom exporters doing now in order to improve their
performance on the eve of this very hard period of dynamic changes? For sure, they are not
passive, and they are improving the integration of the companies within the sector. Such an
example is the Association of Polish Food Producers of Mushrooms. In the era of stronger
competition and harder external threats, the only reliable advice might be to follow the way of
producing excellent Polish mushrooms, but be cautious and never give up, as everybody
knows that the integrated industry in the EU might take more advantages of the institutional
framework of the EU, even when the CAP is to be under liberalisation. What creates the
interesting opportunity for integrated producers within the groups and organisation is the
ability to apply for subsidies addressed only to such well organised mushrooms producers.
This structure of distribution of subsidies is based on two rules: firstly, the decoupled
303
subsidies from the products and secondly the risk of taking off the subsidies by the retail trade
companies instead of the producers. As the market of fresh mushrooms is dominated by well
concentrated retail trade companies, there is no opportunity to transmit the subsidies within
the prices. However, the highest profits are made by the retail traders are made on the added
value made by the producers, but this profit is not transmitted back to them. Additionally,
fresh mushrooms producers might take more advantages of the institutional framework of the
national budgets, even when the national agricultural policy is to be under renationalisation.
The global market of fresh mushrooms in the era of liberalisation of international trade of
agricultural commodities might undergo specific transition into the liberal market, strongly
affected by the highest competition between producers. Therefore the integration of
mushrooms producers within the group of producers might strengthen their position on the
future liberal market. Therefore, the basic assumption of the CAP reforms, which is the
creation of strongly integrated producers within the privileged groups is very prospective for
the future developments of agricultural sector in the EU because such CAP reforms strengthen
the position of agricultural producers on the global liberal market. Summing up, the CAP
reform within the perspective of Polish mushrooms producers creates for them the forward-
looking opportunities, but under the condition that they would be integrated in the future,
because they are not integrated and of low-scale of production and low-efficiency of
production in the time of increasing costs of production. For instance, the average Polish
mushroom farm is 5-times smaller than the average Dutch mushroom farm, the average value
of output per one farm is in Poland 11-12 times lower than in the Netherlands.
304
D
INDEX Quality control 188
Dietary supplements 188
A Discolouration 139
Agaricus bisporus 8, 48, 83, 96, 113, Disease control 120, 155
128, 139, 158, 165, 181, 203, 298 Disturbed forest stand 287
Agaricus spp 148 DNA quantification 139
Agronomic traits 113 dsRNAs 148
Antagonistic bacteria 158 Double cropping 48
Antimicrobial activity 31
Antioxidants 8, 165 E
Armillaria ellea 31 ECO Consult Foundation 231
Azadirachtin 212 Ectomycorrhizal fungus 197
Ectomycorrhizal mushroom 287
B Edible and medicinal mushrooms 255
Bacterial blotch 128 Endosulfan 36
Biodegradation 36 Environmental protection 61
Biological control 158 Enzyme induction 21
Biologicalefficiency 83 L-Ergothioneine 165
Biorecycling 255, 287 European policies and directives &
Biorefinery 231 industry review 61
Bioremediation 1
Biotechnology 255 F
Bipolar mating system 104 Forest ecosystem 287
Bottle culture 197 Forestry management 246, 287
Breeding 54 Free-radical scavenging activity 8
Bruisometer 181 Fungal pathogen 139
C G
Casing soil 231 Ganoderma lucidum 155, 171
Cellulase gene expression 21 Genetic base 96
Cellulases 21 Germplasm resources 54
Champost 231 Green mould disease 158
Chromosome length polymorphism 96
Cladobotryum mycophilum Type 2,120 H
Clamp cell formation 104 Hericium erinaceus 91
Clitocybe geotropa 31 High nitrogen medium 36
Commercial cultivation 197 High temperature fermentation 203
Compostre-supplementation 48 Homeodomain protein 104
Consumer acceptability 188
Cultivation 91, 246 I
Cycling of organic matter 246 Immunological detection 148
Increased yields 48
Inhibition of mold growth 74
305
Inoculation methods 263 Pholiota nameko 104
Plastic container 91
L Pleurotus flabellatus 212
Laccase 220 Pleurotus ostreatus 74, 246
Lentinula edodes 54, 171 Pleurotus pulmonarius 36
Ligninolytic enzymes 220 Pleurotus spp 36, 220, 298
Liquid spawn 197 Polish mushroom production 298
Lyophyllum shimeji 197 Polyporus arcularius 21
Pseudomonas 128
M
Medicinal aspects 1 Q
Medicinal mushrooms 171 Quality assurance protocols 61
Meripilus giganteus 31
Molecular modelling 181 R
Mushroom breeding 96 Radical scavenger 165
Mushroom compost 61 Reactive oxygen species 8
Mushroom cultivation 1, 255 Real-time PCR 21, 139
Mushroom diseases 120 Re-casing 48
Mushroom export 298
Mushroom nutriceuticals 188 S
Mushroom quality 181 Sparassis crispa 31
Mushroom senescence 181 Spent mushroom compost 83, 231
Mushroom Virus X 120, 148 Spotting and discoloration 128
Mycorrhization 272 Standardized protocols 188
Mycotherapy 171 Strain identification 54
Strain protection 96
N Strain selection 91
Natural truffières 272 Stress factors 165
Naturopathic treatments 171 Substrate fermentation 74
Neem oil 212 Substrate moisture content 83
Non-composted substrate 83 Substrate optimization 91
Nutritional attributes 1 Substrate selectivity 74
Sustainable food production 61
O SWOT analysis 298
Olive mill waste 220
Organic cultivation 203, 212 T
Outcrossing 113 Trichoderma aggressivum 120
Trichoderma spp 128, 158
P Trichoderma viride 74, 212
Peroxidase 220 Truffle 263
Pesticide degradation 203 Truffle plantation 272
Pesticide residue analysis 203 Tuber borchii 263
Pharmacological activity 54 Tuber melanosporum 263, 272
Pheromone receptor gene 104 Tuber mycelia 263
306
T. uncinatum 272
Turkey 31
V
Verticillium fungicola 113
Vinyl cover cultivation method 155
W
Wild strains 148
Wine and winery wastes 255
Wood decomposition 246
X
Xylogone sphaerospora 155
Y
Yellow rot 155
________________________________
307

6 International Conference Proceedings

Загружено:

Сведения о документе

Авторское право

Доступные форматы

Поделиться этим документом

Поделиться или встроить документ

Параметры публикации

Этот документ был вам полезен?

Это неприемлемый материал?

Авторское право:

Доступные форматы

6 International Conference Proceedings

Загружено:

Авторское право:

Доступные форматы

All Rights reserved.

No part of this publication may be reproduced or

1. Mushrooms, Cause and Cure 1

L.J.L.D VAN GRIENSVEN

Part I PHYSIOLOGY AND BIOCHEMISTRY

Reactive Oxygen Species and the Strategy of Antioxidant Defence in

Recognition and Degradation of Insoluble Crystalline Cellulose by

TADANORI AIMI, YUKA OHNISHI, MITSUTOSHI NAGASE,

Antimicrobial Activities of Four Wild Mushroom Species Collected

FATIH KALYONCU & MUSTAFA OSKAY

Degradation of Endosulfan by Pleurotus spp 36

GABRIELA M. MENDOZA, JOSÉ E. SANCHEZ, MARIA G. NIETO &

Part II CULTIVATION TECHNOLOGY

Double Cropping Agaricus bisporus by Re-supplementing and Re-casing

Mushroom Compost Production – A Review of Industry Quality

Effect of Aerobic Fermentation Substrate on Pleurotus ostreatus

GERARDO MATA & FLOR E. TORRES-HERNÁNDEZ

Yield and Mushroom Solids of Agaricus bisporus as Influenced by

Cultivation Technique using Plastic Container and Selection the

Part III GENETICS AND BREEDING

Mushroom Breeding: Hurdles and Challenges 96

ANTON S.M. SONNENBERG, JOHAN J.P. BAARS & RICK W.

Molecular Genetics of the Mating System in the Bipolar Mushroom,

RUIRONG YI, MUKAIYAMA HIROYUKI, TAKASHI TACHIKAWA

Outcrossing via the Buller phenomenon in a substrate simultaneously

PHILIPPE CALLAC, MICHELINE IMBERNON & JEAN-MICHEL

Challenges Facing Mushroom Disease Control in the 21st Century 120

Spotting and Discoloration of the Cultivated Mushroom, Agaricus

D. L. RINKER, J. DANO, D. SIVANESAN, C. DOBBIN, H.

Agaricus bisporus Infection by Verticillium fungicola and Incidence

M. L. LARGETEAU, C. LATAPY, P. BROCA & J.-M. SAVOIE

Immunological Detection of dsRNAs in Wild Agaricus Species and

ANDRÁS GEÖSEL, KRISZTIÁN HALÁSZ, JÓZSEF SZARVAS,

Control of Yellow Rot on Reishi Mushroom (Ganoderma lucidum

Part V NUTRITIONAL & MEDICINAL ASPECTS

ROBERT BEELMAN & HYUN-JU LEE

Mycotherapy - Treatment with Medicinal Mushrooms 171

Molecular Modelling and Modification of Mushroom Senescence

K. S. BURTON, A. MEAD, M. P. CHALLEN, B. HERMAN, J. GREEN,

Safety, Quality Control and Regulational Aspects Relating to

S. T. CHANG & J. A. BUSWELL

Part VII MUSHROOM RESOURCE DEVELOPMENT

Commercial Cultivation of Lyophyllum shimeji 197

B. L. DHAR, O. P. AHLAWAT, R. K. SHARMA, J. K. DUBEY, S. K.

Part VIII ENVIRONMENTAL IMPLICATIONS AND APPLICATIONS

Olive Mill Waste as a Substrate for the Cultivation of Pleurotus spp

Alternative Uses of Spent Mushroom Compost 231

PETER OEI, HUI ZENG, JIANHUA LIAO, JIANQING DAI, MEIYUAN

M. PAVLIK, M. HRASKO & A. PAVLIKOVA

Biotechnology to Grow Edible and Medicinal Mushrooms on Vine and

M. PETRE & A. TEODORESCU

Part IX MYCORRHIZAL MUSHROOMS AND MYCORRHIZATION

Problems and Perspectives in the Production of Tuber Infected Plants 263

ALESSANDRA ZAMBONELLI, MIRCO IOTTI & FEDERICA

Mycorrhizal Research Applied to Experiences in Plantations of

Occurrence of Ectomycorrhizal Mushrooms in Disturbed

Part X ECONOMICS AND MARKETING

The Development of Polish Mushroom Exports 298

O. P. AHLAWAT (203) National Research Centre for Mushroom, Chambaghat, Solan -

Professor Daniel J. Royse

It is my pleasure to welcome you to the 6th International Conference on Mushroom Biology

Mushrooms: Cause and Cure

Leo van Griensven

Key Words: Mushroom cultivation; Nutritional attributes; Medicinal aspects;